text
stringlengths 0
868k
|
|---|
A class of small rnas, piwi - interacting rnas (pirnas), is associated with the piwi clade of argonautes and acts to repress mobile genetic elements in the germline of both drosophila and mammals (fig . 1, left side). Pirnas are generated by rna - transcription of long te clusters, resulting in the accumulation of short mature pirnas in the cytoplasm by the ping - pong mechanism (reviewed in ref . Pirnas then act as guides to destroy complementary transposon transcripts by endonucleolytic cleavage (i.e., within piwi complexes). Briefly, during the ping - pong cycle, primary pirnas are processed and loaded into mili containing complexes . This complex is thought to cleave te antisense transcripts generating secondary pirnas that are associated with miwi2 . Miwi 2 then cleaves te sense transcripts producing new sense pirnas that are again loaded into mili . Additionally, both in droshophila and mammals some piwi members may localize to the nucleus, but their nuclear function is not fully understood . Furthermore, there is a clear connection to dna - methylation, as the mouse pirna pathway is required for de novo dna methylation and silencing of tes in germ cells . Thus, it is thought that the combined action of dna - methylation and pirnas may control the accumulation of new tes in germ cells of mammals . Indeed, most te insertions in humans and mouse seem to be accumulated during early embryogenesis and new insertions in germ cells are rare . We have recently described that the microprocessor, a nuclear protein complex involved in microrna (mirna) biogenesis, may act as a new post - transcriptional mechanism to control the mobilization of mammalian retrotransposons in the nucleus (fig . 1, right side). During mirna biogenesis, the microprocessor recognizes and cleaves hairpin rna structures embedded within the sequence of primary mirna sequences (pri - mirnas) in the nucleus . The minimal catalytically active microprocessor is a heterodimer formed by the double - stranded rna - binding protein, dgcr8 and the rnaseiii enzyme, drosha . Dgcr8 recognizes the pri - mirna substrate whereas drosha functions as the endonuclease generating precursor mirnas (pre - mirnas) that are exported to the cytoplasm where they are further processed by another rnase iii enzyme, dicer (dcr), to generate mature mirnas . A dgcr8 hits - clip (high - throughput sequencing of rna isolated by cross - linking immunoprecipitation) experiment designed to identify novel substrates of the microprocessor revealed that this complex binds and regulates a large variety of cellular rnas . The clip protocol is based on an uv irradiation step in order to induce covalent links between protein and rna molecules present within a complex . In principle, this allows to conduct highly stringent immunoprecipitation and washing conditions so that only those rnas directly bound to the protein of interest are selected (reviewed in refs . We compared endogenous dgcr8 hits - clip reads with a replicate of the experiment using transiently transfected epitope - tagged dgcr8 protein (pcg t7-dgcr8). Notably, we observed a strong correlation between both experiments, which suggests that the identified dgcr8 targets are indeed specific targets . Interestingly, one third of the dgcr8 rna targets corresponded to human repetitive sequences, including active tes . We confirmed that dgcr8 recognizes and binds active retrotransposons (line-1, alu and sva) in human cultured cells and that the microprocessor can process line-1 and alu derived rnas in vitro and likely in vivo . Notably, we also determined that the microprocessor regulates the abundance of l1 mrnas and encoded proteins both in human pluripotent cells as well as in dgcr8 mouse embryonic stem (mes) cells . Altogether, these data strongly suggest that the microprocessor controls te expression levels by processing their rna derived transcripts . Importantly, we demonstrated that the microprocessor negatively regulates alu and line-1 engineered retrotransposition in cultured hela cells, most likely by binding and processing rna derived from these tes (fig . 1). Furthermore, other transposable elements and even processed pseudogenes that require l1-encoded proteins for their mobilization might be indirectly regulated by the microprocessor . In sum, these data suggest a function for the microprocessor in restricting non - ltr retrotransposon mobilization; we further propose that this regulation might be relevant in somatic tissues, acting as a repressor of those active te copies that escape transcriptional silencing . Notably, a high proportion of the reads from hits - clip experiments mapped to transcripts derived from inactive tes in humans, like mrnas derived from evolutionary older line-1 subfamilies, ltr retrotransposons and even dna - transposons . That could reflect that this complex has acted in reducing the impact of te mobilization through evolution . However, mutation accumulation over time and high error rates of reverse transcriptases encoded by ltr and non - ltr retrotransposons make it unlikely that pri - microrna like structures have remained unchanged through evolution . Thus, we speculate that the binding and likely processing of rnas derived from inactive tes could also reflect a more generic function of the microprocessor: destabilization of non - functional rnas transcribed within cells . The hits - clip approach also revealed that dgcr8 binds many other types of structured rnas: several hundred mrnas / pseudogenes and non - coding rnas such as rrnas, snrnas, snornas (small nucleolar rnas) and lincrnas (long intergenic non - coding rnas). We confirmed the direct interaction of dgcr8 with several of those rna targets (such as mrnas, snornas, lincrnas as well as tes) by immunoprecipitation / rt - qpcr experiments . Some of those rnas could probably correspond to aberrant transcripts or non - functional transcripts that might be destabilized by the microprocessor in the nucleus . Furthermore, this hypothesis could explain the identification of additional biding sites for dgcr8 in the antisense strand of rc - l1s, alu and sva derived rna sequences, although we cannot rule out that they might have a role in te biology or genome regulation . An additional arising question is whether some te - derived rna products generated by the microprocessor are further processed in the cytoplasm by dicer (dcr) to generate mature and functional mirnas . Indeed, previous bioinformatic analyses have shown that subsets of canonical mammalian mirnas are derived from line-2 elements and other currently inactive genomic repeats . Notably mirnas and small - interfering rnas (sirnas) are cleaved from short hairpin and double - stranded rna precursors by dcr endonucleases and bound by argonaute proteins (ago) in a large multiprotein complex called risc (fig . 1). Risc then targets homologous sequences in cellular rnas, inducing their degradation or suppressing their translation . Interestingly, a recent study that analyzed the repertoire of small rnas (srnas) in cultured mes revealed a significant depletion of sense and antisense 5utr - l1-derived 22nt - srna in dcr mes cells and qrt - pcr experiments showed that a fraction of them were specifically loaded in ago2, as canonical micrornas . Interestingly, ago2 and dcr mes cells also exhibit increased levels of mouse l1 derived mrnas . Ciaudo and colleagues attributed the activation of line-1 in those cells to the depletion of 5utr - l1 derived srna and proposed that rnai may act to control retrotransposition in mes cells . Indeed, a model where the bidirectional transcription of opposed l1 retrotransposon sequences results in the formation of double - stranded rnas processed to sirnas that suppress retrotransposition by an rna interference mechanism was previously suggested in human cells . Remarkably, it has been recently demonstrated that rnai has an important function in immunity against viruses in mammals . This pathway seems to be active exclusively in stem cells (i.e., early embryogenesis) where the innate antiviral interferon (ifn) response is non functional . Indeed, maillard and colleagues observed that upon infection of mes cells with encephalomyocarditis virus (emcv) or nodamura virus, virus - derived small rnas (vsrnas) were associated with ago2, whereas they were undetectable in cells lacking dicer and decreased upon cell differentiation . Furthermore, the infection of mes cells, hamster cells and suckling mice by nodamura virus requires rnai suppression by an inhibitor of dicer encoded by the virus . Altogether, these data suggest that dcr recognizes and cleaves dsrna in undifferentiated cells and further support that rnai is an ancient form of immunity that evolved to suppress viruses and transposable elements during early embryogenesis (fig although heritable new te insertions in humans may accumulate during early embryogenesis, recent studies have also uncovered a surprisingly load of somatic retrotransposition in selected tissues, mainly in the brain and in several type of tumors (recently reviewed in refs . Thus, further studies are required to fully understand the contribution of rna - derived mechanisms in the control of te mobilization in cancer and the human brain . Most mirnas interact with 3utrs of rna targets inducing their degradation or suppressing their translation . Thus, and in order to test whether the control of l1 mobilization by the microprocessor is mediated by mirnas, we used engineered retrotransposition constructs lacking 3utr sequences . Importantly, a similar increase in retrotransposition was observed for the construct that lacks the 3utr upon microprocessor depletion, strongly suggesting that the microprocessor control of l1 mobilization seems to work in a dcr and mirna independent manner . Supporting this hypothesis, luciferase - based reporters containing the 5utr of an active line-1 produced more reporter activity in the absence of the microprocessor than in the absence of dcr . Altogether, these data suggest that the microprocessor and dcr can independently regulate te rna levels and subsequent mobilization . Notably, other key factors that may have a role in the dynamic regulation of te derived rnas were further identified by ciaudo et al ., as depletion of nuclear xrn2 and exosome co - factor rrp6 led to the accumulation of l1 transcripts and l1-orf1p, correlating with reduced levels of the most abundant sense and antisense l1-derived srnas(fig . 1). Additionally, previous studies have shown that the microprocessor co - operates with setx, xrn2 and rrp6 to induce the premature termination of transcription by rna pol ii at the hiv-1 promoter . The exosome complex is the major source of 35 ribonucleolytic activity in eukaryotic cells and exerts an indispensable role in rna processing and quality control . Rrp6 is an rnase d - related 35 exoribonuclease that provide this activity to the nuclear exosome . Setx is the human homolog of the sen1 protein in yeast, a rna / dna helicase contained in a complex involved in transcriptional termination of several classes of rnas . Is potentiated by a 5 3 exoribonuclease, rat1p / xrn2, that following cleavage, degrades the uncapped nascent transcript to promote the release of rnapii from its template . Whether l1 mrna destabilization by these rna surveillance pathways is coordinated with microprocessor - mediated processing remains to be seen . In sum, data from different laboratories indicate that several rna - mediated mechanisms act to control the expression and mobilization of tes . Importantly, characterization of endogenous line-1 mobilization events in stem and somatic cells using the latest advances in high - throughput sequencing and single cell genomic is still required to unambiguously determine the real impact of the microprocessor and other factors in retrotransposon control . In sum, these data suggest that several post - transcriptional mechanisms targeting mammalian retrotransposon derived mrnas might simultaneously act in nucleus and cytoplasm to reduce their mutagenic potential (fig . 1). These results further reveal the complex regulation of tes within a host, and suggest that multiple mechanisms at different levels act to control the impact of tes in genomes.
|
Encouragingly, the boolean model was able to make highly accurate predictions on spatial and temporal gene expression patterns . Indeed, only several predictions among the 2,772 time - space - gene combinations were at odds with experimental data . This may not seem surprising because the grn is based on interpretations of huge masses of expression data, perturbation data and cis - regulatory data . Proceeded to perform more stringent tests of the model by asking how it would respond to four perturbations: extinction of the expression of the delta gene, global expression of the pmar1 gene, extinction of hox11/13b expression, and most challengingly, the transplantation of four cleavage skeletogenic micromeres into the animal pole of an otherwise normal embryo that possessed its own set of four micromeres at the vegetal pole . (the intra - embryo transposition of blastomeres harkens back to the classical era of experimental embryology .) The authors emphasized that except for the hox11/13b test, the perturbation results they sought to reproduce were not used in building the grn . (transplanted micromeres could of course not have been part of the grn, which is for a normal embryo .) The results of these perturbation tests were in nearly perfect agreement with the experimental data, which led the authors to two conclusions: the grn contained sufficient information to provide a system - level causal explanation for sea urchin development, and the boolean computational model was a useful tool for in silico testing of grn and making predictions upon perturbations . The test of blastomere transplantation demonstrated the critical role of intercellular signaling between the different spatial domains in development . The cells in these domains obviously need to work cooperatively to ensure precise and robust developmental progression and thus information on the regulatory state of each cell must be able to diffuse spatially . We enjoy so many examples of such events in development, e.g., the wnt pathway in drosophila development to mention just one of many examples, but we have no case in which a paracrine signaling pathway amidst a developmentally determinative cluster of cells can be put into the context of a grn as detailed as the one peter et al . Have defined . From the information theory perspective, intercellular thus, the developmental process is also a diffusion process of the genomic regulatory information . Related domains of this emerging field include molecular information theory and information networks in the data mining field from both of which the modeling of intercellular signaling may benefit . Went so far as to suggest that the gene regulatory models could sufficiently explain all the gene expression patterns in sea urchin development, without considering non - coding rnas . For example, a recent study identified long noncoding rnas (lncrna) in zebrafish embryogenesis and revealed that lncrnas were specifically enriched in early - stage embryos . Ironically, davidson and his longtime partner roy britten were the first to postulate such a role . Is there any information loss from the continuous data to boolean data, from gene regulatory logic to boolean logic? What would be a good cutoff for converting the expression level to on or off? If a grn is not available in a given case, can a boolean model be directly inferred and tested using raw experimental data? If so, what kinds of experimental data are most suitable and in what way can the causal structure be best captured in the boolean model? Theoretical frameworks of causal inference from observational data have been studied in machine learning for decades . Possibly the established causal inference algorithms can expand this newest chapter in grn - ology from the pioneering davidson lab into more general settings . Can this work provide insights into other animal development, e.g., mouse, human or into human embryonic stem (es) cell differentiation? Is it possible to apply the general computational framework to test grn models derived from biological processes in addition to development, such as immunology and postnatal neurogenesis in the subventricular zone of the brain to mention only two of many frontiers before us that beckon for the grn approach? With the advances of next generation sequencing technology and its cost now rocketing downward, a large amount of data will soon be in hand for various biological processes across diverse phyla . Much of this momentum now comes from the sea urchin embryo and from the scientific mind of eric davidson.
|
According to the international diabetes federation in 2013, 328 million people are currently diagnosed with diabetes and there is a projected rise of 55% to 592 million people in the world living with diabetes by the year 2035.1 the greatest rise is projected to occur in africa, the middle east, southeast asia, and south and central america, with a greater than 50% increase projected in each of these areas.1 treatment options for diabetes continue to increase to provide more individualized treatment for patients with type 2 diabetes mellitus (t2 dm). Glucagon - like peptide-1 (glp-1) receptor agonists (ras) are part of the incretin mimetic diabetes treatment options . Endogenous glp-1 is an incretin hormone that is released from the intestine in response to food intake . Glp-1 effects include increased insulin secretion, decreased glucagon release, increased satiety and slowed gastric emptying.24 glp-1 is degraded by dipeptidyl peptidase - iv (dpp-4) in the human body within minutes of release, thereby causing a limitation in replication of this incretin hormone . Currently, exenatide, exenatide long - acting release (lar), liraglutide, albiglutide, and lixisenatide are available in the united states and/or europe, with exenatide first available as a twice - daily formulation approved in april of 2005 . Since that time, additional formulations have offered once - daily (liraglutide and lixisenatide) and once - weekly (exenatide lar and albiglutide) dosing strategies . A review of national guidelines for use of glp-1 ras demonstrates a variance in opinion for the place in therapy for these agents . The american diabetes association / european association for the study of diabetes places glp-1 ras as second- and third - line therapy.5 they state that these agents have a high efficacy for lowering glycated hemoglobin (a1c), a low risk for hypoglycemia, promote weight loss, include gastrointestinal (gi) side effects, and have a high cost compared to the other second- and third - line agents, including insulin, sulfonylureas, thiazolidinediones, and dpp-4 inhibitors . The american association of clinical endocrinology promotes metformin as first - line therapy, but lists glp-1 ras as an option here as well in place of metformin, along with being the preferred second- and third - line option in addition to metformin therapy.6 they too base this on a high a1c lowering property, promotion of weight loss, low risk for hypoglycemia, and their ability to reduce pre- and postprandial glucose levels; they also state that they are available in several formulations . The uk s national institute for health and clinical excellence guideline was last updated in 2009.7 it recommends glp-1 ras as third - line therapy after metformin and sulfonylureas if: a patient has a body mass index (bmi) 35.0 kg / m and has specific psychological or medical problems associated with high body weight; or a patient has a bmi <35.0 kg / m and therapy with insulin would not be permitted due to the patient s occupation; or weight loss would be beneficial for obesity - related comorbidities . As previously described, glp-1 ras mimic the release of endogenous glp-1 after a meal or oral glucose load.24 this incretin effect is the process where more insulin secretion occurs when glucose is administered orally than when the same amount of glucose is administered intravenously.4,8 this is a glucose - dependent action and occurs by increasing the -cell s sensitivity to glucose while preventing its apoptosis, exerting weight loss through satiety.4,9 patients with t2 dm have an impaired response to endogenous glp-1 action, but this can be overcome through pharmacological doses of glp-1.4 as discussed, current guideline recommendations place glp-1 agonists as second - line therapy behind first - line metformin for the majority of patients with t2dm.5,6 when used as monotherapy or as add on therapy to existing regimens, the currently marketed glp-1 agonist exenatide twice - daily monotherapy lowered a1c by 0.4 to 1.6%, and liraglutide alone or in combination with glimepiride, metformin and rosiglitazone, and long acting insulin was found to lower a1c by 0.9 to 1.5%.1014 dulaglutide was found to lower a1c from by 0.9 to 1% in a dose - dependent fashion when used as monotherapy in a 12-week placebo - controlled dose - response trial in patients who had discontinued metformin.15 in a pharmacokinetic and pharmacodynamic safety and tolerability trial, dulaglutide reduced a1c by 0.2 to 1.2% over 5 weeks in patients using diet and exercise alone or who were on monotherapy.16 in uncontrolled patients taking metformin, dulaglutide reduced a1c more significantly over sitagliptin, with dulaglutide 1.5 mg reducing a1c by 1.1%0.06% and dulaglutide 0.75 mg reducing a1c by 0.87%0.06% versus sitagliptin reducing a1c by 0.39%0.06% (p<0.001).17 on average, the a1c lowering potential for glp-1 ras is approximated at 1%1.5%.3 traditionally, glp-1 ras have lowered both fasting and postprandial plasma glucose, and each formulation differs in the extent to which it lowers the glucose level . Short - acting glp-1 ras predominantly lower postprandial plasma glucose (exenatide short acting, lixisenatide) through slowing gastric emptying, whereas long - acting glp-1 ras lower blood glucose by stimulating insulin secretion and reducing glucagon (dulaglutide, liraglutide, albiglutide, exenatide lar).8 dulaglutide reduces both fasting and postprandial glucose when compared to placebo in uncontrolled patients who have failed oral antidiabetic medications.18 as a once - weekly glp-1 ra formulation, dulaglutide has been shown to have a more robust effect on fasting plasma glucose than postprandial blood glucose . Despite the lowering of plasma glucose, significant hypoglycemia is not demonstrated with glp-1 ras secondary to the glucose - dependent mechanism, which is considered a benefit to this class of medications.19 in contrast to guidelines previously discussed, the 2007 institute for quality and economic efficiency in health care found the glucose - lowering effect of the glp-1 exenatide twice daily to be similar to that of insulin glargine or insulin aspart, without additional benefit, including benefits to quality of life or treatment satisfaction.20 this report also found the impact of weight loss to be unclear, with occurrence of harmful gi adverse events.20 since the publishing of this 2007 report, additional agents within this class have come to market and glp-1 ras dulaglutide, a once - weekly injectable (given via subcutaneous administration) glp-1 ra was approved in september 2014 by the food and drug administration (fda) in the united states and november 2014 by the european commission based upon published trials summarized below (table 1).15,17,18,2123 most trials compare dulaglutide to placebo in addition to first - line metformin therapy and have demonstrated promising a1c reductions for dulaglutide . Grunberger et al completed a 12-week double - blind, placebo - controlled study in 167 t2 dm patients (a1c 7.2%0.6%, duration of diabetes: 3.9 years) who had either received metformin therapy or were treatment nave.15 patients were randomized to one of five treatment arms (placebo, 0.1 mg, 0.5 mg, 1 mg, or 1.5 mg dulaglutide) in a 1:1:1:1:1 manner with the primary endpoint being change from baseline a1c and secondary endpoints being efficacy and safety . Results demonstrated a dose - dependent a1c reduction (p<0.001 for all) for dulaglutide and greater reduction compared to placebo (p<0.001 for all) except for in the 0.1 mg dose . Similar results were seen for daily plasma glucose and fasting plasma glucose (fpg) with dose - dependent reductions for all (p<0.001) which were greater when compared to placebo (p<0.001) except for the 0.1 mg dose . More patients receiving dulaglutide achieved a1c reductions of 7% (p<0.001) or <6.5% (p<0.001) than those receiving placebo . Dose - dependent increases in the homeostasis model assessment (homa)2-b (a marker of basal beta - cell function to release insulin during the fasting state) were seen with all dulaglutide groups (p=0.036) and were greater than that for placebo except for the 0.1 mg dose (p0.013); no changes were noted for any group for homa2-s (an assessment of insulin sensitivity). Body - weight reductions were noted for all dulaglutide groups with dose - dependent results; however, these were not significant when compared to placebo . Safety data showed treatment - emergent adverse drug events (ades) included nausea, diarrhea, and nasopharyngitis, with four patients discontinuing dulaglutide due to ades . Four cases of serious ades, with two of these linked to study drugs, included hemorrhagic pancreatitis associated with cholelithiasis (placebo) and abdominal pain / distension (dulaglutide 1.5 mg). No reports of severe hypoglycemia were noted, with rates of hypoglycemia similar across all groups . Both diastolic and systolic blood pressures were similar across all groups, along with levels of pancreatic enzymes being similar between groups at endpoint . One treatment - emergent case of anti - dulaglutide antibody (dulaglutide 1 mg) was reported, along with one patient reporting treatment - emergent skin rash and skin exfoliation (dulaglutide 0.1 mg). Overall, this study demonstrated safety and efficacy for the dulaglutide 0.5, 1, and 1.5 mg once - weekly dosages compared to placebo . Umpierrez et al compared dulaglutide to metformin therapy in a 52-week double - blind, parallel - arm, randomized trial in 807 t2 dm patients (baseline a1c 7.6%, duration of diabetes: 3 years) who were uncontrolled for diet and exercise alone or on one oral antidiabetic agent for 3 months.21 patients former medications were discontinued and they were randomized to once - weekly dulaglutide 1.5 mg or 0.75 mg, or metformin 1,5002,000 mg daily, with the primary noninferiority outcome of change from baseline a1c at 26 weeks . All three treatments reduced a1c by less than 1% with the greatest least - squares mean (lsm) change in the 1.5 mg dulaglutide arm, which was statistically greater than that of the metformin group (p=0.002). The dulaglutide 0.75 mg arm also had a greater change than metformin . At 52 weeks, the lsm decrease in a1c for the dulaglutide 1.5 mg and 0.75 mg, and metformin arms were 0.70.07 vs 0.550.07 vs 0.510.07% with the greatest reduction in the dulaglutide 1.5 mg arm (p=0.02). At 26 weeks, more patients reached an a1c of 7% with dulaglutide 1.5 and 0.75 mg than with metformin (p=0.02 for both). The same was seen for a1c of 6.5% (p<0.001 and p=0.011 for dulaglutide 1.5 mg and 0.75 mg, respectively, versus metformin). Similar results for reaching a1c goals were seen for dulaglutide 1.5 mg compared to metformin at 52 weeks (p0.01 for both). Changes in lsm fpg were similar at 26 weeks but were greater for dulaglutide 1.5 mg at 52 weeks (p=0.025 dulaglutide 1.5 mg versus metformin). Weight loss was similar for dulaglutide 1.5 mg and metformin at both 26 weeks and 52 weeks, but compared to dulaglutide 0.75 mg at both 26 and 52 weeks, metformin had greater loss (p=0.003 [26 weeks] and p=0.001 [52 weeks]). Increased in all arms at 26 weeks with greater changes in the dulaglutide arms than in metformin (p<0.01 for both). Homa2-s was the opposite, with the greater change in metformin compared to dulaglutide (p=0.001 for dulaglutide 1.5 mg and p=0.01 for dulaglutide 0.75 mg). Similar results were seen for 52 weeks except that the difference between dulaglutide 1.5 mg and metformin for homa2-s was no longer significant . Nausea, diarrhea, and vomiting were the most common side effects, with the majority being mild to moderate in severity and no difference between the groups . Overall, hypoglycemia was similar (12.3% for 1.5 mg dulaglutide, 11.1% for 0.75 mg dulaglutide, and 12.7% for metformin) with no severe hypoglycemic episodes . No cases of pancreatitis or pancreatic cancer were noted during the study . Blood pressure changes, both diastolic and systolic, were similar in all three arms . Two percent of patients (n=10) developed treatment - emergent dulaglutide antidrug antibodies with no reported systemic hypersensitivity reactions . Overall, this study demonstrated that dulaglutide 1.5 mg had similar to slightly better reduction of a1c and a greater percentage of patients reaching goal than metformin, with similar efficacy for the 0.75 mg dosage . Ades were also similar, demonstrating safe and effective use of dulaglutide as monotherapy in the early treatment of t2 dm . In another placebo - controlled study, 262 overweight / obese (bmi 33.94.1 kg / m) t2 dm patients (a1c 8.24%0.93%, duration of diabetes: 7.59 years) who failed to meet a1c goal <7% on oral antidiabetic medications were randomized to dulaglutide 0.5 mg titrated to 1 mg, dulaglutide 1 mg, dulaglutide 1 mg titrated to 2 mg, or placebo groups.18 patients continued their two oral antidiabetic medications (sulfonylurea, biguanide, thiazolidinedione, or dpp-4 inhibitors). The primary endpoint of change in a1c (lsm) was greater in each of the dulaglutide doses compared to placebo (p<0.001 for all), ranging from 1.32% to 1.59% . The proportions of patients achieving a1c 6.5% or <7% were similar for all treatment groups . Decreases in fpg were significantly lower for all treatment groups compared to placebo (p<0.001 for all) and ranged from 37 to 48 mg / dl for dulaglutide compared to 9 mg / dl for placebo . Weight loss was greatest in the 1 mg titrated to 2 mg dulaglutide group (p<0.05) and overall greater weight loss was seen than for placebo (p<0.05 for all). The most frequent ades were nausea, diarrhea, and abdominal distention, and these were more frequent with the higher dulaglutide doses . Serious ades were noted in seven patients (one for placebo, three for 0.5 mg titrated to 1 mg, two for 1 mg, and one for 1 mg titrated to 2 mg) including hallucinations, cryptogenic organizing pneumonia, and pancreatitis (three episodes of which were possibly related to study drug and/or diabetes). Hypoglycemia was low but greater in the dulaglutide groups compared to placebo (weeks 4 and 12, p<0.05) with the rate decreasing over time; there was no significant difference at week 16 and no severe hypoglycemic events reported . Pulse and diastolic blood pressure were increased but systolic blood pressure was decreased in the dulaglutide groups, with no clinically significant ades noted due to vitals . In this study of overweight / obese t2 dm patients, dulaglutide lowered the a1c and fpg, while promoting weight loss with expected adverse effects for a once - weekly glp-1 ra . Dulaglutide was compared to sitagliptin in 1,098 t2 dm patients (a1c 8.1%, duration of diabetes: 7 years) uncontrolled on metformin therapy in a double - blind, parallel - arm randomized study.17 patients who were receiving metformin (1,500 mg / day) with or without another oral antidiabetic medication were randomized to a dose - finding arm of dulaglutide, sitagliptin 100 mg / day, or placebo, and after dosing were entered into either the dulaglutide 0.75 mg / week or dulaglutide 1 mg / week dosage arms for comparison to sitagliptin and placebo (replaced with sitagliptin at week 26 for blinding purposes) in a 2:2:2:1 ratio for a total of 104 weeks . The lsm change in a1c at week 52 revealed a greater decrease in a1c for both dulaglutide arms (decrease of 0.87%1.1%) compared to sitagliptin (decrease of 0.39%, p<0.001). More patients achieved an a1c of <7% and 6.5% in the dulaglutide arms compared to sitagliptin (p<0.001 for both) at 52 weeks . The lsm change in fpg was less for sitagliptin compared to both doses of dulaglutide (p<0.001 for both). At week 52, weight loss followed the same trend with greater reduction for dulaglutide 1.5 mg and 0.75 mg compared to sitagliptin (p<0.001 for both). The -cell function as estimated by homa2-b increased in all arms at 52 weeks with significantly greater changes in dulaglutide compared to sitagliptin (p<0.001). No differences were seen for homa2-s for insulin sensitivity . Dulaglutide produced a reduction in low - density lipoprotein (ldl) cholesterol whereas sitagliptin saw an increase at week 52 for a significant between - treatment difference (p=0.03). In terms of safety, a total of four patients died during the trial (one in the dulaglutide 1.5 mg arm, one in the sitagliptin arm, and two in the placebo arm [during the sitagliptin phase of the study]). Dulaglutide had a higher percentage of nausea, diarrhea, vomiting, and decreased appetite compared to sitagliptin (p<0.05) with similar results compared to placebo . The gi adverse effects were worse during the first 2 weeks and declined over time . Discontinuation from the study due to medication ades at week 52 was similar across all arms, with hyperglycemia and nausea being the most common ades . Hypoglycemia occurrences were greatest for dulaglutide 1.5 mg (10.2%) followed by dulaglutide 0.75 mg (5.3%) and then sitagliptin (4.8%) at 52 weeks with no severe hypoglycemia reported during the study . Acute pancreatitis occurred in three patients (two on sitagliptin and one on placebo [during the sitagliptin phase]). Nine patients had treatment - emergent anti - dulaglutide antibodies noted during the treatment period (1.3%) with no hypersensitivity events . Overall, dulaglutide lowered the a1c and fpg greater than sitagliptin at week 52 with similar hypoglycemia and expected gi ades during this trial . Dulaglutide has also been studied as add - on to pioglitazone and metformin compared to exenatide in a 52-week, parallel arm, randomized study in 976 t2 dm patients (baseline a1c 8.1%, duration of diabetes: 9 years).22 patients were included if they were receiving monotherapy with one oral antidiabetic agent with an a1c of 7%11% or combination therapy with an a1c of 7%10% . These oral antidiabetic agents were discontinued during the lead - in phase except for metformin or pioglitazone which were titrated up to 1,5003,000 mg daily and 3045 mg daily, respectively . Patients were randomized in a 2:2:2:1 ratio to once - weekly dulaglutide 1.5 mg, once - weekly dulaglutide 0.75 mg, exenatide 5 g titrated up to 10 g twice daily, or placebo . The primary endpoint was change in a1c at 26 weeks, which revealed a decrease by week 26 for all arms with the dulaglutide 1.5 and 0.75 mg being superior to placebo (p<0.001 for both). Changes compared to exenatide were superior for dulaglutide 1.5 and 0.75 mg arms (p<0.001 for both). At 52 weeks, the changes in a1c were also decreased in all arms with the dulaglutide 1.5 and 0.75 mg being superior to exenatide (p<0.001 for both). The percentage of patients reaching a1c <7% and 6.5% at 26 weeks was higher for dulaglutide 1.5 and 0.75 mg compared to exenatide (p<0.001 for both). Dulaglutide 1.5 and 0.75 mg decreased fpg greater than exenatide at both 26 (p<0.001 for both) and 52 weeks (p0.05 for both). Both dulaglutide arms demonstrated a greater reduction in preprandial blood glucose compared to placebo and exenatide (p<0.001 for both). The dulaglutide 1.5 mg group had a greater reduction in all postprandial blood glucose values compared to exenatide (p=0.047). Weight loss was significantly greater for the dulaglutide and exenatide groups compared to placebo at 26 weeks . Homa2-b results at 26 weeks increased in dulaglutide and exenatide arms with greater increases in dulaglutide 1.5 mg the dulaglutide 1.5 mg arm showed a significant mean decrease in total and ldl cholesterol along with triglyceride levels compared with placebo at 26 weeks . Serious ades were similar in all groups, with two patients dying (one from myocardial infarction in the 1.5 mg dulaglutide group and one from natural causes in the dulaglutide 0.75 mg group) and overall incidence of ades was similar across all groups . Gi ades were most commonly reported, with more in the dulaglutide 1.5 mg and exenatide arms than in the dulaglutide 0.75 mg arm . One patient in the dulaglutide 1.5 mg group was diagnosed with chronic pancreatitis at 7 months with no previous history . Hypoglycemia occurred more in the exenatide group compared to the dulaglutide 1.5 mg group (p=0.007) with overall rates at 26 weeks of 10.4% in the dulaglutide 1.5 mg arm, 10.7% in the dulaglutide 0.75 mg arm, 15.9% in the exenatide arm, and 3.5% in the placebo arm . No severe hypoglycemia events were reported in the dulaglutide arms and two were reported in the exenatide arm . Ten (1.8%) patients were positive for dulaglutide - developed treatment - emergent antidrug antibodies, but none reported systemic reactions . This trial revealed that dulaglutide provided greater glycemic control overall than exenatide twice daily and placebo . A head - to - head randomized, open - label, parallel - arm study comparing dulaglutide 1.5 mg once - weekly to liraglutide 1.8 mg daily in 599 t2 dm patients (baseline a1c 8.1%, duration of diabetes: 7.2 years) uncontrolled on metformin 1,500 mg daily for 3 months was conducted.23 the primary outcome was noninferiority for change in a1c at 26 weeks with further efficacy and safety evaluated at the same time . Dulaglutide was shown to be noninferior to liraglutide with a between - group a1c difference of 0.06% (95% confidence interval [ci], 0.19 to 0.07, p<0.001) and individual decreases of lsm of 1.4% for dulaglutide and 1.36% for liraglutide (p<0.0001 from baseline for both). Similar percentages of patients receiving dulaglutide and liraglutide reached an a1c of <7% and 6.5% . No difference was found between dulaglutide and liraglutide with decreases in fpg or postprandial glucose (lsm 46 versus 44 mg / dl, respectively). Weight loss was greater with liraglutide compared to dulaglutide with a between - group difference of 0.71 kg (95% ci, 0.171.26, p=0.011). Serious, but nonsigificant adverse drug reactions occurred in 2% of the dulaglutide group and 4% of the liraglutide group with no deaths and with similar rates of treatment - emergent ades . Gi adverse effects were similar, mild to moderate in overall severity, and transient . There were no severe hypoglycemic events and rates for overall hypoglycemia were 9% for dulaglutide and 6% for liraglutide . No cases of pancreatitis or pancreatic cancer were reported . One cardiovascular event of a myocardial infarction occurred in the liraglutide group, and there were similar changes in both systolic and diastolic blood pressures and no differences in lipids between both groups . Treatment - emergent antibodies developed in three patients (1%) in the dulaglutide group (not assessed in the liraglutide group) that did not develop into hypersensitivity reactions . Overall, dulaglutide 1.5 mg once weekly demonstrated noninferiority for efficacy and safety to liraglutide 1.5 mg daily . A review of dulaglutide at clinicaltrials.gov reveals several ongoing trials, including studies comparing dulaglutide to placebo in patients already receiving sulfonylurea therapy (nct01769378), glimepiride (nct01644500), and once - daily basal glargine insulin (nct01648582).2426 the primary outcome for each of these studies is change in a1c at 2426 weeks . Dulaglutide, a once - weekly injectable (given via subcutaneous administration) glp-1 ra was approved in september 2014 by the food and drug administration (fda) in the united states and november 2014 by the european commission based upon published trials summarized below (table 1).15,17,18,2123 most trials compare dulaglutide to placebo in addition to first - line metformin therapy and have demonstrated promising a1c reductions for dulaglutide . Grunberger et al completed a 12-week double - blind, placebo - controlled study in 167 t2 dm patients (a1c 7.2%0.6%, duration of diabetes: 3.9 years) who had either received metformin therapy or were treatment nave.15 patients were randomized to one of five treatment arms (placebo, 0.1 mg, 0.5 mg, 1 mg, or 1.5 mg dulaglutide) in a 1:1:1:1:1 manner with the primary endpoint being change from baseline a1c and secondary endpoints being efficacy and safety . Results demonstrated a dose - dependent a1c reduction (p<0.001 for all) for dulaglutide and greater reduction compared to placebo (p<0.001 for all) except for in the 0.1 mg dose . Similar results were seen for daily plasma glucose and fasting plasma glucose (fpg) with dose - dependent reductions for all (p<0.001) which were greater when compared to placebo (p<0.001) except for the 0.1 mg dose . More patients receiving dulaglutide achieved a1c reductions of 7% (p<0.001) or <6.5% (p<0.001) than those receiving placebo . Dose - dependent increases in the homeostasis model assessment (homa)2-b (a marker of basal beta - cell function to release insulin during the fasting state) were seen with all dulaglutide groups (p=0.036) and were greater than that for placebo except for the 0.1 mg dose (p0.013); no changes were noted for any group for homa2-s (an assessment of insulin sensitivity). Body - weight reductions were noted for all dulaglutide groups with dose - dependent results; however, these were not significant when compared to placebo . Safety data showed treatment - emergent adverse drug events (ades) included nausea, diarrhea, and nasopharyngitis, with four patients discontinuing dulaglutide due to ades . Four cases of serious ades, with two of these linked to study drugs, included hemorrhagic pancreatitis associated with cholelithiasis (placebo) and abdominal pain / distension (dulaglutide 1.5 mg). No reports of severe hypoglycemia were noted, with rates of hypoglycemia similar across all groups . Both diastolic and systolic blood pressures were similar across all groups, along with levels of pancreatic enzymes being similar between groups at endpoint . One treatment - emergent case of anti - dulaglutide antibody (dulaglutide 1 mg) was reported, along with one patient reporting treatment - emergent skin rash and skin exfoliation (dulaglutide 0.1 mg). Overall, this study demonstrated safety and efficacy for the dulaglutide 0.5, 1, and 1.5 mg once - weekly dosages compared to placebo . Umpierrez et al compared dulaglutide to metformin therapy in a 52-week double - blind, parallel - arm, randomized trial in 807 t2 dm patients (baseline a1c 7.6%, duration of diabetes: 3 years) who were uncontrolled for diet and exercise alone or on one oral antidiabetic agent for 3 months.21 patients former medications were discontinued and they were randomized to once - weekly dulaglutide 1.5 mg or 0.75 mg, or metformin 1,5002,000 mg daily, with the primary noninferiority outcome of change from baseline a1c at 26 weeks . All three treatments reduced a1c by less than 1% with the greatest least - squares mean (lsm) change in the 1.5 mg dulaglutide arm, which was statistically greater than that of the metformin group (p=0.002). The dulaglutide 0.75 mg arm also had a greater change than metformin . At 52 weeks, the lsm decrease in a1c for the dulaglutide 1.5 mg and 0.75 mg, and metformin arms were 0.70.07 vs 0.550.07 vs 0.510.07% with the greatest reduction in the dulaglutide 1.5 mg arm (p=0.02). At 26 weeks, more patients reached an a1c of 7% with dulaglutide 1.5 and 0.75 mg than with metformin (p=0.02 for both). The same was seen for a1c of 6.5% (p<0.001 and p=0.011 for dulaglutide 1.5 mg and 0.75 mg, respectively, versus metformin). Similar results for reaching a1c goals were seen for dulaglutide 1.5 mg compared to metformin at 52 weeks (p0.01 for both). Changes in lsm fpg were similar at 26 weeks but were greater for dulaglutide 1.5 mg at 52 weeks (p=0.025 dulaglutide 1.5 mg versus metformin). Weight loss was similar for dulaglutide 1.5 mg and metformin at both 26 weeks and 52 weeks, but compared to dulaglutide 0.75 mg at both 26 and 52 weeks, metformin had greater loss (p=0.003 [26 weeks] and p=0.001 [52 weeks]). Increased in all arms at 26 weeks with greater changes in the dulaglutide arms than in metformin (p<0.01 for both). Homa2-s was the opposite, with the greater change in metformin compared to dulaglutide (p=0.001 for dulaglutide 1.5 mg and p=0.01 for dulaglutide 0.75 mg). Similar results were seen for 52 weeks except that the difference between dulaglutide 1.5 mg and metformin for homa2-s was no longer significant . Nausea, diarrhea, and vomiting were the most common side effects, with the majority being mild to moderate in severity and no difference between the groups . Overall, hypoglycemia was similar (12.3% for 1.5 mg dulaglutide, 11.1% for 0.75 mg dulaglutide, and 12.7% for metformin) with no severe hypoglycemic episodes . No cases of pancreatitis or pancreatic cancer were noted during the study . Blood pressure changes, both diastolic and systolic, were similar in all three arms . Two percent of patients (n=10) developed treatment - emergent dulaglutide antidrug antibodies with no reported systemic hypersensitivity reactions . Overall, this study demonstrated that dulaglutide 1.5 mg had similar to slightly better reduction of a1c and a greater percentage of patients reaching goal than metformin, with similar efficacy for the 0.75 mg dosage . Ades were also similar, demonstrating safe and effective use of dulaglutide as monotherapy in the early treatment of t2 dm . In another placebo - controlled study, 262 overweight / obese (bmi 33.94.1 kg / m) t2 dm patients (a1c 8.24%0.93%, duration of diabetes: 7.59 years) who failed to meet a1c goal <7% on oral antidiabetic medications were randomized to dulaglutide 0.5 mg titrated to 1 mg, dulaglutide 1 mg, dulaglutide 1 mg titrated to 2 mg, or placebo groups.18 patients continued their two oral antidiabetic medications (sulfonylurea, biguanide, thiazolidinedione, or dpp-4 inhibitors). The primary endpoint of change in a1c (lsm) was greater in each of the dulaglutide doses compared to placebo (p<0.001 for all), ranging from 1.32% to 1.59% . The proportions of patients achieving a1c 6.5% or <7% were similar for all treatment groups . Decreases in fpg were significantly lower for all treatment groups compared to placebo (p<0.001 for all) and ranged from 37 to 48 mg / dl for dulaglutide compared to 9 mg / dl for placebo . Weight loss was greatest in the 1 mg titrated to 2 mg dulaglutide group (p<0.05) and overall greater weight loss was seen than for placebo (p<0.05 for all). The most frequent ades were nausea, diarrhea, and abdominal distention, and these were more frequent with the higher dulaglutide doses . Serious ades were noted in seven patients (one for placebo, three for 0.5 mg titrated to 1 mg, two for 1 mg, and one for 1 mg titrated to 2 mg) including hallucinations, cryptogenic organizing pneumonia, and pancreatitis (three episodes of which were possibly related to study drug and/or diabetes). Hypoglycemia was low but greater in the dulaglutide groups compared to placebo (weeks 4 and 12, p<0.05) with the rate decreasing over time; there was no significant difference at week 16 and no severe hypoglycemic events reported . Pulse and diastolic blood pressure were increased but systolic blood pressure was decreased in the dulaglutide groups, with no clinically significant ades noted due to vitals . In this study of overweight / obese t2 dm patients, dulaglutide lowered the a1c and fpg, while promoting weight loss with expected adverse effects for a once - weekly glp-1 ra . Dulaglutide was compared to sitagliptin in 1,098 t2 dm patients (a1c 8.1%, duration of diabetes: 7 years) uncontrolled on metformin therapy in a double - blind, parallel - arm randomized study.17 patients who were receiving metformin (1,500 mg / day) with or without another oral antidiabetic medication were randomized to a dose - finding arm of dulaglutide, sitagliptin 100 mg / day, or placebo, and after dosing were entered into either the dulaglutide 0.75 mg / week or dulaglutide 1 mg / week dosage arms for comparison to sitagliptin and placebo (replaced with sitagliptin at week 26 for blinding purposes) in a 2:2:2:1 ratio for a total of 104 weeks . The lsm change in a1c at week 52 revealed a greater decrease in a1c for both dulaglutide arms (decrease of 0.87%1.1%) compared to sitagliptin (decrease of 0.39%, p<0.001). More patients achieved an a1c of <7% and 6.5% in the dulaglutide arms compared to sitagliptin (p<0.001 for both) at 52 weeks . The lsm change in fpg was less for sitagliptin compared to both doses of dulaglutide (p<0.001 for both). At week 52, weight loss followed the same trend with greater reduction for dulaglutide 1.5 mg and 0.75 mg compared to sitagliptin (p<0.001 for both). The -cell function as estimated by homa2-b increased in all arms at 52 weeks with significantly greater changes in dulaglutide compared to sitagliptin (p<0.001). No differences were seen for homa2-s for insulin sensitivity . Dulaglutide produced a reduction in low - density lipoprotein (ldl) cholesterol whereas sitagliptin saw an increase at week 52 for a significant between - treatment difference (p=0.03). In terms of safety, a total of four patients died during the trial (one in the dulaglutide 1.5 mg arm, one in the sitagliptin arm, and two in the placebo arm [during the sitagliptin phase of the study]). Dulaglutide had a higher percentage of nausea, diarrhea, vomiting, and decreased appetite compared to sitagliptin (p<0.05) with similar results compared to placebo . The gi adverse effects were worse during the first 2 weeks and declined over time . Discontinuation from the study due to medication ades at week 52 was similar across all arms, with hyperglycemia and nausea being the most common ades . Hypoglycemia occurrences were greatest for dulaglutide 1.5 mg (10.2%) followed by dulaglutide 0.75 mg (5.3%) and then sitagliptin (4.8%) at 52 weeks with no severe hypoglycemia reported during the study . Acute pancreatitis occurred in three patients (two on sitagliptin and one on placebo [during the sitagliptin phase]). Nine patients had treatment - emergent anti - dulaglutide antibodies noted during the treatment period (1.3%) with no hypersensitivity events . Overall, dulaglutide lowered the a1c and fpg greater than sitagliptin at week 52 with similar hypoglycemia and expected gi ades during this trial . Dulaglutide has also been studied as add - on to pioglitazone and metformin compared to exenatide in a 52-week, parallel arm, randomized study in 976 t2 dm patients (baseline a1c 8.1%, duration of diabetes: 9 years).22 patients were included if they were receiving monotherapy with one oral antidiabetic agent with an a1c of 7%11% or combination therapy with an a1c of 7%10% . These oral antidiabetic agents were discontinued during the lead - in phase except for metformin or pioglitazone which were titrated up to 1,5003,000 mg daily and 3045 mg daily, respectively . Patients were randomized in a 2:2:2:1 ratio to once - weekly dulaglutide 1.5 mg, once - weekly dulaglutide 0.75 mg, exenatide 5 g titrated up to 10 g twice daily, or placebo . The primary endpoint was change in a1c at 26 weeks, which revealed a decrease by week 26 for all arms with the dulaglutide 1.5 and 0.75 mg being superior to placebo (p<0.001 for both). Changes compared to exenatide were superior for dulaglutide 1.5 and 0.75 mg arms (p<0.001 for both). At 52 weeks, the changes in a1c were also decreased in all arms with the dulaglutide 1.5 and 0.75 mg being superior to exenatide (p<0.001 for both). The percentage of patients reaching a1c <7% and 6.5% at 26 weeks was higher for dulaglutide 1.5 and 0.75 mg compared to exenatide (p<0.001 for both). Dulaglutide 1.5 and 0.75 mg decreased fpg greater than exenatide at both 26 (p<0.001 for both) and 52 weeks (p0.05 for both). Both dulaglutide arms demonstrated a greater reduction in preprandial blood glucose compared to placebo and exenatide (p<0.001 for both). The dulaglutide 1.5 mg group had a greater reduction in all postprandial blood glucose values compared to exenatide (p=0.047). Weight loss was significantly greater for the dulaglutide and exenatide groups compared to placebo at 26 weeks . Homa2-b results at 26 weeks increased in dulaglutide and exenatide arms with greater increases in dulaglutide 1.5 mg compared to exenatide (p<0.001 for all). The dulaglutide 1.5 mg arm showed a significant mean decrease in total and ldl cholesterol along with triglyceride levels compared with placebo at 26 weeks . Serious ades were similar in all groups, with two patients dying (one from myocardial infarction in the 1.5 mg dulaglutide group and one from natural causes in the dulaglutide 0.75 mg group) and overall incidence of ades was similar across all groups . Gi ades were most commonly reported, with more in the dulaglutide 1.5 mg and exenatide arms than in the dulaglutide 0.75 mg arm . One patient in the dulaglutide 1.5 mg group was diagnosed with chronic pancreatitis at 7 months with no previous history . Hypoglycemia occurred more in the exenatide group compared to the dulaglutide 1.5 mg group (p=0.007) with overall rates at 26 weeks of 10.4% in the dulaglutide 1.5 mg arm, 10.7% in the dulaglutide 0.75 mg arm, 15.9% in the exenatide arm, and 3.5% in the placebo arm . No severe hypoglycemia events were reported in the dulaglutide arms and two were reported in the exenatide arm . Ten (1.8%) patients were positive for dulaglutide - developed treatment - emergent antidrug antibodies, but none reported systemic reactions . This trial revealed that dulaglutide provided greater glycemic control overall than exenatide twice daily and placebo . A head - to - head randomized, open - label, parallel - arm study comparing dulaglutide 1.5 mg once - weekly to liraglutide 1.8 mg daily in 599 t2 dm patients (baseline a1c 8.1%, duration of diabetes: 7.2 years) uncontrolled on metformin 1,500 mg daily for 3 months was conducted.23 the primary outcome was noninferiority for change in a1c at 26 weeks with further efficacy and safety evaluated at the same time . Dulaglutide was shown to be noninferior to liraglutide with a between - group a1c difference of 0.06% (95% confidence interval [ci], 0.19 to 0.07, p<0.001) and individual decreases of lsm of 1.4% for dulaglutide and 1.36% for liraglutide (p<0.0001 from baseline for both). Similar percentages of patients receiving dulaglutide and liraglutide reached an a1c of <7% and 6.5% . No difference was found between dulaglutide and liraglutide with decreases in fpg or postprandial glucose (lsm 46 versus 44 mg / dl, respectively). Weight loss was greater with liraglutide compared to dulaglutide with a between - group difference of 0.71 kg (95% ci, 0.171.26, p=0.011). Serious, but nonsigificant adverse drug reactions occurred in 2% of the dulaglutide group and 4% of the liraglutide group with no deaths and with similar rates of treatment - emergent ades . Gi adverse effects were similar, mild to moderate in overall severity, and transient . There were no severe hypoglycemic events and rates for overall hypoglycemia were 9% for dulaglutide and 6% for liraglutide . One cardiovascular event of a myocardial infarction occurred in the liraglutide group, and there were similar changes in both systolic and diastolic blood pressures and no differences in lipids between both groups . Treatment - emergent antibodies developed in three patients (1%) in the dulaglutide group (not assessed in the liraglutide group) that did not develop into hypersensitivity reactions . Overall, dulaglutide 1.5 mg once weekly demonstrated noninferiority for efficacy and safety to liraglutide 1.5 mg daily . A review of dulaglutide at clinicaltrials.gov reveals several ongoing trials, including studies comparing dulaglutide to placebo in patients already receiving sulfonylurea therapy (nct01769378), glimepiride (nct01644500), and once - daily basal glargine insulin (nct01648582).2426 the primary outcome for each of these studies is change in a1c at 2426 weeks . Dulaglutide was compared to sitagliptin in 1,098 t2 dm patients (a1c 8.1%, duration of diabetes: 7 years) uncontrolled on metformin therapy in a double - blind, parallel - arm randomized study.17 patients who were receiving metformin (1,500 mg / day) with or without another oral antidiabetic medication were randomized to a dose - finding arm of dulaglutide, sitagliptin 100 mg / day, or placebo, and after dosing were entered into either the dulaglutide 0.75 mg / week or dulaglutide 1 mg / week dosage arms for comparison to sitagliptin and placebo (replaced with sitagliptin at week 26 for blinding purposes) in a 2:2:2:1 ratio for a total of 104 weeks . The lsm change in a1c at week 52 revealed a greater decrease in a1c for both dulaglutide arms (decrease of 0.87%1.1%) compared to sitagliptin (decrease of 0.39%, p<0.001). More patients achieved an a1c of <7% and 6.5% in the dulaglutide arms compared to sitagliptin (p<0.001 for both) at 52 weeks . The lsm change in fpg was less for sitagliptin compared to both doses of dulaglutide (p<0.001 for both). At week 52, weight loss followed the same trend with greater reduction for dulaglutide 1.5 mg and 0.75 mg compared to sitagliptin (p<0.001 for both). The -cell function as estimated by homa2-b increased in all arms at 52 weeks with significantly greater changes in dulaglutide compared to sitagliptin (p<0.001). No differences were seen for homa2-s for insulin sensitivity . Dulaglutide produced a reduction in low - density lipoprotein (ldl) cholesterol whereas sitagliptin saw an increase at week 52 for a significant between - treatment difference (p=0.03). In terms of safety, a total of four patients died during the trial (one in the dulaglutide 1.5 mg arm, one in the sitagliptin arm, and two in the placebo arm [during the sitagliptin phase of the study]). Dulaglutide had a higher percentage of nausea, diarrhea, vomiting, and decreased appetite compared to sitagliptin (p<0.05) with similar results compared to placebo . The gi adverse effects were worse during the first 2 weeks and declined over time . Discontinuation from the study due to medication ades at week 52 was similar across all arms, with hyperglycemia and nausea being the most common ades . Hypoglycemia occurrences were greatest for dulaglutide 1.5 mg (10.2%) followed by dulaglutide 0.75 mg (5.3%) and then sitagliptin (4.8%) at 52 weeks with no severe hypoglycemia reported during the study . Acute pancreatitis occurred in three patients (two on sitagliptin and one on placebo [during the sitagliptin phase]). Nine patients had treatment - emergent anti - dulaglutide antibodies noted during the treatment period (1.3%) with no hypersensitivity events . Overall, dulaglutide lowered the a1c and fpg greater than sitagliptin at week 52 with similar hypoglycemia and expected gi ades during this trial . Dulaglutide has also been studied as add - on to pioglitazone and metformin compared to exenatide in a 52-week, parallel arm, randomized study in 976 t2 dm patients (baseline a1c 8.1%, duration of diabetes: 9 years).22 patients were included if they were receiving monotherapy with one oral antidiabetic agent with an a1c of 7%11% or combination therapy with an a1c of 7%10% . These oral antidiabetic agents were discontinued during the lead - in phase except for metformin or pioglitazone which were titrated up to 1,5003,000 mg daily and 3045 mg daily, respectively . Patients were randomized in a 2:2:2:1 ratio to once - weekly dulaglutide 1.5 mg, once - weekly dulaglutide 0.75 mg, exenatide 5 g titrated up to 10 g twice daily, or placebo . The primary endpoint was change in a1c at 26 weeks, which revealed a decrease by week 26 for all arms with the dulaglutide 1.5 and 0.75 mg being superior to placebo (p<0.001 for both). Changes compared to exenatide were superior for dulaglutide 1.5 and 0.75 mg arms (p<0.001 for both). At 52 weeks, the changes in a1c were also decreased in all arms with the dulaglutide 1.5 and 0.75 mg being superior to exenatide (p<0.001 for both). The percentage of patients reaching a1c <7% and 6.5% at 26 weeks was higher for dulaglutide 1.5 and 0.75 mg compared to exenatide (p<0.001 for both). Dulaglutide 1.5 and 0.75 mg decreased fpg greater than exenatide at both 26 (p<0.001 for both) and 52 weeks (p0.05 for both). Both dulaglutide arms demonstrated a greater reduction in preprandial blood glucose compared to placebo and exenatide (p<0.001 for both). The dulaglutide 1.5 mg group had a greater reduction in all postprandial blood glucose values compared to exenatide (p=0.047). Weight loss was significantly greater for the dulaglutide and exenatide groups compared to placebo at 26 weeks . Homa2-b results at 26 weeks increased in dulaglutide and exenatide arms with greater increases in dulaglutide 1.5 mg compared to exenatide (p<0.001 for all). The dulaglutide 1.5 mg arm showed a significant mean decrease in total and ldl cholesterol along with triglyceride levels compared with placebo at 26 weeks . Serious ades were similar in all groups, with two patients dying (one from myocardial infarction in the 1.5 mg dulaglutide group and one from natural causes in the dulaglutide 0.75 mg group) and overall incidence of ades was similar across all groups . Gi ades were most commonly reported, with more in the dulaglutide 1.5 mg and exenatide arms than in the dulaglutide 0.75 mg arm . One patient in the dulaglutide 1.5 mg group was diagnosed with chronic pancreatitis at 7 months with no previous history . Hypoglycemia occurred more in the exenatide group compared to the dulaglutide 1.5 mg group (p=0.007) with overall rates at 26 weeks of 10.4% in the dulaglutide 1.5 mg arm, 10.7% in the dulaglutide 0.75 mg arm, 15.9% in the exenatide arm, and 3.5% in the placebo arm . No severe hypoglycemia events were reported in the dulaglutide arms and two were reported in the exenatide arm . Ten (1.8%) patients were positive for dulaglutide - developed treatment - emergent antidrug antibodies, but none reported systemic reactions . This trial revealed that dulaglutide provided greater glycemic control overall than exenatide twice daily and placebo . Similar ades were seen overall between dulaglutide and exenatide . A head - to - head randomized, open - label, parallel - arm study comparing dulaglutide 1.5 mg once - weekly to liraglutide 1.8 mg daily in 599 t2 dm patients (baseline a1c 8.1%, duration of diabetes: 7.2 years) uncontrolled on metformin 1,500 mg daily for 3 months was conducted.23 the primary outcome was noninferiority for change in a1c at 26 weeks with further efficacy and safety evaluated at the same time . Dulaglutide was shown to be noninferior to liraglutide with a between - group a1c difference of 0.06% (95% confidence interval [ci], 0.19 to 0.07, p<0.001) and individual decreases of lsm of 1.4% for dulaglutide and 1.36% for liraglutide (p<0.0001 from baseline for both). Similar percentages of patients receiving dulaglutide and liraglutide reached an a1c of <7% and 6.5% . No difference was found between dulaglutide and liraglutide with decreases in fpg or postprandial glucose (lsm 46 versus 44 mg / dl, respectively). Weight loss was greater with liraglutide compared to dulaglutide with a between - group difference of 0.71 kg (95% ci, 0.171.26, p=0.011). Serious, but nonsigificant adverse drug reactions occurred in 2% of the dulaglutide group and 4% of the liraglutide group with no deaths and with similar rates of treatment - emergent ades . Gi adverse effects were similar, mild to moderate in overall severity, and transient . There were no severe hypoglycemic events and rates for overall hypoglycemia were 9% for dulaglutide and 6% for liraglutide . One cardiovascular event of a myocardial infarction occurred in the liraglutide group, and there were similar changes in both systolic and diastolic blood pressures and no differences in lipids between both groups . Treatment - emergent antibodies developed in three patients (1%) in the dulaglutide group (not assessed in the liraglutide group) that did not develop into hypersensitivity reactions . Overall, dulaglutide 1.5 mg once weekly demonstrated noninferiority for efficacy and safety to liraglutide 1.5 mg daily . A review of dulaglutide at clinicaltrials.gov reveals several ongoing trials, including studies comparing dulaglutide to placebo in patients already receiving sulfonylurea therapy (nct01769378), glimepiride (nct01644500), and once - daily basal glargine insulin (nct01648582).2426 the primary outcome for each of these studies is change in a1c at 2426 weeks . Dulaglutide is dosed at 1.5 mg and 0.75 mg once - weekly as a subcutaneous injection based upon the award-5 trial, which included a dose finding portion.17 dulaglutide is to be delivered in a prefilled subcutaneous automatic injection device that will extend a needle, deliver dulaglutide, and retract the needle with the push of a button, and patients will not handle a needle.27 one advantageous benefit of glp-1 agonists, including dulaglutide, is a potential increase in -cell mass in vitro via increased cellular regeneration and inhibition of apoptosis as seen in young rodent models which leads to slower progression of t2 dm and a potential delay in the need for insulin therapy.8,28 although this was not shown to be detectable in older rodent models or human trials, there is evidence of preservation of -cell function after 3 years of treatment with short acting exenatide.29 studies currently completed with dulaglutide have shown an increase in -cell function measured by an increase in homa2-b, but the insulin sensitivity marker homa2-s was not increased by dulaglutide as compared to placebo, sitagliptin, metformin, and exenatide twice daily.15,17,18,21,22 furthermore, when compared head - to - head, dulaglutide and liraglutide both improved homa2-b.23 overall, dulaglutide may slow the progression of t2 dm and delay the need for insulin therapy through increasing homa2-b, but long - term data is not available . Glp-1 agonists promote weight loss over conventional therapies for the treatment of t2 dm with a moderate weight loss approximated at 13 kg (table 1).15,17,18,2123 dulaglutide specifically reduced weight in a dose - dependent fashion by 0.22.5 kg, compared to placebo.17,18 when compared to sitagliptin, dulaglutide produced greater weight reduction than sitagliptin.17 weight - loss comparisons between dulaglutide 1.5 mg and metformin 1,5002,000 mg daily showed similar results.21 compared with other glp-1 ras, dulaglutide at 1.5 mg produced similar results to exenatide 10 g twice daily but statistically significant lower results compared to liraglutide 1.8 mg daily.22,23 since 2008, the united states department of health and human services fda has provided guidance and recommendation that agents developed for the treatment of t2 dm demonstrate that they do not cause increased or unacceptable cardiovascular risk.30 exenatide (both formulations) and liraglutide have provided promising cardioprotective effects in animal models and early clinical studies, including reduced systolic blood pressure, ldl cholesterol, and triglycerides.31 additionally, the rate of heart failure in patients receiving exenatide twice daily was lower than in patients receiving other treatments.31 in one retrospective study, patients with risk factors for cardiovascular disease who received exenatide were less likely to have a cardiovascular event.32 a recent meta - analysis that included 33 trials consisting of exenatide, exenatide long - acting, liraglutide, taspoglutide, and albiglutide demonstrated no increased major cardiovascular events (odds ratio [or] = 0.078 [95% ci, 0.541.13], p=0.18), myocardial infarctions (or = 0.87 [95% ci, 0.481.56], p=0.63), strokes (or = 0.87 [95% ci, 0.372.05], p=0.75), or all - cause mortality (or = 0.89 [95% ci, 0.461.70], p=0.81).33 compared to placebo, the glp-1 ras appeared to provide a potential benefit; however, the results were nonsignificant . Moreover, evidence exists that glp-1 receptors are expressed within cardiomyocytes and arterial walls, and rodent models have demonstrated reduced infarct size and improved left - ventricular - ejection function during coronary ischemia when treated with a glp-1 ra.8 no current studies have been published with major adverse cardiovascular events for dulaglutide . The researching cardiovascular events with a weekly incretin in diabetes (rewind) trial (nct01394952) is an ongoing trial that is randomizing patients with t2 dm and an a1c of 9.5% to either dulaglutide 1.5 mg every week or placebo, with the primary outcome of time from randomization to first occurrence of cardiovascular death, nonfatal myocardial infarction, or nonfatal stroke (a composite cardiovascular outcome); it is expected to be completed by april 2019.34 cardiovascular safety endpoints, such as change in systolic and diastolic blood pressure for dulaglutide, have shown positive effects . Overall decreases in blood pressure have been minimal with only a few trials producing statistically significant, but not clinically significant, results (table 2).15,17,18,2123 the same is true for cholesterol, with decreases noted in ldl, triglycerides, and total cholesterol.22,23 adverse drug events of dulaglutide have been consistent with those of other agents in this class, with the most common seen being transient and mild gi side effects . These include nausea, vomiting, and diarrhea which are expected based upon the mechanism of action and usually decrease over time . Hypoglycemia is similar to other glp-1 ras and was typically not significant in the clinical trials, with no reports of severe hypoglycemia occurring in any trial.15,17,18,2123 injection - site reactions are also possible but have not been reported at a high rate in currently available clinical trials . Development of antibodies against the medication may potentially lead to reduced efficacy and/or changes in the safety profile . The risk with dulaglutide in clinical trials appears to be low according to currently available trials but varied from study to study from no reports to up to ten reports.15,17,18,2123 out of the reported cases, only one hypersensitivity reaction occurred resulting in treatment - emergent skin rash and skin exfoliation.15 pancreatitis is a concern for all incretin agents . In march 2013, the fda released a drug - safety communication describing the risk of pancreatitis with these agents . This communication was in response to postmarketing reports of acute pancreatitis with exenatide and sitaglipitn along with results from a population - based matched case - control study demonstrating increased risk for hospitalization with acute pancreatitis from sitagliptin and exenatide.35 this study found that t2 dm patients who had pancreatitis and were taking these two incretin agents were more likely to have hypertriglyceridemia, increased alcohol use, gallstones, tobacco abuse, obesity, biliary and pancreatic cancer, cystic fibrosis, and any neoplasm compared to controls . After adjusting for confounders, including specifically metformin therapy, the association for risk of acute pancreatitis was higher in those having ever taken sitagliptin and exenatide (adjusted or, 2.07 [95% ci, 1.363.13], p=0.01). However, a meta - analysis published in february 2014 reviewed 80 studies and included 41 studies in an analysis of 14,972 patients; it found the overall risk of pancreatitis was not different between glp-1 ras and comparators (or,1.01 [95% ci, 0.372.76], p=0.99).36 in another meta - analysis of randomized and nonrandomized trials, prospective and retrospective cohort studies, and case - controlled studies of treatment with glp-1 ras or dpp-4 inhibitors in t2 dm patients, the risk for pancreatitis was compared to placebo, lifestyle modification, or oral antidiabetic medications.37 a total of 60 studies were included and, from the 55 randomized controlled trials, there was no increased risk for pancreatitis seen for the incretin therapies (or, 1.11 [95% ci, 0.572.17]). Overall, the risk in currently available clinical trials is inconclusive as there have been either no cases reported, or one to two cases which may have been related to the study drug . In addition it should be noted that patients with diabetes have an associated higher rate of pancreatitis . A meta - analysis of t2 dm patients revealed an increased relative risk of 1.8 (95% ci, 1.452.33, p=0.000).38 along with approval of this agent, the fda has mandated a risk evaluation and mitigation strategy to be completed postmarketing to monitor and lessen the potential risk of pancreatitis and medullary thyroid carcinoma.39 these risk evaluation and mitigation strategies are required for all glp-1 ras currently available on the market in the united states . The risk for medullary thyroid cancers is because thyroid c - cell tumors have been seen in rodent studies with other glp-1 ras.39 currently, data and pricing information for dulaglutide is comparative to mid - range glp-1 agonists on the market . Glp-1 therapies range from $391 to $706 based on average wholesale price package price information (table 3).40 a recent retrospective cohort study using medical and pharmacy claims examined per - patient costs of glycemic control in adult patients nave to incretin therapies who had a baseline a1c average of 7.8%.41 this study examined the cost of reducing a1c to <7% with liraglutide or exenatide twice daily . Unadjusted cost for total diabetes - related pharmacy was similar for patients who received liraglutide compared to exenatide ($1,993 versus $1,924, p=0.376). When age, sex, baseline a1c, comorbidity history, and concomitant medication - use factors were controlled for, the exenatide group had lower diabetes - related pharmacy costs per patient than the liraglutide group (estimated $203.1 difference in cost; p=0.0002). Additionally, the liraglutide group had a higher predictive diabetes related pharmacy cost per patient than the exenatide group ($2,002$502 for liraglutide versus $1,799$502 for exenatide, p<0.001), but more patients in the liraglutide group reached a1c of <7% . With this, cost per patient successfully achieving a1c of <7% (cost for control) was lower with liraglutide compared to exenatide ($3,108$779 versus $3,354$936, p<0.0001). Since dulaglutide is a long - acting glp-1 similar to liraglutide, clinicians may see results similar to liraglutide when dulaglutide comes to market dulaglutide is a glp-1 ra that has demonstrated a1c reduction of 0.7%1.5% and reductions of fpg by 1343 mg / dl, as monotherapy or in combination, at 0.75 and 1.5 mg once - weekly doses in clinical trials . Compared to other glp-1 ras in the class, it has been shown to be overall noninferior for both safety and efficacy . Safety concerns are similar to other agents in the class, with similarly low risk for hypoglycemia and the most common ades being transient gi problems . Similar to other agents in the class, it has demonstrated weight loss of 1.33 kg which has been sustained over at least 26 weeks . There are still questions remaining about long - term efficacy and safety, including major cardiovascular events which are currently being researched, but dulaglutide has not demonstrated a significant increased risk for pancreatitis or pancreatic cancer in short - term trials . Overall, it should be located alongside the other long - acting agents in the glp-1 ra class within the recommended guidelines.
|
Influenza a virus infections in birds account for important inputs into the evolutionary porcine - human complex of this prominent anthropozoonotic pathogen . Among influenza a viruses, which broadly exhibit 17 ha and 9 na antigenic subtypes, only three haemagglutinin (ha) subtypes (h1, h2, and h3) and two neuraminidase (na) subtypes (n1 and n2) have circulated widely in swine and human populations since the 20th century . Viruses from waterfowl reassorted with existing human and/or porcine influenza viruses to generate the 1957, 1968, and 2009 (novel swine - origin influenza a (h1n1) virus investigation team, 2009) pandemic influenza viruses and may expectably play a similar role in the creation of future pandemic viruses . In addition, on multiple occasions, it has been evident that avian influenza viruses (aivs), chiefly the subtypes h5n1, h7n7, and h9n2, directly transmitted from birds to humans [3, 4]. Avian - originated h1n1, h3n2, h5n1, and h9n2 viruses have been recovered from pigs in asia, europe, and canada [57]. Pigs have been postulated, hence, to be the ultimate mixing vessels for mammalian influenza viruses and aivs and can play an important role in the genetic reassortment of influenza viruses . Therefore, detection and characterization of aivs, especially those subtypes having the potential to transmit to mammals, including pigs and humans, are significant . Avian h7n7 and h3n8 strains are contracted and circulated by horses, as well, and an equine h3n8 virus apparently was involved in the formation of the pandemic h3n2 virus, and perhaps the h3n8 pandemic virus of 1889 . The genome of influenza a viruses consists of eight different segments of single - stranded negative - sense rna . Most gene segments encode for one protein; whereas the gene segments 2 (polymerase basic1pb1), 7 (matrix m), and 8 (nonstructural ns gene), each encodes one additional protein from alternatively spliced mrna . Among the proteins, 9 are structural, while the rest two, namely pb1-f2 and ns1, are nonstructural . Aquatic birds are the primary reservoir of type a influenza viruses and are classified into various antigenic subtypes, based on their two surface glycoproteins, the ha, and the na . So far, seventeen ha (h1h17) and nine na subtypes (n1n9) have been identified from avian species, representing the entire pool of influenza a viruses known today . Although largely shaped by the ha, the virulence of influenza a viruses is polygenic in nature . H5 and h7 influenza viruses with multiple basic amino acids nearby to the cleavage site of the ha glycoprotein exhibit a wide range of tissue tropism and lead to systemic disease in chickens with fatality . It has been demonstrated that the amino acids at positions 627 and 701 of the polymerase basic 2 (pb2) protein influence the outcome of infection in mice [12, 13]. Several studies have reported that the ns1 protein is also associated with the virulence of influenza viruses [14, 15]. The glutamic acid at position 92 of ns1 of h5n1 influenza virus confers virulence and resistance to antiviral cytokines in pigs . In spite of those well - known, meaningful functions of the ns gene concerning virulence and escape from host cytokine response, the degree of variation in the ns gene pool of aivs in their natural reservoirs, particularly in the northern pintail (anas acuta) (thereafter referred to as pintail (s)) ducks, a globally major influenza host wintering in japan, is poorly studied . In this paper, we focused on genetic analysis of h1n1, h1n2, and h1n3 strains of aivs that we isolated from apparently healthy migratory pintails wintering in japan [17, 18]. Also, we analyzed the ns genes of h5 and h7 subtypes, in addition to the above - mentioned aivs . Moreover, polymerase acid (pa), nucleoprotein (np), m, and ns genes of h5n9 strain, an uncommon antigenic combination which we isolate for the first time in asia, were further looked into in the present study . Viruses used in this study (table 1) were of low pathogenicity and isolated in embryonated chicken eggs (ece) from fecal materials of migratory, apparently healthy pintails wintering in japan [17, 18]. Working stocks of viruses were prepared by 3rd passage in ece, and allantoic fluid was harvested at 3 days after inoculation (dpi) and stored at 80c . Total viral rna was extracted from infected allantoic fluid using the isogen - ls (nippongene, tokyo, japan), in accordance with the manufacturer's instructions . Reverse transcription was carried out with the uni12 primer (5-agc aaa agc aag g-3) and mmlv reverse transcriptase (geneamp rna pcr kit, applied biosystems, tokyo, japan), followed by full length amplification of each gene segment, as described earlier . The pcr product was purified using qiaquick gel extraction kit (qiagen, valencia, ca), according to the manufacturer's instructions . The pcr product was sequenced by dideoxy chain terminating method, using dye terminator cycle sequencing fs ready reaction kit (perkin - elmer applied biosystems, japan). Sequencing was carried out with the same primers used to amplify the gene and continued with subsequently designed sequence - specific primers . Nucleotide sequences were determined using an automated dna sequencer (abi 310 dna sequencer, applied biosystems, foster city, ca), edited and assembled with genetyx - mac (version 10.0; software development corp ., tokyo, japan). Multiple sequence alignments and processing were performed with the molecular evolutionary genetics analysis (mega) version 4.1.0 software, with an engine based on the clustalw algorithm . The phylogenetic analyses were performed using neighbor joining tree inference analysis, with the 1000 bootstrap replications, to assign confidence levels to branches . Nucleotide sequences of entire open reading frame (orf) of each gene segment (except pb1 gene of a / northern pintail / aomori/1130/08 h1n3 (aomori/1130/08 h1n3)) were used in the phylogenetic analysis . The pb1 gene of aomori/1130/08 h1n3 was partially 1350 base pair (1 - 1350 bp) sequenced and used in the phylogenetic analysis . Furthermore, the ha gene of a / northern pintail / akita/1364/08 h1n2 (akita/1364/08 h1n2) was sequenced partially 765 bp (760 - 1524) and was not included in the phylogenetic analysis . The nucleotide sequences generated in this study have been deposited in genbank and are available under accession number ab546149ab546193 . As a part of longitudinal virological studies, we have isolated various subtypes of aivs from fecal materials of migratory, apparently healthy pintails wintering in tohoku district, japan [17, 18]. Of these, h1n1, h1n2, and h1n3 viruses were characterized genetically . For phylogenetic relationships of ns gene, the latter from viruses bearing h1, h5, and h7 ha was sequenced and compared with viruses from genbank . The sequenced ha genes (n = 6) of h1 subtype with different na subtype combinations (n1, n2, and n3) isolated from pintails during 2007 - 2008 were closely related to each other (figure 1(a); table 2). The nucleotide and amino acid sequence identities were found to range from 96.5 to 100% and 98.0 to 100%, respectively . Phylogenetically, the viruses were clustered with the viruses from eurasian countries, mostly with viruses from china, namely a / duck / hebei/843/05 h1n2 and a / wild duck / jx/12416/05 h1n1 (> 97% nucleotide homology) (figure 1(a)). The ha genes of sequenced viruses were grouped into the h1.1.2 (subtype h1). Viruses of the present study had a sister group relationship with the japanese h1 viruses including a / pintail / shimane/324/98 h1n9 isolated earlier . North american strains, and swine, human seasonal and pandemic h1 strains integrated sharply in different branches . It means that although bearing the same antigenic subtype (h1n1) and obtained during 2007 - 2008, our isolates were unrelated to the porcine - derived 2009 pandemic and seasonal flu strains . Like ha genes, the nucleotide homologies of the na genes of the isolates with each other were 96.899.8% and 99.799.9% for n1 (n = 3) and n2 (n = 3), respectively, for each subtype . On the other hand, the amino acid sequence identities were found to range from 97.4 to 99.8% (n1) and 99.499.8% (n2). A duck - originated japanese strain obtained 2 years earlier, a / duck / tsukuba/67/05 h1n1 (tsukuba/67/05 h1n1) was found most closely related to one of the isolates a / northern pintail / aomori/422/07 h1n1 (aomori/422/07 h1n1) (> 98% homology at both nucleotide and amino acid sequences)of the present study, while two other viruses have maximum homology to a mongolian strain, a / duck / mongolia/116/02 h1n1 (mongolia/116/02 h1n1), isolated in 2002 (> 98% homology at both nucleotide and amino acid sequences). For n2 nas, a chinese strain, namely a / goose / gui yang/3799/05 h5n2 (gui yang/3799/05 h5n2) isolated from goose in 2005 was found rather closely related (> 98% nucleotide and amino acid identity). The n3 na gene of aomori/1130/08 h1n3 has> 99% nucleotide and amino acid homology to a duck strain, namely a / duck / niigata/514/06 h5n3 (niigata/514/06 h5n3) isolated in 2006 in japan (table 3). Principally, the na genes of the sequenced viruses were clustered with viruses of eurasian origin (figures 1(b) and 1(c)). Na gene of aomori/422/07 h1n1 strain branched separately from other strains isolated by us in 2008 (figure 1(b)), the n2 na genes of which were all integrated into a single branch represented by a h5n2 strain, gui yang/3799/05, which was isolated in china in 2005 (figure 1(c)). Like h1 ha genes, the n1 na genes were distinctly separated from pandemic strains (figure 1(b)). A remarkably diverse variation in the nucleotide sequence identities (50100%) was found among the ns genes of the sequenced viruses (table 4). When analyzed phylogenetically, they were distinctly branched into two branches, allele a and b, and clustered with eurasian origin viruses (figure 1(d) and table 4). Nucleotide sequence identities of ns genes within allele a and within allele b were 97.7100% and 94.4100%, respectively . However, the divergence between the two alleles was approximately 50%, regardless of their isolation time and geographical location . The majority of the viruses of the present study were branched with allele a viruses represented with / by a / mallard / sweden/2724/06 h5n1 and a / duck / hong kong / y439/97 h9n2 (hong kong / y439/97 h9n2). In contrast, a / northern pintail / aomori/372/08 h7n7 (aomori/372/08 h7n7), aomori/385/08 h5n3, and a / northern pintail / miyagi/674/08 h7n7 (miyagi/674/08 h7n7) viruses were clustered with allele b viruses represented with / by a / goose / guangdong/1/96 h5n1 (guangdong/1/96 h5n1). As for allele a, two pairs h5n2 and akita/1355/07 h5n2, alongside with akita/1353/08 h1n2 and akita/1364/08 h1n2 viruses were found 100% homologous, while in allele b aomori/372/08 h7n7 and miyagi/674/08 h7n7 viruses were found to be entirely identical . Significantly, the ns1 genes of influenza viruses in general have been divided into two alleles: a and b . Regardless of some exceptions, all influenza viruses circulating in mammalian species and many viruses from avian species comprise the allele a, while allele b is found within only aivs . The ns1 gene of the majority of highly pathogenic avian influenza (hpai) h5n1 viruses isolated from humans since 1997 is affiliated with allele a. in contrast, the ns1 gene of the guangdong/1/96 virus, which was the source of the initial hpai h5n1/1997 ha gene, belonged to allele b . The ns1 genes of viruses of the present study all lpai belong either to allele a or allele b. curiously, it was pointed out that some strains of the hpai h5n1 virus were preserved genetically unchanged from 1997 up to 2005 . In that connection, perhaps, it is of note that the ns gene of some viruses, for example aomori/372/08 h7n7 and miyagi/674/08 h7n7 of this study have only <3% nucleotide disparity from that of a russian strain, namely a / duck / chabarovsk/1610/72 h3n8 (chabarovsk/1610/72 h3n8), isolated in 1972 . The ns gene of one of the viruses we had isolated from pintail ducks, namely akita/714/06 h5n2, has 98.3% nucleotide homology to the same russian isolate chabarovsk/1610/72 h3n8 . It means that the ongoing mutation rate during about 35 years was only about 1.7%, which is markedly less than the expected one . This may imply that throughout about a third of that 35 years period the ns gene has been somehow conserved, considering that the estimated ns gene evolutionary rates for avian, classic swine, and equine lineages are 0.841.27 nucleotide changes per site per year, and even higher, within both wild and domestic avian host species . Basically, the two reasons thought to possibly account for unexplained genetic conservation in influenza a viruses are cross contamination, or interference with vaccine strains . The strain chabarovsk/1610/72 or related strains are not held in our laboratory, and interference with a vaccine strain seems unlikely, in that case . These, together with the location of chabarovsk being close to the regular migration route of pintails between japan and siberia, have to further be looked into . Prevalence of allele a and b viruses in their natural hosts has been reported to vary spatially, as well . Generally, allele b viruses were reported to be less common in their natural hosts than allele a. out of 11 ns genes sequenced in this study, 72.7% (8/11) were classified as allele a, and 27.3% (3/11) as allele b. in asia, the prevalence of allele b viruses in all avian species has been reported to be only 15%, which is markedly lower than found in this study . However, the prevalence rate of allele b viruses in north american free flying birds has been documented to be 30%, similar to that observed in pintails in our study, but higher than found in northern european mallards (13%; 6 out of 45). Most pintails which winter in japan originate from eastern russia [33, 34]. Besides, pintails marked in north america have been recovered during winter in japan and vice versa [35, 36]. Moreover, some pintails migrate from north america to eastern russia, where they could come into contact with birds that migrate from six continents, including asian wintering sites . Furthermore, from the recent satellite telemetry data, provided by the united states geological survey (usgs) and the us fish and wildlife service, it is evident that pintails marked during winter in japan move to alaska through russia and return to japan, following the same route (alaska science center, movements of northern pintail ducks and whooper swans marked with satellite transmitters in japan http://alaska.usgs.gov/science/biology/avian_influenza/pintail_movements_virus.php . Thus, inter- and intra continental exchange of genes and genomes of aiv could occur through congregation of north american and asian migrants at shared summer habitats in eastern russia, or by means of pintails that migrate between north american nesting grounds and japanese wintering grounds (assessment of virus movement across continents: using northern pintails (anas acuta) as a test . Also the number of samples may possibly have effect on the results found in this study . The np genes of the sequenced viruses have 90.499.9% nucleotide homologies among each other, regardless of their temporal and spatial differences in isolation (table 5). Broadly, viruses isolated from eastern hemisphere have high homologies to the np genes of the viruses of this study (97.2 to 99.5% nucleotide identity). It is noteworthy that the np gene of the majority of viruses (75% of 8 viruses) investigated in this study had a high homology to a porcine strain, namely a / swine / korea / c12/08 h5n2 (korea / c12/08 h5n2) isolated in 2008, suggesting that the np genes of these viruses and the korea isolate might have a common ancestral origin . Similar to np gene of h1 viruses, the ha genes of some h5n2 viruses isolated by us during 2006 - 2007 were found to be closely related to this korean virus [19, 26]. In conjunction, biogeographically and phylogenetically, other related strains, namely a / garganey / san jiang/160/06 h5n2, a / baikal teal / hongze/14/05 h11n9, and a / duck / hong kong / mps180/03 h4n6 originated from china, and one strain, a / mallard / hokkaido/24/09 h5n1, from japan . For np gene viruses from both eurasian countries and north america were clustered with the viruses of the present study (figure 1(e)). The nucleotide sequence disparity between viruses of this study and north american viruses clustered together ranged from 1.4 to 9.3% . Especially, and not by chance, in all likelihood, aomori/422/07 h1n1 has 98.6% nucleotide identity to the strain a / pintail / alaska/1/07 h3n8, meaning isolated from the same host in the same year . In that case, viruses of north american lineage integrated distinctly from those of eurasian lineage, suggesting, in light of the mentioned high np gene homology, intercontinental gene exchange through reassortment, rather than whole genome intercontinental conveyance . The ha amino acid sequences deduced from nucleotide sequences analysis revealed that all the viruses contain seven potential n - linked glycosylation sites (5 in ha1 and 2 in ha2) throughout the ha molecule . Except for aomori/422/07 h1n1, the amino acid motif of the ha0 cleavage site of all the sequenced h1 viruses was psiqsr*glf (* cleavage point), which is common in all avian, porcine, and human viruses . H1n1 contains a rare amino acid motif, psvqsr*glf . Among the h1 avian strains isolated globally and sequences reported in genbank during 19802009, only one strain, namely a / mallard / new york/170/82 h1n2 has identical (psvqsr*glf) amino acids . However, aomori/422/07 h1n1 solely clustered with the eurasian viruses (figure 1(a)), implying, ostensibly that it has no relation with the mallard - originated new york strain and evolves individually . Still, the extreme rareness of the mentioned motif might possibly be supportive of genetic recombination event that perhaps took place within collocated ducks from north america and asia . The ha molecules of all of the sequenced h1 viruses contain residues gln (q) and gly (g) at positions 240 and 242 (h1 numbering), respectively, which indicate the avian receptor specificity . On the other hand, the amino acid sequence analysis of nas revealed that all the viruses contain full length na protein with seven potential n - linked glycosylation sites in n1 and n2 known to be conserved in wild ducks . In all na molecules, a residue his (h) was found at position 274 (n2 numbering), thereby indicating sensitivity to oseltamivir or zamamivir . Besides, typical catalytic sites, framework sites as well as other specific regions were found completely conserved as described previously . Residue position 198 in n3 na contains asn (n) instead of asp (d) and is also shown to be conserved . The n1 and n2 na of the sequenced viruses possessed e119 and r292 amino acid residues, indicating that the commonly mutated residues in na inhibitor - resistant viruses were not present . Deletion of several amino acids in the ns1 gene has been observed more frequently in aivs in recent years, a feature of possible adaptation of these viruses to poultry [24, 43]. The viruses sequenced in our study contained full length ns genes, indicating basically wild bird strains . Nevertheless, all isolates possessed residue ala (a) position 149, which is important for replication of viruses in chickens . Also, residue asp (d) instead of glu (e) was found at position 92 of the ns1, which is reported to be involved in modulation of cytokine response, and has been associated with the high virulence exhibited by hpai h5n1 viruses in pigs . All the sequenced viruses contain a pdz (postsynaptic density, psd-95; discs large, dlg; zonula occludens-1, zo-1) domain ligand at the c terminus of ns1 (esev - cooh), which plays an important role in many key signaling pathways of viral replication . When compared to pandemic and seasonal influenza viruses, the ha genes' nucleotide identity of viruses of the present study was found to range from 67.1 to 76.4%, while amino acid sequence homology was found 81.892.1% (table 6). In difference, for na gene, a somewhat higher nucleotide and amino acid identity was found (79.386.5% nucleotide and 84.992.5% amino acid sequence identities). Not only the ha and na genes but also other internal genes of pandemic and seasonal flu strains were clustered distinctly from those of our isolates, suggesting no relation between these viruses . Basically, genomic analyses of the last four pandemic strains showed that the genes contributed by avian strains are those that encode for the polymerases and surface antigens, as follows:1918pb1 and pa; 1957pb1, ha, and na; 1968pb1 and ha; 2009pb2 and pa . This means that among the presently prevailing pandemic and seasonal strains, only the seasonal h3n2 has past affinity to avian ha, when it originally formed as a then pandemic strain in 1968, thereafter considerably drifting genetically for already 43 years . Independent drift probably took place during that period of time within the precursor avian h3 ha gene in bird populations . In conclusion, our genetic analysis suggests that the sequenced viruses were to an appreciable degree characteristic of the pintail populations we sampled, which typically winter in japan . Except in one strain, the ha0 cleavage site of h1 was found as usually found in all avian, porcine, and human viruses . The residues that compose the catalytic and framework sites of the na enzyme were completely conserved in the studied viruses . The np gene of the majority of the strains sequenced in this study (5/8) was related to that of the porcine strain korea / c12/08 h5n2 . Thus, it may be presumed that our isolates evolved through reassortment process during the cocirculation of these strains . Our findings clearly demonstrate that two distinct gene pools, corresponding to both ns allele a and b, were present within the pintail populations wintering in japan . It is noteworthy that some strains contain ns gene highly related to a duck isolate obtained in russian in 1972, about 35 years prior to our isolate, indicating significant gene conservation . It is also concluded that although bearing the same antigenic subtype (h1n1) and obtained during 2007 - 2008, our isolates were unrelated to 2009 pandemic and seasonal flu strains.
|
There are changes for mortality, communicable diseases (cd), and non communicable diseases (ncd) worldwide (16). Sub - saharan africa shows several studies about poverty, industrialization, urbanization, and epidemiologic transition (614). In particular, significant changes in the delivery of health care in the public sector occurred since the end of apartheid in 1994 . South africa (sa) has also embarked in redressing past inequalities and improving access to, and quality of health care to all citizen of the country (1315). Among other issues, the eastern cape of sa, faces significant challenges with ncd research, practice, and policy, basic equipment for effective diagnosis and treatment of ncd; and adequately trained health workers . Therefore, the objective of this study was to identify, based on hospital data, the mortality rates of ncd and cd, as well the epidemiologic transition, and the trends of mortality . Data in this study came from a survey of rural eastern cape province - wide . The province shares borders with the free state province and lesotho kingdom in the north, kwazulu - natal in the north - east, the indian ocean along its south - eastern borders, and western and northern cape provinces in the west . We evaluated all cases of deaths in each district, not only for those who have come to the hospital . Officer responsible of statistics in the district is responsible for registration of both cases of death in the hospitals or also other cases of death especially those who had never came to hospital . Causes of deaths among the admissions were coded to the 10 revision of international classification of diseases (icd-10). The variables of interest comprised of demographic (age and sex), months (season of winter / june), ncd, cd, hiv / aids, tuberculosis, and years of 2002, 2003, 2004, 2005, and 2006 . Data were extracted from deaths registration using standardized procedures published by other researchers (1618). Data were presented as frequencies (number), proportions (%) for qualitative variables, and mean standard deviation for continuous variable . The trends of mortality were done across the months, ages, and the years 20022006 . The software spss for windows version 16.0(spss inc, chicago, il, usa) was performed . Data were presented as frequencies (number), proportions (%) for qualitative variables, and mean standard deviation for continuous variable . The trends of mortality were done across the months, ages, and the years 20022006 . The software spss for windows version 16.0(spss inc, chicago, il, usa) was performed . For the 5-year period between 2002 and 2006, 107380 admissions had complete data . Of these hospital admissions, the sex ratio was almost 3.1 men (n=3453): 1 woman (n=1113). Out of all deaths, 62.9% (n=2872) were attributable to ncd, while 37.1% (n=1694) were attributable to cd: the ratio ncd / cd being 1.7 . The ncd had 22 deaths in age<30 years, 2422 deaths in age 3064 years, and 428 deaths in age>65 years . There was an inverse relationship between cd deaths and ages: 1345 deaths in age<30 years, 309 deaths in age 3064 years, and 40 deaths in age>65 years . The ratio of ncd / cd deaths in men was 1.3(n=1951 ncd vs. 1502 cd). The ratio of ncd / cd deaths in women was 1.9 (n= 735 ncd vs. 378 cd). The peak of deaths was observed in june (winter season) between 2002 and 2006 (fig . The trend of deaths including the majority of ncd, had an increase with r= 30.1% from 2002 to 2006 (fig . 2). There was a tendency of an increase of tuberculosis deaths (r= 64.9%), but an inverted curve of hiv / aids deaths tended to decrease from 2002 to 2006(r= 25.4%) (fig . The study investigated the extent and the changes of mortality patterns in eastern cape province of sa with a profile of similar to that of countries facing epidemiological transition (19). However, the crude death rate in 2002 2006 from this study undertaken in hospitals was significantly lower than the double estimates for rural populations in india (20). This study also confirmed ncd to be the leading causes of death in eastern cape . The data reported globally (26), in all south africa (11) and in other developing countries (20) also incriminated ncd as the leading causes of mortality . According to who, ncd were responsible of 60% (35/58 million) of all global deaths in 2005 (21). In this study conducted in one of the poorest province of sa (15), 62.9% of deaths these findings were similar with 53.8% of all deaths attributed to ncd and 36.4% due to cd in the all developing countries (5). In its report, the who identified a long time ago observed the growing prevalence of ncds accounting for the largest proportion of the global burden of disease and even outpacing infectious diseases in all developing countries with the exception of sub - saharan africa (22). There however remains a constant challenge that even in the light of body of evidence, public health policies and practices globally have consistently been either non - existent or slow in responding to ncds, with the priority continuing to be on communicable diseases control . Two main reasons for this trend were identified by glasgow (23) viz . Compared to communicable diseases, ncds play a non - significant role in both high and low politics, no immediate security thread is posed by ncds compared with hiv?aids and hemorrhagic fevers that have been seen destroying even security forces . Secondly, the rising prevalence of ncds in low and middle income countries is viewed as attributable to western lifestyle globalization including consumption of unhealthy western diets . This latter theory thus supports non - public health view that ncds are individuals responsibility because they are self created (2425). The present study showed that this province has witnessed a dramatic change from a burden of disease dominated by mortality from infectious causes to degenerative and chronic causes . This epidemiologic transition (26) as reported in other low- and middle - income countries (2729), has been experienced in shorter time frame (10 years after 1994, end of apartheid) than that experienced historically in rich countries (26). In this study, intra- midst-, immediate post-, and advanced post - epidemiologic transition stages were defined in all patients, in men, and in women . Eastern cape province is in stage of receding pandemics, which was characterized by cvd and its risk factors predominated by hypertension, congestive heart failure, renal failure, cancer, and stroke . The important determinants of mortality in eastern cape province during the 2002 2006 period were male gender, aging, rural area, and winter . In our survey of 2002 2006, males were more vulnerable than females as reported by several studies from the literature (30). The improvement of sanitation in south africa after 1994 (end of apartheid) may explain the control of perinatal deaths, maternal mortality and death related to infection diseases (13). 80% of cvd deaths occur in developing countries, mainly individuals aged 3069 years (6). Winter was associated with higher risk of mortality among the patients from eastern cape as well observed in other settings . Heunis et al . Investigated the short - term relationship between winter temperatures and cardiac diseases mortality in cape town, western cape province of south africa (31). They found a strong lagged relationship between extreme temperatures / large daily variations of temperatures and above - average mortality rates . Data from spain showed the effect of extreme winter temperature on mortality in madrid for people aged>60 years (32). Poor people from eastern cape province live in huts or shuck without windows neither heater . Cold temperatures increase blood pressure, cholesterol, fibrinogen and erythrocyte numbers (33). These mechanisms may explain the outbreaks of deaths observed in this study with cvd and respiratory diseases as leading causes of death . This study showed a significant social gradient in which patients living in the poor rural areas had higher rates of mortality than advantaged patients from urban areas . The same social gradient was previously demonstrated by grunewald et al . In the poor sub district of khayelitsha from cape town, western cape province of south africa (34). These findings will play an important role in managing patients and shaping public - health policy in eastern cape province and in other resources limited settings in and outside south africa . Training of health professionals with a new approach to primary health - care system, adequate management of ncd, and priority actions for the response to the ncd crisis are urgently needed in this poor province and globally . These changes in mortality patterns will provide insight into the evolving course of health transition in easter cape province . Public - health leadership, prevention, treatment, international cooperation, monitoring and accountability are thus at a crossroads of eastern cape province . As the stages of epidemiologic transition occur ongoing, modification of the eastern cape health system is required to ensure that the services provided address the main diseases suffered by the population (20). Among the communicable causes of death that were still widespread in eastern cape province, hiv / aids may well have been a contributor to other cases of deaths in infectious diseases such as tuberculosis and meningitis as well as in ncd such as cvd, metabolic syndrome, diabetes mellitus and cancers (8, 11). Antiretroviral therapy (haart) may impact on decline in hiv / aids deaths . Who recommends state members to pay attention to formulating and testing frameworks for chronic care systems, and to the skill - set that is required of multipurpose health professionals to support long - term patient - centered care . For this reason, cambodia has demonstrated the feasibility of integrating care for hiv / aids with ncd in chronic diseases clinics (35). The first step to combat the ncd epidemic should encompass an extensive and comprehensive research on the dimensions and actual burden of ncd in eastern cape . Thorough understanding of the dynamics of epidemiologic transition is important to achieve a serious appraisal of primary health - care systems in this province . Research to establish the cost, value and feasibility of implementation of the framework will have the way for international support (36). The lancet ncd action group and the ncd alliance propose the delivery of the following priority interventions: tobacco control, salt reduction, improved diets and physical activity, reduction in hazardous alcohol intake, essential drugs and technologies . Although in eastern cape province, the burden of mortality due to cd and hiv / aids has often overshadowed that due to ncd, there is evidence now of a shift of attention to ncd by identifying and addressing modifiable risk factors(lifestyle changes), screening, diagnosing, treating and follow - upping patients with ncd . Essential components of these implications include: effective surveillance mechanisms supplemented by focused research; generating broad interest and consensus; mobilizing leadership and commitment at all levels; involving local and international expertise; building on existing efforts; and seeking integrated, multidisciplinary and multi - sector approaches (37). This study is limited to some degree because of its setting, design and methods . The findings from this hospital - based survey are difficult to be generalized to the eastern cape general population . In limited resources settings, the cross - sectional design is not able to demonstrate a causal association in the findings . Several settings use hospital wide mortality rates to evaluate the quality of hospital care (38), although the usefulness of this metric has been questioned (39). This study is limited to some degree because of its setting, design and methods . The findings from this hospital - based survey are difficult to be generalized to the eastern cape general population . The cross - sectional design is not able to demonstrate a causal association in the findings . Several settings use hospital wide mortality rates to evaluate the quality of hospital care (38), although the usefulness of this metric has been questioned (39). This study contributes to understand the changes of mortality patterns in a poor setting facing post - epidemiologic transition stages . There is a positive and significant association between male gender, aging, winter season, rural residence, and higher rates of all deaths . Ncd are the leading causes of mortality pn this poorest and rural province of south africa . Health policies and programs should learn from the observed and unique pattern of mortality with a rapid progression of epidemiologic transition in general and in women in particular . Clinical implications and perspectives for public health (prevention, health promotion, and interventions) should be adequately based on comprehensive information about the extent and nature of mortality in eastern cape . An urgent reorganization of the eastern cape health delivery is needed to enable the implementation of evidence - based activities that can curb the rising of ncd . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors.
|
, multisensory processing has been an active topic of research and numerous studies have demonstrated that multisensory processing can improve accuracy (e.g., sumby and pollack, 1954, reduce reaction times, e.g., gingras et al ., 2009), improve precision (e.g., ernst and banks, 2002; alais and burr, 2004), and provide more complete information about objects (newell et al ., 2001). Furthermore, recent studies have established the presence of a significant degree of plasticity in multisensory processes, including processes such as crossmodal simultaneity (e.g., fujisaki et al ., 2004, and temporal order, e.g., miyazaki et al ., 2006) that had previously been thought to be hardwired or highly stable . This is despite the fact that several studies indicate that unisensory processing is altered through multisensory experience . In section improvement in unisensory sensitivity as a result of correlated multisensory training, we describe recent studies that show that training observers using correlated auditory visual stimuli improves subsequent performance in a unisensory (visual or auditory) detection, discrimination, and recognition task . In section change in unisensory map as a result of exposure to crossmodal error, we discuss recent research demonstrating that momentary exposure to auditory visual spatial discrepancy results in a shift in the auditory space map . We discuss how this crossmodal sensory recalibration is continuously engaged in updating unisensory perceptual processing and is an integral part of perceptual processing . In section improvement in unisensory sensitivity as a result of multisensory associative learning, we present results from an adaptation study that shows that passive exposure to consistently paired auditory and visual features enhances visual sensitivity . These three sets of findings involve very different types of learning perceptual learning, recalibration, and associative learning and may involve different mechanisms and time scales, yet they all show a significant influence of multisensory processing on unisensory representations . This diversity of phenomena suggests that these multisensory influences on unisensory learning may reflect a general strategy of learning in the brain . Multisensory stimulation is widely thought to be advantageous for learning (montessori, 1912; fernald and keller, 1921; orton, 1928; strauss and lehtinen, 1947). As such, numerous educational programs, including the montessori (1912, 1967) and multisensory structural language education method (birsh, 1999), incorporate multisensory training techniques in their teaching . The benefits of multisensory training go beyond the simultaneous engagement of individuals with different learning styles (e.g., visual learners and auditory learners; coffield et al ., 2004). However, benefits of multisensory training are typically stated in anecdotal terms, such as treichler s (1967) statement that people generally remember 10% of what they read, 20% of what they hear, 30% of what they see, and 50% of what they see and hear . (but see thompson and paivio, 1994). While the benefits of multisensory training have long been appreciated and exploited by educational and clinical practitioners, until recently there has been little solid scientific evidence to support this view . To address the extent to which multisensory training shows benefits over unisensory training, we recently investigated how visual perceptual learning of motion direction perception (ball and sekuler, 1982, 1987; liu, 1999; seitz et al . ., 2010) is influenced by the addition of auditory information (seitz et al . Perceptual learning is an appropriate method to address the benefits of multisensory training since it is a well - established learning paradigm and a great deal is known regarding the mechanisms involved (gilbert et al ., 2001; fahle and poggio, 2002; ahissar and hochstein, 2004; ghose, 2004; seitz and dinse, 2007; shams and seitz, 2008). Avcong - trained) and visual (v - trained) training on perceptual learning using a coherent motion detection and discrimination task (seitz et al . The individuals in the avcong - trained group were trained using auditory and visual stimuli moving in the same direction, where as the v - trained group was trained only with visual motion stimuli . Critically, the two groups were compared on trials without informative auditory signals (stationary sound, and in a subsequent study described below, the two groups were compared on identical trials with no sound). Compared to the v - trained group, the avcong - trained group showed greater learning both within the first session and across the 10 training sessions (figure 1a). The advantage of av training over visual - alone training was substantial: it reduced the number of sessions required to reach asymptote by 60%, while also raising the maximum performance . Performance on visual - only trials (no auditory signal) is shown for different groups trained in different conditions . Green, blue, and red curves represent groups trained with only visual stimuli (v - trained group), trained with congruent auditory and visual motion (avcong - trained group), and trained with incongruent (moving in opposite directions) auditory and visual motion (avincong - trained group), respectively . (a) data from seitz et al . (2006a) shows that learning occurred more quickly and more extensively for the avcong - trained group (blue) compared to the v - trained group (green). (2008) shows that relative to the v - trained group (green), the enhanced learning is limited to the avcong - trained group (solid blue) and does not occur for the avincong - trained group (solid red). Solid lines represent performance on silent v trials . Broken blue and broken red lines show performance in congruent av and incongruent av trials, respectively . (2008). A second study (kim et al ., 2008) showed that benefits of multisensory training were specific to training with congruent auditory visual stimuli (i.e., moving in the same direction); a group trained with sound moving in the opposite direction of visual motion (avincong - trained group) did not show any facilitation of learning (figure 1b). This indicates that the facilitation of learning is not due to a putative alerting effect of sound during training . Additionally, results of a direction test showed that performance was significantly greater for trained directions (10 and 190) than for untrained directions, confirming that this improvement reflects perceptual learning rather than general task learning (ball and sekuler, 1982; fahle, 2004). Intriguingly, for the avcong - trained group, the performance on silent visual trials (figure 1b, solid blue) converged to the level of performance on congruent av trials (figure 1b, broken blue). In other words, individuals trained with congruent av stimuli not only showed facilitated visual performance when auditory stimuli were not present, but also they performed in the absence of sound as well as they would perform in the presence of sound . For example, individuals trained with faces and voices can better recognize voices (auditory - alone) than those trained with voices alone (von kriegstein and giraud, 2006). Memory research suggests that multisensory encoding of objects facilitates the subsequent retrieval of unisensory information (murray et al . In addition, multisensory exposure has been reported to enhance unisensory reinforcement learning (guo and guo, 2005) in drosophila (fruit flies). Collectively these studies indicate that crossmodal facilitation of learning is a general phenomenon occurring in different tasks, and across different modalities, and even species . In a recent review, shams and seitz (2008) discussed how multisensory training could benefit later performance of unisensory tasks . One possibility is that facilitation benefits learning in the same representations that undergo modification in classic unisensory learning (seitz and dinse, 2007). Alternatively, facilitation can be explained through multisensory exposure resulting in alterations to multisensory representations that can then be invoked by a unisensory component (rao and ballard, 1999; friston, 2005). While, the findings discussed in this section can be explained by either, or a combination, of these mechanisms, other findings discussed below are suggestive that the latter mechanism (unisensory representations becoming equivalent to multisensory representations) likely play some role in the observed facilitation of learning . As highlighted in the introduction, being endowed with multiple sensory modalities has its advantages in immediate perceptual processing . However, as illustrated in the previous section, multisensory stimulation also has a lasting effect on subsequent unisensory stimulation . Perception can generally be considered an unsupervised inference process, where the ground truth (i.e., the environmental state) is unknown, and can only be estimated from the sensorium . Therefore, comparing sensory estimates across modalities over time allows the system to perform self - maintenance by recalibrating its unisensory processes (king, 2009; recanzone, 2009). Such changes are necessary when coping with endogenous changes that occur during development or injury, or exogenous changes in environmental conditions . An example of crossmodal recalibration is the rubber - hand illusion in which a brief (seconds) tactile stimulation of one s occluded arm while seeing a synchronous tactile stimulation of a rubber - hand subsequently induces a shift in the proprioception of the hand in the direction of the seen rubber hand (botvinich and cohen, 1998). Another extensively studied example of crossmodal recalibration is the ventriloquist aftereffect (vae): the shift in perceived location of sounds (in isolation) that occurs after repeated exposure to consistent spatial discrepancy between auditory and visual stimuli (canon, 1970; radeau and bertelson, 1974; recanzone, 1998; lewald, 2002). While the rubber - hand illusion shows that recalibration of proprioception can occur rapidly, after seconds of exposure to tactile visual discrepancy, recalibration of other sensory modalities such as hearing and vision has been shown to occur only after substantial exposure to spatial inconsistencies between the sensory signals, for example, after hundreds or thousands of repeated exposures to consistent discrepancy between the senses (radeau and bertelson, 1974; zwiers et al ., 2003; in some cases, auditory recalibration has been reported after weeks, days, or hours of exposure to inconsistency (hofma et al ., 1998; zwiers et al ., 2003). The vae has been reported to occur after several minutes of continuous exposure, or after thousands or hundreds of trials (canon, 1970; radeau and bertelson, 1974; recanzone, 1998; lewald, 2002; frissen et al ., 2003). Altogether these results have given the impression that the human auditory and visual systems require a substantial amount of evidence that the sense is faulty before recalibration occurs . Observers were presented with small white disks on a black screen and white noise bursts at variable locations along azimuth for 35 ms, and were asked to localize the stimuli using a trackball that controlled the position of a cursor on the screen . On some trials only an auditory stimulus was presented, on some trials only a visual stimulus was presented, and on some trials both were presented . On bisensory trials, the observers were asked to report the location of both the visual stimulus and the auditory stimulus . All combinations of visual and auditory visual locations were presented with equal probability on both unisensory and bisensory trials, and the trials were interleaved pseudorandomly . Therefore, an auditory - alone trial could be preceded by a visual, auditory, or auditory visual trial, and the spatial discrepancy between the auditory and visual stimuli could vary from trial to trial . This experimental design allowed us to investigate whether there is a systematic influence of av spatial discrepancy experienced on a bisensory trial on the subsequent perception of location of sound on a unisensory auditory trial . In figure 2, the change in perceived location of sound is plotted as a function of av discrepancy in the immediately preceding av trial . As can be seen, the perceived location of sound is shifted to the right if the auditory trial is preceded by a trial in which vision is to the right of sound, and the perceived location of sound is shifted to the left if the auditory trials is preceded by a trial in which visual stimulus was to the left of the auditory stimulus . The shift in perceived location is calculated as a difference between the reported location on a given auditory trial as compared to the reported location of sound averaged across all unisensory auditory trials with sound presented at the same location . The same qualitative results are obtained if change in perceived location is measured relative to the actual location of sound . The shift in perceived auditory location (mean sem across observers) as a function of auditory visual spatial discrepancy in the preceding av trial . Stars denoted datapoints that are significantly different from zero (corrected for multiple comparisons using bonferroni these findings show that auditory recalibration can occur very rapidly, after only milliseconds of exposure to sensory discrepancy and suggest that any exposure to discrepant auditory this indicates a much stronger degree of malleability in our basic auditory representations (such as space) than previously thought . Interestingly, the degree of recalibration appears to depend more on the perceived discrepancy between the auditory and visual stimuli than the physical discrepancy . The amount of recalibration was four times larger for trials in which the auditory and visual stimuli were perceived to originate from the same location than in trials where they appeared to stem from different locations (wozny and shams, 2011). Considering that it is not clear how long lasting the observed shifts in the auditory map are, it is possible that the recalibration phenomenon discussed here and the learning effects discussed in the previous section are mediated by distinct neural mechanisms visual recalibration can involve plasticity in traditionally considered unisensory auditory and visual brain areas such as inferior colliculus (feldman and knudsen, 1997) and optic tectum (debello and knudsen, 2004). Whether the rapid human spatial recalibration observed in wozny and shams (2011) while the studies described above detail how unisensory representations are altered through multisensory experience, they do not directly address how the unisensory processing is impacted by the presence of the multisensory stimulation . (2008) investigatedwhether after exposure to arbitrarily paired auditory and visual features, the processing of the visual feature is enhanced by the mere accompaniment of the associated auditory feature even when auditory signals are not informative for the task . If the learning of auditory visual associations occurs at a sensory level, one could expect that the mere presence of the associated auditory feature could improve the representation of the visual feature, however if the association is not established or if it is established at a higher level of processing, then the presence of task - irrelevant auditory signal would not enhance the visual performance (detection, discrimination, etc . ). To address this issue, two experiments were conducted in which observers were passively exposed to a paired auditory visual stimulus . In both experiments, observers demonstrated a relative increase in sensitivity to that visual stimulus when it was accompanied by the auditory stimulus that was coupled with it during exposure, even though auditory stimulus was uninformative to the subjects task . These results suggest that unisensory benefits occur, at least in part, due to an alteration, or formation, of multisensory representations of the stimuli, as discussed in shams and seitz (2008). In one experiment, a sinusoidal grating of given visual angle of orientation (v1) was consistently presented with an auditory tone (a1) while the orthogonal orientation (v2) was presented in silence (figure 3a). The visual and auditory stimuli (v1a1) co - varied in randomly chosen suprathreshold stimulus intensities across trials . The task was to keep fixation and detect any changes in the color of the fixation cross by pressing the spacebar . A change in fixation cross color occurred in approximately 10% of trials . Testing occurred prior to and after exposure . During test sessions subjects had to detect in which of two intervals the oriented grating appeared (embedded in visual noise). In trial types that involved the presentation of tones, the tone was played in both intervals and therefore, was uninformative for the task . Subjects who scored close to chance (below 60%) on one or more of the pre - test conditions were excluded from sample . Influence of exposure to paired visual orientation and auditory frequency on subsequent visual orientation detection . (a) top, the stimulus conditions to which the subjects were passively exposed . Bottom, the stimulus conditions in which subjects were tested in a 2ifc detection task . Stars denote significant one - tailed paired t - tests (p <0.05) between pre and post tests corrected for multiple comparisons using the bonferroni holm method . A two - way repeated measures anova with factors test (pre and post) and condition (v1a1, v1a2, v1, and v2a1) showed a significant interaction between test and condition [f(3,114) = 3.86, p <0.05]. To determine whether passive exposure to a specific pair of auditory and visual stimuli would result in a relative increase in detection performance for that visual stimulus when accompanied by the associated sound, we compared performance differences between the pre - test and post - test data between v1a1 and v1, and found that there was a significant difference between these conditions (p = 0.013, one - tailed paired t - test, df = 38, bonferroni holm = 0.017; figure 3b column 1). If the pairing with sound had only facilitated the visual learning, the relative performance between these two conditions should have been the same . In contrast, our results suggest that an auditory visual association was learned . To determine whether the benefit for the v1a1 condition is a specific effect to this associated auditory visual stimulus or whether it is a generalized effect, we examined the performance on the other testing conditions . First, if the improved performance in v1a1 is due to an alerting effect of sound, then we would expect to see the same degree of improvement in both v1a1 and v2a1 . However, this was not the case as the comparison between v1a1 vs. v2a1 conditions confirmed that the facilitation was orientation specific (p = 0.009, one - tailed paired t - test, df = 38, bonferroni holm = 0.0125; figure 3b column 2). However, a significant difference was not found between learning for the exposed v1a1 condition (350 hz tone) vs. the same orientation paired with a slightly different tone v1a2 (925 hz), suggesting that the learning transfers across at least some range of frequencies (figure 3b column 3). This degree of transfer is not entirely surprising given that the frequencies of a1 and a2 lie within an octave and a half of each other, which is within the range of auditory recalibration transfer shown in other studies (frissen et al ., 2003). Future experiments should investigate whether a wider frequency range would still show transfer of learning . Finally, as a control, we compared two conditions that had an equal amount of exposure to their components, but arranged in opponent pairings (v1 vs. v2a1) and found there was no noticeable difference in relative performance across these conditions (figure 3b column 4). Altogether, these results suggest that a specific auditory visual association was learned between v1 and a1 by passive exposure . In the experiment described above, the auditory visual pairing presented to subjects during exposure (v1a1) showed the greatest degree of relative improvement . This condition also happened to be the only condition tested in which the visual stimulus was presented in the same context as that of the exposure phase . Therefore a similarity in context can be an alternative explanation for the pattern of results found in the first experiment . To address this potential confound, and to see if the effect can be replicated with other visual features, we conducted a second experiment . In this experiment, the exposure phase was similar to the first experiment, where an auditory tone (a1) was consistently paired with a particular direction of coherent motion (v1), while the orthogonal motion direction (v2) was presented in silence . During testing, subjects had to determine the direction of coherent motion, presented with and without a1 . Schematic depiction of the design is shown in figure 4a, which shows the testing and exposure pairings . In contrast to the first experiment, here in addition to testing the exposed auditory visual pair v1a1, we tested v2, in which the other visual feature (not coupled with sound) is also presented in the same context (no sound) as that of the exposure phase . If the improved performance in v1a1 observed in the first experiment was due to familiar context, then similar improvement should be observed here for v2 (no - sound context). But if the improved performance was due to acquisition of a compound av feature, then the improvement should only be observed for v1a1 and not for v2 . Influence of exposure to paired visual motion direction and auditory frequency on subsequent visual motion detection . (a) top, the stimulus conditions to which the subjects were passively exposed . Bottom, the stimulus conditions in which subjects were tested in a 2ifc detection task . Stars denote significant one - tailed paired t - tests (p <0.05) between pre and post tests corrected for multiple comparisons using the bonferroni holm method . Subjects were instructed to maintain fixation and to report any changes in the contrast of the fixation dot . Exposure was preceded by 256 test trials, and followed by 128 randomly interleaved test trials, 400 more exposure trials, and 128 test trials . This top - up design was used to minimize the erosion of learning effect during post - test trials . The post - test results shown below reflect the data from all 256 post - exposure trials . The entire experiment lasted about an hour . For the test sessions, a two - alternative - forced - choice (2afc) procedure was used where a single trial was presented and the subjects were asked to report by keypress whether the coherent motion moved at 45 or 135. four stimulus conditions were tested: v1a1, v1, v2a1, and v2 . Similar to the previous experiment, we performed two - way repeated measures anova with test (pre, post) and condition (v1a1, v1, v2a1, v2) as factors . We found a significant interaction [f(3,135) = 2.68, p <0.05]. Here too, there was a significant difference between conditions v1a1 and v1 (p = 0.007, one - tail paired t - test, df = 45, bonferroni holm = 0.01; figure 4b column 1). This effect seems to be direction specific given that there is a trend of increased performance in the v1a1 conditions compared to v2a1 condition (p = 0.036, one - tailed paired t - test, df = 45, bonferroni holm = 0.0167; figure 4b column 2). The fact that the results hold true for a discrimination task in addition to the detection task used in the first experiment demonstrates that these effects are not a task - specific oddity . The fact that the v1a1 association is found for motion direction stimuli in addition to static oriented gratings suggests that these automatic associations that we observe between the auditory and visual stimuli are a general visual phenomenon . Another goal of this experiment was to test the hypothesis that the learning was simply due to shared context with the exposure, rather than an effect that depended on multisensory stimulation . To address this question we compared the performance between the two tested contexts that were maintained from the exposure (i.e., v1a1 and v2). We found that performance improvement from pre - test to post - test in v1a1 was superior compared to performance improvement in v2 (p = 0.012, one - tail paired t - test, df = 45, bonferroni holm = 0.0125; figure 4b, column 3). Likewise, columns 4 and 5 of figure 4b show comparison v2 vs. v1 and v2 vs. v2a1, respectively . There was not any significant difference between these conditions, even though the v2 condition was equally exposed as the v1a1 condition . These results confirm that the presentation in familiar context is not the underlying factor behind the observed improvements for v1a1 . A key question is whether the exposure period creates a response bias or leads to a change in sensitivity to the stimulus . In the first experiment, we used a 2ifc paradigm in which response bias has no impact on the results . In the second experiment, we found an increase in sensitivity for the av trials after exposure (figure 5a) and no change in the bias measurements (figure 5b). Our 2ifc design for the first experiment and signal detection analysis for the second experiment indicate that the improved relative performance observed for the detection / discrimination of the sound - coupled visual feature is due to an increase in sensitivity . This finding in turn suggests that the improved performance reflects learning of a low - level perceptual association . Visual perceptual associations can be acquired based on brief exposure to correlated auditory and visual coincidences even in adult sensory systems . Signal detection analysis of the experiment on associative learning of visual motion and auditory frequency . (a) a histogram of d differences between the auditory visual (av) and the vision alone conditions (v)., the d values of the vision alone trials were subtracted from that of the auditory visual trials . Thus, a positive shift in the distribution indicates an increase in sensitivity for the av trials . In contrast to previous studies of crossmodal associative learning, our study compares the effect of crossmodal associative learning on sensitivity to a visual feature with that of an exposure to the visual stimulus alone . The fact that improvement in v1a1 condition was superior to that of v2 despite the equal exposure of v1 and v2 indicates that the increase in sensitivity to a visual feature achieved through establishment of a new auditory visual feature is superior to any fine tuning of the representation obtained by exposure to the visual feature alone . This is an interesting finding, and can have important implications for perceptual skill acquisition in general . The exact mechanism by which the coupling of sound with the visual stimulus results in improved detection and discrimination of the visual stimuli is not clear . However, one possible mechanism is one in which the correlated incidence of the auditory and visual stimuli leads to establishment of new connections between the two types of feature detectors, i.e., the formation of a multisensory representation (shams and seitz, 2008). This will result in increased gain in the visual feature detectors whenever the visual stimulus is encountered in presence of the coupled sound . The increase in gain will in turn result in a higher sensitivity to the visual stimulus . The human brain has evolved to learn and operate optimally in natural environments in which behavior is guided by information integrated across multiple sensory modalities . Crossmodal interactions are ubiquitous in the nervous system and occur even at early stages of perceptual processing (shimojo and shams, 2001; calvert et al ., 2004; schroeder and foxe, 2005; ghazanfar and schroeder, 2006; driver and noesselt, 2008). Until recently, however, studies of perceptual learning focused on training with one sensory modality . This unisensory training fails to tap into natural learning mechanisms that have evolved to optimize behavior in a multisensory environment . We discussed three sets of learning phenomena that differ both in time scale and type of learning . However, in all cases multisensory exposure caused a marked change in later unisensory processing . In the learning studies discussed in section improvement in unisensory sensitivity as a result of correlated multisensory training, the facilitation of visual learning by sound was apparent within the first hour - long session as well as across days of training . In the experiments discussed in section improvement in unisensory sensitivity as a result of multisensory associative learning, the visual learning was evident after minutes of exposure to paired auditory visual stimuli . The crossmodal recalibration study discussed in section change in unisensory map as a result of exposure to crossmodal error provided evidence that significant changes in unisensory representations can occur after only milliseconds of exposure to conflicting auditory visual stimuli . In the recalibration study discussed in section change in unisensory map as a result of exposure to crossmodal error, as well as many other previous studies of crossmodal recalibration, a mismatch between two sensory modalities (or in sensorimotor modalities) causes a change in unisensory representations . The study by wozny and shams (2011) shows that this adjustment of unisensory representation based on an error signal computed from comparison with another modality does not require a protracted exposure to repeated error, and occurs continuously and incrementally . This continuous modification of unisensory representations as a result of exposure to crossmodal mismatch blurs the distinction between unisensory processing and multisensory processing . It appears that unisensory representations are closely yoked to mechanisms that keep track of crossmodal consistency / error even in the mature human nervous system . In contrast to the learning involved in recalibration, which is caused by exposure to a mismatch between modalities, the learning phenomena discussed in sections improvement in unisensory sensitivity as a result of multisensory associative learning result from exposure to multisensory stimuli that are not mismatched . In both of these cases, exposure to correlated auditory visual stimuli causes enhanced performance in unisensory tasks . In the perceptual learning studies discussed in section improvement in unisensory sensitivity as a result of correlated multisensory training, the multisensory stimuli are ecologically correlated, whereas in the associative learning experiments of section improvement in unisensory sensitivity as a result of multisensory associative learning we suggest that associative and perceptual learning may represent two different stages of learning along the same dimension, with the associative learning (see improvement in unisensory sensitivity as a result of multisensory associative learning) representing an initial process of learning and the perceptual learning (see improvement in unisensory sensitivity as a result of correlated multisensory training) occurring once the association is built (see figure 6). The idea is that initially the auditory and visual stimuli are not associated with each other in the brain, and therefore the association needs to be established by repeated exposure to coupled stimuli . The establishment of the association enables the auditory stimulus to enhance the processing of the visual stimulus (and vice versa), thus improving performance in visual detection / discrimination in presence of the coupled stimulus, as described in section improvement in unisensory sensitivity as a result of multisensory associative learning . Once this multisensory association is established, the pairing of the auditory visual stimuli will not only improve processing at the time of stimulation (as described in improvement in unisensory sensitivity as a result of multisensory associative learning) but will also lead to plasticity within and between the sensory representations of these associated features, producing the facilitation and enhancement that occurs in the absence of multisensory stimulation, as described in section improvement in unisensory sensitivity as a result of correlated multisensory training . This could be the result of visual and multisensory representations eventually becoming equivalent, where exposure to a unisensory stimulus could invoke the multisensory representation, without the need for multisensory stimulation . Such a phenomenon would result in the performance in the visual - alone and auditory visual conditions to become equivalent, as was observed in our study (figure 1b). A possible progression of learning as a result of repeated exposure to coupled auditory and visual stimuli . The newly learned association between the auditory and visual features (a and v) results in enhanced processing of the visual stimuli when accompanied by the coupled auditory stimuli . This phenomenon was discussed in section improvement in unisensory sensitivity as a result of multisensory associative learning . For auditory and visual stimuli that are already associated in the brain, additional repeated exposure causes the connectivity / association between the two features to be strengthened further, gradually blurring the distinction between unisensory and bisensory representations (a unisensory representation becomes as effective as a bisensory representation). This strong link between the two representations results in enhanced processing of the visual features even in the absence of the coupled auditory stimulation (and vice versa). This phenomenon was discussed in section improvement in unisensory sensitivity as a result of correlated multisensory training . However, alternatively, the learning of association between arbitrary a and v stimuli may not progress to the phenomenon of enhanced visual processing in the absence of a. the latter phenomenon may be confined to a and v features that are ecologically related (such as motion) as it may require hard - wiring between brain areas that mediate their representations . Improvement in unisensory sensitivity as a result of correlated multisensory training and improvement in unisensory sensitivity as a result of multisensory associative learning while we hypothesize that newly learned multisensory associations can lead to facilitation of learning, it may be the case that repeated pairing of arbitrary auditory and visual stimuli may not be sufficient to lead to lasting enhancement of unisensory processing in the absence of the crossmodal signal . It is possible that this multisensory facilitation of unisensory learning is only possible for auditory and visual features that are ecologically associated, such as auditory and visual motion, or lip movements and voice, etc . These ecologically valid associations may be distinct due to hardwired connectivity in the brain, or learning of synaptic structures that are only possible during the critical period, and no longer possible in the mature brain . If so, then regardless of the amount of exposure, arbitrary auditory and visual features will never progress to the stage of enhanced unisensory processing in the absence of the coupled stimulus, and the phenomena discussed in sections improvement in unisensory sensitivity as a result of multisensory associative learning represent two separate learning phenomena as opposed to stages of the same learning continuum . Further research is required to address these questions and to shed light on the neural and computational mechanisms mediating the three types of phenomena outlined in this paper . We conclude that experience with multisensory stimulus arrays can have a profound impact on processing of unisensory stimuli . This can be through instant recalibrations of sensory maps (see change in unisensory map as a result of exposure to crossmodal error), the formation of new linkages between auditory and visual features (see improvement in unisensory sensitivity as a result of multisensory associative learning), or the unisensory representations becoming increasingly indistinct from multisensory representations (see improvement in unisensory sensitivity as a result of correlated multisensory training). While these are operationally distinct processes for example, enhancement of unisensory representations as well as recalibration of sensory maps both require establishment of their association . While further research will be required to better understand each of these types of learning, and how they relate to each other, it is now clear that the concept of unisensory processing is limited at best, and that prior multisensory exposure can affect perception within a single sensory modality even when the immediate inputs being processed are unisensory . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
Charcot marie tooth disease (cmt) is a clinically and genetically heterogeneous group of sensorimotor peripheral neuropathies and represents the most frequent inherited disorder(s) affecting the nervous system . In this study, we provide preclinical, proof of principle data demonstrating efficacy in a mouse model of the demyelinating form of cmt (cmt1), supporting an adenoassociated virus (aav)-mediated neurotrophin 3 (nt-3) gene therapy clinical trial . There is no treatment for this condition with onset between 5 and 25 years bilateral foot drop, symmetric atrophy of muscles below the knee, and weakness of hands . Cmt1 is the most common of all inherited neuropathies (prevalence 30/100,000), and the subtype of cmt1a with mutations of peripheral myelin protein 22 (pmp22) represents 7080% of all cmts . Cmt1a is a primary schwann cell (sc) disease resulting from 1.4 mb duplication at chromosome 17p11.2 that encompasses pmp22 . Nt-3 is expressed by scs and takes part in an autocrine survival loop that allows scs to survive and differentiate without the axon and stimulates neurite outgrowth and myelination as shown in both in vivo and in vitro regeneration paradigms of central and peripheral nerves . We hypothesize that priming scs with nt-3 might be beneficial to axonal regeneration and associated myelination as a crucial first step in the treatment of cmt neuropathies . These studies utilized two experimental paradigms to show that nt-3 improved nerve function: (i) a xenograft model of grafted nerve segments from patients with a pmp22 duplication of cmt1a and (ii) studies in the tremblerj (tr) mouse, a naturally occurring animal model of cmt carrying a point mutation in the pmp22 gene . Nt-3, given in peptide form, via subcutaneous injections significantly improved axonal regeneration and enhanced the myelination process in both models . Moreover, a pilot clinical trial of recombinant methionyl human nt-3 (r - methunt-3) given subcutaneously to cmt1a patients improved regeneration of myelinated fibers (mf) in sural nerve biopsies accompanied by clinical improvement in the mayo clinic neuropathy impairment score . It was the short serum half - life of nt-3 and potential need for repeated dosing to maintain uninterrupted nt-3 levels that led us to consider aav - mediated gene delivery . Nt-3 plasma half - life is only 1.28 minutes after intravenous administration making it impractical for clinical application . An alternative and in many ways more advantageous delivery system for nt-3 is through gene transfer using aav1 as the vehicle for transfer . The aav1 vector carrying the nt-3 gene can provide a continuous source of nt-3 serum levels following injection of skeletal muscle . In this study, we chose tr mouse model of cmt well - characterized histopathological phenotype and abnormal sc - axon interactions leading to profound alterations in the neurofilament (nf) cytoskeleton and impaired nerve regeneration . Trembler nerves show severe hypomyelination, a decreased large mf population, reduced axon caliber, increased nf packing density, and nf hypophosphorylation similar to cmt1a nerves . Here, we report for the first time that in tr mice, raav1.nt-3 gene transfer into muscle tissue results in nt-3 secretion into circulation reaching therapeutic blood levels, sufficient to provide functional, histopathological, and electrophysiological improvements in peripheral nerves . Furthermore, we established the therapeutic dose and a preferential muscle - specific promoter to achieve sustained nt-3 levels following intramuscular (i.m .) Delivery of aav1.nt-3, which would then serve as a template for future clinical trials in cmt neuropathies, as well as other nerve diseases with impaired nerve regeneration . We generated an aav expression cassette carrying the human nt-3 cdna (genebank designation ntf3, referenced in this paper as both ntf3 and nt-3) coding sequence under the control of cytomegalovirus (cmv) promoter or triple muscle - specific creatine kinase (tmck) promoter and packaged it using either single - stranded (ss) or self - complementary (sc) aav1 vectors (figure 1). We tested the potency of the ssaav1.cmv.nt-3 vector in c57bl/6 mice by delivering 1 10 vg (vector genome) to the gastrocnemius muscle by i.m . Three weeks postinjection, nt-3 serum levels were easily detectable, and the levels remained elevated for at least 10 months (the final time point of the study). In preliminary studies, we had examined nt-3 serum levels in a small cohort of mice following the injection of empty capsids as controls and found no differences compared to phosphate - buffered saline (pbs)-injected control group . Serum levels of nt-3 in tr mice at 23 weeks postinjection significantly increased compared to pbs treated showing almost undetectable levels (5.11 3.49 versus 0.23 0.19 ng / ml; supplementary figure s1). We then asked whether we could reduce the required vector dose and achieve the same level of expression by packaging our expression cassette with scaav1 . We performed a dose response study on c57bl/6 mice at different time intervals comparing serum nt-3 levels following i.m . Injection of scaav1.tmck.nt-3 and scaav1.cmv.nt-3 at three doses (3 10 vg, 1 10 vg and 3 10 vg). Figure 2a illustrates that scaav1.cmv.nt-3 vector at 1 10 vg produced significantly higher nt-3 levels than the single - stranded vector at the same dose, consistent with greater potency using self - complementary vectors . A half - log dose reduction (3 10 vg) of both cmv and tmck in c57/bl produced comparable nt-3 serum levels to those obtained from mice that received ssaav1.cmv.nt-3 at 1 10 vg dose . Comparison of nt-3 levels from tr mice at 24 weeks postinjection with scaav1.cmv.nt-3 and scaav1.tmck.nt-3 vector is seen in figure 2b; at a dose of 3 10 vg, both showed functional efficacy (see below). Functional studies . The effect of nt-3 gene therapy on hindlimb grip strength function was assessed in the regenerating nerves from tr mice receiving ssaav1.cmv.nt-3 at a dose of 1 10 vg following a nerve crush paradigm . In these experiments, gene transfer was carried out by needle injection to the left gastrocnemius muscle of tr mice at 912 weeks of age (n = 12) followed by left sciatic nerve crush, performed 3 weeks postinjection . Grip strength was monitored weekly . Mice were killed at 20 weeks postcrush; both sciatic nerves were removed for morphological studies, and serum was collected for nt-3 enzyme - linked immunosorbent assay (elisa). Functional studies revealed significantly improved grip strength in limbs harboring the regenerating sciatic nerves compared to the pbs - treated tr at the 15-week postcrush time point (figure 3a). In a parallel group injected into the right quadriceps ssaav1.cmv.nt-3 (1 10vg) compared to pbs (n = 14 per group), we correlated functional studies with sciatic nerve conduction parameters in the same limb . Left hindlimb (figure 3b) and simultaneous bilateral hindlimb grip (figure 3c) strength measures in tr mice were monitored weekly up to 20 weeks . The nt-3 gene therapy group performed significantly better starting around 10 weeks compared to pbs controls . We continued to collect functional data from these animals and recorded their rotarod performance weekly between 20 and 40 weeks postinjection . Figure 3d shows a continuous improvement in rotarod performance of the nt-3-treated group compared to the pbs controls . These data clearly show that we have a long lasting functional improvement with nt-3 in this model (last data collection is at 10 months postgene transfer). Such findings are illustrated in figure 4a from sciatic nerve of control tr receiving pbs showing severe hypomyelination compared to a wild - type control (figure 4b). At 20 weeks postcrush, morphometric studies 4 mm distal to the crush site corroborated the functional studies showing significant increases in mf densities in both regenerating and uncrushed contralateral sciatic nerves from the ssaav1.cmv.nt-3 injected tr mice compared to pbs controls (table 1; supplementary figure s2a d). Mf size distribution histograms revealed an increase in the subpopulation of axons less than 4 m in diameter in regenerating, as well as uncrushed contralateral sciatic nerves (supplementary figure s3a, b). This demonstrates that there is a remote effect extending to the opposite extremity from the gene transfer site . Moreover, g ratio (axon diameter / fiber diameter) determinations of the mf in the uncrushed intact sciatic nerves showed an increase in myelin thickness in the ssaav1.cmv.nt-3-treated group (figure 4c, d), partially improving the hypomyelination / amyelination state of the peripheral nerves, the hallmark of trembler pathology . The mean g ratio in the pbs - treated tr is 0.79 0.004, significantly greater than that obtained from wild type (0.65 0.002; p <0.0001), reflecting the hypomyelination state in this model . In the aav1.cmv.nt-3-injected tr mice, the g ratio was significantly reduced (0.75 0.004; p <0.0001), indicative of an increased myelin thickness in comparison to the pbs - treated control tr . As seen in the scattergram (figure 4d), although the myelin thickness in the aav1.cmv.nt-3 group improved across all axon diameters, this was predominantly for the small and medium diameter axons at this 20 weeks postgene injection time point . We have previously shown that exogenous nt-3 in peptide form improved sc proliferation and survival in the tr mouse model for cmt as well as in the sural nerves from patients with cmt1a . Aav1.nt-3 treatment at 20 weeks postinjection resulted in a more robust sc density increase effect in crushed as well as intact tr nerves . The increase in the sc number by 3,300/mm (19%) in the treated crushed nerves was significant (p <0.04) compared with the untreated crushed nerves (figure 5). The difference between the intact treated nerves and the intact untreated nerves was 3,210/mm (p <0.001) corresponding to an increase of 23% . Table 1 summarizes the long - term biological effect of nt-3 gene therapy on tr nerve pathology comparing single - stranded and self - complementary vectors, treatment duration, doses, and promoters . Mf density was significantly increased at 40 weeks compared to pbs - treated controls and further increased compared to 20 weeks posttreatment . Furthermore, experiments carried out using scaav1 vectors, with either cmv or tmck promoters, increased mf densities at half - log doses less than single - stranded vectors . In these studies, there was a strong spearman correlation between mf densities and nt-3 levels for all samples (p = 0.0003). Assessment of nf cytoskeleton: trembler axons display an increased nf packing density associated with increased hypophosphorylation state of the nfs . Ultrastructural morphometric studies assessing nf cytoskeleton at 20 weeks post-ssaav1.cmv.nt-3 injection showed a decrease in nf packing density toward normalization . Figure 6a shows distribution histograms of the number of nf per a unit hexagonal area from wild type, nt-3-treated tr and pbs - treated tr nerves . Aav1.nt-3 treatment resulted in a shift to left toward normalcy, which is reflected in the representative cross sectional areas from mid - sciatic nerves (figure 6b). Western blot analyses complement the ultrastructural findings (figure 6c). In response to aav1.nt-3 gene therapy, the phosphorylated nf h subunit (nf - h) is significantly increased in the trembler peripheral nerves compared to the pbs - treated tr controls correlating with a less densely packed nf cytoskeleton at the ultrastructural level . Muscle diameter increases at 40 weeks posttreatment: we also assessed the effects of nt-3 gene therapy in tr mice upon muscle fiber size at 40 weeks postinjection in a subset of animals injected with ssaav1.cmv.ntf3 (1 10 vg) compared to pbs . Neurogenic changes characterized by atrophic angular fibers and group atrophy were evident in the muscles from untreated mice while evidence for reinnervation as fiber type groupings and an overall fiber size increase were recognizable as treatment effect (supplementary figure s4). Muscle fiber size histograms generated from contralateral anterior and posterior compartment muscles of the left lower limb (tibialis anterior and gastrocnemius) showed an increase in fiber diameter providing supporting histological evidence of nerve regeneration into the muscle (supplementary figure s5). Our previous studies from wild - type and tr mice showed a reproducible and significantly slower conduction velocity in sciatic nerve comparable to published reports . In the studies described here, we set out to examine the efficacy of nt-3 gene therapy by assessing the alterations in the sciatic nerve conduction parameters and correlative ipsilateral and bilateral hindlimb grip strength . For these experiments, tr mice received ssaav1.cmv.nt-3 (1 10 vg) or pbs injections into the right quadriceps muscle, and sciatic nerve conduction studies were carried out on the opposite extremity at baseline, 20 and 40 weeks postinjection . A representative tracing of sciatic motor nerve conduction from wild type and tr are seen comparing baseline and endpoint at 40 weeks postvector injection in supplementary figure s6 . The mutant demonstrated a marked reduction of the compound muscle action potential (cmap) amplitude, prolonged distal latency, and polyphasic prolonged duration cmap relative to the wild type comparable to published results . Cmap amplitude, which reflects the number of motor axons that established connection with the muscle, has been shown to be a valid outcome measure for nerve regeneration and reinnervation that correlates with grip strength . Table 2 summarizes the electrophysiological findings on tr at baseline, 20 and 40 weeks postinjection using 1 10 vg of ssaav1.cmv.nt-3 . Results indicate significantly greater cmap amplitude in the nt-3-treated tr corresponding to a 37% difference compared to the pbs control group at 20 weeks . This cmap amplitude increase correlated with hindlimb grip strength corresponding to a 39.7% improvement (10.53 g (grip force) difference; p = 0.0001) in simultaneous bilateral grip strength (figure 3c) and a 29% improvement (6.4 g difference; p = 0.0009) when tested on only the ipsilateral side (figure 3b). The results of these studies validate that the cmap parameter can be used as a reliable outcome measure . Endpoint electrophysiological studies at 40 weeks posttreatment revealed a mean cmap increase of 84% greater amplitude in the nt-3 group compared to the pbs (table 2). At this time point, there was a small but statistically significant increase in the sciatic nerve conduction velocity . Moreover, compared with baseline, the ssaav1.cmv.nt-3 group at 20 weeks postinjection demonstrated 28% increase of cmap amplitude, which increased to 52% at 40 weeks (p <0.05) while in the pbs - tr controls, over the same period, there was a decline in the cmap amplitude suggesting a correlation with the natural progression of the neuropathic process in this model (figure 7). Baseline cmap amplitude decreased to 0.38 0.04 mv (n = 9) at 40 weeks corresponding to a 27% reduction without reaching statistical significance . Supplementary table s1 summarizes the electrophysiological parameters comparing the efficacy of scaav1.nt-3 under control of the cmv promoter versus the muscle - specific tmck promoter given at three doses (3 10 vg, 1 10 vg, and 3 10 vg) at 24 weeks post - gene transfer . At high dose (3 10 vg), both cmv and tmck vectors produced statistically highly significant improvements in cmap amplitudes compared to pbs control group . Neither cmap aplitudes nor nt-3 levels were statistically different for these two promoters at this dose when they were compared with each other . Analysis failed to find significant difference in cmap amplitudes for intermediate and lower doses for both vectors compared to the pbs - tr controls . We found no strong relationship between cmap amplitude and nt-3 levels in each group, but dose does have significant efect on cmap (spearman correlation; p = 0.0138). We generated an aav expression cassette carrying the human nt-3 cdna (genebank designation ntf3, referenced in this paper as both ntf3 and nt-3) coding sequence under the control of cytomegalovirus (cmv) promoter or triple muscle - specific creatine kinase (tmck) promoter and packaged it using either single - stranded (ss) or self - complementary (sc) aav1 vectors (figure 1). We tested the potency of the ssaav1.cmv.nt-3 vector in c57bl/6 mice by delivering 1 10 vg (vector genome) to the gastrocnemius muscle by i.m . Three weeks postinjection, nt-3 serum levels were easily detectable, and the levels remained elevated for at least 10 months (the final time point of the study). In preliminary studies, we had examined nt-3 serum levels in a small cohort of mice following the injection of empty capsids as controls and found no differences compared to phosphate - buffered saline (pbs)-injected control group . Serum levels of nt-3 in tr mice at 23 weeks postinjection significantly increased compared to pbs treated showing almost undetectable levels (5.11 3.49 versus 0.23 0.19 ng / ml; supplementary figure s1). We then asked whether we could reduce the required vector dose and achieve the same level of expression by packaging our expression cassette with scaav1 . We performed a dose response study on c57bl/6 mice at different time intervals comparing serum nt-3 levels following i.m . Injection of scaav1.tmck.nt-3 and scaav1.cmv.nt-3 at three doses (3 10 vg, 1 10 vg and 3 10 vg). Figure 2a illustrates that scaav1.cmv.nt-3 vector at 1 10 vg produced significantly higher nt-3 levels than the single - stranded vector at the same dose, consistent with greater potency using self - complementary vectors . A half - log dose reduction (3 10 vg) of both cmv and tmck in c57/bl produced comparable nt-3 serum levels to those obtained from mice that received ssaav1.cmv.nt-3 at 1 10 vg dose . Comparison of nt-3 levels from tr mice at 24 weeks postinjection with scaav1.cmv.nt-3 and scaav1.tmck.nt-3 vector is seen in figure 2b; at a dose of 3 10 vg, both showed functional efficacy (see below). Functional studies . The effect of nt-3 gene therapy on hindlimb grip strength function was assessed in the regenerating nerves from tr mice receiving ssaav1.cmv.nt-3 at a dose of 1 10 vg following a nerve crush paradigm . In these experiments, gene transfer was carried out by needle injection to the left gastrocnemius muscle of tr mice at 912 weeks of age (n = 12) followed by left sciatic nerve crush, performed 3 weeks postinjection . Mice were killed at 20 weeks postcrush; both sciatic nerves were removed for morphological studies, and serum was collected for nt-3 enzyme - linked immunosorbent assay (elisa). Functional studies revealed significantly improved grip strength in limbs harboring the regenerating sciatic nerves compared to the pbs - treated tr at the 15-week postcrush time point (figure 3a). In a parallel group injected into the right quadriceps ssaav1.cmv.nt-3 (1 10vg) compared to pbs (n = 14 per group), we correlated functional studies with sciatic nerve conduction parameters in the same limb . Left hindlimb (figure 3b) and simultaneous bilateral hindlimb grip (figure 3c) strength measures in tr mice were monitored weekly up to 20 weeks . The nt-3 gene therapy group performed significantly better starting around 10 weeks compared to pbs controls . We continued to collect functional data from these animals and recorded their rotarod performance weekly between 20 and 40 weeks postinjection . Figure 3d shows a continuous improvement in rotarod performance of the nt-3-treated group compared to the pbs controls . These data clearly show that we have a long lasting functional improvement with nt-3 in this model (last data collection is at 10 months postgene transfer). Such findings are illustrated in figure 4a from sciatic nerve of control tr receiving pbs showing severe hypomyelination compared to a wild - type control (figure 4b). At 20 weeks postcrush, morphometric studies 4 mm distal to the crush site corroborated the functional studies showing significant increases in mf densities in both regenerating and uncrushed contralateral sciatic nerves from the ssaav1.cmv.nt-3 injected tr mice compared to pbs controls (table 1; supplementary figure s2a d). Mf size distribution histograms revealed an increase in the subpopulation of axons less than 4 m in diameter in regenerating, as well as uncrushed contralateral sciatic nerves (supplementary figure s3a, b). This demonstrates that there is a remote effect extending to the opposite extremity from the gene transfer site . Moreover, g ratio (axon diameter / fiber diameter) determinations of the mf in the uncrushed intact sciatic nerves showed an increase in myelin thickness in the ssaav1.cmv.nt-3-treated group (figure 4c, d), partially improving the hypomyelination / amyelination state of the peripheral nerves, the hallmark of trembler pathology . The mean g ratio in the pbs - treated tr is 0.79 0.004, significantly greater than that obtained from wild type (0.65 0.002; p <0.0001), reflecting the hypomyelination state in this model . In the aav1.cmv.nt-3-injected tr mice, the g ratio was significantly reduced (0.75 0.004; p <0.0001), indicative of an increased myelin thickness in comparison to the pbs - treated control tr . As seen in the scattergram (figure 4d), although the myelin thickness in the aav1.cmv.nt-3 group improved across all axon diameters, this was predominantly for the small and medium diameter axons at this 20 weeks postgene injection time point . We have previously shown that exogenous nt-3 in peptide form improved sc proliferation and survival in the tr mouse model for cmt as well as in the sural nerves from patients with cmt1a . Aav1.nt-3 treatment at 20 weeks postinjection resulted in a more robust sc density increase effect in crushed as well as intact tr nerves . The increase in the sc number by 3,300/mm (19%) in the treated crushed nerves was significant (p <0.04) compared with the untreated crushed nerves (figure 5). The difference between the intact treated nerves and the intact untreated nerves was 3,210/mm (p table 1 summarizes the long - term biological effect of nt-3 gene therapy on tr nerve pathology comparing single - stranded and self - complementary vectors, treatment duration, doses, and promoters . Mf density was significantly increased at 40 weeks compared to pbs - treated controls and further increased compared to 20 weeks posttreatment . Furthermore, experiments carried out using scaav1 vectors, with either cmv or tmck promoters, increased mf densities at half - log doses less than single - stranded vectors . In these studies, there was a strong spearman correlation between mf densities and nt-3 levels for all samples (p = 0.0003). Assessment of nf cytoskeleton: trembler axons display an increased nf packing density associated with increased hypophosphorylation state of the nfs . Ultrastructural morphometric studies assessing nf cytoskeleton at 20 weeks post-ssaav1.cmv.nt-3 injection showed a decrease in nf packing density toward normalization . Figure 6a shows distribution histograms of the number of nf per a unit hexagonal area from wild type, nt-3-treated tr and pbs - treated tr nerves . Aav1.nt-3 treatment resulted in a shift to left toward normalcy, which is reflected in the representative cross sectional areas from mid - sciatic nerves (figure 6b). Western blot analyses complement the ultrastructural findings (figure 6c). In response to aav1.nt-3 gene therapy, the phosphorylated nf h subunit (nf - h) is significantly increased in the trembler peripheral nerves compared to the pbs - treated tr controls correlating with a less densely packed nf cytoskeleton at the ultrastructural level . Muscle diameter increases at 40 weeks posttreatment: we also assessed the effects of nt-3 gene therapy in tr mice upon muscle fiber size at 40 weeks postinjection in a subset of animals injected with ssaav1.cmv.ntf3 (1 10 vg) compared to pbs . Neurogenic changes characterized by atrophic angular fibers and group atrophy were evident in the muscles from untreated mice while evidence for reinnervation as fiber type groupings and an overall fiber size increase were recognizable as treatment effect (supplementary figure s4). Muscle fiber size histograms generated from contralateral anterior and posterior compartment muscles of the left lower limb (tibialis anterior and gastrocnemius) showed an increase in fiber diameter providing supporting histological evidence of nerve regeneration into the muscle (supplementary figure s5). Our previous studies from wild - type and tr mice showed a reproducible and significantly slower conduction velocity in sciatic nerve comparable to published reports . In the studies described here, we set out to examine the efficacy of nt-3 gene therapy by assessing the alterations in the sciatic nerve conduction parameters and correlative ipsilateral and bilateral hindlimb grip strength . For these experiments, tr mice received ssaav1.cmv.nt-3 (1 10 vg) or pbs injections into the right quadriceps muscle, and sciatic nerve conduction studies were carried out on the opposite extremity at baseline, 20 and 40 weeks postinjection . A representative tracing of sciatic motor nerve conduction from wild type and tr are seen comparing baseline and endpoint at 40 weeks postvector injection in supplementary figure s6 . The mutant demonstrated a marked reduction of the compound muscle action potential (cmap) amplitude, prolonged distal latency, and polyphasic prolonged duration cmap relative to the wild type comparable to published results . Cmap amplitude, which reflects the number of motor axons that established connection with the muscle, has been shown to be a valid outcome measure for nerve regeneration and reinnervation that correlates with grip strength . Table 2 summarizes the electrophysiological findings on tr at baseline, 20 and 40 weeks postinjection using 1 10 vg of ssaav1.cmv.nt-3 . Results indicate significantly greater cmap amplitude in the nt-3-treated tr corresponding to a 37% difference compared to the pbs control group at 20 weeks . This cmap amplitude increase correlated with hindlimb grip strength corresponding to a 39.7% improvement (10.53 g (grip force) difference; p = 0.0001) in simultaneous bilateral grip strength (figure 3c) and a 29% improvement (6.4 g difference; p = 0.0009) when tested on only the ipsilateral side (figure 3b). The results of these studies validate that the cmap parameter can be used as a reliable outcome measure . Endpoint electrophysiological studies at 40 weeks posttreatment revealed a mean cmap increase of 84% greater amplitude in the nt-3 group compared to the pbs (table 2). At this time point, there was a small but statistically significant increase in the sciatic nerve conduction velocity . Moreover, compared with baseline, the ssaav1.cmv.nt-3 group at 20 weeks postinjection demonstrated 28% increase of cmap amplitude, which increased to 52% at 40 weeks (p <0.05) while in the pbs - tr controls, over the same period, there was a decline in the cmap amplitude suggesting a correlation with the natural progression of the neuropathic process in this model (figure 7). Baseline cmap amplitude decreased to 0.38 0.04 mv (n = 9) at 40 weeks corresponding to a 27% reduction without reaching statistical significance . Supplementary table s1 summarizes the electrophysiological parameters comparing the efficacy of scaav1.nt-3 under control of the cmv promoter versus the muscle - specific tmck promoter given at three doses (3 10 vg, 1 10 vg, and 3 10 vg) at 24 weeks post - gene transfer . At high dose (3 10 vg), both cmv and tmck vectors produced statistically highly significant improvements in cmap amplitudes compared to pbs control group . Neither cmap aplitudes nor nt-3 levels were statistically different for these two promoters at this dose when they were compared with each other . Analysis failed to find significant difference in cmap amplitudes for intermediate and lower doses for both vectors compared to the pbs - tr controls . We found no strong relationship between cmap amplitude and nt-3 levels in each group, but dose does have significant efect on cmap (spearman correlation; p = 0.0138). Studies described here are the first preclinical studies to illustrate proof of principle in support of aav1.nt-3 gene therapy for sustained nt-3 delivery through secretion by muscle cells for the most common of the cmt neuropathies, cmt1a . We report a long - term efficacy of nt-3 gene therapy on tr nerve pathology comparing single - stranded and self - complementary vectors, treatment duration, doses, and promoters . The biological systemic effect of nt-3 is mediated through its continuous release from the muscle as illustrated with a long - lasting therapeutic serum nt-3 levels and functional, histopathological, and electrophysiological improvements observed not only in the vector - injected limb but also in the contralateral limb . The long - lasting positive outcome of this treatment paradigm was validated with continuous improvement of mf densities and cmap amplitudes over time . Studies carried out to 40 weeks showed significantly increased mf densities and cmap amplitudes compared to 20 weeks posttreatment and baseline values . Furthermore, we have established correlative functional improvement between grip strength and cmaps that has potential for relevance in future clinical trials . Scaav permits lower dosing that enhances safety and at the same time eases the burden of vector production for clinical application . Furthermore, the use of a muscle specific promoter, tmck, is a valued added safety feature helping to avoid off target expression with the potential for toxicity . As expected, scaav1.cmv.nt-3 vector at 1 10 vg produced significantly higher nt-3 levels than the single - stranded vector at the same dose, and a half - log dose reduction (3 10 vg) of both scaav1.cmv.nt-3 and scaav1.tmck.nt-3 vectors produced improvements in cmap amplitudes comparable to ssaav.cmv.nt-3 supporting the use of the tmck promoter in a self - complementary vector for future clinical trials . Cmt1a is a conventional prototype of a myelin disease by histological and electrophysiological criteria but at the same time manifests a clinical phenotype typical of a length - dependent neuropathy resulting from preferential distal axonal loss . Our previous studies, along with others have shown that axonal pathology in demyelinating cmt neuropathies is a major pathologic component contributing to the clinical phenotype that directly correlates with the clinical disability . Profound axonal cytoskeletal abnormalities leading to axonal degeneration and distally prominent axonal loss are thought to result from impaired sc - axon interactions . Studies in tr have shown reduced phosphorylation of nf - h and nf - m, permitting nfs to become densely packed as the hallmark cytoskeletal change representing perturbed sc - axon interactions . Previous studies from this laboratory have shown that in animal models of cmt, in addition to axonal pathology, there is impaired nerve regeneration . Moreover, in the tr nerves distal to the nerve crush at day 3 and 6, significant sc apoptosis was seen suggesting that mutant scs are highly susceptible to apoptotic cell death when they return to promyelinating mode in the regenerating nerves . It is likely that the poor regeneration response to crush injury in tr is related to impaired sc proliferation / differentiation and subsequent sc loss by apoptosis . Similarly, apoptotic sc loss is seen in cmt1a patient biopsies, occurring in clusters where loss of axonal sprouts took place in an early stage of regeneration . Furthermore, we identified a defect in nerve regeneration characterized by fewer scs in the regenerating nerve fibers of crushed sciatic nerves of nt3+/ heterozygous mice . Using sciatic nerve allograft paradigms we showed that nt3+/ status of the scs, but not of the axons, is responsible for impaired nerve regeneration and that nt-3 is essential for sc survival in early stages of regeneration - associated myelination in the adult peripheral nerve . It should be emphasized here that prolonged denervation with accompanying sc atrophy, a model that simulates a chronic distal axonal neuropathic process in humans has a series of consequences that include decreased regeneration capacity related to loss of receptors and reduced expression of growth factors, a gradual decline in sc number with downstream inability to maintain bands of bungner . From a translational viewpoint, collectively these observations strongly support our central hypothesis that priming scs with nt-3 is beneficial to nerve regeneration and associated myelination, by transforming denervated scs into a competent promyelinating state of readiness as a crucial first step in the potential treatment of chronic neuropathic conditions, especially for disorders like the primary sc forms of cmt neuropathies . In our previous studies, we observed three important biologic effects of nt-3: (i) an increase in the sc numbers, (ii) an increase in the number of mfs, and (iii) a normalization of axonal nf cytoskeleton . With the current study, using a gene therapy approach, we confirmed those findings and firmly established the efficacy of nt-3 in the intact and regenerating tr nerves by providing qualitative and quantitative data for improvements in the mf density, myelin thickness, sc number, and axonal cytoskeletal properties (increased nf - h phosphorylation and decreased nf packing density) as well as muscle fiber diameter . Moreover, we provided functional and electrophysiological evidence that nt-3 improves efficiency of axonal regeneration resulting in improved motor function and cmap amplitude in the tr mouse model of cmt . We believe that nt-3 effect on mutant sc survival and differentiation with resulting increases in the competent sc pool as well as improvements toward normalization of axonal nf cytoskeletal properties appear as the major players in this outcome . In addition to sc - mediated augmentation of regeneration, there may also be a direct effect upon neurons that promote axonal sprouting . Nt-3 and its high - affinity receptor, trkc, are present in high numbers of spinal motor neurons and in a subpopulation of large diameter primary sensory neurons . Furthermore, nt-3 is internalized and retrogradely transported from the periphery to motoneuron cell bodies . Nt-3 also plays a role in functional maturation of neuromuscular synapses and is expressed in skeletal muscle as the predominant neurotrophin . It was reported that nt-3 exerts a selective action on type 2b fast muscle fibers of gastric muscle 8 months after nerve repair following local delivery . However, using our experimental approach that results in the systemic exposure of the neuromuscular system to nt-3, we found significant diameter increases for both fast twitch oxidative and glycolytic fibers as well as the slow twitch oxidative fibers in the tr gastrocnemius muscles (results not shown) with more prominent increases in both fast fiber subtypes . Our finding of increased myelin thickness in trembler nerves with nt-3 gene therapy is in contrast with the previously proposed inhibitory role for nt-3 in myelination but supports an opposite role for nt-3 as shown by more recent in vivo studies . Studies by woolley et al . Demonstrated that developmental loss of nt-3 results in reduced levels of myelin - specific proteins, reduced extent of myelination, and increased apoptosis of scs . Our own previous studies in the nude mice harboring allografts from nt3+/ mice revealed a retardation of the myelination process emphasizing the supportive / facilitator role of nt-3 for optimal myelination . Nt3+/ scs were halted at their immature state with processes engulfing polyaxonal aggregates of the recipient nude mice axons with nt3+/+ status . Our data suggests that nt-3-primed scs are more competent in the myelination process as reflected by significant improvements in the g ratios across all axon diameters, particularly for small and medium diameter axons at 20 weeks aav1.nt-3 postinjection . Therefore, the nerve conduction studies will not reflect the histological changes in myelin thickness at this time point . It should be noted however that the sustained nt-3 effect on myelin thickness on these severely hypomyelinated tr nerves resulted in very modest increases in the sciatic nerve conduction velocity at 40 weeks post - gene injection, as anticipated . On the other hand, the improved grip strength in this model directly correlates with increased cmap amplitudes as an index of the number of axons that have functional neuromuscular connections . Moreover, increases in muscle fiber diameters that we observed in histograms from anterior and posterior compartment muscles of the lower limb at 40 weeks provide additional evidence of nerve regeneration into the muscle . Finally, the clinical outcome of a length dependent distal axonal disease (worsening, stable or improved) depends on two seemingly opposing but intimately associated pathobiological processes: (i) the degree or rate of axonal degeneration, progressing centripetally toward cell body and (ii) the ability of the nascent axon tips to regenerate efficiently . It is important to reemphasize that our current strategy to alter these processes would improve the efficiency of nerve regeneration and associated myelination . Nt-3, with its proven biologic efficacy in trembler model fulfills criteria to consider this approach using aav - mediated gene delivery as potential therapy for cmt1a, but also raises the possibility for translation to other longstanding neuropathies with distal axonal loss . Although we have confidence in potentially providing a safe product delivered by raav, it is best to be cautious about predicting efficacy in a clinical trial in cmt patients based on a study in mice . Vector dna plasmid paav.cmv.nt-3 (gift from b.k.k .) Was used to generate single - stranded raav1.cmv.nt-3 . It contains the human nt-3 cds (genebank designation ntf3) under the control of the cmv promoter cloned between aav2 inverted terminal repeats . To generate self - complementary (sc) aav vectors, aav dna plasmid vectors pscaav.cmv.nt-3 were generated as follows: the nt-3 coding sequence was polymerase chain reaction (pcr) amplified from plasmid, the paav.cmv.nt-3 vector using forward (5-accttgcggccgccaccatgtccatcttgttttatg-3) and reverse (5-catatgcggccgcctcatgttcttc cgatttttctcgacaaggcacaca-3) primers . The nt-3 pcr fragment was then digested with not i and ligated into the self - complementary paav.cmv.x5 (b54) vector from which the x5 cdna was removed by not i digestion . For generating self - complementary dna vector plasmid pscaav.tmck.nt3, the nt-3 cdna was amplified from plasmid paav.cmv.nt-3 by pcr using forward (5-atgtcggtacctgcagggatatcca ccatgtccatcttgttttatgtga-3) and reverse (5-tcagtggcgcgccgaaaaaacctcccacacctccc-3) primers . The resulting nt-3 cdna pcr fragment was then digested with kpn i and asc i enzymes and cloned into a self - complementary pscaav.tmck.asg vector plasmid from which the sg transgene was removed by kpn i and asc i digestion . All vectors include a consensus kozak sequence, an sv40 intron, and synthetic polyadenylation site (53 bp). It is a modification of the previously described ck6 promoter and includes a modification in the enhancer upstream of the promoter region containing transcription factor binding sites . The tmck promoter modification includes a mutation converting the left e - box to a right e - box (2r modification) and a 6 bp insertion (s5 modification). Aav1 vector production was accomplished using a standard 3 plasmid dna / capo4 precipitation method using hek293 cells . Two hundred and ninety - three cells were maintained in dmem supplemented with 10% fetal bovine serum and penicillin and streptomycin . The production plasmids were: (i) paav.cmv.nt-3, pscaav.cmv.nt-3, or pscaav.tmck.nt-3 (ii) rep2-cap1 modified aav helper plasmid encoding the cap 1 serotype, and (iii) an adenovirus type 5 helper plasmid (padhelper) expressing adenovirus e2a, e4 orf6, and va i / ii rna genes . A quantitative pcr - based titration method was used to determine an encapsidated vg titer utilizing a prism 7500 taqman detector system (pe applied biosystems, grand island, ny). The primer and fluorescent probe targeted the tmck and cmv promoters and were as follows: tmck forward primer, 5-acccgagatgcctggttataatt-3; tmck reverse primer, 5-tccatggtgtacagagcctaagac-3; and tmck probe, 5-fam - ctgctgcctgagcctgagcggttac - tamra-3; cmv forward primer, 5-tggaaatccccgtgagtcaa-3; cmv reverse primer, 5-catggtgatgcggttttgg-3; and cmv probe, 5-fam - ccgctatccacgcccattgatg - tamra-3. Animals, procedures and treatment groups . Tr mice (b6.d2-pmp22/j) and c57bl/6 wild type were obtained from jackson laboratory (bar harbor, me). All animal experiments were performed according to the guidelines approved by the research institute at nationwide children's hospital animal care and use committee . The design of the experimental groups comparing single - stranded and self - complementary aav1.nt-3 vectors, treatment duration, doses, and promoters is outlined below: (i) for the nerve regeneration study, 912-week - old tr mice were injected in the left gastrocnemius muscle with either pbs or 1 10 vg of ssaav1.cmv.nt-3 (n = 12). At 3 weeks postinjection, under isoflurane anesthesia, left sciatic nerves were exposed and crushed with a fine forceps at a level 5 mm distal to the sciatic notch to generate a regeneration paradigm as previously described . Functional recovery, measured weekly by grip strength obtained from the limb harboring the crushed nerve and the morphological assessment of nerve regeneration were the primary endpoints of this study . At 20 weeks, postcrush mice were euthanized for tissue and serum collection for nt-3 elisa enumeration . (ii) in this set of experiments, the effect of nt-3 gene therapy on the sciatic nerve motor conduction parameters and on the motor functions (ipsilateral and simultaneous bilateral grip strength) were investigated with endpoint correlative histopathology . Six- to 8-week - old tr mice received 1 10 vg of ssaav1.cmv.nt-3 or pbs in the right quadriceps muscle (n = 14 in each group). The left sciatic nerve conduction studies were performed at baseline age and were repeated at 20 and 40 weeks post - gene transfer . At 20 weeks, four vector - injected and five pbs - injected mice were euthanized for tissue collection for the assessment of nf cytoskeleton and nf phosphorylation studies using ultrastructural morphometry and western blot . Functional status of the remainder mice were monitored using rotarod between 23 and 40 weeks, and following endpoint electrophysiology, mice were euthanized for harvesting left sciatic nerve and distal leg muscles . (iii) the efficacy of scaav1.nt-3 under control of the cmv promoter versus the muscle - specific tmck promoter both given at three doses, within a half - log range (3 10 vg, 1 10 vg, and 3 10 vg) was assessed using endpoint electrophysiological and morphological studies . A total of 177 tr mice in 7 cohorts (n = 2329 in each cohort) were generated, receiving i.m . Injections of the self - complimentary vectors into the right gastric muscle at low dose, intermediate dose, or high dose with either promoters as indicated above or pbs . Technically acceptable quality nerve conduction studies were obtained from the left sciatic nerves in 171 mice . At the end of each study mf density determinations were done in high - dose cohorts (n = 13 with cmv, n = 26 with tmck, and n = 12 with pbs). Serum collected from pbs and aav1.nt-3 injected mice was assayed for nt-3 levels using a capture elisa assay . Briefly, immunlon4 plates were coated with 100 l of a monoclonal anti - human nt-3 capture antibody (cat #mab267, 4 g / ml, r&d systems, minneapolis, mn) in buph carbonate buffer for 6 hours at 25 c . Plates were subsequently blocked with pbs + 1% bsa + 5% sucrose overnight at 28 c . The next day, plates were washed four times with pbs + 0.05% tween20 (pbs - t) and a nt-3 standard (recombinant human nt-3, cat #267-n3, r&d systems) was prepared using serial twofold dilutions in the range of 101,280 pg / ml in 20 mmol / l tris, 150 mmol / l nacl, 0.1% bsa, 0.05% tween-20 and applied to the plate (100 l volume). Animal sera were diluted 1:20 and 1:50 using the same dilution buffer used for the nt-3 standard and 100 l added to the plate . Standards and serum samples were incubated at room temperature (25 c) with gentle shaking for 2 hours 10 minutes . Following four pbs - t washes, 100 l of a diluted goat anti - nt3-biotin detection antibody was added to each well and incubated 90 minutes 10 minutes . At rt (0.2 g / ml of polyclonal goat anti - nt3-biotin detection antibody; cat #baf267; r&d systems). Following pbs - t washes, 100 l of a 1:1,000 dilution (pbs diluent) of extra - avidin - hrp developer solution was added to the wells and incubated for 60 minutes 10 minutes at rt (extra - avidin - hrp; cat #e2896; sigma, st louis, mo). After washing, plates were developed by adding 100 l of rt tmb substrate solution in the dark for 15 minutes 1 minutes (1-step ultra tmb - elisa; cat #34028; thermo, waltham, ma). The reaction was stopped by adding 50 l of 2n h2so4, and the optical density at 450 nm determined for each well on a bio - tek synergy 2 elisa plate reader running the gen5 2.0 data analysis software package (bio - tek us, winooski, vt). Nt-3 serum concentrations were extrapolated from the nt-3 standard curve using a best fit algorithm . Tr mice were tested for baseline motor function within 1 week prior to receiving i.m . Motor function tests included bilateral simultaneous hindlimb grip power and that of the left hind paw using a grip strength meter (chatillon digital meter; model dfis-2; columbus instruments, columbus, oh) as we have used in our previous studies . Bilateral or unilateral grip strength was assessed by allowing the animals to grasp a platform followed by pulling the animal until it releases the platform; the force measurements were recorded in four separate trials . Endpoint bilateral and ipsilateral grip strength measurements were done in two sessions (morning and afternoon), three trials in each per day for 3 consecutive days prior to obtaining the nerve conduction studies . Mouse motor function and balance was tested weekly by using the accelerating rotarod (columbus instruments). Mice were trained on the rotarod apparatus for 2 weeks to acclimate to testing protocol prior to data collection . A fixed rotation protocol at 5 rpm constant rotation was used, and the average of the three trials per session was recorded . Temperatures were recorded with an infrared thermometer (fisher scientific, pittsburgh, pa), and body temperature was maintained between 32 and 36 c using a heating pad . Following body temperature equilibration, left sciatic nerve conduction studies were obtained using a xltek neuromax 1002 electromyograph (ontario, canada) and rhythmlink disposable subdermal needle recording electrodes (for both stimulation and recording) as we described previously . The stimulating electrodes were placed at the proximal and distal stimulation sites (i.e., the left sciatic notch and just above the ankle, respectively), and a third pair of recording electrodes was positioned in the foot pad between the second and third digits of the left foot . The latency, duration, negative area under curve, and conduction velocity values of the recorded sciatic motor responses were determined . A caliper was utilized to measure the interelectrode distances, and these distances were used in calculations of intersegmental velocity . In addition, onset latency, duration, and amplitude were also calculated . Mice were killed quickly by an overdosage of xylazine / ketamine anesthesia at 20 weeks postcrush . The sciatic nerves from crushed and intact sites were removed under a dissecting microscope, fixed in glutaraldehyde; tissue blocks were marked for proximodistal orientation and processed for plastic embedding for light and electron microscopy using standard methods established in our laboratory . In all other experiments, left sciatic nerves were removed and processed in the same manner . Quantitative analysis at the light microscopic level was performed on 1 m thick cross sections from regenerating and intact uncrushed sciatic nerves using a microscope - mounted video camera at 1,600 magnification and an image analysis software (bioquant tcw98 image analysis software; r&m biometrics, nashville, tn) as previously described . Data assessing regeneration response were obtained from the second segment, at a level ~4 mm distal to the crush . Mf densities (mean number se / mm) and composites of mf axon size distribution histograms were generated in raav1.nt-3 and pbs - injected groups the g ratio refers to the ratio of axonal diameter / fiber diameter, and lower g ratios represent axons with thicker myelin . For g ratio determinations, three representative areas of cross sectional images of mid sciatic nerves from three ssaav1.cmv . Nt-3- and pbs - injected tr mice and wild type were captured at 100 magnification, and the shortest axial lengths as axon diameters and fiber diameters were recorded with a calibrated micrometer, using the axiovision, 4.2 software (zeiss) as we described previously . One micrometer thick, plastic embedded cross - sections were used for mf and sc nuclei counts . Three randomly selected areas in five aav1.cmv.nt-3- and pbs - injected tr mice were photographed at 100, and the number of mf and sc nuclei not in contact with the mfs was determined . Morphologic criteria used for identification of sc nuclei included homogenous, rounded, ovoid, or bean - shaped appearance with irregular contour . The sc densities were estimated as number per mm of the endoneurial area, by adding the number of sc nuclei belonging to unmyelinated fibers or at a promyelination stage with 1:1 axon - sc relationship to the number of mfs as we reported previously . Ultrastructural morphometric studies were performed using cross sectional images of sciatic nerves at 52,000 final magnification . Nf density histograms were generated by determining the number of nfs per unit hexagonal area in randomly selected myelinated axons from treated and untreated tr mice and wild - type mice as previously described . Ten randomly selected mfs with axon diameters between 3.6 and 5.0 m at 20 weeks posttreatment were analyzed in each group . Gastrocnemius and tibialis anterior muscles from ssaav1.cmv.nt-3 and pbs - injected tr mice (n = 3 in each group) were removed and 12 m thick cross cryostat sections were stained for succinic dehydrogenase for generation of muscle fiber size distribution histograms as previously described . Over 2,000 fibers were analyzed in each group . Sciatic and spinal nerves and roots from ssaav1.cmv.nt-3 and pbs - injected tr mice were used for quantitative western blot analysis of nf proteins with nf - h - specific antibodies . Tissues were homogenized in radio immunoprecipitation assay buffer (50 mmol / l tris - hcl ph 8.0, 1% np-40, 150 mmol / l nacl, 0.5%sodium deoxycholate, 1% sodium dodecyl sulfate, 1 mmol / l ethylene glycol tetraacetic acid, 1 mmol / l na3vo4, 1 mmol / l naf, phenylmethylsulfonyl fluoride (1:250), complete protease inhibitor (1:25), and 25.5 mmol / l sodium pyrophosphate) using blue tip and kontes pestle . Protein concentrations were determined using rc / dc method (biorad laboratories, hercules, ca). For sodium dodecyl sulfate polyacrylamide gel electrophoresis, 5 g of protein was run on 38% tris - acetate nupage gels (invitrogen, grand island, ny) and transferred to pvdf membrane (amersham biosciences, pittsburgh, pa). After blocking for 1 hour in 5% nonfat dry milk in tbst (100 mmol / l tris - hcl, ph 8.0, 167 mmol / l nacl, 0.1% tween), the western blots were incubated with diluted primary antibodies against total nf - h (ab1989, cooh - terminal antibody from chemicon; diluted 1:500), hyperphosphorylated nf - h (smi-31 from sternberger; diluted 1:20,000) and hypophosphorylated nf - h (smi-35 from sternberger; diluted 1:10,000). Blots were washed and incubated in appropriate horseradish peroxidase conjugated secondary antibodies at a dilution of 1:2,000 . Gapdh was used as loading control (millipore, billerica, ma; diluted 1:500). Immunoreactive bands were visualized with the use of ecl plus western blotting detection system (ge healthcare, pittsburgh, pa) and hyperfilm ecl (amersham biosciences). Signal intensities were measured with imagequant software (ge healthcare). Statistical analysis . For comparisons between ssaav1.cmv.nt-3 gene transfer and pbs - treated tr groups, statistical analysis were performed in graph pad prism 4 software, using one - way analysis of variance followed by bonferroni multiple post hoc comparisons . Differences between the means were considered significant at two - tailed test . Significance level was set at p <0.05 . For the studies comparing the efficacy of scaav1.nt-3 under control of the cmv promoter versus the muscle - specific tmck promoter both given at three doses, the following analyses were used: (i) spearman correlation to study the relationship between outcomes, (ii) kruskal wallis test to compare outcomes among all groups (pbs, cmv low dose / intermediate dose / high dose and tmck low dose / intermediate dose / high dose), and (iii) mann whitney u - test to compare outcomes between each group and pbs (control) group, and bonferroni correction to adjust for multiple comparisons . Two - way analysis of variance is used to study the effects of gene vectors and doses on outcomes . All tests are conducted by sas 9.2 (by sas institute, cary, nc). Serum levels of nt-3 in tr mice at 23 weeks postinjection (shown as individual mice) compared to pbs - treated tr controls (numbers 567, 570, 573, and 591) are shown in individual mice . One micrometer thick, toluidine blue - stained representative cross sections of intact / uncrushed (a, b) and regenerating (c, d) sciatic nerves from tr mice injected with pbs (a, c) and aav1.nt-3 (b, d) at 20 weeks . Thinly myelinated and naked axons are indicated with arrows in pbs - treated intact and regenerating nerves (a, c). Aav1.nt-3 gene therapy results in an increase of axons with thicker myelin (arrows) in intact nerves (b) and an apparent increase in the small myelinated fibers (arrows) in regenerating nerves (d). Composite histograms showing myelinated fiber distribution in the regenerating (a) and contralateral intact (b) sciatic nerves from tr mice at 20 weeks post aav1.nt-3 gene therapy showing an increase in the subpopulation of axons <4 m in diameter in aav1nt3 group compared to pbs - control . Neurogenic changes in the gastrocnemius muscle from a pbs - treated tr (a) showing atrophic angular fibers of either histochemical fiber types (arrows) or fiber type atrophy (asterisk). Reinnervation induced changes (asterisks mark fiber type groupings) at 40 weeks post aav1.nt-3 gene therapy (b). Muscle fiber size histograms from tibialis anterior (a) and gastrocnemius (b) muscles at 40 weeks post aav1.nt-3 gene therapy . Both muscles showed an increase in fiber diameter (c) as histologic evidence of nerve regeneration into the muscle compared to pbs - injected control group . Representative tracings of sciatic motor nerve conduction from a wild - type and tr mouse at baseline and endpoint at 40 weeks postvector injection . Serum levels of nt-3 in tr mice at 23 weeks postinjection (shown as individual mice) compared to pbs - treated tr controls (numbers 567, 570, 573, and 591) are shown in individual mice . One micrometer thick, toluidine blue - stained representative cross sections of intact / uncrushed (a, b) and regenerating (c, d) sciatic nerves from tr mice injected with pbs (a, c) and aav1.nt-3 (b, d) at 20 weeks . Thinly myelinated and naked axons are indicated with arrows in pbs - treated intact and regenerating nerves (a, c). Aav1.nt-3 gene therapy results in an increase of axons with thicker myelin (arrows) in intact nerves (b) and an apparent increase in the small myelinated fibers (arrows) in regenerating nerves (d). Composite histograms showing myelinated fiber distribution in the regenerating (a) and contralateral intact (b) sciatic nerves from tr mice at 20 weeks post aav1.nt-3 gene therapy showing an increase in the subpopulation of axons <4 m in diameter in aav1nt3 group compared to pbs - control . Neurogenic changes in the gastrocnemius muscle from a pbs - treated tr (a) showing atrophic angular fibers of either histochemical fiber types (arrows) or fiber type atrophy (asterisk). Reinnervation induced changes (asterisks mark fiber type groupings) at 40 weeks post aav1.nt-3 gene therapy (b). Muscle fiber size histograms from tibialis anterior (a) and gastrocnemius (b) muscles at 40 weeks post aav1.nt-3 gene therapy . Both muscles showed an increase in fiber diameter (c) as histologic evidence of nerve regeneration into the muscle compared to pbs - injected control group . Representative tracings of sciatic motor nerve conduction from a wild - type and tr mouse at baseline and endpoint at 40 weeks postvector injection.
|
Measuring performance of health systems is an essential tool for health policy - makers to conduct analysis and track change . The 2000world health organization (who) report reflects that promoting health status, fairness in financing and responsiveness are the three main goals of evaluating health system performances (2). Responsiveness refers to the ability of a health system to respond to the legitimate expectations of the population; this is associated with the non - medical aspect of the health system and environment in which the people are treated (2,3). " Respect for human right " and " client - orientation " are two broad categories of responsiveness . Furthermore, respect for human right consists of dignity, autonomy, communication and confidentiality (2,4). Client orientation includes prompt attention, quality of basic amenities and access to social support networks as well as choice of provider . In 2000, iran s health system was ranked 100th in terms of responsiveness (2,5). Prompt attention and dignity were the most important domains of responsiveness of health systems for the iranian populations (6). Besides, urgent and special attention was recommended to improve the responsiveness of the health system (7,8). In a survey on health system responsiveness in tehran, more than 90% of the households believed that responsiveness was very important (5). In addition, it was reported that responsiveness was better for outpatient care than inpatient care (9). Most of the studies on health care responsiveness have focused on household survey, and only a few studies were conducted to address the responsiveness of a health system to inpatient care (5,6,10,11). Moreover, there is a gap in the concerning patients views on health system responsiveness in iran . The 11th government, elected in june 2013, took health as the top priority of its administration and has been implementing a health sector evolution plan (hsep) since may 6, 2014 (12). Hsep is a national plan, with two main phases: the first phase relating to improving fair access to healthcare and quality of inpatient and outpatient care in hospitals and the second to the public health care (13). Hsep aimed to provide the followings: health insurance coverage to all uninsured individuals, reducing out - of - pocket expenses for inpatient services, providing financial protection of patients with specific diseases and poor patients, encouraging medical doctors to stay in deprived areas through motivational policies, improving quality of care through increasing specialists, and improving hospital amenities and lodging services (13,8). This study aimed at examining the effect of hsep on health system responsiveness in kermanshah, western iran . The findings may contribute to improvements in the responsiveness of the health system in this area of iran . This was a cross - sectional study conducted on the responsiveness of the hospitals in admitted patients in kermanshah in 2015 . The city has seven public university hospitals with a total number of 1,570 active beds and two private hospitals . Data were collected from six public university hospitals with the exception of the seventh university hospital, which was a psychiatry hospital . A sample of 335 patients was calculated using the formula for single population proportion at 50% proportion of responsiveness (as no evidence was available from similar studies in the area), 5% level of significance and 0.05 margin of error . The proportionate allocation to population size technique was employed to collect data from each hospital . At least three days hospitalization by a patient and age above three years were the inclusion criteria whilst patients who refused to participate or admission in intensive or critical care units were excluded . Data were collected using standard world health survey(whs) questionnaire, which was developed by world health organization (who).this questionnaire is a valid, reliable and comparative instrument that contains questions about the importance of responsiveness domains from an inpatient s point of view, health services utilization and people's view about the responsiveness domain of inpatient services (14). Items in each component of responsiveness were as follows: prompt attention (2 items); communication (2 items); human gentility and dignity (2 items); patient s participation in decision - making and autonomy (2 items); confidentiality and trust (2 items); choice of provider (1 items); quality of basic amenities (2 items); and access to social support (2 items). In this study, responsiveness of the hospitals was considered as a dependent variable while the socio - demographic variables of the patients were the independent variables . We used a five - point likert scale where 5was very important / very good, and 1 represented least important / very poor . The responsiveness score for each domain was obtained by dividing the sum of the scores within the domain by the number of items in the likert scale . The stata version 12 statistical package was used to analyze the responses of a five - point likert scale data . The frequency distribution, ranges and mean (sd) were used to describe the data . The principal component analysis (pca) similar to another study in iran (5), we used 0.4 and above as a cutoff for factor loading in the pca . The overall relationship between the socio - demographic variables and health system responsiveness was checked by chi - square test . This was a cross - sectional study conducted on the responsiveness of the hospitals in admitted patients in kermanshah in 2015 . The city has seven public university hospitals with a total number of 1,570 active beds and two private hospitals . Data were collected from six public university hospitals with the exception of the seventh university hospital, which was a psychiatry hospital . A sample of 335 patients was calculated using the formula for single population proportion at 50% proportion of responsiveness (as no evidence was available from similar studies in the area), 5% level of significance and 0.05 margin of error . The proportionate allocation to population size technique was employed to collect data from each hospital . At least three days hospitalization by a patient and age above three years were the inclusion criteria whilst patients who refused to participate or admission in intensive or critical care units were excluded . Data were collected using standard world health survey(whs) questionnaire, which was developed by world health organization (who).this questionnaire is a valid, reliable and comparative instrument that contains questions about the importance of responsiveness domains from an inpatient s point of view, health services utilization and people's view about the responsiveness domain of inpatient services (14). Items in each component of responsiveness were as follows: prompt attention (2 items); communication (2 items); human gentility and dignity (2 items); patient s participation in decision - making and autonomy (2 items); confidentiality and trust (2 items); choice of provider (1 items); quality of basic amenities (2 items); and access to social support (2 items). In this study, responsiveness of the hospitals was considered as a dependent variable while the socio - demographic variables of the patients were the independent variables . We used a five - point likert scale where 5was very important / very good, and 1 represented least important / very poor . The responsiveness score for each domain was obtained by dividing the sum of the scores within the domain by the number of items in the likert scale . The stata version 12 statistical package was used to analyze the responses of a five - point likert scale data . The frequency distribution, ranges and mean (sd) were used to describe the data . The principal component analysis (pca) similar to another study in iran (5), we used 0.4 and above as a cutoff for factor loading in the pca . The overall relationship between the socio - demographic variables and health system responsiveness was checked by chi - square test . Three hundred thirty five, 190 (56.7%) male and 145 (43.3%) female, patients with the mean (sd) age of 41.5 (2.36) yrs . And the age range of 3 - 92 yrs.were included in the study . Of the respondents, 92.8% had health insurance coverage, and 44.7% were illiterate (table 1). The respondents rank on the level of importance of the health system responsiveness based on the domains of the responsiveness questionnaire is shown in fig . The proportion of patients who rated the responsiveness of the hospitals as important or very important based on quality of the basic amenities, communication and dignity domains accounted for 94%, 91% and 90%, respectively . The social support domain was considered as the least domain as only 77% of the patients rated this domain as important or very important . Proportion of the participants who rated the responsiveness domain as important / very important the mean performance of each domain of the health system responsiveness is shown in table 2 . The best and worst performance for domains of dignity and autonomy were 82.2 and 62.5, respectively . The findings indicated that 68% of the variance of the overall responsiveness score was explained by four components . The first component which contained communication, dignity and autonomy explained 31.4% of the variance; the second component contained confidently and social support and explained17.6% of the variance; the third component contained quality of basic amenities and choice domain and explained 11% of the variance and the fourth component contained dignity domain only and explained8% of the variance . The empirical analysis revealed no significant association between total health system responsiveness scores and gender, education, age, health insurance coverage, and working status of the respondents . This study was the first of its type after health sector evolution plan (hsep). The aim of this study was to describe health system responsiveness in western part of iran . However, several studies have been conducted on health system responsiveness before hsep elsewhere (5,10,11,16). Responsiveness of the health system is the result of interactions between health system agents and the patients (16), which is related to the patient s well - being (17). The well - being of the patients is influenced by health system and the health system s responsiveness to the patients (18). Quality of basic amenities, dignity, communication and prompt attention received higher scores in terms of importance . This implies that from patient s point of view, these domains are more important than other domains of responsiveness . In addition, compared to previous studies in iran, patients kept their preferences about responsiveness domains . In this study, the mean performance of each domain of the health system responsiveness was not much different except for autonomy that was rated the least . In another study that assessed the responsiveness of hospitals to inpatient care in zanjan reported an overall responsiveness score of 58.4 (10). Similarly, karami - tanha et al . Found hospital responsiveness score of 57 to patients with heart failure (15). Furthermore, a household survey on responsiveness of health systems to outpatient and inpatient services in tehran reported 70.6 responsiveness score (5). Generally, the overall score of responsiveness of the hospitals to inpatient services in our study was higher than the scores reported in previous studies in iran . Besides, hospital responsiveness scores in our study were higher than the scores reported in studies elsewhere (9,21,22), but lower than the scores reported in germany (23). In this study, dignity, confidentiality, and quality of basic amenities had the best performance . This finding is in line with the reports of several studies (11,15,17,18), and with that of rashidian et al ., but the quality of basic amenities in their report was the second worst performance (5). In previous iranian studies, social support / confidentiality/ dignity (11), dignity/ confidentiality/ prompt attention/ (5), dignity/ confidentiality/ prompt attention (15) confidentiality/ communication / prompt attention (10) were reported as the best performing domains . Unlike our study, a study in china reported social support to be the best performance domain (24). Confidentiality and dignity domains achieved highest scores in the health system of iran before and after hsep . In addition, a high score in the quality of basic amenities means that the rooms in the hospitals were clean and there were enough waiting and examination rooms . In fact, after hsep, public hospital rooms were renovated and lodging and welfare equipment were purchased (12). In this study, the autonomy domain had the worst performance score followed by choice domain . This finding is similar to the findings reported in several other studies (5,10,15,22,23). In the above - mentioned study of iran, autonomy/ quality of basic amenities (5), autonomy/ communication (11), choice/ autonomy (10), and autonomy / choice received the least score (15). In this study, performance of hospitals with respect to communication, prompt attention, social support, choice and autonomy were rated 4th to 8, respectively . Therefore, providing training for the health care providers and improving their knowledge is necessary to achieve a higher score in the autonomy and choice domains . In this study, the principal component analysis revealed that responsiveness for inpatients care included communication dignity/ autonomy, confidently/ social support, and lastly quality of basic amenities / choice as the main factors . In a study conducted in taiwan, five factors of respect, access, confidentiality, basic amenities and social support were extracted . These five factors revealed acceptable internal consistency, four of which were significantly correlated with the overall responsiveness score (25).in other studies, communication, autonomy and confidentiality were the main factors (5,21). While the majority of the above - mentioned reports included both inpatient and outpatient cares, this study was limited to inpatient care and university hospitals . This study indicated a high rate of overall responsiveness score of each of the domains compared to other similar previous studies in iran . Although it is difficult to reach a conclusion, our findings may show better responsiveness of the health system than the previous reports . The relatively higher responsiveness of the hospitals in the " quality of basic amenities " domain may be a direct result of huge resources use that was allocated to the hospitals during hsep . Finally, improvement in client - oriented domains of health system responsiveness such as quality of basic amenities and prompt attention may require large investments and additional resources, while improvement in
|
The large number of photoswitchable biomolecules discovered and developed in recent years covers a great variety of cellular functions, like catalysis of metabolic processes, cytoskeletal polymerization and motors, nucleic acids dynamics, intracellular signaling, and, perhaps most dazzling, membrane excitability, which has been at the focus of optogenetics and optopharmacology . The dream of precisely and remotely photocontrolling every aspect of the cell s inner workings in intact tissue appears within reach and offers the promise of interrogating complex cellular processes to discover their molecular mechanisms . In order to take full advantage of light - regulated proteins, multiphoton excitation with near - infrared (nir) light provides sub - micrometric resolution in three dimensions, deep penetration into tissue, and patterned illumination . However, to be adapted to two - photon stimulation technology, the light response of natural photoswitchable proteins like channelrhodopsin-2 (chr2) must often be adjusted by mutating the tight binding pocket of the natural chromophore, which has fixed photochemical characteristics . In contrast, synthetic photoswitches developed by optochemical genetics and optopharmacology are based on chromophores that act on the protein surface and thus offer excellent opportunities for rationally tuning their photochemical behavior by chemical substitutions that do not affect the functional properties of the protein . Remarkably, two - photon stimulation of synthetic photoswitchable proteins has not been investigated despite the advances of neurotransmitter uncaging and optogenetics using pulsed nir illumination . To demonstrate the multiphoton activation of synthetic photoswitches, we chose ion channels because they constitute highly sensitive transducers of chromophore isomerization (potentially up to the single channel level). In particular, we focused on the well - characterized light - gated glutamate receptor (liglur), a gluk2 kainate receptor - channel that is chemically conjugated to a maleimide azobenzene cis photoisomerization of this photoswitchable tethered ligand (ptl) allows the efficient activation of the receptor upon one - photon absorption of violet or blue radiation (open liglur, figure 1b), a process that can be reverted back either by absorption of green light or thermal relaxation in the dark (closed liglur, figure 1b). (a) structures of the photoswitchable tethered ligands applied to the two - photon control of liglur: mag (1), mag2p (2), and maga2p (3). Violet (one - photon) or nir (two - photon) light excitation induces glutamate recognition and channel opening via trans this process is reverted by illumination with visible light (one - photon excitation) for liglur - mag and by thermal back - isomerization for liglur - mag2p and liglur - maga2p . To control liglur using multiphoton excitation, here we have investigated the performance of mag and two new mag derivatives (2 and 3, figure 1a) upon pulsed nir illumination . Compounds 2 and 3 were devised to enhance the two - photon excitation response of the symmetrically substituted azobenzene chromophore in mag, which is expected to be poor . We introduced an asymmetric aminoazobenzene with sufficiently strong push pull character as to enhance its two - photon absorption cross - section (mag2p). In addition, the presence of the electron - donating tertiary amine in the 4-position should dramatically decrease the thermal stability of its cis state in physiological conditions, thus resulting in fast spontaneous cis trans back - isomerization and, as such, enabling single - wavelength operation of the switch . This behavior is also expected for 3 containing the same azobenzene core as mag2p . However, a novel scheme was exploited in this compound to enhance its nonlinear optical response, which consists in the introduction of a light - harvesting antenna to sensitize the trans cis isomerization of the system by absorption of nir radiation and subsequent resonant electronic energy transfer (ret) to the trans - azobenzene group . Because of its maleimide azobenzene glutamate antenna structure, we named compound 3 as maga2p . A naphthalene derivative was selected as antenna because of (i) its high two - photon absorption cross - section, (ii) the large spectral overlap between its emission and the absorption of the trans isomer of the aminoazobenzene group in 3, and (iii) its reduced size, to minimize potential steric hindrance effects on the glutamate - binding site of the receptor . The preparation of compounds mag2p and maga2p was achieved via a multistep modular synthetic sequence allowing structural diversity in the final compounds as well as the additional incorporation of a photo - harvesting antenna in 3 (scheme 1). In both cases, we took the n, n - orthogonally diprotected l - lysine 4 as scaffold, to which the different functional fragments of the target compounds were sequentially introduced: o - protected aminoazobenzene 5, fully protected glutamate derivative 6, naphthalene derivative 7, and furan - protected maleimide 8 . These fragments were obtained from commercial products as described in the supporting information . With respect to the synthesis of mag, several changes first, a branching point was inserted between the glutamate and azobenzene moieties to facilitate the incorporation of additional functional units to the ptl structure . Second, we introduce herein the use of 6 and 8 as more robust, versatile, and convenient precursors of glutamate and maleimide moieties during the multistep synthesis of novel mag derivatives . Reagents and conditions: (a) 5, hatu, dipea, thf (89%); (b) 37% hcl, meoh (93%); (c) 6, edci, hobt, dipea, thf (88%); (d) 20% piperidine / dmf (87%); (e) 7, edci, dipea, thf (81%); (f) 20% piperidine / dmf (64%); (g) clcoch3, pyridine, thf (69%); (h) 37% hcl, meoh (93%); (i) 6, edci, hobt, dipea, thf (71%); (j) rhcl(pph3)3, etoh / h2o, reflux; (k) hgo, hgcl2, acetone / h2o, reflux; (l) 8, ph3p, diad, thf (81%, over the three steps, for 13a, 27% for 13b); (m) toluene, reflux; (n) tfa, ch2cl2 (81% over the two steps for 2, 86% for 3). Abbreviations: hatu, o-(7-azabenzotriazol-1-yl)-n, n, n,n-tetramethyluronium hexafluorophosphate; dipea, diisopropylethylamine; edci, n - ethyl - n-(3-dimethyldiaminopropyl)-carbodiimide hcl; hobt, 1-hydroxybenzotriazole hydrate; diad, diisopropyl azodicarboxylate . The synthesis of both mag2p and maga2p began by the coupling reaction of 4 with aminoazobenzene 5 to afford the common intermediate 9, from which the synthetic pathways diverged . For the synthesis of mag2p, acid removal of the tert - butyl carbamate protection of 9 was followed by the coupling reaction of the resulting amine with glutamate derivative 6, basic deprotection of the terminal amine, and its acetylation to furnish intermediate 12a . In the case of maga2p, the best results were obtained by deprotecting first the amino terminus and proceeding through its reaction with the antenna fragment 7 to deliver 11 . Removal of the carbamate protection and coupling with 6 then furnished compound 12b . From intermediates 12a and 12b, the next synthetic steps were analogous for both ligands: removal of the allyl protecting group, introduction of the furan - protected maleimide 8 under mitsunobu conditions, release of the maleimide moiety via a retro - diels alder reaction, and cleavage of the tert - butyl carbamate and ester protections, thus finally affording the target compounds mag2p and maga2p . Figure 2a plots the electronic absorption spectra of the initial trans state of compounds 13 and of the photo - harvesting antenna tethered to maga2p (see also figures s1 and s2 in the supporting information). Owing to the 4-amino substituent introduced in the azobenzene core of trans - mag2p and trans - maga2p, the absorption maximum of the azoaromatic * electronic transition of these compounds clearly bathochromically shifts with respect to trans - mag (50 nm in dmso). This allows the trans cis photoisomerization of mag2p and maga2p to occur upon illumination with blue light instead of violet radiation . As shown in figure 2b, excitation of both ligands at 473 nm led to a noticeable decrease of their * absorption band, a typical signature of photoinduced cis isomer formation . This was further confirmed by h nmr measurements in dmso - d6, which revealed that the relative concentration of cis - mag2p and cis - maga2p in the resulting photostationary mixtures was 58% in both cases . Such photoproducts can be transformed into their corresponding trans isomers by irradiation with green light, as previously reported for mag (figure s3 in the supporting information). In the case of mag2p and maga2p, however, spontaneous thermal cis trans isomerization plays a significant role in the recovery of the initial state of the ligands, and it strongly competes with cis this effect is ascribed to the introduction of a 4-amino substituent in the azobenzene moiety of mag2p and maga2p, and it is expected to be dramatically enhanced in aqueous media . Thus, while the lifetimes of cis - mag2p and cis - maga2p in the dark at room temperature are 75 min in dmso (see figure s4 in the supporting information), they further drop off down to the millisecond time scale in aqueous buffer (= 118 and 96 ms in 80% pbs: 20% dmso, respectively; figure 2c). Cis isomerization of mag2p and maga2p at high frequencies in aqueous media with a single irradiation source, which we have exploited to demonstrate the high photostability of these light - responsive ligands (figure s5 in the supporting information). (a) absorption spectra in dmso of trans - mag, trans - mag2p, trans - maga2p, and the free naphthalene photo - harvesting antenna . (b) absorption spectra of trans - mag2p and trans - maga2p (solid lines), and the photostationary states obtained upon photoexcitation of these compounds in dmso at exc = 473 nm (dashed lines). (c) variation of the absorption at = 450 nm of trans cis mixtures of mag2p and maga2p in the dark at 25 c in 80% pbs:20% dmso . At these conditions, thermal cis trans back - isomerization takes place, thus restoring the initial concentration of the trans state of the ligands, which presents a larger extinction coefficient at abs = 450 nm . Solid lines correspond to the experimental data, while dashed lines were obtained from monoexponential fits . Although the incorporation of a photo - harvesting antenna negligibly affects the intrinsic photochemical behavior of the azobenzene group of maga2p with respect to mag2p, it provides ligand 3 with some additional optical properties . Thus, trans - maga2p displays an extra band in the absorption spectrum (max = 385 and 380 nm in dmso and 80% pbs:20% dmso, respectively), which arises from the naphthalene sensitizer (figure 2a and figure s1 in the supporting information). The fluorescence emission of this group is however strongly quenched upon covalent attachment to the ligand, with a 20-fold decrease in fluorescence quantum yield measured in aqueous buffer (antenna = 0.43 and trans - maga2p = 0.02; figure 3a). This indicates the occurrence of efficient ret processes from the photoexcited naphthalene antenna to the azo moiety of trans - maga2p, in agreement with the large frster radius calculated for this donor acceptor pair (see figure s6 in the supporting information). Cis isomerization should take place in this ligand, as demonstrated in figure 3b: 60% increase in trans cis photoconversion was determined for maga2p with respect to mag2p upon selective irradiation of the naphthalene antenna at exc= 355 nm . (a) fluorescence emission spectra in 80% pbs:20% dmso of trans - maga2p and the photo - harvesting antenna tethered to this ligand . The spectra are normalized relative to the excitation intensity and the absorption at the excitation wavelength (exc = 355 nm). (b) trans cis photoconversion efficiency of trans - mag2p and trans - maga2p upon irradiation at = 355 nm in dmso, which allows nearly selective excitation of trans - maga2p sensitizer (see figure 2a). We next tested mag, mag2p, and maga2p to photoswitch liglur in living cells using one- and two - photon stimulation . We expressed gluk2-l439c - egfp in hek293 cells and incubated them in mag, mag2p, or maga2p in order to allow the selective conjugation of the ptls to the cysteine introduced at position l439c of the receptor . For each compound, we recorded the corresponding photocurrents generated upon light - induced opening of liglur channels using whole - cell patch clamp (see the supporting information). One - photon liglur currents were obtained when the receptor was conjugated with the new compounds (figures 4 and 5a). The magnitude of the photocurrent response was not reduced after repeated stimulations, demonstrating the photostability of these compounds after protein conjugation (figure 4b, c and figure s8 in the supporting information). Figure 4 shows that for one - photon excitation, the wavelength dependence of current amplitude measured is different for each ptl . Photocurrent amplitudes at different wavelengths were quantified from electrophysiological recordings obtained for the three compounds (figure 4a c), and the corresponding one - photon action spectra were calculated (figure 4d). Introduction of the 4-amino substituent in the azo core allows the one - photon action spectra of mag2p and maga2p to red - shift 60 nm with respect to that of mag, as recently reported for a similar compound (figure 4d and table s1 in the supporting information). An additional peak is observed for maga2p at = 360 nm, which lies very close to the absorbance band of the naphthalene moiety (see figure 2a). Thus, sensitization of the azobenzene photoisomerization by the antenna also occurs when the photoswitch is conjugated to liglur . In addition, the time course of the mag2p and maga2p one - photon currents (blue and red traces in figure 5a) confirms that fast spontaneous cis trans back - isomerization and channel closure takes place after the illumination is switched off, while it requires irradiation with green light for mag (black trace in figure 5a). By fitting the one - photon current decays in the dark with monoexponential functions, the lifetimes of cis - mag2p and cis - maga2p tethered to liglur were determined to be 150 and 265 ms, respectively (table s1 in the supporting information). These values are larger than those measured in solution (see above), which suggests that the ligand - binding site interaction slows down the thermal cis this effect is enhanced for maga2p probably due to additional hydrophobic interactions and/or steric hindrance effects arising from the tethered naphthalene antenna . Whole - cell voltage - clamp current recordings in hek293 cells expressing gluk2-l439c after conjugation to (a) mag, (b) mag2p, and (c) maga2p . Current responses to one - photon light pulses of wavelengths ranging from 325 to 575 nm were quantified . (note that in (a) resting = 500 nm induces liglur deactivation, and in (b) and (c) resting = 690 nm is not absorbed and allows thermal relaxation of these photoswitches .) (d) normalized one - photon action spectra corresponding to mag (black), mag2p (blue), and maga2p (red) (n = 2 cells, n = 38 cells, and n = 410 cells, respectively). Before averaging over different cells, wavelength - dependent current amplitudes were normalized to the maximum photocurrent along the spectral range measured for each cell . Errors are sem . (a) one- and (b) two - photon whole - cell voltage - clamp recordings on hek293 cells expressing liglur conjugated with mag (black), mag2p (blue), and maga2p (red). Bars indicate stimulation pulses applied to open (one - photon pulses in violet and blue, two - photon pulses in gray) and close liglur (one - photon pulses in green). Two - photon excitation conditions: mag (= 820 nm, 10 scans of 0.4 s, 38 mw on sample), mag2p (= 900 nm, 0.4 s scan, 30 mw on sample), and maga2p (= 880 nm, 0.4 s scan, 42 mw on sample). Using a custom - built multiphoton setup where a tightly focused fs laser is raster scanned over the cells of interest, all three ptls display robust and liglur - specific photocurrents in living cells that first demonstrate two - photon stimulation with nir light of a synthetic photoswitchable protein (figure 5b and figures s9 and s10 in the supporting information). The amplitude of the responses follows the characteristic power dependence of two - photon absorption processes (figure s11 in the supporting information) and corresponds to 1020% of the photocurrent under one - photon excitation (table s2 in the supporting information). In order to optimize the multiphoton stimulation conditions we characterized the two - photon action spectrum of each ptl (figure 6a). The wavelength that yields maximal two - photon responses of mag is around 820 nm . Repeated cell raster scans are required to get a saturating photocurrent from all available receptors (black trace in figure 5b). Then, the current remains stable without laser illumination until liglur is closed with 500 nm light via one - photon cis the mag2p two - photon action spectrum is red - shifted and yields maximum current amplitude around 900 nm . The reduced currents obtained from maga2p hindered the acquisition of a detailed action spectrum, but are sufficient to identify two spectral ranges allowing two - photon activation of liglur: the first can be found at 880 nm (corresponding to the direct absorbance of azobenzene, as in mag2p), and the second is located around 740 nm and is consistent with the naphthalene - sensitized photoisomerization . (a) two - photon action spectra of liglur - mag (black) and liglur - mag2p (blue) and two - photon activation of liglur - maga2p (red) at selected wavelengths . Photocurrent amplitudes were corrected for the different power densities used (pd), averaged over all cells measured, and normalized to the spectral maximum . (b) absolute two - photon (2p) responses at the optimal wavelength . For maga2p values are given for sensitized (= 740 nm) and direct (= 880 nm) azobenzene excitation . (c) ratio between the two- and one - photon responses (2p/1p). To compare between different liglur - tethers, two - photon responses were corrected for the distinct power densities and excitation times used and averaged over all cells measured . In all spectra here, remarkably, multiphoton currents mediated by mag2p and maga2p completely saturate after a few laser scans of the recorded cell (blue and red traces in figure 5b). In addition, their rapid relaxation allows liglur to close immediately after the end of each stimulus, with time constants similar to those obtained with one - photon illumination (table s2 in the supporting information), which enable fast, repeated activation of the receptor without requiring a second irradiation source for deactivation . Thus, the novel compounds mag2p and maga2p enable single - wavelength, multiphoton gating of liglur . However, mag achieves higher two - photon current amplitudes than mag2p and maga2p in the long term (figure 6b), because the thermal stability of its cis isomer allows building up a larger population of open - state channels upon repeated cell raster scans (figure s12 in the supporting information). To compare the efficacy of liglur activation between ptls, we calculated the ratio between two - photon and one - photon maximal responses (figure 6c). Noticeably, mag2p and maga2p (both via direct and sensitized azobenzene excitation) display a higher ratio than mag, thereby demonstrating that the efficiency of multiphoton isomerization was enhanced by the design of the new photoswitches . After characterizing the two - photon stimulation of liglur, we pursued physiological applications that exploited the ability of this receptor to rapidly activate neurons and trigger calcium - regulated processes . The stimulation of individual neurons in micrometric volumes and millisecond time scales has been demonstrated using two - photon neurotransmitter uncaging and optogenetics . To complement this set of tools for investigating brain connectivity, we applied two - photon activation of liglur in neuronal and non - neuronal cells of the brain using the high photocurrents provided by mag and mag2p . We expressed gluk2-l439c - egfp in cultured hippocampal neurons, incubated them in mag2p and recorded neuronal activity using whole - cell patch clamp (figures 7). Excitation of the soma with 900 nm light elicits inward currents in voltage - clamp experiments (figure 7c). In current - clamp mode, these photocurrents triggered action potentials in two out of three tested neurons (figure 7d). Although several properties of liglur - mag2p must be improved in order to reliably photocontrol whole neurons and individual presynaptic terminals (lifetime of the cis isomer, receptor expression level, and subcellular localization), these results indicate that it is possible to activate neurons using two - photon stimulation of synthetic photoswitchable proteins . (a) two - photon image (= 1000 nm) of a cultured liglur - mag2p hippocampal neuron filled with alexa fluor 594 . (b) voltage - clamp recording during one - photon stimulation (blue bar). (c, d) two - photon raster scan (gray bars) of the same neuron during (c) voltage - clamp recording, which shows two - photon current with a transient current spike (two - photon mean current amplitude: 21 3 pa, 19 2% of one - photon current, n = 3), and (d) current - clamp recording (resting potential = 45 mv). Two - photon excitation conditions: = 900 nm, 0.25 s scan, and 24 mw on sample . In the same experimental conditions, no spikes were elicited by two - photon stimulation of liglur - mag, probably due to the slow photoresponses shown in figure 5b . However, the large, step - function photocurrents provided by mag and the calcium permeability of gluk2 make liglur - mag more attractive to trigger calcium - regulated processes including astrocyte activation (see also figure s7 in the supporting information). In cultured astrocytes expressing liglur - mag (figures 8), two - photon excitation at 820 nm triggered bistable currents (figure 8c). Interestingly, whole - cell photocurrents can also be measured during the stimulation of a subcellular region (figure 8d) or a spot (figures 8e g), and these responses are reversible by illuminating the cell at 500 nm (figures 8c, d, h). In order to verify whether such stimuli were enough to activate an intracellular calcium response in the astrocyte, we performed two - photon calcium imaging together with two - photon stimulation of astrocytes expressing liglur - mag . When we stimulated an expressing astrocyte, liglur activation caused a calcium increase that propagated to neighboring cells, generating a calcium wave that expanded to astrocytes throughout the field of view (figure 8i k and movie s1 in the supporting information). This effect, which is not observed when locally stimulating non - expressing astrocytes (figure s13 and movie s2 in the supporting information), demonstrates that two - photon liglur activation can be used to manipulate cytosolic calcium levels in cultured astrocytes . (a) two - photon image (= 1000 nm) of a cultured liglur - mag astrocyte filled with alexa fluor 594 . Red and blue squares define the whole cell and subcellular raster scan areas, respectively . (b) whole - cell voltage - clamp recording of the astrocyte during one - photon stimulation (liglur opening, purple bar; liglur closing, green bar). (c h) two - photon currents measured on the same astrocyte (liglur opening, gray bar; one - photon liglur closing, green bar): (c) cell scan stimulation at = 820 nm, 10 scans of 0.7 s and 37 mw on sample (mean current amplitude: 60 20 pa, 30 10% of one - photon current, n = 2); (d) subcellular scan stimulation at = 820 nm, 10 scans of 0.25 s and of 68 mw on sample (mean current amplitude: 17 9 pa, n = 2); (e g) single - point stimulation (gray bar) at = 820 nm, 50 ms and 68 mw on sample (points 1 and 2 are on the cytoplasm, and point 3 is out of the cell as control); (h) liglur closing at the end of the stimulation protocol (green bar). (i k) two - photon calcium imaging of cultured astrocytes loaded with fura-2 (in purple, = 800 nm) overlapped with an image of gfp fluorescence (in green, = 900 nm) to identify astrocytes expressing liglur - mag . (j) images at 1.55, 4.65, and 7.75 s after targeting the astrocyte to which the arrow points in (i) with two - photon stimulation (20 targets, 16-pixel diameter, 10 ms per point at = 800 nm, 60 mw on sample). We have demonstrated the two - photon activation of azobenzene - based photoswitches in living cells expressing the light - gated receptor liglur . Although a symmetrically substituted azobenzene was reported to photoisomerize under continuous - wave nir excitation, in general these chromophores present low two - photon absorption cross sections . However, synthetic ptls like mag offer great flexibility to adjust their photochemical properties without altering protein function . We have rationally designed mag derivatives with visible absorption, fast thermal relaxation, and high two - photon isomerization efficacy based on push pull substitutions and sensitization of the azobenzene photoisomerization . These modifications and the reported multiphoton excitation conditions should be directly applicable to all azobenzene - based bioactive ligands, including intracellular photoswitches known to penetrate into cells directly or through specific ion channels, and hyperpolarizing step - function photoswitchable channels like spark or ligaba . Our findings thus enable the use of synthetic photoswitches to manipulate extra- and intracellular biochemical processes with the spatiotemporal precision provided by two - photon stimulation . A detailed description of the synthesis of target photoswitchable tethered ligands is given in the supporting information . Cis isomerization of mag2p and maga2p in solution was investigated by (i) h nmr for the elucidation of the photostationary - state mixtures; (ii) steady - state uv vis absorption spectroscopy for trans trans thermal back - isomerization processes; and (iii) transient absorption spectroscopy for fast cis tsa201 cell line, cultured hippocampal neurons, and astrocytes plated on glass coverslips were transfected with gluk2-l439c - egfp . Prior to each experiment, they were incubated with one of the ptls to allow the chemical conjugation with the receptor channel and light sensitization . A second incubation with concavalin a was done in order to inhibit desensitization of the glutamate receptor . For two - photon stimulation, voltage - clamp and current - clamp recordings under whole - cell configuration were done with an axon multiclamp 700b amplifier (molecular devices), and data were acquired at 10 khz . Borosilicate glass pipettes were pulled with a typical resistance of 46 m for hek293 tsa201 cells and neurons or 78 m for astrocytes . Bath solution was composed of 140 mm nacl, 1 mm mgcl, 2.5 mm kcl, 10 mm hepes, 2.5 mm cacl2, and 1020 mm glucose to fix osmolarity to 310 mosmkg, ph 7.42 adjusted with naoh . For hek293 tsa201 cell line, pipet solution contained 120 mm cesium methanosulfonate, 10 mm tea - cl, 5 mm mgcl2, 3 mm na2atp, 1 mm na2gtp, 20 mm hepes, and 0.5 mm egta, 290 mosmkg, ph 7.2 adjusted with csoh . For neurons and astrocytes it consisted of 130 mm potassium gluconate, 5 mm nacl, 10 mm hepes, 0.1 mm egta, 2 mm mgso4, 4 mm mg - atp, 0.4 mm naxgtp, 7 mm na2-phosphocreatine, 2 mm pyruvic acid, and 0.1 mm alexa fluor 594 (molecular probes), ph 7.3 adjusted with koh . All two - photon experiments were performed in the yuste laboratory with a custom - made two - photon laser scanning microscope based on a modified olympus bx50wi microscope with a ti: sapphire laser as light source (coherent chameleon ultra ii, 140 fs pulses, 80-mhz repetition rate). Laser power was modulated by a pockels cell (conoptics) and adjusted for each wavelength to be close to 40 mw on sample for mag2p and maga2p and 50 mw on sample for mag, if not specified otherwise . In experiments with mag, we used a 20x/0.5-na objective (olympus), and with the red - shifted compounds, we used a 20x/0.95-na objective (olympus) in figures 5 and 6 and a 40x/0.8-na objective (olympus) in figures 7 and 8 . For two - photon stimulation we defined a roi and applied a unidirectional raster scan using fluoview software, or we performed point stimulations with custom - written labview software . First, 50 l of dmso was added to a 50 g aliquot of fura-2-am (life technologies). Next, 0.2 l of this solution and 0.2 l of pluronic acid (20% in dmso) in 2 ml supplemental media were added to the culture dish and incubated at 37 c for 30 min, before washing and liglur conjugation with mag and concanavalin a treatment . We raster - scanned fura-2 (100 frames, 1.55 s / frame) at 800 nm and 40 mw on sample with a 20x/0.5-na objective for recording the activity of astrocytes and stimulated single nonexpressing or gfp - positive astrocytes using custom written software, with a protocol of 20 stimulation targets on the cell with a16-pixel diameter, corresponding to approximately 11 m diameter . Amplitudes of liglur currents were analyzed using igorpro (wavemetrics), and closing time constants of liglur were determined with a custom - made software using labview . In the two - photon action spectrum of each compound, every set of data from one cell was normalized to the action spectrum integral from a chosen representative before cell average . Calcium imaging of astrocytes was analyzed using custom written software (caltracer) and imagej.
|
Cyclophosphamide is nitrogen mustard - derived alkylating agent used as a cytostatic drug in the treatment of lymphomas, some forms of leukemia, and some solid tumors . Symptoms of neurotoxicity are common in myeloablative regimens of the therapy with nitrogen mustard - derived alkylating agents used as cytostatic drugs [14]. Some others of side effects are hepatotoxicity [5, 6] and enterotoxicity [3, 7]. The impairment of hepatic and (or) colonic barrier functions may enhance the flux of gastrointestinal ammonia into the bloodstream, thus contributing to neurotoxic effects of cytostatic drugs and restricting their endurable dose levels . Hyperammonaemia is a regular finding in shock [8, 9], and the latter is one of high - dose nitrogen mustards acute effects . To elucidate the role of the digestive tract luminal ammonia in the toxic action of nitrogen mustard - derived alkylating agent cyclophosphamide, the single high - dose administration of cyclophosphamide at the background of a gavage with ammonium acetate (aa) mature breedless male albino rats (44.5 months old, 200240 g) from the rappolovo breeding center of the russian academy of medical sciences were used in experiments in accordance with the regulations of performing scientific investigations on toxic action of pharmaceuticals with the use of experimental animals (by the public health ministry of the russian federation, 1997). Within the day before the experiment rats were not fed and had the unlimited access to water . The officinal cyclophosphamide (cyclophosphanum, 200 mg per flack, ag biochimik, russia), has been dissolved in distilled water ex tempore and administered to rats i / p (1 ml per 100 g of body weight) in lethal doses 200, 600, 1000, or 1400 mg / kg . Using animals of the same series, it has been revealed by the authors that these doses were relevant to the mean duration of life 240, 51, 13, and 2 h, respectively . Aa was administered by a single gavage (1 ml per 100 g of body weight) in nonlethal dose 12 mmol / kg (0.35 ld50). The same dose of sodium acetate (sa) the glutamine concentration was calculated by the increase of ammonia content resulted from the acidic hydrolysis . Urea was determined by diacetyl monoxime method using the reagent kit purchased from olvex diagnosticum gmbh, russia . All determinations were performed within 1 day; the number of each experimental group was 6, except for the assessment of the mean survival time (11 animals per group per dose of cyclophosphamide). The effect of cyclophosphamide on the metabolism of ammonia was estimated at the background of the increased gastrointestinal luminal ammonia pool . Ammonia, glutamine, and urea were assayed in blood obtained from the trunk by decapitation at 0.5, 1.5, or 3 h after the administration of aa and (or) cyclophosphamide (600 mg / kg). Aa was administered immediately before the exposure to cyclophosphamide . In set 2, the clinical meaning of alterations of the kinetics of gastrointestinal ammonia was elucidated by assessing the impact of gavages with aa upon clinical manifestations of toxic effects and the duration of life observed in rats after the subsequent treatment with cyclophosphamide (200, 600, 1000, or 1400 mg / kg). Differences between group mean values of metabolic indices were estimated by the two - way anova (cyclophosphamide aa) and the fisher lsd test, that of mean survival time by the mann - whitney u test . The data was analyzed using originpro 8.5 software (origin lab corporation, northampton, mass, usa) and presented as mean se . At p in rats, subjected to the sole gavages with ammonium or sodium salts of acetic acid (12 mmol / kg), no visible toxic effects have been noticed within subsequent 48 h. the administration of cyclophosphamide in dose 200 mg / kg had no marked effect upon animals' behavior within 18 h; 600 mg / kg resulted in the development of slowly progressing somnolence and stupor . The administration of cyclophosphamide in dose 1000 or 1400 mg / kg resulted in tremor, the loss of righting, and audiomotor reflexes within 3 h; within 16 h the soporose state was incidentally superposed by tonic seizures . No noticeable symptoms of intoxication were observed within 0.5 h after the administration of cyclophosphamide in any dose but 1400 mg / kg . The increase of blood ammonia, glutamine, and urea was observed within 3 h after the administration of cyclophosphamide and (or) aa . At the background of their combined dosing, the blood ammonia level increased 2.3 times at 1.5 h, while at the background of the separate application of cyclophosphamide this could be observed 1.5 h later . At 1.5 h after the combined toxicants' administration, the ammonia blood level has been 1.6 times higher, compared with the separate application of cyclophosphamide . When combined, aa and cyclophosphamide increased blood levels of ammonia, glutamine (at 1.5 h), and urea (at 3.0 h) more markedly than that when separately applied (figure 1). The pretreatment with nonlethal dose of aa enhanced the lethal action of cyclophosphamide: the mean survival time of rats, which obtained cyclophosphamide in doses 200, 600, 1000, or 1400 mg / kg, decreased 1.5, 2.1, 2.8, or 6.1 times, respectively (figure 2). Animals, subjected to the combined dosing, manifested symptoms which were characteristic of the effect of lethal doses of ammonia salts, such as exophthalmos, transient excitation, trembling, replaced by opistotonus and apnea, despite the fact that no marked symptoms of intoxication were observed in intact rats which obtained the same dose of aa . The digestive tract is a primary ammonia pool in the human body . Though depending on the constitution of the indigenous gut microflora, the luminal ammonia production varies largely among individuals [13, 14]. On an average, 4 g of ammonia comes from the gut into a portal blood and eventually are absorbed by the liver during a 24-h period . Normally, luminal ammonia is absorbed readily by gastric, iliac, and colonic mucosa . The hepatic vein blood ammonia level depends linearly on a portal ammonia level, and the latter on a luminal ammonia concentration . The caval blood ammonia level may have the similar dependence because of the substantial rate of the transperitoneal ammonia translocation . Hence, the flux of gastrointestinal ammonia into the common bloodstream and then into the brain may vary depending on the digestive tract luminal ammonia pool . This must be of a special importance at the background of the impairment of the intestinal mucosa barrier function, which is characteristic of the systemic action of both nitrogen and sulfur mustards [3, 7, 21]. Our study showed that the pronounced hyperammonaemic effect could be seen at 3.0 h after the administration of cyclophosphamide . When the latter was combined with aa, the ammonia level exceeded that in case of the separate application of cyclophosphamide (figure 1). In intact rat, the luminal ammonia pool of the digestive tract amounts to 1.1 mmol / kg (calculated by the data of). This indicates the positive correlation between the hyperammonaemic action of cyclophosphamide and the luminal ammonia pool of the digestive tract . In rats, the inhalation of methyl - bis (-chloroethyl) amine has been reported to inhibit the liver urea synthesis . Hypothetically, the similar effect could contribute to hyperammonaemia observed in this work, though cyclophosphamide increased not only the blood level of ammonia but that of glutamine and urea as well (figure 1). So, the present data provide no evidence of the failure of glutamine and/or urea synthesis as a major contributive cause of observed hyperammonaemia . Therefore, the latter may be attributed, mainly, to the impairment of the gastrointestinal barrier function . The enhancement by gavages with aa of the hyperammonaemic action of cyclophosphamide promoted its lethal action; the degree of the promotion correlated positively with the dose of cyclophosphamide (figure 2). The involvement of ammonia in the lethal effect was clearly indicated by the accentuation of symptoms which were the characteristic effect of lethal doses of ammonia salts . The maximal decrease of the mean survival time has been demonstrated at the background of cyclophosphamide - induced severe neurological disorders . Accordingly, the maximal detrimental effect of the redistribution of gastrointestinal luminal ammonia should be expected in heavy exposure to mustard gas, bringing to the development of acute neurological disorders . Such cases have been observed in iran - iraqi war as well as in bari harbor accident on december 2nd, 1943, where first deaths occurred 18 h after the exposure . Ammonia gas is very aggressive and cytotoxic until it is converted into ammonium ions, which cells can tolerate at millimolar levels . The ensuing restriction of the cellular energy supply may be potentiated by the draining of the cellular nad pool by the alkylating agent - mediated activation of poly - adp - ribosylation in various cells . Hence, the digestive tract luminal ammonia pool might be involved in the development of not only acute neurological disorders but also some other systemic effects . This may explain the shortening by gavages with aa of the mean survival time in rats treated with cyclophosphamide in dose which was not apparently neurotoxic (200 mg / kg). Therefore, in rat, the size of the luminal ammonia pool of the digestive tract constitutes one of leading factors contributing to the severe toxicity of cyclophosphamide . In rats, the increase of the digestive tract luminal ammonia pool by the mean of an oral gavage with nonlethal dose of ammonium acetate enhanced the hyperammonaemic action of cyclophosphamide while promoting its lethal action . Animals, exposed to the combination of toxicants, manifested symptoms which were characteristic of the effect of lethal doses of ammonia salts . These data provide the evidence of the detrimental role of gastrointestinal luminal ammonia in the acute high - dose cyclophosphamide toxicity . So, before addressing the challenge of cyclophosphamide myeloablative therapeutic regimens, it is important to consider the possibility of the promotion of the toxic action of cyclophosphamide by digestive tract luminal ammonia.
|
Acute obstructive suppurative pancreatic ductitis (aospd) is a rare complication of chronic pancreatitis that has been described in only seven previous case reports since 1995 . Aospd is defined as suppuration from the pancreatic duct; however, in contrast to the pancreatic infections that typically complicate chronic pancreatitis, it is not associated with pancreatic pseudocyst, abscess or necrosis . A 33-year - old female presented in july 2015, with complaints of pain in epigastric region and multiple episodes of vomiting . Pain was dull aching and radiating to back associated with multiple episodes of bilious vomiting . On per abdomen examination, there was tenderness in epigastrium and right hypochondrium . Laboratory investigations revealed an elevated total leukocytes count (10 000/cumm), with normal serum amylase (41.9 units / l) and serum lipase (29.4 units / l)., multiple radio - opaque shadows were seen corresponding with distal part of pancreas (fig . Ultrasonography was suggestive of hyper - echoic and atrophic pancreas with main pancreatic duct dilated upto 1 cm and 6 mm calculus in the main pancreatic duct at the level of pancreatic head . On computed tomography (ct), multiple, conglomerated calcifications were noted in the head and tail of pancreas and just proximal to ampulla of vater resulting in dilatation of the common bile duct, common hepatic duct and main pancreatic duct (fig . 2). Figure 1:radiograph showing multiple radio - opaque shadows corresponding to the distal part of pancreas . Intra - operative photograph showing frank pus on opening of pancreatic duct . On august 2015, patient underwent endoscopic retrograde cholangio - pancreatography (ercp)-guided stone removal with common bile duct (cbd) stent placement at other center . Two months later, patient came back with fever and pain in epigastric region with multiple episodes of bilious vomiting . On examination, there was tenderness all over the abdomen . Patient was taken for exploratory laparotomy . On exploration of pancreas main pancreatic duct aspiration revealed frank pus (fig . The presence of a stone was noted at the tail of pancreas, which was crushed and extracted . Longitudinal pancreaticojejunostomy with roux - en - y jejunojejunostomy was done . On microbiological examination of pus she was started on pancreatic lipase 25 000 iu twice daily for additional 3 months . Chronic pancreatitis is an inflammatory and fibrosing disease of the exocrine pancreas characterized by irreversible morphological changes and permanent loss of function . According to the marseille rome classification of 1988, chronic pancreatitis is used to refer to recurrent or persistent abdominal pain that is associated with irreversible and ongoing inflammatory destruction of exocrine parenchyma and, eventually, islets . A new clinical entity termed as aospd was described by weinman et al ., defining it as a rare complication of chronic pancreatitis with suppuration of the pancreatic duct not associated with pancreatic pseudocyst, abscess or necrosis . Aospd has been described in only seven previous case reports since 1995 . While the pathogenesis of aospd is not completely understood, chronic pancreatitis, prior sphincterotomy, pancreatic stasis secondary to pancreatic duct obstruction and diabetes mellitus patients undergoing biliary sphincterotomy have a common or shared biliary and pancreatic sphincter; duodenal contents might also reflux into the pancreatic duct, in effect seeding the pancreatic duct . If pancreatic duct stones were obstructing the outflow of the duct, a ductal infection could result . This would be analogous to calculus obstruction of the biliary tree resulting in acute bacterial cholangitis . The normal pancreas is usually resistant to infection, presumably because of the presence of bacteriostatic and bacteriocidal agents elaborated in pancreatic secretions . A chronically diseased pancreas may be much more susceptible to infection because these same antibacterial agents may be significantly impaired or diminished . A pancreatic duct contaminated by duodenal reflux and obstructed by intraductal stones, in the setting of chronic pancreatitis, would seem a sufficient setting for the development of acute suppuration of the pancreatic duct . Diabetes mellitus, while not present in our patient, predisposes patients to a variety of uncommon infections and may play an additive role in infection with klebsiella . This bacterium is usually contracted by oral route and one can only speculate that during previous instrumentation of the ampulla of vater, duodenal contents contaminated with this unusual organism may have refluxed into the pancreatic duct resulting effectively in seeding of the pancreatic juice . However, the presence of bacteria in the pancreatic duct is not by itself sufficient to cause suppuration . Fujimori et al . Reported a case of aospd in the setting of peripheral blood stem cell transplantation for acute myeloid leukemia and subsequent chronic leucopoenia . Tajima et al . Described aospd in the setting of pancreatic cancer; as it can predispose to infection from biliary or pancreatic obstruction . In all the reported cases the diagnosis of aospd was made on identification of pus in the pancreatic duct on ercp . In our case, the diagnosis was made on exploring the main pancreatic duct before performing a pancreaticojejunostomy . In all previous cases, patients complaints resolved post - ercp stent . Here, the definite treatment was a longitudinal pancreaticojejunostomy with roux - en - y jejunojejunostomy (modified puestow procedure). Surgery results in opening of the pancreatic capsule, which alleviates interstitial pressure, whereas longitudinal anastomosis ensures full drainage of the whole pancreatic duct length . As aospd is a rare complication of chronic pancreatitis it should be kept in mind while coming across cases with dilated main pancreatic duct and chronic pancreatitis . Once diagnosed, aospd should be treated with prompt intravenous antibiotic treatment with pancreatic duct decompression, which can be achieved either through ercp stenting or surgical decompression specifically longitudinal pancreaticojejunostomy with roux - en - y anastomosis . Surgical management should be preferred as ercp stenting can further lead to biliary reflux into the pancreatic duct after ercp sphincterotomy, which lead to further infection of the pancreatic duct . However, as only seven cases have been reported since 1995, there appears to be some other factors contributing to its pathogenesis . Thus, further study into this rare entity shall help provide more information in the near future.
|
The definition of a gerbode defect, according to the society of thoracic surgeons congenital heart nomenclature and database project is true left ventricular (lv) to right atrial (ra) communication . However, no sources provide a definition encompassing congenital right ventricular (rv) to left atrial (la) communication . Zacharkiw and stimpson recently described this pathology as a mirror - image gerbode defect in a patient following atrioventricular (av) septal defect repair . In the present study, the case of a congenital la - rv shunt in an adult is presented and the classification of such defects is discussed . A 74-year - old woman was referred to our center with a worsening history of orthopnea, paroxysmal nocturnal dyspnea, and peripheral edema . Transthoracic echocardiography revealed lv hypertrophy, a dilated left atrium, severe mitral valve insufficiency, and pulmonary hypertension (60 mmhg). A careful review of the preoperative transesophageal echocardiography (tee) revealed a clear jet across a small defect between the rv and la (figs . 1, 2). The pericardium was entered through a midsternal incision and a patch was fixed using glutaraldehyde . Following the establishment of cardiopulmonary bypass (cpb), a vertical cleft separating the anterior leaflet into two hemileaflets was observed on the mitral valve (fig . Aspirator - guided inspection showed that the defect was located between the la and the rv (fig . The cleft was closed without tension after resection of the abnormal chordae attached to its edges . Direct suture was not technically possible due to the fibrous reaction of the edges of the cleft with an area lacking valvular tissue . Instead, the edges of the cleft were resected and the anterior leaflet of the mitral valve was reconstructed using an autologous pericardial patch . However, the saline test revealed regurgitation at both commisures . The patch was then replaced with a 27-mm porcine bioprosthetic valve (biocor; st . Paul, mn, usa) which was implanted in a supra - annular fashion with the use of interrupted, pledgeted, 20 everting mattress sutures . Rewarming was initiated, the atriotomy was closed, the heart was de - aired, and the cross - clamp was removed . The av junctions are the area of the heart where the atrial myocardium is inserted into the base of the ventricular mass . Partial av septal defects are malformations with two av valve orifices and no interventricular communication, whereas complete av septal defects have a common av valve orifice and extensive interventricular communication . Lv to ra atrial communications, known as gerbode defects and lv - ra shunts, are encountered from time to time and are caused by surgical mishaps, trauma, and endocarditis . However, we could find only three cases of mirror - image gerbode defects (la - rv shunts) that have been reported to date in the literature [2,46]. Of those cases, only one was congenital, while in the other cases, the defect emerged after the repair of an av septum . The previously reported congenital case was a 39-year - old woman with a common av junction and partially separated right and left av orifices, and the shunt was exclusively from the la to the rv due to overriding of the left av valve . However, in our case, each atrium was connected to its own ventricle through separate leaflets . Additionally, a cleft in the anterior mitral leaflet existed, which may have been linked developmentally, on the basis of different degrees of failure of fusion of the av endocardial cushions . A literature review demonstrated that it is virtually impossible to categorize the spectrum of av septal defects into satisfactory and noncontroversial subgroups with regard to patients such as ours . We believe that diagnosis and surgical treatment strategy will become easier if case - specific morphologic and functional variables are analyzed.
|
Water intoxication is a fatal disorder with brain function impairment, defined as hypo - osmolar syndrome resulting from an excess intake of water, with dilutional hyponatremia formed principally by (1) the retention of water exceeding renal free water excretion, or (2) impaired free water excretion from the kidneys . The former situation is occasionally observed in psychiatric patients with polydipsia, or it may develop as a result of iatrogenic water overloading . The latter situation results from an inappropriate secretion of antidiuretic hormone (adh) to the plasma osmolality . In hypo - osmolar syndrome, the translocation of a massive amount of extracellular water into the cells generates an increase in the cellular volume, leading to the development of brain edema, demonstrating a variety of neurological signs from appetite loss or emesis to convulsion or consciousness disturbance, depending on the severity and rapidity . Here, we report a case of water intoxication caused by excessive water drinking in a detention facility . In this case, the secondary development of syndrome of inappropriate secretion of adh (siadh) contributed to the patient's prolonged hyponatremia after discontinuation of the excessive water intake . A 22-year - old man who was an inmate in a detention facility joined a game of rock / paper / scissors with his roommates at 8:00 p.m. they made a rule that the loser of each game must drink a cup of water as a penalty by using a plastic cup with a capacity of 300 ml . That night, he lost the game again and again, and had to drink 2022 cups of water during 2528 games in total for the 3-hour game, indicating that he must have drunk at least 6 liters of water in 3 h. at 11:30 p.m., 3.5 h after beginning the penalty drinking, he showed restlessness and peculiar behavior, including speaking meaningless words . Because he also started vomiting and having convulsions soon thereafter, he was seen by a doctor in a clinic at the facility at midnight, and he was administered 100 mg phenobarbital intramuscularly . However, his condition was not improved by the treatment, and it progressively worsened, showing more serious signs such as incontinence of urine and feces, tonic convulsions, and consciousness disturbance . He was finally transferred to our hospital at 2:00 p.m., 18 h after the beginning of the penalty drinking . Clinical episodes which can cause siadh, such as epilepsy, brain surgery history, head injury or a history of meningoencephalitis, were not seen in his past history . When he was hospitalized, he was in a coma (japan coma scale; iii-100). His height, body weight, blood pressure, pulse rate and body temperature were 167 cm, 49 kg, 140/90 mm hg, 60 beats / min and 36.8c, respectively . The results of the laboratory tests on admission are summarized in table 1, and significant hyponatremia (120 mmol / l) was assumed to be the principle cause of the coma and/or other neurological abnormalities . A brain magnetic resonance imaging (mri) study showed high - intensity signals in the perilateral ventricular region and brain white matter consistent with the development of brain edema, as shown in fig . 1 . A chest x - ray showed no abnormalities, including alveolar shadow, pleural effusion, cardiomegaly and congestion (x - ray not shown). Although excess water drinking in the detention facility would have triggered the dilution of the patient's body fluid, it was not concluded that the temporal massive water drinking caused the prolonged dilution of body fluid until 15 h after the discontinuation of the water drinking . Indeed, his laboratory tests showed hypertonic urine (305 mosm / kg h2o), indicating the disturbance of free water excretion in response to the remarkable hyponatremia . This finding, taken together with the patient's decreased free water clearance, inhibition of the renin - aldosterone system and hypouricemia with elevated uric acid clearance led us to make a tentative diagnosis as secondary siadh, and the diagnosis was confirmed later by the detection of an inappropriate elevation of the plasma adh concentration . The patient's clinical course and the changes in the laboratory findings are summarized in fig . In addition, 6.6 mg dexamethasone was also administered for the reduction of the patient's brain edema . Because he showed systemic convulsions again on the 2nd day, an electroencephalogram was performed and showed a spike and wave pattern, suggesting the diagnosis of epilepsy . His consciousness disturbance had almost disappeared, with an elevation of the serum sodium concentration (138 mmol / l). On admission, he showed elevated serum creatine phosphokinase (2,386 iu / l) and urine myoglobin (372.1 ng / ml) as well as muscle pain, which were consistent with rhabdomyolysis resulting from the recurrent convulsions and hyponatremia . Following the improvement of the hyponatremia after confirmation of the disappearance of the brain high - intensity signals by mri and the normalization of the disturbed free water clearance on the 5th day, the patient was discharged and he returned to the detention facility with no significant clinical signs on the 6th day . Many patients with psychotic illness have shown excessive drinking behavior, and 610% of hospitalized psychotic patients show polydipsia, which occasionally causes water retention and resultant hyponatremia [1, 2]. The majority of these patients are administered anticholinergic agents or carbamazepine, which are known to cause drug - induced siadh . Some of the patients are known to show an abnormal threshold of thirst, leading to the loss of suppression of their drinking desire even if their body fluid osmolality is sufficiently low [3, 4]. However, our patient had no history of psychotic abnormalities or of taking psychosomatic medications or any medications known to cause drug - induced siadh, suggesting that the water intoxication in this case was triggered purely by the excessive water intake . Urine osmolality can reach 40100 mosm / kg h2o in the maximum water - diuretic condition, and the maximum excretion of free water by an adult human is approximately 18 liters / day . Hence, a maximal water intake of 2.6 liters over a 3.5-hour span is theoretically considered to be excreted without changing the plasma osmolality . However, our patient reportedly drank 6 liters of water over a 3.5-hour period, which was a far greater volume than the safety range, indicating that at least 3.4 liters of water would have accumulated in his body even if the free water was excreted normally . Assuming that approximately 2.3 liters of water would move to the intracellular space, the remaining 1.1 liters of water in the extracellular space would be sufficient to lower the sodium concentration to 125 mmol / l, and the translocation of water into the intracellular space would be sufficient to cause cellular edema by an approximately 12% increment in intracellular volume . If our patient's free water had been excreted adequately, his plasma osmolality and sodium concentration would have been restored to the normal range within 69 h. however, his hyponatremia was prolonged until 15 h after the discontinuation of the drinking, suggesting that his hyponatremia was conserved by an additional disease causing impaired free water excretion, such as siadh . The patient's recurrent emesis might have been involved in the development of the secondary siadh, although emetic stress is generally believed to have a limited effect on adh secretion . The elevation of intracranial pressure is reported to be a sufficient stimulus to cause secondary siadh in patients with meningoencephalitis or hydrocephalus . Therefore, an elevation of intracranial pressure by the rapid development of brain edema might contribute to the development of secondary siadh . Although we did not observe apparent physical signs being consistent with the elevation of intracranial pressure, it was presumed that his convulsion in the early phase resulted from brain edema . Therefore, in addition to the brain mri findings, we suspected the possible involvement of brain edema as a partial cause of the secondary siadh . Additionally, elevated adh concentrations have been reported in epileptic patients showing frequent convulsions, and the expression of vasopressin mrna is up - regulated by convulsions in rats . Cases of water intoxication without psychotic illness have been reported, including a case of massive water intake in the context of serious diarrhea, excess water supplementation for thirst during military training, compulsory water drinking as a form of child abuse and massive water drinking during military urine drug screening . Some of these cases demonstrated prolonged hyponatremia even at 20 h or more after the discontinuation of water intake, but the involvement of secondary siadh was not discussed in the case reports . Hyponatremia resulting from water intoxication should be limited to the short term if the free water excretion is not disturbed . Therefore, the majority of the cases cited above may have been associated with secondary siadh, as in the present case.
|
Unexpandable lung is a mechanical complication resulting in the inability of the lung to expand to the chest wall . In clinical practice, an unexpandable lung may be due to either the presence of pleural disease, endobronchial obstruction resulting in lobar collapse, or chronic atelectasis . Unexpandable lung due to pleural disease is clinically obvious when a pneumothorax develops following thoracentesis or when chest pain develops during or following pleural fluid removal . However, with the application of pleural manometry, all cases of unexpandable lung can be accurately diagnosed . The term trapped lung has traditionally been used interchangeably to describe an unexpandable lung occurring from either active or remote pleural disease . Currently, we have adopted a more strict definition for a trapped lung . Trapped lung is the sequela of remote pleural space inflammation resulting in the development of a mature, fibrous membrane that impedes lung expansion during fluid removal (figure 1). In other words, trapped lung can be considered to be defective pleural healing once inflammation in the pleural space has resolved . In contrast, lung entrapment is considered a complication of active pleural inflammation, malignancy, or hemothorax . Identifying active pleural inflammation or clinical conditions associated with the development of lung entrapment include coronary artery bypass graft surgery, post cardiac injury syndrome, empyema / complicated parapneumonic effusions, uremia, radiation therapy, and rheumatoid pleurisy [1 - 3]. This is an air - contrast chest computed tomography scan showing abnormal visceral pleural thickening (arrows) in the setting of lung entrapment from a resolving hemothorax . In the setting of lung entrapment, chest radiography may reveal contra - lateral mediastinal shift . Pleural fluid analysis is typically exudative by both protein and lactate dehydrogenase (ldh) criteria; however, discordant protein and ldh exudates can occur as the inflammatory process is resolving . An increased total nucleated cell count with either a lymphocyte or neutrophil predominance is observed depending upon the etiology of the lung entrapment . Treatment of lung entrapment is dictated by the underlying process that resulted in the unexpandable lung . Rapid evacuation of a hemothorax or prompt antibiotic therapy for pneumonia with parapneumonic effusion usually prevents the development of trapped lung following these conditions . However, in the setting of malignancy, the presence of lung entrapment will significantly decrease the success of pleurodesis . Pleural manometry remains the method of choice for detecting unexpandable lung [3 - 9]. The measurement of pleural liquid pressure can be performed either by using a simple water column manometer or with elaborate electronic, physiologic systems connected to a standard hemodynamic transducer . A simple, over - damped water manometer can be easily employed by all physicians performing therapeutic thoracentesis . Measuring pleural liquid pressure may improve patient safety and reduce the development of re - expansion pulmonary edema (rpe). Rpe is a well - recognized complication of therapeutic thoracentesis and is characterized by the development of unilateral pulmonary edema in a lung re - inflated rapidly after a period of collapse from either a pleural effusion or pneumothorax . Historical recommendations to prevent rpe suggest that fluid removal should not exceed 1 - 1.5 liters at a single sitting . Current recommendations to terminate thoracentesis include the development of excessively negative pleural pressures or the development of chest pain [3 - 9]. In addition to providing improved patient safety, pleural manometry is useful for the diagnosis of an unexpandable lung at the bedside and for predicting pleurodesis success . Pressure measured with a catheter residing in a pleural effusion is representative of the actual pressure at that level of the effusion . The pressure measured is reflective of the recoil pressures of the lung and chest wall and the vertical extent of the pleural effusion . The measured pressure changes are reflective of the changes of the recoil forces, and pleural space elastance (pel) can be calculated (pel = change in pleural liquid pressure in cm h2o per liter of fluid removed). The pressure / volume curve of a patient with an expandable lung is monophasic with a normal elastance, defined as a pel 14.5 cm terminal negative pressure deflections are seen when minimal amounts of pleural fluid remain and are attributed to local deformation forces around the catheter . The pressure / volume curve of a patient with a trapped lung is monophasic with an elevated pel> 14.5 cm h2o / l . Finally, a biphasic pressure / volume curve demonstrates a normal pel prior to an inflection point and a high pel in the terminal portion of the pressure / volume curve . The presence of a biphasic pressure / volume curve is consistent with lung entrapment assuming that the clinical history and pleural fluid analysis supports a finding of malignancy, infection, or inflammation (figure 2). The curve denoted by the solid circles represents a monophasic pressure / volume curve with normal pleural elastance predicting normal lung expansion . The curve denoted by open circles is a biphasic pressure / volume curve from a patient with malignant lung entrapment . Note that the calculated pleural space elastance (pel) prior to the inflection point is normal, while the calculated pel after the inflection point is increased, predicting abnormal lung expansion . The curve denoted by the solid triangles represents a monophasic pressure / volume curve with increased pel . Unexpandable lung resulting from an endobronchial obstruction is managed by removing either the tumor or foreign body impeding normal lung expansion . In the setting of chronic atelectasis, the lung may re - expand over several days as long as the underlying lung parenchyma is devoid of significant fibrosis . Most patients with trapped lung are asymptomatic; however, it may be the cause of significant restriction and dyspnea . In this case, the only effective therapy would be surgical decortication only after other causes of dyspnea are excluded . In contrast, the focus of initial treatment for lung entrapment is dependent on the nature of the active process . For example, antibiotics and pleural drainage are required for treating a complicated parapneumonic effusion and pleural drainage is required for hemothorax evacuation . In contrast, lung entrapment in the setting of a malignant pleural effusion can only be successfully managed with a chronic, indwelling pleural catheter . Finally, we have obtained better insights into the mechanism by which a pneumothorax occurs following ultrasound - guided thoracentesis and why chest tubes can be safely removed despite the presence of an air leak or pneumothorax . The development of pneumothorax is commonly due to the drainage itself and is not related to direct puncture of the visceral pleural or to the introduction of air into the pleural space via the drainage system . The pathophysiology of drainage - related pneumothorax is the result of transient, pressure - dependent, parenchymal - pleural fistulas, which develop as a consequence of an existing unexpandable lung unable to conform to the shape of the chest wall with fluid removal . This pathophysiologic mechanism is further supported by the safety data reported by cerfolio and colleagues on removing chest tubes in post - lobectomy patients despite the presence of a persistent air leak or a pneumothorax.
|
The serum samples were collected as part of a household survey conducted during 20132014 in 2 eastern counties of kenya, garissa and tana river (technical appendix). Of those for whom information about sex and age was known, 603 were female and 407 were male, and median age was 27 (range 590) years . Occupational data were available for 650 (57.9%) participants; the 3 largest occupational groups represented were pastoralist (20.6%), farmer (17.0%), and student (11.4%). The households of nearly all participants kept or owned livestock, mainly goats, sheep, cattle, and donkeys . Although camel husbandry was not common among participants, camels are widespread in this region . The average camel density (calculated on the basis of census data from 20002013) was 1.68 and 1.98 camels / km in garissa and tana river county, respectively (7). We analyzed serum samples for antibodies against mers - cov by using a commercial anti mers - cov recombinant elisa (relisa; euroimmun ag, lbeck, germany), which is based on the recombinant mers - cov spike protein subunit 1 and specifically detects igg . Samples were tested at a dilution of 1:100; an optical density ratio of 0.3 was set as a cutoff (6,12). The assay conditions used were the same as those used during a nationwide serologic study in saudi arabia (6). A total of 16 (1.40%) samples had positive results by relisa (table, figure 1). The proportion of seropositive specimens in both counties in kenya did not differ significantly (fisher exact test, p = 0.07). Plot of all individual optical density (od) ratios obtained from recombinant elisa testing of human serum samples for middle east respiratory syndrome coronavirus (mers - cov) antibodies, africa, 20132014 . All 16 samples exceeding the cutoff of 0.3 and 22 other samples showing an od ratio below the cutoff were subsequently tested in a plaque - reduction virus neutralization (prnt) test; these samples are shown in blue, and the 2 samples positive by prnt are shown in red . The horizontal dashed line represents the cutoff value as determined in a nationwide, cross - sectional serologic study in saudi arabia (6). We subsequently tested all samples positive by relisa by using a highly specific mers - cov plaque - reduction neutralization test (prnt) as recommend by the world health organization (6,13). Of note, the mers - cov strain emc/2012 used for prnt may genotypically differ from putatively circulating mers - cov strains from africa . However, there is no serotypic discrimination between strains because the ability of human serum to neutralize diverse mers - cov strains, including the emc/2012 strain, does not differ (14). For the prnt, dilutions starting at 1:10 were used and titers resulting in 50% (prnt50) and 90% (prnt90) plaque reduction were recorded . The prnt50 end point was considered confirmation of positivity by relisa because this end point was found to be most sensitive and still specific during investigations of antibody responses in reverse transcription pcr confirmed mers - cov positive samples from patients in south korea (14). Of the 16 samples positive by relisa, 2 (0.18%) had reproducible mers - cov prnt50 titers of 1:20 and 1:40 (table; figure 2); 1 of these samples also had a titer of 1:40 when the more stringent prnt90 end - point criterion was used (figure 2). For controls, we conducted prnt testing of 22 samples negative by relisa from persons originating from the same region as the 2 samples positive by prnt . None of these 22 samples showed neutralizing activity at a 1:20 dilution (figure 1). Middle east respiratory syndrome coronavirus (mers - cov) plaque - reduction neutralization test (prnt) results for 2 serum samples positive by recombinant elisa, showing virus neutralization activity against mers - cov strain emc/2012 exceeding a titer of 1:10 . Titers and number of plaques (in parenthesis) are shown next to the corresponding images . 976 showed> 50% plaque reduction up to a titer of 1:20, and sample no . Note that the image cannot represent the morphology and the contrast of plaques that was visible with direct inspection of cell culture plates with an appropriate light source, as was done for these experiments . The 2 samples positive by prnt were from a woman (26 years of age) and a man (58 years of age) from tana river county . The woman kept goats, sheep, cattle, and donkeys; the man kept goats and donkeys . Both persons had low antibody titers, and neither reported any recent clinical symptoms, indicating that their mers - cov infections probably occurred well before the time of sampling and that the infections may have been mild or subclinical . Because data about persistence of mers - cov antibodies after asymptomatic infection are not available, it can only be speculated when and where these infections were acquired . Neither the 2 mers - cov antibody positive persons nor most of the other tested persons owned dromedaries . Nevertheless, camels roam in both counties (7), and humans have regular contact with camels and are likely to consume camel products . First, we were not able to test samples from persons who had close contact with camels, such as camel pastoralists . Second, although we used well - validated methods and a 2-step approach recommended by the world health organization for mers - cov diagnostics (13), our results should be confirmed by larger studies that may enable direct virus detection . The absence of autochthonous human mers - cov infections in africa has triggered hypotheses regarding differences in disease transmission between africa and the arabian peninsula and has raised doubts regarding the role of camels as a source of infection . The proportion of seropositive specimens that we found is comparable to previously reported proportions of unrecorded infections in the general population in saudia arabia (1.52% vs. 1.43% positivity by relisa and 0.15% vs. 0.18% positivity by prnt for kenya vs. saudi arabia, respectively) (6). Because of an apparently low infection rate and a bias toward reporting severe cases, the discovery of unreported mers cases requires testing of large sample sizes with well - validated serologic methods (6). Although the number of samples we tested was approximately only one tenth of the number of samples tested during the saudi arabia study, the proportion of seropositive specimens may be similar in kenya and saudi arabia . The lack of a well - developed public health system in parts of africa could lead to underdiagnosis of clinical cases and would therefore prevent case notification . Moreover, less accessible hospital care might preclude large nosocomial outbreaks as have been observed in countries on the arabian peninsula and in south korea . Other possible explanations for the absence of confirmed and reported clinical cases of mers - cov infection in africa include lesser virulence of strains from africa and cultural differences that might cause persons of different age ranges to be exposed to the virus . On the basis of the ability of mers - cov to infect a wide range of hosts in cell culture experiments (15), it remains to be excluded that other wild and livestock animals might act as additional sources of human mers - cov infection . It is paramount to characterize mers - covs from humans, camels, or tentative other animal hosts in africa . For increased understanding of any possible differences in pathogenicity and transmission potential, technical appendix . Sampling frame and methods used in a household survey conducted during 20132014 to compare the risk for zoonotic virus infection among humans and livestock in eastern kenya.
|
Granular cell tumor (gct) is an uncommon condition of the skin that was described firstly by weber in 1854 and established as a clinical entity by abrikossoff in 1926 who termed it as granular cell myoblastoma . The tumor occurs frequently among women and blacks, between the second and sixth decades of life . The common location of gct is the oral cavity, but it can also occur at any other sites . Gct of the skin is commonly presented with asymptomatic, slow - growing solitary nodule with overlying normal skin . Multiple gct was also reported as unusual presentation, and malignant transformation is considered in lesions that rapidly grows or invades the adjacent tissues . The characteristic histological feature of gct is the coarse eosinophilic cytoplasmic granules which represent lysosomes similar to that found within schwann cells when ingest myelin . Although gct was suggested firstly to originate from myoblasts, it is accepted now that other cells such as histiocytes, fibroblasts, undifferentiated mesenchymal cells, and schwann cells are implicated in the histogenesis . Secondary ulceration is uncommon in gct, and to our knowledge there was no previous study that fully discussed the criteria of this clinical variant . In this study, we highlight the clinicopathological and immunohistochemical features of this ulcerative variant that help to distinguish it from other common ulcerative lesions . A total of fourteen cases were enrolled in this study, and they were collected from al - azhar university hospitals and the national cancer institute, cairo, egypt during the period from 2000 to 2010 . Clinical data including age, sex, onset, course, and duration of the lesion in addition to the clinical characteristics of the ulcer (size, location, morphology, base, surface, margin, and border) were recorded for each case . History of similar previous lesions or other chronic ulcer(s) in addition to history of other dermatologic or systemic disorders was also recorded . A skin biopsy was obtained from the edge of the ulcer, and the specimen was preserved in formalin and embedded in paraffin for processing . Routine hematoxylin and eosin, special staining with periodic acid - schiff (pas) and masson trichrome, immunohistochemical staining with s-100 protein, neuron specific enolase (nse), cytokeratin (ck), cd68, hmb-45, epithelial membrane antigen (ema), vimentin, and desmin were done for each case . Immunohistochemical staining was performed using avidin - biotin peroxidase complex method on formalin - fixed, paraffin - embedded tissue sections, with a 1/50 dilution of monoclonal antibodies (dako, denmark). Briefly, tissue sections were mounted on 3-aminopropyl - triethoxysilane - coated slides and dried overnight at room temperature . Subsequently, they were dewaxed in xylene and rehydrated in graded ethanol . After being rinsed with phosphate - buffered saline, they were immersed in 0.01 mol / l citric acid titrated to ph 6.0 and heated twice for 10 minutes in a microwave oven . Diaminobenzidine was used as a chromagen, and the slides were counterstained with mayer's hematoxylin . Out of 117 cases of cutaneous gct, only 14 cases (12%) were presented with cutaneous ulcer during the time of diagnosis . The study included 11 males and 3 females with male to female ratio 3.6: 1 . The age of patients ranged from 17 to 42 years (mean 31.5 7.42). The tumor was appeared as asymptomatic nodular lesion with normal overlying skin which was slowly progressed and gradually ulcerated . The duration of the lesion ranged from 23 to 51 months (mean 37.2 8.32) while the time of secondary ulceration ranged from 1941 months (mean 31.5 6.71). At the time of diagnosis, all cases were presented with solitary large rounded or oval ulcerative lesion; twelve were located on the extremities (5 arm, 2 forearm, 3 foot, and one lesion on both leg and thigh) while two lesions were located on the anogenital region (scrotum and perineum). The size of ulcers ranged from 3.8 3.5 cm to 5.2 5.1 cm with average 4.1 3.9 cm . The base was indurated with a characteristic firm to hard consistency (button like) and extended beyond the surface (ranged from 0.7 to 1.2 cm). The floor of ulcer was dry and filled with clean necrotic tissue in the acral lesions (figure 1(a)), while in the anogenital lesions; it was filled with granulation tissue and discharging minimal exudates (figure 1(b)). There was no tenderness of any lesion, and lymph nodes were mildly enlarged in anogenital lesions without associated symptoms while in acral lesions there were no abnormal changes in the regional lymph nodes . The clinical diagnosis in 9 lesions was suspected as an infectious granuloma (leishmaniasis, lupus vulgaris, bilharziasis, and chancroid) while in 5 lesions, a malignant neoplasm (squamous cell carcinoma, malignant lymphoma, malignant melanoma, and soft tissue tumor) was suspected . There was no reported past history of similar lesion or other skin disorder at the same site of the lesion . Histologically, the tumor presented with a poorly circumscribed dermal infiltrate which was separated from the epidermis by a clear zone (figure 2(a)). The infiltrate was formed of sheets, fascicles, and groups of large cells with small rounded nuclei and an eosinophilic granular cytoplasm without observation of significant atypical features in any case (figure 2(b)). The epidermis showed mild to moderate acanthosis, and pseudoepitheliomatous hyperplasia was seen in 3 cases . In two cases the erector pili muscles showed characteristic infiltration by tumor cells in all cases (figure 3). Pas stain showed positive staining of the cytoplasmic granules in all cases; the staining was strongly positive in 10 cases (figure 4(a)) and weak positive in 4 cases . Immunohistochemical study showed strong positive staining for s-100 (figure 4(b)) and nse (figure 4(c)) in all cases (100%). Positive immunoreactivity was observed also with vimentin in 7 cases (50%) and cd68 in 5 cases (35.7%); the staining was mostly strong with vimentin but it was weak with cd68 (figure 4(d)). Other markers including cytokeratin, ema, desmin, and hmb-45 were negative . Clinical data, histological, and immunohistochemical staining results are summarized in (table 1). Follow - up data were available for only 3 patients who showed no recurrence of the lesion after one year of total excision . The histological and immunohistochemical features of the ulcerative area were similar to that of the borders with the exception of epidermal changes which showed loss of the epidermis with scale - crust formation and the dermal changes which showed increased number of thin - walled capillaries and dense inflammatory cells in the upper dermis . Generally it is presented as a solitary asymptomatic nodule, less than 3 cm in size, pink in color, hard in consistency and usually reveals an intact overlying epithelium . The diagnosis of gct is mostly based on the histological findings and confirmed by immunohistochemical staining which usually shows positive staining for s-100 and nse . The tumor also expresscs vimentin, pgp9.5, nki / c3, and cd68 while some markers such as inhibin-, calretinin, galectin-3, and hbme show varying rates of staining . Ulcerative gct is a rare variant which is not fully studied in the literature, and there was no previous description for the clinical characteristics of this ulcer in addition to the histological and immunohistochemical features of such lesion . The main clinical challenge in ulcerative gct is the resemblance to infectious granulomatous ulcers especially cutaneous leishmaniasis and tuberculosis in addition to the malignant neoplasms especially squamous cell carcinoma and cutaneous lymphoma . The ulcer of cutaneous leishmaniasis usually overlay a large red nodule with formation of central crust . Superficial softness and the volcano sign are important diagnostic features for leishmaniasis ulcer; it is felt soft and slightly mobile over the underlying dermis with indurated firm base, but never hard, and the margin characteristically slopes upwards smoothly, giving the appearance of flattened volcano . The ulcer usually persists for 36 months and starts to regress within 512 months leaving a sharply demarcated, irregular, cribriform scar . In lupus vulgaris, ulceration is uncommon presentation and usually overlay a solitary reddish - brown, flat, soft, or gelatinous plaque with gyrate or discoid shape . The lesion is common in adults with female predilection and mostly occurs on the head and neck, and next in frequency are the extremities . Moreover, the ulcer of lupus vulgaris may be due to malignant transformation especially when it shows persistence progression, large size, and lack of response to antituberculous drugs . Squamous cell carcinoma (scc) is an important differential diagnosis for ulcerative gct especially for the lesions which are located on sun - exposed areas . The nodulo - ulcerative lesion is considered the commonest form of scc while marjolin's ulcer which is developed in relation to certain kinds of injury such as burns, scars, and long - standing sores is less frequent . The ulcer of scc is challengeable because it feels firm with indurated base, usually extended beyond the visible margin of the lesion, and it shows an indurated margin with purulent, exuding surface that bleeds easily . The outline may be rounded, but is often irregular . In malignant lymphomas, . It can occur with a variety of lymphomas, and frequently the ulcers are multiple, necrotic, infected, and placed on tumors . Shah described an ulcer of malignant lymphoma in a 55-year - old man which was located on the upper back . The ulcer was characterized by large size (6 7 cm), indurated margin, yellowish - black slough, and foul - smelling discharge, and it was associated with multiple small firm swellings in the surrounding area in addition to enlargement of supraclavicular nodes . In this study, we described the clinical features of ulcerative gct as a large, asymptomatic, nontender rounded, or oval solitary ulcer . It shows indurated base (firm to hard) which extended beyond the surface, necrotic floor (dry in acral location and exudated in genital area), elevated border, and normal margin . The tumor is characterized by slowly progressive course and ulceration usually occurred after a long duration (more than 1.5 years). It is more located on the extremities with male predilection and usually affected young adults (2nd and 3rd decades). These criteria may help to suspect the clinical diagnosis of gct in ulcerative lesions and to facilitate the clinical differentiation from other ulcerative lesions . Compared with nonulcerative forms of cutaneous gct, ayadi et al . Reported that gct presented clinically as nodular (55.5%) or polypoid lesion (45.5%), often lonely, equal in both sexes (male to female ratio 1: 1.25); median age was 33.9 years including children, more located on the head and neck with a mean size 1.15 cm and smooth or warty surface . Apisarnthanarax also reported the clinical features of 16 patients with gct with an average age incidence of 39 years, a greater frequency among negroes (69%) and females (62.5%). It was presented clinically with asymptomatic solitary mass in 75%, multiple in 25%, and 84% of lesions were located on the skin . Although the location of gct seems to be nonspecific, the oral cavity was reported as the commonest location for gct followed by the extremities, back, trunk, cheek, and lastly the pubic region . Gct of external genitalia and perineum was described in both males [22, 23] and females . While involvement of the vulva was more reported in the literature, anogenital ulcers in this study were only observed in males . Histologically, our cases were consistent with classically reported cases which show round or polygonal cells with abundant pale eosinophilic granular cytoplasm and small eccentric nucleus . There was absence of any histological signs that increase the likelihood of malignancy such as mitotic figures, cellular and nuclear pleomorphism, necrosis, wide cellular sheets, spindle - cell structure, and metastasis . An important feature in all cases was the marked infiltration of erector pili muscles with granular cells . Infiltration of skeletal muscle is a common feature of gct involving the squamous mucosa; in such areas, regenerating and degenerating muscle fibers are entrapped among fascicles of tumor cells . The immunostaining in our cases showed strong positive reactivity with s100 and nse in all cases (100%) while vimentin showed 50% positivity and cd68 showed positivity in 35.7% . Compared with nonulcerative forms, ayadi et al . Found that tumor cells in nodular lesions were positive for s100 in 100%, vimentin in 90%, and nse in 80% while they were negative for cytokeratin and anti - mutant nucleophosmin (aml) the pattern in both variants is more consistent with schwann cell origin for nongingival gct which express diffuse cytoplasmic and nuclear staining for s100 protein . This may replace the initial theory which suggested that the tumor cells are derived from muscle cells . The neural histogenetic origin of gct was also proposed after immunohistochemical analysis of 15 oral lesion by rejas et al . Who found a positive staining for s-100, p75, nse, and cd68 while other markers including ki-67, synaptophysin, hhf-35, sma, ema, chromogranin, progesterone, androgen, and estrogen were negative . Although there was strong staining for cd68 in both gct and schwannomas in previous studies which strengthen the histogenetic relationship between gct and schwann cells, we couldnot observe such relation in our cases which expressed weak positive staining in only 35.7% of cases . This may suggest another neural differentiation of such variant but more immunohistochemical studies are required to explain these changes . Our results denote that ulcerative form of gct may form a clinical diagnostic challenge but clinical suspicion could be considered in long standing, asymptomatic solitary ulcer which is located on the extremities in a young male . To our knowledge, this is the first study that discusses the clinicopathological and immunohistochemical features of ulcerative form of gct . Although it is uncommon variant, we recommend it to be considered in the differential diagnosis of solitary large ulcerative lesions especially those located on the extremities or genital region.
|
The juice was extracted from the fruits and subjected to centrifuge . In the supernatant equal amount of ethanol was added and kept it in refrigerator for 30 min, then centrifuge the mixture and dry at room temp . Fine powder was collected as bio - polymer . For the granulation 1%, 3% and 5% solution of polymer was made in distilled water and appropriate amount of lactose (10 gm) was added to it . Then granules were subjected to resize with sieve#16 . Before compression of granules, 2%talc and 2% fine powder were mixed well . For the preparation of sustained release tablets containing rifampicin same procedure was followed with 3% and 5% of polymer for preparation of sustained release tablets . Additional tablets of 100 mg, 200 mg and 400 mg were prepared using 5% concentration of the polymer . The biopolymer from citrus limetta was isolated and evaluated for release retardant property in sustained release tablet . Among the three formulations, fm-3 shows hardness of 5moh, friability of (.90), weight variation of (5.0). It had t50% and t 80% of 1.34 hrs and 2.52 hrs at ph (1.2) respectively . In - vitro release study for tablets prepared by using 5% conc . Of polymer graph for cumulative% drug release vs time of rifampicin at ph (1.2) observation table for release study the results indicated that the selected biopolymer had a good release retardant property thus it can be concluded that the selected biopolymer can be utilized as low cost natural biocompatible and biodegradable agent.
|
Normal c57bl/6 mice and mice containing foxo1 knock - in (foxo1tag), foxp3-ires - rfp and bira alleles or foxp3-ires - rfp and bira alleles were previously described . Treg cells in mice carrying the foxp3-ires - rfp allele were marked by red fluorescence protein (rfp). All mice were maintained under specific pathogen - free conditions, and animal experimentation was conducted in accordance with institutional guidelines . Cd62l nave cd4 t, cd8 t, and foxp3 treg cells were isolated by facs - sorting, and then fixed for 10 min at 25 c with 10% formaldehyde . After incubation, glycine was added to a final concentration of 0.125 m to the lysates were pelleted, re - suspended and sonicated to reduce dna length to 300500 base pairs (bp). The chromatin prepared from t cells of c57bl/6 mice was incubated with protein - a - anti - foxo1 (ab39670, abcam) or an isotype control antibody overnight . The chromatin prepared from t cells of foxo1tag / tag bira foxp3-ires - rfp or control bira mice was incubated with streptavidin overnight . The immune complexes were washed, and eluted in 500 l of elution buffer containing 50 mm tris, 10 mm edta and 1.0% sds . Precipitated chip dna and input dna were incubated at 65 c to reverse the crosslinking . After digestion with rnase and proteinase k, the chip and input dna were purified with phenol / chloroform extraction and ethanol precipitation . The purified dna was repaired, ligated with an adaptor, and amplified by pcr for 1520 cycles . Initial quality control of the sequencing was performed using fastqc (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). After verifying acceptable base calling quality, nucleotide distribution, and adapter contamination, reads were aligned to the mouse mm9 (ncbi, build 37, july 2007) reference genome obtained through the ucsc table browser (http://genome.ucsc.edu/) using version 0.12.7 of the bowtie short read alignment software (http://bowtie-bio.sourceforge.net/index.shtml). Peak calling was then performed on the aligned reads . For the cd4 and treg cell - types, macs (version 1.4.1, http://liulab.dfci.harvard.edu/macs/) macs makes use of the inherent tendency of clusters of sense and antisense reads flanking protein - dna interaction sites to model fragment length . It then considers this estimate when defining windows used to scan the genome for enrichment according to a poisson distribution . For the analysis of the cd8 data, we developed a novel peak - calling algorithm bcp (http://rulai.cshl.ed/bcp/), which employs a bayesian hidden markov model, to perform segmentation of the genome and identify enrichment . This method expands peak - calling capabilities to more diffuse, less punctate enrichment, as seen in many histone modification chip - seq and dnase i hypersensitivity sequencing assays . Because bcp does not have an integrated method for dealing with potential pcr duplicates, we preprocessed the read alignments to include only one instance of each unique chromosome start and end position . In both cases, we employed the empirical fdr (efdr) metric as described by yong, z., et al . To minimize false positives . This entailed using the input alignments as the treatment data and the chip alignments as the control to infer the background peak - calling rate . The p - value of peak calling used by macs or bcp was then adjusted to ensure that the fraction of background peaks divided by called peaks did not exceed the efdr threshold . This was set to 0.01 for macs but 0.05 for bcp since, in our experience, it was less sensitive to low density peak false calls . The bedtools suite of utilities was used for post - processing tasks such as finding overlapping antibody and biotin immunoprecipitated peaks . Normal c57bl/6 mice and mice containing foxo1 knock - in (foxo1tag), foxp3-ires - rfp and bira alleles or foxp3-ires - rfp and bira alleles were previously described . Treg cells in mice carrying the foxp3-ires - rfp allele were marked by red fluorescence protein (rfp). All mice were maintained under specific pathogen - free conditions, and animal experimentation was conducted in accordance with institutional guidelines . Cd44 cd62l nave cd4 t, cd8 t, and foxp3 treg cells were isolated by facs - sorting, and then fixed for 10 min at 25 c with 10% formaldehyde . After incubation, glycine was added to a final concentration of 0.125 m to the lysates were pelleted, re - suspended and sonicated to reduce dna length to 300500 base pairs (bp). The chromatin prepared from t cells of c57bl/6 mice was incubated with protein - a - anti - foxo1 (ab39670, abcam) or an isotype control antibody overnight . The chromatin prepared from t cells of foxo1tag / tag bira foxp3-ires - rfp or control bira mice was incubated with streptavidin overnight . The immune complexes were washed, and eluted in 500 l of elution buffer containing 50 mm tris, 10 mm edta and 1.0% sds . Precipitated chip dna and input dna were incubated at 65 c to reverse the crosslinking . After digestion with rnase and proteinase k, the chip and input dna were purified with phenol / chloroform extraction and ethanol precipitation . The purified dna was repaired, ligated with an adaptor, and amplified by pcr for 1520 cycles . Initial quality control of the sequencing was performed using fastqc (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). After verifying acceptable base calling quality, nucleotide distribution, and adapter contamination, reads were aligned to the mouse mm9 (ncbi, build 37, july 2007) reference genome obtained through the ucsc table browser (http://genome.ucsc.edu/) using version 0.12.7 of the bowtie short read alignment software (http://bowtie-bio.sourceforge.net/index.shtml). Peak calling was then performed on the aligned reads . For the cd4 and treg cell - types, macs (version 1.4.1, http://liulab.dfci.harvard.edu/macs/) macs makes use of the inherent tendency of clusters of sense and antisense reads flanking protein - dna interaction sites to model fragment length . It then considers this estimate when defining windows used to scan the genome for enrichment according to a poisson distribution . For the analysis of the cd8 data, we developed a novel peak - calling algorithm bcp (http://rulai.cshl.ed/bcp/), which employs a bayesian hidden markov model, to perform segmentation of the genome and identify enrichment . This method expands peak - calling capabilities to more diffuse, less punctate enrichment, as seen in many histone modification chip - seq and dnase i hypersensitivity sequencing assays . Because bcp does not have an integrated method for dealing with potential pcr duplicates, we preprocessed the read alignments to include only one instance of each unique chromosome start and end position . In both cases, we employed the empirical fdr (efdr) metric as described by yong, z., et al . To minimize false positives this entailed using the input alignments as the treatment data and the chip alignments as the control to infer the background peak - calling rate . The p - value of peak calling used by macs or bcp was then adjusted to ensure that the fraction of background peaks divided by called peaks did not exceed the efdr threshold . This was set to 0.01 for macs but 0.05 for bcp since, in our experience, it was less sensitive to low density peak false calls . The bedtools suite of utilities was used for post - processing tasks such as finding overlapping antibody and biotin immunoprecipitated peaks.
|
Programmed cell death (pcd) plays an important role in sculpting tissues during animal development (adams and cory, 2002; danial and korsmeyer, 2004). The molecular regulators that are central to this process seem to be evolutionarily conserved from worms to mammals (danial and korsmeyer, 2004; horvitz, 1999) and include autocatalytic initiator caspases, trans - activable effector caspases, cytosolic activating factors (apaf-1), and multidomain bcl-2 proteins (danial and korsmeyer, 2004; horvitz, 1999). The proapoptotic bcl-2-family proteins oligomerize and permeabilize mitochondria, releasing intermembrane space components such as cytochrome - c and smac / diablo into the cytosol, where they activate initiator caspases by an atp - dependent mechanism (danial and korsmeyer, 2004). Initiator caspases trans - activate effector caspases that cleave multiple cellular substrates, resulting in dna degradation, nuclear condensation, and loss of cell integrity (danial and korsmeyer, 2004; wang, 2001). Mitochondrial outer - membrane permeabilization has been proposed to depend on the mitochondrial fission and fusion machinery (perfettini et al ., 2005; youle and karbowski, 2005). Consistent with this, mitochondria undergo dramatic fragmentation very close in time to cytochrome - c release during mammalian cell death (frank et al ., 2001; mancini et al ., 1997). Furthermore, an increase in mitochondrial fragmentation and a block in mitochondrial fusion are essential for cell death progression (frank et al ., 2001; karbowski et al ., 2002; yu et al ., 2005). In normal cells, the balance in the rates of mitochondrial fission and fusion regulated by dynamin - related protein-1 (drp-1), fis-1 and endophilin (fission), or mitofusins and opa-1 (fusion) maintains the dynamic, interconnected mitochondrial tubules (meeusen and nunnari, 2005; okamoto and shaw, 2005; yaffe, 1999). An increase in recruitment of drp-1 to the mitochondria accentuates staurosporine, lipid, and free oxygen radical stress - induced mitochondrial outer - membrane permeabilization (breckenridge et al . Moreover, multiple apoptotic stimuli induce mitochondrial recruitment of the proapoptotic bcl-2-family protein, bax, to drp-1 and mitofusin-2-positive putative mitochondrial fragmentation sites (karbowski et al ., 2002; 2005) in a fis-1-dependent manner (lee et al ., 2004), consistent with a role for mitochondrial fission and fusion machinery in cell death . In drosophila, rhg - family proteins (richardson and kumar, 2002), genotoxic stresses, and protein synthesis inhibitors (chew et al ., 2004; zimmermann et al ., 2002) antagonize drosophila inhibitor of apoptosis protein-1 (diap-1)-mediated inhibition of the activation of the apical caspase dronc in an ark- (drosphila apaf-1) and atp - dependent manner (mills et al ., 2006), leading to effector caspase activation and cell death . Cytochrome - c has been shown to be differentially displayed from the mitochondria during cell death (varkey et al ., 1999). Knockdown of drosophila cytochrome - c did not affect cell death triggered by genotoxic stress in vitro (means et al ., 2006) and ex vivo (zimmermann et al ., 2002) or developmental stimuli in vivo (dorstyn et al ., 2004), although certain nonapoptotic caspase activation pathways utilized during sperm individualization were affected (arama et al ., 2003). Furthermore, mitochondrial morphology during drosophila pcd has not been previously reported . In this study, we show that multiple apoptotic stimuli result in mitochondrial fragmentation upstream of caspase activation, phosphatidylserine exposure, and nuclear condensation in drosophila cells . While etoposide induced mitochondrial fragmentation, c6-ceramide resulted in an increase in mitochondrial contiguity prior to its fragmentation . Drp-1 mutant or rnai - treated s2r cells are considerably protected from multiple apoptotic stimuli, consistent with reduced mitochondrial fragmentation . Thus, mitochondrial remodeling plays an important role in modifying the propensity of cells to undergo pcd in drosophila . Precisely timed ecdysone pulses induce reaper and hid expression in the drosophila larval midgut (0 hr after puparium formation [apf]) or the salivary gland (10 hr apf) and trigger developmental pcd (yin and thummel, 2005). Mitochondria, visualized by using matrix - targeted gfp (mito - gfp) (pilling et al ., 2006) in acridine orange - positive, dying prepupal midgut cells (1 hr apf, figure 1aiii) and salivary glands (4 hr apf, figure 1biii), were remarkably fragmented, unlike third - instar larval (4 hr apf) mitochondria . Quantification revealed a dramatic decrease in the prepupal mitochondrial cross - sectional area (csa; midgut [0.7 m from 1.4 m, figure 1a] and salivary gland [figure s1a, see the supplemental data available with this article online]) and a significant increase in the number of mitochondria per cell (figure s1a). Moreover, ecdysone - induced mitochondrial fragmentation was mimicked ex vivo on third - instar larval wing discs by using 1 mm ecdysone (kilpatrick et al ., 2005) for 2 hr (figure 1c; figure s1b). In addition, overexpression of hid resulted in mitochondrial fragmentation in acridine orange - positive eye disc cells (figure s1c). Thus, mitochondria in drosophila tissues fragment during pcd, as has been reported in c. elegans (jagasia et al ., 2005) and mammalian cells (frank et al .,, mitochondrial morphology was temporally characterized in etoposide-, actinomycin - d-, cycloheximide-, or c6-ceramide (a lipid cell death mediator)-treated (walter and hajnoczky, 2005) larval hemocytes (sriram et al ., 2003) and the s2r cell line . A 3- to 4-fold increase in nuclear condensation (6 hr, figure 1h) was preceded by effector caspase activation (5 hr, figures 2a2biv) and phosphatidylserine (ps) exposure in propidium iodide (pi)-negative hemocytes (6 hr, figures 2a2bv). These cells subsequently (10 hr) became characteristically blebbed (figures 2a2bvi) and pi permeable (figures 1d1eiv, top inset). The number of etoposide - treated apoptotic hemocytes increased with time (figure 1 g). Interestingly, mitochondrial fragmentation (figures 1dii and 1 g), as confirmed by quantifying functionally isolated mitochondria (figure s2 and movie s1) (collins et al ., 2002) at 3 hr, preceded the onset of ps exposure (figure 2av) or nuclear damage (figures 1 g and 1h). Quantification showed an increase in the number of mitochondria and the contribution of fragmented mitochondria to the mitochondrial csa (figures s3b, s3d, and s3e). Mitochondrial fragmentation was also observed in cycloheximide- or actinomycin - d - treated, mito - yfp - transfected s2r cells (6 hr, figures s3 g and s3h). Surprisingly, mitochondria in c6-ceramide - treated (3060 min) hemocytes that had normal nuclei were highly contiguous (open arrowheads, figure 1eii). Quantifying functionally isolated mitochondrial csa per cell showed a significant increase in the contribution of tubular or extensively tubular mitochondria in these cells when compared with untreated cells (figure s3f). However, by 4 hr, these extensively tubular mitochondria underwent fragmentation in fitc - annexin v (anv)-negative hemocytes that had normal nuclei (figures 1eiii and 1i), similar to what was observed with genotoxic stress (figure 1dii). Therefore, genotoxic stresses triggered mitochondrial fragmentation, while the lipid cell death mediator induced increased mitochondrial contiguity and subsequent fragmentation prior to ps exposure, nuclear condensation, and finally plasma membrane permeability during drosophila cell death . In hemocytes incubated with an apoptotic stimulus, mitochondrial fragmentation (34 hr) preceded any detectable effector caspase activation (5 hr [figures 2a and 2biv]). Furthermore, inhibiting caspases with zvad - fmk or by overexpressing diap-1 (diap-1 +) (hay et al ., 1995) did not affect mitochondrial fragmentation (figure 2c), although hemocyte death was inhibited (figures 2f2h), as revealed by a lack of apoptotic markers (figures 2d and 2e; zvad - fmk; data not shown). In addition, overexpression of dcp-1, a drosophila effector caspase, did not affect mitochondrial morphology (figure s4). The drp-1 mutants used to study the role of mitochondrial remodeling during drosophila pcd are functional null alleles, drp-1 (gly293ser mutation), picked in a forward screen for genes affecting neurotransmission and drp-1, a p element insertion between the first two exons of drp-1 (13510 in this study) and a hypomorph, nrd (arg278trp mutation; 3665 in this study) (rikhy et al ., 2007; verstreken et al ., 2005). Drp-1, 13510, and the deficiency df exel6008 were second - instar larval lethal (data not shown); however, drp-1 yielded bang - sensitive escapers (verstreken et al ., 2005). The hypomorphic trans - allelic combination of 3665/13510 was third - instar larval lethal, although it yielded a few temperature - sensitive adults (rikhy et al ., 2007). A genomic duplication of drp-1 (dp [2;1] js13 [rikhy et al ., 2007]) completely rescued the lethality associated with drp-1, 13510, and 3665/13510 . Mitochondria in drp-1 and 3665/13510 hemocytes were extensively tubular when compared with wild - type mitochondria (open arrowheads, figures 3bi3biii). Quantifying mitochondrial morphology revealed a 2-fold decrease in the number of mitochondria and a significant increase in the contribution of tubular and extensively tubular mitochondria to the total mitochondrial csa in drp-1 mutant hemocytes when compared with wild - type cells (figure s5). Interestingly, 13510/+ hemocytes (figures 3biv and 3ci) or eye disc cells (figure s5) displayed a dominant mitochondrial fission defect that was completely rescued by a genomic duplication of drp-1 (figure 3cii). The mitochondrial fission defect in mutant cells could result from a reduced mitochondrial association of drp-1 (figure s6). An increase in mitochondrial contiguity due to a loss of drp-1 function was also confirmed by measuring fluorescence recovery after photobleaching (frap) of mito - yfp (collins et al ., 2002) in drp-1 rnai - treated s2r cells that had extensively tubular mitochondria (figure 3d). Relative frap of mito - yfp in a defined mitochondrial region in drp-1 rnai - treated cells was significantly (p <0.01) higher than that observed in mock rnai - treated cells (figure 3f). Drp-1 mutant hemocytes were protected from etoposide - induced death up to at least 10 hr (figures 4a and 4b), as revealed by a lack of caspase activation, ps exposure, or pi permeability in the majority (80%) of these cells (figures 4fi, 4fii, 4fv, and 4fvi). Furthermore, drp-1 mutant and dsrna - treated s2r cells were significantly protected (p <0.01) from cycloheximide-, actinomycin - d- (figures 4c and 4d), or uv - b - induced (figure consistent with increased protection, mitochondria in the majority (98%) of etoposide - treated drp-1 hemocytes failed to fragment (6 hr; compare figure 4gii with figure 4gi). Interestingly, mitochondria in etoposide - treated 3665/13510 hemocytes revealed a tubular, yet beaded and swollen intermediate in mitochondrial fragmentation by 4 hr (figure 4giii) that yielded some fragmented mitochondria in few (25%) cells later (6 hr; data not shown). Therefore, reduced (drp-1) or delayed (3665/13510) mitochondrial fragmentation decreased effector caspase activation and protected cells from genotoxic stress . Moreover, an increase in expression of drp-1 in hemocytes resulted in enhancement of etoposide - induced cell death (figure s8). The majority (70%) of the c6-ceramide - treated drp-1 hemocytes did not show effector caspase activation or ps exposure and displayed significant (p <0.05) protection (figures 4e, 4fiii, and 4fvii), similar to what was observed with etoposide, although hemocytes derived from the weaker allelic combination, 13510/3665, were apoptotic (figures 4fiv and 4fviii). Unlike 13510/3665 mitochondria, drp-1 mitochondria failed to fragment (figure 4hi), consistent with an essential role for drp-1-mediated mitochondrial fragmentation during apoptosis in drosophila . Moreover, developmental pcd in drp-1 mutant larvae was considerably reduced, as revealed by the enlarged central nervous system and a prominently elongated ventral ganglion (figure 4i), similar to other pcd - defective mutants reported (mills et al ., 2006). During metamorphosis, the first ecdysone pulse triggers mitochondrial fragmentation in prepupal tissues, although it is after the second ecdysone pulse that salivary gland histolysis occurs . It is likely that diap-1 inhibits caspases in these cells that have fragmented mitochondria until it is downregulated at the transcriptional level or degraded after the second ecdysone pulse (yin and thummel, 2005). The data presented here show involvement of mitochondrial fragmentation for ark - mediated dronc activation during cell death . The rhg - family proteins that localize to the mitochondria (claveria et al ., 2002; haining et al ., 1999; olson et al ., 2003) might activate drp-1-mediated mitochondrial fragmentation . This could result in exposure of cytochrome - c (varkey et al ., 1999) or release of peanut (gottfried et al ., 2004), which antagonize diap-1-mediated suppression of dronc however, as drosophila pcd was unaffected upon knockdown of cytochrome - c (dorstyn et al ., 2004), mitochondrial fragmentation in drosophila and mammalian cells would increase mitochondrial surface area and perhaps the concentration of bulky head group lipids on the outer mitochondrial membrane, facilitating recruitment of proapoptotic proteins . Drp-1 might organize sites for drosophila bcl-2-family protein debcl function on mitochondria (dorstyn et al ., 2002) that are similar to mitochondrial sites of bax recruitment in mammalian cells (karbowski et al ., 2002). These results provide the first, to our knowledge, evidence that drp-1-mediated mitochondrial fragmentation upstream of effector caspase activation modifies apoptotic sensitivity (figure 4j). Thus, mitochondrial fragmentation, like caspase activation, plays a conserved and unifying role in diverse cell death pathways from worms to mammals (frank et al . Although the function of the highly contiguous mitochondria during lipid - induced cell death remains poorly understood, this study brings to the forefront a modulatory role for mitochondrial remodeling in determining the susceptibility of drosophila cells to death . Media and chemicals were obtained from gibco - brl or sigma - aldrich unless otherwise specified . Secondary antibodies (jackson immunoresearch laboratories) were conjugated to fluorescent dyes as recommended by the manufacturer . Drp-1 mutants, collagen - gal4, and uas - mito - gfp were kindly provided by hugo j. bellen (baylor college of medicine, tx), k.s . Krishnan (dbs, tifr, mumbai), charles r. dearolf (duke university, nc), and william saxton (indiana university, in). Third - instar larval tissues were dissected in schneider insect medium supplemented with 10% non - heat - inactivated fetal bovine serum and 1 g / ml bovine pancreatic insulin (scm). They were washed in 1 pbs (ph 7.4) and incubated with 1 mm water - soluble ecdysone (ag scientific, inc .) Diluted in pbs for 2 hr (20c), fixed with 4% formaldehyde (30 min), permeabilized with 0.37% igepal (13 min), and labeled with alexa 568 phalloidin (1:200; molecular probes) for 30 min . Mitochondria were selected based on a threshold and were quantified by using metamorph (molecular devices corporation). Hemocytes derived from late third - instar larvae and s2r cells were plated in 35 mm coverslip - bottom dishes . Hemocytes at 1 hr postdissection were incubated with etoposide (10 m), cycloheximide (0.5 g / ml), or c6-ceramide (20 m or 40 m; matreya, inc .) Diluted in 1 medium 1 (m1) supplemented with 2 mg / ml glucose (imaging medium [i m]) at 20c for the indicated times prior to staining nuclei with 5 g / ml hoechst-33342 (5 min). Hemocytes were preincubated (30 min) with 50 m caspase inhibitor-1 (zvad - fmk; calbiochem) in i m before incubation with apoptotic stimuli in the presence of 50 m zvad - fmk in order to inhibit caspases . Immunofluorescence staining was carried out as described earlier (sriram et al ., 2003), by using affinity - purified rabbit anti - drp-1 antibody (1:200), mouse biotin antibody (1:500), and appropriate secondary antibodies (1:500). Drp-1 punctae were selected by using a threshold on background corrected images and were quantified . A total of 1 10 s2r cells were cotransfected with 1 g sirnai (dharmacon, inc .) And 0.25 g pavw vector (expressing eyfp only) (drosophila genomics resource centre, indiana university), by using cellfectin transfection reagent (invitrogen). After 5 days, cells were treated with prescribed concentrations of actinomycin - d or cycloheximide for 18 hr, and surviving yfp - expressing cells in five randomly selected fields were counted (n = 5; total cells = 14,020). Counts were normalized to the untreated control; error bars represent standard error of the mean for normalized data . Hemocytes were incubated with 10 m caspace substrate (fitc - vad - fmk, promega) for 20 min (20c) or stained with pi (20 g / ml), anv (2 g / ml) (santa cruz biotechnology), and hoechst-33342 (5 g / ml) diluted in m1 supplemented with 2.5 mm calcium chloride and 2 mg / ml glucose (20 min) and were imaged . Tissues and cell cultures in 35 mm coverslip - bottom dishes were imaged by using 60 or 100, 1.4 na, oil - emersion objectives on a nikon te 2000-u epi - fluorescent inverted microscope with optimized dichroics and filters and a cascade 512b em - ccd camera (photometrics) controlled by metamorph (molecular devices corporation). Confocal images were acquired by using either a 60, 1.4 na or a 100, 1.45 na objective on a biorad mrc 1024 or zeiss lsm 510 (carl zeiss microimaging, inc .) Images were processed by using metamorph (molecular devices corporation) and adobe photoshop software . Tubulin - gal4 or collagen - gal4 was used to express mito - gfp in multiple tissues by using the gal4-uas system (brand and perrimon, 1993). Hemocytes were incubated with 100 nm mitotracker diluted in i m supplemented with 1.5 mg / ml bsa (im+bsa) for 20 min (20c) and were imaged . S2r cells were grown in schneider's medium supplemented with 10% fetal bovine serum (gemini bio - products) at 25c . A total of 1 10 cells were plated and transfected with 1 g eyfp - mito vector (lajeunesse et al ., 2004) by using 5 l cellfectin transfection reagent (invitrogen). Mitochondria were selected by using defined thresholds post background correction and were quantified by using metamorph (molecular devices corporation). Third - instar larvae were exposed (90 s) on a dual intensity transilluminator (tm20; uvp, inc .) A total of 6 hr later, wing discs were dissected and stained with 3 g / ml acridine orange in pbs (5 min), washed, and imaged on the confocal microscope . Hemocytes were incubated with 10 nm tmrm diluted in scm or im+bsa (15 min) and were exposed to 555 nm wavelength light on a wide - field microscope . Time - lapse images (0.2 s) were acquired every 1 s until tmrm was released from all the mitochondria . Individual mitochondria were outlined and quantified by using metamorph (molecular devices corporation) (n = 510). S2r cells that were cotransfected with 1 g sirnai (dharmacon, inc .) And 1 g eyfp - mito by using cellfectin transfection reagent (invitrogen) according to the manufacturer's instructions were analyzed 5 days posttransfection . Drp sirna was targeted to 5-acactccggttcacaataa-3 (nm_134850 bases 19942012), and sicontrol nontargeting sirna #1 (dharmacon, inc . ), a mitochondrial region of interest (roi, 1.75 m in diameter) was selected and bleached (after 4 s, indicated by a solid bar) with high - intensity 488 nm wavelength light (1 s), and fluorescence in the roi was measured for an additional 25 s. rna was extracted from transfected s2r cells by using the rneasy mini kit (qiagen), and rt - pcr was conducted by using the qiagen onestep rt - pcr kit (qiagen). The drp - specific 5 primer 5-tcattcacgaggagatgcag-3 (designed to nm_134850 bases 12981317) and the 3 primer 5-tgcttggtgttgatgtaggc-3 (designed to nm_134850 bases 14901509) ribosomal protein 49 (rp49) primers (5-atgaccatccgcccagcatac-3 and 5-gagaacgcaggcgaccgttgg-3) amplified a 391 bp fragment between bases 1 and 391 of the coding region (genbank accession number y13939) (ge et al ., 2004).
|
Its effect is mediated via interactions with several receptors in the central nervous system and results from a combination of antidopaminergic, anticholinergic, antihistaminic, and weak antiadrenergic actions . The therapeutic effects of chlorpromazine are frequently accompanied by unwanted side effects that include sedation, autonomic, endocrine, and neurological effects . To date tinnitus is a common adverse reaction (adr) to several drugs and may occur during long - term therapies or after a single drug administration . Even though not life threatening, tinnitus may be discomforting; it may also be irreversible despite drug withdrawal . To date, over 130 drugs have been described to be potentially ototoxic, among which the most common inducers of tinnitus are aminoglycosides and other antimicrobials . We report on a suspect adr to chlorpromazine that occurred in a 12-year - old boy, affected by severe generalized anxiety disorder . He received initially a benzodiazepine therapy, which was switched to chlorpromazine (6.25 mg / day orally) because of the absence of a significant clinical response . Ten days after treatment with chlorpromazine, the patient experienced an enhanced sensitivity to sounds accompanied by perception of noises of the buzzing or ringing type . Information about the patient's medical history did not report conditions that may have predisposed to the onset of the disturbance manifested . Moreover, the patient was in overall good health and had never suffered from hearing disorders . In view of the medical history, the inability to discontinue therapy with chlorpromazine resulted in an objective worsening of the patient's symptoms, which are still present to date . The naranjo adr probability scale identified the relationship between the patient's development of adr and the drug as possible . This is the first report on a case of tinnitus related to the administration of chlorpromazine . Chlorpromazine is an antagonist of several dopamine cochlear receptors that play an important role in the sensory process by modulating afferent auditory nerve activity . Dopamine, released from the terminals of lateral olivocochlear efferent fibers, is protective against acoustic trauma, hypoxia, and ototoxicity . In this context, the dopamine antagonist activity of chlorpromazine may result in a higher risk of ototoxicity . It controls the cochlear blood flow, acting on the precapillary sphincters and increasing the microcirculatory flow . Clinical evidence indicates that h1 histamine agonists are effective in reducing tinnitus via improving vestibular compensation of the microcirculation . Chlorpromazine antagonism on h1-receptors may thus play a role in counteracting the vessel modulatory effect of histamine and by this means have contributed to tinnitus development in our patient . Acetylcholine is the major neurotransmitter in the olivocochlear efferent pathway, which is a feedback control system to the inner ear comprising a medial olivocochlear pathway projecting to outer hair cells and a lateral olivocochlear pathway projecting to dendrites of cochlear nerve fibres . In this context, the anticholinergic effects of chlorpromazine may have inhibited efferent signalling via the 9/10 nicotinic acetylcholine receptor complex in the outer hair cells which is known to be protective against acoustic injury . Another action of chlorpromazine that may have contributed to generate tinnitus in our patient is its antagonism of serotonergic receptors . Serotonin is one of the neurotransmitters acting on the auditory pathways; in particular it is involved in sound detection, location, and interpretation . Serotonin is currently believed to be one of the most important neurotransmitter involved in the perception of tinnitus . Indeed, serotonin reuptake inhibitor drugs reduce the intensity of tinnitus acting directly on nerve conduction of the auditory stimulus, particularly in the central auditory pathways . In this scenario, it is thus conceivable that antagonism at serotonin receptor levels caused by chlorpromazine causes auditory disorders leading to tinnitus . Finally, a role for an action of chlorpromazine on gamma amino butyric acid (gaba) cannot be excluded . Gaba inhibits auditory system and systemic administration of a gaba transaminase inhibitor improves tinnitus by suppressing hyperactivity in the auditory system . The neurotransmitter serotonin, involved in a large variety of physiological functions, behaves as a neuromodulator by strengthening the gaba system . Chlorpromazine, by decreasing the availability of serotonin, may lead to decreased gabaergic activity and this action may have contributed to tinnitus development . We cannot establish which among the actions of chlorpromazine described above has been predominant in the tinnitus - inducing action we observed, and the most likely possibility is that tinnitus resulted from a synergism among these different actions . A predisposition of the patient to develop tinnitus following chlorpromazine cannot also be ruled out . Receptors for serotonin, histamine, dopamine, and gaba are polymorphic and the presence of specific single nucleotide polymorphisms that acted as predisposing factors may be present in this specific patient . In addition chlorpromazine is substrate of cytochrome p4502d6 (cyp2d6), a highly polymorphic isoform of cytochrome . Genetically determined functional variations of this cytochrome may be present in the patient and may also have contributed to the onset of tinnitus . To our knowledge, this is the first report on the development of tinnitus following chlorpromazine administration . Although there is no information on dechallenge and rechallenge, the inability to discontinue therapy with chlorpromazine resulted in an objective worsening of the patient's symptoms . This clinical case is of great clinical interest as chlorpromazine is not currently included among potentially ototoxic drugs; paradoxically phenothiazines can be prescribed to alleviate symptoms related to disorders of the vestibular system.
|
Multiple sclerosis (ms) is a chronic inflammatory disease of the central nervous system (cns) that results in impairment of a range of functions, including physical disability and cognitive dysfunction (krupp et al ., 1989; magnetic resonance imaging (mri) of the brain is an established tool to monitor disease activity and disease progression by measuring brain volume loss and lesion load accrual (miller et al ., 1998). Whole brain volume loss, which can be estimated by the brain parenchymal fraction (bpf), is a common measure of neurodegeneration; while, brain lesion load, assessed by the t2 hyperintense lesion volume (t2lv), is a common measure of the total cerebral burden of inflammatory / demyelinating foci in ms (bermel and bakshi, 2006; filippi et al ., 2002; fisher et al ., 2002 many cross - sectional studies have compared these measures in groups of ms subjects to show that increased t2lv and lower bpf reflect more advanced disease . In addition to cross - sectional studies, many longitudinal studies including the most recent clinical trials have assessed the changes in these measures over time (rudick et al ., 2000; zivadinov et al ., 2007). When measuring cross - sectional and longitudinal change in each mri measure, researchers must consider the potential impact of between - subject and within - subject variations due to mri acquisition protocols . To address the potential confounding effects associated with changes in acquisition parameters, most clinical trials require that all of the sites use the same protocols, and significant effort is expended to ensure similarity across scanners . Even though a well - controlled clinical trial provides the best evidence regarding short - term changes in mri measures, these studies are generally limited to 23 years . To study longer timelines, investigators may need to rely on real world such observational studies typically involve variations in scanner platform and acquisition protocol to meet the demands of routine clinical care and ever - changing acquisition platforms and protocols . Therefore, there is an unmet need to consider what statistical approaches may be necessary to address the challenge of providing unbiased estimates of intra - subject and inter - subject changes with time in the face of heterogeneously obtained mri data . Linear mixed - effect (lme) models (fitzmaurice et al ., 2012; verbeke and molenberghs, 2009) have been shown to be efficient in performing group - based inference for neuroimaging data, as shown in studies analyzing both functional mri (fmri) and structural mri data (bernal - rusiel et al ., 2013; bowman, 2014; lange, 1999). Lme models account for both between - subject and within - subject variance components, enabling researchers to obtain subject - specific estimated means and account for unbalanced data due to measurements at irregular time points of observation (fitzmaurice et al ., 2012; several ms researchers have aimed to study subject - specific atrophy rates via the mixed - effect modeling framework (anderson et al . More recently, jones et al . Demonstrated that a mixed - effect model is superior to a linear regression model in explaining the brain atrophy rate . These investigators proposed including acquisition protocol in lme models using a categorical variable for protocol (jones et al ., 2013). Despite this initial investigation of the impact of protocol on modeling disease course in ms, a comprehensive evaluation of the possible fixed and random effects including those associated with acquisition parameters has not been completed . Such assessment is warranted to appropriately identify the mean response trajectory for mri data such as bpf and t2lv . The aim of this study was to build a comprehensive model for the bpf and t2lv including subject - specific (random) effects and mri acquisition parameter (individually or combined) (fixed) effects . Longitudinal mri scans from 1341 subjects were selected from the comprehensive longitudinal investigation of multiple sclerosis at the brigham and women's hospital, partners ms center (climb), an ongoing prospective observational cohort study that began enrolling subjects in 2000 (gauthier et al ., 2006). Inclusion criteria for the climb study are age 18 years and a clinically isolated syndrome (cis) or diagnosis of ms according to the revised mcdonald criteria (polman et al ., 2005). Subjects have clinical visits every 6 months that include complete neurological examinations and expanded disability status scale (edss) ratings (kurtzke, 1983). All subjects from the climb cohort with available mri scans up to 6 years after study entry were included in this study . We limited the follow - up time to 6 years in order to ensure that the subset of subjects followed for much longer periods did not have too much leverage on this analysis . Hence, scans for subjects that are greater than 6 years from their baseline scan were excluded . Demographic and clinical characteristics of subjects are provided in table 1 . Bpf and t2lv were calculated by applying an image analysis pipeline to dual - echo, conventional spin - echo images (de - cse). Over the years all mri scans were acquired on various 1.5 t signa ge scanners at the brigham and women's hospital (bwh), boston, massachusetts, using at times a standard quadrature head coil, and at other times a multichannel head coil (8 channel high resolution brain array (8hr brain)). De - cse mri protocols were acquired axially with pulse sequences including various combinations of following parameter ranges: tr = 22163000 ms, te1/te2 30/80 ms, slice thickness 3 mm, with no interslice gaps, resulting in a pixel size of 0.78130.9375 mm . In this study, nineteen unique de - cse mri protocols (i.e., variably parametrized de - cse mri pulse sequences) were used as detailed in table 2 . The original standard protocol in the climb study was protocol a. over the years, this protocol had to be adapted because of operational considerations, resulting in the 19 distinct protocols in table 2 . Quantitative image analysis was performed from the dual - echo images using an automated template - driven segmentation pipeline with partial volume effect correction (tds+) (wei et al ., 2002) followed by manual editing of output segmentation maps by an experienced observer . Large scale data management and analysis was enabled by an image analysis workflow management system linked to our image centered oracle ms database (liu et al ., 2005). The pipeline involves a semi - automated skull - stripping editing procedure to derive the intracranial volume (icv) followed by automated segmentation of gray matter (gm), csf, white matter (wm), and white matter lesions through tds+ (wei et al ., 2002). Bpf was calculated by the following formula: bpf = (gm + wm + lesions)/icc (wei et al ., 2004), where icc is the volume of the intracranial cavity serving as reference for individual head size (kikinis et al ., 1992). After the pipeline was completed, all of the mri scans reported in this study (n = 3453) underwent manual correction of automatically generated segmentation maps of t2 lesions, brain parenchymal compartments and csf by expert readers using 3d slicer software (liu et al ., 2005). We note that no correction for misclassification of t1 hypointensities was performed in our pipeline, but recent work from our group has demonstrated that these hypointensities have a limited impact on measures of bpf (dell'oglio et al ., 2015). Statistical analyses were conducted using the mixed procedure in the statistical analysis system (sas) version 9.3 (cary, nc). A cube root transformation was applied to t2lv prior to analysis to avoid violation of model assumptions . In addition, bpf was modeled as a percent to allow easier interpretation of the model coefficients . Since the goal of our analysis was the estimation of both the mean bpf and t2lv trajectories over time with a set of serial measurements from subjects, an lme model was used . In the process of model selection, several models were proposed and investigated, but two main considerations were of interest . First, using the most complex mean model, several potential models for the covariance / random effect structures were compared . Once the covariance / random effects structures were compared, several models for the impact of protocol parameterization on the fixed effects were assessed (diggle et al ., 2002). For the assessment of the covariance structure, the model included protocol, baseline age, baseline disease duration, study time and an interaction term between protocol and study time . In terms of covariance structure/ random effects, we compared three models: (a1) subject - specific random intercept only, (a2) subject - specific random intercept and study time effect, and (a3) subject - specific intercept and study time effect with protocol specific residual variance . Although assessment of protocol specific random study time effects was of interest, many protocols failed to have multiple observations on the same subject so these variance components were not estimable in our dataset . In order to compare models, akaike information criterion (aic) with the regression equation for each model and the associated sas code for fitting the model are shown in the appendix . After selection of the best covariance parameter model, selection of the fixed effects was performed based on five possible models . The first model (model b1) included age at the time of the visit, baseline disease duration and protocol as fixed effects . Each of the 19 protocols in the study was given a separate intercept in this model . This model is the same as the model from jones et al . Without the additional covariates . Despite the appeal of using age at scan as the time metric, this model makes the assumption that the cross - sectional and longitudinal effects of age are the same . To assess this assumption, study age was broken into two components (baseline age and study time) in model b2, but protocol remained in the model as a fixed effect . The third model (model b3) added protocol by study time interactions to the previous model (model b2), to assess whether the estimated change with time was different across the protocols . The fourth and fifth models (models b4 and b5) were similar to models b2 and b3, but rather than using a separate intercept for each of the protocols, the components of the protocols were included as separate fixed effects . This approach reduced the number of parameters to estimate but added the assumption that the effect of each component of the protocol was independent and additive . For the protocols in this study, protocols were defined using these parameters: type of coil, pixel bandwidth, pixel size, repetition time, and scanner (table 2). We note that echo time was always the same across all protocols so this parameter was not included . The regression equation for each of the models and sas code for fitting the models comparison of models for the selection of covariance parameters is presented in at the top of table 3; additional statistics from each of the models are presented in supplementary table 1 . The random intercept and slope model (model a2) was superior to the random intercept only model (model a1), and the improvement was substantial . Further, the random intercept and slope model with protocol specific residual variance (model a3) was superior to the random intercept and slope model . Therefore, model a3 was the chosen covariance structure . Using this covariance structure, the fit of the model with the specified fixed effects are shown in table 3; additional statistics from each of the models are presented in supplementary table 2 . This model includes separate estimates for cross - sectional effect of age and the longitudinal change with age, demonstrating the potential problems associated with using age at the mri visit as the time metric in longitudinal models for bpf . Further, a protocol by study time interaction was not found to add significantly to the model since model b3 did not lead to improvement over model b2 . Finally, the model including fixed effects for each of the components of the protocol provided an inferior fit compared to a model with a protocol specific effect, demonstrating that the parameters for the protocols do not have simple additive effects on bpf, as might have been expected, given that individual protocol parameters might have complex interactions towards the resulting image contrast and noise characteristics . Comparison of models for the selection of covariance parameters is presented at the top of table 4; additional statistics for each of the fixed effects models are shown in supplementary table 4 . The random intercept and slope model (model a2) was superior to the random intercept only model (model a1), and the improvement was substantial . For t2lv, the random intercept and slope model with protocol specific residual variance (model a3) could not be fit because the residual variance associated with one of the protocols was estimated to be equal to 0 . Given the inability to estimate some of the parameters, model a2 was chosen for further analysis . Using this covariance structure, the fit of the model with the specified fixed effects are shown in table 4; additional statistics for each of the fixed effects models are shown in supplementary table 5 . The results show that the lowest aic was attained with models b2 and b5 . As for bpf, the results show that including separate estimates for cross - sectional effect of age and the longitudinal change with age showed superior fit compared to a model using age at the mri visit as the time metric . Further, a protocol by study time interaction was not found to add significantly to the model since model b3 did not lead to improvement over model b2 . Finally, the model including fixed effects for each of the components of the protocol provided an inferior fit relative to a model with a protocol specific effect . Interestingly, model b5 had a similar aic as model b2, but model b2 is easier to interpret so this model is chosen as superior . The aim of this study was to build comprehensive models for the estimation of mean bpf and t2lv in ms subjects encompassing subject - specific (random) effects and acquisition parameter (fixed) effects . A series of models with different covariance parameters and models of different fixed - effects were compared, and the optimal model for bpf and t2lv was the same in terms of the fixed effects but differed in terms of the variance components . For the bpf, the variance components included a random intercept and slope as well as protocol specific variance terms, indicating that the residual variability associated with each of the protocols differed . For the t2lv, the random intercept and slope model with equal variance across the protocols was chosen due to the inability to estimate all the protocol specific variance parameters . For each of the outcomes, protocol by study time interactions were not found to significantly improve the models, but separate parameters for the cross - sectional effect of age at study entry and the within subject longitudinal change provided a superior fit compared to a model with a single parameter for age . Within the analysis of the bpf, the residual variability associated with each of the protocols was found to differ, demonstrated by the improvement in model fit comparing models a2 and a3 . This result indicates that the homoscedasticity assumption of many commonly used models may be inefficient when subjects are measured using different scanning protocols . When the estimated residual variances were investigated in supplementary table 3, the protocols with the largest deviations from protocol a had the largest difference in terms of residual variability . These results show that accounting for heteroscedasticity due to protocol may be an important consideration in modeling bpf data from multiple protocols . In addition to the impact of protocol on residual variance, protocol was found to have an impact on the intercept (p <0.001 for overall effect of protocol in model b2), but there was no protocol by study time interaction (p = 0.06 from model b3). Further, including the components of the protocol as additive fixed effects failed to improve model relative to including protocol specific fixed effects . Within the analysis of the cube root transformation of t2lv, the model with protocol specific residual variance failed to converge because the residual variance for one of the protocols was found to be equal to 0 . When this protocol was removed, the model with protocol specific residual variance was observed to lead to improved fit, but this model failed to converge with other fixed effects . Therefore, the model with just a random intercept and slope was chosen as optimal based on our dataset, but heteroscedastic variance might be appropriate in other datasets . In addition to the variance components, the comparison of the fixed effects models showed that protocol had a significant effect (p <0.001 for the overall effect of protocol in model b2), but there was no protocol by study time interaction (p = 0.10 from model b3). Interestingly, a larger number of protocols had a highly significant effect on the intercept for the t2lv compared to the bpf . This results shows that the impact of protocol appears larger for the t2lv, demonstrating the importance of incorporating this into the models . For both outcome measures, separate parameters for the cross - sectional effect of age and the within subject change with age were found to lead to an improved fit relative to a single parameter for the effect of age . In both models, the within subject change in the outcomes with age was found to be larger than the cross - sectional effect of age . Therefore, estimating the change with age using a single parameter would underestimate the change with time for a specific subject . Further work assessing the impact of age may provide more insight regarding this finding . For this analysis, model selection was based on the aic . The aic includes a penalty for model complexity, but an alternative measure for model selection is the bayesian information criterion (bic). The bic has a larger penalty for model complexity compared to the aic; therefore, models with fewer parameters are favored by the bic more than the aic . The bic for each of the model compared in this paper are also provided in the supplementary tables . When the bic is used for model selection, the same variance components were chosen, but model b4 was found to be superior to model b2 in each case . This result is driven by the fact that model b4 required fewer parameters . At the same time, we prefer model b2 because we had sufficient sample size to estimate all of the parameters in our model so choosing the model with fewer parameters was not viewed as an advantage . First, our results are based on a specific mri processing pipeline . In particular, the reported results regarding brain atrophy are based on analysis of bpf measured two channel (pd / t2 weighted mri) pipeline in which two variables (lesion volume and brain atrophy) are measured simultaneously, while other pipelines measure normalized brain volume using alternative approaches . To assess whether these results apply to other brain atrophy measures and processing pipelines, second, we were unable to assess the impact of protocol on the random effect variances due to the limited number of subjects who had repeated observations on the many protocols . Furthermore, we did not assess the potential role of changes in the post - processing pipeline . This may be especially relevant to the combining of existing datasets from multiple centers that have already been processed by different analysis pipelines . Thus, future work will be required to fully assess the range of deviations that may have an impact on the random effect distributions, which includes the inter - rater reliability of scan editing for both icc and final segmentation correction . Third, the presence of steroid treatment for a relapse at the time of the mri scan could have impacted the modeling of longitudinal change . Therefore, future work investigating the impact of steroids / relapses at the time of an mri scan in modeling the longitudinal change of bpf and t2lv is warranted . Our analysis only assessed the impact of protocol parameters described in table 2, but other potential sources of variability including scanner changes could have impacted the longitudinal changes . Therefore, the impact of other sources of variability on the modeling of longitudinal changes will be a subject of further research . In conclusion, we believe that our proposed models for both outcomes provide a good fit to the data . In light of these findings, future research pertaining to bpf and t2lv outcomes should carefully account for protocol in the analysis to ensure that the true disease trajectory of ms subjects can be assessed.
|
It affects most organ systems including skin, heart and blood vessels, bone, nervous system, and eye [1, 2]. The ocular manifestations of acquired syphilis are protean and syphilitic uveitis may be included in the differential diagnosis of any form of ocular inflammation . A classic treatment regimen for neurosyphilis with intravenous penicillin g has been considered successful in the treatment of syphilitic uveitis and resulting in good prognosis . The prevalence of syphilis in china has increased rapidly in recent years; however most reports in the literature on clinical features of syphilitic uveitis were from europe and the united states and only few reports were in chinese patients . In this study, we investigated the different manifestations and treatment effects of syphilitic uveitis in chinese patients . This is a retrospective case series of fifteen consecutive patients with syphilitic uveitis presenting at eye and ent hospital, fudan university, china, between may 2012 and april 2015 . This study was approved by the hospital ethics committee and all processes were in agreement with the declaration of helsinki . Written informed consent was obtained from the patients before collection of blood samples . The diagnosis of syphilitic uveitis was confirmed by positive serologic tests, including rapid plasma regain titer (rpr) and treponema pallidum particle agglutination assay (tppa). Anterior chamber (ac) cells and flare were graded on the ordinal scales and vitreous cells and haze were graded based on standard photographs developed by nussenblatt and associates, with the modification adopted by the sun working group [8, 9]. The gradings of vitreous cells, vitreous haze, and location of inflammation were made with the pupil dilated . Each patient underwent complete ophthalmologic examination including best - corrected visual acuity (bcva), slit - lamp biomicroscopy, applanation tonometry, ophthalmoscopy, and b - scan ultrasonography . Color and fundus fluorescein angiography (ffa) were obtained in each case except for patients whose fundus were blurred with dense vitritis . Optical coherence tomography (oct), electroretinogram (erg), and visual evoked potential (vep) were performed in selected patients . Concomitant systemic findings were collected including the presence of mucocutaneous lesions and human immunodeficiency virus (hiv) antibody status . All patients received the standard treatment for neurosyphilis, intravenous penicillin g at the dose of 1824 million units per day for 2 weeks, or an alternative regimen of intravenous ceftriaxone at a dose of 2 g per day for 2 weeks for those who are allergic to penicillin . All patients were followed by the same uveitis specialist and the follow - up time ranged from 6 months to 23 months . Any changes of ocular inflammation and visual acuity were recorded . At the end of treatment, ophthalmologic examination and the laboratory evaluation for syphilis the treatment was considered successful if the patients had no ocular inflammation in both eyes and serologic test of rpr was negative after completion of therapy . Fifteen patients with syphilitic uveitis were evidenced by ocular inflammation, positive rpr, and tppa tests . Nine patients (60%) were male and six patients (40%) were female . Serum rpr titers and tppa were positive in all patients (100%) at presentation . Rpr titers ranged from 1: 8 to 1: 256 and tppa were positive (1: 80). Coinfection with human immunodeficiency virus was detected in two male patients (13.3%) and one of them was homosexual . Of the fifteen patients, three (20%) had a history of oral ulcers, two (13.3%) had chancre, one (6.7%) suffered from headache, two (13.3%) had genital ulcers, and two (13.3%) had skin rash of secondary syphilis . The follow - up time ranged from 6 months to 23 months with a mean of 10.1 months (table 1). The duration of ocular symptoms before presentation ranged from 1 month to 18 months and the patients presented with active inflammation or chronic processes . Ocular involvement was bilateral in 11 patients (73.3%) and unilateral in 4 patients (26.7%). The main complaints were blurry vision in 15 patients (100%), redness in 7 patients (46.7%), floaters in 6 patients (40%), and ocular pain in 3 patients (20%). Twenty eyes (76.9%) had concomitant anterior chamber inflammation and mutton - fat keratic precipitates . Iris involvement may manifest as posterior synechiae in five eyes (19.2%) and iris nodules (busacca nodules within the iris stroma) in three eyes (11.5%). Eight eyes (30.8%) developed secondary cataract and five eyes (19.2%) had raised intraocular pressure (iop). Mild - to - severe vitreous opacities were observed in twenty - four eyes (92.3%). Three eyes (11.5%) presented with posterior placoid chorioretinitis, with circular, yellowish, outer retinal lesion (figure 1). Two eyes (7.7%) fifteen eyes (57.7%) had retinitis and retinal vasculitis (figure 2), and papillitis was evident in nine eyes (34.6%). Four eyes (15.4%) had cystoid macular edema (cme) and three (11.5%) had epiretinal membrane (erm). Serous retinal detachment and retinal splinter hemorrhage were seen in one eye (3.8%), respectively . The fundus was blurred in six eyes (23.1%) due to vitreous opacity, and retinal edema was detected in those eyes using b - scan ultrasonography . Signs and symptoms of all patients improved with systemic therapy for syphilis . After treatment, inflammatory cells in anterior chamber and vitreous body decreased and vision improved in all eyes (table 2). Best - corrected visual acuity at final visit ranged from 20/20 to 20/60, with a median of 20/32 . No patients were found to increase in the severity of uveitis following a jarische herxheimer reaction to treatment . Nine of the fifteen patients were diagnosed previously as other types of uveitis that led to a delay in treatment, and long - standing cystoid macular edema and optic neuropathy resulted in poor visual acuity (p <0.05). One patient relapsed after treatment and presented with a recurrence of chorioretinitis and concomitant anterior chamber inflammation during the follow - up . She received a new treatment cycle of intravenous penicillin g with topical corticosteroids and cycloplegic drops, and her final visual acuity was 20/25 in the right eye and 20/20 in the left eye, respectively . Syphilis has reemerged in china and the prevalence of syphilitic uveitis has increased markedly in the past few years [5, 12]. However most reports in the literature on clinical features of syphilitic uveitis were from europe and the united states and only few reports were from china . In this study, we summarized the clinically distinct features of syphilitic uveitis in chinese patients . Our data showed both male and female were almost equally affected and coinfection of syphilis with human immunodeficiency virus was uncommon . Misdiagnosis was common and the delay in treatment was associated with poor final visual outcomes . Although other series suggested that males were predominantly affected with syphilitic uveitis [4, 1315], our data showed both male and female were almost equally affected . Coinfection with hiv was also low in our cohort, compared to what reported in the literature . Vitreous cells were present in the majority of our patients, and involvements of retina and/or choroid were found in all eyes . Isolated anterior involvement was not found in our cohort; in contrast, in a singaporean population anterior uveitis was reported to be one of the most common manifestations of syphilitic intraocular inflammation . The difference could be partially due to frequent use of ffa in our series, as ffa can help to identify vasculitis, which may not be visualized by fundus exam . The most common manifestations were retinal vasculitis and papillitis, which were in accordance with previous studies . Acute syphilitic posterior placoid chorioretinitis (asppc) was previously reported as a distinctive ocular manifestation of syphilis infection [2, 16, 17] and was identified in a few cases in our series . Asppc has been postulated to be the result of an active inflammatory reaction at the level of the choriocapillaris - pigment epithelial - retinal photoreceptor complex . Eyes with asppc typically presented as yellow - white, placoid, circular, or oval lesion in the macular or extramacular area at the level of rpe (figure 1(a)). Fundus fluorescein angiography revealed early - phase hypofluorescent or faint hyperfluorescent central lesion and staining in the later frames (figures 1(b), 1(c), and 1(d)). Although the incidence of hiv coinfection was previously reported higher in patients with asppc (nearly 40%), none of the patients with asppc in our cohort were found to be hiv positive . . The opacities could be mild or severe, and multiple scattered preretinal vitreous opacities were characteristic, which can be recognized to assist early diagnosis . Syphilitic uveitis is one of the few ocular entities that can be cured with appropriate antimicrobial therapy . As the eye is an extension of the cns, ocular syphilis should be treated as neurosyphilis, and the classic treatment regimen for neurosyphilis was intravenous penicillin g . In our study, when a course of penicillin g was completed, ocular inflammation decreased in all patients and best - corrected visual acuity improved significantly . Severe ocular inflammation such as vasculitis or dense vitritis or papillitis may not lead to permanent visual impairment when appropriately treated . The patients with prompt treatment had complete functional and morphological recovery with good visual acuity and normal fundus appearance at final visit . Nine patients in our study were misdiagnosed and treated as noninfectious uveitis prior to visiting our center, and the delay in diagnosis and treatment led to long - standing cystoid macular edema and optic neuropathy, which associated with poor visual acuity . Therefore, early diagnosis and prompt treatment of syphilis are important and any delay may increase the risk of severe ocular complications and irreversible visual loss . Syphilis uveitis is one of the so - called masquerade syndromes in its ability to mimic various diseases such as atypical presentations of vogt - koyanagi - harada disease, viral retinitis, sarcoidosis, tuberculosis, and intraocular lymphoma . Although the presentation may be various in different patients, certain features were characteristic for syphilitic uveitis, such as posterior placoid chorioretinitis and dense preretinal vitreous opacity . In addition, seven patients in our study had a history of mucocutaneous manifestation of syphilis, which was useful in differentiating this condition clinically from other types of uveitis . Sixty percent of the patients in our cohort were misdiagnosed, which was much higher than previously reported . It is necessary to reemphasize the importance to include syphilis uveitis as differential diagnosis for any form of ocular inflammations, especially posterior uveitis and pan - uveitis . Syphilitic uveitis is an important clinical entity in china and various presentations may make early diagnosis difficult . In our cohort, both male and female were almost equally affected, and coinfection of syphilis with human immunodeficiency virus was uncommon . All patients in this study had posterior involvement and the most common manifestations were retinal vasculitis and papillitis, while isolated anterior uveitis was rare . Characteristic acute posterior placoid chorioretinitis and preretinal vitreous opacities were identified in a few cases . Associated systemic involvement consisting of headache and mucocutaneous manifestations . Timely diagnosis and appropriate treatment are crucial for visual prognosis and any delay in treatment of syphilitic uveitis was associated with poor visual prognosis.
|
In vivo, the biologically active form of dna in prokaryotes is negatively supercoiled . The amount of superhelical stress imposed on the dna is determined by the levels of competing dna topoisomerase enzyme activities, and by local events such as protein binding or dna transcription (13). Transient changes in the level of global dna supercoiling have been observed with several types of environmental stress, including heat shock, cold shock, ph changes, osmotic shifts, transitions from aerobiosis to anaerobiosis and starvation (1,2). Along with these changes in stress level, the expression patterns of the bacteria involved were observed to be dramatically altered (46). Reactions occurring on the dna template, including transcription and replication, also affect the local level of supercoiling . When rna polymerase threads through the dna template, it pushes a wave of positive supercoils ahead, and leaves a trail of negative supercoils behind (3,7). One way in which negative superhelicity can influence regulation is through the destabilizing effect it has on the double helix at susceptible locations within the sequence . Destabilization by even a few kilocalories, far less than would be required to open the duplex, can have a profound effect on the ability of a regulatory molecule to unpair the dna, as is required for the initiation of transcription or replication . In this manner experiments have shown that stress - induced duplex destabilization plays essential roles in the transcriptional regulation of several genes (810). We have developed computational methods that evaluate the patterns of stress - induced dna duplex destabilization (sidd) in dna sequences (11,12). These analyses predict the locations where the dna duplex becomes susceptible to separation when under superhelical stress . All conformational and thermodynamic parameters are given their experimentally measured values, so there are no free parameters in these analyses . Despite this, their results are in quantitative agreement with experiments in all cases where experimental information is available . When the entire escherichia coli genome is analyzed in this way, the sites that are predicted to be easily stress - destabilized are found not to be distributed at random . Instead, these sidd sites are highly enriched in those intergenic regions that are known or inferred to contain promoters, and occur infrequently in coding regions (13). Both components of this pattern have very high statistical significances . The frequency of sidd sites in intergenic regions separating convergent open reading frames (orfs), which are inferred not to contain promoters, are consistent with random . A similar pattern of sidd sites avoiding coding regions and being enriched in intergenic regions was noted in yeast, although there the strongest sidd sites were in the terminal flanks of genes, not in their promoters (14). Our most recent studies also indicate that those genes in e.coli whose promoters have strong sidd sites are clustered in certain functional groups such as transcription regulators, transport and membrane proteins . It is interesting that many known supercoil - responsive genes and environmental stress - responsive genes have highly destabilized sites in their upstream 5 flanks . Sidd sites have been shown to be important functional elements in regulating transcriptional initiation, transcriptional termination and other biological activities . In e.coli, activation of both the ilvpg and leuv promoters are mediated by similar mechanisms involving a binding - induced translocation of superhelical tension from a sidd site to the promoter (8,9). This translocated superhelical tension facilitates the formation of the open initiation complex by unwinding the dna duplex in the promoter region . In humans, the initiation of transcription of the c - myc gene is regulated by the binding of fbp to a highly destabilized sidd site (15). Sidd sites also have been implicated in transcriptional termination and chromosomal matrix attachment in yeast (16). These and other results show that sidd is an essential component of regulatory mechanisms for a variety of biological activities . It is important to understand that sidd properties are not simply reflections of the underlying thermal stability of the sequences involved . Stresses couple together the destabilization behaviors of all base pairs that experience them this leads to much more complex, interactive behaviors than that occur with thermal melting . [see figures 1 and 2 of ref (17).] Here we describe the database we are compiling of the sidd profiles of microbial genomes . Accessible over the web at, it gives users an overview of the sidd sites in their selected genome, and their positions relative to the annotated genes . This information will facilitate the identification of regulatory elements, such as promoter - containing regions, in the genomic sequence . In addition, the original sidd profiles (raw data and graphs) can be visualized and made available for downloading . The refseq sequences of the analyzed microbial genomes were downloaded from the nih microbial website . In all cases the protein gene products are classified into functional categories according to the information in the clusters of orthologous groups (cog) database (18). Our research group has developed three algorithmic strategies to evaluate the equilibrium distribution of states of destabilization of a short dna sequence in response to negative superhelicity (12,19,20). These methods can calculate the probability of opening of each base pair in the sequence . One algorithm also calculates the incremental free energy g(x) needed to guarantee opening of the base pair at position x. this can be done for each base pair in the sequence . Strongly destabilized sites require little or no extra free energy to open, so their values of g(x) are near zero . Sites that remain virtually as stable as they would be in relaxed conditions (which is the majority of the genome) have g(x) near 10 kcal / mol . Partially destabilized sites these methods have been extended recently to enable the analysis of long dna sequences, and successfully applied to the complete genome of e.coli (13,17). (for detailed information on the algorithms and the methods for analyzing their results, please refer to the cited publications .) The sidd analysis of complete microbial genomes has been semi - automated on a 38 node apple cluster . All sidd profiles were calculated at superhelical density = lk / lk0 = 0.06, a moderate physiological value . The results from the calculations were manually reviewed for integrity, then their global characteristics were analyzed by a set of perl scripts and c++ programs . The results were directly channeled to a postgres database for storage, visualization and further analysis . As of the present (september 8, 2005) there are 134 analyzed microbial genomes in this database, 118 from bacteria and 16 from archaea . We update the database whenever the sidd analysis of another fully sequenced genome is completed, so the number of analyzed genomes will rise in the future . For each analyzed genome each sidd site in the graph is a set of contiguous base pairs for all of which g(x) <8 kcal / mol . These sidd sites were binned into disjoint sets according to the minimum value gm that g(x) attains within them . The lowest bin is determined by gm 0, and the other bins contain the sidd sites satisfying i1 <gm i for i = 1,, 6 . A color map scheme is used to represent these binned sidd sites . The sidd sites in all the fully analyzed bacterial genomes have a similar pattern of distribution to that reported previously for the e.coli genome (13). Strong destabilization preferentially occurs in the intergenic regions separating divergently (div) or tandemly (tan) transcribed orfs, while avoiding coding regions . Destabilization in intergenic regions separating convergently transcribing orfs (con), which may be inferred not to contain promoters, is consistent with random . This trend is clearly demonstrated in figure 2, which summarizes data from the analysis of sidd locations in 42 bacterial genomes . For each genome in the siddbase database we provide a table summarizing the number of sidd sites at each level of destabilization, and the number of these that occur in the three types of intergenic regions div, tan and con . Systematic analysis is underway to compare the sidd properties of different strains of the same species, between different phylogenetic groups of the same kingdom and between different kingdoms . One also can display detailed sidd information for any specific region of interest, as shown in figure 3 . These requests can be made by clicking on a region of the circular map, or by specifying the site either by identifying an annotated gene it contains or by its chromosomal location . The figure displayed is a plot of the oriented genes in a 10 kb window centered on the requested position, together with the locations of the sidd sites in the region . The genes are labeled, their orientations are shown by arrowheads, and they are color coded according to their cog classification . X.) The end of an arrowhead corresponds to the stop codon position of a gene . The sidd sites are shown as colored bars, coded according to their gm values, and displayed below the line showing the annotated genes . The graph of the sidd profile of a 5 kb long region centered on a sidd site can be viewed by clicking on the color bar corresponding to that site . While the sidd calculation for an entire bacterial genome is time consuming, calculations for short dna sequences (viz 5 kb) can be executed efficiently . We have provided a website where users can calculate sidd profiles of short sequences of interest to them . There one can set some of the calculation parameters, including the assumed superhelix density . It should be noted that the results calculated from the web server may not necessarily be identical as the ones displayed on this database, even when the sequences and the parameters are the same . The sidd profile of a dna segment in this database was calculated in its native global genomic context, while the results from the web server calculation were not . The current database only contains sidd profiles of complete genomes from prokaryotes and archaea . In the future we also will deposit the results of sidd analyses for eukaryotic genomes . Initially this will be yeast, at least one complete chromosome from each fully sequenced eukaryote, and the encode regions of the human genome . We intend eventually to include the sidd profiles of the complete genomes of all fully sequenced model organisms . We will also provide sidd profiles of specific prokaryotic genomes at several superhelical densities . We will add further functionalities to the database as these are developed, including sidd - based (or sidd - assisted) promoter predictions . We will continue to analyze more microbial genomes as their sequences are completed, and we will periodically update our analyses in response to significant changes in ncbi refseq sequences . The genes are plotted in the inner circle, color coded according to their cog classifications as shown in the gene color map . The sidd sites are shown in the outer circle, color coded according to their minimum sidd energy as shown in the sidd color map . The ratio of the observed number of sidd sites to the number expected if they were located at random . This ratio has been calculated for sidd sites that overlap intergenic regions whose flanking orfs are in any of three orientations (div, divergent; con, convergent; and tan, tandem), and also for those that occur within coding regions . These results were calculated from the sidd profiles of 42 bacterial genomes that were chosen to represent the phylogenetic diversity of sequenced genomes and the range of at / gc ratios . The x - axis is the sidd level; the y - axis is the ratio of predicted sidd sites found in the regions to the expected number of such sites if they were located at random . This shows that the pattern reported previously in e.coli k12 occurs throughout the sequenced prokaryotes . This view is obtained from the window of figure 1 by clicking on a gene, or by entering a gene name or chromosomal location into the appropriate field . The genes are annotated, and the sidd sites are displayed as colored bars belowthe line . Clicking on a sidd color bar gives an annotated sidd profile centered on that region, as shown.
|
The importance of parasites in shaping community structure and influencing ecosystem functioning in the marine environment has gained considerable recognition over the past few decades (dobson and hudson, 1986, poulin, 1999, poulin et al ., 2016). Parasites have complex roles in community ecology by influencing population sizes and shifting patterns in both biodiversity and community structure . Parasites can also alter the outcome of competitive interactions, either by enabling rare species to coexist with dominant ones or by helping to eliminate competitors . Additionally, parasites have become increasingly recognized as important components of trophic pathways (see demopoulos and sikkel, 2015). The inclusion of parasites in food webs has revealed higher connections among species (amundsen et al ., 2009) and higher trophic efficiency (arias - gonzlez and morand, 2006). Although the importance of parasites in marine ecosystems is clear, there is still much to be learned regarding the multiple effects that parasites have in different ecosystems throughout the marine realm . A recent review regarding the synergy of marine ecology and parasitology highlighted seven key areas to further increase our understanding of the importance of parasites in marine ecosystem functioning (poulin et al ., 2016). (2016) emphasized the need to discover and identify key parasite species that play pivotal roles in ecosystems, while adding new model systems to broaden perspectives on marine parasitism . Because the majority of marine parasitology studies have been conducted in coastal and coral reef ecosystems, it was also suggested that research should be expanded to additional marine habitats . Focusing on a narrow range of habitats can constrain generalizations regarding parasitism in the marine environment (poulin et al ., the deep sea is one such understudied ecosystem in which data on parasitism remains limited . For fishes inhabiting the deep sea, knowledge of parasitism is limited to <10% (klimpel et al ., 2006). The few studies on parasitism in deep - sea fishes have focused mainly on the prevalence of endoparasitism (noble, 1973, campbell et al ., 1980,, 2006, palm and klimpel, 2008), revealing the importance of temperature, depth, and habitat (such as submarine canyons) in influencing the prevalence of endoparasite infections in the deep sea (manter, 1934, campbell et al ., 1980, gartner and zwerner, 1989, marcogliese, 2002, klimpel et al ., however, deep - sea fishes are also hosts to ectoparasites, which can adversely affect fishes by causing anemia (adlard and lester, 1995, lester et al ., 1995), tissue damage (adlard and lester, 1995, lester et al ., 1995), scarring (ross et al ., 2001), and behavioral changes (e.g. Welicky and sikkel, 2014, artim et al ., 2015), while transmitting other diseases [e.g., blood parasites, (davies and smit, 2001), viruses (lawler et al ., 1974)]. Ectoparasitism may thus influence population dynamics of deep - sea fishes and may be important in trophic ecology through direct consumption by other organisms (johnson et al . Yet, ectoparasitism remains understudied, partly because prior data have been obtained opportunistically from trawling and dredging efforts . These types of gear can dislodge ectoparasites from their hosts during collection (ross et al ., 2001). To investigate ectoparasitism in the deep sea, direct observations using remotely operated vehicles (rovs) provide an alternative method to trawling . Visual based surveys have provided a considerable amount of information on ectoparasite - host interactions in shallow waters, while revealing effects of parasitism on fish behavior (e.g., swimming behavior, site fidelity, barber et al ., 2000, trophic connections have also been determined from in situ observations (i.e., cleaner stations on coral reefs, sikkel et al ., 2004). Thus, the value of visual analysis in parasite studies, from shallow waters to the deep - sea, is clear . Recent expeditions to survey various seafloor features along the continental margin of the northeastern united states (neus) provided an opportunity to increase knowledge of ectoparasites infecting demersal fishes in the deep sea . Visual observations from rov surveys were used in the present study to identify ectoparasites and their hosts and examine whether ectoparasite diversity declines with increasing depth . We also examined whether ectoparasite - host interactions and intensity of infections differ among depths and habitats in each of three common fish species [antimora rostrata (family moridae), nezumia bairdii (family macrouridae), and synaphobranchus (family synaphobranchidae)]. The high - definition video obtained from these expeditions enabled in situ observations of host - parasite interactions while providing unparalleled, high - resolution images of ectoparasites infecting fishes in the deep sea . Forty - three remotely operated vehicle (rov) dives were conducted with the rov deep discoverer (d2) along the neus continental margin and new england seamount chain during two expeditions (9 july to 16 aug 2013 and 19 sep to 6 oct 2014) aboard the noaa ship okeanos explorer (fig . 1). These expeditions were telepresence - enabled, with live video feeds transmitted back to shore in real time (http://oceanexplorer.noaa.gov/okeanos/media/exstream/exstream.html), allowing scientists on shore and on the ship to interact during the dives via an internet chat room and satellite teleconference line . The rov d2 was equipped with two high - definition cameras and 16,600 lumens of hydraulically positioned led lights . A sea - bird 911 + conductivity - temperature - depth (ctd) logger with a dissolved oxygen (do) sensor paired lasers (10 cm apart) were positioned on the rov to approximate field of view and sizes of fishes and ectoparasites . The okeanos explorer followed the vehicles using dynamic positioning and tracked vehicle position with an ultra - short baseline tracking system . Each rov dive traversed one broad - scale habitat feature at depths ranging from 494 to 4689 m (fig . 1). These habitat features included: submarine canyons (25 dives), cold seeps (three dives), open slope / intercanyon areas (seven dives), and seamounts (eight dives). No fishes were observed during one dive at the deepest seamount surveyed (un - named seamount, 45524689 m). As the rov traversed a habitat feature (0.10.2 knots, 1 knot = 0.514 m s), the cameras were generally set on wide - angle view, but zooms were frequently conducted to obtain detailed imagery of each previously undocumented species encountered during a given dive survey . The over - ground distance covered by the rov [measured in arcgis v9 (esri)] varied across dives (3002200 m), but the observation time on bottom was approximately the same (57 h per dive). During each dive, video clips (103191clips) from the high - definition camera mounted on the rov d2 were contiguously acquired as part of the mission of the expeditions . These video clips ranged in length from approximately 30 s to 5 min . Sixty - nine demersal fish taxa and three mesopelagic taxa were identified using both frame grab and video observations (see quattrini et al ., 2015). Ectoparasites were identified to the lowest taxonomic level on fishes from all available frame grabs . Ectoparasite type, placement, number and size also ensured that individuals were counted only once . Because we restricted this analysis to using frame grabs only, we calculated frequency of ectoparasite - host interactions to examine general patterns across the region . Three species of fishes (antimora rostrata, n. bairdii and synaphobranchus spp .) That were dominant in the region and had ectoparasites were further enumerated using all video clips . The average intensity of infection (number per one side) was estimated for these species using individuals imaged during times when the camera was positioned to permit accurate counts . Although gnathiid parasites were common, these could not be consistently identified on all individuals due to the wide camera view . Thus, estimates provided herein for this taxonomic group are conservative and many parasites labeled as unknown may in fact be gnathiids . For each dominant fish species, abundances of ectoparasite - host interactions were estimated by taking the total number of hosts observed with at least one ectoparasite during a dive and dividing by the product of the total over the ground distance covered by the rov and the estimated field of view (4.3 m). Depth zones were binned into 300 m depth intervals from 500 to 3200 m, except the last depth zone ranged from 2900 to 3262 m. a single dive may have traversed across two depth zones, but only across one broad - scale habitat feature . A kruskal - wallis (k - w) test was used to determine if hosts or ectoparasite - host interactions were significantly more abundant within a particular depth range or habitat . Following other deep - sea studies (e.g., davies et al ., 2008, doughty et al ., 2014), only dives in which each of the dominant species was present were included in these tests . All statistical tests were conducted in r v 3.1 (r core team ., 2015; http://www.r-project.org). A total of 125 adult fishes [out of 1429 individuals confirmed with or without ectoparasites] representing at least 25 species [out of 69 demersal species (quattrini et al ., 2015) and three mesopelagic species] from 18 families were observed hosting at least five families of ectoparasites (table 1). The isopoda (aegidae, cymothoidae, gnathiidae) was the most common group of ectoparasites observed, infecting 74 individual hosts . An additional 29 individual hosts were infected with ectoparasites that could not be identified; however, many were possible gnathiids . Gnathiids were the most common ectoparasite observed across species, infecting at least 19 species (table 1). Hoplostethus mediterraneus hosted a cymothoid isopod (table 1, table 2). Siphonostomatoid copepod parasites were observed on at least four host species: a. rostrata, diaphus sp . Two families of siphonostomatoid copepods were identified on three species of fishes (fig . Copepods from the family lernaeopodidae, sized at approximately 13 cm total length (tl), were observed on a. rostrata (fig . Copepods were attached to anal fins, below second dorsal fins, and behind the eyes . At least two species (likely lophoura spp .) From the family sphyriidae infected synaphobranchus spp . The copepods (23 cm tl) infecting n. bairdii were attached directly behind the dorsal fin, whereas larger copepods (45 cm tl) infecting synaphobranchus spp . Unidentified siphonostomatoid copepods were observed (2 cm tl) on mesopelagic fishes, including two diaphus sp . Hyperparasitism was observed on n. bairdii, with each sphyriid copepod infected by at least three to eight leeches (fig . Of the three families of isopods that infected demersal fishes, gnathiids were the most common, with 1 to 45 individuals infecting at least one side of each individual fish . Gnathiids were translucent, attached to all fins, heads, and sides of bodies (fig . 2h), and ranged in size from 1 to 3 mm tl . One large (2.5 cm tl) aegid was attached mid - way on the body of a. radiata, at the juncture of the left pectoral wing and the central disk (fig . The other fish individual had at least 15 smaller (12 mm tl) aegids attached to both the wings and the central disk . Each aegid (23 cm tl) was attached behind the dorsal fin (fig . One cymothoid isopod (4 cm tl) was observed attached on the side of the body below the dorsal fin of h. mediterraneus (fig . Ectoparasite - host interactions were documented during 36 dives across the entire study region at depths ranging from 494 to 3262 m (temperature 5.6 to 2.6 c, dissolved oxygen 3.65.6 ml observations of host - ectoparasite interactions were more frequent in canyons (66%, n = 23 dives) than in open slope (23% n = 7 dives), cold seep (7%, n = 3 dives), and seamount (4%, n = 3 dives) habitats (fig . 1). Of the six seamounts where fishes were observed (<20 individuals per dive), ectoparasites (gnathiids) were observed on five individuals, one individual each on kelvin and retriever seamounts and three individuals from mytilus seamount, at depths ranging from 2035 to 3260 m (fig . 1, table 2). The number of species infected with parasites was similar among open slope (6 spp), seamount (4 spp . ), and cold seep (4 spp .) Frequencies of ectoparasite - host interactions ranged from 2 to 34%, with the most frequent observations in 8001100 m and 11001400 m (table 2). Few (n = 8) ectoparasite - host interactions were observed in the deeper areas (> 1700 m) (table 2). The number of host species infected with parasites was highest at depths of 8001100 m (n = 12 species), followed by 11001400 m (n = 11 species), and then declined with increasing depth (table 2). Species richness of ectoparasites was similar among habitats, but declined with deeper depths (table 2). Siphonostomatoid copepods were observed in canyon, cold seep, and open slope habitats at depths down to 1400 m. aegids were observed in open slope and canyon habitats at depths down to 1100 m. one cymothoid isopod was observed in a canyon habitat at a depth of 739 m. gnathiids were observed in all habitats and at the deepest depths surveyed (down to 3300 m). Out of the three common species enumerated on video, antimora rostrata (n = 97 adults, n = 29 dives) was observed with parasites most frequently . We positively identified ectoparasites on 33% of all observed a. rostrata (2540 cm tl). Of the individuals confirmed with parasites, 88% were infected with gnathiids and 12% were infected with lernaeopodid copepods (fig . 3, table 1). 3). For the remaining 55% (n = 53) of individuals, it could not be determined whether or not individuals had ectoparasites because individuals in the video were too far from the camera to confirm whether or not ectoparasites were present . The average number of parasites infecting a single side of an individual was 7.72 1.89 se parasites (n = 26 individuals, 1 to 45 ectoparasites per individual). The most intense infections (9.05 2.39 se ectoparasites per side) were observed on individuals in canyon habitats, particularly at depths ranging from 1100 to 2000 m (table 3). Although prevalence of infections did not differ (k - w, x = 0.14, p = 0.93) among the three dominant species, the infection intensity was significantly higher (k - w, x = 14.78, p = 0.0006) in a. rostrata than in the other species . Antimora rostrata was observed at depths ranging from 810 to 2718 m. this species was most abundant at depths of 1100 to 1400 m (0.029 0.010 se individuals 10 m) followed by 1400 to 1700 m (0.027 0.009 se individuals 10 m) (fig . Although ectoparasite - host interactions (0.010 0.006 se interactions 10 m) were slightly higher at 800 to 1100 m, there were no significant differences in ectoparasite - host interactions among depth zones (k - w, x = 4.28, p = 0.63, fig . Only two individuals were infected with gnathiid parasites depths> 2000 m. among all habitats, a. rostrata was most abundant in cold seeps (0.020 0.009 se individuals 10 m, fig . 5, fig . A. rostrata was most abundant during a single dive at a cold seep site (0.37 individuals 10 m, 14121474 m depth). Here, only 0.004 ectoparasite - host interactions 10 m was estimated . The greatest number (0.005 0.001 se interactions 10 m) of ectoparasite - host interactions was in submarine canyons, but interactions were not significantly different among habitats (k - w, x = 5.56, p = 0.13, fig . 5a). The highest abundance (0.13 interactions 10 m) of ectoparasite - host interactions during a single dive was from heezen canyon (16941722 m), where the abundance of a. rostrata was 0.018 individuals 10 m. for n. bairdii (n = 153 individuals, n = 24 dives), we positively identified ectoparasites on 12% of all individuals (1525 cm tl), while 25% of n. bairdii individuals had no ectoparasites . Of the individuals confirmed with parasites, 42% were infected with gnathiids, 26% were infected with aegid isopods, 21% were infected with sphyriid copepods, and 11% had unidentified parasites (table 1, fig . 3). For the remaining 63% of individuals, it could not be determined whether or not individuals hosted parasites . The average number of parasites infecting a single side of an individual was 2.15 0.52 se parasites per side (n = 13 individuals, 1 to 7 ectoparasites per individual). The highest intensity of infections (2.67 0.92 se ectoparasites per side) on n. bairdii occurred in open slope / intercanyon habitats (table 3). While n. bairdii was observed at depths of 500 to 1860 m, this species was most abundant (0.035 0.007 se individuals 10 m) between 1100 and 1400 m. however, ectoparasite - host interactions were not significantly different among depth zones (k - w, x = 7.57, p - value = 0.11) (fig . Ectoparasite - host interactions also did not differ among habitats (k - w, x = 1.92, p = 0.38, fig . 5, fig . (n = 6 dives, open slope) to 0.038 individuals 10 m (n = 1 dive, cold seep). During a single dive, n. bairdii was most abundant (0.054 individuals 10 m) in okeanos canyon at depths ranging from 1360 to 1500 m; yet no individuals had ectoparasites at this site . The greatest number of individuals with ectoparasites (0.009 interactions 10 m) was during a single dive in phoenix canyon at depths ranging from 1035 to 1172 m. here, abundance of n. bairdii was 0.041 individuals 10 m. the cutthroat eel, synaphobranchus spp . Was the most abundant species observed (n = 1785 individuals, 33 dives) across the study area, but had the fewest ectoparasites . (2550 cm tl), whereas 68.2% of synaphobranchus individuals had no ectoparasites . Of the individuals confirmed with parasites, 32% were infected with sphyriid copepods, 2% were infected with gnathiids, and 48% had unidentified parasites (fig . 3). For the remaining 30.4% of individuals the average number of parasites infecting a single side of an individual was 1.45 0.21 se parasites per side (13 ectoparasites per individual). The most intense infections (2.00 0.25 se ectoparasites per side) were in canyon habitats (table 3). Was observed at depths ranging from 500 to 2025 m and was most abundant (0.256 0.074 se individuals 10 m) at depths of 1100 to 1400 m. ectoparasitism, however, was slightly more abundant at 800 to 1100 m, but not significantly higher (k - w, x = 4.20, p = 0.52) than other depth ranges (fig . Although synaphobranchus spp . Were abundant in open slope habitats (0.165 0.083 se individuals 10 m), ectoparasite - host interactions did not differ among habitats (k - w, x = 0.79, p = 0.67, fig . 5, fig . Ectoparasite - host interactions ranged from 0.002 0.001 to 0.003 0.003 se individuals 10 m in open slope, canyon, and cold - seep habitats . During a single dive, both the highest abundances of synaphobranchus spp . (0.68 individuals 10 m) and ectoparasite - host interactions (0.014 individuals 10 m) were observed in phoenix canyon at depths ranging from 1000 to 1170 m. no notable differences in behavior were observed for the majority of fishes infected with ectoparasites, particularly those infected with gnathiids . Most of the individuals appeared to be either resting on the bottom [e.g., a. radiata, bathysaurus ferox, cottunculus thomsonii] or swimming normally (e.g., sharks, chimaeras, ophidiids, morids, macrourids, synaphobranchids) either close to or just a few meters above the seafloor . Only a few of the fishes that had large ectoparasites appeared to be behaving abnormally . One n. bairdii individual with a sphyriid copepod hyperparasitized by eight leeches (fig . 2c) appeared to be underweight than other individuals of similar total lengths (15 cm tl). This individual was observed swimming in circles and appeared to be leaning towards one side (suppl . One hoplostethus mediterraneus with a large cymothoid isopod on its left side was observed making short, erratic movements using its pectoral fins . Finally, one synaphobranchus individual with a large (5 cm tl) sphyriid copepod was swimming so close to the seafloor that both host and copepod were in contact with the sediment, perhaps increasing the chance for parasite removal . Although rov lights and noise can alter individual fish behavior (stoner et al ., 2008), abnormal swimming behaviors were likely not an effect of the rov because these behaviors were not observed in numerous uninfected individuals . The following is the supplementary data related to this article: video s1nezumia bairdii with a sphyriid copepod hyperparasitized by eight leeches (phoenix canyon, 8001100 m depth). Video recorded by rov d2 during the noaa okeanos explorer program, 2014 atlantic canyons and seamounts expedition . Nezumia bairdii with a sphyriid copepod hyperparasitized by eight leeches (phoenix canyon, 8001100 m depth). Video recorded by rov d2 during the noaa okeanos explorer program, 2014 atlantic canyons and seamounts expedition . Rov video provided remarkable observations of ectoparasite infections on deep - sea fishes . These observations enabled us to determine that ectoparasitism occurs across a variety of depths (5003300 m), habitats (seamounts, canyons, cold seeps, open slope), and host species (25 species) along the northeastern u.s . We found that the abundance of ectoparasite - host interactions and intensity of infections peaked within particular depths and habitats depending upon the host species examined, but that submarine canyons may enhance ectoparasitism . We also found that species richness of ectoparasites declined with depth; only gnathiids were observed at the deepest depths surveyed . Thus, our results strengthen the notion that as temperature decreases (poulin and rohde, 1997) and the number of host species decline (campbell et al ., 1980) with increasing depth, the diversity of host - ectoparasite interactions decreases as well . We also note that, at least at the family level, ectoparasites infecting demersal fishes appear to be both generalist (gnathiids, infecting 19 host species) and specialist (copepods, aegids, and cymothoids, each infecting 12 host species) species, likely due to differences in parasite life cycles . Although our estimates of ectoparasite diversity are conservative, as species cannot be identified without collections, our study demonstrates the utility of using an rov to observe and count ectoparasite - host interactions across a variety of depths, habitats, and host species, while providing the opportunity to examine in situ the impact of ectoparasite infections on fish behavior . Ectoparasitism was widespread across fish species, with 18 families of teleosts and chondrichthyans observed with ectoparasite infections . Many ectoparasites have benthic life stages (e.g., smit and davies, 2004) and thus would more likely encounter a demersal fish host than a mesopelagic host . The majority of fish species harboring ectoparasites were both relatively abundant in the region and/or were habitat generalists (auster et al . Thus, the number of ectoparasite - host interactions could be a consequence of the host population size or the host adopting a generalist strategy by utilizing a wide range of niches, including food resources and habitats . Other host behaviors, such as spawning (e.g., scyliorhinids) or feeding on the benthos (e.g., n. bairdii, campbell et al ., 1980) or aggregating (a. rostrata, iwamoto, 1975), may also increase ectoparasite infections (boxshall, 1998). Our study also revealed that demersal lifestyle alone, of hosts, was not sufficient to explain ectoparasite infections . The number of demersal host species (24 species) with ectoparasites constituted approximately one third of all demersal species (69 species) observed across the same depth range in the region (table s1, quattrini et al ., 2015). Although ectoparasite - host interactions may be underestimated, our results are comparable to those documented from deep - sea fishes (to 1000 m) collected off australia using surface - deployed gear (e.g., traps, trawls) (rohde et al ., 1995). The absence of ectoparasites on several species might provide evidence of unoccupied niches for the ectoparasites (rohde et al ., 1995). Alternatively, the absence of ectoparasites could be a result of a fish's resistance to infection (e.g. Mucous production, skin / scale resiliency, coile and sikkel, 2013), rarity of the fish host (boxshall, 1998) or fish behavior (boxshall, 1998). The intensity of infections and the abundance of ectoparasite - host interactions was not a function of host abundance . Ectoparasitism was not most abundant where both n. bairdii and a. rostrata were locally most abundant . Furthermore, synaphobranchus spp . Was the most abundant species observed; yet ectoparasitism was relatively low in this species compared to the others . Additionally, among the three dominant species, the infection intensity was highest in a. rostrata, yet all three species were common across depths and habitats and all are generalist feeders . Scavenge (collins et al ., 1999, jamieson et al ., 2011) or feed on benthopelagic species and n. bairdii feeds mainly on benthic invertebrates (campbell et al ., 1980, perhaps the higher intensity of infections on a. rostrata relate to movement and/or aggregation of individuals (boxshall, 1998) for reproduction (iwamoto, 1975, wenner and musick, 1977). Aggregating at a single, dominant spawning site or undergoing periodic re - distribution during reproduction (white et al . Higher infection intensity in a. rostrata may also be due to reduced resistance to infection . Gnathiids could perhaps more easily penetrate a. rostrata, as this species has relatively large, overlapping cycloid scales . In addition to the ecology and biology of the host species, the ecology and life history traits of the ectoparasites also influence prevalence, specificity, and intensity of infections . Compared to the other ectoparasite families, gnathiids infected a variety of host species (19 spp .) Across the entire depth range . A single species of gnathiid is known to infect numerous host species in shallow waters (e.g., coile and sikkel, 2013). Life history characteristics of gnathiids likely increase their ability to infect a variety of species and more than one host species in their lifetime (lafferty and kuris, 2002, jones et al . Although the three larval stages of gnathiids are obligate fish parasites, between each stage, larval gnathiids return to the benthos (e.g., sponges, corals, serpulid tubeworms, tunicates, sediments, among rocks, wood) to molt until infecting another species or until the final, non - feeding adult stage (mouchet, 1928, stoll, 1962, upton, 1987, jacoby and greenwood, 1988, klitgaard, 1991, smit et al ., 1999, thus, gnathiids may have been so successful at colonizing, with high intensity, a diversity of host fishes from shallow waters to the deep sea because of attributes of their life cycle . In contrast to gnathiids, siphonostomatoids, aegids, and cymothoids isopods are known to be highly host specific (wilson, 1919, ho, 1985, boxshall, 1998, bunkley - williams and williams, 1998, ross et al ., 2001). In our study, siphonostomatoid copepods and aegid and cymothoid isopods infected four, two, and one species, respectively . For cymothoids and copepods, free - living juvenile stages attach to hosts and remain on the host for life until reproduction (boxshall, 1998, bunkley - williams and williams, 1998). Although these ectoparasites have reproductive strategies that would help them complete their life cycle in the deep sea [e.g., males parasitizing females (copepods, boxshall, 1998) and hermaphroditism (cymothoids, bunkley - williams and williams, 1998)], specializing on only a few host species may help increase encounter rates of male and females during periods of sexual reproduction . In contrast, aegids are temporary parasites, changing hosts during their lifetimes by settling on the benthos until infecting another species (bunkley - williams and williams, 1998). This behavior may result in higher infection rates of demersal fishes that feed on the benthos, such as n. bairdii and a. radiata (e.g., campbell et al ., 1980). Based on previous research, ectoparasites from the host - specific families observed in this study were most likely different species . Leptodactylus gracilis has been reported from s. kaupii (wilson, 1919) whereas leptodactylus pentaloba and leptodactylus bouvieri have been reported from n. bairdii (wilson, 1919, ho, 1985). Parabrachiella pinguis is the only lernaeopodid that has been reported from a. rostrata in the neus region (wilson, 1915, ho, 1985). Sarcotretes scopeli (family pennellidae) is the only copepod recorded from myctophids in the atlantic (gartner and zwerner, 1989, boxshall, 1998). As for the isopods, the aegid syscenus infelix has been reported from n. bairdii along the neus slope (ross et al ., 2001). Aega psora is the only aegid recorded from antimora radiata, documented only once in the bay of fundy (wallace and huntsman, 1919). One cymothoid was observed in this study, and to our knowledge constitutes the first record of ectoparasitism on h. mediterraneus . Few cymothoids are known to inhabit deep waters (brusca, 1981), particularly below 800 m (poore and bruce, 2012). Ectoparasite - host interactions were observed in all habitats, but our data suggest that submarine canyons may increase abundance of ectoparasite - host interactions, the number of host species infected, and the intensity of infections, at least for some species . Canyons (alvin, nygren, hydrographer, phoenix) with the highest ectoparasite - host interactions observed contained relatively high numbers of fish species observed (1420 species per dive) than other sites in the region (see quattrini et al ., 2015). Additionally, for each dominant species, ectoparasite - host interactions were most abundant during a single dive in a canyon habitat . For a. rostrata, the mean abundance of ectoparasite - host interactions and the intensity of ectoparasite infections were also higher in submarine canyons than other habitats . (1980) found a higher endoparasite load in both a. rostrata and n. bairdii occupying canyon habitats in the same region . Higher intensities of infections in canyon environments may in part be related to increased habitat heterogeneity, including higher abundances of both corals and sponges (huvenne et al ., 2011, quattrini et al ., 2015). Corals and sponges have been noted to house resting stages of gnathiid larvae (klitgaard, 1991). In fact, all resting larval and adult stages have been previously collected from a single sponge in deep waters (150487 m, klitgaard, 1991), suggesting some site fidelity for parasites ., 2006, oliveira et al ., 2007), and have been documented with higher abundances of fauna compared to the surrounding slopes (vetter and dayton, 1999). It is possible that deep - sea fishes, including a. rostrata, are more actively feeding in submarine canyons, and thus these behaviors may increase infection rates of ectoparasites . Peaks in both ectoparasite diversity and ectoparasite - host interactions were observed at mid - slope depths . Ectoparasite - host interactions were most abundant at depths of 800 to 1100 m for a. rostrata and synaphobranchus spp . And at 500 to 800 m for n. bairdii . Ectoparasitism diversity was highest at depths of 500 to 1400 m, and then declined with increasing depth . Siphonostomatoid copepods, aegids, and cymothoids were absent at depths> 1400 m; only gnathiids were observed at the deepest depths surveyed (up to 3260 m). Peaks at mid - slope depths appear to correspond to higher species richness of fishes . Rov dives from the 20132014 expeditions documented fewer numbers of species (512 species per dive) at deeper depths (> 1400 m) than in shallower (5001400 m) depths (920 species per dive, see quattrini et al ., 2015). The absence of the host - specific ectoparasites at deeper depths is due to decreased diversity and depth range limits of host species, similar to the endoparasite fauna sampled from fishes in the same region (campbell et al ., 1980). But in contrast to patterns in the endoparasite fauna, the number of ectoparasite - host interactions did not decrease linearly with depth in this region; similar abundances of ectoparasite - host interactions were observed at depths> 1100 m (campbell et al ., 1980). In addition to host distribution, environmental conditions, such as temperature, could also limit the distribution of ectoparasites . Temperature has a significant effect on the species richness of ectoparasite communities (rohde et al ., 1995). In the neus region, temperature changes from 4 - 5 c to 34 c at a depth boundary of approximately 1300 m, corresponding to a change in deep water masses (pickart, 1992). This study was part of a larger expedition that was not focused solely on documenting ectoparasites on deep - sea fishes . Thus, we note a few methodological limitations and suggest modifications for future use of rovs to fully document ectoparasitism in the deep sea . Due to inadequate camera angles, we were unable to determine whether ectoparasites were present on a portion of the dominant species . Targeted rov surveys that incorporate frequent zooms and discrete collections, perhaps in combination with museum collections, would be best to elucidate fine - scale patterns of ectoparasitism in the deep sea . We acknowledge that further sampling across similar depths and habitats is necessary to resolve confounding effects of habitat and depth on the distribution of ectoparasites and ectoparasite - host interactions; most effort was conducted at depths of 500 to 1100 m in canyon habitats . Further quantification is necessary to determine whether submarine canyons significantly influence the prevalence, abundance, and infection intensity of ectoparasitism in deep - sea fishes . Metazoan parasites are an important, yet overlooked, component of deep - sea communities . Similar to shallow - water communities, an estimated 1.5 metazoan parasite species occur per fish species; thus parasites likely have significant impacts on ecosystem functioning in the deep sea (klimpel et al ., 2001). In the present study, the widespread occurrence of ectoparasitism across a variety of host species, depths, habitats, and locations indicate that ectoparasites are a significant component of deep - sea biodiversity . Because ectoparasitism is widespread and many fishes also have wide - ranging distributions (e.g., moore et al ., 2003), ectoparasites could alter behavior and population dynamics of hosts, while increasing trophic connections (amundsen et al ., 2009, demopoulos and sikkel, 2015) in communities throughout the deep sea . Understanding parasite ecology may thus serve as a proxy for determining healthy ecosystems (hudson et al ., 2006). For example, recent studies in shallow water ecosystems have demonstrated the important connections between fishes, ectoparasites, and cleaner species (johnson et al ., 2010); disruptions to these connections can cause community changes (e.g., lafferty et al ., 2008, sun et al ., 2015). Focused parasitology studies are sorely needed to further our understanding of the roles of parasites in both community and trophic ecology in the deep sea (poulin et al ., 2016). By demonstrating the widespread occurrence of ectoparasitism in the deep sea using visual based surveys, we hope that this study can serve as a basis for testing further hypotheses regarding the role of parasitism throughout the deep sea . Amq analyzed the video, conducted analyses, and wrote the text with significant contributions from awjd.
|
Clustering of several risk factors for cardiovascular disease, obesity (particularly abdominal obesity), dyslipidemia, insulin resistance, and hypertension . Obesity is a public health concern because of its association with a number of medical complications that lead to increased morbidity and mortality . The most common obesity - related complications are type-2 diabetes mellitus, hypertension, dyslipidemia, cardiovascular diseases, gallstones and cholecystitis, respiratory dysfunction, non - alcoholic chronic liver disease, and certain cancers . The prevalence of the metabolic syndrome is increasing because of the obesity epidemic. The increased prevalence of obesity has been accompanied by a parallel increase in the prevalence of the metabolic syndrome . The metabolic syndrome, which is associated with three - fold and two - fold increases in type-2 diabetes mellitus and cardiovascular disease, respectively, has become a major public health challenge around the world . Research is urgently required to elucidate the prevalence and associated risk factors, in countries where it had not been estimated yet . There is very minimal data available on the prevalence of the metabolic syndrome in obese patients . Furthermore, few systematic data are available on the prevalence of the metabolic syndrome in obese persons from the most recent worldwide criteria of the international diabetes federation (idf) metabolic syndrome definition . The objectives of this study are to determine the prevalence of the metabolic syndrome among obese patients using the idf definition and to identify the factors that are associated with the metabolic syndrome among these patients . The aim of this cross - sectional study was to measure the prevalence of metabolic syndrome among obese qataris attending the primary health care centers in doha . The subjects of the study were the attendants of primary health care centers who were selected through a multiple - stage sampling procedure . First, four primary care centers were chosen randomly from the four different regions of doha city; the northern, southern, central, and western regions . One of every three clients who visit the health center and fulfill the inclusion criteria: age> 18 years and obese (bmi 30 kg / m2) were invited to participate in the study . Exclusion criteria were underlying endocrine diseases such as cushing's disease, acromegaly, hypothyroidism, hypogonadism, patients on prolonged steroid use, and those who were on active drug treatment for obesity at the time of recruitment . Sample size determination was conducted by the epi - info stat - calculator, and was calculated as 148 subjects considering a 10% dropout . The questionnaire portion of this study was designed to be quick and easy to fill out by the researchers . It was translated from english to arabic, and then translated again from arabic to english, to ensure language consistency . It had two sections, one describing the personal characteristics, and the other questioning the different risk factors of the metabolic syndrome . The anthropometric measurements included body weight; height and girth were taken with the subjects in light clothing and without shoes . Body mass index was computed as the ratio of weight (kg) to the square of height (m) (kg / m). Waist circumference was defined as the average of two measurements taken after normal expiration to the nearest 0.1 cm at the midpoint between the lowest rib and the iliac crest . Blood pressure was measured on the right arm, with the subject in a sitting position, after a minimum five - minute rest, using a standard mercury sphygmomanometer . Two consecutive measures of systolic and diastolic blood pressure were recorded to the nearest 2 mmhg . The second blood pressure recording was performed at least one minute after the first one . A 20-ml blood sample was drawn on disodium ethylenediaminetetraacetic acid (edta) kept at room temperature, and centrifuged within four hours . Metabolic syndrome was diagnosed according to the idf definition, which was the presence of central obesity: abdominal circumference 94 cm in males or 80 cm in females, plus any two of the following: hdl cholesterol <1.03 mmol / ml (<40 mg / dl) [males] or <1.3 mmol / ml (<50 mg / dl) [females], triglycerides 1.7 mmol / ml (150 mg / dl), blood pressure 130 / 85 mmhg or the patient receiving antihypertensive treatment, and baseline glycemia> 5.6 mmol / ml (> 100 mg / dl), or previously - diagnosed type 2 diabetes mellitus . The collected data was entered into the spss software (version 16). For cross - tabulation and computation, statistical significance using 95% confidence interval (ci) was calculated . A chi - square test was used for the comparison of different categorical groups with a p - value <0.05 considered to be significant . Unavailable and multivariable binary logistic regression analyses were used to identify factors that were significantly associated with the metabolic syndrome among obese patients . The findings were presented with the adjusted odds ratio (or), its 95% confidence interval (ci), and the corresponding p - values . Informed consent was signed by the participants after explanation of the purpose of the study, the direct and indirect benefits and risks as well as confidentiality of the collected data, with their rights to withdraw at any stage of the study . The aim of this cross - sectional study was to measure the prevalence of metabolic syndrome among obese qataris attending the primary health care centers in doha . The subjects of the study were the attendants of primary health care centers who were selected through a multiple - stage sampling procedure . First, four primary care centers were chosen randomly from the four different regions of doha city; the northern, southern, central, and western regions . One of every three clients who visit the health center and fulfill the inclusion criteria: age> 18 years and obese (bmi 30 kg / m2) were invited to participate in the study . Exclusion criteria were underlying endocrine diseases such as cushing's disease, acromegaly, hypothyroidism, hypogonadism, patients on prolonged steroid use, and those who were on active drug treatment for obesity at the time of recruitment . Sample size determination was conducted by the epi - info stat - calculator, and was calculated as 148 subjects considering a 10% dropout . The questionnaire portion of this study was designed to be quick and easy to fill out by the researchers . It was translated from english to arabic, and then translated again from arabic to english, to ensure language consistency . It had two sections, one describing the personal characteristics, and the other questioning the different risk factors of the metabolic syndrome . The anthropometric measurements included body weight; height and girth were taken with the subjects in light clothing and without shoes . Body mass index was computed as the ratio of weight (kg) to the square of height (m) (kg / m). Waist circumference was defined as the average of two measurements taken after normal expiration to the nearest 0.1 cm at the midpoint between the lowest rib and the iliac crest . Blood pressure was measured on the right arm, with the subject in a sitting position, after a minimum five - minute rest, using a standard mercury sphygmomanometer . Two consecutive measures of systolic and diastolic blood pressure were recorded to the nearest 2 mmhg . The second blood pressure recording was performed at least one minute after the first one . A 20-ml blood sample was drawn on disodium ethylenediaminetetraacetic acid (edta) kept at room temperature, and centrifuged within four hours . Metabolic syndrome was diagnosed according to the idf definition, which was the presence of central obesity: abdominal circumference 94 cm in males or 80 cm in females, plus any two of the following: hdl cholesterol <1.03 mmol / ml (<40 mg / dl) [males] or <1.3 mmol / ml (<50 mg / dl) [females], triglycerides 1.7 mmol / ml (150 mg / dl), blood pressure 130 / 85 mmhg or the patient receiving antihypertensive treatment, and baseline glycemia> 5.6 mmol / ml (> 100 mg / dl), or previously - diagnosed type 2 diabetes mellitus . The collected data was entered into the spss software (version 16). For cross - tabulation and computation, statistical significance using 95% confidence interval (ci) was calculated . A chi - square test was used for the comparison of different categorical groups with a p - value <0.05 considered to be significant . Unavailable and multivariable binary logistic regression analyses were used to identify factors that were significantly associated with the metabolic syndrome among obese patients . The findings were presented with the adjusted odds ratio (or), its 95% confidence interval (ci), and the corresponding p - values . Informed consent was signed by the participants after explanation of the purpose of the study, the direct and indirect benefits and risks as well as confidentiality of the collected data, with their rights to withdraw at any stage of the study . A response rate of 91.9% was achieved in this study as 136 adults had successfully completed the study, from them 48.5% were males and 51.5% females . Near half of them, 48.5%, had passed the primary, secondary school levels, while 22.1% had passed the university level, and 29.4% were illiterate . More than three - quarters of them were married, 77.9% . With regard to the working status, the mean (sd) age of the studied group was 45.2 (12.9), the mean (sd) height of the studied group was 163.2 (10.5), the mean weight (sd) was 101 (23.3), the mean (sd) waist circumference was 111.3 (13.8), and the mean (sd) of their bmi was 37.8 (6.8), as shown in table 2 . The bmi of 44.9% of the studied population was less than 34.9, the bmi of 23.5% was between 35 and 39.9, while 31.6% had morbid obesity [table 3]. However, there was no significant difference in the prevalence between males and females [table 4]. The prevalence of metabolic comorbidities of abnormal waist circumflex, raised blood pressure, raised fasting blood sugar, high triglycerides, and reduced high - density lipoprotein was 88.2, 42.6, 32.4, 31.6, and 27.9%, respectively [table 5]. The results of simple binary logistic regression analysis for potential associated factors of the metabolic syndrome were dm and increasing age, which were the only independent variables that were statistically significant in the multivariate analysis, using multiple binary logistic regressions [table 6]. Frequency distribution of the studied population according to demographic characteristics (n = 136) physical characteristics of the studied group (n = 136) prevalence of obesity class among the studied population (n = 136) prevalence of metabolic syndrome among the studied population by gender (n = 136) prevalence of metabolic comorbidities among the studied population (n = 136) associated factors of the metabolic syndrome using simple binary logistic regression (n = 136) in the current study, the overall prevalence of the metabolic syndrome among obese qatari adults, attending primary health care centers was 46.3%, which was constant, with a previous finding from a study among obese kuwaiti adults, which was 46.8% using necp atp iii . The prevalence in the current study was higher than the prevalence among obese adults attending the obesity clinic in malaysia, which was 40.2% using the idf definition of the metabolic syndrome, but was considerably lower than that in other comparable studies in obese patients conducted in italy (53%) and taiwan (50.7%). The differences in prevalence might be due to the different definition used for the criteria of the metabolic syndrome in the different study populations . The studies in italy and taiwan used the national cholesterol education program adult treatment panel (ncep atp) iii definition, while the ncep atp iii criteria were similar to the idf criteria, except that central obesity was not a mandatory criteria, unlike that proposed by the idf . This might give rise to a higher prevalence of the overall metabolic syndrome in the studies using the ncep atp iii definition . The current study showed that prevalence of the metabolic syndrome among females (50%) was higher than males that in males (42.4%), which was consistent with marchesini et al ., who reported a prevalence of 56.7% in females, compared to 51.9% in males . Similarly, lee et al . Found a higher prevalence among females at 31.9%, and 20.5% among males, but found that males were significantly associated with an increased risk of having the metabolic syndrome . However, the present study and the study conducted by marchesini et al . Did not find a similar association . Population - based studies have also shown that the prevalence of the metabolic syndrome using the idf criteria tended to be higher in females . The current study showed that the prevalence of the metabolic syndrome was noted to increase from obesity class 1 to 2, although the prevalence in obesity class 3 was slightly lower . Similarly in nhanes iii, the metabolic syndrome was present in 5% of those with normal weight, 22% in those who were overweight, and 60% in those who were obese . A large waist circumference alone identified up to 46% of the individuals who would develop the metabolic syndrome within five years . A similar finding was seen by marchesini et al ., who showed that the prevalence of the metabolic syndrome in their obese subjects increased with a rising obesity class and the metabolic syndrome was significantly associated with bmi . However, the metabolic syndrome was not significantly associated with the bmi class in the current study . The prevalence of individual metabolic comorbidities of the metabolic syndrome in the current study, according to the idf definition, was abnormal waist circumflex, raised blood pressure, raised fasting blood sugar, high triglycerides, and the reduced high density lipoprotein was 88.2, 42.6, 32.4, 31.6, and 27.9%, respectively . Similar findings were observed in us nhanes iii 20032006 survey indicating a high prevalence of components of the metabolic syndrome, as defined by atp iii . Among the 3423 adults, abdominal obesity was present in 53%, elevated blood pressure in 40%, and hyperglycemia in 39% . These were the most frequently occurring risk factors for the metabolic syndrome, regardless of whether one examined the crude or age - adjusted estimates . A smaller percentage of adults had elevated tg (31%) and low hdl (25.1%). An analysis of the 1998 singapore national health survey found that the hypertension factor was positively loaded for obesity . This finding was in - keeping with the existing knowledge that obesity was clearly linked to essential hypertension . Age and being diabetic were the only significant associated factors found to influence the odds of having the metabolic syndrome in this study . Marchesini et al . Reported that the odds of having the metabolic syndrome increased by 1.43 (95% ci 1.321.56) for every ten - year age increment . This was also inconsistent with the results of (nhanes iii,19881994), which showed that at the baseline, the prevalence of the metabolic syndrome was 26.8% in men and 16.6% in women . After eight years of follow - up, there was an age - adjusted 56% increase in prevalence among men and a 47% increase among women . Also many studies reported that most of diabetic patients with type 2 diabetes had features of the metabolic syndrome . The relatively small sample that was chosen from patients who attended the primary care centers made it difficult to generalize the results from this study, so a population - based study with a large sample was needed . The relatively small sample that was chosen from patients who attended the primary care centers made it difficult to generalize the results from this study, so a population - based study with a large sample was needed . The prevalence of the metabolic syndrome among obese patients using the idf definition was high; it was higher among females and significantly increased with the presence of diabetes and increase in age . The abnormal waist circumference, raised blood pressure, and raised fasting blood sugar were the most common metabolic comorbidities found in obese patients followed by high triglycerides and reduced hdl . In the future such findings should be taken into account when planning for new or expansion of existing health services and when implementing future non - communicable disease prevention and control programs.
|
Approximately, two - thirds of all gists occur in the stomach, followed by the small intestine, rectum, and esophagus . Moreover, the body and fundus are the most frequent site of gists in stomach . Endoscopy reveals a smooth mass with normal overlying mucosa or with mucosal ulceration in larger tumors . Tissue sampling with standard endoscopic mucosal biopsy is mostly negative in gists for lying underneath normal appearing mucosa . Endoscopic ultrasonography (eus) has the ability to obtain differential diagnosis by the wall layer of origin and echogenicity . On eus, gists are usually hypoechoic masses, which originate from the muscularis propria, also occasionally they can arise from the muscularis mucosa . In some larger tumors, the eus features include irregular extra - luminal border, echogenic foci, and cystic spaces . Although only 10%-30% of gists are clinically malignant, all gists are known to have some degree of malignant potential . Therefore, a simple classification of benign and malignant is not appropriate . At present, the modified fletcher classification system has been used most frequently to assess the malignant potential of gists [table 1]. This risk classification system is composed of four factors: tumor size, tumor site, mitotic count, and presence of tumor rupture and classifies the malignant potential as four grade: very low, low, intermediate, and high grade . For patients with high risk of recurrence, preoperative neoadjuvant therapy with imatinib is recommended . Among the four factors in fletcher system, tumor size, tumor site, and presence of tumor rupture are easy to determine by endoscopy and eus, whereas the mitotic count is generally obtained from resection specimens . Although eus - guided fine needle aspiration (fna) and eus - guided trucut biopsy (tcb) can also obtain specimens before surgery, these techniques have risks of complications such as bleeding, localized abdominal pain, puncture site infection, and fever, and both have a limitation of inadequate specimen for immunohistochemical analysis . For these reasons, eus - fna or eus - tcb contrast - enhanced ultrasound (ce - us) has been applied in clinical practice for more than 10 years, especially in diseases of digestive and cardiovascular system . With the development of eus techniques and the advent of second generation contrast agent, ce harmonic (ceh)-eus has been used for diagnosis of lesions of pancreas, liver, and gallbladder . In this prospective study, eus and ceh - eus the relationship between features of eus / ceh - eus and the malignant potential in gists was evaluated . Between march 2015 and december 2015, a total of 19 patients suspected of having a gist were enrolled in our study . The exclusion criteria include severe heart failure, severe chronic obstructive pulmonary disease, known allergic disposition to sonovue (59 mg, bracco societa per azioni, milan, italy), pregnancy or lactation, severe psychiatric disorders, and esophagogastric varices . This study was approved by the ethics committee of beijing friendship hospital, capital medical university . All patients provided informed consent . Before undergoing ceh - ues, endoscopy features including tumor location, size, mucosa appearance, and other lesions then standard b - mode eus was performed in all patients to determine the tumor size, originating layer, echogenicity, and the growth patterns . Color doppler mode was performed to detect intratumoral color doppler flow signals . For ceh - eus, the extended pure harmonic detection mode was used, with the mechanical index set at 0.25 and a transmitting frequency of 4.7 mhz . Eus and ceh - eus were performed in the left lateral decubitus position under midazolam - induced conscious - sedation with heart rate and oxygen saturation monitoring . A bolus infusion of sonovue (59 mg/5 ml) was administered via peripheral vein catheter, followed by a 10 ml saline flush . The agent arrival time (aat) was recorded, and the vascular structures were assessed in real time . Us video sequences were continuously recorded and stored in the hard disk for off - line analyses . All eus and ceu - eus were performed by two experienced endoscopists using an olympus gf - ue260 (olympus medical systems co., ltd ., tokyo, japan) connected to a us system (prosound ssd -10; hitachi - aloka, tokyo, japan). Routine blood count, liver and kidney function, and coagulation function were performed in all patients . Ce - computed tomography (ct) and chest radiograph were obtained to exclude distant metastases . Laparoscopic surgical procedures were performed in 3 cases with tumor size> 50 mm and/or with obviously extraluminal growth . Endoscopic resections were performed in the other 16 patients under a complete general anesthesia . An olympus gif260j endoscope with an auxiliary water jet (olympus medical systems co., ltd ., tokyo, japan) was used . The steps of endoscopic resection were as follows: (1) marking of the entire circumference using a dual knife at intervals of a few millimeters, approximately 25 mm laterally from the lesion; (2) local injection of glycerin - fructose - methylene mixture (consisted of 10% glycerin, 5% fructose, and methylene 4 mg in 250 ml normal saline solution); (3) circumferential mucosal incision using dual knife; (4) dissection of the tumor using it knife; (5) en bloc resection of the tumor using snare; (6) withdrawal of the resect specimen using the grasping forceps; (7) wound closure with clips and hemostasis using hemostatic forceps or by argon plasma coagulation anytime when hemorrhage is observed . After surgery or endoscopic resection, fasting, water - deprivation, and intravenous fluid continued for at least 48 h. patients without complication started drinking water after 48 h and were discharged within 47 days . The histologic diagnosis of gist was defined as subepithelial tumors composed of spindle cells that stained positive for c - kit and cd34 . The immunohistochemistry examination included the following: cd34, c - kit, dog-1, smooth muscle actin (sma), desmin, and ki67 . The independent sample t - test was used for the comparison of two groups regarding continuous variables . The chi - square test was used to compare the frequency data of two groups including clinical characteristics, eus, and ceh - eus features . Statistical analyses were performed with spss software (version 17.0; spss, chicago, il, usa). Between march 2015 and december 2015, a total of 19 patients suspected of having a gist were enrolled in our study . The exclusion criteria include severe heart failure, severe chronic obstructive pulmonary disease, known allergic disposition to sonovue (59 mg, bracco societa per azioni, milan, italy), pregnancy or lactation, severe psychiatric disorders, and esophagogastric varices . This study was approved by the ethics committee of beijing friendship hospital, capital medical university . All patients provided informed consent . Before undergoing ceh - ues, endoscopy features including tumor location, size, mucosa appearance, and other lesions then standard b - mode eus was performed in all patients to determine the tumor size, originating layer, echogenicity, and the growth patterns . Color doppler mode was performed to detect intratumoral color doppler flow signals . For ceh - eus, the extended pure harmonic detection mode was used, with the mechanical index set at 0.25 and a transmitting frequency of 4.7 mhz . Eus and ceh - eus were performed in the left lateral decubitus position under midazolam - induced conscious - sedation with heart rate and oxygen saturation monitoring . A bolus infusion of sonovue (59 mg/5 ml) was administered via peripheral vein catheter, followed by a 10 ml saline flush . The agent arrival time (aat) was recorded, and the vascular structures were assessed in real time . Us video sequences were continuously recorded and stored in the hard disk for off - line analyses . All eus and ceu - eus were performed by two experienced endoscopists using an olympus gf - ue260 (olympus medical systems co., ltd ., tokyo, japan) connected to a us system (prosound ssd -10; hitachi - aloka, tokyo, japan). Routine blood count, liver and kidney function, and coagulation function were performed in all patients . Ce - computed tomography (ct) and chest radiograph were obtained to exclude distant metastases . Laparoscopic surgical procedures were performed in 3 cases with tumor size> 50 mm and/or with obviously extraluminal growth . Endoscopic resections were performed in the other 16 patients under a complete general anesthesia . An olympus gif260j endoscope with an auxiliary water jet (olympus medical systems co., ltd ., tokyo, japan) was used . The steps of endoscopic resection were as follows: (1) marking of the entire circumference using a dual knife at intervals of a few millimeters, approximately 25 mm laterally from the lesion; (2) local injection of glycerin - fructose - methylene mixture (consisted of 10% glycerin, 5% fructose, and methylene 4 mg in 250 ml normal saline solution); (3) circumferential mucosal incision using dual knife; (4) dissection of the tumor using it knife; (5) en bloc resection of the tumor using snare; (6) withdrawal of the resect specimen using the grasping forceps; (7) wound closure with clips and hemostasis using hemostatic forceps or by argon plasma coagulation anytime when hemorrhage is observed . After surgery or endoscopic resection, fasting, water - deprivation, and intravenous fluid continued for at least 48 h. patients without complication started drinking water after 48 h and were discharged within 47 days . The histologic diagnosis of gist was defined as subepithelial tumors composed of spindle cells that stained positive for c - kit and cd34 . The immunohistochemistry examination included the following: cd34, c - kit, dog-1, smooth muscle actin (sma), desmin, and ki67 . The independent sample t - test was used for the comparison of two groups regarding continuous variables . The chi - square test was used to compare the frequency data of two groups including clinical characteristics, eus, and ceh - eus features . Statistical analyses were performed with spss software (version 17.0; spss, chicago, il, usa). Between march 2015 and december 2015, a total of 19 patients suspected of having a gist were enrolled in our study . The exclusion criteria include severe heart failure, severe chronic obstructive pulmonary disease, known allergic disposition to sonovue (59 mg, bracco societa per azioni, milan, italy), pregnancy or lactation, severe psychiatric disorders, and esophagogastric varices . This study was approved by the ethics committee of beijing friendship hospital, capital medical university . Before undergoing ceh - ues, endoscopy features including tumor location, size, mucosa appearance, and other lesions were obtained . Then standard b - mode eus was performed in all patients to determine the tumor size, originating layer, echogenicity, and the growth patterns . Color doppler mode was performed to detect intratumoral color doppler flow signals . For ceh - eus, the extended pure harmonic detection mode was used, with the mechanical index set at 0.25 and a transmitting frequency of 4.7 mhz . Eus and ceh - eus were performed in the left lateral decubitus position under midazolam - induced conscious - sedation with heart rate and oxygen saturation monitoring . A bolus infusion of sonovue (59 mg/5 ml) was administered via peripheral vein catheter, followed by a 10 ml saline flush . The agent arrival time (aat) was recorded, and the vascular structures were assessed in real time . Us video sequences were continuously recorded and stored in the hard disk for off - line analyses . All eus and ceu - eus were performed by two experienced endoscopists using an olympus gf - ue260 (olympus medical systems co., ltd ., tokyo, japan) connected to a us system (prosound ssd -10; hitachi - aloka, tokyo, japan). Routine blood count, liver and kidney function, and coagulation function were performed in all patients . Ce - computed tomography (ct) and chest radiograph were obtained to exclude distant metastases . Laparoscopic surgical procedures were performed in 3 cases with tumor size> 50 mm and/or with obviously extraluminal growth . Endoscopic resections were performed in the other 16 patients under a complete general anesthesia . An olympus gif260j endoscope with an auxiliary water jet (olympus medical systems co., ltd ., tokyo, japan) was used . The steps of endoscopic resection were as follows: (1) marking of the entire circumference using a dual knife at intervals of a few millimeters, approximately 25 mm laterally from the lesion; (2) local injection of glycerin - fructose - methylene mixture (consisted of 10% glycerin, 5% fructose, and methylene 4 mg in 250 ml normal saline solution); (3) circumferential mucosal incision using dual knife; (4) dissection of the tumor using it knife; (5) en bloc resection of the tumor using snare; (6) withdrawal of the resect specimen using the grasping forceps; (7) wound closure with clips and hemostasis using hemostatic forceps or by argon plasma coagulation anytime when hemorrhage is observed . After surgery or endoscopic resection, fasting, water - deprivation, and intravenous fluid continued for at least 48 h. patients without complication started drinking water after 48 h and were discharged within 47 days . The histologic diagnosis of gist was defined as subepithelial tumors composed of spindle cells that stained positive for c - kit and cd34 . The immunohistochemistry examination included the following: cd34, c - kit, dog-1, smooth muscle actin (sma), desmin, and ki67 . The independent sample t - test was used for the comparison of two groups regarding continuous variables . The chi - square test was used to compare the frequency data of two groups including clinical characteristics, eus, and ceh - eus features . Statistical analyses were performed with spss software (version 17.0; spss, chicago, il, usa). One patient was pathologically diagnosed as middle differentiation adenocarcinoma and was excluded from this study . The other 18 patients were confirmed by pathology and immunohistochemistry examination . According to the modified fletcher classification system, 18 resected tumors consisted of 4 very low, 6 low, 6 intermediate, and 2 high malignant potential gists . We divided the 18 patients into 2 groups: group i (lower malignant potential) included low and very low malignant potential and group ii (higher malignant potential) included high and intermediate malignant potential . Mean (mean standard deviation [sd]) age was 51.5 10.0 years in group i and 58.9 14.1 years in group ii [table 2]. One (1/10) patient of group i and 3 (3/8) patients of group ii were symptomatic . The other 14 patients were asymptomatic and were discovered incidentally or by other image examinations . The majority of tumors (7/10 vs. 5/8) located in fundus and cardia of stomach . No significant difference of these 3 features was found between group i and group ii (p = 0.21, 0.28 and 0.95). Clinical characteristics of 18 patients with gastrointestinal stromal tumors mean (mean sd) diameter measured on eus was 14.6 5.8 mm and 32.1 8.4 mm [table 3] and tumor size in group ii was significantly larger than that in group i (p <0.05). Furthermore, the number of patient with tumor size 20 mm was 3 of 10 in group i and 7 of 8 in group ii (p <0.05). Intraluminal growth was the predominant growth pattern in the two groups except that extraluminal growth was found in one patient in group ii, who underwent surgical resection . Homogeneous hypoechogenicity was observed in all ten patients in group i while heterogeneous hypoechogenicity with focal hyperechoic area or anechoic area was found in four of eight patients in group ii (p <0.05). After a bolus infusion of sonovue, the mean value of aat was 10.9 0.2 s in group i and 10.7 0.2 s in group ii (p = 0.10). No irregular intratumoral vessel was found in group i, regular fine intratumoral vessels were found in six patients, and no vessel was detected in other four patients . On contrast, in group ii, irregular intratumoral vessels were found in six of eight patients [figure 1] and regular fine intratumoral vessels were found in other two patients . Endoscopic ultrasonography and contrast enhanced harmonic - endoscopic ultrasonography features of 18 patients with gastrointestinal stromal tumors an intermediate malignant potential gastrointestinal stromal tumor of the stomach in a 76-year - old man . (a) white light endoscopy shows a ball - shaped mass with normal overlying mucosa; (b) endoscopic ultrasonography shows a hypoechoic mass originated from the muscularis propria . (c) contrast enhanced harmonic -endoscopic ultrasonography shows irregular vessels except one patient with middle differentiation adenocarcinoma, the other 18 patients met gist diagnostic criteria . According to the modified fletcher classification system, tumor size and mitotic count were used for assessing the malignant potential, and no tumor rupture was found in all patients . In group i, four and six patients were very low and low malignant potential, respectively; in group ii, six and two patients were intermediate and high malignant potential, respectively . Sma was positive in one patient with very low malignant potential gist and one with low malignant potential gist . Ki67 was positive in both two patients with high malignant potential gist and one with intermediate malignant potential gist [figure 2]. (a) h and e; (b) cd34; (c) c - kit; (d) dog-1; (e) smooth muscle actin; (f) desmin; (g) ki67 (all for 200) the modified fletcher classification system is the most commonly used standard for assessing the malignant potential of gists, which comprises four factors: tumor size, tumor site, mitotic count, presence of tumor rupture . The assessment of malignant potential is difficult to perform before tumor resection for the reason that the modified fletcher classification system depends on postoperative pathology . In the present study, we observed features of eus and ceh - eus preoperatively and evaluated the correlation between the features and malignant potential of gists . The modified fletcher classification system classifies the malignant potential as four grades: very low, low, intermediate, and high malignant potential . We collapsed patients with very low and low malignant potential gists into group i (the lower group) as well as intermediate and high malignant potential gists into group ii (the higher group). No significant difference was found in the mean age, gender and tumor location between group i and group ii . The majority of patients in both groups were asymptomatic, of which subepithelial masses were detected incidentally during routine endoscopic screening or other image examinations . The tumor size is one of the four factors in the modified fletcher classification system, and the mean tumor size in group ii was significantly larger than that in group i (4.6 5.8 mm vs. 33.4 10.6 mm, p <0.05). The tumor size was <20 mm in most patients in group i while only few in group ii (7/10 [70%] vs. 1/8 [12.5%], p we interpret this result as that the percentage of larger size (20 mm) in higher malignant potential gists is higher than that in lower malignant potential gists . Furthermore, it does not mean that the malignant potential of a larger gist must be higher than that of a smaller gist . On the contrary, some smaller gists revealed higher malignant potential . On eus, gists are usually homogenous hypoechoic masses or heterogeneous hypoechoic masses with anechoic cystic spaces due to cystic degeneration and liquefaction necrosis . In our study, all of the ten gists in group i were homogenous hypoechoic and originated from the muscularis propria . On contrast, only four gists in group ii were heterogenous hypoechoic with focal hyperechoic area (p <0.05). No severe complication such as bleeding or peritonitis was observed in all 18 patients . To date, no recurrence was found in all patients during endoscopy surveillance, and the follow - up is in progress . In some previous studies, researchers found that detection of intratumoral irregular vessels had important value in assessing the malignant potential of gists . In our study, we detected intratumoral irregular vessels by ceh - eus . In group ii, irregular vessels were detected in both two high malignant potential gists and four intermediate malignant potential gists . In group i, no irregular vessel was found in ten low and very low malignant potential gists . There was a significant difference for the detection of irregular vessels between the two groups . Detection of irregular vessels had good sensitivity and specificity in discriminating higher and lower malignant potential gists, which are 75% and 100%, respectively . The positive predictive value of detection of irregular vessels to high malignant potential was 33%, and the negative predictive value was 100% . Ce - ct, color, and pd - eus, ceh - eus are used for detection of intratumoral vessels clinically, and the efficacy of the former two methods is correlated to the diameter and flow of vessels . For ceh - eus, the harmonic signal of microbubbles was directly depicted, particularly in the vessels with small diameter and slow flow, which were hard to be identified by ce - ct or pd - eus . Therefore, ceh - eus can be used to diagnose disease in various organs with abundant as well as poor blood supply . Some researchers had reported the diagnostic value of ceh - eus in lesions of pancreas and gallbladder . Found that aat of endometrial carcinoma was shorter than that of normal myometrium, and contributed this to by numerous and complex neovascularization in malignant lesions . In a study on evaluation of severity of chronic hepatitis c, ridolfi et al . Also revealed that the mean hepatic vein arrival time decreased progressively with increasing severity of liver disease . However, no significant difference of aat was found between colorectal adenocarcinoma and adenoma . In this study, we also found no significant difference of aat between the two groups . The diagnosis of gists must be confirmed by pathology and immunohistochemistry examinations . At present, the diagnostic criterion of gists was defined as subepithelial tumors composed of spindle cells c - kit(+) and cd34(+). Eighteen patients, who met the criterion in this study except one patient, were diagnosed middle differentiated adenocarcinoma . Dog-1 is a calcium dependent, receptor activated chloride channel protein expressed in gists, and it is positive in all 18 patients in our study . Leiomyoma is another common subepithelial tumor in gastrointestinal tract, which is difficult to discriminate from gists by endoscopy and eus . However, cd34 and c - kit are rarely positive in leiomyoma, whereas sma and desmin are always positive . In this study, ki67 is a nuclear proliferation associated antigen expressed in the growth and synthesis phases of the cell cycle (g1, s, g2, and m) but not in the resting phase (g0). This antigen provides information about the proportion of active cells in the cell cycle and is correlated with tumor recurrence and prognosis . We observed that ki67 was positive in two high malignant potential gists and in one intermediate malignant potential gists in group i and was all negative in group ii . Hence, strict follow - up and endoscopy surveillance are needed in these three patients with ki67(+). . The limitations of this study are the small number of patients enrolled and the relatively short period of follow - up . The follow - up is still in progress, and further study with larger number of cases is needed.
|
A 53-year - old caucasian female with complaints of dry eyes and a burning sensation in the eyes presented to our ophthalmology clinic 5 years ago . Her medical history revealed that the symptoms had persisted for 10 years, with some relief with lubricating eye drops used every 0.51 h. prior serology studies for antinuclear antibodies (ana), ro and la were all negative . She denied any symptoms of dryness of her mouth, and she had no other comorbidities . Clinical examination showed dry eyes, with slit lamp examination revealing thickening and hyperemia of the eyelids . She was put on genteal gel alternating with artificial tears (restasis eye drops) four times / day . During the course of the next 5 years, she underwent multiple surgeries for persistent eye dryness, including three procedures of silicone punctual plug placement in each eyelid, permanent thermal punctual occlusion, and later, resection of the canaliculus due to repeat reopening of the punctum despite three permanent thermal occlusions and continued patient discomfort secondary to refractory dryness of the eyes . Additional evaluation to determine the etiology of dry eyes was done . It revealed the presence of antibodies to salivary gland protein 1 (sp1) and parotid secretory protein (psp), leading to the diagnosis of sjogren's syndrome (ss). A 68-year - old caucasian female with a known history of rheumatoid arthritis (ra) presented to our ophthalmology clinic with complaints of persistent dry eyes and irritation for the last 25 years . She had tried artificial tears, restasis eye drops and genteal gel with some relief . Her prior workup by her rheumatologist included antibodies to ro and la, which were both negative . On physical evaluation, she was noted to have dry eyes . Slit lamp examination revealed hyperemia and thickening of the eyelids . Her laboratory evaluation in our clinic included antibodies to ro and la that were negative and antibodies to ana and rheumatoid factor, which were both positive . Evaluation of additional autoantibodies revealed the presence of antibodies to sp1 and psp, leading to the diagnosis of ss . Antibody testing for sp1 and psp in both patients was done at immco diagnostic laboratory, buffalo, n.y . A 53-year - old caucasian female with complaints of dry eyes and a burning sensation in the eyes presented to our ophthalmology clinic 5 years ago . Her medical history revealed that the symptoms had persisted for 10 years, with some relief with lubricating eye drops used every 0.51 h. prior serology studies for antinuclear antibodies (ana), ro and la were all negative . She denied any symptoms of dryness of her mouth, and she had no other comorbidities . Clinical examination showed dry eyes, with slit lamp examination revealing thickening and hyperemia of the eyelids . She was put on genteal gel alternating with artificial tears (restasis eye drops) four times / day . During the course of the next 5 years, she underwent multiple surgeries for persistent eye dryness, including three procedures of silicone punctual plug placement in each eyelid, permanent thermal punctual occlusion, and later, resection of the canaliculus due to repeat reopening of the punctum despite three permanent thermal occlusions and continued patient discomfort secondary to refractory dryness of the eyes . Additional evaluation to determine the etiology of dry eyes was done . It revealed the presence of antibodies to salivary gland protein 1 (sp1) and parotid secretory protein (psp), leading to the diagnosis of sjogren's syndrome (ss). A 68-year - old caucasian female with a known history of rheumatoid arthritis (ra) presented to our ophthalmology clinic with complaints of persistent dry eyes and irritation for the last 25 years . She had tried artificial tears, restasis eye drops and genteal gel with some relief . Her prior workup by her rheumatologist included antibodies to ro and la, which were both negative . Her medications included methotrexate for her ra for the last 30 years . On physical evaluation, her laboratory evaluation in our clinic included antibodies to ro and la that were negative and antibodies to ana and rheumatoid factor, which were both positive . Evaluation of additional autoantibodies revealed the presence of antibodies to sp1 and psp, leading to the diagnosis of ss . Antibody testing for sp1 and psp in both patients was done at immco diagnostic laboratory, buffalo, n.y . Ss is an autoimmune disease starting in the lacrimal and salivary glands but with eventual systemic involvement of multiple other organs . Ss can also occur secondary to other autoimmune diseases such as lupus and ra, known as secondary ss . Patients with ss typically present with a dry, gritty sensation in the eyes and a dry mouth . At this stage typically, involvement of the lachrymal and submandibular glands occurs before involvement of the parotid glands . Due to this, the presentation of dry eyes may occur much earlier in the disease process and precede the presence of a dry mouth . About 5% of the patients with ss develop b cell lymphoma, most commonly occurring in the salivary glands and gastrointestinal tract [1, 2, 3]. The diagnostic criteria for ss include clinical criteria: a schirmer test with a result of <5 mm of wetting/5 min or a rose bengal score of> 4 (van bijsterveld) as well as ocular and oral symptoms . Daily persistent dry eyes for more than 3 months, use of lubricants more than 3 times / day, a recurrent feeling of sand or gravel in the eyes as well as a dry mouth for more than 3 months with a glass of water required to eat dry foods further support a diagnosis of ss . In our clinics, the limit for schirmer's test is set at 3 mm to reduce positive results in the normal population to <15% . Histological criteria for ss include focal sialoadenitis, and serological criteria include ana, rf and antibodies to ro and/or la . The diagnosis of ss is excluded if there is a history of head and neck radiation treatment, hepatitis c, aids, lymphoma, sarcoidosis, graft versus host disease or anticholinergic drugs . The 2 patients described in this case report met the clinical criteria for ss based on dry eyes and a positive schirmer test but lacked antibodies to ro or la . The autoantibodies that are most commonly believed to be associated with ss are ro and/or la antibodies . Ro (ss - a) is an extractable nuclear antigen that is composed of proteins 52 kd and 60 kd combined with cytoplasmic rna species [1, 6]. Antibodies to ro are found in patients with autoimmune mediated systemic connective disorders including ss . Antibodies to ro are detected in 4060% of the patients [1, 6, 7]. La (ss - b) is a 48-kd protein and an extractable nuclear antigen . Antibodies to la are detected in <20% of the patients but they are highly specific to ss [6, 7]. However, there are multiple other antibodies being studied, including antibodies to muscarinic receptor 3, tissue kallikrein, alpha - fodrin, carbonic anhydrase ii and vi, psp and sp1 . The significance of these autoantibodies has not been fully appreciated [7, 8, 9, 10, 11, 12, 13, 14, 15]. One of the mouse models used to study ss is the interleukin 14 alpha transgenic (il14tg) mouse . It reproduces all events noted to occur in ss patients in the same relative time frame [16, 17, 18]. The use of this animal model led to the discovery of the novel autoantibodies in ss . These include antibodies to sp1, carbonic anhydrase 6 (ca6) and psp . The presence of these autoantibodies in the sera of patients with ss has been confirmed . As per these studies, only 25% of the il14tg mice developed ro and/or la antibodies . Interestingly, the time course in the development of the autoantibodies showed that the sp1 and ca6 antibodies were present very late in the disease . Our first patient had symptoms of dry eyes requiring multiple procedures to help control them . Our second patient had dry eyes for many years along with the comorbidity of ra . However, a diagnosis of ss was not made in either of our patients due to the lack of ro and/or la antibodies . The detection of sp1 and psp antibodies in our patients led to the diagnosis of primary ss in the first and secondary ss in the second patient . These cases stress the importance of using autoantibodies besides ro and la in the diagnosis of ss . Further studies are in progress to define whether antibodies to sp1 and psp not only define early stages of ss but also particular forms of ss . Md, and l.s ., phd, participated in the discovery of the autoantibodies to sp1 and psp . The suny at buffalo school of medicine holds a patent on these autoantibodies that is licensed to immco and nicox.
|
Atherosclerosis is a common disease primarily affecting large arteries, which begins in childhood and progresses with age . It is the principal cause of heart attack, stroke, and gangrene of the extremities . Several pathophysiologic mechanisms, including the inflammatory response, immune response, cellular growth and proliferation, lipoprotein metabolism and coagulation, each of which are regulated by numerous gene products, can contribute to atherosclerosis either individually or in concert . One of the candidate genes for the development of atherosclerosis regardless of localization is methylenetetrahydrofolate reductase (mthfr; ec 1.5.1.20). Mthfr is a regulatory enzyme of the homocysteine (hcy) metabolism, and is also necessary in the metabolism of tetrahydrofolate, as well as in the synthesis of purine, dna, and rna . Elevated plasma total homocysteine (thcy) concentration is now widely accepted as a major independent risk factor for cerebrovascular, peripheral vascular disease and may explain, at least in part, the occurrence of coronary artery disease (cad) in patients who do not have dyslipidemia, hypertension, and other conventional risk factors [3, 4]. Hcy is a sulphur - containing amino acid, formed by demethylation of the essential amino acid methionine . It can be either degraded by transsulfuration, involving the vitamin b6-dependant enzyme cystathionine -synthase, or remethylated to methionine, involving the cobalamine (vitamin b12-dependant enzyme) methionine synthase . Elevations of thcy might result from nutritional deficiencies, including folate, pyridoxal phosphate (vitamin b6), and methylcobalamin (vitamin b12), or from genetically determined abnormalities of hcy metabolism (e.g., mthfr), or a combination of these [5, 6]. Mthfr is an enzyme that reduces 5,10-methylenetetrahydrofolate to 5-methylenetetrahydrofolate, the main circulating form of folate and the methyl donor for the remethylation of hcy to methionine . A thermolabile form of mthfr has been identified [7, 8] and found to be caused by a missense mutation in its encoding gene, with the cytidine residue at nucleotide position 677 being replaced by thymidine (mthfr c677 t), resulting in the substitution of valine for alanine in the enzyme . The homozygous 677tt genotype of this mutation has been found to specify a variant enzyme with reduced activity and to be associated with elevated thcy levels, particularly in the setting of low folate levels, as compared to the wild - type (677cc) and heterozygous (677ct) genotypes . Also, data have shown that the frequency of the mutation varies among different populations [9, 10]. These considerations have raised the possibility that the relatively common c677 t mutation in mthfr might be an important genetic risk factor for cardiovascular disease through its effects on homocysteine metabolism [11, 12]. The aim of this study was to investigate the frequency of mthfr c677 t mutation and its association to cad and to fasting plasma thcy concentrations in moroccan population . We also evaluated interactions between mild elevated thcy levels, mthfr c677 t polymorphism, and conventional risk factors of cad . The study sample consisted of individuals undergoing coronary angiography because of either symptoms of suspected cad or unrelated conditions requiring angiographic evaluation (e.g., cardiomyopathy, valvular disease). Patients were designated as having cad if they had 50% stenosis of at least one coronary artery, and having no cad if <10% stenosis was present in all major vessels . The protocol was ethically approved by the review board of the national league of cardiology, rabat, morocco . The study consisted of 400 unrelated individuals (age mean = 50 10) in whom coronary angiography was clinically indicated (218 men, 182 women). The group of cases was formed by 210 (52.5%) patients with angiographically confirmed cad . The group of controls included 190 (47.5%) subjects with normal coronary angiograms . Patients with an acute illness, such as myocardial infarction or coronary artery bypass graft surgery occurring three months prior the study, or with a chronic disease, such as chronic renal, hepatic or thyroid failure, were excluded of the protocol . Arterial hypertension was defined in the presence of active treatment with antihypertensive agents or otherwise as systolic blood pressure of 140 mmhg and/or diastolic blood pressure of 90 mmhg on at least two separate occasions . Patients were considered to have diabetes mellitus if they were receiving active treatment with insulin or oral hypoglycemic agents, or if fasting glucose in the serum was 126 mg / dl . Dyslipidemia was defined as triglycerides (tg) value of 1.50 mmol / l or ldl cholesterol (ldlc) value of 3.92 the weight and height were measured and the body mass index (bmi) was obtained from the ratio of weight (kg) to height squared (m). Subjects were considered substantially obese when the bmi was> 30 kg / m . Twelve hour fasting venous blood samples were obtained from all subjects at the day of the coronary angiography . Venous blood was collected into heparinized tubes and immediately centrifuged at 1.550 g for 10 minutes . Total serum cholesterol, hdl cholesterol, and triglycerides were measured by enzymatic methods on a hitachi analyzer using standard kits (roche diagnostics). Ldl cholesterol was calculated with the friedewald formula in subjects with triglycerides levels below 4.40 mmol / l . Plasma total homocysteine was determined by immunoassay (axis biochemicals, oslo, norway). The assay method was based on an enzymatic conversion of homocysteine to s - adenosyl - l - homocysteine, followed by quantification of s - adenosyl - l - homocysteine by an enzyme - linked immunoassay . The coefficients of variation within and between days for the assays were 5% or less . Cross reactivity with glutathione, l - cysteine, adenosine, l - cystathionine was below 0.1% . Dna was extracted from white cells of fresh or frozen peripheral blood by phenol - chloroforme - isoamylalcool method . The region surrounding the 677 mthfr mutation site (a 223 bp fragment) was polymerase chain reaction - amplified, using the following primers (mthfr 618a: 5-agctttgaggctgacctgaag-3 and mthfr 14 - 5b: 5-aggacggtgcggtgagagtg-3) (oligo express). Pcr amplification reactions were performed with 300 ng of genomic dna in pcr buffer containing 1.5 mm mgcl2, 200 m dntps, 0.1 m of each primer, and 1u taq polymerase (applied biosystems). The reaction mixture (20 l) was denatured at 94c for 1 minute, annealed at 58c for 15 seconds and extended at 72c for 30 seconds for a total of 34 cycles . Since the polymorphism creates a hinfi recognition site, 5 l of the pcr product was then digested with 5u hinfi, 2 l 10x reaction ne buffer 2 (new england, biolabs) and 12.5 l of water at 37c for 3 hours . The digestion product was electrophoresed on a 2.5% agarose gel . The wild - type allele (677c) corresponds to the presence of one band of 223 bp, and the mutant allele (677 t) corresponds to the presence of two bands of 175 bp and 48 bp . The heterozygous genotype (ct) corresponds to the presence of three bands of 223, 175, and 48 bp . Skewed variables were naturally log - transformed to normalize the distribution before any statistical analysis . The student's t - test and one - way anova procedures were used for mean comparison between groups . Hardy - weinberg equilibrium was assessed by chi - square test, which was equally used for the comparison of categorical variables between two groups . The comparison between three groups was assured by the kruskal - wallis test and the adequate post hoc multiple comparisons . Model selection log - linear analysis based on backward elimination was used for highly correlated variables identification, and the discriminant analysis with stepwise method was computed for identifying variables that have significant effects on cad and on hhcy . On the basis of the previous statistical analysis, logistic regression model with backward likelihood ratio method was used to compute odds ratio (ors) and their 95% confidence interval (95% ci). All statistical analysis was performed with spss for windows (release 7.5.1; standard version). All tests were two - tailed and p - value of <.05 was deemed significant . The demographic characteristics of the study population and the main risk factors are presented in table 1 . As expected, the mean age, frequency of occurrence in men, hypertension, smoking, diabetes, dyslipidemia, and obesity were significantly higher in cases than in controls (p <.05). The risk of cad were significantly increased by the presence of conventional risk factors (all 95% ci not contain the value of 0), and varying from 1.5 fold for male compared to female (or = 1.60, 95% ci: 1.072.38, p <.05) to 3 fold for smoking habits compared to no smoking (or = 2.97, 95% ci: 1.844.78, p <.001). Independently of cad, no significant difference was found between men and women for mthfr c677 t genotype frequencies (p = .880). In women, the genotype frequencies were 53.3% (21.4% in cases and 31.9% in controls), 35.7% (17.0% in cases and 18.7% in controls), and 11.0% (7.7% in cases and 3.3% in controls) for 677cc, 677ct, and 677tt, respectively . In men, the genotype frequencies were 53.7% (28.4% in case and 25.2% in controls), 33.9% (21.6% in cases and 12.4% in controls), and 12.4% (7.8% in cases and 4.6% in controls) for 677cc, 677ct, and 677tt, respectively . T polymorphism and cad were significantly independent in men (p = .302); but in women, the association was at the limit of the significance (p = .049). For the overall population, the prevalence of 677cc, 677ct, and 677tt genotypes were 53.5%, 34.8%, and 11.8%, respectively . The mutant homozygous, 677tt, was recorded in 8.4% of controls and 14.8% of cad patients . The wild - type genotype, 677cc, was found in 59.5% of controls and 48.1% of cad subjects . The difference between controls and cad patients was statistically significant for mthfr genotype and allele frequencies (p <.05). Taking the wild - type genotype as a reference, the mutant genotype increases the risk of cad by 2 fold (or = 2.17, 95% ci: 1.124.20, p <.05), while the cad risk increase associated to the mutant allele (677 t) was 1.5 fold compared to the wild - type allele 677c (or = 1.54, 95% ci: 1.111.84, p <.01). Subjects with cad had significantly (p <.001) higher thcy levels (mean sd = 14.9 3.1 l as the cut - off point to classify mild hyperhomocysteinaemia (hhcy), 49.5% of cad patients (49.2% men, 50.0% women) and 21.1% of controls (27.2% men, 15.3% women) had hhcy (table 2). Mild hhcy was significantly associated to cad (p <.001) in men and women separately . In all subjects, cad was significantly associated to hhcy, with a risk increase of about 4 fold compared to non - hhcy (or = 3.68, 95% ci: 2.375.72, p <.001). Thcy levels were positively and significantly associated to mthfr gene polymorphism (spearman's rho = 0.38, p <.001). This relationship was observed in case (spearman's rho = 0.44, p <.001) and control (spearman's rho = 0.32, p <.01) groups . Based on the post hoc multiple comparison appropriate for equal variances not assumed, there is a graded and significant (p <.01) increase in thcy levels from 677cc to 677tt genotypes of mthfr gene in both cases and controls groups . The frequencies of the simultaneous presence of cad and hhcy were 16.4%, 30.2%, and 57.4% in 677cc, 677ct, and 677tt genotypes, respectively (see table 2). Discriminant analysis and model selection log - linear analysis were computed prior to the logistic regression analysis based on the backward likelihood ratio method . The final model shows that hhcy is mainly and only significantly (p <.01) affected by the mthfr polymorphism and smoking habits, and their combined effects were not significant (see table 3). The mutant genotype had the more adverse effect (or = 11.72, 95% ci: 4.9127.96, p <.001) than smoking habits (or = 6.92, 95% ci: 3.5013.70, p <.001). As expected, traditional risk factor frequencies were higher in cases than controls, with exception for dyslipidemia and obesity in the 677tt genotypes . In cases subjects, all conventional risk factor frequencies were lower in 677tt genotype than in the remainders (see table 4). Those differences lead to think that conventional risk factors do not have the same effect on cad according to mthfr genotypes . In fact, in subjects with the wild - type genotype, the cad risk increase was significantly associated to smoking habits, obesity, dyslipidemia, and hypertension . In heterozygous individuals, the risk increase was more likely associated to smoking habits and hypertension; while the hhcy was the sole factor that significantly increases the risk of cad in subjects with the mutant genotype . In addition, it is important to note that hhcy was associated to a significant and graded cad risk increase from 2.5 fold in subjects with 677cc genotype (or = 2.47, 95% ci: 1.314.65, p <.01) to 9 fold in individuals with 677tt genotype (or = 8.68, 95% ci: 2.0536.69, p <.01). In consequence, it appears that the 677 t allele multiplies by 2 the risk of cad associated to hhcy (see table 5). On the basis of the results from model selection log - linear analysis and discriminant analysis procedures, logistic regression model based on backward likelihood method was used to compute the or of cad associated to the studied parameters (see table 6). Dyslipidemia, smoking habits, hypertension, and diabetes, as well as hhcy, were independent risk factors for cad . Therefore, mthfr polymorphism and hhcy interactive effect were found to be a strong predictor of cad risk (p <.01). The negative interactive effects between smoking habits and mutant genotype, as well as between dyslipidemia and hhcy, should be more likely the consequence of the small observed frequencies of smokers with 677tt genotype and the lowest frequency of hhcy among subjects with dyslipidemia, rather than an eventual protective effect . In accordance with a previous study (see), the present report confirms that cad is strongly and significantly associated to hhcy in moroccan population . This is in agreement with the meta - analysis by christen et al ., in which 43 studies were analyzed . In another meta - analysis, boushey et al . Evaluated 27 studies and showed that hcy is an independent and gradual risk factor for cad . The ors for cad ranged from 1.6 for men to 1.8 for women, for each thcy level elevation of 5 m . The increase in coronary risk resulting from this increase is similar to an increase of 20 mg / dl in total cholesterol levels . The authors considered that 10% of the risk of the general population for the development of cad can be attributed to hcy . The homocysteine hypothesis of atherosclerosis was largely based on the clinical and pathological observations in patients with homocystinuria, a metabolic disorder characterized by markedly increased levels of homocysteine . Biologic support of the theory was derived from experimental studies in which homocysteine concentrations far exceeded the levels encountered, even under the most severe pathological conditions, putting doubt on pathophysiological relevance in the clinical setting . The strongest support for a possible causal link between homocysteine levels and atherosclerosis came from retrospective, cross - sectional, or case - control studies . Some identified hcy as an independent risk factor [18, 19], but others did not [20, 21]. Recently, wald et al . Published a comprehensive meta - analysis of 16 prospective studies . The or for a 5 m increase hcy level was 1.23 (95% ci = 1.141.32). Published the results of a 24-year follow - up evaluating hcy quintile, relative risk was 1.86 (95% ci = 1.063.26) for acute myocardial infarction and 5.14 (95% ci = 2.2211.92) for death due to acute myocardial infarction . Our study was of interest because, despite a high prevalence of coronary morbidity and mortality in morocco, the total cholesterol concentrations are relatively low and are not the major cause for the development of atherosclerosis . In the light of these findings, we thought that plasma thcy concentrations might be an important risk factor for cad in morocco . Mol / l were a significant and independent risk factor for cad [25, 26]. Our results confirmed this effect which suggests that smoking increases hhcy, which in turn increases risk of cad . Smoking affects the vascular tree, platelet activation, lipid peroxidation, enhanced tissue factor activation, and reduced von willebrand factor, via several different interactive mechanisms [28, 29]. Nicotine and carbon monoxide separately produce tachycardia, hypertension, and vasoconstriction and both produce direct endothelial damage . Smoking also affects vaso - occlusive factors such as platelet aggregation, plasma viscosity, and fibrinogen levels [31, 32]. Homocysteine may damage endothelial cells and has been shown to be associated with elevated levels of von - willebrand factor in vivo, and with enhanced nitric oxide production in cultured cells, and thus would increase risk of atherosclerosis . Also, woo et al . Demonstrated impaired flow - mediated dilatation of the brachial artery in 17 healthy individuals who had no other risk factor except hhcy . Furthermore, thcy levels and endothelial function were corrected with folic acid supplementation . In addition, some studies have demonstrated an association between homocysteine and an increase risk of initial and recurrent venous thrombosis, and although this has not been shown in all studies, it has been confirmed in a meta - analysis in patients with fasting hhcy . First, as in previous studies, we found a strong link between the mthfr gene c677 t polymorphism and plasma thcy levels . Second, our study provides a very reliable phenotype characterization of cad, by performing coronary angiography in all patients and controls . Third, our study is the first and the largest one conducted in moroccan population, this facilitates the examination of the thermolabile mthfr genotype as an independent risk factor for cad and of the relations between genotypes, thcy, and risk . In the present study, mthfr gene c677 t polymorphism was significantly associated with cad (p <.05). Compared with homozygous wild - type, the homozygous mutant of mthfr gene was associated to a significant cad risk increase . In particular, morita et al . Reported that the frequency of this mutation was correlated with the severity of stenotic lesions and the number of stenotic coronary arteries, suggesting that this mutation is closely associated with the severity of cad . Therefore, the finding of an increased risk of cad associated with mthfr is not surprising because mthfr is strongly associated with an increased risk of hhcy . In the original description of thermolabile mthfr, selhub and d'angelo et al . Reported that thermolabile mthfr, which is correlated with the 677tt genotype, can be an inherited risk factor for cad . They documented a prevalence of 17% in patients with cad and of 5% in control subjects ., in a prospective study of patients with angiographically proved cad, found no relation between mthfr gene c677 t polymorphism and the risk of cad . In a health report of us physicians, the frequency of the mthfr genotypes was similar between patients and control subjects . The discrepancy between the results from all those studies is unclear and may be due to differences in nutritional intake of cofactors required for the mthfr pathway, such as vitamin b12 or folate, or other ethnic differences (e.g., weight, bmi). Our study showed a positive association between the homozygous mutant genotype and elevated plasma thcy levels in both cases and controls . This association suggests that mthfr gene c677 t mutation may increase plasma thcy levels and could be an independent predictor of plasma homocysteine levels, particularly in the setting of low folate status . On this basis, but without implying causality, it is reasonable to suggest that the effect of the 677tt genotype on cad may be mediated through high plasma thcy and low plasma folate concentration . Therefore, it is important to note that when cad and sex categories were considered together, mthfr c677 t polymorphism was not associated to cad (p>.05) in men; but in women this relation was at the limit of the significance (p = .049). Our data do not allow us to conclude clearly about mthfr c677 t mutation and cad association according to sex differences . When we assess the distribution of conventional cardiovascular risk factors according to mthfr c677 t polymorphism, we found that homozygous 677tt with cad had significantly lower frequencies of these risk factors than those having 677ct and 677cc . In 677cc and 677ct subjects, the cad risk is mediated by traditional risk factors and hhcy, while in 677tt subjects, the cad risk is conferred only by isolated hhcy . In the studied moroccan population, elevated thcy level is a strong risk factor for cad independently of the traditional risk factors, and this cad risk increase is strongly influenced by mthfr c677 t polymorphism . Traditional risk factors were associated to a significant increased risk of cad in subjects with 677ct and 677cc genotypes, while hhcy were the main and sole risk factor of cad in subjects with 677tt . For an eventual strategy of cardiovascular disease prevention in morocco, it is obvious that conventional cardiovascular risk factors should be viewed in the context of mthfr genotype and, of course, of other genetic determinants.
|
In february 2012, the birmingham and solihull tb service noted 2 distinct 24-loci miru - vntr strain types of mycobacterium tuberculosis (clusters a and b) isolated from 4 eritrea - born patients with pulmonary tb . The diagnoses were made in july (cluster a) and december 2011 (cluster b). Epidemiologic links were considered to be patients naming each other as contacts, sharing a contact without naming each other, or sharing a location during the infectious period of 1 patient . Case managers interviewed patients to elicit names of persons they may have had regular contact with over the infectious period; contacts in nonhousehold settings (e.g., workplace, leisure sites) were also included, but geographic locations were not always defined . The infectious period was defined as the date of onset of respiratory symptoms, if known, or 3 months before diagnosis . Surveillance data revealed an increased number of eritrea - born tb patients (1, 4, and 19 cases in 2004, 2006, and 2011 respectively); estimated incidence was 960 cases per 100,000 persons . To investigate whether transmission had occurred in the united kingdom and to identify opportunities for wider community intervention, we invited all eritrea - born tb patients (with and without strain typing available) reported during 2004august 2012 for an extended interview with a dedicated tb nurse . Semistructured questions examined potential sources of infection and secondary cases . To systematically explore locations frequented by patients, nurses asked patients to complete a 24-hour work / rest / play diary . Since november 2011, extended interviews have been routinely conducted for all miru - vntr clustered tb patients in birmingham; no ethics approval was required . According to routine practice, clustered eritrea - born patients continued to be interviewed through december 2013 . Most patients were male (65%) and had pulmonary tb (67%); median age was 29 (interquartile range 2535) years, and median length of time in the united kingdom before diagnosis was 4 (interquartile range 25) years . Of 62 (71%) patients who could be located, 49 participated in extended interviews . Except for homelessness (1 patient), no other social risk factors (e.g., drug and/or alcohol misuse, imprisonment, or mental health problems) were noted . Socializing occurred mainly in places of worship (43/49 patients frequented 9 places of worship) and private homes (10/49 patients frequented 7 residences). Miru - vntr typing was available for all 61 culture - confirmed cases; 46 isolates had 24 loci, and 15 isolates had 15 loci (table 1). Of the isolates with 24 loci, 27 (59%) clustered in 6 strain types . To identify risk factors for strain - type clustering, we compared demographic characteristics of clustered and nonclustered patients (table 2). According to bivariable analysis results, a noncongregate location was significantly associated with cluster a only (table 2). * miru - vntr, mycobacterial interspersed repetitive units variable - number tandem - repeat; na, not applicable . No epidemiologic links between those from different countries were found except in cluster e. 15-loci miru - vntr typing was available beginning in 2003 . Iqr, interquartile range; bcg, bacillus calmette - gurin; miru - vntr, mycobacterial interspersed repetitive units variable - number tandem - repeat; na, not applicable; rv, religious venue; tb, tuberculosis . Fisher exact test, the figure shows the overlap of social networks and miru - vntr strain - type clusters for eritrea - born tb patients . Few cases were linked by routine contact investigation alone because patients named the place of congregation (designated as religious venue [rv] 1 in the figure) in different ways . The extended interviews defined geographic locations to street level, and it was determined that rv1 was used for multidenominational worship and therefore was recognized by different names . Routine contact investigation also failed to elicit other households where patients socialized (h58 in the figure). As a result of the study, location - based contact tracing at rv1 was undertaken . An additional 68 persons were assessed, of which 19 (28%) had latent tb (16 started treatment and 14 completed treatment) and 1 had active tb . Latent tb was confirmed by a single interferon- release assay; therefore, infection resulting from distant exposure could not be ruled out . Social network of eritrea - born patients with tb in relation to 6 distinct 24-loci miru - vntr strain - type clusters and associated cluster members born elsewhere, united kingdom, january 2009december 2013 . Nonclustered eritrean patients are included if> 1 epidemiologic link to clustered patients is known . Circles denote eritrea - born patients; triangles denote patients born elsewhere; solid squares denote places of social mixing . For patients, labels denote strain type cluster (a f; x, no strain typing available) and chronological order of case notification within each strain type cluster . For places, labels denote type (h, private home; rv, religious venue; sc, school; wp, workplace). Double lines with arrows denote connections between tb patients who named each other as contacts during routine contact tracing investigations . Detached symbols at the bottom indicate persons for whom no epidemiologic links to any other case were detected . Miru - vntr, mycobacterial interspersed repetitive units variable - number tandem - repeat; tb, tuberculosis . Combined strain typing and in - depth interviewing also uncovered apparent casual transmission involving cluster e at a workplace (wp1 in the figure). Six months before diagnosis, patient e2 had worked at wp1 for 2 weeks, during the infectious period of patient e1 . As a result, 5 new workplace contacts were investigated; 3 cases were diagnosed (no patients were born in the united kingdom, and interferon- release assay conversion was not documented), and these patients completed treatment for latent tb . A third case (in patient f5) occurred at wp1, 6 months after illness of patient e2, but the isolate from patient f5 was of a different strain type . Given the low probability of transmission, no further location - based contact tracing was undertaken at wp1 . Discrepant strain types between patients known to have socialized at rv2, rv3, and school (sc) 1 also suggested that these cases did not involve the same chain of transmission . The infectious period for patient b1 preceded the arrival of patient b2 in birmingham, and local transmission was thought to be unlikely; both patients originated from the same town in eritrea . Genetically homogenous strain lineages prevalent in the countries of origin may falsely cluster persons from the migrant population (10); in our study, no patients within cluster d could be linked despite extensive epidemiologic investigation . We have demonstrated the value of identifying places of social mixing during contact investigation for recognizing such microepidemics early . This approach has been found useful in other settings (11,12). A recent evaluation of the tb strain typing service in the united kingdom found that strain typing did not significantly affect time to diagnosis or the median number of secondarily infected persons found per index case (13). However, strain typing can highlight gaps in current contact investigation procedures in specific patient populations and can help focus resources on scenarios in which recent transmission is more likely . Whole - genome sequencing may offer the ability to identify more recent strain evolution and transmission (14). Conventional epidemiologic methods should be improved to complement molecular epidemiologic methods and increase their effect on tb control.
|
Abdominal wall pain is a common complaint, and patients can present with it in the acute perioperative period as well as in a chronic pain state.1 pain - relieving therapies are varied, and range from oral medication to interventional procedures . Recently, the ultrasound - guided transversus abdominis plane (tap) block has become more widely used as an alternative technique for perioperative analgesia for abdominal procedures.24 the abdominal wall is innervated by the anterior division of the lower thoracic and upper lumbar nerves . The nerves course within the fascial plane between the internal oblique and transverse abdominis muscle the tap.5 with this anatomy and its innervation, the tap block has been shown to provide effective postoperative analgesia, reducing opioid requirements and improving patient satisfaction in the early postoperative period.5 the tap block had been used previously with a nonguided or blind double - pop technique that relies on tactile sensation to determine the appropriate level of local anesthetic infiltration.6 cadaver studies have established the petit triangle, defined medially by the latissimus dorsi muscle, laterally by the external oblique muscle, and inferiorly by the iliac crest . These superficial landmarks, when combined with knowledge of the path of the thoracolumbar nerves, have allowed clinicians to perform blind tap blocks with varying degrees of success.7,8 there are 2 potential pitfalls with a blind tap block . First, the final needle tip position may be superficial to the transversus abdominis fascial plane, resulting in intramuscular or subcutaneous deposition of the injectate . Second, the final needle tip position may be deep to the intended target, resulting in an intraperitoneal injection . Both of these aberrant injections would produce a failed block that results in pain, requiring rescue pain management because of liver laceration or bowel injury, to name just a few complications.9 with the advent of ultrasound guidance, the transversus abdominis fascial plane in which the thoracolumbar nerves reside can be identified and accurately injected with the intended medication.10,11 the ideal volume for a tap block is unknown . Different techniques (ie, subcostal versus midaxillary) have been described, and one study suggests that the more subcostal tap compartment does not communicate with the more lateral triangle of petit.12 volumes of injectate have varied among studies, with some using weight - based volumes versus standard volumes, without any conclusions regarding optimal volume . A recent retrospective review by abdallah et al13 suggested that 15 ml may be an optimal volume, although findings were inconclusive . We therefore sought to further investigate the spread of various volumes of contrast injected under ultrasound guidance into the tap layer as identified by computed tomography (ct) imaging . After receiving approval from the mayo clinic institutional review board, we obtained two unembalmed adult cadaveric torso specimens . No specimens exhibited signs of prior surgery, trauma, or major deformity around the abdomen, specifically at the injection sites . Each cadaver was imaged with a 64-slice (2 32 detectors) siemens somatom definition ct scanner (siemens healthcare, erlangen, germany) using a scan protocol consisting of 2-mm axial sections obtained in a soft - tissue kernel . All images were interpreted by an experienced musculoskeletal radiologist using a ge advantage workstation (ge healthcare institute, waukesha, wi, usa). All ultrasound procedures were performed with a philips cx50 ultrasound machine (philips healthcare, andover, ma, usa), using a 12-mhz linear array transducer with a 35-mm footprint, standard ultrasound gel, a 22-gauge, 89-mm diamond point stainless steel spinal needle (covidien, mansfield, ma, usa), and iodinated contrast agent (omnipaque 300, ge healthcare as, oslo, norway) diluted with 0.9% saline to a concentration of 36 mg / ml (10%). The tap layer was identified along the midaxillary line by an ultrasound of each cadaver by an experienced sonographer . From superficial to deep, the external oblique muscle, internal oblique muscle, and transversus abdominis muscle, including the tap fascial plane between the internal oblique and transversus abdominis muscles, were identified along the midaxillary line between the iliac crest and the subcostal margin, as previously described in the medical literature.4 a 22-gauge, 89-mm spinal needle was advanced under direct ultrasound visualization in a slightly oblique anterior to posterior direction toward the tap . Once the needle tip was observed to enter this fascial plane, hydrolocation with 0.9% normal saline was performed to confirm the fascial plane and facilitate better sonographic visualization14 (figure 1). Each cadaver was then placed in the ct scanner to verify the anatomical placement of the needle and to obtain baseline imaging of the relevant anatomy prior to contrast administration . Following the initial ct scan, the needle was left in place and extension tubing with a syringe containing the dilute iodinated contrast agent was connected to the needle . A predetermined amount of contrast was then injected under direct ultrasound visualization into the tap layer, and the cadaveric torso was rescanned using the same ct scan parameters . This procedure was repeated on both sides of each cadaver with different volumes of contrast: cadaver a (left, 5 ml; right, 10 ml); cadaver b (left, 15 ml; right, 20 ml). All needle entry points were between the level of the lumbar (l)3 disk space and the middle of the l4 vertebral body . Contrast injected under ultrasound guidance was identified in the tap in both cadavers on ct imaging (figure 2 and 3). Intraperitoneal contrast spread was also noted with the 15 ml injection (figure 3). Caudal spread of injected contrast correlated with increasing volumes of injectate (table 1). Caudal distribution was roughly 1 vertebral level (end plate to end plate) for the 5 ml injection and 2 vertebral levels for the 10, 15, and 20 ml injections . Anterior - posterior and transverse spread of injected contrast did not correlate with increasing volumes of contrast (table 1). As described in prior studies, there exists a difference in spread when a tap block is performed under ultrasound guidance, versus a nonguided approach to the triangle of petit.13 we chose to perform the injection using ultrasound guidance, with the goal of accurately measuring injectate spread delivered reliably into the transversus abdominis fascial plane . It is not uncommon to see a small amount of intramuscular spread of contrast within the tap layer that is likely related to incomplete separation of the fascial planes under pressurization . However, we were surprised to discover contrast in the peritoneal space despite direct visualization of the needle placement with ultrasound . Logically, the ability to see the injection under live imaging guidance should be safer and more successful; however, the possibility of accessing an unintended target exists, regardless of experience or technique.15,16 the entrance of the needle and thus injectate could pose risk to patients including bowel penetration, injury, or infection . Furthermore, when performing injections on cadavers there is no movement such as breathing or bowel peristalsis which may make injections easier but can also make identifying structures more difficult . This is true for the tap block, where the peritoneum can be identified by movement and the muscle layer superficial to it can be identified as the transversus abdominis muscle followed by the internal and external oblique muscles . Importantly, in this study, increased volumes of injectate correlated with increased cranial caudal spread, and demonstrated good spread around the midaxillary line where the iliohypogastric, subcostal, and intercostal nerves have been shown to course in the tap.1 this study helps further the understanding of injectate spread following ultrasound - guided tap injections . Specifically, it suggests that 15 ml provides additional cranial caudal spread and may be an optimal volume of anesthesia . The optimal volume required to achieve an adequate sensory block will vary, depending on the site of planned incision or the severity of abdominal pain . Furthermore, the degree of injectate spread may be different for live patients compared with that in fresh cadavers, and in addition, may also vary according to variability of patient height, weight, and previous abdominal surgeries . Therefore, further in vivo studies are warranted to investigate the minimum volume of ultrasound - guided injectate required to cause a sensory blockade of the anterior abdominal wall.
|
Unless otherwise stated, all chemicals and solvents were purchased from commercial suppliers in reagent- or technical - grade quality and used directly as received without further purification . The bis(arylimino)acenaphthene ligands were prepared from acenaphthenequinone and the corresponding substituted anilines in anology to literature methods. [14, 27] the rhenium complex 1 was synthesized as previously reported . General procedure for the preparation of 2 and 3: equimolar amounts of re(co)5cl (0.05 g, 0.14 mmol) and the corresponding bis(arylimino)acenaphtene ligand were refluxed in dry toluene (4 ml) for 30 min . Complete precipitation of the product was obtained upon cooling the reaction mixture to room temperature and slow addition of n - hexane . As a service to our authors and readers, this journal provides supporting information supplied by the authors . Such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset . Technical support issues arising from supporting information (other than missing files) should be addressed to the authors
|
Solar lentigines are well - circumscribed or irregularly shaped dark brown or black macules that occur on sun - exposed areas, predominantly on dorsal aspects of the hands and the face . Because of the negative social impact on quality of life, there are two types of treatment: (1) physical therapies, which include cryotherapy, laser therapy, intense pulsed light (ipl), and chemical peeling and; (2) topical therapies such as hydroquinone and tretinoin . Although it is inexpensive and effective, side effects such as post - inflammatory hyperpigmentation (pih) limit its use especially in darker fitzpatrick's skin types . Because of the broad absorption spectrum of melanin (351 - 1064 nm), multiple type of lasers (e.g., pulsed dye laser (pdl), q - switched ruby, q - switched nd: yag) have been used in the treatment of solar lentigines . Although pdl is a gold standard laser treatment for many superficial cutaneous vascular lesions, several studies suggest the good efficacy of pdl with compression in the treatment of solar lentigines. [410] to our knowledge, there are no published studies comparing cryotherapy with 595-nm pulsed dye laser (pdl) and cutaneous compression in the treatment of solar lentigines . The aim of this study was to compare the efficacy and safety of these modalities in the treatment of solar lentigines . Twenty - four patients with fitzpatrick's skin type ii - iv with facial or hand lentigines were enrolled in this evaluator - blinded randomized clinical trial . All patients, who completed follow up, were between the ages of 28 and 67 years (mean, 51.2 years; 20 females and 2 males) and had solar lentigines on their face or hands based on clinical diagnosis . The exclusion criteria were as follows: pregnancy, recent sun tanning, previous laser or topical treatments, history of oral retinoid treatment with in the previous 6 months, known photosensitivity or taking photosensitizing medication and history of vitiligo or psoriasis or keloid formation . The study protocol conformed to the ethical guidelines of the 1975 declaration of helsinki, and was confirmed by the ethical committee of our university . Lesions of one side of the face or each hand were randomly assigned and treated with either cryotherapy or 595-nm pdl (vbeam, candela corporation, wayland, ma) with cutaneous compression . Treatments were performed with radiant exposures of 10 j / cm, 7-mm spot size, and 1.5-ms pulse duration with no epidermal cooling . During each pulse, proper compression with convex surface of a fused - silica meniscus optical element with zero optical power was used to push the blood to the outside of laser treatment area and prevent purpura . The cryospray was applied for 35 s on each lesion from a distance of 3 cm from the lesion . Patients were asked to avoid sun exposure and use sunscreen on their hands and face . Before treatment and 1-month later, digital photographs were taken with the same camera . Two blind observers (both board - certified dermatologists) were asked to grade each treated site (hands or face) according to before and after pictures . The degrees of lightening of the lentigines were graded as either poor (minimal change with lightening of 0%25%), mild (slight improvement with lightening of 26%50%), moderate (though quite improved, can be differentiated from the surrounding healthy skin with lightening of 51%75%), or marked (difficult to differentiate from the surrounding healthy skin with lightening of 76%100%). The side effects including pih and hypopigmentation, post - pdl erythema, atrophic and hypertrophic scar were recorded in a follow - up session after 1 month . Data were analyzed with spss 16.0 software using wilcoxon - signed - ranks test and chi - square test . Of the original 24 patients, 22 patients (20 females and 2 males) participated in this study . The frequency of fitzpatrick's skin types were as follows: five cases (22.7%) skin type ii, eight cases (36.4%) skin type iii and nine cases (40.9%) skin type iv . About two - thirds (68.2%) of the lentigines were on the dorsum of the hands and 31.8% on the face . After 1 month, pdl with compression produced more than 75% lightening (marked improvement) in 10 patients (45.5%) compared with 2 patients (9.1%) in the cryotherapy group [table 1]. Statistical analysis showed a significant difference (p <0.05; [figures 1 and 2], respectively). Response to treatment in study groups treatment response after treatment: marked improvement of medial lesion with pdl with compression after 1 month pdl response showed a significant difference in patients with fitzpatrick's skin type iii and iv (n = 8, n = 9; p <0.05). In contrast, there might be no significant difference between pdl and cryotherapy response in fitzpatrick's skin type ii (n = 5; p> 0.05) [table 2]. Side effects were only post - pdl minimal erythema (after 1 month) in six patients (27.3%) of the pdl group and only (pih) in eight patients (36.4%) of the cryotherapy group . There were no other side effects such as atrophic and hypertrophic scar or purpura or hypopigmentation . Topical therapies of solar lentigines have fewer side effects but usually take longer than physical therapies to achieve a good result . These are frequently used with excellent clinical success rate; however, these types of therapies should be balanced against associated side effects . Cryotherapy is one of the most widely used and effective treatments in this field which is inexpensive and easily accessible . The principle of treatment in cryotherapy in solar lentigines is melanocytes vulnerability to cold injury, which can destroy them at temperatures of 4c to 7c . Accordingly, various types of lasers such as pulsed dye (595 nm),[410] frequency - doubled nd: yag (532 nm), ktp (532 nm), q - switched ruby (694 nm), q - switched and long - pulse alexandrite (755 nm), and q - switched nd: yag (1064 nm) have been used to treat solar lentigines . Recently, this laser has been usedsuccessfully for the treatment of epidermal pigmented lesions such as solar lentigines, freckles, and seborrheic keratosis with some modifications . Using skin compression during pdl removes the blood from the targeted treatment area, effectively eliminating hemoglobin as a competing target chromophore, and thereby minimizing the risk of purpura production, and allowing for the use of effective radiant exposure range for treating epidermal pigmented lesions (910 j / cm, 1.5-ms pulse duration). [45] epidermal cooling, which is usually used during treatment of vascular lesions with pdl, decreases the interaction between laser energy and the superficial pigmented lesion . Similar to previous studies,[410] epidermal cooling was not used in our study and no epidermal burning was recorded . Kono et al . Attached a flat glass to the laser's hand - piece in their first study . Later they found that attaching a convex glass instead of flat one allows for a more uniform blood displacement during skin compression from the irradiated field and better preventing purpura . Used convex surface of a fused - silica meniscus optical element with zero - optical power for compressing the skin during laser treatment . By using this compression technique, darker skin patients such as asians have higher epidermal melanin content and are more likely to develop erythema and pih, which can be considered as a default pathophysiologic response to cutaneous injury in these patients . Several factors contribute to the development of pih, including increased melanocytic activities, dermal melanophages, and hemosiderin deposition secondary to hemorrhage . The severity of pih is related to the degree of inflammation and extent of disruption of the dermo - epidermal junction caused by endogenous inflammatory skin disorders or iatrogenic sources such as lasers and cryotherapy . We have pih in our patients only in cryotherapy group suggesting that inflammatory response which is responsible for developing pih may be more prominent in cryotherapy than pdl group . Although q - switched ruby and alexandrite are highly effective in the treatment of lentigines, the risk of complications such as erythema, blistering and pih in darker skin types (fitzpatrick's skin type iii and iv) in these lasers are higher . Kono et al . Compared q - switched ruby laser (qsrl) versus pdl with compression for treating facial lentigines in asian (fitzpatrick's skin type iii and iv). They found that pdl with compression is more effective than qsrl with substantially less side effects . This study showed that pdl with compression is superior to qsrl for treating pigmented lesions in darker fitzpatrick's skin types . In our study, no pih was seen in the pdl group . Todd et al . Compared three type of lasers (frequency - doubled q - switched nd: yag laser, krypton laser, and 532-nm diode - pumped vanadate laser), and cryotherapy in the treatment of solar lentigines . It is difficult to directly compare these results with our study, as the types of the lasers used, are different . However, similar to todd study, the improvement in our patients in laser group wassuperior to cryotherapy (p <0.05) with fewer side effects . Compared cryotherapy versus trichloroacetic acid 33% (tca) in solar lentigines treatment and found better results with cryotherapy . Pih was the major complication in both treatments especially in fitzpatrick's skin type iii and iv . In our study, we detected pih only in cryotherapy group especially in darker skin types . Our study is a pilot one to compare efficacy and safety of a popular therapeutic modality like cryotherapy with a new laser method, pdl 595-nm with compression, in the treatment of solar lentigines . Therefore, it seems that confirming these results needs more studies with larger population size . Finally, it seems that the major factor in determining the therapeutic modality for solar lentigines is fitzpatrick's skin type . In darker skin types such as skin type iii and iv however, when the patient has lower skin types such as skin type ii, there may be no difference between the two therapeutic methods . In addition, side effects in pdl with compression are minimal (only minimal erythema in a few cases without pih or purpura) as compared with cryotherapy.
|
Cardiovascular disease (cvd) is a major cause of death and an important contributor to the wide and growing inequalities in mortality in high - income countries.1 as a result, the reduction of cvd has long been an objective of health policy in the uk and elsewhere, with a series of initiatives introduced with this as either a primary or secondary focus.2 recently, there has been interest in the potential of health checks (a non - programmatic form of screening for cvd risk factors) to contribute to reductions in overall cvd mortality and inequalities.3 4 the core theory for this approach is that it is possible to influence several of the factors (such as smoking, high blood pressure and obesity) that increase the risk of cvd, using primary prevention therapies such as statin and antihypertensive drugs and behavioural interventions to reduce cvd risk for those without cvd but currently at high risk . By systematically identifying and offering treatment to those at high risk, it is proposed that population health improvement (and reductions in health inequality) can be expected.3 however, there is controversy about whether health check programmes are effective in reducing the cvd risk of populations5 6 and whether an approach based on identifying individuals at high risk is appropriate.79 keep well (kw) was originally funded by the scottish government as a cvd prevention programme based on health checks in primary care.10 it was primarily designed to reduce cvd incidence and to narrow socioeconomic inequalities in cvd.11 previous evaluation work focused on implementation and reach of the programme, but questions surrounding the impact on health impacts could not be addressed.12 we aimed to assess whether trends in cvd - related mortality, hospitalisations and prescribing in those general practices involved in wave 1 of the kw programme changed after the implementation of the programme and whether they differed from the trends in non - kw practices . We used an interrupted time series design as the best available means of assessing its impact . The programme's prespecified theory of change indicated that, if successful, there would be increased prescribing of preventive therapies for cvd risk factors in the short - to - medium term, and greater reductions in cvd hospitalisations and mortality in the medium - to - long term in the kw intervention practices compared with non - kw practices.11 the wave 1 kw model was introduced in 2006 using heath checks delivered in primary care for adults aged 4064 years living in areas of the greatest material deprivation.11 those eligible were offered a cvd - focused health check to identify modifiable risk factors (using the assign score13). Those identified as having high cvd risk were offered a combination of advice, medical therapy and signposting or referral to other sources of support, including smoking cessation and weight loss programmes according to their identified risk factors.11 in wave 1 of kw, implementation occurred in the five community health partnerships (chps) with the highest proportion of their population living in the most deprived areas; defined using the scottish index of multiple deprivation (simd), which identifies small area concentrations of multiple deprivation across scotland.14 the five pilot sites were within four national health service (nhs) health boards (nhs greater glasgow and clyde (nhsggc), nhs lanarkshire, nhs lothian and nhs tayside). By 2013/2014, nhs boards reported that a total of 251 734 health checks had been carried out, of which 85.5% were delivered to individuals residing in the two most deprived simd quintiles (simd 1=70.8%, simd 2=14.7%).11 for the period january 1999 to august 2013, we obtained monthly counts of deaths and incident hospitalisations for stroke and coronary heart disease (chd) among those aged 4065 years from the information services division (isd) of nhs national services scotland for two groups of general practices: (1) those taking part in wave 1 of kw and (2) all other scottish practices . Incident cases were defined as admissions or deaths where there was no record of a hospitalisation for the same diagnosis in the 10 years prior to the index event . For each month, we obtained separate counts for kw wave 1 general practices and for all other scottish practices . We used corresponding population denominators for the kw and non - kw populations to calculate mortality and hospitalisation rates . Chd was defined using international classification of diseases (icd)9 codes 410 - 14 and icd10 codes i20 - 25 . Stroke (broadly defined as cerebrovascular disease) was defined using icd9 codes 430 - 38 and icd10 codes i60 - 69 and g45 . Prescribing data were obtained from isd for the period january 2002 to june 2011 for all general practices in scotland . We included prescriptions used in the primary prevention of cvd, categorised into statins, antihypertensives and antiplatelet drugs using classifications from the british national formulary . The data for each drug were provided as defined daily doses (ddds) by general practice and month of prescription . Total general practice populations for each practice and each year were also provided by isd from the community health index (chi) database to serve as denominators . Isd were provided with the date on which general practices started implementation of kw checks to allow coding of the prescriptions data as preimplementation or postimplementation without disclosure of the identity of individual practices . All data were provided at an aggregate level and the analytical approach described below reflects these data structure . We calculated monthly incidence rates for each health outcome for the kw and non - kw practice groups . We modelled the kw intervention effect using a covariate (st) coded as 0 at all time points before the intervention had started (prior to october 2006) and coded as 1 at all time points after kw implementation (after august 2010). For time points between these dates, the covariate took a value between 0 and 1, defined as the sum of the population size of practices that had started kw implementation at the given time point divided by the total population size of all kw practices by august 2010 . The intervention covariate (st) was therefore the proportion of the population size covered by kw at any given point in time as a fraction of the final kw population size . The interpretation of the exponential of the coefficient associated with st is a percentage change in the level of outcome after kw was implemented in all participating practices (from september 2010) compared with before kw was implemented in any practice (prior to october 2006). Mortality and hospitalisation rates were modelled using time series regression with autoregressive integrated moving average (arima) errors4 (additional information in the online supplementary material s1). Our analytical strategy consisted of initially modelling the respective series without the intervention to obtain an adequate preliminary model that passed all diagnostic tests and then modelling and testing the effect of the intervention.15 the most appropriate and parsimonious model was selected using the akaike information criterion (aic).16 web - table 1 provides further specifications of these models . To enable comparison with a control group, we employed the same analytical approach using data for non - kw practices . In addition, simultaneous time series of corresponding mortality and hospitalisation rates in non - kw practices were entered as a covariate in the arima error models for kw practices . This allowed us to control for factors external to the intervention which might affect mortality and hospitalisation rates, providing a net effect of the intervention.17 regression models were used to assess changes in prescribing after the introduction of kw for practices implementing wave 1 of the programme and for non - kw practices . Arima error models were created for each drug category to account for autocorrelation and seasonality in the data.18 in further analyses, we examined the possibility of a variation of the intervention effect between different health boards by including interaction terms . Data from 66 wave 1 kw practices were included for the additional analyses (data from practices in nhs tayside did not include practice codes and could not be matched by isd to the practice - level data on prescription rates and so were excluded). Generalised estimating equations (gees) were used to analyse prescribing data over time for practices in the remaining three health board areas . The quasi - likelihood under the independence model criterion (qic) statistic informed model selection.19 all analyses were undertaken using stata v.12.1 software (stata corp, college station, texas, usa; http://www.stata.com). The wave 1 kw model was introduced in 2006 using heath checks delivered in primary care for adults aged 4064 years living in areas of the greatest material deprivation.11 those eligible were offered a cvd - focused health check to identify modifiable risk factors (using the assign score13). Those identified as having high cvd risk were offered a combination of advice, medical therapy and signposting or referral to other sources of support, including smoking cessation and weight loss programmes according to their identified risk factors.11 in wave 1 of kw, implementation occurred in the five community health partnerships (chps) with the highest proportion of their population living in the most deprived areas; defined using the scottish index of multiple deprivation (simd), which identifies small area concentrations of multiple deprivation across scotland.14 the five pilot sites were within four national health service (nhs) health boards (nhs greater glasgow and clyde (nhsggc), nhs lanarkshire, nhs lothian and nhs tayside). By 2013/2014, nhs boards reported that a total of 251 734 health checks had been carried out, of which 85.5% were delivered to individuals residing in the two most deprived simd quintiles (simd 1=70.8%, simd 2=14.7%).11 for the period january 1999 to august 2013, we obtained monthly counts of deaths and incident hospitalisations for stroke and coronary heart disease (chd) among those aged 4065 years from the information services division (isd) of nhs national services scotland for two groups of general practices: (1) those taking part in wave 1 of kw and (2) all other scottish practices . Incident cases were defined as admissions or deaths where there was no record of a hospitalisation for the same diagnosis in the 10 years prior to the index event . For each month, we obtained separate counts for kw wave 1 general practices and for all other scottish practices . We used corresponding population denominators for the kw and non - kw populations to calculate mortality and hospitalisation rates . Chd was defined using international classification of diseases (icd)9 codes 410 - 14 and icd10 codes i20 - 25 . Stroke (broadly defined as cerebrovascular disease) was defined using icd9 codes 430 - 38 and icd10 codes i60 - 69 and g45 . Prescribing data were obtained from isd for the period january 2002 to june 2011 for all general practices in scotland . We included prescriptions used in the primary prevention of cvd, categorised into statins, antihypertensives and antiplatelet drugs using classifications from the british national formulary . The data for each drug were provided as defined daily doses (ddds) by general practice and month of prescription . Total general practice populations for each practice and each year were also provided by isd from the community health index (chi) database to serve as denominators . Isd were provided with the date on which general practices started implementation of kw checks to allow coding of the prescriptions data as preimplementation or postimplementation without disclosure of the identity of individual practices . All data were provided at an aggregate level and the analytical approach described below reflects these data structure . We calculated monthly incidence rates for each health outcome for the kw and non - kw practice groups . We modelled the kw intervention effect using a covariate (st) coded as 0 at all time points before the intervention had started (prior to october 2006) and coded as 1 at all time points after kw implementation (after august 2010). For time points between these dates, the covariate took a value between 0 and 1, defined as the sum of the population size of practices that had started kw implementation at the given time point divided by the total population size of all kw practices by august 2010 . The intervention covariate (st) was therefore the proportion of the population size covered by kw at any given point in time as a fraction of the final kw population size . The interpretation of the exponential of the coefficient associated with st is a percentage change in the level of outcome after kw was implemented in all participating practices (from september 2010) compared with before kw was implemented in any practice (prior to october 2006). Mortality and hospitalisation rates were modelled using time series regression with autoregressive integrated moving average (arima) errors4 (additional information in the online supplementary material s1). Our analytical strategy consisted of initially modelling the respective series without the intervention to obtain an adequate preliminary model that passed all diagnostic tests and then modelling and testing the effect of the intervention.15 the most appropriate and parsimonious model was selected using the akaike information criterion (aic).16 web - table 1 provides further specifications of these models . To enable comparison with a control group, we employed the same analytical approach using data for non - kw practices . In addition, simultaneous time series of corresponding mortality and hospitalisation rates in non - kw practices were entered as a covariate in the arima error models for kw practices . This allowed us to control for factors external to the intervention which might affect mortality and hospitalisation rates, providing a net effect of the intervention.17 regression models were used to assess changes in prescribing after the introduction of kw for practices implementing wave 1 of the programme and for non - kw practices . Arima error models were created for each drug category to account for autocorrelation and seasonality in the data.18 in further analyses, we examined the possibility of a variation of the intervention effect between different health boards by including interaction terms . Data from 66 wave 1 kw practices were included for the additional analyses (data from practices in nhs tayside did not include practice codes and could not be matched by isd to the practice - level data on prescription rates and so were excluded). Generalised estimating equations (gees) were used to analyse prescribing data over time for practices in the remaining three health board areas . The quasi - likelihood under the independence model criterion (qic) statistic informed model selection.19 all analyses were undertaken using stata v.12.1 software (stata corp, college station, texas, usa; http://www.stata.com). We calculated monthly incidence rates for each health outcome for the kw and non - kw practice groups . We modelled the kw intervention effect using a covariate (st) coded as 0 at all time points before the intervention had started (prior to october 2006) and coded as 1 at all time points after kw implementation (after august 2010). For time points between these dates, the covariate took a value between 0 and 1, defined as the sum of the population size of practices that had started kw implementation at the given time point divided by the total population size of all kw practices by august 2010 . The intervention covariate (st) was therefore the proportion of the population size covered by kw at any given point in time as a fraction of the final kw population size . The interpretation of the exponential of the coefficient associated with st is a percentage change in the level of outcome after kw was implemented in all participating practices (from september 2010) compared with before kw was implemented in any practice (prior to october 2006). Mortality and hospitalisation rates were modelled using time series regression with autoregressive integrated moving average (arima) errors4 (additional information in the online supplementary material s1). Our analytical strategy consisted of initially modelling the respective series without the intervention to obtain an adequate preliminary model that passed all diagnostic tests and then modelling and testing the effect of the intervention.15 the most appropriate and parsimonious model was selected using the akaike information criterion (aic).16 web - table 1 provides further specifications of these models . To enable comparison with a control group, we employed the same analytical approach using data for non - kw practices . In addition, simultaneous time series of corresponding mortality and hospitalisation rates in non - kw practices were entered as a covariate in the arima error models for kw practices . This allowed us to control for factors external to the intervention which might affect mortality and hospitalisation rates, providing a regression models were used to assess changes in prescribing after the introduction of kw for practices implementing wave 1 of the programme and for non - kw practices . Arima error models were created for each drug category to account for autocorrelation and seasonality in the data.18 in further analyses, we examined the possibility of a variation of the intervention effect between different health boards by including interaction terms . Data from 66 wave 1 kw practices were included for the additional analyses (data from practices in nhs tayside did not include practice codes and could not be matched by isd to the practice - level data on prescription rates and so were excluded). Generalised estimating equations (gees) were used to analyse prescribing data over time for practices in the remaining three health board areas . The quasi - likelihood under the independence model criterion (qic) statistic informed model selection.19 all analyses were undertaken using stata v.12.1 software (stata corp, college station, texas, usa; http://www.stata.com). These show changes relative to the preintervention period for kw and non - kw practices . Rates of incident hospitalisation and mortality for chd and stroke in kw and non - kw practices are shown in figure 1a d . Chd mortality declined over time in kw and non - kw practices, with kw practices having consistently higher rates than non - kw practices (figure 1a). All results refer to changes after adjusting for seasonal variation and the underlying temporal trends . Following the introduction of kw health checks (vertical line), a small increase of 0.4% in the chd mortality rate in the kw population was observed (95% ci 5.2% to 6.3%; table 1). In non - kw practices, chd mortality rates decreased by 0.3% (95% ci 2.7% to 2.2%) over the same period . Modelled changes in mortality, hospitalisation and prescriptions in kw and non - kw practices comparing preintervention and postintervention periods * percentage change in the mean level of outcome after kw was implemented in all participating practices (from september 2010) compared with the mean level of outcome before kw was implemented in any practice (prior to october 2006). Chd, coronary heart disease; ddd, defined daily dose; gee, generalised estimating equation; ggc, greater glasgow and clyde; kw, keep well; nhs, national health service . (a d) mortality and incident hospitalisation rates (coronary heart disease (chd) and stroke) in keep well (black line) and non - keep well (grey line) practices (vertical line indicates introduction of keep well intervention). For stroke mortality, a high degree of month - to - month variability was observed, with an overall downward trend for both groups, with higher rates in kw wave 1 practices (figure 1b). Comparing periods before and after the introduction of kw checks, stroke mortality increased by 6.7% (95% ci 2.6% to 16.9%) in kw practices . The adjusted mortality rate in non - kw practices showed no appreciable change (0.2%; 95% ci 6.7% to 6.7%) during the same period . Chd incident hospitalisation rates decreased by 1.1% (95% ci 3.4% to 1.3%) in kw practices, comparing the periods before and after the introduction of health checks (figure 1c). In non - kw practices, no appreciable change in chd incident hospitalisation rates was found (0.1%; 95% ci 1.8% to 1.7%) comparing the same two periods (table 1). Stroke incident hospitalisations showed a decrease of 1.5% (95% ci 4.4% to 1.6%) in kw practices and no appreciable change (0.1%; 95% ci 1.5% to 1.3%) in non - kw practices (table 1). The inclusion of the data series of non - kw practices did not alter results for kw practices appreciably (table 1). In kw and non - kw practices, prescription rates (expressed as ddds per 100 patients) for all drug classes increased over time, although rates for antiplatelets showed only a small increase . Prescription rates for statins were consistently higher in kw than in non - kw practices (figure 2a), while rates for antihypertensive drugs were similar (figure 2b). For antiplatelet prescriptions, rates started to decline from 2009 onwards (figure 2c). There was some degree of seasonality in rates, in particular for statins and antihypertensive drugs . (a c) mean rates of defined daily doses (ddds) prescribed by drug class in keep well (black line) and non - keep well (grey line) practices (vertical line indicates introduction of keep well intervention). Statin prescription rates showed a small increase of 0.4% (95% ci 10.4% to 12.5%) in kw practices following the introduction of health checks (table 1). In non - kw practices, comparison of the corresponding periods showed a decrease in the statin prescription rate of 1.5% (95% ci 9.4% to 7.2%) relative to the underlying trend . In kw practices, the antihypertensive prescription rate decreased by 2.5% (95% ci 12.3% to 8.4%) following the introduction of the kw intervention, whereas in non - kw practices, a decrease of 1.6% (95% ci 7.1% to 4.3%) was observed . The prescription rate for antiplatelets decreased by 0.9% (95% ci 6.5% to 5.0%) in kw practices and by 2.4% in non - kw practices (95% ci 10.1% to 6.0%). We considered the possibility that the kw intervention might be more effective in some nhs boards than others, due to board - level variations in the degree of engagement with the programme by including interaction terms between health board and the intervention (table 1). For statins, a negative association was found between the intervention and prescription rates, suggesting a decrease in prescription rates after the introduction of kw . This decrease was modified by health board area, with nhsggc showing a larger decrease than the other two health boards (3.9% (95% ci 7.6% to 0.1%)). Prescription rates for antihypertensive drugs declined at a higher rate in lothian than in the remaining two health board areas (5.7%; 95% ci 11.2% to 0.04%). Trends in antiplatelet prescription rates were not altered by the introduction of the kw intervention (figure 2c and table 1). In nhsggc and lothian, the intervention was associated with an increase in rates of ddds, whereas in lanarkshire, a relative decrease was observed . The gee models without the interaction terms had a smaller qic value than those with interactions, partly supporting our conclusions that changes in prescription rates were not markedly modified by health board location . These show changes relative to the preintervention period for kw and non - kw practices . Rates of incident hospitalisation and mortality for chd and stroke in kw and non - kw practices are shown in figure 1a d . Chd mortality declined over time in kw and non - kw practices, with kw practices having consistently higher rates than non - kw practices (figure 1a). All results refer to changes after adjusting for seasonal variation and the underlying temporal trends . Following the introduction of kw health checks (vertical line), a small increase of 0.4% in the chd mortality rate in the kw population was observed (95% ci 5.2% to 6.3%; table 1). In non - kw practices, chd mortality rates decreased by 0.3% (95% ci 2.7% to 2.2%) over the same period . Modelled changes in mortality, hospitalisation and prescriptions in kw and non - kw practices comparing preintervention and postintervention periods * percentage change in the mean level of outcome after kw was implemented in all participating practices (from september 2010) compared with the mean level of outcome before kw was implemented in any practice (prior to october 2006). Chd, coronary heart disease; ddd, defined daily dose; gee, generalised estimating equation; ggc, greater glasgow and clyde; kw, keep well; nhs, national health service . (a d) mortality and incident hospitalisation rates (coronary heart disease (chd) and stroke) in keep well (black line) and non - keep well (grey line) practices (vertical line indicates introduction of keep well intervention). For stroke mortality, a high degree of month - to - month variability was observed, with an overall downward trend for both groups, with higher rates in kw wave 1 practices (figure 1b). Comparing periods before and after the introduction of kw checks, stroke mortality increased by 6.7% (95% ci 2.6% to 16.9%) in kw practices . The adjusted mortality rate in non - kw practices showed no appreciable change (0.2%; 95% ci 6.7% to 6.7%) during the same period . Chd incident hospitalisation rates decreased by 1.1% (95% ci 3.4% to 1.3%) in kw practices, comparing the periods before and after the introduction of health checks (figure 1c). In non - kw practices, no appreciable change in chd incident hospitalisation rates was found (0.1%; 95% ci 1.8% to 1.7%) comparing the same two periods (table 1). Stroke incident hospitalisations showed a decrease of 1.5% (95% ci 4.4% to 1.6%) in kw practices and no appreciable change (0.1%; 95% ci 1.5% to 1.3%) in non - kw practices (table 1). The inclusion of the data series of non - kw practices did not alter results for kw practices appreciably (table 1). In kw and non - kw practices, prescription rates (expressed as ddds per 100 patients) for all drug classes increased over time, although rates for antiplatelets showed only a small increase . Prescription rates for statins were consistently higher in kw than in non - kw practices (figure 2a), while rates for antihypertensive drugs were similar (figure 2b). For antiplatelet prescriptions, rates started to decline from 2009 onwards (figure 2c). There was some degree of seasonality in rates, in particular for statins and antihypertensive drugs . (a c) mean rates of defined daily doses (ddds) prescribed by drug class in keep well (black line) and non - keep well (grey line) practices (vertical line indicates introduction of keep well intervention). Statin prescription rates showed a small increase of 0.4% (95% ci 10.4% to 12.5%) in kw practices following the introduction of health checks (table 1). In non - kw practices, comparison of the corresponding periods showed a decrease in the statin prescription rate of 1.5% (95% ci 9.4% to 7.2%) relative to the underlying trend . In kw practices, the antihypertensive prescription rate decreased by 2.5% (95% ci 12.3% to 8.4%) following the introduction of the kw intervention, whereas in non - kw practices, a decrease of 1.6% (95% ci 7.1% to 4.3%) was observed . The prescription rate for antiplatelets decreased by 0.9% (95% ci 6.5% to 5.0%) in kw practices and by 2.4% in non - kw practices (95% ci 10.1% to 6.0%). We considered the possibility that the kw intervention might be more effective in some nhs boards than others, due to board - level variations in the degree of engagement with the programme by including interaction terms between health board and the intervention (table 1). For statins, a negative association was found between the intervention and prescription rates, suggesting a decrease in prescription rates after the introduction of kw . This decrease was modified by health board area, with nhsggc showing a larger decrease than the other two health boards (3.9% (95% ci 7.6% to 0.1%)). Prescription rates for antihypertensive drugs declined at a higher rate in lothian than in the remaining two health board areas (5.7%; 95% ci 11.2% to 0.04%). Trends in antiplatelet prescription rates were not altered by the introduction of the kw intervention (figure 2c and table 1). In nhsggc and lothian, the intervention was associated with an increase in rates of ddds, whereas in lanarkshire, a relative decrease was observed . The gee models without the interaction terms had a smaller qic value than those with interactions, partly supporting our conclusions that changes in prescription rates were not markedly modified by health board location . Six years after the introduction of health checks in kw wave 1 practices, any effect of the intervention on trends in chd and stroke mortality, incident hospitalisations and prescription rates was likely to be very small . Once the seasonal pattern and strong downward temporal trend are taken into account, our results are consistent with both increases and decreases in mortality and hospitalisation following the intervention, but based on the cis, we can fairly reliably exclude reductions of more than 12% in hospitalisations and of more than 36% in mortality (because of the greater uncertainty due to the smaller number of deaths). Comparing the periods before and after the start of kw health checks, we found small relative declines in prescribing of statins, antihypertensive and antiplatelet drugs . The data have complete national coverage and are likely to accurately estimate the incidence of cvd and cvd - related prescribing in scotland with a low likelihood of missing cases or misclassification . The arima models were supported by relatively long time series available both before and after the intervention and accounted for random variation, temporal trends and seasonality . The health outcomes were clearly linked to the original defined purpose of wave 1 of kw and allowed the theory to be evaluated at different points after implementation . Wave 1 because subsequent waves had a less consistent focus on cvd, operated in more diverse settings where consistent monitoring data were not always available, and had a shorter duration of follow - up . We were not able to access individual - level data nationally because information sharing was not agreed with general practitioners (gps). This meant that we had to define the eligible population at practice level (for prescriptions) or for specific age groups within practices (for hospitalisations and mortality) and no adjustments for patient characteristics was possible . However, any changes in practice configuration (age structure, sex and deprivation) would be similar in kw and in non - kw practices . Since the analyses compare changes within kw practices and changes within non - kw practices, it is unlikely that aggregation would affect results . Furthermore, aggregation meant a reduction in the power of the study to detect any impact of the intervention by misclassifying some untreated individuals as treated . Similarly, it is likely that the comparison group (the rest of the scottish population) included some people who received a health check as part of subsequent waves of kw . The effect of both of these factors would be to dilute the measured impact of kw, creating a bias towards a null result . However, kw recipients other than wave 1 formed a very small proportion of the overall scottish population, so the impact of this bias is likely to be small . It is also important to recognise that analyses at individual level (as performed in some local studies) provide information only on efficacy (ie, potential benefits for those who actually received checks) rather than on real - life population impact . Although aggregate mortality and hospitalisation data were used in our analyses, this approach is likely to give a more realistic estimate of the real - life effectiveness of the programme . Information was available on the approximate dates on which each general practice started health checks as part of kw wave 1 but not on the speed or intensity with which the intervention was implemented . If some practices implemented the programme in a less vigorous way, this may have diluted the impact of kw . Our analyses of prescription rates including interaction terms between health board and the intervention variable attempted to account for overall variations between practices in different health boards . Clinical guidelines first published in 2007 recommended that cvd risk should be assessed in all individuals aged 40 years and above at least every 5 years, although this was based on low - quality evidence.20 guidelines also recommend (for those at high risk) prescription of antiplatelet therapy and statins, and antihypertensive therapy for those with hypertension.2123 however, the effectiveness of cvd screening programmes has been disputed for some time,24 25 with the latest cochrane reviews concluding that there is evidence for a reduction in risk factors but not mortality or morbidity and that universal health checks should therefore be abandoned.26 27 evaluation of health checks in england have found that, on average, there is no evidence of an increased identification of undiagnosed disease28 but some evidence of decreased cvd risk.29 30 a recent study reported an increased detection of hypercholesterolaemia but no increase in detection of obesity, smoking and hypertension.31 however, these studies do not account for secular trends (eg, declining smoking rates) and one is subject to a number of important biases including regression to the mean and selection bias.32 although these results are somewhat imprecise, they make it very unlikely that the implementation of the first wave of kw health checks in scotland was associated with substantial or important changes in cvd outcomes or prescribing . It is possible though that the overall level of health check coverage was not sufficient to produce a measurable effect or that participants did not receive all the interventions that were originally planned . This, however, reflects the nature of an effectiveness study (rather than efficacy) and is perhaps a more realistic assessment of the real - world impact . It is possible that while the individual components of the kw check (drug therapy, lifestyle advice, etc) are effective in trial situations, other factors including the challenges of programme delivery and the individual situations of people in deprived circumstances mean that their real - life effectiveness is much less . This may also include variations in care delivered by different healthcare professionals; that is, nurses, gps and other staff . Our analyses include a 6 years follow - up, but it is possible that clear benefits might only emerge later because of the length of time required for primary prevention to reduce risk factors and decrease morbidity and mortality at population level . Given the change in prescription rates was found to be small, it seems unlikely that mortality and hospitalisation rates would change . The data have complete national coverage and are likely to accurately estimate the incidence of cvd and cvd - related prescribing in scotland with a low likelihood of missing cases or misclassification . The arima models were supported by relatively long time series available both before and after the intervention and accounted for random variation, temporal trends and seasonality . The health outcomes were clearly linked to the original defined purpose of wave 1 of kw and allowed the theory to be evaluated at different points after implementation . Wave 1 because subsequent waves had a less consistent focus on cvd, operated in more diverse settings where consistent monitoring data were not always available, and had a shorter duration of follow - up . We were not able to access individual - level data nationally because information sharing was not agreed with general practitioners (gps). This meant that we had to define the eligible population at practice level (for prescriptions) or for specific age groups within practices (for hospitalisations and mortality) and no adjustments for patient characteristics was possible . However, any changes in practice configuration (age structure, sex and deprivation) would be similar in kw and in non - kw practices . Since the analyses compare changes within kw practices and changes within non - kw practices, it is unlikely that aggregation would affect results . Furthermore, aggregation meant a reduction in the power of the study to detect any impact of the intervention by misclassifying some untreated individuals as treated . Similarly, it is likely that the comparison group (the rest of the scottish population) included some people who received a health check as part of subsequent waves of kw . The effect of both of these factors would be to dilute the measured impact of kw, creating a bias towards a null result . However, kw recipients other than wave 1 formed a very small proportion of the overall scottish population, so the impact of this bias is likely to be small . It is also important to recognise that analyses at individual level (as performed in some local studies) provide information only on efficacy (ie, potential benefits for those who actually received checks) rather than on real - life population impact . Although aggregate mortality and hospitalisation data were used in our analyses, this approach is likely to give a more realistic estimate of the real - life effectiveness of the programme . Information was available on the approximate dates on which each general practice started health checks as part of kw wave 1 but not on the speed or intensity with which the intervention was implemented . If some practices implemented the programme in a less vigorous way, this may have diluted the impact of kw . Our analyses of prescription rates including interaction terms between health board and the intervention variable attempted to account for overall variations between practices in different health boards . Clinical guidelines first published in 2007 recommended that cvd risk should be assessed in all individuals aged 40 years and above at least every 5 years, although this was based on low - quality evidence.20 guidelines also recommend (for those at high risk) prescription of antiplatelet therapy and statins, and antihypertensive therapy for those with hypertension.2123 however, the effectiveness of cvd screening programmes has been disputed for some time,24 25 with the latest cochrane reviews concluding that there is evidence for a reduction in risk factors but not mortality or morbidity and that universal health checks should therefore be abandoned.26 27 evaluation of health checks in england have found that, on average, there is no evidence of an increased identification of undiagnosed disease28 but some evidence of decreased cvd risk.29 30 a recent study reported an increased detection of hypercholesterolaemia but no increase in detection of obesity, smoking and hypertension.31 however, these studies do not account for secular trends (eg, declining smoking rates) and one is subject to a number of important biases including regression to the mean and selection bias.32 although these results are somewhat imprecise, they make it very unlikely that the implementation of the first wave of kw health checks in scotland was associated with substantial or important changes in cvd outcomes or prescribing . It is possible though that the overall level of health check coverage was not sufficient to produce a measurable effect or that participants did not receive all the interventions that were originally planned . This, however, reflects the nature of an effectiveness study (rather than efficacy) and is perhaps a more realistic assessment of the real - world impact . It is possible that while the individual components of the kw check (drug therapy, lifestyle advice, etc) are effective in trial situations, other factors including the challenges of programme delivery and the individual situations of people in deprived circumstances mean that their real - life effectiveness is much less . This may also include variations in care delivered by different healthcare professionals; that is, nurses, gps and other staff . Our analyses include a 6 years follow - up, but it is possible that clear benefits might only emerge later because of the length of time required for primary prevention to reduce risk factors and decrease morbidity and mortality at population level . Given the change in prescription rates was found to be small, it seems unlikely that mortality and hospitalisation rates would change . . However, our findings are consistent with systematic reviews suggesting that delivering these interventions in a systematic population wide way may not be effective . The kw approach (like the english health check programme) is essentially a screening programme, and more rigorous evidence of effectiveness is required before it is adopted . Our interrupted time series approach could be criticised as a weaker design than cluster randomisation or stepped wedge approaches . We suggest that for large - scale population interventions, randomised approaches are more feasible than currently assumed by policymakers, and we think they should be more widely used ., these could prevent cardiovascular disease (cvd) in asymptomatic individuals and narrow existing socioeconomic inequalities in health . Health check programmes have been implemented to specifically target those at high risk of cvd, but there is controversy about whether these are likely to be effective at the population level and about whether a screening approach is justified . A key early aim of the scottish keep well programme was to narrow socioeconomic inequalities in cvd by targeting individuals living in deprived areas, screening for cvd risk factors and then providing drug therapies (eg, statins and antihypertensives) and lifestyle advice for those at high risk . Our study suggests that, after accounting for seasonal and secular trends, the effect of the keep well intervention on cvd mortality and incident hospitalisation was unlikely to be substantial.
|
Providing immigrants with proper health care is a challenge, given language barriers and cultural differences . At the primary health care level, it becomes the responsibility of the clinic to arrange such practical issues as providing capable interpreters when needed . One of the fundamental objectives of public health care systems with universal health coverage is to achieve equal use of the health care system and equal access to the services for equal needs, named horizontal equity . From ancient times, there have been resettlements of people . As a result of the constant conflicts and wars around the world, there is also immigration in search of better living conditions, often from low - income regions . Today some 9% of the inhabitants of iceland are immigrants, the same percentage as that in europe [1, 5]. According to studies, the immigrants are often in better health than the average for the nonimmigrant population [6, 7]. Loss of social network, isolation, and low socioeconomic status, however, can often contribute to worse health of immigrants in their new homeland [7, 8]. On the other hand, immigrants to the usa have a considerably longer life expectancy than people born in the states . There are studies indicating that immigrants utilize the health care system differently from the nonimmigrants, partly because they do not have access to information about the health care system and where to attend [4, 10]. Language is the basis of all communication in health care, and it takes time for immigrants to learn a foreign language sufficiently well to communicate about their health issues . The health of immigrants can be affected by infections prevalent in their former geographical home, and they may have genetic variations uncommon in the new country . Many of the asylum seekers have had traumatic experiences in military conflicts where human rights have been violated . The immigrants and refugees present clinical symptoms according to their ethnic background, in some cultures towards somatization . The health care provider should provide medical advice and treatment with understanding and respect towards the ethnicity of the immigrant . The country is an island in the north - atlantic ocean and with a population of over 330 thousand . Though not a part of the eu, it is a part of the european economic area . Its welfare infrastructure is similar to those in other scandinavian countries . During the 10 years prior to this study, there had been a rapid increase in the number of immigrants, from 3% in 1998 up to 10.4% of the population in reykjavk in 2008 [5, 16] (see figure 2). The primary health care system in the capital area is based on 17 health care centres, each with district responsibility, and the service is mainly state financed . There are other open access units as well, including the er ward at the national university hospital as well as a relatively open private specialist service in reykjavk . The health care centre in glaesibaer was opened in 2006 and is served by 5 family physicians . From the beginning, there was a focus on immigrant health, their access, and discussions on cultural aspects of health care and the use of interpreters . One of the family doctors (hj) has been educated in international health and has a long experience of working in africa . Many of his patients were immigrants, though other family doctors had immigrants in their registers as well . With the intent of optimizing the service for immigrants at the health care centre, we decided to compare the health care utilization of immigrants to that of nonimmigrants . This included the diagnosis, attendance rate, and identification of any differences in family structure, as well as the need for interpreters and the immigrants' opinion of the quality of the service provided . The study took place at the health care centre in glaesibaer, reykjavk, which is a primary health care clinic with a broad spectrum of services, such as consultations with family physicians and primary health care for children and pregnant women . There is, as well, a walk - in service during the day and afternoons for the acutely sick and for minor accidents . As a case control study, we invited all immigrants to participate who attended the health care centre in over a two - week period in the autumn of 2008 . For the controls we also asked the nonimmigrants to participate who were attending the same kind of service, at the same time, and were paired by age and sex . The medical doctors conducting the study invited all immigrants who came during the time period to participate . The same medical doctors then looked at the same time at the booking register to find a nonimmigrant control, within the same age group and of the same sex who attended the same kind of service . The participants answered a structured questionnaire about country of birth, family structure, and the length of time they had lived in iceland, as well their attitude to the service provided . The formal questions were explained and translated to the immigrant by an interpreter as needed . The participants evaluated the quality of the service on a scale from zero to five . The questions used were the same as those used in a yearly quality control survey conducted on almost all public services in iceland . A medical doctor looked at information from the health care records concerning the diagnosis and how often they and their children had attended the clinic during the previous year . A paired t - test was used for paired continuous variables and the chi - square test for categorical variables . The study was, as well, granted permission from the data protection authority, number 2008/23 . There were 57 pairs of immigrants and nonimmigrants, 48 pairs of women and 9 of men . There were eight from thailand and seven from poland, five from vietnam, four from the philippines, and the others from different countries and continents of the world . The mean age of the participants was 34.0 years in the immigrant group and 33.7 years in the nonimmigrant group, p = 0.664 . Of the immigrants, 26 women were married, 9 cohabiting, and 12 single, compared to 11 married, 24 cohabiting, and 13 single in the group of nonimmigrants . Of the women living in permanent relationships, being married compared to cohabiting was more common in the immigrant group, p <0.001 . The immigrants attended the clinic for their own consultations equally often per year as the controls or 4.6 times for the immigrant cohort and 4.7 times for the controls, p = 0.92 . During the preceding year, the immigrants attended the clinic with their children equally often as the controls, 6.9 versus 6.6 times, p = 0.76 (table 2). Interpreters were used in 12 (21%) of the 57 consultations . When asked about the quality and satisfaction with the interpreter service, the 12 immigrants rated it as 4.6, on a scale of zero to five . When asked for assessment of the quality of the service of the health care centre, the immigrants rated it as 4.3 and the controls as 4.1, p = 0.27 . The immigrants evaluated the service in iceland as 4.3 and the service in their homeland as 1.68, p <0.001 (table 3). There were no differences in the diagnoses of the patients between cases and controls while attending the health care centre (table 4). Icelandic society has been rapidly changing, from being an ethnically homogeneous population to a multicultural immigrant society . In the ten years from 1998 to 2008, the percentage of immigrants increased from 3% to 10.4% (see figure 2). The need for good health service for immigrants has therefore become of increasing importance and a study has been needed to check on the results . To the best of our knowledge, no such similar studies on the utility of immigrant of health service have been conducted in iceland . In fact, there are few studies on the health care utility of immigrants in clinical settings . This study showed how divergent the group of immigrants in reykjavk was, as the participants came from 27 widely separated countries . The immigrant women were more often married and the icelandic women more often cohabiting, which was a clear cultural difference, as cohabiting has been a common form of family structure in iceland, especially among younger people . Here we have to bear in mind that about 10.4% of the population in reykjavk were immigrants at the time of the study and some 17% of pregnant women were of foreign origin . There were no differences in the number of visits during the observation period or the preceding year, for the immigrants or nonimmigrants or their children . The participants came 4.6 times on average to the clinic, which is a similar utility rate per person as the average in iceland, bearing in mind the sample population, many attending maternity, and child preventive services . This was in contrast to a study from sweden, where immigrants more often visited the emergency department (19% more visits) but used the outpatient clinics less often . In another swedish study from malm, there was hardly any difference after correcting for social and economic status . In studies using a huge patient data basis from primary health care in norway and spain, this is in contrast to a systematic review of the utilization of health care of immigrants in europe, which showed that immigrants consulted general practitioners more often than nonimmigrants but used telephone contacts less frequently (perhaps because of language difficulties). Attendance at health care centres in iceland is free of charge for children and pregnant women in preventive care, and the fee is low for other services and substantially lower than attending a hospital or private specialists . The difference in cost can cause bias, if the better - off nonimmigrants are prone to attend private specialists or hospitals . This can as well explain why immigrants use health services less often than nonimmigrants in countries without universal health care coverage . The preventive services for children and maternity care in iceland, on the other hand, are strictly on a district basis and are the same for everyone, regardless of immigrant or nonimmigrant status or income level, and the services is not provided elsewhere in city . The doctor or the health care provider has to gather information from the patient or relatives; this information must be sufficiently clear so that it can be understood in terms of medical standards and patient needs, as well as in terms of cultural aspects . Even though the immigrants had not stayed in iceland for more than seven years on average, some 80% managed consultations on their own and spoke either icelandic or english . The attitude to the quality of the service was the same among immigrants and the nonimmigrants . The results were similar to those obtained by official inquiries about the quality of the primary health clinics in the capital area of reykjavk . The immigrants regarded the service provided at the glaesibaer public health care centre as better than they were used to, a result that of course reflected the fact that a proportion of them had come from parts of the world that are low - income regions . There was only a relatively small number of participants, so it is possible that a larger study, perhaps including more than one district public health care clinic, could have detected a difference in the rate of attendance or of diagnosis . We asked all immigrants attending the clinic at the time of conducting the study to participate . However, some refused to participate and we do not have any information about their number nor their backgrounds . The present study had a high proportion of women, and this could have caused bias . The group of immigrants was young, with a mean age of 34 years, reflecting the fact that 21 of them were attending preventive care for maternity or children . We do not have any information as to whether this group consisted of heavy or light attenders to private specialist care or emergency departments of the hospitals . The immigrants in iceland are mostly economic immigrants and not seeking asylum, so they should be in better general health than refugees coming from regions of ongoing military or political conflicts . As the people attending the clinic came at random, we regard the participants as randomly selected . But with a low number of participants and with observation from a single health care centre this can be biased . We nevertheless assume that the cases represented a random group of immigrants, and the nonimmigrants are a random group of controls . It would be interesting to analyse whether there are differences by region of origin or by the length of time immigrants have spent in iceland . Due to the small sample size, the strength of the study, on the other hand, lies in its design, as a case control study, with the groups evaluated being of the same age and sex and attending the same kind of service . In the hope of optimizing the service of immigrants in a health care centre, in a rapidly changing society, we have tried to integrate knowledge on cultural aspects into the services as well as providing interpreters as needed . The immigrants attending the clinic came from all over the world, had similar diagnoses, and were attending the clinic as often per annum as the nonimmigrants . The health and health care utilization of immigrants did not differ from those of the nonimmigrants.
|
Twenty - two volunteers (10 women) aged between 18 and 50 years underwent a rigorous protocol using standard measures of obesity and insulin resistance . Specifically, participants were nondiabetic (normal glucose tolerance or impaired glucose tolerance) according to an oral glucose tolerance test (ogtt) (world health organization 1999 criteria), nonsmokers at the time of the study, and healthy according to a detailed physical examination and routine blood analyses . No participants had clinical or laboratory signs of acute or chronic infection or took any medication or used illicit drugs at the time of the study . The protocol was approved by the alfred hospital ethics committee and complied with the declaration of helsinki 2004 . All participants were characterized for plasma inflammation markers, body composition, glucose tolerance, insulin action, and nf-b and jnk1 activity in pbmcs and muscle and adipose tissue (table 1). Anthropometric and metabolic parameters of the study population * p <0.05 male vs. female subjects . All subjects underwent medical screening, which included history, physical examination, and basic laboratory tests (including fasting plasma lipid levels, liver function tests, urea, creatinine, and electrolyte levels, urinary illicit drug screening, an anthropometric assessment, an ogtt, and a hyperinsulinemic - euglycemic glucose clamp . Before metabolic testing, participants were asked to abstain from strenuous exercise and caffeine for 3 days . Body composition was estimated by total - body dual - energy x - ray absorptiometry (dpx - l; lunar radiation, madison, wi) with calculations of percent body fat, fat mass, and fat - free mass as described previously (11). Waist and hip circumferences were measured and waist - to - hip ratio (whr) was calculated as an index of body fat distribution . A 2-h 75-g ogtt was performed after a 12-h overnight fast, and glucose tolerance status was determined by world health organization 1999 criteria . Plasma glucose concentrations were determined by the glucose oxidase method (elm 105; radiometer, copenhagen, denmark). Insulin action was assessed at physiological insulin concentrations during a hyperinsulinemic - euglycemic clamp . In brief, after an overnight fast, a primed continuous intravenous insulin infusion (9 mu / kg) was administered for 120 min at a constant rate of 40 mu / mbody surface area per minute (m). Plasma glucose was measured every 5 min during the clamp, and the variable infusion rate of glucose was adjusted to maintain blood glucose at a constant value of 5 mmol / l . The rate of total insulin - stimulated glucose disposal (m) was calculated for the last 40 min of the insulin infusions . Blood samples for analysis of inflammation markers were drawn before the start of the glucose clamp . Biopsies of subcutaneous adipose and vastus lateralis muscle were performed on a separate day using standard aseptic technique and local anesthesia . In brief, before a percutaneous muscle biopsy of the vastus lateralis muscle, a scalpel blade was used to make a 7-mm skin incision and to cut the fascia . A side - cutting muscle biopsy needle was passed through the incision to obtain 100 mg of muscle tissue . Adipose tissue was obtained by needle biopsy from the abdominal area, 12 cm superior to mcburney's point . After making an 5-mm skin incision, the needle biopsy was performed using a 50-ml plastic syringe attached to a 13-gauge aspiration needle . The muscle and adipose tissues were immediately placed in liquid nitrogen and then stored at 80c . Blood samples were drawn using standard phlebotomy techniques into sodium citrate vacutainers for measurement of inflammatory markers . The tubes were centrifuged immediately (1,500 g, 15 min, 4c), and the plasma was stored at 80c until analyses were performed . Monocyte chemoattractant protein-1 (mcp-1) was measured using a beadlyte plex kit (upstate cell signaling solutions, charlottesville, va). Multiplexed assays were run according to the manufacturer's instructions on a luminex 100 bioplex machine using luminex pro software version 1.7 (bio - rad, atherton, ca). Plasma high - sensitivity c - reactive protein (hscrp) was measured by an immunoturbidimetric assay . Hepatic enzymes, alanine aminotransferase (alt) and -glutamyltranspeptidase (ggt), were measured by nadh (without p-5-p) andl--glutamyl-3-carboxy-4-nitroanilide substrates, respectively . Hscrp and hepatic enzymes (alt and ggt) were measured by alfred hospital pathology services using the architect system (abbott diagnostics, abbott park, il). Pbmcs were isolated from whole blood using ficoll - paque plus density centrifugation (amersham biosciences, uppsala, sweden). The pbmc pellet was resuspended in fbs with 10% dmso and stored at 80c . Nuclear extraction from pbmcs and adipose and skeletal muscle tissue muscle and adipose tissue biopsy samples were homogenized in a 1:5 w / v ice - cold homogenization buffer (50 mmol / l tris - hcl, ph 7.8, 10 mmol / l edta, ph 8.0, 100 mmol / l naf, 2 mmol / l na3 vo4, 1 mmol / l sodium pyrophosphate, 250 mol / l phenylmethylsulfonyl fluoride, 10 g / ml aprotinin, and 10 g / ml leupeptin) with a hand - held homogenizer (polytron - aggregate; kinematica, switzerland). Samples were then rotated for 30 min, end - over - end, at 4c, before being centrifuged (14,000 g, 30 min, 4c) to isolate the nuclear pellet . The nuclear pellet was then resuspended in 500 l buffer a (10 mmol / l hepes, ph 7.9, 10 mmol / l kci, 0.1 mmol / l edta, 0.1 mmol / l egta, and 0.7% v / v igepal), vortexed and centrifuged (7,000 g, 1 min, room temperature), and then resuspended in 500 l buffer b (10 mmol / l hepes, ph 7.9, 10 mmol / l kci, 0.1 mmol / l edta, and 0.1 mmol / l egta). Supernatant was removed, and the pellet was resuspended in 150 l buffer c (20 mmol / l hepes, ph 7.9, 400 mmol / l nacl, 1 mmol / l edta, and 1 mmol / l egta), incubated on ice for 20 min, and then centrifuged (10,000 g, 30 min, room temperature). Pbmc samples were washed in excess pbs and centrifuged (400 g, 5 min, 4c), to remove residual fbs and dmso . The supernatant was discarded, and the pellets were resuspended in 100 l triple detergent buffer (50 mmol / l tris - hcl, ph 8.0, 150 mmol / l nacl, 0.02% nan3, 0.1% sds, 100 g / ml phenylmethylsulfonyl fluoride, 1 g / ml aprotinin, 1% nonidet p-40, and 0.5% sodium deoxycholate, in milli - q h2 o). These were then sonicated for 1 min and centrifuged (400 g, 3 min, 4c). The protein concentration of all protein isolates was determined using the bicinchoninic acid protein assay (pierce, rockford, il), performed according to the manufacturer's instructions . The transam nfb dna - binding activity assay (active motif, carlsbad, ca) was used to detect and quantify nf-b transcription factor activation, specifically of the p65 subunit . Nuclear extracts obtained from muscle (1 g protein / well) and adipose tissue (5 g protein / well) biopsies and pbmc (30 g protein / well) samples were analyzed for their binding capacity to an nf-b consensus sequence in labeled dna in a 96-well plate format . The assays were performed according to the manufacturer's instructions, and absorbance was measured on a victor3v multilabel plate reader (perkinelmer, wellesley, ma). Phosphorylation of jnk ([thr / tyr] /total jnk) was used as a surrogate for jnk1/2 activity as described previously (21). Pbmc, subcutaneous adipose tissue, and skeletal muscle samples were homogenized, and protein concentrations were determined . Total protein (40 g) was separated by sds - page and blotted onto a polyvinylidene fluoride membrane . Blots were performed for phosphorylated jnk (1:1,000) and total jnk (1:1,000) using antibodies from cell signaling technologies . Bands were visualized using a bio - rad anti - rabbit igg horseradish peroxidase (1:4,000) conjugated antibody and ecl solution (sigma) and developed on film . Jnk1/2 activity in muscle and adipose tissue was available for only 18 individuals because insufficient tissue was available for analyses . Gene expression of the p65 subunit of nf-b and ib in pbmcs was assessed by real - time quantitative rt - pcr, performed using the taqman system based on real - time detection of accumulated fluorescence (abi prism 7700 sequence detection system; pe biosystems, foster city, ca) as described previously (23). Briefly, 4 g total rna was isolated from pbmcs with trizol according to the manufacturer's instructions (gibco brl, grand island, ny). The resulting rna was used to synthesize cdna with a superscript first strand synthesis system (gibco brl). To control for variation in the amount of dna available for pcr in the different samples, gene expression was normalized simultaneously (by multiplexing) in relation to the expression of the housekeeping gene 18s rrna (18s rrna taqman control reagent kit) as an endogenous control . Primers and taqman probes for the proteins described above were constructed with the help of primer express (perkinelmer) (for sequences, see table 2) and fluorescence for each cycle was quantitatively analyzed by an abi prism 7700 sequence detection system . Results are expressed as arbitrary units, related to minor groove binding (mgb) probe sample fluorescence, corrected to endogenous 18s expression . Real - time rt - pcr probes and primers used for amplification of nf-b p65 and ib in pbmcs statistical analyses were performed using sas jump statistics software (sas institute, cary, nc). The values for inflammatory markers and m were logarithmically transformed before analysis to approximate normal distributions . The relationships between inflammatory markers, nf-b, jnk1/2, and anthropometric and metabolic variables were examined by calculating pearson correlation coefficients, and p values were corrected for multiple comparisons (benjamini - hochberg procedure). Multiple linear regression models and partial correlations were used to examine the relationships after adjustment for covariates . Stepwise regression was used to determine a relative contribution of each of the variables to the model . Our correlation tests are sufficiently sensitive at = 0.05 with a power of 1 = 0.80 for two - sided correlations at r = 0.53 and for one - sided correlations at r = 0.48 (n = 22, degrees of freedom = 20). Because inflammation markers are known to be positively associated with obesity and negatively with insulin sensitivity, the one - sided calculation is most relevant to the current analyses . Post hoc statistical power calculations for the multiple regression models of our main findings, which all had r>0.6, give power estimates greater than 0.90 for up to five independent variables in the model at = 0.05 . Body composition was estimated by total - body dual - energy x - ray absorptiometry (dpx - l; lunar radiation, madison, wi) with calculations of percent body fat, fat mass, and fat - free mass as described previously (11). Waist and hip circumferences were measured and waist - to - hip ratio (whr) was calculated as an index of body fat distribution . A 2-h 75-g ogtt was performed after a 12-h overnight fast, and glucose tolerance status was determined by world health organization 1999 criteria . Plasma glucose concentrations were determined by the glucose oxidase method (elm 105; radiometer, copenhagen, denmark). Insulin action was assessed at physiological insulin concentrations during a hyperinsulinemic - euglycemic clamp . In brief, after an overnight fast, a primed continuous intravenous insulin infusion (9 mu / kg) was administered for 120 min at a constant rate of 40 mu / mbody surface area per minute (m). Plasma glucose was measured every 5 min during the clamp, and the variable infusion rate of glucose was adjusted to maintain blood glucose at a constant value of 5 mmol / l . The rate of total insulin - stimulated glucose disposal (m) was calculated for the last 40 min of the insulin infusions . Blood samples for analysis of inflammation markers were drawn before the start of the glucose clamp . Biopsies of subcutaneous adipose and vastus lateralis muscle were performed on a separate day using standard aseptic technique and local anesthesia . In brief, before a percutaneous muscle biopsy of the vastus lateralis muscle, a scalpel blade was used to make a 7-mm skin incision and to cut the fascia . A side - cutting muscle biopsy needle was passed through the incision to obtain 100 mg of muscle tissue . Adipose tissue was obtained by needle biopsy from the abdominal area, 12 cm superior to mcburney's point . After making an 5-mm skin incision, the needle biopsy was performed using a 50-ml plastic syringe attached to a 13-gauge aspiration needle . The muscle and adipose tissues were immediately placed in liquid nitrogen and then stored at 80c . Blood samples were drawn using standard phlebotomy techniques into sodium citrate vacutainers for measurement of inflammatory markers . The tubes were centrifuged immediately (1,500 g, 15 min, 4c), and the plasma was stored at 80c until analyses were performed . Monocyte chemoattractant protein-1 (mcp-1) was measured using a beadlyte plex kit (upstate cell signaling solutions, charlottesville, va). Multiplexed assays were run according to the manufacturer's instructions on a luminex 100 bioplex machine using luminex pro software version 1.7 (bio - rad, atherton, ca). Plasma high - sensitivity c - reactive protein (hscrp) was measured by an immunoturbidimetric assay . Hepatic enzymes, alanine aminotransferase (alt) and -glutamyltranspeptidase (ggt), were measured by nadh (without p-5-p) andl--glutamyl-3-carboxy-4-nitroanilide substrates, respectively . Hscrp and hepatic enzymes (alt and ggt) were measured by alfred hospital pathology services using the architect system (abbott diagnostics, abbott park, il). Pbmcs were isolated from whole blood using ficoll - paque plus density centrifugation (amersham biosciences, uppsala, sweden). The pbmc pellet was resuspended in fbs with 10% dmso and stored at 80c . Nuclear extraction from pbmcs and adipose and skeletal muscle tissue briefly, muscle and adipose tissue biopsy samples were homogenized in a 1:5 w / v ice - cold homogenization buffer (50 mmol / l tris - hcl, ph 7.8, 10 mmol / l edta, ph 8.0, 100 mmol / l naf, 2 mmol / l na3 vo4, 1 mmol / l sodium pyrophosphate, 250 mol / l phenylmethylsulfonyl fluoride, 10 g / ml aprotinin, and 10 g / ml leupeptin) with a hand - held homogenizer (polytron - aggregate; kinematica, switzerland). Samples were then rotated for 30 min, end - over - end, at 4c, before being centrifuged (14,000 g, 30 min, 4c) to isolate the nuclear pellet . The nuclear pellet was then resuspended in 500 l buffer a (10 mmol / l hepes, ph 7.9, 10 mmol / l kci, 0.1 mmol / l edta, 0.1 mmol / l egta, and 0.7% v / v igepal), vortexed and centrifuged (7,000 g, 1 min, room temperature), and then resuspended in 500 l buffer b (10 mmol / l hepes, ph 7.9, 10 mmol / l kci, 0.1 mmol / l edta, and 0.1 mmol / l egta). Supernatant was removed, and the pellet was resuspended in 150 l buffer c (20 mmol / l hepes, ph 7.9, 400 mmol / l nacl, 1 mmol / l edta, and 1 mmol / l egta), incubated on ice for 20 min, and then centrifuged (10,000 g, 30 min, room temperature). Pbmc samples were washed in excess pbs and centrifuged (400 g, 5 min, 4c), to remove residual fbs and dmso . The supernatant was discarded, and the pellets were resuspended in 100 l triple detergent buffer (50 mmol / l tris - hcl, ph 8.0, 150 mmol / l nacl, 0.02% nan3, 0.1% sds, 100 g / ml phenylmethylsulfonyl fluoride, 1 g / ml aprotinin, 1% nonidet p-40, and 0.5% sodium deoxycholate, in milli - q h2 o). These were then sonicated for 1 min and centrifuged (400 g, 3 min, 4c). The protein concentration of all protein isolates was determined using the bicinchoninic acid protein assay (pierce, rockford, il), performed according to the manufacturer's instructions . The transam nfb dna - binding activity assay (active motif, carlsbad, ca) was used to detect and quantify nf-b transcription factor activation, specifically of the p65 subunit . Nuclear extracts obtained from muscle (1 g protein / well) and adipose tissue (5 g protein / well) biopsies and pbmc (30 g protein / well) samples were analyzed for their binding capacity to an nf-b consensus sequence in labeled dna in a 96-well plate format . The assays were performed according to the manufacturer's instructions, and absorbance was measured on a victor3v multilabel plate reader (perkinelmer, wellesley, ma). Phosphorylation of jnk ([thr / tyr] /total jnk) was used as a surrogate for jnk1/2 activity as described previously (21). Pbmc, subcutaneous adipose tissue, and skeletal muscle samples were homogenized, and protein concentrations were determined . Total protein (40 g) was separated by sds - page and blotted onto a polyvinylidene fluoride membrane . Blots were performed for phosphorylated jnk (1:1,000) and total jnk (1:1,000) using antibodies from cell signaling technologies . Bands were visualized using a bio - rad anti - rabbit igg horseradish peroxidase (1:4,000) conjugated antibody and ecl solution (sigma) and developed on film . Jnk1/2 activity in muscle and adipose tissue was available for only 18 individuals because insufficient tissue was available for analyses . Gene expression of the p65 subunit of nf-b and ib in pbmcs was assessed by real - time quantitative rt - pcr, performed using the taqman system based on real - time detection of accumulated fluorescence (abi prism 7700 sequence detection system; pe biosystems, foster city, ca) as described previously (23). Briefly, 4 g total rna was isolated from pbmcs with trizol according to the manufacturer's instructions (gibco brl, grand island, ny). The resulting rna was used to synthesize cdna with a superscript first strand synthesis system (gibco brl). To control for variation in the amount of dna available for pcr in the different samples, gene expression was normalized simultaneously (by multiplexing) in relation to the expression of the housekeeping gene 18s rrna (18s rrna taqman control reagent kit) as an endogenous control . Primers and taqman probes for the proteins described above were constructed with the help of primer express (perkinelmer) (for sequences, see table 2) and fluorescence for each cycle was quantitatively analyzed by an abi prism 7700 sequence detection system . Results are expressed as arbitrary units, related to minor groove binding (mgb) probe sample fluorescence, corrected to endogenous 18s expression . Real - time rt - pcr probes and primers used for amplification of nf-b p65 and ib in pbmcs statistical analyses were performed using sas jump statistics software (sas institute, cary, nc). The values for inflammatory markers and m were logarithmically transformed before analysis to approximate normal distributions . The relationships between inflammatory markers, nf-b, jnk1/2, and anthropometric and metabolic variables were examined by calculating pearson correlation coefficients, and p values were corrected for multiple comparisons (benjamini - hochberg procedure). Multiple linear regression models and partial correlations were used to examine the relationships after adjustment for covariates . Stepwise regression was used to determine a relative contribution of each of the variables to the model . Differences between men and women were assessed by unpaired student's t test . Statistical significance was assumed when p <0.05 . Our correlation tests are sufficiently sensitive at = 0.05 with a power of 1 = 0.80 for two - sided correlations at r = 0.53 and for one - sided correlations at r = 0.48 (because inflammation markers are known to be positively associated with obesity and negatively with insulin sensitivity, the one - sided calculation is most relevant to the current analyses . Post hoc statistical power calculations for the multiple regression models of our main findings, which all had r>0.6, give power estimates greater than 0.90 for up to five independent variables in the model at = 0.05 . All subjects were deemed healthy according to their physical examination, were normotensive with normal lipid profile, full blood count, plasma crp levels, liver function tests (table 1), and renal function (estimated glomerular filtration rate> 60 ml / min per m), and therefore subclinical inflammation was ruled out . Women had higher percent body fat and hdl cholesterol levels, but there were no other sex differences seen among any of the other anthropometric and metabolic variables . Nf-b activity in pbmcs was positively associated with nf-b activity in the skeletal muscle (r = 0.68, p = 0.0004) but not in adipose tissue (r = 0.17, p = 0.4). Jnk1/2 activity in pbmcs was not related to jnk1/2 activity in skeletal muscle (r = 0.14, p = 0.6) or subcutaneous adipose tissue (r = 0.34, p = 0.2). In addition, no relationship between jnk1/2 activity and nf-b activity was identified in any of the tissues studied (all p> 0.2). White blood cell count (r = 0.39, p <0.05) and plasma levels of mcp-1 (r = 0.63, p <0.05) were each associated with nf-b activity in pbmcs but not with nf-b activity in the skeletal muscle or subcutaneous adipose tissue (table 3). Plasma hscrp (table 3) was not related to nf-b activity in any of the tissues investigated and did not correlate with insulin sensitivity (r = 0.20, p = 0.4). Jnk1/2 activity was not associated with any of these markers of inflammation (p> 0.1). Pearson correlation coefficients between nf-b and jnk1/2 activity in pbmcs and muscle and adipose tissue with anthropometric and metabolic variables * p <0.05 . Nf-b activity in either pbmcs or skeletal muscle was not associated with an overall measure of obesity, percent body fat (table 3,fig . 1). Nf-b activity in subcutaneous adipose tissue also was not related to any of the anthropometric variables . Furthermore, the gene expression of ib and nf-b (p65) in pbmc did not correlate with any of the anthropometric or metabolic parameters or nf-b activity in pbmcs (data not shown). However, we found that nf-b activity in both pbmcs and skeletal muscle was positively associated with whr (r = 0.48, p = 0.02; r = 0.68, p = 0.003) (table 3,fig . 1) before and after adjustment for age and sex (both p <0.05). This association persisted after additional adjustment for percent body fat (both p <0.05). Tissue jnk1/2 activity was not related to any measures of obesity (both p> 0.1) (table 3). Nf-b p65 activity in pbmcs and central obesity, insulin sensitivity, and jnk1 activity in subcutaneous adipose tissue and insulin sensitivity . C: nf-b p65 activity in pbmcs and m. d: jnk1/2 activity and insulin sensitivity (m). Nf-b activity in pbmcs was inversely associated with insulin sensitivity before (r = 0.46, p = 0.03) (table 3) and after adjustment for age, sex, percent body fat, and whr (p = 0.02). In stepwise regression, elevated nf-b activity in pbmcs explained 16% of the variance in the model after adjustment for the variables stated above . Nf-b activity in skeletal muscle and adipose tissue were not associated with insulin sensitivity (both p> 0.1). Jnk1/2 activity in the adipose tissue was related to insulin sensitivity (r = 0.54, p <0.05) (fig . 2) before and after adjustment for age, sex, percent body fat, and whr (p = 0.04). In stepwise regression with age, sex, percent body fat, and whr, jnk1/2 activity in adipose tissue explained the 29% variance in insulin sensitivity (p = 0.02). When both jnk1/2 in adipose tissue and nf-b activity in pbmcs were entered in the same model, only jnk1/2 activity in adipose tissue remained a significant determinant of insulin sensitivity, explaining 29% (p = 0.02), whereas percent body fat contributed 21% (p = 0.02) and sex 10% (p = 0.07). When forced into this model, nf-b activity in pbmcs explained only 4% of the variance in insulin sensitivity (p = 0.1). Jnk1/2 activity in pbmcs and muscle was not associated with any measures of obesity or glucose metabolism (all p> 0.2). Exclusion of the two subjects with impaired glucose metabolism (one with impaired glucose tolerance and one with impaired fasting glucose) did not significantly alter the correlations presented . Representative immunoblots of human adipose tissue (n = 6) probed for total jnk (tjnk) and phosphorylated jnk (pjnk, thr / tyr). Nf-b activity in pbmcs was positively associated with nf-b activity in the skeletal muscle (r = 0.68, p = 0.0004) but not in adipose tissue (r = 0.17, p = 0.4). Jnk1/2 activity in pbmcs was not related to jnk1/2 activity in skeletal muscle (r = 0.14, p = 0.6) or subcutaneous adipose tissue (r = 0.34, p = 0.2). In addition, no relationship between jnk1/2 activity and nf-b activity was identified in any of the tissues studied (all p> 0.2). White blood cell count (r = 0.39, p <0.05) and plasma levels of mcp-1 (r = 0.63, p <0.05) were each associated with nf-b activity in pbmcs but not with nf-b activity in the skeletal muscle or subcutaneous adipose tissue (table 3). Plasma hscrp (table 3) was not related to nf-b activity in any of the tissues investigated and did not correlate with insulin sensitivity (r = 0.20, p = 0.4). Jnk1/2 activity was not associated with any of these markers of inflammation (p> 0.1). Pearson correlation coefficients between nf-b and jnk1/2 activity in pbmcs and muscle and adipose tissue with anthropometric and metabolic variables * p <0.05 . Nf-b activity in either pbmcs or skeletal muscle was not associated with an overall measure of obesity, percent body fat (table 3,fig nf-b activity in subcutaneous adipose tissue also was not related to any of the anthropometric variables . Furthermore, the gene expression of ib and nf-b (p65) in pbmc did not correlate with any of the anthropometric or metabolic parameters or nf-b activity in pbmcs (data not shown). However, we found that nf-b activity in both pbmcs and skeletal muscle was positively associated with whr (r = 0.48, p = 0.02; r = 0.68, p = 0.003) (table 3,fig . 1) before and after adjustment for age and sex (both p <0.05). This association persisted after additional adjustment for percent body fat (both p <0.05). Tissue jnk1/2 activity was not related to any measures of obesity (both p> 0.1) (table 3). Nf-b p65 activity in pbmcs and central obesity, insulin sensitivity, and jnk1 activity in subcutaneous adipose tissue and insulin sensitivity . C: nf-b p65 activity in pbmcs and m. d: jnk1/2 activity and insulin sensitivity (m). Nf-b activity in pbmcs was inversely associated with insulin sensitivity before (r = 0.46, p = 0.03) (table 3) and after adjustment for age, sex, percent body fat, and whr (p = 0.02). In stepwise regression, elevated nf-b activity in pbmcs explained 16% of the variance in the model after adjustment for the variables stated above . Nf-b activity in skeletal muscle and adipose tissue were not associated with insulin sensitivity (both p> 0.1). Jnk1/2 activity in the adipose tissue was related to insulin sensitivity (r = 0.54, p <0.05) (fig . 2) before and after adjustment for age, sex, percent body fat, and whr (p = 0.04). In stepwise regression with age, sex, percent body fat, and whr, jnk1/2 activity in adipose tissue explained the 29% variance in insulin sensitivity (p = 0.02). When both jnk1/2 in adipose tissue and nf-b activity in pbmcs were entered in the same model, only jnk1/2 activity in adipose tissue remained a significant determinant of insulin sensitivity, explaining 29% (p = 0.02), whereas percent body fat contributed 21% (p = 0.02) and sex 10% (p = 0.07). When forced into this model, nf-b activity in pbmcs explained only 4% of the variance in insulin sensitivity (p = 0.1). Jnk1/2 activity in pbmcs and muscle was not associated with any measures of obesity or glucose metabolism (all p> 0.2). Exclusion of the two subjects with impaired glucose metabolism (one with impaired glucose tolerance and one with impaired fasting glucose) did not significantly alter the correlations presented . Representative immunoblots of human adipose tissue (n = 6) probed for total jnk (tjnk) and phosphorylated jnk (pjnk, thr / tyr). In the present study, we showed for the first time that, among healthy, nondiabetic individuals, both nf-b activity in pbmcs and jnk1/2 activity in subcutaneous adipose tissue were important determinants of insulin resistance and explained 16 and 29%, respectively, of its variance after adjustment for appropriate covariates . Moreover, nf-b activity in both pbmcs and skeletal muscle was also associated with central obesity . The cross - sectional relationships between nf-b activity in pbmcs and adiposity were consistent with previous findings in obese patients in whom nf-b activity in pbmcs was elevated (20,24) and correlated with bmi (20,25). We added to the current evidence by showing this relationship across a wide range of adiposity . We also provided more precise measures of overall adiposity, specifically percent body fat by dual - energy x - ray absorptiometry as opposed to bmi, but, interestingly, our study showed that nf-b activity in pbmcs was specifically associated with central obesity but not overall adiposity (measured as total percent body fat or bmi), perhaps because we have studied participants with a wide range of adiposity as opposed to only morbidly obese patients . In the above - mentioned studies (20,24), it is well established that central adiposity is a stronger predictor than overall adiposity of insulin resistance and progression to type 2 diabetes than overall adiposity and is likely to be responsible for the proinflammatory phenotype seen in these conditions (2631). Thus, our additional findings showed for the first time a relationship between nf-b activity in skeletal muscle and central obesity, suggesting that activation of the nf-b / ib pathway in muscle may contribute to a local inflammatory environment due to lipid accumulation and contributing to insulin resistance . In accordance with two other studies (20,24), we also found a relationship between increased nf-b activity in pbmcs and insulin resistance . In contrast to these studies, which used a calculated homa as a proxy for insulin resistance, we examined insulin resistance directly using the standard hyperinsulinemic - euglycemic clamp . Moreover, we showed that the relationship between nf-b activity in pbmcs and insulin resistance is independent of the degree of obesity and explained 16% of variance in insulin resistance after adjustment for age, sex, percent body fat, and whr . Although previous studies have shown that nf-b activation in skeletal muscle is related to insulin resistance in obese humans (20,24), this was not seen in our study in nondiabetic healthy individuals . Our data are consistent with rodent studies in which overexpression of the p65 subunit of nf-b in skeletal muscle had no effect on insulin resistance as measured by glucose clamp (32). In our study, we also found no relationship between activation of nf-b in adipose tissue and any of the anthropometric or metabolic parameters . Animal models of type 2 diabetes have demonstrated an association between insulin resistance and elevated levels of the activator of nf-b, ikk, at the gene level, in perigonadal but not in mesenteric adipose tissue (33). Gene levels of the inhibitor of nf-b (ib) have also been associated with central adiposity in obese elderly women (34). Both of these studies (33,34), however, examined only gene expression as opposed to activity . The absence of an association between nf-b activity in adipose tissue and anthropometric or metabolic parameters in the present study could also be due to differences in the populations examined . Both of the previously reported studies described the relationship in obese and insulin - resistant animals / populations (33,34), whereas our study was conducted in a healthy population . Interestingly, nf-b activity in pbmcs was associated with circulating mcp-1 levels but not with crp . Mcp-1 is one of the many downstream cytokine targets of the key proinflammatory transcription factor, nf-b . Mcp-1 is known to recruit white blood cells to the site of inflammation and therefore may be considered an important driver and perpetuator of nf-b activation and inflammation (35). Nf-b activity in pbmcs and adipose tissue have been shown previously to correlate with the gene (20,34) and protein (20) expression of interleukin-6, macrophage inhibitory factor, and hscrp in obese individuals . In our study, however, plasma levels of crp were not associated with either nf-b activity or insulin sensitivity probably because of the low plasma levels of crp (all values within normal range) in our healthy nondiabetic population . Therefore, nf-b may be a more sensitive early marker of inflammation than crp in healthy individuals . We have made the novel observation that nf-b activity in pbmcs is an important determinant of both central adiposity and insulin resistance . Interestingly, arkan et al . (13) demonstrated that mice lacking ikk in pbmcs, which makes them unable to activate the nf-b / ib pathway, are protected from systemic insulin resistance . Our data demonstrated this relationship for the first time in humans . To date, jnk1/2 activity has only been associated with obesity in animal models of obesity and diabetes (9). In this study, we showed that jnk1/2 activity in pbmcs, skeletal muscle, and subcutaneous adipose tissue was not associated with any measure of obesity in humans . Importantly, in the current study we also showed that jnk1/2 activity in subcutaneous adipose tissue was associated with insulin resistance, independently of age, sex, percent body fat, and whr and explained 29% of the variance in insulin resistance after adjustment for these covariates . In this study, we have made the novel observation that when both nf-b activity in pbmcs and jnk1/2 activity in subcutaneous adipose tissue are included in this model, only jnk1/2 activity was a significant determinant of insulin resistance, suggesting not only that these pathways are codependent but also that jnk1/2 activity is an independent and therefore potentially more important determinant of insulin resistance in nondiabetic, otherwise healthy individuals . Jnk activity in skeletal muscle has been shown to be associated with insulin resistance in obese and diabetic subjects (22). We have also shown previously that obese insulin - resistant humans (insulin sensitivity assessed by homa) have increased jnk1/2 phosphorylation in skeletal muscle (21). In our present study, however, we did not see a relationship between jnk1/2 activity in skeletal muscle and insulin resistance, most likely because of our different study population, i.e., healthy nondiabetic individuals versus obese, type 2 diabetic subjects . Adipose tissue jnk activity was not examined in either of these previous studies (21,22), so we cannot compare our results in this regard . It could be hypothesized that different inflammatory pathways may be important in the initiation of insulin resistance as opposed to when diabetes has already developed . In our study, tissue jnk1/2 activity was not associated with circulating inflammatory makers, suggesting that tissue - specific inflammation and activation of jnk are enough to cause insulin resistance . First, because of the cross - sectional nature of the study, we cannot delineate the cause and effect relationships between jnk and nf-b activity and insulin resistance . Second, the sample size is small, and, hence, the results should be interpreted with caution . However, the strength of the correlations and their robustness in various adjusted models attests to the validity of our findings . Third, standard imaging methods such as computed tomography or magnetic resonance imaging would have provided a better assessment of central adiposity than waist circumference . In conclusion, we have demonstrated that elevated nf-b activity in pbmcs and jnk1/2 activity in subcutaneous adipose tissue are both important determinants of insulin resistance in a healthy nondiabetic population . Moreover, we show that jnk1/2 activity in adipose tissue but not nf-b activity in pbmc is an independent determinant of insulin resistance in this population . Further investigation is warranted to determine the mechanisms by which changes in nf-b and jnk1/2 activity contribute to the development of type 2 diabetes in humans.
|
Mankind is still struggling against the parasites, plasmodium is considered as cause of malaria since ancient times and is the leading cause of mortality worldwide, infecting approximately 3.3 billion people were at risk globally in 2011 (1 - 3). Both treatment and control of malaria are hampered by the spread of resistance to common antimalarial drugs, especially against p. falciparum (6, 7). In pakistan, malaria threatens millions of people, due to poor conditions; and it remains endemic in most parts of country (8). Five different species of plasmodium: p. falciparum, p. vivax, p. malariae and p. ovale, p. knowlesi cause human malaria (9, 10). Two species of plasmodium have reported in pakistan: p. vivax (75%) and p. falciparum (25%) (8). As there is no vaccine available for malaria and current treatments suffer from several limitations (11), hence the emphasis falls on accurate diagnosis of malaria to provide novel drugs to treat different types of malaria, especially for p. falciparum the most fatal infection (12 - 15). Polymerase chain reaction (pcr) has proved to be an efficient, sensitive and specific method for diagnosis of mixed infections, low parasitaemia and species detection for malaria (10, 13, 16 - 20). Pcr has the potential to overcome all the limitations of the traditional diagnostic method, but their high cost limits their clinical implication for malaria diagnosis (3, 21). The present study was aimed to determine the epidemiology of malaria by comparison of microscopy and nested pcr . Genus - specific and species - specific primers for 18s rrna gene of plasmodium species were used for two plasmodium species (p. falciparum and p.vivax) infection by nested pcr . Whole blood (5 ml) was drawn by sterilized syringes and collected in edta vacutainer tubes . Negative controls blood was obtained from students of department of zoology, university of the punjab, lahore . The blood smears were stained with 1% giemsa stain in phosphate - buffered saline (ph 7.0) and examined under the microscope at a magnification of 1,000x for the presence of malaria parasites . Dna was extracted from 200 l of edta blood using qiaamp dna blood mini kit (qiagen, germany) according to given protocol . The extracted dna was stored at -20 c. the purified dna templates were used for amplification of 18s rrna gene using primers (table 1), as described by (16), in nested pcr . All the oligonucleotides were prepared from cemb (center for excellence in molecular biology), lahore . The pcr master mix for 50 l reaction was prepared by mixing 5.0 l of 10x pcr buffer (500 mm kcl, 100 mm tris - hcl [ph 8.8 at 25c]) (fermentas, eu), 4.0 l of 10 m deoxyribonucleoside triphosphate (dntps) (fermentas, eu), 5.0 l of 2.5 mm mgcl2 (fermentas, eu), 1.5 l of each primer (10 m), 0.5 l taq dna polymerase (1 u/l; fermentas, eu) and 22.5 l nuclease - free water . Fifty l reactions using 40 l of master mix and 10 l of dna template were performed . The reaction conditions used for pcr1 were: hold at 95 c (10 min); 35 cycles of: denaturation at 94 c (1 min), annealing at 60 c (2 min), and extension at 72 c (2 min); hold for final extension at 72 c (10 min) and hold for indefinite period at 4 c . The sensitivity, specificity, and efficacy of nested pcr were calculated by using these formulas, respectively: [true positives / (true positives + false negatives) 100%]; [true negatives / (true negatives + false positives) 100%]; and [1 (false negatives + false positives / total) 100]. Whole blood (5 ml) was drawn by sterilized syringes and collected in edta vacutainer tubes . Negative controls blood was obtained from students of department of zoology, university of the punjab, lahore . The blood smears were stained with 1% giemsa stain in phosphate - buffered saline (ph 7.0) and examined under the microscope at a magnification of 1,000x for the presence of malaria parasites . Dna was extracted from 200 l of edta blood using qiaamp dna blood mini kit (qiagen, germany) according to given protocol . The purified dna templates were used for amplification of 18s rrna gene using primers (table 1), as described by (16), in nested pcr . All the oligonucleotides were prepared from cemb (center for excellence in molecular biology), lahore . The pcr master mix for 50 l reaction was prepared by mixing 5.0 l of 10x pcr buffer (500 mm kcl, 100 mm tris - hcl [ph 8.8 at 25c]) (fermentas, eu), 4.0 l of 10 m deoxyribonucleoside triphosphate (dntps) (fermentas, eu), 5.0 l of 2.5 mm mgcl2 (fermentas, eu), 1.5 l of each primer (10 m), 0.5 l taq dna polymerase (1 u/l; fermentas, eu) and 22.5 l nuclease - free water . Fifty l reactions using 40 l of master mix and 10 l of dna template were performed . The reaction conditions used for pcr1 were: hold at 95 c (10 min); 35 cycles of: denaturation at 94 c (1 min), annealing at 60 c (2 min), and extension at 72 c (2 min); hold for final extension at 72 c (10 min) and hold for indefinite period at 4 c . The sensitivity, specificity, and efficacy of nested pcr were calculated by using these formulas, respectively: [true positives / (true positives + false negatives) 100%]; [true negatives / (true negatives + false positives) 100%]; and [1 (false negatives + false positives / total) 100]. Microscopy is a conventional method for detection of malaria, but pcr has been developed for the rapid and correct diagnosis of malaria . From total of 100 clinically positive samples, 60 patients were negative and 40 patients were positive for malaria by microscopy; whereas by nested pcr, 41 specimens were positive and 59 specimens were negative for plasmodium spp . The comparison of malaria epidemiology in south punjab observed by clinical symptoms, microscopy, and nested pcr in present study was presented in table 2 . According to table 3, one specimen was found to be infected by p.vivax by microscopy but it was confirmed to be negative for plasmodium spp . By nested pcr . 1 mixed infection (p. falciparum and p. vivax) was diagnosed by microscopy; rather nested pcr determined mixed infections (p. falciparum and p. vivax) in 10 specimens . Plasmodium was detected in 41% samples by nested pcr as compared to 40% by microscopy . Species identification by nested pcr was done for all plasmodium positive samples (41%). Out of which 15% were having p. falciparum infection, 16 were having p. vivax infection, and 10 were mixed infections (p. falciparum and p. vivax). Figure 1 is showing nested pcr result of three samples with p. falciparum, p. vivax and mixed infections . Incorrect speciation of p. falciparum and p. vivax was resolved by nested pcr in 8 samples; p. falciparum was identified in 4 clinically and microscopically positive specimens that showed p. vivax infection by nested pcr; and 4 p. vivax positive specimens were shown to be p. falciparum infection by nested pcr . All concordant results for parasite identification were resolved by nested pcr; nested pcr was able to determine plasmodium dna in 2 specimens that were depicted to be negative for malaria by microscopy . The sensitivity, specificity, and efficacy of nested pcr were calculated to be 95%, 98%, and 97%, respectively . The specificity and sensitivity of nested pcr, calculated from present study was better than that of microscopy . Malaria is a life - threatening infection impacting most of the developed countries of the world . The who recommended method and the gold standard for routine laboratory diagnosis of malaria is microscopy, despite its decreased sensitivity and specificity in situations of low parasite density and mixed infections . Compared to microscopy, molecular methods (pcr) has achieved much higher detection sensitivities and specificities, especially in cases of low parasitaemia or mixed infections and differential diagnosis of plasmodium species (17, 21 - 23). They are more important due to the automation of the process and have objective of reading the results by machines . This makes them a valuable option for large - scale epidemiological studies (24). Especially, nested pcr has proven to be a sensitive method for diagnosis of all species of plasmodium and has expected to exceed the sensitivity of microscopic examination (25). Moreover, nested pcr has appeared to be effective in correcting wrong diagnosis, identified as plasmodium species by microscopist . This was obvious in the present study with the misdiagnosed plasmodium negative specimens (1%). The non concordant smear positive / pcr negative cases can also be attributed to either degradation of parasite dna or low parasitemia combined with degradation of parasite dna (26). In certain cases, parasite morphology is damaged due to exposition to prophylactic medication or auto - medication, making malaria diagnosis by microscopy difficult (27), which may lead to the death of the patient by improper medication . It was found that 8 specimens were microscopically misdiagnosed as p. falciparum or p. vivax infection and they were diagnosed correctly by pcr . It is suggested that it can be due to chemoprophylactic effect on the shapes of the parasites (22). In 2% of samples, the parasite could not be determined by microscopy; by pcr, the parasite was detected even in a very low quantity . It has been found that the pcr assay is usually effective in detecting malarial mixed infections than microscopy (16, 21, 23) but not in all situations (28). Infected samples were confirmed to be mixed infection (p. falciparum and p. vivax) by the pcr but only 2.4% was identified by microscopy . In case of mixed infections, it was suggested that one species has the ability to dominate over other species; as a result, one may be overlooked in microscopic examination (29). In present study, 6 samples, microscopically diagnosed p. vivax infection were determined as mixed infection (p. falciparum and p. vivax) by pcr and 3 samples microscopically detected p. falciparum, were depicted as mixed infection (p. falciparum and p. vivax) by pcr . It is clear from the present study that p. vivax have higher tendency to dominate over p. falciparum . Detection of mixed infection may be of clinical importance because interactions between different species simultaneously infecting the same individual could result in significant changes in the course of the infection and disease . It may also be helpful in the effective treatment of malaria because the treatment of malaria depends on the correct diagnosis of the species (15). As p. falciparum and p. vivax have developed resistance against specific drugs and there are many drugs which are effective for p. vivax but not for p. falciparum . For example, mefloquine is an effective drug for treatment of p. vivax malaria but not effective on p. falciparum malaria . Pcr detected a high number of mixed infections in the samples analyzed, but its routine clinical use for diagnosing malaria is still under consideration because of its high cost and resource requirements (18, 21). The high prevalence of p. vivax (39%) may lead to serious complications like cerebral malaria but the comparatively less prevalent (36.6%) p. falcip - arum also poses a significant health hazard . Compared to microscopy, the nested - pcr is a rapid, sensitive, and specific method for the detection of malaria . The primary goal of the present study was to assess the value of a pcr - based method for the routine diagnosis of malaria at species level and study was conducted to evaluate the epidemiology of malaria in south punjab . Although the number of samples used here are small, but the high degree of both sensitivity and specificity is encouraging . Larger studies of both p. falciparum and p. vivax malaria in endemic regions will enhance the generalizability of the present findings.
|
Catheter ablation has become a standard therapy in the treatment of many arrhythmias . While different ablation strategies have been proposed and are currently applied, all ablation procedures share one commonality in their necessity for the use of fluoroscopy to visualize catheters . Heavy reliance on the use of live x - ray for ablation procedures was alleviated in the 1990s with the advent of 3d electroanatomical mapping systems (eams) that helped to significantly reduce radiation time and dosage . Integration of cardiac imaging using magnetic resonance imaging (mri) and computed tomography (ct) was shown to even further reduce fluoroscopy exposure during ablation procedures . More recently, a new technology for catheter visualization, called the mediguide-(mg) technology, has been introduced that can further facilitate reduction in radiation exposure . Briefly, single - coil sensors embedded in the catheter tip can be accurately localized by an electromagnetic field . Information about the 3d position and orientation of the tools is then transferred to the fluoroscopy system and is used to visualize the catheter tip in a virtual bi - planar view projected on 2 pre - recorded cine loops . It has been previously shown that the application of the mg technology can lead to a significant reduction in fluoroscopy burden by using diagnostic catheters in atrial flutter and by using both diagnostic and ablation catheters in several supraventricular tachycardias (svt) and atrial fibrillation (af) cases . There may be concerns that the application of the non - fluoroscopic catheter visualization (nfcv) technology may increase procedural risks in the absence of the catheter shaft visualization and catheter localization that is solely based on the location of the catheter tip . It was demonstrated that the complication rate is equal or even lower to procedures performed with conventional tools . This could be explained by a limitation of conventional procedures: only in a certain percentage of the procedure catheters will be visible . This changed by application of nfcv technology since catheters will be visible during the entire procedure on this virtual biplanar view . In this protocol, we perform an ablation of atrial fibrillation in a patient with paroxysmal, drug - refractory and highly symptomatic atrial fibrillation . The goal of this protocol is to achieve the same endpoints as in a conventional procedure, i.e., isolation of all pulmonary veins with proven bi - directional block, and to reduce fluoroscopy exposure for the patient by> 90% as compared to conventional settings via the additional use of the nfcv technology . All patients signed an informed consent form after all typical complications of an ablation procedure such as pericardial effusion, vascular complications at the access site, stroke / tia, and esophago - atrial fistula, were explained . No patient subgroup had to be excluded (e.g., patients with pacemakers or icd); only general contraindications for af ablation procedures (e.g., contraindication for anticoagulation, hyperthyreosis, valvular af, etc .) Had to be addressed . On the day of hospital admission, perform a routine physical exam including resting ecg, blood analysis, transesophageal echo and a contrast - enhanced ct scan of the heart on the patient . If novel anticoagulants are used, skip either 1 dose (rivaroxaban) or 2 doses (dabigatran and apixaban) before the procedure . Place the 3d eams patches on the patient per manufacturer s instructions on the thorax (front and back; left and right), neck, and belly . Monitor oxygen saturation using a finger clip, as well as the non - invasive blood pressure . Administer midazolam (2 - 3 mg, i.v .) And fentanyl (0.025 mg, i.v .) As premedication to slightly sedate the patient and to provide some analgesics during the puncture of the femoral vessels . Start the procedure with the injection of 40 ml of 1% mepivacain to the left and right groin areas . Start the puncture for venous access 1 cm medial to the femoral artery, 1 cm below the connection between symphysis and crista iliaca anterior superior . Perform two 7f punctures in the left femoral vein for placing two diagnostic catheters: 1 steerable decapolar catheter for the coronary sinus (cs) and 1 steerable decapolar catheter for the right ventricular apex . After a successful puncture of the vessels, advance a guidewire, remove the puncture needle and place the sheath over the wire per the seldinger technique.next, perform 2 punctures on the right side: a 4f puncture in the right femoral artery for invasive blood pressure measurements, and an 11f one in the right femoral vein for the transseptal sheath . Before inserting the 11f sheath, control the intravasal position of the wire using fluoroscopy and then place the sheath . Perform two 7f punctures in the left femoral vein for placing two diagnostic catheters: 1 steerable decapolar catheter for the coronary sinus (cs) and 1 steerable decapolar catheter for the right ventricular apex . After a successful puncture of the vessels, advance a guidewire, remove the puncture needle and place the sheath over the wire per the seldinger technique . Next, perform 2 punctures on the right side: a 4f puncture in the right femoral artery for invasive blood pressure measurements, and an 11f one in the right femoral vein for the transseptal sheath . Before inserting the 11f sheath, check the activated clotting time (act) every 20 min; the target for the anticoagulation is an act between 250 and 350 sec . If necessary, administer boluses of heparin according to act measurements . During the procedure, maintain the patient in a deep analgosedation using midazolam (2 - 5 mg), fentanyl (0.05 - 0.1 mg) and propofol (bolus 0.5 mg / kg and constant basal rate of 0.5 mg / kg / h). Acquire 2 live fluoroscopy or cine loops using the x - ray fluoroscopy system in a right anterior oblique projection (rao 15) and a left anterior oblique projection (lao 50), each approximately 3 sec long (figure 3 and video 1). Note: the nfcv projects the catheter tips on these pre - recorded cine loops allowing a non - fluoroscopic placement of the diagnostic catheters . Place one of the diagnostic catheters in the cs by first advancing the catheter tip to the superior vena cava (svc), then pulling it back slowly and deflecting it to bring it close to the bundle of his . Deflect the catheter to its maximum allowable curve and perform a clockwise rotation to bring the tip to the cs ostium . Advance the catheter as deep as possible in the cs to achieve a stable position . Then, place a landmark on the catheter tip using the nfcv system to mark the location.use the other diagnostic catheter to place landmarks for superior vena cava (svc), inferior vena cava (ivc) and fossa ovalis (see figure 1). Deflect the catheter to its maximum allowable curve and perform a clockwise rotation to bring the tip to the cs ostium . Advance the catheter as deep as possible in the cs to achieve a stable position . Then, place a landmark on the catheter tip using the nfcv system to mark the location . Use the other diagnostic catheter to place landmarks for superior vena cava (svc), inferior vena cava (ivc) and fossa ovalis (see figure 1). Perform a trans - atrial septal puncture using a long steerable sheath . Insert a long guidewire to the svc and verify the position with fluoroscopy . Advance the steerable sheath over the wire to the junction between the svc and the right atrium (ra). Insert a long needle into the dilator, pull back the sheath until it jumps into the fossa ovalis.perform the puncture by advancing the needle and injecting contrast dye (15 ml of ultravist 300) to verify the correct position of the sheath in the left atrium (la).once the needle tip is in the la, advance the dilator to la, disconnect it from the sheath and advance the sheath over the dilator into the la . Deflect the sheath and slowly remove the needle and dilator from the sheath.aspire 10 ml of blood from the sheath and carefully flush the sheath with heparinized saline . Flush the sheath with heparinized saline constantly at a flow rate of 2 ml / hr . Note: the diagnostic catheter is used for electroanatomical reconstruction of the la and pulmonary venous anatomy . Coronary sinus catheter remains in place and serves as the reference catheter for the 3d mapping system . Advance the steerable sheath over the wire to the junction between the svc and the right atrium (ra). Insert a long needle into the dilator, pull back the sheath until it jumps into the fossa ovalis . Perform the puncture by advancing the needle and injecting contrast dye (15 ml of ultravist 300) to verify the correct position of the sheath in the left atrium (la). Once the needle tip is in the la, advance the dilator to la, disconnect it from the sheath and advance the sheath over the dilator into the la . Deflect the sheath and aspire 10 ml of blood from the sheath and carefully flush the sheath with heparinized saline . Flush the sheath with heparinized saline constantly at a flow rate of 2 ml / hr . Note: the diagnostic catheter is used for electroanatomical reconstruction of the la and pulmonary venous anatomy . Coronary sinus catheter remains in place and serves as the reference catheter for the 3d mapping system . Insert the long sheath in the superior pulmonary veins and perform 2 new fluoroscopy or cine loops in rao 15 (right pv) and lao 50 (left pv) during injection of 15 ml of contrast dye (ultravist 300). Map anatomical landmarks in the la carefully and use for this co - registration process . For example, use the junction of the left inferior pulmonary vein (lipv) to the la body . Take at least 10 - 15 points for the fusion process and then double - check and optimize the co - registration process with the roving catheter . Upon completion, the segmented ct model is positioned at an anatomically correct position in 3d space . For example, use the junction of the left inferior pulmonary vein (lipv) to the la body . Take at least 10 - 15 points for the fusion process and then double - check and optimize the co - registration process with the roving catheter . Upon completion, the segmented ct model is positioned at an anatomically correct position in 3d space . Place a temperature probe with 3 thermocouples trans - orally to measure the intra - luminal intra - esophageal temperature at the level of the la . Perform ablation around the ipsilateral pulmonary veins by using power settings of 35 w (anterior) and 25 w (posterior) at an irrigation rate of 17 ml / min . If the intra - luminal temperature exceeds 39 c, immediately stop the ablation and adjust the power settings, lowering the minimum power to be 20 w. in case of temperature rise despite reduction of energy settings, consider modifying the lesion setting to go more antral if it is too close to the esophagus . If the temperature still exceeds 41 c, perform an esophagoscopy the day after the ablation to exclude mucosal thermal damage which could develop to an esophago - atrial fistula . If the temperature still exceeds 41 c, perform an esophagoscopy the day after the ablation to exclude mucosal thermal damage which could develop to an esophago - atrial fistula . Check the completeness of the pulmonary vein isolation using a decapolar circular catheter by pacing maneuvers at maximum power (usually 10 ma / msec) from all bipoles of the spiral catheter . Make sure that the stimulus does not capture the la by checking signals on the cs catheter . Gaps in the lesion set: move the ablation catheter around the circumferential lesions and stimulate with maximum output from the tip of the ablation catheter . If the atrium is captured, start ablation until the local capture disappears . Use this pace - and - ablate-technique around all pulmonary veins . If necessary, detect and close gaps in the lesion set: move the ablation catheter around the circumferential lesions and stimulate with maximum output from the tip of the ablation catheter . Once the isolation line around the pulmonary veins is completed, perform a voltage map of the left atrium to determine a healthy atrium (shown in purple) or a fibrotic atrium (shown in blue, yellow, and grey) [see figure 1 and 2]. Use the cut - off values 0.5 mv for normal tissue and 0.2 mv for scar tissue . Use the ablation catheter or the diagnostic catheter and start in the pulmonary vein antrum . Make sure that there is sufficient contact with the catheter tip and register the local signal amplitude to the 3d mapping system . For a normal sized la, take points covering the entire la body and pv antrum (100 - 150 points). Use the ablation catheter or the diagnostic catheter and start in the pulmonary vein antrum . Make sure that there is sufficient contact with the catheter tip and register the local signal amplitude to the 3d mapping system . For a normal sized la, take points covering the entire la body and pv antrum (100 - 150 points). Perform a test for inducibility with 20 sec burst - pacing from the coronary sinus with cycle lengths of 300 msec, 250 msec and 200 msec or to atrial refractory time . If a stable atrial tachycardia or atrial flutter is induced, map and ablate accordingly . If atrial fibrillation is induced, perform an electrical cardioversion (with 200 j biphasic shock) and terminate the procedure . Antagonize heparin by injecting protaminsulfat (10,000 iu, i.v .) And remove the sheaths from the groin . After removal of the sheaths manually, compress the puncture sites on both sides . Check if there is still active bleeding after 5 min . If not, continue compression for at least an additional 5 min and place the pressure bandage for 6 hr . After removal of the pressure bandage and checking the femoral vessels clinically (palpation and auscultation), deliver the next dose of anticoagulant drugs (warfarin or novel anticoagulants). On the day of hospital admission, perform a routine physical exam including resting ecg, blood analysis, transesophageal echo and a contrast - enhanced ct scan of the heart on the patient . If novel anticoagulants are used, skip either 1 dose (rivaroxaban) or 2 doses (dabigatran and apixaban) before the procedure . Place the 3d eams patches on the patient per manufacturer s instructions on the thorax (front and back; left and right), neck, and belly . Monitor oxygen saturation using a finger clip, as well as the non - invasive blood pressure . Perform disinfection of the groin region . Administer midazolam (2 - 3 mg, i.v .) And fentanyl (0.025 mg, i.v .) As premedication to slightly sedate the patient and to provide some analgesics during the puncture of the femoral vessels . Start the procedure with the injection of 40 ml of 1% mepivacain to the left and right groin areas . Start the puncture for venous access 1 cm medial to the femoral artery, 1 cm below the connection between symphysis and crista iliaca anterior superior . Perform two 7f punctures in the left femoral vein for placing two diagnostic catheters: 1 steerable decapolar catheter for the coronary sinus (cs) and 1 steerable decapolar catheter for the right ventricular apex . After a successful puncture of the vessels, advance a guidewire, remove the puncture needle and place the sheath over the wire per the seldinger technique.next, perform 2 punctures on the right side: a 4f puncture in the right femoral artery for invasive blood pressure measurements, and an 11f one in the right femoral vein for the transseptal sheath . Before inserting the 11f sheath, control the intravasal position of the wire using fluoroscopy and then place the sheath . Perform two 7f punctures in the left femoral vein for placing two diagnostic catheters: 1 steerable decapolar catheter for the coronary sinus (cs) and 1 steerable decapolar catheter for the right ventricular apex . After a successful puncture of the vessels, advance a guidewire, remove the puncture needle and place the sheath over the wire per the seldinger technique . Next, perform 2 punctures on the right side: a 4f puncture in the right femoral artery for invasive blood pressure measurements, and an 11f one in the right femoral vein for the transseptal sheath . Before inserting the 11f sheath, check the activated clotting time (act) every 20 min; the target for the anticoagulation is an act between 250 and 350 sec . If necessary, administer boluses of heparin according to act measurements . During the procedure, maintain the patient in a deep analgosedation using midazolam (2 - 5 mg), fentanyl (0.05 - 0.1 mg) and propofol (bolus 0.5 mg / kg and constant basal rate of 0.5 mg / kg / h). Acquire 2 live fluoroscopy or cine loops using the x - ray fluoroscopy system in a right anterior oblique projection (rao 15) and a left anterior oblique projection (lao 50), each approximately 3 sec long (figure 3 and video 1). Note: the nfcv projects the catheter tips on these pre - recorded cine loops allowing a non - fluoroscopic placement of the diagnostic catheters . Place one of the diagnostic catheters in the cs by first advancing the catheter tip to the superior vena cava (svc), then pulling it back slowly and deflecting it to bring it close to the bundle of his . Deflect the catheter to its maximum allowable curve and perform a clockwise rotation to bring the tip to the cs ostium . Advance the catheter as deep as possible in the cs to achieve a stable position . Then, place a landmark on the catheter tip using the nfcv system to mark the location.use the other diagnostic catheter to place landmarks for superior vena cava (svc), inferior vena cava (ivc) and fossa ovalis (see figure 1). Deflect the catheter to its maximum allowable curve and perform a clockwise rotation to bring the tip to the cs ostium . Advance the catheter as deep as possible in the cs to achieve a stable position . Then, place a landmark on the catheter tip using the nfcv system to mark the location . Use the other diagnostic catheter to place landmarks for superior vena cava (svc), inferior vena cava (ivc) and fossa ovalis (see figure 1). Perform a trans - atrial septal puncture using a long steerable sheath . Advance the steerable sheath over the wire to the junction between the svc and the right atrium (ra). Insert a long needle into the dilator, pull back the sheath until it jumps into the fossa ovalis.perform the puncture by advancing the needle and injecting contrast dye (15 ml of ultravist 300) to verify the correct position of the sheath in the left atrium (la).once the needle tip is in the la, advance the dilator to la, disconnect it from the sheath and advance the sheath over the dilator into the la . Deflect the sheath and slowly remove the needle and dilator from the sheath.aspire 10 ml of blood from the sheath and carefully flush the sheath with heparinized saline . Flush the sheath with heparinized saline constantly at a flow rate of 2 ml / hr . Note: the diagnostic catheter is used for electroanatomical reconstruction of the la and pulmonary venous anatomy . Coronary sinus catheter remains in place and serves as the reference catheter for the 3d mapping system . Advance the steerable sheath over the wire to the junction between the svc and the right atrium (ra). Insert a long needle into the dilator, pull back the sheath until it jumps into the fossa ovalis . Perform the puncture by advancing the needle and injecting contrast dye (15 ml of ultravist 300) to verify the correct position of the sheath in the left atrium (la). Once the needle tip is in the la, advance the dilator to la, disconnect it from the sheath and advance the sheath over the dilator into the la . Aspire 10 ml of blood from the sheath and carefully flush the sheath with heparinized saline . Flush the sheath with heparinized saline constantly at a flow rate of 2 ml / hr . Note: the diagnostic catheter is used for electroanatomical reconstruction of the la and pulmonary venous anatomy . Coronary sinus catheter remains in place and serves as the reference catheter for the 3d mapping system . Insert the long sheath in the superior pulmonary veins and perform 2 new fluoroscopy or cine loops in rao 15 (right pv) and lao 50 (left pv) during injection of 15 ml of contrast dye (ultravist 300). Perform fusion of the electroanatomical map with 3d reconstructed ct anatomy . Map anatomical landmarks in the la carefully and use for this co - registration process . For example, use the junction of the left inferior pulmonary vein (lipv) to the la body . Take at least 10 - 15 points for the fusion process and then double - check and optimize the co - registration process with the roving catheter . Upon completion, the segmented ct model is positioned at an anatomically correct position in 3d space . For example, use the junction of the left inferior pulmonary vein (lipv) to the la body . Take at least 10 - 15 points for the fusion process and then double - check and optimize the co - registration process with the roving catheter . Upon completion, the segmented ct model is positioned at an anatomically correct position in 3d space . Place a temperature probe with 3 thermocouples trans - orally to measure the intra - luminal intra - esophageal temperature at the level of the la . Perform ablation around the ipsilateral pulmonary veins by using power settings of 35 w (anterior) and 25 w (posterior) at an irrigation rate of 17 ml / min . If the intra - luminal temperature exceeds 39 c, immediately stop the ablation and adjust the power settings, lowering the minimum power to be 20 w. in case of temperature rise despite reduction of energy settings, consider modifying the lesion setting to go more antral if it is too close to the esophagus . If the temperature still exceeds 41 c, perform an esophagoscopy the day after the ablation to exclude mucosal thermal damage which could develop to an esophago - atrial fistula . If the temperature still exceeds 41 c, perform an esophagoscopy the day after the ablation to exclude mucosal thermal damage which could develop to an esophago - atrial fistula . Check the completeness of the pulmonary vein isolation using a decapolar circular catheter by pacing maneuvers at maximum power (usually 10 ma / msec) from all bipoles of the spiral catheter . Make sure that the stimulus does not capture the la by checking signals on the cs catheter . If necessary, detect and close gaps in the lesion set: move the ablation catheter around the circumferential lesions and stimulate with maximum output from the tip of the ablation catheter . Use this pace - and - ablate-technique around all pulmonary veins . If necessary, detect and close gaps in the lesion set: move the ablation catheter around the circumferential lesions and stimulate with maximum output from the tip of the ablation catheter . Once the isolation line around the pulmonary veins is completed, perform a voltage map of the left atrium to determine a healthy atrium (shown in purple) or a fibrotic atrium (shown in blue, yellow, and grey) [see figure 1 and 2]. Use the cut - off values 0.5 mv for normal tissue and 0.2 mv for scar tissue . Use the ablation catheter or the diagnostic catheter and start in the pulmonary vein antrum . Make sure that there is sufficient contact with the catheter tip and register the local signal amplitude to the 3d mapping system . For a normal sized la, take points covering the entire la body and pv antrum (100 - 150 points). Use the ablation catheter or the diagnostic catheter and start in the pulmonary vein antrum . Make sure that there is sufficient contact with the catheter tip and register the local signal amplitude to the 3d mapping system . For a normal sized la, take points covering the entire la body and pv antrum (100 - 150 points). Perform a test for inducibility with 20 sec burst - pacing from the coronary sinus with cycle lengths of 300 msec, 250 msec and 200 msec or to atrial refractory time . If a stable atrial tachycardia or atrial flutter is induced, map and ablate accordingly . If atrial fibrillation is induced, perform an electrical cardioversion (with 200 j biphasic shock) and terminate the procedure . Remove the transseptal sheath and catheters . Antagonize heparin by injecting protaminsulfat (10,000 iu, i.v .) And remove the sheaths from the groin . After removal of the sheaths manually, compress the puncture sites on both sides . Check if there is still active bleeding after 5 min . If not, continue compression for at least an additional 5 min and place the pressure bandage for 6 hr . After removal of the pressure bandage and checking the femoral vessels clinically (palpation and auscultation), deliver the next dose of anticoagulant drugs (warfarin or novel anticoagulants). The patients are under deep analog - sedation, meaning that they are sleeping, receiving analgesics but breathe spontaneously . If all endpoints including bi - directional block in all pulmonary veins, healthy left atrial tissue, and non - inducibility of atrial fibrillation or atrial flutter are achieved, patients have about a 75% probability of freedom from atrial fibrillation recurrence after 12 months . If the left atrium has fibrotic tissue with low voltage areas (see figure 2), the chances of permanent freedom from arrhythmias decrease compared to patients with healthy left atrial tissue (see figure 3). Typically, patients can be discharged 24 hr after the procedure . In the first 4 - 6 weeks after the ablation procedure after 6 weeks, the likely outcomes of the ablation procedure are evident . In most cases, all medical anti - arrhythmic treatments are discontinued on the day of the ablation procedure . Oral anticoagulation is mandatory and needs to be continued after the ablation procedure irrespective of the individual s stroke risk for at least 3 months . Figure 1: ablation of atrial fibrillation using nfcv technology . Left and middle: catheter visualization using the nfcv technology: ablation catheter (red tip) in the left superior pulmonary vein (lspv, blue marker). Ablation catheter (green halo) placed in the left superior pulmonary vein close to the ridge to the left atrial appendage . 3d reconstructed ct with low - voltage areas at the posterior wall of the left atrium and in the mitral isthmus region indicating areas of previous ablation . A color - coded voltage map is shown with purple for healthy tissue (electrograms> 0.5 mv) and grey for scar tissue (electrograms <0.2 mv). Electrogram amplitudes> 0.2 mv and <0.5 mv are displayed in yellow, red, and blue . 2 short cine loops (3 sec each) are recorded and are used as the dynamic background for catheter visualization . Specially - designed catheters with miniaturized sensors at the tip are inserted in the patient and visualized by the nfcv system . Radiation exposure for interventional cardiologists and electrophysiologists is an underestimated risk because of its unpredictable side - effects . Current literature reveals a higher incidence of left - sided brain - tumors among this subgroup of clinicians, suggesting that the proximity of the left hemisphere to the x - ray source may be a culprit . The latency between radiation exposure and diagnosis of neoplasia has been reported to be 20 years or more . Therefore, today s interventionalists should use all technological options to reduce radiation exposure to a minimum . The nfcv system can help reduce fluoroscopy exposure without affecting procedure time with a workflow that was adapted several times over the past 3 years in order to minimize radiation exposure according to the alara principle . 3d mapping systems can help to improve the understanding of complex 3-dimensional structures, but the basic orientation for the operator is generated using conventional fluoroscopy . The transseptal puncture remains the largest contributing step (75 - 80%) of the radiation dose during these procedures since no sensor - equipped material for use with nfcv technology is currently available . Especially in unexperienced hands this represents the most critical step in that procedure- other imaging modalities (such as intracardiac or transesophageal echo) can contribute to safe punctures and low complication rates . The nfcv is not only used in ablation procedures but also in complex implantations such as cardiac resynchronization therapy (crt). In these procedures, the system allows the reduction of fluoroscopy burden by 75 - 80% compared to conventional implantations . A recent publication could show that after a learning curve of 30 - 40 procedures a median fluoroscopy time of 1.1 min for 50 consecutive patients is feasible and safe this was confirmed when extending the data acquisition to> 500 patients (see figure 4). Figure 4: please click here to view a larger version of this figure . The limitation of the current available system is that only the tips of the catheters are visualized . Unexperienced operators will probably not be able to interpolate from the orientation of the tip to know what the position of the catheter shaft will be . Only a limited choice of catheters are currently available- therefore only a limited number of different procedures is suitable using nfcv technology . In near future more devices and tools will be available that are equipped with a sensor to be visualized non - fluoroscopically . The system here basically works as a cardiovascular platform for different procedures; electrophysiology is just the first application that has been introduced.
|
The purpose of this article is to describe a new surgical method of arthroscopy assisted treatment of intraarticular proximal tibial fractures (arif arthroscopic reduction and internal fixation), analyzing its efficiency and safety on a series of patients . The proximal tibia is vulnerable because of its anatomical position and the complex injuries that occur at this level, affecting both bone and soft tissues (knee s articular cartilage, ligaments or menisci). Tibial plateau fractures affect the proximal tibial metaphysis and articular surface, representing 1.2% of all fractures and up to 8% in elderly . These fractures are produced as a result of the action of a deformation force in valgus / varus or axial compression . Pure splitting fractures are common especially in younger patients, in case of severe trauma, as the solid structure of subchondral bone is able to cope with the strong compressive force of the femoral condyle . With time, the dense cancellous bone in the tibial condyle is affected by osteopenia, it loses strength and will no longer resist to compressive forces . Splitting and depression fractures are more common in patients after the fifth decade, occurring in low energy trauma . The goal of the surgical treatment is to obtain a very good reduction of the fracture and a stable internal fixation, with low aggression and morbidity . The surgical approach should not create any further damage, especially of local blood supply, but it has to facilitate good visualization and adequate gestures in order to reposition the bony fragments and repair the associate soft tissue lesions . Treatment outcomes can be impaired by the restriction of articular motion, lack of articular congruence, stability or alignment restoration, and possible complications: vicious consolidation, algodystrophy, residual instability, infection, or osteoarthritis . These facts represent the main drawbacks of the classical surgical treatment by open reduction and internal fixation orif . First we describe the surgical technique of arif: under spinal anesthesia and tourniquet, the patient is positioned supine on standard operating table and a leg holder is used above the knee to allow 0120 mobility . Standard arthroscopic al / am portals of the knee are used . Gravitational pressure lavage and arthroscopic shaver debridement after this step, a full inspection of the joint will reveal associated lesions (menisci, articular cartilage, cruciate ligaments, etc) (fig . Then we continue with the evaluation of the fracture pattern, localization, extension in all three planes and degree of comminution (fig . 2). The direct arthroscopic view shows a realistic comprehensive image of the mri or ct - scan slices (fig . The area of maximum depression of the tibial plateau must be identified and a 2 mm k - wire is inserted from the metaphyseal region to the articular surface through the acl ligamentoplasty tibial guide at sixty degrees of angle, and it will serve as a guide for medial corticotomy of the tibia - performed using an 810 mm cannulated drill . With a cylindrical beater the depressed fragments are gently elevated altogether with the cancellous bone underneath, visualizing the restoration of the articular surface . The inferior facet of the meniscus serves as a level guide for articular surface height, which has to be also verified with the c - arm (fig . The fixation is accomplished by two cannulated 6.5 mm cancellous screws, inserted in the proximity of the subchondral bone, to support the articular surface and prevent secondary displacement ., it should be filled with 1020 cc . Of cancellous bone or bone graft substitutes . At the same time, the treatment of the associated meniscal lesion (suture or partial meniscectomy) or chondral lesion (debridement, microfractures) has to be performed . Postoperatively we recommend immobilization of the knee in a fixed brace for the first 24 weeks, with alternative active mobilization (090) protected by a mobile brace and muscular reinforcement, without weight - bearing . Full weight - bearing is considered only after clinical and radiological consolidation of the fracture . The patients should be reviewed clinically and radiological at 4, 8, 12 weeks, 6 months, and 1 year after the intervention . Our case series consists of 6 patients with schatzker types i iii tibial plateau fractures, treated in the orthopedic and traumatology clinic of cluj - napoca from july 2012 to august 2014 . All of them signed the informed consent mandatory in our service and they were evaluated retrospectively . The patients mean age was 48 years and there were three men and three women . Two of them presented schatzker i tibial plateau fracture, two patients schatzker ii fracture and the others two schatzker iii type . The diagnosis was established on standard radiographs of the knee (face and profile). For a better evaluation of the lesions we performed preoperative ct - scan with 3d reconstruction in 4 cases, or preoperative mri in the other 2 . All the patients benefited from a fixation of the tibial plateau fracture under arthroscopic control according to the technique described above . They all followed the same postoperative rehabilitation protocol and they were evaluated at three months follow - up using the rasmussen score . 6a), but in one patient, due to the stability obtained by insertion of the bone substitute (fig . The results obtained with the arthroscopic method were excellent in 5 cases (mean rasmussen score 27.60 points) and just good in only 1 case (score 23.75). We encountered a case of transitory edema of the calf, which lasted about three weeks, and a case of persistent articular effusion with flexion limitation . No case of compartment syndrome was registered . Regarding the associated lesions, we found two external meniscal lesions, treated by suture in a case and minimal resection in the other . There were also three mirror chondral lesions of the lateral femoral condyle, for which we practiced arthroscopic debridement . Recently emerged as a treatment option for tibial plateau fractures (schatzker i - iii), this method seems to be adopted by more and more surgeons in the world, as it benefits from the advantages of minimally invasive surgery - reduced hospitalization, faster recovery of knee mobility, reduced cutaneous complications . Regarding the fracture reduction, direct visualization of the articular surface is a major advantage because it allows an anatomical reduction without requiring an extensive arthrotomy . The lavage of the joint cavity is one of the most important steps of the procedure and should be done intensively . For the initial evaluation, a probe is used to elevate the lateral meniscus, as the fracture is localized frequently under the meniscus . Other lesions (external meniscus is damaged in about 3050% of cases, lesions of cartilage or osteochondral lesions) can simultaneously benefit from specific treatment, improving patient recovery . Tears of the anterior cruciate ligament are also frequent, most of the time partial . Bone defect filling in case of younger patients is not mandatory . It is possible to use acrylic bone cement, autologous bone graft, allograft, or bone substitutes . Acrylic bone cement is very useful in aged patients, because it can associate filling of the cavity and immediate fixation of the bony fragment . Among the disadvantages of this method, we can include higher cost and duration of surgery and probably less rigid fixation than with plates . More thorough biomechanical studies are needed to better analyze this aspect, and analytical studies to compare the different methods of treatment and fixation of these fractures . The utilization of arthroscopy offers a good visualization of articular fracture reduction, allowing a stable fixation without the need of an extensive approach . Diagnosis and treatment of associated lesions (especially those of meniscus and articular cartilage), shortening of hospitalization duration and postoperative rehabilitation, but also the lower rate of complications, can make arthroscopy assisted reduction and internal fixation the method of choice for the operative treatment of selected schatzker i iii types of articular proximal tibial fractures.
|
The data file of recommendations by pbac was created by abstracting data from the pbac web site (http://www.health.gov.au/internet/main/publishing.nsf/content/public-summary-documents-by-product). Data were taken from recommendations made from july 2005 through november 2009 . In the data if a product had more than one submission for the same indication, more than one record was created under the same unique identification number . However, if a product had multiple submissions that included a different indication, a new unique identification number was created for that product and indication . The data file included pbac's recommendation (to recommend a listing with or without restrictions, not to recommend a listing, or to defer), the incremental cost - effectiveness ratio (cost per quality - adjusted life - year [qaly]), and the highest value of the financial impact presented in the summary document for each product . In addition, other variables were abstracted that have been shown to be associated with pbac's reimbursement recommendations in previous studies (12;13) (supplementary table 1, which can be viewed online at www.journals.cambridge.org/thc2013079). The four categories of outcomes abstracted were combined to create a binary variable with categories recommended (yes, restricted yes), and not recommended (no, deferred). The predictors of the pbac recommendation that were tested in the analyses were either abstracted or derived variables that were classified as either economic variables or clinical variables as seen in previous studies (1214). Economic variables included the following: (i) population size, created from reported patient population size treated per year: low (<10,000), medium (10,00050,000), and high (> 50,000). (ii) estimated financial impact per annum, using the upper bound value presented and estimated for the impact on only the drug budget: a$0,> a$0 to <a$10 million, a$10 million to a$30 million, and> a$30 million . A categorical variable was used for the analysis because the pbac summaries presented financial impact as an upper bound or range rather than a continuous variable for most of the submissions . (iii) cost per qaly, using the upper bound base case analyses:> a$0 to a$45,000,> a$45,000 to a$75,000, and> a$75,000 as used in the chim and colleagues study (12) of the impact of cost - effectiveness on reimbursement decisions . A fourth category, no cost - effectiveness analysis presented, was assigned to those submissions that used a cost - minimization approach for the economic evaluation . Clinical variables included the following: (i) active comparator (yes or no) that indicated whether an active comparator was used as the comparison group in at least one of the pivotal studies; (ii) manufacturer claim for the clinical benefits of the new product: noninferior or equivalent or superior; (iii) comparative clinical evidence available from randomized clinical trials only (rct) or from rct data plus a meta - analysis or indirect comparison analysis (rct plus meta - analysis or indirect comparison analysis); (iv) disease category (oncology or other), as a proxy measure of likelihood of reduced life expectancy and the dread factor associated with the disease (12); and (v) surrogate end point (yes or no), derived from a review of the end points in the submission . The unit of analysis for all analyses was the unique drug and indication submission after july 2005 . Only the first observed submissions of the unique drug and indication combination within our database were included in the univariate and initial multivariable logistic analyses because subsequent resubmissions were correlated with the first observed submission . A test result was declared statistically significant if p value was <.05 and marginally statistically significant if p value was>.05 but .1 . First, a univariate analysis was performed to explore the association between the pbac recommendation and the variables described previously . Next, a multivariable logistic regression was performed to evaluate the relationship between the probability of a positive recommendation and the categorical financial impact, while adjusting for other factors . The variables included in the logistic model were those that had an association with the recommendation with a p value .30 in the univariate analysis (15). A discrete time - to - event analysis was performed, including all extracted data: both the first observed submission data and all resubmission data to determine the relationship between multiple submissions and pbac recommendations while accounting for the correlations between repeated submissions and to determine the impact of the omission of the resubmissions on our estimates for financial impact . We performed the analysis using the logistic model as described in allison (16). Total submission count was determined by counting the number of times the same drug plus indication was submitted . Only nine records had a total count of four or more, and these records were omitted from the analysis . The variable time since previous submission was included because the resubmissions happened at irregular intervals . A submission or resubmission for a drug plus indication that happened once or more than once but that was not recommended for reimbursement also, submissions could be left censored if data for the first observed submission indicated that previous submissions had occurred before july 2005 . Finally, a decision tree analysis was performed using the recursive partitioning algorithm in jmp analysis software (sas, cary, nc). Recursive partitioning is a nonparametric classification technique that splits into subsets, called nodes, observations with similar response values for predictor variables (17). In each node, the predictor variable with the strongest association to the outcome variable is chosen for splitting the node . For a categorical outcome, the recursive partitioning algorithm in jmp analysis software uses log10 (p value), also called logworth, where the p value is an adjusted p value given by a likelihood ratio test . To avoid overfitting, only partitions that had a logworth value 1.12, which corresponded to log10 (0.05), because this is a nonparametric method, it has an advantage over logistic regression by not assuming any functional form for the association between predictors and outcome . Furthermore, recursive partitioning has the advantage of detecting possible complex interactions between predictors that may not have been detected by the logistic regression, and because it is easy to visualize and interpret, it is suitable for a decision - making process (18). Moreover, the relative importance of the predictors can be inferred by the order in which they partition the data (i.e., the earlier the predictor is used by the partition algorithm, the more important it is). The logistic regression and decision tree analyses were also performed using only those submissions with a reported cost per qaly to assess the importance of financial impact in this subset of the total submissions . A total of 260 submissions, representing 214 unique drug plus indication combinations and 46 resubmissions during the data abstraction time period, were extracted from the pbac web site . Most, or 170 of the 214 (79.5 percent) unique drug plus indication combinations, were not submitted before july 2005; 27 (12.6 percent) were submitted once before july 2005; and 17 (7.9 percent) were submitted multiple times before july 2005 . Of the 260 submissions, 106 (40.8 percent) were recommended for reimbursement, 47 (18.1 percent) were partially recommended for reimbursement (i.e., recommended with restrictions), 100 (38.4 percent) were not recommended for reimbursement, and 7 (2.7 percent) were deferred . Therefore, the binary variable pbac recommendation for reimbursement had 153 submissions (58.9 percent) that were recommended and 107 submissions (41.1 percent) that were not recommended . Five variables financial impact, cost per qaly, manufacturer's claim, active comparator, and disease category had a statistically significant association with the pbac recommendation . With the exception of the financial impact category> a$30 million, the percentage of submissions that were recommended decreased as the financial impact and the cost per qaly increased . In addition, 74.3 percent of the submissions that did not report a cost per qaly were recommended as compared with 40.0 percent for those submissions with a reported cost per qaly . The percentage of recommendations was higher for entries that claimed noninferiority or equivalence, that had used an active control as the comparator in at least one pivotal clinical trial, and that were not in the oncology category . The other included variables (population size, comparative clinical evidence, and surrogate end points) did not have a statistically significant association with the pbac recommendation . Based on the univariate analyses, six possible predictors of pbac recommendations with a univariate p value .30 table 1.univariate association between pbac recommendations and predictorsvariableno . In each variable categorypercentage in each variable category recommended for reimbursement by pbacp value for difference between categoriesfinancial impact (million a$)>302245.5%<.000110 to 304235.7%>0 to <1010154.5%03992.3%cost per quality - adjusted life - year (thousand a$)>751915.8%<.0001>45 to 752733.3%>0 to 455950.9%none10974.3%population sizehigh4047.5%.3671medium5259.6%low12259.8%manufacturer claimsuperior or advantages10843.5%<.0001noninferior or equivalent10671.7%comparative clinical evidencerandomized controlled trial9953.5%.2792rct + meta - analysis or indirect comparison analysis11560.9%active comparatorno5232.7%<.0001yes16265.4%disease categoryoncology3740.5%.0219other17761.0%surrogate end pointyes15058.0%.5846no5453.7% percentages were calculated out of the available data for the respective variable category . P value was calculated using pearson's chi - square test for difference between the variable categories.pbac, pharmaceutical benefits advisory committee . Univariate association between pbac recommendations and predictors percentages were calculated out of the available data for the respective variable category . P value was calculated using pearson's chi - square test for difference between the variable categories . Figure 1 and supplementary table 2, which can be viewed online at www.journals.cambridge.org/thc2013079, present the results of the multivariable logistic analyses . Only the effect of financial impact (p = .0242), cost per qaly (p = .0235), and active comparator (p = .0365) were statistically significant . After adjusting for the other factors in the model, the only statistically significant odds ratios for financial impact were for comparing either category a$10 million to a$30 million (0.12; 95 percent confidence interval [ci]: 0.030.51) or> a$0 to <a$10 million (0.16; 95 percent ci: 0.040.60) with the category a$0 . The odds ratio for the financial impact category> a$30 million compared with the category a$0 was not significant (0.25; 95 percent ci: 0.051.34). For cost per qaly, the only statistically significant odds ratios were for comparing the category> a$75,000 with either the category> a$0 to a$45,000 (0.11; 95 percent ci: 0.020.55) or to the category none (0.06; 95 percent ci: 0.010.40). The odds of recommending a drug submission that used an active comparator were 2.49 (95 percent ci: 1.065.85) times the odds of recommending a drug submission that used placebo as the primary comparator . Figure 1 presents a plot of selected odds ratios obtained from the first logistic model . Financial impact was not statistically significant (p = .1801) when the same model was run using only submissions that reported a cost per qaly (n = 103). Cost per qaly was the only statistically significant factor (p = .0158) in this model . Figure 1.multivariable logistic regression results (n = 204): odds ratios with 95% ci plots . Ci, confidence interval; qaly, quality - adjusted life - year; rct, randomized controlled trial . Multivariable logistic regression results (n = 204): odds ratios with 95% ci plots . Ci, confidence interval; qaly, quality - adjusted life - year; rct, randomized controlled trial . Figure 2 and supplementary table 2 present the results of the analysis of discrete - time survival data, using multivariable logistic analysis . The statistically significant effects were total submission count (p = .0029), financial impact (p = .0021), cost per qaly (p = .0135), and an active comparator (p = .0229). The odds ratio estimates for financial impact, cost per qaly, and an active comparator were very similar to the corresponding odds ratios obtained in the first model . After adjusting for other factors in the model, the odds of recommending a drug that was submitted a third or second time were 9.62 (95 percent ci: 2.4737.42) or 3.66 (95 percent ci: 1.359.96) times the odds of recommending a drug submitted the first time, respectively . The odds of recommendation were 0.83 lower for a 1-trimester increase in time since the previous submission . Figure 2 presents the odds ratio plots for the second logistic model . When the same model was run only using submissions (n = 126) with a reported cost per qaly, financial impact was still statistically significant (p = .0223). Figure 2.multivariable logistic regression results for discrete time - to - event data (n = 238): odds ratios with 95% ci plots . Ci, confidence interval; qaly, quality - adjusted life - year; rct, randomized controlled trial . Multivariable logistic regression results for discrete time - to - event data (n = 238): odds ratios with 95% ci plots . Ci, confidence interval; qaly, quality - adjusted life - year; rct, randomized controlled trial . In addition to the variables used in the logistic analyses, population size and surrogate end point were also included . Categorical financial impact was the most important factor to make the first partition (logworth = 7.18) by grouping the three financial impact categories,> a$0 to <a$10 million, a$10 million to a$30 million, and> a$30 million, into a single category and comparing it with a$0 . Cost per qaly, active comparator, and disease category were the next predictors selected for recursive partitioning . For cost per qaly, the categories none and> a$0 to a$45,000 were combined by the model program and compared with> a$45,000 to a$75,000 and> a$75,000 . The results of the recursive partitioning model indicated that the chance of being recommended for reimbursement for drug submissions with a financial impact a$0 was 91.4 percent, and the chance for drug submissions with a financial impact> a$0 and a cost per qaly either not estimated or a$0 to a$45,000 was 57.5 percent as compared with 24.4 percent for submissions with a financial impact> a$0 and cost per qaly> a$45,000 . Lower chances for reimbursement recommendation were estimated for drug submissions with a financial impact> a$0, a cost per qaly either not calculated or> a$0 to a$45,000, and without an active comparator (29.6 percent). When a new tree was constructed considering only submissions with a reported cost per qaly, the cost per qaly was the only important factor in the partitioning analysis . The results of the analyses presented in this study indicate that the estimated financial impact of a drug on the australian drug budget is a predictor of the pbac reimbursement recommendation, even when controlling for the cost - effectiveness ratio and other confounding variables . In the descriptive analysis, there was a gradient in probability of reimbursement, with the highest probability for drugs that were estimated to be cost - saving and the lowest probability for drugs that were estimated to increase annual costs between a$10 million and a$30 million . However, probability of recommendation was higher for those submissions with a financial impact of> a$30 million compared with those with a financial impact of a$10 to a$30 million . The logistic analyses demonstrated that this pattern was similar even when controlling for the cost - effectiveness ratio and other confounding variables and the number of submissions and even when only including those submissions that presented a cost per qaly estimate . A review of the submissions with an estimated financial impact> a$30 million (22 submissions) found that products in this category that were recommended for reimbursement either had cost per qaly estimates in the lower end of the a$0 to a$45,000 range, or very favorable clinical benefits, or indications where there were no alternative treatments that might explain this seemingly anomalous result . The impact of multiple submissions on the probability of recommendation for reimbursement was significant with an odds ratio of 9.62 for a third and 3.66 for a second observed submission compared with the first observed submission . Supplementary table 3, which can be viewed online at www.journals.cambridge.org/thc2013079, presents a summary of the changes in the categorical values among the 29 multiple submissions . A review of these changes indicated that, although reductions in price were likely key factors in obtaining a positive reimbursement recommendation in many cases, changes in the clinical data submitted were also influential in obtaining a positive recommendation . Finally, the recursive partitioning decision analysis supported the importance of a positive financial impact for the reimbursement decision with the full database because the variable with the greatest discriminative power for reimbursement recommendations was shown to be a positive financial impact of any magnitude, followed by the cost per qaly . However, the results for the subset of submissions that report a cost per qaly, all of which had a positive financial impact, indicated that the cost per qaly variable had the greatest discriminatory power . A threshold value of a$10 million was used for the financial impact analysis because full approval by the cabinet of the federal government was needed for drugs when their annual financial impact was expected to exceed a$10 million in any 12-month period within the first 4 full years of product listing . Having mandated that a multiyear financial impact analysis be included in submissions has allowed the pbs to put in place price - volume contracts for those drugs that exceed the a$10 million per year limit (19), although the specific agreements are confidential . The results of our analyses are supported by and extend those from three previous analyses of pbac data (1214). All three studies included financial impact on the healthcare sector as an explanatory variable . In the supplemental appendix of clement et al . (13), in a descriptive analysis of submissions not needing a cost - per - qaly estimate, the probability of reimbursement in australia was much higher (81 percent) than for those needing a cost - per - qaly estimate (44 percent) (13). In the harris et al . (14) study, for a sample of the decisions that also included an estimate of the cost - per - qaly gained, harris and colleagues (14) estimated that for each increase of a$5 million in financial impact above the mean value, the probability of a pbac recommendation for reimbursement would decrease by 0.03 . However, by excluding any submissions that estimated financial cost - savings and many that estimated a budget impact <a$10 million, they may have underestimated the importance of the financial impact for reimbursement decisions, especially for drugs with multiple submissions . Finally, chim and colleagues (12) compared the impact on reimbursement of two financial impact categories: <a$10 million and a$10 million . In a logistic analysis, they estimated a statistically significant odds ratio of reimbursement of 0.46 for submissions with a financial impact of a$10 million compared with those with a financial impact of <a$10 million . The strengths of our analysis included the use of multiple analytic techniques that all provided similar results . The use of the survival analysis allowed us to include data from multiple submissions as well as right- and left - censored submissions, appropriately accounting for the correlation among repeat submissions of the same drug / indication pair . The use of the recursive partition decision analysis estimation technique is important because the results provided a simple stepped process for predicting whether a submission will be recommended for reimbursement in australia . The major limitation is that, in many cases, the financial impact on the drug budget or the cost per qaly was provided in the public summary document only as an inequality or range . Thus, it was not possible to enter financial impact into the model as a continuous variable . Instead, we created four financial impact categories . Also, the sample size was relatively small (n = 260), limiting our ability to include a high number of explanatory variables or more than four categories of financial impact . There was also the possibility of multicollinearity among the independent variables used in the analysis . To test for this, we estimated tolerance scores for each independent variable and found that all variable scores were above 0.40, values not considered to be of concern for multicollinearity (16). Supplementary table s4, which can be viewed online at www.journals.cambridge.org/thc2013079, presents the regression results . The choice of oncology as a proxy for disease severity was also a source of uncertainty because other diseases may also be associated with very limited life expectancy and dread . The implications of the findings in this study are that, in australia, the financial impact on the drug budget is an important determinant of whether a new drug is recommended for reimbursement with the strongest positive impact for products that have a zero or negative financial impact . Our findings are consistent with the conclusions of the recent published analyses on the possibility that financial impact plays a role in the hta agency reimbursement recommendations, although not specifically listed as a criterion (68). In addition, the explicit instructions provided in the pbac submission guidelines for performing financial impact analysis indicate the potential importance of these results for the pbac review . Although financial impact is a specific part of the decision making for reimbursement in australia, this is not necessarily the case in other countries . Whether financial impact influences reimbursement decisions in these countries is an empirical question that can be resolved only by performing similar analyses in these jurisdictions . Supplementary table 1: www.journals.cambridge.org/thc2013079 supplementary table 2: www.journals.cambridge.org/thc2013079 supplementary table 3: www.journals.cambridge.org/thc2013079 supplementary table 4: www.journals.cambridge.org/thc2013079 josephine mauskopf, phd, vice president health economics (jmauskopf@rti.org), costel chirila, phd, senior statistician, biometrics, catherine masaquel, mph, associate director in the market access and outcomes strategy, rti health solutions, po box 12194, research triangle park, nc, 27709 kristina s. boye, phd senior director global health outcomes, diabetes, lee bowman, phd senior director, global health outcomes oncology, julie birt, pharmd senior research scientist, global health outcomes, health technology assessment center of expertise, david grainger, bs global public policy director, lilly and company, indianapolis, indiana, united states josephine mauskopf, catherine masaquel, costel chirila report payment to their institution by a contract from eli lilly and company for leading the research reported in the manuscript.
|
Interstitial pneumonitis is a classical complication of many drugs.pulmonary toxicity due to 5-azacytidine is rarely mentioned.it is important to anticipate diagnosis of 5-azacitidine - associated interstitial lung disease to limit antibiotics abuse and to set up emergency treatment . Pneumonitis, often called interstitial lung disease or ild, is a possible manifestation of many antineoplastic and other drugs, with several ild subtypes being described in association with drugs . Pulmonary toxicity from 5-azacytidine, a deoxyribonucleic acid (dna) methyltransferase inhibitor which also exerts cytotoxic effects, has rarely been reported, although the drug has been used since 1982 . 5-azacytidine acts as a hypomethylating agent of the y globin suppressor gene to induce fetal hemoglobin in thalassemia and, since 2000, to treat high - risk myelodysplastic syndrome (mds) and acute myelogenous leukemia (aml) with low blast counts . Here, we report a case of 5-azacytidine - asociated pneumonitis, review the literature, and develop a diagnostic algorithm for this rare condition to avoid delay in medical care and misuse of antibiotics . A 67-year - old woman presented as an outpatient of our hematology department in august 2015 for progressive neutropenia, anemia, and fatigue . Peripheral blood examination showed a normochromic normocytic anemia with 9.4 g / dl hemoglobin, 0.350 10/l neutrophils and 138 10/l platelets . A bone marrow aspirate (bma) showed hypercellular marrow with trilineage dysplastic features, micromegakaryocytes and 13% myeloblasts . A diagnosis of refractory cytopenia with multilineage dysplasia was given, based on the who mds classification . A trephine biopsy was in accordance with the results from the bone marrow aspirate with 15% myeloblasts displaying dyserythropoiesis and dysmegakaryopoiesis . Karyotype g banding analysis revealed a complex cytogenetic abnormality: 46,xx, del(5)(q14q34) /49,sl,+1,+9,+11 /52,sd1,+11,+22,+22 . She received the first cycle of 5-azacytidine at the conventional dosage of 75 mg / m for 7 days from september 28, 2015 . One week after starting 5-azacytidine, she developed moderate fever along with dry cough and, subsequently, her temperature rose to 39.5 c . She was placed under broad - spectrum antibiotics based on the protocol for febrile neutropenia, including ciprofloxacin 750 mg twice daily, ceftazidime 1 g three times daily (tid), and sulfamethoxazole / trimethoprim 400 mg/80 mg tid . The chest and sinus radiographs were normal, as were precipitins against aspergillus and titers against cytomegalovirus (cmv) and epstein - barr virus (ebv). Marrow re - aspiration revealed a 22% increment of blast number, suggesting a transformation towards acute myeloid leukemia . During her second week in hospital, blood gas showed a pao2 of 59 mmhg and paco2 of 29 mmhg . High - resolution computed tomography (hrct) of the chest disclosed diffuse bilateral opacities with ground - glass shadowing and pleural effusion bilaterally (fig . 1). The patient was transferred to the intensive care unit on october 23 for bronchoalveolar lavage (bal), which showed 170 red blood cells / mm and 10 white blood cells / mm . Polymerase chain reaction (pcr) for mycobacterium tuberculosis, pneumocystis jiroveci, and cmv were negative . A diagnosis of drug - induced pneumonitis was considered and, given the negative bal in terms of an infection, corticosteroid therapy was given at a dose of 1 mg / kg body weight on october 28 . Within 4 days, a significant improvement in clinical status and imaging was noted . A repeat chest computed tomography (ct) scan at 1 week also showed significant improvement . Left upper chest pain corresponding to lobulated pleural effusion was noted and 1200 ml of serosanguinous fluid was removed via chest tube . 1high - resolution computed tomography of the chest disclosed diffuse bilateral interstitial opacities with ground - glass shadowing, and pleural effusion bilaterally high - resolution computed tomography of the chest disclosed diffuse bilateral interstitial opacities with ground - glass shadowing, and pleural effusion bilaterally clinical features of 5-azacytidine - associated ild include cough, dyspnea, pleuritic chest pain, and hypoxemic respiratory failure . Like many antineoplastic agent - induced lung diseases, prominent imaging findings include diffuse multifocal ground - glass shadowing, interstitial thickening, and pleural effusion . Here we review 12 earlier cases of 5-azacytidine - associated pneumonitis (table 1). Delayed diagnosis following failure of broad - spectrum antibiotic therapy was common [314]. Corticosteroids were used depending on severity.table 1clinical characteristics, examination, and treatment of myelodysplastic syndrome and acute myeloid leukemia patients with 5-azacitidine - induced interstitial lung diseasestudydiseasesexageclinical symptomstime of onset of symptomsexaminationtreatmentevolutionrechallengeadams et al . 2005; usa mdsm71bilateral crackles and wheezing<7 dayschest radiograph: patchy bilateral, perihilar airspace disease, organizing pneumonitisbronchoscopy: scattered petechiae, thin watery secretions, with no lesions or evidence of hemorrhagecultures negativebiopsy: acute and chronic interstitial and alveolar fibrosis with chronic inflammation, marked atypia of pneumocytes, no pathogens1 . Cefotaxime, azithromycin, metronidazolediednohueser and patel 2007; usa mdsf55hyperthermia, hypoxic respiratory failure, acute respiratory distress syndrome5 dayschest tomography: bilateral interstitial opacities1 . Empiric broad - spectrum antibiotics, antifungal drugs and methylprednisolone 100 mg every 12 hoursrecoverednopillai et al . 2012; uk mdsf74fever, dry cough, breathlessness2 weekstomography scan: peribronchiolar shadowingcultures negative1 . Antimicrobial therapyrecovered spontaneouslyyesfever, dry cough, dyspnea5 days after 2nd cyclechest x - ray: bilateral patchy shadowingct scan: reticulo - nodular and ground - glass shadowing, pleural effusions1 . Mg / kg / day + oxygenrecovered and died of sepsis after 5 monthsnosekhri et al . Negativerecoveredyesfever, cough, dyspnea, hypoxia2 days after 2nd cyclecultures negativetomography scan: extensive bilateral airspace disease with nodular opacitiesbiopsy: interstitial lung disease and bronchocentric granulomatous patternbal negative1 . 2012; usa mdsm76dyspnea, non - productive cough, fever3 weekschest x - ray: bilateral interstitial infiltratesct scan: diffuse bilateral patchy infiltratesbiopsy: organizing pneumonia with intra - alveolar plugs and fibroblastic tissue, predominant eosinophilic infiltrationcultures negative1 . 2012; japan mdsm74fever, dry cough, worsening shortness of breath2 dayschest x - ray: infiltration in the right middle lung fieldcultures negativechest tomography: organizing pneumonia1 . 2014; japan mdsm72moderate pyrexia, dyspnea, dry cough, bloody sputum and wheezing, hypoxic respiratory failure3 dayschest x - ray: patchy airspace diseasetomography scan: areas of interstitial opacity and ground - glass shadowingno infections in cultures1 . Oxygen2 . Micafungindiednoverriere et al . 2015; france amlf86grade iii skin reaction, nausea, gastric pain, dry cough, hyperthermia, ear pain, asthenia, anorexia, hyperthermia2nd day of the 3rd cyclect scan: diffuse interstitial opacities and ground - glass shadowing (mediastinal and hilar lymph nodes)1 . Corticotherapy 0.75 mg / kg per day + oxygen therapyrecoverednopatel et al . 2015; usa mdsm74fever, cough, shortness of breath2 days after 2nd cyclechest radiograph and tomography: bilateral interstitial infiltrates and ground - glass opacitiescultures negativebal inflammatory1 . 2015; canada mdsm73fever, chills, night sweatsstart of 3rd cycleblood culture: mycobacterium fortuitum chest radiograph: bilateral hilar enlargement and bilateral perihilar ground - glass opacitieschest tomography: bilateral ground - glass opacities with reticulation in the mid- and upper lung zones and patchy peripheral airspace consolidationbal negative1 . 2016; usa mdsm67worsening shortness of breath, mild productive cough2 weeks after 2nd cyclect scan: massive multifocal bilateral pulmonary consolidations, surrounding ground - glass opacities, pleural effusioncultures negativelung biopsy: chronic nonspecific inflammation with macrophages4 . Levofloxacin + piperacillin / tazoactam5 . Methylprednisolone 60 mg twice dailyrecoveredno aml acute myeloid leukemia, bal bronchoalveolar lavage, ct computed tomography, dild drug - induced lung injury, f female, iv intravenous, m male, mds myelodysplastic syndrome, na not available clinical characteristics, examination, and treatment of myelodysplastic syndrome and acute myeloid leukemia patients with 5-azacitidine - induced interstitial lung disease aml acute myeloid leukemia, bal bronchoalveolar lavage, ct computed tomography, dild drug - induced lung injury, f female, iv intravenous, m male, mds myelodysplastic syndrome, na not available the diagnosis of drug - induced pneumonitis rests on history of drug exposure, clinical imaging, bronchoalveolar lavage, exclusion of other lung conditions, improvement following drug discontinuation, and recurrence of symptoms upon rechallenge with the drug . In the present case, we were reluctant to readminister the drug as the risk of doing so is poorly known . The naranjo probability score in this case was 6, consistent with probable adverse reaction [15, 16]. In our case, despite steroid use, symptoms relapsed and were characterized as serosanguinous pleural effusion . Serosanguinous pleural exudates with polymorphonuclear leukocyte predominance without bacteriological evidence of infection may be a manifestation of pleurisy such as in lupus erythematosus, which might be induced by the drug in question . Mechanisms for drug - induced ild are direct cytotoxicity, hypersensitivity, oxidative stress, release of cytokines and thus pyrogens, and lastly impaired repair by type ii pneumocytes . Chronology of events, unexplained fever, and steroid response to clinical and radiological signs constitute a hypersensitivity pneumonitis . 5-azacytidine is a cytosine analog, a potent inhibitor of dna methyltransferase, with a hypomethylating effect in vivo and in vitro . Unlike gemcitabine, although cytotoxic at high dose, at low dose it is capable of inducing differentiation and hypomethylation . Hence, profound myelosuppression or direct lung injury like capillary leak syndrome is not encountered during 5-azacytidine toxicity . The role of oxidative stress is still unclear although there are a few reports concerning induction of necrosis in vitro by 5-azacytidine . Oxidative stress could contribute to t - cell response by inhibiting the erk pathway signaling in t cells . Recently we observed drug - associated ild in two patients treated with an experimental inhibitor of dna methyltransferase, suggesting a common class effect [19, 20]. Although an elevated ige level was reported in one case by nair et al ., the evidence is not sufficient to conclude a type i reaction . Although the histopathological evidence is rarely possible in immunocompromised patients with hematological malignancy, sekhri et al . Hence, another plausible explanation could be a delayed type of hypersensitivity (type iv) with activation of cd8 t cell, which could explain most of the symptoms . The pulmonary fibrosis may be due to dna hypomethylation causing direct upregulation of type i collagen synthesis . Sanders et al . Suggested that the dna methylation is important in idiopathic pulmonary fibrosis (ipf), as an altered dna methylation profile moreover, there are reports suggesting the epigenetic priming by 5-azacytidine confers transdifferentiating properties to various cells . However, it is difficult to establish a relationship at present . Our diagnostic algorithm is based on that of drug - induced interstitial lung disease (dild), and is not specific for 5-azacytidine (fig . 2). Any febrile condition in those patients with worsening pulmonary symptoms despite broad - spectrum antibiotics should arouse suspicion of dild . Hrct and bal are crucial as 5-azacytidine - induced pneumonitis remains a diagnosis of exclusion, like many other dilds . Some nonspecific immunological tests could be helpful, like levels of p - anca (antineutrophil cytoplasmic antibody) and ana (antinuclear antibody). A high degree of vigilance is advised to entertain the diagnosis in a timely manner, since the condition can be fatal . We now utilize a decision algorithm in order for timely diagnosis of 5-azacitidine - induced ild to limit antibiotics abuse and to set up emergency treatment . Misra, l. gabriel, e. nacoulma, g. dine, and v. guarino declare that they have no conflict of interest . Written informed consent was obtained from the patient for publication of this case report and any accompanying images . A copy of the written consent may be requested for review from the corresponding author.
|
Apixaban, an oral direct factor xa inhibitor, is indicated for the prevention of stroke and systemic embolism in nonvalvular atrial fibrillation (nvaf).14 apixaban has also been approved for the prophylaxis of deep vein thrombosis (dvt) in patients who have undergone hip or knee replacement surgery,1,2,57 as well as for the treatment of dvt and pulmonary embolism (pe), and for the reduction of the risk of recurrent dvt and pe following initial therapy.1,2,8,9 apixaban is often coadministered with treatments for cardiovascular comorbidities, such as hypertension, congestive heart failure, and diabetes . Therefore, it is important to assess the potential for pharmacokinetic interactions between apixaban and possible concomitant cardiovascular treatments . The pharmacokinetics (pk) of apixaban in healthy subjects are characterized by a time to peak plasma concentration (tmax) of 34 hours and a mean elimination half - life (t1/2) of ~12 hours.2,10 apixaban is 87% bound to serum proteins, and is eliminated through multiple mechanisms, including cytochrome p450 3a4 (cyp3a4)-mediated metabolism, and renal, biliary, and direct intestinal excretion.2,1013 in addition to cyp3a4, apixaban is also a substrate of the drug efflux transporter, p - glycoprotein (p - gp).2,10,14 therefore, strong inhibitors and inducers of cyp3a4 and p - gp increase and decrease apixaban exposure, respectively.15,16 apixaban does not inhibit or induce cyp3a4 or other cyp isoenzymes, and does not inhibit p - gp.14,17 therefore, it is unlikely that apixaban would alter the metabolic clearance of concomitant medications that undergo cyp enzyme - mediated metabolism, and an interaction between apixaban and p - gp substrates is not expected . Lanoxin (digoxin), a cardiac glycoside used for the treatment of congestive heart failure as well as atrial fibrillation,18,19 has a narrow therapeutic index . Because it is likely that apixaban and digoxin will be coadministered in some patients, it is important to evaluate the potential for apixaban to alter the pk of digoxin . Oral digoxin is rapidly absorbed, with a tmax of 13 hours, and is eliminated slowly, with a mean t1/2 of 1.52.0 days.19 approximately 25% of digoxin in the plasma is protein - bound, and only 16% of the dose is metabolized, with 50%70% excreted unchanged in the urine.19 metabolism of digoxin is independent of cyp, and digoxin does not appear to induce or inhibit the cyp system.19 the potential for a drug drug interaction (ddi) between apixaban and digoxin was considered to be low on the basis of their individual absorption, distribution, metabolism, and excretion profiles . Digoxin also serves as an acceptable p - gp probe substrate to predict the effects of p - gp modulators used in the clinical setting.20 tenormin (atenolol) is a cardioselective beta - blocker that is prescribed to treat hypertension.21 the pk of oral atenolol is characterized by a tmax of 24 hours, and a mean elimination t1/2 of 67 hours . Half of the oral atenolol dose is excreted unchanged in the feces; most of the remainder is eliminated through renal excretion, with little or no metabolism by the liver.21 beta - blockers may reduce hepatic blood flow22; however, apixaban clearance is not expected to be limited by reduced hepatic blood flow because it is not a high extraction ratio drug.2 although atenolol is not metabolized by cyp enzymes and does not inhibit p - gp - mediated transport, both apixaban and atenolol are p - gp substrates.14,23 two separate phase 1 studies were conducted to evaluate the risk of clinically meaningful ddis between apixaban and digoxin or atenolol . Based on the pharmacokinetic characteristics of these drugs, interactions between apixaban and digoxin and between apixaban and atenolol were expected to be minimal . The primary objective of the digoxin ddi study (nct02262520) was to assess the effect of multidose apixaban on the pk of multidose digoxin in healthy subjects . The primary objectives of the atenolol ddi study (nct02262533) were to assess the effect of atenolol on the pk of apixaban and the effect of apixaban on the pk of atenolol in healthy subjects . The digoxin ddi study was an open - label, multidose, two - treatment, single - sequence study in healthy subjects (figure 1a). The atenolol ddi study was an open - label, single - dose, randomized, three - period, three - treatment, crossover study in healthy subjects (figure 1b). The protocols for both studies were approved by the new england institutional review board (wellesley, ma, usa) and the studies were conducted in accordance with title 21, part 56 code of federal regulations (cfr) and title 21, part 50 cfr, the principles of the declaration of helsinki, good clinical practice as defined by the international conference on harmonisation, and the ethical principles underlying the european union directive 2001/20/ec . Both studies recruited male and female subjects aged 1845 years with a body mass index of 1830 kg / m who were considered to be healthy according to medical history, physical examination, vital signs, 12-lead electrocardiogram (ecg) assessment, and clinical laboratory tests . Subjects underwent screening evaluations within a 21-day period prior to dosing to determine eligibility . Both trials excluded female subjects who were pregnant or nursing . The digoxin study excluded all women of childbearing potential; the atenolol ddi study allowed them to participate if they used accepted methods of contraception, excluding use of hormonal contraception, within 3 months of study start . In both studies, all subjects provided written informed consent prior to the initiation of any study - specific procedures . Subjects were excluded from the digoxin ddi study if they had relevant arrhythmias, unexplained syncope, abnormal renal function, or conditions that can cause electrolyte disorder . Subjects were excluded from the atenolol ddi study if they had a history of asthma, bronchitis or other significant pulmonary disease, or a history of hypotension . For both studies, exclusion criteria also included a history or evidence of abnormal bleeding or coagulation disorder and/or having a first - degree relative under 50 years of age with a history of abnormal bleeding or coagulation disorder, significant gastrointestinal (gi) disease (within 3 months) or gi surgery that could affect absorption of study drug, a history of significant drug allergies, or prior exposure to apixaban . Other exclusion criteria included exposure to any investigational drug within 4 weeks of study start, prescription drugs within 4 weeks of study start, or any over - the - counter medications or herbal preparations within 1 week (digoxin study) or 2 weeks (atenolol study) of study start . For both studies, subjects were admitted to the clinical facility on the day before study drug administration and remained there until clinical and laboratory safety data evaluations had been completed (day 22 for the digoxin ddi study and day 4 of period 3 for the atenolol ddi study). In the digoxin ddi study, subjects were assigned to receive a digoxin 0.25 mg tablet q6h on day 1 and a digoxin 0.25 mg tablet once daily on days 210, followed by an apixaban 20 mg tablet once daily and a digoxin 0.25 mg tablet once daily on days 1120 . The dose and dosing regimen for digoxin were selected to mimic a commonly administered digoxin dosing regimen in the clinical setting, and to achieve, but not exceed, the therapeutic concentration range for atrial fibrillation (~1.42.5 ng / ml).24,25 apixaban 20 mg once daily was selected to represent the highest dose evaluated in phase 2 clinical trials at the time the study was conducted.2628 digoxin 0.25 mg tablets were provided by the investigator and manufactured by glaxosmithkline (research triangle park, nc, usa), and apixaban 20 mg tablets were supplied and manufactured by bristol - myers squibb company (new brunswick, nj, usa). Subjects in the atenolol ddi study were randomly assigned to receive a single oral dose of apixaban 10 mg, atenolol 100 mg, or apixaban 10 mg + atenolol 100 mg on day 1 of period 1 . The alternative treatments were administered during periods 2 and 3 according to a randomization schedule . An atenolol dose of 100 mg was chosen for this study as representative of the upper end of the dose range.21,29 an apixaban dose of 10 mg was selected on the basis of safety data available at the time, and reflected exposures likely to be observed in patients, as the phase 3 clinical trials evaluated apixaban doses ranging from 2.5 to 10 mg twice daily for reducing the risk of stroke in nvaf, prophylaxis of thrombosis - related events following hip or knee replacement surgery, or treatment of dvt and pe.39,30 atenolol 100-mg tablets were supplied by the investigator and manufactured by astrazeneca pharmaceuticals lp (wilmington, de, usa), and apixaban 5-mg tablets were supplied and manufactured by bristol - myers squibb company . In both studies, blood samples for analysis were collected via indwelling catheter or by direct venipuncture . In the digoxin ddi study, blood samples for digoxin pk were collected at selected times over the 24-hour dosing interval on days 10 and 20 . Blood samples for digoxin trough concentrations were collected predose on days 8, 9, 10, 18, 19, and 20 . Blood samples for apixaban trough concentrations were collected predose on days 1820 . For apixaban and digoxin pharmacokinetic analysis, each 5 ml blood sample was gently inverted a few times immediately after collection to ensure complete mixing (with anticoagulant [sodium citrate] or the clot activator gel for apixaban and digoxin, respectively) in the serum - separating tube and was then placed on chipped ice . Samples for pharmacokinetic analysis of apixaban (within 15 minutes) and digoxin (after a 30- to 60-minute wait to allow for clotting) were centrifuged for 15 minutes at ~1500 g at room temperature to separate the plasma and serum, respectively . Separated plasma (apixaban) and serum (digoxin) were transferred to cryogenic vials, immediately stored at or below 20c, and sent for analysis (apixaban: intertek pharmaceutical services, el dorado, ca, usa; digoxin: advion biosciences, ithaca, ny, usa). For the atenolol ddi study, blood samples for pk assessment were collected both predose and over a period of 72 hours postdose for apixaban and through 48 hours postdose for atenolol . For atenolol and apixaban pk analyses, each 3.0 and 2.7 ml blood sample, respectively, was gently inverted a few times immediately after collection to ensure complete mixing with anticoagulant (k2edta for atenolol, 3.2% sodium citrate for apixaban) and then placed on chipped ice . Within 15 minutes, each blood sample was centrifuged for 15 minutes at ~1500 g at 4c to separate the plasma, and was then transferred to a cryogenic vial, immediately stored at or below 20c, and sent for analysis (apixaban: intertek pharmaceutical services; atenolol: vimta labs, andhra pradesh, india). In both studies, the serum (digoxin) and plasma (atenolol and apixaban) samples were analyzed using validated liquid chromatography mass spectrometry / mass spectrometry (lc / ms / ms) methods.31 the between - run and within - run variabilities for digoxin in serum quality - control samples were 4.6% and 8.0%, respectively, with deviations from nominal concentration of within 3.3% . The between - run and within - run variabilities for atenolol in plasma quality - control samples were 6.3% and 8.6%, respectively, with deviations from nominal concentration of within 8.4% (data on file, bms, 2008). The lower limit of quantification is 0.1 and 1.0 ng / ml for digoxin and atenolol, respectively . Individual subject pharmacokinetic parameter values were derived by standard noncompartmental methods using kinetica within the etoolbox software package (thermo fisher scientific, waltham, ma, usa). The digoxin ddi study assessed the following digoxin parameters: peak plasma concentration (cmax), trough observed concentration (cmin), tmax, and the area under the plasma concentration time curve over one dosing interval (auctau) for digoxin on days 10 and 20 . In addition, cmin for apixaban was assessed on days 1820 . In the atenolol ddi study, single - dose pharmacokinetic parameters assessed for apixaban and atenolol included cmax, tmax, the auc from time 0 to the time of last quantifiable concentration following a single dose (auc0t), the auc from time 0 extrapolated to infinite time following a single dose (aucinf), and the plasma t1/2 . Subjects were closely monitored throughout both studies for adverse events (aes), and were not discharged from the study until the investigator determined that all aes had resolved or were not of clinical significance . Data on aes were collected through constant monitoring, volunteering of information by the study participants, and daily questioning by the medical staff . Additionally, aes could be identified by investigator review of vital signs, ecgs, and laboratory and other data . All aes were coded and grouped by system organ class, preferred term, treatment, and severity according to the medical dictionary for regulatory activities criteria (version 8.1 for digoxin study and 10.0 for atenolol study). In the digoxin ddi study, all available data from subjects who received digoxin were included in the digoxin pk data set, but only subjects with sufficient data points to establish a complete pharmacokinetic profile from both treatments were included in the summary statistics and statistical analysis . The apixaban data set included all available data from subjects who received apixaban . In the atenolol ddi study, all available concentration all available derived pharmacokinetic parameter values were included in the pk data set and reported, but only subjects with an evaluable pharmacokinetic profile were included in the summary statistics and statistical analysis . In both studies, all available data for subjects who received study medication were included in the safety data sets . All statistical analyses were carried out using sas / stat version 8.2 (sas institute, cary, nc, usa). In the digoxin ddi study, summary statistics were tabulated for the digoxin pharmacokinetic parameters by treatment . A linear mixed - effect model with treatment as fixed effect and subject as repeated measures was fitted to the log - transformed pharmacokinetic parameters (cmax, auc) for use in estimation of effects and construction of confidence intervals (cis). An absence of an effect of apixaban on digoxin pharmacokinetic parameters would be concluded if the 90% cis for the ratios of the geometric means for digoxin cmax and auctau, with and without apixaban, were within the equivalence interval of 80%125% . If apixaban had no effect on the pk of digoxin, then data from 20 subjects would have provided 96% power to conclude absence of effect with respect to cmax and 94% power to conclude absence of effect with respect to auctau . These calculations used the approach described by diletti et al32 and assumed log - normal distributions of cmax and auc0t for digoxin with intrasubject coefficients of variation (cvs) of 18% and 20%, respectively, as reported by mant et al.33 twenty - four subjects were enrolled to allow for possible dropouts . In the atenolol ddi study, summary statistics were tabulated for apixaban and atenolol pharmacokinetic parameters by treatment . A linear mixed - effect model with treatment, period, and sequence as fixed effects and subject as repeated measures was fitted to the log - transformed pharmacokinetic parameters (cmax and auc) for use in estimation of effects and construction of cis . An absence of effect of one drug on the pk of the other drug would be concluded if the 90% cis for the ratios of geometric means for cmax and aucinf with and without the coadministered drug were within the clinically meaningful equivalence interval of 70%143% . This ci was selected because atenolol is a cardioselective beta - blocker that has limited metabolic drug interaction potential, is not a narrow therapeutic index drug, and is dosed to pharmacological effect.21 in addition, there is sufficiently understood clinical relevance of changes in exposure to apixaban . This approach has been used with other drugs without ddi liabilities.34,35 if atenolol 100 mg had no effect on the pk of apixaban, 12 subjects would have provided 94% power to conclude absence of effect with respect to cmax and 99% power to conclude absence of effect with respect to aucinf . These calculations used the approach described by diletti et al32 and assumed cmax and aucinf were log - normally distributed with intrasubject standard deviations (sds) of 0.23 for log(cmax) and 0.16 for log(aucinf) for apixaban, as derived from data reported by yamahira et al.30 if apixaban 10 mg had no effect on the pk of atenolol, 12 subjects would have provided 99% power to conclude absence of effect with respect to both cmax and aucinf . These calculations assumed cmax and aucinf were log - normally distributed with intrasubject cv of 19% for cmax and 13% for aucinf for atenolol, as derived from czendlik et al.36 fifteen subjects were enrolled to allow for possible dropouts, with no replacements allowed for discontinuations . The digoxin ddi study was an open - label, multidose, two - treatment, single - sequence study in healthy subjects (figure 1a). The atenolol ddi study was an open - label, single - dose, randomized, three - period, three - treatment, crossover study in healthy subjects (figure 1b). The protocols for both studies were approved by the new england institutional review board (wellesley, ma, usa) and the studies were conducted in accordance with title 21, part 56 code of federal regulations (cfr) and title 21, part 50 cfr, the principles of the declaration of helsinki, good clinical practice as defined by the international conference on harmonisation, and the ethical principles underlying the european union directive 2001/20/ec . Both studies recruited male and female subjects aged 1845 years with a body mass index of 1830 kg / m who were considered to be healthy according to medical history, physical examination, vital signs, 12-lead electrocardiogram (ecg) assessment, and clinical laboratory tests . Subjects underwent screening evaluations within a 21-day period prior to dosing to determine eligibility . Both trials excluded female subjects who were pregnant or nursing . The digoxin study excluded all women of childbearing potential; the atenolol ddi study allowed them to participate if they used accepted methods of contraception, excluding use of hormonal contraception, within 3 months of study start . In both studies, all subjects provided written informed consent prior to the initiation of any study - specific procedures . Subjects were excluded from the digoxin ddi study if they had relevant arrhythmias, unexplained syncope, abnormal renal function, or conditions that can cause electrolyte disorder . Subjects were excluded from the atenolol ddi study if they had a history of asthma, bronchitis or other significant pulmonary disease, or a history of hypotension . For both studies, exclusion criteria also included a history or evidence of abnormal bleeding or coagulation disorder and/or having a first - degree relative under 50 years of age with a history of abnormal bleeding or coagulation disorder, significant gastrointestinal (gi) disease (within 3 months) or gi surgery that could affect absorption of study drug, a history of significant drug allergies, or prior exposure to apixaban . Other exclusion criteria included exposure to any investigational drug within 4 weeks of study start, prescription drugs within 4 weeks of study start, or any over - the - counter medications or herbal preparations within 1 week (digoxin study) or 2 weeks (atenolol study) of study start . For both studies, subjects were admitted to the clinical facility on the day before study drug administration and remained there until clinical and laboratory safety data evaluations had been completed (day 22 for the digoxin ddi study and day 4 of period 3 for the atenolol ddi study). In the digoxin ddi study, subjects were assigned to receive a digoxin 0.25 mg tablet q6h on day 1 and a digoxin 0.25 mg tablet once daily on days 210, followed by an apixaban 20 mg tablet once daily and a digoxin 0.25 mg tablet once daily on days 1120 . The dose and dosing regimen for digoxin were selected to mimic a commonly administered digoxin dosing regimen in the clinical setting, and to achieve, but not exceed, the therapeutic concentration range for atrial fibrillation (~1.42.5 ng / ml).24,25 apixaban 20 mg once daily was selected to represent the highest dose evaluated in phase 2 clinical trials at the time the study was conducted.2628 digoxin 0.25 mg tablets were provided by the investigator and manufactured by glaxosmithkline (research triangle park, nc, usa), and apixaban 20 mg tablets were supplied and manufactured by bristol - myers squibb company (new brunswick, nj, usa). Subjects in the atenolol ddi study were randomly assigned to receive a single oral dose of apixaban 10 mg, atenolol 100 mg, or apixaban 10 mg + atenolol 100 mg on day 1 of period 1 . The alternative treatments were administered during periods 2 and 3 according to a randomization schedule . An atenolol dose of 100 mg was chosen for this study as representative of the upper end of the dose range.21,29 an apixaban dose of 10 mg was selected on the basis of safety data available at the time, and reflected exposures likely to be observed in patients, as the phase 3 clinical trials evaluated apixaban doses ranging from 2.5 to 10 mg twice daily for reducing the risk of stroke in nvaf, prophylaxis of thrombosis - related events following hip or knee replacement surgery, or treatment of dvt and pe.39,30 atenolol 100-mg tablets were supplied by the investigator and manufactured by astrazeneca pharmaceuticals lp (wilmington, de, usa), and apixaban 5-mg tablets were supplied and manufactured by bristol - myers squibb company . In both studies, blood samples for analysis were collected via indwelling catheter or by direct venipuncture . In the digoxin ddi study, blood samples for digoxin pk were collected at selected times over the 24-hour dosing interval on days 10 and 20 . Blood samples for digoxin trough concentrations were collected predose on days 8, 9, 10, 18, 19, and 20 . Blood samples for apixaban trough concentrations were collected predose on days 1820 . For apixaban and digoxin pharmacokinetic analysis, each 5 ml blood sample was gently inverted a few times immediately after collection to ensure complete mixing (with anticoagulant [sodium citrate] or the clot activator gel for apixaban and digoxin, respectively) in the serum - separating tube and was then placed on chipped ice . Samples for pharmacokinetic analysis of apixaban (within 15 minutes) and digoxin (after a 30- to 60-minute wait to allow for clotting) were centrifuged for 15 minutes at ~1500 g at room temperature to separate the plasma and serum, respectively . Separated plasma (apixaban) and serum (digoxin) were transferred to cryogenic vials, immediately stored at or below 20c, and sent for analysis (apixaban: intertek pharmaceutical services, el dorado, ca, usa; digoxin: advion biosciences, ithaca, ny, usa). For the atenolol ddi study, blood samples for pk assessment were collected both predose and over a period of 72 hours postdose for apixaban and through 48 hours postdose for atenolol . For atenolol and apixaban pk analyses, each 3.0 and 2.7 ml blood sample, respectively, was gently inverted a few times immediately after collection to ensure complete mixing with anticoagulant (k2edta for atenolol, 3.2% sodium citrate for apixaban) and then placed on chipped ice . Within 15 minutes, each blood sample was centrifuged for 15 minutes at ~1500 g at 4c to separate the plasma, and was then transferred to a cryogenic vial, immediately stored at or below 20c, and sent for analysis (apixaban: intertek pharmaceutical services; atenolol: vimta labs, andhra pradesh, india). In both studies, the serum (digoxin) and plasma (atenolol and apixaban) samples were analyzed using validated liquid chromatography mass spectrometry / mass spectrometry (lc / ms / ms) methods.31 the between - run and within - run variabilities for digoxin in serum quality - control samples were 4.6% and 8.0%, respectively, with deviations from nominal concentration of within 3.3% . The between - run and within - run variabilities for atenolol in plasma quality - control samples were 6.3% and 8.6%, respectively, with deviations from nominal concentration of within 8.4% (data on file, bms, 2008). The lower limit of quantification is 0.1 and 1.0 ng / ml for digoxin and atenolol, respectively . Individual subject pharmacokinetic parameter values were derived by standard noncompartmental methods using kinetica within the etoolbox software package (thermo fisher scientific, waltham, ma, usa). The digoxin ddi study assessed the following digoxin parameters: peak plasma concentration (cmax), trough observed concentration (cmin), tmax, and the area under the plasma concentration time curve over one dosing interval (auctau) for digoxin on days 10 and 20 . In addition, cmin for apixaban was assessed on days 1820 . In the atenolol ddi study, single - dose pharmacokinetic parameters assessed for apixaban and atenolol included cmax, tmax, the auc from time 0 to the time of last quantifiable concentration following a single dose (auc0t), the auc from time 0 extrapolated to infinite time following a single dose (aucinf), and the plasma t1/2 . Subjects were closely monitored throughout both studies for adverse events (aes), and were not discharged from the study until the investigator determined that all aes had resolved or were not of clinical significance . Data on aes were collected through constant monitoring, volunteering of information by the study participants, and daily questioning by the medical staff . Additionally, aes could be identified by investigator review of vital signs, ecgs, and laboratory and other data . All aes were coded and grouped by system organ class, preferred term, treatment, and severity according to the medical dictionary for regulatory activities criteria (version 8.1 for digoxin study and 10.0 for atenolol study). In the digoxin ddi study, all available data from subjects who received digoxin were included in the digoxin pk data set, but only subjects with sufficient data points to establish a complete pharmacokinetic profile from both treatments were included in the summary statistics and statistical analysis . The apixaban data set included all available data from subjects who received apixaban . In the atenolol ddi study, all available concentration all available derived pharmacokinetic parameter values were included in the pk data set and reported, but only subjects with an evaluable pharmacokinetic profile were included in the summary statistics and statistical analysis . In both studies, all available data for subjects who received study medication were included in the safety data sets . All statistical analyses were carried out using sas / stat version 8.2 (sas institute, cary, nc, usa). In the digoxin ddi study, cmin for apixaban and digoxin were summarized by study day . A linear mixed - effect model with treatment as fixed effect and subject as repeated measures was fitted to the log - transformed pharmacokinetic parameters (cmax, auc) for use in estimation of effects and construction of confidence intervals (cis). An absence of an effect of apixaban on digoxin pharmacokinetic parameters would be concluded if the 90% cis for the ratios of the geometric means for digoxin cmax and auctau, with and without apixaban, were within the equivalence interval of 80%125% . If apixaban had no effect on the pk of digoxin, then data from 20 subjects would have provided 96% power to conclude absence of effect with respect to cmax and 94% power to conclude absence of effect with respect to auctau . These calculations used the approach described by diletti et al32 and assumed log - normal distributions of cmax and auc0t for digoxin with intrasubject coefficients of variation (cvs) of 18% and 20%, respectively, as reported by mant et al.33 twenty - four subjects were enrolled to allow for possible dropouts . In the atenolol ddi study, summary statistics were tabulated for apixaban and atenolol pharmacokinetic parameters by treatment . A linear mixed - effect model with treatment, period, and sequence as fixed effects and subject as repeated measures was fitted to the log - transformed pharmacokinetic parameters (cmax and auc) for use in estimation of effects and construction of cis . An absence of effect of one drug on the pk of the other drug would be concluded if the 90% cis for the ratios of geometric means for cmax and aucinf with and without the coadministered drug were within the clinically meaningful equivalence interval of 70%143% . This ci was selected because atenolol is a cardioselective beta - blocker that has limited metabolic drug interaction potential, is not a narrow therapeutic index drug, and is dosed to pharmacological effect.21 in addition, there is sufficiently understood clinical relevance of changes in exposure to apixaban . This approach has been used with other drugs without ddi liabilities.34,35 if atenolol 100 mg had no effect on the pk of apixaban, 12 subjects would have provided 94% power to conclude absence of effect with respect to cmax and 99% power to conclude absence of effect with respect to aucinf . These calculations used the approach described by diletti et al32 and assumed cmax and aucinf were log - normally distributed with intrasubject standard deviations (sds) of 0.23 for log(cmax) and 0.16 for log(aucinf) for apixaban, as derived from data reported by yamahira et al.30 if apixaban 10 mg had no effect on the pk of atenolol, 12 subjects would have provided 99% power to conclude absence of effect with respect to both cmax and aucinf . These calculations assumed cmax and aucinf were log - normally distributed with intrasubject cv of 19% for cmax and 13% for aucinf for atenolol, as derived from czendlik et al.36 fifteen subjects were enrolled to allow for possible dropouts, with no replacements allowed for discontinuations . In the digoxin ddi study, a total of 24 healthy male subjects were enrolled and received treatment a (digoxin 0.25 mg), and 23 of those subjects also received treatment b (digoxin 0.25 mg + apixaban 20 mg). One subject discontinued after day 8 of treatment a because of an ae of elevated alanine transaminase (alt) and another received study drug through day 19 and withdrew consent on day 20 . A total of 15 healthy male and female subjects were randomized and received treatment in the atenolol ddi study . Of the 15 treated subjects, 14 completed the study and one discontinued after receiving apixaban alone and apixaban plus atenolol, owing to an ae (cellulitis, considered unrelated to study medication). The mean concentration versus time profiles of digoxin were similar when administered alone or with apixaban (figure 2) and the 90% cis for the ratios of geometric means of digoxin cmax and auctau (versus without apixaban) were within the prespecified equivalence criteria of 80%125% (table 2), indicating the absence of an interaction . The mean sd daily cmin values of digoxin were similar during treatment with digoxin 0.25 mg (ranging from 0.52 [0.20] to 0.57 ng / ml [0.19]) and digoxin 0.25 mg plus apixaban 20 mg (ranging from 0.46 [0.17] to 0.53 ng / ml [0.20]), indicating that digoxin was at steady state in both treatment periods . The mean (sd) cmin values of apixaban on days 18, 19, and 20 were similar (ranging from 49.0 [19.5] to 49.6 ng / ml [23.3]), demonstrating that apixaban was at steady state during the pk assessment . The mean concentration time profiles of apixaban administered alone and with atenolol are shown in figure 3a and summary statistics for apixaban pharmacokinetic parameters in the atenolol ddi study are shown in table 3 . Apixaban cmax, auc0t, and aucinf values decreased by 18%, 15%, and 15%, respectively, when apixaban was coadministered with atenolol . Apixaban tmax and t1/2 values were similar following administration alone and with atenolol (table 3). The 90% cis for the ratios of geometric means of apixaban (versus without atenolol) were within the prespecified equivalence criteria of 70%143% . The mean concentration versus time profiles of atenolol administered alone and with apixaban are shown in figure 3b and summary statistics for atenolol pharmacokinetic parameters are also shown in table 3 . No effect of apixaban on atenolol pk was observed, and the 90% cis for the ratios of geometric means of atenolol (versus without apixaban) were within the prespecified equivalence criteria of 70%143% . No deaths, serious aes, or major bleeding - related aes were reported during either study . All aes reported in the digoxin ddi study were mild to moderate in intensity and resolved without treatment . The most frequently reported treatment - emergent aes were an increase in alt and ocular or scleral hyperemia, each reported in three subjects, and dizziness and pharyngolaryngeal pain, each reported in two subjects . Elevated alt occurred during digoxin treatment and prior to the administration of apixaban in two subjects, one of whom discontinued the study before the start of apixaban treatment . A single bleeding - related ae of gingival bleeding occurred in one subject on day 18, and resolved after 4 days without requiring interruption of study drug . The event was considered to be mild in intensity and possibly related to study drug by the investigator . This event was considered to be mild in intensity and was considered unlikely to be related to study medication . Few aes (five for apixaban and four for apixaban + atenolol) occurred during the atenolol ddi study, none of which were bleeding - related, with no appreciable difference between treatments . One subject discontinued due to moderate cellulitis that began on day 4 after administration of a single dose of apixaban + atenolol; this ae was considered unrelated to study treatment . In the digoxin ddi study, a total of 24 healthy male subjects were enrolled and received treatment a (digoxin 0.25 mg), and 23 of those subjects also received treatment b (digoxin 0.25 mg + apixaban 20 mg). One subject discontinued after day 8 of treatment a because of an ae of elevated alanine transaminase (alt) and another received study drug through day 19 and withdrew consent on day 20 . A total of 15 healthy male and female subjects were randomized and received treatment in the atenolol ddi study . Of the 15 treated subjects, 14 completed the study and one discontinued after receiving apixaban alone and apixaban plus atenolol, owing to an ae (cellulitis, considered unrelated to study medication). The mean concentration versus time profiles of digoxin were similar when administered alone or with apixaban (figure 2) and the 90% cis for the ratios of geometric means of digoxin cmax and auctau (versus without apixaban) were within the prespecified equivalence criteria of 80%125% (table 2), indicating the absence of an interaction . The mean sd daily cmin values of digoxin were similar during treatment with digoxin 0.25 mg (ranging from 0.52 [0.20] to 0.57 ng / ml [0.19]) and digoxin 0.25 mg plus apixaban 20 mg (ranging from 0.46 [0.17] to 0.53 ng / ml [0.20]), indicating that digoxin was at steady state in both treatment periods . The mean (sd) cmin values of apixaban on days 18, 19, and 20 were similar (ranging from 49.0 [19.5] to 49.6 ng / ml [23.3]), demonstrating that apixaban was at steady state during the pk assessment . Time profiles of apixaban administered alone and with atenolol are shown in figure 3a and summary statistics for apixaban pharmacokinetic parameters in the atenolol ddi study are shown in table 3 . Apixaban cmax, auc0t, and aucinf values decreased by 18%, 15%, and 15%, respectively, when apixaban was coadministered with atenolol . Apixaban tmax and t1/2 values were similar following administration alone and with atenolol (table 3). The 90% cis for the ratios of geometric means of apixaban (versus without atenolol) were within the prespecified equivalence criteria of 70%143% . The mean concentration versus time profiles of atenolol administered alone and with apixaban are shown in figure 3b and summary statistics for atenolol pharmacokinetic parameters are also shown in table 3 . No effect of apixaban on atenolol pk was observed, and the 90% cis for the ratios of geometric means of atenolol (versus without apixaban) were within the prespecified equivalence criteria of 70%143% . No deaths, serious aes, or major bleeding - related aes were reported during either study . All aes reported in the digoxin ddi study were mild to moderate in intensity and resolved without treatment . The most frequently reported treatment - emergent aes were an increase in alt and ocular or scleral hyperemia, each reported in three subjects, and dizziness and pharyngolaryngeal pain, each reported in two subjects . Elevated alt occurred during digoxin treatment and prior to the administration of apixaban in two subjects, one of whom discontinued the study before the start of apixaban treatment . A single bleeding - related ae of gingival bleeding occurred in one subject on day 18, and resolved after 4 days without requiring interruption of study drug . The event was considered to be mild in intensity and possibly related to study drug by the investigator . This event was considered to be mild in intensity and was considered unlikely to be related to study medication . Few aes (five for apixaban and four for apixaban + atenolol) occurred during the atenolol ddi study, none of which were bleeding - related, with no appreciable difference between treatments . One subject discontinued due to moderate cellulitis that began on day 4 after administration of a single dose of apixaban + atenolol; this ae was considered unrelated to study treatment . The two ddi studies reported here investigated potential pharmacokinetic interactions between apixaban and digoxin and apixaban and atenolol in healthy subjects . The results of both studies confirmed the hypothesis of little potential for a ddi between apixaban and either digoxin or atenolol.14,17,19,20 these studies are in agreement with previous studies indicating a low potential for apixaban to interact with concomitant medications.12,14 in the digoxin ddi study, administration of multidose apixaban 20 mg once daily did not affect the pk of multidose digoxin . With a multidose regimen, the digoxin ddi study was designed to evaluate the potential for a ddi at steady - state levels . Both apixaban and digoxin reached steady state (based on cmin values) by the time of the individual pharmacokinetic evaluations . The achievement of apixaban steady state is consistent with previous observations.10 the 90% cis for digoxin cmax and auctau geometric mean ratios were within the equivalence interval of 80%125%, indicating absence of an effect of apixaban on digoxin pk . The findings provide support for the low potential for apixaban to affect the pk of other p - gp substrates, as digoxin is a commonly used p - gp probe substrate.20 it should be noted that the apixaban dose in this study (20 mg) is expected to result in steady - state exposure (i.e., auctau) that is ~1.52 times higher than that achieved in most patients treated with the highest approved apixaban dose, 10 mg twice daily, for the treatment of venous thromboembolism (vte), which provides further assurance that apixaban - mediated interactions with other p - gp substrates (eg, quinidine) are unlikely . There was no impact of apixaban on the pk of atenolol observed in this study . The atenolol tmax was slightly shortened from 3 to 2 hours; however, the point estimates for atenolol cmax and auc ratios with and without apixaban coadministration are close to 1 (0.981.00), with the 90% ci for cmax and aucinf ratios within the prespecified no - effect interval of 70%143% . It is even more important to note that the cis observed for all of the exposure parameter point estimates fell between 0.84 and 1.13, and would have also met the usual and narrower typical bioequivalence criteria of 80%125% . Atenolol pk is reported to be impacted by fruit juices, most likely due to atenolol being a substrate of transporters such as oatp2b1.37,38 based on the results of this study, apixaban does not modulate transporters for atenolol nor affect its gi absorption . Although coadministration of apixaban and atenolol did result in a small decrease in apixaban exposure (18% decrease in cmax and 15% decrease in aucinf), the 90% cis for the point estimates fall within the prespecified no - effect criteria . Based on our review of the literature and product label, atenolol does not appear to be a modulator of cyp enzymes or transporters, and has limited potential to be a perpetrator of pharmacokinetic drug interactions . This decrease in apixaban exposure is similar to other factors that impact apixaban exposure, such as body weight, for which subjects 120 kg have 23% lower aucinf and 31% lower cmax.39 this modest decrease in exposure was deemed not clinically relevant, and the dose of apixaban was not adjusted based on body weight alone.2 in addition, in the exposure response prediction for vte prevention following orthopedic surgery, an 18% decrease in apixaban exposure resulted in a hazard ratio for bleeding of 0.97.40 therefore, the decrease in apixaban exposure in the presence of atenolol is not considered clinically meaningful.2 the doses used in the atenolol study represent the high end of the recommended dose range for both atenolol (100 mg) and apixaban (10 mg). Thus, it is expected that concomitant administration of apixaban and atenolol at a dose of 100 mg or lower is unlikely to result in a clinically relevant pharmacokinetic drug interaction . The results of these studies indicate that there is no reason to exclude digoxin or atenolol as concomitant medication for patients who are treated with apixaban . Apixaban is 87% protein - bound, while atenolol and digoxin are minimally protein - bound (25% bound).2,19,21 these differences in protein - binding properties eliminated concerns about either drug displacing the coadministered drug from protein - binding and affecting unbound levels of coadministered drug . Apixaban has multiple pathways of metabolism and elimination, and does not interfere with the corresponding elimination pathways of atenolol or digoxin . The single bleeding - related ae of gingival bleeding in the digoxin study does not signal a ddi effect because coadministration of digoxin resulted in an overall decrease in apixaban exposure . These studies did have a few limitations, including a small population composed of healthy subjects and the controlled clinical settings . In the real world, apixaban had no effect on the pk of digoxin and there was no clinically relevant interaction between apixaban and atenolol . Based on these results, there are no restrictions on apixaban coadministration with either digoxin or atenolol . Coadministration of digoxin or atenolol with apixaban in healthy subjects was also generally well tolerated.
|
Toxoplasma gondii is an obligate intracellular parasite that actively invades host cells through a sequential secretion of proteins from apicomplexa - specific secretory organelles, namely, micronemes and rhoptries as well as by the participation of the parasite motility based on its subpellicular cytoskeleton . The highly replicative and invasive form of toxoplasma, the tachyzoite, proliferates within an intracellular compartment named the parasitophorous vacuole (pv). The pv delimiting membrane (pvm) is formed at the time of invasion from both the host cell membrane components and parasite - secreted products [3, 4]. Once installed within the host cell, the pv is rapidly encaged by host cell intermediate filaments and microtubules, whilst the pvm associates with host cell mitochondria and endoplasmic reticulum [68]. Studies showed the formation of host - microtubules - based invaginations of the pvm named host sequestering tubulo - structures or hosts that serve as conduits for nutrient acquisition from the host cytoplasm to the pv lumen . Apart from rhoptry proteins, the pvm is also decorated with several proteins secreted from a third type of apicomplexa - specific secretory organelles, the dense granules, which contain the gra proteins . Observation of infected cells by electron microscopy showed that a membranous nanotubular network (mnn) of 4060 nm in diameter assembles at the invaginated posterior end of the parasite during the first hour following invasion and further extends into the pv space in order to connect with the pvm . Immunoelectron microscopy analysis showed that the mnn has a stable association with several gra proteins including gra2, gra4, gra6, and gra9 and showed that gra2 contributes to the formation of a multiprotein complex within the mnn . Transmission electron microscopy (tem) analysis in thin sections of embedded infected host cells with gra2 toxoplasma knock - out mutant showed that deletion of the corresponding gene leads to complete disappearance of the mnn without altering parasite in vitro proliferation [14, 15]. Once tachyzoites have established metabolic connections with the host cell by means of the mnn, the hosts, and the pvm, they begin to divide asexually mainly by endodiogeny, a process that is characterized by the synchronous assembling of two daughter parasites within each mother cell . Once two sets of intracellular organelles have been assembled within the mother cell, daughter cells emerge from the mother, leaving remnants of the mother cell at their posterior end . These apparent remnants have been referred to as the residual body (rb) of division . After the third division, to date there is not data about the fine structure of the rb or its function . Analysis of the intravacuolar arrangement of tachyzoites during endodiogeny has been successfully achieved by transmission electron microscopy (tem) [15, 18, 19]. By using a method proposed by tanaka for scanning electron microscopy (sem) in which apical plasma membrane is removed thus preserving the integrity and spatial distribution of intracellular compartments and organelles [15, 18, 19], it was possible to know the relationship between the intravacuolar organization of proliferating tachyzoites and the mmn [15, 18, 19]. In the present study we characterized the intravacuolar organization of tachyzoites of the rh strain of t. gondii in rosettes during proliferation in an attempt to better characterize origin, structure, and function of the rb . We additionally determined the contribution of gra2 protein in the intravacuolar organization of tachyzoites by studying gra2 knock - out mutant - infected cells . Specific reagents for electron microscopy were from polysciences (warrington, pa) unless otherwise indicated . Balb / c mice used for parasite infections were maintained in an animal facility with regulated environmental conditions in terms of temperature, humidity, and filtered air . Animals were maintained according to the country official norm nom-062-zoo-1999 (http://www.sagarpa.gob.mx/dgg/nom/062zoo.pdf) for the production, care, and use of laboratory animals (mxico). Madin - darby canine kidney epithelial cells (mdck, atcc - ccl 34) were used as host cells for both parasite invasion and proliferation . Mdck cells were maintained in dulbecco minimum essential medium (dmem) (gibco, usa), supplemented with 10% fetal calf serum (fcs, equitech - bio, usa), under a 5% co2 atmosphere, at 37c . Parasites of the rh strain (wild type) were maintained by intraperitoneal passages in female balb / c mice . After cervical dislocation, tachyzoites were harvested from intraperitoneal exudates, washed in phosphate - buffered saline (pbs, 138 mm nacl, 2.7 mm kcl, 8.1 mm na2hpo4, 1.1 mm kh2po4, and ph 7.4), and filtered through 3 m pore polycarbonate membranes (millipore, bedford, mass). The gra2-hxgprt knock - out mutant constructed in the rh strain background and was maintained in mdck cells . Prior to each experiment, cells were lysed and parasites were harvested, rinsed in pbs, counted, and suspended in appropriate medium . Mdck host cells were grown on sterile coverslips in dmem supplemented with 10% fcs for 24 h to reach between 8090% confluency . Cells were exposed to parasites at the ratio of 5: 1 parasites per host cell, incubated for 2 h and washed with pbs to discard extracellular parasites . Infected mdck cells were maintained in dmem with 10% fetal calf serum under a 5% co2 atmosphere at 37c and at desired times . Mdck cells infected for 24 h were fixed in 3.7% paraformaldehyde for 20 min, permeabilized for 10 min in 0.1% triton x-100, blocked in 0.5% bsa, and incubated for 2 h with the following primary antibodies diluted in pbs: monoclonal antibody (mab) tg05.54 anti - sag1, mab tg17.43 anti - gra1, mab tg17.179 anti - gra2, and rabbit serum anti - gra6, each at the dilution of 1: 500, or mab t5.2a3 anti - rop1, mab t34a5 anti - rop2, each at the dilution of 1: 25 (the mabs anti - rop proteins were provided by j. f. dubremetz, cnrs umr 5539, universit montpellier ii, france, and the rabbit serum anti - gra6 was obtained from l. d. sibley, department of molecular microbiology, washington school of medicine, saint - louis, mo). Cells were rinsed in pbs, incubated for 1 h with goat anti - mouse igg (h+l) or with goat anti - rabbit igg (h+l), both coupled to alexa fluor 488 (molecular probes, usa). To detect nuclei in tachyzoites organized in rosettes, cells were incubated for 1 h with 10 g / ml of the fluorescent stain 46-diamidino-2-phenylindole specific for double - stranded dna (dapi, sigma - aldrich co., mexico). Coverslips were mounted on glass slides in vectashield mounting medium (vector laboratories, uk) and analyzed with an axioscope ii fluorescence microscope coupled to an axiocam ii rc digital camera (carl zeiss). For tem, mdck cells infected for 24 h were fixed for 1 h in 2.5% glutaraldehyde . Cell monolayers were scraped off, rinsed in pbs and fixed for 1 h in 1% oso4 at 4c, rinsed, gradually dehydrated in ethanol, and finally embedded in spurr's resin . Thin sections were obtained with an ultracut e ultramicrotome (reichert jung, austria) and stained with uranyl acetate and lead citrate . Copper grids with the sections were examined in a jeol 1400 transmission electron microscope at 80 kev (jeol ltd, japan). Digital images were obtained and processed with adobe photoshop software (usa). For sem using the tanaka method, mdck cells were infected for 1, 6, 12, and 24 h and then processed according to travier et al . . Briefly, at selected times, infected monolayers were fixed with 2% glutaraldehyde and 1% oso4 in pbs, ethanol dehydrated, critical point dried in co2 atmosphere in a samdry-780a apparatus (tousimis research, usa), and gold coated in a denton vacuum desk ii (inxs . Coverslips containing the infected monolayers were attached to sem aluminum holders, and the apical plasma membrane of host cells was removed by an adhesive tape . Both the treated coverslips and the adhesive tapes recovered from the rod were gold coated and analyzed using a sem jeol 65lv (jeol, ltd, japan). Coverslips with mdck cells infected for 24 h were mounted within observation chambers and then were exposed to 0.1 m ionomycin (in 0.001% dmso in pbs) to induce parasite egress . Exteriorization was recorded under time lapse mode in a phase contrast microscope using an axiocam rc digital camera (carl zeiss) and the axiovision software . Three - dimensional model of a rosette was built using autocad software version 2007, and it was based on the morphological properties of intravacuolar tachyzoites micrographed by sem and on the spatial distribution of the tachyzoites nuclei stained with the dapi dye . The front isometric view of the tachyzoite, providing the width and height dimensions, was divided in 26 longitudinal sections of 190 nm, each with a total length of 5.14 m . The top isometric view provided the width and depth dimensions of each cross - section . Both parameters were taken in consideration to create the geometry of the parasite, consisting of 26 planar section curves . Sweeping the planar sections along a defined spine designed to be the main geometry axis, allowed the creation of a complex multisection solid . Each 3d tachyzoite was adapted in specific position, around a 3d rb model, according to the interparasite distance observed in sem micrographs of rosettes in order to construct the respective 3d digital model . By detaching the plasma membrane of infected cells, the spatial distribution of the intravacuolar tachyzoites was exposed further showing their relationship with the mnn and the rb under the high resolution of an sem (figure 1(b)). After 24 hours of proliferation, most of the tachyzoites were organized within the vacuole in rosettes around an rb located in the center of the structure (figures 1(a) and 1(b), arrow). Tachyzoites were surrounded by the mnn and tightly associated through their posterior end to the rb (figure 1(b)). During the detaching process, most of mnn and vacuolar components remained associated to the rosette while detached apical membrane remained free of parasites or of any mnn component (figure 1(c)). In sem images, the rb was clearly identified as a round structure located in the center of the rosette with diameter of 1.43 m 1.0 (measured in 11 rosettes analyzed) that was linked to the posterior ends of parasites in proliferation (figure 2(a), rectangle). A magnification of the interaction zone between the rb and the posterior end of the tachyzoites showed a close association between both membrane areas (figure 2(b)). In order to further examine the fine structure of the rb and its relationship with the daughter tachyzoites in the rosette a membrane was found limiting the periphery of the rb (figure 2(c), insets (a), (b)). At the interior of the rb were identified several organelles characteristics of tachyzoites such as dense granules, rhoptries, nuclear fragments, mitochondria, and golgi between others, suggesting their origin from components that were trapped in the rb during the division of the tachyzoites (figure 2(c)). The structural analysis of the interaction zone showed a membrane continuity between the membrane of the posterior end of the tachyzoites and the rb membrane, with the presence of an apparent communication between the cytoplasm of both the rb and the tachyzoites (figures 2(c)2(e), white arrows). In regions of the rb membrane not involved in the intermembrane interaction, we detected a typical three - membrane pellicle (figure 2(c); inset (b)). According to the magnification shown in figure 2(e), the polar posterior ring (indicated by double arrows) appears to contribute to stabilizing the intermembrane junction . Polar posterior ring of tachyzoites can be clearly identified by a submembrane electron dense zone at the posterior end of the tachyzoites . Identification of some proteins present in the rb was made by immunofluorescence with antibodies against proteins from secretory organelles such as dense granules and rhoptries . Dense granule proteins gra1, gra2, and gra6 that are normally secreted in the pv were detected in the rb (figure 3, arrows). Interestingly, gra5, a protein that has been described associated with the pvm [22, 25], was also found in the rb . During the focusing of the tachyzoites in the rosettes by phase contrast microscopy, the definition of the rb was lost showing an apparent absence of the structure . Antibodies against sag1, the parasite major surface protein, labelled the plasma membrane of proliferating parasites but not the rb membrane (figure 3, arrow in sag1); probably the availability of the rb membrane was limited by the binding of the tachyzoites . Proteins from rhoptries rop1 and rop2 were detected only in the apical end of parasites but not in the rb indicating the specificity of the staining (figure 3). Dna staining with dapi showed the presence of the nuclei of tachyzoites and only a slight rb labeling (figure 3). In the particular case of dapi, we had to focus on the rb because the signal we were looking for was precisely within the rb, that is why in the image of phase contrast microscopy the rb appeared as a clear and well - defined structure . In order to characterize the formation of the rb during endodiogeny, infected mdck cells were cultured for 1, 6, 12, and 24 h to obtain pvs containing 1, 2, 4, 8, and 16 parasites, and after 1 h of invasion, the mnn was detected mainly concentrated on the incurved face of recently invaded parasites (figure 4(a), forming a web that kept the first parasite attached to the pvm (arrowhead). Parasites that resulted from the first division at 6 h after invasion (figure 4(b)) remained connected with the pvm via extensions of the mnn located at the parasite posterior ends (arrow) as well as on their incurved face (arrowhead). In addition, we detected a residual body that kept the two parasites united by their posterior ends (asterisk). At twelve hours after invasion, the rb acquired a spherical shape while the network that surrounded the parasites favoured interparasitic cohesion (figure 4(c)). At 24 h of proliferation of parasites, the rb was found in the centroid of the rosette with the presence of several parasitic interconnections (figure 4(d), arrow). There were also connections between parasites and the pvm (arrowheads). To study whether the rb contributes to the efficient use of intravacuolar space by the proliferating parasites, tachyzoites organized in rosettes were stained with the fluorescent dye for nuclei, dapi, and serial optical sections obtained in a confocal microscope (figure 5(a)). Serial images showed that the nuclei and thus parasites are arranged in two adjacent planes which contain each 8 parasites (figure 5(a), insets 3 and 8 resp . ). Parasites in both planes showed an interspersed distribution; however, in a certain optical section (inset 7) all nuclei were visible although with clear differences in their respective confocal planes (see inset 7, figure 5(a)). By imaging tachyzoites and rosettes by sem and their nuclei by confocal microscopy, we could develop a three - dimensional digital model of the rosette (figures 1 and 5(b), and inset 1). The exact location of the parasites in the two planes was deduced from the images of the nuclei obtained by confocal microscopy (figure 5(a)), resulting in the three - dimensional arrangement of the rosette shown in figure 5(b) (inset 2). According to the 3d model of the rosette, each parasite is pointing outward in an organization in the form of wagon wheel in order to define possible externalization individual routes . The gra2-hxgprt strain (gra2) is an rh mutant knocked out for expression of gra2 that has been previously characterized to lack of the typical mnn [14, 15]. We used the gra2 strain in order to determine if the lack of expression of gra2 protein could modify the intravacuolar organization of the tachyzoites and the structure of the rb . Firstly, the absence of protein gra2 did not alter the invasive capacity finding that approximately 40% of the cells were infected with both the rh strain as the gra2 strain (data not shown). To follow the intravacuolar development of the tachyzoites, cells were invaded for 1, 6, 12 and 24 h and processed for sem as described in figure 4 . In all the intravacuolar development stages, typical rbs were not detected, and the mnn was observed as an abundant amorphous material covering the parasites with only few fibers interconnecting parasites and attaching them to the pvm (figures 7(a) and 7(b), arrowhead). An interesting observation was to find gra2 strain at 24 h organized in clusters of 2 to 8 parasites in the same pv but not in the typical rosette arrangement (figures 6(e) and 6(f), and 7). In most cases, a clear lack of interparasite cohesion was evidenced by the parasites separation even in the cluster distribution (e). Parasites were found attached to the rb through fibrous tubules leaving spacing between the body and the posterior end (figures 6(e) and 6(f)). It is possible that the structural modifications of the rb and the type of interaction with the tachyzoites altered somehow the intravacuolar organization, therefore rosettes were not formed . To determine the involvement of rb in the externalization of the tachyzoites from infected cells, mdck cells infected with rh or gra2 strains were exposed to calcium ionophore ionomycin to induce the externalization, and this was recorded in real time by time - lapse video microscopy . Parasites of the rh strain left the pv and the host cell after the ionomycin stimulus by propelling themselves in a synchronous and in a centrifugal way along individual routes to reach the extracellular medium as fast as 1.3 0.5 seconds (figure 8(a), inset 1.03, arrows). The trigger for the output started with a vibratory movement of the tachyzoites followed by twirling and sliding movements that were oriented to transverse the pvm followed by the plasma membrane . During externalization, there were two constrictions of the parasites, the first when they traversed the vacuolar membrane and the second when they passed through the cell membrane . The rb after the exteriorization remained inside the host cell (figure 8(a), 1.23, asterisk). The externalization of the gra2 strain was more erratic although very similar to the rh strain (1.6 0.7 seconds). Although many parasites left the cell, several of them could not do it being trapped in the nucleus or the cytoplasm . Apparently, differences in egress time were not observed; however, one event important to remark is the fact that some parasites of dgra2 mutant even if leave of parasitophorous vacuole are unable to leave their cells staying into of cytoplasm . During the development of toxoplasma within the pv, proteins secreted from dense granules contribute to the formation of new membranes, including those that form the pv and the mnn, but their function is poorly known in part due to the few experimental approaches available to isolate them and to gain access to the pv [1, 26]. Several technical procedures have been used to examine the intravacuolar arrangements of toxoplasma including tem analysis on thin sections and integration of serial optical sections obtained by confocal microscopy, although most of them have limitations in terms of image interpretation, resolution, or technical difficulty . One possibility to examine the inner structure of a cell and its organelles is by using the technique previously developed by tanaka and recently used in the study of toxoplasma [15, 19]. In this method, the plasma membrane of cells previously processed for sem is mechanically detached, exposing the spatial distribution of the intracellular organelles . By applying the sem technique in infected cells, we were able to study the arrangement of the intravacuolar tachyzoites in rosettes (figure 1). According to our results, the rosette may represent a type of organization adopted by parasites to optimize the cytoplasmic space available for proliferation in cells with different phenotypes such as neurons, epithelial cells, muscle cells . During endodiogeny, the favored type of tachyzoite division, the mother parasite forms two new dome - shaped conoids, each with an associated inner membrane complex and a set of microtubules and secretory organelles . Most of the mother cell cytoplasm and organelles are incorporated into the two daughter cells . Although directly linked to the endodiogeny process, the rb is a structure that has been reported but poorly characterized; even more, it has been suggested that the rb is degraded into the vp during posterior endodiogeny cycles . The rb has also been considered as a product of stress condition, and it has been assumed that it is generated by treatments that affect an adequate assembly of the daughter cells . The rb is more easily observed when artificially enlarged as the result of ectopic protein expression or treatment with several drugs that affect the cytoskeleton [29, 30]. Presence of large rb (higher to 5 m) containing mitochondria and dense granules observed after exposure to actin - modifying drugs delayed or inhibited the parasite egress . In parasites overexpressing myosin, the rb observed was lacking organelles or dna . In our study and under normal culture conditions and in absence of drugs, tachyzoites of rh strain the rb is an interesting structure that has been considered as a waste material without a defined function [16, 29, 31, 32]. Here, we showed that it is a natural structure located in the centroid of the rosette . It was detected from the first cell division in pv containing two tachyzoites and appeared simultaneously to the formation of the mnn . We consider that the rb may contain remnants released from the rear during cell division, but finding the parasites stably bound to it in the rosettes is very possible that the residual body fulfills a role as an organizer system in the rosette formation . Although variations in the size of the rb were detected, there is no evidence to suggest that large or small residual bodies represent a defect in the process of endodiogeny . The mnn has been considered as a tubule connection system between parasites and the pvm for exchange of nutrients and/or molecules between the host cell and the parasite . The mnn consisted in tubules that keep connections between each daughter tachyzoites keeping them in close proximity to the pv . Data obtained with rh and gra2 strains indicate that the mnn is an important structure involved in the maintenance of internal parasitic cohesion within the pv and that, somehow favors replicative cycle synchronization . Absence of the gra2 protein in the gra2 strain resulted in a complete loss of the mnn [14, 15] with the presence of atypical rbs . Gra2 disruption resulted in the loss of parasite division synchrony, as observed by phase contrast microscopy in live cells and by sem (figures 6 and 7). These data suggest that the rb as well as the mnn favor the parasitic cohesion during the intravacuolar division and the parasitic arrangement in rosettes: the structural complex of mnn - rb and its extensions to the pvm would anchor the recently internalized parasites to the pvm to immobilize them as an initial necessary step to allow the synchronized proliferation of the parasites . According to the sem analysis in numerous samples, we proposed that formation of rb during organization of the rosette could involve the following steps (figure 9); (i) a first parasite starts the endodiogeny process; (ii) at the same time, mnn components are secreted through the posterior end of the parasite, followed by an apparent pinching event at the posterior end with a trapping of the pellicle and cytoplasm components into a nascent rb that remains linked to the membrane of the posterior end of the parasite; (iii v) during the next replication cycles, the rb increases its size and the amount of stored material keeping all the time the daughter tachyzoites attached through their posterior end to the rb membrane . Maintenance of the interparasite space attached to the rb membrane determines the distribution of the parasites in a rosette organization (vi). To date, there are no reports about the presence of rbs in infected animal tissues with toxoplasma . Most reports about the intravacuolar organization of the parasite within infected animal tissues correspond to the presence of tissue cysts in animal models of toxoplasmosis . Of course, the study of the presence of rb's in the infected animal could be interesting and validate that our observations done in vitro are also occurring in vivo . Although we studied the proliferation of tachyzoites in epithelial cells in vitro, under physiological conditions, tachyzoites or bradyzoites also come into contact with epithelial cells as enterocytes or endothelial cells from the vascular tissue, so it is possible that in vivo toxoplasma can be organized in rosettes with a central rb . Our study showed that (1) the rb is a spheroid structure occurring naturally during endodiogeny of rh strain (2) is possible to observe this structure as soon as the first parasite division takes place, and it is formed simultaneously to the organization of the mnn; (3) it is limited by a membrane and it is probably formed from the first division by a pinching event of the posterior end membrane and through secretion of parasite's components; (4) during endodiogeny, daughter, tachyzoites remain attached to the rb membrane showing a continuity between the rb and tachyzoites cytoplasm; (5) while the mnn determines interparasite cohesion, the rb defines the spatial position in the rosette organization, acting like an organizing center during proliferating as a strategy to allow successful coordinated parasite division; (6) the rb may contain cytoplasmic organelles, such as mitochondria, nuclear fragments, and dense granules; (7) during exteriorization, the rb could determine the adequate parasite orientation with the aim to favor an efficient egress through individual routes of exteriorization; (8) the ability of exteriorization of the parasites attached to the rb indicates they are mature enough to display all the events involved in exteriorization, such as motility, conoid extrusion, and ropthry secretion, and the rb does not represent an obstacle for such dynamic secretory processes; (9) interdigitated distribution in tachyzoites around the rb could optimize the intravacuolar space during proliferation; (10) lack of gra2 protein produced atypical amorphous mnn and rb and absence of rosettes.
|
Acanthosis nigricans (an) is a cutaneous eruption characterised by symmetric velvety hyperpigmented, verrucous plaques of the intertriginous surfaces of the axilla, neck, inframammary, and mucocutaneous regions and can be classified as benign or malignant . Benign cases are typically associated with obesity and insulin resistance, while malignant an (man) has been associated with intra - abdominal malignancies including gastric, oeseophageal, pancreatic, and hepatic duct adenocarcinomas and also rarely gynaecological malignancies . We present the case of a 28-year - old female with an associated with a combination of benign and malignant aetiologies . She initially presented with benign features of obesity and insulin resistance; however, the progressive nature of her an later manifested as a paraneoplastic dermatosis of endometrial adenocarcinoma . A 28-year - old morbidly obese female was referred to the dermatology clinic with a pruritic, hyperpigmented facial eruption . The patient reported this profound increase in pigmentation occurred after she gained approximately 3040 kg over the last 8 years since the birth of her first child . She had been using intermittent topical corticosteroids for the last 5 years with minimal effect . She had been feeling otherwise well with no constitutional symptoms and denied any alteration in her bowel habit, melaena, or per rectal blood loss . Her background medical issues included morbid obesity, sleep apnoea, and a recent diagnosis of bilateral cataracts, requiring surgery . She reported a positive family history of diabetes and breast cancer but denied any personal history of diabetes or malignancy . She was currently unemployed and lived with her 7-year - old daughter . On examination, the patient was obese with a bmi of 49 . There was widespread hyperpigmentation with marked skin thickening of her axillae, arms, abdominal folds, face, and ears (fig . 1, fig . She had macrocephaly with a prominent nose, round face and a buffalo hump . Examination of the scalp revealed cerebriform folding of the skin consistent with cutis verticis gyrata . Multiple punch biopsies were performed which showed psoriasiform hyperplasia, moderate dermal fibrosis, and superficial to mid - perivascular and perifollicular inflammation consistent with an . Given the extensive presentation of an, the patient subsequently underwent extensive investigations for potential endocrinopathies and to exclude underlying malignancy . Serological investigation showed a mild polycythaemia with a haemoglobin level of 163 g / l, with an otherwise normal full blood count and iron studies . She had an elevated alt of 49 u / l, but other liver function tests were normal . Mmol / l, and triglycerides were 2.1 mmol / l . In terms of investigation for endocrinopathy, she had an undetectable growth hormone, a low igf-1 at 7 nmol / l, a low 24-h urinary free cortisol and normal thyroid function tests . Fsh and lh were significantly depressed, and she had elevated testosterone and free androgen index . The patient was referred to gynaecology where she underwent a further panel of investigations . A ct of the chest, abdomen, and pelvis revealed no abnormalities, and tumour markers were also unremarkable, with a nonsignificant ca 125 level of 16 histology of the curettings confirmed grade 1 adenocarcinoma of the endometrium, and the patient was scheduled for a formal hysteroscopy / dilation and curettage in 3 months time . Additionally, the patient was referred to dietetics for education regarding diet and weight reduction and was referred for a formal sleep study to investigate her sleep apnoea . An is a cutaneous eruption characterised by symmetric velvety hyperpigmented, verrucous plaques of the intertriginous surfaces of the axilla, neck, inframammary, and mucocutaneous regions . An is a cutaneous marker of systemic diseases, which can be classified into benign and malignant forms . Benign an can be familial, drug induced, or correlated with a variety of endocrinopathies, notably insulin resistance and obesity . In contrast, man is most commonly related with intra - abdominal malignancies and very rarely gynecological carcinomas . Man is usually rapid in onset, widespread in distribution, and sometimes has facial involvement . It can also be associated with skin tags, multiple seborrheic keratosis (the sign of leser - trelat), or ridged velvety lesions on the palms (tripe palms). The pathophysiology of an is unknown but thought to involve one or more stimulating factors, which ultimately cause the epidermal proliferation that is seen on histopathological section . In man, the proposed etiology is thought to involve tumour secretion of a peptide with growth factor properties potentially transforming growth factor - alpha, insulin growth factor-1, or melanocyte - stimulating hormone alpha . Histopathology of biopsies typically reveals papillomatosis, hyperkeratosis, and acanthosis and an increased number of basal melanocytes . Interestingly, man tends to follow the course of an underlying malignancy often spreading with tumour progression, then regressing with successful therapy . Gynaecological malignancies have rarely been reported with man including 6 cases of ovarian cancer, 5 cases of endometrial carcinoma, and 2 cases of cervical carcinoma (table 1). These patients presented with man between the ages of 4783 years, with an average age of 59.5 years . Tripe palms and man occurring in the axillae are the most common sites occurring in 77 and 85% of the cases, respectively . Compared to previous cases, our case is of particular interest because our patient's an could be due to a combination of both benign and malignant aetiologies which has not previously been reported . The patient initially had features consistent with a benign form including an insidious onset at a young age associated with insulin resistance and obesity . This was then followed recently with a rapid year - long deterioration of the condition associated with widespread hyperpigmentation and hyperkeratosis involving the axillae, arms, abdominal folds, ears, and the face suggestive of man . Compared to previous cases of gynaecological malignancy associated with man, our case also presented at a much younger age and also at an unusually young age for the diagnosis of endometrial carcinoma . Our patient also had cutis verticis gyrata, a rare clinical finding with cerebriform thickening of the scalp, manifesting as deep furrows and convoluted ridges . This condition is commonly due to systemic disease, inflammatory dermatoses, underlying nevoid abnormalities, or trauma . The condition has rarely been described in association with malignancy, and although the cause of our patient's cutis verticis gyrata is not clear, the fact that it appeared in association with this patient's endometrial carcinoma is of note . Although rare, man is often an initial sign of malignancy and should trigger extensive investigation . This should include a review of systems including gastrointestinal symptoms, constitutional symptoms and a detailed gynaecological history . Initial investigations should include routine blood tests, chest x - ray, and also possible referral for endoscopy, breast examination, pap smear, pelvic examination / ultrasound, and other abdominal imaging if relevant . In patients diagnosed with benign an, any atypical features or poor response to treatment should also raise the possibility of underlying malignancy . This was depicted by the dual aetiologies in our patient and shows that physicians should have a low threshold for thorough investigation if malignancy is a possibility.
|
Measurement of cardiac output (co) requires use of invasive or minimally invasive devices; the use of noninvasive and minimally invasive devices has gained popularity in recent years . The bioreactance technique is a relatively new, continuous, totally non - invasive technique for measuring co that is easily implemented . This new technique involves analyzing phase shifts of a delivered oscillating current that occur when the current traverses the thoracic cavity, and differs from traditional bioimpedance techniques that rely on analysis of changes in signal amplitude . Most validation studies in critically ill patients have shown good correlation and/or agreement of bioreactance values compared with co values obtained using other devices in patients admitted after cardiac surgery [2 - 4]. However, validation in critically ill patients is lacking . As part of the internal evaluation of a bioreactance device before its implementation in the unit (evaluation of new non - invasive monitoring systems before introduction in the unit does not require the approval of the ethics committee in our institution), we compared co values obtained using the bioreactance technique (nicom system; cheetah medical inc ., portland, or, usa) with those measured using semi - continuous cardiac output by thermodilution (cco) with a pulmonary artery catheter (vigilance, edwards lifesciences, irvine, ca, usa). In 11 patients the co values were compared at study inclusion and each time a relevant change in hemodynamics and/or in therapeutics (for example, fluid challenge, inotrope or vasopressor infusions) was observed (table 1). Patient characteristics data in parentheses represent maximal dose, range (g / minute for norepinephrine and g / kg.min for dobutamine). We recorded bioreactance co (average of five values over a 5-minute period) just after obtaining the pulmonary artery catheter cco (average of five cco values over a 5-minute period). We collected 141 pairs of measurements (3 to 23 per patient); the duration of monitoring was at least 3 hours but never exceeded 24 hours . There was poor correlation between the two techniques (correlation coefficient r = 0.145) (figure 1). To limit the time effect, we randomly selected one pair of measurements for each patient - but this did not improve the results (r = 0.13). Bland and altman analysis with correction for multiple measurements showed wide limits of agreement (figure 2). The time course of co was not well tracked either, sometimes with opposite trends between the two devices . Correlation between pulmonary artery catheter semi - continuous cardiac output by thermodilution and bioreactance cardiac output . Pulmonary artery catheter semi - continuous cardiac output by thermodilution and bioreactance cardiac output: bias and agreement . Co, cardiac output; pac - cco, pulmonary artery catheter semi - continuous cardiac output by thermodilution . The bioreactance technique is dependent on diffusion of electrical current, so interstitial edema may interfere with measurements; we believe this is the most probable explanation for the poor correlation . Whatever the reason, these data suggest that caution should be applied when using bioreactance devices in critically ill patients.
|
Increased writing activity is seldom seen in neurological conditions, except in some patients with cerebrovascular disease, frontal - type dementia, temporal lobe epilepsy, and parkinson's disease . We report a patient with a left inferior capsular genu infarction who developed abulia and increased writing activity, similar to automatic writing behavior . The patient was a 79-year - old, right - handed woman who could independently perform daily living activities, including cooking, washing, and cleaning . One day she suddenly lost spontaneous speech, responded to questions with a nod, and remained in bed all day . Two days later, she was admitted to our hospital for evaluation of decreased spontaneity . She had a history of angina, but had no history of psychiatric disease or cognitive impairment . Brain magnetic resonance images (mri) revealed ischemic lesions involving the inferior genu of the left internal capsule, a part of the internal segment of the globus pallidus, and subcortical white matter with mild cortical atrophy (fig . Diffusion - weighted mri confirmed that the lesion in the left internal capsule of the genu extended to a part of the internal segment of the globus pallidus, and was responsible for the patient's symptoms (fig . 1d). Magnetic resonance angiography (mra) showed no occlusions or stenoses in the main cerebral arteries . Technetium-99 m ethyl cysteinate dimer single - photon emission computed tomography (spect) revealed a left - dominant diffuse hypoperfusion in the basal ganglia and frontal lobe (fig . Electroencephalography findings showed left - dominant theta activity of approximately 7 hz, without epileptic discharges or triphasic waves . She scored 7 points on the mini - mental state examination scale (mmse). The wechsler adult intelligence scale - revised and the trail making test were discontinued halfway through the assessment due to decreased spontaneity . Her writing was severely impaired; she could spell only a few words correctly, although when asked to write her name, she exhibited neologism in kanji and wrote ishimura - shinbun, combining ishimura (her last name) and shinbun (the newspaper placed before her) (fig . 2a). When directions to write her favorite food, hometown, and current date or place were given, she continued to write neologistic kanji words related to her last name . Shinkeinaika (neurology) was placed in front of her as a written note, she wrote the same word in place of her name and continued writing . The writing was mainly perseverative with lexicographemic alterations; many words written along the lines were legible and without spatial distortions . Increased writing activity was observed when ruled paper and a pen were presented to her; however, this was not observed when blank paper was presented . She could use other tools such as a toothbrush, scissors, and a comb accurately; utilization behavior was not elicited by presenting those items ., when she was asked to write something (her name, her daughter's name, current date or her feelings), she wrote only a few words related to her last name; her increased writing characteristic disappeared completely, except for a slight perseveration . Two years later, her response time to questions had become slightly shorter; however, she replied in a small voice, with a smile, and continued to exhibit decreased spontaneity . She scored 7 points on the mini - mental state examination scale (mmse). The wechsler adult intelligence scale - revised and the trail making test were discontinued halfway through the assessment due to decreased spontaneity . Her writing was severely impaired; she could spell only a few words correctly, although when asked to write her name, she exhibited neologism in kanji and wrote ishimura - shinbun, combining ishimura (her last name) and shinbun (the newspaper placed before her) (fig . When directions to write her favorite food, hometown, and current date or place were given, she continued to write neologistic kanji words related to her last name . However, after the word shinkeinaika (neurology) was placed in front of her as a written note, she wrote the same word in place of her name and continued writing . The writing was mainly perseverative with lexicographemic alterations; many words written along the lines were legible and without spatial distortions . Increased writing activity was observed when ruled paper and a pen were presented to her; however, this was not observed when blank paper was presented . She could use other tools such as a toothbrush, scissors, and a comb accurately; utilization behavior was not elicited by presenting those items . When she was asked to write something (her name, her daughter's name, current date or her feelings), she wrote only a few words related to her last name; her increased writing characteristic disappeared completely, except for a slight perseveration . Two years later, her response time to questions had become slightly shorter; however, she replied in a small voice, with a smile, and continued to exhibit decreased spontaneity . This is the first report of an increased writing activity, together with perseverative writing, that was related to a capsular genu infarction . However, verbal perseveration in patients with capsular genu infarctions has been reported previously, and all patients had left - sided infarctions and showed abulia (table 1). Lai et al . Reported a 46-year - old patient with a left capsular genu infarction who exhibited auditory hallucinations and dysgraphia, and whose symptoms predominantly included paraphasia and character error without increased writing activity or perseveration . Van vugt et al . Reported a 70-year - old right - handed man with a history of alcohol abuse who demonstrated progressive memory disturbance (score of 11 points on the mmse), verbal aspontaneity, and increased writing activity, which was described as automatic writing behavior. This diagnosis was based on the perseverative, legible writing pieces of language that he produced both visually and verbally at the syntactic or lexical level, and well - ordered spatial arrangement . On the basis of spect findings from right - dominant frontal hypoperfusion, the mechanism was considered to be a particular form of utilization behavior caused by suppression of the inhibitory system of the frontal lobes . The increased writing activity seen in our patient was more similar to automatic writing behavior than hypergraphia . Evyapan and kumral studied automatic writing behavior in three patients with right cerebral hemispheric strokes . They suggested that a combination of visuospatial neglect and frontal dysfunction may be responsible for the mechanism, as all of the patients showed left visuospatial neglect, and writing behavior was elicited only by the visual letters on the right side . In contrast, the neologism in our case of ishimura - shinbun (see fig . 2a) is considered to represent automatic reproduction of the visual stimulus, although our patient did not show visuospatial neglect . In the study by van vugt et al ., the duration of the patient's automatic writing behavior was permanent, while our patient's writing characteristic was temporary and similar to that reported by evyapan and kumral . Automatic writing behavior in our patient manifested after the oral or written direction to write, or the presence of ruled paper and a pen . It was probably due to a form of motor perseveration related to the basal ganglia . The pallidum and substantia nigra are the sites of input from motor corticostriatal pathways that interact as part of normal motor control and the termination of movement . Four patients with infarction in the thalamus and the basal ganglia developed motor perseveration of the upper and lower extremities induced by passive movement . One of these patients demonstrated perseveration in drawing figures, which suggests impairment of the prefrontal cortico - basal ganglia - thalamocortical loops . In this case, spect images revealed diffuse hypoperfusion in the left frontal lobe and basal ganglia, which implies that damage in the anterior and inferior thalamic peduncles, adjacent to the capsular genu, led to thalamocortical disconnection and interruption of the cortico - basal ganglia - thalamocortical loops . Our patient's repeated writing of her last name may indicate dysfunction of recall and understanding of characters in the dominant hemisphere, which is a requirement for writing . Moreover, a previous study reported that more severe verbal memory loss is caused by lesions on the left side of the capsular genu, compared with lesions on the right . As described in a previous report, the transient quality of automatic writing behavior implies possible diaschisis . It remains unclear why other perseverative movements, in addition to writing, did not occur . However, with regard to speech, we assume that the absence of verbal perseveration can partially be attributed to the effect of severe abulia . We suggest that this may be due to the involvement of a part of the left internal segment of the globus pallidus . Focal dystonia has been thought to be responsible for globus pallidus and thalamic infarction . In our case, the main blood supply route to the capsular genu was undetermined, since cerebral angiography was not performed . However, based on mra results, our patient did not have occlusions or severe stenoses in the main arteries . It has been reported that the capsular genu is supplied by perforating arteries, arising from the apex of the internal carotid or anterior cerebral artery, or by the anterior choroidal artery . The patient was not examined for cognitive or mental function before the onset of the capsular genu infarct; however, we believe that she did not have dementia or psychiatric diseases on admission, since her family attested that before the stroke she had been able to perform her usual activities properly and had showed no personality changes . Moreover, two years after the stroke, the patient showed persistent abulia that did not progress further . Therefore, we suggest that the acute - onset abulia and automatic writing behavior were likely due to the new infarct in the capsular genu (corresponding to high signal intensity on the diffusion - weighted images) rather than concomitant psychiatric or neurodegenerative disorders that exhibited dementia . However, we cannot exclude the possibility that an interaction between a concomitant underlying cognitive dysfunction, due to mild cortical atrophy or subcortical multiple infarcts, and the capsular genu infarct may exist . This may then cause the characteristic writing behavior, since leukoaraiosis has been associated with subtle cognitive impairment . In conclusion, we suggest that malfunction of the frontal - subcortical circuit, due to an inferior capsular genu infarction, contributed to the development of motor perseveration in writing.
|
During the past decade, advances in synthesis and biofunctionalization of colloidal semiconductor nanocrystals have generated an increasing widespread interest among investigators in the field of biology and medicine . The multitude of successful uses of quantum dots (qds) as specific markers for cellular structures and molecules, monitoring molecular and physiological events in live cells and animals, is a testimony of their great potential as multipurpose bioprobes [1, 2]. However, there exists an open question regarding whether nanoparticles per se can elicit biological responses, which could interfere with the phenomena they are intended to measure . Evidences are cumulating that nanoparticles play active roles even in the absence of specific ligands and that factors such as size and charge are crucial for the activation of cell responses, internalization, and intracellular trafficking [3, 4]. Thus, it is a priority for the wide scientific community working to develop nanostructured materials for biomedical purposes to relate the physical and chemical characteristics of nanomaterials to their behaviour, in vivo . While most of the published data addressing this important issue rely on cell culture studies and are focussed on the identification of the physicochemical parameters influencing the impact of nanoparticle on living cells [5, 6], we propose a new model system to work at the whole animal level . The small freshwater polyp hydra vulgaris (cnidaria, hydrozoa) is a diploblastic animal, at the base of the metazoan evolution, composed of just two epithelial cell layers (an inner endoderm and an outer ectoderm facing the low ionic strength medium) with few interspersed specialised cell types, a neuronal net controlling functions and physiology (figure 1). This structural complexity, simpler than vertebrates, with central nervous system and specialized organs, but much complex compared to cultured cells, makes hydra comparable to a living tissue whose cells and distant regions are physiologically connected . The feasibility to approach biological issues using hydra as model system has been shown previously by our group . In a pioneer work, we synthesised glutathione functionalised quantum dots (gsh - qds), studied the biological activity evoked in living polyps, and identified gsh - targeted cells . In the following studies, we used rod - shaped cdse / cds nanocrystals (qrs) not bearing functional groups to identify the mechanisms underlying cell - qr interaction . Unexpectedly, hydra treated with qrs showed a behavioural response, a tentacle writhing activity, which was finely characterized and shown to be calcium dependent and relying on the presence of tentacle neurons . These results indicated that the interactions between living organisms and newly synthesised nanomaterials need to be deeply investigated before employing any new nanostructure for biological purposes, that is, for cell - tracking studies, drug delivery . We have also identified both chemical and biological factors involved in the interaction qr - hydra working both in vivo, at the level of whole animal and isolated cells, and in vitro on fixed specimens, concluding that the qr internalization is the combined results of qr positive surface charge and membrane trafficking events regulated by the presence of annexin proteins on cell membranes . A remarkable advantage offered by hydra as a model organism to be targeted by metal - based nanocrystals is the possibility to evaluate the potential toxicity of these nanoparticles on different aspects of hydra physiology . The availability of new animal models suitable for the assessment of nanotoxicity is currently recognised as a priority . Hydra is sensitive to a range of pollutants and has been used as a biological indicator of water pollution [1012]. Metal pollutants such as copper, cadmium, and zinc have been tested against different hydra species, and the relative toxicity based on the median lethal concentration (lc50) for all species was ranked from copper, the most toxic, to cadmium with zinc, the least toxic . Drugs and pharmaceuticals targeted at mammalian receptors have also been shown to adversely affect hydra, showing the feasibility to use this aquatic invertebrate to accurately assess the potential toxicological effect of pharmaceuticals entered into natural waters through sewage effluent and landfill leakages . Several bioassays are available to assess the toxicity of a given compound in terms of acute or sublethal toxicity . Polyps exposure to different drugs may cause (1) alteration of morphological traits and developmental programs, (2) alteration of regeneration or pattern formation; the remarkable regenerative capacity of hydra relies on the presence of mitotically active multipotent stem cells in the gastric region, able to regenerate a new organism within 72 hr; as this process is controlled by temporal, positional, and morphogenetic factors, the presence of toxicants in the medium may affect the full process, and (3) alteration of population growth rates; bioassays measuring hydra population growth by asexual reproduction are rapid, sensitive, and precise . Large numbers of hydra can be cultured due to their small size and rapid reproductive rate . The high reproductive rate of hydra enables subchronic toxicity test which assess the population reproductive effects of a toxicant to be done in short time periods . In the present paper, we evaluated the toxicological effects of fluorescent cdte qds, presenting different chemical coatings, on a whole organism, hydra vulgaris . By using different approaches, from in vivo evaluation of morphological traits to the impact on growth rate and regeneration, we determined different behaviours and toxicological effects played by cdte qds, such as the influence of the surface coating, showing the feasibility of using hydra as fast, low - cost, and reliable tool for nanotoxicology studies . The water - soluble cdte qds used in this study were surface capped with thioglycolic acid (tga) or glutathione (gsh) and synthesized as described in . In this work, tga - qds (mean diameter of 3.1 nm) present an absorption wavelength of the first electronic transition at 537 nm, while gsh - qds (mean diameter of 3.6 nm) at 598 nm . Hydra vulgaris (strain zurich, originally obtained by p. tardent) were asexually cultured in physiological solution (solhy: 1 mm cacl2, 0.1 mm nahco3, ph 7) by the method of loomis and lenhoff with minor modifications . The animals were kept at 18 1c and fed three times per week with freshly hatched artemia salina nauplii . Groups of 20 animals were collected in plastic multiwells and allowed to equilibrate at room temperature in 300 l of physiological solution (solhy: cacl2 1 mm, nahco3 0.1 mm, ph 7). The test was initiated by adding test qds to each well containing 10 polyps and incubating as necessary . Qd uptake was monitored in vivo, unless otherwise stated, by continuous video recording using a camedia digital camera (olympus) connected to a stereomicroscope (olympus zsx - rfl2) equipped with fluorescence filter sets (bp460490/dm505/lp510). Following extensive washes, in vivo imaging was accomplished at several magnifications by using both a stereomicroscope and an inverted microscope (axiovert 100, zeiss) equipped with a digital colour camera (olympus, dp70) and fluorescence filter sets (bp4502013490/ft510/lp515). In order to assay acute toxicity, the morphological changes induced by qd treatment were monitored, by using a scoring procedure of the progressive changes in structure . This procedure allows to examine the ability of animals to recover from qd - induced damage . Every day, using a stereomicroscope, recognizable physical changes in response to different qd ranges were recorded, according to score values (ranging from 1 to 10) described by wilby . For imaging acquisition and analysis, the software system cell f (olympus) was used . For regeneration experiments, treated polyps were bisected in the gastric region and in vivo imaged at various time points after amputation . A quantitative method was used for the evaluation of distal regeneration in hydra, based on estimates of tentacle elongation during 14 days of regeneration, determination of a tentacle regeneration index (tri), and a statistical analysis of profiles obtained from various samples in different experiments . According to this method, for each of the n polyps, it is possible to calculate at time t the corresponding tentacle regeneration index (tri) as follows: (1)rj(t)=k=15pk nkj(t)nmax j=1,2,...,n, where n represents the maximal tentacle number for a single polyp under physiological conditions, that is, nmax = 8; nk(t) represents the number of tentacles of class k (5 tentacle classes were set, of length equal to 1/8, 1/4, 1/2, 3/4, and1) regenerated by the jth hydra at time t. the series of tri values of the jth polyp, obtained at the fixed observation times, represents the individual regeneration profile of the polyp . Finally, for each group of n = 4 hydra, a mean tri was calculated at any observation time t in order to follow the average regeneration rate of the group . Experiments were performed in air - conditioned environment at 22c and repeated three times for each condition tested . Median lethal concentrations (lc50) and lethal time (lt50) were calculated using the spearman - karber trim method . Experimental animals (four hydra with one bud) were treated with the indicated qd, for 4 h, then washed, and the following day placed in 3.5 cm petri dishes (1 hydra / dish). Both experimental and control hydra were fed once daily, and the population doubling time was determined as growth parameter . The growth rate constant (k) of an exponentially growing group of animals is defined as ln (n / n0) = kt, where n is the number of animals at time t and n0 the number of animals at t0 . For n / n0 = 2, t = t2, the doubling time of the population t2 was determined by linear regression . Lc50 and a t - test (p <.001) was used to test for significance between tri values within treatments . The slope of the regression curves obtained from single population growth rate was tested for significance using a two - way anova (p <.001). The two types of highly luminescent cdte qds were utilised, thioglycolic acid - capped cdte qd (from here it is indicated as tga - qds) and glutathione - capped qds (from here named gsh - qds), and the effects on animal behaviour and morphology where investigated over different incubation times . Being hydra a small water living animal, the simple addition of qds to the culture medium enables us to study the interaction between qd and animals, avoiding delivering methods or invasive procedures . Tga - qds and gsh - qds were added at different concentrations to groups of living polyps which were continuously monitored by fluorescence stereomicroscopy to visually inspect potential qd uptake, localisation, and cell morphology following incubation . By fluorescence microscopy observation, the animals appeared not fluorescently labelled, possibly due to the effect of calcium ions present in hydra culture solution, which have been shown to bleach the qd luminescence . As shown in figure 2, morphological alterations were induced by the treatment the with both cdte - based qds and scored according to previous methods . A precise and accurate estimation of the median lethal concentration (lc50) was obtained by applying the trimmed spearman - karber method, which has good statistical properties, is easy to use, and is recommended for accurate and precise calculation of lc50 values and their 95% confidence interval end points . As this method counts the dead animals and hydra can recover the damage, we considered dead animals as those showing scores lower than 4 . Median scores recorded at each qd test concentration of treated animals decreased with increasing exposure, concentration, and time, as shown in the graphs of figure 3 . In table 1, lc50 and lt50 values calculated using the spearman - karber method are reported for both tga- and gsh - capped qds . Tga - qds are characterized by lower values of both lc50 and lt50 compared to gsh - qds, indicating a more toxic effect played by the thioglycolic acid surface compared to glutathione capping . To fully characterize the toxicological impact of cdte qds on hydra the first one is based on the capacity of hydra to regenerate missing parts of the body after amputation . During head regeneration, the development of new tentacles can be monitored by stereomicroscopy, and tentacles numbers and lengths can be scored daily to assess the potential effects played by a toxicant on this controlled process . We used a quantitative method to assay the effect of qd treatment on hydra regeneration, calculating every day for each condition the tentacle regeneration index (tri), which indicates the average tentacle length / hydra (relative to the maximum tentacle length, assumed as 1 when the process is completed). As shown by the graph of figure 4, tri values for tga - qd - treated animals were significantly lower compared to tri of untreated animals . These differences were more evident during the first days of tentacle regeneration (gray shaded in the left panel of figure 4) and less evident during the late stages of tentacle development . Gsh - qd - treated animals, by contrast, were characterized by tri similar to untreated animals, indicating for this qd type the absence of toxic effect on hydra regeneration . Finally, the potential long - term toxic effects induced by cdte qds on hydra reproductive capabilities were assayed . Growth rate of hydra tissue is normally regulated by a balance between epithelial cell cycle length, phagocytosis of ectodermal cell in thus, the population growth rate is an indirect measure of the hydra tissue growth rate and cell viability . The growth rates of qd - treated polyps were calculated and compared to untreated animals, under regular feeding regime . As shown in the graph of figure 5(a), the growth rate of polyps treated with gsh - qds (two different sublethal concentrations were used) was similar to untreated animals, indicating the absence of toxic effects . Slight differences were observed only at the beginning of the experiment, as shown by the ratio n / n (number of individuals / number of the founders) at day 4, but not later, that is, at day 11, when the differences were not significant . Constant growth rates of hydra treated with tga - qds (figure 5(b)), on the opposite, were significantly different from untreated hydra . Differences in the ratio n / n were found all along the period of investigation, indicating an adverse effect displayed by this type of qd on hydra reproductive capability . Despite the abundant data accumulated on the toxicity of cdte qd on cell culture systems [2023], it is a priority of the scientific community to assess toxicological effects at the level of whole animal . Hydra vulgaris represents an amenable system to study the impact of the new nanomaterials on living organism, as it is very simple; it is structured in only two cell layers, thus it can be compared to a living tissue, but it presents the complex physiology and behaviour of evolved animals . The transparency of the epithelia makes it possible to track fluorescent nanoparticles, while its sensitivity to metals makes it an ideal model for nanotoxicology studies . In this study, we investigated the effect of cdte qds on hydra, using three different approaches, that is, assessing the effect on the polyps morphology and regenerating and reproductive capabilities . We quantitatively estimated these effects, calculating lc50 and lt50 values, tentacle regeneration index, and population growth rate, respectively, for each approach . Overall our data show that tga - capped qds display toxic effect compared to gsh - capped qd or to untreated animals . As by fluorescence microscopy, we were unable to evaluate the uptake of the fluorescent qds into hydra cells; at this stage, we cannot assess whether the toxicity is due to an intracellular or extracellular action played by the tga - qds . As we have previously shown that the positive surface charge is the crucial factor for nanoparticle internalization into hydra cells, the observed toxicity of tga - qd might be due to an extracellular activity, that is, binding and competing to divalent ions for membrane receptors, and we are currently investigating in to this aspect . Several studies suggested that the cytotoxic effects of (qds) may be mediated by cadmium ions (cd) released from the qd cores, and indeed hydra has been shown sensitive to free cd ions . However, we performed similar bioassays using the supernatant of pelleted qd preparation, and we could not detect any induced toxicity, suggesting a potential role of the cd ions coordinated by the negative groups of the capping tga, on the qd surface, rather than a release cd from the qd core . Thus, the identification of hydra cd responsive membrane proteins would shed light on the potential mechanism of cdte - qd - induced toxicity . The dose - dependent correlation between animal viability and qd administered further supports the hypothesis that their cytotoxicity depends on the qd actions and not on other ongoing processes, opening the path to future investigations on the intriguing cellular and molecular mechanisms underlying the cdte - qd response in hydra . Confocal laser microscopy of single - cell preparation from cdte - qds - treated animals imaged with organelle - specific dyes might reveal lysosomal damage attributable to the presence of reactive oxygen species (ros), which can be formed via cd - specific cellular pathways and/or via cdte - triggered photo - oxidative processes involving singlet oxygen or electron transfer from excited qds to oxygen [20, 25]. Cell biology investigation tools to check for the presence of necrosis processes or for the induction of programmed cell death (apoptosis) will help to unravel the mechanism underlying cdte qd toxicity, which would be of invaluable help to decipher the basis of semiconductor nanocrystal toxicity also in higher organisms . In summary, we have shown that, when cdte qds interact with hydra cells, this interaction induces progressive changes of cell morphology, leading finally to cell and animal death . Cdte - qd - induced cytotoxicity was associated with qd exposure time and concentration and with the surface chemistry and coating of the qd . Animal exposure for 2 hr to nanomolar doses of cdte qd induced progressive morphological alterations, which were scored up to 72 hrs when the complete death was detected . Anterior - posterior polarity, which is normally established during bud morphogenesis and regeneration, was not affected . The induced toxicity was more pronounced in case of tga - qd exposure, rather than gsh - qd, as shown by the dose responses curves . By treating the animals with sublethal doses of qds, both regeneration assay and population growth rate were affected by tga- and not gsh - capped qd, suggesting either an increased subcellular stability of gsh - qds or a protective role played by gsh against potential cd - induced ros productions . As nanoparticles may enter natural waters through sewage effluent and landfill leakages and present unknown risk to aquatic species including freshwater invertebrates, we recommend that invertebrate testing is used not only to advance the level of knowledge in nanoecotoxicology but also for investigating the behaviour and bioavailability of engineered nanoparticles in the aquatic environment through standardized tests . In conclusion, we suggest that our simple model system, up to now used mainly by a niche of biologists to study developmental and regeneration processes, has great potential to inspire many scientists working in the field of nanoscience, from chemists to toxicologists demanding new models to study the impact of nanoparticles on living organisms and their environment and to investigate the molecular basis of the bio - nonbio interactions.
|
Hydroxyapatite (hap) with multiple substitutions at all sites and containing ~4% to 6% carbonate is the primary component of bones (70% wt) and teeth (96% wt) [1, 2]. Several authors have reported on the structure and properties of human dental carbonate hap [35]. They study the enamel part of the tooth with a focus on the crystallographic structure and the carbonate substitution because carbonate affects important properties of the physiological hap such as reactivity and solubility . Studies on the graded nature and texture of dental enamel by comparison of the microstructures of slices of human adult and baby canine enamel have been reported [7, 8]. Human deciduous and permanent enamel samples were studied by fourier transform infrared (ftir) spectroscopy to determine quantitatively the b - type (carbonate for phosphate) and a - type (carbonate for hydroxyl) carbonate contents in human enamel . The mineral content, crystallite size, and mechanical properties of aging (transparent) human dentin were compared with the ones in normal human dentin in recent studies [10, 11]. We study the average crystal structure properties in bulk human dental apatite as a function of age in the range 587 years without separating the enamel from the dentin . We have undertaken a research project that requires a large and diverse origin of specimens in order to correlate the average crystal structure properties of aging dental apatite with the parameters that create the structural changes . Understanding the fundamental science of the dental mineral phase as a function of age could be helpful in efforts of remineralization of human dental apatite . Here we report some preliminary results on systematic trends of average crystal structure parameters and carbonate content in bulk human dental apatite as a function of age by using powder x - ray diffraction (xrd), thermogravimetric analysis (tga), and ftir spectroscopy . Two local dental offices provided teeth samples for this research with the informed consent of their patients . The teeth - samples were selected in the age range 1787 years old . One healthy 5 year old deciduous tooth was offered by a family member of the first author . The cleanest pieces of each tooth (free of fillings, etc .) Were selected under magnification, powdered with an agate mortar and pestle, and passed through a 125 sieve . The way of preparation of the samples implies that the average crystal structure properties of the dental apatite are studied . Each specimen was labeled with a capital t followed by a number that represents the age of the donor of the tooth . Powder x - ray diffraction measurements were performed using a siemens d5000 powder diffractometer operating at 45 kv and 40 ma with cu - k radiation and a diffracted beam monochromator . Data were collected in the 2 range of 890 with a step size of 0.02 and a counting time of 20 seconds at each step . The data bank from the international center for diffraction data (icdd) was used in a search / match program for phase identification . The rietveld refinement method in the gsas program was used for crystal structure analysis of the diffraction patterns only for the hap phase . The crystallographic model used space group p63/m with isotropic atomic displacement parameters . First, the scale factor, background, peak profile (pseudovoight function) and lattice parameters were simultaneously refined; then, the atomic positions and isotropic displacement parameters were refined for all the atoms except for the oxygen and hydrogen of the hydroxyl site in the diffraction patterns from the older age teeth, because combination of low occupancy at the channel site, poor crystallization and peak overlapping would create instability of the refinement . For the same reason, the fractions of the ca1, ca2, and p atoms were refined in diffraction patterns up to 45-year - old teeth . The loss of weight as a function of temperature from samples of 50100 mg was recorded using a perkinelmer thermogravimetric analyzer tga-6 . The heating rate was 10c / min in the temperature range 25c to 950c . Ftir spectroscopy was used to study the carbonate presence in the hap structure of the specimens . The ftir spectra were recorded on a bruker optic ifs66v / s interferometer equipped with an attenuated total reflectance (atr) unit . The atr unit permits the spectra collection without any special sample preparation and it is used for characterization and quantitative estimations in several materials . At a minimum two samples from each age were measured . The range of frequencies was 500 to 4000 cm and the spectra were recorded in ambient conditions with a resolution of 2 cm . In order to obtain a good signal - to - noise ratio, more than a hundred scans figure 1 shows the x - ray diffraction pattern collected from the sample t17 in comparison with the hap phase pdf number 9 - 432 . While this is the main identified phase in the diffraction patterns of all samples, minor unidentified phase(s) exist even in the young - age teeth, although within the detection limits of the method in the later . The identified secondary phases vary with the tooth - age qualitatively and quantitatively, as deduced from the bragg peaks and their relative intensities . Poor crystallinity, broadening, and overlapping of the diffraction peaks would make the phase identification ambiguous especially in old age teeth - samples . Possible secondary phases include the biologically relevant calcium compounds: ca2(p4o12).4h2o (no . 50 - 582), ca8h2 (po4)65h2o (no . 71 - 2392) and ca2p2o7 (73 - 440) [6, 15]. The x - ray diffraction patterns of figure 2 reveal a systematic decrease of the crystallinity of human dental apatite from 587 years old . It is quite noticeable that patterns collected from teeth up to 45 years old show highly crystallized materials (with the exception of t43), whereas the patterns from older - age teeth display an increasing broadening of the bragg peaks that indicates an increasing loss of crystallinity of the human dental apatite as a function of age . As it has been demonstrated, acids produced by plaque bacteria, acidic food, or drink cause a partial dissolution of dental apatite . Then it is reasonable to expect that aging of dental apatite favors such dissolution which is followed by decrease of the crystallite size . This decrease as a function of age is demonstrated by the broadening of the diffraction peaks of figure 2 . The average crystallite size was calculated from the fwhm of the (002), and (310) bragg peaks using the scherrer formula = k / cos . These two peaks were chosen because they do not overlap with others . It was found that the average crystallite - size in the specimens varies from ~12 nm (older age teeth) up to ~38 nm (younger age teeth). These numbers are in agreement with values found for crystallites in dentin and enamel . The average crystallographic properties of the specimens were found from rietveld refinement of the powder diffraction patterns . The weighted r factors of the refined patterns of all the samples were 0.15 rwp 0.18 except for the t87 with rwp = 0.28 . The reduced were 1.2 1.6 and the rbragg were 0.06 rbragg 0.13 . The low counting rate, presence of secondary phases, and nanoscale crystallite size explain such high residuals combined with low goodness of fit . The occupancies of the ca and p sites refine to values less than one as expected from the chemical composition of dental apatite [1, 2]. A systematic decrease of the a - lattice constant with the tooth - age is demonstrated in figure 4 . Decrease of the a - lattice parameter in carbonate apatites is associated with an increase in carbonate content [1, 2, 17]. Higher number of planar carbonate ions substituting for the tetrahedral phosphate ions in the apatite structure is followed by an increased crystal structure disorder and reduction of the crystallinity as it is demonstrated by the broadening of the diffraction peaks in figure 2 . This is biologically important because the increase in carbonate content as a function of age also means an increase of the solubility of the dental apatite and consequently the formation of calcium phosphate phases that alter the composition of the dental mineral . On the other hand, as figure 5 shows, no significant changes of the c - lattice constant with the tooth - age were found with the exception of one sample . Accordingly, no significant substitution variations occur at the channel (hydroxyl) site as a function of the tooth - age . The refined interatomic distances between the atoms of the phosphate tetrahedron as calculated from the rietveld refinements of the x - ray diffraction patterns are plotted in figure 6 versus age . Notice that while in young - age teeth the tetrahedral distances p - o2 (triangles) and p - o3 (circles) are distributed around the ideal value of 1.54 (marked with the dashed line), they show disturbance in older - age teeth . Moreover, the p - o1 distances (squares) are noticeably disturbed in all samples compared to the p - o2 and p - o3 bond lengths . Distortion of the phosphate tetrahedron is correlated with the well - known lattice disorder caused by the carbonate for phosphate (b - type) substitution in natural and synthetic apatites, referred to as the carbonate substitution problem [18, 19]. Notice that this distortion is different from the one observed in carbonate natural fluorapatites and synthetic haps that was studied earlier in the sense that in those both the p - o1 and p - o2 interatomic distances of the atoms on the mirror plane of the phosphate tetrahedron were distorted by 3 - 4% because of the carbonate for phosphate substitution . Further investigation is required to draw conclusions on this subject regarding the dental carbonate hap . The wt% of the carbonate loss from several samples versus the tooth - age is plotted in figure 7, as evaluated from differential thermogravimetric analysis in the temperature range above 600c up to 950c . Weight losses of absorbed, adsorbed water, or possible organic compounds that take place at temperatures less than 600c were evaluated . An increase of carbonate content with the age is demonstrated in this figure confirming the correlation between the decrease of the a - lattice constant as a function of age of figure 4 with an increased carbonate content . Figure 8 shows the 1750800 cm region of the ftir spectra as collected from samples in the age range 586 years old . These spectra are characteristic of bio - apatites; the phosphate bands are identified by peaks at ~962 cm (1 po4 stretching ir mode), and the 3 po4 region which appears as a very strong broad asymmetric b and at ~1015 cmand consists of at least three submodes . Strong peaks assigned to the b - type carbonate substitution (carbonate for phosphate ion) are observed at 872 cm(2 co3 mode) and at 1405, 1450 cm(3 co3). The weak bands in the 3 co3 region are attributed either to co3 replacing po4 ions without an adjacent oh ion (at 1480 cm), or to the a - type carbonate substitution (weak shoulders at 880 cm, ~1495 cm, and ~1530 cm). Organic phase related bands, mainly due to dentin, have been observed in the raman spectra of tooth samples [22, 23]. In particular, the raman bands peaked at 1250, 1450 and 1670 cm were related with the amide iii, amide ii, and amide i bands, respectively . The amide bands have been observed in the ir spectra of tooth samples above 1500 cm . The broad feature above 1600 cm that consists of two subbands at 1610 and 1650 cm can be attributed to overlapping bands of carbonate containing phases other than hap (carbonate probably at the channel sites), with amide iii bands . The 1650 cm band dominates over the 1600 cm in the spectra from teeth older than 45 years old . Usually the higher - frequency subband is stronger at dentin untreated samples, while it loses intensity at enamel samples or upon treatment . According to the aforementioned assignment the subbands behavior can be related either with the different content of dentin and enamel in the samples with age or with the secondary phases observed in the x - ray diffraction patterns . In favor of the secondary phases' explanation, some other weak bands at the 2 co3 region also imply the presence of carbonate in slightly different environments than a- and b - type as mentioned earlier for the weak bands in the 3 co3 region . In a previous work we have used the atr technique for a quantitative estimation of the relative carbonate content in specimens of synthetic and natural carbonate apatites from the ratios of the intensities of the 2 co3 modes to the 1 po4 . Figure 9 presents the ratio of the ir intensities of the 2[b] co3 mode to the 1 po4 (b - type carbonate substitution marked with squares) as a function of age . In the same figure the intensity ratios of the 2[a] co3 to the 1 po4 mode (a - type carbonate substitution) as a function of age are marked with circles . Figure 9 clearly demonstrates a trend of increasing carbonate content with the tooth age, which is in a good agreement with the results of the xrd experiments shown in figure 4 and the actual measurements of the carbonate loss of figure 7 . The maximum b- to a - type relative carbonate content is approximately 5, a value that is close to other estimates in biological apatites [9, 15]. Other authors have found similar results by using the relative intensities of the 1415 cm (3[b] co3) to the 603 cm (4 po4) band and the 1545 cm (2[a] co3) to the 4 po4 band, respectively . We prefer to use the ratios as in figure 9 because there is no coexistence of more than one a- and b - type bands in the 2 co3 region as in the 3, hence we avoid a possible fitting procedure uncertainty . Consistent, systematic variations of average crystal structure properties of human dental apatite as a function of age were found in this study from xrd, tga, and ftir spectroscopy experiments . The decrease of the a - lattice constant versus age in dental apatite that is associated with increased carbonate content is related to increasing solubility which in turn results in a decrease of crystallinity and disturbance of the local lattice order of the biomineral . The approximately age - independent c - lattice parameter implies that the phosphate tetrahedron remains the main site of the carbonate substitution in the apatite lattice (b - type substitution) in the studied age - range . Ftir spectra also show an increase of the b and a - type carbonate contents as a function of the age of the dental mineral phase with the b - type substitution up to 5 times greater than the a - type . These trends of the average crystal structure properties of human dental apatite as a function of age could be useful in understanding the details of structural modifications in aging teeth . However, further research is required using specimens from a large, diverse pool in order to acquire statistical information considering that the tooth bioactivity is greatly affected by diet, diseases, or other local factors that consequently affect the evolution of the mineral phase in aging human teeth.
|
Usually the course of ns in children is chronic with periods of recurrence and if untreated, it will lead to end - stage renal disease (esrd) and death . Now oral corticosteroids are the first line treatment of ns and the majority of these children respond to steroids . About 12 - 22% of the children with ns are steroid resistant and 70% will experience an episode of relapse . Long - term corticosteroid therapy has several known adverse effects like obesity, diabetes mellitus, poor growth, adrenal suppression, and hypertension . Despite the fact that both ns and its therapeutic protocols (steroids, and steroid sparing agents) can affect growth, clinical studies have shown conflicting results[35]. This study intends to assess the effect of corticosteroid on linear body growth of children . The study was conducted in children's medical center, the largest university affiliated pediatric hospital in tehran . In a hospital - based retrospective approach the effect of steroid therapy on linear growth of nephrotic children in a 5-year follow up was evaluated . Hospital records of 147 patients with diagnosis of ns within 1988 - 2008 who met the following criteria were reviewed and data extracted; age within 1 to 15 years, admission to the center on the first episode of ns, steroid therapy for at least four months, minimum follow - up of five years, accurate and careful data registry of height measurements and treatment modalities . All patients had normal renal function with serum creatinine level of <0.8 mg / dl and creatinine clearance of 100 ml / min per 1.73 m at the last visit . Nephrotic syndrome was considered in patients who had proteinuria (> 40 mg / m / h), and hypoalbuminemia (serum albumin <2.5 g / dl) according to the criteria of international study of kidney disease in children (iskdc)[6, 7]. The remission of the disease was characterized by disappearance of albuminuria (dipstick testing 0 to trace), whereas relapse was defined as reappearance of proteinuria (dipstick testing 2 + for at least 3 consecutive days). Kidney biopsy had been done in children with early (<1 year old) or late (> 10 years) disease onset, presence of gross hematuria, persistent hypertension with or without microscopic hematuria, low gfr unresponsive to correction of intravascular volume depletion, steroid resistance or dependence, frequent relapses, family history of glomerulopathies, and low c3 level . Patients were initially treated with 60 mg / m / d (2 mg / kg / d) of oral steroids [prednisolone (psl)] for at least 4 weeks . The therapy was followed by another 4 weeks with 40 mg / m / d (1.5 mg / kg / d) on alternate days and then it was tapered and stopped over the next 8 - 12 weeks . The above therapeutic protocol had been prescribed for the first episode of the disease, while an individualized treatment had been considered for the next episodes . Steroid - sparing agents (including levamisole, cyclophosphamide, cyclosporine a, and azathioprine) had been given if indicated . The period of psl administration, total dosage of psl in terms of milligram per kilogram, and prescription of steroid - sparing agent treatments were recorded for each patient . Data on subjects height at admission and in the last follow - up visit were gathered . In order to compare their linear growth with normal population and adjustment of age and sex, standard deviation score (sds) of the height was calculated by plotting figures on centers for disease control of usa (cdc) growth chart for the respective age and sex . The height sds (ht sds) was then calculated for each subject according to the following equation: height sds(htsds)=(patient s height - height at50thpercentile)/(height at50thpercentile - height at5thpercentile) changes in ht sds (ht sds) throughout follow - up visits were also calculated . In order to evaluate the effect of pre - pubertal steroid therapy of ns on patients linear growth, age of 10 years for female and 12 years for male patients was considered as the age of puberty . Analysis used spss version 15 (spss, inc, chicago, il, usa). Chi - square test and student's t - test were used to compare losses and gains in percentiles with nominal variables such as histological type of ns, sex, and steroid - sparing medications . The pearson's correlation was used to compare gains and losses in percentiles (ht sds) in the patient population as a whole and in selected subgroups, considering continuous variables including onset age, age at last follow up, duration of psl medication, and cumulative received psl . The study was conducted in children's medical center, the largest university affiliated pediatric hospital in tehran . In a hospital - based retrospective approach the effect of steroid therapy on linear growth of nephrotic children in a 5-year follow up was evaluated . Hospital records of 147 patients with diagnosis of ns within 1988 - 2008 who met the following criteria were reviewed and data extracted; age within 1 to 15 years, admission to the center on the first episode of ns, steroid therapy for at least four months, minimum follow - up of five years, accurate and careful data registry of height measurements and treatment modalities . All patients had normal renal function with serum creatinine level of <0.8 mg / dl and creatinine clearance of 100 ml / min per 1.73 m at the last visit . Nephrotic syndrome was considered in patients who had proteinuria (> 40 mg / m / h), and hypoalbuminemia (serum albumin <2.5 g / dl) according to the criteria of international study of kidney disease in children (iskdc)[6, 7]. The remission of the disease was characterized by disappearance of albuminuria (dipstick testing 0 to trace), whereas relapse was defined as reappearance of proteinuria (dipstick testing 2 + for at least 3 consecutive days). Kidney biopsy had been done in children with early (<1 year old) or late (> 10 years) disease onset, presence of gross hematuria, persistent hypertension with or without microscopic hematuria, low gfr unresponsive to correction of intravascular volume depletion, steroid resistance or dependence, frequent relapses, family history of glomerulopathies, and low c3 level . Patients were initially treated with 60 mg / m / d (2 mg / kg / d) of oral steroids [prednisolone (psl)] for at least 4 weeks . The therapy was followed by another 4 weeks with 40 mg / m / d (1.5 mg / kg / d) on alternate days and then it was tapered and stopped over the next 8 - 12 weeks . The above therapeutic protocol had been prescribed for the first episode of the disease, while an individualized treatment had been considered for the next episodes . Steroid - sparing agents (including levamisole, cyclophosphamide, cyclosporine a, and azathioprine) had been given if indicated . The period of psl administration, total dosage of psl in terms of milligram per kilogram, and prescription of steroid - sparing agent treatments were recorded for each patient . Data on subjects height at admission and in the last follow - up visit were gathered . In order to compare their linear growth with normal population and adjustment of age and sex, standard deviation score (sds) of the height was calculated by plotting figures on centers for disease control of usa (cdc) growth chart for the respective age and sex . The height sds (ht sds) was then calculated for each subject according to the following equation: height sds(htsds)=(patient s height - height at50thpercentile)/(height at50thpercentile - height at5thpercentile) changes in ht sds (ht sds) throughout follow - up visits were also calculated . In order to evaluate the effect of pre - pubertal steroid therapy of ns on patients linear growth, age of 10 years for female and 12 years for male patients was considered as the age of puberty . Analysis used spss version 15 (spss, inc, chicago, il, usa). Chi - square test and student's t - test were used to compare losses and gains in percentiles with nominal variables such as histological type of ns, sex, and steroid - sparing medications . The pearson's correlation was used to compare gains and losses in percentiles (ht sds) in the patient population as a whole and in selected subgroups, considering continuous variables including onset age, age at last follow up, duration of psl medication, and cumulative received psl . Hospital records of 147 patients consisting of 99 (67.3%) males and 48 (32.7%) females were reviewed . Mean age of the subjects at first visit was 5.14 (range 1 to 15 years) and the mean follow - up time was 9.3 years (range 4 to 20 years). Ns had a significantly earlier onset in the male patients compared to the female group (p=0.024). By the last follow - up visit, 6 (12.5%) female patients were 10 years and 42 (87.5%)> 10 years old, while 34 (34.35%) male patients were 12 years and 65(65.7%)> 12 years old . Percutaneous renal biopsy was performed in 34.7% of the subjects, in 26 of whom histo - pathological findings were compatible with minimal change ns . Mean total dose of prednisolone was 2205.90 mg / kg (1265.40) with a mean duration of 7.05 years steroid therapy . Steroids were given to 69 subjects before puberty (54 males and 15 females), while 78 patients (45 males and 33 females) received psl before and after puberty . One, two, or three ssa were given in conjunction with prednisolone in 88 (59.9%) children (53, 21, or 14 patients respectively). The mean ht sds of the 147 patients initial height was -0.761.96, and the final ht sds -0.89 2.05(p=0.49). The height of 39 (21.1%) patients measured <5% cdc (less than 2 sd of normal population) at the first visit . However, 13 of these patients had reached the 5 percentile for height or higher (table 1). Cross - tabulation between htsds of the first and last follow - up visit sds: standard deviation score/ht: gains and losses in percentiles of height (growth change) sixty - two children (group a) had linear growth improvement during the follow - up time, whereas 85 (group b) were found to have growth retardation . Those who had improved linear growth included 40 males and 22 females with the mean initial and final ht sds of -1.631.87 and -0.082.13 respectively (p<0.001). First height of 22 (15.0%) of these children was below the 5 percentile . However, by the last follow - up visit, 13 of them had heights above 5 percentile . On the contrary, group b comprised 85 (59 male and 26 female) patients, whose average ht sds for initial and final height records were 0.131.78 and 1.591.68 respectively (table 2). From the first till the last follow up visit, 22 patients suffered negative growth below the 5 percentile while the rest, though showing negative growth, remained above the 5 percentile . As it is shown in table 3, patients that had received ssa were younger and had received significantly higher doses of psl . Comparison of growth determinants between children according to their growth status, improvement (group a) or retardation (group b) sds: standard deviation score comparison of growth indicators between patients who used prednisolone alone and those who used additional steroid - sparin ssa: steroid sparing agent/ht: gains and losses in percentiles of height (growth change) linear growth was not related to age at onset, age at final follow - up, duration of the disease, or cumulative dosage of psl (table 4). Pearson correlation coefficients and significance (p. values) between growth change (htsds) and growth determinants we also compared the various histological types of ns for differences in the growth indicators . Significant differences were noticed in the age at onset (p=0.008), duration (p=0.006) and dose (p=0.006) of steroid therapy, but not the age at the last follow - up visit . In the past when steroids were not prescribed for ns, a major cause of growth retardation was protein calorie malnutrition secondary to poor appetite, malabsorption due to gi tract edema, and proteinuria . Today, corticosteroids are believed to be the major cause, though emotional deprivation and chronic anxiety may also play a role . In ns, the dosage and duration of steroid therapy and renal function are principal factors associated with patients linear growth . Prolonged high - dose corticosteroid administration suppresses growth . However, previous studies on ns raised controversies, whereas some reported loss of growth velocity in long - term steroid therapy[812], others failed to show significant growth impairment[2, 1317]. In the current study, we found no difference between subjects first and final height . This favorable outcome might be due to long - term maintenance steroid therapy administered on alternate days . However, inclusion of children with a benign course of ns might also underestimate the side effects of prolonged steroid treatment . Linear growth was not related to gender, age at onset, age at final follow - up, duration of the disease, cumulative dosage of psl, and ns histology . There was no difference in mean ht sds change between patients treated with and without steroid - sparing agents (-0.142.30 vs. -0.11 2.13; p=0.93), which is in accordance with the findings of the study by matsukura et al, in which they found no association between height sds change and ssa use in ns patients . As previously reported in a study by padilla et al, these agents are beneficial for linear growth through steroid sparing effect . Total psl dose and duration of steroid therapy this is in agreement with an earlier study by kitamura, which showed no significant reduction in the dose or duration of prednisolone treatment by concomitant ssa administration as it is more probable that these patients were steroid resistant . We also compared various histological types of ns for differences in the potential growth determinants . Age at onset of the disease, as well as duration and dose of steroid therapy were significantly different . Though a larger population of renal biopsy is required to better elucidate these differences, our data is in agreement with those of the iskdc which shows that mcns is more frequent in younger ages[6, 7]. Mcns could, due to its higher relapse rate, more likely cause longer duration and higher cumulative dose of steroid medication . It is hard to explain the difference between the two groups (group a and b) as they were both comparable for potential determinants of ht sds . Even the patients clinical history did not reveal any data suggestive of chronic disease before onset of the ns . <-2 (below the 5 percentile) at first visit, achieved a ht sds of 5 percentile for height by the end of follow up time . Loke et al suggest that catch - up growth compensates for pubertal growth retardation . In subgroup a, the gain of growth percentiles could possibly be attributed to several factors that acted in isolation or in concert: catch - up growth could have affected 34 of 99 male and 6 of 48 female children who received steroids intermittently and have gained growth percentiles before adolescence in accordance with a study by loke et al . A pubertal growth spurt might have occurred in 45 male and 33 female patients during the follow - up period . Both effects (pubertal growth spurt and catch - up growth) might have been operating in 20 male and 9 female patients who were able to discontinue steroids before puberty and afterwards, still off steroids, entered puberty during the study period . Considering the similarities of group b patients with those of group a, the cause of loss of growth percentiles in group b could be attributed to more sensitivity to side effects of psl or a more severe disease . Corticosteroids are believed to be associated with elevation of serum igf-1 levels that can result in igf resistance and growth retardation . However, this finding is in agreement with several other studies[2225]. This could be due to differences in pharmacokinetics, steroid sensitivity, and severity of the underlying disease . Identifying these factors will be of great value in clinical practice, but until then, steroids side effects have to be monitored individually . Though height sds was not significantly decreased in the studied subjects following prednisolone therapy according to the guidelines of iskdc, mild retardation was observed in a group of children . In order to further elucidate this issue, additional research is required with regard to the period of active proteinuria, other causes of growth retardation such as hypothyroidism and vitamin d deficiency as well as accurate consideration of number of relapses.
|
Different countries appear to differ significantly with respect to rates of permanent pacemaker (ppm) implantations . For example, the number of ppm implantations per capita is much lower in the populations of asian countries than in western populations . According to the 2009 11th world survey of arrhythmias project,1) the number of new ppm implantations in 2009 was 927 per million in germany and 767 per million in the united states . In contrast, in japan, ppms were implanted in 272 patients per million as opposed to only 35 per million in korea an eight - fold difference in the rates of per capita ppm implantations . Possible explanations for the differences between two countries may include (1) differences in reimbursement policies, (2) differences in the incidence of sinus node or conduction disorders, and (3) cultural differences regarding the acceptance of device implantation among physicians and patients that may serve as barriers to ppm implantation . We conducted a survey among physicians in japan and korea to determine what factors may be influencing their decision to implant ppms . A survey was created that included 15 different clinical case scenarios representative of the class i, iia, iib, and iii indications for ppm implantation stated in the 2008 aha / acc / hrs guidelines.2) members of the korean and japanese societies of cardiology (including electrophysiologists, non - electrophysiologists, and cardiac surgeons) were asked to respond to a questionnaire to determine whether or not they would implant a ppm in each of the clinical scenarios presented to them . Although the classes were not indicated in the questionnaire, they could be broken down as follows: five in class i (group 1), 6 in class iia (group 2), 2 in class iib (group 3), and 2 in class iii (group 4). Respondents, who remained anonymous, were asked to rate each scenario according to a 5-point scale; a score of 5 signified that the respondent was confident that a ppm should be implanted and a score of 1 signified that the physician was confident that it should not be implanted . For the purpose of our analysis, scores of 4 and 5 were considered to be positive for the decision to implant a ppm . Survey results were compiled and analyzed using spss software version 15.0 (spss inc ., chicago, il, usa). The surveys were sent to 330 korean physicians and 390 japanese physicians, of whom 89 (27%) and 192 (49%) returned the completed questionnaires . Table 1 lists the characteristics of the respondents, and the responses to each questionnaire from the two physician groups are presented in supplemental table 2 . Results were analyzed according to either class indications or disease entities (table 2 and fig ., there was no significant difference in the decision to implant a ppm between korean and japanese physicians . However, for the group 2, the japanese physicians were significantly more likely than the korean physicians to implant a ppm (48% vs. 37%, p<0.001); corresponding rates were 40% vs. 19% (p<0.001) for group 3 and 36% vs. 18% (p<0.001) for the group 4 scenarios . These results did not change when the cases were categorized based on disease entity, such as sinus node dysfunction and conduction abnormality . This study demonstrates significant differences in the clinical decisions made by korean and japanese physicians based on various indications for ppm implantation . Most likely, these differences are not simply due to relative conservatism among korean electrophysiologists compared with their japanese counterparts . Other factors such as national reimbursement policies and cultural differences with respect to patient acceptance of ppm implantation may also influence their decisions . The korean government is in charge of the single health insurance organization in the country, and all medical practices are monitored by the health insurance review and assessment (hira) service . The japanese government runs two health insurance organizations but does not impose the additional level of regulation found in korea (korean hira). In general, the reimbursement environment is more strict in korea than in japan . In japan, all the procedures and treatments are reimbursed by the insurance system regardless of the class indications stated in the aha / acc / hrs guidelines . In contrast, physicians in korea can be reimbursed only for class i and selective class iia indications in implanting a ppm . This difference in reimbursement systems between the two countries is likely to play a major role in physician decisions about whether or not to implant a ppm . According to our survey analysis, korean and japanese physicians differed mainly in their decisions regarding class ii ppm indication scenarios (groups 2 and 3). In both countries, the majority of respondents did not favor implantation of ppms for class iii indication scenarios (group 4), although japanese physicians responded more positively to these scenarios . Japanese physicians have their own guidelines for pacemaker implantation3) that do not include class iii indications in patients with sinus node dysfunction or atrioventricular block, and this could explain the difference in their decisions regarding the group 4 scenarios . It is well known that racial differences can affect decisions about the utilization of certain medical procedures.4)5)6) this discrepancy may be due in part to cultural factors regarding the acceptance of innovative medical technologies.7) differences in the relative acceptance of pacemaker implantation by patients in korea and japan may also influence physician decision making processes . The response rate was lower in korea (27%) than in japan (49%). In studies with this type of methodological design in addition, in order to increase participation in this survey, we limited the number of questions and made each question as simple as possible . Our case scenarios were carefully designed to represent scenarios for which a divergence of opinion was likely, thus disclosing subtle differences in physician decision making . Furthermore, during the design of the questionnaire, each case scenario required consensus among three electrophysiologists in the assignment of appropriate class indications . Korean physicians are generally less likely to favor implantation of a ppm than are japanese physicians for class iia and iib ppm indications . These differences in physician decision making probably contribute to the small number of ppms implanted in korea, as compared with japan . Insurance reimbursement systems as well as cultural differences might influence physicians' decision in implanting a ppm . The present study has several limitations . The response rate was lower in korea (27%) than in japan (49%). In studies with this type of methodological design in addition, in order to increase participation in this survey, we limited the number of questions and made each question as simple as possible . Our case scenarios were carefully designed to represent scenarios for which a divergence of opinion was likely, thus disclosing subtle differences in physician decision making . Furthermore, during the design of the questionnaire, each case scenario required consensus among three electrophysiologists in the assignment of appropriate class indications . Korean physicians are generally less likely to favor implantation of a ppm than are japanese physicians for class iia and iib ppm indications . These differences in physician decision making probably contribute to the small number of ppms implanted in korea, as compared with japan . Insurance reimbursement systems as well as cultural differences might influence physicians' decision in implanting a ppm.
|
It is estimated to be the most common cause of neonatal hospital readmission in north america (1). It may lead to bilirubin accumulation in basal ganglia and brain stem nuclei and lead to kernicterus . If the infants survive the acute phase, which is marked by lethargy, hypotonia, poor feeding and opisthotonus, they may develop chronic encephalopathy . This condition is manifested by cerebral palsy, sensory neural hearing loss, dental dysplasia, upward gaze paralysis and mental retardation (2). Causes of severe neonatal hyperbilirubinemia are categorized either as hemolytic (blood group mismatch, sepsis, g6pd deficiency) or non - hemolytic (breast feeding jaundice, internal hemorrhage, gestational diabetes, pyloric stenosis, hypothyroidism and some mutations in hepatic enzymes). Prematurity, jaundice in the first 24 hours of life, jaundice noted before discharge from hospital, a history of jaundice treated with phototherapy in siblings and asian race are other predisposing factors for severe hyperbilirubinemia noted by various studies (3 - 5). However, severe hyperbilirubinemia is mainly treated by exchange transfusion (et).according to american academy of pediatrics (aap), neonates with weight 2500 grams in healthy term, et is indicated when indirect bilirubin level reaches 25 mg / dl and 20 mg / dl and in cases with risk factors or gestational age of35 - 37 wk and well despite 6 hr of intensive phototherapy . In newborns of 35 - 37 wk and risk factors, et is indicated when the indirect bilirubin level reaches 18 mg / dl despite 6 hr of intensive phototherapy (2). Et is associated with many complications such as hypersensitivity reactions, sepsis, catheter - induced vascular damage, hypotension, necrotizing enterocolitis, etc (5). The present study has been conducted to investigate the causes of severe hyperbilirubinemia leading to exchange transfusion from march 2009 to march 2011 in bahrami children hospital, tehran, iran . The aim was to identify neonatal predisposing factors that can be prevented by screening or other measures, thus reducing the incidence of kernicterus, which can be prevented and also to avoid et and its side effects . All infants below 30 days who underwent et for severe hyperbilirubinemia in bahrami children hospital during 2009 - 2011 were enrolled into this cross sectional study . A questionnaire prepared consisted of neonates gender, gestational age, age at the time of admission, birth weight, time of jaundice appearance, history of severe hyperbilirubinemia in siblings, blood group and rh of both mother and neonate, g6pd activity, complete blood count, reticulocyte count, peripheral blood smear, total and direct bilirubin before and after exchange transfusion, direct coombs in mother and indirect coombs in neonates, times of transfusion, any other diagnostic laboratory data based on attending neonatologist's decision and the cause of hyperbilirubinemia stated by the attending neonatologist . Criteria for diagnosis of abo incompatibility were type o maternal blood group and a, b or ab neonatal blood group associated with neonatal hb drop . Positive coombs, peripheral blood spherocytosis and high corrected reticulocyte count were other diagnostic criteria . Icteric breastfed newborns with the beginning of jaundice in the second or third day of life and 2% or more weight loss per day of life with or without uremia or hypernatremia were considered breastfeeding jaundice . During the study period, 94 neonates (56.4% boys and 43.6% girls) underwent exchange transfusion due to severe hyperbilirubinemia . The infants had a mean birth weight of 195040 g and a mean gestational age of 35.21.4 weeks . Fifty nine (63%) of neonates were preterm, and history of neonatal jaundice in siblings was reported in 50% of cases . However, only 18(19%) had a history of severe hyperbilirubinemia leading to et in their siblings . Most cases (40.5%) of severe hyperbilirubinmia started to become icteric on the second day after birth . First day jaundice was observed in 10 neonates, all of them due to hemolysis . Table 1 shows a summary of underlying factors for severe hyperbilirubinemia according to the onset of jaundice . The majority of infants (91.5%) had only one episode of et, and hemolysis was the sole underlying reason in the remaining who had 2 or 3 episodes of et . Totally, after prematurity, the second most prevalent underlying factor for severe hyperbilirubinemia was breastfeeding jaundice that included 33(35%) of neonates . We found that the next most prevalent causes were abo mismatch and g6pd deficiency (table 2). There was no kriglernajar cases in our study because no significant hyperbilirubinemia was found after discharging and fallow up . According to epidemiological studies, some risk factors are associated with severe hyperbilirubinemia in neonates . The risk factors are male gender, jaundice presenting in the first 24 hours after birth, jaundice noted at discharge from the hospital, previous sibling with jaundice, preterm labor, breast feeding, rh and abo incompatibility, g6pd deficiency and sepsis (4,6). According to the canadian pediatric society, gestational age of 35 - 36 weeks is an important risk factor for hyperbilirubinemia (7). Kuzniewicz et al also reported gestational age to be the main predictor of severe hyperbilirubinemia (8). In our series, infants had a mean gestational age of 35.2 weeks and fifty nine (63%) of neonates were preterm . Most cases (40.5%) of severe hyperbilirubinmia started on the second day after birth . This corresponds with views of american academy of pediatrics and canadian pediatric society, which recommend clinical assessment of infants for jaundice within the first 48 hours of birth (6, 7). However, clinical assessment of newborns is not an accurate means of assessing the severity of hyperbilirubinemia (1). In the present study, breastfeeding jaundice, as the most important factor associated with severe hyperbilirubinemia and according to salas and mazzi (9), is encountered in 33(35%) of cases . The data also corresponds with findings of huang et al (6), who reported an odds ratio of 3.2 for severe hyperbilirubinemia in neonates who were breastfed (10). Guidelines advise mothers to nurse their infants at least 8 to 12 times per day for the first several days, rooming in with night feeding, discouraging 5% dextrose or water supplementation and ongoing lactation support for reducing the incidence of breast feeding jaundice (2). In this study, abo mismatch was the third most common cause of severe hyperbilirubinemia and accounted for 24.5% of cases . This is similar to the reports of badee and sanpavat who reported abo mismatch in 22% and 21.3% of cases, respectively (11, 12). However, according to canadian surveillance program, the most common causes of severe hyperbilirubinemia were incompatibility abo blood group and g6pd deficiency . The g6pd deficiency was the fourth most prevalent risk factor for severe hyperbilirubinemia leading to et and accounted for 12(12.8%) of cases . Badee also reported g6pd deficiency in 19.1% of neonates who underwent et (11). According to johnson et al, g6pd deficiency was considered to be the main cause of hyperbilirubinemia in 19 of 61 (31.5%) infants who developed kernicterus (14). Sepsis was the most common underlying cause for et in the study performed by koosha and rafizadeh (15). Prematurity was the most prevalent risk factor for severe hyperbilirubinemia . Thus following protocols for prevention of premature labor is recommended . Educating mothers for breast feeding in regard to the right times and method of feeding are important issue that should be considered . Since blood group mismatch and g6pd deficiency were the third and fourth most prevalent underlying factors, screening infants for blood group and if proven to be cost effective, g6pd activity in the first day of life are also recommended . Arranging earlier and continuous visits in neonates with these risk factors during the first four days of life are also mandatory.
|
Evidence is increasing that asthma is a heterogeneous disease constituted by overlapping separate syndromes with probably different, but yet undefined, causes and natural histories . There is a need to identify each of these groups of patients (the so - called asthma phenotypes), whose clinical and prognostic characteristics and responses to treatment may be heterogeneous between groups and homogeneous within each group . All asthmatics, by definition, share a common physiologic abnormalities of reversible airflow obstruction detected by spirometry, airway hyperreactivity, and symptoms that can include shortness of breath, wheezes, and cough . Despite these shared features, a great heterogeneity was noticed in the severity of airway obstruction, clinical phenotypes, degree of reversibility, and the amount of improvement in response to asthma medicines . Other phenotypes defined by clinical or physiological categories (i.e., severity, age at onset, and chronic airway obstruction), by asthma triggers (i.e., viral, exercise, occupational allergens, or irritants), by their pathobiology (i.e., eosinophilic, neutrophilic, and paucigranulocytic asthma), or by their course (i.e., early transient / persistent / late onset wheeze) have also been proposed [36]. In an attempt to understand the mechanisms for these variable clinical phenotypes and response to medications, many approaches have been taken to assign asthmatics to distinct phenotypes that can predict disease course and treatment response . Thus, identification of asthma phenotypes should also lead to increasing the understanding of underlying pathobiology that contributes to a particular phenotype . The huge advances in asthma pathology achieved in the last decades have resulted in discussions about whether asthma definition and classification should be revised, but their implications in the clinical practice are still missing . We hypothesize an approach to classify asthma phenotypes based on symptomatology in correlation with cytokine profile and airway inflammatory biomarkers as a trial to individualize asthma treatment . Beside our trial to characterize the proposed clinical asthma phenotypes, we aim to detect whether those clinical asthma phenotypes may affect the response to the main controller medications . This trial may translate the results into a simple clinical guide that can help to tailor the asthma medicines . Patients (n = 203) 8 to 14 years of age with partially controlled asthma were enrolled in the study after validation of their symptoms [7, 8] into shortness of breath, cough, and wheezy phenotype groups . They had asthma symptoms or rescue medication use on average of 3 or more days per week during the previous 4 weeks and improvement in fev1 12% after maximal bronchodilation . They had no corticosteroid treatment within 4 weeks, no antihistamines within 3 months, no montelukast treatment within 2 weeks, and no history of respiratory tract infection within 4 weeks of enrollment . Children were excluded for the following comorbidities such as chronic cardiopulmonary disease, concurrent pneumonia, nasal polyps, obesity, and gastroesophageal reflux . Also, patients under immunotherapy were excluded . The study included 44 healthy controls (mean age 10.20 0.22 years) of matched age and sex without apparent evidence of allergic diseases . We defined the level of asthma control according to established guidelines of global strategy for asthma management and prevention . Informed consent was obtained from all parents of patients and healthy controls and approved by ethical committee of mansoura faculty of medicine, egypt . According to the clinical phenotypes based on validated symptomatology [7, 8], asthmatic children were divided into 68 children presented solely with shortness of breath (defined by the patient as chest tightness, labored breathing, and difficulty in drawing sufficient breath, heavy breath) with a mean age of 9.7 3.2 years, 63 children presented solely with cough without other symptoms such as dyspnea or wheezes with a mean age of 9.8 2.3 years, and 72 children presented predominately with wheezes (defined by the patient as creaking, rattle, whistling, and jingling) with a mean age of 9.3 1.2 years . In either group of patients, the presenting clinical phenotype had to be persistent during their followup; those who had variable clinical presentation between the phenotypes were excluded . After a 10- to 14-day characterization period, participants were randomized to either line of treatment using an active ics, inhaled fluticasone propionate 100 g twice daily, for 8 consecutive weeks (flixotide diskus, glaxo wellcome egypt, under license from glaxo wellcome operations, uk), or montelukast 5 mg chewable tablet once daily at bedtime, for 8 consecutive weeks (singulair, merck, whitehouse station, nj, usa). Short - acting 2 agonists (ventolin, glaxo wellcome, london, uk) were administered as a rescue medication . During treatment, patients were asked to regularly visit the outpatient clinic on weekly bases to evaluate compliance to therapy and degree of asthma control . Evaluation was done using peak flow measurements (am1, jaeger - toennies gmbh, hoechberg, germany) and asthma symptom scores . An asthma - free day was defined as a day without the following: daytime or nighttime symptoms, use of rescue salbutamol for asthma symptoms or low peak flow, asthma health care use, or missed school or work for asthma symptoms . Patients were excluded from the study if they showed deterioration of their clinical status accidentally used other controller medication, and were willing to get back to their regular treatment . Serum concentrations of soluble intercellular adhesion molecule (sicam), soluble vascular cell adhesion molecule (svcam), soluble interleukin-2 receptor (sil-2r), total serum immunoglobulin e (sige), peripheral eosinophil%, serum eosinophilic cationic protein (secp), and pulmonary function tests (pfts) were done before and after treatment for patients and were done once to controls . One aliquot was used for complete blood count for eosinophils and expressed in cell / mm . The other was kept for 30 min to clot and then centrifuged at 3,000 rpm for 10 min . Sicam-1, svcam-1, sil-2r, and total ige levels were measured by using immunoassay techniques . Sicam-1, svcam-1, and sil-2r were measured by using elisa kits from diaclone research, france . Serum eosinophilic cationic protein (ecp) assay was done using immulite system from dpc (diagnostic procedure corporation) los angeles, ca, usa . Fev1 was measured by spirometry (master screen body); the highest reading of three successive measurements was taken . Reference values were computed according to the recommendations of the american thoracic society (ats) standards of acceptability and reproducibility . The target sample size of 203 randomized participants provided 85% statistical power for detecting a significant correlation between the study medications . Statistical analysis was done by using spss (statistical package for social science) software (version 12.0, spss inc ., the results were analyzed by using paired student's t - test and wilcoxon rank test to assess differences in serum levels of icam-1, vcam-1, il-2r, ecp, and total ige at the beginning and at the end of treatment . Two hundred thirty - nine asthmatic children were enrolled in the study, 203 had successfully completed both treatment arms, and 15.06% of the participants did not complete the study (figure 1). The three studied groups (sob, cough, and wheezy) showed insignificant difference as regards age and sex . There was statistical significance between asthmatic children and healthy controls regarding fev1%, serum levels of ige, peripheral eosinophilic%, serum eosinophilic cationic protein (secp), soluble intercellular adhesion molecule (sicam-1), soluble vascular cell adhesion molecule (svcam-1), and soluble interleukin-2 receptor (sil-2r) (table 1). Before treatment, shortness of breath (sob) group showed significant increase in total serum ige when compared with both cough and wheezy groups . Whereas cough phenotype group showed significant increase in both peripheral eosinophilic% and secp when compared with sob and wheezy groups . On the other aspect, wheezy group showed mixed pattern in the form of significant increase in peripheral eosinophilic% and secp when compared with sob group, beside a significant increase in total serum ige when compared with cough group (table 1). There was agreement in the responses to the two medications at the end of 8-week treatment period, with clear difference in the response according to the clinical phenotype . Shortness of breath group responded to fluticasone alone with significant improvement in both fev1 and asthma symptom scores as well as significant decrease of peripheral eosinophilic percentage, secp, sicam, and total serum ige (table 2). On the other aspect, cough group responded to montelukast alone with significant improvement in both fev1 and asthma symptom scores and with significant decrease in peripheral eosinophilic% and secp (table 3). Wheezy group responded to both medications in which mean (sd) fev1 percentage of improvement was 14.1% for fluticasone and 8.6% for montelukast . Also, the same groups showed significant improvement in asthma symptom scores with significant decrease in peripheral eosinophilic percentage and secp in response to both medications . Overall, the difference in the response for the two medications in wheezy group was found to be significant with upper hand to fluticasone (table 4). Table 5 showed comparison between phenotypic clinical parameters as well as peripheral eosinophilic percentage among cases controlled with either montelukast or fluticasone . Cases controlled with montelukast were found to have cough phenotype with eosinophilic pattern, younger age (<10 years) with shorter disease duration (<10 years), and female gender with positive family history of asthma . On the other aspect, cases controlled with fluticasone were found to have shortness of breath phenotype, older age with longer disease duration, and male gender with negative family history of asthma . Asthma is increasingly considered a syndrome, with diverse overlapping pathologies and phenotypes contributing to significant heterogeneity in clinical manifestations, disease progression, and treatment response . Better defining asthma phenotypes may improve the understanding of the underlying pathobiology of the phenotypes and lead to targeted therapies for individual phenotypes . We are exploring whether each clinical phenotype (sob, cough, and wheeze) has its own specific features and inflammatory biomarkers aiming to characterize those clinical asthma phenotypes and to look for their implications on the response to the main controller asthma medicines . Our study described a wide variability between the proposed clinical phenotypes in which the sob phenotype group were found to have elevated levels of total sige, older age (> 10 years), male gender, and longer disease duration with negative family history of asthma . Whereas cough phenotype group were found to have an eosinophilic pattern, younger age (<10 years), female gender, and shorter disease duration, with positive family history of asthma . On the other aspect, the children in our study were treated for eight consecutive weeks with two controller asthma medicines ics and ltra . The effect of each medicine was found to vary according to the proposed clinical asthma phenotype . Sob phenotype group responded to fluticasone alone by significant improvement in both fev1% and asthma symptom scores and significant decrease of peripheral eosinophilic%, secp, total sige, and sicam-1 . The response to ics in sob phenotype group may be explained by a proposed cytokine pathway in this phenotype or attenuated cysteinyl leukotriene pathway in this group; however, the detailed mechanisms remain to be clarified by future controlled studies . On the other aspect, cough phenotype group responded to montelukast alone by significant improvement of both fev1 and asthma symptom scores with significant decrease in peripheral eosinophilic% and secp . Also in the current study, both of these classes of medicines fluticasone and montelukast were found to be effective in the wheezy group by significant improvement in both fev1 and asthma symptom scores with significant decrease of peripheral eosinophilic% and secp . The differential response between the two medications was found to be significant with upper hand to fluticasone . Overall, in current research, cough group was found to have an eosinophilic pattern and responded to montelukast alone which may be explained by an underlying leukotriene - driven eosinophilic inflammation, whereas sob group was found to have higher levels of total sige and responded to ics but not to ltras . On the other aspect, wheezy group that responded to both medications ics and ltras was found to have a mixed eosinophilic and ige mediated pattern and this may need further studies to delineate the underlying pathogenesis . Data emerging from the present study showed that the sob phenotype group had significant increase in total sige levels with significant decrease in fev1 in comparison with cough and wheezy groups . These findings may characterize and reflect the severity of this group on a clinical background . A number of previous studies indicated that total sige levels might reflect the severity of asthma . Tenor study showed that mean sige levels were significantly higher in children with severe asthma than in those with moderate or mild disease . Naqvi, 2007, found that higher total sige among 739 african - american, mexican, and puerto rican adults and children with asthma was associated with lower baseline lung function and more severe asthma . Another cross - sectional cohort study of 157 asthmatic children, aged 5 to 15 years, reported a correlation between disease severity and specific ige to house dust mite, dermatophagoides pteronyssinus . Different clinical research has suggested an emerging clinical usefulness of eosinophilic percentage and serum eosinophil granule proteins in the assessment and management of asthma, of which ecp has been most widely characterized and researched . Eosinophils are a characteristic feature of the pathology of asthma in which the granular constituents of eosinophils are cytotoxic and cause desquamation and destruction of bronchial epithelium, which may lead to bronchial hyperresponsiveness; lipid mediators secreted from eosinophils, such as leukotrienes c4, d4, and e4 and platelet activating factor, can induce bronchoconstriction, vascular permeability, and bronchial hyper responsiveness . Peripheral eosinophils and s - ecp levels were found to be sensitive markers for asthma severity and assessment of asthma control [23, 24]. Therapy guided by eosinophilic% has proven to be effective with cutoffs generally less than 2% of forced sputum or bronchoalveolar lavage (bal). Eosinophilic asthma patients tend to respond well to steroids and bronchodilators but have a high frequency of flares [26, 27]. In conclusion, although there is a variability in response to ics and ltras, we did identify the characteristics of patient that should guide the clinician in the choice of asthma controller medications . Children who have sob as main complaint with high levels of total sige should receive ics therapy, whereas cough phenotype group with high levels of eosinophilic% and secp should receive montelukast . While wheezy group with mixed eosinophilic and ige mediated pattern could receive therapeutic trials of either ics or ltras with an assessment of the response.
|
Stress factors in operation room and block level mismatch with surgical area may contribute to discomfort, anxiety and restlessness in patients under spinal anaesthesia . It may provide freedom from specific discomfort and can impart some amnesia for the block procedure and surgical operation . Thus, judicious use of sedation can make surgeries under spinal anaesthesia more comfortable for the patient, the surgeon and the anaesthetist . Spinal anaesthesia itself can impart some sedative effects . The interaction between spinal local anaesthetics and sedatives can lead to an augmentation of sedation, thereby decreasing the requirement of propofol or midazolam to obtain a desired level of sedation . Oversedation may jeopardise the safety of the patient . While levels of sedation progress in a dose - response continuum, it is not always possible to predict precisely how an individual patient will respond to a particular dose . Oversedation may be associated with untoward effects of respiratory and cardiovascular depression resulting in higher chances of airway instrumentation and hypotension leading to a prolonged stay in the post - anaesthetic care unit, entailing increased burden on staff, bed availability and associated costs . Appropriate monitoring of depth of sedation thus remains important, as also the search for an agent with a shorter recovery time . Midazolam, a short - acting benzodiazepine, is frequently used as a sedative during procedures under spinal anaesthesia . It has a property of rapid onset and offset of action after intravenous (iv) injection . Propofol, a non - benzodiazepine anaesthetic agent, is frequently being used as an iv sedative agent during regional anaesthetic procedures, as it has a quick onset and offset of action with easy arousability . Lower doses of propofol as sedative also produces amnesia and anxiolysis, but has the propensity of greater cardiovascular and respiratory depression when used in higher doses bispectral index (bis) monitoring may be helpful when oversedation has to be avoided because clinical scales do not allow a discrimination of deep sedation . Only one study has utilised the bis monitor for assessing the recovery time . Hence, we envisaged this study to compare the characteristics of recovery from sedation while patients were sedated either with propofol or midazolam under bis monitoring during spinal anaesthesia for infraumbilical surgeries . The two drugs have been evaluated with respect to arousal times from sedation (primary outcome). Correlation between the observed bis and observer's assessment of awareness / sedation (oaa / s) scores was also analysed . The present study compared the two drugs propofol and midazolam for intra - operative sedation during spinal anaesthesia in respect to arousal time from sedation following stoppage of infusion . Intra - operative haemodynamic changes and patients satisfaction regarding quality of intra - operative sedation by utilizing 7-point likert - like verbal rating scale were also noted . Patients of either sex with age between 18 and 60 years complying with american society of anesthesiologists (asa) physical status i and ii criteria, posted for elective infraumbilical operations (surgical, gynaecological, or orthopaedic) of approximate 90 min duration were selected . Patients not willing to accept spinal anaesthesia, those not willing to receive sedation during surgery, or having any contraindication to spinal anaesthesia were excluded . Considering a difference of 30% regarding the arousal time to be clinically significant and taking an error of 0.05 and power of the study (1-) to be 80%, the number of patients was calculated to be 44 in each group . Expecting a dropout of 20%, a total of 110 patients were recruited . Using lottery method, they were randomly assigned to receive either propofol (group p, n = 55) or midazolam (group m, n = 55). The weight and height of all patients were noted during the pre - anaesthetic checkup . They were also given a demonstration about the use of the 7-point likert - like verbal rating scale to express their satisfaction about the quality of sedation they would receive during the intra - operative period . Ctri/2012/08/002934. In the pre - operative room, one large bore (18 g) iv cannula was established and an infusion started with ringer's lactate at 15 ml / kg over 30 min . Premedication was given with injection ranitidine 50 mg, injection ondansetron 4 mg and injection . Multichannel monitor (non - invasive blood pressure, electrocardiogram, pulse oximeter) was attached and the baseline parameters (mean arterial pressure [map], heart rate [hr] and peripheral arterial oxygen saturation [spo2]) were recorded . The anaesthesia machine with resuscitating facilities was kept ready for use in emergency . The forehead and both the temples of the patient were cleaned with spirit and the four electrodes of bis monitor (aspect medical systems, inc . The infusion pump was readied with injection propofol or injection midazolam as per the study group . Spinal anaesthesia was given in the left lateral decubitus position with 2.53.0 ml of 0.5% bupivacaine heavy using quincke needle (26 g) at the l3l4 interspinous space . After a sensory block to t6, sedation was initiated as appropriate for the group of study and the surgery was started . The patients in the group p were given a bolus of propofol (1 mg / kg) followed by infusion of propofol (at 3 mg / kg / h). The group m received a bolus of midazolam (0.05 mg / kg), followed by infusion of midazolam at 0.06 mg / kg / h . The infusion was continued until a bis score of 70 was reached . At this point, the oaa / s score was also noted as a clinical measurement of the patient's sedation status . Map was measured continually at 5 min intervals and hr, spo2 were monitored continuously throughout the surgery . Bispectral index score was observed continuously after the induction of spinal anaesthesia till the arousal of the patient . The arousal time from sedation (i.e. Time from stoppage of infusion of study drug till a bis score of 90 is achieved) was recorded . At this point, oaa / s score was observed . The time taken to reach oaa / s score of 5 (patient is awake clinically) was also noted . Correlation between the 2 times was derived from the recorded data to determine the correlation between electro - encephalogram (eeg) defined and clinical based recovery profiles . The patient's satisfaction with the sedation was assessed by the 7-point likert - like verbal rating scale with some questions like where will you put your experience with this sedation on this scale? In a language which the patient understands, at a point of time when the patient had a mental state suitable for communication . Data were charted on the excel workbook (microsoft office home and student 2007, microsoft corporation, one microsoft way redmond, wa 98052 usa) and analyzed using statistical package for the social sciences (spss) for windows (version 12.0, spss inc ., chicago, il, usa)., two patients had to be converted to general anaesthesia and in one, surgery ended much earlier than in the study protocol . In group m, two patients needed general anaesthesia and two patients had surgeries of much shorter duration than in study protocol . Thus, data from 103 patients (group p [n = 52], group m [n = 51]) were analysed . The groups p and m were found to be comparable in respect of age, weight, height, sex distribution, the asa physical status and duration of surgery [table 1]. The intra - operative haemodynamic parameters (map and hr) and the peripheral oxygen saturation were compared at various time points . The map and the hr were lower in the group p than in group m, but the intra - group map and hr in both the groups were stable throughout . The map and hr [figures 1 and 2] showed a slight rise nearing the end of surgery and recovery in both groups . In both groups, the spo2 values were distributed in an almost linear fashion with no wide variations . Group p patients receiving injection propofol; group m patients receiving injection midazolam haemodynamic parameters: heart rate . Group p -patients receiving injection propofol; group m patients receiving injection midazolam the arousal time from sedation was significantly lower for the group p when compared to group m (p = 0.000); the time taken to reach an oaa / s score of 5 was also found to be lower for group p (p = 0.000) as cited in table 2 . Recovery characteristics the mean arousal time from sedation (bis score 90) with injection propofol was 7.54 3.70 min, whereas, with injection midazolam it was 15.54 6.93 min, the difference being statistically significant . The time taken to reach an oaa / s score of 5 was 6.81 2.54 min with propofol versus 13.51 6.24 min with midazolam . At bis score of 90, the point of recovery, the number of patients with oaa / s score of 4 were 13 (in group p) and 12 (in group m) respectively, and those with oaa / s score of 5 were 39 (75% patients) in either of groups p and m. spearman's correlation was calculated between the arousal time from sedation and the time taken to reach an oaa / s score of 5 in both the study groups . In group p, the spearman's correlation was 0.890 (p = 0.000), which was very strong, and in group m, it was 0.837 (p = 0.000), which was also strong . This is also evident from the figure 3 showing near - parallel graphs (within a group) when the arousal time from sedation and the time taken to reach an oaa / s score of 5 was plotted on a scatter diagram . Scatter diagram showing the relation between the arousal time from sedation (bispectral index 90) and time taken to reach an observer's assessment of awareness / sedation score of 5 in both the study groups . Group p -patients receiving injection propofol and group m patients receiving injection midazolam the patients satisfaction scores on the 7-point likert - like verbal rating scale were comparable in both the groups [table 3]. In the present study, the time to reach bis score of 90 (arousal time from sedation) was lower with injection propofol than midazolam (7.54 3.70 min and 15.54 6.93 min, respectively). Similarly, the patients became clinically awake (time taken to reach an oaa / s score of 5) earlier when sedated with propofol (6.81 2.54 min with propofol vs. 13.51 6.24 min with midazolam). Found that the recovery was quicker with propofol (8.9 2.8 min) than with midazolam (12.5 3.5 min), monitoring sedation clinically . This may be due to the higher clearance rate of propofol (around 30 ml / kg / min) with respect to that of midazolam (6 - 11 ml / kg / min), which is claimed to be a result of extrahepatic metabolism of propofol . Furthermore, the concentration of propofol in the brain falls rapidly owing to its redistribution, leading to quick recovery . In comparison, the concentration of midazolam in the brain tissue has an initial phase of rapid decrease due to redistribution, which is followed by a slower phase resulting from the metabolism of the drug . Midazolam on metabolism in the liver produces an active metabolite, 1-hydroxy midazolam, which may be responsible for its delayed offset of action . The emergence time from sedation may thus depend on the total dose of midazolam infused as the metabolite accumulates on prolonged infusion . The metabolites of propofol have not been reported to have any such sedative - hypnotic activity . The context - sensitive half - time, which depends on the clearance of the drug from the body compartments when an infusion is given, is much lower for propofol than for midazolam . This perhaps explains the earlier recovery from sedation with propofol when compared with midazolam . In the present study, the time to reach bis score of 90 (arousal time from sedation) was found to tally with the time taken to reach an oaa / s score of 5, at which the patient was awake on clinical observation . There was a strong correlation between the 2 times when they were analysed statistically (spearman's correlation was 0.890 in group p and 0.837 in group m). The oaa / s score was 5 in> 75% of patients in either group at a bis score of 90, the point of recovery in the study . The above findings imply that both the eeg based monitoring (bis monitoring) and clinical monitoring (oaa / s) techniques were equally effective in monitoring recovery from sedation, and thus either can be relied upon independent of the other . This is however in contrast to the finding that the bis score and oaa / s score have poor correlation during onset of sedation while using the same two drugs, more so with midazolam . Bispectral index monitoring for assessing the level of sedation is appealing as it can help in better titration of propofol resulting in reduced dose requirement of propofol and potential economic benefits compared with clinical monitoring of depth of sedation . Reported that bis monitoring reduced propofol requirement by 47% during combined spinal epidural anaesthesia for gynaecological surgeries . They reported that delayed recovery occurred in bis monitored group as most of the patients maintained desired level of sedation (bis value around 70), whereas earlier recovery occurred in control group (without bis monitoring) due to frequent intra - operative awakening as a result of clinical assessment . It is already established that bis scores may vary for a particular level of clinical sedation and variable recovery pattern can be seen with different sedatives - hypnotics . Hence, it can be said that relying solely on eeg - based monitor (like bis) may not ensure the attainment of proper recovery . As clinical sedation is our area of interest, the combination of both methods of monitoring can provide complementary facts and can consolidate a better understanding of patient's response to sedation than when using either method singly . At least, additional clinical assessment should be done after attainment of the desired instrumental score, if repeated stimulation is to be avoided with the concern of changing sedation level as might occur during clinical monitoring of depth of sedation . Propofol does not change hr significantly and has a minimal action on the sinus node or atrioventricular node . Blunting of the tachycardic response to hypotension may lead to a lower hr among those receiving propofol in the present study . Propofol can produce hypotension when given in bolus or infusion as a result of vasodilatation and negative inotropic action on the heart . Midazolam also produces hypotension to a lesser magnitude, only when it is given as an induction agent which entails a higher dose over a short time . This hypotension may be due to its curtailing effect on sympathetic tone during onset of anaesthesia . This difference in the mechanism of hypotension may have resulted in the lower map in patients receiving propofol compared with midazolam in this study . During recovery, the map and hr increased, probably due to cessation of infusion and thus waning of the effect . Use of target - controlled infusion with patient - controlled feedback was also not possible owing to lack of resources . Placebo - controlled study design was not followed because the authors considered it to be unethical to give sedation to one group while denying sedation in other group of patients . A shorter arousal time from sedation during spinal anaesthesia can be achieved using propofol compared with midazolam while monitoring the depth of sedation with bis monitor . Similar findings were evident when clinical sedation score was analysed and both the monitoring systems were found to correlate strongly during the recovery from sedation.
|
All mice were housed and bred in a specific pathogen - free facility and used at 412 wk of age . Tcr mice (21) were obtained from the jackson laboratory (bar harbor, me). Tcr mice (22) were mated with rag2 mice (23) to generate double - deficient rag2tcr mice . Mice transgenic for a chimeric protein consisting of the extracellular and transmembrane domains of human cd25 and the cytosolic domain of murine tcr (tt, line no . 35) (24) were also bred onto the rag2 background to make ragtt mice . Rag2 and rag2 mice were injected intraperitoneally with 250 g of affinity - purified anti - cd3 mab (145 - 2c11) (25) or with the dose indicated . Ragtt mice were injected with 250 g anti - tac mab (1ht4 - 4h3). Where indicated, rag2 mice were injected with 250 g of affinity - purified anti - cd3 mab on both day 0 and day 8 and then subjected to the coreceptor reexpression assay on day 12 . Where indicated, rag2 mice were radiated with 400 cgy and analyzed 3 wk later (26, 27). Performance of the coreceptor reexpression assay on electronically sorted thymocyte populations has been described previously (8). In brief, single cell suspensions of thymocytes were stained with pe - conjugated anti - cd4 mab (gk1.5; becton dickinson, san jose, ca) and fitc - conjugated anti - cd8 mab (53 - 6 - 72, becton dickinson). Stained thymocytes were electronically sorted by a facstar plus according to the gates indicated in each figure . Sorted cells were washed extensively with pbs and treated with 0.04% pronase (calbiochem novabiochem, san diego, ca) and 100 g / ml dnase i (boehringer mannheim, indianapolis, in) at 37c for 15 min, pelleted, and pronase treated for another 10 min at 37c . Cells were placed in culture for 1216 h of culture at either 4 or 37c, after which harvested cells were restained with anti - cd4pe and anti - cd8fitc . For three - color analysis cells were also stained with anti - cd5 (53 - 7 - 3; pharmingen) followed by cy-5 avidin (caltag, san francisco, ca). Dead cells were excluded by electronic gating on both forward light scatter and propidium iodide intensity . Flow cytometry using three- or four - decade logarithmic amplification as indicated was performed on a facstar plus and data were analyzed using software designed by the division of computer research and technology at the national institutes of health . All mice were housed and bred in a specific pathogen - free facility and used at 412 wk of age . Tcr mice (21) were obtained from the jackson laboratory (bar harbor, me). Tcr mice (22) were mated with rag2 mice (23) to generate double - deficient rag2tcr mice . Mice transgenic for a chimeric protein consisting of the extracellular and transmembrane domains of human cd25 and the cytosolic domain of murine tcr (tt, line no . 35) (24) were also bred onto the rag2 background to make ragtt mice . Rag2 and rag2 mice were injected intraperitoneally with 250 g of affinity - purified anti - cd3 mab (145 - 2c11) (25) or with the dose indicated . Ragtt mice were injected with 250 g anti - tac mab (1ht4 - 4h3). Where indicated, rag2 mice were injected with 250 g of affinity - purified anti - cd3 mab on both day 0 and day 8 and then subjected to the coreceptor reexpression assay on day 12 . Where indicated, rag2 mice were radiated with 400 cgy and analyzed 3 wk later (26, 27). Performance of the coreceptor reexpression assay on electronically sorted thymocyte populations has been described previously (8). In brief, single cell suspensions of thymocytes were stained with pe - conjugated anti - cd4 mab (gk1.5; becton dickinson, san jose, ca) and fitc - conjugated anti - cd8 mab (53 - 6 - 72, becton dickinson). Stained thymocytes were electronically sorted by a facstar plus according to the gates indicated in each figure . Sorted cells were washed extensively with pbs and treated with 0.04% pronase (calbiochem novabiochem, san diego, ca) and 100 g / ml dnase i (boehringer mannheim, indianapolis, in) at 37c for 15 min, pelleted, and pronase treated for another 10 min at 37c . Cells were placed in culture for 1216 h of culture at either 4 or 37c, after which harvested cells were restained with anti - cd4pe and anti - cd8fitc . For three - color analysis cells were also stained with anti - cd5 (53 - 7 - 3; pharmingen) followed by cy-5 avidin (caltag, san francisco, ca). Dead cells were excluded by electronic gating on both forward light scatter and propidium iodide intensity . Flow cytometry using three- or four - decade logarithmic amplification as indicated was performed on a facstar plus and data were analyzed using software designed by the division of computer research and technology at the national institutes of health . To assess the possibility that dp thymocytes spontaneously terminated cd8 coreceptor synthesis even in the absence of tcr cd3 signals, we examined dp thymocytes from tcr mice by the coreceptor reexpression assay . Tcr thymocytes cannot express conventional tcr complexes and, consequently, cannot differentiate beyond the dp stage of development (21). To enrich for dp thymocytes that might have committed to the cd4 or cd8 t cell lineages, we electronically sorted for cd48 and cd48 transitional cell populations and utilized the coreceptor reexpression assay to determine the coreceptor molecules they were actively synthesizing (fig . 1, a and b). In the coreceptor reexpression assay, preexisting surface cd4 and cd8 coreceptor molecules are removed from the sorted cells by treatment with low doses of pronase, and the stripped cells then placed into single cell suspension cultures for 14 h. metabolic activity of cultured cells is inhibited at 4c, so that cell surface coreceptor reexpression does not occur (fig . 1 a and b, middle columns). However, cells cultured at 37c do reexpress the cd4 and/or cd8 coreceptor molecules that they are actively synthesizing . Indeed, we have previously demonstrated that coreceptor reexpression in this assay requires active coreceptor transcription and protein synthesis (8). Interestingly, virtually all cd48 sorted cells from tcr dp thymocytes reexpressed both cd4 and cd8 coreceptors and so reappeared as dp cells (fig . Identical results were obtained with cd48 sorted cells from tcr mice (fig . 1 b, top). That is, none of the dp thymocytes present in tcr mice had selectively terminated either cd4 or cd8 coreceptor synthesis, indicating that none had undergone lineage commitment . Thus, these results indicated that lineage commitment did not occur spontaneously in immature dp thymocytes but might be dependent upon signals transduced by surface tcr cd3 complexes . To assess directly the role of tcr cd3 signals in inducing lineage commitment in dp thymocytes, we assessed dp thymocytes from experimentally induced rag2 mice . Rag2 mice fail to express any clonotypic tcr chain because they are unable to recombine any tcr gene locus . As a result, rag2 thymocytes are arrested at the cd48 (double - negative, dn) stage of development (23). However, rag thymocytes can be induced to differentiate further into dp cells by either sublethal -irradiation (26, 27) or by injection of anti - cd3 mab (28, 29) (fig . 1, a and b, left column). Induced rag dp thymocytes did not further differentiate into phenotypically mature t cells as thymocytes from stimulated rag mice that appeared cd48 or cd48 (fig . 1, a and b, left columns) were predominantly precursor cells that spontaneously became cd48 in overnight culture (data not shown; reference 30). Even though sublethal -irradiation and anti - cd3 injection both induced generation of rag dp thymocytes (fig . That is, sublethal -irradiation did not detectably stimulate cd3 signal transduction as revealed by the absence of cd5 upregulation, whereas injection of anti - cd3 mab did stimulate cd3 signal transduction and cd5 upregulation (fig . 2). Assessment of cd48 and cd48 sorted cells from -irradiated rag2 mice by the coreceptor reexpression assay revealed that none had undergone lineage commitment (fig . Assessment of cd48 sorted cells from anti - cd3 induced rag2 mice revealed the presence of cd4-committed dp thymocytes that had selectively terminated cd8 coreceptor synthesis, as well as the presence of uncommitted dp thymocytes (fig . The cd4-committed thymocytes that were present in anti - cd3induced rag2 mice expressed the phenotype of newly committed thymocytes in that they were hsa, thymic shared antigen (tsa)-1 (data not shown). In contrast, anti - cd3induced rag2 thymocytes had no cd8-committed cells among either cd48 or cd48 sorted cell populations (fig . 1, a and b). Thus, these results (a) confirm that dp thymocytes do not undergo lineage commitment in the absence of tcr cd3 signals, and (b) demonstrate that cd3 signals stimulated by anti - cd3 mabs are sufficient to induce dp thymocytes to selectively terminate cd8 coreceptor synthesis and commit to the cd4 lineage, even in the absence of clonotypic tcr chains . To determine whether signals transduced by tcr chains are indispensable for induction of cd4 commitment, we generated double knockout rag2tcr mice . In vivo injection of anti - cd3 mabs into ragtcr double knockout mice induced the generation of dp thymocytes, as has been described (31), and signaled these cells to upregulate cd5 expression (fig . Interestingly, we found that cd48 sorted thymocytes from these anti - cd3injected mice did contain cd4-committed cells that had selectively terminated cd8 coreceptor synthesis (see fig ., no cd8-committed cells were detected in either cd48 or cd48 sorted cell populations (fig . 1, a and b). These results demonstrate that cd3-transduced signals can induce cd4 commitment in dp thymocytes in the absence of clonotypic tcr chains and in the absence of tcr chains . To determine whether signals transduced by tcr chains were able to induce cd4 commitment, we assessed lineage commitment in dp thymocytes from rag2 mice that expressed a chimeric transgenic protein consisting of the external and transmembrane domains of human cd25 and the cytosolic domains of tcr (24). The extracellular domain of this transgenic protein is recognized by anti - tac mab . Injection of anti - tac mab into ragtt mice induced the generation of dp thymocytes (fig . 1 a), as previously reported (24), and signaled them to upregulate cd5 expression (fig . We found that cd48 sorted thymocytes from these mice did contain cd4-committed cells, but did not contain any cd8-committed cells in either cd48 or cd48 sorted cell populations (see fig . 1, a and b). These results demonstrate that signals transduced by the cytosolic portion of tcr chains are sufficient to induce dp thymocytes to selectively terminate cd8 coreceptor synthesis and to undergo cd4 commitment . Next, we wished to evaluate the relationship between cd5 upregulation and cd4 commitment in anti - cd3 signaled rag2 thymocytes . In vivo injection of a single dose of either 10 or 250 g of anti - cd3 mab induced substantial numbers of dp thymocytes in rag mice when assayed 8 d later (fig . While both injection doses induced differentiaton to the dp stage, we reasoned that only the high dose might persist long enough in vivo to stimulate a subsequent cd3 signal after dp thymocytes appeared . Indeed, only dp thymocytes from high dose injected animals had upregulated cd5 expression, and only dp thymocytes from high dose injected animals contained cd4-committed thymocytes (fig . 3). Dp thymocytes from low dose injected animals were cd5 and remained uncommitted (fig . We conclude that cd4 commitment requires cd3 signals in dp thymocytes that are of sufficient intensity to upregulate surface cd5 expression . Finally, having observed that a single injection of antibody was sufficient to stimulate cd3 or tcr chains to transduce signals that upregulated cd5 surface expression and induced cd4 commitment but not cd8 commitment, we assessed whether cd8-committed cells might appear in rag2 thymi upon antibody restimulation . In fig . 4, rag2 mice were injected with anti - cd3 mab on both days 0 and 8, and then assessed 4 d later on day 12 . Thymocytes were sorted into cd48 and cd48 populations and then assessed for coreceptor synthesis by the coreceptor reexpression assay . We found that cd48 thymocytes contained cd4-committed cells that had selectively terminated cd8 coreceptor synthesis (fig . 4, middle row), but neither sorted population contained cd8-committed cells (fig ., cd8-committed cells did not appear in rag2 thymi despite a second antibody injection and despite assessment on day 12 after the initial injection of antibody (fig ., we also failed to detect cd8-committed thymocytes on days 28 and 35 after antibody injection (data not shown). The present study demonstrates that immature dp thymocytes do not spontaneously terminate synthesis of either cd4 or cd8 coreceptor molecules . Rather, selective termination of coreceptor synthesis by immature dp thymocytes requires signals transduced by either cd3 or tcr chains, and can occur in signaled dp thymocytes that lack clonotypic tcr chains . Interestingly, cd3-signaled dp thymocytes upregulated cd5 expression and selectively terminated cd8 coreceptor synthesis, but did not selectively terminate cd4 coreceptor synthesis . Thus, cd4 commitment is induced in dp thymocytes by cd3 signals that are of sufficient intensity to upregulate cd5 expression . The results of the present study are not readily compatible with either instructional (1, 2) or stochastic / selection (37) models of lineage commitment . That is, the instructional model cannot explain the presence of any lineage - committed rag2 thymocytes in response to lineage - neutral cd3 and tcr signals, whereas the stochastic / selection model cannot explain why cd3 and tcr signals only induced rag2 thymocytes to become cd4 committed without inducing an equal number to become cd8 committed . In contrast with these two models of lineage commitment, the present results are concordant with the asymmetric commitment model of lineage commitment (8, 13). That is, our results are consistent with the concept that cd4 commitment, unlike cd8 commitment, can occur in the absence of lineage - specific signals . Importantly, the present results extend the asymmetric commitment model by demonstrating that cd4 commitment does not occur spontaneously in unsignaled dp thymocytes, but rather is induced by lineage - neutral signals transduced by cd3 and/or tcr chains . Importantly, we found that cd3 signaling did not induce all dp thymocytes in the present study to become cd4 committed, as only a small minority of cd3-signaled rag2 thymocytes terminated cd8 coreceptor synthesis, even though all dp thymocytes had upregulated cd5 surface expression . This observation is consistent with our recent finding that only a small fraction of cd5 dp thymocytes in normal mice have undergone lineage commitment, with most cd5 dp thymocytes remaining lineage uncommitted (20). Our current perspective is that cd3 signaling drives cd5 dp thymocytes to become cd5, at which point they developmentally await the induction of lineage - specific signals . If lineage - specific signals are generated, perhaps by notch proteins (12), cd5 dp thymocytes terminate cd4 coreceptor synthesis and become cd8 committed . But if lineage - specific signals are not generated, cd5 dp thymocytes terminate cd8 coreceptor synthesis and become cd4 committed . We do not know how long cd5 dp thymocytes await the appearance of lineage - specific signals before terminating cd8 coreceptor synthesis, and we do not know whether there are intrathymic signals that regulate the timing of this event . Finally, the present results are remarkable in their demonstration that cd3-signaled dp thymocytes could undergo cd4 commitment even in the absence of clonotypic tcr chains . Of course, dp thymocytes express surface molecules in addition to clonotypic tcr chains that can stimulate cd3 signaling, such as cd2, cd5, thy-1, and ly6 (3234). Consequently, it is conceivable that engagement of such nonclonotypic molecules by intrathymic ligands can inefficiently mimic clonotypic tcr chains in their ability to stimulate cd3 signals that induce cd5 dp thymocytes to become cd5, and so eventually to become cd4 committed . The absence of cd5 dp thymocytes and cd4-committed cells in tcr mice does not rule out intrathymic signaling by nonclonotypic molecules because surface cd3 expression is probably too low on tcr thymocytes to transduce such signals . Indeed, stimulation of cd3 signals by nonclonotypic receptors may provide one explanation for the appearance of small numbers of cd4-committed dp thymocytes in mhc - deficient thymi (8). Purified populations of cd48 thymocytes (a) and cd48 thymocytes (b) were obtained by electronic cell sorting according to the indicated sorting gates superimposed on the starting thymocyte populations (left columns). Sorted thymocyte populations were stripped of surface coreceptor molecules by treatment with low doses of pronase, after which they were placed in suspension cultures at 4c (middle panels) or 37c (right panels) for 1216 h and restained for cd4 and cd8 surface expression . The coreceptor reexpression assay detects the coreceptor molecules that individual thymocytes synthesized during the 37c culture, and is dependent upon new transcription and new protein synthesis (8). Sorted thymocytes that reexpress both cd4 and cd8 coreceptor proteins are lineage - uncommitted cells; those reexpressing only cd4 are cd4 committed; and those reexpressing only cd8 are cd8 committed . Cells cultured at 4c do not reexpress surface coreceptor molecules so that their cd4cd8 histograms reflect whatever coreceptor molecules that potentially remain after pronase treatment (middle columns). As we have previously described (8), the anti - cd4 mab used to prepare thymocytes for cell sorting minimally interferes with stripping of surface cd4 molecules by pronase, resulting in a small number of residual cd4 molecules remaining on the cell surface . Consequently, to highlight changes in coreceptor reexpression during 37c cultures, histogram boxes were drawn based on the 4c profiles of each sorted and pronase - stripped cell population . The frequency of cells in each box is indicated . The number of the thymocytes obtained in these experimental mice were the following: tcr (9 10 cells), -irradiated rag2 (4 10 cells), anti - cd3 mab injected rag2 (1.1 10 cells), anti - cd3 mab injected ragtcr (8 10 cells), and anti - tac mab thymocytes from the indicated experimental mice were stained with anti - cd5 mab (solid line) or an irrelevant antibody (shaded curve). Cd5 expression on normal b6 thymocytes stained at the same time as a positive control is also shown for comparison (dotted line). Rag mice received one intraperitoneal injection of either 250 g or 10 g of affinity - purified anti - cd3 mab . 8 d later, thymocytes were sorted according to the indicated gates and assessed for lineage commitment by the coreceptor reexpression assay (left panels). Unsorted thymocytes were placed in culture for 12 h at 4c, at which temperature thymocyte phenotype is stable, and then assessed for surface cd5 expression (right panels). The dotted line represents cd5 expression on normal b6 thymocytes stained at the same time as a positive control and is shown for comparison . The number of thymocytes obtained on day 8 were 11.5 10 cells and 34 10 cells with the injection of 250 g and 10 g, respectively . Cd8-committed thymocytes do not appear in rag2 thymi even after two injections of anti - cd3 mab . Rag2 mice were injected with 250 g of affinity - purified anti - cd3 mab on both day 0 and 8 . On day 12, thymocytes were harvested, sorted into cd48 and cd48 populations, and assessed by the coreceptor reexpression assay for appearance of cd4-committed and cd8-committed cells.
|
Alzheimer disease (ad) is a rapidly expanding health crisis affecting over 26 million people, with the prevalence expected to rise dramatically (brookmeyer et al ., 2007). Research examining ad biomarkers suggests a rise in underlying pathology a decade or more before the onset of dementia, and continuing throughout the early stages of the disease (bateman et al ., 2012; benzinger et al ., 2013; jack et al ., there is need to translate such biomarkers from a laboratory setting into a clinical environment to assist with disease diagnosis and prognosis . The hallmarks of ad pathology are the formation of amyloid beta (a) plaques and the aggregation of tau into neurofibrillary tangles (nfts) (braak and braak, 1995; hardy and higgins, 1992). Early elevations in such pathology are subsequently followed by hypometabolism, structural atrophy, and cognitive impairment (bateman et al ., 2012; benzinger et al ., 2013; jack et al ., 2010). Atrophy of cortical and subcortical gray matter has long been noted in ad (e.g. Fox et al ., 1996; gordon et al ., 2013; scheltens et al ., 1992). Less attention has been paid to white matter damage and declines tied to ad disease progression . Early work with computed tomography (ct) images noted increased incidence of white matter leukoaraiosis in individuals with ad (blennow et al ., 1991; rezek et al ., similar results were found with the introduction of magnetic resonance imaging (mri) (barber et al ., 1999; fazekas et al ., 1987). In this initial work the most common way to characterize white matter damage was to use semi - quantitative scales (fazekas et al ., 1987; kapeller et al ., 2003; scheltens et al ., 1995) to grade the severity of white matter hyperintensities (wmhs) on t2-weighted or fluid - attenuated inversion recovery (flair) scans . At a pathological level, higher ratings on these scales are associated with both cognitive decline (debette et al . ., 2008) and cortical atrophy (capizzano, 2004; schmidt et al ., 2005). In general there is a rising interest on the clinical importance of wmh across diseases (debette and markus, 2010). The relationship between wmh and amyloid is complex and has not been fully evaluated, although there are suggestions that both contribute to cognitive impairment (provenzano et al ., 2013). White matter damage may be both a downstream result of elevated a levels, as well as a marker of comorbid pathology (e.g. Cardiovascular disease). A leads to oxidative damage and the formation of free radicals (hensley et al . 1996), and the administration of a damages oligodendrocytes in vitro (roth et al ., 2005) and in vivo (jantaratnotai et al ., 2003). Conversely damage to myelin releases iron molecules that promote a oligomerization (bartzokis et al . An initial rise in a would damage white matter, which in turn would elevate a levels, subsequently leading to more white matter damage in a continuing cyclical process . Alternatively, white matter lesions from a secondary process (e.g. Head injury) may release iron, and initiate or accelerate the pathological influences of a on white matter . Such results can been seen in the literature as circulating levels of a are associated with wmh (gurol et al ., 2006), and baseline levels of white matter lesions predict an accelerated accumulation of amyloid over time (grimmer et al ., 2012). Using semi - quantitative scales, white matter lesions have often been seen in individuals with compromised cardiovascular systems (breteler et al ., 1994; consistent with these results, there has been a suggestion that ad may have a larger vascular component than often recognized (bartzokis, 2011; de la torre, 2010; launer, 2002). Indeed, in epidemiological studies, cardiovascular risk factors such as diabetes or stroke lead to increased risk of ad (luchsinger et al ., damage to the cardiovascular system, such as a thickening and sclerosis of arteries, may lead to an impaired drainage of molecules such as a (huang et al ., it is of interest to know whether the incidence of wmhs provides any diagnostic value above and beyond levels of a pathology in the brain . White matter damage in the brain can be assessed using visual ratings of wmh, quantification of wmh volumes, and using diffusion tensor imaging (dti). While there is a clear utility to quantifying damage using dti and wmh volumetric measurement, visual rating scales are an easily obtained radiological measure available across both research and clinical settings . Here we examine the relationships between a deposition, white matter damage, and dementia in a population of cognitively normal, very mildly demented, and mildly demented individuals . Based upon prior work in the literature, we hypothesize that more severe semi - quantitative ratings of white matter damage will be related to an impaired cognitive status . Middle aged and older adults were drawn from studies on aging and dementia conducted through the knight alzheimer's disease research center (adrc) at washington university in st . Louis . Based upon the clinical dementia rating (cdr) scale (morris, 1993) participants were classified as cognitively normal (cdr = 0, n = 397, female = 256), very mildly demented (cdr = 0.5, n = 51, female = 20), or mildly demented (cdr = 1, n = 11, female = 1). Individuals with dementia using these diagnoses individuals whose dementia was thought to be from a non - alzheimer cause (e.g. Lewy bodies, vascular dementia, depression) were excluded from all analyses . The population ranged in age from 42 to 90, with a mean age of 68.5 years (table 1). All participants underwent a structural imaging session as well as positron emission tomography (pet) to estimate amyloid deposition using [c] pittsburgh compound b (pib) (klunk et al ., 2004). All procedures where approved by washington university's institutional review board and were conducted in accordance with the declaration of helsinki . High - resolution t2-weighted images were acquired on a siemens trio 3 t scanner (siemens medical systems, iselin, nj). Scan parameters were: repetition time (tr) of 3200 ms, echo time (te) of 455, flip angle (fa) = 120, with a 256 256 field of view, and a 1 mm isotropic resolution . A trained neurologist (s.n . ), blind to clinical diagnosis, examined the t2-weighted images . The presence and severities of wmh were rated using criteria outlined by fazekas et al . Briefly, periventricular hyperintensities (pvwmhs) were rated as follows: 0 absence of wmh; 1 caps or pencil - thin linings; 2 halos; and 3 irregular pvh extending into deep white matter . Ratings of wmh in the deep white matter (dwmh) were rated as follows: 0 absence of wmh, 1 solitary foci; 2 the beginning aggregation of foci; and 3 large confluent areas of wmh . Examples are given in fig . 1 and distributions of scores across the three clinical groups binding potentials were calculated for multiple regions of interest (rois) derived from freesurfer using a cerebellar reference for regions - of - interest . The raw time activity curve for each region was adjusted by a csf dilution factor in a given voxel to yield partial volume corrected data . An average across both left and right lateral orbitofrontal, interior parietal, precuneus, rostral middle frontal, superior frontal, superior temporal, and middle temporal rois yielded the mean cortical binding potential (mcbp). All analyses used mcbp as a continuous variable . As supplementary analyses, individuals were also codified as pib positive or negative using a previously published value from our center of unadjusted mcbp of 0.18 (vlassenko et al ., 2011). A second supplementary analysis defined the cutoff on partial - volume corrected mcbp data derived from a roc analysis comparing 212 cognitively normal individuals to 59 cdr = 0.5 with an ad diagnosis . Using this approach the partial - volume adjusted mcbp cutoff was determined to be .23, which was the point that maximized the youden index (sensitivity + specificity 1)., individuals were also codified as pib positive or negative using a previously published value from our center of unadjusted mcbp of 0.18 (vlassenko et al ., 2011). A second supplementary analysis defined the cutoff on partial - volume corrected mcbp data derived from a roc analysis comparing 212 cognitively normal individuals to 59 cdr = 0.5 with an ad diagnosis . Using this approach the partial - volume adjusted mcbp cutoff was determined to be .23, which was the point that maximized the youden index (sensitivity + specificity 1). 1 . We assessed the presence (1) or absence (0) of a history of hypertension, heart attack, atrial fibrillation, angioplasty, bypass surgery, congestive heart failure, stroke, transient ischemic attack, and diabetes . Height information and weight information were used to calculate bmi, and coded for the presence or absence of obesity (bmi> 30). An aggregate vascular risk factor was created by summing the scores of all variables (possible range of 010) (actual range 06, mean 1.14, median 0). Across the entire sample there was a modest bivariate correlation between a history of hypertension and pvwmh (r = .21, p <.0001) and dwmh (r = .19, p <.0001) scores . Similarly the summary vascular risk score significantly correlated with both pvwmh (r = .17, p <.001) and dwmh (r = .16, p <.001). Unsurprisingly, a history of hypertension and the vascular risk were highly correlated (r = .65, p <initial stepwise logistic regressions examined the effects of age, gender, mcbp and a measure of white matter damage (either dwmh or pvwmh). Models additionally allowed for an interaction between white matter damage and mcbp to enter the model . Models tested whether each predictor discriminated between cognitively normal individuals and demented individuals (combined cdr = 0.5 and 1). For the gender variable women were coded as 0 and males as 1 . For each predictor the exponentiation of the beta coefficient (exp(b)) indicates the odds ratio, or the change in relative log odds of being in the tested group (e.g. Cdr> 0) relative to the reference group (e.g. Cdr = 0) with a one unit change in the predictor . If the odds ratio for a given predictor (e.g. Age) is> 1, then an increase in the predictor indicates a greater likelihood to be in the test group (e.g. Cdr> 0). If the odds ratio is <1, then the outcome is more likely to be in the reference group (e.g. Cdr = 0). For all analyses an increase in the exp(b) indicated greater cognitive impairment . An additional way to examine the data was presented by calculating the area under the curve (auc) values from receiver operating characteristics (roc) curves separating cognitively normal individuals from demented individuals . The first model looked at the auc only using the initial covariates of age and gender . A second set of models examined the auc using the covariates and then one predictor of interest (i.e. Mcbp, pvwmh, or dwmh). A final set of models examined the auc when using covariates, mcbp, and either of the wmh measures . Significant changes in the auc were assessed using delong's test for correlated roc curves (delong et al ., 1988) using a package implemented in r (robin et al ., 2011). These analyses test whether each predictor of interest (e.g. Wmh, mcbp, age) significantly differs between each level of the dependent variable (cdr 0, 0.5, and 1). The structure of these models was set to be identical to that revealed by the stepwise logistic regression comparing cognitively normal to all demented individuals . Middle aged and older adults were drawn from studies on aging and dementia conducted through the knight alzheimer's disease research center (adrc) at washington university in st . Louis . Based upon the clinical dementia rating (cdr) scale (morris, 1993) participants were classified as cognitively normal (cdr = 0, n = 397, female = 256), very mildly demented (cdr = 0.5, n = 51, female = 20), or mildly demented (cdr = 1, n = 11, female = 1). Individuals with dementia using these diagnoses individuals whose dementia was thought to be from a non - alzheimer cause (e.g. Lewy bodies, vascular dementia, depression) were excluded from all analyses . The population ranged in age from 42 to 90, with a mean age of 68.5 years (table 1). All participants underwent a structural imaging session as well as positron emission tomography (pet) to estimate amyloid deposition using [c] pittsburgh compound b (pib) (klunk et al ., 2004). All procedures where approved by washington university's institutional review board and were conducted in accordance with the declaration of helsinki . High - resolution t2-weighted images were acquired on a siemens trio 3 t scanner (siemens medical systems, iselin, nj). Scan parameters were: repetition time (tr) of 3200 ms, echo time (te) of 455, flip angle (fa) = 120, with a 256 256 field of view, and a 1 mm isotropic resolution . A trained neurologist (s.n . ), blind to clinical diagnosis, examined the t2-weighted images . The presence and severities of wmh were rated using criteria outlined by fazekas et al . Briefly, periventricular hyperintensities (pvwmhs) were rated as follows: 0 absence of wmh; 1 caps or pencil - thin linings; 2 halos; and 3 irregular pvh extending into deep white matter . Ratings of wmh in the deep white matter (dwmh) were rated as follows: 0 absence of wmh, 1 solitary foci; 2 the beginning aggregation of foci; and 3 large confluent areas of wmh . Examples are given in fig . 1 and distributions of scores across the three clinical groups the intraclass correlation was .91 for periventricular ratings and .98 for deep white matter ratings . Binding potentials were calculated for multiple regions of interest (rois) derived from freesurfer using a cerebellar reference for regions - of - interest . The raw time activity curve for each region was adjusted by a csf dilution factor in a given voxel to yield partial volume corrected data . An average across both left and right lateral orbitofrontal, interior parietal, precuneus, rostral middle frontal, superior frontal, superior temporal, and middle temporal rois yielded the mean cortical binding potential (mcbp). All analyses used mcbp as a continuous variable . As supplementary analyses, individuals were also codified as pib positive or negative using a previously published value from our center of unadjusted mcbp of 0.18 (vlassenko et al ., 2011). A second supplementary analysis defined the cutoff on partial - volume corrected mcbp data derived from a roc analysis comparing 212 cognitively normal individuals to 59 cdr = 0.5 with an ad diagnosis . Using this approach the partial - volume adjusted mcbp cutoff was determined to be .23, which was the point that maximized the youden index (sensitivity + specificity 1)., individuals were also codified as pib positive or negative using a previously published value from our center of unadjusted mcbp of 0.18 (vlassenko et al ., 2011). A second supplementary analysis defined the cutoff on partial - volume corrected mcbp data derived from a roc analysis comparing 212 cognitively normal individuals to 59 cdr = 0.5 with an ad diagnosis . Using this approach the partial - volume adjusted mcbp cutoff was determined to be .23, which was the point that maximized the youden index (sensitivity + specificity 1). We assessed the presence (1) or absence (0) of a history of hypertension, heart attack, atrial fibrillation, angioplasty, bypass surgery, congestive heart failure, stroke, transient ischemic attack, and diabetes . Height information and weight information were used to calculate bmi, and coded for the presence or absence of obesity (bmi> 30). An aggregate vascular risk factor was created by summing the scores of all variables (possible range of 010) (actual range 06, mean 1.14, median 0). Across the entire sample there was a modest bivariate correlation between a history of hypertension and pvwmh (r = .21, p <.0001) and dwmh (r = .19, p <.0001) scores . Similarly the summary vascular risk score significantly correlated with both pvwmh (r = .17, p <.001) and dwmh (r = .16, p <.001). Unsurprisingly, a history of hypertension and the vascular risk were highly correlated (r = .65, p <.00001). Initial stepwise logistic regressions examined the effects of age, gender, mcbp and a measure of white matter damage (either dwmh or pvwmh). Models additionally allowed for an interaction between white matter damage and mcbp to enter the model . Models tested whether each predictor discriminated between cognitively normal individuals and demented individuals (combined cdr = 0.5 and 1). For the gender variable women were coded as 0 and males as 1 . For each predictor the exponentiation of the beta coefficient (exp(b)) indicates the odds ratio, or the change in relative log odds of being in the tested group (e.g. Cdr> 0) relative to the reference group (e.g. Cdr = 0) with a one unit change in the predictor . If the odds ratio for a given predictor (e.g. Age) is> 1, then an increase in the predictor indicates a greater likelihood to be in the test group (e.g. Cdr> 0). If the odds ratio is <1, then the outcome is more likely to be in the reference group (e.g. Cdr = 0). For all analyses an increase in the exp(b) indicated greater cognitive impairment . An additional way to examine the data was presented by calculating the area under the curve (auc) values from receiver operating characteristics (roc) curves separating cognitively normal individuals from demented individuals . The first model looked at the auc only using the initial covariates of age and gender . A second set of models examined the auc using the covariates and then one predictor of interest (i.e. Mcbp, pvwmh, or dwmh). A final set of models examined the auc when using covariates, mcbp, and either of the wmh measures . Significant changes in the auc were assessed using delong's test for correlated roc curves (delong et al ., 1988) using a package implemented in r (robin et al ., 2011). These analyses test whether each predictor of interest (e.g. Wmh, mcbp, age) significantly differs between each level of the dependent variable (cdr 0, 0.5, and 1). The structure of these models was set to be identical to that revealed by the stepwise logistic regression comparing cognitively normal to all demented individuals . There were more males in the cdr 0.5 (= 12.2, p <.0005) and cdr 1 (= 14.1, p <.0005) groups relative to cdr 0 . Compared to cdr 0 individuals, cdr 0.5 individuals were older (t = 7.0, p <.000001), had lower mmse (13.2, p <.000001), greater mcbp (t = 8.3, p <.00001), and a greater proportion of pib+ individuals (= 45.2, p <.000001). Similarly relative to cdr 0 individuals those with a cdr = 1 were older (t = 3.81, p <.001), had lower mmse (18.9, p <.00001), and a greater proportion of pib+ individuals (= 22.7, p <.000005). Cdr 1 individuals had lower mmse than cdr 0.5 individuals but did not significantly differ in any other way . As age and gender differed across groups, they were considered as covariates when examining the effects of wmh and amyloid on cognition . The full results from the initial logistic regressions are presented in table 2 . For all significant effects, an increase in the odds ratio for the measure of interest (e.g. Age) indicated a greater likelihood of being cognitively impaired . When examining mcbp alongside pvwmh there was a significant effect of age (exp(b) 1.08, p <0.001), gender (exp(b) 3.50, p <0.001), mcbp (exp(b) 3.68, p <0.0001), and pvwhm (exp(b) 2.03, p <0.01). When examining mcbp alongside dwmh there was a significant effect of age (exp(b) 1.10, p <0.001), gender (exp(b) 3.60, p <0.001), mcbp (exp(b) 3.63, p <0.0001), and dwmh (exp(b) 1.52, p <0.05). The interaction terms between mcbp and wmh were non - significant and not entered into either model . 2, which depicts the distribution of the fazekas scores for periventricular white matter hyperintensities (pvwmhs) and deep white matter hyperintensities (dwmhs) across the three groups . Treating amyloid deposition as a dichotomous pib+/ variable did not substantively change the models (supplementary tables 1 and 2). It is possible to gain a bit more understanding of the size of these effects by calculating the roc auc . When predicting dementia status solely from the covariates (age and gender) the auc is .831 . When adding mcbp to the model the auc significantly increased to .875 (z = 2.41, there were non - significant increases in the auc when adding only the pvwmh (auc.849, z = 1.34, p = .18) or dwmh (auc = .836, z = .5242, p = .60) to the covariate only model . Including both mcbp and pvwmh led to an auc of .886 (z = 2.63, p <.01) and auc of .876 when using mcbp dwmh (z = 2.26, p = <while significant relative to the covariate only models, the increase in auc in the models combining mcbp and wmh was not significantly different from models considering mcbp alone . Combined with the results from the logistic regressions, this suggests only modest effects of wmh above amyloid deposition . The full results from the multinomial logistic regressions are presented in tables 3 and 4 . These results are quite similar to the logistic regressions above when comparing cognitively normal individuals to either group of demented individuals . When contrasting those with very mild dementia (cdr 0.5) to those with mild dementia (cdr 1) there were no significant effects, although gender, mcbp, and dwmh demonstrated modest trends . As wmh are thought to be vascular in nature (breteler et al ., 1994), we additionally examined the initial models predicting dementia status with mcbp and measures of wmh while including a history of hypertension, or an aggregate vascular risk factor in the model . A history of hypertension was not significant in either model (pvwmh or dwmh, see table 5) and only slightly lowered the contributions of wmh to the model, but such effects were still significant . The aggregate vascular risk factor was significant in both models, but again the effects on the wmh scores were minor (table 6). There were more males in the cdr 0.5 (= 12.2, p <.0005) and cdr 1 (= 14.1, p <.0005) groups relative to cdr 0 . Compared to cdr 0 individuals, cdr 0.5 individuals were older (t = 7.0, p <.000001), had lower mmse (13.2, p <.000001), greater mcbp (t = 8.3, p <.00001), and a greater proportion of pib+ individuals (= 45.2, p <.000001). Similarly relative to cdr 0 individuals those with a cdr = 1 were older (t = 3.81, p <.001), had lower mmse (18.9, p <.00001), and a greater proportion of pib+ individuals (= 22.7, p <.000005). Cdr 1 individuals had lower mmse than cdr 0.5 individuals but did not significantly differ in any other way . As age and gender differed across groups, they were considered as covariates when examining the effects of wmh and amyloid on cognition . The full results from the initial logistic regressions are presented in table 2 . For all significant effects, an increase in the odds ratio for the measure of interest (e.g. Age) indicated a greater likelihood of being cognitively impaired . When examining mcbp alongside pvwmh there was a significant effect of age (exp(b) 1.08, p <0.001), gender (exp(b) 3.50, p <0.001), mcbp (exp(b) 3.68, p <0.0001), and pvwhm (exp(b) 2.03, p <0.01). When examining mcbp alongside dwmh there was a significant effect of age (exp(b) 1.10, p <0.001), gender (exp(b) 3.60, p <0.001), mcbp (exp(b) 3.63, p <0.0001), and dwmh (exp(b) 1.52, p <0.05). The interaction terms between mcbp and wmh were non - significant and not entered into either model . 2, which depicts the distribution of the fazekas scores for periventricular white matter hyperintensities (pvwmhs) and deep white matter hyperintensities (dwmhs) across the three groups . Treating amyloid deposition as a dichotomous pib+/ variable did not substantively change the models (supplementary tables 1 and 2). It is possible to gain a bit more understanding of the size of these effects by calculating the roc auc . When predicting dementia status solely from the covariates (age and gender) the auc is .831 . When adding mcbp to the model the auc significantly increased to .875 (z = 2.41, p <there were non - significant increases in the auc when adding only the pvwmh (auc.849, z = 1.34, p = .18) or dwmh (auc = .836, z = .5242, p = .60) to the covariate only model . Including both mcbp and pvwmh led to an auc of .886 (z = 2.63, p <.01) and auc of .876 when using mcbp dwmh (z = 2.26, p = <.05). While significant relative to the covariate only models, the increase in auc in the models combining mcbp and wmh was not significantly different from models considering mcbp alone combined with the results from the logistic regressions, this suggests only modest effects of wmh above amyloid deposition . The full results from the multinomial logistic regressions are presented in tables 3 and 4 . These results are quite similar to the logistic regressions above when comparing cognitively normal individuals to either group of demented individuals . When contrasting those with very mild dementia (cdr 0.5) to those with mild dementia (cdr 1) there were no significant effects, although gender, mcbp, and dwmh demonstrated modest trends . As wmh are thought to be vascular in nature (breteler et al ., 1994), we additionally examined the initial models predicting dementia status with mcbp and measures of wmh while including a history of hypertension, or an aggregate vascular risk factor in the model . A history of hypertension was not significant in either model (pvwmh or dwmh, see table 5) and only slightly lowered the contributions of wmh to the model, but such effects were still significant . The aggregate vascular risk factor was significant in both models, but again the effects on the wmh scores were minor (table 6). In the current analyses we examined whether measures of amyloid deposition and white matter damage predict cognitive impairment . We found that both amyloid burden, estimated by pib mcbp, as well as measures of wmh independently discriminate between cognitively normal individuals and those with very mild or mild dementia . This is unsurprising as the correlation between ratings of dwmh and pvwmh lesions was .58 (p the fazekas visual rating of white matter disease was associated with a greater risk of ad . This can clearly been seen in how the distribution of the fazekas scores shifts across groups in fig . 2 . Individuals who are cognitively normal have highly right skewed distributions, with the vast majority of individuals having no observable white matter damage . As dementia severity increases, the scores become more and more left skewed as higher proportions of the population accrue white matter damage . Although the graphs in fig . 2 suggest differences between cdr = 0.5 and 1 individuals the effects were not statistically significant . This is most likely due to the modest sample size of mildly demented subjects (cdr = 1, n = 11). Alternatively these markers may possess nonlinear trajectories that do not significantly differ across graded levels of dementia severity . In our cohort all of the individuals with a cdr = 1 had a primary clinical diagnosis of dementia of the alzheimer's type at baseline . Of the 51 individuals with a cdr rating of 0.5, 21 had a dat diagnosis at baseline and 14 received a diagnosis at a later clinical point . Along with the high levels of amyloid deposition, this would suggest that the majority of the impaired cohort are representative of an ad trajectory . There were no significant differences in age, gender composition, or severity of white matter damage between those with and without an ad diagnosis . This suggests that the white matter effects are not being driven by a small subsample of individuals who are demented but are not on an ad trajectory . Many healthy older adults show elevated levels of amyloid without significant cognitive impairment (arriagada et al ., 1992). Additionally there are numerous risk factors for a clinical diagnosis of ad including a family history of ad (breitner et al ., 1988), the apoe 4 genotype (corder et al ., 1993), head trauma (mortimer et al ., 1985), and diabetes (luchsinger et al ., 2001). The additive effects in our study of whm and pib deposition are consistent with a broader view of ad that suggests that multiple factors can influence substantial cognitive decline and dementia . For example after head trauma there is a deposition of a in the cortex, and this deposition is increased in individuals with the apoe 4 genotype (mayeux et al ., 1995). The results of our analyses are consistent with a large body of prior work linking white matter damage with impaired cognition (bozzali et al ., 2002;, 2010; frisoni et al ., 2007; head et al ., 2004; prins et al ., 2004). An increased prevalence of white matter damage is thought to be mainly vascular in nature, as hypertension, stroke, and diabetes all lead to increases in white matter lesions (debette and markus, 2010; pico et al . There were modest correlations (rs <.2) between measures of vascular health and wmh . Further an aggregate measure of vascular risk was itself predictive of dementia status above the effects of amyloid deposition and wmh . However measures of wmh were still predictive of dementia status after including vascular risk as a covariate . This may be due to the fact that our measures of vascular health are imperfect as they are derived from self - report and do not account for medication usage . Although the examinations presented here indicated unique statistical effects of age, mcbp, and wmh this does not necessarily mean that the biological processes these values represent are truly orthogonal processes . One of the greatest challenges facing ongoing studies of ad is how to tease apart the contributions of comorbid pathologies . Large cohort studies are just now reaching the point to investigate modifiers (e.g. Cardiovascular health, stroke, diabetes, head trauma) of longitudinal ad biomarker trajectories . Individuals suffering from autosomal dominant ad become demented at a much earlier age than those with sporadic ad . Due to the young age of onset of clinical symptoms, this population may provide greater insight into the relationship between white matter damage and ad removed from age - related comorbidities such as cardiovascular health . The current work demonstrates a significant relationship between both levels of amyloid deposition and white matter damage on cognition . The sample contained only a modest number of mildly demented individuals (cdr = 1), limiting our ability to detect differences with progressive increases in dementia severity . As commonly done in the literature, our visual ratings were made on t2-weighted sequences, although more precise measures may have been obtained using a more optimal sequence (e.g. Flair). Additionally, although visual ratings of wmh such as the fazekas rating scale have a clear utility, they do not provide the fine - grained detail as would be obtained from a quantification of wmh volume . Finally, although the fazekas scale separates lesions into periventricular and deep white matter scores, three - dimensional renderings of typical lesions suggest that such lesions are part of the same process rather than representing disparate effects . The work presented here demonstrated the detrimental influences of advancing age, amyloid deposition in the brain, and white matter damage . These factors independently discriminated healthy controls from very mildly and mildly demented individuals . From a clinical standpoint, this suggests that easily available radiological measures of white matter health could be an asset in disease diagnosis in addition to psychometric testing and ad biomarkers such as amyloid imaging . 1distributions of unadjusted mean cortical binding potentials in cognitively normal (left) and demented (right) participants . Distributions of unadjusted mean cortical binding potentials in cognitively normal (left) and demented (right) participants.
|
Periprosthetic joint infection (pji) is a devastating complication seen in total joint arthroplasty (tja) patients . It could lead to prolonged hospitalization, repeated surgical intervention, significant permanent deformity, or even definitive loss of the implant . The symptoms of pji are often nonspecific, which makes the diagnosis of pji quite challenging . In caring for a painful joint arthroplasty, the ability to distinguish between septic and aseptic failures of the prosthesis is critical as the treatment for pji necessitates unique surgical strategies that aim to eradicate the infecting organism(s). Traditionally, the hematological diagnosis of pji is performed by measuring inflammatory factors of white blood cell (wbc) levels, erythrocyte sedimentation rate (esr), and serum c - reactive protein (crp). In addition, microbiology analysis of synovial fluid and periprosthetic tissue using histology and synovial fluid culture and imaging tests such as enhanced computed tomography bone scanning, magnetic resonance imaging, and positron emission tomography are also used . However, some of these results are nonspecific for pji, and the test results have to be combined with the clinical history and symptoms; thus, a more specific and sensitive routine for pji diagnosis is required . To address the inconsistency of different tests, the american academy of orthopedic surgeons (aaos) published their first guideline in 2010 as a reference for the diagnosis of pji, in which esr and crp were used as screening tests and joint aspiration should be performed when the level of these markers are elevated . Then, in 2012, the musculoskeletal infection society (msis) renewed with a consensus statement providing a concise definition of a pji . Although the msis definition provides a standard for definitive retrospective diagnosis and research, its complexity makes it difficult to use in daily clinical practice . The ideal method of pji diagnosis would be a single test or panel that is highly sensitive, specific, and simple to interpret . In recent years, researches on pji diagnosis have started to focus on synovial fluid instead of serum, since synovial fluid is the site of primary infection, and the diagnosis should be more sensitive than that of serum theoretically . Studies have revealed that number of antimicrobial peptides and inflammatory cytokines including crp, interleukin (il)-1, il-6, il-17a, interferon-, tumor necrosis factor-, defensin, cathelicidin ll-37, and so on in synovial fluid could be used as biomarkers for diagnosis . Crp is a protein that has long been measured in the serum as an indicator of infection, and it has already become a well - known protein in the orthopedic community . Until now, several studies have suggested that the crp levels in synovial fluid may serve as a simple and cost - effective means for improving the diagnosis of pji as the local crp is thought to enhance complement activation and phagocytosis . However, there are also studies concluded that crp from synovial fluid does not offer a diagnostic advantage in the detection of pjis after comparing the value of synovial fluid crp with serum crp . To address this controversy, we believe that establishing a prompt, precise, and convenient diagnostic guideline based on current evidence, consensus, expert opinions, and reviews is necessary . Therefore, in this study, we aim to conduct a meta - analysis to investigate the diagnostic accuracy of synovial fluid crp for diagnosing pji . Ultimately, this will improve the management of patients with pji as an effective treatment of pji requires an accurate and quick diagnosis . To the best of our knowledge, our study is the first meta - analysis that evaluates the clinical utility of synovial fluid crp in the diagnosis of pji . In our study, we compared the diagnostic performance of synovial fluid crp with the consensus - based guidelines . The methodological approach to evidence searching and synthesis described in this protocol was based on the cochrane collaboration's diagnostic test accuracy methods . In our study, we performed a literature search, screened the studies identified, and selected the studies that meet the eligibility criteria . We then extracted the data from the selected studies and assessed the eligible studies by means of the revised quality assessment of diagnostic accuracy studies (quadas-2) criteria . Statistical analysis, evidence synthesis, and report compilation were carried out as the steps below . We strictly adhered to standards of the preferred reporting items for systematic reviews and meta - analyses in reporting the findings of this review . We searched the electronic databases including pubmed, embase, web of science, the cochrane library, and science direct for entries recorded from the time of database inception to december 2015 . Prosthesis - related infections to represent the disease, synovial fluid or fluid, synovial to represent the source of our target biomarker, and c - reactive protein or protein, c - reactive as our target index . Studies that were related with patients suffering from the hip, knee, and shoulder joint arthroplasties or investigated our target biomarker were included . Therefore, animal - only studies and studies that do not report data on the diagnostic performance of our target index were excluded . Screening was performed in a two - step process: title / abstract screening and full - text screening . Two researchers independently reviewed the title and abstract of each assay to select those that were likely for further screening . In the initial stage of the screening, 1015 articles should be used to reach acceptable levels of agreement among the researchers . When confronted with disagreements, two researchers had to come to a consensus about the screening methods . Following full - text screening, a list of excluded studies with reasons for exclusion was presented . Inclusion criteria were as follows: patients who have undergone knee, hip, or shoulder joint replacements; sufficient synovial fluid had to be aspirated for study method and crp of synovial fluid was detected; the diagnosis of pji was confirmed by msis or aaos; sufficient data can be extracted for the construction of a 2 2 contingency table . Exclusion criteria were as follows: unrelated biomarkers, crp of the serum, not synovial fluid; insufficient data to calculate sensitivity and specificity; case reports, commentaries, expert opinion, and narrative reviews; duplicates . The methodological quality of the included studies was appraised by an adapted version of the quadas-2, which consisted of four key domains that discussed patient selection, index test, reference standard, and flow and timing . Risk of bias assessment of the four domains and clinical applicability of the first three domains were assessed with signaling questions . Questions were answered as yes for low risk of bias / concerns, no for high risk of bias / concerns, or the following information was extracted: (1) study characteristics including author, year of publication, country, design, sample size, and number analyzed for each study; (2) population characteristics including patients mean age, sex; (3) intervention characteristics including method of sampling, method of measuring, and threshold; (4) gold standard including msis or aaos; (5) outcomes including false / true positive, false / true negative from 2 2 table for diagnostic studies, sensitivity and specificity, positive likelihood ratio (plr), and negative likelihood ratio (nlr). Data were extracted by a single reviewer with all outcomes and then verified by the other reviewers . For all the studies from which we constructed the 2 2 table, pooled sensitivity, specificity, plr, nlr, and the diagnostic odds ratio (dor) were calculated using the bivariate model . The summarized receiver operating characteristic (sroc) curve was constructed . In diagnostic test, if there were more than one threshold in an article, the threshold with the largest youden index was chosen . The percentage of the total variation across studies was described by the i statistic, which indicated the existence of significant heterogeneity when the value exceeded 50% . The value of i ranges from 0 to 100%, with 0 implying no observed heterogeneity, and larger values indicating increasing heterogeneity . The random effects model was chosen due to the expected clinical and statistical heterogeneity among the studies . All analyses were conducted using meta - disc software (version 14.0, unit of clinical biostatistics team, madrid, spain). The methodological approach to evidence searching and synthesis described in this protocol was based on the cochrane collaboration's diagnostic test accuracy methods . In our study, we performed a literature search, screened the studies identified, and selected the studies that meet the eligibility criteria . We then extracted the data from the selected studies and assessed the eligible studies by means of the revised quality assessment of diagnostic accuracy studies (quadas-2) criteria . Statistical analysis, evidence synthesis, and report compilation were carried out as the steps below . We strictly adhered to standards of the preferred reporting items for systematic reviews and meta - analyses in reporting the findings of this review . We searched the electronic databases including pubmed, embase, web of science, the cochrane library, and science direct for entries recorded from the time of database inception to december 2015 . Prosthesis - related infections to represent the disease, synovial fluid or fluid, synovial to represent the source of our target biomarker, and c - reactive protein or protein, c - reactive as our target index . Studies that were related with patients suffering from the hip, knee, and shoulder joint arthroplasties or investigated our target biomarker were included . Therefore, animal - only studies and studies that do not report data on the diagnostic performance of our target index were excluded . Screening was performed in a two - step process: title / abstract screening and full - text screening . Two researchers independently reviewed the title and abstract of each assay to select those that were likely for further screening . In the initial stage of the screening, 1015 articles should be used to reach acceptable levels of agreement among the researchers . When confronted with disagreements, two researchers had to come to a consensus about the screening methods . Following full - text screening, a list of excluded studies with reasons for exclusion was presented . Inclusion criteria were as follows: patients who have undergone knee, hip, or shoulder joint replacements; sufficient synovial fluid had to be aspirated for study method and crp of synovial fluid was detected; the diagnosis of pji was confirmed by msis or aaos; sufficient data can be extracted for the construction of a 2 2 contingency table . Exclusion criteria were as follows: unrelated biomarkers, crp of the serum, not synovial fluid; insufficient data to calculate sensitivity and specificity; case reports, commentaries, expert opinion, and narrative reviews; duplicates . The methodological quality of the included studies was appraised by an adapted version of the quadas-2, which consisted of four key domains that discussed patient selection, index test, reference standard, and flow and timing . Risk of bias assessment of the four domains and clinical applicability of the first three domains were assessed with signaling questions . Questions were answered as yes for low risk of bias / concerns, no for high risk of bias / concerns, or the following information was extracted: (1) study characteristics including author, year of publication, country, design, sample size, and number analyzed for each study; (2) population characteristics including patients mean age, sex; (3) intervention characteristics including method of sampling, method of measuring, and threshold; (4) gold standard including msis or aaos; (5) outcomes including false / true positive, false / true negative from 2 2 table for diagnostic studies, sensitivity and specificity, positive likelihood ratio (plr), and negative likelihood ratio (nlr). Data were extracted by a single reviewer with all outcomes and then verified by the other reviewers . For all the studies from which we constructed the 2 2 table, pooled sensitivity, specificity, plr, nlr, and the diagnostic odds ratio (dor) were calculated using the bivariate model ., heterogeneity was commonly caused by threshold effect . When threshold effect existed, there was a negative correlation between sensitivity and specificity . If there were more than one threshold in an article, the threshold with the largest youden index was chosen . The percentage of the total variation across studies was described by the i statistic, which indicated the existence of significant heterogeneity when the value exceeded 50% . The value of i ranges from 0 to 100%, with 0 implying no observed heterogeneity, and larger values indicating increasing heterogeneity . The random effects model was chosen due to the expected clinical and statistical heterogeneity among the studies . All analyses were conducted using meta - disc software (version 14.0, unit of clinical biostatistics team, madrid, spain). Of the identified 237 articles, 186 of which were excluded with the reasons of duplicates . Among the left 51 articles, 40 were excluded after reading the title and abstract, reasons including the unqualified source of crp detected and inappropriate article type (reviews, comments, or letters). After reading the whole 11 articles included, 4 were unqualified due to insufficient data, and 7 of which were considered suitable for systematic review . Among these articles, one used improper cutoff value and was excluded, leaving 6 further analyzed for meta - analysis . Graphical summary of the methodological assessment based on quadas-2 quality assessment for the 6 studies of meta - analysis is shown in figure 2 . . A total of 456 samples from patients who had undergone hip or knee joint replacement were included in the meta - analysis . All studies were conducted prospectively, and five of the studies took the synovial fluid samples before any clinical treatment while one did not mention . However, the cutoff value of synovial fluid crp varied in each study: 2.8, 3.65, 6.6, 9.5, and 12.2 mg / l, respectively . In addition, to determine synovial fluid crp, enzyme - linked immunosorbent assay (elisa) was used in two studies while turbid metric immunoassay or kinetic infrared immunoassay was used in the other four . As for the standard diagnosis, msis and aaos were both included since the details had an overlap with each other . Detailed characteristics of individual study are summarized in table 1, and detailed number of patients involved in each study and their diagnosis results are illustrated in table 2 . Characteristics of studies included for meta - analysis ua: unavailable; p: prospective study; elisa: enzyme - linked immunosorbent assay; rbm: rules - based medicine s human inflammation multianalyte profiling; msis: musculoskeletal infection society; aaos: academy of orthopedic surgeon s; crp: c - reactive protein . Data extracted for the construction of 2 2 table tp: true positive; fp: false positive; fn: false negative; tn: true negative . For the included studies, the overall pooled sensitivity was 0.92 (95% confidence interval [ci]: 0.860.96), and the pooled specificity was 0.90 [95% ci: 0.870.93, figure 3a and 3b]. The pooled plr and nlr were 9.00 (95% ci: 6.1513.16) and 0.10 [95% ci: 0.060.18, figure 4a and 4b], respectively . The area under the sroc (ausroc) was 0.9663 [standard error 0.0113, figure 5] and the dor was 101.40 (95% ci: 48.07213.93). Spearman's correlation coefficient (0.40) and the p value (0.60), which represent threshold effect were tested for the between - study variability (heterogeneity). We could also come to the same conclusion since there was no shoulder - like roc plane curve . The heterogeneity for sensitivity and specificity was tested through i range (0 and 26.8%, respectively). Pooled sensitivity and specificity of crp in the diagnosis of pji . Lr: likelihood ratio; crp: c - reactive protein; pji: periprosthetic joint infection . Summary of sroc of crp in the diagnosis of pji . Sroc: summarized receiver operating characteristics curve; crp: c - reactive protein; pji: periprosthetic joint infection; se: standard error . Summary results of bivariate model analysis sen: sensitivity; ci: confidence interval; spe: specificity; plr: positive likelihood ratio; nlr: negative likelihood ratio; dor: diagnostic odds ratio; sroc: summarized receiver - operating curve; se: standard error . Pji is currently one of the most common complications associated with tja and difficult to diagnose . The major reasons for this difficulty are the absence of specific clinical signs and symptoms, the relative lack of accurate laboratory tests, and low culture rate in isolation of pathogens due to prior therapy and formation of biofilms . The accurate definition of what constitutes pji is still controversial; therefore, several orthopedic associations have established clinical guidelines for diagnosing pji . The msis recently responded to this diagnostic difficulty by developing a definition for pji . According to the msis, the diagnosis of pji definition requires positive result in either one of two major criteria (sinus tract communication with a prosthesis or pathogen isolated by culture from two separate fluid samples) or four of six minor criteria (elevated esr, elevated crp, elevated wbc count, elevated percentage of polymorphonuclear neutrophils (pmn), presence of purulence, and greater than five neutrophils per high - power field on frozen section). By comparison, aaos guideline is similar to msis, including the following four thresholds: esr> 30 mm / h, serum crp value> 10 mg / l, synovial wbc count> 1760 cells/l for chronic infection or 10,700 cells/l for acute infection, and synovial pmn differential percentage> 73% for chronic infection or greater than 89% for acute infection . Although clinically useful, these definitions are complex and time - consuming, with the subjective interpretation of the frozen section histology and the delay in diagnosis of several independent culture results . On the contrary, synovial fluid aspirated from patients with joint replacement may provide researchers with a perfect source of pji diagnosis since host proteins with direct antimicrobial activity may play an important role in response to pathogen elimination . The promise of synovial fluid biomarkers to diagnose pji has been reported during the past few years; however, the reference standard in some of these studies is not based on msis or aaos, which makes the comprehensive analysis of these studies more challenging . According to our search results, none of the articles so far have carried out a systematic review or meta - analysis about synovial fluid biomarkers in the diagnosis of pji and we consider it necessary to fill this gap . At the initial stage of our systematic study, we used the keywords such as biological biomarkers, inflammatory cytokines, and antimicrobial peptides in the research strategy to obtain as many highly correlated articles as possible . After reviewing searched studies, only two out of five qualified studies used synovial fluid il-6 as a biomarker for diagnosis of pji; hence, the meta - analysis would not be accurate due to the limited numbers . As for -defensin, all qualified five studies came to the same conclusion that it was a biomarker with high sensitivity and specificity for the diagnosis of pji . Based on the studies we have searched, opinion toward the diagnostic value of synovial fluid crp is still in debate; thus, we focused on this biomarker . Crp release is induced by the recognition of pathogenic patterns, playing several mechanistic roles in the innate immune response and is currently assayed in the serum as a common and inexpensive test to screen for the presence of pji in msis . However, elevated concentration of serum crp is nonspecific for the diagnosis of localized infection since crp is an acute - phase reactant in numerous noninfectious diseases . After quality assessment, six articles were highly qualified for our meta - analysis, four of which used msis as the reference standard and the rest used aaos as the reference standard . In our meta - analysis, we found that synovial fluid crp showed high sensitivity and specificity for the diagnosis of pji . Pooled estimates of sensitivity and specificity were 0.92 and 0.90, respectively . Based on the low i (0 and 26.8%, respectively), spearman's correlation coefficient with p> 0.05, and inexistence of shoulder - like curve, we believe that the heterogeneity among studies is low . As for the diagnostic performance estimated by the summary roc, synovial fluid crp had a high (area under the curve [auc]> 0.9) diagnostic ability to identify pji patients based on the suggested guidelines for the interpretation for the ausroc . The dor of our pooled analysis is 101.40, indicating a high diagnostic value of synovial fluid crp in pji diagnosis . Of seven articles screened for systematic review, the one carried out by deirmengian et al . Was not included in meta - analysis due to the use of an improper cutoff value . In the article however, crp was used solely as a complementary biomarker and evaluated through roc analysis with the purpose of improving the specificity of -defensin assays used . As part of the combined algorithm, after the detection of both -defensin and crp, the false positive -defensin results could be reversed to true negative, which meant this crp cutoff value was decided only for the false positive samples . Therefore, the crp cutoff value used was relatively low and the generated 2 2 table was not suitable for the meta - analysis in this study . Two studies conducted by parvizi et al . Came to the conclusion that future investigations are needed to confirm their findings in a larger cohort . We performed this meta - analysis with the primary aim of enlarging the number of samples, which is in accordance with the studies of parvizi et al . And vanderstappen et al ., who found that intra - articular crp level could also reflect the severity of pji in their studies . Admitted that synovial fluid crp was easier to obtain, less expensive, and less dependent on the technique of obtaining and interpreting the frozen section . Found that measurement of crp in synovial fluid rather than serum using readily available assays does not offer a diagnostic advantage in the detection of pjis . However, based on our meta - analysis, the diagnostic value of synovial fluid crp is higher than that of serum crp . The pooled estimates for sensitivity, specificity, and the auc for the serum crp of the 25 included studies were 0.82 (95% ci: 0.800.84), 0.77 (95% ci: 0.760.78), and 0.877 0.016, respectively . First, despite an in - depth search of several electronic databases, there were only six articles qualified for our meta - analysis and it was impossible to further analyze and divide the studies into subgroups to explore other potential factors that may affect the heterogeneity and perform meta - regression analysis . Therefore, characteristics of patients included in each study including age, basic condition before surgery, and the existence of systematic diseases could not be fully analyzed in the meta - analysis . Second, the ideal cutoff value for the synovial fluid crp test could not be determined since the raw data were not provided in the published articles . It is hard to come to a consistent cutoff value since different laboratories used different methods to detect synovial fluid crp, for example, elisa and turbidimetric immunoassay, both of which performed antibody response with the target protein (crp). As a matter of fact, there is still no standard cutoff value for the diagnosis worldwide currently even for the same method . Thus, our meta - analysis also indicates that large - scale, prospective, randomized trials with standardized reference and detecting method, strict included, and excluded criteria are in urgent requirement to generate a more precise cutoff value for clinicians . To the best of our knowledge, our study is the first meta - analysis that evaluates the clinical utility of synovial fluid crp in the diagnosis of pji . Although the number of studies included in our meta - analysis is limited, all the included studies are highly qualified and illustrate the high sensitivity and specificity of synovial fluid crp in discriminating pji patients from those who had undergone joint replacement and showed similar symptoms . This systematic review has constituted a primary foundation for evidence - based guides on the diagnostic performance of synovial fluid, which can provide recommendations to clinicians for diagnosing pji accurately and efficiently . Meanwhile, prospective studies are in urgent need to further validate our findings, and more synovial fluid biomarkers of high sensitivity and specificity are required in clinical practice for the diagnosis of pji.
|
One - dimensional (1d) nanostructures such as nanorods, nanowires and nanotubes have attracted attention due to their novel physical and chemical properties as well as their potential use in a wide range of advanced applications in the past decade . As a consequence, many synthetic methods have been developed to prepare various 1d nanostructures [3 - 6]. Of particular interest is the preparation of 1d nanostructure of tungsten trioxides (wo3) and its suboxides (wo3 x). Wo3 is used extensively as materials for electrochromic devices [7 - 10], gas sensors, catalysts and secondary batteries . Several synthetic approaches including electrochemical techniques, sonochemical approach, template mediated synthesis, bioligation, hydrothermal, wet organic and inorganic routes and thermal methods a method for the synthesis of tungsten oxide nanorods with planar defects or textured structure has been introduced by zhang et al . And this method involves growth of wo3 x nanorods on the tips of electrochemically etched tungsten filament . However, synthesis of such structure has been possible only in the presence of h2 atmosphere . The nanorods of wo3 have also been obtained by sonochemical method wherein koltypin et al . Tungsten oxide nanorods could also be obtained from templated route by using cnts and colloidal gas aphrons as templates [18 - 20]. Therese et al . Have adopted an organic amine assisted low temperature hydrothermal route for the synthesis of hexagonal wo3 nanorods . Inorganic compounds such as na2so4, rb2so4 and k2so4have been demonstrated as structure directing agents for the hydrothermal synthesis of 1-d wo3 nanorods by gu et al . Gel followed by dip coating to produce wo3 nanorods . By altering the composition and concentration of solvent, it was shown that different morphologies and phases of wo3 nanorods can be achieved . However, all of these reported efforts involve multistep processes and limited to the use of directing agents such as cnts and m2so4 (m = na, rb and k). Hence, the synthesis would be tedious and requires careful removal of the structure directing agents to avoid contaminants . Moreover, sol gel and hydrothermal methods proceed with a low yield . In order to overcome the difficulties mentioned, thermal method has been employed widely for the large scale synthesis of tungsten oxide nanorods / nanowires as they are simple, easy and free from catalysts and contaminants . Heat treatment of tungsten metal, such as, tungsten foil or tungsten filament heated at 8001,600 c [40 - 42], tungsten powder heated at 950 c under the ar gas flow on ito glass / tungsten substrate at 9001,100 c, thermal evaporation of tungsten powder and tungsten hexacarbonyl heated at 700 c have yielded 1-d wo3 nanorods . All the above thermal methods related to 1-d tungsten oxide formation from the gaseous phase (vapor deposition) or thermal evaporation techniques are technically complex, require high temperature, harsh growth conditions, expensive experimental setup and complicated control processes . Recently, the single source molecular precursor route has opened a useful way for the synthesis of wo3 nanorods / nanowires by thermal decomposition method [49 - 51]. It offers the distinct advantage of simplified fabrication procedure and equipment as compared with the thermal evaporation or vapor deposition methods . However, multiple steps for the synthesis of both precursor and 1-d wo3, longer reaction time for precursor (6 days or 10 h) and relatively higher pyrolysis temperature (750 c) were required . In this report, a facile synthesis of wo3 nanorods based on the thermal decomposition of tetrabutylammonium decatungstate has been described . Firstly, it has been possible to obtain high yields of wo3 nanorods at a relatively low temperature (450 c) and short reaction time as compared to previously reported methods involving high temperature (700 c). Secondly, different morphologies of the material (nanosheets and nanorods) can be achieved by altering the pyrolysis time . Moreover, the method followed for the synthesis of precursor is a simple precipitation which does not require any tedious experimental set up or does not consume much time when compared to the other methods . Finally, it is a generic method which can be applied for synthesis of other metal oxides such as moox and v2o5 by suitably altering the metal in the precursor . There has been a continuous interest in studying the dimensionality - dependent properties of wo3 and ultimately to fabricate nanodevices . Wang et al . Have shown high li intercalation capacity (1.12 li per formula unit) for wo3 nanorods than its bulk counterpart (0.78 li per formula unit). The enhanced electrochemical performance has been attributed to the unique rod - like structure combined with increased edge and corner effects . Non stoichiometric wo2.72 nanorods are found to function as sensors with extraordinary sensing ability and the activity has been attributed to the very small grain size and high surface to volume ratios associated with the nanorods . Liu et al . Have exhibited low turn on field for electronic emission by wo2.9 nanorods . Photoluminescent emission spectrum of tungsten oxide nanorods was found to show an additional blue emission peak at 437 nm than its bulk system . All these results show the unique properties of wo3 nanorods in comparison to their bulk counterpart . The aim of the current study is to verify such a supposition experimentally which is significant in the development of electrodes for electrochemical hydrogen production . In recent years, hydrogen, in combination with fuel cells, has been proposed as a major alternative energy source . It provides energy at less environmental damage, with greater efficiency and acceptable cost compared to the conventional fossil fuels . Materials such as raney ni, ni mo and noble metals such as pt, pd and ru have been employed for this purpose [52 - 55]. Inspite of their high catalytic activity for hydrogen evolution reaction, the process involving pt and pd are not commercialized due to their high cost and low abundance . This has lead to the investigation of newer materials or reduction of the loading of noble metals . It has been demonstrated that the presence of w in the form of wo3 in the polyoxometalates enhanced the electrocatalytic activity for hydrogen evolution . Have shown electrodeposited composites of non - stoichiometric tungsten oxides and either ruo2 or iro2 to catalyze the hydrogen evolution in acid medium . Platinum when supported on tungsten trioxide showed electrocatalytic activity for her due to the synergism towards reactions in acid involving hydrogen atoms . All these results show the significance of wo3 in hydrogen evolution reaction . In this article, we report a surfactant directed large scale synthesis of monoclinic wo3nanorods . This has been achieved by a simple pyrolysis of a single source precursor which consists of surfactant encapsulated tungsten oxide clusters . The employed route is template free, contaminant free, easy, economical and requires a low temperature for the fabrication of wo3nanorods . The morphology, chemical composition and structure were characterized by scanning electron microscopy (sem), transmission electron microscopy (tem), high resolution transmission electron microscopy (hrtem) and x - ray diffraction (xrd). The as - synthesized tungsten trioxide nanorods have been employed as an electrocatalyst for hydrogen evolution reaction (her). The electrocatalytic activity of the material for her was investigated by cyclic voltammetry, linear sweep voltammetry and tafel plots . Enhanced catalytic activity has been observed for wo3nanorods compared to bulk wo3as an electrocatalyst for her . All other chemicals were purchased from sisco research laboratories pvt . Ltd and used as received . The typical procedure involved the precipitation of tetrabutylammonium decatungstate by adding an aqueous tetrabutyl ammonium bromide solution to a clear yellow solution of tungstic acid preformed using sodium tungstate and concentrated hydrochloric acid . The white precipitate was washed with boiling water and ethanol, filtered, dried and then recrystallized in hot dimethyl formamide to give yellow crystals . The thermogravimetric analysis revealed that the tetrabutylammonium cation content in the compound is 29.0% (theoretical value: 29.2%) and the decomposition temperature is around 450 c as reported . The synthesis of tungsten trioxide (wo3) nanorods from tetrabutylammonium decatungstate ((c4h9)4n)4w10o32) is carried out as follows: the precursor compound (1 g) was taken in an alumina or quartz boat and loaded inside a tubular furnace and heated at 450 c at a heating rate of 25 c per min under ar atmosphere for 3 h. this was followed by gradual cooling to room temperature to obtain a blue powder of wo3 nanorods . The total yield of the obtained material was 71% by weight (relative to the starting material). To further investigate the role of tetrabutylammonium (tba) group on the morphology of wo3, an experiment has been carried out in the absence of tetrabutylammonium ion . To achieve this, (nh4)10h2w12o42 xh2o has been taken as the precursor and pyrolysed under similar experimental conditions that were employed for the formation of wo3 nanorods . X - ray diffraction (xrd) patterns were obtained by a powder diffractometer (xrd - shimadzu xd - d1) using a ni - filtered cuk x - ray radiation source . Crm 200 raman spectrometer was employed, using the 514.5 nm line of an ar ion laser as the excitation source . The morphology of the wo3nanorods was investigated by a scanning electron microscopy (sem) (fei, model: quanta 200). Transmission electron microscopy (tem), electron diffraction and energy dispersive x - ray analysis (edax) were performed on a philips cm12/stem instrument . High - resolution transmission electron microscopy (hrtem) was carried out on a jeol 3010 . A three electrode cell consisting of the glassy carbon as working electrode (0.07 cm), pt wire and ag / agcl (satd . The working electrodes for electrochemical measurements were fabricated by dispersing 5 mg of the catalyst in 100 l of deionized water by ultrasonication for 20 min . From this dispersion the solvent was slowly evaporated by placing the electrode in an oven at 70 c . Five microliter of nafion solution has been coated on the electrode as a binder and dried at room temperature . The electrolyte solution was deaerated with high purity n2(99.99%) for 30 min before the electrochemical measurements . All other chemicals were purchased from sisco research laboratories pvt . Ltd and used as received . The typical procedure involved the precipitation of tetrabutylammonium decatungstate by adding an aqueous tetrabutyl ammonium bromide solution to a clear yellow solution of tungstic acid preformed using sodium tungstate and concentrated hydrochloric acid . The white precipitate was washed with boiling water and ethanol, filtered, dried and then recrystallized in hot dimethyl formamide to give yellow crystals . The thermogravimetric analysis revealed that the tetrabutylammonium cation content in the compound is 29.0% (theoretical value: 29.2%) and the decomposition temperature is around 450 c as reported . The synthesis of tungsten trioxide (wo3) nanorods from tetrabutylammonium decatungstate ((c4h9)4n)4w10o32) is carried out as follows: the precursor compound (1 g) was taken in an alumina or quartz boat and loaded inside a tubular furnace and heated at 450 c at a heating rate of 25 c per min under ar atmosphere for 3 h. this was followed by gradual cooling to room temperature to obtain a blue powder of wo3 nanorods . The total yield of the obtained material was 71% by weight (relative to the starting material). To further investigate the role of tetrabutylammonium (tba) group on the morphology of wo3, an experiment has been carried out in the absence of tetrabutylammonium ion . To achieve this, (nh4)10h2w12o42 xh2o has been taken as the precursor and pyrolysed under similar experimental conditions that were employed for the formation of wo3 nanorods . X - ray diffraction (xrd) patterns were obtained by a powder diffractometer (xrd - shimadzu xd - d1) using a ni - filtered cuk x - ray radiation source . Crm 200 raman spectrometer was employed, using the 514.5 nm line of an ar ion laser as the excitation source . The morphology of the wo3nanorods was investigated by a scanning electron microscopy (sem) (fei, model: quanta 200). Transmission electron microscopy (tem), electron diffraction and energy dispersive x - ray analysis (edax) were performed on a philips cm12/stem instrument . High - resolution transmission electron microscopy (hrtem) was carried out on a jeol 3010 . A three electrode cell consisting of the glassy carbon as working electrode (0.07 cm), pt wire and ag / agcl (satd . The working electrodes for electrochemical measurements were fabricated by dispersing 5 mg of the catalyst in 100 l of deionized water by ultrasonication for 20 min . From this dispersion 10 l has been taken and placed on a glassy carbon electrode . The solvent was slowly evaporated by placing the electrode in an oven at 70 c . Five microliter of nafion solution has been coated on the electrode as a binder and dried at room temperature . The electrolyte solution was deaerated with high purity n2(99.99%) for 30 min before the electrochemical measurements . The precursor material is composed of the cationic surfactant group (tetrabutyl ammonium ion) and the anionic decatungstate ion, represented as octahedral units . Formation of the precursor can be understood as follows: the tba cations react with the tungsten oxide octahedra (fig 1a) and forms lamellar aggregates (also supported from the sem image fig 3a) of the ((c4h9)4n)4w10o32 in which the tungstate anions are encapsulated in the array of tba groups . The tba groups are suggested to behave as glue that holds the wo6 octahedra together with spacing between different lamellar layers (fig 1b). In the crystallization process, surfactant molecules may serve as a growth controller, as well as an agglomeration inhibitor, by forming an encapsulated layer . When heated at 450 c for 2 h, the structure directing, tetrabutylammonium group decomposes resulting in the formation of lamellar sheets of wo3 (fig 1c). On gradual increase of the pyrolysis duration to 3 h the presence of tetrabutylammonium group in the precursor plays a vital role in the formation of nanorods . The hydrophilic head group of the surfactant binds to the w10o32 anions . During this process the hydrophobic tail groups form a shield outside the anionic octahedra which prevents their agglomeration . The presence of the surfactant coating is of key importance not only for hydrophilic stabilization of the octahedra, but also for controlling long range self - assembly in concentrated dispersions . Scheme for the formation of wo3 nanorods figure 2a shows the xrd recorded for wo3nanorods synthesized by a single step pyrolysis of tetrabutylammonium decatungstate . There are no peaks detected for other phases, indicating that single phase of wo3with high purity has been prepared . The average crystallite sizes of the nanorods was calculated by using scherrer s formula where, l is the average crystallite size, = 0.15418 nm for cuk, is the half maximum peak width and is the diffraction angle in degrees . The average crystallite sizes calculated by the scherrer s formula along the (001), (020), (200), (021) and (220) have values of about 36, 27, 34, 39 and 33 nm, respectively . The raman spectrum (fig . 2b) for the material shows characteristic o w o bending (260 and 334 cm) and stretching modes (703 and 813 cm) of wo3 . The typical morphology of the precursor compound, tetrabutylammonium decatungstate, ((c4h9)4)n)4w10o32 and the as synthesized wo3are presented in the sem images (fig . The rods are polydispersed with few hundred nanometers (100500 nm) of length and 2060 nm of width . Thus the findings indicate that the pyrolysis products are obtained from the ((c4h9)4)n)4w10o32microsheets and the synthesized material constitutes nanosized one dimensional tungsten oxide materials . Figure 3c displays the sem image of the wo3obtained from the pyrolysis of ammonium paratungstate, (nh4)10h2w12o42 xh2o . It can be seen that the material is composed of irregular particles of varying size with plate like morphology . From the sem analysis, it is revealed that rod like morphology can be obtained only when tetrabutylammonium group is present in the precursor compound . Sem has also been employed to observe the morphology of the commercially obtained wo3(fig 3d). Tem was also employed to provide further insight into structure and morphology of the as synthesized material . The morphologies of the products obtained after 2 h and 3 h were confirmed by the tem images to be nanosheet (fig . The sheet has a dimension of about 350 nm and 190 nm lateral size and thickness, respectively . The dimensions of the nanorods vary in ranges 130480 nm and 1856 nm of length and width, respectively . The high resolution tem image of a nanorod is illustrated in fig . The lattice fringes are explicitly clear with d spacing of 0.375 nm for the (020) plane . There has been a strong correlation on the d value obtained from the hrtem and xrd . The electron diffraction shown in the inset of fig . (a) powder x - ray diffraction pattern and (b) raman spectrum of wo3 nanorods (a) sem images of tetrabutylammonium decatungstate, (b) wo3 nanorods obtained from the pyrolysis of tetrabutylammonium decatungstate, (c) wo3 obtained from the pyrolysis of ammonium paratungstate and (d) commercially obtained wo3 tem images of wo3 obtained from tetrabutylammonium decatungstate at various pyrolysis time . (a) 2 h and (b, c) 3 h, (d) hrtem image of a wo3 nanorods . Inset of fig.4c electron diffraction pattern of wo3 nanorods edx spectrum of wo3 nanorods tungsten trioxides in sulfuric acid medium form tungsten bronzes which are highly electron and proton conducting [61 - 63]. The redox processes involved in acid medium can be represented as follows: during the forward process represented in eq . 1, hxwo3 (tungsten bronze) is formed and in the reverse process (eq . (1)(2) figure 6a and b shows the cyclic voltammograms of wo3 nanorods (as synthesized) and bulk wo3 (commercial) respectively on glassy carbon electrode in 1 m h2so4 at a scan rate of 25 mv s. the bare glassy carbon electrode (gce) shows no activity towards hydrogen evolution (fig . Nanorods show a broad anodic peak at potential 0.1 v whereas the peak has shifted towards positive potential (0.2 v) for bulk wo3 . The anodic peak current density of wo3 nanorods and bulk wo3 are 14 ma cm and 5 ma cm, respectively, at a scan rate of 25 mv s. the current density for wo3 nanorods is enhanced by 2.8 times to that of the bulk wo3 . The lower anodic peak potential and higher current density for wo3 nanorods reveal the facile formation of tungsten bronzes in nanorods compared to the bulk material . (b) bulk wo3 and (c) bare glassy carbon electrode in 1 m h2so4 at a scan rate of 25 mv s the stability of electrode in working electrolyte is one of the important properties when it is applied in industrial production . Figure 7a and b shows the cyclic voltammograms of wo3 nanorods and bulk wo3 respectively in 1 m h2so4 at a scan rate of 25 mv s for 50 consecutive cycles . For the wo3 nanorods almost no activity variation was observed even after several cycles indicating its stability in sulfuric acid medium . Where as for the bulk wo3, the peak current was observed to decrease as the cycle number increases . This result is in agreement with the stability of the nanostructures of wo3 described by lee et al . And ganesan et al . It has been demonstrated that the nanoparticles of wo3 and wo3 microspheres exhibit excellent cycling stability in 1 m h2so4 compared to the amorphous wo3 films . The linear sweep voltammograms of wo3 nanorods and bulk wo3carried out in 1 m h2so4 at a scan rate of 5 mv s in the potential range 0.2 to 0.8 v are shown in fig . The bare glassy carbon electrode showed no activity towards hydrogen evolution as evident from the fig . The current densities of her on wo3 nanorods (23 ma cm) is higher than that of bulk wo3 (15 ma cm) indicating the enhanced electrocatalytic activity of wo3 nanorods . The kinetic parameters of the electrodes were determined from the tafel plot as shown in fig . The tafel plots show two well - defined linear regions for both bulk wo3 as well as wo3 nanorods . The slopes in the low current density region (region 1) for bulk wo3 and wo3 nanorods are 213 and 188 mv a cm, respectively . The slopes are 30 and 25 mv a cm in the high current density region for bulk wo3 and wo3 nanorods respectively (region 2). The lower tafel slope obtained for wo3 nanorods in comparison to bulk the exchange current densities calculated at 0.199 v (ag / agcl (satd kcl)) for 1 m h2so4 solution provides information on the catalytic activity of the electrode for her . The higher exchange current density value of wo3 nanorods (2.75 10 a cm) when compared to bulk wo3 (8.57 10a cm) shows the better catalytic performance of wo3 nanorods towards her . The results can be attributed to the unique electrochemical behavior of 1-d nanostructures . 1-d nanostructures provide large electrode - electrolyte interface for the reaction to take place in a facile manner . Moreover, it has also been reported that the nanorod and nanowire form of the material is considered to influence its physical properties, which depart from the properties of their bulk phases due to the quantum effects related to the shape and size . Thus it is demonstrated that improved her activity can be achieved by using wo3 nanorods as an electrocatalyst . Cyclic voltammograms of (a) wo3 nanorods and (b) bulk wo3 for 50 cycles in 1 m h2so4 at a scan rate of 25 mv s linear sweep voltammograms of (a) wo3 nanorods and (b) bulk wo3 and (c) bare glassy carbon electrode in 1 m h2so4 at a scan rate of 5 mv s tafel plots for her on wo3 nanorods and bulk wo3 in 1 m h2so4 at a scan rate of 2 mv s electrochemical parameters of the her obtained from the tafel plots for different electrode materials in summary, we demonstrate a thermal decomposition method for the synthesis of 1-d wo3nanorods in high yield using a single source precursor . One of the important aspects of this method is the in situ formation of nanostructures due to the surfactant encapsulated metal oxide clusters . The advantage of this method is the tunability of the metal precursor and the surfactant group . This aspect of the method can be exploited for the synthesis of several other transition metal oxide nanorods . We have also synthesized nanorods of molybdenum oxide and mixed oxides of molybdenum and vanadium using similar strategy . The as synthesized wo3nanorods perform well as an electrocatalyst with enhanced electrocatalytic activity for her when compared to its bulk counterpart . The results show the possibility of minimizing the loading of noble metal electrocatalyst for her by using wo3nanorods as catalyst support.
|
The study was approved by the joint ethics committee of the institute of neurology and the national hospital for neurology and neurosurgery, london, uk . All structural and functional scans at time 1 and time 2 were acquired from the same siemens 1.5 t sonata mri scanner (siemens medical systems, erlangen, germany). The structural images were acquired using a t1-weighted modified driven equilibrium fourier transform sequence with 176 sagittal partitions and an image matrix of 256 224, yielding a final resolution of 1 mm [repetition time / echo time / inversion time = 12.24 ms / 3.56 ms / 530 ms]. Pre - processing of 66 structural images (33 participants 2 time points) used spm8 (http://www.fil.ion.ucl.ac.uk/spm) with the dartel toolbox to segment and spatially normalize the brains into the same template; with and without modulation . Modulated images incorporate a measure of local brain volume while unmodulated images, used with proportional scaling to correct for global grey matter, provide a measure of regional grey matter density . Previous studies have shown the correlations between brain structure and cognitive ability are better detected by grey matter density . Images were smoothed using an 8 mm isotropic gaussian kernel at full width half maximum (fwhm). The relationship between change in iq and change in brain structure was investigated by entering the appropriate pre - processed images (modulated or unmodulated grey or white matter) into within subjects paired t - tests, with change in iq (viq, piq or fsiq) and year of scan as covariates . The degree to which time 2 iq was predicted by changes in brain structure was investigated in a hierarchical regression analysis with time 1 iq entered before change in brain structure . Details of the functional imaging paradigm have been reported elsewhere and are summarised in supplementary information).
|
Oral health status has a major impact on the general feature of life and well - being . With the increasing rate of oral diseases, the global necessity of effective and economical products for prevention and treatment has intensified . This calls for an understanding of traditional practices and oral health beliefs . Use of modern toothbrushes and inter - dental cleaners has ignored the most effective primitive oral hygiene tool, that is, the chewing sticks also known as miswak . Chewing sticks of plants were prehistorically used by the early arabs, babylonian, greek, and roman societies for cleaning teeth . Chemical examinations have revealed a new era of chewing sticks reimbursement, which established that these sticks contain natural ingredients, which are beneficial for oral health . It has been reviewed that it contains ascorbic acid, tri - methylamine, chloride, fluoride, silica, resins, and salvadorine, which have proved potency to heal the inflamed and bleeding gums, produce stimulatory effect on gingiva, remove tartar, and other stains from the teeth, re - mineralize dental hard tissue, whitens teeth, provide enamel barrier, and increase salivary flow, respectively . In addition, chewing sticks also contains volatile oils, tannic acid, sulphur and sterols which attribute to anti - septic, astringent and bactericidal properties that help reduces plaque formation, provides anti - carious effects, eliminates bad odor, improves the sense of taste, and cure many systemic diseases . All these laboratory findings have discovered a new paradigm in the history of preventive dentistry and researchers aimed to bring back the focus on chewing sticks due to its diverse oral health benefits and orthodox adaptation of feasible structure . The discovery and apprehension for the alternate oral practices, in particular reference to these chewing sticks, was recommended in 1987 by the world health organization and is still being endorsed in order to support these as an effective tool for oral hygiene . The use of chewing sticks also fulfils the fundamental requisite of primary health care and may be a proper substitute to the modern manual toothbrush to accomplish the goal of prevention of oral diseases, especially in countries with economic restraints and countries with restricted oral health care services for general population . It is affordable and easily available in majority of urban and rural areas of developing countries . In pakistan, the main factor attributed to the selection of chewing sticks against toothbrush is its acquisition by more than 50% of its population living in rural areas . It is observed that the affordability of toothbrush is low among rural (only 8%) than urban (38%) societies of pakistan . Similarly, chewing sticks has been reported to be practiced by 90% of rural population in nigeria and tanzania, 50% of saudi arabians, and 65% rural, and 43% urban indian population . In order to reestablish chewing sticks as an effective and exclusive oral hygiene tool in today's nylon toothbrush society where newer attractive products are being introduced everyday in market, clinical evidence proving not only its chemical but also its mechanical superior properties is of prime importance . Therefore, this study was conducted with a testing null hypothesis that no difference in the mean plaque and gingival scores will be observed for different sites of the examined teeth among chewing stick and manual toothbrush users . The objective of this trial was to compare the effectiveness of two oral hygiene aids: chewing stick and manual toothbrush, for plaque removal and gingival health after one month of a randomized clinical trial . Methodology of the present study was composed in line with consolidated standards of reporting trials (consort) guidelines for reporting clinical trials and pursued the ethical standards of world medical association for human experimentation 2008 version of helsinki declaration . Permission to conduct the study was obtained from the institutional review board (irb) of dow university of health sciences (duhs), karachi, pakistan . A group of regularly attending dental students (age 18 - 22 years) of the same university were recruited for this trial over a span of 1 month (april 2013). The sample size was determined using the american dental association (ada), acceptance program guidelines for chemotherapeutic products for control of gingivitis, 2009 . A signed written consent informing about the aim and benefits of the study was taken from each study subject . Subjects with any systemic or oral disease, dental prosthesis, poor manual dexterity, recent or current antibiotic coverage, and non - consenting cases were excluded from the study . Selected participants were then randomized into two interventional groups (group a and group b) using simple random number table . Details of randomized participants were enclosed in sequentially numbered, opaque, sealed envelopes (snose). The examiners and trial statistician (outcome assessor) were blind to the treatment allocation, while the participants and principal investigator (am) were not masked to group assignment . Group a participants were provided with the new, soft textured, nylon manual toothbrushes while members of group b were given new fresh chewing stick of neem tree measuring 20 cm (length) 20 mm (diameter). Before the commencement of study a pre - trial workshop was conducted in which the participants of both groups were demonstrated about the appropriate and recommended use of manual toothbrush and chewing stick respectively . The recommendations for toothbrush users (group a) included brushing teeth according to bass method with toothpaste application of full length on toothbrush and brushing teeth twice daily (after breakfast and before going to bed) for 2 minute . The demonstrations and instructions for chewing stick users (group b) included the technique of preparation of working end of chewing sticks and its appropriate brushing technique . It was advised to prepare a new working end every day and brushing twice daily (after breakfast and before going to bed) for 2 - 5 minutes . Dental examination was conducted at baseline and later after 1 month, that is, pre - interventional and post - interventional phases, respectively . Training included the discussion sessions and practical exercises with the out patients from the oral diagnostic department . Turesky quigley hein plaque index (1962) and loe and silness gingival index (1962) were used as basic examination tools to assess dental plaque and gingival status respectively . Examination was performed on mobile dental units under day time sun light using sterilized mouth mirror and community periodontal index of treatment need (cpitn) probe . Inter - examiner reliability for the two indices was attained between the two examiners on 10% of the total study subjects . After recording the gingival status, the participants were asked to dissolve the given plaque disclosing lozenges (with 1% fucoaslid) in the oral cavity in order to stain the overnight deposition of dental plaque which was then scored using turesky quigley hein plaque index . Data was entered and analyzed using statistical package for social science (spss) version 16 . Descriptive statistics were used to calculate mean (standard deviation) scores of plaque and gingival indices . Paired t - tests were applied to compare the difference in mean plaque and gingival scores at the pre - intervention and post - intervention phases of examination separately for group a and group b, whereas the significant difference for post - intervention plaque and gingival scores between both the groups was calculated by employing two sample independent t - test . The p value for statistically significant differences in mean plaque and gingival scores was considered as <0.05 at 95% confidence level . Data was entered and analyzed using statistical package for social science (spss) version 16 . Descriptive statistics were used to calculate mean (standard deviation) scores of plaque and gingival indices . Paired t - tests were applied to compare the difference in mean plaque and gingival scores at the pre - intervention and post - intervention phases of examination separately for group a and group b, whereas the significant difference for post - intervention plaque and gingival scores between both the groups was calculated by employing two sample independent t - test . The p value for statistically significant differences in mean plaque and gingival scores a total of 50 subjects were recruited for the trial with a mean age of 20 0.66 years, out of which 80% were females and 20% were males . Table 1 demonstrates the observed mean (standard deviation) of plaque and gingival scores for both group a and group b, which were calculated at pre - interventionand post - intervention examination phases . The same table illustrates the paired t - test values which imply comparative (pre and post intervention) differences in plaque and gingival mean scores within chewing stick users, as well as within toothbrush users . Similarly, the table also appreciates a significant difference (<0.0001) in the final mean plaque scores (p), where as a non - significant difference (0.166) in the final mean gingival scores (g) of the two respective interventional groups . Comparison of mean plaque and mean gingival scores between the two interventional groups at pre- and post - examination phases the present trial was conducted to assess the comparative effectiveness of two oral hygiene aids that is, chewing stick of neem tree and manual toothbrush on dental plaque removal and gingival health . Sample size and trial specifications for this research were followed using the ada guidelines, which recommend that at least 25 patients for each product should be available for examination at the end of the study . These guidelines also suggests to conduct a trial for at least 30-day period with measurements to be taken at baseline (prior to the study), 15 days (optional), and at 30 days . The subjects should report having not cleaned their teeth for 12 - 16 hours (overnight plaque formation). All these guidelines were taken into consideration while conducting this trial . Moreover, the reason for conducting trials over a span of 1 month is that, a period of 9 to 21 days is reported to be required to appreciate excessive plaque deposits and mild gingivitis in the oral cavity . Every participant of group a (tooth brush users), was individually taught the recommended brushing method . These participants were allowed to use toothpaste on toothbrush for the reason that chewing sticks also releases chemicals (fluoride) that can maintain oral hygiene . However, professional oral cleaning measures such as scaling, curettage or high - fluoride applications were strictly prohibited during the study period . The proper preparation, maintenance, and technique to use the given chewing sticks were also demonstrated in detail to the members of group b (chewing stick users) in order to prevent the gingival trauma . For centuries the roots, twigs and stems of salvadora persica (arak tree) sticks have been used as oral cleaning aids and have superior chemical properties . Due to its rare availability in south asian countries these were not used in this study; instead, azadirachta indica sticks taken from flexible branches of neem tree, were used as an alternative having closest properties to arak plant . Also in a recent indian study the neem tree sticks were found to be similarly effective in removing plaque as modern toothbrushes . Negligible trials have been conducted so far those can be used to compare the results . However, a few available evidences have reported the effectiveness of chewing sticks against modern toothbrushes . None of these studies have followed the consolidated standards of reporting trials guidelines (consort), whereas the current trial was based on these international guidelines and hence maintain to prove a more reliable slant . According to the results of this trial, it is interpreted that the testing null hypothesis has partially been accepted, as no difference in gingival scores was observed for different sites of the examined teeth among chewing stick and toothbrush users and therefore chewing stick was found to be equally effective as toothbrush in terms of gingival status . On the other hand, chewing stick had shown even better results in terms of reduction in plaque scores than in subjects using toothbrush . It may further emphasized that the results of this trial are in close proximity with the results of a previously reported literature by bhambal et al ., who also reported no significant difference in plaque and gingival scores between the miswak and toothbrush users . The increase in plaque scores of subjects using toothbrush has not been observed in any of the previous studies, only a single study has reported the superior cleaning action of chewing stick in comparison to nylon toothbrush that too only for interproximal surfaces . As far as the antimicrobial actions of chewing stick is concerned, literature has shown that the risk of dental caries identified was 9.35 times more in subjects using toothbrush than those using chewing sticks . Also lower occurrence of dental caries due to less plaque deposits has been observed in populations using the neem and arak miswak sticks . The current trial did not take dental caries into consideration, therefore, cannot suggest any effective equivalency of toothbrush and the chewing stick pertinent to dental caries . However, the superior chemical and antimicrobial effect according to the previous literature and the anti - periopathic result of this trial has made chewing stick no less than today's nylon toothbrushes . Chewing sticks (miswak) has revealed parallel and at times greater mechanical and chemical cleansing of oral tissues as compared to a toothbrush . Therefore, it is suggested that advocacy may be planned to amplify the use of chewing sticks on the evidence of the current trial especially in the developing countries with financial limitations and restricted oral health care services for general population.
|
Cystinuria is an autosomal recessive genetic disorder that leads to defects in the transepithelial transporters for the dibasic amino acids, including cystine, ornithine, lysine, and arginine . The urine concentrations of those amino acids in cystinuric patients become elevated as a result of impaired reabsorption from the renal proximal tubule . However, of these dibasic amino acids, only cystine is relatively insoluble at physiological ph, which leads to crystal formation and, ultimately, stone disease . More than 50% of patients with cystinuria show stone formation throughout their lifetime, as well as a high rate of recurrence of up to 60% . Furthermore, more than three - quarters of cystinuric patients show a likelihood of bilateral stone formation . Hence, these patients are at high risk of renal function impairment and consequent poor quality of life . Cystine stones are relatively uncommon compared with other stone compositions, constituting just 1% to 2% of adult urinary tract stone diseases, and accounting for up to 10% of pediatric stone diseases . Patients typically present with their first symptoms of cystine stones between 2 and 40 years of age with the peak age of onset in the third decade of life . Incidence is equal between the genders, but male patients tend to present with symptoms earlier and also with more aggressive disease . The prevalence of cystinuria is regionally variable, ranging from 1:1800 persons on the east coast of the mediterranean to 1:100,000 persons in sweden . However, although there is a report by turkish investigators that the prevalence of cystinuria in asia is estimated as 1:1000, there are very few reports on this issue among populations in northeast asia . Research from japan reported a prevalence of cystine crystalluria of 1:16,000, but it is still difficult to find recent reports on patient series from this region . Because patients with cystinuria may develop serious problems with renal function and hence life quality owing to its high recurrence rate, appropriate principles for treatment plans and follow - up schedules should be established for these cases . Therefore, we report here our single - center experience of 14 cases of cystine stones to contribute to the development of such principles . This study was performed with the approval and oversight of the institutional review board at asan medical center . We retrospectively reviewed the data for 14 patients diagnosed with cystine stones who visited our outpatient clinic between march 1994 and july 2012 . Patient age at first visit, gender, family history, body mass index (bmi), presence of a single kidney, stone locations, stone burden, routine urinalysis, and urine culture results were the variables reviewed . In addition, the average number of repeated surgeries, complications, types of surgeries, intervals between repeated surgeries, shock wave lithotripsy (swl), medical treatment, recurrences or regrowth of stones, and overall treatment success rates were also analyzed . Stones were generally examined by computed tomography (ct) scans combined with abdominal plain films (kidney - ureter - bladder, kub), and the diameters of the stones were estimated before surgery . Most patients underwent surgery, swl, or both to treat this condition, and the type of operation was determined by the stone location and burden . Either percutaneous nephrolithotomy (pcnl) or ureterorenoscopic lithotomy (urs) was performed, although there was one case of open surgery in our series . Pcnl was performed with a 26-fr adult nephroscope and stones were fragmented by use of an ultrasonic lithotriptor, ballistic lithotripter, or holmium: yttrium - aluminium - garnet (yag) laser . A 14-fr malecot nephrostomy tube was then placed at the end of the procedure . For urs, 6-fr or 7.5-fr semirigid scopes (richard wolf medical instruments co., vernon hills, il, usa) with a 3.5-fr operative working channel, or two - way actively deflectable (270/270) flexible ureteroscopes (richard wolf medical instruments co.; and storz, flex - x2, tuttlingen, germany) with 3-fr dual working channels fragmentation of stones during urs was performed with 365- and 200-m diameter holmium: yag laser fibers for semirigid and flexible instruments, respectively . Stone analyses were performed in all patients with a fourier - transform infrared spectrometer (perkin - elmer, berlingen, germany) after surgery or if spontaneous stone passage occurred . If cystine stones were found, we recommended genetic testing and that the patients' siblings accompany them to the clinic . Intravenous pyelographies were seldom used and were mostly performed during the early part of our current study period . The definition of recurrence or regrowth of stones was a newly appeared stone or stones that became larger than a previous finding as seen in the image during the follow - up period . The overall success of treatment was defined as either no visible residual stones or the presence of remnant stones smaller than 2 mm in diameter on a postoperative kub image or ct scan performed on the last day of follow - up . Potassium citrate (1,000 mg three times a day) or sodium bicarbonate (500 mg four times a day) was recommended for all patients after diagnosis . D - penicillamine (250 mg twice a day) was recommended for recurrent cases despite urine alkalization therapy . The mean age of our study patients at the first visit was 19.6 years and 8 patients (57.1%) were male . We identified 23 calyceal stones (41.1%), 2 pelvic stones (3.6%), and 31 ureteral stones (55.3%) in our cohort of 14 patients . Two patients (14.3%) had a family history of cystinuria and 3 patients (21.4%) had a single kidney at the first visit . Among the patients with a single kidney, all patients had a unilateral non - functioning kidney before the visit to our clinic . One patient with a single kidney had undergone a simple nephrectomy because the patient's right kidney was found to have no function following a tc-99 m diethylene triamine penta - acetic acid renal scan and the patient had a complete staghorn stone causing right flank pain . Eight patients underwent swl regardless of surgery or as an adjunctive treatment method . A list of the patients, their demographic characteristics, and stone locations are detailed in tables 1 and 2 . Pcnl was repeated up to four times in one patient and three times in three urs cases . However, this patient had undergone several urs sessions at other hospitals before visiting our outpatient clinic and is currently receiving only potassium citrate treatment . The mean number of repeat surgeries per patient was 2.7 during the median follow - up period of 60.3 months . One patient underwent six repeated surgeries including four pcnl and two urs procedures (table 2). A total of 4 complications were observed over 35 procedures: 2 cases of transfusion, 1 case of febrile urinary tract infection (uti), and 1 case of gross hematuria . The median interval between repeat surgeries was 27.3 months (interquartile range, 10.1 - 42.9 months). Medications were recommended for all patients after the diagnosis had been made by stone analysis, but only 9 patients (64.3%) continuously followed the medication regimen with good compliance . Of these furthermore, three patients were prescribed a thiol medication, d - penicillamine, in addition to urine alkalizers . Patients with cystine stones suffered from multiple recurrences or regrowth of stones (mean number, 3.2) during the follow - up period . Nine patients (64.2%) had either no visible stones or no significant residual stones and two patients were lost to follow - up . Patients with cystinuria are reported to present their first typical symptomatic stone between 2 and 40 years of age, with a median age of onset of 12 and 15 years in female and male patients, respectively . In addition, the incidence of cystinuria has been found to be comparable in both genders in most previous studies . Although the age at first visit did not reflect the exact timing of symptom onset, the mean age of our patients at their first outpatient visit was 19.6 years, which is slightly higher than that of previous reports . Previous studies have reported that male patients tend to have a more aggressive cystinuric disease course with a significantly higher number of stones and an earlier onset of symptoms . In our current analysis, male patients were slightly younger (19.2 years vs. 20.2 years), had undergone more repeat surgeries (2.9 vs. 2.5), and showed more frequent recurrences or regrowth of stones (3.5 vs. 2.3). There was almost no difference between the stone burdens of our male and female patients (23.0 cm vs. 23.7 cm). However, none of these comparisons showed statistical significance, likely because of the small number of cases (data not shown). Because cystinuria is a genetic disorder, family histories are very important in the management of affected patients . Cystinuria is an autosomal recessive disease, but some heterozygote carriers have an autosomal dominant, incomplete penetrance appearance with increased, but typically normal, urinary cystine excretion . Therefore, the first classification of cystinuria by rosenberg et al . Was based on phenotypic characteristics . They classified cystinuric patients into three subgroups: type i, type ii, and type iii (the latter two are referred to as non - type i). Type i is characterized by its autosomal recessive, normal urinary cystine excretion pattern (0 - 100 mmol of cystine / g creatinine), whereas non - type i is considered to be an autosomal dominant disorder with incomplete penetrance and a slightly higher risk of stone formation . However, a new classification of the disease has been proposed by dello strologo et al . These authors reported that the slc3a1 gene in chromosome 2 and the slc7a9 gene on chromosome 19 are mutated in type a and type b cystinuric patients, respectively . In our current data, the family history was identified in only two patients, probably because of autosomal recessive inheritance or incomplete penetrance . The main treatment aims for patients with cystine stones are complete stone clearance, prevention of stone recurrence, and preservation of renal function . Therefore, establishing appropriate treatment plans that combine medical or surgical treatment with a regular follow - up schedule is paramount . In this regard, multimodal approaches that include swl, urs, and pcnl have been suggested as primary therapies for treating patients with cystine stones . Have suggested swl, urs, and pcnl as an initial approach for stones smaller than 12 mm, 12 - 20 mm, and larger than 20 mm, respectively . In our present study, the surgical approaches were determined in accordance with the size and location of the stones . Stones larger than 20 mm were usually managed by pcnl as an initial approach, whereas stones between 15 mm and 20 mm were treated by using either pcnl or multiple urs sessions, depending on stone location and size . Because many patients with cystinuria usually undergo repeat surgeries, surgical complications can be an important issue . One previous study reported a complication rate associated with pcnl in patients with cystine stones of 15.4% . The complication rate we observed in the present series was 11.4%, but none of these complications were major and thus no additional procedures were needed to manage them . The aims of medical treatment for cystinuric patients are to prevent recurrences and to dissolve existing stones, thereby supplementing surgery or swl . Hydration, a low - sodium diet, urine alkalization, and thiol drugs comprise the main aspects of treatment for cystinuria . However, thiol medications that are used to treat cystinuric patients, such as d - penicillamine and tiopronin, have several adverse effects, including alteration of taste perception, muco - cutaneous lesions, proteinuria due to nephrotic syndrome, and various other immune - mediated diseases . Poor compliance is an issue for these therapies, probably because of these adverse effects as well as the different socioeconomic situations of the patients . Treatment with potassium citrate or sodium bicarbonate is recommended for all cystinuric patients, and d - penicillamine is recommended in cases refractory to other therapies . However, only 9 of 14 patients were compliant for such treatment regimens in our current study cohort . The number of recurrences or regrowth of stones during follow - up in each of our patients varied widely, from none to six . Patients with no recurrence underwent two sessions of urs and consistently followed our treatment regimen, including potassium citrate medications and the follow - up schedule . In contrast, patients with six incidences of recurrence or regrowth of stones were noncompliant with their treatment regimens for both medication and the follow - up schedule . A previous study reported an overall success rate of pcnl in children with cystine stones of 63.1% . Another previous study reported a success rate of 71% in patients with cystine stones who underwent urs . Although there are some differences in the definition of treatment success, the success rate among our current patient series (64.3%) is comparable with previous results . The definition of treatment success in previous studies was the absence of any residual stones regardless of size, whereas a residual stone smaller than 2 mm in diameter was included in our category of treatment success herein . However, because previous reports have routinely evaluated treatment results by kub or ultrasonography of the abdomen instead of ct scanning, complete stone clearance might have been overestimated . In contrast, we routinely performed ct scans as part of our follow - up protocol . Furthermore, we have shown here the results of a multimodal treatment approach in patients with cystine stones rather than reporting the results of only one treatment modality . Our analyses were retrospective and we did not perform genetic studies on all patients to determine the type of cystinuria or to evaluate the different responses to treatments, especially medications . Despite these limitations, our current report is the first study to report the characteristics as well as the relatively successful treatment outcomes in a cohort of patients with rare cystinuria from northeast asia . Further prospective, multicenter studies of a larger number of patients, including studies assessing the efficacy of different medications, are needed to evaluate these treatment outcomes more accurately . Patients with cysteine stones have high recurrence or regrowth rates and relatively large stone burdens with an earlier age of onset . Successful management of cystinuria thus requires a strict and regular follow - up schedule, appropriate multimodal approaches, and high patient compliance, especially in relation to medications, to prevent recurrent stone formation . Additional research is needed to determine adequate treatment strategies for this condition, including surgical and medical therapies, to eventually prevent deterioration of renal function in affected patients.
|
Diabetic peripheral neuropathy (dpn) is a late - stage microvascular complication that develops in nearly 50% patients during the course of type 2 diabetes mellitus (t2 dm), affecting particularly low extremities . Dpn is characterized by irreversible nerve structural and functional changes due to demyelination, axonal atrophy, and diminished regenerative potential, clinically presenting as a symmetric chronic pain, paraesthesia, and sensory loss . The development of dpn often worsens the quality of life, and increases the risk of cardiovascular morbidity, foot ulcerations, amputations, and overall mortality . Although exact mechanisms are not fully understood, dpn is generally regarded as the consequence of chronic hyperglycemia - induced endothelial dysfunction, resulting in impaired endoneurial blood flow, ischemia, and nerve hypoxia . Metabolic - vascular interactions in dpn are however highly complex and include diverse molecular pathways, like activation of protein kinase c and polyol metabolism, glycation and glycoxidation, low - grade inflammation, and excessive formation of reactive oxygen species (ros), such as superoxide and hydrogen peroxide . In vascular compartment these ros can react with intrinsic vasodilator nitric oxide, and while the fall of nitric oxide levels would cause vasoconstriction, the resulting peroxynitrite could trigger the downstream events leading to nerve damage . Because normal oxygen supply is fundamental for all tissues, impaired vasodilation is often associated with cellular energy crisis and increased breakdown of purine nucleotide to uric acid (ua) via xanthine oxidoreductase . Under physiological conditions this enzyme functions as dehydrogenase, but during hypoxia or after limited proteolysis it is converted to oxidase form (xod). Unlike dehydrogenase, xod more readily generates ros able to impair vascular relaxation . In diabetic patients, hyperglycemia - induced endothelial dysfunction is chronic and not limited solely to the blood vessels irrigating nerve tissue but to variable extent occurs throughout the body . Moreover, xod has been previously linked to oxidative damage in diabetes [6, 7] and diabetic cataract, as well as metabolic syndrome and its cardiovascular complications, and the role of xod was also proposed in an experimental model of diabetic neuropathy . As a molecular fingerprint of imminent hypoxia, serum ua was reported higher in t2 dm than in nondiabetic subjects, especially in those with dpn . During hypoxia, circulating serum albumin can undergo conformational changes at n - terminus aspartyl - alanyl - hystidyl - lysine sequence, which decrease its natural ability to bind cobalt and several other transition metal ions . The resulting ischemia - modified albumin (i m a) was originally associated with hypoxic conditions during myocardial ischemia but was thereafter reported also in t2 dm and some diabetic complications . However, there are missing data regarding serum xod activity or i m a in dpn . Currently, there is no effective therapy to cure dpn, and even with good glycemic control the chance to develop dpn is relatively high among t2 dm patients . Given that xod could be a significant source of ros in vascular compartment causing endothelial dysfunction, and a possible therapeutic target, this study was aimed at investigating the relationship between xod and dpn in t2 dm patients . This study enrolled 80 patients previously diagnosed with t2 dm, both sexes, who attended our local clinical hospital center on regular basis for diabetes control . Not included were patients with significant motor deficits, recent cardiovascular or cerebrovascular events, overt renal or hepatic diseases, and retinopathy and those with foot ulcerations, amputations, and recent inflammatory disease or with known autoimmune or malignant disease . The control group was consisted of 30 age- and sex - matched subjects without dm, recruited from medical stuff and their relatives, who met the same exclusion criteria . This study was conducted in accordance with the declaration of helsinki, after informed consent from patients was provided . The institutional review board of the medical faculty pristina (kosovska mitrovica) has approved this study . Dpn was defined as symmetrical sensorimotor polyneuropathy, diagnosed using a simplified scoring system for bedside examination, the diabetic neuropathy symptom (dns) score, followed by michigan neuropathy screening instrument (mnsi) scoring system . The mnsi consists of two parts: the first part is a 15-item yes or no questionnaire about history of sensory and motor dysfunction (pain, temperature sensitivity, tingling, numbness, cramps, muscle weakness, feet ulcers or cracks, and amputation). The second part of mnsi encompasses examination of foot skin appearance, inspection for foot ulcers, examination of ankle reflexes, vibration perception testing using a 128-hz tuning fork test at the great toe, and fine touch sensation testing using a 10 g semmes - weinstein monofilament applied on the plantar sites of each foot . Hypertension was defined as having systolic blood pressure 140 mmhg or diastolic blood pressure 90 mmhg or being on antihypertensive medication . Microalbuminuria, as a marker of incipient kidney damage, was defined as urinary albumin - to - creatinine ratio of 30300 mg / g . Body mass index (bmi) was calculated as the ratio of body weight (kg) and square of body height (m). Venous blood was taken after an overnight fasting into vacutainer tubes without or with anticoagulant (edta) to obtain serum, plasma, or whole blood samples . The first morning urine sample taken into sterile urine containers during two months in three nonconsecutive days was provided for determination of urinary albumin and creatinine . Serum xod activity was measured according to the method of roussos, as described earlier . Xod activity was calculated after correction for preexisting uric acid, using molar absorbance of uric acid at = 293 nm, of = 1.26 10 l m cm . One unit of xod activity was defined as 1 mol / min uric acid formed at 37c . Serum i m a was measured using a colorimetric method described by bar - or et al . . Concentration of total serum thiols, as an indicator of protein oxidative damage, was measured using ellman's reagent . Concentration of serum age was determined spectrofluorometrically by the method of kalousov et al . And expressed as relative fluorescence units (rfu). Concentration of advanced oxidation protein products (aopp), as marker of chronic oxidative albumin damage, was determined from lipid - depleted plasma samples to avoid interference with lipid status, by the method of anderstam et al . . Serum xod, age, and aopp were assessed from aliquoted samples (0.5 ml) kept at 80c . Concentrations of serum and urinary creatinine, serum total proteins, albumin, triglycerides, total cholesterol, hdl - cholesterol, ua, and blood glycated hemoglobin (hba1c) were measured on cobas integra 400 biochemical analyzer, using standard protocols . Urinary albumin was determined using tinaquant albumin gen.2 assay kit (roche diagnostics gmbh, mannheim, germany). The average of urinary albumin excretion was calculated for each patient from results of three nonconsecutive urine samples . Atherogenic index of plasma (aip), as a surrogate marker of atherogenic dyslipidemia, was calculated according to dobiasova, as the logarithm of triglycerides to hdl - cholesterol concentration ratio . Data were presented as either arithmetic mean sd, frequencies (f), or median and 95% confidence interval of the median . Differences between groups were tested by anova and student's independent samples t - test, or chi - square test, where appropriate . The relationship between dpn, xod, and other risk factors was investigated by multivariable logistic regression analysis . Basic demographical, clinical, and biochemical findings in controls and t2 dm patients are presented in table 1 . Of 80 t2 dm patients enrolled in the study, 29 were with dpn; the remaining (n = 51) comprised the non - dpn group . There were no significant differences between control and groups with dm, in terms of age and sex distribution, smoking status, presence of hypertension, serum creatinine, and total protein levels (table 1). Twenty - five t2 dm patients were with microalbuminuria, having urinary albumin to creatinine ratio within the range of 30300 mg / g . Patients with t2 dm had significantly higher bmi than control subjects and were rather overweight (n = 31) or obese (n = 26). Concentrations of fasting blood glucose, total cholesterol, hdl - cholesterol, ldl - cholesterol, triglycerides, and aip significantly differed from controls in both groups with t2 dm (table 1). In comparison to non - dpn group, concentration of hdl - cholesterol was significantly lower in dpn group . In the overall sample the median xod activity was 16.4 u / l (95% ci 13.820.4). Serum xod activity and i m a concentration were higher in t2 dm patients than in control subjects and significantly differed between dpn and non - dpn groups (table 2). Serum albumin and total thiols were lower in dm patients than in controls and differed between dpn and non - dpn groups . Compared to controls, hba1c and serum age were increased in dm patients, being higher in dpn than in non - dpn group; the occurrence of dpn also affected serum ua concentrations . Serum aopp was higher in t2 dm patients than in controls, but the difference between diabetic groups was insignificant (table 2). In patients with t2 dm, serum xod activity was directly correlated to bmi, the presence of hypertension, and levels of hba1c, age, i m a, and ua and inversely correlated to serum albumin and total thiol groups concentrations (table 3). Correlations between xod activity and age, duration of diabetes, aip, aopp, and microalbuminuria were not significant . We further analyzed the association between several clinical and biochemical variables and the occurrence of dpn . Included were duration of diabetes, hba1c, aip, hypertension, serum xod, and ua levels . The multivariable logistic regression analysis (b = 5.014; chi - square = 20.023; p = 0.0027) clearly revealed hba1c and serum xod activity as independent predictors of dpn, whereas the influence of diabetes duration was of the borderline significance (table 4). The major finding of the present study was significant elevation of serum xod activity in patients with t2 dm and an independent association between xod activity and the occurrence of dpn . Serum xod activity was well correlated to the levels of i m a and some other biomarkers of increased ros formation . Furthermore, xod activity was directly correlated to several risk factors relevant for the development of dpn, including hypertension, higher bmi, and concentrations of hba1c and ua, indicating the role of xod in the development of dpn . Xod is a rate - limiting enzyme of purine catabolism to ua, during which high quantities of ros are produced . We observed that the formation of ros was specifically increased in dpn group, documented as decreased serum total free thiols and increased levels of oxidatively damaged molecules, like i m a and age, accompanied by higher concentration of serum ua (table 2). These findings are consistent with the concept that increased ros formation can contribute to the development of dpn [4, 23]. Serum total free thiol groups essentially originate from a single 34 cystein residue of albumin, which is abundantly present blood protein . Acting as nonenzymatic antioxidant and reducing agent these free thiols are rapidly oxidized after exposure to ros, forming mixed disulfides and related sulfur - containing acids . In one previous study the loss of total serum thiols was found to correspond to the severity of diabetic microvascular complications and the development of dpn, and our current results support that finding . There was also a significant increase in serum i m a concentrations in t2 dm, especially in dpn group, in our study . Several other studies reported elevated serum i m a levels in diabetes, correspondingly to the presence or severity of complications, including peripheral arterial disease . We observed that i m a concentrations were positively correlated to xod activity, indicating that oxidative damage of circulating biomolecules in dpn can be, at least partly, inflicted by xod - derived ros . Although exact chemical mechanisms of i m a formation are still a matter of debate, it is generally accepted that i m a is formed due to oxidative damage of serum albumin n - terminus, specifically in hypoxic conditions, such as those created by dysfunctional blood vessels . In accordance to that, i m a is now regarded as a biomarker of widespread endothelial damage in a variety of pathological states, including t2 dm . However, in the absence of other biomarkers of endothelial damage these results should be cautiously interpreted . Besides i m a, the occurrence of dpn was associated with higher serum ua and lower albumin levels, which are known risk factors of dpn . Also, 31% of patients included in the study were microalbuminuric; thus the coexistence of decreased ua elimination rate and increased urinary albumin excretion rate as confounding factors cannot be excluded . Still, increased serum levels of i m a and ua have been regarded as biomarkers widespread endothelial dysfunction in a variety of pathological states, including t2 dm [13, 25]. Tissues irrigated by dysfunctional vessels inevitably suffer hypoxic and even anoxic conditions, which promote the transition of xanthine dehydrogenase to xod form . Within vascular compartment the enzyme is found mostly at xod form, attached to endothelial cell surface via sulfated glycosaminoglycan - rich receptors, and as a free enzyme in the blood . Both bound and free xod can generate ros able to modify circulating blood and vascular wall constituents, such as albumin and endothelium - derived nitric oxide . The reaction of nitric oxide and superoxide anion radical diminishes nitric oxide levels and yields peroxynitrite, which can act as toxic mediator inducing nerve injury . At the same time, diminished availability of nitric oxide would exacerbate endothelial dysfunction, since it is implicated in regulation of vascular tone, as well as in prevention of platelet adhesion and aggregation and leukocytes adhesion to the vascular wall . Moreover, augmented serum xod activity has been already linked to increased ros formation in metabolic syndrome and its cardiovascular complications, clinical and experimental diabetes, and diabetic ocular complications [69]. To the best of our knowledge the majority of vascular xod is believed to be of hepatic origin, nonspecifically released into the blood, particularly under hyperglycemic conditions . It was therefore not surprising that hba1c levels were directly correlated to xod activity in our and some previous studies [6, 7], thereby confirming that glycemic control plays critical role in modulating xod presence / activity within vascular compartment . Besides hba1c, serum xod activity was also correlated to ages, which are chemically heterogeneous products of protein nonenzymatic glycation and subsequent oxidation reactions . Ages not only are biomarkers of glycoxidative protein damage but also act as toxic mediators after binding to specific receptors, like multiligand rage or macrophage scavenger receptors . In peripheral nerves rage it is of note that age - rage interaction facilitated endoneurial vascular dysfunction in peripheral nerves, leading to microangiopathy . Etiology of dpn is however highly complex, since diverse though interrelated metabolic lifestyles and genetic factors can be involved . For example, a prolonged ischemia and obesity can be both present in patients with t2 dm and associated with higher levels of serum ua . In fact, one recent study demonstrated that, beyond purine metabolism, xod also plays a role in differentiation of adipocytes acting as a regulator of the nuclear receptor peroxisome proliferator - activated receptor activity, which is the key factor controlling the induction and maintenance of adipogenesis . In the present study, serum xod activity was correlated to bmi as well as to ua levels (table 3). One probable explanation could be a high prevalence of overweight (38.7%) and obese (23.5%) diabetics, and since xod is abundantly expressed in adipocytes it might cause increased secretion of ua from adipose tissue, especially during ischemia . These results are consistent with those of feoli et al ., who reported a similar relationship in metabolic syndrome . It has been previously shown that ros formed in chronic hyperglycemia may induce unmyelinated and myelinated nerve fibers loss and impairment of endoneurial blood flow, resulting in nerve conduction velocity abnormalities ., macrophages can produce high quantities of ros via xod, thereby causing local endothelial dysfunction, further impairment of endoneurial blood flow, and myelin degeneration . Overexpression of xod is actually necessary step for macrophages activation and regulation of proinflammatory mediators and chemokines secretion [31, 32]. Furthermore, ros generated by local macrophages via xod may induce nerve axonal loss and demyelination, as demonstrated in a murine model of neuroinflammation . Because of high content of polyunsaturated fatty acids nervous tissue is exceptionally susceptible to ros; thus tight control of prooxidant enzyme activity is of great importance . Previously, inkster et al . Reported that inhibition of xod with allopurinol, a structural analogue of hypoxanthine with both hypouricemic and anti - inflammatory effects, was able to prevent the loss of motor and sensory conduction velocity in an animal model of diabetes . Their study demonstrated that inhibition of xod improved blood flow in sciatic and cervical nerve ganglion, thereby suggesting that upregulated xod present in nerve microvasculature, including endothelium and perivascular space, can cause neurovascular dysfunction leading to diabetic neuropathy . Allopurinol also prevented cardiac ischemia and impaired relaxation in an experimental model of insulin resistance, normalized endothelial function in t2 dm patients with mild hypertension, alleviated oxidative injury and improved cardiovascular functions in diabetics in several intervention studies, and acted antinociceptive against various noxious stimuli in mice . On the other side, peripheral neuropathy can be a side effect of allopurinol treatment, and this drug failed to prevent the progression of dpn in type 1 diabetes mellitus patients with mild - to - moderate cardiovascular autonomic neuropathy . Nonetheless, the current study has demonstrated that augmented xod activity was present within vascular compartment in t2 dm patients diagnosed with dpn . Moreover, serum xod activity was closely correlated to risk factors relevant for the development of dpn, including poor glycemic control, obesity, and serum i m a and ua levels, which are considered as markers of generalized endothelial dysfunction in diabetics . Our results therefore indicate that upregulated xod can be an additional source of ros in vascular compartment, implicated in chronic oxidative injury and endothelial dysfunction in t2 dm patients with poor glycemic control, contributing overtime to the development of dpn.
|
Takayasu s arteritis is a granulomatous vasculitis of unknown etiology that affects mainly the aorta and its branches . As a result of intimal fibroproliferation, segmental stenosis, occlusion, dilatation, and aneurysmal formation of the involved vessels it is an uncommon disease, with an approximate incidence of 23 cases per year per million individuals and usually affects young female of asian ascendance during their second and third decades of life . We describe a case of a previously healthy caucasian female whose takayasu s arteritis presented as an association of aortic and main left coronary aneurysms with severe aortic insufficiency . A 26-year - old caucasian female was admitted to our hospital with a 3-week history of fatigue, malaise, exertion dyspnea, ortophnea and paroxysmal nocturnal dyspnea . There was a marked difference on the blood pressure measurement between the arms (140/90 mmhg on the right arm and 90/60 mmhg on the left). The brachial pulse could not be felt on the left arm and a systolic murmur was heard on the left infraclavicular area . On cardiac auscultation, a diastolic murmur (+ + + + /vi) was heard on the aortic area, and there were some crackles in the basal regions of both lungs . Her erythrocyte sedimentation rate (esr) was 64 mm on the first hour and the result of the serum c - reactive protein (crp) was 24 mg / dl (normal: 06 mg / dl). Based on the 1990 american college of rheumatology criteria, a diagnosis of takayasu s arteritis was made . A high - resolution thorax computed tomography (ct) showed a 4-cm aortic aneurysm spanning the ascending and the proximal descending portions, as well as the aortic arch . Cineangiocoronariography confirmed the findings of the ct and also revealed a severe aortic insufficiency and a large main left coronary aneurysm (figure 1). A three - day course of intravenous high - dose methylprednisolone (1000 mg) was administered, as well as medications for the management of the heart failure (diuretics, digoxin, angiotensin - converting enzyme inhibitor), which resulted in a remarkable improvement in general symptoms . Methotrexate was started at 15 mg / week as a steroid - sparing medication . Takayasu s arteritis is primarily a chronic inflammatory vasculitis characterized by stenosis of large and medium sized arteries . The coronary arteries are involved in about 10% of cases, but aneurysm formation, especially affecting the main left coronary, is a very rare finding . Destruction of the elastic fibers in the media of the vessel is the leading pathogenic mechanism of aneurysms formation . In some situations of massive aortic regurgitation coronary aneurysms predispose to thrombus formation and acute myocardial infarction, even in patients receiving aspirin and/or warfarin . On the other hand, revascularization under inflammatory circumstances carries a higher risk of complications, such as stenosis, suture line dehiscence and pseudoaneurysm formation . A case of successful surgical resection of a giant right coronary artery has been reported, even though the best surgical timing in takayasu s arteritis still remains controversial, as long as even when asymptomatic and with no serological evidence of current inflammation (normal esr), up to 44% of these patients show some degree of histologic active disease . To our knowledge, this is the first report of an association of aortic and coronary aneurysms with severe aortic insufficiency in a takayas s arteritis patient . The complexity of this case, allied to the absence of previously described medical interventions specific to this situation, certainly turns it into a therapeutic challenge . Proper follow - up is warranted, to get nearer to an accurate decision about the best moment to choose for a surgical approach, considering its costs and benefits when dealing with vasculitic vessels and its inner complications.
|
In the previous issue of critical care, rhodes and colleagues report on significantly increased levels of circulating dna in patients admitted to the intensive care unit (icu) in comparison with healthy controls . They show plasma dna levels to be an independent predictor of mortality and the development of sepsis in these patients . In sepsis and trauma, circulating nucleosomal dna is positively correlated with disease severity and adverse outcome . In cancer, interestingly, in systemic lupus erythematosus, an autoimmune disease in which nucleosomal dna functions as autoantigenic target, no correlation of circulating nucleosomal dna with disease severity can be found; instead there is a correlation with anti - nucleosomal dna antibodies . Dna in plasma most probably circulates bound to proteins in the form of mononucleosomes and/or oligonucleosomes and is released after the cleavage of easily accessible linkage sites of cellular dna by endonucleases after cell death . A mononucleosome consists of a core particle composed of an octamer of two copies each of histones h2a, h2b, h3 and h4, around which a stretch of helical dna 146 base pairs in length is wrapped . Oligonucleosomes are composed of variable amounts of mononucleosomes connected by intact linker dna with a variable length of 15 to 100 base pairs containing a' linker' histone h1 . Once released into the circulation, nucleosomes seem to be protected by their structure from further degradation by endonucleases . In healthy individuals, the concentration of circulating dna is low, because dead cells are removed efficiently from circulation by phagocytes . Circulating dna has a short half - life (10 to 15 minutes) and is removed mainly by the liver . Accumulation of dna in the circulation can result from an excessive release of dna caused by massive cell death, inefficient removal of the dead cells or a combination of both . Rhodes and colleagues demonstrate that increased circulating dna not only predicts the development of sepsis but also mortality in patients admitted to the icu . Moreover, they show that patients requiring renal support have significantly higher values of circulating dna than patients with sufficient renal function . Unfortunately, the authors provide no information on liver function, because most nucleosomal dna is efficiently cleared by the liver and only a small fraction is eliminated by the kidney . Our recent study in patients with sepsis showed that nucleosomal dna increased with disease severity, but we found no difference in nucleosome levels in patients with severe renal insufficiency and normal renal function, respectively . Other studies in patients with trauma and stroke showed that increased circulating dna levels were correlated with morbidity and mortality . Hence, assessment of circulating dna offers a useful tool for predicting mortality and morbidity of patients admitted to the icu . Further studies on circulating dna in icu patients, including more patients and other scoring systems for illness severity such as saps ii (simplified acute physiology score ii), logistic organ dysfunction and apache ii (acute physiology and chronic health evaluation ii) scores, are needed to establish circulating dna as a predictor for mortality and morbidity in patients admitted to the icu . Quantification of circulating nucleosomes can be assessed either by real - time quantitative pcr (rq - pcr) or immunological assays . However, contamination of a sample with nucleated cells can affect the apparent concentration of circulating dna . Chiu and colleagues showed that a two - step procedure of sample centrifugation (800 g or 1,600 g) followed by either high - speed centrifugation or filtration was superior to a single centrifugation step only . Nevertheless, a 13.5-fold variation in circulating dna levels over 3 days can be detected in female volunteers . Therefore, even though an appropriate sample preparation protocol may be used, notable variation requires a careful interpretation of circulating dna levels . Nucleosomal dna can also be assessed by elisa technique as recently described by different groups . In our laboratory we developed an elisa with the use of a mouse monoclonal anti - histone 3 antibody (clb - ana/60) as a catching antibody and a monoclonal mouse antibody recognizing an epitope exposed on complexes of histone h2a, histone h2b and double - stranded dna, present only on nucleosomes, as a detection antibody . This technique renders quantitative determinations reliable and reproducible . Also with elisa, careless blood withdrawal and delayed centrifugation can result in false positive results, and insufficient storage conditions can lead to false negative results . Moreover, sandwich elisas are vulnerable to false positive results resulting from xenoantibodies, c1q, rheumatoid factors and anti - nucleosome antibodies (l aarden, unpublished work). A comparison of rq - pcr and elisa methods revealed a high concordance in the quantification of circulating dna in plasma and serum . Quantification should preferably be performed in plasma because, probably as a result of the clotting process, higher levels of circulating dna can be measured . However, determination of circulating dna by rq - pcr seems to be more sensitive than by elisa . The lowest circulating dna level measured by rq - pcr in the present study was 14 ng / ml, which corresponds to 2,121 genome - equivalents / ml (assuming a dna content of 6.6 pg per cell). However, circulating dna can be detected by rq - pcr up to 2 genome - equivalents / ml . In our recent study on nucleosome levels assessed by elisa, we reported a detection limit of 35 units / ml, which corresponds to 3,500 cells / ml . Further improvement of the assay improved the detection limit to 1,000 cells / ml . Fully automated systems in dna isolation, pcr mixture preparation and rapid thermal cycling profile offer a quick and sensitive tool for quantifying circulating dna in plasma . However, these systems require considerable amounts of plasma: reliable dna extraction for rq - pcr requires at least 200 l of plasma, whereas only 25 l suffices for elisa . Assessment of circulatory dna is a useful tool for predicting morbidity and mortality in patients admitted to the icu . Elisa = enzyme - linked immunosorbent assay; icu = intensive care unit; lod = logistic organ dysfunction; rq - pcr = real - time quantitative polymerase chain reaction.
|
Patients with end - stage renal disease treated with intermittent hemodialysis (hd) have to maintain proper fluid volume balance, which should be achieved by daily restrictions in fluid consumption . The improper drinking behaviors seen in this group of patients leads to chronic fluid overload, which may result in uncontrolled hypertension, pulmonary edema or other cardiovascular manifestations, and dramatically increase the risk of premature death . Thus, although inter - dialytic weight gain (iwg) seems to be an indirect indicator of patients adherence to the renal replacement therapy, it may be modulated by many factors, the foremost being excessive thirst, probably stimulated by xerostomia (a feeling of a dry mouth). In addition, some hemodialysis patients may demonstrate impaired saliva secretion, which not only produces an oral cavity environment conducive to caries associated with changes in oral soft tissue (e.g., mucosal soreness, gingivitis, cheilitis fissuring of the tongue and recurrent yeast infections) but may also enhance thirst and a subjective sensation of a dry mouth [510]. Note that these factors contribute to the intake of fluids and consequently to excessive iwg in patients on maintenance hemodialysis . Additionally, our previous study demonstrates that thirst and iwg may not be linked with pre- nor post - dialysis sodium serum concentration, but mainly with pre - dialysis sodium gradient, which makes this factor worthy of further consideration . The aim of the study was therefore to determine whether hyposalivation is really a factor which enhances xerostomia, thirst and weight gain (iwg) in patients on maintenance hemodialysis . A prospective trial was conducted in 111 maintenance hemodialysis patients (64 males and 47 females), mean age 59.1 13.6 years . The mean time from starting hemodialysis was at least 6 months: the mean time being 14.7 8.9 months . All subjects were recruited from the dialysis department of the norbert barlicki memorial teaching hospital no . The causes of end - stage renal disease included chronic glomerulonephritis in 28 patients, diabetic nephropathy in 40, adult polycystic kidney disease in 8, hypertension in 16, tubulointerstitial nephritis in 6 and unknown in 13 patients . The eligibility criteria for a patient to be included into the study were as follows: age between 18 and 80 years old, a fixed hemodialysis schedule of 3 times a week and a stable clinical condition . The exclusion criteria comprised uncontrolled hypertension or recurrent symptomatic hypotension episodes, chronic heart failure (nyha stage 4), severe acute infections requiring hospitalization and the administration of centrally acting sympatholytics . Two subgroups were formed basing on the presence of hyposalivation, defined by a salivary flow rate below 0.1 ml / min . To confirm or exclude hyposalivation, unstimulated whole saliva (uws) was collected for 5 mins through use of the spitting method before a mid - week hd session . The subject refrained from eating, tooth brushing, mouth rinsing or smoking for at least 1 h before spitting . The participants were instructed to avoid swallowing the saliva during sample collection to allow the saliva to accumulate in the floor of the mouth and were instructed to spit out into test tubes every 30 s for 5 mins . The dialysis thirst inventory (dti) is a questionnaire which consists of 7 items, while the validated xerostomia inventory comprises 11 items, each with a 5-point likert scale ranging from never (1) to always (5). The results of the inventories range from a minimum of 7 and 11 points (no thirst and no dry mouth) to a maximum of 35 and 55 points (enormous thirst and extremely dry mouth), respectively . Both questionnaires were conducted together with the biochemical tests, i.e., pre- and post - dialysis serum sodium concentration and sodium gradient: the difference between serum sodium and dialysis fluid sodium concentration presented as absolute numbers . Simultaneously, iwg, defined as the difference between current body mass and dry weight (iwg), and blood pressure (bp) were measured . All assessments, i.e., blood specimens and saliva collection as well as the survey, were conducted with the principle of the single time point assessment (a mid - week hd session). The antihypertensive treatment allowed bp below 140/90 mmhg before and 130/80 mmhg after hemodialysis to be achieved in most of the participants . Standard bicarbonate dialysate fluid containing 140 mmol / l of sodium, 1.25 mmol / l of calcium and 0.75 mmol / l of magnesium was used . The potassium concentration varied depending on the degree of the patient s kalemia before the session . The dialysis adequacy was assessed with a single pooled kt / v of average value 1.21.4 . The dry weight was established based on clinical examination, bp measurements and whole body composition spectroscopy . In all participants, the mineral bone disorder associated with their renal anemia and kidney diseases was successfully treated according to kdoqi recommendations [14, 15] as was diabetes mellitus . Both study subgroups were age and sex matched, and significant parameters were comparable with regard to the number of participants . The characteristics of subgroups are summarized in table 1.table 1characteristics of the study grouphyposalivationno - hyposalivation p value n 3279nsmales1945nsage (years)59.1 14.258.3 13.5nsdiabetes (n)1531nshba1c (%) 6.3 0.46.4 0.3nssmokers (n)811nshemodialysis vintage (months)13.8 7.214.2 6.9nsdialysis session time (min)255 20250 30ns kt / v 1.21 0.21.22 0.15nshgb (g / dl)10.8 1.510.7 1.3nsalbumins (g / l)4.0 1.93.9 2.1nsresidual diuresis (n)917nsvolume (ml / day)740 120710 110nsacei treatment (n)1835nsxerogenic medication (n)713nsalcohol consumption13nsdentures (n)1226ns hba1c glycosylated hemoglobin type a1c, hgb hemoglobinvalues are mean standard deviation (sd) ns not significant characteristics of the study group hba1c glycosylated hemoglobin type a1c, hgb hemoglobin values are mean standard deviation (sd) the abnormality of distribution was checked by the kolmogrov associations between iwg and pre-, post - dialysis sodium gradient or serum concentration, xerostomia, thirst score, and hyposalivation were estimated by using generalized linear regression with a compound symmetry covariance structure . Differences were considered significant if p was less than 0.05 . The results were expressed as mean standard deviation . The study protocol was approved by the medical university of lodz bioethics committee, resolution number rnn 147/09/ke . According to principles of gcp, informed consent was obtained from all patients prior to their inclusion in the study . Associations between iwg and pre-, post - dialysis sodium gradient or serum concentration, xerostomia, thirst score, and hyposalivation were estimated by using generalized linear regression with a compound symmetry covariance structure . Differences were considered significant if p was less than 0.05 . The results were expressed as mean standard deviation . The study protocol was approved by the medical university of lodz bioethics committee, resolution number rnn 147/09/ke . According to principles of gcp, informed consent was obtained from all patients prior to their inclusion in the study . The mean unstimulated salivary flow was 0.31 0.28 ml / min . Hyposalivation (uws <0.1 ml / min) was reported in 28.8% of hd patients . A statistically significant difference was seen between subgroups with regard to inter - dialysis weight gain, which was higher in participants with hyposalivation (table 2).table 2the comparison of parameters in patients with and without hyposalivationhyposalivationno - hyposalivationpre - dialysis sodium serum concentration (mmol / l)136.9 2.4138.3 2.8post - dialysis sodium serum concentration (mmol / l)138 2.6138.4 2.2pre - dialysis sodium gradient3.22 2.1 * 1.6 2.8*post - dialysis sodium gradient1.9 2.41.5 2.2thirst score (pts)17.9 5.918.5 6.9xerostomia score (pts)34.1 11.031.7 11.3inter - dialysis weight gain (kg)3.65 1.78**3.0 1.4**values are mean standard deviation (sd) * z = 2 . 9, p = 0.0314 * * z = 2.73, p = 0.0424 the comparison of parameters in patients with and without hyposalivation values are mean standard deviation (sd) * z = 2 . 9, p = 0.0314 * * z = 2.73, p = 0.0424 both patients with and without hyposalivation demonstrated similar post - dialysis sodium serum concentrations . Although the pre - dialysis sodium serum concentration was lower in the subgroup with hyposalivation than the one without, the differences did not reach statistical significance (table 2). Similarly, although the post - dialysis sodium gradient in both subgroups did not differ, the pre - dialysis gradient was significantly higher in the hyposalivation subgroup (table 2). The pre - dialysis sodium gradient in both subgroups in comparison with pooled hd patients is presented in fig . 1the comparison of assessed parameters in subgroups and in pooled hd patients presented as a graph with logarithmic scale the comparison of assessed parameters in subgroups and in pooled hd patients presented as a graph with logarithmic scale in the hyposalivation group, pre - dialysis sodium serum gradient negatively correlated with saliva outflow (= 0.61, p = 0.019) and positively with iwg (= 0.49, p = 0.022). In no - hyposalivation no statistically significant differences were found between the subjects with hyposalivation and the rest of hd patients (table 2). Interestingly, as with the xerostomia inventory, the thirst scores showed little variation between the hyposalivation and no - hyposalivation subgroups (table 2). . 1 . A positive correlation between iwg and xerostomia (= 0.341, p = 0.038), as well as a low and positive correlation between iwg and thirst (= 0.2 although positive correlations between thirst score and iwg was noted (= 0.386, p = 0.033) in the no - hyposalivation group, no significant correlations were found in the hyposalivation group, except between iwg and xerostomia score (= 0.622, p = 0.016). No correlations between unstimulated salivary flow rate and iwg, thirst inventory or xerostomia score were found, neither in the whole group of patients nor in the subgroups of patients with hyposalivation . In multivariable analysis, pre - dialysis sodium and saliva flow rate remained significant predictors of iwg . No interactions were present between other variables and iwg (table 3).table 3multivariable predictors of excessive weight gain in hemodialysis patients (whole cohort)estimationodds ratio95% ci p valuepre - dialysis sodium serum concentration0.060.740.811.11nspost - dialysis sodium serum concentration0.210.980.592.5nspre - dialysis sodium gradient0.960.390.381.5<0.01post - dialysis sodium gradient0.060.510.241.11nsthirst score0.210.880.122.6nsxerostomia score0.291.90.853.31nssaliva flow rate1.982.20.74.31<0.01 multivariable predictors of excessive weight gain in hemodialysis patients (whole cohort) the mean unstimulated salivary flow was 0.31 0.28 ml / min . Hyposalivation (uws <0.1 ml / min) was reported in 28.8% of hd patients . A statistically significant difference was seen between subgroups with regard to inter - dialysis weight gain, which was higher in participants with hyposalivation (table 2).table 2the comparison of parameters in patients with and without hyposalivationhyposalivationno - hyposalivationpre - dialysis sodium serum concentration (mmol / l)136.9 2.4138.3 2.8post - dialysis sodium serum concentration (mmol / l)138 2.6138.4 2.2pre - dialysis sodium gradient3.22 2.1 * 1.6 2.8*post - dialysis sodium gradient1.9 2.41.5 2.2thirst score (pts)17.9 5.918.5 6.9xerostomia score (pts)34.1 11.031.7 11.3inter - dialysis weight gain (kg)3.65 1.78**3.0 1.4**values are mean standard deviation (sd) * z = 2 . 9, p = 0.0314 * * z = 2.73, p = 0.0424 the comparison of parameters in patients with and without hyposalivation values are mean standard deviation (sd) * z = 2 . 9, p = 0.0314 * * z = 2.73, p = 0.0424 although the pre - dialysis sodium serum concentration was lower in the subgroup with hyposalivation than the one without, the differences did not reach statistical significance (table 2). Similarly, although the post - dialysis sodium gradient in both subgroups did not differ, the pre - dialysis gradient was significantly higher in the hyposalivation subgroup (table 2). The pre - dialysis sodium gradient in both subgroups in comparison with pooled hd patients is presented in fig . 1the comparison of assessed parameters in subgroups and in pooled hd patients presented as a graph with logarithmic scale the comparison of assessed parameters in subgroups and in pooled hd patients presented as a graph with logarithmic scale in the hyposalivation group, pre - dialysis sodium serum gradient negatively correlated with saliva outflow (= 0.61, p = 0.019) and positively with iwg (= 0.49, p = 0.022). In no - hyposalivation no statistically significant differences were found between the subjects with hyposalivation and the rest of hd patients (table 2). Interestingly, as with the xerostomia inventory, the thirst scores showed little variation between the hyposalivation and no - hyposalivation subgroups (table 2). The results in both subgroups and in pooled hd patients are presented on fig . 1 . A positive correlation between iwg and xerostomia (= 0.341, p = 0.038), as well as a low and positive correlation between iwg and thirst (= 0.2, p = 0.041), were observed in all hd patients . Although positive correlations between thirst score and iwg was noted (= 0.386, p = 0.033) in the no - hyposalivation group, no significant correlations were found in the hyposalivation group, except between iwg and xerostomia score (= 0.622, p = 0.016). No correlations between unstimulated salivary flow rate and iwg, thirst inventory or xerostomia score were found, neither in the whole group of patients nor in the subgroups of patients with hyposalivation . In multivariable analysis, pre - dialysis sodium and saliva flow rate remained significant predictors of iwg . No interactions were present between other variables and iwg (table 3).table 3multivariable predictors of excessive weight gain in hemodialysis patients (whole cohort)estimationodds ratio95% ci p valuepre - dialysis sodium serum concentration0.060.740.811.11nspost - dialysis sodium serum concentration0.210.980.592.5nspre - dialysis sodium gradient0.960.390.381.5<0.01post - dialysis sodium gradient0.060.510.241.11nsthirst score0.210.880.122.6nsxerostomia score0.291.90.853.31nssaliva flow rate1.982.20.74.31<0.01 multivariable predictors of excessive weight gain in hemodialysis patients (whole cohort) according to the most recent criteria, impaired saliva secretion, hyposalivation, is defined as unstimulated salivary flow rates below 0.1 ml per / min [12, 17]. The percentage of patients treated with intermittent hemodialysis, in whom objectively measured hyposalivation was observed to be 28.8%, which was lower than that found by bots et al . Who note decreased salivation in 36.2% of cases . However, different criteria were used by these authors to define hyposalivation, a 0.15 uws flow rate, which would have widened the group of patients, and the subjects of the present study were treated in one center and lived in one region, in contrast to the multi - center study performed by bots et al . . The mean hd vintage time in our study was relatively shorter than in other studies; however, the study group was more homogenous in regard to this parameter range (654 months) than in cited reference (range 3188 months). It might be possible that the relatively short hemodialysis vintage is reflected lower than in bots et al . But, on the other hand, according to bots et al ., after 2 years of follow - up, no change from baseline for uws value was noted in patients who remained on dialysis (0.31 0.19 vs 0.31 0.18 ml / min). Additionally, in the study by kho et al ., the hd vintage was shorter than in both of bots et al . Studies (22 vs 35.8 and 33 months) [5, 18], but the mean uws values in those trials were comparable . The percentage of hd patients with hyposalivation is higher than in general population . Wiener et al . Determined the percentage of older adults with diagnosed hyposalivation (uws <0.1 ml / min) to be 12.1%, which is over two times lower than in participants of our study, even though the population of older adults (over 70 years old) is susceptible to reduced saliva production related to certain medications and chronic conditions however, although the mean salivary flow in our study (0.31 0.28 ml / min) was slightly higher, it was still comparable with the mean salivary flow rates demonstrated in bots et al . (0.30 0.22 ml / min) or galvada et al . (0.28 0.16 ml / min) [4, 5]. The unstimulated salivary flow rate in the present study was close to the value obtained by wiener et al . For a population of older adults (0.4 0.3 ml / min). Our study also seems to confirm the finding that unstimulated salivary flow rate is comparable with values for healthy subjects [4, 5]. However, different results were obtained by kho et al . Despite the fact that the average uws flow rate was very similar to the values given in the studies mentioned above (0.30 0.18 ml / min), those authors found it to be significantly different to the uws flow rate of their control group (0.45 0.25 ml / min). Xerostomia, defined as the subjective sensation of oral dryness, is an important condition that significantly decreases the quality of life (qol) for 1729% of the older adult population of the usa . Reports of its prevalence in european countries vary, ranging from 6% at 50 years of age and 15% of those at 65 years of age in the swedish population and to more than 30% of the hungarian population . In the english population, self - reported xerostomia was found in 63% of hospitalized patients [2022]. However, the prevalence of the sensation of dry mouth is as high as almost 100% in patients with sjgren s syndrome and those who are receiving radiation therapy for head and neck cancers . Xerostomia in patients on maintenance hemodialysis can be caused by reduced salivary flow secondary to atrophy and fibrosis of the salivary glands, use of certain medications, but mainly to the restriction of fluid intake . Literature data shows that the percentage of hd patients who suffer from xerostomia is high and ranges between 32.9 and 76.4% [47]. This is in accord with the present study, in which 71.8% of the hd patients report having dry mouth symptoms . Tools such as the xerostomia inventory (xi) cannot only be used to discriminate individuals with or without self - reported dry mouth, but also help to assess the severity of xerostomia . The subjective feeling of dry mouth for hd patients in the present study (xi = 33.1 10.7) was found to be similar to that of hd patients according to bots et al . (xi = 28.3 9.1) and higher than seen in teratani et al . (xi = 22.2 7.4 and xi = 20.6 5.9, in patients who need hemodialysis owing to diabetic nephropathy and chronic glomerulonephritis, respectively). The xi score was also seen to be higher than for the general population of older adults described in wiener et al . The present study confirms those of other authors in the respect that some patients experience a subjective feeling of dry mouth despite normal, objectively measured, levels of saliva secretion, whereas others do not complain about oral dryness, despite objectively diagnosed hyposalivation [21, 26, 27]. Report that a total of 70.4% of the participants in their study group suffered from hyposalivation, but did not report having xerostomia . In our study, only 4 of 32 hd patients with hyposalivation did not report xerostomia, which confirms that the prevalence of xerostomia in hd patients is more frequent than in the general population of older adults with hyposalivation . On the other hand, in our study, only 5 of 76 patients with a salivary flow higher than 0.1 ml / min reported never having any symptoms of dry mouth . According to the literature, the sensation of xerostomia may occur in people who have normal salivary flow rates because areas of localized mucosal dehydration may exist in conjunction with normal salivary flow . A literature search completed over the period of 19801999 by mistiaen describes the prevalence of thirst to vary from 6 to 95%, but the most representative studies on relatively large samples of hd patients report it to be around 85% . Of the groups of patients with low thirst scores, 14% reported feeling not abnormally thirsty and 15% never thirsty . In our study, only one patient reported a dti score of 7 (never) for all questions concerning perceived thirst and 10.81% with answers hardly ever and never for the rest of questions (dti score 8 and 9 in 2 and 5 patients, respectively). The mean dti score of the patients (18.6 6.21) was comparable with that of the patients in the bots et al . This slightly lower value can be explained by the shorter mean time of treatment of hemodialysis in our study, which, according the bots et al . Findings, may influence thirst sensation (patients> 24 months on dialysis reported more thirst the present study investigates whether hyposalivation, xerostomia or thirst sensation were related to iwg . Similar to bots et al ., a significant correlation was found between iwg and thirst, as well as iwg and xerostomia in whole group of hd patients, and no relationship between uws flow rate and iwg was observed . Nevertheless, when the subjects were divided into groups with and without hyposalivation, the average iwg was found to be significantly higher in patients with hyposalivation, which may suggest that this factor plays an important role in enhancing weight gain . It is worth noting that in the hyposalivation subgroup, only self - reported dry mouth was related to iwg, which may indicate that mouth dryness dominates over thirst sensation in hd patients with hyposalivation, and this is the main reason for frequent fluid intake . As a very low amount of saliva causes oral mucosa dryness (dehydration), those patients frequently moisten oral mucosa by sipping fluids, which may mask the perception of thirst . However, in the subgroup with a saliva flow rate higher than 0.1 ml / min, the thirst sensation was the one that correlated with iwg . Also, other studies confirm that thirst is related to iwg despite being based on a range of methodologies involving different answer categories varying from a dichotomous yes / no answer to 5-point answer categories or visual analogue scales (vas). Nevertheless, mistiaen, in a review of published studies concerning the relationship between thirst and iwg in hemodialysis patients, underlines that this relationship is not necessarily as linear as often thought . For example, patients with high iwg who do not complain of thirst may drink a lot to prevent thirst, or drink whenever they feel slightly thirsty . It may also happen that a patient feels very thirsty but are able to refrain from drinking . Additionally, the concept of an individual sodium set - point and its kinetics in hemodialysis must be considered in regard to iwg and thirst or xerostomia . To maintain osmolar homeostasis, the sodium changes are always linked with water ingestion, which is of importance in the determination of the iwg . The sodium water overloads must be removed during hd, but in patients with a lower sodium set - point, this process is probably slower if not disrupted, and ultrafiltrated sodium tends to be hypotonic, the gibbs donnan effect, which implies that the diffusion process is responsible for final sodium tuning . Overall, the problem of hyposalivation and associated xerostomia, thirst or excessive iwg seems to be more complex than previously considered . One could speculate that lower serum sodium concentration (below 140 mmol / l) and elevated sodium gradient (over 3 mmol / l) [33, 34], which are rapidly normalized during hemodialysis session due to ultrafiltration (pure water removal) and dialysis with 140 mmol / l sodium in dialysate, which increases serum sodium concentration, can initiate the process of cell dehydration . Confirm that the saliva of hemodialysis patients is hypertonic in comparison with the saliva of healthy people and its contact with the mucous membranes of the mouth can in fact lead to cell dehydration rather than moisturization . Our earlier study demonstrates that the decrease in sodium concentration in dialysate normalizes sodium gradient and reduces iwg and should be of interest, whether or not it may have an influence on saliva secretion . The major study limitation is its design as an observational trial, which can describe only associations but does not provide certain casual relationships . However, its influence on thirst and mouth dryness, according to survey results, seems to be weaker than expected . Additionally, hyposalivation was found to be associated with an elevated pre - dialysis sodium gradient, which serves to clarify the connection between decreased saliva production and excessive weight gain in patients on maintenance hemodialysis, as well as its underlying cause . Although those findings potentially introduce new aspects in the assessment of the hyposalivation etiopathogenesis, the implications of our results need to be investigated in future studies.
|
Samples of stem, root, and leafy branches preserved in 70% ethanol were collected from a population near saipipi, savaii, samoa . A healer preparation from falealupo prostratin (1) was detected in each sample, and these materials were used for method development and validation . Another collecting expedition was made to the island of savaii, samoa, in january 2005 . Thirty - six samples, consisting of vouchers and ethanol - preserved pharmaceutical grade collections, were taken from three natural populations near the villages of saipipi, tafua, and falealupo . Six trees were sampled from each population, and gps coordinates, elevation, dbh, height, petiole color, and surrounding vegetation were recorded for each tree sampled . From three plants at each site three different morphological samples were collected: roots (bark + wood), stem (bark + wood), and leafy branches, with fruit and/or flowers if present . Only stem samples were collected from the other three trees at each site for a total of 12 samples per site . Nine stem samples were collected on additional expeditions to the island of tutuila in american samoa in may and november of 2005 for a total of 45 samples including 27 stemwood samples . Samples were shipped in vacuum - sealed aluminum vessels in 70% ethanol (except for the tutuila island collections, which were shipped in 70% 2-propanol). The alcohol fractions were separated and the plant material air - dried in a fume hood . Vouchers were deposited at the herbarium of the california state university fullerton s department of biological science . Plant material was finely chopped then pulverized with a coffee grinder, and approximately 1 g of dry sample tissue was suspended in 25 ml of acetone in a 55 c bath for 10 min . 4 disk, dried in a savant aes1000 speedvac, suspended in 500 l of 80% ethanol in hplc grade water, and then filtered with a 0.22 m millipore ultrafree mc centrifugal filter device . Nontarget organics were removed from the alcohol fraction with a waters sep - pak c18 cartridge using reversed - phase elution (conditioning: sequential washes of 5 ml of 52% acetonitrile, 5 ml of 26% acetonitrile, and 2.5 ml of 100% hplc water; loading: 100 l of sample; separation: 1 ml of hplc water, 2.5 ml of 26% acetonitrile, and 2.5 ml of 40% acetonitrile); the last fraction was filtered with a 0.22 m ultrafree mc centrifugal filter, dried, and suspended in 40 l of 80% ethanol for injection . The ethanol or 2-propanol fractions and the acetone extract for each of 45 samples were analyzed by hplc in triplicate to measure prostratin (1) concentration in g per g. prostratin was separated by reversed - phase elution using a waters nova - pak c18 column, 4 m bead, 300 3.9 mm, on a gradient hplc system (waters 717 automated injector, waters 1525 binary solvent delivery system, and empower data analysis system) at 30 c . Identification was using a waters 2487 dual - wavelength uv absorbance detector using an authenticated standard (icn mp biomedicals) at 254 nm . Aliquots of 10 l of each sample were injected, eluted over 15 min with a linear gradient mixing from 32% to 40% acetonitrile using filtered and degassed hplc grade water (fisher) and hplc grade acetonitrile (sigma chromasolv), with a flow of 1.0 ml / min . Method validation was completed in compliance with the specifications in the united states pharmacopoeia (usp), general chapter 1225,(33) and meyer. (34) ruggedness was evaluated by calculating the precision of biweekly triplicate injections at one concentration during the entire range of the study (rsd 5.21%). Linearity was evaluated by plotting peak area as a function of analyte concentration, and regression analysis was performed: slope = 207.78; intercept = 1468.70; correlation coefficient = 0.9997; residual sum of squares = 716 109 646.17 . The limit of detection (lod) and limit of quantification (loq) were determined as 2.5 and 25 pmol, respectively, with a range to 30 nmol . Accuracy (recovery = 96%) was calculated by spiking blank matrix with known amounts of 1 in triplicate at five concentrations . Repeatability was assessed with triplicate injections at five concentrations on two consecutive days (rsd 1.81%). Intermediate precision was calculated biweekly over the range of the study with triplicate injections at three concentrations (rsd 5.87%). The observed concentrations of 1 were ranked, and 95% confidence limits for the distribution of these concentrations around the median were constructed using eq 8.2.2 in snedecor and cochran. (35) to determine if the median prostratin (1) concentrations of all populations were equal, statistical hypotheses were tested using a kruksalwallis h test, the nonparametric analogue of anova . The resultant h statistic was tested for statistical significance at the p <0.05 level using standard tables . A chi - square test for independence was employed to ascertain if the occurrence of exceptionally high concentration plants was equal between populations and also to determine if the falealupo population had a greater than expected number of exceptionally high - yielding prostratin plants . We used a similar chi - square procedure to test the tafua and tutuila populations to see if they had a higher than expected number of exceptionally low - yielding 1 plants . Spearman s rank correlation coefficient was calculated to assess the correlation between prostratin concentration and diameter at breast height (dbh). A kruskalwallis h test was employed to establish if 1 was equally distributed throughout plant parts (leafy branches, stem, and root); to determine if plants with high stem concentrations also have high concentrations in the leaf or roots, we calculated a spearman s rank correlation coefficient and tested for significant correlation at the p <0.05 level.
|
Continuous phase transitions can be characterised by an order parameter which changes from zero above the critical temperature to a finite value below tc . The landau theory of phase transitions allows a very succinct phenomenological description of such phase transitions . It uses an expansion of the free energy of the system in terms of powers of the order parameter:1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f\left ({x, t} \right) = f_{0} \left ({x, t} \right) - \left [{hm\left ({x, t} \right)} \right] + \alpha \left (t \right)m^{2} \left ({x, t} \right) + \lambda m^{4} \left ({x, t} \right) $$\end{document}f(x, t)=f0(x, t)[hm(x, t)]+(t)m2(x, t)+m4(x, t)here, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f\left ({x, t} \right) $$\end{document}f(x, t) is the free - energy density, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$m\left ({x, t} \right) $$\end{document}m(x, t) is the local order parameter, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha \left (t \right) $$\end{document}(t) is a coefficient, which depends linearly on \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t $$\end{document}t: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha \left (t \right) = \alpha_{0} \left ({t - t_{\text{c}}} \right) $$\end{document}(t)=0(ttc), and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\lambda> 0 $$\end{document}>0 is a constant, and h is an external field . In field - free space, the expression contains only even powers of the order parameter, since the sign of the order parameter is irrelevant for the free energy . Consider for instance the order parameter of a ferromagnetic material, i.e. The local magnetisation . Obviously, the free energy depends only on the magnitude, not on the direction of the magnetisation . In the presence of an external field, however, the term given in square brackets in eq . It is linear in the order parameter, and hence changes sign, as either the order parameter or the external field are reversed . Now we concentrate on the phase transition at \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t_{\text{c}} $$\end{document}tc in the absence of an external field . At \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t_{\text{c}} $$\end{document}tc both the first and the second derivative with respect to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$m $$\end{document}m of the free energy are zero for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$m = 0 $$\end{document}m=0 . As a consequence, the order parameter is allowed to fluctuate around zero . Thus, the system is in a quite exceptional state, it exhibits critical fluctuations . This implies that the local order parameter varies in time and space from point to point . However it does so in a very peculiar manner, since the fluctuations are correlated . As \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t $$\end{document}t approaches \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t_{\text{c}} $$\end{document}tc the correlation length diverges . If the phase with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$m = 0 $$\end{document}m=0 is denoted as phase 1 and the phase with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$m \ne 0 $$\end{document}m0 as phase 2, then a diverging correlation length means that there are domains of either phase in the system which momentarily span the whole system . Moreover, at every moment, phase 2 is nucleating within phase 1 and vice versa . Thus, at a given time, phase 2 domains of every size are found in phase 1 and phase 1 domains of every size in phase 2 . Consequently at \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t_{\text{c}} $$\end{document}tc the correlation length \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\zeta $$\end{document} is the only characteristic length scale in the system . With \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\zeta $$\end{document} diverging at \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t_{\text{c}} $$\end{document}tc, the system is said to be scale free . The proliferation of phase boundaries in this state causes strong light scattering, the so - called critical opalescence . The fluctuation dissipation theorem states that the material s response function \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\chi \left (t \right) $$\end{document}(t) which characterises the response of a system to an external perturbation is proportional to the fluctuations of the order parameter:2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\chi \left ({\omega = 0,t} \right) = \frac{1}{{k_{b} t}}\left ({\left\langle {m^{2}} \right\rangle - \left\langle m \right\rangle^{2}} \right) $$\end{document}(=0,t)=1kbt(m2m2) thus, a fluctuating system is exceptionally sensitive against external perturbations . Consequently a material which can be kept in such a fluctuating state lends itself to applications in switching and sensing devices . The problem is of course that normally a precise fine - tuning of the thermodynamic parameters is required to keep the system close to the critical condition . If, for instance, point-, line-, or planar defects are immersed into the fluctuating system, the boundary conditions at the defects enforce a change of the fluctuation spectrum . Accordingly, the energy density between the defects is altered which results in an attractive or repulsive interaction between the defects depending on the boundary conditions (hertlein et al . This is a generalised casimir effect, the analogue to the interaction resulting from a modification of the vacuum fluctuation spectrum between to dielectric bodies . Even more importantly, fluctuations are believed to be responsible for the cooper pairing interactions in the unconventional superconductors, namely the cuprates and the iron - based superconductors (tru and kazuo 2003). Since in both cases the undoped parent compounds are antiferromagnetic, it is not surprising that spin density wave fluctuations are generally held responsible for the formation of the cooper pairs . Figure 1 shows a cartoon of the interaction between charge carriers with opposite spin in an antiferromagnetically fluctuating background (monthoux et al . Note that this type of interaction naturally explains the d - wave symmetry of the pairing interaction experimentally found in the cuprates . One should hasten to add that the subtle interactions governing the pairing and the formation of the bose condensate require low temperatures . Hence only critical fluctuations at a phase boundary which in the phase diagram heads down to very low temperatures are relevant for superconductivity (see fig . 2). If one extrapolates such a phase boundary through the superconducting dome, it is seen to cross the zero - temperature axis . At this point the fluctuations are obviously no longer thermally driven, but governed by quantum fluctuations . The property of materials in the vicinity of such a quantum phase transition are not yet very well understood (sachdev 1999). Different scaling laws apply and it is for instance not clear, at what temperature above the quantum critical point the signature of quantum fluctuations disappears . It is often presumed that unconventional superconductivity is not only a consequence of quasi - critical fluctuations of, let s say, the af order parameter, but that it results from the system s reluctance to enter that bizarre quantum regime close to the quantum critical point . Instead the system tilts over into a new phase, the superconducting phase . For the present purpose, it suffices to note that quasi - critical fluctuations along a phase boundary which heads towards the zero temperature axis as a function of some experimental parameter (doping, pressure, external field, etc .) 1schematic representation of spin - fluctuation mediated singlet pairing with d - wave symmetry . Orange (blue) sites represent preference for spin up (down) in an antiferromagnetic background . The interaction of a spin - up particle with a spin - down particle is attractive \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left ({\left ({\left ({} \right)} \right)} \right) $$\end{document} ((())), if the latter occupies a nearest - neighbour (nn) site, while it is repulsive \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left . {\left . {} \right)} \right)} \right)\left ({\left ({\left ({} \right .} $$\end{document}))) (((, if it occupies a nn site . 2schematic phase diagram of an unconventional superconductor schematic representation of spin - fluctuation mediated singlet pairing with d - wave symmetry . Orange (blue) sites represent preference for spin up (down) in an antiferromagnetic background . The interaction of a spin - up particle with a spin - down particle is attractive \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left ({\left ({\left ({} \right)} \right)} \right) $$\end{document} ((())), if the latter occupies a nearest - neighbour (nn) site, while it is repulsive \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left . {\left . {} \right)} \right)} \right)\left ({\left ({\left ({} \right .} $$\end{document}))) (((, if it occupies a nn site . As mentioned above, establishing quasi - critical fluctuations requires in general a precise fine - tuning to near a continuous phase transition or a critical point . In the following discussion, we concentrate on the temperature as the tuning parameter . In 3d, systems fluctuations are in general rapidly suppressed as the temperature deviates only by a few tenths of a degree from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t_{\text{c}} $$\end{document}tc . This problem can be solved by constructing low - dimensional systems . As the dimensionality is lowered, the temperature regime where appreciable fluctuations occur broadens considerably . Consider for instance a one - dimensional (1d) ising chain of length n with exchange interaction j <0, so that the groundstate is ferromagnetic . Flipping one of the spins in the chain changes the free energy f:3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\updelta f = \updelta u - t\updelta s = \left| j \right| - k_{b} t\ln n $$\end{document}f=uts=|j|kbtlnnwith \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left| j \right| $$\end{document}|j| being the energy cost for the spin misalignment and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$k_{b} \ln n $$\end{document}kblnn the configurational entropy arising from the free choice on which of the n positions the spin is flipped . Obviously, for t> 0 the free energy is always lowered, provided that n is large enough . Hence the correlation length in such a system with discrete symmetry and solely nn interactions diverges only for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t \to 0 $$\end{document}t0 k. similarly, in a 2d system with continuous symmetry, e.g. A heisenberg spin array, the correlation length will also diverge only for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t \to 0 $$\end{document}t0 k (mermin and wagner 1966). Accordingly, fluctuations will prevail in such materials down to 0 k. the broad range where fluctuations are expected to dominate the behaviour of quasi-1d systems is also illustrated by the calculations of anderson and co - workers (lee et al . 1973) who show that in their system, the correlation length diverges only at about 20% of the critical temperature \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t_{\text{c}} $$\end{document}tc . The bottom line is that quasi - critical fluctuations are difficult to establish in a 3d material, but by engineering low - d materials it is possible to considerably enlarge the parameter space for such a fluctuating state and eventually harness the exotic properties associated with it for practical applications . As a practical example we first consider a simple 2d system, i.e. An adsorbate on a transition metal . The model system chosen here is half a monolayer (ml) of bromine on pt(110). One ml is defined here as the surface atom density of the unreconstructed pt(110) surface (9.2 10 m). Halogen adsorption lifts the (1 2)-missing - row reconstruction of the clean surface and at room temperature the br forms a long - range - ordered c(2 2) structure as shown in fig . This is a very common structure, because the quasi - hexagonal one packing the repulsive energy between the adatoms is minimised . Since the pt(110) surface features close - packed atom rows with a nn distance of 0.277 nm, with the rows being separated by a lattice constant, i.e. 0.392 nm, the surface is strongly anisotropic . Actually, 1d electronic surface states are present and thus the surface may be considered as quasi-1d . Upon heating, a continuous disordering transition takes place.fig . 3the c(2 2)-br / pt(110) surface: ball model and stm topographic image (3.8 3.8 nm) (blum et al . (color figure online) the c(2 2)-br / pt(110) surface: ball model and stm topographic image (3.8 3.8 nm) (blum et al . 2002). (color figure online) the phase transition can be monitored by analysing the spot profile in low - energy electron diffraction (leed). For a long - range - ordered system, the spot profile is a gaussian and the height of the gaussian serves as a measure of the order parameter . As shown in fig . 4a, the gaussian peak height drops precipitously as the disordering temperature at ~370 k is reached indicating the loss of long - range order . As a result of defect pinning at monatomic steps of the pt(110) close to the transition temperature the peak profile is not a pure gaussian . Due to the local fluctuating order a lorentzian component appears and this is shown together with the correlation length derived from the width of the lorentzian in fig . 4b and c. from the temperature dependence of the lorentzian peak height one can conclude that fluctuations in the system are prominent within a range of about 100 k around \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t_{\text{c}} $$\end{document}tc . 4spot profile analysis of the half - order (red) and an integer - order (green) leed spot for the c(2 2)-br / pt(110) structure . The profile has been recorded in the direction perpendicular to the close - packed pt atom rows . A gaussian component of the spot profile which is a measure of the order parameter (long - range order). Insert theoretical temperature dependence of order parameter near t c. b lorentzian component which is a measure of the short - range order in a fluctuating system . Insert monte - carlo calculation of the lorentzian amplitude at t c in a finite 2d ising system . C correlation length of the fluctuations derived from the width of the lorentzian component . (color figure online) spot profile analysis of the half - order (red) and an integer - order (green) leed spot for the c(2 2)-br / pt(110) structure . The profile has been recorded in the direction perpendicular to the close - packed pt atom rows . A gaussian component of the spot profile which is a measure of the order parameter (long - range order). Insert theoretical temperature dependence of order parameter near t c. b lorentzian component which is a measure of the short - range order in a fluctuating system . Insert monte - carlo calculation of the lorentzian amplitude at t c in a finite 2d ising system . C correlation length of the fluctuations derived from the width of the lorentzian component . This is surprising, since cooling of an ordered structure usually tends to improve the order . Scanning tunnelling microscopy (stm) topographic images recorded at 50 k (fig . 5a, b) reveal why order is lost: another phase appears, with br atoms being arranged in a (2 1) unit cell . According to our dft calculations this is the actual groundstate of the system in agreement with its appearance upon lowering the temperature . It is somewhat unexpected that the (2 1) structure is most stable, since it should exhibit a higher inter - adsorbate repulsive energy as compared to the c(2 2). Instead, heating the sample is needed for rearranging the br atoms into the latter structure with extremely well - developed long - range order at room temperature . The presence of a second long - range - ordered structure for the same coverage at higher temperature is extremely rare in any adsorbate system . It requires this structure to have a much higher entropy than the groundstate . Since the long - range order excludes a substantial contribution from configurational entropy, the entropy gain in the adsorbate layer would have to arise from vibrational entropy . However the local bonding site is the same in both structures, so the vibrational entropy difference cannot explain this order the solution to the problem lies in the substrate contribution (cordin et al . While the pt(110) surface is flat and essentially bulk truncated, there is a pronounced buckling present in the (1 2)-br / pt(110) surface (cordin et al . This periodic lattice distortion (pld) is associated with a periodic charge modulation (cdw) in the surface . The br rows decorate the charge density maxima of the cdw.fig . 5phase transition c(2 2) (2 1) occurring upon cooling . A the long - range ordered c(2 2) structure observed at room temperature decays into a striped pattern of bright and dark domains . B a close - up reveals the bright domains to be formed by c(2 2) and the dark domains by (2 1) order . C ball model of the (2 1) structure: grey balls are substrate pt atoms, yellow balls br atoms . (color figure online) phase transition c(2 2) (2 1) occurring upon cooling . A the long - range ordered c(2 2) structure observed at room temperature decays into a striped pattern of bright and dark domains . B a close - up reveals the bright domains to be formed by c(2 2) and the dark domains by (2 1) order . C ball model of the (2 1) structure: grey balls are substrate pt atoms, yellow balls br atoms . (color figure online) qualitatively, the observed phase transition can therefore be described as follows: to establish the low - t (2 1) structure an extra energy cost has to be spent on the inter - adsorbate repulsion and the distortion of the substrate . This extra energy, however, is over - compensated by an increased bonding strength of the br to the substrate, as the latter offers more favourable bonding sites on the cdw maxima . Rising the temperature increases both, the lattice entropy and the electronic entropy in the substrate until the combined pld / cdw melts. In other words, the periodic lattice and charge density modulation is increasingly blurred by thermal excitation of phonons and by excitation of electrons across the peierls gap . As the pld / cdw order parameter is thermally suppressed, the energy balance tilts in favour of the c(2 2) structure, since in the latter the inter - adsorbate repulsion is minimised . To substantiate this idea we investigate the individual free energy contributions in the system . The inter - adsorbate repulsion can be represented in an ising - type model . To each of the adsorption sites \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$i $$\end{document}i is assigned an occupation number \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$s_{i} = \pm {1 \mathord{\left/ {\vphantom {1 2}} \right . \kern-0pt} 2} $$\end{document}si=1/122, depending on whether it is occupied (+) or not (). Since the br br distance along the close - packed row direction (the [1 1 0] direction) is the same in both structures, the difference in repulsive energies arises solely from the difference in the occupation of nn sites in the direction . Accordingly, in a (minimal) 1d model the repulsive energy can be represented by a term \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\sum\limits_{i} {js_{i} s_{i + 1}} $$\end{document}ijsisi+1, where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$i $$\end{document}i counts the adsorption sites in direction . For the c(2 2) structure, the occupation numbers change sign from place to place, and therefore the contribution to the free energy is negative . In the (2 1) structure in contrast, all \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$s_{i} $$\end{document}si are positive and a positive contribution to the free energy is obtained . The substrate contribution is provided by the usual landau expansion of the free energy in terms of powers of the order parameter, here the amplitude of the pld / cdw . Finally we need to represent the adsorbate coupling to the substrate cdw . To this end we introduce a coupling term \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\sum\limits_{i} {gm\left ({s_{i} + s_{i + 1}} \right)} $$\end{document}igm(si+si+1). For \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$g <0 $$\end{document}g<0 and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$m \ne 0 $$\end{document}m0, this term lowers the total free energy, if the adsorbate forms a (2 1) phase, but it is zero in the c(2 2) phase and also, if \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$m = 0 $$\end{document}m=0, i.e. If the substrate pld / cdw is suppressed . Thus, one obtains in total (ignoring a constant contribution \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f_{0} $$\end{document}f0 to the free energy):4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f = \sum\limits_{i} {js_{i} s_{i + 1} + \sum\limits_{i} {gm\left ({s_{i} + s_{i + 1}} \right)}} + \alpha \left (t \right)m^{2} + \lambda m^{4} $$\end{document}f=ijsisi+1+igm(si+si+1)+(t)m2+m4 the resulting free energy surface as a function of temperature and order parameter is discussed in detail in ref (cordin et al . On the flat substrate \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$m = 0 $$\end{document}m=0 and owing to the first term the free energy is minimised, if \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$s_{i} = - s_{i + 1} $$\end{document}si=si+1 . If the substrate is buckled \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left ({m \ne 0} \right) $$\end{document}(m0), then the coupling term becomes effective . For strong enough coupling, it will outweigh the first term and thus favour the (2 1) structure . Note that the second term has the form of an external field contribution to the free energy (compare eq . 1). Thus, it stabilises a finite value of the order parameter even for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t> t_{\text{c}} $$\end{document}t> tc . Actually, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t_{\text{c}} $$\end{document}tc could even be negative implying that the pld / cdw is unstable at all temperatures on the clean surface . Nevertheless, on the adsorbate covered surface an order parameter \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$m \ne 0 $$\end{document}m0 could persist up to some finite temperature due to the stabilisation of the pld / cdw as the adsorbate locks into the cdw fluctuations . The adsorbate freezes them into a (more or less) static pld / cdw phase in a bootstrap type mechanism . The stability of the system then depends on the barrier in the free - energy surface at a given temperature . Actually, in the present system there are still c(2 2) (2 1) fluctuations present at \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$t = 50 $$\end{document}t=50 k, albeit on a time scale of several seconds . As pointed out before, this is not too surprising, as a strong kohn anomaly has been observed even in the bulk (tsunoda 2011). Very recently a discussion arose about the origin of surface structures observed on the cleavage planes of 122 fe - based superconductors afe2as2, where 122 refers to the chemical composition and a is an earth alkali metal (ba, sr, ca) (hoffman 2011). On these cleavage planes c(2 2) and (2 1) structures where observed, with the former prevailing after room temperature cleavage of bafe2as2 and srfe2as2, while the latter was found after low - temperature cleavage . On cafe2as2 the (2 1) structure was stable also after room temperature cleavage . Long - range ordered domains were often found to co - exist with disordered areas . The results were similar for the undoped parent compounds and the doped superconductors, with a possible dependence of the relative stability of the two structures on doping . The interpretation of the observed structures was subject to controversy . While some groups favoured an explanation in terms of earth alkaline metal adsorbate superstructures (boyer et al . 2010), other groups proposed reconstructions of the arsenic top - layer (niestemski et al . This is motivated by (i) the striking similarity of stm topographs obtained on br / pt(110) as compared to results from afe2as2 cleavage planes [see figs . 2009)], (ii) the similar relative stability of the long - range ordered structures as a function of temperature and composition and (iii) similar structures in the fermi surface mapping obtained by angle - resolved photoemission spectroscopy (arpes). Argument (i) is perhaps somewhat phenomenological, but it would be surprising, if a reconstruction of a bare surface would produce not only a similar contrast, but also identical domain structures of coexisting adsorbate phases with a coverage of 0.5 ml . Argument (ii) deserves a more detailed consideration . The existence of two different long - range ordered structures depending solely on temperature is not trivial to explain, neither in the bare - surface, nor in the adsorbate - on - surface model . In both cases, the substrate has to co - operate in the phase transition delivering a substantial entropy contribution in the high - temperature structure . As pointed out above, the entropy difference could result from the melting of a cdw in the substrate . (2009), but was discarded, because they did not observe a contrast inversion in the stm image, as the bias was reversed . This conclusion, however, is not justified, if the cdw is decorated by an adsorbate . Moreover, on a bare surface the melting of a cdw above the critical temperature should result in a (1 1) structure rather than a c(2 2) as it is found in the present case . Further support for the adsorbate - on surface hypothesis derives from theoretical work by gao et al . Their ab initio dft calculations showed the surface with 0.5 ml earth - alkaline metal coverage to be the energetically preferred one . As to the superstructure, the c(2 2)-a structure was found to be the most stable one for a = ba, to be marginally stable for a = sr, and to be unstable with respect to the (2 1)-a structure for a = ca . Of course, dft total energy calculations yield the groundstate for t = 0 k and as such are not able to predict or explain phase transitions . As judged from experiment, the equilibrium groundstate is more likely the (2 1) state for all three cases, but the trend in relative stability is apparently correctly represented in the dft calculations (cordin et al . (4) yields an explanation for the phase transition as well as for the relative stability: since the first term in eq . (4) representing the inter - adsorbate repulsion favours the c(2 2) structure and since the repulsive energy j is expected to be the largest for ba and the smallest for ca, the c(2 2) structure should indeed be the most stable for bafe2as2, as predicted by gao et al . (2010). The explanation of the different structures as a function of temperature in the present model is based on the assumption of a cdw instability in the substrates, viz . The asfe2as sandwiches . This leads to argument (iii) from above: in pt(110), the cdw instability was attributed to a nesting vector between two points of high density - of - states (dos) at the fermi level (see fig . A similar nesting condition is not anticipated for the afe2as2 compounds, at least not in many of the model band structures on which the analysis of antiferromagnetic correlations in the 122 compounds is usually based . Note that the nesting vector underlying the cdw correlations postulated in the present model includes an angle of 45 with the nesting vector which is held responsible for the antiferromagnetic instability . Recent arpes results, however, are at variance with the band topology at the surface brillouin boundaries (sbz) proposed in some simplified band structure models (zabolotnyy et al . Points of high arpes intensity and consequently high dos are found at the fermi level which resemble closely the ones seen in the fermi surface map of pt(110) shown in fig . 6b (cordin et al . 2012). Neither in pt(110) nor in the 122 fe arsenides do the connecting vectors precisely match half a reciprocal lattice vector as expected for a cdw of period 2 . If this were the case, the result would presumably be a static cdw rather than cdw fluctuations . One should also be careful in applying nesting arguments too rigidly as pointed out by mazin and coworkers (johannes and mazin 2008). Usually, the structures in the response function \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\chi \left (q \right) $$\end{document}(q) caused by fermi surface nesting are not sharply peaked, since they result from integration over a finite energy interval around ef and in addition are weighted by the electron 6 a coexistence of c(2 2) and (2 1) domains showing a striking similarity to surface structures observed on srfe2as2 (niestemski et al . 2009). B fermi surface map of pt(110) recorded in angle - resolved photoemission spectroscopy . The orange arrow indicates a wave vector q of excitations between two points of high density of states at the fermi level . (color figure online) a coexistence of c(2 2) and (2 1) domains showing a striking similarity to surface structures observed on srfe2as2 (niestemski et al . B fermi surface map of pt(110) recorded in angle - resolved photoemission spectroscopy . The orange arrow indicates a wave vector q of excitations between two points of high density of states at the fermi level . (color figure online) the present model attributes the (2 1) phase to a cdw in the asfe2as sandwich layer which is stabilised in a bootstrap mechanism by the earth alkaline metal atoms . In the bulk compound, however, this mechanism cannot operate, since there is a full a layer separating the asfe2as sandwiches . Thus, instead of a static cdw, only charge density fluctuations are expected . The corresponding wave vector is oriented in the real space direction of the pairing interaction (zhai et al . It is conceivable that a surface cdw stabilising the (2 1) structure could also originate from fluctuating orbital order (kontani and onari 2010) with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathbf{q}} = \left ({\pi, 0} \right) $$\end{document}q=(,0) (zhou et al . 2011). Tuning materials into a quasi - critical fluctuation regime offers the opportunity to make use of exotic properties associated with such a fluctuating state . Among these properties are a strong response to external perturbations and novel types of interactions, such as the casimir force or cooper pairing . The parameter range in which fluctuations persist is considerably enhanced in low - dimensional systems . Hence, precision tuning can be avoided, if low - dimensional systems are constructed . As an example, a metal adsorbate system is analysed, in which charge - density fluctuations cause an unconventional phase transition . The phase transition is modelled in the spirit of landau theory by expanding the free energy in terms of a cdw order parameter, but also adding terms representing the inter - adsorbate repulsion and the adsorbate substrate coupling . Transferring the same model to the controversially discussed surface structures observed on 122 fe - based superconductors a consistent explanation of both, the temperature dependence and the relative stability of the structures as a function of chemical composition is reached . As a consequence, it is suggested that cdw (or eventually orbital order) fluctuations are present in these compounds with a wave vector differing by an angular offset of 45 from that of the afm this underlines the pivotal role of fluctuations in unconventional superconductors, on the other hand it illustrates the rich phenomenology accessible by steering different order parameters into the fluctuation regime.
|
The leading cause of nontraumatic extremity amputation is complications of diabetes, with over 96,000 amputations per year.1 neuropathy associated with diabetes predisposes to pain, numbness, ulceration, infection, gangrene, and amputation . Somatic and autonomic diabetic neuropathy contribute to 87% of these amputations.2 it is now appreciated that there are different forms of neuropathy in diabetes.1 damage occurs to both large, myelinated nerve fibers and small, unmyelinated fibers (c - fibers). The small, unmyelinated c - fibers subserve thermal and pain perception, and the small autonomic fibers affect sweating and vascular control.3 damage to small, unmyelinated c - fibers has the greatest impact on survival and quality of life, producing initial symptoms such as pain, numbness, and anhidrotic skin with disordered skin blood flow (skbf) predisposing to foot ulcers, infection, gangrene and limb loss.4 diabetic peripheral neuropathy is the primary cause of diabetic ulcers and the most predictive diagnosis for an eventual amputation . Current therapies for diabetic peripheral neuropathy are for symptomatic relief of pain and not for the underlying disorder.58 any addition to the therapeutic armamentarium would be welcome . It has been shown that small fiber neuropathies are quantifiable with newer tests of c - fiber integrity that include quantitative measures of skbf and corneal confocal microscopy,911 quantification of intraepidermal nerve fibers (ienf),1216 and quantitative sensory testing (qst).17 heat- induced vasodilation (44c), is reduced in subjects with impaired glucose tolerance, and in type 2 diabetic patients with and without neuropathy.18 we have reported that one of the earliest quantitative sensory abnormalities found in people with diabetic peripheral neuropathy is the impairment of small fiber sensory perception that cosegregates with disordered neurovascular function.19,20 furthermore, there is evidence to suggest that one of the early manifestations of c - fiber dysfunction can be based upon skin biopsies, with measurement of the density of thin, unmyelinated nerve fibers using immunohistochemistry for protein gene product 9.5 (pgp-9.5) as a neuronal marker.12,13,15,16,21,22 since description of the utility of pgp- 9.5 as a marker for ienf in human skin,23 it has been used for identification of small nerve fibers in the dermis and epidermis in a range of small fiber neuropathies, including human immunodeficiency virus, and idiopathic small fiber and postherpetic neuralgia, among others.13,15,2429 in addition, we have now established that there are characteristic changes in ienf that distinguish the metabolic syndrome from diabetes . 30 ienf density was recently given a level a recommendation by the european federation of the neurological societies and the peripheral nerve society as a reliable and efficient technique to confirm the clinical diagnosis of small fiber neuropathy.31 the ienf density has been shown to correlate inversely with cold and heat detection thresholds.32 a oneyear diet and exercise intervention program in patients with small fiber neuropathy and impaired glucose tolerance led to increased ienf density.33 ienf loss is evident early in the disease process, declines with increasing neuropathic pain, and can be used as an outcome measure in clinical trials.31,33 apart from the one - year trial on diet and exercise,33 no drug has been shown to induce c - fiber regeneration . Topiramate, a structurally novel antiepileptic drug, is effective in treatment of various types of epilepsy and prevention of migraine headaches . A sulfamate - substituted derivative of d - fructose, topiramate has several pharmacologic properties suggesting it may have potential for overcoming the programmed cell death implicated in the pathogenesis of neuropathy.4 it enhances gamma aminobutyric acid (gaba) activity by interacting with a nonbenzodiazepine site on gaba receptors, has negative modulatory effects on voltage - activated na+ channels,34 selectively blocks ampa / kainate glutamate receptors, has negative modulatory effects on l - type high voltage - activated ca channels,35 and inhibits the carbonic anhydrase isozymes, ca - i and ca - ii.34 these multiple mechanisms of action may contribute to its anticonvulsive, antinociceptive, and putative neuroprotective properties . There has been no report on the ability of topiramate to influence the structure and function of ienf, although there are animal studies to suggest that it may exercise these properties.36,37 topiramate thus clearly offers an advantage over agents currently used for neuropathy in as much as it relieves pain and, in animal studies, is neurotrophic and neuroprotective, and may have beneficial effects on weight, blood pressure, and lipids . The american diabetes association and the american society of pain have recently added topiramate and other anticonvulsant medications to the diabetic neuropathy treatment regimen.38 there may be an added benefit with topiramate in treating diabetic patients with neuropathy, because it exerts both neurotrophic and metabolic effects that have not been shown by other anticonvulsants.7,8,39 we have reported on pain reduction with topiramate7 which persisted for at least six months40 and had salutary effects on weight, blood pressure, and serum lipids . The aim of this study was to determine whether topiramate induces regeneration of small cutaneous nerve fibers in concert with improved skbf and sensory measures of c - fiber function . The eastern virginia medical school institutional review board approved the study and all subjects gave written informed consent prior to any study procedures . All subjects participating in this study had type 2 diabetes, were aged 3575 years, and had documented evidence of diabetic peripheral neuropathy . The study was a pure within - subject repeated - measure design comparing skin biopsy data, sensory responses, and skbf before and after treatment with topiramate in subjects with diabetic peripheral neuropathy . All assessments occurred once prior to treatment and again at the end of the 18-week treatment period . Neurologic symptom scores and neurologic disability scores were generated by completion of a questionnaire modified from dyck.41 the sum of the three scores (symptom, motor, and sensory scores) is the total neuropathy score . Neuropathy was established by the criteria suggested by the american diabetes association and american academy of neurology.42 qst included measures of temperature and touch perception thresholds . Quantitative autonomic function was assessed by three tests, ie, heart rate variability during deep breathing at six breaths per minute (e: i ratio), the r: r variation in response to the valsalva maneuver, and the r: r variation is response to postural change as suggested by the neurologic disability score position statement on neuropathy.38 qst was performed using the medoc device (tsa2001/vsa3001) following previously published procedures . Touch pressure was measured using graded monofilaments (semmes weinstein).17 measurements were taken 2 cm proximal to the skin biopsy sites on the nondominant limbs . Nerve conduction studies were performed on the nondominant peroneal motor, sural sensory, and ulnar motor and sensory nerves, using standard techniques of supramaximal percutaneous nerve stimulation, surface recording, and appropriate filtering and signal amplification . Stimulation - to- recording electrode distances, electrode placement, and limb surface temperatures were defined for each nerve conduction study to ensure that all studies were performed under similar conditions . Neurologic symptom scores and neurologic disability scores were generated by completion of a questionnaire modified from dyck.41 the sum of the three scores (symptom, motor, and sensory scores) is the total neuropathy score . Neuropathy was established by the criteria suggested by the american diabetes association and american academy of neurology.42 qst included measures of temperature and touch perception thresholds . Quantitative autonomic function was assessed by three tests, ie, heart rate variability during deep breathing at six breaths per minute (e: i ratio), the r: r variation in response to the valsalva maneuver, and the r: r variation is response to postural change as suggested by the neurologic disability score position statement on neuropathy.38 qst was performed using the medoc device (tsa2001/vsa3001) following previously published procedures . Touch pressure was measured using graded monofilaments (semmes weinstein).17 measurements were taken 2 cm proximal to the skin biopsy sites on the nondominant limbs . Nerve conduction studies were performed on the nondominant peroneal motor, sural sensory, and ulnar motor and sensory nerves, using standard techniques of supramaximal percutaneous nerve stimulation, surface recording, and appropriate filtering and signal amplification . Stimulation - to- recording electrode distances, electrode placement, and limb surface temperatures were defined for each nerve conduction study to ensure that all studies were performed under similar conditions . Skbf was measured by continuous laser doppler assessment of the response to varying stimuli, as previously described.20,43 testing was done on the nondominant foot and proximal calf at baseline, after six weeks of maintenance treatment (ie, a total of 12 weeks treatment) and at the end of 12 weeks of maintenance treatment . The skbf and temperature probes were placed over the external aspect of the nondominant leg 10 cm below the knee over the area where the skin biopsy sample was taken and on the dorsum of the foot . Skbf examinations were done with the patient in a reclined position with the legs elevated and completely extended . After a 10-minute baseline period, the temperature was increased to 32c for 10 minutes, 40c for 10 minutes, and then to 44c for 20 minutes . Biopsies were collected from each patient s dorsal forearm, lateral thigh (10 cm proximal to patella), lateral proximal leg (10 cm distal to fibular head), and lateral distal leg (10 cm proximal to lateral malleolus). Tissue samples were immediately fixed in 2% buffered paraformaldehyde / lysine / periodate solution for 1224 hours at 4c . They were subsequently cryoprotected in phosphate buffer with 20% glycerol overnight and frozen for later cryosectioning . Procedures for identifying neurons in skin biopsies employed immunofluorescence techniques in a modification of the protocol described by mccarthy et al.13 the processing and cutting of the slides were done following procedures previously described.30 the skin biopsy data from this cohort of patients was also compared with healthy control patients taken from the large skin biopsy database created and maintained at our institute . Blood samples were obtained at the screening and final visits for determination of glycosylated hemoglobin (hba1c), lipid profile including total serum cholesterol, high - density lipoprotein (hdl) cholesterol, low - density lipoprotein (ldl) cholesterol, free fatty acids, and triglycerides, and fasting serum glucose and c - peptide . We also measured serum b12 and rapid plasma reagin at screening in order to rule out occult neuropathies . In addition, liver enzymes were measured at screening, and at weeks 4, 6, 12, and 18 . The primary endpoints were skbf, qst, and indices of ienf density and length, all of which are continuous (parametric) data . Repeated measures analysis of variance was used to examine the treatment effects for skbf, qst, and skin biopsies . Significant differences were accepted as p <0.05 . Where significant treatment differences were observed, contrast testing was used to determine the significance at each level, while allowing for multiplicity of comparisons . In addition, nonparametric spearman rank correlations were done to examine the relationship between ienf, skbf, and measures of neurologic function . The patients entered into this study were predominantly caucasian, overweight, male, and hypertensive type 2 diabetics with clinical evidence of distal symmetric polyneuropathy (table 1). Our previous experience prescribing topiramate led us to use a low starting dosage and a slow dosage - escalation protocol . Oral topiramate was administered initially at a dose of 25 mg / day and gradually titrated over six weeks to a dose of 100 mg / day or the maximum tolerated dose . Fifteen of the 20 subjects were able to tolerate 100 mg / day, two subjects were maintained on 75 mg / day, and three were on 50 mg / day . A 12-week maintenance period followed the titration phase . During this period, the dose of study medication remained constant . One of the 20 patients was discontinued from the study early due to cognitive effects of the medication, including psychomotor slowing, word finding difficulty, and fatigue . We have previously reported16 that mean dendritic length and ienf density progressively decreased from proximal to distal sites in patients with neuropathy . In this cohort of patients, there was a similar decrease in ienf density and mean dendritic length from proximal to distal sites (figure 1a and 1b). Nerve fiber density in skin taken from patients before topiramate treatment was significantly lower than in skin taken from comparable sites in healthy control patients in our large skin biopsy database . Comparing the results at each site, ienf density in the forearm was significantly lower in patients (13.2 3.5) compared with controls (32.9 3.2; p <0.001). Similar deficits in ienf were seen in the thigh (8.4 5.7 versus 35.6 7.3; p <0.01), proximal leg (3.1 2.2 versus 17.4 2.0; p <0.001), and distal leg (4.6 4.6 versus 28.0 3.9; p <0.001). Mean dendritic length of nerve fibers in skin from controls was similar, regardless of site, ie, forearm (3.28 0.18 m), thigh (3.69 0.3 m), proximal leg (3.34 0.23 m), and distal leg (3.31 0.3 m). There was a progressive shortening of fibers in patients before treatment with topiramate from forearm to distal leg . In addition, mean dendritic length in skin from patients before topiramate treatment was significantly lower than skin taken from comparable sites in control subjects, ie, thigh (2.28 0.23; p <0.001), proximal leg (1.79 0.26; p <0.001), and distal leg (1.94 0.35; p <0.005). Mean dendritic length was not different from controls in the forearm (2.86 0.19; p <0.05). Treatment with topiramate significantly increased mean dendritic length in the forearm and proximal leg (figure 1a) and ienf density in the proximal leg (figure 1b). This was associated with improvement in total neuropathy scores, including touch, vibration, and prickling pain thresholds, and reduction in weight, body mass index, systolic and diastolic blood pressures, and hba1c (table 2). A significant increase in skbf was seen at week 12, but returned to baseline at week 18 . Skbf in the leg increased from 87.7 0.1 to 101.3 0.1 (p <0.001) and in the foot from 102.6 0.2 to 143.7 0.6 (p <0.001) laser doppler units at 12 weeks . No correlations were found between the changes in measures of neurologic function, ienf, and the changes in metabolic parameters . In this small within - subject pilot study, we have shown that 18 weeks of treatment with topiramate induced improvement in neurologic disability scores, including prickling, vibration, and touch perception . This was associated with improvement in skbf after 12 weeks of treatment, but this returned to baseline at 18 weeks . Quantification of ienf density and mean dendritic length in skin biopsies, carried out at entry into the study and repeated at the same sites after 18 weeks of treatment, showed an increase in nerve fiber length at the forearm and proximal leg after treatment with topiramate, and an increase in nerve fiber density at the proximal leg . We have previously shown4,44 that the earliest change found in patients with the metabolic syndrome without hyperglycemia is a reduction in mean dendritic length and that the decrease in ienf density occurs after at least five years of diabetes and is most prominent at the distal site.44 thus, the patients in this study most closely resemble those with diabetes, including those with features of the current definition of the metabolic syndrome (table 1). There is a distinct clinical entity of neuropathy associated with the metabolic syndrome in the absence of glucose intolerance . However, up to 50% of patients with painful neuropathy may have impaired glucose tolerance.17,45,46 this suggests that treatment of the nonhyperglycemic components of the metabolic syndrome may be important . While we do show an improvement in hba1c, blood pressure, and weight similar to that reported for topiramate in previous neuropathy studies,7,39 we could not find correlations between changes in nerve fibers or cognitive function and changes in the metabolic parameters . In this study we showed that 18 weeks of treatment with topiramate improves total neuropathy scores, touch, prickling pain, and vibration perception, as well as ienf . We have reported16,44 that distal leg ienf density showed significant negative correlations with warm (p <0.02) and cold (p <0.05) thermal threshold, heat pain (p <0.05), pressure sense (p <0.05), sensory score (p <0.03), and total neuropathy score (p <0.03), and thus objective measures are likely to be related . It is not clear, at this point in time, if these changes can be sustained for greater periods . It has been shown that pain improvement persists for at least six months,40 and anecdotally our patients appeared to continue to improve beyond the defined study period . Clearly, longer duration studies are needed to determine if the cross - sectional correlates of nerve fiber densities and mean dendritic length with different sensory modalities can be realized . We have reported that there is a direct correlation between distal leg ienf density and duration of diabetes,47 suggesting that there is a loss of about one nerve fiber per mm per year . A reduction of one nerve fiber per mm translates into clinically significant changes in total neuropathy scores and objective measures of cognitive function . Furthermore, an improvement in the proximal leg of three nerve fibers per mm was found to provide clinically meaningful changes in objective parameters of nerve function . Therefore, we would propose that a conservative estimate of double the value for change in function, ie, two nerve fibers per mm, could be considered a minimal requirement for success in future studies of agents affecting nerve biology . Furthermore, we have also reported that there is a progressive shortening of the mean dendritic length in the distal leg.47 since this change occurs in the metabolic syndrome independent of blood glucose,44 it seems that this could be a valuable endpoint in patients being treated for components of the metabolic syndrome other than hyperglycemia . The pattern of regeneration is unique and dictates a need to use ienf length, rather than density, as an endpoint in clinical studies at sites where viable nerve fibers still exist . Because of the demonstrated effects of topiramate on various metabolic aspects, it could be an important addition to therapies aimed at the metabolic syndrome and its sequelae, including neuropathy and diabetes . Topiramate has been reported to have positive effects on pain relief in diabetic peripheral neuropathy,7 an effect which has been shown to be durable40 in clinical trials for the management of diabetic peripheral neuropathy pain syndromes . In these studies it was noted that weight loss and changes in metabolic parameters accompanied pain relief, but the role of topiramate in disease modification of neuropathy is limited.48 although the mechanisms underlying the neuroprotective effect of topiramate are not fully understood, there may be added benefits for people with type 2 diabetes . Topiramate inhibits weight gain in animals on a high - fat diet, but the mechanism through which change in energy balance is achieved is unclear.49 topiramate causes weight loss50 sustained for one year.51 in our studies, treatment with topiramate not only improved symptoms of neuropathy, but also reduced body weight, body mass index, systolic and diastolic blood pressure, and hba1c . These findings are not unlike those previously reported with topiramate treatment in normal healthy patients, as well as in patients with diabetes.50,51 the caveats, however, are that this was a small open - label trial, with careful attention paid to minimizing the untoward side effects known to occur at higher doses of topiramate . Effects of topiramate on cognitive function, including psychomotor slowing, short - term memory loss, fatigue, and anorexia have been reported with topiramate treatment . These common side effects make it difficult to design a true placebo - controlled trial . In our short study, we found if there was a low starting dose (15 mg), and a slow taper to a low maximum dose of 100 mg, many of these side effects are mitigated . What would be attractive is the discovery of an agent with the beneficial neurologic and metabolic effects of topiramate, but free of cognitive dysfunction and intensive dosing requirements, which would allow a true placebocontrolled trial to be performed.
|
Patients with cancer who undergo complex treatments may experience psychological distress, but it is often unrecognized, and if left untreated may contribute to poor health outcomes among patients and their caregivers . Evidence - based distress management guidelines, developed by the national comprehensive cancer network (nccn) include psychological distress screening for all cancer patients early in the course of treatment, so that mental health treatment plans and referrals may be instituted promptly . The guidelines were developed based on the available evidence, which was primarily among women with breast cancer, but little is known about the guidelines' utility with patients with other types of cancer . Ovarian cancer is more lethal, and typically affects women who are older than those with breast cancer . Psychological distress experienced by women with ovarian cancer tends to be worse among younger women, those recently diagnosed, or with advanced forms of the disease or recurrence [35], and distress tends to worsen as cancer progresses [6, 7]. It is not known whether the demographic and clinical factors unique to women with ovarian cancer require special refinements to the distress management guidelines when treating their psychological distress . Advanced practice nursing (apn) interventions, which incorporate physical, educational, psychological, and care coordination interventions during patients' transitions from hospital discharge through chemotherapy, have been associated with improvements in quality of life among patients with cancer [8, 9], including women with ovarian cancer . Oncology apns focus on symptom management from cancer and cancer treatments, while apns specializing in psychiatric care are qualified to perform in - depth mental health assessments and may treat or refer patients to other mental health clinicians for psychological problems . The identification of the specific interventions administered by oncology apns, including those derived from consultation with psychiatric apns to women with high psychological distress, is important to understand the trajectory of psychological distress in ovarian cancer, evaluate the utility of the distress management guidelines in clinical practice, and determine best practices in managing mental health needs specific to patients with ovarian cancer . The purpose of the current study was to examine in depth the documented problems encountered by women with ovarian cancer soon after surgery, as well as apn interventions performed during a series of clinical encounters within six months following hospital discharge . Screening for psychological distress, a component of the distress management guidelines, provided a unique opportunity to analyze the incorporation of this activity into the treatment plan . In addition, it compared problems and nursing interventions for highly distressed patients who received specialized mental health services provided by psychiatric apns with those patients in the study with both low and high distress who had not received these services . Because symptoms of ovarian cancer are often subtle and initially attributed to minor problems, more than 70% of ovarian cancer cases are diagnosed at advanced stages when it has metastasized to the liver, intestines, diaphragm, or lungs . Surgical treatment for ovarian cancer includes total abdominal hysterectomy and bilateral salpingo - oopherectomy, an extensive procedure, which entails a difficult postoperative recovery period followed by aggressive chemotherapy . The ability to tolerate the rigors of surgery and chemotherapy the time when women need to adjust to the physical toll of surgery for ovarian cancer, embark on a difficult course of chemotherapy, and contemplate the existential concerns inherent in life - threatening illness may subject them to undo strain and predispose them to sustain psychological distress and its resultant adverse consequences, including anxiety and depression . Little available research has examined the specific physical and psychosocial problems experienced over time among women with ovarian cancer and high psychological distress . Norton and colleagues identified mild or greater depressive symptoms in 55% of a sample of women with varying stages of ovarian cancer on the beck's depression inventory, and the association of high numbers of symptoms and heightened distress in ovarian or other gynecological cancers has also been reported . Literature is emerging which identifies clinically significant psychosocial and treatment issues among women with ovarian cancer . For example, women under age 60 have higher depressive symptoms and prefer information on coping techniques than older women with ovarian cancer . The need to maintain normality, especially in social relationships, and the tendency to comfort loved ones distraught over their diagnosis, rather than the reverse, however, few studies outline specific interventions helpful in addressing the psychosocial problems experienced among women with ovarian cancer, including the use of clinical practice guidelines as a way to improve effectiveness in treating mental health issues in cancer . However, several randomized clinical trials support their use in primary care with regard to depression [1621]. Although busy clinicians in various settings struggle within increasingly contracted timeframes to meet their patients' physical and psychosocial needs, quality cancer care nevertheless requires that it be customized to patients' needs and values, proactive to patients' anticipated needs, provide patient education, and allow patients control over their health care decisions [22, 23]. Several creative initiatives designed to improve care related to these recommendations include incorporating the services of apns to use a broad array of strategies among diverse samples of patients to deliver care inclusive of the above criteria . In oncology, much of the research on apn effectiveness reflects activities performed in ambulatory or homecare oncology settings . In several well - designed randomized trials, mccorkle's research teams have illustrated the effectiveness of a specialized oncology nursing intervention, delivered through periodic apn visits over the course of several months on physical and psychological outcomes in patients with advanced cancer, including reduced symptom distress, increased independence, and lower hospitalizations among lung cancer patients, improved function and mental health in patients with solid tumors, and improved survival after cancer surgery . Apn activities specified in the above studies targeted pain and symptom management, educated patients and families about cancer, cancer treatment, and self - care, and provided ongoing physical and psychological assessments to promote early recognition and management of clinical problems that might otherwise prompt hospital admissions . To identify key aspects of the intervention most likely responsible for these outcomes, several authors have analyzed the content of the apn interventions through secondary analysis . In one study, apn interventions for patients with radical prostatectomy focused predominantly on patient teaching (45%) and psychologically based interventions (20%). Similarly, activities which focused on teaching and providing psychological support and reassurance were among the most frequent nursing interventions delivered to postsurgical cancer patients . These examples illustrate that much of the interventions effective in improving outcomes for patients with advanced cancer who receive specialized care by apns may be associated with the influence of psychological, educational, and supportive activities . Mccorkle and colleagues recently found that a specialized apn intervention program resulted in less uncertainty and better mental health summary measures of quality of life than an attention - control group up to six months after ovarian cancer surgery in a randomized control trial . Highly distressed subjects in the intervention group who consented to an additional psychiatric apn intervention consisting of a mental health evaluation and treatment plan resulted in these women reporting significantly less uncertainty and symptom distress and better physical and mental health summary measures of quality of life over time than the women who did not receive this intervention . These findings highlight the complexity of needs experienced by women with ovarian cancer, as well as the importance of tailoring interventions to patients' specific physical and psychological needs . Identification and classification of patient problems and apn interventions for the purpose of analysis requires the use of a valid and reliable classification system to allow for sufficient detail in both of these parameters, individually as well as in relation to one another . The omaha system is a research - based, practice and documentation classification system with demonstrated validity and reliability in three decades of prospective and retrospective research [30, 31]. It is one of seven standardized terminology systems recognized by the american nurses association and is endorsed by the health information technology standards panel . The alliance of nursing informatics (ani) cites its utility as a point - of - care technology that enables users to capture and represent health data regarding assessment, service, and outcomes . It has demonstrated applicability to diverse patient groups, is relatively easy to use, and is able to capture discrete clinical details throughout the course of care . Although research in ovarian cancer has grown substantially over the past decade, longitudinal research examining patient characteristics and treatments for psychological distress, as well as their relationships to one another, are lacking . The current study provided an in - depth examination of the problems experienced by women with ovarian cancer and the discrete apn interventions administered to them over the course of their treatment . These findings contribute to the evolving ovarian cancer literature and present important clinical insight as to the utility of performing distress screening, mental health evaluation, and subsequent mental health treatment plans for distress, in accordance with the nccn distress management guidelines and in combination with apn processes of care . This study was a secondary analysis of existing research documents obtained during a previously completed longitudinal study among a cohort of women with newly diagnosed ovarian cancer undergoing standard treatment (surgery and chemotherapy, with or without radiation). The parent study was a single - blind prospective randomized control trial, designed to test the hypothesis that women with suspected ovarian cancer who received a specialized nursing intervention program would have greater improvement in quality of life measures over time than women with suspected ovarian cancer in an attention - control group . Ruth mccorkle, and the study was funded through a grant from the national institutes of health, national institute for nursing research, 1r01nr07778 . All subjects were screened for psychological distress using the distress thermometer (dt) at baseline, prior to hospital discharge . Subjects randomized to the intervention arm (n = 73) received 18 contacts by an apn with oncology expertise over six months following hospital discharge . The apn conducted the initial contact and most of the remaining contacts in person, usually at the patient's home or oncology clinic, and the remainder by telephone . The specialized intervention primarily focused on assessment and management of patients' symptoms related to both the cancer and its treatment, while also assisting the patient to gain competence in self - management of these issues over the ensuing months of treatment . The apns also helped patients navigate the healthcare system and obtain necessary information and resources to improve their experiences and overall quality of life . The intervention spanned six months and was divided into four phases of care: initiation (baseline assessment, initial symptom management), stabilization (ongoing assessment and symptom management during chemotherapy), adjustment (continuing assessment, symptom self - management support and referral), and termination (referral and support in preparation for discontinuation from study). Figure 1 illustrates the phases along the six - month care trajectory . Subjects randomized to the attention control group (n = 72) were scheduled to receive eight contacts over six months by a non - nurse research assistant . The first visit occurred in subjects' homes soon after hospital discharge, at which time they received personal instruction and a detailed manual regarding symptom management issues related to cancer treatment . Subjects also received a list of referral personnel, websites, and available volunteer organizations and were encouraged by the research assistants to contact these resources to help them cope with physical or psychosocial concerns experienced during the course of treatment . The resources included names and telephone numbers of area mental health professionals and support groups, as well as the contact information for the principal investigator and project director for additional support and guidance . Subjects were subsequently contacted via telephone by the research assistant six additional times over the course of the six - month study period . The major findings of the parent study indicated that the specialized nursing intervention program resulted in less uncertainty and better mental health measures of quality of life than an attention - control intervention up to six months after ovarian cancer surgery . In addition, highly distressed women who received this intervention plus an additional intervention consisting of a mental health evaluation, treatment plan, and ongoing mental health consultation by a psychiatric apn serving in a consultation - liaison nursing role (pcln) reported significantly less uncertainty and better physical and mental health measures of quality of life over time than women who did not receive the specialized nursing intervention plus the pcln intervention . Subjects for the current study were selected from those who were randomly assigned to the parent study's intervention arm . Included subjects were also required to have the diagnosis of newly diagnosed ovarian cancer, rather than recurrent ovarian cancer or other gynecological cancer diagnoses . This sample was selected to solely study women with ovarian cancer, since its diagnosis is often more insidious, and its prognosis more worrisome than many other gynecological cancers . Because women with recurrent ovarian cancer would likely have more previous knowledge and experience with their disease and treatment than women with newly diagnosed disease, these subjects were excluded to avoid threats to internal validity due to maturation and history effects . Thirty - two subjects from the parent study sample fit these criteria, twenty - four identified as having heightened baseline measures of distress by scoring at least 4 on the dt . A dt score of 4 or more is considered serious enough to require further evaluation . From the 32 subjects, three subsamples were determined as follows: 18 of the 24 women with high distress agreed to receive the additional evaluation and treatment plan by a psychiatric apn (pcln). This group constituted one subsample of the current study (the high distress / apn + pcln subsample). The 14 remaining women with newly diagnosed ovarian cancer did not receive the pcln intervention; six with high distress who declined the pcln intervention comprised the second subsample for this study, the high distress / apn only / refused pcln subsample . Eight subjects scored less than 4 on the dt and were considered to have low distress . These subjects comprised a third subsample, the low distress / apn only subsample . Distress thermometer (dt)at baseline during the parent study, subjects had completed the dt (holland, 1996), a rapid screening tool used to identify the presence of distress as endorsed by the nccn . With this tool, subjects were instructed to mark from a list of thirty - five choices any problems they felt contributed to their distress and indicate their overall level of distress on the tool's visual analog scale . The dt has been found to compare to the center for epidemiological studies - depression (ces - d) score of 16 in receiver operating characteristic (roc) curve analysis, with an estimated area roc curve of.75, suggesting satisfactory sensitivity and specificity . A cut - score of 4 on the dt is reported to have the greatest sensitivity and specificity with the ces - d, the hospital anxiety and depression scale (hads), and the eighteen item version of the brief symptom inventory (bsi). At baseline during the parent study, subjects had completed the dt (holland, 1996), a rapid screening tool used to identify the presence of distress as endorsed by the nccn . With this tool, subjects were instructed to mark from a list of thirty - five choices any problems they felt contributed to their distress and indicate their overall level of distress on the tool's visual analog scale . The dt has been found to compare to the center for epidemiological studies - depression (ces - d) score of 16 in receiver operating characteristic (roc) curve analysis, with an estimated area roc curve of.75, suggesting satisfactory sensitivity and specificity . A cut - score of 4 on the dt is reported to have the greatest sensitivity and specificity with the ces - d, the hospital anxiety and depression scale (hads), and the eighteen item version of the brief symptom inventory (bsi). Parent study data collection formscertain demographic, medical history, cancer - specific, and psychiatric data obtained during the parent study were included for analysis . In addition, work performed by apns during the parent study and documented on standard pencil and paper forms for each of the 18 contacts provided raw data which was coded using content analysis for the current study . This raw data consisted of checklists and short - answer responses regarding physical, psychological, and social problems commonly experienced by patients with ovarian cancer, reported functional abilities, and health care utilization . It included a nursing care plan, with patient problems, interventions planned and performed, and patient evaluations, with specific notations regarding the types of interventions provided (symptom management and monitoring, counseling and emotional support, education regarding disease, treatments, lifestyle changes, health behaviors, problem - solving, coordination of services and referrals, prescribing of nursing interventions, and direct nursing care) and the focus of the intervention (patient, caregiver, or both). Patient problems and nursing interventions derived through content analysis were entered into a relational database containing the omaha system codes . Specific logistical data regarding individual visits such as the length, setting (home or clinic), and type of contact (in person versus telephone) were entered into a separate access database.pcln documentation forms used for documenting the mental health evaluations and treatment plans consisted of an in - depth mental health assessment using a guided interview format, standard checklists to document common signs and symptoms of major psychiatric illnesses, results of the mental status examination, and the clinical impression regarding psychiatric status . It was one of the tools used to obtain information regarding patients' past psychological history, the pclns' clinical impression of the patients' psychological status, and the date, setting, and type (telephone or in person) of the mental health evaluation . Certain demographic, medical history, cancer - specific, and psychiatric data obtained during the parent study were included for analysis . In addition, work performed by apns during the parent study and documented on standard pencil and paper forms for each of the 18 contacts provided raw data which was coded using content analysis for the current study . This raw data consisted of checklists and short - answer responses regarding physical, psychological, and social problems commonly experienced by patients with ovarian cancer, reported functional abilities, and health care utilization . It included a nursing care plan, with patient problems, interventions planned and performed, and patient evaluations, with specific notations regarding the types of interventions provided (symptom management and monitoring, counseling and emotional support, education regarding disease, treatments, lifestyle changes, health behaviors, problem - solving, coordination of services and referrals, prescribing of nursing interventions, and direct nursing care) and the focus of the intervention (patient, caregiver, or both). Patient problems and nursing interventions derived through content analysis were entered into a relational database containing the omaha system codes . Specific logistical data regarding individual visits such as the length, setting (home or clinic), and type of contact (in person versus telephone) were entered into a separate access database . Pcln documentation forms used for documenting the mental health evaluations and treatment plans consisted of an in - depth mental health assessment using a guided interview format, standard checklists to document common signs and symptoms of major psychiatric illnesses, results of the mental status examination, and the clinical impression regarding psychiatric status . It was one of the tools used to obtain information regarding patients' past psychological history, the pclns' clinical impression of the patients' psychological status, and the date, setting, and type (telephone or in person) of the mental health evaluation . Patient problems and apn interventions identified from the parent study records were coded using omaha system criteria, using established formats as included in the omaha system: a key to practice, documentation, and information management, 2nd edition, the primary source for use of the omaha system . The omaha system consists of a problem classification scheme, an intervention scheme, and a problem rating scale for outcomes [28, 38]. The problem classification scheme consists of four domains: environmental, psychosocial, physiological, and health - related behaviors . Forty - two problems are categorized under one of the four domains and are identified by the signs and symptoms of the problem, the focus of the problem (individual, family or community), and whether the problem is actual, potential, or encompasses the clients' needs for health promotion . The intervention scheme includes four intervention categories: health teaching, guidance, and counseling; treatments and procedures; case management; and surveillance . Specific nursing interventions further delineate the interventions through the use of 75 targets, which describe discreet foci for nursing activities as applied to the four intervention categories . Examples of targets include such items as dressing change / wound care, bowel care, coping skills, and medication administration . Pairing intervention categories with targets specify the intervention, as illustrated in the following examples: health teaching, guidance and counseling for dressing change / wound care, treatments and procedures for bowel care, case management regarding coping skills, and surveillance of the patient's medication administration . The final omaha system component, the problem rating scale for outcomes (prso), is used to evaluate patients' knowledge, behavior, and status in relation to outcomes for each problem . The prso was not used in this study because there was no available documentation to support assessment of knowledge, behavior, or status for identified problems . Documentation from parent study forms included narrative notes, checklists, and fragments of data which were readily understood by members of the nursing profession, but required classification into a standardized language of problems and interventions for the data to be organized and analyzed . Content analysis is a procedure used to categorize verbal or behavioral data for classification, tabulation, and summarization . The coding process entailed both manifest and latent content analysis of problems and interventions identified . Manifest content is content extracted from written, visible components, such as text taken verbatim . Latent content is text that provides underlying meaning through its interpretation, requiring the coder to infer from what is written . The primary investigator coded the nursing intervention records which met inclusion criteria, coding both patient problems and nursing interventions for each contact according to the criteria defined in the omaha system literature . Detailed memos regarding coding decisions and their rationale were generated as decisions were made to promote consistency . The entire process was enhanced by ongoing contact with an omaha system expert who has over 15 years of experience using the system . Coding reliabilitycoding reliability was accounted for by using a multistep process involving exercises to evaluate coding stability, reproducibility, and accuracy, as suggested by krippendorff . Stability was determined by the principal investigator through recoding of previously coded phrases several months after the original coding, with the results of the two coding processes compared using percent agreement . A minimum score of 80% was used to provide a measure of extent of agreement beyond chance, as suggested by kerr . For reproducibility, the entire set of study records from three subjects were recoded by the omaha system content expert, and these results were compared to the primary investigator's codes using kappa scores, again using 80% as the minimum acceptable score . The principle investigator received training from two omaha system content experts, as well as ongoing supervision and consultation throughout the coding process . During this process, any vague or problematic issues experienced in determining the best coding matches were clarified for standardization and included in a coding decision document, so that future issues would be handled similarly . One of the content experts included the author and codeveloper of the omaha system, karen martin, while the second content expert has conducted extensive nursing research using the omaha system (dr . Kathryn bowles). The expertise of the content experts provided insight into the intent of the given codes, and suggestions for understanding and clarifying entries that were more challenging to identify . Coding reliability was accounted for by using a multistep process involving exercises to evaluate coding stability, reproducibility, and accuracy, as suggested by krippendorff . Stability was determined by the principal investigator through recoding of previously coded phrases several months after the original coding, with the results of the two coding processes compared using percent agreement . A minimum score of 80% was used to provide a measure of extent of agreement beyond chance, as suggested by kerr . For reproducibility, the entire set of study records from three subjects were recoded by the omaha system content expert, and these results were compared to the primary investigator's codes using kappa scores, again using 80% as the minimum acceptable score . The principle investigator received training from two omaha system content experts, as well as ongoing supervision and consultation throughout the coding process . During this process, any vague or problematic issues experienced in determining the best coding matches were clarified for standardization and included in a coding decision document, so that future issues would be handled similarly . One of the content experts included the author and codeveloper of the omaha system, karen martin, while the second content expert has conducted extensive nursing research using the omaha system (dr . Kathryn bowles). The expertise of the content experts provided insight into the intent of the given codes, and suggestions for understanding and clarifying entries that were more challenging to identify . Data analysisbaseline demographic, medical, cancer - specific, and psychological status were compared overall, and among subjects within each of the subsamples using chi - square for categorical data and anova for continuous data . Discrete data quantifying numbers of patient problems and numbers of interventions were analyzed at increasing levels of complexity, including analysis of these data for the full sample and each subsample overall, per contact, per omaha system domain, and per intervention phase . Baseline demographic, medical, cancer - specific, and psychological status were compared overall, and among subjects within each of the subsamples using chi - square for categorical data and anova for continuous data . Discrete data quantifying numbers of patient problems and numbers of interventions were analyzed at increasing levels of complexity, including analysis of these data for the full sample and each subsample overall, per contact, per omaha system domain, and per intervention phase . Human subjectsthe study was a secondary analysis, and participation did not put subjects at risk for harm or manipulation . Informed consent was previously obtained for the parent study and was subsequently obtained for the current study through expedited review from the human subjects research review committee . The study was a secondary analysis, and participation did not put subjects at risk for harm or manipulation . Informed consent was previously obtained for the parent study and was subsequently obtained for the current study through expedited review from the human subjects research review committee . The current sample revealed characteristics similar to other published samples of women with ovarian cancer with respect to age and race, and included subjects who were approximately 60 years old and predominantly white . The majority of the subjects received some college education and had health insurance, but nearly half of the sample reported an annual income of less than $50,000 . Most attended religious services, were married, and did not live alone . A comparison of the current sample and subjects from the parent study who were excluded due to having recurrent or nonovarian cancer revealed that the included and excluded subjects were very similar with regard to demographic, medical, cancer - specific, and psychological factors . Of the included subjects, the three subsamples had similar demographic, medical, and cancer - specific factors, but differed significantly with regard to race and education, with the low distress / apn only subsample having more nonwhite and fewer college - educated subjects than either of the high distress subsamples . Table 1 illustrates the baseline characteristics of the three subsamples . At baseline, of the 42 available problems, problems identified in at least 30% of the subjects included mental health (the most frequent problem), followed by medication regimen, pain, bowel function, digestion / hydration, and skin problems . No significant differences in any of the specific problem frequencies were identified among the three subsamples at baseline . For the six - month study period, 26 problems were identified, with mental health the most frequent problem, followed by medication regimen, bowel function, pain, digestion / hydration, circulation, skin, neuromusculo / skeletal, sleep and rest, and communicable / infectious conditions occurring in at least 30% of the total sample . Subsamples had similar mean numbers of total problems per contact as well as problems per contact within each problem domain . However, when problems per contact were evaluated with regard to the study phases, significant differences emerged at initiation, with the most physiological, health - related behavior, and total problems for the low distress / apn only subsample, and the fewest physiological, health - related behavior, and total problems for the high distress / apn only / refused pcln subsample . The latter subsample also had somewhat more environmental problems identified in the stabilization phase than the other subsamples, but this difference disappeared during the remaining intervention phases . These analyses were limited by small sample sizes, particularly among problems reported within the environmental domain (see table 2). Among the eighteen subjects who consented to the mental health evaluation (high distress / apn plus pcln subsample), psychiatric diagnoses were identified by the pclns in eight subjects . Diagnoses included mood disorders, anxiety disorders, adjustment disorders, and psychiatric disorders due to medical conditions, with two of the subjects found to have more than one disorder . No psychotic disorders were identified (see table 3). Throughout the six - month study, 7,722 interventions were provided to the 32 subjects, which is an average of 241 (108.6) interventions per subject and 14.0 (4.6) interventions per contact . Most interventions provided were surveillance interventions (6,526; 81.46%), followed by teaching, guidance, and counseling interventions (1,196; 15.49%) and case management interventions (236; 3.06%). Subsamples had similar numbers of total interventions and interventions per contact, as well as interventions per contact provided within each of the omaha intervention categories . However, when evaluated with respect to when they were administered per the study's intervention phases, the low distress / apn only subsample appeared to receive the most interventions per contact at initiation (baseline), but the least for the remainder of the study period, in comparison to the other (high distress) subsamples . In contrast, the high distress / apn only / refused pcln subsample appeared to receive the least interventions at initiation, but gradually more interventions per contact throughout the six - month study period, receiving the most interventions per contact during the study's final (termination) phase (see figure 3). No differences were noted in numbers of contacts, length of the contacts, or whether the contacts were delivered in - person or by telephone among the three subsamples . Examination of the interventions provided with respect to the four problem domains revealed several interesting findings . Interventions administered for environmental problems were significantly higher for the high distress / apn only / refused pcln subsample than the other two subsamples, although this finding occurred among a very small sample . In addition, differences in numbers of interventions per contact for psychosocial problems approached significance, with the high distress / apn only / refused pcln subsample appearing to receive the fewest in comparison to the other two subsamples . A larger sample may provide clarity as to the significance of this observation (see table 4). Along the study trajectory, intervention pattern differences were observed relative to numbers of interventions per contact provided within each problem domain . In particular, the high distress / apn plus pcln subsample initially received the most interventions for psychosocial domain problems than the other two subsamples, but this number remained relatively constant throughout the study period . In contrast, the high distress / apn only / refused subsample, and low distress / apn only subsample appeared to receive increasingly more interventions for psychosocial problems through the end of the study, with this phenomenon markedly apparent for the low distress / apn only subsample (see figure 4). Interventions for physiological problems were highest at baseline among the low distress / apn only subsample, and this subsample as well as the high distress / apn plus pcln subsample received a steady reduction in interventions per contact for physiological problems as the study progressed . In contrast, the high distress / apn only / refused pcln subsample did not experience a similar reduction in interventions for physiological problems as the study progressed, receiving the most by the termination phase (see figure 5). In addition, interventions for health - related behavior domain problems remained relatively constant for all three subsamples as the study progressed, but patterns may indicate a trend of diminishing numbers of interventions along the study trajectory provided to the high distress / apn plus pcln and low distress / apn only subsamples . A similar pattern was not evident for the high distress / apn only / refused pcln subsample, who received a relatively constant number throughout the study (see figure 6). The first limitations were related to the study's use of data by secondary analysis of previously - collected data . Since the data had been designed for a different purpose, they required content analysis to quantify them into discrete units for comparison using the omaha system . Retrospectively categorizing existing data did not allow for further clarification in several instances where, as they were described, signs and symptoms were not able to be straightforwardly coded into omaha system problems . This issue highlights a semantic limitation with the omaha system, which was particularly evident in trying to determine how to classify the symptom fatigue . Since fatigue was associated with several omaha problems, including sleep and rest, circulation, digestion / hydration, and medication regimen (when fatigue was considered a chemotherapy side effect), the primary investigator needed to identify the suspected source of the fatigue to correctly identify it as the symptom indicative of a particular omaha problem . This was sometimes problematic, because this detail of information was not always evident from the research records . It was therefore possible that errors were made in identifying the correct omaha problem associated with fatigue for those patients who experienced this symptom . The dt, one of the primary independent variables used to determine subsample assignment, has not undergone substantial cross - cultural validation, and therefore its ability to measure distress among subjects of various ethnicities and levels of education is not known . Assignment of subjects into the three subsamples based on subjects' dt scores, as well as their consent for the pcln intervention, resulted in the subsample with low distress (low distress / apn only) being the only subsample with nonwhite subjects . It is also not known whether additional factors not explored prior to the analysis may have been associated with these subjects' decision to decline the pcln intervention . In order to reduce the artificial effect potentially introduced by dissimilar group characteristics that may have been associated with reasons to accept or decline the pcln referral, a more extensive exploration of baseline and situational factors would have been needed . In addition, a larger and more diverse sample would have provided more reliable evidence as to whether the factors education or race may have influenced the degree of psychological distress or the propensity to decline or accept pcln care . Finally, the sample was derived from a larger sample of women from a single comprehensive cancer center who were being treated for ovarian cancer . The findings therefore are limited in their ability to be generalized to other samples of women with ovarian cancer . Much of the research on ovarian cancer, including the current study, has been conducted on women who were white and generally older than age 55 . However, the significant finding associating nonwhite race and lower education levels among the current study's low distress / apn only subsample begs for exploration of the influence of race and education on psychological distress among women with cancer, using larger more racially diverse studies . Further, although the study's results support previous research identifying various symptoms as prevalent among women with ovarian cancer, the novel use of the omaha system identified unique issues which were not typically explored among this population of women . Specifically, the high distress / apn only / refused pcln subsample may have been less forthcoming with problems and may also have been more distressed due to environmental problems such as issues with income and residence than either the high distress / apn plus pcln or the low distress / apn only subsample . Although such environmental issues are not typically associated with ovarian cancer, in the context of difficult ovarian cancer treatment, they may have contributed to already high distress levels . Accurate examination of the unpleasant symptoms and problems experienced by women undergoing ovarian cancer treatment should also explore additional sources of their distress so that appropriately targeted treatments may be initiated . One - fourth of the women with high distress refused pcln care; however, this ratio was better than has been reported by previous studies among cancer patients . The therapeutic relationship established between the apns and their assigned subjects improvements in distress among cancer patients has been positively linked to better adherence to cancer therapies, it may be especially important to provide a mechanism for certain patients to establish such therapeutic relationships as a component of their chemotherapy plans, either within the clinic setting, or perhaps as a homecare adjunct to chemotherapy . The use of the distress thermometer resulted in 24 of 32 subjects reporting high distress . This screening mechanism prompted mental health evaluations to be performed for eighteen women, which revealed that eight of the women were suffering from clinically significant psychiatric conditions, while ten of the women were evaluated as not having clinically significant psychiatric conditions . The most frequent conditions identified included anxiety, mood disorders (depression), adjustment disorders, and psychiatric disorders due to medical conditions . In this manner, the use of the dt in clinical practice, as endorsed by the nccn guidelines, may be seen as effective in identifying and treating potentially serious psychiatric conditions among cancer patients . Since the dt was easy to use and has shown good reliability with the ces - d and similar measure of psychological distress, it may be advantageous for patients to complete the dt prior to every chemotherapy session, rather than at a single time at the onset of treatment, as occurred in the current study . More frequent monitoring of distress could improve the accuracy of psychiatric problem identification by offering opportunities to compare previous ratings, while also potentially targeting psychiatric evaluation and treatment for those who need it the most . The omaha system offered a unique method of capturing the broad array of patient problems within all four potential problem domains without simply identifying symptoms or targeting a single area of clinical concern among the universe of possibilities . The study findings show the complexity of the ovarian cancer patients' needs, the intensity of nursing care, and the value of a classification system to capture that description . The omaha system also ensured a high degree of problem specificity by requiring that each active problem be counted only when clearly linked with at least one omaha system - defined sign or symptom . Many of the omaha system problems found closely resembled problems identified among other samples of women with ovarian cancer using different measurement systems . However, the broad range of problems identified enhanced this body of knowledge by also identifying the effects of nontreatment issues sometimes experienced by women with ovarian cancer that may contribute to psychological distress . A major semantic problem occurred with respect to the issue of fatigue and may require a more in - depth examination of the omaha system's ability to capture in detail the etiology and clinical significance of this problem . Interventions identified using the omaha system were classified into surveillance, teaching, guidance, and counseling, and case management interventions, with surveillance comprising the largest category . Although the three subsamples received relatively similar interventions within the intervention categories throughout study period, by the end of the six - month period, the high distress / apn only / refused pcln subjects received more interventions overall than subjects in the other two samples . This finding also points to the possibility that this highly distressed subsample may not have initially been ready to discuss psychological issues and may have required additional time to feel comfortable disclosing sensitive information to the apns . The six - month study period was only beginning to provide the opportunity for them to develop therapeutic relationships sufficiently meaningful to allow for such disclosure . This finding suggested that a six - month time period may be insufficient to allow some patients, even highly distressed ones, to accept certain interventions, but longer - term relationships among patients and clinicians may enhance this ability . Based on the current study's significant findings and methodological limitations, the following suggestions for future research are presented . First, the dt requires additional testing for reliability, validity, and stability among a racially diverse sample with different levels of education and cancer types . Such testing should also include sensitivity and specificity testing to reliably evaluate its use as a screening tool throughout the cancer treatment process in order to fully support its universal usage per nccn distress management guidelines . Second, although the omaha system is commonly used in practice within the homecare and other settings, more studies using the omaha system exclusively among cancer patients may provide evidence as to the unique nature of problems experienced by them . One area in need of careful evaluation concerns the issue of fatigue among cancer patients . The omaha system may offer a viable tool to uncover contributory and mediating factors associated with this elusive problem . In addition, semantic study of this problem for clarity in categorizing it according to omaha system criteria is in order to improve standardization in documentation . Third, the longitudinal nature of the current study provided an opportunity for the investigator to examine linkages between patient problems and apn interventions, while incorporating systems characteristics such as the timing of apn contacts and the use of the dt . Further studies which link patient problems, nursing interventions, and outcomes are essential in order for nurses to refine their practice through the merits of evidence . This need is especially important as populations become more diverse and complex, and as the shrinking nursing workforce struggles to meet patients' needs for quality health care . Although secondary analysis was an inexpensive and convenient method for designing and completing this study, future studies among patients with cancer, using the omaha system in a prospective manner may prove more accurate in correctly identifying omaha problems related to specific symptoms and would eliminate the need for content analysis to categorize the data . In addition to the problem and nursing intervention schemes, the omaha system provides the opportunity to utilize the problems rating scale for outcomes scheme, which would be helpful in determining linkages between patient problems, nursing interventions, and patient outcomes . This scheme would enable evaluation of changes within three subscales of patient conditions in relation to specific omaha problems: knowledge (patient's understanding about a problem), behaviors (patient's actions / responses in relation to a problem), and status (wellness or illness in relation to a problem) using a five - point rating scale for each subscale . Finally, it is possible that extraneous factors not identified may have influenced patients' inclinations to accept or decline pcln or other mental health referrals . The analysis plan for future studies will need to adjust for these factors, and the results from these studies will need to be evaluated within the context of how these factors versus the intervention alone may account for the results so that the possibility of an artificial effect imposed by these factors is minimized . The current study highlighted clinical outcomes resulting from distress screening for women in active treatment for ovarian cancer . The dt isolated unique phenomena among women who reported varying levels of distress at baseline, which may be helpful to clinicians who care for this cancer population . Women with low distress (the low distress / apn only subsample) appeared to be very open to communicating their needs and concerns, were able to articulate their needs to apns, and became active participants in achieving their health goals, as evidenced by the clear reduction in their problems and interventions as the study period progressed . Those with high distress who were willing to receive services to treat this distress (the high distress / apn plus pcln subsample) also appeared to receive valuable assistance in caring for their health during the cancer treatment period through interactions with oncology and psychiatric apns . Several of these women were identified to have psychiatric conditions worthy of further treatment and were referred appropriately . However, the high distress / apn only / refused pcln subsample presented challenges unique to this subsample . These women may have experienced more environmental problems contributing to their distress; therefore, clinical settings need to provide ample opportunities for women to receive assistance in meeting financial, residence, and employment needs, which although not directly related to their disease process, may seriously degrade quality of life during already challenging health events . Clinicians need to be keenly aware of such patients and interact with them with particular sensitivity through continued support and gentle, repeated reminders of how they may be helped . The dt was a simple screening tool which identified 24 patients in distress at baseline, with eight evaluated as needing further mental health treatment . The nccn guideline suggests serial dt screenings to be useful for clinicians to use at baseline and throughout the treatment process, so that areas of distress may be identified and addressed promptly . This would be particularly helpful among women who may be reticent to disclose such problems in conversation, but may feel comfortable completing the dt . For these women, the dt in combination with astute, compassionate clinical assessments during oncology visits may provide the best opportunities to uncover clinically - significant psychological distress . Key elements of quality care, including those providing psychological support services and compassionate care to individuals with cancer, are recognized as essential areas in need of improvement [23, 43]. The recently passed patient protection and affordable care act (ppaca) increases funding for general care nurses as well as apns, with the anticipated outcome being to expand the nursing workforce overall . An area of particular promise is a grant program to fund innovative safety - net programs, such as nurse - managed clinics . Although initially focused on primary care, these safety net programs may also include care for patients who may not be acutely ill, but require management of chronic conditions or support during times of transition (such as from hospital to home). The chronic nature of many types of cancer, including ovarian cancer, which is often characterized by bouts of exacerbations of symptoms over the course of months or years, may be ideally suited for this model of care . Further definition of the apn role in ensuring effective psychosocial care, including teaching, guidance, counseling, case management, and appropriate surveillance is essential at this time in order for these services to be recognized as worthy of reimbursement . The methodological strengths of the omaha system coupled with the unique opportunities afforded by frequent clinical encounters provided important details about the range of patient problems and apn interventions for women after ovarian cancer surgery not previously described . This study provided extensive information about the specific problems experienced by these vulnerable women as they weathered the course of treatment . It also explored the relationship between documented problems and apn interventions in this sample, including those prompted by pcln evaluation, treatment, and referral for high distress . Information gained from these descriptions provides evidence useful in examining the clinical processes resulting from screening and initiating a guideline - based clinical plan for psychological distress when experienced by women after surgical treatment for ovarian cancer . Such information is essential for establishing the effectiveness of the current nccn distress guidelines, so that they are most instructive to clinicians who care for women with ovarian cancer in oncology and homecare settings . Promoting the guidelines' utility through appropriate translation methods may facilitate their adoption by clinicians and may support their full integration into the healthcare system through institutional policy reforms . Such enhancements address the priorities endorsed by the iom and nccn in relation to health care quality . Apns may provide a critical link in identifying cancer patients in distress, assisting patients to cope with the distress, and referring them appropriately to minimize its adverse effects.
|
Mast cells are long - lived resident tissue cells distributed throughout vascularized connective tissues and are especially numerous near surfaces exposed to the environment, including the skin, the respiratory system, the gastrointestinal and genitourinary tracts, i.e. At the portals of pathogen entry . These cells are a potent source of various biologically active mediators, such as granule - associated preformed mediators (e.g. Histamine, neutral proteases, metalloproteinases, proteoglycans), de novo generated arachidonic acid metabolites (i.e. Leukotrienes, prostaglandins, thromboxanes), and many cytokines and chemokines . Mast cell mediators can exert diverse regulatory / modulatory effects on surrounding cells and tissues [13]. Therefore, mast cells are involved in homeostasis maintenance and are important players in many physiological processes, such as wound healing, angiogenesis, regulation of vascular permeability, and tissue remodeling and repair [2, 3]. These cells are known to participate in inflammation and affect both innate and adaptive immune responses, as well [46]. Moreover, mast cells take part in different pathological processes, including chronic allergic disorders, autoimmune diseases, and neoplastic processes [2, 3, 7]. Nowadays, more and more data indicate that mast cells are critical component of host defence against a variety of microorganisms, mainly bacteria and viruses . The role of these cells in protection against fungal infections is less understandable . Without a doubt, the strategic location of mast cells at the portals of infection allows them to establish quick contact with invading pathogens . Moreover, these cells have the ability to phagocytose and subsequently kill bacteria, via oxidative and non - oxidative systems [11, 12]. It should be highlighted that mast cells can kill bacteria independently of phagocytosis, because they form extracellular traps composed of dna, histones, tryptase, and cathelicidin . What is important, following phagocytosis these cells are capable of processing bacterial antigens for presentation through class i and ii mhc molecules, which leads to the development of antimicrobial adaptive immunity [11, 14]. Finally, mast cell - derived proinflammatory mediators, cytokines and chemokines induce the development of inflammation at the site of pathogen entry [4, 5, 8]. The initial recognition of microorganisms is mediated by different specialized pattern recognition receptors (prrs). These receptors identify a diverse set of microbial molecules, called pathogen - associated molecular patterns (pamps). What is more, prrs can recognize various host - derived molecules, called damage - associated molecular patterns (damps), released from infected or necrotic cells and damaged tissues . The prr family includes toll - like receptors (tlrs), c - type lectin - like receptors (clrs), rig - i - like receptors (rlrs), and nod - like receptors (nlrs) [15, 16]. The best characterized prrs are tlr family members expressed in diverse body cells either on plasma membrane (tlr1, tlr2, tlr4, tlr5, tlr6, tlr10) or on membrane of endosomes (tlr3, tlr7, tlr8, tlr9). Without any doubt, out of all prrs, members of the tlr family play particularly significant role in initiation host defence against pathogens because these receptors recognize both wide range of microbial pamps and various endogenous damps released in response to infection [1719]. Considering the important role of mast cells in antimicrobial protection it is essential to comprehend the expression of tlrs by these cells . Accordingly, we decided to examine the constitutive expression of both surface and endosomal tlrs in fully mature tissue mast cells . Dulbecco s modified eagle medium (dmem) was obtained from biowest (kansas city, mo, usa). Fetal calf serum (fcs), gentamicin, glutamine, hank s balanced salt solution (hbss), and sodium bicarbonate were purchased from gibco (gaithersburg, md, usa). Phosphate buffered saline (pbs), percoll, saponin, toluidine blue, trypan blue, and tween 20 were obtained from sigma - aldrich (st . The genematrix universal rna purification kit was purchased from eurx (gdansk, poland). Anti - tlr2, anti - tlr3, anti - tlr4, anti - tlr5, anti - tlr7, anti - tlr9 antibodies, nonspecific goat igg (isotypic control), as well as fluorescein isothiocyanate (fitc)-conjugated polyclonal, donkey anti - goat and donkey anti - rabbit antibodies, and blocking peptides were obtained from santa cruz biotechnology inc . The high - capacity cdna reverse transcription kit, taqman probes dyed fam (rtlr2, rtlr3, rtlr4, rtlr5, rtlr7, rtlr9 and r-actin), and taqman gene expression master mix were purchased from applied biosystems (foster city, ca, usa). Female albino wistar rats weighing 220 - 250 g, aged 3 - 4 months were used . The experimental procedures were approved by the local ethics committee for experiments on animals of the medical university of lodz (the approval no . Mast cells were collected from peritoneal cavities of female wistar rats by lavage, with 50 ml of 1% hbss supplemented with 0.015% sodium bicarbonate . After abdominal massage (90 s) the cell suspension was removed from the peritoneal cavity, centrifuged (150 g, 5 min, 20c) and washed twice in complete dmem (cdmem), containing dmem supplemented with 10% fcs, 10 g / ml gentamicin, and 2 mm glutamine . Isotonic 72.5% percoll density gradient centrifugation (190 g, 15 min, 20c) was used for mast cell purification . Subsequently, isolated mast cells were centrifuged twice in cdmem (150 g, 5 min, 20c). Purified mast cells were counted and resuspended in an adequate volume of cdmem to obtain mast cell concentration of 1.5 10 cells / ml . Mast cells were prepared with purity> 98%, as determined by metachromatic staining with toluidine blue . The viability of mast cells was over 98%, as estimated by trypan blue exclusion assay . Genematrix universal rna purification kit was used to isolate total rna from native mast cells . Isolated rna was reverse transcribed to cdna using high capacity cdna reverse transcription kit according to the manufacturer s protocol . The expression of tlr2, tlr3, tlr4, tlr5, tlr7, tlr9 mrnas as well as the expression of the endogenous -actin mrna were performed with using taqman gene expression master mix . Reactions were carried out with the use taqman probes and 7900ht fast real - time pcr system (applied biosystems, foster city, ca, usa). For determination of tlr2, tlr3, tlr4, tlr5, tlr7, and tlr9 surface protein expression and tlr3, tlr7, and tlr9 intracellular protein expression flow cytometry technique was applied . Mast cells were washed twice in the cdmem after isolation and fixed with cellfix solution overnight at 4c . Next, mast cells were washed twice in cdmem, and then resuspended in 1 pbs . To verify the presence of tlr receptors intracellularly, mast cells were permeabilized with 0.1% saponin for 30 min at the room temperature . Non - permeabilized and permeabilized mast cells were stained for 1 h with appropriate primary antibodies (antibody dilution 1: 100). Cells were then washed with pbs containing 0.05% tween 20 and incubated for 1 h with fitc - conjugated secondary antibodies . Finally, cells were washed with pbs containing 0.05% tween 20 and resuspended in 1 pbs . Immunofluorescence analysis of 20 000 cells was performed by facs canto ii flow cytometer (bd biosciences, san jose, ca, usa). Statistical analysis included mean value and standard error of the mean (sem). In this study, we determined the expression of tlrs in freshly isolated mature rat mast cells using qrt - pcr and flow cytometry . We first examined tlr2, tlr3, tlr4, tlr5, tlr7, and tlr9 transcript levels by qrt - pcr . We found that naive mature mast cells express mrna for all the studied receptors (fig . 1). It is necessary to point out that the expression of tlr3, tlr4, tlr5, tlr7, and tlr9 transcripts were low and comparable . Only the expression of tlr2 transcript was significant and up to six times higher than those . Controls without reverse transcriptase confirmed that the source of the products was indeed from mrna, and not from contaminating genomic dna . Tlr2, tlr3, tlr4, tlr5, tlr7, and tlr9 mrna expression were examined by qrt - pcr . Each bar represents the mean sem of four experiments performed next, we conducted experiments, by means of flow cytometry, to establish whether tissue mast cells constitutively express tlr proteins . As can be seen in figures 2a - c surface tlr2, tlr4, and tlr5 were detected on non - permeabilized native mast cells . Moreover, staining of non - permeabilized and permeabilized mast cells showed that tlr3, tlr7, and tlr9 proteins were located both on the cell surface and intracellularly (fig . Representative flow cytometry histograms showing (a) tlr2, (b) tlr4, and (c) tlr5 protein expression . The shaded bars: isotype control and open bars: tlr expression constitutive protein expression of both surface and intracellular tlrs in freshly isolated rat peritoneal mast cells . Representative flow cytometry histograms showing surface (a) stlr3, (b) stlr7, (c) stlr9 and intracellular (d) itlr3, (e) itlr7, (f) itlr9 protein expression . The shaded bars: isotype control and open bars: tlr expression a comparison of expression levels of tlrs proteins is shown in figure 4 . From among intracellular receptors expression of itlr7 protein was on average two times higher than itlr9 expression and more than three times higher than itlr3 expression . We also noticed, that all receptors expressed both on the cell surface and intracellularly exhibit higher expression intracellularly than on the surface . Comparison of tlr expression at protein levels expressed as mean fluorescence intensity (mfi). They are the major sensors of the innate immunity and are implicated in priming the adaptive immune response crucial for killing invading pathogens . Binding of tlr agonists to their receptors begins the activation of complex networks of intracellular signal transduction processes to coordinate the inflammation . Tlr2 identifies and binds peptidoglycan, lipoteichoic acid, lipoproteins, lipoarabinomannan, and fungal zymosan . It is worth pointing out that tlr2 and tlr4 recognize also some endogenous molecules that arise in the course of host response to infections, including high mobility group box 1 protein (hmgb1), heat shock proteins hsp60 and hsp70, -defensins, and hyaluronan fragments . Tlr3, tlr7, and tlr8 recognize ligands of viral origin, i.e. Double - stranded rna (dsrna) and single - stranded rna (ssrna). Tlr3, tlr7, and tlr9 molecules can also bind endogenous ligands, including endogenous nucleic acids (tlr3) and immune complexes containing nucleic acids (tlr7 and tlr9) [1719]. Although the role of mast cells in antimicrobial host defence is well documented the expression of tlrs in these cells is not fully described . Furthermore, most studies on the tlr expression were conducted on mast cell lines or mast cell differentiated in vitro . It should be highlighted that these cells differ with respect to phenotype and activity from native tissue mast cells and can serve as replacements of mature mast cells to a limited degree only . Tlr1 transcript was found in lad and ku812 lines, as well as in cord blood - derived mast cells (cbmcs) and human cultured mast cells (hcmcs). Tlr2 and tlr4 mrnas were described in lad, hmc-1 [21, 24], ku812, and mc/9 cell lines, as well as in cbmcs [22, 2628], mouse bone marrow - derived mast cells (bmmcs) [25, 2933], and hcmcs . Tlr3 transcript was found in lad, hmc-1, and p815 cell lines [23, 34] and in bmmcs and hcmcs . Tlr5 transcript was described in lad, hmc-1, and hcmcs [21, 23, 29, 36, 37], while tlr6 mrna was found in mc/9 and ku812 lines, as well as in cbmcs [22, 26], bmmcs [25, 2931, 33], and hcmcs . It was also documented that lad, hmc-1, p815 cells, bmmcs, and hcmcs express tlr7 and tlr9 mrnas while tlr8 transcript was found in bmmcs . It was shown that lad and hmc-1 cells express tlr2, tlr4 [21, 24, 37], tlr5 [23, 36], tlr6, tlr7, and tlr9 [21, 23, 37] proteins, while tlr1 protein was expressed only on lad cells [21, 37]. Hcmcs express tlr2, tlr6, tlr7, and tlr9 proteins, whilst cbmcs express tlr2 and tlr4 and bmmcs express tlr3 and tlr4 proteins . Data documenting expression of tlrs in fully mature tissue mast cells are still far from sufficient and require further detailed study . The majority of tlr transcripts in matured mast cells were demonstrated in fetal skin - derived mast cells (fsmcs) and mast cells isolated from human lung and skin [26, 30]. Only tlr2, tlr3, and tlr4 proteins were found in mast cells from isolated human nasal polyps, murine peritoneal cavity, and fsmc . Our previous studies have shown that freshly isolated rat peritoneal mast cells express both surface tlr2 and tlr4 molecules [20, 39], as well as tlr3 and tlr7 surface proteins [40, 41]. In this study we evaluated the expression of tlr receptors in native fully mature rat mast cells freshly isolated from the peritoneal cavity, that is connective tissue type mast cells . We found that these cells constitutively express mrnas for tlr2, tlr3, tlr4, tlr5, tlr7, and tlr9 . Our results from qrt - pcr analysis of tlr mrna expression in rat peritoneal mast cells confirm and are coinciding with results of other authors who detected transcripts encoding tlr1, tlr2, tlr3, tlr4, tlr5, tlr6 and tlr8 in freshly isolated and purified mast cells . Moreover, we have clearly documented that rat mast cells express tlr2, tlr4, and tlr5 on cell surface, while tlr3, tlr7, and tlr9 proteins are located both on the cell membrane and intracellularly . These observations undoubtedly indicate that mature tissue mast cells have a broad set of tlr molecules, thus can recognize and bind bacterial, viral, and fungal pamps as well as various endogenous molecules generated in response to infection.
|
Acute coronary syndrome (acs) is a significant cause of morbidity and mortality in patients with coronary heart diseases . It is important to identify high - risk patients and determine who will be treated immediately in acs . Red cell distribution width (rdw) and fragmented qrs (fqrs) complexes are predictors of cardiac events and all - cause mortality in these patients [13]. Rdw, a measurement of variability and size of erythrocytes, can be easily measured during routine complete blood counts (cbc). The relationship between rdw and coronary artery disease (cad), heart failure (hf), and stroke has been found in recent studies [46]. High rdw levels were associated with adverse outcomes in patients with st elevation myocardial infarction (stemi) and hf . Inflammation may bring about changes in red blood cell maturation by disturbing the red cell membrane, leading to increased rdw . The fragmented qrs (fqrs) complexes are novel electrocardiographic signals, which reflect the altered ventricular conduction delays around the regions of a myocardial scar . The presence of fqrs in the resting 12-lead electrocardiogram (ecg) revealed an increased risk for adverse outcomes . Fqrs has been reported to be a predictor of cardiac events and all - cause mortality in cad patients . The relationship of systemic inflammation with the presence of fqrs in patients with acs has been studied previously . In this study, we investigated the association of serum rdw levels and fqrs in patients with nst - acs . Records of patients with acs defined as unstable angina (ua) and non - st elevated myocardial infarction (nstemi) who were admitted to the coronary care unit of our institution between january 2011 and april 2012 were evaluated retrospectively . Ua was diagnosed by typical chest pain and/or electrocardiographic changes indicating myocardial ischemia with negative cardiac enzymes . Nstemi diagnosis was based on elevated cardiac enzymes with typical chest pain and/or electrocardiographic changes suggestive of myocardial ischemia . Typical chest pain was evaluated as more than 20 min in duration, new - onset angina, and an increase in its frequency and duration or severity . We excluded patients with clinical evidence of cancer, active infection, hematological proliferative diseases, active or chronic inflammatory or autoimmune diseases, pregnancy, recent blood transfusion, a history of chronic obstructive pulmonary disease, a typical bundle - branch block pattern (qrs 120 ms) or incomplete right bundle - branch block pattern, permanent atrial fibrillation, ventricular paced rhythm, a previously implanted implantable cardioverter - defibrillator (icd) or a clinical indication for an icd at the time of enrollment, left ventricular hypertrophy, wolff - parkinson - white syndrome, cardiomyopathy, myocarditis, or congenital heart disease . There were 91 patients excluded from the final analysis: 24 patients with incomplete right bundle - branch block pattern, 18 patients with typical bundle - branch block pattern, 15 patients with chronic obstructive pulmonary disease, 14 patients with permanent atrial fibrillation, 11 patients with active infection, and 9 patients with left ventricular hypertrophy . Therefore, a total of 251 patients who were diagnosed with nst - acs were included in the analysis in this study . Demographic information, cardiovascular history, smoking status, hypertension (ht), and diabetes mellitus (dm) status of patients were obtained from the medical records . Patients who had been treated with antihypertensive drugs or those whose baseline blood pressure exceeded 140/90 mm hg were diagnosed with ht . Dm was defined as fasting blood sugar more than 126 mg / dl or the use of anti - diabetic medications . The ecg and supplemental criteria for fqrs patterns were defined by das (10). The resting 12-lead ecg (filter range, 0.15100 hz; ac filter, 60 hz, 25 mm / s, 10 mm / mv) was analyzed by 2 independent, blinded cardiologists . The fqrs pattern was defined as the presence of an additional r or crochetage wave, notching in the nadir of the s wave or fragmentation of the rs or qs complexes in 2 contiguous leads corresponding to a major coronary artery territory . Complete blood counts and biochemical values were evaluated retrospectively from blood samples obtained by antecubital vein puncture upon admission to the emergency department . Hemogram parameters and other biochemical measurements using standard biochemical techniques were determined with the beckman coulter lh 780 (beckman coulter ireland inc ., all measurements were performed using a commercially available machine (vivid 7, ge vingmed ultrasound a / s, horten, norway) with a 3.5-mhz transducer . Simpson s method was used to assess the lvef, as recommended by the american society of echocardiography . All patients underwent a coronary angiography by femoral approach using the standard judkin s technique . Iopromide as a contrast agent (ultravist-370, bayer schering pharma, germany) and 6f diagnostic catheter were used in all subjects . All statistical studies were carried out with the spss program (version 17.0, spss, chicago, illinois). Quantitative variables are expressed as the mean value standard deviation or median (interquartile range), and qualitative variables were expressed as percentages (%). A comparison of parametric values between the groups was performed using the student s t test for normally distributed parameters or mann - whitney u test for non - normally distributed parameters . Categorical variables were compared by the likelihood ratio chi - square test or fisher exact test . Spearman correlation analysis was used for determining association between rdw with clinical and laboratory findings for both the study population and nstemi patients . Records of patients with acs defined as unstable angina (ua) and non - st elevated myocardial infarction (nstemi) who were admitted to the coronary care unit of our institution between january 2011 and april 2012 were evaluated retrospectively . Ua was diagnosed by typical chest pain and/or electrocardiographic changes indicating myocardial ischemia with negative cardiac enzymes . Nstemi diagnosis was based on elevated cardiac enzymes with typical chest pain and/or electrocardiographic changes suggestive of myocardial ischemia . Typical chest pain was evaluated as more than 20 min in duration, new - onset angina, and an increase in its frequency and duration or severity . We excluded patients with clinical evidence of cancer, active infection, hematological proliferative diseases, active or chronic inflammatory or autoimmune diseases, pregnancy, recent blood transfusion, a history of chronic obstructive pulmonary disease, a typical bundle - branch block pattern (qrs 120 ms) or incomplete right bundle - branch block pattern, permanent atrial fibrillation, ventricular paced rhythm, a previously implanted implantable cardioverter - defibrillator (icd) or a clinical indication for an icd at the time of enrollment, left ventricular hypertrophy, wolff - parkinson - white syndrome, cardiomyopathy, myocarditis, or congenital heart disease . There were 91 patients excluded from the final analysis: 24 patients with incomplete right bundle - branch block pattern, 18 patients with typical bundle - branch block pattern, 15 patients with chronic obstructive pulmonary disease, 14 patients with permanent atrial fibrillation, 11 patients with active infection, and 9 patients with left ventricular hypertrophy . Therefore, a total of 251 patients who were diagnosed with nst - acs were included in the analysis in this study . Demographic information, cardiovascular history, smoking status, hypertension (ht), and diabetes mellitus (dm) status of patients were obtained from the medical records . Patients who had been treated with antihypertensive drugs or those whose baseline blood pressure exceeded 140/90 mm hg were diagnosed with ht . Dm was defined as fasting blood sugar more than 126 mg / dl or the use of anti - diabetic medications . The ecg and supplemental criteria for fqrs patterns were defined by das (10). The resting 12-lead ecg (filter range, 0.15100 hz; ac filter, 60 hz, 25 mm / s, 10 mm / mv) was analyzed by 2 independent, blinded cardiologists . The fqrs pattern was defined as the presence of an additional r or crochetage wave, notching in the nadir of the s wave or fragmentation of the rs or qs complexes in 2 contiguous leads corresponding to a major coronary artery territory . Complete blood counts and biochemical values were evaluated retrospectively from blood samples obtained by antecubital vein puncture upon admission to the emergency department . Hemogram parameters and other biochemical measurements using standard biochemical techniques were determined with the beckman coulter lh 780 (beckman coulter ireland inc ., mervue, galway, ireland) device in the hematology laboratory of our institution . All measurements were performed using a commercially available machine (vivid 7, ge vingmed ultrasound a / s, horten, norway) with a 3.5-mhz transducer . Simpson s method was used to assess the lvef, as recommended by the american society of echocardiography . All patients underwent a coronary angiography by femoral approach using the standard judkin s technique . Iopromide as a contrast agent (ultravist-370, bayer schering pharma, germany) and 6f diagnostic catheter were used in all subjects . All statistical studies were carried out with the spss program (version 17.0, spss, chicago, illinois). Quantitative variables are expressed as the mean value standard deviation or median (interquartile range), and qualitative variables were expressed as percentages (%). A comparison of parametric values between the groups was performed using the student s t test for normally distributed parameters or mann - whitney u test for non - normally distributed parameters . Categorical variables were compared by the likelihood ratio chi - square test or fisher exact test . Spearman correlation analysis was used for determining association between rdw with clinical and laboratory findings for both the study population and nstemi patients . The fqrs pattern was defined in 63 patients (fqrs+ group) and was not defined 188 patients (fqrs group). In the analyzes of the study groups, no significant differences were found between the groups regarding sex, body mass index, ht, dm, number of coronary arteries narrowed, culprit lesion, heart rate, current smoker status, and previous mi history . The patients with fqrs group were older than in the group without fqrs (65 [3090] vs. 59.5 [3088], p=0.018). The fqrs+ group s lvef levels were significantly lower than in the group without fqrs (50 [2565] vs. 55 [2565], p=0.031). In patients in the fqrs group, there was an increased incidence of nstemi (76.2% vs. 59%, p=0.015). There were no significant differences found between groups in levels of total cholesterol, low - density lipoprotein (ldl), high - density lipoprotein (hdl), triglyceride, mean platelet volume (mpv), mean corpuscular volume (mcv), platelet (plt), white blood cell (wbc), neutrophil, lymphocyte, hemoglobin, and hematocrit . Baseline rdw and troponin levels were significantly higher in the fqrs group (p=0.019 and p=0.02, respectively). There were positive correlations between age, number of coronary arteries narrowed, and rdw (r=0.270, p<0.001 and r=0.190, p=0.002, respectively), there were negative correlations between triglyceride, lvef, and rdw (r=0.140, p=0.027 and r=0.229, p<0.001, respectively) in study patients . There were positive correlations between number of fqrs leads, age, and rdw (r=0.239, p=0.002 and r=0.238, p=0.003, respectively), and negative correlations between triglyceride, lvef, and rdw (r=0.201, p=0.011 and r=0.251, p=0.001, respectively) in nstemi patients . Independent predictors of rdw were determined by a backward stepwise multivariate regression analysis in the entire study population and nstemi patients . Age and lvef were found to be associated with rdw in the entire study population . Age and lvef were found to be independent predictors of rdw in multivariate analyses [: 0.22, 95% ci: 0.010.03, p<0.001 and: 0.04, 95% ci: (0.040.016), p<0.001, respectively]. Age, lvef, number of fqrs leads, and ldl were found to be associated with rdw in nstemi patients . Age, lvef, number of fqrs leads, and ldl were found to be independent predictors of rdw in multivariate analyses [: 0.15, 95% ci: 0.010.03, p=0.036;: 0.27, 95% ci: (0.050.01), p<0.001;: 0.17, 95% ci: 0.020.29, p=0.018; and: 0.17, 95% ci: 0.0010.009, p=0.018, respectively]. The relationship between rdw and number of fqrs leads in nstemi patients is shown in figure 1 . Our study results demonstrate that an elevated rdw value is associated with fqrs in patients with nst - acs . High rdw values are positively correlated with the number of fqrs leads in nstemi patients . We found that the patients were older and lvef was significantly lower in the fqrs group, similar to findings of previous studies . To our knowledge, this is the first study to evaluate the association between high rdw values and fqrs . The rdw, an indicator of the variability of the circulating rbc size, is often used to diagnose different types of anemia . Recent studies have reported the relationship between rdw and cad, hf, and stroke [46]. Reported that high rdw levels were associated with adverse outcomes in patients with hf and stemi, respectively . A relationship of rdw with adverse outcomes in these patient groups has not been completely explained . Weiss et al . Demonstrated that inflammation may bring about the changes in red blood cell maturation by disturbing the red cell membrane, leading to increased rdw . On the other hand, lippi et al . Reported a correlation between rdw and inflammatory markers such as c - reactive protein (crp) and sedimentation rate . These results suggest that inflammation may be a key factor underlying the biological mechanism of increased rdw values . Fqrs is defined by unexpected deviations in qrs morphology and the specific cause of fractionation on surface ecg, but the determinants of this phenomenon are not completely understood . Theoretically, fqrs is generally accepted to be derived from regional myocardial fibrosis / scar and ischemia, which cause heterogeneous myocardial electrical activation [1620]. In patients with ischemic or nonischemic lv dysfunction, though the clinical importance is known, it is not yet used for direct detection of myocardial fibrosis as a noninvasive technique . Transesophageal echocardiography (tee), cardiac magnetic resonance imaging (cmri), and endomyocardial biopsy (emb) are diagnostic methods for determining cardiac fibrosis [2325]. Tee and emb are invasive techniques and cmri is expensive and not available at every center . Pietrasik has reported on the sensitivity of fqrs in detecting myocardial scars, and postulated that the presence of fqrs could be a good predictor of cardiac events . Reported that the fqrs complex is a highly sensitive and specific marker of myocardial fibrosis and may be a strong marker in detecting myocardial fibrosis . Peters et al . Demonstrated that fqrs is a diagnostic sign of arrhythmogenic right ventricular dysplasia or cardiomyopathy, which is associated with right ventricular scarring . In addition, there is evidence that fqrs could play an important role as a screening and prognostic tool in patients with brugada syndrome, long qt syndrome, arrhythmogenic right ventricular dysplasia, and cardiac sarcoidosis . Furthermore, kadi et al . Showed that fqrs is increased even in patients with rheumatoid arthritis without cardiovascular disease . The presence or absence of fqrs on admission to emergency departments has been demonstrated in some clinical trials to be related to prognosis and irreversible ischemia in patients with stemi and nstemi . These findings not only establish the relationship between fqrs and fibrosis, but also myocardial ischemia in patients with acs . These results suggest that the presence of an fqrs complex is an easily evaluated, noninvasive electrocardiographic parameter and that fqrs complex is associated with cardiac fibrosis and/or ischemia . Firstly, this was a retrospective study based on a relatively small group of patients, and additional prospective data are needed in a larger study population to confirm our findings . Secondly, rdw values may increase in some conditions such as impaired iron metabolism, suppressed erythropoietin gene expression, inhibition of proliferation of erythroid progenitor cells, downregulation of erythropoietin receptor expression, and reduced erythrocyte circulatory half - life . Elevated rdw levels are associated with levels of iron and vitamin b12, folate deficiency, reticulocyte count, erythropoietin levels, and measures of hemolysis, but our study did not measure these parameters . Thirdly, one of the most important limitations is the failure to measure inflammation parameters such as high - sensitivity crp and mmp-9, which could be helpful in evaluating the relationship between rdw and fqrs . Firstly, this was a retrospective study based on a relatively small group of patients, and additional prospective data are needed in a larger study population to confirm our findings . Secondly, rdw values may increase in some conditions such as impaired iron metabolism, suppressed erythropoietin gene expression, inhibition of proliferation of erythroid progenitor cells, downregulation of erythropoietin receptor expression, and reduced erythrocyte circulatory half - life . Elevated rdw levels are associated with levels of iron and vitamin b12, folate deficiency, reticulocyte count, erythropoietin levels, and measures of hemolysis, but our study did not measure these parameters . Thirdly, one of the most important limitations is the failure to measure inflammation parameters such as high - sensitivity crp and mmp-9, which could be helpful in evaluating the relationship between rdw and fqrs . Results of the present study indicate that an elevated rdw value is associated with fqrs in patients with nst - acs . It appears that the mechanistic link between elevated rdw values and fqrs is a result of the effect of an inflammatory process, fibrosis, and/or ischemia in nst - acs . Rdw levels and ecg are routine, simple, and inexpensive methods for evaluating patients with acute coronary syndromes . In addition, elevated rdw values and fragmentations on ecg together may be useful for identifying nstemi patients in nst - acs . The rdw and fqrs might be helpful to determine high - risk patients and treatment strategies.
|
Epilepsy is a group of conditions characterized by recurrent, unprovoked seizures that result from abnormal synchronized neuronal firing in the brain . Epilepsy will affect up to 1 in 26 individuals and confers a significant health and economic burden . There are many forms of epilepsy that can be distinguished by various characteristics including age of onset, predominant seizure type(s), and etiology . Three broad classes of epilepsy include genetic generalized epilepsy (gge; formerly idiopathic generalized epilepsy), focal epilepsy, and epileptic encephalopathy, though it should be noted that there are many specific epilepsy syndromes within each class (table 1). Table 1examples of epilepsy syndromesmajor classexamples of specific syndromesgenetic generalized epilepsy (gge)juvenile myoclonic epilepsy (jme)childhood absence epilepsy (cae)generalized epilepsy with febrile seizures plus (gefs+)focal epilepsytemporal lobe epilepsyautosomal dominant focal epilepsy with auditory features (adpeaf)epileptic encephalopathyohtahara syndromedravet syndromewest syndrome examples of epilepsy syndromes the causes of epilepsy are diverse . Non - genetic or acquired etiologies account for 2030% of cases and include stroke, head injury, and tumor . In the remaining cases, genetics in fact, it has been recognized since the time of hippocrates that epilepsy is, at least in part, genetic . Modern evidence for genetic factors comes from twin studies, family studies, and the identification of single - gene disorders resulting in epilepsy syndromes . Studies in twins show an excess of disease concordance in monozygotic twins compared to dizygotic twins for most types of epilepsy . In a large australian cohort, generalized epilepsies showed the highest concordance (~80%); focal epilepsies have a lower (36%) but still significant concordance . Family studies reveal that the overall recurrence risk for epilepsy in first - degree relatives of affected individuals is 25% [4, 5], and at least one study has shown that there is similar increased recurrence for family members of probands with either generalized or focal epilepsy . Finally, large multiplex families in which epilepsy segregates in an autosomal dominant manner have been used to identify linkage regions and causative genes in several different epilepsy syndromes . Despite longstanding knowledge that epilepsy has a strong genetic component, it was not until 1995 that the first gene for a form of epilepsy was identified: mutations in the alpha 4 subunit of the nicotinic acetylcholine receptor, chrna4, were identified in a large family with autosomal dominant nocturnal frontal lobe epilepsy (adnfle). Since that time, multiple genes in which mutations cause epilepsy have been discovered [9, 10]. While many epilepsy genes encode ion channel subunits, several non - channel genes encoding proteins important for brain development copy number variants (cnvs) are large (> 1 kb) deletions or duplications of dna . Cnvs can contain zero, one, or many genes and have been increasingly recognized as an important source of both normal genetic variation and pathogenic mutation . Recurrent cnvs are deletions and duplications that occur as a result of non - allelic homologous recombination (nahr) at meiosis due to a predisposing sequence architecture: 50 kb to 10 mb of unique dna flanked by duplicated blocks of sequence that are> 10 kb with> 95% sequence identity . Examples of recurrent cnvs associated with neurological or neurodevelopmental disorders include duplications of 17p12 causing charcot tooth type ia, deletions of 15q11-q13 in prader willi and angelman syndromes [13, 14], and deletions of 7q11 causing williams beurens syndrome . Because of the mechanism by which they are generated, recurrent cnvs in two unrelated individuals with the same disorder have nearly identical breakpoints . Non - recurrent cnvs occur throughout the genome, but the breakpoints are not consistent . While recurrent cnvs are generated by aberrant recombination, non - recurrent cnvs are often due to errors at replication . There are several mechanisms for the generation of non - recurrent breakpoints that have been described, many of which involve microhomology few to several identical base pairs at each breakpoint . Non - recurrent cnvs can be simple, where a stretch of dna is simply cut out of its original location and the ends rejoined, or complex, in which a deletion may be accompanied by insertion or duplication of dna at the breakpoints for example . It is rare to find two or more patients with the same non - recurrent cnv . However, comparison of overlapping cnvs in similarly affected patients often reveals a smallest region of overlap that can highlight one or a few genes as primarily responsible for the phenotype . Examples include the discovery of chd7 as the gene for charge syndrome, ehmt1 as the critical gene in 9q34 deletions (kleefstra syndrome), and mbd5 in 2q23.1 deletions . Genome - wide identification of cnvs became efficient with the introduction of array comparative genomic hybridization (cgh) and single nucleotide polymorphism (snp) microarrays . These technologies allow the detection of submicroscopic cnvs that are too small to be recognized by routine karyotype analysis . Since the introduction of these technologies, the rate of discovery of submicroscopic rearrangements in both affected and unaffected individuals has increased dramatically . The first large disease cohorts to be systematically studied were patients with intellectual disability (i d), followed by autism and schizophrenia [28, 29]. Comparison of cnvs in patients to those in controls combined with the identification of similar cnvs in multiple affected individuals led to the discovery of novel, disease - associated cnvs . Systematic cnv discovery in patients with epilepsy followed, and there has been steady progress that provides new insight into the genetics of epilepsy and related disorders . The remainder of this review will focus on cnv discovery and characterization in patients with epilepsy and recommendations for clinical testing . The importance of non - recurrent cnvs in epilepsy has actually been known for some time . For example, techniques such as quantitative pcr and multiplex ligation - dependent probe amplification (mlpa) have been used to detect single- and multiple - exon deletions and duplications in known genes such as scn1a [30, 31]. However, qpcr and mlpa are assays directed at specific locations in the genome, which means cnvs elsewhere will not be detected . Real advances in cnv discovery came from the application of genome - wide investigations using array cgh or snp microarrays . Heinzen and colleagues performed cnv discovery in a large cohort of 3812 patients with primarily focal epilepsy syndromes and identified an excess of large (> 1 mb) deletions in affected individuals, the majority of which were seen in one individual each [32]. We performed array cgh studies in 517 patients with various types of epilepsy (primarily generalized); ~5% of patients carried a non - recurrent cnv that affected at least one gene and was not seen in controls . In a study of 102 patients with epilepsy with or without other neurodevelopmental abnormalities, 23/102 individuals had at least one non - polymorphic cnv . Investigation of patients with epileptic encephalopathy syndromes also confirms the role of non - recurrent cnvs in severe epilepsies [35]. Together, these studies confirm that cnvs are important contributors to the genetics of broad classes of epilepsy . Because non - recurrent cnvs are rare and often unique, it can be difficult to interpret the clinical significance of any given cnv . Several criteria can be used, including size, gene content, presence or absence in control studies, and inheritance . While a cnv in a single patient may be difficult to interpret, by collecting multiple patients with overlapping non - recurrent cnvs, it becomes possible to determine a critical region and, sometimes, a single critical gene for a given condition . For example, depienne and colleagues performed array cgh on a series of patient with a dravet - like syndrome and identified a single patient with a deletion involving pcdh19 on chromosome x. sequence analysis of the gene in additional patients revealed sequence mutations and established the gene as a cause of epilepsy restricted to females with i d . Similarly, rare reports of deletions involving the grin2a gene highlighted the gene as a potentially important gene . Indeed, we and others have identified mutations in grin2a in 520% of patients with epilepsy syndromes associated with language deficits (epilepsy aphasia syndromes) [39, 40, 41]. We recently identified a patient with a large deletion of 15q26 (reported in [42]). Comparing the deletion in our patient to other 15q26 deletions in the literature using high - throughput targeted sequencing of chd2 in 500 patients with epileptic encephalopathy, we identified de novo pathogenic mutations in 1.2% of cases . Additional studies of overlapping rearrangements published in large disease cohorts, as well as smaller case reports, are likely to yield important causative genes . A major and somewhat surprising advance in the field of epilepsy genetics has been the discovery of recurrent cnvs in patients . The importance of recurrent cnvs as causes of i d syndromes, such as prader willi, angelman, smith magenis, and velocardiofacial syndromes, has been known since the 1980s . More recently, genome - wide cgh in large cohorts of patients with i d led to the identification of several novel recurrent microdeletion syndromes [29, 44]. The first study that highlighted the importance of cnvs in the genetic etiology of epilepsy was the discovery of recurrent 15q13.3 deletions in patients with generalized epilepsy [45]. The 15q13.3 microdeletion (chr15: 31,000,00032,500,000, hg19) was first described in patients with i d, but it was noted that most patients also suffered from seizures . This observation led to a collaborative effort to determine the frequency of the deletion in a cohort of 1,223 patients with generalized epilepsy, most of whom did not have i d or other neurodevelopmental abnormalities . Indeed, 12/1,223 (1%) patients carried a 15q13.3 deletion compared to 0/3,699 control individuals [45]. Several subsequent studies confirmed this finding [33, 47, 48], establishing the deletion as one of the most prevalent genetic risk factors for gge with an estimated odds ratio of 68 (29181). De kovel and colleagues investigated a cohort of 1,234 individuals with gge and 3,022 controls for recurrent cnvs . In addition to 15q13.3 deletions, they found recurrent deletions at 16p13.11 (chr16: 15,500,00016,300,000, hg19) and 15q11.2 (chr15: 22,800,00023,100,000, hg19) in 0.5 and 1% of patients, respectively, representing a significantly increased frequency compared to controls . Heinzen and colleagues performed cnv genotyping in 3,812 individuals with epilepsy, most of which presented with a focal epilepsy syndrome [32]. Deletions of 16p13.11 were also enriched in patients compared to controls (23/3,812 vs 0/1299). While 15q11.2 deletions were identified in 24/3,812 patients, there was not a significant enrichment compared to the frequency in controls (3/1,299). In a study of 517 patients with various types of epilepsy, we identified five patients each with deletions at 15q11.2, 15q11.3, and 16p13.11, again emphasizing the importance of each of these as frequent genetic susceptibility factors in epilepsy . Of note, in an investigation of 315 patients with epileptic encephalopathy, there were no occurrences of 15q13.3, 16p13.11, or 15q11.2 deletions [35], suggesting a different genetic architecture for this class of disorders . Each of the three epilepsy - associated recurrent deletions must be regarded as a risk factor for disease . In each case, the deletion may be de novo or inherited from an affected or unaffected parent . Importantly, all three deletions also confer risk for other neurodevelopmental disorders . As described above, deletions of 15q13.3 were first identified in patients from an i d cohort . The deletion is also enriched in patients with schizophrenia [50, 51] and is seen in patients with autism spectrum disorder and non - specific developmental delays [52, 53]. Similarly, deletions of 16p13.11 and 15q11.2 are also associated with a wide range of neurodevelopmental and neuropsychiatric conditions [32, 5457]. Interestingly, the 15q13.3 deletion appears to confer risk specifically for generalized forms of epilepsy though present in 0.51% of most gge cohorts, it was not reported in> 3,000 patients with focal epilepsy syndromes [32]. Perhaps not surprisingly, patients with one of the epilepsy - associated recurrent deletions may present with a more severe phenotype than expected . This is especially true for gge, which is not typically characterized by other neurocognitive deficits . Muhle and colleagues identified 4/570 patients with various types of epilepsy who carried a 15q13.3 deletion . Detailed phenotype analysis revealed that all patients had absence epilepsy as well as some degree of i d . More recently, a systematic comparison of the frequency of recurrent cnvs in patients with gge compared to patients with gge and i d showed that patients with dual disability are more likely to carry one of the three epilepsy - associated cnvs than patients with gge without other features [42]: 10% of the gge + i d patients had one of the three recurrent cnvs compared to ~3% of patients with gge but no i d . Other recurrent cnvs that are associated with neurodevelopmental disorders are also found in patients with epilepsy, though not as frequently as the three deletions discussed above [28, 29, 60]. The role of cnvs in the genetic etiology of epilepsy has been clearly established, and diagnostic testing by chromosome microarray should be considered in this population . There is a clear consensus that chromosome microarray testing should be the first - line test in the diagnosis of patients with neurodevelopmental disorders or multiple congenital anomalies . Given the overlapping genetic etiologies of a broad range of neurodevelopmental disorders, patients with epilepsy that is associated with other findings such as i d, autistic features, or developmental delays should be tested . Indeed, for gge with i d, the diagnostic yield will be 10% or greater . Similarly, patients with brain malformations or other congenital abnormalities and patients with epileptic encephalopathy without a clear diagnosis should undergo cnv testing . The yield of cnv testing in patients with epilepsy and no other features may be lower, but a cnv involving a known epilepsy gene would be an important diagnostic finding . Both recurrent and non - recurrent cnvs have been identified in most major classes of epilepsy . In some cases, cnvs are highlighting the shared genetic susceptibility for a range of neurodevelopmental and neuropsychiatric conditions . It is clear that the identification of disease - associated cnvs will lead to improved diagnosis and prognosis counseling . Recurrence risk counseling will remain complicated for cnvs with broad effects but is nevertheless an important consideration for families . Finally, as patients with shared genetic etiologies of epilepsy are identified, studies of genotype phenotype correlation, natural history, and therapeutic response to specific anti - epileptic drugs can be performed, which will lead to improved long - term care and outcomes for patients.
|
Various mechanical and chemical surface modifications of titanium dental implants, such as blasting, alkaline treatment, or hydroxyapatite coating, have been reported for improving the bone response during healing process [14]. Some reported the effectiveness of the surface coating or immobilization with cell adhesive protein, such as, fibronectin (fn) or laminin, for enhancing cell attachment, cell spreading, and cell activity [5, 6]. For biochemical surface treatment, several methods for covalent immobilization of cell adhesive proteins have been reported . Silane coupling reagents have been widely used for the immobilization of cell adhesive proteins [710]. On the contrary, hayakawa et al . Reported an easy and simple method for the immobilization of cell adhesive proteins onto a titanium surface, which was named the tresyl chloride - activated method [11, 12]. Hayakawa et al . Applied tresyl chloride directly on the titanium surface without the use of any solvent and found the basic hydroxyl groups of the titanium surface reacted with tresyl chloride [11, 12]. Cell adhesive protein could be easily immobilized onto titanium surface through ionic interaction as shown in figure 1, which was confirmed by quarts - crystal microbalance - dissipation measurements . Fibronectin-, collagen-, and fibronectin - derived peptides could be easily immobilized onto a titanium surface . Gene expression of osteoblast - like cells was monitored on titanium immobilized with fibronectin or fibronectin - derived grgdsp peptide and it was found that the expression levels of some genes related to the mineralization process, for example, bone sialoprotein and osteomodulin, were upregulated [1517]. Many studies have shown that a rougher surface provided better bone formation or osteoconduction compared with a smooth surface . However, the issues of optimal surface roughness and superficial morphology are still controversial and need to be clarified . Larsson et al . Reported that differences of surface roughness between ra = 30.3 m (machined) and ra = 2.9 nm (electropolishing) varied the amount of bone after 6 weeks of implantation in rabbit cortical bone but not after 1 year of implantation . They reported that the roughest plasma - sprayed surface (ra = 33 nm) exhibited the highest number of cell attachment cells and alp activity . However, they also reported that the alp level of the polished surface with nanometer smoothness (ra = 6 nm) was much higher than that of the satin- (ra = 0.83 m) and grit - blasted (ra = 11 m) groups at 16 days of cell culture . Previously we investigated the influence of two different surface roughness, namely, nanometer smoothing (ra: approximately 2.0 nm) and sandblasting (ra: approximately 1.0 m), as well as biochemical treatment, namely, fibronectin immobilization using tresyl chloride - activated technique, of a titanium surface on osteoblast - like cell behavior . It was reported that the nanometer - smooth surface was beneficial for the differentiation of mc3t3-e1 cells and that fn immobilization provided better arrangement of attached cells . In the present study, we aimed to evaluate cell viability of mc3t3-e1 and total protein content on the above - mentioned four different titanium surfaces, as a next series of our experiments . Commercially pure titanium disk (= 15 mm 1.0 mm, jis, japan industrial specification h 4600, 99.9 mass% ti, furuuchi chemical corp ., nanometer - smooth titanium surface (ti - smooth) was prepared by polishing with diamond slurry with diamond particle diameters of 6 m, 3 m, and finally 1 m using a rapping machine (rapping machine 12 in, tdc, corp ., miyagi, japan). After polishing, sandblasted surface (ti sand) was prepared by sandblasting with alumina powder (50 m) at 5 atmospheric pressures for 5 s. after sandblasting, the specimen was cleaned ultrasonically with acetone - distilled water mixture and was then cleaned with 10 wt% hf and 5 wt% hno3 aqueous mixture for 20 s to remove any remaining alumina powder . Finally, the sandblasted specimen was cleaned ultrasonically again with acetone - distilled water mixture . The surface roughness of nanometer - smooth titanium disk, which was determined with talysurf cci3000 (0.35 mm length and 12 nm pitch, ametek co., ltd . Tokyo, japan), was 2.0 0.9 nm, and that of sandblasted titanium disk determined with surfcom-30a (tokyo seimitsu, japan, 4 mm scale length and 0.8 mm pt .) Was 1.0 0.7 m . Fn immobilization on the titanium was performed in accordance with previous reports [11, 12] ti smooth and ti sand disks were completely covered with tresyl chloride (fluka, buchs, switzerland) and then stored at 37c for two days . Afterwards, tresylated titanium disks were washed with double - distilled water followed by double - distilled water - acetone solution (50: 50) and then dried and stored in a desiccator . Human plasma fibronectin (harbor bio - products, ma, usa) was dissolved in phosphate - buffered saline (pbs) solution (ph 7.4) at a concentration of 100 g / ml for cell attachment assay . Tresylated titanium disks were immersed in the fibronectin - pbs solution for 24 hours at 37c and then rinsed with double - distilled water . Finally, the titanium disks were dried with a gentle stream of dry air and stored in a desiccator . Thus, fibronectin - immobilized ti smooth (ti smooth / fn) and ti sand (ti - sand / fn) disks were prepared . The fn immobilization was confirmed by an x - ray photoelectron spectroscope (xps; axis ultra, kratos analytical, uk), which was equipped with a monochromatized alk x - ray source operated at 15 kv and 15 ma . The binding energy scale for each spectrum was calibrated against the c1s peak at 284.8 ev . An n1s peak of amide bonds in fibronectin was detected at 399.9 ev . The cells were cultured in mem (invitrogen, md, usa) supplemented with 10% heat - inactivated fetal bovine serum, 66.7 g / ml kanamycin sulfate, and 284 m l - ascorbic acid 2-phosphate at 37c in a humidified atmosphere of 95% air and 5% co2 . Subsequently, the cells were cultured to subconfluence in 100 mm standard dishes (falcon, becton - dickinson labware, franklin lakes, nj, usa) and transferred to bioflex collagen i - coated 24-well plates (falcon) after treatment with 0.25% trypsin / edta (invitrogen, md, usa). Classical medium without any bone differentiation components was employed in the preset study for evaluating the influence of fibronectin immobilization and surface roughness on the cell behavior [22, 23]. Four different surfaces, that are, ti smooth, ti smooth / fn, ti sand, and ti sand / fn were evaluated by cell assay . Mc3t3-e1 cells were seeded on each titanium disc in 24-well plates at a density of 5 10 cells / cm and incubated for 11 days . Cell viability was determined by (3-(4,5-di - methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt) assay by using vialight plus kit (lonza group ltd, basel, switzerland). At predetermined time intervals (1 and 11 days), attached cells were rinsed with pbs and 200 l of culture medium was added . Then, 200 l of the cell lysis reagent was added, and cells were incubated in the orbital shaker for 10 min at 600 rpm, and 100 l of cell medium was transferred to a white plate . Afterwards, 100 l of atp monitoring reagent plus was added, and the plate was incubated for 2 min in the dark condition (inside the luminometer) before the measurement . Measurement was taken with the plate reader (wallac 1420 arvosx, perkinelmer, inc . Four runs were performed and four specimens were analyzed for each substrate and each period . Mc3t3-e1 cells were seeded on each titanium disc in 24-well plates at a density of 5 10 cells / cm and incubated for 11 days . To determine the total cellar protein, bca protein assay kit (thermo fisher scientific k.k . 200 l of the cell lysis reagent was added to each well, and then 10 l of each specimen was pipette and 90 l of cell lysis buffer was added into a 96-well plate . 100 l of the reagent (micro bca kit; thermo fisher scientific inc ., the enzyme reactions were conducted for 30 min at 37c, and absorbency at 570 nm was immediately measured using a plate reader (bio rad model 550, bio - rad laboratories, inc . After 1 day of cell culture, titanium disks were rinsed thoroughly in pbs, mounted on a piece of cork, and fixed in 2.5% glutaraldehyde in phosphate buffer (ph 7.4). Following fixation, disks were dehydrated through a graded series of ethanol (50, 60, 70, 80, 90, 95, and 100%) and then dried with tetramethylsilane . After ion coating with gold, the morphology of the cells was observed using a scanning electron microscope (s4000, hitachi, tokyo, japan) at an accelerating voltage of 5 kv . Significant differences were determined by one - way analysis of variance (anova) using graphpad software (graphpad prism, graphpad software inc . The results of mtt assay are shown in figure 2 . At 1 day of cell culture, there were no significant differences among four different titanium surfaces . At 11 days, ti sand / fn showed the significantly highest cell viability than ti sand, no significant differences were detected between ti smooth / fn and ti smooth . Between 1 day and 11 days of cell culture, there were no significant differences for each titanium surface . Figures 4 and 5 show the sem views of attached cells after 1 day of cell culture . Fn immobilization did not have any influence on the morphologies of attached cells but did have some influence on the number of attached cells . Cells attached on nanometer smooth titanium (ti smooth, ti smooth / fn) showed the flat shape with a large and thin cytoplasmic layer and with numerous filopodia . The filopodia was extending from the cell body to the titanium surface and higher magnification indicated the presence of short - fiber - like structure, which is presumed to be microvilli . Comparing ti smooth and ti smooth / fn, ti smooth / fn surface showed more attached cells and attached cells showed better arrangement on ti smooth / fn surface rather than on ti smooth (figure 3). Attached cells on sandblasted surface (ti sand and ti sand / fn) were slightly less spread than on nanometer smooth surface (ti smooth, ti smooth / fn). Some of them had a globular appearance, especially cell on ti sand / fn . More globular structure was observed on ti sand / fn and higher magnification clearly showed the globular structure of attached cell (figure 4). In this study, we evaluated cell viability and total protein contents of mc3t3-e1 cells on four different titanium surfaces, ti smooth, ti smooth / fn, ti sand, and ti sand / fn . The influences of mechanical treatment (nanometer smoothing and sandblasting) and biochemical treatment (with and without fibronectin immobilization) of a titanium surface were investigated . Previously, we monitored dna amounts, alp activity, octeocalcin production and mineralization behavior to four different surfaces same as the present study . It revealed that surface roughness enhanced the differentiation of mc3t3-e1 but not fn immobilization . The cell viability for ti sand / fn showed greater cell viability than that for ti sand . Although the reason is not clear, the combination of sandblasting and fn immobilization provided better cell viability . Pugdee et al . Reported that significantly more mc3t3-e1 cells attached to fn - immobilized titanium disk than to untreated titanium disk at 30 min after cell seeding . However, the present study showed no remarkable enhancement of cell attachment by fn immobilization, which was determined by total protein contents . It is presumed that the controversial results were caused by the difference of cell assay time, 30 min versus 11 days and the difference of number of seeded cells, 1 10 versus 5 10 cells / cm . Fn is a major extracellular matrix protein, and cultured cells produce fn by themselves during cell assay . It concluded that fn immobilization only enhanced the initial cell attachment, not proliferation . Cell on ti sand / fn showed the highest cell viability, but not the highest total protein contents . It is suggested that the activities and/or morphologies of cells on ti sand / fn were influenced by the combination of surface roughness and fn immobilization . Sem observation appeared that more attached cells were present on the ti smooth / fn surface than on ti smooth . Therefore, the arrangement of attached cells is controlled by the presence of immobilized fn . Classical medium without any bone differentiation components was employed in the preset study for evaluating the influence of fibronectin immobilization and surface roughness on the cell behavior [22, 23]. Fn could be easily immobilized on both nanometersmooth and sandblasted titanium surfaces by our originally developed method, namely, the tresyl chloride - activation technique [11, 12]. First they treated titanium surface with a mixture of sulfuric acid and hydrogen peroxide to reproduce titanium oxide surface layer and then applied - silane - coupling agents to oxide titanium layer for the immobilization of proteins . Another advantage of tresyl chloride - activation technique is that any types of proteins and cytokine such as bmp or tgf- can be immobilized on titanium . The influence of the immobilization of other types of proteins or cytokines, for example, laminin or bmp, on the cell behaviors should be further investigated.
|
Cancer, which is commonly a harbinger of imminent patient death, is a group of diseases characterized by uncontrolled growth and spread of abnormal cells and aberrant cell behavior, which leads to expansive masses that destroy surrounding normal tissue and is able to attack vital organs resulting in disseminated disease . It is an inevitable matter of concern in the medicinal chemistry era and an increasing burden to the population . According to estimates from the international agency for research on cancer (iarc), the global burden is expected to grow to 21.4 million new cancer cases and 13.2 million cancer deaths by 2030 . There were 12.7 million new cancer cases in 2008 worldwide, of which 5.6 million were in the economically developed countries and 7.1 million were in the economically developing countries . The corresponding estimates for total cancer deaths in 2008 were 7.6 million (about 21,000 cancer deaths a day), 2.8 million in the economically developed countries and 4.8 million in the economically developing countries [1, 2]. Pathophysiology of all cancers involves the malfunction of genes that control cell growth, division, and death . Cancers evolve through multiple changes resulting from a combination of hereditary and environmental factors, which mutate genes encoding critical cell - regulatory proteins . The new generations of anticancer drugs affect the signals that promote or regulate the cell cycle, growth factors and their receptors, signal transduction pathways, and pathways affecting dna repair and apoptosis rather than targeting the direct synthesis of dna . Chalcone derivatives of diverse chemical architectures are quite significant in anticancer drug discovery and hence are in the center of attention of drug hunters . Anticancer activity of chalcone might be due to molecular alteration such as induction of apoptosis, dna and mitochondrial damage, inhibition of angiogenesis, tubulin inhibition, kinases inhibition, and also drug efflux protein activities . Chalcone is chemically 1,3-diaryl-2-propen-1-one (figure 1) in which the two aromatic rings are joined by a three - carbon,-unsaturated carbonyl system, representing a class of flavonoids that occur naturally in fruits and vegetables . Chalcones are also metabolic precursors of some flavonoids and isoflavonoids . The plants containing chalcone are traditionally employed for therapeutical purposes [37]. Chalcones were exploited well for their wide application in pharmacological area . It is reported that chalcones have several advantages such as poor interaction with dna and low risk of mutagenicity . Hence, some clinically useful anticancer drugs have reported genotoxicity due to their interaction with amino groups in nucleic acids; chalcones may be devoid of these side effects due to their structural flexibility . Literature reveals that natural and synthetic chalcones are desirable to elicit cytotoxic and apoptotic activity (figure 2). They have been reviewed not only in the articles mentioned in the text but also in more recent articles, which have eluded the authors [911]. This review (surveyed database, 20132015) is complementary to the researchers for optimizing the lead chalcone as potential anticancer scaffold with increased potency . Cell death in tumors is a passive degradative reaction known as necrosis, most likely due to inadequate angiogenesis within the tumor cell . On the other hand, apoptotic cell death includes a number of gene families, and altering proapoptotic pathways specifically in tumors is something of a holy grail for oncology and medicinal chemistry . When cell production rate exceeds the cell loss rate through mitosis, it results in net tumor . Apoptosis is often referred to as an altruistic cell suicide process, where damaged dna in the cell produces signals, resulting in both repair and apoptotic pathways, and if repair cannot be done then the cell undergoes apoptosis in a manner like better dead than wrong . The cells which harbour mutant p53 will have a survival advantage over normal cells . In response to dna damage, normal cells upregulate p53 which acts as a transcription factor for cell cycle arrest and apoptosis; thereafter, p53-mutant cells become unable to carry out this protective arrest or apoptosis and might survive with what otherwise would turn to lethal genetic damage, perhaps explaining why p53 mutations are so common in human cancers . The decision of apoptosis is largely played out on the mitochondrial surface between three major families: the so - called three horsemen of apoptosis . The final executioner proteases called caspases play pivotal role by cleaving critical substrates such as dna repair enzymes and cytoskeletal proteins, but they are stored as zymogens bound to an apoptotic adenosine triphosphate, apoptosis - activating factor-1 (apaf-1), which is the mammalian homologue of the nematode caenorhabditis elegans cell death protein, ced-4 . Once cytochrome c is released, it binds to the cytosolic protein apaf-1 to facilitate the formation of apoptosome, which in turn activates apoptotic caspases . However, proapoptotic bcl-2 family proteins such as bax which is upregulated by p53 can activate apoptosis by releasing cytochrome c (cyt - c) from mitochondria, where apaf-1 activation takes place [2, 6, 12, 13]. Literature on anticancer chalcones highlights the employment of three pronged strategies, namely, structural manipulation of both aryl rings, replacement of aryl rings with heteroaryl scaffolds, and molecular hybridization through conjugation with other pharmacologically interesting scaffolds for enhancement of anticancer properties . Various substitutions on both aryl rings (a and b) of the chalcones, depending upon their positions in the aryl rings, appear to influence anticancer activity by interfering with various biological targets . Similarly, heterocyclic rings, either as ring a or as ring b in chalcones, also influence the anticancer activity shown by this class of compounds . Hybrid chalcones formulated by chemically linking chalcones to other prominent anticancer scaffolds such as benzodiazepines, benzothiazoles, and imidazolones have demonstrated synergistic or additive pharmacological activities too . Anticancer activity of three naphthyl chalcones, 1, 2, and 3, shown in figure 3 was investigated by winter et al ., these chalcones were found to possess concentration- and time - dependent cytotoxicity on murine lymphoblastic leukemia cell line (l1210). Chalcones 1, 2, and 3 induced apoptosis via an activated caspases - dependent pathway . The activities of caspase-8, caspase-9, and caspase-12 were found to increase after the treatment of l1210 cells with the cc50 of 30 m of chalcone 1 and 40 m of chalcones 2 and 3 . It was found that chalcones 1 and 2 induced an increase of proapoptotic proteins bax, bid, and bak (only chalcone 2), as well as a decrease in antiapoptotic bcl-2 expression . These chalcones also induced an increase in death receptor fas and a decrease in p21 and p53 expression . Chalcones 1 and 2 exert a statistically significant increase in cytochrome c release from mitochondria to cytoplasm . Cytochrome c release mediates caspase-9 activation, while the apoptosis inhibitors from bcl-2 family prevent the efflux of cytochrome c from mitochondria . Chalcone 3 seems to act by a different mechanism to promote cell death, as it did not change the mitochondrion - related proteins nor did it induce the cytochrome c release . Chalcones 1, 2, and 3 induced an increase in cell calcium concentration and an increase in chop (c / ebp homologous protein) expression which is the transcription factor involved in endoplasmic reticulum stress, together with an increase in caspase-12 activity, suggesting that chalcones could induce an endoplasmic reticulum (er) stress . They did not result in the arrest of g0/g1, s, or g2/m phases of the cell cycle in contrast to paclitaxel, which was used as a positive control in this study and induced a statistically significant enrichment of g2/m fraction . They presented a selectivity index (si) higher than one, indicating that chalcones show higher selectivity to leukemic cells when compared to nontumoral cells (vero = monkey kidney cells and nih/3t3 = murine fibroblast). The only exception was chalcone 3 which presented the same toxicity in l1210 and vero cells . The selectivity index (si) corresponds to cc50 (concentration of the compounds, which results in 50% of cell viability) of chalcones on nontumoral cell lines (vero and nih/3t3) divided by cc50 determined for cancer cells (l1210). 2,4,5-trimethoxychalcones 4, 5 (figure 3) were found to reduce the viability of human k562 acute myeloid leukemia cell and human jurkat acute lymphoid leukemia cell significantly and caused a cytotoxic effect in both cell lines in a concentration- and time - dependent manner . They were found to have low ic50 values (4 to 8 m) against both cell lines and did not have a cytotoxic effect on normal human lymphocytes . The mechanism of action involves the reduction of cell proliferation which has been shown by a reduction in the expression of cell proliferation marker ki67 . Cell death induced by 2,4,5-trimethoxychalcones was due to induction of apoptosis through the reduction of the mitochondrial membrane potential, reduction in bcl-2 expression, increase in bax expression, increase in active caspase-3, and activating the intrinsic pathway and execution phase of apoptosis . Histone deacetylases (hdacs) are enzymes which catalyze removal of acetyl groups from lysine residues . Hdacs play a critical role in epigenetic gene regulation and hence control multiple cellular events . Hence, hdacs expressions and/or activity are deregulated in various cancer subtypes, leading to a target for anticancer therapy . Coumarin - containing compounds 6a, 6b, and 6c (figure 3) were found to inhibit total hdac activity by 2050% at 100 m in chronic myeloid leukemia k562 and histiocytic lymphoma u937 cell lines . The activity of the compounds was compared to peripheral blood mononuclear cells (pbmcs) of healthy donors, which showed no effect on pbmc viability . In comparison to 6a, compound 6b, with a methoxy group at r3, presented increased levels of inhibition . Compound 6b was tested against seven hdac isoenzymes (1, 2, 3, 6, 8, 10, and 11) and acted as a pan - hdaci with ic50s between 12 and 85 m . 6b inhibited hdac3 with an ic50 at 12 m and may serve as a lead for targeting this nuclear isoenzyme . Chalcone 7 (figure 3) with monomethoxy group at the ortho position showed a significant effect on downregulation of cancer cell proliferation and viability in three different leukemia cell lines (k562, jurkat, and u937). The executioner caspase cleavage analyses indicated that the cytotoxic effect mediated by chalcone 6 is due to induction of apoptotic cell death by caspase-3 and caspase-7 activation . The cytotoxic effect was cell type - specific and targeted preferentially cancer cells as peripheral blood mononuclear cells (pbmcs) from healthy donors were less affected by the treatment compared to k562, jurkat, and u937 leukemia cells . It was observed that compound 6 obeyed lipinski's rule of five which indicates drug - likeness property of that molecule . 2-hydroxy-2,4,6-trimethoxy-5,6-naphthochalcone, 8 (figure 4), had most effectively inhibited the clonogenicity of sw620 colon cancer cells . The ic50 value for compound 8 was 14.5 1.1 m against sw620 cells . Mechanistically, compound 8 triggered cell cycle arrest at g2/m phase, followed by an increase in apoptotic cell death, which involves the disruption of microtubular networks . The mitotic spindle network is essential for appropriate segregation of chromosomes between the two daughter cells at cell division, where disruption leads to apoptosis . Compound 8 was found to destabilize microtubule assembly during mitosis, associated with failure of mitotic spindle formation, in turn blocking mitosis at the prometaphase or metaphase - anaphase transition . However, the study did not distinguish between the dna damage checkpoint and mitotic checkpoint pathways of apoptosis . Trail (tumor necrosis factor- (tnf-) related apoptosis - inducing ligand) is a member of the tnf superfamily of cytokines . Tnf family members contain highly conserved carboxyl - terminal domains and induce receptor trimerization for the transduction of intracellular signal . Trail binds to four different receptors, two of which are death receptors 4 and 5 (dr4 and dr5, resp . ), induces apoptosis, and decoys receptors, dcr1 and dcr2, which lack the cytoplasmic death domain for transducing apoptotic death signals and protect cells from trail induced cell death by interfering with signaling through dr4 and dr5 . It is generally believed that transformed tumor cells are more susceptible to trail - mediated cell death owing to the selective loss of decoy receptors . Chalcone 9 (figure 4) (ic50 = 4.39 m) containing an amino (-nh2) group was the most potent and selective against trail - resistant human colon cancer (ht-29) and nontoxic against normal human embryonic kidney (hek-293) cells . It was observed that a large portion of ht-29 cells had undergone late apoptosis and/or necrosis after treatment with 5-fluorouracil (5 m). These findings were consistent to show that chalcone 33 induces apoptosis rather than necrosis in ht-29 cells . It increases the death receptors expression (trail - r1 and trail - r2) and proapoptotic markers (p21, bad, bim, bid, bax, smac, caspase-3, and caspase-8) as well as reducing the antiapoptotic markers (livin, xiap, and hsp27). Anthraquinone based chalcone compounds were synthesized and evaluated for their anticancer potential, where compounds 10a, 10b, and 10c (figure 5) showed promising activity in inhibition of cervix adenocarcinoma (hela) cells with ic50 values ranging from 2.36 to 2.73 m and low cytotoxicity against healthy human fetal lung fibroblast cell lines (mrc-5). All the compounds cause the accumulation of cells in s and g2/m phases in a dose - dependent manner and induce caspase-3-dependent apoptosis and noncovalent interaction with the minor groove of the double - helical ct - dna and the damage of dna double helix structure . Significant increase of p18 bax in treated hela cell line yielded consistency with the higher cytotoxic efficacy of compounds which implies the involvement of mitochondria in apoptotic process . Synthesis and antiproliferative activity of a series of novel coumarin - chalcone hybrids were done by singh et al . . The most potent molecule of the series was compound 11 (figure 5). Regression of tumors induced by hela cell xenografts in nod scid mice was found after oral administration of this molecule . It inhibited proliferation of cervical cancer cells (hela and c33a) by inducing apoptosis and arresting cell cycle at g2/m phase . Apoptosis was due to induction of caspase - dependent intrinsic pathway and alterations in the cellular levels of bcl-2 family proteins . The mitochondrial transmembrane potential also got highly depleted in compound 11 treated cells due to an increase in bax / bcl-2 ratio and intracellular ros . Compound 11 induced release of cytochrome c into the cytosol and activation of initiator caspase-9 and executioner caspase-3 and caspase-7 . Tumor suppressor protein p53 and its transcriptional target puma (p53 upregulated modulator of apoptosis) were upregulated, suggesting their role in mediating the cell death . Based on dose response curves, the calculated ic50 (after 48 h treatment) was 4.7 1.0 m for c33a cells and 7.6 2.0 m for hela cells . Similar results were found in colony formation assay, where significant decrease in cellular colonies was observed in compound treated groups . Chalcone 11 was apparently nontoxic to the animals as they did not show any loss of weight during experiment . Cell population with fragmented nuclei increased in a time - dependent manner with the addition of chalcone 11 . Significant increase in apoptotic cells with fragmented nuclei, which is consistent with the changes in nuclear morphology and flow cytometry analysis, indicated induction of apoptosis by chalcone 11 . Novel isoxazolyl chalcones were synthesized and evaluated for their activities in vitro against human non - small lung cancer cells (h1792, h157, a549, and calu-1). Compounds 12a and 12b (figure 6) were identified as the most potent anticancer agents with ic50 values ranging from 1.35 to 2.07 m and from 7.27 to 11.07 m against h175, a549, and calu-1 cell lines, respectively . The structure - activity relationship study showed that compounds bearing electron withdrawing groups (ewg) at the 2-position of the phenyl ring in aryl group were more effective . Compounds 12a and 12b increased the percentage of cell in sub - g0 phase and decreased the percentage of cell in g0/g1 phase . These results suggested that 12a and 12b induced apoptosis in a549 cells in a dose - dependent manner . They have upregulated the dr5 in a dose - dependent manner which suggests the extrinsic pathways of apoptosis . Cleaved bands of caspase-8, caspase-9, caspase-3, and poly (adp - ribose) polymerase (parp) also indicated the induction of apoptosis . Imine derivatives of hybrid chalcone analogues 13a, 13b, 13c, and 13d (figure 6) containing anthraquinone scaffold were synthesized and evaluated for their in vitro cytotoxic activity against hela, ls174, and a549 cancer cells . Compound 13c with furan ring linked to imino group showed potent activity against all target cells with ic50 values ranging from 1.76 to 6.11 m, which are comparable to cisplatin . Generally, introduction of electron withdrawing substituents such as -cl and -cf3 in metaposition of the phenyl ring was found to exert good cytotoxicity . Compounds did not have tendency to significantly accumulate the cells in sub - g1 phase, except compound 13a, which led to an increase in sub - g1 (observed only in cells undergoing apoptosis) phase in a549 cells as well as changes in g2/m arrest of a549 and ls174 cells . Compounds induced the activities of caspase-3 and caspase-8 in treated hela cells and exhibited strong antiangiogenic activity by showing potent inhibitory potential against matrix metalloproteinases (mmp-2) secretion . Strong implication of mmp-2 is found in angiogenesis and promotes tumor metastatic potential playing crucial role not only in invasion but also in determination of cancer cell transformation, growth, apoptosis, and signal transduction pathways . 3-phenylquinolinylchalcone derivatives, 14 and 15 (figure 6), were synthesized and evaluated for their antiproliferative activities . Compound 14 was active against the growth of non - small cell lung cancer cells h1299 and skbr-3 breast cancer cells with ic50 values of 1.41 and 0.70 m, respectively, which was more active than the positive topotecan (ic50 values of 6.02 and 8.91 m, resp . ). Compound 15 exhibited an ic50 value of less than 0.10 m against the growth of mda - mb231 in a dose- and time - dependent manner and was noncytotoxic to the normal mammary epithelial cell (h184b5f5/m10). The proportion of cells was decreased in g1 and accumulated in g2/m phase after 24 h treatment of compound 15, while the hypodiploid (sub - g0/g1 phase) cells increased . Compound 15 caused activation of caspase-3, cleavage of parp, and consequently the cell death . Caspase-3 is an executioner caspase whose activation leads to the cleavage of key cellular proteins including dna repair enzyme poly (adp - ribose) polymerase which is involved in dna repair predominantly in response to environmental stress and is important for the maintenance of cell viability . -cyano bis(indolyl)chalcone 16 (figure 6) was found to be the most potent and selective against a549 lung cancer cell line (ic50 = 0.8 m) in vitro which is time - dependent . The activity is due to the presence of methoxy and fluoro substituents on indole rings . It was found to enhance tubulin polymerization suggesting the activity as microtubule stabilizing agents, though it was a preliminary study . Nf-b pathway has been shown to be critical to survival of lung cancer cells, and many natural products obtained from plants were found to inhibit the activation of this pathway . Two cardamonin analogs, 4,4-dihydroxylchalcone, 17, and 4,4-dihydroxy-2-methoxychalcone, 18 (figure 6), were found to suppress the activation of nf-b pathway in lung cancer cells . Compound 17 inhibited the survival of primary lung cancer cells with ic50 values of 0.44 0.05 and 0.16 0.03 m, respectively, against two lung cancer cells tested . Compound 18 inhibited their survival with similar ic50 values (0.56 0.12 m and 0.65 1.36 m). Immunoblot analysis displayed that caspase-3 and parp were both cleaved in the two lung cancer cell lines treated with compounds 17 and 18, indicating the activation of apoptotic pathway . Subsequent estimation of the phosphorylation level of ikk, nf-b pathway stimulating kinase, by immunoblotting assay demonstrated that both decreased ikk phosphorylation in lung cancer cell lines including a549, nci - h460, and nci - h1668 and lead to the accumulation of ib and ib and the export of nuclear p65 transcription factor . From the immunofluorescent staining, it was shown that transcription factor p65, which is a downstream effect of nf-b pathway, was sequestered in the cytoplasm of a549 cells treated by compound 17 or compound 18 . Incorporation of luciferase reporter system also results in transcription activity of nf-b in lung cancer cells treated with compound 17 or compound 18 and demonstrated that relative luciferase expression was significantly reduced in compound 17 or compound 18 treated lung cancer cells . In addition, the transcription of target genes of nf-b pathway, bcl-2, and survivin was found to be suppressed in lung cancer cells treated with the two compounds . . Higher concentration of the two compounds greatly inhibited the growth of tumors by 71.0 and 79.1%, respectively, although inhibitory effect was not significant at lower concentration . Compared with compound 17, compound 18 appeared to be slightly more potent to retard the growth of established tumors . -carboline based chalcones were synthesized and evaluated for their cytotoxic activity against a panel of human cancer cell lines . Compounds 19a and 19b (figure 6) showed very good antiproliferative activity against breast cancer cell line (mcf-7), where ic50 values were recorded at 2.25 m and 3.29 m, respectively . Furthermore, compound 19a markedly induced dna fragmentation and apoptosis in breast cancer cells, which is an essential step in the cells undergoing apoptosis . The molecular mechanism to induce apoptosis in human hepatoma smmc-7721 cells was investigated by using 2,4-dihydroxy-6-methoxy-3,5-dimethylchalcone, 20 (figure 7), isolated from the buds of cleistocalyx operculatus . Compound 20 induced apoptosis via a mitochondria dependent pathway involving inhibition of bcl-2 expression leading to disintegration of the outer mitochondrial membrane . Further downstream of the apoptosis cascade, compound 20, increases caspase-3 and caspase-9 activities . Angiogenesis and invasion are two highly interconnected events in cancerous cells where involvement of multiple molecules and pathways takes place . Hypoxia inducible factor-1 (hif-1) has been identified as an important protein involved in those events . Activated hif-1 controls the expression of genes involved in tumor cell immortalization, stem cell maintenance, metabolic reprogramming, autocrine growth, and treatment failure, thereby making it an important target for the development of new antitumor therapy . A novel series of chalcone derivatives were synthesized and their biological activities against hif-1 were evaluated by wang et al . It has been found that compound 21 (figure 7) exhibited inhibitory effects on hif-1 at 10 m concentration by downregulating the expression of hif-1 and hif-1 under hypoxic conditions . The hif inhibition rate has been found to be 83.0 16.9%, while topotecan, hif-1 inhibitor, was used as control and for comparison it has the inhibition rate of 82.8 2.9% . In addition, compound 21 displayed inhibitive effect against the migration and the invasion of hep3b (human liver cancer cell line) and human umbilical vein endothelial cells (huvec) and tube formation of huvecs and significant antiangiogenic and anti - invasive activities . From the in vivo study it has been found that 21 could retard tumor growth of hep3b xenograft models and reduced cd31 and mmp-2 expression in tumor tissues . Cd31 (cluster of differentiation 31) is platelet endothelial cell adhesion molecule (pecam-1), which is a protein found to be expressed in certain tumors . Compound 27 was well tolerated and was found to be nontoxic up to 200 mg / kg in swiss mice in acute intravenous toxicity . The molecular mechanisms of growth inhibition in human bladder cancer cell lines t24 and ht-1376 by chalcone 22 (figure 8) are due to the induction of apoptosis, cell cycle progression inhibition by regulating cell cycle related factor like significant reduction in the expression of cyclin a and cyclin b1, decreases in the expression of cdc2, and also increases in the expression of p21 and p27 . So, chalcone may cause cell cycle arrest by reducing the complex of cdc2/cyclin b due to downregulation of multiple g2/m regulating proteins . It triggers the mitochondrial apoptotic pathway by releasing cytochrome c from the cytoplasm with an increase in caspase-9 and activating caspase-3 . It is also increases the expression of proapoptotic proteins bax and bak, which are responsible for the initiation of mitochondrial apoptotic pathway, and decreases the expression of antiapoptotic proteins bcl-2 and bcl - xl, while overexpression of bcl-2 and bcl - xl is associated with enhanced oncogenic potential . Chalcone inhibits the nf-b activation by increasing the expression of ib in cytoplasm, leading to apoptosis . The copper chelate complex 23 (figure 8) showed promising activity with ic50 value of 5.95 m against pc3 cancer cell line in vitro . The estimated ic50 value for doxorubicin was 8.7 m, which was used as positive control . It was found that cancer cells have high affinity to copper ions; thus, upon chelation of chalcones with copper they are thought to be more liable to target cancer cells in microdendron architecture . It was assumed that copper ions might act as penetration enhancers of chalcones into cancer cells . Even if copper ions are noncytotoxic to cancer cells, they might act as inhibitors of drug efflux proteins characteristic to cancer cells . Drug efflux proteins, such as p - glycoproteins (pgp), breast cancer resistance protein (bcrp), and multidrug resistance - associated protein 1 (mrp1), are responsible for drug resistance of cancer cells . The high cytotoxic activity is attributed to the presence of the p - methylphenyl moiety of ring b and the copper ion . Hybrids of n-4-piperazinyl - ciprofloxacin - chalcone were prepared by abdel - aziz et al . National cancer institute (nci) selected 5 compounds, namely, 24a, 24b, 24c, 24d, and 24e (figure 9), to carry out in vitro one - dose anticancer assay against full nci 60 cell lines derived from leukemia, lungs, colon, renal, melanoma, cns, prostate, ovarian, and breast cancer cell lines . Of the selected compounds, 24a and 24d exhibited the highest ability to inhibit the proliferation of different cancer cell lines while undergoing one - dose anticancer test . Among the nine tumor subpanels tested for, compound 24a was found to have broad - spectrum antitumor activity with selectivity ratios ranging between 0.42 and 1.87 at the gi50 level without producing selectivity, while compound 24d showed high selectivity towards the leukemia subpanel with selectivity ratio of 6.71 at gi50 level . Moreover compound 24d showed remarkable anticancer activity against most of the tested cell lines with gi50 ranging from 0.21 to 57.6 m . Furthermore, compounds 24c and 24e have shown remarkable topo - ii inhibitory activity compared to etoposide at 100 m and 20 m concentrations . Compounds 24c and 24e were found to be potent topo - i inhibitors at 20 m concentration when compared to camptothecin . The results that were obtained indicated that introduction of n-4-piperazinyl moiety of ciprofloxacin into the chalcones derivatives dramatically increases the anticancer activity of the tested compounds severalfold higher than that of the activity shown by weak anticancer ciprofloxacin . Increase in antiproliferative activity of the tested compounds might be the result of either synergistic effect of the chalcone derivatives and/or alteration of the physicochemical properties of ciprofloxacin . To determine the dna unwinding properties of 24c and 24e, amsacrine (m - amsa), a well - known dna intercalator, was chosen as a standard where a supercoiled phot1 dna was used as a substrate since unwinding of the double strand of dna helix is a practical characteristic of intercalating drugs . Amsacrine blocked unwinding of phot1 dna in the presence of excess topo - i in dose - dependent manner, while compounds 24c and 24e did not block dna unwinding at high concentration up to 1000 m treatment . The assay indicated that 24c and 24e do not interact with dna but interact with topoisomerases for their inhibitory activity . Compound 25 (figure 9) with a propionyloxy group at the 4-position of the left phenyl ring showed the most potent inhibition activity which inhibited the growth of hepg2, a549, a375, smmc-7221, and k562 cancer cell lines with ic50 values of 0.15, 0.36, 0.62, 0.61, and 0.52 m, respectively . Compound 25 was also shown to arrest cells in the g2/m phase of the cell cycle and inhibit the polymerization of tubulin . Molecular docking study suggested that compound 25 binds into the colchicine binding site of tubulin . In summary, these findings suggest that compound 23 is a promising new antimitotic compound for the potential treatment of cancer . A new series of pyrano chalcone derivatives containing indole moiety synthesized by wang et al . (2014) were evaluated for antiproliferative activities . Among those, compound 26 (figure 9), with a propionyloxy group at the 4-position of the phenyl ring a and n - methyl-5-indolyl on the b ring displayed the most potent cytotoxic activity against all tested cancer cell lines including multidrug resistant phenotype, which inhibits cancer cell growth with ic50 values ranging from 0.22 to 1.80 m . The tested cell lines were smmc-7221, hepg2 (liver), pc-3 (prostate), a549 (lung), k562 (leukemia), hct116 (colon), skov3 (ovarian), mcf-7 (breast), vincristine resistant hct-8 (hct-8/v), and taxol resistant hct-8 (hct-8/t). Compound 26 was the most potent towards hepg2 cells with ic50 value of 0.22 m . Colchicine (2.5 m) and paclitaxel (2.5 m) were used as a reference . Compound 26 produced cytotoxic activity in normal human liver cell line (lo2) above the concentration of 10 m . It significantly induced cell cycle arrest in g2/m phase and inhibited the polymerization of tubulin . It was also shown from molecular docking analysis that compound 26 binds at the colchicine binding site of tubulin . Chalcone 26 also exerted potent anticancer activity in hepg2 xenografts in balb / c nude mice, where the growth of tumors in mice treated with chalcone 26 (30 mg / kg) was reduced by 56.58% compared with that in control mice treated with vehicle only at day 35 . Positive control reduced the growth of tumors by 25.93% . Cell division cycle 25 (cdc25), which includes cdc25a, b, and c homologues, a subfamily of dual - specificity protein tyrosine phosphatases, plays a role in the regulation of the cell cycle . The cdc25a and cdc25b isoforms are overexpressed in primary tissue samples from various human cancers, which is strongly associated with tumor aggressiveness and poor prognosis . Cdc25b controls cell cycle progression by catalyzing removal of covalently attached contiguous phosphates and the subsequent activation of cyclin - dependent kinase 1 (cdk1). Cdc25b overexpression has been documented in a variety of human cancers, including head and neck and colon, and non - small cell lung cancer validates its oncogenic potential . A series of 2-hydroxy-4-isoprenyloxychalcone derivatives were evaluated for the inhibition of cdc25b activity by zhang et al . (2014). Among those, two compounds, 27 and 28 (figure 9), have been found to have the potent inhibition activity and significantly inhibited cdc25b with inhibition rates of 99.95% and 99.75%, respectively, at a dose of 20 g / ml, which is similar to the known tyrosine phosphatase inhibitor sodium orthovanadate . In vitro cytotoxic activity assays showed that compounds 27 and 28 were potent against hct116, hela, and a549 cells . They were particularly cytotoxic against colon hct116 cancer cell line with ic50 values of 0.89 and 1.76 irinotecan (ic50 = 2.14 mol / l), a clinically relevant camptothecin, was chosen as a reference drug . In colo205 xenograft balb / c nude male mice, compound 27 produced a tumor volume inhibition of about 50% . A new series of pyrazole chalcones were screened for the in vitro anticancer activities against mcf-7 (human breast adenocarcinoma) and hela (human cervical tumor cells) cell lines . Compound 29 (figure 9) showed the highest inhibition in human mcf-7 and hela cell lines with an ic50 value of 0.018 g / ml and 0.047 g / ml, respectively . The ic50 for standard doxorubicin in hela and mcf-7 cells was 1.15 g / ml and 1.84 g / ml, respectively . New prenylated chalcone, 30 (figure 9), named as renifolin c, was isolated from whole desmodium renifolium plants and cytotoxicity was evaluated against five human tumor cell lines (nb4, a549, shsy5y, pc3, and mcf7) using the mtt method, using paclitaxel as a positive control . The ic50 values were 6.4 m and 8.5 m against nb4 and pc3 cell lines and above 10 m for the other cell line tested . Various benzylidene pregnenolones were synthesized and in vitro cytotoxicity studies were performed by banday et al . Compounds 31a and 31b (figure 9) were found to be active against the hct-15 (colon) and mcf-7 (breast) cell lines . Chalcone 31a has ic50 value of 1.02 m and 0.79 m, respectively, against hct-15 and mcf-7, while 31b has 0.81 m and 1 m, respectively . Chalcone - coumarin hybrid 33 (figure 10) (ic50 = 0.53 m) displayed cytotoxicity against human lymphoblastic leukemia cell line (molt-3), where etoposide (ic50 = 0.05 m) was taken as a standard . Compounds 32 and 33 shown in figure 10 displayed higher cytotoxic potency against hepg2 cells than the control drug, etoposide . The hybrid 33 (ic50 = 4.26 m) was potent but was found to be toxic toward noncancerous african green monkey kidney cell line (vero). Though analog 32 displayed cytotoxic activity against hepg2 with ic50 value of 8.18 m, it was found to be nontoxic against vero cells . It has been shown from molecular docking study that compounds could snugly occupy the colchicine binding site of -tubulin . (2013). Among them, potent chalcone 34 (figure 10) induced apoptotic cell death of a wide variety of tumor cell lines including multidrug resistant human tumor cell lines in the nanomolar range by attacking microtubules . Flow cytometric study showed that chalcone 34 significantly induced cell cycle arrest in g2/m phase at 0.2 m concentration . In vitro immunofluorescence staining and tubulin polymerization assay displayed that chalcone 34 promoted tubulin polymerization into microtubules and caused microtubule stabilization similar to paclitaxel, which is suggesting that chalcone 34 is a microtubule stabilizer via enhancing the rate of tubulin polymerization . Then, in in vivo study, 34 exhibited potent inhibitory activities in human hepg2 xenograft tumor models . Chalcone derivatives, named parasiticins c, 35 and 36 (figure 10), were isolated from the leaves of cyclosorus parasiticus . The in vitro cytotoxic activities were evaluated against lung cancer a549, hepatocellular carcinoma hepg2, breast cancer mcf-7 and mda - mb-231, leukemia all - sil, and pancreatic cancer sw1990 . Compounds 35 and 36 exhibited substantial cytotoxicity against all six cell lines, especially toward hepg2 with the ic50 values of 1.60 and 2.82 m, respectively, which is comparable to the doxorubicin positive control (1.19 m). They induced apoptosis in the hepg2 cell line . In the clonogenicity assay on hepg2 cell line, capacity of single cancer cells to generate colonies compound 35 showed more potent cytotoxicity than 36, suggesting that the presence of an additional lactone ring fused enhances the cytotoxic activity . A fission yeast, schizosaccharomyces pombe, was utilized in bioassay guided screening on several plant extracts to search for anticancer agents by snchez - pic et al . It was found that an extract from leaves of corema album belonging to family ericaceae had antiproliferative activity . 2,4-dihydroxychalcone, 37 (figure 11), the promising cytotoxic compound, was found in this extract and cytotoxic activity is likely due to its ability to induce dna damage which blocks cell cycle progression at the g2/m transition in a concentration of 8 m to 20 m . Compound 37 could induce dna damage or interfere with dna replication, which would eventually result in the activation of the cell cycle checkpoints, thus blocking cell cycle in g2 . In subsequent study, deletions of rad3, chk1, and cds1, three key kinases required for dna checkpoints operating at g2/m, were done . Rad3 is required in order to signal downstream of either dna replication problems or dna damage, whereas chk1 transmits dna damage - induced signals and cds1 signals in response to defective dna replication . It was found that both rad3 and chk1 deletions suppressed the cell cycle block produced by compound 37, while cds1 deletion showed partial suppression, suggesting that the g2/m block observed in compound 37 is mostly caused by the activation of dna damage checkpoint response . Methyl methanesulfonate (mms), an alkylating compound that induces dna damage, was used as control . Thus, compound 37 (820 m) directly or indirectly causes damage to the dna which results in a rad3-dependent and chk1-dependent cell cycle block at the g2/m transition . Cathepsins have emerged as a potential target for chemoprevention and anticancer therapy . Increased levels of cathepsin b and cathepsin h in a variety of tumors have shown their contribution towards invasion and metastasis . Molecule 38 (figure 12) has been found to be potent among the synthesized inhibitors, which inhibits cathepsin b and h. the ki (inhibition constant) value against cathepsin b was 6.18 10 m and 2.8 10 m for cathepsin h. the inhibition was of competitive type . 2-hydroxychalcones have been evaluated as potential inhibitors to these cysteine proteases probably due to presence of,-unsaturated carbonyl moiety in the molecule . -ch2sh moiety present at the active site of enzymes can interact with the electron deficient center present in the chalcones inhibiting the enzymes activity . Nitrosubstitution is useful for an effective interaction with cathepsins b and h. its inhibition to cathepsin b as compared with cathepsin h indicates that cathepsin b's active site is more susceptible to these compounds as compared to cathepsin h. the results were also found to be consistent when compared with in silico docking studies . Cotreatment with a chemosensitizer such as compounds 39a and 39b (figure 13) and trail was found to be more efficient to treat gbm (glioblastoma multiforme) than treatment with trail alone . Gbm is one of the most aggressive forms of human malignant brain tumors, characterized by rapid growth, extensive invasiveness, and robust neoangiogenesis . Against human crt - mg astroglioma cells by using the lactate dehydrogenase (ldh) release assay, it was found that compounds 39a and 39b with trail (25 ng / ml) showed good cytotoxicity . 2-ethylamino and substituted triazole groups are promising templates in the backbone of chalcone to develop trail sensitizers as anticancer agents . Mdr (multidrug resistance) can be defined as the ability of cancer cells to survive exposure to different chemotherapeutic agents and is a major cause of treatment failure in human cancers . 4-hydroxy-2,6-dimethoxychalcone, 40 (figure 14), was isolated from polygonum limbatum with ic50 values of 2.54 m against multidrug resistant cem / adr5000 leukemia cells . P - glycoprotein - expressing and multidrug resistant cem / adr5000 cells were much more sensitive toward compound 40 than doxorubicin (ic50 = 195.12 m), which is a reference drug . Compound 40 (figure 14) has been found to arrest the cell cycle between g0/g1 phases, which is via the strong induction of apoptosis by disrupting mitochondrial membrane potential (mmp) and an increased production of reactive oxygen species (ros) in the studied leukemia cell line . It was found that caspases were not involved in the apoptotic pathway induced by compound 40 . The presence of hydroxyl (-oh) and methoxy (-och3) substituents influences the activity of compound 40 . The membrane transporter p - glycoprotein (p - gp), encoded by mdr1 gene, is the main mechanism responsible for resulting in decreased intracellular drug accumulation in human mdr cancers . Mitogen activated protein (map) kinase pathway is involved in p - gp - mediated mdr . Dimer of chalcone named as tomoroside b, 41 (figure 14), was isolated from the aerial parts of helichrysum zivojinii . The combined effects of chalcone dimer 41 and tipifarnib (the inhibitor of map kinase signaling cascade, a farnesyltransferase inhibitor) in mdr cancer cell line, nci - h460/r, were found . These results point to the ability of compound 41 to enhance tipifarnib efficacy in mdr cancer cells as it reduced the ic50 for tipifarnib from 9.0 m (applied alone) to 3.8 m . Activity was compared to tipifarnib employing human sensitive non - small cell carcinoma cell line nci - h460 (ic50 = 198 m for compound 41 alone), its multidrug resistant (mdr) counterpart nci - h460/r (ic50 = 172 m for compound 41 alone), and spontaneously immortalized normal human keratinocyte cell line hacat . The concentration around 100 m of compound 41 significantly inhibited the growth of normal hacat cells, considering that hacat are normal, but transformed cells with immortalized phenotype; these results point to the potential of compound 41 to exert the cancer preventive effects . Compound 41 increased the expression of hif-1, probably by exerting antioxidant and redox status modulator effect . Compound 41 increased the expression of hif-1 and acted synergistically with tipifarnib probably by inhibiting the map kinase prosurvival signaling . To identify potent anticancer agents against the cisplatin - resistant human ovarian cancer cell line the two most active compounds were 42 (gi50 = 3.87 m) and 43 (gi50 = 3.95 m) (figure 14). It was found that compounds 42 and 43 trigger cell cycle arrest at the g2/m phase and apoptotic cell death in a2780/cis cancer cells . Aurora a kinase is known to be involved in cell cycle arrest at the g2/m phase . In vitro aurora a kinase assay of compound 42 showed the half - maximal inhibitory concentration (ic50) of 66.4 m . Because aurora a kinase may not be a real molecular target of compound 42, gi50 value of compound 42 is higher than the ic50 value of 42 . Chalcone architecture linked with various substitutions, such as methoxy, amino, and hydroxyl, and alteration of both rings has been found to be effective in making it a potential candidate in the anticancer armamentarium . The related studies showed excellent cytotoxic activities of chalcones in the different cell death pathways, not just acting in blocking the process of cell division . Inhibitory concentrations in nanomolar range were impressive to show its ability to arrest cell division . Furthermore, besides preclinical study, clinical study of chalcone may yield the development of research in this field . It is expected that this review may give the medicinal chemists a basis to get in touch with the recent updates and will be helpful for enrichment in this field.
|
The subjects of this comparative study were primary and preschool aged children (6 - 9 year - old) selected from the 1st and 2nd educational district of yazd, southeast iran . For sampling, the list of children with the above conditions was prepared . In the next step, for muster of comparison group, 30 children were selected with a stratified random method; and for muster of experimental group, 30 children who referred to the imam hosein clinic, and were diagnosed as having adhd by a psychiatrist during 2011 - 2012 were selected . All of the participants in experimental group were interviewed clinically by a psychologist . Further, in order to diagnose adhd, and their parents and teachers were asked to complete the child symptom inventory-4 (csi-4). Children in both groups were matched with respect to age, sex, and school . Children in the comparison group were selected from the same class as the experimental group . We included all boys and girls with adhd who had all the three types of this disorder which included mainly inattentive type, mainly hyperactive- impulsive type and combined type in the experimental group . The comparison group consisted of children who did not have any history of psychiatric disorder according to the diagnostic and statistical manual of mental disorders (dsm - iv) axis i and ii . We also included children who wore glasses . The exclusion criteria were color blindness, diagnosis of a physical or mental disorder, or drug consumption . Children who had been previously diagnosed with adhd and were on medication were also excluded from the study because of the drug's effect on their attentiveness and ultimately on their iconic memory . The csi is a common screening tool for psychiatric disorders; and its items are written based on the diagnostic criteria of dsm - iv . This inventory includes the symptoms of 21 behavioral and emotional disorders such as adhd (14). The fourth edition of this inventory (csi-4), like the previous versions, has a teacher and parent checklist . The parent checklist consists of 112 items including 41 items (group a, b, and c) related to destructive behavior and attention deficit . The teacher checklist has 79 items, 35 of which (a, b, and c) are related to destructive behavior and attention deficit disorders . Group a consists of 18 items and is similar in both parent and teacher checklists . The csi-4 is scored either by criterion - related cut - off scores or by norm - based cut - off scores for determining symptom severity . In most studies as well as ours, criterion - related cut - off scores are used because of higher reliability and efficiency . In this method, a score of zero is given to items rated as never and seldom, and one to items rated as sometimes and often (14). The cutoff point score for diagnosing adhd based on the csi-4 was 6 for both the mainly attention deficit (questions 1 - 9) and the mainly hyperactive - impulsive (questions 10 - 18) types . These scores are summed up for the diagnosis of adhd (14). In a study conducted in iran, the retest reliability of the parent and teacher checklists of the csi-4 was reported to be 0.90 and 0.96, respectively . Moreover, kalantari and colleagues (2006) also reported a reliability of 0.91 and 0.85 for the parent and teacher checklists, respectively (14). With respect to face validity, the items of this questionnaire were compiled based on the criteria of csi-4, whose reliability had been previously assessed by the american psychiatric association . Shariatzadeh (2007) assessed the reliability of this inventory using a cronbach's alpha of 0.92 and a sensitivity of 0.94 (14). This test was designed for testing iconic memory and adapted from a test initially introduced by sperling and averbach in 1961 for testing iconic memory in healthy individuals . In this test, a 22 matrix is presented to the participants . Since this test has been designed for children, instead of alphabets used in sperling and averbach's test (1961), images of an object, which are easily identifiable for 6 - 9 year - old children, are presented in each box . Twelve images were shown to twenty 6-year - old children, and 4 images that were nearly identifiable by all children were selected for the test, assuming that the images that can be identified by 6-year - olds would also be easily identified by 9-year - olds . In general, the iconic memory test consists of two blocks each containing 20 test trials and 90 experimental trials . For the experimental trials, the durations were 50, 100, and 300 ms for the first 30, second 30, and third 30 trials, respectively . The size of the whole matrix was 1280800 pixels and the size of each cell was 320266 pixels . In the first block, then, by bringing a random arrow next to each row, the participant was asked to name the objects in that row aloud . In the second block, after presenting the matrix in each trial, an empty matrix was shown . In order to determine the row in which the participants should name the objects, two different sounds were used (top row: high - pitched sound, bottom row: low - pitched sound). Based on sperling and colleagues report (1961), the iconic memory test was scored as follows: the number of right answers in the marked row divided by the total number of presentations in that row . Sperling and colleagues (1961) found that healthy individuals had an iconic memory score more than 0.75 . In this scoring system the number of correct answers in each marked row could also be considered as the iconic memory score . Here, the highest score is equivalent to the number of cells in each row (15). Our test score was equal to the number of right answers in the marked row . Therefore, the highest score would be 2 and the lowest 0 . In order to assess the reliability of this test, it was done twice for 25 children aged 6 - 9 years (12 girls and 13 boys) with a one - week interval, and the correlation coefficient between the two presentations was calculated . The total reliability of the test was 0.92, with a reliability of 0.88 for the visual section and 0.87 for the auditory section . Mean and standard deviations were computed for descriptive data . Since several repeating experimental forms were used for each participant in this study, repeated measure anova was used . The csi is a common screening tool for psychiatric disorders; and its items are written based on the diagnostic criteria of dsm - iv . This inventory includes the symptoms of 21 behavioral and emotional disorders such as adhd (14). The fourth edition of this inventory (csi-4), like the previous versions, has a teacher and parent checklist . The parent checklist consists of 112 items including 41 items (group a, b, and c) related to destructive behavior and attention deficit . The teacher checklist has 79 items, 35 of which (a, b, and c) are related to destructive behavior and attention deficit disorders . Group a consists of 18 items and is similar in both parent and teacher checklists . The csi-4 is scored either by criterion - related cut - off scores or by norm - based cut - off scores for determining symptom severity . In most studies as well as ours, criterion - related cut - off scores are used because of higher reliability and efficiency . In this method, a score of zero is given to items rated as never and seldom, and one to items rated as sometimes and often (14). The cutoff point score for diagnosing adhd based on the csi-4 was 6 for both the mainly attention deficit (questions 1 - 9) and the mainly hyperactive - impulsive (questions 10 - 18) types . These scores are summed up for the diagnosis of adhd (14). In a study conducted in iran, the retest reliability of the parent and teacher checklists of the csi-4 was reported to be 0.90 and 0.96, respectively . Moreover, kalantari and colleagues (2006) also reported a reliability of 0.91 and 0.85 for the parent and teacher checklists, respectively (14). With respect to face validity, the items of this questionnaire were compiled based on the criteria of csi-4, whose reliability had been previously assessed by the american psychiatric association . Shariatzadeh (2007) assessed the reliability of this inventory using a cronbach's alpha of 0.92 and a sensitivity of 0.94 (14). This test was designed for testing iconic memory and adapted from a test initially introduced by sperling and averbach in 1961 for testing iconic memory in healthy individuals . In this test, a 22 matrix is presented to the participants . Since this test has been designed for children, instead of alphabets used in sperling and averbach's test (1961), images of an object, which are easily identifiable for 6 - 9 year - old children, are presented in each box . Twelve images were shown to twenty 6-year - old children, and 4 images that were nearly identifiable by all children were selected for the test, assuming that the images that can be identified by 6-year - olds would also be easily identified by 9-year - olds . In general, the iconic memory test consists of two blocks each containing 20 test trials and 90 experimental trials . For the experimental trials, the durations were 50, 100, and 300 ms for the first 30, second 30, and third 30 trials, respectively . The size of the whole matrix was 1280800 pixels and the size of each cell was 320266 pixels . In the first block, then, by bringing a random arrow next to each row, the participant was asked to name the objects in that row aloud . In the second block, after presenting the matrix in each trial, an empty matrix was shown . In order to determine the row in which the participants should name the objects, two different sounds were used (top row: high - pitched sound, bottom row: low - pitched sound). Based on sperling and colleagues report (1961), the iconic memory test was scored as follows: the number of right answers in the marked row divided by the total number of presentations in that row . Sperling and colleagues (1961) found that healthy individuals had an iconic memory score more than 0.75 . In this scoring system the number of correct answers in each marked row could also be considered as the iconic memory score . Here, the highest score is equivalent to the number of cells in each row (15). Our test score was equal to the number of right answers in the marked row . Therefore, the highest score would be 2 and the lowest 0 . In order to assess the reliability of this test, it was done twice for 25 children aged 6 - 9 years (12 girls and 13 boys) with a one - week interval, and the correlation coefficient between the two presentations was calculated . The total reliability of the test was 0.92, with a reliability of 0.88 for the visual section and 0.87 for the auditory section . Standard deviations were computed for descriptive data . Since several repeating experimental forms were used for each participant in this study, repeated measure anova was used . The mean age of the participants in both groups was 7.60.99 (range: 6 - 9) years (table 1). Thirty seven (61.7%) children in both groups were the first child of their family (table 2). Most of the fathers (35%) and mothers (50%) had a diploma or associate degree (table 2). Age distribution in the experimental and comparison groups frequency of some demographic variables in the experimental and comparison groups the performance of children in both groups differed significantly at the different types of symbols and durations of stimulation (table 3). Repeated measure anova for type of symbols and durations of stimulation based on the iconic memory test, the mean score of adhd children was significantly lower than that of children without adhd (27.611.41 vs. 38.411.41 (p <0.001). Moreover, the performance of the experimental group differed significantly when the duration of the presentation differed from 50 ms to 100 ms as compared with the comparision group (p <0.001). The number of correct answers increased in the experimental group as the duration of presentation increased . However, children with adhd scored less than children without adhd at 50 ms (25.361.47 vs. 37.461.47) as well as 100 ms (29.861.45 vs. 39.361.45). Therefore, by increasing the duration of stimulation, the performance of the children with adhd could be improved . We also found no significant difference in the performance of children with adhd with respect to the type of symbols (visual or auditory) when we calculated the average duration of presenting the stimulants . The meansd scores of visual and auditory symbols were 27.481.36 and 27.751.67, respectively (p the corresponding figures for stimulation duration of 100 ms were 28.561.43 and 31.161.74, respectively . The duration of presentation had a significant effect on the performance of children with adhd, regardless of the type of presentation . The mean scores of the children with adhd increased as the duration of the presentation increased from 50 ms (25.361.46) to 100 ms (29.861.43) to 300 ms (31.501.62) (p <0.001). Meansd scores of visual and auditory symbols at different durations of stimulation we found a non - linear relationship between the two different groups with respect to the number of correct answers at different durations of stimulation . Repeated measure anova was performed in order to determine which type of symbol (visual or auditory) creates this relationship . We found that the group - time interaction existed between auditory symbols (table 5). As the duration of stimulation increased from 50 ms to 100 ms, the number of correct answers had a higher increase in the experimental group compared with the comparison group . However, although the performance of children with adhd improved at stimulation duration of 300 ms and had a slight increase, the scores of children without adhd had a considerable increase at the mentioned time . Meansd scores of both groups with respect to group - time interactions in visual and auditory symbols a linear relationship was found between group and stimulation durations of 50 ms and 100 ms . The two groups differed in the mean scores of auditory symbols at 50 ms and 100 ms (p <0.001). We found that iconic memory (visible and informational persistence) was weaker in adhd children than children without adhd . Moreover, the performance of children with adhd is weaker when the duration of visual and auditory stimulations is shorter . We also found no significant difference in the performance of adhd children with respect to the type of symbols . Since iconic memory is a subcategory of the human memory, our findings are consistent with studies showing memory impairment in patients with adhd . Children with adhd do not process most information because of inattention (1621 and 5) or more specifically deficits in temporal resolution of visual attention (22). Therefore, they lose the time to save some information and as a result experience memory deficits . Jonsdottir and colleagues (2004) found that children with adhd do not show deficits in active memory (35). Sadeh and co - workers (1996) found no significant difference between children with and without adhd with respect to their visual memory and visual organization (36). The difference in the iconic memory of children with and without adhd can show that the iconic memory test could differentiate between the iconic memory of children with and without adhd . Moreover, age was not an effective differentiating factor between children with and without adhd . By controlling this factor, we still found a significant difference in the mean scores of the visual memory test between the case and comparison groups . Moreover, the weaker performance of children with adhd cannot be attributed to their sex or school since the children in both groups were matched with respect to these factors . On the other hand, since all the subjects had 20 test trials before the experimental trials, this weakness cannot be attributed to their lack of knowledge regarding the nature of the test . We also found that visual and informational performance (iconic memory) did not differ between the two groups with respect to both visual and auditory symbols . In contrast, kataria, wright hall, wong, & keys (1992) found that children with adhd have disorders in sensory, short - term, and long - term memory in visual and auditory symbols . They found a more significant difference in auditory symbols making them more susceptible to losing more information in auditory presentations (34). Moreover, shapiro and co - workers (1993) found that children with adhd have a weaker performance in tasks that need complex processes at the conscious level, which is inconsistent with our study (13). We only used visual and auditory symbols and the stimulants that the children identified were only visual . It can be stated that the symbols used in our study are instructions that guide children to the place where they should remember the images . It can be concluded that presenting short instructions in the form of visual or auditory symbols does not create any difference in the performance of children with adhd . As the duration of presentation increased, the performance of children with adhd significantly improved . Consistently, young and colleagues (2006) found that as the presentation time becomes shorter and the test harder, children with adhd experience higher memory impairment (26). In our study, increased test time positively improved the performance of children with adhd . The scores at 300 ms were significantly higher compared with 50 and 100 ms . Due to inattention, children with adhd experience more problems when the duration of stimulation is shorter and as time increases their performance improves because they have more time to concentrate . Children with and without adhd differed significantly with respect to auditory presentations time of 50 and 100 ms . Children with adhd had considerable differences in test scores in the two mentioned durations, while children without adhd did not show a considerable difference at the two different presentation times . This is because at longer presentation time complex auditory processing improves in children with adhd . The current study had a number of limitations, of which the following worth mentioning . Firth, in this study two groups were not matched in terms of iq and children's ability of intelligence was not assessed . Third, it would have been useful if the study evaluated other psychiatric disorders such as learning disabilities . Visual memory is weaker in children with adhd and these children perform weaker than normal children in both visual and auditory symbols at presentation durations of 50 and 100 ms . Therefore, we had to compare our results with studies on other types of memory . Moreover, since the subjects had 20 test trials before the 90 experimental trials, the results may have been affected by learning and repetition.
|
Several diseases are associated with the extracellular deposition of protein aggregates, including the alzheimer's disease, the transthyretin, and light chain amyloidoses as well as type ii diabetes . Accumulation of insoluble protein in the extracellular space results from the aberrant assembly of proteins into aggregates, usually with a quaternary structure rich in cross--sheets, known as amyloid . The causative link between the observed pathophysiology and amyloid formation is now supported by numerous genetic, biochemical, and pharmacological studies [1, 35]. More than 30 human endogenous proteins have been identified as precursors of amyloid fibrils whose deposition is associated with tissue degeneration . Although these amyloidogenic precursors share no sequence and native state structure homologies, amyloids extracted from patients share several structural, chemical, and biological features, including an extensive cross -sheet structure and the capacity to bind specific dyes, such as congo red and thioflavin t (tht). Particularly, fibrils are virtually always associated with nonfibrillar biomolecules, including the serum amyloid p component, apolipoprotein e, collagen, metals, glycosaminoglycans (gags), and various lipids . However, over the last two decades, several studies have instead highlighted that these amyloid cofactors can promote and/or modulate the amyloidogenic process . In this view, amyloid formation might not be simply a consequence of a protein misfolding event but may be more a consequence of the interaction of the amyloidogenic protein precursor with extrinsic factors and/or its (bio)chemical microenvironment . The deposition of amyloid fibrils in the islets of langerhans of patients afflicted by type ii diabetes was originally described at the beginning of last century . Over the 20th century, it was confirmed that islet hyalinization, that is, tissue degeneration into a classy translucent material, was closely associated with diabetes mellitus, particularly in elderly individuals [13, 14]. It is only in 1987 that the major component of islet amyloids was identified as a 37-residue peptide, the islet amyloid polypeptide (iapp) or amylin . As iapp is coexpressed, copackaged, and cosecreted with insulin by the pancreatic -cells, the overproduction of insulin often associated with type ii diabetes will lead to an increased release of iapp . This elevated local concentration of iapp in the islets of langerhans should, in theory, promote the formation of amyloid . Nonetheless, although iapp is expressed in nondiabetic subjects at levels higher than those required to form amyloids in vitro, iapp rarely deposits in the pancreas of normal individuals . This suggests that iapp concentration is not the critical factor contributing to its aggregation and proposes that other elements could play a determinant role in the amyloidogenic process and, accordingly, in the etiology of type ii diabetes . In this review, we will initially describe iapp structure and normal physiological functions and briefly present its proposed mechanisms of aggregation . We will mainly focus on the roles of amyloid cofactors and/or the biological environment in amyloid formation . As the role of model membranes in iapp fibrillogenesis has been previously discussed in outstanding reviews [2023], the present paper will mainly put an emphasis on other factors, such as gags and metals . Finally, we will discuss the potential roles of amyloid cofactors in -cells degeneration associated with iapp aggregation and amyloid deposition . Characterization of the peptide isolated from human islet amyloids led to the identification of a c--amidated 37-residue peptide . Iapp is expressed as an 89-residue polypeptide, called preproiapp, containing a 22-residue signal peptide that is cleaved off in the reticulum endoplasmic to form proiapp . Subsequent posttranslational modifications of proiapp involving the action of prohormone convertase (pc) enzymes and carboxypeptidase e (cpe) lead to the formation of a c--amidated, cyclized, and biologically active peptide . The primary structure of iapp has been determined in several mammalian species, including monkey, dog, mouse, and rat (figure 1(a)). The n- and c - terminal regions of iapp have been well conserved in all mammalian species, whereas the central 2129 domain is more variable and shows important interspecies variations . Particularly, iapp sequences found in mice and rat contain pro residues at positions 25, 28, and 29 whereas the human sequence encompasses ala, ser, and ser, respectively . This variation is significant for the amyloidogenesis process, as rat (riapp) and mice (miapp) peptide are less prone to aggregation and these two species do not form islet amyloids . In solution, human iapp (hiapp) exhibits a conformational ensemble mainly populated by disordered conformations, although it diverges from an absolute random coil by the presence of local and transient ordered structures . For instance, the segment 519 of riapp, which exhibits a high homology with hiapp, appears to transiently populate -helix in its monomeric form [28, 29]. Besides, from molecular dynamics simulations, it was reported that hiapp monomers could form ordered and extended -hairpins . In presence of lipid membrane models or organic solvent, such as hexafluoroisopropanol (hfip), hiapp readily adopts an -helical conformation (figure 1(b)). For example, in dodecylphosphocholine (dpc) micelles, riapp exhibits a structure characterized by a single helical region spanning from residues ala-5 to ser-23 followed by a disordered c - terminal domain . When incubated with sodium dodecyl sulfate (sds) micelles, hiapp forms, instead, two -helical segments spanning from residues ala-7 to val-17 and asn-21 to ser-28 and a short 310 helix from gly-33 to asn-35 . Both rat and human 119 iapp fragments show a helical conformation in dpc micelles, although they adopt different orientation on the micelle surface . Iapp is a member of the calcitonin peptide family, which includes calcitonin, calcitonin - gene - related peptides (cgrps), and adrenomedullin . These peptide hormones mediate their biological activities by binding and activating class b g protein - coupled receptors (gpcrs). Interestingly, no specific gpcr per se for iapp has been identified so far . Instead, iapp shares the calcitonin receptor (ct) with calcitonin, although it binds to ct with a relatively low affinity . The function, pharmacology, and selectivity of the ct receptor are altered by its association with receptor activity - modifying proteins (ramps). Ramps constitute a family of single transmembrane proteins with 3 members: ramp1, ramp2, and ramp3 . Association of the ct receptor with ramp1 or ramp3 changes the selectivity of the receptor and increases significantly the affinity for iapp . Iapp specific binding sites were initially identified in the brain and the renal cortex and have now been identified in several peripheral tissues . Under normal physiological conditions, iapp is cosecreted with insulin from -pancreatic cells in response to an elevated blood glucose concentration . In skeletal muscles, iapp inhibits basal and insulin - stimulated glycogen synthesis, resulting in an increase of glucose-6-phosphate level . Studies have also shown that iapp suppresses glucagon secretion, decreases gastric emptying, and induces satiety [25, 39, 40]. Iapp may also be involved in the process of tissues calcification and could play a critical role in the inhibition of bone resorption . Like other members of the calcitonin family, iapp is a potent vasodilator and causes systemic hypotension and tachycardia [25, 42]. However, these effects were observed at much higher concentrations than the circulating physiological concentration of iapp, normally ranging in the low picomolar (320 pm) [23, 43]. Thus, these effects should be interpreted with precaution since they could result from the activation of the ct receptor not associated with a ramp and/or of the ct - receptor - like receptor . Taken together, the biological functions of iapp are still far from being clearly understood . Amyloid fibrils, including iapp amyloids, are highly ordered assemblies that predominantly adopt a characteristic cross--sheet quaternary structure . This structural motif provides the most favorable organization for these supramolecular assemblies and can accommodate a high diversity of polypeptide sequences . Amyloids are characterized by an x - ray diffraction pattern with two characteristic signals, a clear reflection at 4.7 along the direction of the fibril, and a diffuse reflection around 10 perpendicular to the fibril axis (figure 2). By atomic force microscopy (afm) and electron microscopy (em), amyloids extracted from patients or prepared in vitro appear as long (0.5 to 10 m) and unbranched filaments having 4 to 15 nm of diameter (figure 2). Until recently, the structure of amyloids at the atomic level was unclear, since amyloids do not form crystals and are insoluble, precluding their characterization by x - ray crystallography and solution nuclear magnetic resonance (nmr). Thanks to recent advances in techniques such as solid state nmr and the ability of growing nanocrystals of peptide fragments, it has been possible to elucidate the structure of several amyloids . These approaches, along with cryoelectron microscopy, have suggested that amyloid fibrils present a core sharing several characteristics . These differences can be seen in (i) the length of the -strands, (ii) the arrangement (parallel versus antiparallel) of the constituting sheets of the strand, (iii) the length and arrangement of structures which are not inside the fibril core, and (iv) the number of -sheets per each protofilament . Thus, although amyloid fibrils display similar characteristics, a marked polymorphism exists not only between fibrils from different precursors, but also between amyloids assembled from the same polypeptide but in different conditions . The atomic structure of iapp in its fibrillar form has been studied by a variety of approaches, including solid state nmr, x - ray crystallography, and electron paramagnetic resonance (epr) spectroscopy . According to the technique used and/or the conditions in which iapp amyloids were assembled, three main atomic models have been proposed . Firstly, in the model derived from solid state nmr study, iapp protofibrils consist of two columns of symmetry related monomers packed against each other . Each polypeptide monomer adopts a u - shaped structure and contains two -strands connected by a bend - loop . These -strands comprise, respectively, residues 817 and 2837 whereas the loop involves residues 1827 . Residues 1 to 7 do not participate in the -structure, most likely because of the conformational constraints imposed by the disulfide bridge . Secondly, the eisenberg group has proposed a model based on the crystallographic studies of iapp fragments that shares many features with the solid state nmr model described above but differs in how the two columns of iapp monomers pack against each other and in the length of the c - terminal -strand . Thirdly, epr studies of iapp variants lacking the cys cys disulfide bond have led to a slight variation of these two models . The protofibrils are still built up of u - shaped stacks of monomers, but the planes of the two -strands within one iapp molecule are staggered by around 15 . Interestingly, in these three models, the 2029 amyloidogenic segment is not part of a -sheet . Instead, it forms a partially ordered bend that connects the two -strands, questioning the sensitivity of hiapp amyloid formation to substitutions and/or modifications within this amyloidogenic prone region . Structural analysis of iapp fibrils was so far exclusively performed using homogenous peptide assemblies, although amyloid deposits in islets of langerhans of diabetic patients contain a variety of biomolecules, including gags, lipids, and other proteins . Thus, it will be interesting to study the molecular architecture of iapp amyloids assembled in a biologically relevant heterogeneous environment . While the mechanism by which proteins self - assemble into amyloids has been intensively studied over the last two decades, mechanistic details remain partially elusive and still the matter of controversy . Amyloidogenic polypeptides can be divided into two different structural classes: those that are intrinsically (or partially) disordered in their native state and those that show a well - defined tertiary structure in their monomeric soluble state . Generally, natively folded amyloidogenic proteins, such as transthyretin and 2-microglobulin, have to unfold (or misfold), at least partially, to form amyloids . In contrast, intrinsically disordered polypeptides, such as iapp and a peptide, need to undergo conformational rearrangements allowing the formation of locally ordered structure(s) to initiate the amyloidogenic process . The formation of amyloid fibrils is often described as a nucleation - dependent polymerization, although other models have been suggested, including the nucleated conformational conversion and the monomer - directed conversion . The nucleated polymerization model is characterized by the rate - limiting formation of the nucleus, which results from the equilibrium between monomers that are and are not assembly competent . As soon as the nucleus is formed, assembly rapidly occurs by the addition of competent monomers to the growing end of the protofibrils . Firstly, a low amount of dynamic and transient oligomeric species is produced in the lag phase . This phase takes place slowly because of the unfavorable interactions between monomers to form oligomers . Secondly, once the nucleus (competent oligomer) is formed, the elongation phase begins, leading to the rapid growth of the (bio)polymers . Amyloid formation kinetics, seeding experiments as well as the difficulty of detecting low ordered oligomers, suggest that iapp amyloidogenesis could be ascribed to a nucleated polymerization . Recent studies performed with different amyloidogenic proteins have suggested that oligomers could be the most proteotoxic species of the aggregation cascade [5658]. For iapp, two major models have been proposed for its oligomerization in homogenous solution: the helical intermediates model and the -hairpins model . As inferred from nmr analysis and in silico prediction, monomeric soluble iapp transiently adopts an -helix between residues 519 and it has been suggested that this helical intermediate could be on - pathway to amyloid formation . For instance, by analyzing the kinetics of -sheet formation using two - dimensional infrared (2d ir) spectroscopy, it was observed that the disappearance of the random coil conformation was associated with the emergence of a -helix . Besides, the presence of a low percentage of hfip, a solvent known to promote helical formation, in the aggregation solution of iapp accelerates the rate of amyloid formation [62, 63]. Similarly, whereas the binding of iapp to model membranes favors its initial conformational conversion from a random coil to a -helix, it is well known that lipid vesicles significantly accelerate iapp amyloid formation . According to the helical intermediates hypothesis, self - association would be thermodynamically associated with helix formation within the 520 segment, in a similar way of the driven forces of coiled - coil motif formation . In turn, this transient helical oligomer would generate a high local concentration of the c - terminal amyloidogenic segment of iapp, favoring the intermolecular -sheets formation . Taking into account this model, several molecules have been recently designed to target and stabilize helical intermediates with the ultimate goal of inhibiting iapp amyloid formation [6568]. By combining ion mobility mass spectrometry and molecular dynamics simulations, it was instead proposed that iapp early oligomerization steps include the formation of -strand rich dimers [29, 60]. Bowers and colleagues have suggested that iapp -sheet - rich assemblies are formed from ordered beta - hairpins rather than from coiled structures . The discrepancy between these two models indicates that the initial events of iapp amyloidogenesis still remain unclear . It is worth mentioning that in contrast to in vitro homogenous aqueous solution, the mechanisms of amyloid formation in vivo are most likely to be different and could involve alternative pathways . Iapp amyloidogenesis takes place in a heterogeneous and crowded environment with the potential interactions with several components of the extracellular matrix and the plasma membrane . Thus, mechanistic examinations of amyloid formation in heterogeneous environments constitute an important issue and relevant studies will now be discussed . Amyloid formation has been originally perceived as a self - assembly homogeneous process in which the inherent physicochemical and structural properties of the amyloidogenic proteic precursor as well as its concentration constitute the major driving forces to fibrillation . Accordingly, the presence of biomolecules tightly associated with the amyloids in vivo, including gags, metals, glycoproteins, and lipids, was seen as a contamination of the fibrils occurring after aggregation and/or deposition . However, numerous biophysical investigations as well as in vivo biochemical studies have shown a prominent role of these extrinsic factors in amyloid deposition associated with the etiology of various diseases, including type ii diabetes [1, 8, 9]. It is now evident that the biochemical microenvironment in which amyloid formation occurs and the interactions of the polypeptide precursor with various biomolecules not only modulate the rate and extent of aggregation, but also remodel the mechanisms as well as the structure, toxicity and stability of the resulting fibrils . Immunohistochemical analysis revealed that the basement membrane heparan sulfate proteoglycan (hspg), perlecan, was present within islet amyloid deposits, suggesting a causative role of sulfated gags in iapp fibrillogenesis . Besides, incubation of hiapp transgenic mouse isolated islets with was-406, an inhibitor of hspgs synthesis, resulted in a dose - dependent decrease in amyloid formation . Similarly, the westermark group has established a mouse strain that overexpresses both hiapp and heparanase, an enzyme that catalyzes the cleavage of cell surface heparan sulfate . They reported that isolated islets from these mice showed a marked reduction in amyloid accumulation upon a 2-week high glucose treatment; these conditions simulate the hyperglycemia observed in type ii diabetes and stimulate iapp expression and secretion . In addition, since the original work by castillo et al ., several reports have shown that sulfated gags, including heparin, heparan sulfate, and heparin derivatives, accelerate dramatically the rate of iapp and pro - iapp amyloid formation in vitro [7377]. Overall, these studies constitute a clear testimony that sulfated gags could play an active role in islet amyloid deposition associated with type ii diabetes . Gags are long and linear polysaccharides composed of repeating disaccharide units and some gags can contain up to 200 repeating disaccharide units . They are abundant on the outer leaflet of the plasma membrane of every cell type of metazoan organisms and in their basement membrane and extracellular matrix (ecm). According to the structure of their carbohydrate backbone the most ubiquitous class of gag is heparan sulfate (figure 3(a)) which is expressed at the cell surface of nearly every cells, constituting more than 50% of total proteoglycans [80, 81]. Other types of gags include heparin, chondroitin sulfate, dermatan sulfate, keratan sulfate, and hyaluronic acid . Owing to their high density of carboxylate and sulfate groups, gags are highly negatively charged biopolymers that constitute a major reservoir of polyanions surrounding cells . With exception of hyaluronic acid and heparin, gags are usually covalently o - linked to a protein core, forming a structure known as proteoglycans . Hspgs, which constitute approximately 95% of all proteoglycans, are present in all tissues and comprise five types of protein core, including the cell surface syndecan and the ecm perlecan, the latter being a major constituent of pancreatic islet amyloids . Over the last 15 years, several studies have demonstrated that the addition of sulfated gags to amyloidogenic proteins accelerates their fibrillogenesis in vitro . These polypeptides include both intrinsically disordered polypeptides such as the a peptide, -synuclein, and iapp and natively folded proteins such as transthyretin, gelsolin, and 2-microglobulin . It has been proposed that gags hasten amyloidogenesis by a scaffold - based mechanism, in which the amyloidogenic protein, either in its monomeric or oligomeric form, interacts with the sulfated polysaccharides mainly through electrostatic interactions, increasing its local concentration and promoting aggregation [85, 86, 88]. It was also reported that the interaction with gags induces the conformational transition of the 3 kda fragment of gelsolin and a peptide from a random coil to -sheet . However, this structural modification is most likely related to the aggregation process rather than to a conformational conversion within the monomeric protein . The mechanisms by which sulfated gags accelerate iapp amyloid formation have been studied by a combination of biophysical approaches and are similar to the one described for other amyloidogenic polypeptides . Owing to its net positive charge at physiological ph, iapp can bind by means of electrostatic interactions with polyanionic sulfated gags . As a matter of fact, it was observed by nmr spectroscopy that heparin binds to the n - terminal segment of iapp, which includes the only four potential positive charges in iapp sequence: the -amino group, lys-1, arg-11, and his-18 . Besides, it was reported by isothermal titration calorimetry (itc) that the affinity of iapp to sulfated gags was dependent on the protonation state of his-18 and that the binding was predominately enthalpy - driven, most related to electrostatic interactions . A heparin binding site was characterized within the n - terminal domain of proiapp [77, 90] and it was suggested that the interaction of unprocessed proiapp with sulfated gags could have strong implications for amyloid formation in pancreatic islets . Fret analyses between tht and fluorescein - labelled heparin (fh) [73, 74] showed that iapp binds to sulfated gags before amyloid formation, most likely in its monomeric form . As reported for other amyloidogenic polypeptides, heparin is incorporated into the fibrils and/or is tightly associated with the mature amyloids . By cd spectroscopy, iapp and proiapp association to sulfated gags induces a random coil to -helix conformational conversion [75, 77] and this helical structure is rapidly converted into a -sheet structure . As the binding of iapp and proiapp accelerates the rate of amyloid formation, this secondary conformational conversion supports the helical intermediates hypothesis described above . By using heparin analogs of different length and/or degree of sulfation, it was reported that the effects of gags on iapp amyloidogenesis were dependent on the oligosaccharide length and sulfate content and not on the amount of charged monomers [72, 73]. Nonetheless, it was observed that the degree of sulfation of heparan sulfate isolated from pancreatic -tc3 cells does not determine all aspects of gag - mediated amyloid formation . Besides, the nature of gag backbone also affects, to some extent, the enhancement of iapp fibril formation [72, 92]. Overall, these studies suggest a model for gags - accelerated iapp amyloidogenesis in which the positively charged n - terminal segment of the peptide binds to the sulfate moieties of gags, inducing the formation of a -helix . In turn, this generates a high local concentration of peptide on gag scaffold that drives the association of iapp amyloidogenic segment, accelerating drastically the formation of -sheet rich assemblies (figure 3(b)). Several reports have suggested that the dysregulation of metal ion homeostasis could be implicated in the pathogenesis of amyloid diseases, comprising type ii diabetes . Binding sites for transition metals, including zinc, copper, and iron, have been characterized in numerous amyloidogenic polypeptides, such as a peptide, -synuclein, and 2-microglobulin . Most of mechanistic studies have been so far performed with the a peptides and have shown that physiological concentrations of metals, particularly zn, are sufficient to accelerate the rate of amyloid formation, although divergent results were reported . While it is known for more than 20 years that the secretory granules in pancreatic islets of langerhans, which store iapp and insulin, are characterized by a high concentration of zinc, the role of this metal in iapp amyloidogenesis has not been addressed until recently [98, 99]. Particularly, it has been reported that zinc transport into -cells secretory granules, involving the pancreas - restricted zinc transporter znt8, could play a significant role in the etiology of type ii diabetes [100, 101]. This observation suggests that zinc homeostasis could be associated with iapp misfolding / aggregation, although this avenue has not been explored in vivo so far . The modulation of iapp amyloidogenesis in vitro by zinc is complex and is dependent on zinc concentration as well as the ph and peptide concentration . At ph 7.5, the presence of a low concentration of zn in the incubation solution decreases the rate of amyloid formation whereas at higher concentration the fibril elongation rate increases . It was also observed that while the total amount of fibrils is greatly reduced by zinc at all concentrations, the general morphology of the individual fibrils remained somewhat similar . Notably, typical concentrations of zinc reported in the extracellular space where iapp deposition occurs, ranging from 10 to 25 m, decrease significantly amyloid formation at physiological ph . In sharp contrast, at ph 5.5, at which the residue his-18 is protonated, zinc accelerated iapp fibrillogenesis . Brender and colleagues have observed that iapp in an organic solvent undergoes a structural conversion upon zinc binding characterized by a local disruption of the helical structure around residue his-18 . Thus, the inhibitory effect of zinc observed at low concentrations was initially ascribed to the unfavorable incorporation of a charge inside the loops, as the imidazole ring of his-18 is located in the hydrophobic core of the fiber . By combining itc, nmr, and esi mass spectrometry, it was observed that zinc favors the formation of off - pathway hexameric species while creating an energetic barrier for the formation of amyloids . Thus, zinc binding to nonfibrillar iapp with an affinity in the micromolar range promotes the formation of prefibrillar aggregates, ultimately inhibiting the formation of amyloid fibrils . The inhibition of amyloid formation by metals appears to be restricted to metals that are known as good ligands for histidine, such as zn and cu, whereas mg and ca, which are poor imidazole ligands, have no significant effect on iapp amyloidogenesis [98, 104]. The effect of the buffer ion composition on the kinetics of iapp amyloid formation was recently examined and it was reported that iapp fibrillogenesis was dependent on the anion identity, while the nature of the cationic species has little effect on the rate of fibrils formation . Overall, whereas the modulation of -synuclein and a-peptide amyloidogenesis by metals is well - documented, the role of metal homeostasis in islet iapp deposition has been so far less studied and deserves further attention . Particularly, it will be interesting to probe the effects of zinc and copper on the kinetics of iapp self - assembly in heterogeneous environment, that is, in presence of other biological factors such as gags and lipid membrane models . Virtually all amyloid deposits, including islet amyloids [106, 107], are associated with apolipoprotein e (apoe), a protein involved in lipid transport and metabolism . The importance of this protein in amyloid deposition has been highlighted in alzheimer's disease as transgenic mice lacking the apoe gene form only diffuse plaques but not mature neuritic plaques . In sharp contrast, transgenic mice expressing hiapp crossbred with apoe deficient mice showed similar prevalence and severity of islet amyloids, indicating that apoe is not a critical factor for islet amyloid deposition . Nonetheless, it was observed in vitro that apoe4 binds iapp and inhibits amyloid formation . Insulin, which is stored with iapp in -cell secretory granules, is one of the most potent inhibitors of iapp aggregation . Insulin binds to the putative helical domain of iapp, stabilizing the compact isoform of iapp and inhibiting the formation of -sheets [112, 113]. The postulated mechanism of fibrillogenesis inhibition by insulin is consistent with the helical intermediates hypothesis . Anionic model membranes are the most studied biological cofactors in the context of iapp amyloidogenesis, since they not only accelerate iapp amyloid formation but they also recapitulate the postulated initial site of iapp - induced cell death . The mechanisms of lipid - accelerated iapp amyloidogenesis have been previously addressed in several excellent reviews [2023, 114] and readers are invited to consult them for additional information . The presence of insoluble protein deposition in the pancreatic islets of patients suffering from type ii diabetes has initially led to the postulate that amyloid fibrils cause -cell degeneration . This hypothesis was later reinforced by the work of lorenzo and colleagues demonstrating the potential toxicity of iapp fibrils on human pancreatic islet cells . This cell death event was associated with membrane blebbing, chromatin condensation, and dna fragmentation, indicating that iapp amyloids trigger -cell apoptosis . However, over the last fifteen years, several studies have instead suggested that nonfibrillar intermediates are the most toxic species of iapp amyloid cascade . For instance, it was observed that the inhibition of amyloid fibril formation with rifampicin did not reduce iapp - induced pancreatic cell death . Furthermore, in a homozygous hiapp transgenic mouse model, selective -cell death and impaired insulin secretion were associated with the formation of early, small amorphous intra- and extracellular aggregates rather than with large amyloid deposits . Bram and colleagues have recently reported the isolation of antibodies from diabetic patients that specifically recognized iapp oligomers . Remarkably, these antibodies were shown to neutralize the apoptotic effect induced by iapp cytotoxic species on -cell . Moreover, dynamic light scattering revealed that cytotoxicity corresponds to iapp aggregates containing between 25 and 6 000 iapp molecules . Thus, as for other amyloid - related diseases, the scientific community generally agrees on the hypothesis that prefibrillar aggregates might be the toxic species causing -cell death . However, considering that pancreatic islets from patients afflicted with type ii diabetes are almost all converted into amyloids, this massive iapp deposition most likely interferes with normal -cell functions, such as insulin release . Noteworthy, the search for the culprit species of the amyloidogenic cascade has been so far exclusively performed with aggregates prepared in iapp homogenous solution . However, as described above, amyloid cofactors such as metals, gags, and lipids can remodel the pathway of aggregation and can lead to the formation of oligomer species with unusual morphological, physicochemical, and/or biological properties . Thus, it will be crucial in the nearest future to characterize the cytotoxicity of iapp oligomers prepared in heterogeneous environment that reconstitutes, as possible, the extracellular environment of pancreatic islets . Although the mechanisms by which iapp induced -cell death have been intensively investigated since iapp discovery, the subject is very complex and is still the matter of debate . This topic has been recently discussed in excellent reviews [23, 121, 122] and, accordingly, we will briefly present the main postulated mechanisms . One of the most studied and accepted mechanisms is membrane disruption and transmembrane pore formation . Iapp is a cationic peptide, favoring its electrostatic interaction with anionic lipids of the plasma membrane . Experiments performed with planar phospholipid bilayer membranes showed the formation of nonselective ion - permeable channels, suggesting that channel - like formation could trigger iapp - induced cell death . Similarly, the formation of abnormal vesicle - like membrane structures was observed when freshly dissolved iapp was added to mouse and human islet cells . Apoptosis, or programmed cell death, is another mechanism by which iapp can cause -cell death and is closely associated with membrane disruption . Actually, nonspecific channel - like formation by iapp causes a high influx of ca inside the cell that can engage apoptosis [125, 126]. Dna fragmentation, a key apoptosis characteristic, was observable for rinm5f cells exposed to iapp . Moreover, iapp induces p53 activation, a well - known tumor suppressing gene that regulates the cycle and increases the transcription of proapoptotic factors . Similarly, it was observed that the gene encoding the g1 inhibitor p21 is upregulated when cells are incubated in presence of iapp aggregates . Besides, iapp expression in islets upregulates the expression of the fas receptor, a transmembrane protein able to engage programmed cell death, whereas the deletion of fas reduced iapp - induced toxicity, suggesting the involvement of specific apoptotic pathways . Several studies have indicated that iapp can induce pancreatic cell death by inducing the generation of reactive oxygen species (ros). For instance, an increased level of ros was observed when cells were exposed to iapp oligomers . Interestingly, it was observed that phycocyanin, a natural compound known for its antioxidant properties, protects pancreatic -cells against iapp - induced apoptosis by attenuating oxidative stress and modulating apoptotic pathways . In contrast, treatment with the antioxidant n - acetyl - l - cysteine (nac) prevented the rise of ros induced by iapp but did not prevent -cell apoptosis . Due to peripheral insulin resistance associated with type ii diabetes, insulin and iapp expression, maturation, and secretion by pancreatic -cells are significantly increased . This can overload the endoplasmic reticulum (er), leading to er stress and the activation of the unfolded protein response (upr). For instance, an elevated expression of iapp in hiapp transgenic rats induces er - stress, ultimately leading to -cells apoptosis . Interestingly, by establishing a mouse model overexpressing riapp at a comparable rate as the transgenic hiapp mouse model, it was reported that the elevated er stress depends on the propensity of iapp to aggregate but is not the consequence of protein overexpression . It was recently showed that the expression of hiapp in mice with a cell - specific autophagy defect results in an increase of -cell dysfunction associated with iapp - toxicity, suggesting a protective role of autophagy in type ii diabetes . Overall, these studies indicate that iapp - mediated cytotoxicity is multifaceted and is triggered by multiple mechanisms that are intrinsically related to each other . Whereas biophysical studies have indicated that amyloid cofactors, including gags, metals, and lipids, can remodel iapp aggregation landscape and biochemical investigations have suggested that oligomeric species induce -cell death, it appears crucial to address the roles of these cofactors in iapp - induced toxicity . It was observed that the coinjection of sulfated gags with iapp in the culture media protects -pancreatic cells against iapp - mediated cytotoxicity [73, 75]. This result suggests that, by hastening amyloid formation, sulfated gags stimulate the formation of nontoxic fibrillar species, in agreement with the toxic oligomeric species hypothesis . The role of cell surface proteoglycans in iapp - mediated cell death has been recently investigated . Ins-1 cells treated with heparinase and chondroitinase in order to cleave polysaccharide chains of proteoglycans showed a similar vulnerability to iapp to their nontreated counterpart . This data indicates that the lack of gags on the outer leaflet of the plasma membrane does not prevent nor increases iapp toxicity . This result was confirmed by means of the mutant cho cell pgsa-745, which lacks cell surface gags as a result of a deficiency in xylosyltransferase, a key enzyme in proteoglycans biosynthesis . These observations are not in line with previous studies performed with the a peptide showing that heparan sulfate deficient cells were essentially resistant to a cytotoxicity . Similarly, a toxicity is attenuated in embryonic kidney cells overexpressing heparinase . Nonetheless, as reported for iapp, the removal of cell surface gags did not prevent hypf - n aggregates toxicity, suggesting some heterogeneity among the mechanisms of cell death induced by amyloidogenic polypeptides . As described above, membrane disruption, including pore formation and membrane fragmentation, appears to play a key mechanistic role in the toxicity induced by iapp on -pancreatic cells . However, the contribution of the plasma membrane lipid composition and of its physicochemical properties on the cellular susceptibility towards iapp has not been directly addressed so far . In an elegant work, evangelisti and co - workers have recently shown that the extent of cytotoxicity of hypf - n oligomers is the result of a complex interplay between the physicochemical features of both the cell membrane and the oligomeric species . Regarding iapp, it was reported that depletion of cholesterol from plasma membrane of rat insulinoma cells inhibits the internalization of oligomers, which in turn potentiates iapp cytotoxicity . By means of real - time single particle tracking, it was shown that iapp aggregates interact with gm1 gangliosides and decrease their lateral diffusion in neuroblastoma cell membrane . As gm1 is a major constituent of membrane lipid rafts, which are known for their contribution to cell signaling pathways, it will be interesting to probe the role of gm1 in iapp - induced toxicity . By combining biophysical approaches, it was shown that phosphatidylethanolamine (pe) phospholipids modulate the in vitro membrane disruption induced by iapp . This result suggests a possible role of pe in iapp plasma membrane disruption, although this possibility has not been addressed in vivo so far . It was recently observed that copper interacts with iapp to form metallopeptide complexes showing low toxicity towards pancreatic rat -cells, indicating that metal ions can also modulate iapp - induced cell death . As summarized in this review, the role of the so - called accessory amyloid biomolecules in iapp amyloidogenesis has been recently investigated by a combination of biophysical approaches . Regardless of the complexity of the microenvironment in which iapp deposition occurs, the effects of several biological cofactors on amyloid formation are being increasingly recognized . Nonetheless, several issues should be addressed in order to better appreciate the implication of these biomolecules in the development of amyloid deposition . In turn, this knowledge should lead to deeper understanding of the mechanisms by which iapp induced -cell degeneration . Taking into account the prominent role of gags, metals, and lipids in iapp amyloidogenesis, it will be particularly important that the identification of amyloid inhibitors in vitro is performed in milieu that recapitulates, as much as possible, the complex biological environment in which iapp aggregation occurs . For instance, hebda and colleagues have recently performed the screening of small molecules in presence of lipid membrane model and identified 36 molecules that were not previously reported as active toward iapp fibril formation in homogenous solution . Similarly, it was observed that the capacity of insulin to inhibit iapp amyloidogenesis is significantly reduced in presence of sulfated gags whereas the inhibition of iapp fibrillogenesis by is5, a small molecule alpha helix mimetic, is increased in presence of heparin . Considering that the simplistic model of iapp fibrillogenesis as a homogenous self - assembly process does not recapitulate amyloid deposition associated with the etiology of type ii diabetes, it will be important in the future to develop in vitro experimental conditions to study iapp aggregation that resemble the complexity of the pancreatic islet environment.
|
Osteonecrosis of the femoral head (onfh) is a common disease in orthopedics throughout the world . Various accepted risks factors, including trauma, excessive steroid use, alcoholism, damage from radiation, sickle cell anemia, gaucher's disease, and the exposure to high pressures, are reported [17]. Chronic groin pain and gait disturbance is one feature of this disease, which is considered to be caused by the secondary osteoarthritis followed by onfh . Furthermore, when the disease develops to the terminal stage with femoral head collapse and secondary osteoarthritis, a total hip replacement operation is required . To date, the pathogenesis process of onfh is still unclear . It has been demonstrated that onfh is caused by the inadequate blood supply of subchondral bone [1015]. The pathologic process involved in onfh starts with necrosis in femoral head bone tissue which is thought to be a result of the blood circulation disturbance to the femoral head . During the pathogenesis, the levels of various biomarkers in the femoral head bone, cartilage, synovium, and hip joint synovial fluid are changed, which make effects on the disease process . It has been proved that, in the bone matrix of femoral head in patients with onfh, expression level of matrix metalloproteinase-2 (mmp-2) is upregulated, which is related to the reduced repair capacity and altered bone remodeling . In the children's onfh, an increase of proteoglycan fragments in the joint fluid was observed, which implied increased degradation proteoglycan and release of fragments from hip joint cartilage . Moreover, concentrations of proteoglycan fragments, c - propeptide of type - i1 collagen, mmp-3, timp-1, and the molar ratios of mmp-3/ttmp-1 are all increased in hip joint fluid of adult onfh patients even before any evident radiologic changes in the femoral head or hip joint were observed . Collectively, it appears that femoral head cartilage undergoes abnormal metabolic change before collapse in onfh . The adamts (a disintegrin and metalloproteinase with thrombospondin motifs) family consists of 19 secreted zinc metalloproteinases with a precisely ordered modular organization including at least one thrombospondin type i repeat . To our knowledge, these enzymes have important effects in development, angiogenesis, and coagulation and have relationship with coagulation disorders, malignancy, lumbar disc herniation, rheumatoid arthritis, and osteoarthritis [2026]. Adamts-7, a member of the adamts family, is widely expressed in various tissues . Adamts-7 has been reported to negatively regulate endplate cartilage differentiation, facilitate intimal hyperplasia, and mediate vascular remodeling as a novel locus for atherosclerosis . Furthermore, it has been found to degrade cartilage oligomeric matrix protein (comp) which is an important noncollagenous component of cartilage and may play a key role in osteoarthritis pathogenesis [2730]. It is overexpressed in cartilage and synovium of arthritis patients, and the level of fragments of comp in patients' serum is increased concurrently . In vitro, it could negatively mediate chondrocyte differentiation in cartilage differentiation by being a target of parathyroid hormone - related protein (pthrp) [29, 31]. Moreover, adamts-7 is reported to be closely associated with tnf- and nf-b signaling pathway, as tnf- mediated nf-b activation facilitates expression of adamts-7 . The aim of this study was to investigate the expression of adamts-7 in articular cartilage of onfh patients, to elucidate whether the expression was altered with cartilage degradation and radiological change, and to investigate the potential mechanisms involved, which may indicate new clinic therapeutic interventions for onfh . Ethical approval for this study was obtained from the medical ethics committee of qilu hospital, shandong university . What is more, written informed consent from each patient included in this study was obtained . Patients and healthy controls with primary osteoarthritis, ankylosing spondylitis (as), systemic lupus erythematosus (sle), and acute or chronic inflammatory diseases were excluded . All the patients had taken hip x - ray and magnetic resonance imaging (mri) examination . Human hip articular cartilage specimens were collected from patients with femoral neck fracture (fnf) without onfh and oa in x - ray as healthy control named group i (n = 14; the average age was 64 years with a range of 48 to 85 years) and patients with onfh (n = 34; the average age was 51 years with a range of 41 to 70 years). According to arco classification standard, articular cartilage specimens obtained from the onfh patients were categorized into two groups: group ii, 15 cases, stage ii - iii with no obvious collapse in x - ray; group iii, 19 cases, stage iv with obvious femoral head collapse in x - ray . The articular cartilage tissues were dissected carefully from the weight - bearing region of femoral head and subsequently treated according to the corresponding downstream experiments . The cartilage samples were dissected along the axial plane into pieces of 10 mm 5 mm 7 mm with a thin layer of subchondral bone and were fixed in 4% formaldehyde for over 24 hours in room temperature . After being decalcified in 10% ethylene diamine tetraacetic acid (edta) solution for over 2 weeks the cartilage specimens were cut longitudinally into 4 m thick sections and stained with haematoxylin - eosin (h&e) and safranin - o . We used the mankin score (table 1) to evaluate the cartilage degradation . We use primary antibodies for adamts-7 (1: 200; abcam biotechnology co., ltd ., london, uk), tnf- (1: 200, beyotime institute of biotechnology, shanghai, china), and phospho - nf-b p65 (1: 100, bioss institute of biotechnology, beijing, china). A goat anti - rabbit immunoglobulin- (igg-) horseradish peroxidase (hrp) secondary antibody (1: 200; beijing golden bridge biotechnology co., ltd ., images were captured by a nikon eclipse 80i microscope (nikon, tokyo, japan). Image - pro plus software (media cybernetics) was used to qualify the average optical density of the adamts-7 positive, tnf- positive, and phospho - nf-b p65 positive areas at 400x magnification . 2 - 3 grams of samples was put into liquid nitrogen and tripsised into powder . Dalian, china) method according to the manufacturer's instructions . The quantity and integrity of rna were verified . Total rna (1 g) was reverse - transcribed in a total volume of 10 l containing 2 l 5x rt buffer (toyobo co., ltd ., japan), 0.5 l rt enzyme mix (toyobo co., ltd ., japan), and 0.5 l prime mix (toyobo co., ltd ., the reaction was performed at 37c for 15 min and 95c for 5 min . Rt - pcr reactions were carried out in triplicate with 100 ng cdna (rna equivalent) each with sybr green dye i master mix using a roche lightcycler (roche, switzerland) and the data were analyzed by lightcycler software 4.0.0.23 . To normalize adamts-7 gene expression, the genome - wide specificity of the primers was confirmed by blast searches (genbank database). A standard melting curve cycle was used to verify the quality of amplification and absence of primer dimer formation . The relative expression levels of adamts-7 in each sample were analyzed using the 2 method . Tissue samples were conserved in liquid nitrogen; total protein was extracted and determined using a bca protein assay kit according to the manufacturer's instruction . Equal amounts of protein (10 g) for each sample were resolved by 10% acrylamide - sds - page . The samples were subsequently transferred to polyvinylidene difluoride membranes (pvdf; millipore, billerica, ma). Primary antibodies (rabbit anti - adamts-7, 1: 3,000, abcam biotechnology co., ltd ., london, uk; rabbit anti - comp, 1: 3,000, abcam biotechnology co., ltd ., london, uk), and a goat anti - rabbit immunoglobulin- (igg-) horseradish peroxidase (hrp) secondary antibody (1: 2,500; beijing golden bridge biotechnology co., ltd ., equal amounts of protein loading were confirmed by reprobing the membranes with the rabbit anti - gapdh - hrp antibody (1: 5,000, abcam biotechnology co.). Protein bands were detected using a fluorchem e chemiluminescent western blot imaging system (cell biosciences, santa clara, ca) and quantified by densitometry analysis using imagej software (national institutes of health, usa). Statistical analysis of the data was performed using unpaired student's t - test and two - way analysis of variance (anova) with prism software followed by the student - newman - keuls post hoc test . Differences were considered to be statistically significant if the p value <0.05 (or) or 0.01 (or). We used h&e and safranin - o staining to determine the cartilage degradation in onfh patients; mankin score was also evaluated . The cartilages of fnf patients had mild moderated perichondrium, and the cells organizations were normal or mildly irregular with little chondrocyte clusters and necrosis; the safranin - o staining was normal or mildly reduced with intact tidemark . Groups ii and iii exhibit moderate - marked irregularity and more chondrocyte clusters and necrosis; the safranin - o staining of group ii showed moderate - marked reduction while group iii was almost not stained; their tidemark integrity was destroyed (figure 1). We measured the mankin score, and groups ii and iii exhibited significantly higher score than group i, in which group iii got the highest (figure 1(d)). The results indicated that, during the pathogenesis of onfh, the cartilage has a progressive degradation . The immunohistochemistry results revealed that adamts-7 and tnf- were expressed in all three groups, but the levels of adamts-7 and tnf- were significantly increased in degraded cartilage of groups ii and iii . Furthermore, we also found a statistically significant increase in the expression of adamts-7 and tnf- in group iii compared to in group ii (figure 2). The results suggested that the level of adamts-7 was markedly upregulated with the degradation of cartilage . Mrna is expressed in both degraded cartilage from onfh patients and relatively normal cartilage from fnf patients . When we compared the expression levels of the target gene, a statistically significant increase in the gene expression of adamts-7 was obtained in degraded cartilage compared with the relatively normal cartilage (figure 3). What is more, in different groups of the degraded cartilage, there was also a significant increase in the adamts-7 expression in cartilage of hip joint at stage 4 compared with that at stage 2 - 3 . Adamts-7 has been proved to degrade comp in oa and some circulation diseases [3436]. So we examined the adamts-7 and comp protein level in fnf and onfh patients' cartilage samples . The comp degradation was also observed in onfh cartilage . With the increase of adamts-7, the result indicates a positive association between increased adamts-7 and comp degradation in onfh patients . In order to investigate the mechanisms involved in the increased expression of adamts-7 in cartilage of onfh patients, we stained phospho - nf-b p65 in the cartilage of both onfh and fnf patients . The results showed that the onfh groups exhibited significantly higher expression of phospho - nf-b p65 compared with the fnf group, while phospho - nf-b p65 was rarely expressed in relatively normal cartilage (figure 5). Moreover, the adamts-7 and phospho - nf-b p65 are expressed synchronously in degraded and relatively normal cartilage . It has been proved that adamts-7 plays an important role in the pathogenesis of oa; it directly associates with and degrades comp in vitro, and the level of adamts-7 is elevated in cartilage patients with arthritis . The cartilage of patients with onfh exhibits a degraded condition with a relatively femoral head bone formative condition concurrently, which is different from patients with other hip diseases . In the present study, we first evaluated the cartilage degradation levels of onfh and fnf patients by mankin score and examined the expression pattern of adamts-7 . Our results suggested that adamts-7 expression level and mankin score had comparable trend, which prompted us to speculate whether the adamts-7 expression was significantly increased with the degradation of cartilage (figures 1 and 2). One possible explanation is that, in onfh patients, the cartilage degradation is also related to adamts-7 . In all three groups, the onfh groups demonstrated an elevated level of adamts-7 compared to the fnf group . In the comparison between the different stages of onfh, the levels of adamts-7 expression in the patients with onfh changes (stage 4) were significantly increased compared with those observed in stage 2 and stage 3 patients (figure 2). In the stage 4 onfh group, which performed secondary osteoarthritis caused by onfh, level of adamts-7 was the highest among the stages . Similarly, rt - pcr with specific primers for human adamts-7 showed that adamts-7 mrna level exhibits a parallel trend as the immunohistochemistry results, which is in line with adamts-7 expression pattern in primary osteoarthritis . On the other hand, the adamts-7 expression level was enhanced just before the secondary osteoarthritis was formed or the femoral head collapsed, which indicates cartilage degradation throughout the whole process of onfh pathogenesis and that adamts-7 participated in cartilage degradation even in the early stage of onfh . Taken together, the data implied that adamts-7 might be involved in the cartilage pathogenesis of onfh . In the current study, we examined the comp and adamts-7 levels in fnf and onfh patients . Comp is a prominent component of cartilage extracellular matrix (ecm); loss of comp may lead to susceptibility of other cartilage matrix proteins, including col ii and aggrecan, and cause the degradation of cartilage . We revealed a parallel alternation between comp degradation and increased adamts-7 (figure 4). It is reasonable to assume that cartilage degradation in onfh depends, at least in part, on comp degradation; what is more, adamts-7 upregulation greatly enhanced comp degradation in onfh patients, which may strongly contribute to cartilage degradation in onfh . Collectively, in the pathogenesis of onfh, cartilage degradation may stem from comp degradation induced by adamts-7 . Tnf- is a well - described mediator of the inflammatory response and is synthesized and released in many diseases including oa . In the previous studies, tnf- has been reported to play a crucial role in cartilage destruction in arthritis [39, 40]. The increased expression of adamts-7 in the joint tissues of degenerative diseases, such as oa and rheumatoid arthritis (ra), patients is due to proinflammatory cytokines, including tnf- [31, 41]. Tnf- enhances mmps and adamts expressions which could in turn cause exaggerated cartilage matrix degradation, while adamts-7 also upregulated tnf- expression in vitro and in vivo; it is indicated that adamts-7 and tnf- form a positive feedback regulatory loop in cartilage . Our immunohistochemistry results showed that the tnf- expression exhibited a concurrent increase with the increased expression of adamts-7 in the radiographic groups (figure 2). On the basis of the present study and the literature, our results suggest that at a late stage both primary oa and onfh process a comparable inflammation status for the expression profile of tnf-, major inflammatory cytokine, is similar . It also proved the concept that tnf- can enhance adamts-7 expression in onfh patients and indicated that tnf- also played an important role in the pathogenesis of onfh . It has been reported that the hip labrum and synovium of the hip joint of onfh patients exhibited less synovitis, less tnf expression than that of oa . Our results showed that the expression of tnf- was enhanced in cartilage of onfh patients . In contrast, the traumatic injury of femoral neck fracture has a relatively short time process that simply does not facilitate the synthesis of tnf-. Nf-b is a critical transcriptional regulatory factor which has been extensively investigated . Nf-b is activated and enters the cell nucleus and then it combines with specific dna motifs and stimulates the expression of corresponding gene if the cells are stimulated by various cytokines . Tnf--mediated activation of the nf-b signaling pathway plays an important role in the pathogenesis of oa . What is more, the upregulation of adamts-7 mediated by tnf- is primarily through the nf-b signaling pathway . Our results showed that the level of phospho - nf-b p65 expression in onfh patients was much higher than in femoral neck fracture patients (figure 5). It is interesting to surmise that tnf- upregulates adamts-7 expression throughout nf-b pathway in cartilage degradation of onfh patients . In conclusion, this study suggests that adamts-7 is associated with and might be involved in cartilage degradation during the pathogenesis of onfh, and its expression appears to interact with tnf- mediated by nf-b . The detailed underlying mechanisms of these functions are still unknown, and subsequent studies are required to explore the related molecular interactions and signaling pathways . Level of adamts-7 is elevated in articular cartilage of osteonecrosis of femoral head; admats-7 is positively associated with tnf- and nf-b.
|
Tetanus is a severe acute infection caused by the exotoxins produced by an anaerobic, gram - positive bacillus . In developed countries, the rate of death from tetanus is 32% among cases reported in recent years.1 most tetanus cases (approximately 70%80% of cases) result from minor wounds (cuts, scratches, and so on). However, chronic wounds (varicose ulcers, bedsores, etc) also present a significant risk factor (10%15% of cases). Women and people older than 70 years are more easily affected.25 tetanus vaccination is the only effective prevention . Since 1952, when infant vaccination became mandatory in france, the incidence of tetanus has dropped significantly, going from 25 to 0.5 cases per million people . Various immunization policies have been proposed, the most recent in 2013,6 yet many people still are not fully protected.710 it is difficult to assess a patient s tetanus immunization status when one relies only on the patient s testimony.4,710 as a consequence, when in doubt, physicians often choose to give one or more preventive injections when they treat the wound of a patient at risk for tetanus . A strategy for the prophylaxis and therapy of tetanus has been developed by the french national health authorities that includes, for emergency services only, immunochromatographic testing . The medical and economic value of these tests has been assessed in that context.1114 the tests quickly determine the patient s immune status and present real advantages over the preventive injection of immunoglobulins.3,1113 in france, the lack of epidemiological data on the wounds treated in general practice limits the application of those tests outside the hospital setting . The current overcrowding of emergency services has led to public health policies that focus on general practitioners (gps), as they are the primary care providers, and the strategies used in emergency services, including immunochromatographic testing, should also be applied to general practices . To optimize wound management in general practice, an epidemiological study was conducted in france, including vaccination status and taking into account vaccination schedule changes after the study period . Gps who are members of the french sentinelles network, a national system for the electronic monitoring of diseases,15,16 were invited to participate in an online survey in june 2012 (n=1,028 gps). All gps who were members of the french sentinelles network volunteers could participate without any inclusion or exclusion criteria . They could connect to a platform, using a single password that allowed them to participate only once . French sentinelles network members are representative of the global french gp population regarding age, location (rural / urban), and type of practice (single / two or more physicians). The french sentinelles network received formal approval for this study from the national ethics committee (commission nationale de linformatique et des liberts, cnil 471393). All data were handled confidentially, and the results were anonymous data were collected on all patients wounds treated by gps over the course of 1 week of consultation, in or out of the office . A wound was defined as any break in the skin barrier that caused bleeding or exposed dermis . The questionnaire contained five parts: context of the gp s consultation: reason for the consultation, place, date, and hour; emergency or not; gp s status (family physician or other); and access to the patient s file at the time of consultation.the patient s characteristics: age, sex, weight, height, associated diabetes, addictions, or consumption of toxic substances by injection.description of wound: location, context of occurrence, size, damaged elements (muscle, skin, etc), cleanliness, and time elapsed since trauma; acute (burn, traumatic wound, postsurgical wound) or chronic (venous ulcer, diabetic plantar ulcer, or other wound whose healing time is more than 46 weeks).the gp s identification of tetanus risk using a scale describing the wound as major risk, minor risk, or no risk for tetanus.3,4the patient s immunization status: date of last vaccination and description of documentation used for that identification (health record, vaccination record, computerized patient record, etc). Context of the gp s consultation: reason for the consultation, place, date, and hour; emergency or not; gp s status (family physician or other); and access to the patient s file at the time of consultation . The patient s characteristics: age, sex, weight, height, associated diabetes, addictions, or consumption of toxic substances by injection . Description of wound: location, context of occurrence, size, damaged elements (muscle, skin, etc), cleanliness, and time elapsed since trauma; acute (burn, traumatic wound, postsurgical wound) or chronic (venous ulcer, diabetic plantar ulcer, or other wound whose healing time is more than 46 weeks). The gp s identification of tetanus risk using a scale describing the wound as major risk, minor risk, or no risk for tetanus.3,4 the patient s immunization status: date of last vaccination and description of documentation used for that identification (health record, vaccination record, computerized patient record, etc). An additional survey was carried out among a random sample of 50 nonparticipating gps to determine their reasons for nonparticipation . The incidence of wounded patients was estimated from the average number of treated patients per gp and the average number of weekly consultations (including home visits) for each gp . The gp s french representativeness was obtained from the french health research department.17 the information was obtained from the survey of individual activity and prescription and was provided by the national french health insurance caisse nationale dassurance maladie (cnam) for each participating gp.18 all variables in this study were analyzed using the r software program (http://www.r-project.org/). Categorical variables were compared using the chi - square test or fisher s exact test, and continuous variables were compared using a student s t - test . Gps who are members of the french sentinelles network, a national system for the electronic monitoring of diseases,15,16 were invited to participate in an online survey in june 2012 (n=1,028 gps). All gps who were members of the french sentinelles network volunteers could participate without any inclusion or exclusion criteria . They could connect to a platform, using a single password that allowed them to participate only once . French sentinelles network members are representative of the global french gp population regarding age, location (rural / urban), and type of practice (single / two or more physicians). The french sentinelles network received formal approval for this study from the national ethics committee (commission nationale de linformatique et des liberts, cnil 471393). Gps who are members of the french sentinelles network, a national system for the electronic monitoring of diseases,15,16 were invited to participate in an online survey in june 2012 (n=1,028 gps). All gps who were members of the french sentinelles network volunteers could participate without any inclusion or exclusion criteria . They could connect to a platform, using a single password that allowed them to participate only once . French sentinelles network members are representative of the global french gp population regarding age, location (rural / urban), and type of practice (single / two or more physicians). The french sentinelles network received formal approval for this study from the national ethics committee (commission nationale de linformatique et des liberts, cnil 471393). Data were collected on all patients wounds treated by gps over the course of 1 week of consultation, in or out of the office . A wound was defined as any break in the skin barrier that caused bleeding or exposed dermis . The questionnaire contained five parts: context of the gp s consultation: reason for the consultation, place, date, and hour; emergency or not; gp s status (family physician or other); and access to the patient s file at the time of consultation.the patient s characteristics: age, sex, weight, height, associated diabetes, addictions, or consumption of toxic substances by injection.description of wound: location, context of occurrence, size, damaged elements (muscle, skin, etc), cleanliness, and time elapsed since trauma; acute (burn, traumatic wound, postsurgical wound) or chronic (venous ulcer, diabetic plantar ulcer, or other wound whose healing time is more than 46 weeks).the gp s identification of tetanus risk using a scale describing the wound as major risk, minor risk, or no risk for tetanus.3,4the patient s immunization status: date of last vaccination and description of documentation used for that identification (health record, vaccination record, computerized patient record, etc). Context of the gp s consultation: reason for the consultation, place, date, and hour; emergency or not; gp s status (family physician or other); and access to the patient s file at the time of consultation . The patient s characteristics: age, sex, weight, height, associated diabetes, addictions, or consumption of toxic substances by injection . Description of wound: location, context of occurrence, size, damaged elements (muscle, skin, etc), cleanliness, and time elapsed since trauma; acute (burn, traumatic wound, postsurgical wound) or chronic (venous ulcer, diabetic plantar ulcer, or other wound whose healing time is more than 46 weeks). The gp s identification of tetanus risk using a scale describing the wound as major risk, minor risk, or no risk for tetanus.3,4 the patient s immunization status: date of last vaccination and description of documentation used for that identification (health record, vaccination record, computerized patient record, etc). An additional survey was carried out among a random sample of 50 nonparticipating gps to determine their reasons for nonparticipation . The incidence of wounded patients was estimated from the average number of treated patients per gp and the average number of weekly consultations (including home visits) for each gp . The gp s french representativeness was obtained from the french health research department.17 the information was obtained from the survey of individual activity and prescription and was provided by the national french health insurance caisse nationale dassurance maladie (cnam) for each participating gp.18 all variables in this study were analyzed using the r software program (http://www.r-project.org/). Categorical variables were compared using the chi - square test or fisher s exact test, and continuous variables were compared using a student s t - test . The incidence of wounded patients was estimated from the average number of treated patients per gp and the average number of weekly consultations (including home visits) for each gp . The gp s french representativeness was obtained from the french health research department.17 the information was obtained from the survey of individual activity and prescription and was provided by the national french health insurance caisse nationale dassurance maladie (cnam) for each participating gp.18 all variables in this study were analyzed using the r software program (http://www.r-project.org/). Categorical variables were compared using the chi - square test or fisher s exact test, and continuous variables were compared using a student s t - test . A total of 130 gps participated in the study, representing a participation rate of 12.6% (95% confidence interval [ci], 10.6%14.6%) of the gps invited to complete the survey . Of those reporting, 92 gps (70.1%) treated at least one patient with a wound (table 1); 38 gps (29.9%) did not treat any patients with wounds . Participating gps were mostly male (sex ratio, 3.4:1), had an average age of 53.8 years (95% ci, 52.455.2 years), and ran a rural practice (63.1%). Eighty - two gps had a rural practice, and 48 had an urban one . There was no significant difference between the participating and nonparticipating sample gps and those of the french sentinelles network in terms of average age and sex ratio, but participating gps had a more significant rural practice (table 2). Reasons for nonparticipation reported by the 50 nonparticipating gps were no patient seen with a wound during the studied period (66%; n=33), out of office during the studied period (18%; n=9), lack of time to complete the survey (2%; n=1), and unspecified refusal (14%; n=7). A total of 197 patients with at least one wound were reported, which led to a frequency of 1.4 (95% ci, 1.21.6) cases per 100 consultations . This frequency was significantly higher among gps with an urban practice (1.67 [95% ci, 1.272.07] vs 1.55 [95% ci, 1.351.75] in rural areas; p<0.05). These wounds were treated during a consultation carried out by their family gp (88%), in the gp s office (74.9% of cases), or during a scheduled consultation (62.3% of cases). The wounds were usually the main reason for the consultation (67.4% of cases). Of the 197 patients, 175 were fully described: 118 were seen by gps with a rural practice and 79 by gps with an urban practice . These patients had an average age of 50.8 years, with a homogeneous age distribution (<20 years, 20%; 2040 years, 17%; 4060 years, 20%; 6080 years, 24%;> 80 years, 19%), the sex ratio was three women to one man . Diabetes was present in 13.1% of the cases and obesity in 14.3% of the cases . They were wounded in an environment that facilitated contact with the tetanus bacteria (activity or outdoor recreation and/or presence of animals) in 40.6% of cases . The patients had from one to more than three wounds (76% and 9.7% of cases, respectively). They had been inflicted more than 12 hours before treatment in 74% of cases and had no significant relation with the context of the consultation (scheduled or emergency, p<0.05). They were mostly traumatic (54.8% of cases) and were considered to be clean (94% of cases), and most often they were located on the lower limbs (46.8% of cases). Most patients (76%; 95% ci, 69.7%82.3%) had only one wound, mainly caused by trauma (54.8%; 95% ci, 47.5%62.1%), principally acute (76%; 95% ci, 69.7%82.3%), and were generally considered clean (94%; 95% ci, 90.5%97.5%) and without any significant difference between rural and urban practice (table 3). These wounds mainly sat on the lower limb (46.8%; 95% ci, 39.4%54.2%), upper limb (29.6%; 95% ci, 22.8%36.4%), trunk (12.1%; 95% ci, 7.3%16.9%), and head (11.5%; 95% ci, 6.8%16.2%). Acute wounds were more than 24 hours old in 67.1% (95% ci, 59.1%75.1%) of cases; chronic wounds were more than 1 month old in all cases . Of the wounds, 30.8% were classified as no risk for transmission of tetanus, 60.6% as minor risk, and 8.6% as major risk . Wounds classified as major risk were mostly clean traumatic wounds with muscle damage . A favorable environmental context (with risky occupation or leisure activities increasing the risk for contact with a telluric germ) was the only factor significantly associated with a minor or major tetanus risk (p<0.05). The other criteria (cleanliness, location on the body, wait time before treatment, and patient s immunization status) were not significant in the physicians identification of tetanus risk (table 4). The gps ascertained the immunization status directly from the patient (12.9% of cases) or through the patient s health record (22.6% of cases), the patient s immunization record (1% of cases), or the patient s computerized record (66.1% of cases), with the possibility of accessing several of these sources (table 5). The date of last tetanus immunization was known for 71% of patients . Among those patients, 79% were up - to - date with the immunization schedule recommended at the time of the survey . According to the french national health recommended schedule of 2013,6 the percentage of those patients rose to 90.3% . Each age group showed this increase with the exception of the group of patients older than 75 years, in which 75.9% of the patients had immunizations considered to be up - to - date for the 2012 schedule, dropping to 58.4% for the 2013 schedule . A total of 130 gps participated in the study, representing a participation rate of 12.6% (95% confidence interval [ci], 10.6%14.6%) of the gps invited to complete the survey . Of those reporting, 92 gps (70.1%) treated at least one patient with a wound (table 1); 38 gps (29.9%) did not treat any patients with wounds . Participating gps were mostly male (sex ratio, 3.4:1), had an average age of 53.8 years (95% ci, 52.455.2 years), and ran a rural practice (63.1%). Eighty - two gps had a rural practice, and 48 had an urban one . There was no significant difference between the participating and nonparticipating sample gps and those of the french sentinelles network in terms of average age and sex ratio, but participating gps had a more significant rural practice (table 2). Reasons for nonparticipation reported by the 50 nonparticipating gps were no patient seen with a wound during the studied period (66%; n=33), out of office during the studied period (18%; n=9), lack of time to complete the survey (2%; n=1), and unspecified refusal (14%; n=7). A total of 197 patients with at least one wound were reported, which led to a frequency of 1.4 (95% ci, 1.21.6) cases per 100 consultations . This frequency was significantly higher among gps with an urban practice (1.67 [95% ci, 1.272.07] vs 1.55 [95% ci, 1.351.75] in rural areas; p<0.05). These wounds were treated during a consultation carried out by their family gp (88%), in the gp s office (74.9% of cases), or during a scheduled consultation (62.3% of cases). The wounds were usually the main reason for the consultation (67.4% of cases). Of the 197 patients, 175 were fully described: 118 were seen by gps with a rural practice and 79 by gps with an urban practice . These patients had an average age of 50.8 years, with a homogeneous age distribution (<20 years, 20%; 2040 years, 17%; 4060 years, 20%; 6080 years, 24%;> 80 years, 19%), the sex ratio was three women to one man . Diabetes was present in 13.1% of the cases and obesity in 14.3% of the cases . They were wounded in an environment that facilitated contact with the tetanus bacteria (activity or outdoor recreation and/or presence of animals) in 40.6% of cases . The patients had from one to more than three wounds (76% and 9.7% of cases, respectively). They had been inflicted more than 12 hours before treatment in 74% of cases and had no significant relation with the context of the consultation (scheduled or emergency, p<0.05). They were mostly traumatic (54.8% of cases) and were considered to be clean (94% of cases), and most often they were located on the lower limbs (46.8% of cases). Most patients (76%; 95% ci, 69.7%82.3%) had only one wound, mainly caused by trauma (54.8%; 95% ci, 47.5%62.1%), principally acute (76%; 95% ci, 69.7%82.3%), and were generally considered clean (94%; 95% ci, 90.5%97.5%) and without any significant difference between rural and urban practice (table 3). These wounds mainly sat on the lower limb (46.8%; 95% ci, 39.4%54.2%), upper limb (29.6%; 95% ci, 22.8%36.4%), trunk (12.1%; 95% ci, 7.3%16.9%), and head (11.5%; 95% ci, 6.8%16.2%). Acute wounds were more than 24 hours old in 67.1% (95% ci, 59.1%75.1%) of cases; chronic wounds were more than 1 month old in all cases . Of the wounds, 30.8% were classified as no risk for transmission of tetanus, 60.6% as minor risk, and 8.6% as major risk . Wounds classified as major risk were mostly clean traumatic wounds with muscle damage . A favorable environmental context (with risky occupation or leisure activities increasing the risk for contact with a telluric germ) was the only factor significantly associated with a minor or major tetanus risk (p<0.05). The other criteria (cleanliness, location on the body, wait time before treatment, and patient s immunization status) were not significant in the physicians identification of tetanus risk (table 4). The gps ascertained the immunization status directly from the patient (12.9% of cases) or through the patient s health record (22.6% of cases), the patient s immunization record (1% of cases), or the patient s computerized record (66.1% of cases), with the possibility of accessing several of these sources (table 5). The date of last tetanus immunization was known for 71% of patients . Among those patients, 79% were up - to - date with the immunization schedule recommended at the time of the survey . According to the french national health recommended schedule of 2013,6 the percentage of those patients rose to 90.3% . Each age group showed this increase with the exception of the group of patients older than 75 years, in which 75.9% of the patients had immunizations considered to be up - to - date for the 2012 schedule, dropping to 58.4% for the 2013 schedule . A total of 197 patients with at least one wound were reported, which led to a frequency of 1.4 (95% ci, 1.21.6) cases per 100 consultations . This frequency was significantly higher among gps with an urban practice (1.67 [95% ci, 1.272.07] vs 1.55 [95% ci, 1.351.75] in rural areas; p<0.05). These wounds were treated during a consultation carried out by their family gp (88%), in the gp s office (74.9% of cases), or during a scheduled consultation (62.3% of cases). The wounds were usually the main reason for the consultation (67.4% of cases). Of the 197 patients, 175 were fully described: 118 were seen by gps with a rural practice and 79 by gps with an urban practice . These patients had an average age of 50.8 years, with a homogeneous age distribution (<20 years, 20%; 2040 years, 17%; 4060 years, 20%; 6080 years, 24%;> 80 years, 19%), the sex ratio was three women to one man . Diabetes was present in 13.1% of the cases and obesity in 14.3% of the cases . They were wounded in an environment that facilitated contact with the tetanus bacteria (activity or outdoor recreation and/or presence of animals) in 40.6% of cases . The patients had from one to more than three wounds (76% and 9.7% of cases, respectively). They had been inflicted more than 12 hours before treatment in 74% of cases and had no significant relation with the context of the consultation (scheduled or emergency, p<0.05). They were mostly traumatic (54.8% of cases) and were considered to be clean (94% of cases), and most often they were located on the lower limbs (46.8% of cases). Most patients (76%; 95% ci, 69.7%82.3%) had only one wound, mainly caused by trauma (54.8%; 95% ci, 47.5%62.1%), principally acute (76%; 95% ci, 69.7%82.3%), and were generally considered clean (94%; 95% ci, 90.5%97.5%) and without any significant difference between rural and urban practice (table 3). These wounds mainly sat on the lower limb (46.8%; 95% ci, 39.4%54.2%), upper limb (29.6%; 95% ci, 22.8%36.4%), trunk (12.1%; 95% ci, 7.3%16.9%), and head (11.5%; 95% ci, 6.8%16.2%). Acute wounds were more than 24 hours old in 67.1% (95% ci, 59.1%75.1%) of cases; chronic wounds were more than 1 month old in all cases . Of the wounds, 30.8% were classified as no risk for transmission of tetanus, 60.6% as minor risk, and 8.6% as major risk . Wounds classified as major risk were mostly clean traumatic wounds with muscle damage . A favorable environmental context (with risky occupation or leisure activities increasing the risk for contact with a telluric germ) was the only factor significantly associated with a minor or major tetanus risk (p<0.05). The other criteria (cleanliness, location on the body, wait time before treatment, and patient s immunization status) were not significant in the physicians identification of tetanus risk (table 4). The gps ascertained the immunization status directly from the patient (12.9% of cases) or through the patient s health record (22.6% of cases), the patient s immunization record (1% of cases), or the patient s computerized record (66.1% of cases), with the possibility of accessing several of these sources (table 5). The date of last tetanus immunization was known for 71% of patients . Among those patients, 79% were up - to - date with the immunization schedule recommended at the time of the survey . According to the french national health recommended schedule of 2013,6 the percentage of those patients rose to 90.3% . Each age group showed this increase with the exception of the group of patients older than 75 years, in which 75.9% of the patients had immunizations considered to be up - to - date for the 2012 schedule, dropping to 58.4% for the 2013 schedule . This study describes for the first time in france the epidemiology of wounds in general practice and the status of tetanus immunization in this context . The frequency of wounds observed in general practice (1.4% of consultations) remains significantly lower than that observed in the emergency departments (13%).7,8 these results merit discussion: one of the reasons for a nonresponse from the nonparticipants (nonparticipating study) was that no wounds were treated in consultation . The season when the patient was wounded may also have contributed to the incidence reported here, as the study was conducted neither in the summertime nor during a holiday period, when a greater frequency of outdoor activities can foster their occurrence.19 the representativeness of participating gps can also be discussed . Compared with the overall population of french gps, the gps of this study were slightly older (54 vs 51 years), there were more men than women (78% vs 68%), and they had a mostly rural practice (63% vs 16%). Although a higher incidence of wounds seen in rural areas could be expected20 (because of the remoteness of the emergency department), this study showed the opposite . The small sample and lack of gp representativeness on the criterion of urban or rural practice may explain these results . However, the greater number of participating gps with a rural practice shows that they seem more concerned with this problem . The more autonomous patients behavior in rural areas was related to a medical shortage in urban areas in france; distance may also contribute to these results . In urban areas, a large number of patients and waiting times in emergency departments can provide the opposite behavior . This study shows the difficulties the gps had to assess a tetanus risk which are the same as those faced by emergency practitioners . In the gps opinion, the only parameter associated with a perceived high risk for tetanus was the patient s profession or choice of risky leisure activity . The clinical aspect of the wound was not identified as a risk factor . To our knowledge, the concept of tetanus risk has yet to be validated by a consensual definition, which can explain why these physicians developed their own conception of tetanus risk . This discrepancy has already been mentioned in another french study.5 with the perspective of better wound management, and in accordance with the principles of evidence - based medicine,21 tetanus risk identification based only on the physicians opinion is unlikely to continue in practice . Gathering information on their patients tetanus vaccination history this supports the results of the previous studies performed in emergency departments.5,7,2225 finding immunization information requires the medical attendants to access several sources (paper documentation or computerized reports), as currently 30% of patients are still unaware of their vaccination status . Electronic devices are being used more frequently in patients treatment, and as patient electronic medical recording has recently become compulsory (by now, more than 80%26 of gps participate), this might improve the recordkeeping of patients immunization status and their follow - up . Moreover, the new immunization schedule, based on age groups, will probably improve vaccination coverage in the future . It is difficult for a gp to assess a patient s tetanus risk and know their immunization status when they display one or more wounds, whatever the aspect of the wounds . Thus, under these conditions, immunochromatographic testing seems to be of a great interest for wound management in general practice . At present the tests are only available for emergency use in france . According to the incidence found in this study and the population of french gps, gps perform consultations on about 300,000 wounds each year . Among those wounds, 50,000 could be considered without any tetanus immunization.23 thus, immunochromatographic testing would be useful to avoid immunoglobulin injections as a preventive and more expensive therapy . However, immunochromatographic testing remains to be evaluated in that context in france . Easy to perform and inexpensive, its implementation in general practice may also optimize the economic management of wounds, as is done in emergencies departments . Above all, it is necessary to increase compliance with the recommendations of tetanus vaccination that could improve territorial coverage and vaccination follow - ups . This probably constitutes the best way for an effective primary prevention of wound - induced tetanus . The main problem of their management is the assessment of tetanus risk and vaccination, as information has not yet been collected on a centralized site . Immunochromatographic testing could be interesting as preventive therapy in that context, as it is not yet allowed in general practice in france . Above all, more information on vaccination follow - up and prevention are the best primary prevention.
|
Lithium salts have a long history of human consumption beginning in the 1800s . In psychiatry, they have been used to treat mania and as a prophylactic for depression since the mid-20th century . Today, lithium salts are used as a mood stabilizer for the treatment of bipolar disorder and also, off - label, for other psychiatric indications . For example, lithium is the only drug that consistently reduces suicidality in patients with neuropsychiatric disorders . Despite these effective medicinal uses, current united states food and drug administration (fda)-approved lithium pharmaceutics (lithium carbonate and lithium citrate) are plagued with a narrow therapeutic window that requires regular monitoring of plasma lithium levels and blood chemistry by a clinician to mitigate adverse events . Still, many patients undergoing lithium therapy find the side effects to be unbearable, which negatively affects compliance and discourages physicians from utilizing lithium . These problems arise because lithium s site of action is the brain, and current lithium salts cross the blood - brain - barrier slowly . As a result, there is unnecessary accumulation of lithium ions in peripheral organs, particularly in the kidneys and heart, where side effects can arise . Thus, multiple administrations throughout the day are required to safely reach therapeutic concentrations . Further, the patient must remain keenly aware of their hydration status as dehydration promotes a more rapid serum chemical imbalance with renal and cardiac toxicity . Unfortunately, the serum concentrations required to maintain therapeutic efficacy often lead to metabolic adverse effects such as hypothyroidism, hyperparathyroidism, weight gain, and nephrogenic diabetes insipidus . If supratherapeutic serum concentrations of lithium are achieved, lithium intoxication ensues . Patients with lithium poisoning can exhibit loss of consciousness, muscle tremor, epileptic seizures, and pulmonary complications . Because lithium is so effective at reducing manic episodes and suicidality in patients with bipolar disorder, it is still used clinically despite its narrow therapeutic index and serious side effects . Nevertheless, recent studies have identified many important bioactivities of lithium that may be responsible for its therapeutic efficacy in its current fda - approved indications and beyond . For example, lithium exerts neuroprotective effects, in part, by increasing brain - derived neurotrophic factor (bdnf). Chronic lithium treatment has been shown to increase the expression of bdnf in rats and humans . This increase in bdnf activity can lead to restoration of learning and memory deficits through promotion of neurogenesis and long - term potentiation (ltp). Another neuroprotective mechanism of lithium is attenuation of the production of inflammatory cytokines like il-6 and nitric oxide (no) in activated microglia . This is particularly important since aberrant microglial function is a common finding in a number of neuropsychiatric diseases . Moreover, recent lines of evidence have implicated bdnf and no in novel mechanisms for lithium s antidepressant effects . Lithium has also been found to inhibit certain enzymes in a noncompetitive manner by displacing the required divalent cation, magnesium . Two of these enzymes that have important implications in bipolar disorder are glycogen synthase kinase-3 beta (gsk-3) and inositol monophosphatase (impase). Gsk-3 was first identified as the molecular target of lithium by klein and melton . It functions by phosphorylating glycogen synthase, the rate - limiting enzyme of glycogen biosynthesis . Gsk-3 inhibitors like lithium generally produce antidepressant - like and antimania - like effects in animal models, which have been used to explain lithium s efficacy for bipolar disorder . Gsk-3 is expressed in all tissues, with particularly abundant levels in the brain . Therefore, this enzyme is thought to have tremendous potential as a therapeutic target for the treatment of a variety of neurological diseases that are characterized by dysregulated gsk-3 such as alzheimer s disease, hiv associated neurocognitive disorders, and autism spectrum disorders . In addition to inhibiting gsk-3, lithium also inhibits inositol monophosphatase (impase) leading to cerebral inositol depletion . Lithium, valproic acid, and carbamazepine, which are all used for stabilization of mood, have been shown to lead to the depletion of inositol . This has bolstered support for the inositol depletion hypothesis of lithium therapy and has highlighted this molecular target in the search for lithium mimetics . However, given the frequency of suicidality as a comorbidity in patients with bipolar disorder and that only lithium consistently reduces suicidality in these patients, it is doubtful that selective impase inhibitors will produce the desired clinical outcome that can be achieved with lithium . These lines of evidence imply that the antisuicidality effects of lithium are not solely attributable to impase inhibition / inositol depletion . That the solid - state structure and composition of an active pharmaceutical ingredient (api) critically impacts its drug delivery performance, especially its physicochemical properties, means that materials science plays a critical role in enabling the development of bioactive molecules as drug products . In this contribution, we report that a materials science strategy based upon crystal engineering can enable improvement of the therapeutic window of lithium while retaining the bioactivities of current fda - approved lithium solid forms . Our approach is based upon cocrystallization, which has gained the attention of both academia and industry in the past decade . Indeed, the fda has recently released regulatory guidelines for industry on pharmaceutical cocrystals . Almarsson and zaworotko have defined pharmaceutical cocrystals as co - crystals that are formed between a molecular or ionic active pharmaceutical ingredient (api) and a co - crystal former that is a solid under ambient conditions . Cocrystallization is of growing interest because these multicomponent materials that are based upon two or more further, they represent novel solid forms of apis that can improve the physicochemical properties (e.g., solubility and stability), improve efficacy (e.g., bioavailability), and provide a means for extending the life cycle of existing apis . Previously, we successfully used cocrystallization of two molecular coformers to improve the solubility and consequent bioavailability of the poorly soluble bioflavonoid quercetin and to conversely lower the pharmacokinetics of the highly soluble antioxidant epigallocatechin-3-gallate, egcg . The molecular cocrystals of quercetin and egcg that we studied were stabilized by hydrogen bonded supramolecular synthons, which are assumed to dissociate in vivo leaving therapeutically bioactive quercetin and egcg . Ionic cocrystals (iccs) have even more recently emerged as another class of multicomponent pharmaceutical materials (mpms) of scientific and practical interest . The general formula of iccs is therefore abn, where a is a cation, b is an anion, and n is neutral molecule or another salt . If one of the components of the icc is a pharmaceutical compound then there is considerable opportunity to modulate the physicochemical and biological efficacy of the pharmaceutical compound because there are two components that can be changed . This contrasts with single component crystals of pharmaceutical compounds, which have very limited opportunities for fine - tuning of materials properties, and other mpms such as simple salts, ab, and molecular cocrystals, ab, for which there is only variable component besides the pharmaceutical compound . Reported iccs of inorganic lithium salts, lib, with a series of amino acids, zwitterionic molecules, n, by exploiting the strength of lithium carboxylate bonds . In these iccs, the lithium cation (api) forms coordination bonds to the amino acid coformers and the inorganic anions remain in the composition to balance charge . Given that coordination bonds are stronger than hydrogen bonds we became interested in determining if the stronger bonding would affect the in vivo speciation of lithium and thereby modulate its therapeutic bioactivity and pharmacokinetics . We herein describe the synthesis of two novel iccs of organic anion salts of lithium with the amino acid coformer, proline . We assessed the blood and brain pharmacokinetics of this new speciation of lithium in rats and their therapeutic activities at several established targets of lithium therapy . Lithium salicylate (98% purity), lithium hydroxide (98% purity), nicotinic acid (98% purity), and proline (99% purity) were purchased from sigma - aldrich corporation (st . Louis, mo) and used as such without further purification . Lithium salicylate (98% pure, anhydrous, used as received from sigma aldrich, 1 mmol) and l - proline (99% pure, used as received from sigma aldrich, 1 mmol) were dissolved in 2.0 ml of hot deionized water . The resulting solution was maintained on a hot plate (7590 c) to allow slow evaporation of solvent until crystals had formed . Lithium hydroxide (98% pure, anhydrous, used as received from sigma aldrich, 1 mmol), nicotinic acid (98% pure, anhydrous, used as received from sigma aldrich, 1 mmol), and l - proline (99% pure, used as received from sigma aldrich, 2 mmol) were dissolved in 3.0 ml of deionized water and left to stand on a hot plate until block shape colorless crystals had emerged from solution . The x - ray diffraction data were collected using a bruker - axs smart - apexii ccd diffractometer (cu k, = 1.54178). The structure was solved using shelxs-97 (direct methods) and refined using shelxl-97 (full - matrix least - squares on f) contained in olex2 and wingx v1.70.01 programs . All non - hydrogen atoms, except disordered c29a and c29b, were refined anisotropically . Hydrogen atoms of ch, ch2, nh2, and oh groups were placed in geometrically calculated positions and included in the refinement process using riding model with isotropic thermal parameters: uiso(h) = 1.2ueq (ch, ch2, nh2), uiso(h) = 1.5ueq(oh). One of the l - proline rings is disordered over two positions in a 1:1 ratio . The crystal was a twin, and refinement was conducted with an hkl5 type file generated using the [1/0/0;0/1/0;0.14/0/1] twin law . The structure with probability ellipsoids is available in the supporting information (figure s4). Hydrogen atoms of the ch and ch2 groups were placed in geometrically calculated positions and included in the refinement process using riding model with isotropic thermal parameters: uiso(h) = 1.2ueq (ch, ch2, nh2). Hydrogen atoms of the nh2 group were found from difference fourier map inspection and were freely refined . The l - proline ring was found to be disordered over two positions with an approximate ratio of 0.7:0.3 . Crystallographic data is available in the cambridge structural database (ccdc 962324). The structure with probability ellipsoids is available in the supporting information (figure s2). Powder x - ray diffraction (pxrd) and differential scanning calorimetry (dsc) were used to confirm the purity of the cocrystal preparations . Pxrd patterns (from bulk samples) were compared to the calculated pattern (from the single crystal) and indicated that phase purity had been obtained (figure 3). Dsc indicated a clean single endotherm corresponding to the cocrystals . Prior to bioactivity and pharmacokinetics evaluation, purity was confirmed by preparing equimolar lithium solutions of lispro and lis and measuring lithium concentration using atomic absorption spectrometry . The dsc (figure s1) for lnapro is available in the supporting information . The dsc (figure s3) and aas (figure s5) data for lispro are available in the supporting information . Square grid network exhibited by lispro (a) and lnapro (b). Experimental versus calculated pxrd of lispro (a) and lnapro (b). Adult rat hippocampal neural stem cells (nsc, millipore) were treated with lispro or lis at 0, 1, and 5 mm for 40 h in a differentiation media . Cells were lysed using ripa buffer with protease inhibitors cocktail and subjected to immunoblotting analysis using an antibody against phosphorylated phospho - gsk-3ser9 (inactive form) or total gsk-3. Densitometry analysis was represented by ratio of phospho - gsk-3ser9 to total gsk-3 band intensity under wb from two independent experiments . T - tests were used to assess statistical significance in the ratio of phospho - gsk-3ser9 to total gsk-3. Mouse neuroblastoma (n2a) cells were grown in dulbecco s modified eagle s medium (dmem) supplemented with 10% fetal bovine serum (fbs) and 1% penicillin - streptomycin . Cells were plated in 24-well plate at a density 5 10 cells per well in dmem supplemented with 5% fbs and 1% penicillin - streptomycin . Twenty - four hours later, 1 and 10 mm of lithium as lithium salicylate (lis) or cocrystal (lispro) were added to each well and incubated for 48 h. after treatment, media were collected for brain derived neurotrophic factor (bdnf) enzyme linked immunosorbent assay (elisa) and cells were lysed for bicinchoninic acid assay (bca). Bdnf levels were measured in collected media with a bdnf sandwich elisa kit (millipore, cat . Shortly, samples were incubated in a mouse anti - bdnf monoclconal antibody coated 96-well immunoassay plate at 4 c, overnight on a shaker . The plates were thoroughly washed at least four times, and a biotinylated mouse anti - human bdnf monoclonal antibody was added to each well and incubated for 2.5 h at room temperature on a shaker . After washing, a streptavidin - enzyme conjugate solution was added and incubated at room temperature for 1 h on a shaker . After washing, a tmb / e substrate solution was added to the plates and inactivated after 7 min by adding the stop solution . The bdnf was detected immediately by measuring absorbance at 450 nm using a microplate reader . Bdnf concentration was analyzed based on the bdnf standard curve and normalized to total protein concentration as determined using a bca protein assay kit (pierce, rockford, il). Bv2 microglia cells were grown in dmem supplemented with 10% fbs and 1% penicillin - streptomycin . Cells were plated in 24-well plate at a density 5 10 cells per well in dmem with 10% fbs and 1% penicillin - streptomycin . Twenty - four hours later, 25 and 12.5 mm of lithium in dmem as lis or lispro were added to each wells and incubated for 30 min . The microglia were activated by the addition of 100 ng / ml or lps . Six hours later, media was collected and no was measured using a griess reagent system (promega, madison, wi) per the manufacturer s instructions . Adult rat hippocampal neural stem cells were obtained from millipore (billerica, ma) and grown in expansion media that contained 1 b-27 supplement minus vitamin a, 2 mm gibco glutamax, and 20 ng / ml bfgf in neurobasal a medium (all from gibco, carlsbad, ca). After neurospheres formed, cells were plated on 12 mm poly - l - lysine coated coverslips (bd biocoat, bedford, ma) at density 5 10 cells / well in 3 mm lis and lispro containing neurobasal a medium only . Differentiation was induced for 5 days at 37 c with 5% co2, and equal amounts of media was added to each well at day 3 . Cells were fixed with 4% paraformaldehyde (pfa, sigma - aldrich, st . Louis, mo) for 15 min at room temperature and washed with pbs for 5 min three times . Cells were then permeabilized with 1% triton x-100 in pbs for 10 min at room temperature . After washing with pbs for 5 min three times, cells were blocked with 1% bovine serum albumin (bsa, sigma - aldrich, st . Louis, mo) in 0.02% tween 20 containing pbs (pbst) for 10 min at room temperature with gentle shaking . Mouse monoclonal anti - tuj1 (covance, mms 435p, 1:2000) and rabbit polyclonal anti - gfap (abcam, ab7260, 1:1000) antibodies were diluted in the blocking buffer and incubated for overnight at 4 c with gentle shaking . After washing with 0.02% pbst 5 min for three times, goat anti - mounse alexa fluor 488 (1:250, green) and goat anti - rabbit alexa fluor conjugated 555 (1:250, red) (both from abcam, cambridge, ma) in blocking buffer nuclei were visualized by mounting with vectasheild hardset mounting media with dapi (vector laboratory, burlingame, ca). The animals were housed at the moffitt cancer center vivarium (tampa, fl) with a 12 h light dark cycle . The rats were allowed to acclimate for a period of one week before any experiments are carried out . The rats were dosed via oral gavage with 4 meq / kg elemental lithium as lispro or li2co3 dissolved in deionized water or suspended in 1% methylcellulose, respectively . Animals in each treatment group were euthanized at 2, 24, 48, and 72 h (n = 3/time point), and blood was collected by cardiac puncture and carefully perfused with a pressure - controlled pump to maintain microvasculature integrity before removing brain tissue . Blood was centrifuged at 1600 g at room temperature for 10 min, and plasma was separated . A 500 l aliquot was diluted 10-fold in a 5% tca and 10% ipa solution, vortexed, and allowed to sit for 10 min in order to precipitate proteins . These aliquots were centrifuged at 3000 g for 30 min, and the supernatant was transferred to clean tubes prior to measuring lithium content using atomic absorption spectroscopy (aas). Brains were rinsed with pbs and weighed, and then an equal volume of concentrated hno3 was added . The brains were heated in this nitric acid solution for 1 h, allowed to cool to room temperature, and then centrifuged at 3000 g for 1 h. the supernatant was removed and diluted 10-fold in 10% ipa prior to measuring lithium content using aas (shimadzu aa-6200). Peak height measurements were carried out referring to values obtained for standards of known concentrations . Single crystal x - ray structural analysis reveals that lispro contains four lithium cations, four salicylate anions, and four l - proline molecules in the unit cell . Each lithium cation is linked to adjacent lithium cations by four bridging carboxylate moieties, two from salicylate and two from l - proline (li o distances: 1.916(1), 1.915(1) and 1.875(1), 1.905(1)). The overall network can be described as square grids and is illustrated in figure 2a . The hydroxyl group of salicylate and protonated nitrogen of l - proline are involved in intramolecular and intermolecular hydrogen bonds (o ho: 2.558(1) and 2.641(1); n ho: 2.751(1), 2.745(1) and 2.874(1)) (table 2). The single crystal x - ray diffraction parameters of this and the other crystal structures reported herein are tabulated in table 1 . The crystal structure of lnapro reveals that the 1:1 icc crystallized in space group p21212 and that it contains four lithium cations, four nicotinate anions, and four l - proline molecules in the unit cell . Two carboxylate moieties of nicotinate and two carboxylate moieties of proline molecules bridge adjacent lithium cations (li o distances: 1.897(3), 1.897(3) and 1.920(3), 2.920(3)). The protonated nitrogen atoms of proline form hydrogen bonds with carboxylate moieties (n ho: 2.779(2) and 2.762(2)) (table 3). 1/2 x, 1/2 + y, 1 z. adult rat hippocampal neural stem cells (nsc, millipore) were treated with lispro or lis at 0, 1, and 5 mm for 40 h in a differentiation media and lysates subjected to immunoblotting analysis using an antibody against phosphorylated gsk-3 ser9 (phosph - gsk-3ser9) or total gsk-3. The results from this experiment are shown in figure 4 . Densitometry analysis was represented by ratio of phosph - gsk-3ser9 to total gsk-3 band intensity under western blot . The results of two independent experiments are shown in figure 4b as mean sem . T - tests revealed significant differences in ratio of phosph - gsk-3ser9 to total gsk-3 in 1 and 5 mm of both lispro and lis compared to control (* p <0.05, * * * p <0.001). However, there were no significant differences in the ratio of lispro and lis at equivalent concentrations, suggesting that iccs of lithium remain bioactive and are bioequivalent to inorganic salts of lithium . Lispro treatment increases phosphorylation of gsk-3 in adult rat hippocampal neural stem cells . Adult rat hippocampal neural stem cells (nsc, millipore) were treated with lispro or lis for 40 h in a differentiated media . (a) cells were lysed by ripa buffer with protease cocktails and subjected to immunoblotting (wb) analysis using an antibody against phosphorylated gsk-3 ser9 (phosph - gsk-3 ser9) or total gsk-3. (b) densitometry analysis from two independent experiments is represented by ratio of phosph - gsk-3 ser9 to total gsk-3 band intensity under wb . T - tests revealed significant differences in ratio of phosph - gsk-3 ser9 to total gsk-3 for 1 and 5 mm of both lispro and lis compared to control (* p <0.05, * * * p <0.001). These results are representative of two independent experiments with n = 2 for each condition . Mouse neuroblastoma (n2a) cells were treated with lis and lispro at 5 and 25 mm in dmem supplemented with 5% fbs for 48 h. bdnf quantification was determined via elisa kit . We found that both lis and lispro produced dose dependent increases in bdnf (figure 5). This provides further evidence that the lithium remains bioactive despite being in the icc form, lispro . Neuroblastoma cells were treated with lis and lispro for 48 h. bdnf was quantified in the media by elisa and normalized to total protein in the cell lysate by bca . T - tests revealed significant differences at 1 and 10 mm for lispro compared to the no treatment control (* p <0.05) and only at 10 mm for lis (* * p <0.01). There were no statistically significant differences between lis and lispro at either concentration (p> 0.05). Bv2 microglia cells were treated with lis and lispro at 12.5 and 25 mm in dmem for 30 min prior to activation of microglia by 100 ng / ml lps . No was measured in the media 6 h later using a griess reagent system . Further, lithium treatment (both as lis and lispro) attenuated this proinflammatory response . At 25 mm, both lithium forms completely inhibited no production . At 12.5 mm, we found lispro to be more effective than lis at attenuating no production in these lps - activated microglia . This supports the bioactivity of lispro and suggests that, in some instances, it may be advantageous to the parent salt form, lis . Bv2 microglia were pretreated with lis and lispro at 25 and 12.5 mm for 1 h prior to being activated by the addition of 100 ng / ml lps . The no treatment, no lps control group produced very low (basal) levels of no . The lithium treatments abolished no production at 25 mm and reduced it at 12.5 mm with lispro being advantageous at this concentration . Statistical significance from the no treatment with lps control was assessed by t - tests (* p <0.05, * * p <0.01, * * * p <0.001). Lithium has been shown to promote neuronal differentiation of hippocampal progenitor cells . To test whether lispro possessed this bioactivity, we treated adult rat hippocampal neural stem cells with lithium as lis and lispro at 3 mm for 5 days . Immunocytochemistry studies indicated that, compared to the no treatment control group (figure 7a), both lis (figure 7b) and lispro (figure 7c) did indeed promote differentiation of the progenitor cells into neurons over the course of the experiment . Adult rat hippocampal neural stem cells were cultured with neurobasal media only (a), neurobasal media with 3 mm lis (b), and neurobasal media with 3 mm lispro (c). Blue dapi staining indicates nuclei, red gfap staining indicates astrocytes, and green tuj1 indicates neurons . Dawley rats weighing 200250 g were dosed via oral gavage with 4 meq / kg elemental lithium as the icc lispro dissolved in deionized water or lithium carbonate (li2co3) suspended in 1% methylcellulose . Animals in each treatment group were euthanized at 2, 24, 48, and 72 h (n = 3/time point), and blood and brain were collected . The plasma pharmacokinetics of li2co3 produced a sharp peak and rapid elimination with nearly undetectable levels at 48 h (figure 8a). This produced a concomitant spike in brain lithium levels at 24 h (figure 8b). Lispro produced elevated lithium plasma levels at the earliest time point (2 h) (figure 8c). The plasma lithium levels peaked at 24 h and remained elevated at 48 h before becoming almost undetectable at 72 h. lispro produced steady brain levels of lithium at 24 and 48 h (figure 8d). The compilation of lispro versus li2co3 plasma (figure 8e) and brain (figure 8f) pharmacokinetics reveals some distinct differences between the icc and salt forms . Although lispro produced very steady lithium plasma and brain levels out to 48 h, it was at the cost of bioavailability, which was clearly reduced compared to li2co3 in both the plasma and brain compartments . Male rats (n = 3 per formulation per time point) were dosed with 4 meq / kg of lithium via oral gavage as lispro or li2co3 . Plasma and brain lithium levels were determined at 2, 24, 48, and 72 h by atomic absorption spectrometry . (a) li2co3 plasma lithium concentration versus time (mean sem). (b) li2co3 brain lithium per gram of wet weight versus time (mean sem). (c) lispro plasma lithium concentration versus time (mean sem). (d) lispro brain lithium per gram of wet weight versus time (mean sem). (e) compilation plasma lithium concentration versus time (mean sem). (f) compilation brain lithium concentration versus time (mean sem). In regard to the therapeutic activity of various lithium salts for the treatment of bipolar disorder, equivalence is often assumed because the lithium cation is regarded as the api . Our bioactivity assessments of a new lithium icc compared to the parent lithium salt supports this assumption only for the clinically relevant end points that we evaluated in vitro . Importantly, because the molecular ideology of bipolar disorder is not fully understood, we cannot conclude that various forms of lithium will be equally effective at treating bipolar disorder in vivo . However, in this regard, we note that certain lithium salts alone might offer significant benefits from an efficacy and/or toxicity standpoint . To our knowledge, there have been no side - by - side clinical evaluations of the therapeutic efficacy of the lithium salts that we utilized here . However, empirical evidence suggests that some of the anions might be therapeutically synergistic with lithium for the treatment of bipolar disorder . For example, a recent pharmacoepidemiological study suggests that acetylsalicylic acid (aspirin) might be beneficial as an adjunct treatment with lithium salts for the treatment of bipolar disorder . The anion in lispro, salicylic acid, is the primary bioactive metabolite of aspirin . Reported that low - dose aspirin produced significant reduction in the relative risk of clinical deterioration in subjects on lithium and that this was not the case with other nsaids and glucocorticoids . The authors hypothesize that this is due to synergistic anti - inflammatory actions of lithium and acetylsalicylic acid by increasing the brain concentrations of 17-oh - dha, an anti - inflammatory brain dha metabolite . This hypothesis is supported by previous studies that demonstrated neuroinflammation in bd, that aspirin increases 17-oh - dha, and that lithium reduces neuroinflammation . Lithium nicotinate has been used in russia for the treatment of alcoholism and stress . This lithium salt is distinguished by low toxicity and good tolerance . Collectively, these findings suggest that lithium salicylate and lithium nicotinate might be advantageous to current fda - approved lithium salts from efficacy and toxicity standpoints, respectively . As such, they are ideal as building blocks for the next generation of lithium therapeutics . Conversely, other lithium salts should probably be avoided for pharmaceutical applications . In two recent communications, wouters et al . And braga et al . Reported new iccs of lithium chloride and lithium bromide with racetams . Although racetams generally possess good toxicity profiles and might prove to act synergistically with lithium, bromide salts have been known to cause serious side effects that were coined bromism . This illustrates the importance of considering the safety of all components during crystal engineering studies that involve pharmaceutical materials . Development of multicomponent salt forms as apis for the treatment of bipolar disorder would require high monetary investment and development of such drug products would therefore have to be enabled through exclusive intellectual property protection . Moreover, they are known to modify the physicochemical properties and pharmacokinetics of an api . In our experiments, we synthesized and characterized novel iccs of lithium salicylate and lithium nicotinate with the amino acid proline . Lispro was selected for efficacy and pharmacokinetic evaluations due to the likelihood for additive or possibly even synergistic effects in treating neuropsychiatric diseases due to the biologically noninert anion, salicylic acid . To our knowledge, this represents the first biological assessment of what is likely to become a very important class of pharmaceutical materials (iccs). Our findings suggest that this change in speciation did not negatively affect the in vitro bioactivity of lithium at established targets for the treatment of neuropsychiatric disorders relative to the corresponding parent lithium salt . Furthermore, this is the first report of the pharmacokinetics of a cocrystal of a suspected bcs class i api as defined by amidon et al . Compared to an fda - approved lithium salt, lithium carbonate (li2co3), in addition to being more efficacious by exploiting potential synergies, lispro may also offer a better safety profile due to unexpected pharmacokinetic changes . We found that a 4 meq / kg dose of lispro to rats provided consistently elevated levels of lithium in the plasma and brain out to 48 h. conversely, li2co3 was almost undetectable at 48 h in the plasma and produced a large spike in the plasma and brain at 24 h post dose . This type of pharmacokinetic profile can contribute to the toxicity of lithium given its narrow therapeutic window . Indeed, lippman and evans suggested that an ideal lithium preparation would attenuate high blood level peaks and exhibit gradually declining blood concentrations . This has been the driving logic behind the development and evaluation of many controlled release formulations . Recently, emami et al . Evaluated the pharmacokinetics of a proprietary sustained - release li2co3 formulation compared to eskalith cr, the fda approved controlled - release li2co3 formulation, and conventional li2co3 in man . They found that the plasma spike produced by conventional lithium carbonate was greatly reduced in their proprietary formulation and eskalith cr and conclude that this could be used to reduce the frequency of dosing and improve patient compliance . The pharmacokinetics exhibited by our icc of lithium salicylate, lispro, is very similar to those in controlled release formulations . This apparent pharmacokinetic advantage of lispro compared to conventional lithium carbonate was unexpected . Although serendipitous in nature, this finding could be key in creating the next generation of lithium therapeutics . If these pharmacokinetic changes can be used to modify the dosing regimen for lithium therapy, this could improve patient compliance and reduce toxicity . Future studies are required to evaluate potential toxicity and efficacy advantages in vivo during maintenance lithium therapy conditions . Since we have attained a more attractive in vivo pharmacokinetic profile and equivalent in vitro bioactivity at key therapeutic points, it would be quite significant if we could alleviate side effects in vivo or exploit synergistic activities with these or other lithium iccs . Specifically, future studies are required to assess safety and efficacy advantages of lithium iccs in vivo . Indeed, these findings represent an important initial step in the crystal engineering enabled development of the next generation of lithium therapeutics.
|
H3.3 is incorporated throughout the cell cycle [2, 4], particularly in regions of the genome in which histones need to be displaced, such as transcribed genes or regulatory elements [5, 6]. Incorporation in these contexts depends on the histone chaperone hira and helps maintain chromatin structure by filling gaps left by loss of h3.1/h4 [5, 8]. H3.3 deposition at transcriptionally active loci has also been proposed to help maintain active expression, possibly by creating a more accessible chromatin structure [2, 9]. However, h3.3 is also incorporated in some repressed loci and at telomeres and pericentric heterochromatin, where deposition depends on the atrx - daxx chaperone complex [1012]. Although h3.3 is not essential for transcription in drosophila, its loss results in significantly decreased fertility and reduced viability during embryogenesis . Mouse embryonic stem cells with no h3.3b and depleted of h3.3a exhibit altered regulation of polycomb - dependent gene expression that interferes with their ability to differentiate . Mice lacking h3.3b exhibit a semilethal phenotype with reduced growth, anaphase bridging, and karyotypic abnormalities . Recently, h3.3 has also been implicated in the response to ultraviolet (uv) irradiation, because its chaperone hira is required to promote transcription restart after uv damage . In order to examine the effect of complete loss of h3.3 in a differentiated vertebrate cell line, we created an h3.3 null variant of the chicken bursal lymphoma dt40 . In chicken, as in mammals, h3.3 is encoded by two loci, h3.3a on chromosome 18 and h3.3b on chromosome 3 . Despite considerable divergence of the cdna sequence of h3.3a and h3.3b, they encode identical proteins, which also have the same sequence as human h3.3 . Rna deep - sequencing analysis (rna - seq) of dt40 revealed that h3.3b contributes over 90% of the total pool of h3.3 transcript in chicken dt40 b cells (figure 1a). To create h3.3 null dt40 cells, we first disrupted both alleles of h3.3b by homologous recombination using a targeting strategy that removed the majority of the coding sequence (figure 1b; supplemental experimental procedures available online). This resulted in a substantial reduction of total h3.3 protein levels (figure 1c), as predicted by the rna - seq data (figure 1a). We then disrupted both alleles of h3.3a by removing the whole h3.3a coding sequence (figure 1b). H3.3 cells proliferate more slowly than wild - type (c. 15 versus c. 11 hr; figure 1d). Their unperturbed cell - cycle profile suggests that this is at least in part explained by an increase in spontaneous apoptosis (figure 1e). We next examined the extent of transcriptional dysregulation in cells lacking h3.3 by rna - seq . This analysis revealed that 557 of 16,396 gene transcripts (3.4%) exhibited a> 2-fold and significant (p <interestingly, the number of genes exhibiting a significant decrease in expression (235) is actually slightly exceeded by those increasing in expression (324), supporting recent evidence that h3.3, or its modifications, is not just important for actively expressed loci [12, 14]. We observed no underlying pattern to the chromosomal locations of affected genes (figure s1). Thus, loss of h3.3 is linked to significant changes in gene expression, but affects a relatively small fraction of loci in dt40 cells . In addition to being incorporated during transcription, recent experiments have shown that h3.3 is deposited at sites of uv - induced dna damage by the histone chaperone hira, where it facilitates the recovery of transcription after repair of the damage . H3.3 cells were modestly, but consistently, hypersensitive to uv irradiation (figure 2a). This is unlikely to be a secondary effect, because no known dna damage response genes exhibited significantly dysregulated expression in h3.3 cells (table s1). Further, the sensitivity of h3.3 cells to uv light was reversed by stable expression of h3.3 c - terminally tagged with gfp (figure 2a; figure s2). In fact, ectopic expression of h3.2 appeared to cause further sensitization to uv, as previously observed in yeast . Because h3.3 has been implicated in processes related to nucleotide excision repair (ner), we examined its genetic relationship to ner by performing epistasis analysis of h3.3 with xpa, a key component of the ner pathway . Xpa dt40 cells are highly sensitive to uv light, considerably more so than h3.3 (figure 2b). A double h3.3/xpa mutant was no more sensitive than xpa alone, suggesting that xpa may be epistatic to h3.3 and that h3.3 acts to facilitate excision repair of a subset of uv lesions . However, although the uv colony survival assay has the dynamic range to detect additional sensitivity over and above that of the xpa mutant (figure 2b), the very large difference in the sensitivities of the h3.3 and xpa mutants means that epistasis in this instance must be interpreted with some caution . H3.3 differs at two sites from h3.2, the single canonical h3 in chickens (figure 2c). S31, in the n - terminal tail region and an alanine in h3.2, has been reported to be phosphorylated during mitosis, although the function of this modification is not yet understood . H3.3 also has three residues at the base of helix 2 that differ from h3.2 . These are a87/i89/g90, which are s87/v89/m90 in h3.2 (hereafter referred to as thus, the aig patch is required for binding of h3.3 to daxx and is required for replication - independent chromatin deposition [2, 4], that is dependent on hira . We created h3.3 clones stably expressing h3.3-gfp carrying either a substitution of the aig patch with the svm patch of h3.3 or an s31a substitution and ensured matched expression levels by monitoring gfp by flow cytometry (figure s2). Neither the aig patch nor s31a h3.3 mutants complemented the uv hypersensitivity of h3.3 cells (figure 2d), suggesting that the chaperone binding specificity of h3.3 and a serine at position 31 are required . A potentially phosphomimetic substitution of s31 with aspartic acid also did not complement the uv sensitivity of h3.3 cells (h3.3[s31d]; figure 2e). Recently, mutations in the n - terminal tail of h3.3, in the vicinity of s31, have been linked to a number of pediatric cancers, including glioblastoma, chondroblastoma, and giant cell tumors of bone [1921]. Understanding the mechanistic basis for the clinical effects of these apparently driver mutations has focused on their effects on posttranslational modifications of h3 . Thus, mutations at g34 affect the global distribution of h3k36me3 and changes in gene expression . Likewise, mutation of h3.3k27, a residue whose trimethylation is associated with polycomb complex - mediated transcriptional repression, results in reduced global h3k27me3 and derepression of multiple transcripts . Because s31 lies close to these residues, we wondered whether the cancer - associated mutations k27 m, g34r, and g34v [19, 20] might also confer sensitivity to dna damage . Interestingly, all three h3.3 mutants exhibit uv sensitivity similar to the h3.3 knockout, suggesting that these residues are also required for the role played by h3.3 in facilitating excision repair (figure 2e). This somewhat surprising result suggests the possibility that h3.3 cancer - associated mutations could impact on dna repair as well as on transcriptional regulation, a point that merits further exploration . Although the deposition of h3.3 is primarily replication independent, we asked whether the absence of h3.3 affected replication by monitoring fork progression in stretched dna fibers . We pulse labeled cells sequentially with two different halogenated nucleosides (iododeoxyuridine and chlorodeoxyuridine; 20 min each), stretched the extracted dna on glass slides, and revealed the replicons with antibodies specific for the halogenated nucleotides (figure 3a). We observed a small, but not significant, decrease in median fork velocity in h3.3 cells but no change in replication origin density (figures s3a s3c). However, after uv irradiation, applied at the same time as the second label, replication fork progression in the second 20 min was dramatically reduced in h3.3 cells in comparison to wild - type (figures 3b and 3c). It is likely that at least some of these forks remain persistently blocked, because a greater fraction of h3.3 cells accumulate in late s phase 24 hr after uv exposure, suggesting a delay in completion of replication (figure s3d). The delayed fork progression following uv exposure in h3.3 cells was reduced to wild - type levels by expression of h3.3-gfp but not h3.2-gfp (figure 3c). Although this defect is reminiscent of cells lacking the translesion polymerase rev1 [25, 26], we could observe robust translesion synthesis of uv (6 - 4) photoproducts in xpa / h3.3 cells using a replicating plasmid assay and, further, the frame infidelity characteristic of photoproduct bypass in rev1-deficient cells was not evident (figures s3e thus, delayed replication fork progression after uv damage in h3.3 cells does not appear to result from a significant defect in rev1-dependent translesion dna synthesis . We then asked whether the role of h3.3 at the replication fork was also dependent on both the aig patch and s31, as for uv sensitivity . Whereas the aig - to - svm patch mutant failed to complement the defective fork progression after uv (figure 3c), the h3.3[s31a] mutant restored wild - type behavior (figure 3c), as did the cancer - associated mutants g34v, g34r, and k27 m (figure 3d). In view of the apparent epistasis of h3.3 and xpa, we considered whether the delayed fork progression in h3.3 cells reflected defective excision repair . However, h3.3 cells exhibit a much more prominent defect in fork progression after uv than xpa cells, the response of which is similar to wild - type (figure 3e). This is not consistent with the fork progression defect seen after uv in h3.3 cells resulting from defective ner at the fork, an event that in any case would likely be deleterious to cell survival due to strand incision at the lesion causing replication fork collapse . Finally, we asked whether the role of h3.3 in the response to uv was also seen with other forms of dna damage . In addition to uv, h3.3 cells exhibit mild hypersensitivity to the interstrand crosslinking agent cisplatin and the alkylating agent methyl methanesulfonate (mms) but not to x - rays (figures 4a4c). In the case of cisplatin, both the aig patch and n - terminal tail mutants discussed above exhibit hypersensitivity (figures 4d and 4e), as observed with uv . However, for neither cisplatin nor mms is there any exacerbation of the delay in fork progression induced by these agents (figures 4f and 4 g), a point we consider further below . Our observations provide the first clear evidence of the involvement of a variant histone in replication fork progression, and suggest that forks require a supply of h3.3 when they encounter uv damage to maintain processive replication . Although our experiments are not able to show directly that h3.3 is incorporated by the replication fork during replication of uv dna damage, by analogy with the effect of histone supply on bulk dna replication, we suggest that the defective fork progression in h3.3 cells is a result of failure of a process that would normally see h3.3 incorporated . We speculate that h3.3 incorporation during the replication of uv lesions at the fork, and possibly during postreplicative lesion bypass, may facilitate subsequent access and repair (figure s4). Hira would seem to be a strong candidate given its documented role in h3.3 incorporation at sites of uv damage, although the same study reported that hela cells depleted for hira are not uv sensitive . Whether atrx plays any role in replicating uv - damaged dna is unknown, but it has been implicated in the replication of g quadruplex dna and, recently, atrx - deficient cells have been shown to exhibit replication defects, suggesting that it contributes to limiting fork stalling during s phase . Although cells lacking h3.3 are sensitive to uv, mms, and cisplatin, a fork progression defect, as assessed in labeled dna fibers, is only observed after uv exposure . This suggests a broad requirement for h3.3 in facilitating dna repair, but that incorporation of this histone variant may not only take place on the fly at the replication fork when it encounters dna damage but also, for instance, during lesion bypass in postreplicative gaps . Loss of this latter role would not be detectable as a defect in the dna fiber assay . The basis for this specificity remains unclear, but we speculate that it may be related to the mechanisms and complexes cells bring into play at different lesions, which in turn may affect the timing of lesion bypass . Indeed, such damage - dependent specificity is now well documented in translesion synthesis and, recently, damage caused by uv and by mms has been shown to induce quite distinct bypass responses in human cells . However, much further work is needed to understand the contexts in which h3.3 is required for processive replication of damaged dna . Finally, how might h3.3 incorporation facilitate subsequent dna repair and survival? Because it has been proposed that h3.3-containing chromatin has a more open and accessible structure, its incorporation may be particularly important for promoting ner in highly condensed regions of the genome . Additionally, the damage sensitivity of the h3.3 cells may also be related to its ability to promote transcriptional recovery after repair, possibly through its ability to interact specifically with components of the fact chromatin remodeling complex, which has itself been implicated in transcriptional recovery after ner and in resistance to uv damage . A.f . Performed the experiments, analyzed the data, and wrote the paper . T.l . With a.f . Performed the uv dna fiber analysis . Performed the cell - cycle analysis and global analysis of replication by dna combing and analyzed the rna - seq data.
|
Rheumatoid arthritis (ra), as other autoimmune systemic diseases, is associated with increased cardiovascular morbidity and mortality, mostly attributable to accelerated atherosclerotic process . Data in the literature demonstrated that inflammatory nature of ra contributes to the excess of atherosclerosis observed in this disease . Rheumatoid synovia and atherosclerotic plaque share a common inflammatory cellular and molecular milieu characterized by an activated endothelial phenotype, expression of the same pattern of adhesion molecules, cytokines, and infiltrating leucocytes . Impairment of endothelial function represents the earliest and reversible stage of atherosclerotic plaque formation, originating from the loss of protective antioxidant and anti - inflammatory systems . Integrity of vascular endothelium is essential for arterial wall functions and homeostasis, and its dysfunction represents the key event which subsequently leads to vascular wall disorders . Less than twenty years ago, asahara and coll firstly identified endothelial progenitor cells (epcs) as precursors circulating in peripheral blood, mobilized form bone marrow, and able to differentiate in situ into endothelial cells; such cells contribute to the recovery of injured endothelium, thus, limiting atherosclerotic plaque formation [68]. Mobilization and differentiation of the epcs is known to be regulated by nitric oxide (no) produced through the activation of the endothelial no synthase (enos). An inverse correlation between the number of epcs and the framingham risk factor score has been demonstrated, and defective number and function of these cells have been found in different clinical conditions associated with an increased cardiovascular risk . Endothelial dysfunction has been documented in both long - standing and early ra patients [12, 13] with doppler ultrasound assessment of brachial artery flow - mediated dilatation (fmd) or evaluation of artery wall stiffness . An improvement of endothelial function after treatment has been demonstrated by several authors [1519]. Patients with ra also show a reduced number of circulating epcs, which inversely correlates with disease activity and seems to be responsive to glucocorticoids . Moreover, an association between the endogenous enos inhibitor asymmetric dimethyl arginine (adma) and the number of circulating epcs has been detected in ra patients who have no other cardiovascular risk factors . To date, anti - tnf agents represent a milestone of ra treatment . Given the evident role of tnf in atherosclerosis, a beneficial effect of tnf inhibition has been postulated; however, observational studies and data form registries did not always demonstrate a decrease in cardiovascular events . Long - term controlled studies, directly evaluating the effect of this class of drugs on atherosclerotic process progression, are needed . The aim of our study was to investigate the effect of short - term subcutaneous administration of anti - tnf drugs on epcs number in patients with active ra . Consecutive patients affected by ra according to 1987 criteria, designated to start subcutaneous anti - tnf drugs, were recruited from the biological drugs - dedicated outpatient clinic of the rheumatology unit of sapienza university of rome . All patients signed an informed consent before entering the study . At recruitment, demographic and clinical data, and patients and controls were excluded in case of a diagnosis of cardiovascular diseases, chronic kidney failure, dyslipidemia, and/or diabetes . Before starting anti - tnf, patients were screened for latent tuberculosis and hepatitis virus b and c. ra disease activity was evaluated at baseline, and after 3 months of anti - tnf treatment, by 28-joint disease activity score (das28). Heparinized vials were used to test epcs on the same day of the blood draw . The remaining samples were centrifuged at 3000 g for 10 minutes at room temperature and serum collected and frozen at 80c until analyzed . As for control group, blood samples from healthy subjects were collected on the same day of baseline patients' visit . Peripheral blood mononuclear cells (pbmcs) were obtained by density gradient centrifugation (lympholyte - h; cedarlane laboratories, hornby, ontario, canada), and phenotypic characterization was performed as previously described by vasa et al . . In brief, after incubation with fcr - bloking reagent (miltenyi biotec, bergisch - gladbach, germany), cells were incubated for 30 min on ice with phycoerythrin (pe)-labeled mab anti - cd34 (bd immunocytometry systems, san jose, ca) and allophycocyanin (apc)-labeled mab anti vegf r2/kdr (r&d systems, minneapolis, mn). Acquisition was performed on a facs calibur (bd immunocytometry systems) and included 100.000 to 400.000 events per sample . Epcs were defined as to cd34/kdr double - positive cells, and their number was expressed as a percentage of cells within the lymphocyte gate [21, 23]. Adma serum levels were detected by a commercial human enzyme linked immunosorbent assay (elisa) kit (vinci biochem, florence, italy), according to manufacturer's instructions . Flow mediated dilation in response to reactive hyperemia (endothelium dependent vasodilatation) was evaluated on brachial artery by employing a high - resolution b - mode doppler (atl hdi 5000 with a 7.4 mhz linear - array transducer) and following the guidelines published by the international brachial arterial reactivity task force . All subjects were evaluated fasting between 8 and 11 am, in a quiet and stable temperature environment . A straight, nonbranching segment of the brachial artery 515 cm above the antecubital fossa was identified by a b - mode longitudinal scan . Vessel diameter was recorded in a segment with clear anterior and posterior intimal interfaces between the lumen and vessel wall at rest and during reactive hyperemia . A blood pressure cuff was then inflated around the forearm to a supra - systolic pressure (at least 50 mm hg above the systolic pressure to occlude arterial inflow) for the standardized length of 5 minutes . Measurement of the maximal diameter of the artery was taken 45 to 60 seconds after cuff release . Absolute fmd was expressed as: (postdeflation diameter - resting diameter); fmd relative values were also calculated as percent change from the baseline diameter as follows: 100% ((postdeflation diameter resting diameter)/resting diameter). Two cardiologists (fc and la), blinded to participants' clinical data, interpreted the ultrasound results using an offline method . The intra- and interobserver variability of the fmd were calculated within the study population by plotting the patients' fmd estimates from each measurement against the estimates by two independent measurements . The intra- and interobserver variability were 4.2% and 5.1%, respectively . In order to evaluate the readers' ability to identify positive results, 15 hypertensive patients with known coronary artery disease the study was designed to investigate the effect of short - term subcutaneous anti - tnf therapy on the amount of circulating epc in ra patients . The study protocol was approved by the institutional review board of policlinico umberto i, sapienza university of rome . We recruited 17 ra patients (14f:3 m, mean age 50.4 + 14.4 years, range 2668 years) with long - standing disease (mean disease duration 103 104,4 months, range 24360) who were designed to start a subcutaneous anti - tnf drug . Fourteen were treated with etanercept 50 mg / week / subcutaneously and 3 with adalimumab 40 mg / every other week / subcutaneously . At the time of enrollment, all patients were taking glucocorticoids; none of the patients increased steroid dose during the followup . Clinical characteristics of ra patients at baseline and after 3 months of anti - tnf treatment are reported in table 1 . After 3 months a significant decrease in das28 (versus baseline values) was recorded (p = 0.001). At baseline, the percentage of circulating epcs was significantly lower in active ra patients than in healthy subjects (0.01 0.02% versus 0.05 0.03%, p = 0.001). At 3 months followup, the number of epcs was significantly higher compared to basal values (from 0.01 0.02% to 0.05 0.04%, p = 0.0006 versus baseline; p = n.s . Versus healthy subjects) (figure 2). No significant correlation between epcs and das28 values was detected (p = 0.056); however, an inverse correlation between mean increase in epcs number and mean decrease of das28 after 3 months of anti - tnf therapy was observed (r = 0.56, p = 0.04) (figure 3). Moreover, epcs number inversely correlated with adma serum levels (r = 0.41, p = 0.022) (figure 4). No other correlations between epcs and clinical characteristic nor fmd values were detected . At baseline, after 3 months of anti - tnf, adma serum levels significantly decreased below the values detected before treatment, (0.47 0.04 versus 0.64 0.12 mol / l, p = 0.001). Mean fmd at baseline was 8, 25 0.09% in ra patients, and 4.3 + 0.7% in positive controls (p = 0.001). At 3 months followup, a not significant increase of fmd was observed in ra patients (8, 70 0.06%, p = 0.49 versus baseline). However, even after anti - tnf administration, mean fmd was below the normal value of 10% . The results of our study demonstrate that short - term treatment of ra with tnf inhibitors is associated to an increase in circulating epcs concurrently to a proportional decrease of disease activity; these findings suggest that therapeutic intervention aimed at suppressing the inflammatory process might also positively affect the health of endothelial barrier . In ra patients, traditional risk factors, genetic predisposition, and inflammatory mechanisms are now recognized to act synergistically in determining the increased risk of subclinical atherosclerosis and consequent cv events [25, 26]. Systemic inflammation is responsible for a proatherogenic profile characterized by oxidative stress, lipid abnormalities, insulin resistance, hypercoagulable state, and upregulation of proatherogenic inflammatory leucocytes each contributing to endothelial injury . Healthy endothelium represents the main regulator of vascular tone, inflammation, and remodeling; consequently, a loss of its function initiates the atherosclerotic process which ultimately leads to the development of the plaque . Different cardiovascular risk factors act on endothelial cells inducing senescence and apoptosis, thus, determining endothelial dysfunction . Growing evidence suggests that epcs circulating in peripheral blood play a crucial role in endothelium repair . In ra patients, deficiency of circulating epcs number and functions has been proven [20, 21, 28, 29]. An in vitro study demonstrated that endothelial progenitor cells obtained from ra patients showed impaired migratory response to vascular endothelial growth - factor (vegf) and adhesive properties to mature endothelial cells after stimulation with tnf, when compared to cultured cells from healthy subjects . Other in vitro data demonstrated that tnf - alpha negatively affected proliferative, migratory, and adhesive capacity of human epcs . After tnf - inhibitor administration, a significant increase in adhesion property of epcs was detected . Concerning the number of circulating epcs, a reduction of peripheral blood epcs was described in ra . In their paper, herbrig et al . Aimed at evaluating, ex vivo and in vitro, number and function of endothelial progenitors in 13 patients with impaired endothelial function; all patients were treated with methotrexate, and 6 out of 13 were also taking anti - tnf drugs . The authors suggested two hypotheses explaining the alteration in epcs number and function: the inflammatory disease itself and the effect of methotrexate administration . When comparing the frequency of circulating epcs in patients with high or low disease activity, grisar et al . Observed a significant difference between subjects with active disease and those with low disease activity or in remission who showed epcs levels comparable to healthy subjects . Differently from the population studied by herbrig et al ., we enrolled long - standing ra patients with moderate - high disease activity (das28 3.2) nonresponders to standard disease modifying anti - rheumatic drugs (dmards) and eligible for anti - tnf therapy; in this population we detected a reduced number of circulating epcs compared to healthy subjects not correlating with disease activity . The homogeneity of our population did not allow any stratification based on disease activity status . In another population of moderately active ra patients, no correlation between circulating epcs and disease activity was found . Contrary to most published data on endothelial precursors in ra, few studies demonstrated a higher or similar number of circulating epcs in ra patients compared to patients with other systemic autoimmune diseases or healthy subjects [3234]. Endothelial precursors represent an extremely rare population among peripheral blood mononuclear cells, and this scarcity contributes to the difficulty in cell isolation and definition [35, 36]. An additional way to define epcs is to quantify their ability to proliferate by colony forming unit (cfu) assay . With this method, a depletion of peripheral endothelial progenitors was confirmed [20, 31, 34]. Interestingly, besides a decrease in circulating number, rheumatoid synovia seems to be enriched with epcs suggesting a role for these precursors in local vasculogenesis . Migration of endothelial precursor cells recruited from the peripheral blood through 41 integrin / vascular cell adhesion molecule (vcam)-1 might explain the depletion in peripheral blood which compromises the endothelial renewal, thus, beginning the atherosclerotic process . Serum levels of proinflammatory cytokines, such as il6, showed an inverse correlation with the number of circulating epcs in ra patients . Recently, in other condition characterized by endothelial impairment, even tnf showed an inverse correlation with the number of circulating epcs . Given the pivotal role of tnf in the pathogenesis of both ra and atherosclerosis, we aimed at investigating the effect of tnf inhibition on markers of endothelial function . A first observation of tnf effect on endothelial precursors in ra patients comes from an in vitro study in which the cytokine was demonstrated to impair the cfu formation activity of epcs, while the addition of tnf - inhibitor infliximab to cultured cells reversed this effect . Moreover, other in vitro data showed that tnf was able to stimulate expression of fractalkine on epc surface, which determines progenitor cell killing by natural killer cells . Further evidence of tnf - mediated effect on the number of circulating epcs was provided by ablin et al . Who demonstrated ex vivo a positive influence of infliximab administration; the authors investigated the effect of a single dose of the anti - tnf drug in 14 ra patients who were already treated with infliximab and methotrexate and observed a significant increase of epc number and adhesive function 14 days after drug infusion . The improvement of endothelial precursors after treatment was related to a statistically, even if not clinically, significant decrease in das28 score (from 5.1 1.4 to 4.2 1.1). A drug - mediated effect on epcs number or an indirect effect, working through a reduction of disease activity can be hypothesized; however, it should be considered that patients evaluated in the study were still moderately active after a single infusion of infliximab . One week treatment with intermediate doses of glucocorticoids was also associated to significant reduction of tnf levels and increase of epc numbers . To the best of our knowledge, the present study is the first one specifically designed to investigate short - term effect of repeated subcutaneous administration of tnf - inhibitor on epcs . Differently from a previous study investigating the potential effect of tnf inhibition, in our work we enrolled only ra patients who were naive to any biological drugs . We decided to select patients at their first course of anti - tnf drug in order to minimize potential confounding effect of circulating drugs . As expected, in our ra patients, 3 months treatment with tnf blockers as previously reported by others, parallel to a significant reduction in das28 score our patients showed a significant increase in percentage of circulating epcs which was inversely correlated with the extent of disease activity reduction . Whether the effect of anti - tnf on epcs increase is related to drug itself rather than indirectly mediated by the reduction of disease activity can be arguable . Normal number of progenitors previously detected in patients with low disease activity is in line with indications of reduced cardiovascular risk among ra patients effectively treated with methotrexate . However, methotrexate has demonstrated a proapoptotic effect on cultured endothelial precursors which could at least partially contribute to the decrease of circulating epcs seen in ra patients irrespective of disease activity status . Contrary to the study by ablin et al . At the time of first evaluation, all our patients were anti - tnf naive; however, similarly to this previous study, 10/17 (58,8%) were already treated with mtx so we cannot definitively exclude a contribution of this drug to the decrease of baseline epcs . In 2007 an inverse correlation between epcs and adma is an endogenous inhibitor of no synthase coming into the limelight as a biomarker of endothelial function . Elevated adma serum levels have been described in many conditions associated to increased cardiovascular risk, including long - standing and early ra [21, 44, 45]. Moreover, after effective ra treatment both with standard damrds and biological drugs, decreased adma serum levels were observed [44, 45]. In the present study, we confirmed a significant reduction in adma levels after 3 months of treatment with tnf - inhibitors . This is in line with previous observations that disclosed that anti - tnf blockade led to a decrease of the levels of endothelial cell activation biomarkers in patients undergoing anti - tnf- therapy because of severe disease refractory to conventional therapy . This result, together with the evidence of increased epcs, further suggests the ability of anti - tnf to reverse the effect of chronic low - grade inflammation on endothelial biomarkers in ra patients . Fmd is considered as a noninvasive, standardized method to investigate endothelial function . However, this ultrasonographic technique is limited by operator dependence, and it is related to the environmental conditions in which it is performed . This might explain the reason for nonsignificant improvement of fmd recorded in our patients even if we observed a significant improvement of biomarkers of endothelial function . Even if we detected a slight increase in fmd, the relative small cohort size may partially account for not reaching a statistically significant value . This small prospective study was designed to evaluate the effect of anti - tnf treatment of epcs in ra patients . The major shortcoming of this pilot study is the small size of the cohort evaluated and the relatively short followup . Further assessment of endothelial biomarkers on a wider and heterogeneous ra population and longer followup would confirm the result of our study and allow stratifying patients for cardiovascular risk . In conclusion, our results enhance the current knowledge on the impairment of endothelial biomarkers in ra, as evaluated by epcs and adma . An effective treatment with anti - tnf agents, aimed at reducing disease activity, seems to contribute to the improvement of endothelial barrier function . Such observation suggests a possible role of these drugs in reducing atherosclerotic damage by controlling inflammation.
|
Ng2 cells (neuron - glia chondroitin sulphate proteoglycan 2), also referred to as synantocytes, polydendrocytes, -astrocytes, oligodendrocyte precursor cells (opc) have been recognized as the fourth type of glial cells in the mammalian central nervous system, representing about 58% of the glial cell population . Morphologically, at light microscopy they resemble astrocytes, though their cell body is less rounded and cytoplasmic processes slender . At electron microscopy, ng2 cells show flattened nucleus with decondensed chromatin, well - represented cytoplasmic organelles and, where opposed to neurons, focal membrane densities . Opposite to astrocytes, ng2 cells do not express gfap nor s100 protein, but express the ng2 chondroitin sulphate proteoglycan, a membrane protein with a large extracellular domain, whose function is still obscure . In the central nervous system, ng2 cells can be found in both gray and white matter and have been proposed as resident oligodendrocyte and astrocyte precursors . Actually, their number increases in the vicinity of demyelization foci in some neuropathologies and after wound insult . On the other hand, ng2 cells do not express glutamate transporters, but have calcium - permeable ampa receptors, that cluster in apposition to nerve terminals, forming conventional synapses . This feature suggests that these cells must have a more complex function than to be a simple reservoir of oligodendrocytes or astrocytes . The cerebellum, which has a pivotal role in motor control, timing and learning, has been relatively neglected in studies concerning aging . In elderly people, movement and stability control are less efficient, with increasing fall risk and serious consequences and social costs . Here, we describe that ng2 cells are not evenly distributed in the rat cerebellum and that their distribution and morphology undergo changes during aging . Sprague dawley rats, aged 4 (3 animals) and 28 months (3 animals), purchased from harlan nossan (correzzana, italy) and maintained in standard conditions (12 h light / dark cycle, 23c temperature, food and water ad libitum) for few days were used . Experiments were performed in accordance with the italian and european community law for the use of experimental animals and were approved by a local bioethical committee . Animals were deeply anesthetized with chloral hydrate (0.35 g / g body weight) and perfused transcardially with 4% paraformaldehyde in pbs . Cerebella were excised, postfixed in the same fixative for 4 h and cryoprotected in 30% sucrose overnight . Two out of every 10 sections were processed for immunocytochemistry for ng2 chondroitin sulphate proteoglycan as follows . Briefly, after treatment with 3% h2o2 in 10% methanol in pbs and with 10% normal serum in pbs containing 0.1% nan3, the sections were incubated overnight with 1:200 rabbit polyclonal antibody against ng2 chondroitin sulphate proteoglycan (chemicon, billera, ma, usa). Afterwards the sections were incubated for 90 min in anti - rabbit biotinylated igg, followed by streptavidin - hrp complex (vectastain elite kit, vector, ca, usa). . Some adjacent sections from 28-month - old rats were processed for calbindin immunocytochemistry (with 1:5000 rabbit polyclonal antibody against calbindin, swant, ch) to check for the integrity of the cytoarchitecture . For the reaction control, some sections were incubated with normal rabbit serum instead of the primary antibodies . To quantify the changes in the cerebellar area in which ng2 glia was densely scattered, sections were photographed at low magnification and a morphometric analysis was performed using nih image j software . The total section area and the area in which ng2 cells were densely represented (relative area) were measured by outlining the contours . Since the total area of cerebellar sections can vary with age and among animals of the same group, the ratio between the relative and total areas was calculated to standardize data . In the cerebellar vermis of 4-month - old rats, ng2 cells appear to be unevenly distributed . In lobules vi to viii according to larsell ng2 cells are uniformly and densely scattered in all cerebellar layers, including the white matter (wm); their long, slender cytoplasmic processes extend to form a spider web - like structure throughout all the cerebellar cortex (figure 1a). On the contrary, in the more rostral and caudal lobules (i vi and ix x), only sporadic cells may be observed in the wm and the granule cell layer (igl), the majority of cells lying in the molecular layer (ml). In addition, they appear less intensely stained than in the more central lobules (figure 2a). In control reaction sections in fact, in mammals the central part of cerebellar vermis receives its main input from the cerebral cortex and is therefore called cerebrocerebellum . The anterior and posterior parts receive afferents primarily from the spinal cord and are therefore termed spinocerebellum . With regard to efferent connections, the cerebrocerebellum acts on the cerebral cortex and the spinocerebellum influences the spinal cord . In particular, the cerebrocerebellum receives information, via the corticopontine tract, about movements that are being planned and about commands that are sent out from the motor cortex . In response, it can modulate the activity of the motor cortex so that movements are performed accurately and smoothly . The high density of ng2 cells in the central lobules of the cerebellar vermis in the rat may therefore be due to a higher functional complexity of the cerebrocerebellum, which in turn requires a higher modulation from glial cells . The functional significance of this rapid communication between neurons and ng2 cells is still obscure, but it has been suggested that through synapses ng2 cells can monitor neuronal activity and act consequently, maybe by releasing neurotrophic substances . Figure 1a, b) representative sections of the cerebellar vermis of 4- and 28-month - old rats showing the distribution of ng2 cells . The cerebellar area in which ng2 cells are uniformly and densely scattered (dotted line) is enlarged in aging animals; c) a section from a 28-month - old animal incubated with normal rabbit serum instead of the primary antibody . Scale bar: 2 mm . A, b) representative sections of the cerebellar vermis of 4- and 28-month - old rats showing the distribution of ng2 cells . The cerebellar area in which ng2 cells are uniformly and densely scattered (dotted line) is enlarged in aging animals; c) a section from a 28-month - old animal incubated with normal rabbit serum instead of the primary antibody . Figure 2 in both 4- and 28-old rats, in the more rostral and caudal lobules of the cerebellum, ng2 cells are only sporadically present, mainly in the molecular layer . Inset in b: in the molecular layer of both 4-and 28-month - old animals, immunostained cells show irregular soma and long, slender processes, typical of ng2 glia . Scale bar a, b: 400 m; inset 20 m . In both 4- and 28-old rats, in the more rostral and caudal lobules of the cerebellum, ng2 cells are only sporadically present, mainly in the molecular layer . Inset in b: in the molecular layer of both 4-and 28-month - old animals, immunostained cells show irregular soma and long, slender processes, typical of ng2 glia . The distribution of ng2 cells in the cerebellar vermis of 28-month - old rats is similar to that observed in 4-month - old animals . However, the area in which ng2 cells are more represented and uniformly scattered (relative area) appears to be enlarged, involving also the lobule v and part of the lobule ix (figure 1b). Morphometric analysis revealed that the ratio between the relative and total areas of the sections is increased by 62% in aging animals (0.320.01 vs 0.520.02, in 4- and 28-month - old rats, respectively; p<0.0001). The expansion of the cerebellar area in which ng2 cells are densely represented in aged rats is an enigmatic finding . The spinocerebellum is somatotopically organized as well as its afferent fibers, so that signals from different body parts are kept segregated . The spinocerebellum is involved in the maintenance of the muscle tone and plays a role in the coordination of movements of walking . Taking into consideration that, if not exercised, muscle become hypotonic with aging, it is tempting to hypothesize that the increase in ng2 cells reflects a higher demand of neurotrophic factors or control from cerebellar neurons . Obviously, this is a hypothesis that needs to be tested in animals subjected to daily exercise (treadmill walking, for instance) to maintain muscle tone, and that will have an unconfutable answer only when the function of ng2 cells will be fully elucidated . In aged rats, in lobules i iv and ix x, ng2 cells are no more present in the igl and wm and in the ml they appear paler (figure 2b) than in young - adult animal . However, punctate immunoreaction product is present in correspondence with the apical pole and stem dendrite of purkinje cells (figure 3). The punctate reaction in lobules belonging to the spinocerebellum may represent profiles of hypertrophic ng2 cell processes that ensheath the soma and stem dendrite of purkinje cells . This is the cell region where climbing fibers from neurons of the inferior olivary complex form the majority of synapses with purkinje cells . The cerebellum/ inferior olivary complex system plays a major role as a comparator of sensory information and motor output . Climbing fibers inform about errors in the execution of a movement, so that the cerebellum can adjust it . In this view, since climbing fibers establish synapses with ng2 cells, also ng2 cells could be informed and modulate purkinje cell activity accordingly . On the other hand, it cannot be excluded that the punctate immunoreaction product represents extracellular product . In fact, the large ng2 proteoglycan ectodomain may be cleaved and released in the extracellular matrix . This would also explain the pale staining of ng2 cells residing in the ml in 28-month - old animals . Figure 3a) in the 4-month - old rat cerebellum, in the most rostral and caudal lobules, no immunoreaction product is present in the purkinje cell layer; b, c) representative photographs of portions of the most rostral and caudal cerebellar lobules in 28-month - old rats . Punctate immunoreaction product is visible at the apical pole of purkinje cells; d) particular of the most caudal cerebellar lobules in a section immunostained for calbindin from 28-month - old rat . Ml, molecular layer; pc, purkinje cell layer; igl, granule cell layer . Scale bar a, b, c: 20 m; d: 50 m . A) in the 4-month - old rat cerebellum, in the most rostral and caudal lobules, no immunoreaction product is present in the purkinje cell layer; b, c) representative photographs of portions of the most rostral and caudal cerebellar lobules in 28-month - old rats . Punctate immunoreaction product is visible at the apical pole of purkinje cells; d) particular of the most caudal cerebellar lobules in a section immunostained for calbindin from 28-month - old rat . Ml, molecular layer; pc, purkinje cell layer; igl, granule cell layer . Scale bar a, b, c: 20 m; d: 50 m.
|
The nonclassical hla - g molecule presents several properties that differ from other classical class i hla (-a, -b, and -c) molecules, including restricted tissue distribution; limited protein variability; presence of several membrane - bound and soluble isoforms; unique molecular structure, presenting a particular peptide - binding groove that impairs peptide presentation to t cells; ability to form dimers and polymers and a reduced cytoplasmic tail that impairs molecule turnover; and, most importantly, the molecule that modulates several functions of immune system cells (reviewed by). The interaction of hla - g with leukocyte receptors, particularly ilt-2 and ilt-4, downregulates the cytotoxic activity of t cd8 and natural killer cells and inhibits antigen presentation and lymphocyte proliferation [1, 2]. Due to all of these properties, hla - g has been recognized as a tolerogenic molecule, and the tissue expression of hla - g may protect or harm; that is, it may protect allografts against attack by the recipient immune system and may impair the cytotoxic immune response against tumor cells . The coding region exhibits few polymorphic sites randomly distributed along exons and introns, contrasting with the high rate of exonic polymorphic sites observed in classical hla class i genes . The exonic nucleotide sequences encoding residues that are important for molecule dimerization and molecule interaction with leucocyte receptors are usually conserved, indicating that the overall structure of the molecule was maintained throughout human evolution [1, 2, 4, 5]. Considering that hla - g is expressed on the surface of placenta trophoblast cells, allowing the fetus to properly develop despite the maternal immune response, some sort of functional conservation was expected . On the other hand, gene regulatory regions present several polymorphic sites close to nucleotide sequences that serve as gene regulatory elements [69]. Nucleotide variability in the promoter region may influence hla - g levels by modifying binding affinity for transcription factors . In contrast to classical hla class i genes, the promoter region of hla - g does not have responsive elements for ifn- or nf-b . Similarly, nucleotide variability at the 3 untranslated region (3utr) may influence hla - g mrna stability, microrna targeting, or both, affecting the posttranscriptional gene regulation . Considering that the structure of hla - g molecules has been maintained throughout evolution, the quantity of produced molecules may primarily depend on factors that modulate gene expression by transcriptional and posttranscriptional mechanisms . Firstly, we will review the structure of the hla - g promoter region and its implication in transcriptional gene control; secondly, the structure of the hla - g 3utr and the major actors of the posttranscriptional gene control; and, finally, the presence of elements in the coding region that may regulate gene expression and differential mrna splicing . There is no consensus regarding the positions of the nucleotide variation in the hla - g promoter and 3utr, mainly because (i) the imgt / hla database only presents sequences within 300 bases upstream to the first translated atg, (ii) the complete 3utr gene segment is not considered in the imgt database, and (iii) several hla alleles were described presenting only some exon sequences . Therefore, the nucleotide positions used in the present study follow the one presented in the ng_029039 sequence (http://www.ncbi.nlm.nih.gov/nuccore/ng_029039). The nucleotide named as + 1 is the adenine of the first translated atg (position 5867 at ng_029039). Variations within regulatory elements in the upstream 5 untranslated region and 5 promoter were denoted as negative values, considering position 5866 at ng_029039 as nucleotide 1 . The hla class i genes are usually very similar in nucleotide sequence and structure because most of these genes have been generated in a series of imperfect duplications . Therefore, in general, the same regulatory elements are acting in hla class i genes, with some differences for each hla class i locus . The hla class i promoters are usually conserved, presenting cis - acting regulatory elements mainly within 220 bases upstream to the first translated atg . However, the hla - g promoter is atypical compared to other hla class i genes since most of these regulatory elements are not functional . The hla - g locus presents a tissue - restricted expression pattern, being expressed in physiological conditions only in certain tissues such as trophoblast at the maternal - fetal interface, thymus, cornea, pancreas, proximal nail matrix, erythroblast, and mesenchymal stem cells [1, 1118]. In view of the immunomodulatory properties of the hla - g molecule overall, hla class i genes present two main regulatory modules in the proximal promoter region (200 bases upstream to the translation start point), including (i) the enhancer a (enha) combined with an interferon - stimulated response element (isre) and (ii) the sxy module, in which the transcription apparatus is mounted (figure 1) [1924]. However, these regulatory elements present locus - specific differences leading to different levels of hla class i constitutive- and induced - expression (reviewed at [24, 25]). The enha element includes two adjacent palindromic nf-b binding sites (b1 and b2) that interact with the nf-b family of transcription factors, both important to the constitutive and/or induced expression of hla class i genes . This family includes several members, such as p50, p65 (also known as rela), p52, c - rel, and relb, all usually acting by forming homo- or heterodimers . Theoretically, the interaction of these factors with the enha element may transactivate (acting on any b binding site) any hla class i gene . Thus, the hla locus - specific transcription rate would be determined by (i) the levels of nf-b / rel family proteins in different tissues, (ii) modifications in the regulatory sequences, and (iii) potential activation of different nf-b / rel dimers . In addition, enha may be a target sequence for other dna - binding proteins, such as proteins of the leucine zipper transcription factor family . For instance, p65 has a potent transactivation domain and might operate as a p65/p50 heterodimer or p65/p65 homodimer, while p50 lacks this transactivation domain and may not transactivate as a p50/p50 homodimer . Enha also mediates the tnf - induced transcription of hla class i molecules [20, 29]. Due to variations in the enha nucleotide sequences among different hla class i genes, nf-b / rel factors may interact as homo- or heterodimers resulting in different transcription levels . The hla - g enha element (including b1 and b2 sites) encompasses nucleotides 198 and 172 (regarding ng_029039) and, compared to other hla class i genes, it is the most divergent one [19, 20]. In fact, the b - sites in the hla - g promoter (enha) are reported to bind only p50/p50 homodimers (figure 1). As presented earlier, thus, although hla - g possesses an nf-b responsive element, it is not as efficient as the hla class i classical genes . Isre is a target site for the interferon regulatory factor family, including the interferon regulatory factor-1 (irf-1, activator), irf-2, and irf-8 (inhibitors). Interferon- (ifn-) is the most potent cytokine inducing hla class i gene expression . Ifn- induces the expression of irf-1 by the activation of the janus kinases (jak) 1 and 2 and phosphorylation of stat1 (jak / stat pathway) [19, 21]. Isre is adjacent to the enha element (constituting the module enha / isre presented earlier) and, thus, isre and enha regulate hla class i expression cooperatively (figure 1). Isre also participates in the transactivation of 2-microglobulin, which is associated with the heavy chain of the hla class i molecule, and this information is important because an unbalanced production of these chains may impair correct hla molecule assembly . The nucleotide sequence of isre also varies among hla class i loci . In this respect, locus - specific differences were observed in the ifn - induced expression levels of hla class i genes [21, 2931]. The hla - a locus, for instance, does not respond to ifn at the same level as hla - b and hla - c, probably because of differences in the isre structure [19, 21, 2931]. However, when comparing isre of the hla - g locus with other class i genes, encompassing nucleotides 171 to 161, the hla - g gene presents the most divergent isre compared to the isre consensus sequence, followed by hla - e [19, 21], raising the issue of whether or not this element is fully functional for hla - g and hla - e . In fact, neither hla - g nor hla - e isres mediate ifn--induced transactivation, and the binding of irf-1 is not detected for hla - g . However, in the same way, probably because of the defective nature of the hla - g isre, the binding of irf-2 (transcription repression) was also not detected for hla - g . Isre is also a target for other protein complexes that may mediate hla class i transactivation . However, hla - gb2 (enha) and isre seem to bind only the constitutively expressed factor sp1 (also known as specificity protein 1) [21, 25]. Nevertheless, the binding of sp1 does not modulate the constitutive or ifn - induced transactivation of hla class i genes, including hla - g . On the other hand, a candidate interferon - gamma activated site (gas) was described between the 741 and 733 positions, presenting a sequence that would be compatible with a gas consensus sequence (figure 1). However, besides this new candidate, ifn-, ifn-, and ifn- treatments failed to increase hla - g expression, a fact that was accredited to the defective nature of both the new candidate and the enha / isre region [3234]. Nonetheless, another study showed that ifn- enhances hla - g expression by another isre present next to the nonfunctional gas element at positions 754 to 743 . The sxy module comprises the s, x1, and x2 (also known as site) boxes and the y box (also known as the enhancer b or ccaat box). The x1 box is a target for the multiprotein complex regulatory factor x (rfx), including the rfx5, the regulatory factor x - associated protein (rfxap), and rfxank [20, 25, 35, 36]. These rfx members have been shown to interact with the class ii transactivator (ciita) [37, 38], which is also an important element for hla class i gene transactivation . The x2 box is a binding target for the atf / creb (activating transcription factor / camp response element binding protein) transcription factor family . Box y is a binding target for nuclear factor y (nfy), including subunits alpha (nfya), beta (nfyb), and gamma (nfyc) [25, 40]. The binding of these factors to the sxy module allows the further binding of the coactivator ciita and the nod - like receptor family card domain containing 5 (nlrc5) factors [25, 41, 42]. The ciita is constitutively expressed by antigen presenting cells and is induced by ifn-, and it transactivates hla class i genes [41, 43]. Nlrc5 transactivates hla class i genes (but not hla class ii) and is constitutively expressed in a series of different tissues, mainly hematopoietic cells, or is induced by inf- [4446]. For hla - g, the sxy module presents sequences compatible only with the s and x1 elements, but divergent from x2 and y elements (figure 1). Therefore, ciita, which is dependent on a functional sxy module, does not transactivate hla - g, mainly because of the missing x2 and y elements [25, 41, 42, 47, 48]. Considering all the elements discussed above, it became clear that the hla - g proximal promoter (within 200 bases) did not mediate transactivation by the principal hla class i transactivation mechanisms . In addition, studies evaluating the hla - g promoter region within 1438 bp from atg did not detect differences in the basal level of transactivation for different hla - g promoters in different cell types [49, 50]. Some alternative regulatory elements within the hla - g gene promoter have been described . A heat shock element (hse) which would respond to the presence of heat shock proteins (hsp), especially the heat shock factor 1 (hsf1), hla - g transcription is induced by heat shock (physical stress) or arsenate treatment (chemical stress) in human melanoma and glioblastoma cell lines, in which stress - induced hsf1 binds to an hse lying between the 464 and 453 positions . This hse response was detected for hla - g but not for other hla class i genes . Hla - g expression may also be induced by progesterone, which is an immunomodulatory steroid hormone secreted both by the corpus luteum and placenta, allowing endometrium maintenance and embryo implantation . The mechanism underlying this induction is primarily mediated by the activation of the progesterone receptor (pr) and its subsequent binding to an alternative progesterone response element (pre) found in the hla - g promoter between positions 52 and 38, overlapping the hla - g tata box (figure 1). Experiments with transgenic mice allowed the identification of a locus control region (lcr) candidate located at least 1.2 kb upstream to the first translated atg . This region is critical for the hla - g expression regarding when and where it should be expressed . It is possible that this region acts by maintaining the chromatin in an open state or active configuration, enhancing gene expression [54, 55]. In addition, it may bind protein complexes associated with activation and inhibition of hla - g transcription [56, 57]. At least three cre / tre candidate sites (camp response element / tpa response element) have been already considered, the first one being situated between the 1387 and 1371 positions (inside the putative lcr region discussed earlier), the second between the 941 and 935 positions, and the third between the 777 and 771 positions (figure 1). The first cre site (at lcr) was described to be an in vitro target site for c - jun by using electrophoretic mobility shift assay (emsa). C - jun, together with c - fos, forms the ap-1 early response transcription factor . In addition, this same site was reported to bind atf1/creb1 in vitro and in situ by using chromatin immunoprecipitation (chip). The second cre / tre site binds in vitro to creb1 and the third site binds in vitro to atf1/creb1 . Mutations in all three cre / tre sites have been reported to reduce the hla - g creb1 transactivation, but a stronger inhibition was observed when the first cre / tre site (at the lcr) was mutated . The repressor factor rreb1 (ras responsive element binding 1) may also be implicated in hla - g expression regulation . At least three binding sites for rreb1, known as ras response elements (rre), in the hla - g promoter region have been described . The consensus sequence ggtcct, corresponding to one of the binding sites for rreb1, was found in the proximal promoter between the 59 and 54 positions (one direct site) and between the 148 and 143 positions and the 139 and 134 positions (a direct site and an inverted site). A target site related to the other consensus - binding site for rreb1, ccccaccatcccc, was found within the lcr between the 1363 and 1358 positions (figure 1). The mechanism underlying rreb1 repression is probably associated with the recruitment of the corepressor c - terminal binding protein 1 or 2 (ctbp-1 or ctbp-2), or both, and the deacetylase 1 (hdac1), which is involved in chromatin remodeling probably increasing chromatin condensation and hampering transcription factor accessibility [58, 59]. The gli-3 repressor, a signal transducer of the hedgehog pathway (hh), has also been reported to regulate hla - g during the maturation of osteoblasts, especially in the production of the hla - g5 isoform . It acts by a direct interaction of the hh signaling transducer factor gli-3 with the hla - g promoter . However, it is not clear whether the hh signaling pathway, a highly conserved molecular pathway involved in the development of several tissues, directly regulates hla - g5 expression in other cell types . A negative regulator of gene expression is observed in a sequence about 4 kb upstream to the hla - g translation starting point, overlapping with a line-1 sequence (figure 1). Lines (long interspersed elements) are a group of retrotransposons, which are highly repetitive elements from the eukaryotic genome that contribute to genome variability . The line-1 element described for hla - g (named gl) is an at - rich sequence (about 60%) that presents more sites with a high probability of forming hairpin loops than the general line sequence . These hairpin loops might directly or indirectly interact with the hla - g promoter and interfere with the binding of transcriptional factors and enhancers . Line elements are frequently found lying in the 5 upstream regulatory region of other hla class i genes, including hla - a . However, the line sequence found in the hla - a promoter (named al) is not transcriptionally active and is shorter than the one found in hla - g (gl). Therefore, the presence of this gl element in the hla - g promoter would explain its limited expression compared with other class i genes . However, it should be noticed that this gl element is also present in hla - g - expressing cells; thus, other regulatory elements might inhibit or overcome this negative regulation . Hypoxia is an important physiological microenvironment for placentation and for the formation of the maternal - fetal interface . The microenvironment is also crucial for the function of t and b cells . In this scenario, the hypoxia - inducible factor (hif) is involved in the control of cellular responses to oxygen depletion . The hla - g expression (membrane and soluble) is 2 times increased when extravillous cytotrophoblasts are cultivated under only 2% oxygen . Likewise, hypoxia is associated with increased hla - g transcription in a series of hla - g - negative tumor lineages, such as 1074mel [64, 65] and m8 . A consensus hypoxia response element (hre) some inducers of hla - g expression have been described; but the underlying induction mechanisms are unknown . Interleukin 10 (il-10), which is produced by lymphocytes, monocytes, macrophages, placenta, and some tumors, may induce hla - g expression and the downregulation of other hla class i and ii genes [6870]. Cortisol, a glucocorticoid produced by the adrenal gland, is a potent immunomodulatory hormone at high doses . Hla - g expression in trophoblastic cells was increased following treatment with dexamethasone or hydrocortisone, but no complete glucocorticoid response element (gre) has been identified in the hla - g promoter . Granulocyte - macrophage colony - stimulating factor (gm - csf) is a protein secreted by macrophages, t cells, mast cells, nk cells, endothelial cells, fibroblasts, and uterine epithelium . Gm - csf increases hla - g expression when combined with inf- treatment, but no effect is observed for gm - csf alone [72, 73]. The leukemia inhibitory factor (lif) is a cytokine expressed at the maternal - fetal interface in the cytotrophoblast that plays an important role in implantation . Lif is mainly expressed in the implantation window . By using the choriocarcinoma cell line jeg3, it was demonstrated that lif induces full - length membrane hla - g (hla - g1) expression on the jeg3 cell surface . In addition, lif may induce hla - g1 expression in the presence of erap1 (endoplasmic reticulum aminopeptidase-1) expressed in the endoplasmic reticulum . Repression of erap1 in jeg3 cells treated with lif diminishes hla - g expression, suggesting a role for erap in hla - g regulation . Some drugs may also induce hla - g production, such as methotrexate (mtx), one of the most used antirheumatic drugs for the treatment of rheumatoid arthritis (ra). Mtx can induce apoptosis of mitogen - stimulated peripheral blood mononuclear cells (pbmcs) resembling the mechanisms underlying the inhibition of cytotoxic t cd8 + cell activity by soluble hla - g molecules . Mtx can induce the production of shla - g in unstimulated ra or healthy individual pbmcs and may have a role in the clinical outcome of ra patients . The mechanisms underlying shla - g production after mtx treatment are unknown, but it was reported that mtx therapy mediates an increase of interleukin-10-producing cells, which in turn may stimulate hla - g production . Data from the 1000 genomes project, including 1092 individuals from 14 different populations, showed 32 variable sites within 1500 nucleotides upstream to the first translated atg . Most of these variable sites have been already described in other populations or samples different from those evaluated by the 1000 genomes consortium [69, 7781]. Of those, 24 variable sites present frequencies higher than 1% and 14 present frequencies higher than 10% in the global 1000 genomes data (all 1092 individuals). These variable sites may be important for the regulation of hla - g expression and may act in different ways . Polymorphisms in the proximal promoter of paan - ag, the functional homologue of hla - g in the olive baboon, have been shown to influence nf-b binding and transcription activity [82, 83]. However, the human variable sites may act by mechanisms differing from those described above because, generally, these variable sites do not coincide with known regulatory elements (figure 1). Variation in regulatory elements may affect the binding of the corresponding regulatory factors . In this respect, only four variable sites coincide with known regulatory elements: (i) position 1377 in the first cre site of the lcr, (ii) positions 1310 and 1305 of the lcr, and (iii) position 56 of the ras response element (rre) in the proximal promoter . Of these, only the ones at positions 1305 and 56 are frequently found worldwide (figure 1). Other variable sites are close to known regulatory elements and may somehow influence the binding of transcription factors . In this group we may observe variable sites at positions 762 (between a cre and isre), 725 (next to a nonfunctional gas element), 477 and 433 (around the hse), and 201 (next to enhancer a) (figure 1). The variable site at position 725, in which the minor allele (g) is present in 9.8% of the chromosomes evaluated in the 1000 genomes project, was associated with differential hla - g expression . Hla - g promoter haplotypes (between 1389 and 55 and not considering primer sequences) were cloned into luciferase expression vectors and transfected to the hla - g expressing cell jeg-3, resulting in a significantly higher expression level of the promoters presenting guanine at position 725 . In addition, another study described the same influence of position 725 on hla - g expression levels . This same polymorphism (725 g) has been reported to be associated with sporadic miscarriage and end - stage renal disease, while the most frequent allele (725 c) has been reported to protect against multiple sclerosis . Nevertheless, despite the lack of studies regarding hla - g promoter polymorphisms and hla - g expression, the polymorphism at position 964, which is very frequent among the populations evaluated by the 1000 genomes consortium, was associated with asthma . The 964 g / g genotype was associated with asthmatic children of affected mothers, whereas the a / a genotype was associated with asthmatic children of unaffected mothers . The 964 a and 486 c alleles, together with the 725 g allele, were also associated with protection against end - stage renal disease . The polymorphism at position 1305, also very frequent among the 1000 genomes populations, was associated with nonsegmental vitiligo . The methylation status of the hla - g promoter is also very important to the hla - g transcriptional activity . It has been reported that the cpg islands in the hla - g promoter region of jar (choriocarcinoma) cells, which does not express hla - g, were fully methylated, whereas for an hla - g expressing cell such as jeg-3, the cpg islands were only partially methylated [91, 92]. In addition, hla - g expression was induced in several tumor cell lines by using demethylation agents, such as 5-aza-2deoxycytidine [9397]. Moreover, the levels of histone acetylation in the hla - g promoter chromatin have been reported to be significantly enhanced in fon+ (melanoma) and jeg-3 (human placental choriocarcinoma cell line) cell lines, both expressing hla - g, while in non - hla - g expressing cell lines, such as m8 (melanoma) and jar, histones seem to be hypomethylated [94, 96, 98]. Histone acetylation is usually associated with a relaxed chromatin structure, therefore, with greater levels of gene expression [99, 100]. In this respect, polymorphisms in the hla - g promoter, especially in the cpg islands, might also be associated with different methylation profiles . Although most of the hla - g promoter variable sites do not occur inside known regulatory elements (figure 1), balancing selection has been reported to maintain divergent haplotypes in the 5 promoter [6, 8, 9, 78, 79] and 3utr regulatory regions [6, 27, 28, 78, 101, 102]. In fact, at least 14 variable sites in the promoter region do present frequencies higher than 10%, and 11 variable sites present frequencies higher than 44% (figure 1). However, considering the haplotypes described for the hla - g promoter, which seem to be the same worldwide [6, 8, 9, 7779], most of these frequent variable sites are in complete linkage disequilibrium (ld), and just four main hla - g promoter lineages are associated with these variable sites . These promoter lineages were first proposed by ober's group and subsequently confirmed and named in a brazilian study as promo - g010101, promo - g010102, promo - g0103, and promo - g0104 . In addition, considering data from the 1000 genomes project, only nine promoter haplotypes present frequencies higher than 1% in worldwide populations (figure 2), but two of them, promo - g010101a and promo - g010102a, which are the most divergent ones, account for more than 60% of all haplotypes . Nevertheless, despite the fact that most of these frequent hla - g variable sites are not within known regulatory elements, several lines of evidence indicate balancing selection acting on the hla - g promoter found in several populations [6, 8, 9, 78, 79], suggesting that divergent promoters have been maintained with high heterozygosis . This observation is probably related to a possible better fitness of individuals carrying both high- and low - expressing promoters . Therefore, these divergent hla - g promoter haplotypes are probably associated with differential hla - g expression, but the mechanisms are unknown . However, as discussed later, the pattern of ld observed for the promoter region extends up to hla - g 3utr [6, 8, 9, 27, 7779] and at least 20 kb beyond the hla - g 3utr . Thus, selective pressures acting on other hla - g regions as well as adjacent sequences might also influence hla - g promoter variability and heterozygosis . As previously stated, there is no consensus regarding the positions of the nucleotide variation in the hla - g 3utr, considered to be located mostly in exon 8 . Since there is no official information regarding the hla - g 3utr sequences, the nucleotide positions used in the present study follow those previously reported by our group [1, 6, 27], that is, inferring polymorphic sites in 3utr using the original hla - g sequence described by geraghty and colleagues and considering nucleotide + 1 as the adenine of the first translated atg (similar to the imgt / hla description). In the hla - g 3utr, there is a well - studied polymorphism that consists of a 14-nucleotide deletion (rs371194629 or rs66554220), also known as the 14-bp indel (insertion / deletion) polymorphism . The sequence used as a model for the hla - g promoter structure (ng_029039) does not present this 14-nucleotide sequence (that would be inserted between nucleotides + 2960 and + 2961). Given that the presence of these 14 nucleotides is also found in gorillas and chimpanzees, it should represent the ancestor allele, and the 14 bp sequence therefore, any position after nucleotide + 2960 is taken considering the original ng_029039 sequence plus 14 bases . For instance, the polymorphism at the + 3142 position discussed later in this review refers to the + 3128 nucleotide in the ng_029039 reference sequence . Due to a premature stop codon (positions + 2536 to + 2538 in ng_029039), the hla - g gene presents a relatively large 3utr genomic sequence that extends up to the + 3292 nucleotide, encompassing approximately 754 nucleotides . Inside the 3utr genomic region, there is an intron that is spliced out, giving rise to the mature hla - g mrna with a 3utr sequence of approximately 397 nucleotides (considering the presence of the 14 bases discussed earlier). This 3utr is a key feature for transcriptional hla - g regulation, which is important for (i) hla - g mrna stability, (ii) targeting specific micrornas, and (iii) polyadenylation signal in the au - rich regulatory mrna element . The mrna availability for translation, as well as consequent protein production and maturation, is constantly balanced by the opposing forces of transcription levels and mrna decay . The transcription level is mainly driven by the 5' regulatory region and the presence of specific transcription factors, while mrna decay is mainly driven by its intrinsic stability (which is dependent on the nucleotide sequence) and the action of micrornas . Micrornas may negatively regulate gene expression by translation suppression, rna degradation, or both [104, 106108]. The first mirna was reported in 1993, and more than 2000 human micrornas have been reported to date [110, 111]. The hla - g 3utr presents several polymorphic sites, some of which have been associated with differential hla - g expression profiles . Although the hla - g 3utr segment is quite short compared to the same region in other genes, it presents at least eight polymorphic sites that are frequently found in worldwide populations (figure 3). The hla - g 3utr variability and haplotypes were systematically explored in a southeastern brazilian population, in which seven frequent haplotypes were described, encompassing these eight polymorphic sites, designated utr-1 to utr-7, and a rare one named utr-8 . The relationship between hla - g 3utr polymorphisms (especially for the 14 bp polymorphism) and other variable sites in the hla - g coding and promoter region was also previously explored [77, 78, 105, 112, 113]. Furthermore, several populations were evaluated regarding these polymorphic sites, including additional samples from other brazilian regions and other worldwide populations, and the same pattern of 3utr variability has been observed [6, 27, 28, 85, 102, 114121]. Recently, the variability at the hla - g locus was explored by using the 1000 genomes data [28, 102] and, taking together all of these studies in the last decade, it became clear that the same 3utr pattern observed in brazilians is found worldwide, with just some new low frequency haplotypes . Most of the polymorphisms present in the hla - g 3utr may influence the hla - g expression profile by different mechanisms . Since they are present in a short mrna sequence with just some nucleotides apart, and since the pattern of haplotypes is quite conserved [28, 102], the influence of each polymorphic site on the hla - g expression profile may not be independent of other polymorphic sites; that is, extended haplotypes should be considered due to the cumulative effects of different polymorphisms . For example, the + 3003, + 3010, + 3027, and + 3035 polymorphic sites encompass only 32 nucleotides that are also in linkage disequilibrium with each other and in linkage disequilibrium with variable sites in the coding and promoter segments (figure 3). The first hla - g 3utr polymorphic site associated with hla - g expression levels was an indel (insertion / deletion) variant known as the 14 bp polymorphism . This polymorphism is characterized by the removal of a 14-nucleotide segment between positions + 2961 and + 2974, and it presents high frequency in all populations studied so far . The ancestor allele (the 14 bp presence or insertion) is also found in gorillas and chimpanzees . The 14 bp polymorphism has been associated with the magnitude of hla - g production [77, 123125], modulating hla - g mrna stability [113, 126128] and also as a target for micrornas . In general, the presence of the 14-nucleotide sequence (5-atttgttcatgcct-3) has been associated with lower hla - g production for most membrane - bound and soluble isoforms in trophoblast samples [77, 78, 123, 125, 128]. However, svendsen and colleagues observed the opposite when k562 cells were transduced with ins-14 bp hla - g1 or with del-14 bp hla - g1, in which the expression of hla - g1 was found to be higher for ins-14 bp cells compared to del-14 bp cells . Moreover, this 14-base sequence was also associated with an alternative splicing of the hla - g transcript, in which 92 bases from the mature 3utr hla - g mrna were removed (including the 14-base sequence itself) [113, 128], and these smaller transcripts were reported to be more stable than the complete transcript . Though influencing mrna stability, only a fraction of the mrna bearing these 14 nucleotides is further processed with the removal of 92 bases, and the greater stability apparently does not compensate for the lower hla - g levels associated with the 14-base sequence . Nevertheless, there are controversial results regarding the influence of this polymorphism in hla - g expression and alternative splicing . The following four polymorphic sites, frequently found in the hla - g 3utr in worldwide populations, are present at positions + 3003, + 3010, + 3027, and + 3035 [6, 27]. Although no specific regulation mechanism has been described regarding these polymorphic sites, they might influence microrna binding . Additional polymorphic sites around this small hla - g 3utr segment are infrequently observed in worldwide populations, including the + 3001 c / t polymorphism observed in senegalese and northeastern brazilian populations [115, 116] and the + 3033 c / g polymorphism observed among northeastern brazilians . Although there are no studies evaluating the functional properties of these polymorphic sites, an in silico study reported that several micrornas might target this small segment . The nucleotide variation at position + 3142 has been associated with the magnitude of hla - g expression by posttranscription mechanisms, such as the interaction with micrornas . It was functionally and computationally demonstrated that this variation site would influence the binding of specific micrornas, including mir-148a, mir-148b, and mir-152 . The presence of a guanine at the + 3142 position increases the affinity of this region for these micrornas, hence decreasing hla - g expression by mrna degradation and translation suppression [106, 129, 130]. This polymorphism, together with the 14-bp polymorphism, has been considered to be the most important one regarding hla - g posttranscription regulation, and methodologies have been proposed to quickly type these polymorphic sites [131, 132]. At least two studies have demonstrated that the + 3142 c / g polymorphic site may influence hla - g expression by modulating the mrna interaction with mir-152, particularly in bronchial asthma [129, 133]. However, there is no consensus regarding the influence of this polymorphic site on the binding of such micrornas, since another functional study did not detect this influence . Instead, it was reported that both mir-148a and mir-152 downregulate hla - g expression, irrespective of the + 3142 c or g alleles . These micrornas have already been reported to modulate the expression of another classical hla class i gene, hla - c . Interestingly, only hla - c and hla - g are usually found at the maternal - fetal interface, indicating the presence of some sort of coordinated regulation . Similarly to mir-148a, mir-148b, and mir-152, other micrornas have the potential to bind to the hla - g mrna 3utr and to influence hla - g expression . The binding ability of these micrornas may be potentially influenced by polymorphisms observed in the hla - g 3utr . Another polymorphic site that has been associated with the magnitude of hla - g expression is located at position + 3187 a / g . The mechanism underlying such association has been attributed to the proximity of this polymorphic site to an au - rich motif that mediates mrna degradation . Then, the presence of an adenine instead of a guanine at position + 3187 would lead to a decreased hla - g expression due to the increased number of adenines in this au - rich motif . In addition to the micrornas that might target polymorphic sequences in the hla - g 3utr, some micrornas would bind to nonpolymorphic sequences and modulate hla - g expression irrespectively of the individual genetic background . However, such approach has not yet been used and only micrornas targeting polymorphic sequences have been evaluated . Nevertheless, the microrna mir-133a was found to target a nonpolymorphic sequence upstream to the 14-b sequence fragment, between nucleotides + 2945 and + 2952, downregulating hla - g expression (figure 3). The conserved patterns of hla - g 3utr haplotypes and the few frequent haplotypes found worldwide [102, 116] show that only one haplotype does carry all alleles that have been associated with high hla - g expression . This haplotype, known as hla - g utr-1 (14 bp deletion/+3003 t/+3010 g/+3027 c/+3035 c/+3142 c/+3187 g/+3186 c), does not present the 14 bp sequence; that is, it presents a 14 bp deletion, which was associated with highly soluble hla - g expression; it presents a cytosine at position + 3142 (less sensitive to specific micrornas targeting this region), and it exhibits a guanine at position + 3187 (increased mrna stability). Besides possessing these three polymorphic alleles associated with high hla - g production, utr-1 presents some other interesting features: (i) it is one of the most frequent 3utr haplotypes found worldwide, (ii) it has been described as one of the most recent hla - g 3utr haplotypes among the frequent ones due to its exclusive association with the presence of an alu element that is close to hla - g (20 kb downstream the 3utr), and (iii) utr-1 was recently associated with higher hla - g expression . Several studies have reported that the hla - g 3utr segment is also under selective pressures, whereby balancing selection is maintaining high levels of heterozygosis in this region [6, 27, 28, 101, 139, 140]. As observed worldwide [27, 28, 102], the two most frequent hla - g 3utr haplotypes (utr-1 and utr-2) are also the most divergent ones (figure 3). Therefore, the same phenomenon observed for the promoter region is also seen in the 3utr, in which high heterozygosis is observed between high- and low - expression haplotypes . Moreover, the rate of recombination in the hla - g locus is quite low, and the pattern of linkage disequilibrium found in the hla - g locus encompasses the promoter region, the coding region, the 3utr, and at least 20 kb downstream of the 3utr . Thus, in general, only few frequent extended haplotypes do exist and a specific promoter haplotype is usually accompanied by the same hla - g coding sequence and the same 3utr haplotype [68, 28, 77, 78, 102]. The utr-1 haplotype, for example, is usually associated with the coding sequence for the hla - g*01:01:01:01 allele and the promo - g010101a promoter haplotype [68, 28, 102]. Therefore, the influence of each variable site at the hla - g transcriptional level must be considered . The hla - g genetic structure resembles the class i structure, in which the first translated exon encodes the peptide signal, the second, third, and fourth ones encode the extracellular 1, 2, and 3 domains, respectively, and the fifth and sixth ones encode the transmembrane and the cytoplasmic domain of the heavy chain . Considering the hla - g coding region (from the first translated atg to the stop codon), at least 75 single nucleotide polymorphisms (snp) have been observed, defining the 50 currently described hla - g alleles, encoding only 16 distinct proteins (imgt, database 3.14.0, november 2013). Similarly to what has been described for other genes such as irf4, myc, ifng, and others [141146], it is possible that intronic or exonic nucleotide sequences may exhibit affinity for transcription factors, thereby regulating the expression of the gene; however, this subject has not yet been studied in the context of the hla - g gene . The presence of certain polymorphic sites in the coding region may also regulate the expression of the seven described hla - g isoforms generated by alternative splicing of the primary transcript . Four of the hla - g isoforms are membrane - bound (hla - g1, g2, g3, and g4) and 3 are soluble (g5, g6, and g7) ones . Hla - g1 is the complete isoform exhibiting a structure similar to that of the membrane - bound classical hla molecule, associated with 2-microglobulin, hla - g2 has no 2 domain, hla - g3 presents no 2 and 3 domains, and hla - g4 has no 3 domain . The soluble hla - g5 and hla - g6 isoforms present the same extracellular domains of hla - g1 and hla - g2, respectively, and the hla - g7 isoform has only the 1 domain [147149]. In contrast to most of the currently described hla - g alleles that may produce all membrane - bound and soluble isoforms, the presence of stop codons in the coding region may yield truncated or missing hla - g isoforms . The hla - g*01:05n null allele presents a cytosine deletion in the last nucleotide of codon 129 or in the first nucleotide of codon 130 (exon 3), leading to a tga stop signal in codon 189, yielding incomplete formation of the hla - g1, -g4, and -g5 isoforms and normal expression of hla - g2, -g3, and -g7 [1, 150, 151]. Similarly, the hla - g*01:13n allele presents a c t transition in the first base of codon 54 (1 domain), yielding the formation of a premature tag stop codon, preventing the production of all membrane - bound and soluble isoforms, and therefore it is probably not expressed [1, 152, 153]. Humans bearing allele g*01:05n in homozygosis have been reported [154157], a fact that may indicate that soluble hla - g molecules or molecules lacking the 3 domain are sufficient for hla - g function . The frequency of the g*01:05n allele varies among different populations, ranging from complete absence in amerindian populations from the amazon, mayans from guatemala, and uros from peru [139, 151, 158], to intermediate frequencies in africa and higher than 15% in some populations of india, while allele g*01:13n is quite rare [152, 153]. It has been proposed that high g*01:05n frequencies are associated with high pathogen load regions, and intrauterine pathogens would act as selective agents, with increased survival of g*01:05n heterozygous fetuses . In this case, the reduced hla - g1 expression may result in an improved intrauterine defense against infections [139, 151, 154, 160]. To the best of our knowledge due to the important role of hla - g in the regulation of the immune response and its relevant function during the course of pregnancy, the overall structure of the molecule has been maintained during the evolution process, preserving major hla - g binding sites to leukocyte receptors and hla - g dimer formation . On the other hand, several variable sites although a perfunctory analysis of the many variable sites observed in the promoter region of several worldwide populations indicates that some known transcription factor target regions have also been conserved, one cannot rule out the influence of the differential action of distinct transcription factors according to promoter region variability . In contrast, most of the variable sites found in the hla - g 3utr might influence hla - g expression by facilitating or hindering microrna binding and/or influencing mrna stability.
|
Eu2o3 doped zno films are deposited on cleaned quartz substrate at room temperature (300 k) using radio frequency (rf) magnetron sputtering technique (rf frequency: 13.56 mhz). Pressed zno powder (aldrich 99.99%) with various europium oxide concentrations is used as the target for sputtering . The eu2o3 doping concentrations used for preparing the films are 0, 0.5, 1, 3, and 5 wt% . Argon gas is admitted into the chamber, and argon pressure is maintained at 0.02 mbar . The target is powered through a magnetron power supply (advanced energy mdx 500, colorado). The sputtering is carried out under constant rf power of 150 watts for 30 min . The distance between target and substrate is maintained at 510 m. the deposited films are annealed in air at 773 k for 2 hours . The annealed films with eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt% are designated as e0, e0.5, e1, e3, and e5, respectively . The structural, morphological optical and luminescent properties of the annealed films are investigated in detail . The crystalline quality and crystallographic orientation of the films are investigated using x - ray diffraction analysis (brucker d8 advance x - ray diffractometer, germany) using cu k1 radiation of wavelength 1.5406 a in the 2 range 2070. the vibrational spectra of the films are recorded using micro - raman spectrometer (labram hr-800, horiba jobinyvon, germany) using a laser radiation of wavelength 514.5 nm from an argon ion laser . The surface morphology of the films is investigated using atomic force microscopy (afm) (digital instruments nanoscope iii, usa) analysis . The fesem measurements are carried out using nova nano sem450 (model no.1027647, fei, usa) equipped with xflash detector 6/10 (bruker) and elemental analysis of the films are carried out using electron energy dispersive x - ray spectrometer (eds - quantax 200, germany). The transmittance and reflectance spectra of the films in the spectral range 200900 nm are recorded using jasco v-550 (japan) uv - visible double beam spectrometer . The thickness of the films is measured using dektak stylus profilometer (usa) and also using vertical sem measurements . Photoluminescence spectra of the samples are recorded using perkin elmer ls50b (usa) luminescence spectrometer . The x - ray diffraction patterns of eu2o3 doped zno films at different doping concentrations are shown in fig . 1 . The xrd patterns of all the films present a single sharp intense peak at 2 value 34.9 corresponding to (002) plane of hexagonal wurtzite structure of zno (jcpds card no-75 - 0576). Thus, the films present a single crystalline like structure with c - axis orientation . The c - axis orientation of the films is due to the lowest surface energy of (001) basal plane in zno and minimization of internal stress leading to preferred growth along direction (21, 22). Even after europium doping, the wurtzite crystal structure is preserved in all the films . Also, no spurious phase such as europium oxide is observed within the detection limit . X - ray diffraction patterns of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates and annealed at 773k . The d - value of the films is calculated using bragg's relation (23).1n=2dhklsinhkl where is the wavelength of the x - ray radiation and hkl is the angle of diffraction . Structural parameters of rf sputtered pure and eu2o3 dopedzno films (eu2o3 doping concentrations 0, 0.5, 1, 3 and 5 wt%) on quartz substrates and annealed at 773k it can be seen that the intensity of (002) peak in moderately doped films (e0.5, e1, and e3) is slightly greater than that of the undoped film . Thus, it can be seen that the moderate doping of eu2o3 enhances the crystallinity of the films . It is found that the fwhm of the (002) peak in the eu2o3 doped films are greater than that of undoped film . The ionic radius of zn is 0.74 a and that of eu is 0.947 a (24). The mismatch in the ionic radii of the dopant and host cation can be the reason for enhanced fwhm of the doped films which can introduce stress in the films . The 2 value of the eu2o3 doped films is slightly lower than that of undoped film, which means an increase in d 002 as expected from bragg's law . This may be attributed to the bigger size of the eu ion compared to the zn ion . The substitution of eu ion into the zno lattice may result in the expansion of the lattice . The average size of the crystallites (d hkl) in the films is estimated using the following debye - scherer formula (23).2dhkl=0.9hklcoshkl where is the wavelength of x - ray radiation (1.5406a), hkl is the bragg diffraction angle, and hkl is the fwhm of the diffraction peak in radian . The e0.5, e1, and e3 films show an average crystalline size of 16 nm . The lattice constants can be evaluated using the following equation,31dhkl2=43(h2+hk+k2a2)+l2c2 where a and c are the lattice parameters h, k, and l are the miller indices of the plane and d hkl is the inter - planar spacing . The lattice constant c of the films is calculated and is given in table 1 . It is observed that the lattice parameter c in the doped films is slightly larger than that of the undoped film . The increase in the lattice constant c in the doped films compared to the undoped film indicates slight expansion of the lattice due to the substitution of eu at zn sites . The introduction of dopant and the lattice mismatch between film and substrate can introduce strain in the films . The strain along the c - axis is calculated using the expression (25),4(%)=c - c0c0100 where is the strain along the c - axis perpendicular to the substrate surface . Combined with the elastic constants of single crystalline zno, the stress in the films can be calculated using the biaxial strain model (26),5=-453.6c - c0c0gpa where c is the lattice constant of the film calculated from the xrd data and c 0 is the strain - free lattice constant obtained from the jcpds data card . The positive value of stress indicates that the films are in a state of tensile stress . The biaxial tensile stress in the films is found to be decreasing from 5.54 to 4.93 gpa with eu2o3 doping . The stress developed in the thin films is generally related to growth parameters, substrate on which the film is deposited, defects, impurities, and lattice distortion in the films (6, 27). The stress associated with defects and impurities are termed as intrinsic stress, while that originating from lattice mismatch and difference in thermal expansion coefficient (tec) between film and substrate is termed as extrinsic stress (28). The stress originating from lattice mismatch between film and substrate in these films is difficult to calculate due to the amorphous nature of quartz substrate (28). It is generally assumed that the lattice mismatch strain is relieved at growth temperature by the formation of dislocations near the interface between film and substrate . However, the dislocation process freezes out on cooling and strain develops due to the difference in tecs of the film and substrate (29, 30). The stress introduced due to the difference in tecs of the film and substrate is given by the following equation,6th=tgrowth / annealrt(s-b)e1-dt where and are the tec of substrate and corresponding bulk material respectively . E is the young's modulus and v is the poisons ratio of the material . In the present study, tec values for quartz substrate and zno are = 0.5910/k and = 2.910/k, respectively . The young's modulus e and poisson's ratio v of zno are 100 gpa and 0.36, respectively . Substituting these values in equation, the thermal stress of the zno film is calculated and is found to be ~0.17 gpa . From equation, it is found that the thermal stress for the zno film deposited on quartz substrate increases with increasing annealing temperature . This shows that the thermal stress is small in comparison with the observed stress in the films . Hence, the stress in the films is likely to be intrinsic in nature, contributed by the growth process rather than thermal origin (31). This indicates that the total stress in the film is highly influenced by the sputtering process and is mainly attributed to the implantation of particles sputtered from the oxide target into the growing film . Mohanty et al . Reported that the surface oxygen is easily ionized during sputtering of the oxide target, and then gets accelerated with energy corresponding to full - potential drop across the cathode sheath . Even though these negative ions are neutralized during their transit, they reach the substrate with sufficient energy for implantation (28, 29). The bigger size of eu ion compared to zn ion results in the expansion of the lattice, which may produce deformation of the lattice and thereby introduce strain in the doped films . Zno with hexagonal wurtzite structure has a space group c6v4 (p63mc) with two formula units per primitive cell . (32), yields nine optical modes (excluding the three acoustic modes) and are distributed as7opt = a1 + 2b1+e1 + 2e2 of these, the a 1 and e 1 modes are both raman and ir active, whereas e 2 modes are only raman active and b 1 modes are inactive in both the spectra . The a 1 and e 1 modes are polar and splits into transverse optical (to) and longitudinal optical (lo) modes . The e 2 mode is non - polar with two frequencies: e 2(high) and e 2(low). The raman spectrum of zno powder presents two very intense bands at 100 and 437 cm, medium intense band at 332 cm and weak bands at 202, 379, 410, and 584 cm . Micro - raman spectrum of (a) zno powder and (b) its enlarged spectrum showing weak bands . Based on earlier works, the frequencies of fundamental optical modes in zno can be assigned as follows; e 2(low)=100 cm, e 2(high)=437 cm, a 1(to)=379 cm, e 1(to)=410 cm, and e 1(lo)=584 cm . The band observed at 202 cm may be assigned to 2e 2(low) and the band at 332 cm to e 2(high)e 2(low). Figure 3 gives the micro - raman spectra of undoped and eu2o3 doped zno films . The low - frequency e 2 mode is observed ~100 cm in undoped and eu2o3 doped zno films . The low - frequency mode is associated with the vibration of zn sub - lattice (3335). Raman spectra of both the pure and eu2o3 doped zno films present an intense raman band ~438 cm which can be attributed to e 2(high) mode . This mode is related to the vibration of oxygen atoms and is considered as the raman fingerprint of wurtzite zno phase (36). The medium intense band ~582 cm in the raman spectra of all the films can be due to e 1(lo) mode which is associated with the formation of various crystal defects such as oxygen vacancy, zinc interstitials, and so on in the films (37). The a 1(to) mode and e 1(to) mode can be expected ~380 and 407 cm respectively (38). Raman spectrum of powder sample presents these modes as weak bands ~379 and 410 cm . The a 1(lo) mode is observed as a weak band ~538 cm in the raman spectra of bulk zno (39). Many authors assigned the band ~332 cm as the difference mode e 2high e 2low (40). Micro - raman spectra of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates and annealed at 773k . Compared to the raman spectrum of zno powder (bulk), the raman spectra of films present a broad spectral feature . Here the broad nature of raman spectra of the films can be due to this residual stress . The measured thickness of the films is in the range 8394 nm and hence the spectral contribution from the substrate can also be expected in the raman spectra of the films . The medium intense band around 488 cm can be due to the contribution from the quartz substrate . Compared to the raman spectra of other films, the raman spectrum of 5 wt% eu2o3 doped film presents broader spectral feature . This can be attributed to the decline in crystallinity due to the higher doping concentration in this film as evident from the xrd analysis . In the present study, the e 2(high) mode for the undoped film is observed at 438 cm . The e 2(high) mode of the e 0.5 film also appears at 438 cm, but it is broadened . For e1 and e3 films, the e 2(high) mode is observed at 437 cm . In the e3 film, it is observed as a broader feature compared to e1 film . In the case of e5 film, the e 2(high) mode appears at 435 cm . Also observed similar red shift in the e 2(high) frequency and broadening of e 2(high) mode with europium doping concentration . They suggested that the shift of e 2(high) mode towards lower wave numbers confirms the substitution of zn by eu ions in the zno lattice and the peak broadening indicates decline in crystalline quality of the films with europium doping (41, 42). Reported an additional mode ~275 cm in doped zno films and they attributed it to intrinsic host lattice defects which become activated as vibrating complexes or their concentration increases up on dopant incorporation (43). Scepanovic et al . Also reported an additional raman band ~275 and 284 cm in zno which they attributed to intrinsic host lattice defects such as oxygen vacancies or zinc interstitials (44). In the raman spectra of the pure (e0) and doped films (e0.5, e1 and e3), a less intense band is observed ~276 cm whereas in the e5 film two medium intense bands are observed ~267 and 288 cm . Figure 4 shows the afm images (3d) of undoped and eu2o3 doped zno films . Afm image of undoped zno film presents uniform distribution of densely packed well - defined grains of more or less uniform size (around 45 nm) with well - defined grain boundaries . The e0.5 and e1 films show a tendency of coalescing smaller grains into bigger grains . The afm images of e3 and e5 films show uniform dense distribution of smaller grains . The rms surface roughness of the films is estimated using wsxm4 software, as shown in fig . The films with eu2o3 doping concentration 0.5 and 1wt% show higher rms surface roughness compared to the other films . The variation of the grain size with eu2o3 doping concentration obtained from the afm analysis (table 2) shows the same trend as obtained from xrd analysis . 3d afm micrographs of annealed zno films with different eu2o3 doping concentrations (a) pure (b) 0.5 wt% (c) 1 wt% (d) 3 wt% (e) 5 wt%, and (f) variation of rms surface roughness and grain size with doping concentrations . Morphological and optical parameters of rf sputtered pure and eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3 and 5 wt%) on quartz substrates and annealed at 773k sem micrographs of eu2o3 doped zno films are shown in fig . The sem micrographs also present a smooth surface consisting of small grains of more or less equal size . Sem micrographs of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates annealed at a temperature of 773k showing the surface morphology . The vertical sem micrographs of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates annealed at 773k showing the thickness of the films . Figure 7 shows the edx spectra of the undoped and eu2o3 doped zno films, annealed at 773k . The elemental analysis of the eu2o3 doped zno films show the incorporation of eu in the doped films . The edx spectra of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates annealed at 773k showing the elemental analysis . Figure 8 shows the transmittance and reflectance spectra of undoped and eu2o3 doped zno films recorded in the wavelength range 200900 nm . Average transmittance of the films in the wavelength range 400900 nm are calculated and given in table 2 . All the films show very high transmittance, above 87% in the visible region . For all the films the transmittance exhibits a sharp reduction at around 380 nm corresponding to the fundamental absorption edge of zno . The sharp absorption onset in the uv - region and high transmittance in the visible region indicates the good crystalline and optical quality and direct band gap nature of the films . The oscillations observed in the transmission and reflection spectra of the films can be due to the interference of light arising from the difference in refractive indices of the film and the substrate and the interference of multiple reflections arising from the film and substrate surface . These oscillations in the spectra indicate that smooth films are formed on quartz substrate as evident from the afm analysis . Tan et al . Also observed interference fringes in the transmittance spectra and suggested that the zno films had optically smooth surfaces and the interface with the quartz substrate is also smooth (4649). Uv - visible spectra of undoped and eu2o3 doped zno films (a) transmittance spectra and (b) reflectance spectra . The optical absorption coefficient can be calculated from the transmittance spectra using the following relation8=1tln(1 t) where t is the thickness of the film and t is the transmittance of the film . The optical band gap of the films are calculated using the relation (50),9h=a(h-eg)n where n can have values, /2, 2 or 3 respectively for direct allowed, direct forbidden, indirect allowed and indirect forbidden transitions, h is the plank's constant, v is the frequency of the incident photon and a is the band edge constant depending on electron hole mobility . The band gap e g can be obtained by extrapolating the linear region of (hv) vs. hv plot to hv=0 . The best fit for tauc relation undoped film shows a band gap of 3.24 ev, which is smaller than the band gap of the bulk zno (3.37 ev) and eu2o3 doped films show higher band gap values (table 2). There are several reasons for the shift of band gap in the films such as improvement or reduction in crystallinity, modification in barrier height due to the change in crystallite dimension, quantum size effect, and change in the density of impurities, tensile or compressive strain in the films, and so on (51). Tauc plots of rf sputtered (a) pure and (b e) eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3 and 5 wt%) on quartz substrates and are annealed at a temperature 773k and (f) the variation of refractive indices of these films with photon energy . Huang et al . Reported that a tensile strain produces a decrease in band gap whereas a compressive strain can result in an increase in band gap (52). Ziabari et al . Suggested that the shift in band gap due to moderate or heavy doping is determined by two competing mechanisms: band gap narrowing which is a consequence of many body effects on the conduction and valance bands; and the band gap widening due to the well - known burstein the many body interaction effects leading to band gap narrowing may occur either between free carriers or between free carriers and ionized impurities (54, 55). According to quantum size effect it can be expected that the contribution from euions on substitutional sites of znions and eu - interstitial atoms may determine the widening of the band gap caused by increase in carrier concentration . Moss effect explained the broadening of band gap energy with the increase in carrier concentration . Typically the blue shift of the absorption edge of the eu2o3 doped zno films may be associated with an increase of the carrier concentration blocking the lowest states in the conduction band, which is well known as the burstein - moss effect (57). Optical constants play an important role in design and fabrication of optical devices as they are closely related to the electronic polarizability of ions and the local field inside the materials . The extinction coefficient k of the films is calculated using the equation10k=4 where is the absorption coefficient and is the wavelength of incident light . The optical reflection from the film is directly related to the refractive index of the film by the following relation (58),11n=(1+r)+(1-r)2k21-r where r is the reflectance of the film . The refractive indices of the films are found to be around 2, very close to the bulk value (table 2). The e5 film shows the highest value of refractive index of 2.226 and the e0 film shows the lowest value of refractive index of 1.905 . The optical constants are closely related to the electronic polarizability of ions and the local field inside materials . Hence, the determination of optical constants plays a crucial role in the design of optical devices and optical communication systems (20, 59). The complex dielectric constant of the material can be defined as12()=r()+ii() the real and imaginary parts of the dielectric constant are related to n and k values by the relation13r()=n2()-k2() and14i()=2n()k(). The frequency dispersion of in the films can be obtained from the transmission and reflection spectra, which can provide the propagation, reflection, and loss of light in the films . Figure 10 shows the dependence of real and imaginary parts of dielectric constant on wavelength, known as dispersion curve and absorption curve respectively . The values of real parts of dielectric constants are higher than that of imaginary parts . The real parts of dielectric constants of eu2o3 doped zno films are found to be smaller than that of pure zno films . The variation of r and refractive index follows similar trend, whereas the variation of i follows the behavior of k. the variation of refractive index and extinction coefficients of the films as a function of photon energy is shown in fig . Variation of real and imaginary parts of dielectric constants of undoped and eu2o3 doped zno films as a function of photon energy . Variation of refractive index and extinction coefficients of undoped and eu2o3 doped zno films as a function of photon energy . The loss factor tand is the ratio of i and r (20). Variation of loss factor of undoped and eu2o3 doped zno films as a function of photon energy . Figure 13 shows the room temperature pl spectra of undoped and eu2o3dopedzno films recorded using excitation wavelength of 325 nm . The undoped film shows three main peaks at 409, 450, and 487 nm and a weak peak at 530 nm . The peak ~409 nm corresponds to near band edge emission (nbe) in zno which originates from the recombination of excitons . 0.5 wt% eu2o3 doping has caused reduction in the peak intensity and broadening of the peaks . . Room temperature photoluminescence spectra of undoped and eu2o3 doped zno films using excitation wavelength of 325 nm . The visible emissions observed may be due to the defects such as oxygen vacancy, zn interstitials, antisite oxygen, and so on in the films . Xrd and raman results suggest the presence of tensile stress and formation of defects in the films . Zn interstitial (zni) and oxygen vacancy (vo) are the main donor defects while zn vacancy (vzn) and oxygen interstitial (oi) are the main acceptor defects in intrinsic zno (60). From the calculation using full - potential linear muffin - tin orbital (fp - lmto) method by sun the energy interval between the donor level of zn interstitial and acceptor level of zn vacancies is found to be ~2.6 ev (6165). In the present case, the pl emission obtained ~487 nm corresponds to an energy 2.55 ev and hence it can be due to the transition between these levels . The green luminescence observed at 530 nm is generally attributed to intrinsic defects such as oxygen vacancies in the films (17). The x - ray diffraction patterns of eu2o3 doped zno films at different doping concentrations are shown in fig . 1 . The xrd patterns of all the films present a single sharp intense peak at 2 value 34.9 corresponding to (002) plane of hexagonal wurtzite structure of zno (jcpds card no-75 - 0576). Thus, the films present a single crystalline like structure with c - axis orientation . The c - axis orientation of the films is due to the lowest surface energy of (001) basal plane in zno and minimization of internal stress leading to preferred growth along direction (21, 22). Even after europium doping, the wurtzite crystal structure is preserved in all the films . Also, no spurious phase such as europium oxide is observed within the detection limit . X - ray diffraction patterns of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates and annealed at 773k . The d - value of the films is calculated using bragg's relation (23).1n=2dhklsinhkl where is the wavelength of the x - ray radiation and hkl is the angle of diffraction . Structural parameters of rf sputtered pure and eu2o3 dopedzno films (eu2o3 doping concentrations 0, 0.5, 1, 3 and 5 wt%) on quartz substrates and annealed at 773k it can be seen that the intensity of (002) peak in moderately doped films (e0.5, e1, and e3) is slightly greater than that of the undoped film . Thus, it can be seen that the moderate doping of eu2o3 enhances the crystallinity of the films . It is found that the fwhm of the (002) peak in the eu2o3 doped films are greater than that of undoped film . The ionic radius of zn is 0.74 a and that of eu is 0.947 a (24). The mismatch in the ionic radii of the dopant and host cation can be the reason for enhanced fwhm of the doped films which can introduce stress in the films . The 2 value of the eu2o3 doped films is slightly lower than that of undoped film, which means an increase in d 002 as expected from bragg's law . This may be attributed to the bigger size of the eu ion compared to the zn ion . The substitution of eu ion into the zno lattice may result in the expansion of the lattice . The average size of the crystallites (d hkl) in the films is estimated using the following debye - scherer formula (23).2dhkl=0.9hklcoshkl where is the wavelength of x - ray radiation (1.5406a), hkl is the bragg diffraction angle, and hkl is the fwhm of the diffraction peak in radian . The e0.5, e1, and e3 films show an average crystalline size of 16 nm . The lattice constants can be evaluated using the following equation,31dhkl2=43(h2+hk+k2a2)+l2c2 where a and c are the lattice parameters h, k, and l are the miller indices of the plane and d hkl is the inter - planar spacing . The lattice constant c of the films is calculated and is given in table 1 . It is observed that the lattice parameter c in the doped films is slightly larger than that of the undoped film . The increase in the lattice constant c in the doped films compared to the undoped film indicates slight expansion of the lattice due to the substitution of eu at zn sites . The introduction of dopant and the lattice mismatch between film and substrate can introduce strain in the films . The strain along the c - axis is calculated using the expression (25),4(%)=c - c0c0100 where is the strain along the c - axis perpendicular to the substrate surface . Combined with the elastic constants of single crystalline zno, the stress in the films can be calculated using the biaxial strain model (26),5=-453.6c - c0c0gpa where c is the lattice constant of the film calculated from the xrd data and c 0 is the strain - free lattice constant obtained from the jcpds data card . The positive value of stress indicates that the films are in a state of tensile stress . The biaxial tensile stress in the films is found to be decreasing from 5.54 to 4.93 gpa with eu2o3 doping . The stress developed in the thin films is generally related to growth parameters, substrate on which the film is deposited, defects, impurities, and lattice distortion in the films (6, 27). The stress associated with defects and impurities are termed as intrinsic stress, while that originating from lattice mismatch and difference in thermal expansion coefficient (tec) between film and substrate is termed as extrinsic stress (28). The stress originating from lattice mismatch between film and substrate in these films is difficult to calculate due to the amorphous nature of quartz substrate (28). It is generally assumed that the lattice mismatch strain is relieved at growth temperature by the formation of dislocations near the interface between film and substrate . However, the dislocation process freezes out on cooling and strain develops due to the difference in tecs of the film and substrate (29, 30). The stress introduced due to the difference in tecs of the film and substrate is given by the following equation,6th=tgrowth / annealrt(s-b)e1-dt where and are the tec of substrate and corresponding bulk material respectively . E is the young's modulus and v is the poisons ratio of the material . In the present study, tec values for quartz substrate and zno are = 0.5910/k and = 2.910/k, respectively . The young's modulus e and poisson's ratio v of zno are 100 gpa and 0.36, respectively . Substituting these values in equation, the thermal stress of the zno film is calculated and is found to be ~0.17 gpa . From equation, it is found that the thermal stress for the zno film deposited on quartz substrate increases with increasing annealing temperature . This shows that the thermal stress is small in comparison with the observed stress in the films . Hence, the stress in the films is likely to be intrinsic in nature, contributed by the growth process rather than thermal origin (31). This indicates that the total stress in the film is highly influenced by the sputtering process and is mainly attributed to the implantation of particles sputtered from the oxide target into the growing film . Mohanty et al . Reported that the surface oxygen is easily ionized during sputtering of the oxide target, and then gets accelerated with energy corresponding to full - potential drop across the cathode sheath . Even though these negative ions are neutralized during their transit, they reach the substrate with sufficient energy for implantation (28, 29). The bigger size of eu ion compared to zn ion results in the expansion of the lattice, which may produce deformation of the lattice and thereby introduce strain in the doped films . Zno with hexagonal wurtzite structure has a space group c6v4 (p63mc) with two formula units per primitive cell . (32), yields nine optical modes (excluding the three acoustic modes) and are distributed as7opt = a1 + 2b1+e1 + 2e2 of these, the a 1 and e 1 modes are both raman and ir active, whereas e 2 modes are only raman active and b 1 modes are inactive in both the spectra . The a 1 and e 1 modes are polar and splits into transverse optical (to) and longitudinal optical (lo) modes . The e 2 mode is non - polar with two frequencies: e 2(high) and e 2(low). The raman spectrum of zno powder presents two very intense bands at 100 and 437 cm, medium intense band at 332 cm and weak bands at 202, 379, 410, and 584 cm . Micro - raman spectrum of (a) zno powder and (b) its enlarged spectrum showing weak bands . Based on earlier works, the frequencies of fundamental optical modes in zno can be assigned as follows; e 2(low)=100 cm, e 2(high)=437 cm, a 1(to)=379 cm, e 1(to)=410 cm, and e 1(lo)=584 cm . The band observed at 202 cm may be assigned to 2e 2(low) and the band at 332 cm to e 2(high)e 2(low). Figure 3 gives the micro - raman spectra of undoped and eu2o3 doped zno films . The low - frequency e 2 mode is observed ~100 cm in undoped and eu2o3 doped zno films . The low - frequency mode is associated with the vibration of zn sub - lattice (3335). Raman spectra of both the pure and eu2o3 doped zno films present an intense raman band ~438 cm which can be attributed to e 2(high) mode . This mode is related to the vibration of oxygen atoms and is considered as the raman fingerprint of wurtzite zno phase (36). The medium intense band ~582 cm in the raman spectra of all the films can be due to e 1(lo) mode which is associated with the formation of various crystal defects such as oxygen vacancy, zinc interstitials, and so on in the films (37). The a 1(to) mode and e 1(to) mode can be expected ~380 and 407 cm respectively (38). Raman spectrum of powder sample presents these modes as weak bands ~379 and 410 cm . The a 1(lo) mode is observed as a weak band ~538 cm in the raman spectra of bulk zno (39). Many authors assigned the band ~332 cm as the difference mode e 2high e 2low (40). Micro - raman spectra of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates and annealed at 773k . Compared to the raman spectrum of zno powder (bulk), the raman spectra of films present a broad spectral feature . Here the broad nature of raman spectra of the films can be due to this residual stress . The measured thickness of the films is in the range 8394 nm and hence the spectral contribution from the substrate can also be expected in the raman spectra of the films . The medium intense band around 488 cm can be due to the contribution from the quartz substrate . Compared to the raman spectra of other films, the raman spectrum of 5 wt% eu2o3 doped film presents broader spectral feature . This can be attributed to the decline in crystallinity due to the higher doping concentration in this film as evident from the xrd analysis . In the present study, the e 2(high) mode for the undoped film is observed at 438 cm . The e 2(high) mode of the e 0.5 film also appears at 438 cm, but it is broadened . For e1 and e3 films, the e 2(high) mode is observed at 437 cm . In the e3 film, it is observed as a broader feature compared to e1 film . In the case of e5 film, the e 2(high) mode appears at 435 cm . Lupan et al . Also observed similar red shift in the e 2(high) frequency and broadening of e 2(high) mode with europium doping concentration . They suggested that the shift of e 2(high) mode towards lower wave numbers confirms the substitution of zn by eu ions in the zno lattice and the peak broadening indicates decline in crystalline quality of the films with europium doping (41, 42). Reported an additional mode ~275 cm in doped zno films and they attributed it to intrinsic host lattice defects which become activated as vibrating complexes or their concentration increases up on dopant incorporation (43). Also reported an additional raman band ~275 and 284 cm in zno which they attributed to intrinsic host lattice defects such as oxygen vacancies or zinc interstitials (44). In the raman spectra of the pure (e0) and doped films (e0.5, e1 and e3), a less intense band is observed ~276 cm whereas in the e5 film two medium intense bands are observed ~267 and 288 cm . Figure 4 shows the afm images (3d) of undoped and eu2o3 doped zno films . Afm image of undoped zno film presents uniform distribution of densely packed well - defined grains of more or less uniform size (around 45 nm) with well - defined grain boundaries . The e0.5 and e1 films show a tendency of coalescing smaller grains into bigger grains . The afm images of e3 and e5 films show uniform dense distribution of smaller grains . The rms surface roughness of the films is estimated using wsxm4 software, as shown in fig . The films with eu2o3 doping concentration 0.5 and 1wt% show higher rms surface roughness compared to the other films . The variation of the grain size with eu2o3 doping concentration obtained from the afm analysis (table 2) shows the same trend as obtained from xrd analysis . 3d afm micrographs of annealed zno films with different eu2o3 doping concentrations (a) pure (b) 0.5 wt% (c) 1 wt% (d) 3 wt% (e) 5 wt%, and (f) variation of rms surface roughness and grain size with doping concentrations . Morphological and optical parameters of rf sputtered pure and eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3 and 5 wt%) on quartz substrates and annealed at 773k the sem micrographs also present a smooth surface consisting of small grains of more or less equal size . The thickness measurements carried out using vertical sem micrographs are shown in fig . 6 and the thickness values sem micrographs of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates annealed at a temperature of 773k showing the surface morphology . The vertical sem micrographs of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates annealed at 773k showing the thickness of the films . Figure 7 shows the edx spectra of the undoped and eu2o3 doped zno films, annealed at 773k . The elemental analysis of the eu2o3 doped zno films show the incorporation of eu in the doped films . The edx spectra of rf sputtered eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3, and 5 wt%) on quartz substrates annealed at 773k showing the elemental analysis . Figure 8 shows the transmittance and reflectance spectra of undoped and eu2o3 doped zno films recorded in the wavelength range 200900 nm . Average transmittance of the films in the wavelength range 400900 nm are calculated and given in table 2 . All the films show very high transmittance, above 87% in the visible region . For all the films the transmittance exhibits a sharp reduction at around 380 nm corresponding to the fundamental absorption edge of zno . The sharp absorption onset in the uv - region and high transmittance in the visible region indicates the good crystalline and optical quality and direct band gap nature of the films . The oscillations observed in the transmission and reflection spectra of the films can be due to the interference of light arising from the difference in refractive indices of the film and the substrate and the interference of multiple reflections arising from the film and substrate surface . These oscillations in the spectra indicate that smooth films are formed on quartz substrate as evident from the afm analysis . Tan et al . Also observed interference fringes in the transmittance spectra and suggested that the zno films had optically smooth surfaces and the interface with the quartz substrate is also smooth (4649). Uv - visible spectra of undoped and eu2o3 doped zno films (a) transmittance spectra and (b) reflectance spectra . The optical absorption coefficient can be calculated from the transmittance spectra using the following relation8=1tln(1 t) where t is the thickness of the film and t is the transmittance of the film . The optical band gap of the films are calculated using the relation (50),9h=a(h-eg)n where n can have values, /2, 2 or 3 respectively for direct allowed, direct forbidden, indirect allowed and indirect forbidden transitions, h is the plank's constant, v is the frequency of the incident photon and a is the band edge constant depending on electron hole mobility . The band gap e g can be obtained by extrapolating the linear region of (hv) vs. hv plot to hv=0 . The best fit for tauc relation undoped film shows a band gap of 3.24 ev, which is smaller than the band gap of the bulk zno (3.37 ev) and eu2o3 doped films show higher band gap values (table 2). There are several reasons for the shift of band gap in the films such as improvement or reduction in crystallinity, modification in barrier height due to the change in crystallite dimension, quantum size effect, and change in the density of impurities, tensile or compressive strain in the films, and so on (51). Tauc plots of rf sputtered (a) pure and (b e) eu2o3 doped zno films (eu2o3 doping concentrations 0, 0.5, 1, 3 and 5 wt%) on quartz substrates and are annealed at a temperature 773k and (f) the variation of refractive indices of these films with photon energy . Huang et al . Reported that a tensile strain produces a decrease in band gap whereas a compressive strain can result in an increase in band gap (52). Ziabari et al . Suggested that the shift in band gap due to moderate or heavy doping is determined by two competing mechanisms: band gap narrowing which is a consequence of many body effects on the conduction and valance bands; and the band gap widening due to the well - known burstein the many body interaction effects leading to band gap narrowing may occur either between free carriers or between free carriers and ionized impurities (54, 55). According to quantum size effect it can be expected that the contribution from euions on substitutional sites of znions and eu - interstitial atoms may determine the widening of the band gap caused by increase in carrier concentration . Moss effect explained the broadening of band gap energy with the increase in carrier concentration . Typically the blue shift of the absorption edge of the eu2o3 doped zno films may be associated with an increase of the carrier concentration blocking the lowest states in the conduction band, which is well known as the burstein - moss effect (57). Optical constants play an important role in design and fabrication of optical devices as they are closely related to the electronic polarizability of ions and the local field inside the materials . The extinction coefficient k of the films is calculated using the equation10k=4 where is the absorption coefficient and is the wavelength of incident light . The optical reflection from the film is directly related to the refractive index of the film by the following relation (58),11n=(1+r)+(1-r)2k21-r where r is the reflectance of the film . The refractive indices of the films are found to be around 2, very close to the bulk value (table 2). The e5 film shows the highest value of refractive index of 2.226 and the e0 film shows the lowest value of refractive index of 1.905 . The optical constants are closely related to the electronic polarizability of ions and the local field inside materials . Hence, the determination of optical constants plays a crucial role in the design of optical devices and optical communication systems (20, 59). The complex dielectric constant of the material can be defined as12()=r()+ii() the real and imaginary parts of the dielectric constant are related to n and k values by the relation13r()=n2()-k2() and14i()=2n()k(). The frequency dispersion of in the films can be obtained from the transmission and reflection spectra, which can provide the propagation, reflection, and loss of light in the films . Figure 10 shows the dependence of real and imaginary parts of dielectric constant on wavelength, known as dispersion curve and absorption curve respectively . The values of real parts of dielectric constants are higher than that of imaginary parts . The real parts of dielectric constants of eu2o3 doped zno films are found to be smaller than that of pure zno films . The variation of r and refractive index follows similar trend, whereas the variation of i follows the behavior of k. the variation of refractive index and extinction coefficients of the films as a function of photon energy is shown in fig variation of real and imaginary parts of dielectric constants of undoped and eu2o3 doped zno films as a function of photon energy . Variation of refractive index and extinction coefficients of undoped and eu2o3 doped zno films as a function of photon energy . The loss factor tand is the ratio of i and r (20). Variation of loss factor of undoped and eu2o3 doped zno films as a function of photon energy . Figure 13 shows the room temperature pl spectra of undoped and eu2o3dopedzno films recorded using excitation wavelength of 325 nm . The undoped film shows three main peaks at 409, 450, and 487 nm and a weak peak at 530 nm . The peak ~409 nm corresponds to near band edge emission (nbe) in zno which originates from the recombination of excitons . 0.5 wt% eu2o3 doping has caused reduction in the peak intensity and broadening of the peaks . . Room temperature photoluminescence spectra of undoped and eu2o3 doped zno films using excitation wavelength of 325 nm . The visible emissions observed may be due to the defects such as oxygen vacancy, zn interstitials, antisite oxygen, and so on in the films . Xrd and raman results suggest the presence of tensile stress and formation of defects in the films . Zn interstitial (zni) and oxygen vacancy (vo) are the main donor defects while zn vacancy (vzn) and oxygen interstitial (oi) are the main acceptor defects in intrinsic zno (60). From the calculation using full - potential linear muffin - tin orbital (fp - lmto) method by sun the energy interval between the donor level of zn interstitial and acceptor level of zn vacancies is found to be ~2.6 ev (6165). In the present case, the pl emission obtained ~487 nm corresponds to an energy 2.55 ev and hence it can be due to the transition between these levels . The green luminescence observed at 530 nm is generally attributed to intrinsic defects such as oxygen vacancies in the films (17). Eu2o3 doped zno films are deposited on quartz substrate with various doping concentrations using rf magnetron sputtering . The structural, morphological, optical, and luminescent properties of the films are investigated . Xrd analysis reveals the formation of nanostructured films exhibiting hexagonal wurtzite structure with (002) orientation . Micro - raman spectra show high- and low - frequency e 2 modes indicating the hexagonal wurtzite structure of zno in the films . Afm image of undoped zno film presents uniform distribution of densely packed well - defined grains of more or less uniform size with well - defined grain boundaries . All the films exhibit very good transparency in the visible region with a sharp cut - off around 380 nm . The appearance of interference fringes in the transmittance and reflectance spectra indicates good optical quality of the films . Band gap energy calculations using tauc plot shows slight increase in the values of band gap with eu2o3 doping . The photoluminescence spectra show both nbe and deep level emissions and the intensity of the peaks decreases with eu2o3 doping concentration . There is no conflict of interest in the present study for any of the authors.
|
The countermovement jump (cmj) is an explosive movement that is essential in many sports, including basketball and volleyball1 . Cmj height, which is determined by measuring the jump height starting from an erect position followed by a downward movement before starting to push off, is an important criterion in athletic evaluation . Athletes spend much time and effort in various training activities to improve their athletic performance2 . Many researchers have reported the performance characteristics of the cmj and have discussed multiple issues related to achieving better cmj height3,4,5 . Ugrinowitsch et al.6 reported that better cmj height was the result of an increased vertical shift in the body s center of mass . To improve cmj performance, ankle flexibility4, muscle strength3, 7, 8, initial jumping posture (squat depth)5, and take - off velocity during vertical jump1 are required . Robertson and fleming9 investigated the contributions of the extensors in the lower limb and found that the greatest contributor to jump performance was the hip (40%) followed by the ankle (35.8%) and the knee (24.2%). Furthermore, another study suggested that ankle joint flexibility contributes significantly to increasing cmj height4 . During a vertical jump, the contribution of the ankle joint depends on the torque produced by the plantar flexors as well as the ankle dorsiflexion range of motion (df rom)10 . Toe flexor muscles (tfm), which support the longitudinal arch of the foot against the reaction of the floor on the forefoot, also affect athletic performance11 . Previous studies reported that tfm strengthening may have a positive effect on athletic performance7, 12 . In addition, tfm strength may affect the use of the metatarsophalangeal joint (mpj) before take - off during the cmj10 . To date, no studies on the effects of tfm strength on cmj height have been conducted . Therefore, this study investigated the correlations between peak tfm strength, df rom, and cmj height . The results of this study may help identify the factors for improving cmj height in training athletes . Eighteen healthy volunteers (age: 23.3 2.5 years, body weight: 71.9 11.2 kg, height: 174.6 3.8 cm, df rom: 19.6 3.9, cmj height: 46.3 10.3 cm) participated in this study . All participants were free of injuries, especially in the ankle joints, feet, and mpj . The exclusion criteria were (1) any cardiovascular, respiratory, abdominal, neurological, musculoskeletal, or other chronic disease and (2) any symptoms that could affect the musculoskeletal system . The study procedure was approved by the yonsei university wonju campus human studies committee (approval number: 1041849 - 201508-bm-018 - 03); all participants provided written informed consent before enrollment . Peak tfm strength, df rom, and cmj height were used as the variables in this cross - sectional study . Each participant s body weight and height were determined at the beginning of the test protocol . Prior to gathering data, participants performed a warm - up that consisted of 5 minutes of walking up and down the stairs . Three cmjs were performed by each participant, and the mean value (mean cmj height) was used for analysis . Peak tfm strength was measured using a digital dynamometer (msc-200, ametec inc, largo, fl, usa). For a stable measurement setting, the digital dynamometer was attached to a wooden frame consisting of a platform, a vertical board, and a footboard13, 14 . Each participant was instructed to sit comfortably with his or her back supported by a chair backrest and to place the foot to be tested on the footboard . The hip, knee, and ankle joints were positioned at 90 during the test . The toe to be measured was inserted into a leather cuff that was placed on the plantar side of the proximal phalanx, and the participant was instructed to pull the cuff downward as hard as possible for 5 seconds . Each of the 5 toes (phalanges) was measured 3 times in the same way . For familiarization with the testing procedure, participants were allowed to practice before measurement . For analysis, the highest value of 3 tfm strength measurements in each toe was used . A 3-minute rest period was provided between the strength measurements of each toe to minimize muscle fatigue . A blinded tester with experience working with a digital dynamometer read and recorded the strength value for each tfm on the digital display to eliminate experimental bias (table 1table 1.mean (sd) of peak toe flexor muscle strengths by participants (n=18)first toesecond toethird toefourth toefifth toepeak tfm strength13.1 3.93.1 1.02.8 0.83.1 1.0 4.2 1.3values are presented as the mean sd . Tfm: toe flexor muscle the maximal df rom of the dominant leg was measured with a universal goniometer in 1 increments with the participant lying prone with 90 knee flexion . One lever of the goniometer was positioned on the proximal fibular head, while the pivot was placed on the lateral malleolus . The measuring arm was positioned on the fifth metatarsal bone, and its position was used to determine the passive df rom15 . Participants were instructed to perform 3 maximal cmjs with the use of both arms, trying to cover the longest possible vertical distance . The highest successful cmj height among the 3 attempts of each participant was chosen for jump height analysis7 . Two - dimensional (2d) kinematics measurement was obtained during the procedure with regular sampling at 25 hz . A camera (canon 500d, tokyo, japan) was mounted on a tripod, which was placed 5 m away from the participants, to record movements in the sagittal plane . A marker was placed on the sacrum at the approximate center of mass (com), and the camera lens was focused on each participant s sacral marker in the standing position16 . Video sequences were digitized and examined using virtualdub software (avery lee, version 1.5.10, cambridge, ma, usa; http://www.virtualdub.org/). The images were then analyzed using the imagej computer program (national institutes of health, bethesda, maryland usa; http://rsb.info.nih.gov/nih-image) for height comparison . The data were analyzed using pasw version 18.0 (chicago, il, usa) for windows . Pearson correlation coefficients (r) were used to determine the strength and directionality of the relationships among the variables (peak tfm strength, df rom, and cmj height). Mukaka17 suggested threshold values of 0.00.3, 0.30.5, 0.50.7, 0.70.9, and 0.91.0 for negligible, low, moderate, high, and very high correlation coefficients, respectively . In addition, the coefficient of determination (r) was used to account for the variation among the variables . In all analyses, table 2table 2.correlation coefficients between peak tfm strength, df rom, and cmj heightfirst tfmsecond tfmthird tfmfourth tfmfifth tfmdf romcmj heightfirst tfm strength1.0second tfm strength0.161.0third tfm strength0.0820.7011.0fourth tfm strength0.2280.5030.7901.0fifth tfm strength0.2080.6250.6230.5851.0df rom0.7100.2190.1860.0070.0291.0cmj height0.7650.0210.2330.1020.0630.6421.0*p<0.05; * * p<0.001 . Cmj: countermovement jump, df rom: ankle dorsiflexion range of motion, tfm: toe flexor muscle shows the pearson s correlation coefficients between peak tfm strength, df rom, and cmj height in the participants . Cmj height showed a moderate correlation with df rom (r=0.642, r=41.3%, p<0.001) and a high correlation with peak first tfm strength (r=0.765, r=58.5%, p<0.001). The relationships between cmj height and peak tfm strength of the other toes were negligible (r=0.021 to 0.233, p>0.05). * p<0.05; * * p<0.001 . Cmj: countermovement jump, df rom: ankle dorsiflexion range of motion, tfm: toe flexor muscle the results of this study indicate that cmj height is correlated with peak first tfm strength and df rom in healthy subjects . Several previous studies investigated multiple issues related to cmj and reported a proximal - to - distal sequence of muscle activation hip extensors, followed by knee extensors and finally ankle plantar flexors3, 18and a proximal - to - distal transfer of energy during jumping10, 19 . Papaiakovou4 reported that the ankle should be a key joint in transmitting the energy generated by the proximal part (hip extensor, knee extensor, and ankle plantar flexor) to the ground during cmj execution . However, the mpj is smaller than the other joints in the leg, but the mpj force amounts to about 86% body weight during push - off in the gait cycle20 . The tfm around the mpj may have a profound effect on forefoot loading and force transmission21, and improvements of tfm strength training may have a significant effect on athletic performance enhancement7, 12 . The results of this study indicate a high correlation between peak first tfm strength and cmj height (r=0.765, r=58.5%, p<0.001). Cohen22 reported that the coefficient of determination could be used to more fully interpret the r value . Thus, 58.5% of the total variation in peak first tfm strength can be explained by variation in cmj height . Nihal et al.23 reported that dancers had greater hallux muscle strength than non - dancers (7 4n vs. 6 4n, respectively; p<0.049). In addition, the first tfm strength was twice the second tfm strength (9 4n vs. 4 1n, respectively; p<0.001). Furthermore, tanaka et al.24 demonstrated that the tfm are important contributors to sustaining dynamic balance; in particular, the tfm of the hallux was greater than the sum of the others combined . Tfm strength may influence mpj stiffness before take - off during cmj performance . Stefanyshyn and nigg10 reported that increasing mpj stiffness would decrease the energy lost at the mpj, which would correspond to a positive effect on jump height . This finding may indicate a lack in the peak first tfm strength leading to a large amount of energy loss and, therefore, would not adequately transmit energy via the lower limb extensors before take - off during a cmj . Thus, the results of this study suggest that the peak first tfm strength is an important factor not only in stabilization of the forefoot but also in the transmission of energy generated from the lower limb extensors to the ground, as well as in improving athletic performance; it is a major contributor in performing a higher cmj . Df rom during a full squat before take - off was reported to affect cmj height25 . In this study, cmj height showed a moderate positive correlation with df rom (r=0.642, r=41.3%, p<0.001), consistent with the results of a previous study4 . Individuals with a greater df rom were reported to have the ability to place their heels in contact with the ground during a full squat, which causes the ankle plantar flexor muscles to achieve sufficient force - generating capacity for a deeper squat position before take - off4 . It has been shown that an active muscle, when lengthened, may sustain high forces and stretch the tendon sufficiently so that it can store elastic energy for the late concentric phase when the muscle activity starts to decay26 . However, studies have shown that people lacking df rom raised their heels off the ground, had greater horizontal shift rather than vertical shift of com, and achieved a low jump height25, 26 . Thus, df rom is thought to be a second contributor to achieving sufficient force - generating capacity and proper vertical shift of com during cmj performance . First, the participants performed the experiment barefoot, but they wear shoes for actual athletic activities . Second, other related muscles that may contribute to the cmj, including the ankle plantar flexors, knee extensors, and hip extensors, were not investigated . However, this study is the first to examine the relationship between peak tfm strength and cmj height . Further study is needed to investigate the correlation between peak tfm strength and ankle plantar flexors . Second, further research will need to examine whether improvement in peak tfm strength and df rom can have a clinically useful impact on cmj performance . This study was performed to investigate the correlations between df rom, peak tfm strength, and cmj height . The results of this study indicate that the peak first tfm strength and df rom are the main contributors to cmj performance . Measuring the strength of peak first tfm, ankle plantar flexors, knee extensors, and hip extensors in the lower limb and df rom may be useful in clinical practice for improving jump performance in athletes such as volleyball and basketball players.
|
There is an increase in the use of angiotensin ii type 1 receptor antagonists (at ii antagonists) and angiotensin - converting enzyme inhibitors (ace - inhibitors) as prophylactic treatment of migraines, in addition to their use as antihypertensives . These drugs pass the placenta and have highly adverse effects on the renal organogenesis, leading to maldevelopment firstly of the renal system and secondarily of the lungs [1, 2]. The fetus is autopsied without conclusive diagnosis . In the woman s next pregnancy, only 6 weeks later one week later, the midwife finds a declining symphysis to fundus increment, and the woman is therefore immediately referred to the hospital ., she had three to four attacks every week of unilateral, throbbing pain associated with nausea, vomiting and photophobia, lasting 648 h, preceded by transient scintillating scotomas . During pregnancy,, she has been taking candesartan (16 mg / day), pramipexole (0.18 mg 3) and amitriptyline (25 mg / day) as prophylaxis against migraines, in addition to zolmitriptan and metoclopramide during attacks . Candesartan treatment was initiated more than a year before her first pregnancy by an experienced neurologist who was also consulted during pregnancy . The medication was known to her general practitioner and the doctors who conducted the ultrasound examinations . The hospital obstetricians documented the medication in the admission notes in both pregnancies . Nonetheless, the fetus is 33 weeks before doctors become aware that the medication is fetotoxic . When the baby is born, he has renal tubular dysgenesis, hypoplasia of the skull and the lungs, and hyaline membranes of the lungs . Medline and the norwegian database of adverse effects were searched for descriptions of fetal injuries related to at ii antagonists ace - inhibitors . Information about the extent of use of these drugs in norway was obtained from the national prescription database . Angiotensin ii receptor antagonists and ace - inhibitors reduce blood pressure by blocking the renin - angiotensin system . They also have a positive, prophylactic effect against migraines, although the mechanisms are poorly understood . The colocalization of at1, glutamate and gaba receptors on medullary rostral ventromedial neurons suggests a nociceptive modulatory . Unfortunately, these drugs cross the placenta and affect the circulation of the fetal kidneys, and, more importantly, reduce stimulation of at ii receptors . This has a highly adverse effect on the renal organogenesis in the second and third trimesters . The kidneys develop abnormally and are unable to produce urine; there is oligohydramnion and thereby, inter alia, maldevelopment of the lungs [1, 2]. The summary of product characteristics in the technical brochures clearly states that these drugs are fetotoxic and should not be used during pregnancy . More than 20 cases of fetal injury / maldevelopment after exposure to at ii antagonists and ace - inhibitors have been reported in the literature [1, 2]. 1.2% of women aged 3039 years were dispensed drugs in 2007 that affect the renin - angiotensin system, an increase compared to 2004 . More than 50% of childbearing women in norway are more than 30 years old . The mean age at delivery is increasing and will thus cause the number of pregnant women with hypertension requiring medical treatment to increase . In addition, there is reason to believe that there is an increase in the use of these drugs against migraines . They are well tolerated, and several studies have demonstrated their positive prophylactic effects [711]. In american and european guidelines, candesartan is listed among second- and third - line agents, respectively, for migraine prophylaxis [1214]. In australia it is not yet listed as an appropriate agent, but is widely used by the neurologists . This also appears to be the case in norway, although it is difficult to document, as these are not approved drugs against migraines in this country . A variety of drugs from diverse pharmacological classes are in use for migraine prevention . At ii antagonists and ace - inhibitors are traditional antihypertensives that have proved to be effective also in migraine prophylaxis . Their fetotoxic effects have been demonstrated in humans [1, 2] and well documented in animal research . When administered to rats, mice or piglets during renal development these drugs induce severe renal histological abnormalities, including papillary atrophy, tubulointerstitial fibrosis and tubular atrophy and dilatation [16, 17]. Nonetheless, there is reason to believe that an increasing number of women of reproductive age will use these drugs . They should be advised of the possible hazards, and treatment should be stopped as soon as pregnancy is planned or detected.
|
Deoxyribonucleic acid (dna), the basic substance of life, changes over the long term in the process of evolution, but strict homeostasis of dna is important over the short term for the maintenance of individual organisms . Dna damage is thought to occur at the rate of tens of thousands events daily in each cell (endogenous dna damage) while it is carrying out basic activities (normal metabolic processes) due to replication errors and oxidative damage . Exogenous factors (ultraviolet [uv] light, ionizing radiation, and environmental mutagens created by humans [tobacco smoke, exhaust fumes, etc .]) Also cause dna damage, so it is constantly occurring within living organisms . If the damage affects an important part of the genome, mutation, replication arrest, or inhibition of transcription may occur, leading to impairment of cellular function, cell death, aging, carcinogenesis, or even death of the organism . However, organisms are not defenseless against dna damage, because various dna repair systems have been developed in the course of evolution to efficiently repair harmful dna damage via very precise mechanisms that involve many proteins functioning in an integrated fashion . Xeroderma pigmentosum (xp) is a human mutation that causes hypersensitivity to uv radiation, resulting in inherited severe photosensitivity, which was initially described by the austrian dermatologist kaposi at the end of the 19th century.1,2 the first breakthrough in the study of xp, however, was only achieved when the radiation biologist cleaver found that it was caused by abnormal removal / repair of uv - induced dna damage.3 like xp, cockayne syndrome (cs) and trichothiodystrophy (ttd) are also diseases caused by a human mutation leading to defective dna repair . It is constantly exposed to exogenous factors that cause damage (uv light, ionizing radiation, environmental mutagens, drugs, etc . ), coupled with endogenous factors such as metabolites, reactive oxygen species, and replication errors, resulting in new dna damage at every moment . Dna damage can be classified into the following 8 types based on the structural changes that occur (fig ., type 1 is caused by solar uv radiation (uvc, uvb and uva2) (not visible light) that leads to dimerization of two adjacent pyrimidine bases . Successive pyrimidine bases can be activated by uv radiation, resulting in dimerization via a covalent bond between the c5 and c6 positions to create a cyclobutane pyrimidine dimer (cpd). Alternatively, a bond between the c6 position on the 5 side and the c4 position on the 3 side causes distortion, generating a (64) pyrimidine pyrimidone dimer photoproduct (64pp). Of all dna damage caused by uv irradiation, the former type accounts for 75% and the latter for 25% . Repair of cpd is a relatively slow process, and damage still persists at 24 hours after uv irradiation . On the other hand, repair of 64pp is rapid and the damage is almost completely eliminated after 3 hours . Furthermore, lethality is frequent with the former type of mutation, whereas the latter is associated with a high rate of mutagenicity . In figure 1, is called base modification, and this change does not cause distortion of dna . Living organisms have dna repair systems in order to maintain the integrity of dna that carries the genetic code for life . These repair systems can cope with various types of dna damage and are divided into 6 categories, including photoreactivation, dealkylation of alkylated bases, direct repair of damage (eg, repair of single - strand or double - strand breaks), excision repair, recombination repair, or post - replication repair (translesion dna synthesis). Photoreactivation utilizes long - wavelength uv light and visible light to repair pyrimidine dimers produced by exposure to uv radiation . Depending on the type of dna damage, a covalent bond of a dimer is cut by electron transfer through the activity of two enzymes (cpd photolyase and 64 photolyase). The excision repair system includes a base excision repair (ber) mechanism and a nucleotide excision repair (ner) mechanism . Recently, an association between the onset of neurological symptoms of xp and abnormalities of this repair mechanism has been pointed out.4 the latter is the most important dna repair mechanism (fig . 3), and it plays a role in the removal of cpds and 64pps . This repair mechanism can remove relatively large dna regions encompassing dozens of bases as a complete unit, and is the mechanism most frequently involved in the pathogenesis of xp, cs and ttd . In ner, there are two main pathways, global genome repair (ggr) and transcription - coupled repair (tcr) and each pathway includes 4 steps; these are damage recognition, dna unwinding, incision / dna excision and de novo synthesis.5 post - replication repair (ie, translesion dna synthesis) is a back - up repair system for the ner mechanism that acts slowly and attempts to bypass residual cpd sites . In xp variant (xpv), the ner mechanism functions properly, but there are defects of the post - replication repair system (fig . 3).6 xeroderma pigmentosum is a rare photosensitive dermatosis with autosomal recessive inheritance that is caused by abnormalities of the repair mechanisms for uv - induced dna damage and is associated with a high frequency of skin cancer.7,8 the frequency of xp in japan is 1 person in tens of thousands, but this prevalence is more than 10 times higher compared with that in europe and the united states.9 in a typical case, the skin of the face and other sun - exposed areas is affected by repeated severe sunburn from early childhood (fig . 4b). A phototest will reveal a marked decrease of the minimal erythema dose and a severe delayed erythema reaction . Should patients fail to carry out strict sun protection, skin tumors such as basal cell carcinoma, solar keratosis, squamous cell carcinoma and melanoma will occur frequently from an early age, with the risk being more than 1,000 times higher than in healthy individuals . Progressive central and peripheral neurological degeneration are observed in 30% of all xp patients (60% of japanese patients), but the underlying mechanisms remain unknown . There are several genetically distinct types of xp that are categorized into a total of eight groups . These include seven groups (a to g) with ner abnormalities and one variant that has normal ner function but defective post - replication repair . The progression of symptoms, severity, and prognosis are different for each group.9 the groups that present with characteristic neurological symptoms of xp are xpa, xpd, and xpg . In xpb, all patients have cs (see below), whereas some xpd patients have both cs and ttd (see below). Xpa patients with severe dermatological and neurological symptoms accounts for 54%, followed by the xp variant with only dermatological symptoms, accounting for 25% . On the other hand, xpc patients without neurological symptoms are common (40%) in europe and the united states . Almost all xpa patients develop central or peripheral neurological complications, including impaired psychomotor development, and the severity of their neurological defects influences the prognosis . Based on the clinical diversity of xp, it can be classified as the cutaneous type with skin symptoms only, the neurological type with xp neurological symptoms, the cs type with symptoms of cs, and the ttd type with symptoms of ttd.10 however, the association between clinical features / biological characteristics of xp (decrease of uds and marked decrease of cell viability after uv irradiation) (phenotype) and the type or location of the xp gene mutation (genotype) has not been clarified . Cs was first reported in 1946 by the british pediatrician cockayne as a case with a marked decrease in growth accompanied by atrophy of the optic nerve and hearing loss.11 similar to xp, it is an extremely rare autosomal recessive disorder (1 in 0.51 million) that occurs due to failure of the ner mechanism, a major repair system for uv - induced dna damage, especially for damage at sites of transcription . Over 200 cases have been reported in europe and the united states, whereas there have been about 70 cases reported in japan . Diverse features can be noted, such as microcephaly, a distinct facies (an aged look, sunken eyes, beak - like nose, big ears, protruding upper jaw), short stature, malnutrition, poor growth, pigmentary retinal degeneration, hearing loss, and mental retardation . These findings are not at all apparent immediately after birth, but start to appear around the age of 2 years and progress with aging . Freckle - like pigmentation of sun - exposed areas, as seen in patients with xp, and skin cancer are absent in patients with cs, except for those with xp / cs . Calcification of the brain is observed on head computed tomography (ct) and this finding is of high diagnostic value . Impaired liver and kidney function and diabetes mellitus occur as complications, and 80% of patients die before the age of 20 years due to infections such as pneumonia.12 there are also rare mild cases where the onset is delayed.12 clinically, cs is classified into 3 types: a classic type (type 1) in which patients survive until around the time of puberty, a severe type (type 2) in which patients die in infancy, and a delayed or adult - onset mild type (type 3) 2 genetically different types exist (groups a and b), with 25% being csa and 75% being csb . The defective proteins csa (also called ercc8; the gene responsible is at chromosome 10q11.23) and csb (ercc6; the gene responsible is at chromosome 5q12.1) are essential for the ner mechanism and both act in the early phase of tcr . Diseases that exhibit the cs phenotype can be classified into 5 types according to the genes responsible, which are (1) csa, (2) csb, (3) cs / xpb, (4) cs / xpd, and (5) cs / xpg . Among these xp / cs complex, with each type being attributed to mutation of the xpb gene, xpd gene, and xpg gene, respectively . In types 1 and 2, patient cells maintain normal ggr, but tcr defects lead to impaired cell viability and a markedly decreased ability to synthesize ribonucleic acid (rna) after uv irradiation, despite normal unscheduled dna synthesis (uds), which is an indicator of ggr . Types 3, 4, and 5 are complicated by xp, and occur due to mutations of the xpb, xpd, and xpg genes, respectively, with the clinical picture sometimes including abnormal facial pigmentation and malignant skin tumors in addition to features of cs . Because many of the factors associated with the ner system involved in the pathogenesis of cs also affect transcription, these patients can have various symptoms in addition to symptoms related to premature aging . Cerebro - oculo - facio - skeletal (cofs) syndrome is a disorder with the main characteristics of congenital microcephaly, congenital cataract, microphthalmia, progressive arthrogryposis, and severe growth failure . Recently, a genetic mutation of csb has been found, that is considered to represent a subtype of cs, and its relation to the xpd or ercc1 genes has been suggested in some reports.1315 ttd is known as sulfur - deficient brittle hair syndrome, since the main symptoms of this extremely rare autosomal recessive congenital disease include hair abnormalities due to a decreased sulfur content, accompanied by various other symptoms such as short stature, ichthyosis, mental retardation, abnormal nail plates, abnormal teeth, and infertility . The characteristic of this disease is short and brittle hair (trichorrhexis nodosa or trichoschisis) due to a low content of cysteine, one of the sulfur - containing amino acids . Observation under a polarizing microscope reveals a yellow and black striped pattern known as tiger tail banding . According to statistics from the united states, ttd patients also have mental retardation (86%), short stature (73%), and ichthyosis (65%).16,17 genetically, there are three types of the photosensitive form of ttd: (1) the ttda type with no functional ggr or tcr, high sensitivity to uv radiation, and low uds; (2) a type with xpg gene mutation; and (3) a type with xpd gene mutation . Of these, the third type is the most common (85%), while the first and second types are very rare . The protein responsible for ttda is a component of tfiih, which has recently been revealed to be tfb5 (gtf2h5) involved in both transcription and ner.18 because ttda, xpb, and xpd are all components of tfiih, it is speculated that symptoms of ttd other than hypersensitivity to sunlight may be due to abnormalities of transcription . On the other hand, in the non - photosensitive form of ttd, the responsible gene is ttdn1 (c7orf11), which is only involved in transcription and is not a component of tfiih . The frequency has been reported to be 1 in 1 million persons for europe and the united states, while only 2 cases have been reported in japan (unconfirmed group and ttd - a in 1 case each). Definitive diagnosis of the above - mentioned diseases is mainly achieved by using cultured fibroblasts from the patient s skin to perform the following tests: (1) measurement of uds after uv irradiation, (2) assessment of uv light sensitivity (with or without caffeine), (3) assessment of the level of dna repair and a complementation test, and (4) genetic or protein analysis . In patients with xp (excluding xpv) and ttd, cells are hypersensitive to killing by uv, and uds is reduced to less than 50% of that in normal cells . Cells from csa and csb patients are highly sensitive to uv radiation and show normal levels of uds / impaired synthesis of rna after uv irradiation . The possibility of xpv becomes higher if caffeine increases uv sensitivity . Xpa accounts for the majority of xp in japan, and a homozygous mutation (g to c) at the 3 splice acceptor site of intron 3 of the xpa gene is detected in 79% of patients, while a heterozygous mutation is detected in 16% . In addition, there is a homozygous mutation involving exon 6 (r228x) in 2% and a heterozygous mutation in 9% . These abnormalities (ivs3 - 1 g> c, r228x) represent xpa gene mutation hot spots for japanese patients (the former is the major hot spot and the latter is the minor hot spot), and both mutations can be easily identified by pcr - restriction fragment length polymorphism analysis (alwn i, hph i).9,19 due to the strong founder effect, accurate genetic testing can be performed rapidly in most japanese patients with xpa, and this is also utilized in genetic services such as carrier detection20 and prenatal diagnosis . Definitive diagnosis of other xp groups, cs and ttd can be achieved by a genetic complementation test that assesses the ability of patient cells to reactivate a reporter gene (eg, a luciferase expression vector) after uv damage . It is difficult, however, to obtain a definitive diagnosis of xpe and xpv with this complementation test, so protein and genetic analyses are required.22 since xp, cs, and ttd are all genetic disorders, a cure cannot be expected . Therefore, strict and complete lifetime protection from uv radiation for prevention of complications is the basic policy for patients with these diseases . As measures for protection against sunlight, patients are instructed to use a topical sunscreen with a high spf value and high pa grade, and are told to wear tops with long sleeves, long pants, a hat, uv protective clothing, and uv protective glasses when they go out . Achieving complete uv protection stops the progression of freckle - like pigmentation and suppresses the development of malignant skin tumors (fig ., there are no effective evidence - based treatment measures because the pathogenesis is still unclear . Intake of a diet rich in vitamin c, vitamin e, and catechin (which have an antioxidant effect) stimulation of the brain, and encouragement of movement from early childhood may prevent neurological symptoms from advancing . Older children should regularly attend a rehabilitation service for the purpose of delaying movement disorder and preventing contractures . Due to the need for lifelong protection from sunlight, patients with inherited photosensitivity diseases have an impaired quality of life (qol). Because patients with xp, cs, and ttd also have various specific complications, qol is further decreased for these patients and their families . In other words, patients and families suffer from severe physical, mental, and economic stress due to the heavy burdens of strict lifetime uv protection, complications, children with disabilities, incurable disease, and genetic problems . Adequate care for patients with such diseases and support for their families cannot be provided by physicians alone . Under such circumstances, there is an important role for patient and family advocacy groups, which are founded with the objectives of sharing knowledge about diseases and ideas or information for daily living, sharing enjoyment, and making society aware of these rare diseases in order to improve the healthcare environment . The activities of such patient and family advocacy groups are naturally patient / family - driven, but physicians and researchers involved with these diseases also offer positive support through provision of information and other assistance.
|
A healthy 15-year - old woman was admitted to the department of neurosurgery of our institution with a chief complaint of a 1-month history of headache and dizziness . 1) demonstrated a 6.85 cm - sized, solid and cystic intra - axial mass in the right temporooccipital area, compressing the posterior horn of the right lateral ventricle . The solid portion of the mass included a calcification, thus presumably partly infiltrating into the brain parenchyma . Differential diagnoses based on radiology include astroblastoma, ependymoma, pleomorphic xanthoastrocytoma and supratentorial primitive neuroectodermal tumor . Postoperatively, the patient received a focal fractionated radiotherapy with a total dose of 5,040 cgy . A follow - up mri was taken on postoperative month 5, which revealed no recurrence or progression of the tumor . Most of the small- to medium - sized cells with papillary structures had hyperchromatic nuclei and coarse chromatin . They had a round - to - oval shape and contained hyperchromatic nuclei, eosinophilic cytoplasm and prominent eosinophilic intranuclear inclusions . Considering the cytologic features along with the clinical and radiological data, we made an intraoperative frozen diagnosis of ependymoma . With a retrospective review of the slides, we identified a perivasculasr pseudorosettes - like lesion . The surgical specimens consisted of multiple pieces of soft red - to - grey tissue . Then, the specimens were sectioned at a thickness of 2 m and then stained with a hematoxylin and eosin dye . For immunohistochemistry, we used antibodies against glial fibrillary acidic protein (gfap), epithelial membrane antigen (ema), cytokeratin, ki-67, synaptophysin, and cd99 (mic2). 3, a histopathologic examination showed that the tumor had perivascular pseudorosettes; this is one of the characteristic features of ependymoma . The tumor cells had histopathological findings that are consistent with squash smear ones described above . This was also accompanied by the frequent presence of bizarre pleomorphic giant cells with prominent intranuclear eosinophilic inclusions . According to the who criteria, it had features of an anaplastic tumor, including a marked cellularity, abundant mitoses, vascular proliferation and necrosis . That is, it had a high intensity, a dot - like expression of cd99 and that of ema . In addition, the tumor cells had a ki-67 labeling index of about 10% (fig . A rare variant of ependymoma, gce poses a diagnostic challenge for the pathologists on the intraoperative frozen section as well as the permanent section . But pseudorosettes are not present in all the case of gce . According to zec et al.,2 who first described two cases of gce in 1996, the absence of perivascular pseudorosettes in gce might reflect the failure of the neoplastic cells to elaborate perivascular process . This often leads to the misdiagnosis of gce as glioblastoma multiforme,11 anaplastic astrocytoma,6 subependymomal giant cell astrocytoma or tanycytic ependymoma5 on intraoperative frozen section . In addition, gce should also be differentially diagnosed from anaplastic oligodendroglioma, clear cell ependymoma, pleomorphic xanthoastrocytoma and giant cell glioblastoma.10 despite these diagnostic challenges, there has been an increase in the demand for rapid intraoperative diagnosis . This is particularly case with the neurosurgical practice . A simple, reliable, and rapid method, the squash smear technique is useful to present detailed cytologic features of lesions . It is useful in making an intraoperative diagnosis of central nervous system lesions.14 to our knowledge, however, there are no reports about the cytologic features of gce . We performed a review of literatures about gce, focusing on the cytologic features seen on the tissue sections, whose results including our case are summarized in table 2 . The cytologic features are classified based on the cellularity, hyperchromatic nuclei, binucleation or multinucleation, eosinophilic cytoplasm, intranuclear inclusion / pseudoinclusions, perivascular pseudorosettes, brisk mitosis, necrosis and fibrillary background . Basically, all the 14 cases showed hypercellularity, mitosis and necrosis . Of the total cases, 93% (13/14) had eosinophilic cytoplasm and perivascular pseudorosettes; 71% (10/14) did hyperchromatic nuclei; 57% (8/14) did intranuclear inclusions / pseudo - inclusions; and 50% (7/14) did binucleation or multinucleation . It is noteworthy, however, that these features are based on tissue sections of gce rather than cytology specimens such as the squash smear preparations . It is, therefore, a matter of course that there is no consistency in the cytologic features between the tissue sections and the cytology specimens . In our case, there were perivascular pseudorosettes on the tissue sections, but not found on the squash smear preparations . But both diagnostic modalities showed such findings as mitosis and necrosis, giant cells and intranuclear inclusions / pseudoinclusions . Further comparative descriptions are warranted to define the cytologic features of gce between tissue sections and cytology specimens . In making an intraoperative frozen diagnosis based on squash smear preparations featuring the mitosis and necrosis, as well as the high cellularity, and the presence of giant cells showing hyperchromatic nuclei with eosinophilic cytoplasm and intranuclear inclusions / pseudoinclusions would be key histologic features that are helpful for establishing a diagnosis of gce . This is particularly true to our case; the presence of giant cells with intranuclear inclusions and papillary structures was a critical clue to intraoperative frozen diagnosis . In addition to the cytologic features, the clinical and radiologic findings are helpful for improving the diagnostic accuracy . Due to a relatively smaller number of reported cases, we failed to establish the relationship between the histological pattern of gce and its prognosis . In patients with anaplastic gce, however, a poor prognosis is expected with a relatively higher rate of recurrence (table 1). In our patient, there was no disease progression or recurrence . Due to a shorter length of follow - up, however, further long - term follow - up studies are warranted to predict clinical outcomes of anaplastic gce
|
We retrospectively reviewed seventeen infants with hydrocephalus who were treated in our department by etv from jul . This study included 17 patients between the ages of 51 days and 337 days, with an average age of 143 days, 9 males and 8 females, 4 han people and 13 hui people . Of the 17 patients there were 5 cases with encephalitis history, 2 cases with cerebral hemorrhage, and 10 cases of congenital hydrocephalus . Among the 10 cases with congenital hydrocephalus, were congenital aqueductal stenosis in 6 cases, chiari malformation in 2 cases, and dandy walker syndrome in 2 cases . Cine phase contrast magnetic resonance imaging (pc cine mri) scan shows obstructive hydrocephalus in all cases . The patient is placed supine and the head is elevated 20 - 30 to minimize excessive cerebral spinal fluid (csf) loss . A hook incision is made in the scalp 3 cm in diameter just lateral to the midline and anterior to the coronal suture . After a burr - hole approximately 1 cm diameter is created in the frontal bone, the dura is opened in cruciate fashion and the edges are suspended . 14 peel - away catheter is then used to cannulate the frontal horn of the lateral ventricle . The foramen of monro is located by following the choroid plexus, septal veins, and thalamostriate veins, and the endoscope is passed through this opening and placed into the third ventricle . Once the endoscope is in the third ventricle the cast shadow of basilar artery / posterior cerebral artery, the infundibular recess, and the bilateral mamillary bodies can be observed (fig . Fenestration is performed in the slight avascular area at the midway between the infundibular recess and the mamillary bodies (fig . A special tongs type grab is used for fenestration, and the edges of the orificium fistulae in 5 mm diameter are then coagulated . The lilliquest membrane is opened through the orificium fistulae under the endoscope so that there is full communication between the third ventricle and the basal cistern (fig . After exploring pulsation of the basilar artery and posterior cerebral artery through the orificium fistulae the endoscope is withdrawn . While repeatedly rinsing with 0.9% nacl, a latin sponge is used to close the punctured pathway and the dura is sutured tightly, mending the periosteum if necessary, and the skull is closed . After surgery multiple (2x-3x) lumbar puncture was performed for a period of 7 days in order to promote csf circulation, release hemorrhagic csf, and alleviate the discomfort . Ct or mri was performed 7 days and 30 days after surgery to explore the narrowing of the ventricular system (fig . 2, 3). This study included 17 patients between the ages of 51 days and 337 days, with an average age of 143 days, 9 males and 8 females, 4 han people and 13 hui people . Of the 17 patients there were 5 cases with encephalitis history, 2 cases with cerebral hemorrhage, and 10 cases of congenital hydrocephalus . Among the 10 cases with congenital hydrocephalus, were congenital aqueductal stenosis in 6 cases, chiari malformation in 2 cases, and dandy walker syndrome in 2 cases . Cine phase contrast magnetic resonance imaging (pc cine mri) scan shows obstructive hydrocephalus in all cases . The patient is placed supine and the head is elevated 20 - 30 to minimize excessive cerebral spinal fluid (csf) loss . A hook incision is made in the scalp 3 cm in diameter just lateral to the midline and anterior to the coronal suture . After a burr - hole approximately 1 cm diameter is created in the frontal bone, the dura is opened in cruciate fashion and the edges are suspended . 14 peel - away catheter is then used to cannulate the frontal horn of the lateral ventricle . The foramen of monro is located by following the choroid plexus, septal veins, and thalamostriate veins, and the endoscope is passed through this opening and placed into the third ventricle . Once the endoscope is in the third ventricle the cast shadow of basilar artery / posterior cerebral artery, the infundibular recess, and the bilateral mamillary bodies can be observed (fig . Fenestration is performed in the slight avascular area at the midway between the infundibular recess and the mamillary bodies (fig . A special tongs type grab is used for fenestration, and the edges of the orificium fistulae in 5 mm diameter are then coagulated . The lilliquest membrane is opened through the orificium fistulae under the endoscope so that there is full communication between the third ventricle and the basal cistern (fig . After exploring pulsation of the basilar artery and posterior cerebral artery through the orificium fistulae the endoscope is withdrawn . While repeatedly rinsing with 0.9% nacl, a latin sponge is used to close the punctured pathway and the dura is sutured tightly, mending the periosteum if necessary, and the skull is closed . After surgery multiple (2x-3x) lumbar puncture was performed for a period of 7 days in order to promote csf circulation, release hemorrhagic csf, and alleviate the discomfort . Ct or mri was performed 7 days and 30 days after surgery to explore the narrowing of the ventricular system (fig . 2, 3). Of the 17 postoperative infants the skull and ventricular system of 7 cases shrank: 1 case with encephalitis history, 1 cases with cerebral hemorrhage, 4 cases with congenital aqueductal stenosis, and 1 case with chiari malformation, yielding an effective rate of 41.2% . 1 case failed because of severe ventricle inflammatory adhesion, excessive exudation, and vague basilar artery . In the remaining 9 cases whose ventricles were unchanged, ventriculoperitoneal shunt was performed for 4 cases, 5 cases gave up the further operation . Intraoperatively, 2 cases with small artery hemorrhage were repeatedly rinsed with 0.9% nacl and the bleeding gradually stopped . Of the 17 postoperative infants the skull and ventricular system of 7 cases shrank: 1 case with encephalitis history, 1 cases with cerebral hemorrhage, 4 cases with congenital aqueductal stenosis, and 1 case with chiari malformation, yielding an effective rate of 41.2% . 1 case failed because of severe ventricle inflammatory adhesion, excessive exudation, and vague basilar artery . In the remaining 9 cases whose ventricles were unchanged, ventriculoperitoneal shunt was performed for 4 cases, 5 cases gave up the further operation . Intraoperatively, 2 cases with small artery hemorrhage were repeatedly rinsed with 0.9% nacl and the bleeding gradually stopped . It is thought that the ventricular system may develop at an important and specific embryonic time period of neural stem cell proliferation and differentiation in the brain . There are many factors influencing the incidence of infantile hydrocephalus7) such as: asphyxia in perinatal period, hypoxic ischemic encephalopathy, intracranial hemorrhage, premature birth, hyperbilirubinemia, and perinatal infection; the genetic factors cannot be excluded as well11). Gansu province is located in the upper region of the yellow river in northwestern china . It has a population of 26 million (2009) and has a large concentration of hui chinese in linxia hui autonomous prefecture . In this study we noticed that most infants with infantile hydrocephalus were hui chinese from the linxia area (68.4%). Very recently a specific clinical syndrome or genetic cause was found to correlate with infantile hydrocephalus in a minority in united states (they did not mention which syndrome it is)8). This scientific result inspires us to investigate the possible etiological factors for hui chinese in gansu china in our future work . The second cause we feel it important is hui chinese have an early marriage and pregnancy custom . For these 13 cases, the average maternal ages are only 17.2 years old to give birth, this might be consistent with most research believed maternal component is a significant cause for infantile hydrocephalus4). Currently etv is the first choice for csf shunt therapy in patients with obstructive hydrocephalus; additionally, the prevailing view is that it can be applied to communicating hydrocephalus9). It thereupon popularizes etv to infantile hydrocephalus and congenital hydrocephalus, but the effect is still controversial . Some scholars2,6) believe that it is not suitable for infants younger than 2 years old, especially under 1 year old due to the incomplete absorption system of csf, the orificium fistulae is reclosed, or new membrane formed postoperatively . In 2008 lipina et al.3) reported that 14 patients under 6 months that presented with obstructive hydrocephalus were treated with etv . The etiology of hydrocephalus was congenital aqueduct stenosis in five patients, posthemorrhagic obstruction in eight patients, and combination of posthemorrhagic and postinfection in one patient . They recommend etv as the method of choice in children younger than 6 months of age . In 2010 ogiwara et al.5) investigated 23 patients younger than 6 months that presented with obstructive hydrocephalus and were treated endoscopically . The etiology of hydrocephalus was congenital aqueduct stenosis in 11 patients, posthemorrhagic obstruction in six patients, myelomeningocele in two patients, postmeningitis in two patients, chiari i malformation in one patient, and dandy walker variant in one patient . 3 months of age, success rate was 25.0% . In patients from 3 to 6 months of age, based on the above data, etv should be the first method of choice for hydrocephalus in children younger than 6 months of age, especially in patients older than 3 months of age . Gallo et al.1) reviewed 23 patients younger than 6 months and without a previous history of shunting underwent etv in their institution between 2003 and 2009 . Total success rate was 39.1% . In the successful cases, median age was 140 days, whereas in the unsuccessful cases it was 47 days . The patients' basic body situation should be taken in consideration before the etv performed, such as age, the tolerance of a ventriculoperitoneal shunt, and the incident rate of complications . In our study of 17 patients, 7 cases improved remarkably: their heads and ventricles shrank, cerebral cortexes thickened morphologically . Compared with a ventriculoperitoneal shunt, etv has its own advantages: no foreign object (shunt tubing and valve) implanted in the body thus avoiding the catheter related complications such as shunt occlusion, infection, over drainage, abdominal complications, the danger of an infant's thin skin being punctured by catheter, and need for shunt revision with increased age . After accept etv, the csf is close to the physiologic circulation, meanwhile, some other procedure can be done intraoperatively: pellucid septostomy, aqueductoplasty, cyst fenestration, etc . Our data showed there are fewer postoperative complications, less bleeding, fever, and subdural collection of fluid after surgery . In summary, because of their thin skin and younger age the treatment of infantile hydrocephalus is very difficult . Considering all the benefits mentioned above, we conclude etv is the best treatment choice for infantile hydrocephalus . We will explore the possible pathogenic factors for infants in future studies so we can avoid or prevent hydrocephalus occurred early . It is thought that the ventricular system may develop at an important and specific embryonic time period of neural stem cell proliferation and differentiation in the brain . There are many factors influencing the incidence of infantile hydrocephalus7) such as: asphyxia in perinatal period, hypoxic ischemic encephalopathy, intracranial hemorrhage, premature birth, hyperbilirubinemia, and perinatal infection; the genetic factors cannot be excluded as well11). Gansu province is located in the upper region of the yellow river in northwestern china . It has a population of 26 million (2009) and has a large concentration of hui chinese in linxia hui autonomous prefecture . In this study we noticed that most infants with infantile hydrocephalus were hui chinese from the linxia area (68.4%). Very recently a specific clinical syndrome or genetic cause was found to correlate with infantile hydrocephalus in a minority in united states (they did not mention which syndrome it is)8). This scientific result inspires us to investigate the possible etiological factors for hui chinese in gansu china in our future work . The second cause we feel it important is hui chinese have an early marriage and pregnancy custom . For these 13 cases, the average maternal ages are only 17.2 years old to give birth, this might be consistent with most research believed maternal component is a significant cause for infantile hydrocephalus4). Currently etv is the first choice for csf shunt therapy in patients with obstructive hydrocephalus; additionally, the prevailing view is that it can be applied to communicating hydrocephalus9). It thereupon popularizes etv to infantile hydrocephalus and congenital hydrocephalus, but the effect is still controversial . Some scholars2,6) believe that it is not suitable for infants younger than 2 years old, especially under 1 year old due to the incomplete absorption system of csf, the orificium fistulae is reclosed, or new membrane formed postoperatively . In 2008 lipina et al.3) reported that 14 patients under 6 months that presented with obstructive hydrocephalus were treated with etv . The etiology of hydrocephalus was congenital aqueduct stenosis in five patients, posthemorrhagic obstruction in eight patients, and combination of posthemorrhagic and postinfection in one patient . They recommend etv as the method of choice in children younger than 6 months of age . In 2010 ogiwara et al.5) investigated 23 patients younger than 6 months that presented with obstructive hydrocephalus and were treated endoscopically . The etiology of hydrocephalus was congenital aqueduct stenosis in 11 patients, posthemorrhagic obstruction in six patients, myelomeningocele in two patients, postmeningitis in two patients, chiari i malformation in one patient, and dandy walker variant in one patient . 3 months of age, success rate was 25.0% . In patients from 3 to 6 months of age,, etv should be the first method of choice for hydrocephalus in children younger than 6 months of age, especially in patients older than 3 months of age . Gallo et al.1) reviewed 23 patients younger than 6 months and without a previous history of shunting underwent etv in their institution between 2003 and 2009 . In the successful cases, median age was 140 days, whereas in the unsuccessful cases it was 47 days . The patients' basic body situation should be taken in consideration before the etv performed, such as age, the tolerance of a ventriculoperitoneal shunt, and the incident rate of complications . In our study of 17 patients, 7 cases improved remarkably: their heads and ventricles shrank, cerebral cortexes thickened morphologically . Compared with a ventriculoperitoneal shunt, etv has its own advantages: no foreign object (shunt tubing and valve) implanted in the body thus avoiding the catheter related complications such as shunt occlusion, infection, over drainage, abdominal complications, the danger of an infant's thin skin being punctured by catheter, and need for shunt revision with increased age . After accept etv, the csf is close to the physiologic circulation, meanwhile, some other procedure can be done intraoperatively: pellucid septostomy, aqueductoplasty, cyst fenestration, etc . Our data showed there are fewer postoperative complications, less bleeding, fever, and subdural collection of fluid after surgery . In summary, because of their thin skin and younger age the treatment of infantile hydrocephalus is very difficult . Considering all the benefits mentioned above, we conclude etv is the best treatment choice for infantile hydrocephalus . We will explore the possible pathogenic factors for infants in future studies so we can avoid or prevent hydrocephalus occurred early . Endoscopic third ventriculostomy is a safe and effective procedure for the treatment of infantile hydrocephalus.
|
Thymoma is an uncommon neoplasm of the thymus, derived from the thymic epithelial cells . Myasthenia gravis (mg) is the most common paraneoplastic neurological disorder associated with thymoma . About 3050% of thymoma patients mg with thymoma is particularly associated with autoantibodies against postsynaptic nicotinic acetylcholine receptors (achr - abs). However, mediastinal and pleural recurrence remains a significant clinical problem, especially for patients with advanced and incompletely resected thymoma [68]. Surgical treatment of recurrent thymoma is technically challenging and has been reported to be effective in only one - third of patients . Even following radical thymoma resection, patients may still suffer from mg, and continuous follow - up and pharmacological treatments are needed for these patients . A growing number of studies have indicated that these drugs are effective in treatment of the patients with advanced or invasive thymoma [1116]. In patients with mg - associated thymoma, symptoms of both mg and the tumor have been reported to be improved by steroid therapy, particularly in advanced or metastatic cases . Immunosuppressive agents such as azathioprine and methylprednisolone have also been used for treatment of invasive thymoma - associated mg, with improved clinical symptoms and reduced tumor volumes . Moreover, combined treatment with steroids and immunosuppressive agents has been suggested to be useful in treatment of invasive thymoma and myasthenic symptoms . Myasthenic crisis has been reported in a patient receiving steroid chemotherapy for advanced thymoma with mg . Unfortunately, almost all these studies are case reports, making it difficult to assess the therapeutic potential of steroids in these patients . In this study, we retrospectively analyzed a series of mg patients with metastatic thymoma that received steroid pulse therapy in combination with immunosuppressive agent therapy . Mg patients with metastatic thymoma were reviewed retrospectively . A total of 12 patients who underwent methylprednisolone pulse therapy during january 2013 to january 2016 were identified . The diagnosis of mg was based on clinical symptoms and confirmed by acetylcholine receptor antibody (achr - ab) test, neostigmine test, fatigue test, and electromyography tests . Histological diagnosis of thymomas was performed based on the world health organization (who) histological classification . As shown in table 1, 8 mg patients with metastatic thymoma were initially treated according to their clinical conditions, but the symptoms were not improved . Methylprednisolone pulse therapy was begun at 1 g / day and reduced by half every 3 days until reaching 60 mg / day . Oral methylprednisolone at 52 mg / day was then prescribed and the patients were discharged from the hospital . The dose of methylprednisolone was reduced and then tapered slowly on alternate days cyclophosphamide was given simultaneously at a dose of 100 mg / day and continued for 2 months until the discontinuance of oral methylprednisolone . The clinical outcome of mg at discharge and during the follow - up was assessed based on the clinical absolute and relative scoring system . Briefly, the clinical relative score (crs) was calculated to evaluate the improvement or deterioration of the mg: (1) clinical remission (cr): crs 95%; (2) basic remission (br): 80% crs <95%; (3) marked improvement (mi): 50% crs <80%; (4) improvement (i m): 25% crs <50%; and (5) ineffectiveness (ie): crs <25% . The total clinical efficiency was based on the number of patients with crs 25% (cr, br, mi, and i m). A follow - up ct scan was performed to assess the response of the thymoma according to who criteria . Complete remission was defined as the disappearance of clinical evidence of active tumors for at least 4 weeks; partial remission (pr) as a minimum 50% reduction in total tumor size for at least 4 weeks; non - response (nr) as less than 50% reduction or more than 25% increase in total tumor size of existing lesions; and progressive disease (pd) as more than 25% increase in any measurable lesions or appearance of new lesion(s). All patients were followed up until the date of death or june 2016, and the activity and progression of the diseases were recorded . Mg patients with metastatic thymoma were reviewed retrospectively . A total of 12 patients who underwent methylprednisolone pulse therapy during january 2013 to january 2016 were identified . The diagnosis of mg was based on clinical symptoms and confirmed by acetylcholine receptor antibody (achr - ab) test, neostigmine test, fatigue test, and electromyography tests . Histological diagnosis of thymomas was performed based on the world health organization (who) histological classification . As shown in table 1, 8 mg patients with metastatic thymoma were initially treated according to their clinical conditions, but the symptoms were not improved . Methylprednisolone pulse therapy was begun at 1 g / day and reduced by half every 3 days until reaching 60 mg / day . Oral methylprednisolone at 52 mg / day was then prescribed and the patients were discharged from the hospital . The dose of methylprednisolone was reduced and then tapered slowly on alternate days . Cyclophosphamide was given simultaneously at a dose of 100 mg / day and continued for 2 months until the discontinuance of oral methylprednisolone . The clinical outcome of mg at discharge and during the follow - up was assessed based on the clinical absolute and relative scoring system . Briefly, the clinical relative score (crs) was calculated to evaluate the improvement or deterioration of the mg: (1) clinical remission (cr): crs 95%; (2) basic remission (br): 80% crs <95%; (3) marked improvement (mi): 50% crs <80%; (4) improvement (i m): 25% crs <50%; and (5) ineffectiveness (ie): crs <25% . The total clinical efficiency was based on the number of patients with crs 25% (cr, br, mi, and i m). A follow - up ct scan was performed to assess the response of the thymoma according to who criteria . Complete remission was defined as the disappearance of clinical evidence of active tumors for at least 4 weeks; partial remission (pr) as a minimum 50% reduction in total tumor size for at least 4 weeks; non - response (nr) as less than 50% reduction or more than 25% increase in total tumor size of existing lesions; and progressive disease (pd) as more than 25% increase in any measurable lesions or appearance of new lesion(s). All patients were followed up until the date of death or june 2016, and the activity and progression of the diseases were recorded . The medical records of 12 mg patients with metastatic thymoma who underwent methylprednisolone pulse therapy plus methylprednisolone were reviewed . The median age of the patients was 48 years (range: 2665 years). Clinical characteristics with regard to thymoma and mg of the patients and prior treatments are summarized in table 1 . Anti - acetylcholine receptor (anti - achr - ab) test results were positive in all but 1 patient . The histologic types of thymoma were b2 in 4 patients, b3 in 3 patients, b1 in 2 patients, and ab in 1 patient . The clinical type of mg was iib in 8 patients, iv in 3 patients, and i in 1 patient . As shown in table 3, the most common sites of metastases were the pleura, occurring in 5 out of 12 patients . However, biopsies were not performed in some cases; therefore, the exact histological types of their thymomas were not available . The mean time from surgery to local metastasis was 42 months (range: 1865). The patients were initially treated by radiotherapy, docetaxel - based chemotherapy (docetaxel plus cisplatinum or docetaxel alone), and/or immune globulin therapy, without improvement in clinical outcome . Methylprednisolone pulse therapy was then prescribed in combination with an immunosuppressive agent (ctx). After methylprednisolone pulse plus ctx therapy for 15 days, chest ct showed marked shrinkage of the thymoma in all patients . As shown in table 4, 5 patients were in complete remission and the remaining 7 patients were in partial remission . With respect to clinical outcome of mg, the symptoms of all patients were resolved, with a remission rate of 100% (crs 25%). The response to mg was mi in 6 cases, br in 4 cases, cr and i m in 1 case each . During the treatment period, 1 patient developed myasthenic crisis and the symptom infection was the most common one and occurred in 4 patients (3 with pulmonary infection and 1 with gastrointestinal fungal infection). The patients were followed up for 11.5 months (range: 435). During the follow - up, 1 patient (case no . 8) developed pleural metastasis 20 months later and received further methylprednisolone pulse plus ctx therapy . Steroids and immunosuppressive agents have both been used for treatment of mg and thymoma . The latter is generally prescribed together with steroids to allow tapering the dose of steroids . However, to the best of our knowledge, their use in treatment of mg and thymoma has been reported as case reports in only a few patients with mg - associated thymoma . Therefore, we retrospectively analyzed the therapeutic potential of methylprednisolone pulse plus ctx therapy in a case series of 12 mg patients with metastatic thymoma during january 2013 to january 2016 . Our study showed a marked beneficial effect of combined use of high - dose steroid pulse therapy in combination with an immunosuppressive agent in treatment of metastatic thymoma and mg . Glucocorticoids are widely used for treatment of thymoma, especially for advanced or recurrent / metastatic ones . The most dramatic response has been reported in cases of subtype b1 thymoma, which contains numerous lymphocytes [11,2830]. The mechanism has been suggested to be associated with the apoptotic effects of corticosteroids on the lymphocyte component of the tumors . However, it was also reported to act on both neoplastic thymic epithelial cells and lymphocytes . Glucocorticoid receptor (gr) is expressed in all histological types of thymoma, and no significant difference has been identified among the different subtypes . Furthermore, steroid pulse therapy has been reported to induce the apoptosis of both neoplastic thymic epithelial cells and lymphocytes . In mg - associated thymoma, mg was found to be significantly more common in type b thymomas, particularly in subtype b1 . Most mg - associated thymomas that have been reported to respond to glucocorticoids (alone and combined) were b type . Corroborating the results of these studies, in the present study almost all primary thymomas high - dose methylprednisolone pulse therapy plus immunosuppressive agents dramatically reduced the tumor sizes of all patients . Our findings show that glucocorticoids pulse therapy plus immunosuppressive agents is helpful for treatment of metastatic thymoma with mg . Hayashi et al . Suggested that high - dose methylprednisolone with chemotherapy was potentially effective for invasive thymoma, regardless of the histological subtypes of thymoma . However, in view of the few cases reported and the few cases of type a thymoma - associated mg in our study, it is hard for us to determine the therapeutic effect of glucocorticoids in different histological types of thymoma associated with mg . Therefore, future studies with a larger number of patients, especially with type a thymoma - associated mg, are needed . Both mg and thymoma however, high - dose glucocorticoid pulse therapy has been reported to cause transient exacerbation of mg symptoms, which may lead to use of low - dose steroids among patients and physicians . However, according to a double - blind placebo - controlled study, a single intravenous methylprednisolone pulse caused no severe adverse effects in patients with moderate mg . A comparative study of high - dose intravenous methylprednisone with low - dose oral prednisolone in an open - label, randomized trial showed more rapid improvement and fewer adverse effects in the high - dose intravenous methylprednisone group . In mg - associated thymoma, mg crisis has been reported in a patient when chemotherapy, including high - dose methylprednisolone, was prescribed for advanced thymoma . In other case studies of mg - associated thymoma, however, no adverse effects were reported with use of steroids or their combined therapy with immunosuppressive agents . Our results showed some adverse effects of methylprednisolone pulse therapy plus immunosuppressive agents, most commonly infections . These variations seem to be caused by the different regimens of steroids and immunosuppressive agents used in our study . The combined treatment with steroid - sparing immunosuppressants has been suggested to be helpful for dose - tapering of steroids, which may contribute to the reduced risk of related adverse effects . However, despite these variations, the results of our study show that methylprednisolone pulse therapy plus an immunosuppressive agent was effective and well - tolerated in synchronous treatment of mg and metastatic thymoma, without significant adverse events . Primarily, it was a retrospective study without a control group; therefore, the same diagnostic and therapeutic protocols were not available . In addition, the number of patients recruited was small and it was difficult for us to analyze the risk factors based on this small sample size, and a larger cohort study is needed . Despite these limitations, our study shows therapeutic benefit of methylprednisolone pulse therapy plus immunosuppressive agents in treatment of both mg and metastatic thymoma . Our study describes a series of mg patients with metastatic thymoma well controlled by methylprednisolone pulse therapy plus immunosuppressive agents (ctx). Our findings suggest that steroid pulse therapy in combination with immunosuppressive agents were effective and well - tolerated in treatment of both metastatic thymoma and mg . Steroid pulse therapy plus immunosuppressive agents should therefore be considered in mg patients with metastatic thymoma for synchronous treatment of both thymoma and mg.
|
To estimate population exposure of apes and owm species in africa to evs, we conducted a seroepidemiologic study of serotype - specific neutralizing antibodies against 3 ev types . These seroprevalences were compared with seroprevalences in human populations in areas where primates also lived (cameroon, zimbabwe, and south africa) and with those in control populations in europe (united kingdom and finland). Ethical approval for the use of study samples was obtained from the university of zimbabwe institutional review board and the medical research council of zimbabwe; the human research ethics committee, south african national blood service; the ethics committees of the cameroonian ministry of health; the centre hospitalier universitaire de sherbrooke, canada; and lothian regional ethics committee, edinburgh . Ev - d94 (e210), ev - a76 (kaz0014550) (4,5), and a clinical isolate of echovirus 11 from edinburgh (e-11) were used for seroprevalence studies . Neutralization assays were performed in human rhabdomyosarcoma cells as described (6) with 1 minor change (inactivation at 56c for 45 min). Serum specimens at 2 dilutions (1:16 and 1:64) were incubated with virus (one hundred 50% tissue culture infectious doses) in 96-well plates . Rhabdomyosarcoma cells were added to wells (2 10 cells / ml), and cultures were incubated at 37c for <6 days . The highest dilution that completely inhibited viral replication was taken as the endpoint titer for the sample . Plasma samples were collected from chimpanzees (p. troglodytes), gorillas (gorilla gorilla gorilla), and several owms (table 1). Sample shipments complied with the convention on international trade in endangered species of wild fauna and flora . Samples were collected for veterinary welfare purposes from animals in 2 wildlife sanctuaries in yaound and limbe, cameroon . Animals were primarily wild born and brought to sanctuaries after confiscation by authorities or abandonment by owners . Human samples were obtained from 3 sub - saharan african populations and control groups in the united kingdom and finland (table 2). Plasma was separated from anticoagulated blood by centrifugation and stored at 70c until testing . * the study was designed to determine the extent to which a human ev serotype (e-11) could spread into nonhuman populations, and conversely, the extent to which ev - a76 (previously recovered from chimpanzees) circulated in human populations in areas where chimpanzees also lived (cameroon), elsewhere in africa in regions without apes, and in nonprimate - exposed control populations in europe . Species d viruses are frequently isolated from chimpanzees and gorillas (3), and we selected ev - d94, isolated from populations in central africa, as a representative of this species . Chimpanzees and gorillas showed evidence (figure) of extensive previous exposure to e-11 (58% and 72%) and ev - a76 (40% and 11%). Lower levels of antibodies were detected against ev - d94 (13% and 0%). Conversely, owms showed higher seroreactivity with ev - a76 (37%) than with e-11 (15%) and ev - d94 (2%), which demonstrated wide circulation of this virus among owm species . Seven samples from mona monkeys accounted for half of e-11positive samples, and ev - a76 antibodies were widely distributed in baboons, mandrills, and other species . Seroprevalence of neutralizing antibody (titers> 16) to echovirus 11 (e-11) and enteroviruses a76 (ev - a76) and d94 (ev - d94) in a) human populations and b) nonhuman primates . Contrasting patterns of ev exposure to the 3 ev types were observed in humans (figure). High seroprevalences of e-11 and ev - d94 were observed in all human populations (53%95% and 63%85%), whereas seroreactivity to ev - a76 was largely confined to cameroon (55%) and zimbabwe (35%), and uniformly <6% elsewhere . Serologic testing of nonhuman primate samples provided unequivocal evidence of exposure to all 3 serotypes . Although primate sampling was restricted to animals held in sanctuaries under veterinary supervision and infections may have been acquired in captivity from human or dietary sources, epidemiologic observations support the hypothesis that ev infections may also be acquired in the wild . Many sampled animals were adults on entry to sanctuaries, while analogous to human infections, and ev exposure is frequent during infancy or childhood . Also, ev infections in apes are widespread in the wild, and active infections are found in more than one sixth of animals screened (3). Another factor determining whether evs can be indigenous to a species or originate from repeated external (cross - species) transmission is host population size . Perpetuation of nonpersistent viruses requires minimum population sizes large enough to sustain chains of transmission, which is dependent on duration of infectivity, seasonality of infections, duration of immunity, generation time of the virus and host, rate of population turnover (7,8), and degree of fragmentation of populations . These parameters are difficult to estimate in nonhuman primates, although studies of isolated human communities show that population size needed for maintaining transmission of evs may be large, e.g., poliovirus infections were not sustained among an eskimo community of 450 persons (9). Therefore, chimpanzee and gorilla populations may be too small and fragmented to sustain ev infections . However, relatively long - term fecal excretion of evs, the environmental stability of shed evs, and contamination of nest sites may perpetuate infections within an established group . In contrast to apes, the population size of several owm species is large, and with higher population connectivity, turnover, and supply of susceptible animals, it may support indigenous circulation of evs . Supporting this suggestion is genetic evidence that evs isolated from owms in southern asia and africa group separately from most variants identified in humans elsewhere by phylogenetic analysis (10). Ev variants in chimpanzees that matched owm serotypes (e.g., ev - b110 most closely related to sa5, and ev - a76, ev - a89, and ev - a90 in the owm species a group) (3; unpub . Predation of the red colobus monkey by chimpanzees (11,12) may favor such cross - species transmissions, as documented in the genesis of simian immunodeficiency viruscpz from owm simian immunodeficiency viruses (13). Cross - species transmission from owms to apes is consistent with high seroprevalences of ev - a76 antibodies in apes, baboons, and other owms . Overall, our serologic survey data and previous fecal sampling data (3) provide evidence for extensive circulation of evs between primates and existence of human and owm reservoirs of infection that may spill over into ape populations too small to maintain indigenous ev variants . Whether owms or apes represent a potential source of new evs in humans (that may become pandemic in the absence of prior population exposure) is uncertain . However, the global outbreak of ev - d70 that originally centered on a cluster of human infections in central africa (14,15) provides a potential example of this occurrence . Extensive past infection of a variety of evs in apes and owms should lead to a reappraisal of the host range of what have been considered to be primarily human viruses and a potential source for the periodic emergence of new ev types into immunologically naive human populations.
|
The dissemination of hepatitis viruses among patients in hemodialysis (hd) centers is one of the most important causes of morbidity and mortality in end stage renal disease patients . While the introduction of vaccination programs and isolation of hd machines have limited the spread of hbv infection, its prevalence rates continue to be unacceptably high in most hd centers . Prevalence of positive hepatitis b surface antigen (hbsag) ranged between 1.3% and 14.6% in asia - pacific countries and 13.3% in turkey [2, 3]. Hepatitis c virus (hcv) is also a major cause of liver disease in hd patients . Prevalence of hcv in hd wards has been reported from 5% to 60% in different countries . High risk behaviors and blood transfusion are not the usual routes of hcv transmission in hd patients . Environment of hd and failure to follow the safety measures for infection control may be the main cause of hcv dissemination in these centers . Accordingly the kidney disease improving global outcome (kdigo) in 2008 and the center for disease control and prevention (cdc) in 2001 advised protocols for infection control in hd centers . Principally, these recommendations are based on: (a) compliance with infection control protocols by healthcare professionals (hcp), (b) performing viral serological tests periodically, and (c) continuing training courses for personnel [7, 8]. The main practical points to be considered are cleaning the rooms and patients' area, disinfection of instruments, correct drug preparation, and regular hand hygiene [9, 10]. Appropriate staff training and regular monitoring for hepatitis viruses are also mandatory . In a study from saudi arabia, by utilization of these recommendations, no new case of hcv was found in a period of 2 years . Viral hepatitis infections are still the challenging problem in hd centers in iran . In a review by alavian et al . Serologic markers of hbv and hcv showed a declining trend from 3.8% and 14.4% to 2.6% and 4.5%, respectively, in recent years, but it varies in different parts of the country . In our recent report, seroprevalence of hcv, hbv, and hcv - hbv coinfection was 7%, 7%, and 1.7%, respectively, in hd centers in kerman province . Ministry of health recommended universal anti - infective standard precautions to all hd centers but they are not supervised officially . In order to clarify the contributing risk factors for higher viral transmission in this part of country, this study was conducted to determine the compliance rate of hcp with safety recommendations of kdigo and cdc in southeast of iran . This cross - sectional study was carried out in seven hd centers around the whole province of kerman, in 2011 . Out of 208 hd patients, 91 cases were under healthcare services in kerman city, the center of the province and the remained 117 cases were distributed in other 6 cities . The data were collected by using a check list based on the safety recommendations of cdc and kdigo protocols . These recommendations are a major part of educational program both at the beginning of work and also during the annual retraining courses for hd personnel in iran . The content of the check list comprised of three parts: (a) necessary care taken by the hcp (18 items), (b) periodic viral serological assessment (4 items), and (c) participation of hcp in retraining courses (4 items). The first part of the study was observed during working hours . After the first part finished, the other two parts were assessed by interviewing with the hcp and reviewing the documents . We defined the rate of observance of recommended protocols by hcp into four categories: (a) excellent: 90%, (b) good: 8089%, (c) adequate: 7079%, and (d) weak: less than 69% compared to standard (100%) safety measures by cdc and kdigo protocols . Data were analyzed using spss version15 (spss inc ., chicago, il, usa) software . Dialysis was performed in three running times: 138 (66.3%) cases in the morning, 58 (27.9%) cases in the evening, and 12 (5.8%) cases at the night hours . Hcp who worked in dialysis wards were 61 persons (36 females, 25 males) with a mean age of 32.4 11.2 years old . The first item of this section was the presence of a dedicated clean room in the hemodialysis wards . The level of adherence of hcp was adequate to excellent in 10 items . Weak adherence was observed in 7 items: not sharing of trolley to carry patients' medications (29.8%), cleaning and disinfecting the shared instruments (46.2%), using single use materials for many patients (52.4%), carrying used materials in disposable and nonpermeable containers (51.9%), not returning of unused materials to the clean room (55.3%), adherence to adequate hand washing (58.7%) and not drawing drug for injection to many patients from a single vial (67.3%). A significant difference was observed for some of the items between working shifts (table 1). Hbv monitoring including hbs ag detection, hbv vaccination, and regular measurement of hbs antibody (ab) titer had been performed in all of the patients . It covered 74.1% of men and 61.6% of women (p = 0.063). In case of persistent high alanine aminotransferase (alt) level and negative hcv ab, hcv pcr was measured in 2.4% . Compliance of hcp to report the new cases of positive hcv to the local cdc was 92% . Monitoring of viral markers had a significant difference in favor of other cities than kerman, the center of the province (p <0.001) (table 2). The percentage of hcp who participated in the annual retraining courses were as hand hygiene practice, 76%; use of protective instruments by hcp, 76%; routes of dissemination of viruses, 52%; methods of correct administration of medications, 47% (figure 1). The aim of this study was to assess the rate of compliance of hcp with safety measures for control of hepatitis viruses in hd wards in southeast iran . Compliance of hcp with many items of kdigo and cdc recommendations was adequate to excellent . The main noncompliant items were: sharing the medications trolleys, no disinfection of instruments, reuse of single use materials, return of unused materials to the clean room, and no adherence to hand hygiene . Hd associated viral hepatitis are a challenging health problem around the world and especially in developing countries such as iran . Prevalence of hbv in iranian general population declined to 2.6% due to public hbv vaccination and improved public health awareness in recent years . Hcv prevalence is low in iranian general population and is estimated to be less than 1% . On the other hand, prevalence of hcv and hbv in hd wards in iran has been reported 524% and 7%, respectively [12, 14]. It seems that poor compliance with infection control measures and inadequate disinfection of hd equipments play a major role in hepatitis virus dissemination . In several studies hd environment was the most important factor for hepatitis virus transmission . It is highly recommended that medicines should be prepared in clean areas away from dialysis apparatus and served in separate trays for different patients . Multidoses vials should not be used and the drugs should be carried in separate trolleys for each patient [17, 18]. Based on a survey on hd centers from usa in 2002, hbv incidence was higher in centers with inappropriate drug preparation . In our study, preparation and carrying medicines were served inadequately and they need to be revised by hd staffs . Hd wards equipments including bed, chair and external surfaces of the dialysis apparatus and instruments like scissors, stethoscopes, and blood pressure cuffs should be cleaned and in cases should be disinfected for every patient . These items were also among the other weak adherent points in our study . Hand hygiene practices are mandatory for prevention of viral spreading . In our study, wearing of gloves by personnel was excellent (98%) but they had a weak compliance rate with hand washing (58%). Similar results have indicated in other studies [18, 21, 22]. In girou study, the rate of compliance with hand hygiene was 37%, and gloves were immediately removed after patient care in 33% . Showed that the dialysis staff adhered to hand washing and changing gloves in 57% before starting dialysis, in 55% between injections of medications to different patients, and in 47% when changing from one patient to another . Monitoring of viral markers is also essential for prevention of hepatitis viruses . In our study monitoring of hbv infection was satisfactory but it was weak for hcv, especially at the center of province . Better performance of hcp in other cities could be mainly due to low volume of patients and higher ratio of personnel to patients . According to cdc recommendations all hd patients should be screened and followed for hcv infection by anti - hcv, hcv pcr, and alt level determination . In the present study, periodic test of anti - hcv was performed in 69% of patients, but monthly assessment of alt and in case of high alt, pcr request, were the main defect points . In the 2002 survey of us attention to the primary education of personnel and regular annual retraining courses are the main steps in the elevation of performance of personnel in hemodialysis centers . In a study from sudan, although the knowledge of hcp about infection control measures in hd centers was good (81%) but their performance in patients' bed was weak (823%). In our study 4776% of personnel although there is a decreasing trend in the frequency of viral hepatitis in iran, it seems that still hd patients have a higher risk of infections mainly due to ignoring of safety measures to minimize the risk of transmission . Emphasis on observance of standard infection control recommendations, retraining of hcp, and official supervision on performance of hd centers would be effective steps to reduce the viral transmission.
|
Compounds with metals as therapeutic agents for various diseases states have been investigated in the last few decades [13]. Metals can react with different atoms of many amino acids residues in proteins providing therapeutic actions . Because of their different mechanism of actions, the development of metal complexes for various drugs provides an alternative route of novel drug delivery system . Binding of a drug to metalloelement can enhance or reduce its activity and in some cases the complex may have even such activity that the parent compound does not have . Nonsteroidal anti - inflammatory drugs (nsaids) are some of the most prescribed drugs worldwide as antipyretic, analgesic, and anti - inflammatory agents . However, the major limitation to nsaid use is the gastric and intestinal mucosal damage . In the uk an estimated 12000 peptic ulcer complications and 1200 deaths per year are attributable to nsaids use . Therefore, much has been studied so far to reduce the gastric toxicity of nsaids and in this regard, complex formation of nsaids with transition metals has long been recognized as an effective way of reducing gastric mucosal lesions caused by these drugs . Thus, the present study is performed to synthesize transition metal complexes of naproxen (figure 1), to resolve their characterization, and to observe their relative stability by conducting forced degradation studies . Forced degradation is an integral component of validating many analytical methods that indicate stability of the drug and detect different impurities coming from manufacturing processes [10, 11]. They facilitate analytical methodology development and validation, better understanding of stability of drug molecules in different environments, and finding out the degradation pathways of drugs and byproducts [1214]. To the best of our knowledge, a combined study of synthesis, characterization, and forced degradation study of naproxen - metal complexes has never been done yet . But completed studies of the degradation of the drug substance and drug product are required at the new drug application (nda) stage . So in our current study we put our effort to synthesize and characterize different transition metal - naproxen complexes along with the determination of their relative stability under various stressed conditions . Also, the rp - hplc method for analysis of naproxen outlined in usp has been verified for the drug - metal complexes . All the apparatus and reagents were in analytical grade of merck origin, used without purification, and were available in the laboratory of the department of clinical pharmacy and pharmacology, faculty of pharmacy, university of dhaka . 0.82 gm (0.1 m) of naproxen (ligand) was dissolved with 0.1 m of sodium hydroxide solution in water to form the sodium salt of naproxen . The reaction mixture was put on a water bath to evaporate until a crystal film appeared; upon cooling the white product separated out . Equimolar metal salts dissolved in water were added to the above mixture so that the ratio n (metal): n (ligand) of monovalent, divalent, and trivalent ions used was 1: 1, 1: 2 and 1: 3, respectively, in each case and immediate precipitation occurred . Then the solid complexes were isolated by filtration, washed until being free of chlorides with the corresponding solvent (methanol or water), and finally dried at room temperature . Hplc system (shimadzu prominence), equipped with uv - visible detector, was used for the analysis of the samples . Reversed phase c-18 column (zorbax eclipse xbd - c18, 150 4.6 mm, 5 m) was used to analyze the standards and samples . The hplc assay method described in united states pharmacopoeia (usp35 nf30, volume 3, page 3996, 2012) was used to analyze the samples . It is important that more strenuous conditions than those used for accelerated studies (25c/60% rh or 40c/75% rh) should be used while performing this study . In general, the following conditions were investigated: (1) acid and base hydrolysis, (2) hydrolysis at various ph, (3) thermal degradation, (4) photolysis, and (5) oxidation . It was focused on determining the conditions that degrade the drug by approximately 10% . However, beginning at extreme conditions (80c or even higher, 0.5 n naoh, 0.5 n hcl, 3% h2o2) and testing at shorter (2 hours, 5 hours, 8 hours, 24 hours, etc .) The conditions listed in table 1 were followed in the current study . 1 mg / ml of solutions was prepared of each naproxen - metal chelates . Then 1 ml of sample solutions and 4 ml of 1 m hcl were mixed and mixture was kept for 24 hours at room temperature . After 24 hours, the sample solutions were allowed to be neutralized by 1 m naoh to ph 7.0 and the volume was made up to 10 ml with diluting solution . 1 mg / ml of solutions was prepared of each naproxen - metal chelates . Then 1 ml of sample solutions and 4 ml of 1 m naoh were mixed and mixture was kept for 24 hours at room temperature . After 24 hours, the sample solutions were allowed neutralized by 1 m hcl to ph 7.0 and the volume was made up to 10 ml with diluting solution . . 1 ml of samples and 9 ml of 10% h2o2 solution were mixed and the mixture was kept for 24 hours at room temperature . Reduction of naproxen and its metal complexes was studied using 10% sodium bisulfite for 24 hours . 1 ml of samples and 9 ml of 10% sodium bisulfite solution were mixed and the mixture was kept for 24 hours at room temperature . 1 ml of samples and 9 ml of distilled water were mixed and the mixture was kept for 24 hours at room temperature . 5 mg of each naproxen - metal chelate was placed in an oven for 3 hours at 105c and then the heated samples were dissolved in 5 ml of diluting solution and allowed to attain the room temperature . The analytical method was verified according to united states of pharmacopeia (usp) 37, general information, 1225, validation of compendial procedures guideline with respect to some parameters used in method validation . According to 21 cfr 211.194(a)(2) of the current good manufacturing practice regulations, suitability of all compendia testing methods used shall be verified under actual conditions of use (usp 37, general information/1226 verification of compendial procedures). In current case, system suitability, solution stability, accuracy, precision, and robustness were performed for method verification . All the complexes synthesized were crystalline solids and soluble in common organic solvents but insoluble in ethanol and acetone . They were characterized by elemental analyses, ir spectra, thermal analysis, electronic photography (sem), and magnetic properties (nmr). The melting points or decomposition temperatures of the chelates are higher which suggests their thermal stability . Naproxen decomposes at 153c where the complexes decompose in the range of 218250c (figure 2(a)) followed by complete burning at above 700c . The representative equations for the formation of the complexes can be presented as(1)mn+clnhh2o+nnal = mlnmh2o+nnacl+hm2o (where m = co, cu, zn, ag, fe; n = 1 or 2 or 3; h = 0, 2, 4, or 6; m = 0 or 2 or 3). In this study, the carboxylic acid group of naproxen shows the (c = o) stretching mode as a band at = 1729 cm . This was gone because of deprotonation and in the sodium salt there were two new bands at 15351546 and 14051414 range, the carboxylate antisymmetric and symmetric vibrations, respectively (figures 2(b) and 2(c)). The coordination of the carboxylate ion to metal ion took place in three different ways . The difference between as(coo) and s(coo) in monodentate complexes was expected to be greater than 350 cm . When 200 <<350 cm, anisobidentate was observed which means an intermediate state between monodentate and bidentate and when <200 cm, the carboxylate groups were regarded as bidentate . These situations were observed in the relative position of the antisymmetric and symmetric stretching vibrations . The main ir bands in the spectra of the sodium salt and the complexes are listed in table 3 . There was a band observed in the region 31453455 which is certainly due to the absorption of crystal or coordination water . Assignment of the carboxylate group of these metal complexes coordination depended on the position of both as and s bands and the values of [1721]. The values of all of these complexes lie in the range of 132159 cm which is close to that of sodium salt of naproxen indicating that the carboxylate group acts as a bridging ligand . In solid state, the synthesized complexes of carboxylate mostly form bridged dimers (m2l2 or m2l4) and also polymeric networks . In the h - nmr spectrum of naproxen, the protons of methyl (ch3) group have a sharp doublet at ~ 1.51.6; the methenyl (ch) proton has a triplet around 3.603.90 . In case of the methoxy (ch3o) protons, they exhibit a sharp singlet at 4.00 and the naphthyl protons appear at 7.107.80 as a multiplet . Sequentially all of these protons shift upfield in complexes; the methenyl proton displays the highest shift 0.250.30, whereas the methoxy protons shift the least ~ 0.05 . This occurs because of the lesser electron withdrawing capacity of metal ions in the complexes relative to that of the carboxy proton in the ligand . The hydrogen atom of the cooh group is absent in the metal complexes of h - nmr spectra (range of 1013 ppm). This data indicates coordination and the carboxyl group is not protonated and the complexation reaction takes place . Scanning electron microscope (sem) images were taken in order to study the surface morphology of naproxen - metal complexes . The images showed particles with fiber - like morphology of the complexes compared to ligand (naproxen) which is homogenously distributed in the solid powder . The photograph clearly indicated that the complexes are hydrated and they formed dimer or even polymeric networks in micrometer range . The rp - hplc studies were performed in order to determine identity of the new synthetic products in comparison to the free ligand with respect to retention time . Hplc methods were used to confirm the appearance of new products after the synthesis had been performed . The samples of ligand and complexes eluted close to each other with similar retention times (figure 4). In the forced degradation study it was found that naproxen - metal complexes were the most stable compounds against any type of forced degradation condition applied than parent naproxen . The highest degradation of naproxen was found by acid hydrolysis and it was only 7.92% . Among the complexes, degradation levels are very close among all these complexes and it is due to the almost same coordination environment of the complexes . The most probable reason for their higher stability than naproxen is the possibility of forming dimer or even polymer structures that is shown in sem images . In dsc study, it was also revealed that the complexes have very high decomposition point than that of the parent naproxen . Low quantity of% rsd of area changes demonstrated that the drugs were fairly stable in the diluting solution and in the mobile phase . Results were shown in table 7 . Accuracy or recovery study was performed and result found in acceptable range for all samples for different concentrations . The% rsd values found in precision study depicted in table 8 showed that the compendial method provides acceptable intra- and interday variations for samples . We changed ph 0.2, flow rate 50%, wave length 3 nm, and solvent concentration 30% . Search for drugs of higher efficacy and lower toxicity is a never ending effort . In our current research we were able to synthesize some naproxen - metal derivatives and to highlight their stability profile under stressed conditions with a view to facilitating the invention of novel nsaids with better therapeutic efficacy . But from the result of present study further useful information was achieved that the metal derivatives of naproxen were found more stable than naproxen itself . This finding suggests that the metal derivatives of naproxen can be more potent anti - inflammatory agent in human body with longer half - life as well as in the dosage form with longer shelf life when compared to the parent naproxen.
|
. Two of the most well - known chronic respiratory diseases are asthma and chronic obstructive pulmonary disease (copd). Over 235 million people currently suffer from asthma worldwide, and it is the most common chronic disease amongst children . It is estimated that 600 million people suffer some form of copd, while nearly 3 million people die annually from this disease . Although chronic respiratory diseases such as asthma and copd are incurable, if treated with the correct medication, they can be controlled, . Inhalers are the devices employed to deliver medication to the airways in the treatment of asthma and copd . They are compact, portable, hand - held devices that contain medication and deliver it in exact doses so that it can be inhaled into the airways . Two types of inhalers commonly employed are metered dose inhalers (mdis) and dry powder inhalers (dpis). Dpis are considered advantageous over mdis since they avoid the use of propellants, and are instead actuated during the inhalation maneuver . The elimination of propellants allows patient coordination issues between the drug release and inhalation to be overcome . When used correctly, inhalers (both mdis and dpis) have been shown to greatly improve patients' clinical outcomes, consequently, adherence to inhaler medication can be poor, resulting in poor clinical responses to asthma and copd treatment . Adherence involves both using the inhaler at the correct time of day (temporal adherence) and in the correct manner (technique adherence). Rates of nonadherence among patients suffering from asthma alone range from 30% to 70% . It is estimated that$300 billion is spent annually in the us treating the nonadherence of chronic diseases, with asthma and copd amongst the diseases with the highest nonadherence rates . Poor inhaler adherence arises from non - use, haphazard use, excessive use or poor inhaler technique . Temporal adherence is rooted in patient perceptions of the disease, belief in the medication, medication cost and access to healthcare,, while technique adherence is related to errors in dexterity or a lack of instruction . Several studies have highlighted that errors in inhaler technique may be as detrimental as a lack of temporal adherence, . Regardless of the causes of poor adherence, the consequences are similar and include poor clinical outcomes, wasted medications, higher healthcare costs, increased morbidity, and higher mortality rates . Currently there is no method for reliably monitoring patient inhaler adherence outside clinic visits in community dwelling patients . Clinicians have no objective information on how a patient uses their inhaler in - between visits to the clinic . This is a problem that needs to be acknowledged and addressed . To resolve this problem a device that can monitor patients temporal and technique adherence was developed (previously described in and). The inhaler compliance assessment (inca) device can be attached to the side of the widely used diskus dpi, from where it unobtrusively records the audio signal of patients using their inhaler in uncontrolled real life environments . Ambient (non - contact) microphone technology has recently been reported as a method of successfully detecting snore sounds during sleep . With the aid of ambient microphone recordings, the acoustic profile of the different stages required to achieve successful inhaler drug delivery an example of the audio signal obtained from the inca device and its corresponding spectrogram for diskus inhaler use are displayed in fig . In addition to recording the audio signal of inhaler use, the inca device logs the exact time and date that the inhaler was used . This provides a method of analyzing patients' temporal adherence to their medication . Visual and aural analysis of the audio files can provide information regarding a patient's inhaler technique and thus their technique adherence . However, manual analysis of the audio files obtained from the inca device is a tedious and time consuming process . It takes an experienced respiratory clinician 30 minutes on average to analyze a patient's audio files for one month of typical diskus inhaler use (60 audio files corresponding with 60 doses of medication). This type of labor intensive analysis would not be feasible in a large scale study . The analysis of patients' inhaler technique from audio signals may also be biased by the subjectivity of clinicians . Therefore an algorithm that could automatically analyze inhaler audio recordings and provide objective feedback on patient inhaler adherence would be of great clinical benefit . 1.audio signal (a) and corresponding spectrogram (b) of diskus inhaler use showing the blister, exhalation and inhalation events . The inca device is capable of detecting important critical inhaler technique errors associated with diskus inhaler use . Critical inhaler errors occur as a result of imperfect patient technique or lack of knowledge on correct usage and significantly impact the delivery of adequate medication . Some of the critical errors associated with diskus inhaler use have been identified as: failure to open the inhaler device until the mouthpiece fully appears, failure to prime / blister drug foil before inhalation, failure to exhale fully before inhalation, exhalation into the inhaler before inhalation and insufficient force behind inhalation maneuver, . Given the critical errors observed in diskus dpi use, the main inhaler steps to be identified by an algorithm are breaths (inhalations and exhalations) and the priming / blistering of the drug foil (henceforth referred to as blister). The primary objective of this study was to design and develop an algorithm that could automatically analyze patient inhaler use, in order to evaluate adherence . A patient's temporal adherence to their inhaler medication can be analyzed from the time and date stamp of each audio file . Users of the diskus dpi are generally required to take two doses of medication each day, one dose in the morning, followed by a second dose in a 618 hour interval after the preceding dose . It was hypothesized that technique adherence can be analyzed through the detection of the breath and blister events in the audio signal, the number of each event present and the order in which the events take place . The algorithm should be able to detect the critical errors associated with diskus inhaler use and provide a score on patient technique adherence . This information on inhaler use should also be compiled into an easy to understand and accessible format for both the clinician and patient . Such objective data on inhaler use can provide comprehensive information on patient inhaler use in - between clinic visits for clinicians, as well as acting as an educational aid for patients . Detailed constructive feedback from clinicians on inhaler use may encourage patients to take better control of their adherence, which in turn may improve their quality of life, prevent exacerbations and hospitalizations, and ultimately reduce mortality rates associated with chronic respiratory diseases . An inca device, manufactured by vitalograph ltd ., was employed in this study . The audio files are stored on the inca device from where they can be subsequently uploaded to a computer via a usb connection . The inca device can be bonded securely to the side of the diskus inhaler, from where it does not impact on the mechanics of inhaler use . The inca device starts recording once the diskus inhaler is opened and switches off when the diskus is closed . The acoustics of inhaler use are recorded as mono wav files, at a sampling rate of 8000 hz and resolution of 8 bits / sample . The inca device has sufficient battery life to record patient inhaler use for a period of one month . To validate the performance of the algorithm data was recorded from 12 community dwelling asthmatic patients (6 female & 6 male). The age range of recruited patients was 2083 (mean \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $49\pm 18$\end{document}) years old . It was communicated to patients before they began the study that an acoustic recording device that could monitor their temporal and technique adherence would be attached to their diskus inhaler . The diskus used in this study contained the combination drug seretide, which is comprised of both salmeterol and fluticasone propionate . In each inhaler each patient was given an inca equipped diskus inhaler by their clinician for a period of one month . Patients were instructed to use their inhaler as normal and they were not given any extra advice or special training . After using their inca enabled inhaler for one month the patients returned to their clinic, where the inca device was removed from the inhaler and the audio files were uploaded to a database for analysis . When patients are given a diskus inhaler they are instructed on how to use the inhaler device correctly by their clinician . In this study patients were instructed to use their inhaler twice daily . As there were 60 doses in each inhaler, this corresponds with 30 days of correct usage . The diskus is opened by sliding a thumbgrip to expose the mouthpiece (see fig . 2). When this occurs the inca device switches on and begins to record audio . A lever is then pushed back which opens a blister foil containing medication inside in the mouthpiece (blister event). A sharp click noise indicates that the blister foil was pierced and that there is medication available in the mouthpiece for inhalation . The patient is then instructed to exhale gently away from the mouthpiece, taking care not to exhale into the mouthpiece . They should then seal their lips tightly around the mouthpiece, inhale steadily and deeply and hold their breath for 10 seconds . Once this is complete the patient should use the thumbgrip again to slide the diskus back to its original position . When the diskus is fully closed the inca device will switch off and save the audio file to its internal memory storage . 2.to open a closed diskus dpi (a) slide thumb grip in direction of dashed arrow until mouthpiece is fully exposed as seen in (b). The algorithm designed to detect the common inhaler events initially went through a training phase . There was a great quantity of variation between subjects (inter - subject variability) and also within subjects (intra - subject variability) in terms of environment and subject technique . 202 (33% of total files available) audio files were randomly selected and employed in the training phase of the algorithm . The inhaler events to be detected specifically from the audio recordings are blisters and breaths (both inhalations and exhalations). To detect the blister events, features such as the mean power at select frequency bands, amplitude and duration are computed . A mel frequency cepstral coefficient (mfcc) approach was employed to detect breaths in this study, due to the fact that breaths have a characteristic mfcc pattern that allows them to be distinguished from other sounds . Extracting mfccs is a common parameterization method for vocalization, due to the fact that mfccs model the known variation of the human ears critical bandwidth with frequency . An overview of the steps the algorithm takes to analyze the inhaler recordings is shown in a block diagram in fig . Several studies have previously described algorithm's that were developed to detect breaths in speech and song signals and in respiratory volume signals . Acoustic analysis of breathing has also previously been employed to detect the different phases (inspiration / expiration) of breaths . This study differs from previous acoustic based studies in that the acoustic signal was obtained in uncontrolled environments . Breath events occurring during inhaler use are also significantly different to those obtained during breathing . The algorithm firstly identifies the piercing of the blister containing the drug (stage 1), before identifying breath sounds (stage 2). It then differentiates detected breath sounds as either inhalations or exhalations (stage 3). Lastly the algorithm calculates a score of user technique (stage 4) for each individual audio file . A detailed explanation of each stage of the algorithm and how the technique adherence algorithm was designed will now be given . The first stage of the algorithm involves detecting the piercing of the blister foil containing the medication . The audio signal is segmented into frames of length 100 ms, with an overlap of 10 ms . The mean power spectral density (psd) it was found from empirical observations in the training dataset that blister sounds had a mean power greater than \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} ${-}{\rm 65}~{\rm db}$\end{document}. The reason the power in this frequency band was greater for blisters compared to nonblisters is due to the intrinsic sound associated with the blistering of the drug foil in the diskus inhaler . A fixed threshold \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(\theta_{1})$\end{document} was set and any frames greater than the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} ${-}{\rm 65}~{\rm db}$\end{document} threshold are considered as potential blister sounds . Potential blister sounds with maximum normalized amplitude less than 0.7 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(\theta_{2})$\end{document} are removed, in addition to potential blister sounds greater than one second \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(\theta_{3})$\end{document} in duration . It was found from the training dataset that blisters had a mean power greater than any false positives in this frequency range, due to the distinctive sound of a blister . Any potential blisters with a power less than \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} ${-}{\rm 62}~{\rm db}~(\theta_{4})$\end{document} are considered as false positives and removed . The selected thresholds were set as they gave the highest percentage of true positive blister events in the training dataset . A flow chart of the steps employed to detect blister events is displayed in fig . 4 . The audio signal is first filtered to remove high frequency components above 1400 hz using a low - pass type i 6th order chebyshev filter . Each signal is separated into frames of length 700 ms with an overlap of 20 ms . Twelve mfccs are calculated for each frame, forming a short - time cepstrogram of the signal . Singular value decomposition (svd) is then employed to obtain a normalized singular vector from the cepstrogram of the signal . Singular vectors have been reported to capture the most important characteristics of breath sounds obtained from mfcc calculations . An adaptive threshold \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(\theta_{5})$\end{document} is set that is 7% higher than the lowest singular vector in the inhaler recording . This adaptive threshold was found empirically to produce the most accurate detection of breaths in the training dataset . The mean zero crossing rate (zcr) is then computed to reduce the number of false positive breaths detected by the algorithm . Breaths were found to have a characteristically high zcr compared to that of nonbreaths in the training dataset . A fixed threshold \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(\theta_{6})$\end{document} constant of 0.1 was therefore introduced to reflect this fact . In the training dataset, breaths consistently had a zcr above this threshold value, while false positives were successfully removed . A flow chart of the steps employed to detect breath events can be seen in fig . Stage 3 involves differentiating breaths into inhalations and exhalations . To do this the mean psd of identified breaths it was found from empirical observations in the training dataset that inhalations had a greater power in this specific frequency band compared to exhalations . Based on this fact a fixed threshold \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(\theta_{7})$\end{document} was put in place . Inhalations were found to have a mean power greater than \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} ${-}{\rm 80}~{\rm db}$\end{document} in the training dataset and exhalations were found to have a mean power below this value . The standard deviation of the zcr was also found to be higher for inhalations in comparison to exhalations in the training dataset . A fixed threshold \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $(\theta_{8})$\end{document} of 0.045 was put in place with inhalations having a value greater than this threshold and exhalations a value below this threshold . A flow chart of the processing steps the algorithm employed to differentiate inhalations and exhalations is displayed in fig . 6 . Fig . 6.flow chart of algorithm employed to differentiate breaths into either inhalations or exhalations . The last stage of the algorithm (stage 4) is to analyze all of the events which took place in the audio file and make a decision regarding the quality of a patient's inhaler technique . This information is outputted as a score which can be one of three possibilities; (1) used correctly, (2) technique error or (3) not used . To decide a technique score the algorithm checks to see what events have taken place, the frequency of each type of inhaler event and the order in which these events have taken place (fig . The diskus inhaler is deemed to have been used correctly if a patient first blisters the foil and secondly inhales the medication . Exhalations can take place before the blister or after the inhalation, still leading to a used correctly score from the algorithm . However, if the patient exhales in the time between the blister and inhalation then they are judged to have committed a technique error as they may have exhaled into the mouthpiece of the inhaler and dispersed some of the medication . Although instructions for diskus inhaler use specify that patients should exhale between the blister and inhalation steps, this should be in a direction away from the mouthpiece . Such exhalations will not be detected by the algorithm, however, those in the direction of the mouthpiece will be detected and classified as errors in inhaler technique . For example: an inhalation event followed by a blister event, a blister event but no inhalation present, exhalation event but no inhalation event etc . If the algorithm detects multiple inhalations or multiple blisters then a technique error will also be judged to have taken place . To test the algorithm's performance 407 new audio files were selected from the 12 asthmatic patients recruited in this study (67% of total audio files obtained). Two human raters, trained by an experienced respiratory clinician to identify correct / incorrect diskus inhaler use, independently classified each of the 407 audio files using the audio tool audacity \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} ${\circit{\rm r}}$\end{document}. Each human rater manually examined the audio files using visual and aural methods and scored each individual audio file as one of the three possible outcomes: (1) used correctly, (2) technique error or (3) not used . As previously mentioned the inca device also provides information regarding the exact time and date that the diskus dpi was employed . Using this data the algorithm automatically computed the number of doses that were taken each day and represented this information in bar chart format . Audio files less than one second in duration are discarded for this analysis due to the fact that this is not a sufficient time period to use the inhaler adequately . The algorithm designed in this study aimed to detect blister, inhalation and exhalation events, analyze the frequency of each event, in addition to the order they took place and output a score on user technique each time the inhaler was employed . The patient user technique score for each inhaler audio file, as computed by the algorithm, was designed to be stored in a text file . However, for the purposes of presenting the specific user technique score to both clinicians and patients, it was decided that a more interpretable output would be needed . Previous research has suggested that people perceive visual cues most accurately from information positioned along a common scale . Based on this information the best method of visualizing data is with the use of scatterplots and bar charts . Bar charts and scatterplot graphs were thus used to display adherence data to clinicians and patients . The algorithm analyzed the time and date stamps from the inca device in order to generate feedback on a patient's temporal adherence . 8 presents a bar chart output from the algorithm that can be employed to illustrate patient temporal adherence . In this bar chart graph one can observe if a patient overdoses, underdoses or takes the correct amount of doses of their medication (red dashed line) for each single day that they should be using their inhaler . Fig . Colors are also widely used in data visualization to indicate appropriate levels of risk (i.e., \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} ${\rm green}={\rm safe}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} ${\rm red}={\rm danger}$\end{document}). This output graph displays information on the time and date the inhaler was used, in addition to how the inhaler was used . The color green indicates that the inhaler was used correctly while the color orange indicates that there was a technique error . This allows clinicians to examine a patient's adherence to their inhaler medication, while it also provides a method for patients to easily understand when and how they are using their inhaler . 9.traffic light graph showing the time and day inhaler was used, in addition to how it was used . To assess the performance of the algorithm, one month's data from 12 community dwelling asthma patients using their inhalers in real world environments was analyzed . The validation dataset consisted of 407 audio files in total (mean \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $34\pm 11$\end{document} per patient). Each file was scored as either (1) used correctly, (2) technique error or (3) not used, by two trained independent human raters . Cohen's kappa statistic is a measure of interrater agreement and takes into account the prior probability of a specific class occurring . The overall kappa agreement (cohen's kappa statistic) between rater 1 and rater 2 was found to be 0.58, indicating moderate agreement between the two human raters . Patients were divided into two subgroups based on the kappa agreement scores between the human raters; group a consisted of patients for whom the raters had almost perfect agreement \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $({\rm kappa}{>}{0.81})$\end{document} and group b consisted of patients for whom the kappa agreement was below this score \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $({\rm kappa}{<}{0.81})$\end{document}. For group a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $({\rm n}=8)$\end{document}, the overall accuracy of the algorithm in deciding the correct user technique score compared to the human raters was found to be 83% . For group b \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $({\rm n}=4)$\end{document}, the algorithms accuracy compared to the human raters was found to be 58% . The accuracy of the algorithm in deciding the correct user technique score in comparison to the human raters for each of the eight patients in group a is displayed in fig . Table i details the classification performances of the algorithm, in comparison to the human raters, for the various types of inhaler technique scores in group a. table ii demonstrates the classification performance of the algorithm in detecting blister, inhalation and exhalation events for group a in comparison to the human raters . A cohen's kappa statistic was calculated to compare the agreement between the algorithm and the expert human raters . For this measure of system performance the algorithm was designated as one rater and one of the expert human raters was randomly selected as the other rater . The user technique score between the two classification approaches was investigated for group a and it was found that the kappa agreement statistic was 0.49 . 10.accuracy of algorithm versus human raters for patients in group a. table ialgorithm accuracy compared to human raters in correctly deciding inhaler technique score for each audio file from group a.inhaler technique scorefiles correctly classified by algorithmtotal number of audio filesalgorithm accuracy (%) used correctly1241501 83technique error545893not used152756 table iialgorithm classification performance compared to human raters in correctly classifying blister, inhalation and exhalation events in group a.inhaler eventsensitivity (%) specificity (%) accuracy (%) blister98.386.892.1inhalation84.898.491.7exhalation81.394.593.7 this study presents a method of automatically analyzing patient inhaler adherence through the use of acoustics . This is the first known method of automatically analyzing both the temporal and technique adherence of a patient to their inhaler medication . The algorithm was designed to identify the critical steps associated with diskus inhaler use and the operations that lead to critical errors in user technique . For the patients that the two human raters had almost perfect agreement upon \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $({\rm kappa}{>}{0.81})$\end{document} the algorithms accuracy was 83% in deciding the correct user technique score . When the algorithm was taken as one rater and the human raters as another rater, the kappa agreement statistic was found to be 0.49, indicating moderate agreement between the two classification techniques . This is an encouraging initial result if this algorithm is to be used in a fully automated system that actively evaluates patient inhaler adherence . The gold standard used to evaluate the algorithm in this study was the subjective classification of inhaler audio files by two independent human raters . These raters were trained by an experienced respiratory clinician to assess the diskus inhaler audio files and classify user technique . Overall the two raters agreed with each other at a moderate level \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $({\rm kappa}=0.58)$\end{document}. The fact that the agreement between the human raters, who independently classified the dataset, was moderate demonstrates the subjective nature of analyzing patient inhaler user technique . The identification of common diskus inhaler events from acoustic signals, namely blisters, inhalations and exhalations, can be challenging . Oftentimes it can be difficult to distinguish blister events as they can have similar characteristics to other background artifacts in the audio signal . The human raters also found it problematic to differentiate inhalations from exhalations when using visual and aural analysis methods . It was for these reasons that patients were subsequently divided into two subgroups for analysis, group a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $({\rm kappa}{>}{0.81})$\end{document} and group b \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $({\rm kappa}{<}{0.81})$\end{document}. For group a, the algorithm was able to correctly identify blister, inhalation and exhalation events with an accuracy greater than 90% . Given the level of disagreement between the two human raters, it is clear that a better method of classifying inhaler technique will be needed for future studies . Device specific checklists are currently used as the gold standard to assess inhaler technique in clinical settings, and provide a method of assessing the accuracy of inhaler technique algorithms . However, such checklist methods are subjective in nature and are limited in that they can only be performed in controlled environments . In addition to this, clinicians have no information on the total emitted dose from the inhaler or drug deposition in the airways . We believe that experiments that provide empirical evidence on inhaler use are required to remove the subjectivity of these checklists . Using acoustic algorithms, such as the one presented in this study, will allow the objective analysis of inhaler technique . Such acoustic algorithms can provide all of the existing information that checklists currently provide and improve them furthermore by being objective . In addition, a number of supplementary objective metrics concerning inhaler use may be obtained such as inspiratory flow rate, inspiratory capacity, total emitted dose and drug deposition in the airways . Recent studies have reported that acoustics may be used to obtain such objective metrics, . The accuracy of the algorithm in predicting the user technique score for certain patients in this study was slightly lower than others, for example patients 2, 4 and 7 . The primary reason for this was due to these patients consistently fumbling with their inhaler, creating a large number of blister - like sounding events . These patients also had a number of conversations while using their inhaler and their general inhaler technique was poor and erratic . Future developments will focus on the orientation and number of microphones in the inca device, coupled with adaptive noise cancelling . The robustness of the algorithm to a wide variety of real world environmental noises will also be investigated in future studies . Such modifications to the inca device and testing of the algorithm in noisy environments may improve the accuracy of the algorithm in analyzing future patients' audio files . One of the major benefits of the algorithm described in this study is that it is able to detect critical errors associated with inhaler use . Analysis of the audio files revealed that many patients unintentionally exhaled into the mouthpiece of the diskus inhaler, dispersing some or even all of the medication . Such detrimental exhalations can only take place after a patient has first carried out the blister step and released medication into the mouthpiece of the inhaler . The algorithm designed in this study is capable of detecting this critical error and will give a technique error score if such an exhalation is detected . A previous study demonstrated that acoustics can also be employed to determine if there is a sufficient force behind the inhalation maneuver . Another critical error that was detected during this study was that many patients blister their diskus dpi multiple times or inhale multiple times . The algorithm is capable of automatically detecting these types of critical errors and reporting them to clinicians . As clinicians presently have no method of analyzing patients' inhaler use in - between clinic visits, the use of acoustics and the algorithm to detect such critical errors would be highly beneficial . The algorithm designed in this study has many advantages for both inhaler users and clinicians alike . Currently there is no way for clinicians to know how a patient is using their inhaler once they take the inhaler device home with them . Many patients often show no improvement in their respiratory condition despite receiving an appropriate inhaler and medication regime . Clinicians are often left confused as to why these patients show no improvement in their condition . It provides a record of inhaler use that can be interrogated in order to assess when and how an inhaler was used over a period of days or weeks in uncontrolled environments . For a clinician to manually evaluate a potentially large quantity of audio files thus, an automatic algorithm such as the one described in this study may allow clinicians to efficiently and objectively monitor patients' inhaler adherence . Such information may be used as an educational tool to provide objective feedback to patients in the hope of them improving their adherence . For patients, an improvement in adherence rates will lead to a decrease in the number of exacerbations and subsequently hospital admissions . In conclusion, an algorithm has been designed and developed that can automatically evaluate patient adherence in a common dry powder inhaler . This algorithm creates the opportunity for clinicians to monitor inhaler users in order to understand if they are consistently using their inhaler device with the correct user adherence technique and at the correct time . Active feedback may encourage patients to improve their adherence and take better control of their disease.
|
Bullous systemic lupus erythematosus (bsle) is a subepidermal blistering disease that occurs in a subset of patients with systemic lupus erythematosus (sle) [1, 2]. Cutaneous lesions are reported during the course of sle in 76% of patients; however, it has been reported that bsle is very rare and occurs in less than 1% of patients with sle [35]. Clinically, in addition to the features of sle, the bsle patients especially present with a rapid, widespread development of tense fluid - filled vesicles and bullae . Moreover, this blistering disease may vary from a small group of vesicles to large tense blisters with urticarial eruptions, erosions, itching, and crustations . Histologically, bsle is characterized by a subepidermal blister, with a predominantly neutrophilic dermal infiltrate and only occasional eosinophils . Furthermore, immunofluorescence examination showed linear deposition of lgg, lga, c3, and c1q along the basement membrane zone [5, 6]. Because of the particularly clinical and histological presentation of bsle, camisa and sharma proposed diagnostic criteria for bsle; these include a diagnosis of sle based on the following criteria of the acr; vesicles and bullae mainly located on sun - exposed areas; the histopathology is characterised by subepidermal bullae with microabscesses of neutrophils in the dermal papillae, similar to those found in dermatitis herpetiformis and deposition of igg, igm, or both and often iga in the basement membrane zone . Although blse may exhibit any of the symptoms associated with sle, the onset and course of blistering eruption do not necessarily parallel the activity of the systemic involvement . Furthermore, the therapeutic options for sle are not usually fit for bsle [9, 10]. In some cases, the eruption flared after systemic corticosteroid administration for sle [11, 12]. However, most of the patients have a striking therapeutic response to dapsone [1316]. A response may be seen with very small doses of dapsone . In the case of the present paper, other drugs such as cyclophosphamide, azathioprine, and mycophenolate mofetil and biologic drugs may also be effective for bsle treatment . In the part of literature review, we provide a review of all the available treatment options for bsle . Steroids and antimalarials are the standard treatments for the cutaneous manifestations of sle . In unresponsive patients, azathioprine and high dose or pulse steroids, cyclosporin, and pulse cyclophosphamide are the most commonly used alternative therapies [1820]. Dapsone is less used in the control of the sle rash but has a dramatic improvement in the eruption of bsle patients [15, 16]. We also found that a 22-year - old woman with bsle had multiple tense vesiculobullous lesions on the face, trunk, and limb (figure 1). A biopsy from the upper limb showed a subepidermal blister with a predominantly neutrophilic dermal infiltrate and only occasional eosinophils (figure 2(a)). Immunofluorescence showed a granular band of c1q, c3, and igg at the basement membrane; less iga and igm were observed (figures 2(b)2(f)). The skin condition showed no response in the methylprednisolone, while a considerable improvement after dapsone administration was observed . Regarding the special clinical feature and the discriminative therapies from the sle treatments, we review all the available treatment for bsle . Dapsone is a sulfone that has played a critical role in the eradication of leprosy . Besides, a number of cutaneous eruptions are effectively controlled by dapsone . Due to these eruptions that are largely characterized by the presence of cutaneous neutrophilic dermal infiltrate, such as dermatitis herpetiformis and the inflammatory variant of epidermolysis bullosa acquisita, the mechanism of its anti - inflammatory action mainly relies upon its inhibition of the functions of polymorphonuclearleukocytes and of complement activation via the alternative pathway that has been postulated [15, 23]. Although a new or recurrent rash was considered a factor of sle disease activity index, the eruption of bsle was not constantly associated with a flare of sle . Consequently, because of being unparallel with the disease activity, the eruption of bsle patients is often unresponsive to corticosteroid therapy . Due to the striking histologic resemblance to dermatitis herpetiformis, the patients who were treated with dapsone (2 mg / kg / day) usually obtained a dramatic improvement in the eruption . Patients tend to have an efficacious response with cessation of new blister formation in 1 - 2 days and healing of existing lesions within several days . A relatively low dose (2550 mg) has also been shown to have a response [1, 15, 24]. Interestingly, improvement of the eruption did not correlate with amelioration of the systemic manifestations . The dramatic response to dapsone therapy demonstrated that dapsone is useful in treating bullous lesions of sle [5, 15, 16, 26]. Notably, the blistering eruption was not improved by dapsone in some cases, and even worsening has been noted after its administration . It has been reported that patients with bsle, who initially presented with lesions clinically resembling erythema multiform, experienced exacerbation of their disease with dapsone [2729]. Furthermore, dapsone has been assigned to pregnancy category c; bsle patients with pregnancy might not be fit for administration of this drug . Hemolysis and hepatic and renal toxicity usually accompany administration of the drug in a dose related fashion [3134]; therefore its clinic use was confined and a careful monitoring of its toxicity is required . Corticosteroids are usually required to improve clinical symptoms and laboratory abnormalities and are still a mainstay for inducing remission in sle patients [18, 20, 35]. Unexpectedly, many bullous sle patients tend to be unresponsive to systemic corticosteroid therapy that has been described . Furthermore, in some cases of sle patients, the eruption flared a few days after systemic corticosteroid administration [11, 12]. Interestingly, some patients responded effectively to corticosteroids, although they required relatively high doses . A patient with sle who presented with vesiculobullous lesions during the third trimester of pregnancy has been presented . A skin biopsy of this patient was performed, and it showed significant necrosis of keratinocytes in the epidermis and granular, dense, and continuous deposits of moderate igg positivity in the basement membrane zone . Dapsone has been assigned to pregnancy category c. the pregnant woman treated with high - dose corticosteroids obtained a satisfactory response . As the dapsone administration often causes hepatic and renal toxicity [32, 33, 3840], prednisone alone or in combination with low doses dapsone might be the treatment of choice for these bsle patients . These observations demonstrated that corticosteroids may act as an alternative treatment for bsle when patients are unresponsive or unfit for other drugs . Biologic agents, such as infliximab, rituximab, and anakinra, have emerged as effective therapies for treating a wide spectrum of diseases which includes various rheumatic, gastrointestinal, and cutaneous diseases [4144]. The involvement of all of the key components (especially cytokines and immune cells) of the immune system in the pathogenesis of sle offers many potential targets for therapeutic management of this disease . B cells, a critical immune cell, which can act as antigen - presenting cells, differentiate into plasma cell to produce pathogenic autoantibodies and secrete various cytokines and chemokines in the immune response [45, 46]. These functions of the b cell support the fact that it plays an important role in the development of pathogenesis of sle . Therefore, use of b cell depletion therapy in sle has emerged as a novel and promising therapeutic alternative for sle patients [4749]. Rituximab which is a chimeric monoclonal antibody that reacts with cd20, an antigen that is present on immature, naive, and memory b cells but not on mature plasma cells, has been approved in the treatment of sle . Up to now the patient was treated with hydroxychloroquine (hcq) twice daily, mycophenolate mofetil 1000 mg / d, and varying doses of corticosteroids, while the eruption was not improved . Dapsone and azathioprine were added but had to be stopped because of elevated liver enzymes and leukopenia . Mycophenolate mofetil was increased to 2000 mg / d, but her skin disease remained active . The skin lesions improved within 10 days after the first dose and cleared by day 15 after the second dose . Furthermore, prednisone was successfully tapered, and the patient has remained free of recurrence of cutaneous and oral blistering lesions . The results of this case suggest a potential role for treatment of refractory bsle with rituximab . Methotrexate (mtx) has been widely proved to be an effective agent in control of the rheumatoid arthritis . It has proved that mtx was beneficial in sporadic cases of scle refractory to therapy with conventional therapy [5254], such as antimalarials and corticosteroids . Furthermore, in a randomized and double - blind trial in 41 patients with sle, mtx reveals a role for controlling the skin lesions in 75% of cases, with a mean reduction of prednisone dose of 44% . These reports demonstrated that mtx could represent a valid therapeutic option in controlling the cutaneous sle and in sparing the steroid dose . However, bsle is a subepidermal blistering disease that occurs in a subset of patients with systemic lupus erythematosus (sle). Cutaneous lesions of bsle are reported during the course of sle in less than 1% of patients, while lesions are not in line with the disease activity ., a rapid and full resolution of cutaneous lesions was obtained with methotrexate alone . A case of 40-year - old female with systemic lupus erythematosus (sle) developed a severe bullous eruption on sun - exposed areas, while the previous manifestations of the disease were quiescent . In consideration of prior intolerance to many drugs, hcq is a commonly used drug for controlling the cutaneous lesions and the disease activity of the sle [58, 59], while it does not act effectively in the eruption of bsle . The conventional treatment for sle only revealed modest improvement in steroids and antimalarials . Although cyclophosphamide has been shown to produce moderate improvement of skin lesions of sle, the beneficial role in bsle has not been demonstrated . Mycophenolate mofetil (mmf) has been widely used for suppressing the lupus activity, while it also was not valid for bsle, even at a high dose [10, 37]. In cases nonresponsive to dapsone, the eruption has been controlled by prednisone or with combination therapy of prednisone and azathioprine . In the treatment of bullous sle, dapsone is the effective basic therapy, and it often induces a dramatic response . In some cases, where an adequate response is not achieved with dapsone or the sle disease activity index is high, other immunosuppressants, such as prednisolone, methotrexate, and azathioprine, can be used for controlling the eruption and suppressing the systemic symptoms . Moreover, in some special case, where dapsone administration or other chemical drugs (mtx, azathioprine, etc.)
|
In their companion article, tononi and cirelli argue that i have missed the big picture by conflating questions of sleep function with the underlying mechanisms . As i have discussed elsewhere [2, 3], understanding sleep function is of central importance to biology . Any theory of sleep function must also grapple with universal traits of sleep, some of which were enumerated in their response . There are other theories of sleep function and many of the theoretical arguments made in support of shy (e.g., a need for offline states, sleep homeostasis, and brain metabolism) apply to them . My position is that this evaluation must always include a discussion of mechanisms, because they cannot be disentangled from functional questions . The underlying message from tononi and cirelli is that what really matters is the the end result [1, page 4] rather than how you get there . I find this an odd position to take and a backward step in our pursuit of sleep function . The goal of science is to understand how nature works . That includes an empirical pursuit of physical mechanisms . Scientists should therefore be skeptical of any theory of sleep function that fails to elucidate the underlying mechanisms that govern the proposed function . In this regard, the proponents of shy are in an indefensible position when they argue that the mechanisms have no bearing on whether the core claim of shy is true or false [1, page 3]. They have bearing because if the underlying mechanisms are not sleep dependent then the theory is wrong . Incidentally, the theory is also wrong if the proposed mechanisms do not exist . While it may be true that these mechanisms are complex and perhaps different in different species, that is not a reason to ignore them . On the contrary, that is a reason to explore them . . Indeed, i do find shy confusing because the proposed mechanisms (to date) seem inconsistent with what is actually known about synaptic plasticity . Moreover, their imprecise terminology fogs the issue . They claim that they never meant that the potentiation in wakefulness is hebbian (i.e., some form of ltp), yet it is difficult to draw any other conclusion based on their own words . Their liberal and interchangeable use of the words long - term potentiation, ltp, or this is because ltp is not short - hand for stronger synapse; it has a precise meaning and commonly refers to hebbian processes . In their rebuttal, they back peddle from their past specific language regarding the significance of neuromodulator release and the expression of plasticity molecules in shy . There is, however, little ambiguity in their original description of how these events purportedly promote ltp (or ltp - like events) during wake versus sleep [4, 5]. The concepts and terminology of synaptic homeostasis and scaling predate shy and there is simply no mistaking the broad similarities between synaptic scaling and what is described in shy . For example, here is a more complete excerpt from tononi and cirelli . Like activity - dependent synaptic scaling (emphasis added), however, sleep - dependent downscaling would affect most or all of a neuron's synapses . In this respect, downscaling is conceptually different from long - term depression, which affects select groups of synapses, or depotentiation, which affects only recently potentiated ones therefore, their use of these terms, if in fact they mean something else, is perplexing . The distinctions they make between their version of downscaling and scaling proper are welcome, but quite subtle when compared to the overall similarities . For example, synaptic homeostasis is not only manifested at the level of firing rates as implied by tononi and cirelli . That is one outcome of a homeostatic adjustment of synaptic weights in a network, as measured, for example, by mepscs [7, 8]. This point seems moot, since tononi and cirelli cite changes in firing rates and mepscs as evidence of shy [9, 10]. In the end, it really does not matter what new name they give to their process (or set of processes) that weakens synapses . The point i was making, and which they missed, is that any form of plasticity (especially if possibly novel) should be examined through the prism of known facts about hebbian and non - hebbian plasticity . Case in point: i never stated that the downscaling of shy is identical to synaptic scaling as currently understood in the field . I instead argued that since the concepts of scaling figure prominently in shy, and because scaling is an accepted means of globally adjusting synaptic weight, it is logical to examine the claims of shy based on what is known about synaptic scaling . Synaptic renormalization from synaptic scaling, but this name change does not inoculate shy against scrutiny . The veracity and validity of a scientific theory is not solely determined by the amount of data piled on one side of a scale . It is also determined by a careful examination of each piece of evidence, pro and con . Upon close examination, threads of supportive findings may unravel, and when contrary evidence is properly considered, an otherwise impressive mass of findings may collapse . A large part of their response is a long catalog of supportive data some of which i included in my review . However, as i pointed out, careful examination reveals alternative explanations for some of their results . They also largely ignore evidence consistent with net increases in synaptic strength after sleep, or findings that question their hypothesized relationship between synaptic potentiation and slow - wave electroencephalographic activity (swa) [11, 12]. These findings are consistent with my original discussion and completely in opposition to predictions of shy . When these are also considered the universality of shy, and its utility as an explanation for why we sleep, becomes questionable . In my original review, i considered biological processes other than sleep that might explain some findings ascribed to shy . These included the cumulative effects of natural patterns in brain temperature (and in mammals, glucocorticoid release) across the 24-hour day or after sleep deprivation . Tononi and cirelli present a number of arguments against these ideas, but i have a better idea for example, why not examine the effects of cooling or warming on drosophila synaptic proteins (which are altered by changes in temperature as small as 8c; not as they state 20c)? Tononi and cirelli argue strenuously that shy is a theory of function, yet they support their argument with cellular and molecular findings that have no demonstrable function . Rather than elaborate upon already dense theoretical arguments about the functional importance of shy, why not demonstrate it empirically? In science, no argument, no matter how beautifully crafted, trumps a good experiment . In his discussion of sleep theories 50 years ago, nathaniel kleitman reminded his readers of the cautionary tale of ptolemy of alexandria . Ptolemy was a revered scholar in the 2nd century ad who codified hundreds of years of prior greek astronomy and mathematics into what came to be known as the ptolemaic universe . The ptolemaic universe held that the stars, planets and sun revolved around the earth, embedded in overlapping crystalline spheres . This theory of the natural world was elegant, mathematical, and even highly predictive of astronomical events . The lesson from ptolemy is that scientific theories are ultimately judged not only by their power to explain, but by the validity of their physical mechanisms . Tononi and cirelli argue that for shy to be valid, it does not matter how synapses are weaker after a sleep period, just that they are . But ptolemy reminds us that this is not enough; scientific truth comes from asking hard questions about how things actually work . I do not question their results, showing for example, changes in evoked responses or mrnas consistent with shy . First, they have not identified how sleep actually alters synaptic strength in any species . Second, they have not experimentally excluded the role of other biological processes that coincide with sleep . A final consideration is that if shy is a scientific hypothesis, then tononi and cirelli should propose an experimental outcome that would force a rejection of shy.
|
In order to assure the continuing downscaling of electronic components, new growth methods need to be explored as currently used top - down techniques are approaching their physical limits . An emerging alternative for the growth of nanoscale systems is self - assembly: by exploiting the striving toward the minimal energy it enables the formation of nanostructures even down to the atomic level . However, its future implementation requires extensive fundamental research to unravel the complex interactions involved . Self - assembly of nanostructures on a surface is predominantly governed by two physical processes: the diffusion of atoms and the subsequent island nucleation . The combination of these processes eventually determines the final properties of the nanostructured systems, such as size, distribution, phase, electrical and magnetic properties, etc . Considering the key role of the surface in the implied interactions, surface functionalization provides a potential way to influence and eventually to control the growth of nanostructures on a surface . Our recent results on noble metal induced surface reconstructions prove that an ultra thin buffer layer and the induced surface structure have a major influence on the final morphological island properties [1 - 3]. In order to obtain a better understanding of the microscopic details of the self - assembly process, we investigated in detail the effect of the au - induced superstructure on the subsequent diffusion of adatoms and the nucleation of fe - si nanostructures on si(111). Whereas we previously investigated the morphological properties (e.g., size, height, phase formation, density, etc .) Of the islands on different au - induced surface reconstructions and the cu - induced reconstruction, we now specifically focus on the reconstruction to investigate the microscopic details of the diffusion and nucleation processes on this particular surface . As it consists of domains separated by domain walls that may act as non - reactive diffusion barriers, a study of the influence of these domain walls on subsequent nanostructure formation can reveal the relative importance of the surface topography versus the surface passivation . Furthermore, to determine the relevant kinetic parameters for surface diffusion and island nucleation on the superstructure, the results are interpreted in the framework of the conventional nucleation theory . It is elaborated that this theory is applicable for our system and as such, we present a novel approach for interpreting surface diffusion and island nucleation in reactive systems . In analogy to our previous work, si(111) samples (fz, 812 cm) were cleaned ex situ in a 2% hf solution and in situ using a two - step silicon - flux method . This procedure results in a clean si(111) surface that exhibits the well known si(111)-7 7 reconstruction . Subsequent deposition of 0.760.96 ml au (1 ml = 7.83 10 at / cm) at room temperature followed by a 30 min . Annealing at 700c results in the formation of the si(111)- reconstruction which is thermally stable up to 700c and exhibits no dangling bonds . A conventional molecular - beam epitaxy (mbe) set - up with a base pressure of 5 the deposition rate was monitored in situ with a quartz crystal microbalance, which was calibrated using rutherford backscattering spectrometry and x - ray reflectivity and was kept constant at 0.015 ml / s for all fe depositions . After deposition, the sample cooled down and was investigated at room temperature in vacuo by scanning tunneling microscopy (stm). All substrates used in this work have an unintentional miscut of approximately 0.6 relative to the direction and consequently exhibit surface steps . Due to step bunching, to demonstrate the effect of the reconstruction on the self - assembly of nanostructures, we have first deposited 0.28 ml fe at 300c on the bare si(111)- 7 7 surface as a reference . 1a . A closer look at the surface reveals a high density of very small grains, randomly distributed . This growth behavior finds its origin in the high concentration of dangling bonds present on the 7 7 surface . As a consequence, the surface is highly reactive, thus strongly limiting the diffusion of deposited fe atoms on the surface: the fe atoms will rapidly react with the si surface atoms upon arrival . Next, deposition of the same amount of fe onto the superstructure at 300c results in the formation of well - defined nanostructures, as presented in fig . Meanwhile, the structure remains present on the entire surface, as evidenced by the inset of fig . The drastic change in growth kinetics is induced by the surface, which exhibits no dangling bonds and therefore, is by far less reactive than the 7 7 structure . This lower reactivity delays the reaction with the si atoms and causes a strong increase in the fe surface diffusion, resulting in the formation of distinct nanoclusters, as discussed previously . We want to emphasize that, as a result of the au passivation, we are able to create a silicon surface with a strongly reduced reactivity, which is essential for the correct interpretation of our results below . As mentioned in the introduction, the surface structure exhibits a large density of domain walls separating the domains on the surface (see fig . They contain the excess au atoms residing on top of the reconstruction which explains the critical dependence of their density on the deposited au coverage . The influence of the extra surface corrugation induced by these domain walls on the surface diffusion of fe atoms, is investigated by depositing 0.28 ml fe at 400c onto surfaces with a varying domain wall density . 2a is presented . The density is quantified by the number of domain wall intersections with an artificial, regular grid, divided by the total length of the grid (yielding a domain wall density in nm), as demonstrated in the lower right corner of fig . 2c, where the island density after fe deposition is plotted as a function of the domain wall density on the surface prior to deposition . These results surprisingly show that, within the investigated range and the experimental uncertainty, there is no influence of these domain walls on the island density . As the island density is inversely related to the characteristic diffusion length, i.e. The average distance between two neighboring islands, it is evidenced that the diffusion length (17 nm), despite being significantly larger than the typical distance between the domain walls (59 nm), does not decrease with increasing domain wall density (see fig . Consequently, the presence of these domain walls does not alter the surface potential as felt by the fe atoms . 3, where the typical surface topography of the surface (a) is represented together with a suggested representation of the surface potential (b). Because the domain walls do not have a significant influence on the surface potential, they are invisible in the potential landscape . These results seem to be in contradiction with previous observations of nagao et al . Who claim that surface diffusion of mn atoms is severely hindered by the surface corrugation induced by the domain walls . Draw these conclusions based on the comparison of mn diffusion on different surface reconstructions (and si(111)-6 6-au), but they do not provide evidence on the question of whether the diffusion is limited by the domain walls or, on the other hand, by the specific reconstruction itself . However, we have performed a comparative study on a single reconstruction, specifically investigating the role of the domain walls . Nevertheless, the result is quite unexpected as one would intuitively assume that domain walls influence surface diffusion, based on a comparison of different reconstructions . Atomic steps on the other hand, do show up in the representation of the surface potential (see discussion below). This conclusion points out that the chemical passivation of the si dangling bonds is of much greater importance for the subsequent diffusion than the surface corrugation induced by the domain walls . Stm micrographs of the surface morphology after deposition of 1.1 ml fe at 300c onto (a) the bare si(111)-7 7 surface and (b) the surface . (inset) atomic resolution image of the structure athe surface structure, characterized by a high density of domain walls . In the lower right corner, the grid used for determining the dw density is indicated, together with the intersections.bthe surface in (a) after deposition of 1.1 ml fe at 400c showing a strong increase in domain wall density.cisland density (squares) after fe deposition and characteristic diffusion length (triangles) as a function of the initial domain wall (dw) density prior to fe deposition schematic representation of the typical surface topography of the surface (a) with a suggested representation of the corresponding surface potential (b) on the other hand, the stm observations in fig . 2 reveal that island nucleation itself has a large impact on the domain wall density . In fig . 2a a surface is shown prior to fe deposition with an average domain wall density of 14 1 10 nm while after fe deposition (0.28 ml at 400c), the average density has significantly increased to 33 2 10 nm (fig . As the domain wall density is directly correlated to the au coverage on the surface, we can conjecture that the fe atoms penetrate into the au layer after nucleation, thereby expelling the au atoms . These atoms are redistributed over the remaining surface which results in the creation of new domain walls, as previously shown in . In the same reference consequently, the au layer acts as a surfactant which significantly enhances the diffusion, but does not inhibit the reaction between the nucleated fe nanoclusters and the si substrate . This reaction between the fe adatoms and the si substrate is driven by the large difference in the heat of formation (h = 39.56 kj mol for fe we want to stress that based on these observations, the au layer causes a decoupling of the diffusion and nucleation on the surface and the reaction with the surface as fe diffusion and island nucleation take place before the reaction with the substrate occurs . Naturally, the preservation of the reaction is of major importance for the future growth of binary nanostructures . As it turns out that the domain wall density does not have a major influence on the island formation on different au coverages on si(111) will result in the same island formation which opens a process window for surface functionalization . We therefore deposited 0.28 ml of fe onto the surface at temperatures ranging from 300 to 600c to study the cluster growth kinetics . The stm micrographs in fig . 4show the surface morphology after deposition at 300c (a), 400c (b) and 600c (c). 5a quantitatively show the increase in mean island size from 1.93 0.10 nmat 300c to 666 20 nmat 600c . Moreover, the island height increases considerably with increasing temperature (from 0.23 0.01 nm to 7.11 0.10 nm) as well, as is evidenced by the height distributions in fig . Both observations are explained by the increase in diffusion length caused by the elevated temperatures . Stm images of the surface morphology after deposition of 0.28 ml fe ata300cb400 c andc600c onto the surface.darrhenius plot of the island density, along with a fit to the data according to the conventional nucleation theory aisland size distribution andbisland height distribution after deposition of 0.28 ml fe at 300 and 600 c on the surface . Note the different scale of thex - axis for both temperatures additionally, it is observed that the islands preferentially form at the lower step edge at 600c, (see fig . 4c), whereas at 300 and 400c the dots randomly nucleate on the terraces and the step edges (see fig . This phenomenon is the result of both the passivating au layer and the elevated temperature, which allow the fe atoms to reach the step edges, as typical diffusion lengths at 600c are of the order of 110 nm, which is considerably larger than the average terrace width observed on this surface (approx . These highly coordinated sites are energetically favorable due to the easy access to si atoms . 3: a surface step gives rise to a local minimum in the surface potential which traps diffusing fe atoms . Consequently, the au interlayer not only allows to control diffusion (i.e. Island density and size), but also allows to alter the preferential nucleation site . As the diffusion length increases, the island density decreases as well (see fig . This behavior is predicted by the conventional nucleation theory, which essentially describes the formation kinetics of nanoclusters on a surface . However, our new approach to apply this theory to reactive systems is justified as the surface largely resembles an inert surface from diffusion point of view, due to the decoupling of the diffusion and nucleation on the one hand, and the reaction processes on the other hand . While diffusing over the surface, the fe adatoms might encounter each other and form a nucleus . Whether the nucleus is stable or decays to a smaller cluster the threshold is defined by the concept of the critical nucleus size i defining the largest unstable cluster which will, upon addition of one extra atom, render stable . Furthermore, according to this theory, the density of stable islands nx decreases exponentially with increasing temperature:(1) in this equation represents a constant dimensionless number near 0.2 containing the coverage dependence, f is the deposition flux, d0 is the surface diffusion prefactor, i is the critical nucleus size, and e = (ied + eb)/(i + 2) is the effective diffusion barrier, which is a weighted sum of the activation energy for diffusion ed and the critical cluster binding energy eb . The energy parameter e is experimentally accessible from the slope of vs. 1/kt, whereas the critical nucleus size can be obtained from the 1/t = 0 intercept . In fig . 4d, the arrhenius plot of the island density nx is shown together with a fit to the data yielding the energy parameter e = 0.96 0.05 ev and the critical nucleus size i = 3.1 0.3 (using the known flux 0.015 ml / s and nominal values d0 this implies that a cluster of four atoms is stable and defines a nanostructure . With the value i = 3, the expression for the effective diffusion barrier becomes ev, with e3 the binding energy of a three - atom cluster . In order to calculate the activation energy ed, the binding energy of a free fe3 cluster is used as an estimate for e3, since the au - passivated surface can be considered inert . Taking the value e3 = 2.96 0.20 ev, reported by lian et al ., we find an activation energy for fe diffusion on the surface of ed = 0.61 0.12 ev, which is lower than the value published by wohllebe et al . For fe diffusion on a si(111)-7 7 surface, ed = 0.76 0.10 ev, in accordance with our observations and expectations . However, it is important to point out here, to be very careful with the comparison with these literature data since they are determined using a theory developed for a non - reactive surface in a study of a (highly) reactive si surface . For a fully quantitative comparison, reliable values for fe diffusion on si(111)-7 7, that are currently unavailable, are essential . Nevertheless, the values for the activation energy of the surface diffusion ed and the critical nucleus size i are particularly important for the surface since they determine the microscopic diffusion and nucleation mechanisms on the passivated surface and allow to predict the island density, size and height for a given temperature and deposition rate, which is a key feature in the controlled growth of nanostructures . In conclusion, we have shown that an ultrathin au layer has a drastic influence on the subsequent growth of fe - based nanostructures on the si(111) surface . Surprisingly, the surface corrugation induced by the domain walls, inherent to the reconstruction, does not significantly affect the surface diffusion . This demonstrates that the passivation of the surface plays a much larger role in the adatom diffusion than the surface topography, which is of major importance for the understanding of surface diffusion . Using a novel approach by applying conventional nucleation theory to this reactive system, we determined the activation energy for surface diffusion on ed = 0.61 ev and the critical nucleus sizei = 3, exposing the microscopic details of the diffusion and nucleation mechanisms . Moreover, these parameters allow to predict the island density, the island size and the island height for a given deposition temperature and rate, which is a major prerequisite in controlling nanostructure growth . This work was supported by the fund for scientific research, flanders (fwo), the concerted action of the kuleuven (goa/2009/006), the interuniversity attraction pole (iap p6/42) and the center of excellence programme (inpac ef/05/005).
|
Pulmonary embolism is a common and potentially lethal disorder that frequently recurs and is associated with long - term impairment and suffering . The overall mortality rate of patients with untreated pulmonary embolism is approximately 30%; however, prompt diagnosis and appropriate therapy can reduce the mortality rate to <10% . Pulmonary embolism is the most commonly overlooked disease in patients with pleural effusion (pe). It has been reported that the numbers of patients with pulmonary embolism from 20% of the acute hospital beds were 229,637 in 2005 in usa . If these numbers are extrapolated to all acute hospital beds, the estimated annual occurrence of pulmonary embolism is 1.15 million . Given that 3050% of patients with pulmonary embolism have a pe, the annual prevalence of pe due to pulmonary embolism in usa is 300,000500,000 . Pulmonary embolism has been established to be the fourth main cause of pe in usa after congestive heart failure, parapneumonic effusion, and malignant effusion . In china, the annual incidence of pulmonary embolism is 0.1% (95% confidence interval, 0.10.2%) in overall hospitalized patients, and an increasing incidence gradient for pulmonary embolism is noticed from southern to northern china . However, no data about the incidence of pe in chinese patients with pulmonary embolism are available to date . We therefore performed the current study to investigate the incidence and computed tomography (ct) characteristics of pe in a chinese population of patients with pulmonary embolism . Our data showed that pes, usually small and unilateral effusions, are present in about one fifth of a chinese population of patients with pulmonary embolism . The study protocol was approved by the institutional review boards for human studies of beijing chao - yang hospital, beijing, china and no ethical concerns were raised . We retrospectively reviewed the consecutive medical records of ct pulmonary angiography (ctpa) scan data on all patients with clinically suspected pulmonary embolism from january 2008 until december 2013 at beijing chao - yang hospital, capital medical university, beijing, china . In our hospital, ctpa is ordered for all for patients with suspected pulmonary embolism . Using the electronic database deposited in the department of radiology, we reviewed the study population's clinical records to ascertain demographic details of patients . All ctpa scans were analyzed independently by two thoracic radiologists, who were blinded to the original ct report and patients diagnoses . The images were viewed on a picture archiving and communications system workstation with these settings: width 400 and level 60 hounsfield units . The picture archiving and communications system allowed the radiologists to scroll through the images . Next, the radiologists independently determined if pulmonary embolism and pe were present in each patient: any discrepancies were resolved by reanalyzing the images until consensus was reached . In patients with pulmonary embolism, the clots were classified as central, peripheral or both as described by de mony et al . A central clot was defined as the presence of filling defects within the main to lobar pulmonary arteries, whereas a peripheral clot was defined as the presence of filling defects within the segmental and subsegmental arteries . The pulmonary ct obstruction index was calculated as the method described by qanadli et al . To quantify arterial obstruction with ct in acute pulmonary embolism . Briefly, the ct obstruction index was defined as (n d) (n, value of the proximal clot site, equal to the number of segmental branches arising distally; d, degree of obstruction scored as partial obstruction [value of 1] or total obstruction [value of 2]). If a pe was present, the size was semi - quantified as small, moderate, or large according to the ct imaging features with anteroposterior quartile and maximum anteroposterior depth measured at the midclavicular line as described by moy et al . : first anteroposterior - quartile effusion was small, second quartile effusion was moderate, and third or fourth quartile effusion was large . In borderline cases, anteroposterior depth was measured with 3-cm and 10-cm thresholds for the upper limits of small and moderate, respectively . Descriptive statistics was used, to summarize, patient characteristics, as well as ctpa and pleural fluid findings . Chi - square test was used to compare the incidence of pe in patients with or without embolism, and to determine the statistical significance of the association between the clot score, clot location, and pe . Chicago, il, usa), and a p <0.05 was considered to indicate statistical significance . The study protocol was approved by the institutional review boards for human studies of beijing chao - yang hospital, beijing, china and no ethical concerns were raised . We retrospectively reviewed the consecutive medical records of ct pulmonary angiography (ctpa) scan data on all patients with clinically suspected pulmonary embolism from january 2008 until december 2013 at beijing chao - yang hospital, capital medical university, beijing, china . In our hospital, ctpa is ordered for all for patients with suspected pulmonary embolism . Using the electronic database deposited in the department of radiology, we reviewed the study population's clinical records to ascertain demographic details of patients . All ctpa scans were analyzed independently by two thoracic radiologists, who were blinded to the original ct report and patients diagnoses . The images were viewed on a picture archiving and communications system workstation with these settings: width 400 and level 60 hounsfield units . The picture archiving and communications system allowed the radiologists to scroll through the images . Next, the radiologists independently determined if pulmonary embolism and pe were present in each patient: any discrepancies were resolved by reanalyzing the images until consensus was reached . In patients with pulmonary embolism, the clots were classified as central, peripheral or both as described by de mony et al . A central clot was defined as the presence of filling defects within the main to lobar pulmonary arteries, whereas a peripheral clot was defined as the presence of filling defects within the segmental and subsegmental arteries . The pulmonary ct obstruction index was calculated as the method described by qanadli et al . To quantify arterial obstruction with ct in acute pulmonary embolism . Briefly, the ct obstruction index was defined as (n d) (n, value of the proximal clot site, equal to the number of segmental branches arising distally; d, degree of obstruction scored as partial obstruction [value of 1] or total obstruction [value of 2]). If a pe was present, the size was semi - quantified as small, moderate, or large according to the ct imaging features with anteroposterior quartile and maximum anteroposterior depth measured at the midclavicular line as described by moy et al . : first anteroposterior - quartile effusion was small, second quartile effusion was moderate, and third or fourth quartile effusion was large . In borderline cases, anteroposterior depth was measured with 3-cm and 10-cm thresholds for the upper limits of small and moderate, respectively . Descriptive statistics was used, to summarize, patient characteristics, as well as ctpa and pleural fluid findings . Chi - square test was used to compare the incidence of pe in patients with or without embolism, and to determine the statistical significance of the association between the clot score, clot location, and pe . Chicago, il, usa), and a p <0.05 was considered to indicate statistical significance . During the 6-year study period from january 2008 through december 2013, there was a population of 3196 patients with clinically suspected pulmonary embolism underwent ctpa at the department of radiology in our hospital . The final study population consisted of 3141 patients (1504 male) with a mean age of 60.2 15.1 years (range 1593 years). A diagnosis of pulmonary embolism on ctpa was made in 1220 of the total 3141 patients (38.8%). As shown in table 1, patients with pulmonary embolism had more dyspnea and chest pain syndromes and less chest tightness than those without pulmonary embolism did . The other syndromes, such as hemoptysis, cough, and fever, between two groups were not different . Concomitant central and peripheral emboli were seen in the majority (n = 735, 60.2%) of patients, peripheral emboli were seen in the remaining patients (n = 485, 39.8%), and no central clots alone were seen . The percentages of concomitant central and peripheral emboli or peripheral emboli alone in patients with pe were similar to those in patients without pe [table 2]. Types of pulmonary emboli in patients with and without pes = 0.935, p = 0.342 . A total of 423 patients had pe identified on ct in 3141 patients (13.5%) who underwent ctpa . The incidence of pes was significantly higher in patient with pulmonary embolism (243/1220, 19.9%) than that in those without embolism (180/1921, 9.4%) (= 71.236, p <0.001). As shown in table 3, the presence of pe drove more patients with pulmonary embolism suffering from chest pain and hemoptysis, but not other related syndromes, including chest tightness, dyspnea, cough, and fever, etc . Comparisons of symptoms in pulmonary embolism patients and without pe * student s t - test . Pe: pleural effusion; sd: standard deviation . Among the 243 pulmonary embolism patients with a pe, 88 patients (36.2%) had unilateral left - sided effusions, 74 (30.5%) had unilateral right - sided effusions and 81 (33.3%) had bilateral effusions . In either left or right side, the size of most pes was small or moderate, very few patients showed large effusions [table 4]. Size of pes in patients with pulmonary embolism = 44.918, p <0.001 . The incidence of pe in patients with peripheral pulmonary embolism (18.6%) and in those with concomitant central and peripheral embolism (20.8%) was similar (= 0.935, p = 0.342) [table 2]. We noted that pulmonary embolism was bilateral in 922 patients (75.6%), on the right side in 254 (20.8%), and on the left side in 44 (3.6%). In 243 pulmonary embolism patients with pe, pulmonary embolism was bilateral in 166 patients (68.3%), on right side in 67 (27.6%), and on left side in 10 (4.1%). We further noted that unilateral pulmonary embolism and pe were on the ipsilateral side in 30 patients, on the contralateral side in 24 patients . We calculated ct pulmonary obstruction index according to the method described by qanadli et al ., and found that the obstruction index in the total population studied was 15.7 10.8 (range 1 40). The obstruction index in pulmonary embolism patients without pe (15.6 10.9) was not different from that in the patients with pe (16.6 10.9) (t = 0.921, p = 0.357). As expected, ct abnormalities, including wedge - shaped opacity, linear opacity, and ground - glass attenuation, were more frequently seen in patients with pulmonary embolism than in those without embolism [table 5]. Parenchymal ct findings in patients with and without pulmonary embolism or: odds ratio; ci: confidence interval; ct: computed tomography . Of 243 patients with pulmonary embolism and pe, 89 had wedge - shaped opacity, 51 had atelectasis, 98 had consolidation, 15 had pulmonary masses, 20 had nodule, 96 had mosaic sign, 77 had emphysematous bullae . All the above abnormalities on ct, excluding lung nodule, were much more in pulmonary embolism patients with pe than in those without effusion [table 6]. In a bivariate analysis of these parameters, parenchymal ct findings in pulmonary embolism patients with and without pes or: odds ratio; ci: confidence interval; ct: computed tomography; pe: pleural effusion . During the 6-year study period from january 2008 through december 2013, there was a population of 3196 patients with clinically suspected pulmonary embolism underwent ctpa at the department of radiology in our hospital . The final study population consisted of 3141 patients (1504 male) with a mean age of 60.2 15.1 years (range 1593 years). A diagnosis of pulmonary embolism on ctpa was made in 1220 of the total 3141 patients (38.8%). As shown in table 1, patients with pulmonary embolism had more dyspnea and chest pain syndromes and less chest tightness than those without pulmonary embolism did . The other syndromes, such as hemoptysis, cough, and fever, between two groups were not different . Concomitant central and peripheral emboli were seen in the majority (n = 735, 60.2%) of patients, peripheral emboli were seen in the remaining patients (n = 485, 39.8%), and no central clots alone were seen . The percentages of concomitant central and peripheral emboli or peripheral emboli alone in patients with pe were similar to those in patients without pe [table 2]. Types of pulmonary emboli in patients with and without pes = 0.935, p = 0.342 . A total of 423 patients had pe identified on ct in 3141 patients (13.5%) who underwent ctpa . The incidence of pes was significantly higher in patient with pulmonary embolism (243/1220, 19.9%) than that in those without embolism (180/1921, 9.4%) (= 71.236, p <0.001). As shown in table 3, the presence of pe drove more patients with pulmonary embolism suffering from chest pain and hemoptysis, but not other related syndromes, including chest tightness, dyspnea, cough, and fever, etc . Comparisons of symptoms in pulmonary embolism patients and without pe * student s t - test . Pe: pleural effusion; sd: standard deviation . Among the 243 pulmonary embolism patients with a pe, 88 patients (36.2%) had unilateral left - sided effusions, 74 (30.5%) had unilateral right - sided effusions and 81 (33.3%) had bilateral effusions . In either left or right side, the size of most pes was small or moderate, very few patients showed large effusions [table 4]. Size of pes in patients with pulmonary embolism = 44.918, p <0.001 . The incidence of pe in patients with peripheral pulmonary embolism (18.6%) and in those with concomitant central and peripheral embolism (20.8%) was similar (= 0.935, p = 0.342) [table 2]. We noted that pulmonary embolism was bilateral in 922 patients (75.6%), on the right side in 254 (20.8%), and on the left side in 44 (3.6%). In 243 pulmonary embolism patients with pe, pulmonary embolism was bilateral in 166 patients (68.3%), on right side in 67 (27.6%), and on left side in 10 (4.1%). We further noted that unilateral pulmonary embolism and pe were on the ipsilateral side in 30 patients, on the contralateral side in 24 patients . We calculated ct pulmonary obstruction index according to the method described by qanadli et al ., and found that the obstruction index in the total population studied was 15.7 10.8 (range 1 40). The obstruction index in pulmonary embolism patients without pe (15.6 10.9) was not different from that in the patients with pe (16.6 10.9) (t = 0.921, p = 0.357). As expected, ct abnormalities, including wedge - shaped opacity, linear opacity, and ground - glass attenuation, were more frequently seen in patients with pulmonary embolism than in those without embolism [table 5]. Parenchymal ct findings in patients with and without pulmonary embolism or: odds ratio; ci: confidence interval; ct: computed tomography . Of 243 patients with pulmonary embolism and pe, 89 had wedge - shaped opacity, 51 had atelectasis, 98 had consolidation, 15 had pulmonary masses, 20 had nodule, 96 had mosaic sign, 77 had emphysematous bullae . All the above abnormalities on ct, excluding lung nodule, were much more in pulmonary embolism patients with pe than in those without effusion [table 6]. In a bivariate analysis of these parameters, parenchymal ct findings in pulmonary embolism patients with and without pes or: odds ratio; ci: confidence interval; ct: computed tomography; pe: pleural effusion . There were several mechanisms might be responsible for the development of pe secondary to pulmonary embolism: (1) pulmonary hypertension and increases in the right ventricular pressure can result in an increase of the systemic venous pressure at the parietal pleural surface . (2) the embolus occludes the artery and leads to ischemia distal to the embolus, which leads to an increase in the amount of interstitial fluid in the lung . The interstitial fluid resulting from this increased permeability traverses the visceral pleura, enters the pleural space and leads to pe . (3) when the embolus lodges in the pulmonary artery, cytokine are released, which also increase the permeability of the vessels . A pe occurs when the amount of fluid formed overwhelms the capacity of the lymphatic vessels to remove the fluid from the pleural space . Retrospectively analyzed the medical records of a total of 230 consecutive patients with pulmonary embolism over an 8-year period, and found that pe was observed in 32% and 47% of patients by chest x - ray and ct, respectively . By reviewing all ctpa data performed over the past 6 years on patients with clinically suspected pulmonary embolism, we noted in the present study that a chinese population with pulmonary embolism was more likely to have a pe than those without pulmonary embolism, and the incidence of pe in chinese patients with pulmonary embolism was 19.9%, which was significantly higher than that in those without embolism (9.4%). The incidence of pe in chinese pulmonary embolism patients was lower than the finding reported by porcel et al . And was similar to the finding reported by yap et al . That pe was diagnosed in 21% of 285 patients . The incidence of pe in patients with pulmonary embolism varied dependent on different methods used in different populations . Using thorax ultrasound, mathis et al . Reported that a small pe is found in 49% of patients with pulmonary embolism . However, in the most series, pulmonary embolism accounts for <5% of pes in patients who have undergone a thoracentesis . More recently, hooper et al . Performed a prospective study to evaluate the incidence of pulmonary embolism in patients with unilateral pe, and found that pulmonary embolism is detected in 6.4% patients, indicating that pulmonary embolism is not a common primary cause for unilateral pe . There may be three explanations for this contradiction: (1) the majority of pes secondary to pulmonary embolism are small, which preclude a diagnostic and therapeutic thoracentesis; (2) most patients with clinically suspected pulmonary embolism are immediately anticoagulated while awaiting a confirmatory test, and pe gradually resolve, a thoracentesis is not necessary; (3) pulmonary embolism is frequently not considered in patients with undiagnosed pe . The study by porcel et al . Showed that most pes are small and unilateral, but occasionally they reach more than a half of the hemithorax . A study of yap et al . Also showed that pes are generally very small . Our current data confirmed that most pes presented in patients with pulmonary embolism were unilateral and small, and the frequency was similar to the findings in patients without pulmonary embolism . These findings indicated that the presence of pulmonary embolism increases the possibility of pe formation; however, it does not affect the size of pe . In most of our patients, the emboli were located in both central and peripheral pulmonary arterials, and the percentages of concomitant central and peripheral emboli in patients with or without pe were similar . We also found that in pulmonary embolism patients with or without pe, more emboli were bilateral than unilateral, and the frequencies of bilateral pes in two groups were quite similar . In addition, the ct pulmonary obstruction index in pulmonary embolism patients with or without pe was not different . The above data indicated that the locations of pulmonary emboli in central and peripheral pulmonary arterials, sidedness of pulmonary embolism, as well as the ct pulmonary obstruction indexes are not related to the development of pe . Parenchymal abnormalities at ct, especially peripheral wedge - shaped opacity, have gained attention to be associated with having pulmonary embolism . Our current data showed that ct abnormalities, including wedge - shaped opacity, atelectasis, consolidation, masses, mosaic sign, and emphysematous bullae, were more frequently seen in patients with pulmonary embolism than in those without embolism . Although wedge - shaped opacity, atelectasis, consolidation, pulmonary masses, mosaic sign, and emphysematous bullae was much more in pulmonary embolism patients with pe than in those without pe, a bivariate analysis did not show a relationship between any one of these ct abnormalities and the presence of pe . A significant strength of the present study was that a quite big study population (more than 3000 patients with clinically suspected pulmonary embolism) was included, and 243 pulmonary embolism patients with pe were finally identified . To the best of our knowledge, our series was the biggest one of this kind of studies . As a matter of fact, the numbers of patients with pulmonary embolism diagnosed and treated in our hospital have been being more than those in any one hospital around over the country . It has been documented that pe due to pulmonary embolism is always exudates, frequently hemorrhagic, and with a marked mesothelial hyperplasia . One limitation of our current study was that no data concerning on specimens were available for analyzing biochemical and cytological characteristics of pes, because very few pulmonary embolism patients with pe in our study underwent diagnostic or therapeutic thoracentesis . We also noted that all patients pes gradually resolved soon after the treatment with anticoagulants . Another limitation was that patients undergoing ctpa came from multiple departments of our hospital, including emergency, outpatient departments, and inpatient departments, it therefore was not possible for us to analyze the relationship between the appearance of pe and the prognosis of patients with pulmonary embolism . In summary, we have demonstrated that pes, usually small and unilateral effusions, are present in about one fifth of a chinese population of patients with pulmonary embolism . Therefore, when the etiology of an exudative pe is uncertain, the diagnosis of pulmonary embolism should be considered, and confirmatory tests for pulmonary embolism should be added to the routine evaluations . Our data also suggested that ctpa is a suitable way to identify the presence of pe in patients with pulmonary embolism and to evaluate the possibility of pulmonary embolism in patients with pe.
|
It is well known that uvci could happen post acd / f [17]. An incidence of 24.2% has been reported in one prospective study when including the clinically unapparent injury . Only two cases of bilateral vocal cord injury (bvci) have been described in the english literature . One was after a whiplash injury which, by itself or in combination with the very extensive procedure, could explain the bilateral involvement . In the other case the patient has a history of cardiac surgery that could have been the cause of a silent uvci [1, 8]. We are presenting a case of bvci with no indication of preoperative uvci in order to alert practitioners to this possibility . A 46 year old male with a history of smoking, hypertension and alcoholism with no significant surgical history or other medical problems scheduled for acd for c 6 - 7 herniated discs . After establishing intravenous access and applying standard monitors, after a dose of 0.5 mg vecuronium, anesthetic induction was successfully achieved using fentanyl 250 mcg, thiopental / propofol, 140 mg/70 mg and succinylcholine 100 mg . Atraumatic endotracheal intubation (eti) was accomplished with size 8 tube inserted to 23 cm and secured at the lips uneventfully . The surgery was preformed to the right side using a microscope for the dissection followed by the graft placement under fluoroscopy . As the patient was awakened at the end of the surgery, the endotracheal tube was removed and the patient was taken to the recovery room in a stable condition with no abnormal neurological signs and oxygen saturation (spo2) of 99% on 3l / m nasal oxygen . The patient was noted to develop inspiratory stridor with sternal retraction and had a hoarse / whispering voice . 0.5 ml of racemic epinephrine (2.25%) was administered by inhalation as well as 100 mg of intravenous hydrocortisone . We entertained the possibility of vocal cord paralysis (vcp) and accordingly gave 1 mg of midazolam . Considering the risks of aspiration, the risks of trauma to the neck if the airway had to be established urgently without proper preparation for neck protection, which may lead to paralysis from spinal cord injury, and the severity of the patient's symptoms; all these facts alone with the need for a permanent airway device for ventilation favored performing a tracheostomy . Following the tracheostomy, immediate postoperative evaluation could not identify any pathology for the bvcp . In a follow up visit six weeks later, it was found that the tracheostomy had been properly placed, the patient was able to eat and drink without difficulty, and he could also speak well . Laryngoscopy revealed that his vocal cords continued to be in a paramedian position; therefore, it was not considered safe to remove the tracheostomy tube at that time . A voice analysis study (va) indicated that his left vocal cord had some tone and some movement but his right vocal cord remained atonic . A follow up visit for the removal of the tracheostomy tube was arranged with a local otolaryngologist in his home town . . Some proposed mechanisms of this surgical complication includes direct surgical trauma, nerve division or ligature, pressure or stretch induced neuropraxia, and postoperative edema [2, 9]. A uvci occurs mostly on the right vocal cord due to the fact that the right approach is the preferred one to avoid injury to the thoracic duct, which resides on the left side [2, 4,9]. While this would explain the recurrent laryngeal nerve injury on the right side, it would not explain the left side paralysis noted in our patient . Mark kriskovich et al . Reported a vocal cord paralysis rate of 6.4% in 250 consecutive patients undergoing acd . This was done by deflating the endotracheal tube cuff after placement of the surgical retractors and then re - inflating the cuff to a pressure of 15 mm hg . When the paralyzed cord is near the midline (paramedian), the voice may appear near normal although most of those patients may complain of voice fatigue . This fact indicates that a patient may have normal voice but still have an underline injury . We hypothesize that our patient could have had an unrecognized preexisting uvci . Without a preoperative electromyographic study, it would be hard to determine if one of the paralyzed cords was an older injury . Another explanation for our bvci is the endotracheal tube, which has been shown to lead to uvcp or bvci [11, 12]. Vocal cord paralysis (vcp) as a complication of eti was reported to be 10 - 15% of all causes of vcp . Although it most commonly affects the left vocal cord, cases of bvci have been described from eti . Also postoperative vcp has been reported even in patients who had a laryngeal mask airway during surgery [1517]. Other causes that should be considered includes, but are not limited to, upper respiratory tract infection, thoracic tumor, stroke, diabetes neuropathy, and paradoxical vocal cord dysfunction [1, 13, 14]. Before a definitive diagnosis could be made, conservative treatment included: oxygen by mask, systemic steroids, racemic epinephrine, as well as sedation . After the diagnosis a permanent airway should be established if needed and that was our patient's treatment . Given these occurrences, one should stay on guard for vcp postoperatively in their acd patients . The addition of the technique of maintaining a specific cuff pressure and deflating followed by re - inflating it when the retractor is applied could be helpful in preventing vcp [2, 3]. We cannot on the base of this one case report recommend a preoperative voice analysis study on every patient undergoing an acd simply because this would not be cost effective; however, we do recommend a more detailed airway exam to include a voice exam with specific questioning about voice fatigue in order to identify patients at risk . Most importantly, we hope that this case presentation would alert the practitioners to the possibility of this rare complication after anterior cervical spinal surgeries.
|
The endothelial cell dysfunction is observed in myopia and in contact lens wearers [2, 3]. The decreasing number of endothelial cells can also be a result of a surgical injury related to the opening of the anterior chamber . Many studies have shown that even minor changes in the morphology of the endothelial cells may manifest in the disturbances in the tightness of the endothelial barrier . It has been demonstrated that human corneal endothelial cells have mitotic ability in vitro, but in vivo they do not exit the cell cycle but are arrested in g1 phase . Loss of cells is compensated through the expanding and spreading of cells, which over time results in a lack of tightness and corneal oedema . Prevention of the corneal endothelium dysfunction, its early detection and immediate treatment are therefore crucial, especially if the problem concerns young patients . Noncontact specular microscopy, which evaluates endothelial morphology quickly and easily, can be especially useful with children . There are many reports concerning the analysis of the corneal endothelium in adults with type 1 and type 2 diabetes [69]; however, there are no publications concerning the analysis of the cornea in juvenile patients with this disease . The aim of our study was to compare the endothelial cell density and central corneal thickness in diabetic and nondiabetic patients and to evaluate the local and systemic factors which may affect the corneal endothelium in this group . The current study was performed at the department of pediatric ophthalmology and strabismus, medical university of bialystok, poland . For the purpose of this study we examined 123 eyes of 123 patients with type 1 diabetes (60 boys and 63 girls). The age of diabetic group was 719 years (mean: 15.34 3.06 years). The mean duration of diabetes was 8.02 3.9 years and ranged from 8 months to 16 years . All the diabetic patients were divided into three groups according to diabetes duration: less than 5 years (38 patients), from 5 to 10 years (42 patients), and longer than 10 years (43 patients). 48 persons had bad metabolic control, 37 had moderate metabolic control, and 38 had good metabolic control . At the time of examination, the mean value of hba1c in diabetic patients was 8.02 3.9% (range 5.5%3.2%). Ophthalmologic examination in diabetic patients included slit - lamp examination and binocular indirect ophthalmoscopy fundus examination . As controls, the mean age of the control group was 918 years (mean: 14.58 2.01 years). None of the examined patients had history of ocular disease, topical ocular medications, or contact lens wear . Data from the right eye of each patient was used in this study . The corneal endothelium density (ecd) and central corneal thickness (cct) in its central part the aim of this study was to compare ecd and cct in diabetic and nondiabetic patients and to evaluate a correlation between endothelial cell density, central corneal thickness, and local factors (presence of retinopathy) and systemic factors (age, sex, diabetes duration, the level of hba1c, and plasma creatinine level). The mann - whitney test for ecd and t - test for cct were used to compare medians in diabetic and control group . The kruskal - wallis test and anova test were used to compare the values of medians in different states of metabolic control . Multiple regression analysis was used to analyze the influence of the set of variables for ecd and cct . In the model four continuous variables (age, diabetes duration, plasma creatinine level, and hba1c) and two dummy variables (sex and presence of retinopathy) were used . In our study the starting model and the final model received by the use of backward elimination of variables are presented . The value of multiple r, r2, and p value for the global test that r2 is equal to 0 . The normal distribution of the residuals was verified by the use of pearson's chi square test . The mean endothelial cell density in patients with diabetes was 2435.55 443.43 cells / mm and was significantly lower than in the control group (2970.75 270.1 cells / mm) (p = 0.0001; mann - whitney test). Ecd values in both groups are presented in figure 1 the mean cct was 0.55 0.03 mm in diabetic group versus 0.53 0.033 mm in control group (p <0.0001; t - test). Cct values in both groups are presented in figure 2 in order to determine the systemic and local factors affecting the corneal endothelium in diabetic patients we evaluated the correlation of ecd and cct with the following variables: the patients' age and sex, duration of diabetes, hba1c level, plasma creatinine level, and presence of diabetic retinopathy . The age of diabetic group was 719 years (mean: 15.34 3.06 years). There was no correlation between ecd and age of diabetic patients (p value = 0.111). The mean ecd was 2446 488.3 cells / mm in diabetic boys and 2424 394.7 cells / mm in diabetic girls, and these differences were not statistically significant (p value = 0.99). 38 diabetic patients had good metabolic control (with hba1c less than 7%), 37 subjects had moderate metabolic control (hba1c from 7% to 8%), and 48 persons had poor metabolic control (hba1c above 8%). We did not observed significant differences in ecd in relation to metabolic control (p value = 0.54). The mean duration of diabetes was 8.02 3.9 years (ranged from 8 months to 16 years). In 38 patients duration of diabetes was shorter than 5 years, 42 persons suffered from diabetes from 5 to 10 years, and 43 persons had diabetes longer than 10 years . The mean ecd values in relation to sex, metabolic control, and duration of diabetes are presented in table 1 . The mean hba1c in diabetic patients was 8.26 1.7% and ranged from 5.5% to 13.2% . There was no significant correlation between ecd and hba1c level (p value = 0.378). There was no correlation between ecd and plasma creatinine level (p value = 0.650). We did not observe any correlation between ecd and the presence of diabetic retinopathy (p value = 0.293). The correlation between ecd and duration of diabetes was statistically significant (p value <0.0001) (table 2). The mean cct value in patients with duration of diabetes up to 5 years was 0.539 0.027 mm, with duration of diabetes from 5 to 10 years was 0.551 0.03 mm, and with duration of diabetes over 10 years was 0.558 0.03 mm, and the differences were statistically significant (p value = 0.0144; anova test). Multiple regression analysis for cct indicated that only duration of diabetes was significantly related to cct . The observed disorders include increased fragility and damage of the corneal endothelium and recurring erosions and increased sensitivity to injuries . Experimental research discovered abnormal basement membrane of the endothelium, a decreased number of hemidesmosomes, and a prolonged healing of the cornea and its decreased sensitivity . Many studies confirmed that diabetes causes abnormalities in morphology and functioning of corneal endothelium cells . Functional disturbances may lead to increased autofluorescence of the cornea and its increased penetrability [8, 9]. Morphological changes may result in a high variability factor of the endothelial cell surface and decreased percentage of hexagonal cells in corneas in patients with diabetes, using contact specular microscope, when compared to healthy patients [811]. Although morphology of the endothelial cells is interesting in diabetic patients, the limitations of topcon 2000 are obvious (pleomorphism and polymegathism could not be assessed, and hexagonality was also not available). The existing research data encouraged us to examine the corneas in children and adolescents with this chronic illness . We have established that the mean density of corneal endothelium cells in patients with diabetes was reduced in comparison with the control group by 18% . Similar results were obtained by roszkowska et al ., who after examining 75 adults with type 1 and type 2 diabetes noted the ecd decreased by 5% in type 2 diabetes, and by 11% in type 1 when compared with healthy persons . Lower endothelial cell counts were also proved by sudhir et al ., who examined 1191 adult patients with type 2 diabetes . The mean ecd in their study was 2550 326 cells / mm versus 2634 256 cells / mm in the nondiabetic control group . In our diabetic group ecd was very similar (2435.55 443.43 cells / mm) but ecd in our control group was higher (2970.75 270.1 cells / mm). We have to remember that our diabetic and non - diabetic subjects were young: the mean age in diabetic group was 15.34 3.06 years versus 14.58 2.01 years in control group ., who did not demonstrate significant changes in mean density of corneal endothelium cells in diabetic subjects, but they only examined patients with type 2 diabetes . We also analyzed the influence of local and systemic factors affecting the density of the corneal endothelium in children and adolescents with type 1 diabetes . In contrast, inoue et al . Did not find any ocular and systemic factors that affect the damaging of endothelium in diabetic patients, but it was type 2 diabetes . The authors claim that although they did not show the influence of systemic and ophthalmic factors on the morphology of the corneal endothelium, due to the chronicity of the disease, the relation may not occur during the examination but it may appear some years later . Larsson et al . Noticed several changes in the endothelium in elderly with diabetes, but the observed anomalies may have been additionally caused by the process of senescence . Similarly to our study, lee et al . Showed that ecd in adult diabetic patients was significantly lower for diabetes with over 10 years of duration than for diabetes of under 10 years . Like other authors, we did not prove the influence of sex, the state of metabolic control, and the presence of diabetic retinopathy on the corneal endothelium [11, 16, 17]. Did not detect any relation between the level of glycosylated haemoglobin and the condition of the corneal endothelium . The patients they have examined had similar values of hba1c (mean 8.2%) to the mean hba1c level of our patients (8.01%). They did not detect any influence of diabetes duration (in contrast to our study) and the presence of diabetic retinopathy (similarly to our results) on the corneal endothelium . In the study of mdis et al ., the hba1c level in adult patients with type 1 diabetes mellitus was inversely correlated with the ecd, but they did not prove such correlation in patients with type 2 diabetes mellitus . The authors concluded that type 1 diabetic corneas are more susceptible to environmental changes than type 2 diabetic corneas . We were unable to demonstrate any correlation between ecd and the presence of diabetic retinopathy . While examining 64 adult patients with diabetes mellitus observed that the severity of diabetic retinopathy was correlated with endothelial cell density, but these correlations were low and the corneal changes were not correlated with glycemic control . Inoue et al . Reported that the presence of retinopathy (proliferative also) as well as laser coagulation in medical history did not affect the density of corneal endothelium cells . Recently, the role of growth factors, crp, proinflammatory cytokines, or level of lipids has been emphasised in the pathogenesis of diabetic retinopathy in children [20, 21]. Their significantly higher blood serum levels have noxious influence on the tiny blood vessels in the retina . Specificity of the cornea first of all lack of blood vessels may be one of the reasons, that in many publications concerning with the corneal endothelium in diabetic adults, the analysis of the influence of these factors was not performed [11, 14, 1719, 22]. Shows that the corneal endothelium is a tissue undergoing constant metabolic stress . In normal endothelial cells, circumferential bands of f - actin (a major component of the cellular cytoskeleton) help to maintain the regular and functionally efficient, hexagonal shape . Kim et al . Demonstrated that the corneas of diabetic individuals showed marked irregular f - actin fibers crossing the endothelial cell cytoplasm . They suggested, that these abnormal patterns of f - actin may be the result of constant stress in cell volume regulation in the corneas of diabetic patients . Kleinzeller and ziyadeh showed that dissociation of f - actin fibers either chemically or osmotically caused massive cellular swelling . They presumed that this abnormal collocation of f - actin in the endothelium of diabetics may contribute to altered morphology and, in their opinion, the mechanism may be related to sorbitol accumulation within these cells . Fujishima and tsubota claim that in molecular pathogenesis of corneal changes significant importance may be given to aldose reductase, the first enzyme of the sorbitol pathway . Aldose reductase has been demonstrated immunohistochemically in the corneal endothelium, and the osmotic stress that occurs secondary to sorbitol accumulation could lead to altered endothelial morphology and cell loss . Reported that alterations in endothelial morphology resolve within 3 months after the onset of topical aldose reductase inhibitor treatment . The accumulation of advanced glycation end products (ages) in the epithelial basement membrane or in descemet's membrane may play a role in the disorders of diabetic cornea . Showed that ages formation on fibronectin and laminin attenuated the attachment and spreading of the corneal endothelial cells . They concluded, that ages formation in descemet's membrane may be responsible for the corneal endothelial abnormalities in diabetic patients . The next mechanism could decrease na / k - atpase activity, which influences the endothelial pump action and induces the dysfunction of the corneal endothelial cell layer [18, 29]. Thickness of the cornea indirectly informs about the functioning of the endothelial layer, which plays role as pump, which is responsible for active dehydration of the cornea and also has a barrier function . In our study possible explanations for increased corneal thickness in diabetic patients include (besides inhibition of the corneal endothelial pump) an increased endothelial permeability, which result from the metabolic effects of diabetes . Another reason could be the increased stromal swelling pressure due to the accumulation of sorbitol or from the glycosylation of corneal collagen . Evaluating the condition of the corneal endothelium is important since one of the most frequent reasons of corneal endothelium cells loss is cataract surgery, and cataract, besides diabetic retinopathy, is one of the most common ophthalmic complications of diabetes . The research done by mathew et al . Shows that the removal of cataract is exceptionally traumatizing for the endothelium in eyes of diabetic patients . The diabetic endothelium was found to be under greater metabolic stress and had less functional reserve after manual small incision cataract surgery . It can be assumed that for children suffering from diabetes, an eventual development of cataract in the future and the necessity for its surgery may be a factor that significantly increases the risk of dysfunction of corneal endothelium cells . Shenoy concluded that evaluation of corneal endothelium in diabetic patients should be part of the protocol for eye care of diabetic patients . The results of this study may support the theory of lower endothelial cell density and thicker cornea in children and adolescents with type 1 diabetes mellitus . Duration of diabetes is the factor that affects ecd and cct and observed changes could predispose to corneal dysfunction in the future.
|
Congenital myasthenic syndromes (cmss) are a group of rare genetic disorders affecting neuromuscular junction transmission . The subtype of cms depends on whether the defect is presynaptic, synaptic, or postsynaptic . In the past 33 years, at least 23 genes encoding proteins of the neuromuscular junction have been identified containing causative mutations . Cmss are clinically heterogeneous and characterized by fatigable weakness of skeletal muscle that occurs between infancy and adulthood . Ptosis and extraocular muscle, facial, bulbar, and generalized weakness are the common presentations . Subtypes exist with onset later in childhood that exhibit morbid muscle fatigability with difficulty in running or climbing stairs . Clinical manifestation, severity, and course of cms vary, even between patients from the same family . Although myasthenic symptoms may be mild, respiratory insufficiency may occur in patients with cms if respiratory muscles are severely affected . It has been reported that 75% of cms cases are postsynaptic subtype, and a genetic deficiency of acetylcholine receptor (achr) tends to be the most frequent etiological basis . Cmss that show decreased synaptic response to acetylcholine are referred to as fast channel; conversely, those with an increased acetylcholine response are referred to as slow channel . In patients with slow - channel cms (sccms), electrophysiological examination has revealed that prolonged opening activity of the achr channel causes depolarization block, which contributes to muscle weakness and fatigability . Progressive spinal deformities or scoliosis result from paraspinal muscle weakness and are usually found in adult sccms patients . Patients with cms have been reported worldwide, including in east asia, but there have been only a few published cases of cms in china . Herein, we identified three patients with sccms from a chinese family who presented with muscle weakness during early or late childhood . In these patients, we found autosomal dominant inheritance of a heterozygous mutation in acetylcholine receptor epsilon - subunit (chrne) gene . The proband was referred to the department of neurology, the first affiliated hospital of chongqing medical university in march 2014 . Detailed medical history was obtained from each family member, and the affected family members underwent laboratory tests and physical and electrophysiological examination, including repetitive nerve stimulation (rns) and nerve conduction velocity studies . For low - frequency stimuli, decrements were compared between 1 and the 4 stimuli . For high - frequency stimuli, laboratory tests on the proband consisted of assaying for blood biochemicals, endocrine hormones, antibodies against nuclear antigens, and antibodies against achr . Patients included in this study provided written informed consent, and the study was approved by medical ethics committee of the first affiliated hospital of chongqing medical university . Genomic dna was extracted from peripheral leukocytes of fresh blood samples from the proband (iii-3), elder sister of proband (iii-2), and mother of proband (ii-2), using standard methods of proteinase k digestion and phenol - chloroform extraction . We used next - generation gene sequencing to screen the proband dna for genes associated with neuromuscular diseases, including genes that have been reported to encode factors involved in myasthenic syndromes . The identity of the mutated chrne gene detected by this screen was verified by sanger sequencing . All exons of the chrne gene were amplified by polymerase chain reaction (pcr) using the geneamp pcr system 9700 thermal cycler (perkin elmer, shelton, ct, usa). The promoter region and the entire coding sequence of the chrne gene (genbank accession number af105999/gi4580858) were determined as described . Each 25 l pcr reaction contained 50 ng genomic dna, 10 pmol of each forward and reverse primers, 5 mmol dntps, and 2.5 u of taq polymerase in taq reaction buffer (takara biotechnology, dalian, china). Thermal cycling consisted of a denaturation step at 94c for 5 min, and then 35 cycles at 94c for 3040 s, 5763c for 30 s, and 72c for 30 s, followed by a final elongation step at 72c for 10 min . The pcr products were purified by 1.5% agarose gel electrophoresis and directly sequenced with an abi prism 3730xl dna analyzer (applied biosystems, foster city, ca, usa). The data were analyzed with chromas 2.22 chromatogram file editor software (technelysium pty ltd . The base mutations in chrne gene were described and numbered according to criteria provided by the ensembl genome browser (http://www.ensembl.org). The proband was referred to the department of neurology, the first affiliated hospital of chongqing medical university in march 2014 . Detailed medical history was obtained from each family member, and the affected family members underwent laboratory tests and physical and electrophysiological examination, including repetitive nerve stimulation (rns) and nerve conduction velocity studies . For low - frequency stimuli, decrements were compared between 1 and the 4 stimuli . For high - frequency stimuli, laboratory tests on the proband consisted of assaying for blood biochemicals, endocrine hormones, antibodies against nuclear antigens, and antibodies against achr . Patients included in this study provided written informed consent, and the study was approved by medical ethics committee of the first affiliated hospital of chongqing medical university . Genomic dna was extracted from peripheral leukocytes of fresh blood samples from the proband (iii-3), elder sister of proband (iii-2), and mother of proband (ii-2), using standard methods of proteinase k digestion and phenol - chloroform extraction . We used next - generation gene sequencing to screen the proband dna for genes associated with neuromuscular diseases, including genes that have been reported to encode factors involved in myasthenic syndromes . The identity of the mutated chrne gene detected by this screen was verified by sanger sequencing . All exons of the chrne gene were amplified by polymerase chain reaction (pcr) using the geneamp pcr system 9700 thermal cycler (perkin elmer, shelton, ct, usa). The promoter region and the entire coding sequence of the chrne gene (genbank accession number af105999/gi4580858) were determined as described . Each 25 l pcr reaction contained 50 ng genomic dna, 10 pmol of each forward and reverse primers, 5 mmol dntps, and 2.5 u of taq polymerase in taq reaction buffer (takara biotechnology, dalian, china). Thermal cycling consisted of a denaturation step at 94c for 5 min, and then 35 cycles at 94c for 3040 s, 5763c for 30 s, and 72c for 30 s, followed by a final elongation step at 72c for 10 min . The pcr products were purified by 1.5% agarose gel electrophoresis and directly sequenced with an abi prism 3730xl dna analyzer (applied biosystems, foster city, ca, usa). The data were analyzed with chromas 2.22 chromatogram file editor software (technelysium pty ltd . The base mutations in chrne gene were described and numbered according to criteria provided by the ensembl genome browser (http://www.ensembl.org). The proband (iii-3), 21-year - old man, had generalized muscle weakness at 4 years of age . His ability to run and jump was lower compared with his same - age peers . He had experienced fatigue while walking since 4 years old . Symptoms of weakness fluctuated in severity, and exacerbated transiently by physical activity, but slightly relieved during rest breaks . The symptoms progressed gradually, and the upper limbs became affected at the age of 9 . Symptoms exacerbated several times each year, with each episode lasting a few days to a month, especially during winter . The symptoms gradually progressed in the last 12 months and he experienced difficulty in climbing stairs; however, he did not experience diplopia, dysphagia, respiratory insufficiency, or muscle twitching . Bilateral facial weakness was observed, and the bulbar muscles were slightly involved, manifesting as nasal speech; however, swallowing difficulties were not present, and chewing problems were not marked . Examination showed mild weakness of the neck flexor muscles, bilateral muscles of the tibialis anterior and gastrocnemius, and finger extensor muscles . The mother of the proband (ii-2), a 47-year - old woman, had difficulties in grasping and finger extension at 10 years of age . At age 12, she presented marked muscular weakness and fatigability, especially in the lower limbs . Interestingly, symptoms stopped progressing and she began to recover gradually, though not to normal levels, but she was now able to complete daily housework and perform mildly taxing farm work . She had bilaterally limited eye movements without ptosis, symmetric bilateral facial weakness, and mild weakness of neck flexor and bilateral muscles of the limbs (grade 4/5 on the medical research council scale for the proximal muscles and 4/5 for the distal muscles of the limbs). The affected elder sister (iii-2) was 24 years old and had symptoms similar to the proband . She began to have difficulty in walking and extending fingers at 11 years of age . Facial weakness, muscle wasting in bilateral forearm and interosseous muscles, and bilateral ophthalmoplegia without ptosis were also found . Muscle strength on the medical research council scale was 3/5 for the neck flexor muscles and 4/5 for the proximal muscles . She was neither able to extend her fingers nor able to walk using either the toe or heel . The daughter of the elder sister (iv-1), a 4-year - old girl, however, had no symptoms or complaints . The laboratory tests for proband showed that the levels of creatine kinase and thyroid and sex hormones were normal, and antibodies to achr were not present . A neostigmine test showed no recovery for muscle weakness . With the proband's consent, we prescribed fluoxetine at a dosage of 20 mg / d as treatment . After no improvement was observed in his condition for 2 weeks, we increased the dosage to 40 mg daily; 10 days later, fatigue and weakness were mildly improved . When the elder sister underwent the same fluoxetine treatment, symptoms also were relieved; however, after 6 months of therapy, neurological examination showed no changes for either patient . Motor nerve conduction studies revealed a repetitive - compound muscle action potential (r - cmap) after a single stimulation in the median, ulnar, and peroneal nerves in affected patients from the pedigree [figure 2a2c], which even included the asymptomatic 4-year - old girl although she did not complain of weakness or fatigue [figure 2d]. However, compared with the recordings from the proband [iii-3; figure 2a] and his elder sister [iii-2; figure 2b], the r - cmap of the peroneal nerve of their mother [ii-2; figure 2c] was more noticeably affected . After fluoxetine therapy, r - cmap was still present in the proband (iii-3) and his elder sister (iii-2). (a) iii-3: two peaks, the second peak of the second wave overlaps the first peak of the first wave . Rns induced cmap decrements in several nerves of the affected patients in response to low- or high - frequency rns, as summarized in table 1 and shown in figure 3 . For the proband's mother (ii-2), no decrements were detected in response to low - frequency rns . Decrements of the proband (iii-3) were more obvious than those of the other family members, despite similar degrees of illness . Decrements in response to high - frequency rns were more significant than those to low - frequency rns for all affected members except the 4-year - old girl (iv-1), who did not receive high - frequency rns to avoid inflicting unnecessary pain . For the proband (iii-3), fluoxetine treatment partially restored the decrease in cmap for the facial and peroneal nerves in response to low - frequency rns [figure 3a and 3e], peroneal nerve]. However, significant improvements in the decrements were not observed for any of the tested nerves for the elder sister (iii-2), especially in response to low - frequency rns [figure 3b and 3f, ulnar nerve]. For the 4-year - old girl (iv-1; daughter of iii-2), although she did not have symptoms at the time, we measured a decrease in cmap for the ulnar nerve [figure 3d, ulnar nerve]. In the elder sister (iii-2), a significant decrease in the median nerve response at higher frequency rns was not found [figure 3 g]; however, a significant decrease in the ulnar nerve response at higher frequency rns was observed even after fluoxetine treatment [figure 3h]. Repetitive nerve stimulation tests in the affected patients of the pedigree (% amplitude) na: not available because ii-2 did not receive fluoxetine treatment; nd: decrement was not detected; proband (iii-3; e) and his elder sister (iii-2; f) monitored for the effects of fluoxetine treatment at low frequency . The proband's mother (ii-2; g) and elder sister (iii-2; h) tested at higher 30-hz stimulation . Next - generation sequencing revealed a mutation in the chrne gene of the proband (iii-3). Proband's dna was amplified and sequenced . A heterozygous missense mutation c.865c> t in exon 8 was found [figure 4], resulting in a substitution from leucine to phenylalanine at position 289 (l289f). The mother (ii-2) and elder sister (iii-2) [figure 4] carried the same heterozygous mutation . Dna of the 4-year - old girl (iv-1) was unavailable because her mother refused it . The mutation c.865c> t appears to have been initially reported as c.805c> t, leading to the changed l269f (i.e., a different residue number). This variant is located in chromosome 17 (focus: 4804140 g> a). The ensembl transcript i d is enst00000293780, leading to a cdna.865c> t change . According to the latest mrna sequence of genbank (mrna sequence nm_000080), these two residue positions are in fact identical, and the current accepted numbering is l289; accordingly, the mutation site has been updated as c.865c> t . In the human gene mutation database (hgmd), this mutation c.865c> t has been reported as a known disease mutation (hgmd i d cm960300). The heterozygous missense mutation (arrows), c.865c> t, was identified in the proband (iii-3), his elder sister (iii-2), and his mother (ii-2). The potential functional impacts of mutations within chrne gene were predicted using polymorphism phenotyping 2 (polyphen-2) software (http://geneics.bwh.harvard.edu/pph2/), sorting intolerant from tolerant (sift) software (http://sift.jcvi.org/) and mutationtaster (http://www.mutationtaster.org/). The p. leu289phe substitution was predicted by the polyphen-2 software to be probably damaging and disruptive of the function of chrne . Mutationtaster and sift predicted that the p. leu289phe mutation is functionally disease causing and damaging, respectively . With mutationtaster software, this mutation is predicted to result in splice site changes and that protein features might be affected . It has been reported that the mutation can lead to an unusually high rate of spontaneous achr channel openings and a 9-fold increase in affinity for acetylcholine . This mutation has been found to be absent in the 100 healthy controls (50% male). The proband (iii-3), 21-year - old man, had generalized muscle weakness at 4 years of age . His ability to run and jump was lower compared with his same - age peers . He had experienced fatigue while walking since 4 years old . Symptoms of weakness fluctuated in severity, and exacerbated transiently by physical activity, but slightly relieved during rest breaks . The symptoms progressed gradually, and the upper limbs became affected at the age of 9 . Symptoms exacerbated several times each year, with each episode lasting a few days to a month, especially during winter . The symptoms gradually progressed in the last 12 months and he experienced difficulty in climbing stairs; however, he did not experience diplopia, dysphagia, respiratory insufficiency, or muscle twitching . Bilateral facial weakness was observed, and the bulbar muscles were slightly involved, manifesting as nasal speech; however, swallowing difficulties were not present, and chewing problems were not marked . Examination showed mild weakness of the neck flexor muscles, bilateral muscles of the tibialis anterior and gastrocnemius, and finger extensor muscles . The mother of the proband (ii-2), a 47-year - old woman, had difficulties in grasping and finger extension at 10 years of age . At age 12, she presented marked muscular weakness and fatigability, especially in the lower limbs . Interestingly, symptoms stopped progressing and she began to recover gradually, though not to normal levels, but she was now able to complete daily housework and perform mildly taxing farm work . She had bilaterally limited eye movements without ptosis, symmetric bilateral facial weakness, and mild weakness of neck flexor and bilateral muscles of the limbs (grade 4/5 on the medical research council scale for the proximal muscles and 4/5 for the distal muscles of the limbs). The affected elder sister (iii-2) was 24 years old and had symptoms similar to the proband . She began to have difficulty in walking and extending fingers at 11 years of age . Facial weakness, muscle wasting in bilateral forearm and interosseous muscles, and bilateral ophthalmoplegia without ptosis were also found . Muscle strength on the medical research council scale was 3/5 for the neck flexor muscles and 4/5 for the proximal muscles . She was neither able to extend her fingers nor able to walk using either the toe or heel . The daughter of the elder sister (iv-1), a 4-year - old girl, however, had no symptoms or complaints . The laboratory tests for proband showed that the levels of creatine kinase and thyroid and sex hormones were normal, and antibodies to achr were not present . A neostigmine test showed no recovery for muscle weakness . With the proband's consent, we prescribed fluoxetine at a dosage of 20 mg / d as treatment . After no improvement was observed in his condition for 2 weeks, we increased the dosage to 40 mg daily; 10 days later, fatigue and weakness were mildly improved . When the elder sister underwent the same fluoxetine treatment, symptoms also were relieved; however, after 6 months of therapy, neurological examination showed no changes for either patient . Motor nerve conduction studies revealed a repetitive - compound muscle action potential (r - cmap) after a single stimulation in the median, ulnar, and peroneal nerves in affected patients from the pedigree [figure 2a2c], which even included the asymptomatic 4-year - old girl although she did not complain of weakness or fatigue [figure 2d]. However, compared with the recordings from the proband [iii-3; figure 2a] and his elder sister [iii-2; figure 2b], the r - cmap of the peroneal nerve of their mother [ii-2; figure 2c] was more noticeably affected . After fluoxetine therapy, r - cmap was still present in the proband (iii-3) and his elder sister (iii-2). (a) iii-3: two peaks, the second peak of the second wave overlaps the first peak of the first wave . Rns induced cmap decrements in several nerves of the affected patients in response to low- or high - frequency rns, as summarized in table 1 and shown in figure 3 . For the proband's mother (ii-2), no decrements were detected in response to low - frequency rns . Decrements of the proband (iii-3) were more obvious than those of the other family members, despite similar degrees of illness . Decrements in response to high - frequency rns were more significant than those to low - frequency rns for all affected members except the 4-year - old girl (iv-1), who did not receive high - frequency rns to avoid inflicting unnecessary pain . For the proband (iii-3), fluoxetine treatment partially restored the decrease in cmap for the facial and peroneal nerves in response to low - frequency rns [figure 3a and 3e], peroneal nerve]. However, significant improvements in the decrements were not observed for any of the tested nerves for the elder sister (iii-2), especially in response to low - frequency rns [figure 3b and 3f, ulnar nerve]. For the 4-year - old girl (iv-1; daughter of iii-2), although she did not have symptoms at the time, we measured a decrease in cmap for the ulnar nerve [figure 3d, ulnar nerve]. In the elder sister (iii-2), a significant decrease in the median nerve response at higher frequency rns was not found [figure 3 g]; however, a significant decrease in the ulnar nerve response at higher frequency rns was observed even after fluoxetine treatment [figure 3h]. Repetitive nerve stimulation tests in the affected patients of the pedigree (% amplitude) na: not available because ii-2 did not receive fluoxetine treatment; nd: decrement was not detected;: signal not detected . Proband (iii-3; e) and his elder sister (iii-2; f) monitored for the effects of fluoxetine treatment at low frequency . The proband's mother (ii-2; g) and elder sister (iii-2; h) tested at higher 30-hz stimulation . Next - generation sequencing revealed a mutation in the chrne gene of the proband (iii-3). A heterozygous missense mutation c.865c> t in exon 8 was found [figure 4], resulting in a substitution from leucine to phenylalanine at position 289 (l289f). The mother (ii-2) and elder sister (iii-2) [figure 4] carried the same heterozygous mutation . Dna of the 4-year - old girl (iv-1) was unavailable because her mother refused it . The mutation c.865c> t appears to have been initially reported as c.805c> t, leading to the changed l269f (i.e., a different residue number). This variant is located in chromosome 17 (focus: 4804140 g> a). The ensembl transcript i d is enst00000293780, leading to a cdna.865c> t change . According to the latest mrna sequence of genbank (mrna sequence nm_000080), these two residue positions are in fact identical, and the current accepted numbering is l289; accordingly, the mutation site has been updated as c.865c> t . In the human gene mutation database (hgmd), this mutation c.865c> t has been reported as a known disease mutation (hgmd i d cm960300). The heterozygous missense mutation (arrows), c.865c> t, was identified in the proband (iii-3), his elder sister (iii-2), and his mother (ii-2). The potential functional impacts of mutations within chrne gene were predicted using polymorphism phenotyping 2 (polyphen-2) software (http://geneics.bwh.harvard.edu/pph2/), sorting intolerant from tolerant (sift) software (http://sift.jcvi.org/) and mutationtaster (http://www.mutationtaster.org/). The p. leu289phe substitution was predicted by the polyphen-2 software to be probably damaging and disruptive of the function of chrne . Mutationtaster and sift predicted that the p. leu289phe mutation is functionally disease causing and damaging, respectively . With mutationtaster software, this mutation is predicted to result in splice site changes and that protein features might be affected . It has been reported that the mutation can lead to an unusually high rate of spontaneous achr channel openings and a 9-fold increase in affinity for acetylcholine . This mutation has been found to be absent in the 100 healthy controls (50% male). Sccms is a progressive disorder and may present with ophthalmoplegia, ptosis, facial paralysis, weakness, fatigue of trunk and limb muscles, and spinal deformity such as scoliosis . A pathological gain of function of achr located in the postsynaptic membrane has been observed in sccms, which was caused by mutations in the achr alpha - subunit (chrna) gene and chrne gene . However, mutations of the chrne gene can also lead to the fast - channel variation of csm . The clinical phenotype can range from mild to severe and vary among sccms patients with different mutations and even among patients with the same mutation . The mutation c.865c> t / l289f of chrne gene identified in our study was first identified in 1995 . The mutation identified in 1995 came from a family that was initially described in 1982 . At least seven patients with this mutation in chrne gene have been reported; however, no patient with this mutation has been found in asia until now . Compared with other patients reported to have the same mutation, certain characteristics were different in our chinese family . For example, all members in the family experienced childhood onset and none presented ptosis . Respiratory failure did not occur, hence ventilator - assisted breathing was not used . However, severe symptoms have been reported in other patients carrying this identical mutation, including onset in infancy and severe effects on respiratory muscles that caused respiratory failure requiring mechanical ventilation in two cases . Interestingly, the proband in our family experienced episodes of weakness and deterioration in winter for unknown reasons, the influence of climate on the disease has not been reported previously . We also discovered that, in the mother of the proband, the weakness improved gradually with an increase in age, which suggested that even without medications, this disease might gradually improve with age during adulthood . The role of the mutation c.865c> t in the pathogenesis of cms has been investigated in several studies . This mutation was definitively demonstrated to be a causative factor in the development of sccms and was localized to chrne and more precisely to the pore, within the m2 domain, which forms a part of the achr channel . Mutations in this m2 domain have more severe phenotypic consequences than those in the extracellular domain . Indeed, patch clamp studies revealed an unusually high rate of spontaneous achr channel openings and a 9-fold increase in affinity for acetylcholine resulting from this mutation, leading to pathological gain of function . In addition, ultrastructural studies showed that endplate myopathy occurs in the postsynaptic muscle fiber . After fluoxetine treatment, our patients reported mild improvement of muscular weakness although neurological signs did not change . Electrophysiological studies showed that r - cmap remained after fluoxetine treatment in both the proband (iii-3) and his elder sister (iii-2), which were consistent with a previous study . Varying degrees of decrements in response to rns were found in the affected family members in our study, especially in response to high - frequency stimulation, which indicated that high - frequency rns is a more sensitive indicator than low - frequency rns for this disease . In contrast, decrements were not observed in the mother (ii-2) in response to low - frequency rns . Heterogeneities in the family's electrophysiological data were also found, but we could not fully address the issue, at least not yet, as to whether the magnitude of the cmap decrease observed in the rns test positively correlated with the severity of illness . The 4-year - old girl (iv-1) did not have any symptoms at present; however, decrements were observed when she received low - frequency rns, especially with 3 hz, which indicated that she would likely suffer from this disorder in the future . Furthermore, decrements in response to low - frequency rns of the ulnar nerve of this girl (iv-1) were more pronounced than those in her mother (iii-2). In addition, although the decrease in rns was greater in the proband (iii-3) than the elder sister (iii-2), the severity of the clinical symptoms was nearly same . Therefore, we hypothesized that the extents of decrements in response to rns did not necessarily correlate with the severity of illness . After fluoxetine treatment, decrements in response to rns were observed to improve in a subset of the nerves of one patient but not in the others receiving the same treatment, although they both reported clinical relief of symptoms . Electrophysiological heterogeneities in cms due to chrne gene mutations have been reported . A patient with c.855c> t mutation in chrne gene showed a mild but significant decrement in all the muscles except for the tibialis anterior . The greatest decrement was observed in the anconeus muscle (15% in amplitude). A mild decrement (10%) was found in a patient due to the mutation (epsilon1369delg) of chrne gene, but another patient with the same mutation had no decrement . Patients due to duplication mutations 123_127dupctcac in exon 2 of the chrne gene showed decrements . For sccms patients whose illness can be attributed to the same mutation as in this study, a decremented electromyographic response was observed on 2 to 3 hz of stimulation; however, r - cmap was not found . Rns test revealed 30%70% decrements in different muscles of a spanish boy with the same mutation l269f cms may be misdiagnosed as myasthenia gravis or congenital muscular dystrophy or myopathy, such as ulrich congenital muscular dystrophy, which could lead to incorrect or delayed treatment . For example, pyridostigmine treatment for sccms patients can induce endplate myopathy, and it is thus contraindicated . The presence of r - cmap indicates a diagnosis of either sccms or acetylcholine esterase deficiency, which is caused by mutations in the acetylcholinesterase - associated collagen (colq) gene; hence, the identification of gene mutations underlying sccms will be necessary for further differential diagnosis.
|
Scabies, due to infestation with the sarcoptes scabiei mite, has been estimated to affect approximately 300 million people worldwide each year . Its direct impact is itching, but secondary bacterial infection with streptococci and staphylococci is frequent and can lead to serious and potentially fatal complications, including invasive bacterial infections, renal failure, and chronic rheumatic heart disease.14 the highest rates of scabies in the world are found in pacific island countries.5 in a population - based survey in fiji, 24% of participants had scabies, with a particularly high prevalence in young children (l. romani, personal communication). A prospective study in fijian schoolchildren documented scabies incidence at 51 cases per 100 person - years.6 scabies treatment is primarily with application of topical agents, including benzyl benzoate and permethrin cream, which was introduced to fiji in 2006 and is now the standard of care.7 as s. scabiei is transmitted by close body contact or shared objects, treatment of close contacts is also recommended . One oral agent, ivermectin (ivm), has been used as single dose scabies treatment, repeated at two weeks if symptoms persist.810 the frequency of reinfestation in endemic settings has led to consideration of mass drug administration (mda) as a public health option for scabies control . Small, uncontrolled studies in closed communities such as prisons and aged care facilities have suggested that treatment of entire communities can sharply reduce the prevalence of infestation,8,1113 using either topical treatment or oral ivm, the latter perhaps offering better adherence and fewer side effects.14 to assess the potential role of mda in an open community setting in the general population, we studied oral vs. topical mda in two fijian villages . We performed a prospective trial comparing the efficacy and tolerability of two mda treatment regimens for the control of scabies by offering treatment to all community members regardless of the presence of scabies or its symptoms . Hence, all family members of study participants, including asymptomatic family members of patients with scabies living in either village, were offered treatment immediately after examination and included in the study . We conducted the study in two fijian subdivisions (local administrative areas) in june and july 2004 . The sites were selected by the fiji ministry of health as having approximately the same number of inhabitants and being within a 2-hour drive of the capital, suva, but relatively isolated from each other and from other communities . Allocation to treatment was decided by administrative chance based on the availability of medication at start point . In the tailevu subdivision, three closely linked settlements (sawakasa, dakuinuku, and lodoni, total population 572) were classified as one site . In the rewa subdivision, all fijian nationals living in either of the two sites were considered eligible for the study and were enrolled after signing the consent forms, with parents signing for their children . Study participants were registered by name, age, and sex and were weighed at initial visit . After enrollment, participants were identified only by their numeric code and no further identifying data were used in the study . Participants were asked to complete questionnaires at enrollment and follow - up visit, in either english or fijian, and assisted by the local community nurse if necessary . Each participant was examined by a healthcare professional with experience in scabies diagnosis and treatment and reviewed by a senior doctor if any skin lesions were seen . The diagnosis of scabies was made clinically, based on the presence of characteristic lesions with or without a history of itch . Suspected scabies lesions, either papules, pustules, or crusted lesions on the trunk and limbs, were counted and other dermatological conditions, such as boils and sores, eczema, and tinea were documented before and after treatment . If appropriate, oral antibiotics were given for secondarily infected lesions and therapy provided for other skin conditions . The extent of scabies was quantified as mild (10 lesions or fewer), moderate (1149), severe (50 or more), or crusted (confluent lesions, too many to count).1517 the diagnosis of infected lesions was made based on the presence of erythema, crusting, or pustules . All mda study participants in the rewa subdivision site (ivm group) aged 2 years and over with no medical contraindications received a single dose of oral ivm at 200 g / kg body weight (stromectol 3 mg tablets; merck sharp & dohme, south granville, nsw, australia), rounded to whole 3 mg ivm tablets . Children aged <2 years received topical 5% permethrin cream (lyderm; makans drug & pharmaceutical supplies, taravao, fiji) to be applied from neck to toes . Pregnant (n = 2) and lactating women, and people who reported a history of neurological disease, such as stroke (n = 2) or neurofibromatosis (n = 1), were also given 5% permethrin cream . At the time of the study, benzyl benzoate was the standard treatment for scabies in fiji, available free through clinics, and both benzyl benzoate and permethrin were available for purchase from the private pharmacies . According to the national protocol, participants in the tailevu subdivision site (benzyl benzoate, bb group) were given 25% topical benzyl benzoate lotion, diluted to 12.5% for children aged 212 years, and 8.3% for those aged less than 2 years . Adults were each provided with one 100 ml bottle of benzyl benzoate 25% and asked to apply it that night, and on two successive nights, from neck to toes, covering all areas . Participants were asked to leave it on for 24 hours, then wash and re - apply, following the recommended guidelines for benzyl benzoate in fiji at that time . Participants in both sites were provided with information about the medication they were offered and advised of the need to wash themselves, their bed linen, and clothes used within the previous 24 hours . In the bb group, the follow - up assessment took place 28 days after the initial visit, whereas in the ivm group it was at 24 days . At the follow - up visit, participants were re - examined; scabies lesions were counted and recent medical history recorded . If required, patients were given treatment for any persistent skin lesions . All participants were specifically asked if they had experienced any adverse events apart from itch following treatment and if they had sought medical care for these events . In the self - administered post - treatment questionnaire, statistical analysis was conducted using stata 12 (statacorp lp, college station, tx, usa) and ibm spss statistics version 19 (ibm company, armonk, ny, usa). The effects of the interventions were measured by comparing the prevalence of scabies at follow - up with that before intervention by comparing the reduction of absolute risk with calculation of 95% confidence intervals (ci) and relative risk with 95% cis between the two periods . For comparison of other skin diseases pre- and post - intervention, mcnemar's test was used . Ethics approval for the study was obtained from the fiji national research ethics review committee and reviewed by st . All mda study participants in the rewa subdivision site (ivm group) aged 2 years and over with no medical contraindications received a single dose of oral ivm at 200 g / kg body weight (stromectol 3 mg tablets; merck sharp & dohme, south granville, nsw, australia), rounded to whole 3 mg ivm tablets . Children aged <2 years received topical 5% permethrin cream (lyderm; makans drug & pharmaceutical supplies, taravao, fiji) to be applied from neck to toes . Pregnant (n = 2) and lactating women, and people who reported a history of neurological disease, such as stroke (n = 2) or neurofibromatosis (n = 1), were also given 5% permethrin cream . At the time of the study, benzyl benzoate was the standard treatment for scabies in fiji, available free through clinics, and both benzyl benzoate and permethrin were available for purchase from the private pharmacies . According to the national protocol, participants in the tailevu subdivision site (benzyl benzoate, bb group) were given 25% topical benzyl benzoate lotion, diluted to 12.5% for children aged 212 years, and 8.3% for those aged less than 2 years . Adults were each provided with one 100 ml bottle of benzyl benzoate 25% and asked to apply it that night, and on two successive nights, from neck to toes, covering all areas . Participants were asked to leave it on for 24 hours, then wash and re - apply, following the recommended guidelines for benzyl benzoate in fiji at that time . Participants in both sites were provided with information about the medication they were offered and advised of the need to wash themselves, their bed linen, and clothes used within the previous 24 hours . In the bb group, the follow - up assessment took place 28 days after the initial visit, whereas in the ivm group it was at 24 days . At the follow - up visit, participants were re - examined; scabies lesions were counted and recent medical history recorded . If required, patients were given treatment for any persistent skin lesions . All participants were specifically asked if they had experienced any adverse events apart from itch following treatment and if they had sought medical care for these events . In the self - administered post - treatment questionnaire, statistical analysis was conducted using stata 12 (statacorp lp, college station, tx, usa) and ibm spss statistics version 19 (ibm company, armonk, ny, usa). The effects of the interventions were measured by comparing the prevalence of scabies at follow - up with that before intervention by comparing the reduction of absolute risk with calculation of 95% confidence intervals (ci) and relative risk with 95% cis between the two periods . For comparison of other skin diseases pre- and post - intervention, mcnemar's test was used . Ethics approval for the study was obtained from the fiji national research ethics review committee and reviewed by st . A higher proportion of the population was enrolled in the bb group than the ivm group (76% vs. 49% respectively, fig.1). Otherwise, participant demographics at the two sites did not differ significantly in regards to sex, age, or weight at baseline (table1). Of the 435 enrolled in the bb group, 201 (46%) returned for follow - up . In the ivm group, 325 were enrolled and 126 (39%) returned for follow - up . Demographics characteristics of baseline study populations bb, benzyl benzoate group; ivm, ivermectin group . Includes six indian fijian (all in tailevu) and two european (one in tailevu and one in rewa). Flow chart of participation and follow - up rate at each study site specifically there was significantly higher follow - up in children under the age of five years in the bb group (45.5%) than in the ivm group (20.0%) (p = 0.01; or 3.3; 95% ci 1.48.2), in contrast to those aged 514 years, where 54.2 and 70.3% attended follow - up (p = 0.01; or 0.5; 95% ci 0.30.8). In people aged 1529 years, the difference was highest, 29.6% attending for follow - up in the bb and 9.4% in the ivm group (p = 0.01; or 4.0; 95% ci 1.411.4). At the baseline visit, differences were noted between the two groups, in particular scabies prevalence was higher in the bb group (37.9%) compared to the ivm group (23.7%) (table2). Overall, the severity of scabies at baseline, defined by the number of lesions, did not significantly differ between the two villages . Many study participants had other skin conditions at baseline, overall more common in the ivm group (36.6%) compared to the bb group (26.7%). Dermatologic conditions detected at initial examination and at follow - up bb, benzyl benzoate group; ivm, ivermectin group . Confluence of lesions precluded accurate counting . Comparing the prevalence of scabies before and after mda, the reduction in prevalence was significant in both groups but similar in magnitude (table3). After mda, scabies lesions were present in 40 of 201 people examined (20.0%) in the bb group and 12 of 126 examined (9.5%) in the ivm group . The absolute risk reduction in the bb group was 18% (95% ci 10.524.8) with a relative risk of 0.52 (95% ci 0.390.71), whereas in the ivm group the absolute risk reduction was 14.2% (95% ci 6.520.5) with a relative risk of 0.40 (95% ci 0.230.71). Scabies positivity rate before and after mass drug administration in the two groups overall and by age group bb, benzyl benzoate group; ivm, ivermectin group . Permethrin was used in <2 year olds; however, no significant difference was found . Permethrin was used in two pregnant women with no scabies at start, no follow - up visit . Permethrin was used in three cases with a history of neurological disease, two had scabies at start, none of the three at follow - up . Other skin conditions were noted in 32.3% (65 of 201) of participants in the bb group and in 42.1% (53 of 126) in the ivm group after treatment . There was no significant difference in the change in prevalence of other skin conditions at baseline and follow - up in either group overall; however, diagnoses of boils and sores increased in the bb group from 1.0 to 5.0% (p = 0.04) and fungal diseases in the ivm group from 15.1 to 24.6% (p = 0.02) in participants who attended both visits . Nineteen of 200 people (9.5%) reported having had adverse events (apart from itch exacerbation) after treatment in the bb group whereas only three of 126 (2.4%) did in the ivm group (p = 0.01, or 4.3, 95% ci 1.2514.86). The reported side effects included stinging and burning in the bb group and lethargy and giddiness in the ivm group . No study participants presented for medical care related to adverse events, and community - wide no hospitalizations or deaths occurred during the study period . Mean age in those who reported adverse events was not significantly different between the two villages, 26 years in both groups . No side effects in the ivm group occurred in children under the age of 10 years . In the bb group, 38 of 192 (19.8%, 95% ci 14.426.1) experienced worsening of their itch after treatment, compared to four of 111 (3.6%, 95% ci 1.09.0) in the ivm group . A higher proportion of the population was enrolled in the bb group than the ivm group (76% vs. 49% respectively, fig.1). Otherwise, participant demographics at the two sites did not differ significantly in regards to sex, age, or weight at baseline (table1). Of the 435 enrolled in the bb group, 201 (46%) returned for follow - up . In the ivm group, 325 were enrolled and 126 (39%) returned for follow - up . Demographics characteristics of baseline study populations bb, benzyl benzoate group; ivm, ivermectin group . Includes six indian fijian (all in tailevu) and two european (one in tailevu and one in rewa). Flow chart of participation and follow - up rate at each study site specifically there was significantly higher follow - up in children under the age of five years in the bb group (45.5%) than in the ivm group (20.0%) (p = 0.01; or 3.3; 95% ci 1.48.2), in contrast to those aged 514 years, where 54.2 and 70.3% attended follow - up (p = 0.01; or 0.5; 95% ci 0.30.8). In people aged 1529 years, the difference was highest, 29.6% attending for follow - up in the bb and 9.4% in the ivm group (p = 0.01; or 4.0; 95% ci 1.411.4). At the baseline visit, differences were noted between the two groups, in particular scabies prevalence was higher in the bb group (37.9%) compared to the ivm group (23.7%) (table2). Overall, the severity of scabies at baseline, defined by the number of lesions, did not significantly differ between the two villages . Many study participants had other skin conditions at baseline, overall more common in the ivm group (36.6%) compared to the bb group (26.7%). Dermatologic conditions detected at initial examination and at follow - up bb, benzyl benzoate group; ivm, ivermectin group . Comparing the prevalence of scabies before and after mda, the reduction in prevalence was significant in both groups but similar in magnitude (table3). After mda, scabies lesions were present in 40 of 201 people examined (20.0%) in the bb group and 12 of 126 examined (9.5%) in the ivm group . The absolute risk reduction in the bb group was 18% (95% ci 10.524.8) with a relative risk of 0.52 (95% ci 0.390.71), whereas in the ivm group the absolute risk reduction was 14.2% (95% ci 6.520.5) with a relative risk of 0.40 (95% ci 0.230.71). Scabies positivity rate before and after mass drug administration in the two groups overall and by age group bb, benzyl benzoate group; ivm, ivermectin group . Permethrin was used in <2 year olds; however, no significant difference was found . Permethrin was used in two pregnant women with no scabies at start, no follow - up visit . Permethrin was used in three cases with a history of neurological disease, two had scabies at start, none of the three at follow - up . Other skin conditions were noted in 32.3% (65 of 201) of participants in the bb group and in 42.1% (53 of 126) in the ivm group after treatment . There was no significant difference in the change in prevalence of other skin conditions at baseline and follow - up in either group overall; however, diagnoses of boils and sores increased in the bb group from 1.0 to 5.0% (p = 0.04) and fungal diseases in the ivm group from 15.1 to 24.6% nineteen of 200 people (9.5%) reported having had adverse events (apart from itch exacerbation) after treatment in the bb group whereas only three of 126 (2.4%) did in the ivm group (p = 0.01, or 4.3, 95% ci 1.2514.86). The reported side effects included stinging and burning in the bb group and lethargy and giddiness in the ivm group . No study participants presented for medical care related to adverse events, and community - wide no hospitalizations or deaths occurred during the study period . Mean age in those who reported adverse events was not significantly different between the two villages, 26 years in both groups . No side effects in the ivm group occurred in children under the age of 10 years . In the bb group, 38 of 192 (19.8%, 95% ci 14.426.1) experienced worsening of their itch after treatment, compared to four of 111 (3.6%, 95% ci 1.09.0) in the ivm group . This is the first comparative study of mda for scabies in a general population setting and sets a precedent for possibly conducting general community mda . Our study showed that mda for scabies using either topical or oral medication reduced scabies prevalence by a factor of up to 60% . Although the relative reduction in risk was higher for mda of ivm (60%), compared to benzyl benzoate (48%), the difference was not statistically significant . Both strategies had a low rate of adverse events, but ivm was better tolerated, particularly in terms of stinging and burning . The high scabies prevalence at baseline in the bb group of 38%, and ivm of 24% with frequent secondary bacterial infection, as has been described in other studies, indicates that scabies is a major health issue in fiji.6,18 scabies was found to be a major public health problem in our two examined fijian villages, with particularly high rates among children in both villages . In our study, 69% of all children examined under the age of 5 years had scabies in tailevu, compared to 43% in rewa . Subsequently, scabies prevalence rates of 18% in schoolchildren and 14% in infants were reported in fiji (in 2006/2007).6 the infection rates found in our study in fiji were much higher than in other community - based studies in brazil, timor - leste, the solomon islands, vanuatu, and kenya.1923 a study conducted in papua, new guinea, found higher scabies prevalence than in our study overall (87% in one village and 52% in another); however, numbers of examined people in this study were low.24 several previous non - comparative studies have shown a marked reduction in scabies prevalence following mda . These include an mda of topical permethrin in the san blas islands of the republic of panama25 and an mda of ivm on five isolated islands in the solomon islands.21 in these studies, the prevalence of scabies fell from 33 to 25%, respectively, to <1% at three years . However, both studies employed regular follow - up and retreatment to maintain the sustained reduction in prevalence . Whether the reduction seen in this study could be maintained beyond one month without regular follow - up and re - treatment is not known . Our study is the first comparative study of mda for scabies at the community level for all ages . A previous comparative trial conducted in a closed population of 84 children living in an urban hostel of delhi found that mda ivm (two doses) was more effective than individual treatment with permethrin (single application) for symptomatic patients . In the first six months of the study, permethrin was used, and there were 22 cases, while after mda ivm, there was only one case of scabies detected in the subsequent six months.12 mda has been documented as being effective for treating endemic scabies in the institutional setting for both children and adults but has never been tested in a comparative study in a general population previously.7,10,11 our findings provide support for an mda treatment approach rather than an individual - based approach for communities with a high prevalence of scabies, similar to that used in institutional settings . The first is that follow - up was conducted only at 2428 days after the initial administration of treatment due to operational constraints, and therefore the longer - term impact of mda on scabies could not be assessed . There were also considerable differences in participation rates between the two groups; 76% in the bb group and 49% in the ivm group . This may have diminished the apparent effect of the ivm mda because of a higher risk of reinfestation by non - treated community members in this arm, as those treated may have been exposed to untreated non - participants in their community and hence have had a higher rate of reinfestation . The reasons for the differences in participation may be due to the bb group village being more isolated and that scabies was identified very strongly by this community as a serious and significant health issue (k. haar, personal communication). Further, there was a high loss to follow - up in this study, 54% in one group and 61% in the other . This may have been because people that were successfully treated did not return for follow - up (k. haar, personal communication), and particularly those with persisting skin conditions such as tinea, boils, and sores returned . This factor would have underestimated the efficacy of mda in both arms of the study . People, with only 9% of participants aged 1529 years attending in the ivm group . The relatively high follow - up rate of 70% among children aged 514 years in the ivm group can be attributed to the research team visiting the school to examine trial participants there . Insufficient communication with the village health workers of the importance of all study participants returning for the second village visit, regardless of their outcome, may have contributed to the poor follow - up rates . To improve community - based studies and to enhance participation and follow - up rates, timely planning and detailed written information with precise dates, locations, and instructions should be provided to all community leaders and participants . Another confounder to our study was that the villages were not equal in terms of access to water supply and to primary healthcare . The bb group had a communal water source useable only during the day and single dirt road access, which was sometimes impassable during the wet season . In the ivm group, continuous water supply and plumbing to individual residences was common, with tar road village access, and they were located closer to the local community hospital . Although this situation has improved in the intervening years, assessment of these factors in future studies may determine their role . One limitation of the study is that it was not truly randomized; however, allocation to treatment was decided by administrative chance, based on the availability of medication at start point . In any future study the protocol of applying benzyl benzoate for three consecutive nights was the fiji ministry of health guidelines for the treatment of scabies at that time . One potential source of bias could be the correct application, which we tried to rule out through specific questions post - treatment . However, we did not control the application per se, nor collect empty bottles . Although this protocol allowed ivm to be compared with the standard of care at that time, permethrin cream subsequently became the standard of care and therefore for any future study should include permethrin cream . Ongoing studies in fiji indicate that the overall prevalence of scabies in the country has not changed since this study was performed (l. romani, personal communication), suggesting that the introduction of permethrin cream for individual case management has had little impact on disease burden . Therefore, further investigation into population - based control methods are as pressing today as they were when this study was undertaken in 2004 . Our study provides proof of principle that mda for scabies can reduce scabies prevalence at the community level . A larger study is needed that has longer and more complete follow - up, which includes a cost - effectiveness analysis and compares mda to the more conventional approach of treating symptomatic cases and their contacts . Without these data
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.