text
stringlengths 0
868k
|
|---|
Upper urothelial tract carcinomas (utuc) are rare tumors that account for about 5% of genitourinary malignancies . Despite the introduction of minimally invasive techniques and the revisions in some of the indications for radical surgery, especially for low risk patients, radical nephroureterectomy (rnu) with bladder cuff excision it is also the only one graded with the level of recommendation a in the revised and updated issues of the guidelines of the european association of urology . Tumor necrosis, advanced stage, lymphovascular invasion, hydronephrosis, tumor size and location have all been identified as prognostic factors for the overall and cancer specific survival [3, 4]. Despite the accumulating data, the need for establishing new and reliable prognostic factors may play a bigger role in the near future for establishing recommendations for the stringent follow -up and treatment after rnu for utuc . The aim of the present study was to evaluate the influence of clinicopathological factors including age, gender, tumor grade, tumor stage, lymphovascular invasion (lvi), tumor necrosis and previous history of non - muscle invasive bladder cancer on cancer specific survival (css) and overall survival (os). A retrospective analysis was conducted for the patients who underwent rnu for utuc at our institute during the time period of 2005 to 2012 . Cases of utuc with concomitant or previous history of non - muscle invasive urothelial carcinoma of the bladder were also included in our study . Exclusion criteria was muscle - invasive carcinoma of the bladder, or distant metastasis . Since one of our aims was to evaluate the effect of lvi invasion, positive lymph nodes rnu was performed using a standardized open technique with lumbar and gibson incision for optimal access both to both the kidney and proximal ureter and to the distal ureter and bladder, respectively . The bladder cuff was excised with a radius of at least 1.5 cm around ureteral insertion . Tumor grading was standardized according to the 2004 who grading system distinguishing between papillary urothelial neoplasm of low malignant potential (punlmp) and low and high grade urothelial carcinoma . The surgical specimens were assessed for the depth of tumor invasion, lvi, size of tumor (measured in the surgical specimen) and necrosis of more than 10% of the tumor area . Urine cytology and cystoscopy were performed at the 3 month and 9 month follow - up and if no relapse was observed, procedures were performed annually . Computer tomography scans were performed at the 6 month and 12 month follow - up and then afterwards annually . Statistical analysis was performed to assess the prognostic effect of age, gender, tumor grade, tumor stage, lymphovascular invasion (lvi), tumor necrosis and previous history of non - muscle invasive bladder cancer on cancer specific survival (css) and overall survival (os) among patients treated for utuc . All statistical analyses were performed with spss v. 19 at 5% risk level (p <0.05). A total of 63 patients underwent rnu for utuc at our institute from the period 20052012 . One patient was verified with adenocarcinoma of the renal pelvis and was excluded from the study . One of them had positive lymph nodes, whereas the other underwent rnu with cystoprostatectomy for concomitant muscle - invasive carcinoma of the bladder . A total of 60 patients fulfilled the inclusion criteria and were included in the study . The mean length of follow - up time was 33.3 months with range from 1 to 84 months . Of the 60 patients 32 (53.3%) were under 65 years, whereas 28 (46.6%) where 65 years or over . At the time of our analysis 27 (45%) patients were alive, whereas 33 (55%) were dead . The 1-year, 3-year and 5-year survival rates were 61.7%, 48.4%, and 38.8%, respectively . Accurate cause - specific morality data of our subjects was available only for the first 12 months of our study . From the 19 deceased at the end of the first year, cancer related death was proven for the 16 of them . The other three patients died from non - cancer related reasons (pulmonary embolism, myocardial infarction, and no data for the third patient). Hence, accurate cancer specific survival analyses could be performed only for the first year following rnu, which is 73.4% . Unfortunately, in the following years the drop - off rate of the patients would reach up to 45% by the fifth year . At the end of the study, after evaluating the documents from the follow - up, we discovered that 27 patients dropped out due to unknown reasons . Most of them dropped out of the study between the third and fifth year (20 patients). Survival data for these patients was collected from available national and health data registries . For 4 patients not enough sufficient information was gathered regarding the treatment process or follow - up and they were excluded from the survival analysis . 17 of the patients (28.33%) had concomitant or a history of non - muscle invasive bladder cancer at time of diagnosis, treated with transurethral resection . 8 patients (13.3%) suffered bladder recurrence . For 6 of them (75%) the tumor location was the pyelocaliceal system for 57 cases (95%) and the ureter in 3 (5%). Due to the limited amount of patients no statistical analyses could be performed to assess the effect of tumor location on the outcomes . Sufficient data for tumor size was available for only 34 of the patients . Despite the small amount of patients, we decided to investigate this group separately from the others and to evaluate the effect of the variable on survival outcomes . Our analysis showed that the larger tumor size had a negative effect on survival (p = 0.018), but the small number of observations did not allow us to state this with the desired confidence . On the univariate analysis, variables such as gender (figure 1), grading, tumor stage (figure 2), lvi (figure 3) and tumor necrosis (figure 4) were all demonstrated to be significant prognostic factors affecting os and css (table 1). On the other hand, on the multivariate analysis univariate analysis for overall survival a statistically significant relationship was found between gender and grading . There were 77.5% of males that were high - grade, whereas for females this percent was 50% (p = 0.031). Tumor necrosis was observed in 52.4% of the patients aged 65 years or less and in 10.7% of the patients above 65 years of age (p = 0.031). Tumor necrosis was associated with high grading (p = 0.004) and lvi (p <0.001). The amount of studies regarding the effect of age in patients with utuc is relatively limited (5). Reported that in a series of 1,453 patients, being older at the time of rnu, there was an associated decrease in survival . This was attributed to a change in the biological potential of the tumor cell, a decrease in the host's defense mechanisms, or differences in care patterns . However, advanced age alone should not be regarded as exclusion criteria and many elderly patients might be cured with rnu [2, 5] in our study the percentage of patients over and under 65 years of age were 46.6% and 53.3%, respectively . By the end of our study 60% of patients over 65 years were dead, while for patient under 65 this percent was 51% . No statistical relationship was found between the age and os (p = 0.83). The effect of gender was investigated in a number of studies [6, 7]. Compared 2,903 (59.9%) males and 1,947 (40.1%) females who underwent rnu for pt(1 - 3)n(0/x)m(0) utuc . It was reported that females were more likely to have a more advanced pathologic t stage and higher tumor grade at the time of rnu than males . However, on multivariate analysis accounting for stage, grade, and noncancerous characteristics, gender was no longer found to affect cancer specific survival and os . In the study of shariat et al . Consisting of 754 patients treated with rnu for utuc, male gender was found to correlate with higher grading and similarly to the other mentioned study, it had no effect on cancer specific survival and overall survival . In addition, our study noted a positive correlation between female gender and low grading (p = 0.031) which was consistent with the literature [6, 7]. Male patients were 66.67% in our study and this gender ratio was also consistent with literature . In our study, the male gender was found to be a negative prognostic factor for os (p = 0.006), which did not correlate with the available data, but could be attributed to the small number of patients in our study and to the fact that low grade was found to have a positive effect on os (p <0.001). According to 2004 who classification, tumor grading is divided into papillary urothelial neoplasia of low malignant potential, high grade and low - grade carcinomas . Until 2004, the most commonly used grading system was 1974 who system where three grades were used . Some of the more recent series used the two - piered system and found that low grade was a strong independent prognostic factor for better outcome in patients with utuc that were treated with rnu [23, 24, 25]. In our study a significant relationship was established between tumor grading and os . All of the low grade patients were alive by the end of the study, whereas for the high grade patients the os rate was 19.5% . In previous studies tumor staging has been found to be an important prognostic factor for patients with utuc . In most of the largest series, tumor stage was found to be a prognostic indicator [7, 8, 9, 29]. With the advancing progression of the malignancy, urothelial carcinoma can spread by direct invasion, mucosal seeding, hematogenic and lymphatic routes . Patients with pt1 are found to have a cancer specific survival> 90%, whereas for stage t3t4 it is 40.5% and 19%, respectively . In our study, the 3-year and 5-year survival rates were 48.4%, and 38.8%, respectively . The results were worse than what was most often reported in literature [29, 31]. We can attribute this to the high prevalence of invasive stage disease (> t2) in our series the muscle invasive stage, in most of the series, has been estimated to be 1848% . In some studies, the os and css have been reported to be less than 50% for stage t2 and higher . The late stage at which the patients are diagnosed and treated is a problem which must not be underestimated by physicians . Our statistical analyses revealed that the stage of the tumor has a negative effect on os (p = 0.016). Significant amount of studies show lvi as an important prognostic factor for patients with utuc [1114]. A number of studies show that when strictly evaluated, the addition of lvi to the standard pathological protocol improves its accuracy in the prediction of cancer specific survival and disease recurrence for patients with utuc, especially for node - negative utuc [11, 15, 16]. Some researchers have even proposed its inclusion as part of the tnm staging system, similar to hepatic and testicular cancer . Limitation to this is the difficulty in determining its presence on a morphological level with differences between pathologists . Previous reports show that he staining might be enough to asses routinely for any vascular invasion . In our study assessment of lvi which was made on he stained sections, the lvi rate was found to be 46.6% . From patients reported to be positive with lvi, 9.6% were alive at time of follow - up while from the patients negative for lvi, 75% were alive . Lvi was also associated with the male gender, high grading and tumor necrosis (p = 0.017; <0.001 and <0.001 respectively). On the multivariate analysis lvi remained the only variable with a statistical significance (p value <0.001, hr = 11.089), which corresponds to the literature . Risk stratification based on the lvi status would be helpful for selecting patients at high risk who would be appropriate candidates for clinical trials studying the effects of adjuvant chemotherapy in n0m0 disease . Langner et al . Showed its significance as an independent predictive factor for os and could predict distant metastasis after rnu . Other large series [10, 21, 22]. On a multivariate analysis tumor necrosis was an independent factor for cancer specific survival suggested to become part of pathological reporting . In our study, os rate among the patients with tumor necrosis was estimated to be 7.1% while for patients without tumor necrosis this percent was 56.5% . There was a statistically significant correlation between the tumor necrosis and os (p <0.001). The prognostic role of concomitant non - muscle invasive bladder cancer or previous history of such, in patient with utuc is investigated in limited amount of studies . In their meta - analysis seisen t analyzed the outcomes of concomitant bladder cancer in 4,805 patients, where it was detected in 29% of the cases . There was 28% of the patients who had previous history of bladder carcinoma not invading the bladder muscle . Both studies concluded that previous history of non - muscle invasive bladder cancer had no effect on non - bladder recurrences, cancer specific survival and os on patients with utuc . In our series the previous history of non - muscle invasive bladder cancer had no significant statistical significance as a prognostic factor for os and css (p = 0.584). It was detected in 17 (28.33%) of the patients, which correlates with literature [26, 30]. Limited amount of studies are performed regarding tumor size in patients with utuc [27, 28]. Concluded that tumor diameter 3 cm on both uni- and multivariate analysis has serious prognostic effect regarding cancer specific survival and os . In the same study, larger size was found to correlate strongly with high grade and tumor necrosis (p <0.001). Shimamoto et al . In a series of 105 patients also found tumor diameter 3 cm is an independent prognostic factor for intravesical recurrence, distant metastasis and cancer specific survival . In our series sufficient information for tumor size was found for 34 of the patients . Despite the relatively small number of patients, the statistical analysis of our series found significant association with os (p = 0.018). No statistically significant associations were found between tumor size and other variables which is probably due to the small number of patients . Despite the obtained data, our study has limitations which are its retrospective nature and the relatively small number of patients . Furthermore, the increasing drop - out rates observed during the follow - up, reaching up to 45%, were another limitation . On the univariate analysis, variables such as gender, grading, tumor stage, lvi and tumor necrosis were all demonstrated to be significant prognostic factors affecting css and os after rnu in a patient with utuc . On the other hand on the multivariate analysis only lvi remained statistically significant . Lvi may explain the different clinical course in patients independently and might be considered as part of the pathological reporting and treatment planning.
|
Despite significant scale - up of antiretroviral prophylaxis, 260,000 pediatric hiv-1 infections are still diagnosed annually [1, 2], of which nearly half are a result of breastfeeding . In the united states, it is recommended that hiv - infected mothers use replacement feeding . However, replacement feeding in resource - poor countries is associated with increased mortality from diarrheal disease, pneumonia, and other infectious diseases . In these regions, the world health organization recommends that hiv - infected women breastfeed their infants in the setting of maternal and/or infant antiretroviral prophylaxis, which considerably reduces postnatal hiv-1 transmission [57]. Similar to hiv-1, cmv can be transmitted in utero, peripartum, or via breastfeeding . Congenital transmission has a well - established association with fetal growth restriction, sensorineural hearing loss, and neurodevelopmental abnormalities [8, 9]. Prior to the advent of highly active antiretroviral therapy (haart), reported congenital cmv rates were high among hiv - exposed and hiv - infected infants [1012]. However, studies of congenital cmv in the haart era show lower rates of congenital cmv in hiv - exposed, uninfected infants . In contrast to congenital cmv transmission, peri- or postpartum cmv transmission is typically asymptomatic in healthy full - term infants . However, peripartum cmv acquisition in hiv - infected infants is an important predictor of morbidity and mortality, leading to higher rates of hiv-1 progression . Mounting evidence suggests that growth and development of hiv - exposed, uninfected infants are also adversely affected by perinatal cmv acquisition . Moreover, high rates of symptomatic perinatal cmv infection have been described in hiv - exposed infants, an effect that may be modulated by maternal haart . Perinatal cmv infection may contribute to the recognized growth impairment of hiv - exposed, uninfected infants . Thus, it is important to establish the pathogenesis of perinatal cmv transmission in hiv - exposed infants and the impact of maternal haart on infant cmv exposure . Cmv shedding in milk of cmv - seropositive women is common, with postnatal cmv transmission rates up to 70% [1720]. Breast milk cmv load may be independently associated with the risk of postnatal cmv transmission [21, 22], especially in hiv-1-infected women as a direct correlation between cmv and hiv-1 breast milk viral loads has been described in untreated hiv - infected women . While maternal haart can effectively reduce hiv-1 rna load in breast milk, its effect on cmv shedding is not established . Moreover, establishing the impact of maternal haart on cmv exposure and the effects of cmv exposure on growth and development of hiv - exposed infants is important to improving infant survival in regions of high hiv-1 prevalence . In this study further, we evaluated the impact of milk cmv load on the growth of breastfed, hiv - exposed infants . Sixty - nine hiv-1-infected pregnant women testing positive by rapid antibody test were recruited from two rural health clinics outside blantyre, malawi, between 2009 and 2010 and consented for enrollment in this pilot study [24, 25]. The study and informed consent were approved by the college of medicine research and ethics committee in malawi and institutional review boards at each participating us institution . Maternal peripheral blood cd4 + t - cell count and plasma hiv-1 rna viral load were performed during the third trimester and women with confirmed infection were enrolled at delivery . Maternal antiretroviral use was assessed at each follow - up visit (delivery, 46 weeks, 3 months, and 6 months); untreated mothers and all infants were administered single dose nevirapine at delivery . All women were also screened for cmv igg by elisa using the third trimester blood sample (trinity biotech). Breast milk from right and left breasts was collected separately between four to six weeks postpartum . Mothers were counseled to exclusively breastfeed for the first six months and were provided with a peanut - based food supplement for their own nutrition for six months postpartum . Per national guidelines at the time, hiv - infected mothers were counseled at six months postpartum to choose to continue breastfeeding or rapid weaning if replacement feeding was a viable option . Infants were tested for hiv-1 infection by blood dna pcr at birth (for in utero infection), four to six weeks of age (for peripartum infection), and every three months of life until weaning (for postnatal infection). Infant growth parameters of height (crown - heel length) and weight (by infant scale) were monitored at birth, four to six weeks, three months, and six months . The weight - for - length, length - for - age, and weight - for - age z - scores were determined using the who anthro program (v3.2.2). Congenital cmv infection was diagnosed by cord blood tested for cmv dna pcr and igm, as infant urine and saliva were not collected . Thus, infants with positive cmv dna pcr of cord blood were considered to be congenitally infected with cmv . All infants included in the growth analysis at six months of age were still breastfeeding . Hiv-1 rna load was measured using the roche cobas ampliprep / cobas taqman 48 for hiv-1 load assay . Breast milk supernatant was diluted 1: 5 in phosphate - buffered saline (pbs) prior to analysis, whereas plasma was diluted 1: 10 . The minimum levels of detection for this assay were 480 viral rna copies / ml of plasma and 240 viral rna copies / ml of breast milk . The laboratory performing these assays was enrolled in the national institute of allergy and infectious diseases division of aids virology quality assessment program and certified for hiv-1 load determinations . The limit of quantification was 87 copies / ml . If virus amplification was detected but was below the level of the minimum virus standard, a value of half the minimum of detection was assigned . Sodium and potassium concentration of milk supernatant was measured using the gen2 ion selective electrode on the roche cobias c501 platform (roche diagnostics), with a sodium - potassium ratio> 1 indicative of subclinical mastitis [27, 28]. Distributions of demographic and laboratory characteristics were described using medians and interquartile ranges; differences between medians were described using two - sided p values from wilcoxon rank sum tests . We estimated the effects of haart on cmv breast milk load using linear regression (crude and adjusted) for infant birth weight and gestational age and maternal mastitis, age, and cd4 count . Confidence intervals around the cmv and hiv-1 transmission rates were calculated with a continuity correction . For the analysis of viral load data in each breast, we applied a goodness - of - fit analysis (quasi - akaike's information criterion) to determine whether an independent or exchange structure regression model was a better fit, and the results determined that the independent structure was a better fit . Thus, a generalized estimating equation (gee) with an independent correlation matrix to control for the within - woman correlation was used for the analysis of both breasts and each breast separately (right or left) from each individual woman . Cross - sectional associations between hiv-1 and cmv loads were described using scatterplots and linear regression to obtain slopes and r values . Comparisons of the frequency of hiv-1 or cmv transmission between the groups were performed using the chi squared test . Finally, we estimated the effect of milk cmv dna and hiv-1 rna load at four to six weeks on infant growth z - scores and the change in z - scores for weight - for - length, length - for - age, and weight - for - age using linear regression both crude and adjusted for infant birth weight and gestational age and maternal cd4 count, age, and haart use . Sixteen women initiated haart (trioimmune: stavudine, lamivudine, and nevirapine) prior to enrollment, with two on therapy prior to pregnancy and 14 initiating haart during pregnancy . Single dose nevirapine was provided during labor to the remaining 53 untreated women and all infants . Haart - treated women had a similar peripheral cd4 + t - cell count to that of the untreated women during the third trimester (table 1). Maternal plasma hiv-1 load during the third trimester was significantly lower in haart - treated versus untreated women with log10 plasma hiv-1 rna load 2.4 versus 4.0, respectively . Breast milk hiv-1 rna load was detectable at 46 weeks postpartum in at least one breast in two of 16 women on haart treatment (12.5%) versus 33/53 (62.3%) untreated women (p = 0.0005 by chi squared test). Thus, the median milk hiv-1 rna load measured was similar between the two groups, but the range of the milk virus load was significantly higher in the untreated women (table 1). Despite counseling on benefits of exclusive breastfeeding, of the 67 women who reported the date of initiation of mixed feeding, 10 women reported initiation of mixed feeding prior to 5 months of life (14.9%), 26 women reported initiating mixed feeding in the infant's sixth month of life (38.8%), 24 reported initiating mixed feeding after six months of age (35.8%), and seven women reported not initiating mixed feeding before weaning at six months of life (10.4%). While symptoms or signs of mastitis (such as breast soreness, erythema, or induration) were not reported by any of the subjects, subclinical mastitis was detected at four to six weeks postpartum in a similar proportion of treated and untreated women (table 1). In utero or peripartum hiv-1 transmission occurred exclusively in the untreated group (13%, 95% ci [0.06, 0.26]), despite the use of single dose nevirapine . Moreover, postpartum hiv-1 transmission occurred only in the untreated group (6%, 95% ci [0.01, 0.17]). When these modes of hiv-1 transmission were combined, there was a trend towards a higher rate of vertical hiv-1 transmission in the untreated group compared to the treated group (p = 0.06 by chi square test). Three infants were found to be congenitally infected with cmv by a positive cord blood cmv pcr: two in the treated and one in the untreated group and none of these overlapped with the hiv - infected infants . Low birth weight (<2500 g) was more prevalent in the haart - treated (25%) than the untreated (2%) group . Moreover, preterm birth (<37 weeks gestation), assessed by ballard score, trended towards a higher incidence in the haart - treated versus untreated group (table 1). There was no association between preterm birth and cmv infection in this cohort (p = 0.82 by chi square test), yet with only three congenital cmv infections in this cohort, the power to detect associations is limited . Cmv load was quantitated in milk collected from each breast at four to six weeks postpartum . We assessed the viral loads in milk collected from each breast due to known potential discordance of hiv-1 rna load between breasts and potential for unilateral mastitis [25, 28]. The average cmv load from right and left breasts of haart - treated women was similar to that of untreated women (table 1). To further assess the effect of haart on milk cmv load, we determined the difference in log10 copies / ml milk cmv load from both breasts and right and left breasts separately, associated with maternal haart . There was no association between haart and the magnitude of milk cmv load (table 2). When the results were adjusted for maternal age, cd4 count, mastitis, and infant gestational age and birth weight, there was a trend towards a decrease in milk cmv dna load in both breasts and right and left breasts with maternal haart (log10 difference in milk cmv dna load: 0.33, 0.21, and 0.50, resp . ), though the 95% confidence intervals (ci) included zero in all comparisons . We assessed the difference in log10 copies / ml milk cmv load from both breasts and right and left breasts, associated with subclinical mastitis . In both the raw and adjusted comparison of cmv load detected in milk, there was no association between mastitis and cmv load (log10 difference in milk cmv load associated with subclinical mastitis: 0.23, 0.47, and 0.46, for both breasts, left breast, and right breast, resp . ). After adjustment for maternal age, haart use, and cd4 count and infant birth weight and gestational age, the difference in milk cmv dna load by subclinical mastitis remained nonsignificant . Thus, subclinical mastitis was not associated with elevated milk cmv load in our population . Finally, we compared the milk cmv dna load among hiv - transmitting and hiv - nontransmitting mothers, combining all hiv transmission modes in one group due to the small number of total hiv transmissions . Interestingly, the cmv dna load was higher in transmitting mothers (mean log10 milk cmv dna load = 4.99) compared to nontransmitting mothers (mean log10 milk cmv dna load = 3.81) (p = 0.003). However, cmv dna load in milk of mothers of congenitally cmv - infected infants (mean log10 milk cmv dna load = 3.42) was similar to that of mothers of infants who did not congenitally transmit cmv to their infants (mean log10 milk cmv dna load = 3.99) (p = 0.31). Cmv dna load in mucosal secretions has previously been directly correlated with the magnitude of the hiv-1 rna load in the same compartment [23, 30]. Thus, we assessed the cross - sectional relationship between milk hiv-1 rna and cmv dna load in our cohort of haart - treated and untreated hiv - infected women at four to six weeks postpartum . Using a linear regression model, we determined the rise in log10 cmv copies / ml associated with a one log10 rise in hiv-1 copies / ml (figure 1). The difference in log10 milk cmv dna load for every one log10 rise in milk hiv-1 rna load was estimated at 0.39 (95% ci: 0.130.66) for both breasts, 0.28 for the right breast (95% ci: 0.030.60), and 0.49 for the left breast (95% ci: 0.200.78). However, there was no direct correlation between the milk viral loads in this cohort (correlation coefficient = 0.298, 0.214, and 0.377 for both, left, and right breasts). Thus, there was a weak association between the magnitude of the milk hiv-1 rna and cmv dna load in this cohort of hiv - infected, lactating women . We evaluated the association between the magnitude of postnatal cmv exposure in hiv - exposed, uninfected infants and postnatal growth . Three of the hiv - exposed infants had a positive cord blood cmv dna pcr, for a congenital cmv transmission rate of 4%, similar to previous reports for hiv - exposed infants [13, 31]. For this analysis of postnatal cmv exposure and infant growth, we removed infants that were congenitally or perinatally infected with hiv-1 (n = 10) and congenitally infected with cmv (n = 3). One uninfected infant died prior to 6 months of age (n = 1); thus the analysis was performed on a total of 55 infants . Infant plasma was not available for further cmv testing after birth to determine the incidence of postnatal cmv acquisition . As described in table 3, there was a significant reduction in crude and adjusted length - for - age z - score and the weight - for - age z - score at six months of age per log10 increase in milk cmv dna load, with adjusted analysis controlling for birth weight and gestational age and maternal cd4 count, age, and haart use . As exposure to cmv via breastfeeding is a postnatal exposure, we next assessed the change in the z - score of growth parameters between four to six weeks and six months of age in these hiv-1 and cmv - exposed infants . The milk cmv dna load remained only marginally negatively associated with the change in length - for - age in the adjusted analysis (0.30; 95% ci: 0.86, 0.25). As the milk cmv dna and hiv-1 rna loads were weakly positively associated in this cohort, we tested whether milk hiv-1 rna virus load was a better predictor of infant growth at six months . None of the associations between hiv-1 rna load and infant growth parameter z - scores or change in growth parameter z - scores at six months of age were significant (table 3). However, there was a positive, though somewhat imprecise, association between infant weight - for - length at six months of age and hiv-1 rna load in crude and adjusted analysis (table 3). Thus, the correlations between milk cmv load and infant growth trends are stronger and more consistent than the associations between milk hiv-1 load and infant growth . Haart during pregnancy and breastfeeding is now standard practice for prevention of perinatal hiv-1 transmission . However, this study was initiated prior to establishment of the impact of maternal haart on postnatal hiv-1 transmission, allowing us to compare breast milk cmv shedding and cmv transmission in haart - treated and untreated mothers . In our cohort, haart initiated prior to or during pregnancy successfully prevented in utero or postpartum hiv-1 transmission, further demonstrating the success of maternal antiretroviral prophylaxis . Interestingly, women on haart were more likely to have a low - birth - weight infant compared to untreated women (25% versus 2%, resp . ), consistent with previous reports linking antiretrovirals during pregnancy with low birth weight [3335]. However, this finding is in contrast to other recent data showing the lack of association between preterm birth and non - protease - inhibitor - containing maternal haart regimens [3638]. This finding could also be linked to the older age of women on therapy compared to those that were not . To determine the impact of maternal haart on infant perinatal cmv exposure, we focused on the relationship between haart and milk cmv shedding . Studies have associated perinatal cmv infection with increased morbidity and mortality, not only in hiv - infected infants but also in hiv - exposed, uninfected infants . These groups may have impaired fetal and infant growth attributable to perinatal cmv infection [15, 39]. Despite the well - known risk of cmv and hiv-1 transmission via breast milk, breastfeeding is advocated as the primary source of infant nutrition in hiv - infected women in the developing world due to infeasible alternatives and high infant mortality associated with formula feeding . Moreover, postnatal cmv transmission has been independently linked to breast milk cmv dna load [21, 22]. Our study revealed a weak association in the magnitude of milk hiv-1 and cmv load, such that, for every hiv-1 log10 rise in hiv-1 load, there was a 0.39 log10 increase in cmv load . Similarly demonstrated a correlation between cmv and hiv-1 loads in other mucosal compartments, which is clinically significant as the presence of cmv is associated with hiv-1 disease progression and mortality [30, 40]. The correlation between cmv and hiv-1 shedding is independent of cd4 + t - cell count, plasma hiv-1 load, and other confounders [23, 41]. Despite these associations of mucosal hiv-1 and cmv shedding, our analysis revealed only minimal impact of haart on breast milk cmv load, suggesting that expanded maternal use of antiretroviral therapy may have a limited impact on infant postnatal cmv exposure . Hiv - exposed, uninfected infants have a growth disadvantage compared to their unexposed counterparts, though the underlying pathophysiology is not understood . As congenital cmv infection is independently associated with in utero growth restriction, it is reasonable to consider whether postnatal cmv exposure or infection plays a role in the growth outcome of hiv - exposed, uninfected infants . We found a reduced length - for - age z - score (0.53) and weight - for - age z - score (0.40) for each log10 increase in milk cmv load at 6 months of age in hiv - exposed, uninfected infants . However, the cmv milk dna load remained only marginally negatively associated with the change in length - for - age z - score between one and six months . Thus, the negative association of milk cmv dna load with infant growth may only be significant in the early period of breastfeeding or only reflect the magnitude of the peripartum cmv exposure . Mixed feeding rates were high in this infant cohort before 6 months of life (14.9% prior to 5 months of age and 38.8% in the 6th month of life); thus, the growth rate over the first six months may have been impacted by this infant feeding pattern . Alternatively, high magnitude milk cmv shedding may be associated with maternal health status that is negatively impacting fetal and infant growth independently, as women that shed cmv at higher rates may be more immunocompromised and nutritionally deficient . The limitations of this hypothesis - generating pilot study include a relatively small maternal sample size and lack of infant urine or saliva for confirmatory diagnosis of cmv congenital and postnatal cmv acquisition . Despite its small sample size, this study is unique in its enrollment of both haart - treated and untreated mothers, as it enrolled prior to the establishment of maternal arv treatment during breastfeeding as highly preventative against postnatal hiv transmission, elevating the importance of our analysis of cmv and hiv-1 load in milk and infant growth in this cohort . With these limitations in mind, we have demonstrated that maternal haart does not have a large impact on breast milk cmv shedding, indicating that postnatal cmv exposure for hiv - exposed infants will continue at a similar level despite increasing maternal hiv-1 therapy / prophylaxis during breastfeeding . Moreover, the negative association between milk cmv load and postnatal growth in hiv - exposed infants in this small study is intriguing and should be further assessed in larger clinical studies, determining whether reduction of postnatal cmv exposure is important to improving the developmental outcome of hiv - exposed infants . Additional larger studies of the kinetics of maternal cmv shedding, postnatal transmission, and infant growth in the setting of maternal haart would now be important given the current standard of care . Further understanding of the interaction between cmv and hiv-1 may establish methods to reduce the morbidity and growth impairment of hiv - exposed infants and maximize the benefits of breastfeeding in low - resource countries.
|
The use of various imaging techniques in post - treatment assessment of head neck cancer is gradually on the rise, though clinical examinations at periodic intervals still remains the mainstay of follow - up . 18f fdg pet / ct is increasingly used in the post - treatment setting to diagnose residual / recurrent disease early so that appropriate treatment can be initiated . The effects of multimodality treatment such as surgery, radiation, and chemotherapy can distort normal anatomical landmarks induce inflammation and infection, which can mask disease . It is important to understand the anatomical and functional effects as well as complications produced by these treatment modalities in order to diagnose the resultant imaging pitfalls on fdg pet / ct . Knowledge of the common and unusual patterns of loco - regional recurrent disease and distant metastases on fdg pet / ct is also crucial in the post - treatment assessment of head - neck cancer patients . Radiation therapy alone or in combination with chemotherapy is often used to treat head - neck cancer patients . There are several tissue changes, which are a result of early reaction to radiation . These include thickening of the skin and platysma, stranding of the subcutaneous fat, pharyngeal and laryngeal wall thickening and increased vascularity of the major and minor salivary glands . Edema, inflammation, and increased vascularity in these structures lead to a pattern of fdg uptake which is low grade, diffuse, symmetrical, and restricted to the radiation field [figure 1]. These findings are seen during the course or within 3 months of radiation therapy and are often reversible . Several muscle groups within the radiation field also demonstrate an elevated fdg activity which can be potentially confused with neoplastic uptake . However, absence of a mass lesion on ct and reduction over time differentiate an inflammatory or physiological uptake from disease . Axial pet and fused pet / ct images show diffuse symmetrical fdg uptake in the tongue and oropharynx (arrows in the b and c) and in the floor of mouth (arrows in e and f). Diffuse low intensity fdg uptake is also seen in the neck muscles (arrowheads in b, c, e, f). Diffuse uptake is seen within a few days of radiation and can last up to 810 weeks timing of pet / ct after radiation therapy is an important and often debated clinical issue . Performing pet / ct as early as possible to detect recurrent disease seems logical as salvage treatment can be initiated early enough to derive the best possible clinical benefit . However, studies performed too early may lead to false positive as well as false negative results . Possible mechanism for false negative studies has been attributed to radiation induced vascular damage, which temporarily prevents concentration of radiotracer in the viable tumor cells . Imaging after a further few weeks delay in such cases may allow accumulation of tracer in the viable cells leading to a true positive pet result . Waiting too long to image might result in a loss of therapeutic window and also a more complicated surgical procedure due to fibrosis setting in . In order to strike a balance between misleading pet results when study is performed early and the clinical drawbacks of imaging late, a time interval of 12 weeks after completion of radiation therapy is generally recommended . Absence of fdg uptake at both the primary and nodal sites has a high negative predictive value in ruling out residual disease [figure 2]. Studies have shown that a negative pet scan can potentially defer planned neck dissections after chemo - radiation therapy . Pretreatment coronal fused pet / ct ct studies show fdg avid right sided hypopharyngeal mass (arrow in a and b). Study performed 8 weeks after completion of chemo - radiation therapy show complete metabolic and morphologic response (arrow in c and d) which rules out the possibility of residual disease curative resection involves complex surgical procedures, which result in loss of symmetry and anatomical landmarks . Various reconstructive techniques are used to close the surgical defects and restore function which produces characteristic well - recognizable imaging findings . Procedures such as glossectomy, marginal or segmental mandibulectomy, maxillectomy leave large surgical defects, which are closed by flaps and grafts . Pectoralis myocutaneous flap is an example of a composite flap which is often used for reconstruction of large surgical defects in the face, tongue, and skull base . They can be recognized by the well marginated soft tissue / muscle density at the site of the defect and is often accompanied by fat density [figure 3a, b] produced by a denervation atrophy and fatty replacement of the muscle . Normal symmetric pattern of tracer concentration is disturbed due to absence of physiological fdg uptake at the resected and reconstructed site [figure 3b and d]. In patients undergoing total laryngo - pharyngectomy, a neopharynx is reconstructed which can be recognized as a simple tubular structure sans the accompanying complex anatomy of hypopharynx and larynx [figure 4]. The neopharynx is often constructed by using a jejunal free flap, which is recognised recognized by the mesenteric fat along with its native vessels . Axial fused pet / ct images show myocutaneous flap with fat density used to reconstruct the defect after hemimandibulectomy (arrow in a) and mandibular symphysectomy (arrow in b) performed for buccal cancer absence of normal physiological fdg uptake in the reconstructed flap (arrowheads in a and b) tissue changes after surgery . Axial ct shows a reconstructed neopharynx after a laryngopharyngectomy seen as a tubular structure (arrow in a). Diffuse low grade physiological uptake is seen around the neopharynx (arrow head in b) during or after the course of treatment pitfalls in image interpretation can occur due to several factors . Asymmetric nature of physiological uptake, inflammations / infective processes, and treatment - related complications are some of the common causes of false positive results leading to imaging pitfalls . Sometimes, as a consequence of late effects of radiation therapy, there is a reduction of the normal physiological fdg uptake in structures such as the salivary glands and pharyngeal mucosal lining on the side of the therapy, leading to an appearance of asymmetric increased uptake in the normal tissues on the contralateral side [figure 5]. Coronal and axial (pet) and fused pet / ct images show reduction in physiological uptake (arrows in a, b, d) on the left side due to long term effects of radiation therapy . Note the relative increase in physiological uptake in the parotid and submandibular glands and the oropharynx on the contralateral normal side which can mimic pathology (arrowheads in a and d) absence of physiological fdg uptake in the region of the surgically removed part and persistence of physiological uptake in the normal contralateral side produces an appearance of asymmetric tracer concentration that can mimic disease [figure 6]. Occasionally, after partial resection of an organ such as the tongue, the remnant portion retains its physiological uptake, which appears focal in nature mimicking disease [figure 7]. After extensive jaw surgeries and reconstructive procedures, the altered mechanics of mastication can result in physiologically increased focal uptake in the adjacent masticator muscles that can be mistaken for disease [figure 8]. Axial ct shows changes of right hemiglossectomy with a myocutaneous flap containing fat (arrowhead in a). Axial pet and fusion pet / ct show physiological uptake in the remnant tongue which is focal and asymmetric in nature (arrows in b and c) and can potentially mimic disease pitfalls of due asymmetric physiological uptake . Coronal pet and fusion pet / ct show physiological uptake along the right side of the oral cavity and the floor of mouth which is asymmetric in nature (arrows in b and c) and can potentially mimic disease . Note the absence of normal physiological uptake on the left side (arrowheads in b and c). This pattern was seen more than a year after treatment pitfalls of due asymmetric physiological uptake . Axial pet and fusion pet / ct show focal asymmetric uptake in the left masseter which is physiological in nature (arrows in a and b) and is produced due to altered mechanics of mastication secondary to jaw surgery physiological uptake in the tongue tip and oral cavity arising due to close approximation of tongue and palate, buccal and gingival mucosae can be better resolved by performing certain maneuvers like puffing the cheek and placing a gauzegauze that can help mouth opening . Surgical complications occur early and include serous collections, infections, abscess and fistula formation, flap necrosis . Benign serous collections are self - limiting and should be distinguished from infected abscesses that might need a drainage procedure . Benign serous collections also called seromas usually do not show any fdg avidity unless they get infected . On fdg pet / ct abscesses show a rim of tracer uptake in the periphery with a photopenic center which corresponds to a hypodense collection on ct with air pockets seen occasionally . Linear fdg uptake is seen along the fistulous communications associated with abscesses [figure 9]. These complications occur at the site of surgical resection and reconstructed flaps in the head neck region . Rarely, one can come across infections / inflammations at the site of the donor flap in the chest or the abdominal wall and focal tracer uptake in this region can potentially mimic metastatic disease [figure 10]. Axial fused pet / ct shows an intense focus of fdg uptake in the infratemporal fossa mimicking disease recurrence (arrow in b). Corresponding contrast ct image shows a hypodense collection with an air pocket (arrow in a) suggestive of an abscess . Note the linear fdg uptake along the enhancing fistulous tract opening on the skin surface . (arrowheads in a and b) pitfalls due to treatment related complications (surgery). Coronal mip image shows an intense focus of fdg uptake in the left hemithorax (arrow in a) which appears to be metastatic disease . Fused pet / ct shows focal uptake in the anterior chest wall (arrow in c) which was the site for the pmmc flap . Arrowhead in b) radiation toxicity can lead to intense inflammatory changes in the mucosal structures and the soft tissues of the neck that can cause intense fdg accumulation [figure 11]. Coronal pet (b) and fused pet / ct (c) shows intense fdg uptake in the naso, oro, and hypopharyngeal structures and the soft tissue of the neck bilaterally, with associated ill - defined fat stranding (a arrowhead). Such intense non - infective inflammation is seen on rare occasions after radiation and should not be confused with recurrence radiation induced necrosis can occur in bones (osteoradionecrosis [orn]), cartilage (chondronecrosis / laryngeal necrosis) and even in irradiated soft tissues . Osteoradionecrosis (orn) occurs due to devitalization of irradiated bone which gets exposed through the skin and mucosa and remains without healing for at least 3 months . The risk of orn is greatest at 6 - 12 months after radiation therapy and it is uncommon to see orn at radiation doses below 60 gy . Lytic destruction, cortical erosion and fragmentation of the mandible with associated fistulae and soft tissue thickening are some of the features seen on ct scan [figure 12]. Increased fdg avidity is seen in areas affected by orn [figure 12], but its specificity in differentiating viable tumor from radionecrosis is not reported to be very high . Orn can occur at rare sites such as the hyoid bone and increased fdg avidity may lead to the erroneous diagnosis of viable disease unless the physician is aware of its occurrence [figure 13]. Characteristics osseous changes of orn and absence of associated soft tissue lesion make the diagnosis of radiation necrosis more likely axial ct in soft tissue (a) and bone window settings (b) show soft tissue thickening, erosion and fragmentation of the mandible (arrows). Coronal fused pet / ct shows intense fdg uptake restricted to right hemimandible (arrowhead in c and d). Findings suggest the diagnosis of orn pitfalls due to treatment related complications - osteoradionecrosis [orn]. Axial fused pet / ct shows intense fdg uptake along the hyoid bone (arrowhead in a and b). Axial ct shows subtle erosion of the hyoid bone along with a small collection and air pockets (arrows in c and d). Sometimes, as a consequence of late effects of radiation therapy, there is a reduction of the normal physiological fdg uptake in structures such as the salivary glands and pharyngeal mucosal lining on the side of the therapy, leading to an appearance of asymmetric increased uptake in the normal tissues on the contralateral side [figure 5]. Coronal and axial (pet) and fused pet / ct images show reduction in physiological uptake (arrows in a, b, d) on the left side due to long term effects of radiation therapy . Note the relative increase in physiological uptake in the parotid and submandibular glands and the oropharynx on the contralateral normal side which can mimic pathology (arrowheads in a and d) absence of physiological fdg uptake in the region of the surgically removed part and persistence of physiological uptake in the normal contralateral side produces an appearance of asymmetric tracer concentration that can mimic disease [figure 6]. Occasionally, after partial resection of an organ such as the tongue, the remnant portion retains its physiological uptake, which appears focal in nature mimicking disease [figure 7]. After extensive jaw surgeries and reconstructive procedures, the altered mechanics of mastication can result in physiologically increased focal uptake in the adjacent masticator muscles that can be mistaken for disease [figure 8]. Axial ct shows changes of right hemiglossectomy with a myocutaneous flap containing fat (arrowhead in a). Axial pet and fusion pet / ct show physiological uptake in the remnant tongue which is focal and asymmetric in nature (arrows in b and c) and can potentially mimic disease pitfalls of due asymmetric physiological uptake . Coronal pet and fusion pet / ct show physiological uptake along the right side of the oral cavity and the floor of mouth which is asymmetric in nature (arrows in b and c) and can potentially mimic disease . Note the absence of normal physiological uptake on the left side (arrowheads in b and c). This pattern was seen more than a year after treatment pitfalls of due asymmetric physiological uptake . Axial pet and fusion pet / ct show focal asymmetric uptake in the left masseter which is physiological in nature (arrows in a and b) and is produced due to altered mechanics of mastication secondary to jaw surgery physiological uptake in the tongue tip and oral cavity arising due to close approximation of tongue and palate, buccal and gingival mucosae can be better resolved by performing certain maneuvers like puffing the cheek and placing a gauzegauze that can help mouth opening . Surgical complications occur early and include serous collections, infections, abscess and fistula formation, flap necrosis . Benign serous collections are self - limiting and should be distinguished from infected abscesses that might need a drainage procedure . Benign serous collections also called seromas usually do not show any fdg avidity unless they get infected . On fdg pet / ct abscesses show a rim of tracer uptake in the periphery with a photopenic center which corresponds to a hypodense collection on ct with air pockets seen occasionally . Linear fdg uptake is seen along the fistulous communications associated with abscesses [figure 9]. These complications occur at the site of surgical resection and reconstructed flaps in the head neck region . Rarely, one can come across infections / inflammations at the site of the donor flap in the chest or the abdominal wall and focal tracer uptake in this region can potentially mimic metastatic disease [figure 10]. Axial fused pet / ct shows an intense focus of fdg uptake in the infratemporal fossa mimicking disease recurrence (arrow in b). Corresponding contrast ct image shows a hypodense collection with an air pocket (arrow in a) suggestive of an abscess . Note the linear fdg uptake along the enhancing fistulous tract opening on the skin surface . (arrowheads in a and b) pitfalls due to treatment related complications (surgery). Coronal mip image shows an intense focus of fdg uptake in the left hemithorax (arrow in a) which appears to be metastatic disease . Fused pet / ct shows focal uptake in the anterior chest wall (arrow in c) which was the site for the pmmc flap . Arrowhead in b) radiation toxicity can lead to intense inflammatory changes in the mucosal structures and the soft tissues of the neck that can cause intense fdg accumulation [figure 11]. Coronal pet (b) and fused pet / ct (c) shows intense fdg uptake in the naso, oro, and hypopharyngeal structures and the soft tissue of the neck bilaterally, with associated ill - defined fat stranding (a arrowhead). Such intense non - infective inflammation is seen on rare occasions after radiation and should not be confused with recurrence radiation induced necrosis can occur in bones (osteoradionecrosis [orn]), cartilage (chondronecrosis / laryngeal necrosis) and even in irradiated soft tissues . Osteoradionecrosis (orn) occurs due to devitalization of irradiated bone which gets exposed through the skin and mucosa and remains without healing for at least 3 months . The risk of orn is greatest at 6 - 12 months after radiation therapy and it is uncommon to see orn at radiation doses below 60 gy . Lytic destruction, cortical erosion and fragmentation of the mandible with associated fistulae and soft tissue thickening are some of the features seen on ct scan [figure 12]. Increased fdg avidity is seen in areas affected by orn [figure 12], but its specificity in differentiating viable tumor from radionecrosis is not reported to be very high . Orn can occur at rare sites such as the hyoid bone and increased fdg avidity may lead to the erroneous diagnosis of viable disease unless the physician is aware of its occurrence [figure 13]. Characteristics osseous changes of orn and absence of associated soft tissue lesion make the diagnosis of radiation necrosis more likely (b) show soft tissue thickening, erosion and fragmentation of the mandible (arrows). Coronal fused pet / ct shows intense fdg uptake restricted to right hemimandible (arrowhead in c and d). Findings suggest the diagnosis of orn pitfalls due to treatment related complications - osteoradionecrosis [orn]. Axial fused pet / ct shows intense fdg uptake along the hyoid bone (arrowhead in a and b). Axial ct shows subtle erosion of the hyoid bone along with a small collection and air pockets (arrows in c and d). Fdg pet / ct has been used to detect recurrent disease in the head and neck cancer patients . It can confirm the site of clinically suspected local recurrence and determine its true extent . Recurrences at the site of the treated primary disease, subtle disease in the reconstructed flaps and nodal / soft tissue recurrence in the irradiated neck, the clinical assessment of which is difficult can be seen on pet / ct as enhancing lesions with intense fdg avidity [figures 14 and 15]. At the same time, it can pick up distant failures with a good accuracy and thus is performed before salvage surgery can potentially change the intended treatment plan . In addition to common sites of distant metastases like the lungs and bones, pet / ct has the potential to unmask second primaries as well as certain unusual and rare metastatic sites such as the subcutaneous tissue, muscles, and feeding stomies [figures 16 and 17]. Recurrent disease . Operated case of buccal cancer . Coronal mip shows intense foci of fdg uptake on the left side of the face and neck (arrowhead and arrows in a). Axial fused pet / ct shows fdg avid recurrent nodule in the pmmc flap (arrowhead in b and c) and a metastatic cervical lymph node (arrow in d and e) recurrent disease . Sagittal mip shows foci of fdg uptake in the face (arrows in a). Axial fused pet / ct (arrowhead in b and c) shows subtle uptake at the cut margin of the mandible due to local recurrence as well as metastatic deposit in the pterygopalatine fossa (arrows in d and e) distant metastases . Fusion pet / ct images show metastatic deposits in spleen (b), lungs (c), liver (d), bone (e), subcutaneous region (f) and muscle (g) distant metastases (unusual sites). Operated case of base tongue cancer with feeding gastrostomy . Sagittal pet and pet / ct images show a fdg avid mass in the anterior abdominal wall at the site of the gastrostomy (arrows in a - b) s / o metastatic deposit . Local recurrence in the tongue base fdg pet / ct is a useful modality in the post - treatment setting of head and neck cancers . Knowledge of certain characteristic imaging appearances and a few commonly encountered treatment related complications is important to avoid pitfalls in post - treatment imaging . Understanding the role of fdg pet / ct in detecting local recurrence and distant metastases plays a crucial role in deciding salvage treatment.
|
A 29-year - old male develops severe pancreatitis, presumably as a result of heavy alcohol intake . He is admitted to the hospital ward for management but becomes hypoxic over the first 24 hours, requiring intubation and mechanical ventilation . The patient is admitted to the intensive care unit and, in the course of investigation, he has an abdominal computed tomography scan that shows an inflamed pancreas with some necrotic areas . Although there are no obvious signs of infection, you wonder whether antibiotics are useful in the patient's management . Graham ramsay and paul breedveld antibiotic prophylaxis in necrotizing pancreatitis is attractive as 80% of all deaths from severe pancreatitis are due to infected necrosis, and the time scale for the occurrence of infection makes prophylaxis feasible . Early trials of antibiotic prophylaxis in pancreatitis were negative, probably due to inappropriate antibiotic choice and also due to failure to focus on necrotizing pancreatitis . With more appropriate antibiotics, however, there are now a number of published randomized clinical trials on prophylactic antibiotic use in the management of acute necrotizing pancreatitis [1 - 4]. These include only randomized clinical trials that make specific mention of acute pancreatitis, of incidence of pancreatic infection, of related sepsis and mortality, and that the antibiotics used had a minimal inhibitory concentration in the pancreas . All four randomized clinical trials complied with at least one of the criteria in the guidelines for assessment of the quality of reports of randomized clinical trials of jadad and colleagues . Pederzoli and colleagues included 74 patients, used imipenem and found a significant (p <0.01) reduction of septic complications, such as infected pancreatic necrosis, peripancreatic abscesses or infected pseudocysts . There was no significant reduction in multiorgan failure, in the need to operate or in mortality . Sainio and colleagues included 60 patients, used cefuroxime and found a significant reduction in the number of surgical interventions (p = 0.012) and in mortality (p = 0.028). There was no significant reduction in the incidence of infected pancreatic necrosis or pancreatic abscesses . Delcenserie and colleagues included 23 patients, used a combination of ceftazidime, amikacin and metronidazole, and found a significant reduction of septic complications (p <0.03). Schwarz and colleagues included 26 patients, used a combination of ofloxacin and metronidazole, and found a better survival (0 versus 2 deaths; mortality rate, 0% versus 15%), but no difference in the rate of infection of pancreatic necrosis . Pooling of the data from these 183 patients by bosscha and colleagues in a meta - analysis resulted in a group of 95 patients treated with prophylactic antibiotics and 88 patients without . These pooled data showed a significant risk reduction with prophylactic antibiotic for pancreas - related infection (-14%; p = 0.04), for sepsis (-25%; p = 0.0002), and for death (-13%; p = 0.007). In another meta - analysis, golub and they included a study by luiten and colleagues, which used selective decontamination of the digestive tract . Selective decontamination is attractive as it may allow the use of prophylaxis without the risk of inducing superinfections through the use of long - term broad - spectrum antibiotics . These data support our opinion that patients who develop necrosis due to acute pancreatitis benefit from prophylactic antibiotic use . It significantly reduces the number of infections, reduces sepsis and reduces mortality related to acute pancreatitis . Lorne h blackbourne and stephen m cohn limiting prophylactic antibiotic use in severe pancreatitis minimizes the development of resistance and superinfections in vulnerable hosts, and also avoids unnecessary costs . Nearly three decades ago in small, prospective, randomized trials (totaling 192 patients), the use of antibiotics for routine pancreatitis was shown to be of no apparent benefit [9 - 11]. At this juncture there is no definitive, level one, data supporting the use of intravenous antibiotics in the treatment of patients with severe pancreatitis, even in the setting of pancreatic necrosis . The few prospective studies that exist investigating antibiotic use in severe pancreatitis have been nonblinded trials with small patient populations . Pederzoli and colleagues, in the most often quoted trial to support the routine use of antibiotics in pancreatitis, prospectively randomized 74 patients with severe necrotizing pancreatitis in a nonblinded fashion (secondary to either alcoholism or gallstones) to receive imipenem - cilastin or no antibiotics . They found no significant differences in organ dysfunction or mortality (antibiotics, 29% and 7% versus no antibiotics, 39% and 12%; p = not significant) or mortality (antibiotics, 7% versus no antibiotics, 12%; p = not significant). The frequency of operation for debridement of pancreatic necrosis was also unaffected, but pederzoli and colleagues did note that there was a decrease in the number of positive pancreatic cultures (percutaneously and intraoperatively). Sainio and colleagues randomized 60 patients with alcoholic necrotizing pancreatitis to receive cefuroxime versus no antibiotic treatment in a nonblinded trial . They reported a significant decrease in mortality in the patient group receiving antibiotics when compared with those not receiving antibiotics (3% versus 23%, p = 0.03). This study has been criticized because of its small size and because of the large percentage of patients (50%) who apparently succumbed from infections caused by staphylococcus epidermidis (which were often associated with catheter sepsis). Lutien and colleagues more recently used intravenous and enteral antibiotics (including amphotericin) to achieve decontamination of the gastrointestinal tract for the purpose of possibly decreasing bacterial inoculation of the necrotic pancreatic tissue via translocation . They reported a nonsignificant decrease in mortality (22% gut decontamination versus 35% controls, p = 0.19) in patients undergoing the antibiotic regimen . Other large trials utilizing gastrointestinal decontamination in groups of critically ill patients have failed to demonstrate a decrease in mortality or intensive care days . This extensive protocol, however, requires significant resource utilization and costs, and also carries a potential risk of the development of bacterial resistance . While there is inconclusive data supporting the use of prophylactic antibiotics in the setting of severe pancreatitis, isenmann and colleagues have shown a significant increase in candida infections in patients with pancreatic necrosis with prolonged exposure to antibiotics . Among 92 patients with infected pancreatic necrosis, 22 had candida infections and this subgroup had a major increase in mortality (64%) compared with those patients without candida (19%, p <0.01). Certainly, critically ill patients developing superinfections tend to be those with more severe disease, with longer antibiotic courses and with longer hospital stays . We need to identify the subset of patients who are most likely to benefit from prophylactic antibiotics in the setting of severe pancreatitis . An adequately powered, randomized, double - blind, multicenter trial involving a suitable antibiotic regimen compared with placebo in a homogeneous group with severe pancreatitis is required . The primary endpoints should be clinically relevant, such as defined organ dysfunction, length of intensive care unit stay, and 30-day and 60-day mortality . Until such a study is completed, we cannot recommend routine prophylactic antibiotics in the setting of severe pancreatitis . Graham ramsay and paul breedveld we agree with blackbourne and cohn that all systemic antibiotic use carries a risk of increasing selection pressure for resistance, and that antibiotic use should be minimized where appropriate . We also agree that the early trials they cite were inconclusive . As we said, the discussion should focus on the relative benefit in terms of infection, morbidity and mortality against the risk of increased resistance to antimicrobials, based on the current literature . While we agree that confirmatory studies are desirable (they are in progress) the study of luiten and colleagues on selective decontamination of the digestive tract for prophylaxis deserves special attention . It suggests we can achieve the benefits of prophylaxis without the risk of increasing resistance, through the use of systemic antibiotics . Lorne h blackbourne and stephen m cohn " meta - analysis is to statistical data analysis what metaphysics is to theoretical physics! " Utilizing meta - analyses of tiny, inconclusive and, in some instances, flawed clinical trials to justify the use of a modality (broad - spectrum antibiotics) with known adverse impact (microbial resistance, superinfection, drug toxicity and cost) appears unfounded . We believe that a multicenter, double - blind, prospective, randomized trial is warranted prior to the use of antibiotics in the setting of necrotizing pancreatitis . We presently use antibiotics in this population only when computed tomography - guided aspiration biopsy of pancreatic necrosis reveals bacterial pathogens.
|
Both gonadal and adrenal testosterone can be converted into estrogens (c18 steroids) by the p 450 aromatase, encoded by cyp 19, which is present in many peripheral tissues, including bone . Bone cells express androgen receptor (ar) as well as estrogen receptor- (er) and (er). Therefore, androgen action on male bone may be explained by ar activation or, alternatively, activation of er and (figure 1). The importance of estrogen receptor alpha activation as well as of aromatization of androgens into estrogens was highlighted by a number of cases of men suffering from an inactivating mutation in the estrogen receptor alpha or in the aromatase enzyme [24]. Table 1 shows the age of diagnosis, bone phenotype, and effect of estrogen treatment (if appropriate) in these men . All these men had low bone mass as measured by dexa, high bone turnover, and open epiphyses and the distal radius despite normal to elevated testosterone concentrations . Estrogen treatment resulted in closure of the epiphyses, increased bone density, and reduced bone turnover . One patient diagnosed at much younger age was followed by peripheral computerized tomography during estrogen treatment over a period of three years . During estrogen treatment, there was no effect on trabecular bone density suggesting that the main action of estrogen on male growing bone is on the cortical and not the cancellous compartment . However, it has been suggested that trabecular bone may require higher levels for its regulation . For cortical bone it is clear, therefore, that estrogen is important for epiphyseal closure as well as periosteal bone formation and hence cortical bone mineral acquisition during male growth . Observations in a single patient suffering from an inactivating mutation in the androgen receptor suggest that estrogen may also increase mineral apposition at the endocortical surface . During adult life, estrogens mediate endosteal bone apposition and volumetric bone density, without marked influence on periosteal bone apposition . The finding of a bone size intermediate between male and female supports a role for testosterone as an essential mediator for periosteal bone expansion, but not as the sole stimulus for bone expansion during growth, supporting the concept that estrogen is also involved in bone maintenance after growth in men . Table 2 shows cohort studies in men in which both estradiol and testosterone were measured, with either tandem mass spectrometry (lc - ms - ms) or with immunoassay, and in relation to bone loss and fractures [812]. Most but not all (dubbo osteoporosis epidemiology study) of these studies showed an association between estradiol and fractures in elderly men . While serum estradiol and testosterone are inversely related to fracture risk in older men, serum - sex - hormone binding globulin (shbg) shows a positive relationship . Low serum estradiol, low serum testosterone, and high shbg predict clinical vertebral fractures, nonvertebral osteoporosis fractures, and hip fractures . For estradiol, a threshold effect has been documented, below which estradiol is related to fracture risk . Low estradiol induces bone resorption independently of testosterone, presumably reflecting a net increase in endocortical bone resorption [15, 16]. The effect of estrogen on bone resorption was illustrated by administration of an aromatase inhibitor to men receiving a gnrh agonist in combination with testosterone, resulting in increased bone resorption markers (deoxypyridinoline, n - telopeptide of type i collagen). Bone resorption markers increased significantly in the absence of both testosterone and estrogen and were unchanged in men receiving both hormones . Estrogen prevented the increase in the bone resorption markers, whereas testosterone had no significant effect . By contrast, serum osteocalcin, a bone formation marker, decreased in the absence of both hormones, and both estrogen and testosterone maintained osteocalcin levels . Taken together, according to this one study in men, estrogen may be important in regulating bone resorption, whereas estrogen and testosterone may both be important in maintaining bone formation . Another study in younger men, however, concluded that both androgens and estrogens play independent and fundamental roles in regulating bone resorption . In this study, the first group received only a gnrh analog, the second group a gnrh analog plus testosterone, and the third group a gnrh analog plus an aromatase inhibitor . Bone resorption markers increased in the group who received a gnrh analog alone and the group who received a gnrh analog plus an aromatase inhibitor . Overall, these findings suggest that both estrogens and androgens play independent and fundamental roles in regulating bone resorption in men . This study also suggests that androgens may play an important role in the regulation of bone formation in men . Genetic polymorphism in the cyp 19 or in esr genes, encoding for aromatase and estrogen receptor, respectively, may further mediate the risk for bone loss induced by low estradiol in men . In humans, in contrast to rodents, circulating testosterone and estradiol are bound to sex - hormone - binding globulin, with testosterone more tightly bound than estradiol . The role of free (not bound to any protein) or bioavailable (not bound to shbg) versus total testosterone remains controversial . Shbg, which increases with age, has been associated with bone loss in elderly men . However, other studies in younger men have shown a positive rather than a negative association between peak bone mass and shbg [2224]. However, the exact role and contribution of shbg in bone gain and loss in men remains to be clarified . Compared to estradiol levels (see table 1), testosterone concentrations are less consistently associated with bone loss / fractures in men, except for very low levels in hypogonadal men (especially men following chemical and surgical castration) who show a significant increase in bone turnover, bone loss, and fracture risk . In these men, testosterone inhibits bone resorption and maintains bone mass whereas its effect in elderly men with borderline low testosterone or low normal testosterone concentrations is more controversial . With selective estrogen receptor modulators (serm's), receiving a gnrh agonist for prostate cancer, raloxifene increased bone mineral density of the hip and, to a lesser degree, the spine . In this study, raloxifene reduced serum concentrations of aminoterminal propeptide of type i collagen, a marker of bone formation and also tended to reduce urinary excretion of deoxypyridinoline, a marker of bone resorption . Short - term administration (12 weeks) of an aromatase inhibitor in elderly men was found to increase testosterone and reduce estrogen levels but with hardly any effect on bone metabolism . This lack of an effect may be due to the concomitant increase in testosterone production, the relative modest effect on estradiol production, or a combination of both factors . However when the aromatase inhibitor was administered for a longer term (12 months) there was a decrease in bone mineral density . Therefore, aromatase inhibition does not improve skeletal health in aging men with low or normal testosterone levels . With selective androgen receptor modulators (sarms), capable of selectively stimulating the androgen receptor in bone and muscle but not in prostate, to further investigate the relative importance of androgen receptor - mediated testosterone actions compared to estradiol effects, an increasing number of animal experiments have been published, in particular in the orchidectomized rodent, a well - characterized model for hypogonadal osteoporosis . Following orchidectomy, bone resorption increases at cancellous and endocortical surfaces and results in reduced cancellous and cortical bone volume . Periosteal bone formation during growth is decreased in orchidectomized rodents as well and further lowers bone strength . A number of animal experiments have investigated the bone phenotypic changes induced by androgens, nonaromatisable androgens and estrogens in orchidectomized rodents (mice, rat and growing / non - growing). Table 3 shows the relative effects of androgens [3234], non - aromatisable androgens [3236], estrogens [33, 36, 37] on bone turnover, bone density, and periosteal bone formation in male orchidectomized rats . From these studies, it is clear that non - aromatisable androgens can also stimulate periosteal bone formation and inhibit cancellous bone, although less than testosterone, and that estradiol exerts potent effects on different bone surfaces . However, what is not always clear is to what extent the effects of these hormones are pharmacological or physiological and, if physiological, to what extent the effects can be extrapolated to the human condition, in a context of higher estradiol concentrations than in mice . Other animal experiments have investigated the bone phenotype of transgenic male animals with ko of ar (arko), er alpha (erko), beta (berko), or both (derko), and this in combination with orchidectomy with or without replacement with androgens and estrogens . The latter is needed because the arko and erko models may have an impact on respective concentrations of androgens / estrogens [26, 39] (table 4). Overall, available evidence from these studies suggests that, er activation, not ar activation, is involved in the regulation of male longitudinal appendicular skeletal growth in mice . The ar, not er, is required for the maintenance of cancellous bone mass . Ar and er, but not er, can independently mediate the cancellous bone - sparing effects of sex steroids in male mice . These studies have greatly increased our understanding of the role of estrogen receptor and androgen receptors in male skeletal growth and maintenance in male rodents . Both ar and er are involved in male skeletal growth and maintenance, supporting a dual mode of action for testosterone, either directly on the ar or indirectly on the er through aromatization . In summary, both ar and er is also involved in longitudinal bone formation but its action on periosteal surface as well as growth plate may be mediated indirectly by the gh - igf - i axis . On trabecular bone surfaces, ar activation may be most critical, at least in mice, as elegantly illustrated with a double ko ar - er in comparison with either ar or er disruption alone . Combined ar and er inactivation further reduced cortical bone and muscle mass and ar activation was found to be solely responsible for the development and maintenance of male trabecular bone mass . However, both ar and er activation appeared to be essential to optimize the acquisition of cortical bone and muscle mass . Er, on the other hand, seems not to be relevant for bone growth and maintenance in male mice . To further document the target cell of ar and er in mice, the ar was recently selectively knockedout in bone cells by cre - lox technology . In two studies (table 5), the osteoblast was targeted which resulted in a trabecular and no cortical phenotype, suggesting that the osteoblast is the target cell for androgen - receptor - mediated maintenance of trabecular bone volume and coordination of bone matrix synthesis and mineralization [43, 44]. This assumption was further supported by a coculture experiment were the in vitro osteoclastogenesis was assessed using osteoclast precursor cells from bone marrow and calvaria osteoblasts from male wt and arko mice . When the ar was absent in osteoclast precursor cells, osteoclastogenesis was unaffected . Osteoclastogenesis, in response to 1,25(oh)2d3 after activation by rankl and m - csf (macrophage - colony stimulating factor), also seemed unaffected in ar - deficient osteoclasts . However, ar inactivation in osteoblasts potentiated osteoblastic functions that promote osteoclastogenesis in the presence of inducers . Rankl turned out to be upregulated in these ar - deficient osteoblasts, suggesting that the suppressive function of ar on rankl gene expression mediates the protective effects of androgens on bone remodelling through inhibition of bone resorption . It would seem therefore that intact ar function is required for the suppressive effects of androgens on the osteoclastogenesis supporting activity of osteoblasts, but not osteoclasts . In conclusion, both human and animal experiments suggest that testosterone has a dual mode of action on different bone surfaces.
|
All genetic variations originate from mutations, which are defined as changes in dna sequence . Mutations can affect either germline cells (the cells which produce gametes) or somatic cells (all the cells other than germline cells). In human genetics, the term mutation has often been reserved for dna sequence changes that cause genetic diseases and are consequently relatively rare . Dna sequence variants, which are more common in populations (i.e., such sequence variants in which two or more alleles at locus demonstrate frequencies> 1%), are said to be polymorphic (having many forms). Such loci (plural of locus) are termed polymorphisms, although nowadays, alleles with frequency <1% are often called polymorphisms as well . Many genetic and epigenetic alterations are supposed to contribute directly or indirectly to bladder tumor induction [3, 4]. Attempts are undertaken to classify tumors with regards to the molecular characteristics of changes in neoplastic cells in order to be able to identify the relationship between the type of these changes and clinical characteristics . Every type of cancer has biological subsets that differ in clinical behavior and response to treatment . Personalized cancer medicine is defined as treatment based on the molecular characteristics of a tumor from individual patient . Nowadays this branch of medicine has great potential in the therapy of many types of cancer . Somatic mutations of p53, rb, fgfr3, cdkn2a, and ras genes belong to the group of mutations that most frequently accompany the occurrence of urinary bladder carcinoma [3, 4, 5]. Some of the constitutive changes of the genes (germline), e.g., a72p polymorphism of p53 gene, were also analyzed with regards to the higher risk of neoplasm development . There are also reports, indicating correlations between constitutive mutations of cdkn2a gene and breast cancer, melanoma cancer, nervous system tumours and squamous cell carcinoma of the head / neck region [7, 8, 9], but rather little is known either about the frequency of its occurrence or of its significance in urinary bladder carcinoma . Most frequently described polymorphisms of cdkn2a gene are the substitution of alanine to threonine in the second exon (a148t- rs 3731249) and the two, which occur in the 3 untranslated region of cdkn2a: nt 500c> g and nt540c> t . The cdkn2a gene (omim 600160), localized at chromosome 9p21 encodes p16i cyclin - dependent kinase inhibitor and p14ar activator of p53 . Both gene products have an independent first exon (1-alpha exon and 1-beta exon, respectively), but share exons 2 and 3 and are translated in different reading frames . The genes are involved in the negative control of cell proliferation; p16 produces a g1 cell - cycle arrest by inhibiting the phosphorylation process of retinoblastoma protein (rb), and p14 acts both at g1/s phases in a p53-dependent manner via binding and inhibiting mdm2 protein . There are three major mechanisms at the base of genetic inactivation of cdkn2a gene, including deletions of both alleles, deletion of one allele and mutation of the other allele or deletion or mutation of the first allele and hypermethylation of the second allele . Unlike other suppressor genes, which most often undergo inactivation in result of point mutations, deletions are the most frequent mechanisms by which cdkn2a gene is inactivated . Regarding urinary bladder carcinoma, homozygotic deletions at 9p21 locus (cdkn2a) are found in approximately 20 - 30% of cases, while the loss of heterozygosity may be observed even in 60% of cases [3, 8]. The aim of our study was to characterize a148 t polymorphism of cdkn2a gene in bladder cancer patients . Dna from 84 subjects was analyzed, all of them patients of the department of urology, the j.p . Urologists m. rozniecki and partners department of urology in ask with diagnosed tumor of the urinary bladder (130 men and 26 women, 32 - 86 year old, the mean age: 62.3 years). A detailed medical history was obtained from all the enrolled participants, taking into account the effect of risk factors on neoplastic disease progression . All the identified neoplasms were assessed by two histopathologists for staging and grading according to who histopathological classification . The mean observation period per individual patient was 32 months (16 - 59). Clinical data of the bladder cancer group (the dark blue color designates the cases in which a148 t polymorphism of cdkn2a gene was found) d - death, dacc - death in accident, dint - death of intrinsic cause division of studied material with regards to tumor staging and grading blood samples (5 ml), collected onto edta3k (potassium versenate), were used as study material . A roche magna pure compact automatic workstation was used to isolate dna from 1 ml of anticoagulated blood (out of all samples) by means of a nucleic acid isolation kit i - large volume (cat . No . The volume and purity of obtained dna were determined by absorbance (a) measurements directly in aqueous solutions . The measurements were performed by an nd-1000 spectrophotometer in uv light (measurement of uv adsorbed by dna bases). Nucleic acid concentration was determined by comparing measurement results for blind trial (distilled water) and absorbance levels of studied sample at wavelength of 260 nm (this wave length corresponds to the maximal absorption for nucleic acids). Absorbance at = 280 nm is characteristic for proteins and reflects protein- derived contaminations . 100 ng), 2.5 l of 10 reaction buffer (700 mm tris - hcl, ph 8.3, 166 mm (nh4)2so4, 25 mm mgcl2), 0.5 l of 2,5 mm dntps (takara), 1 l of each primer pair (5 pmol/ l), 1.25 u of taq dna polymerase (novazym), and 18.75 l of distilled water in a total volume of 25 l were used . The used primers included: 5cccaagcttgcatggagccggcggcg3 and 5cgggatccctttcaatcggggatgt3. The applied pcr procedure: preliminary denaturation for 10 minutes at 95c, followed by 40 cycles of 30-second denaturation in 95c, 30-second annealing in 58c, and 30-second elongation in 72c . Pcr products of leukocytes (10 l) were electrophoresed on 2.0% agarose gel and stained with ethidium bromide . The gels were evaluated by visual inspection in uv light . The search for a148 t polymorphism in exon 2 of cdkn2a gene was carried out by the msscp technique in two different temperature profiles (the first one at 23c, for 120 minutes and the second one at 37c for 40 minutes, 23c for 25 minutes, and at 15c for 25 minutes) and by the sequencing technique . Pcr products were sequenced to rule out / confirm mutation or polymorphism, identified during electrophoresis (genomed sp . The chi - square () test, g test is used to assess the significance of differences in contingency tables . Both tests lead to the same conclusions when each cell of the contingency table has a sufficiently high number (o> 10) of observations . However, while the chi - square test cannot be used for lower numbers in any cell, no such restrictions occur for g test . A null hypothesis of no effect cannot be rejected when g statistics is higher than the critical value g0,05 = 3.841 for 1 degree of freedom (table 22). Blood samples (5 ml), collected onto edta3k (potassium versenate), were used as study material . A roche magna pure compact automatic workstation was used to isolate dna from 1 ml of anticoagulated blood (out of all samples) by means of a nucleic acid isolation kit i - large volume (cat . The volume and purity of obtained dna were determined by absorbance (a) measurements directly in aqueous solutions . The measurements were performed by an nd-1000 spectrophotometer in uv light (measurement of uv adsorbed by dna bases). Nucleic acid concentration was determined by comparing measurement results for blind trial (distilled water) and absorbance levels of studied sample at wavelength of 260 nm (this wave length corresponds to the maximal absorption for nucleic acids). Absorbance at = 280 nm is characteristic for proteins and reflects protein- derived contaminations . 100 ng), 2.5 l of 10 reaction buffer (700 mm tris - hcl, ph 8.3, 166 mm (nh4)2so4, 25 mm mgcl2), 0.5 l of 2,5 mm dntps (takara), 1 l of each primer pair (5 pmol/ l), 1.25 u of taq dna polymerase (novazym), and 18.75 l of distilled water in a total volume of 25 l were used . The used primers included: 5cccaagcttgcatggagccggcggcg3 and 5cgggatccctttcaatcggggatgt3. The applied pcr procedure: preliminary denaturation for 10 minutes at 95c, followed by 40 cycles of 30-second denaturation in 95c, 30-second annealing in 58c, and 30-second elongation in 72c . Pcr products of leukocytes (10 l) were electrophoresed on 2.0% agarose gel and stained with ethidium bromide . The search for a148 t polymorphism in exon 2 of cdkn2a gene was carried out by the msscp technique in two different temperature profiles (the first one at 23c, for 120 minutes and the second one at 37c for 40 minutes, 23c for 25 minutes, and at 15c for 25 minutes) and by the sequencing technique . Pcr products were sequenced to rule out / confirm mutation or polymorphism, identified during electrophoresis (genomed sp . The g test, based on the likelihood ratio, was applied . Like the chi - square () test, g test is used to assess the significance of differences in contingency tables . Both tests lead to the same conclusions when each cell of the contingency table has a sufficiently high number (o> 10) of observations . However, while the chi - square test cannot be used for lower numbers in any cell, no such restrictions occur for g test . A null hypothesis of no effect cannot be rejected when g statistics is higher than the critical value g0,05 = 3.841 for 1 degree of freedom (table 22). Common polymorphic variants of cdkn2a gene were found in our study at codon 148 in exon 2 (ala148thr) in 9 cases (tab . All the confirmed cases were first identified by the msscp technique and then verified by sequencing . The obtained frequencies were compared with the control group from the polish population, examined by debniak and colleagues, and a significant difference was found in the prevalence of a148 t polymorphism in the bladder cancer group (g test, table 2 2: nbladder cancer = 156, ncontrol = 1210, g = 4.298, p <0.05). No differences were observed in the frequencies of nt500c> g alleles or in the frequencies of nt540c> t alleles, either in the bladder cancer group or in the reference control group . We used the data for the control group, published by other authors, because they were obtained in studies on a large number of subjects (i.e., 1210) for the polish population, and by researchers, who are unquestionable authorities in the studies on hereditary predispositions to neoplasm development, including the a148 t variant of cdkn2a gene . Frequencies of cdkn2a variants in controls and in the bladder cancer group results of electrophoresis (msscp) of cdkn2a gene exon 2 and of sequentioning of particular codon 148 variants . The black arrow designates the g / g (ala / ala) homozygotic system, the blue arrow the heterozygotic a / g (thr / ala) system and the red arrow the homozygotic a / a (thr / thr) system . The incidence rates of particular variants in codon 148 of cdkn2a gene in various neoplasms, found in the polish population . The occurrence of adenine instead of guanine in codon 148 is associated with the change of the coded amino acid - alanine (cgg) - to threonine (cga). N- the number of studied subjects controls - a control group for the polish population, consisting of 500 newborns and 710 adult; significant - designates a group of neoplasms, in which the percent of the threonine - encoding variant was statistically significantly higher than in the control population; not significant - designates a group of neoplasms in which the distribution of incidence of the threonine - encoding variant is not different from that in the general population . Based on the study by dbniak et al cdkn2a gene inactivation is one of the genetic events, leading to urinary bladder cancer development . According to published reports, 14 - 39% of homozygotic deletions are found in urinary bladder cancer, as well as approximately 12% of hemizygotic deletions of the gene and about 3% of mutations [5, 14]. For comparison, in renal cancer homozygotic deletions however, because cdkn2a gene inactivation plays the key role in the molecular mechanism of urinary bladder cancer development, as designed by goebell et al . In 2010, our interest focused on the constitutional mutations of that gene . The a148 t variant is broadly cited as a common polymorphism, following functional studies, which indicate that these amino acid substitutions do not affect the ability of p16 to precipitate with cdk4/ cdk6 proteins . Variable frequencies of cdkn2a germline muta tions and polymorphism have been reported in different collections of melanoma families in sweden, poland, great britain, and brazil [1620]. The incidence rates of these changes are also higher in cases of liver carcinoma, nervous system tumors, and pancreatic or breast cancers . See table 5 for exemplary data . In poland, the incidence of cdkn2a variant - an alanine to threonine substitution at codon 148 (a148 t) - has been estimated for approximately 3 to 3.5% of the population [13, 21]. Recent studies have shown that a148 t polymorphism is in linkage disequilibrium with a second alteration in the cdkn2a promoter (p-493 variant), which appears to affect gene expression . In the polish control population, the frequency of a148 t changes in 1,210 control samples (500 newborns and 710 adults) was assessed by debniak et al . At 2.89% . The same research team studied the incidence of a148 t variant of cdkn2a gene (see their report of 2007) in the polish population of patients with breast cancer (young women), colon, lung, melanoma, prostate, bladder, kidney, stomach, pancreas and thyroid cancers (see figure 1 for a partial presentation of results) [13, 30, 31]. Significant differences were found for the first four neoplasms in the above list, indicating that the carrier state of the variant may be associated with an increased risk of tumor development . The results, obtained for a group of 223 urinary bladder carcinoma cases (3.1%) did not differ from those for the control group . It should be emphasized that those patients came from the pomeranian region while in our study patients from the lodz voivodeship (central poland) prevailed (131/156). The results of our study (5.77%) indicate that, regarding the polish population (d macroregion), a148 t variant seems to be associated with an increased bladder cancer risk . However, it should eventually be justified to refer to the comparison of results in the study group with those in the control group, representative for the studied region . The frequency of variant a148 t found by us in patients with bladder cancer is similar to the results published in the work of sakano et al . (6%) for patients with bladder cancer in the population of stockholm county in sweden . However, the result cannot be compared with a general population as the authors do not specify what is the frequency of this variant in the population of swedes . The obtained results should by all means be confirmed in a study on a larger population, representing the d macroregion, especially that the results of studies on other neoplasms differ among populations or even within the same population, when differentiated for example by age (the groups of patients below and above the age of 50 years). Breast cancer can be an example, the results for which were different from those in the control group in the group of women below 50, while no differences in the incidence rates were observed between the control group and the group of women above 50 . In case of the studied group, 8 out of 9 a148 t polymorphism cases of cdkn2a gene were identified in men at the age above 60 years at diagnosis (data specified in table 4). No recurrence was observed in 7 out of 9 diagnosed cases . In 6/9 cases, there were neoplasms in high clinical stage; while in 5/9 cases there were tumors with high malignancy grade (g2-g3). Summing up and taking into account the analysis of clinical parameters and the age of disease occurrence, a148 t polymorphism of cdkn2a gene was found in the studied group only in men, in whom the disease was diagnosed at the age above 60 years, while the diagnosed neoplasms were in the majority of cases characterized by higher clinical stage and higher grade of malignancy, as well as by a low percentage of recurrence . Nevertheless, this has been the first study that attempted to show a potential association between a148 t alterations and an increased risk for bladder cancer development . Prevalence of a148 t variant of cdkn2a gene vs. clinical data genotypes and allele frequencies of the a148 t allele in different populations studies on genetic predispositions to neoplasm development allow to distinguish the group of subjects with an increased risk for neoplastic changes vs. the general population . The more we learn about human genetics and human variations, the more apparent it becomes that our individual make - up has a noticeable impact on the risk of cancer development and finally on the effectiveness of therapeutic medications . T variant of cdkn2a gene seems to be associated with an increased risk for developing bladder cancer . Nevertheless, according to debniak et al . (2005), it does not imply that a148 t polymorphism is associated with an increased risk of the diseases alone but it rather suggests the existence of some interactive modifiers that, when grouped together, may trigger the malignancy process . The study was approved by the ethics committee of the medical university of d (permission no rnn/66/02/ke). This work was supported by the state committee for scientific research, poland (kbn grant no 2p05c 076 30).
|
In august, 4 months before presentation, a 35-year - old white woman of scots and english descent developed reddish urine for several days followed by eruption of vesicles and blisters on the dorsal surfaces of her hands and fingers, the sides of her nose, and her upper anterior chest, knees, and legs . She worked as a landscaping contractor and noticed that lesions occurred on areas exposed to sunlight, but application of sunscreen neither diminished the rate at which new lesions appeared, nor promoted healing of older lesions . Her skin was fragile in areas of the lesions and the lesions healed slowly, often with scarring . She also developed dark brown pigmentation and the growth of fine black hair over her cheeks . She consumed three glasses of wine each week and had smoked electronic cigarettes for approximately 6 months, having changed from tobacco cigarettes . She had donated three units of blood for transfusion, but none in several years . She had no menses in the 12 months before presentation due to the effects of a contraceptive vaginal ring (nuvaring; etonogestrel / ethinyl estradiol). A dermatologist performed a punch biopsy of two skin lesions on her left forefinger and referred her for hematology evaluation and treatment . Physical examination confirmed the presence of new vesicles and bullae with erythematous bases, some as large as 1 cm in diameter, and older lesions in various stages of erosion, resolution, and scarring in the anatomical distribution described above . Lesions were most prominent on the dorsal surfaces of the hands and fingers (fig . Milia were scattered over areas affected with bullous lesions and were especially prominent on skin overlying finger joints . (a) before therapy, there were vesicles, bullae with erythematous bases, older lesions in various stages of erosion, resolution, scarring, and punctate milia, all typical of pct . (b) after iron depletion with phlebotomy, there were no active skin lesions, although hyperpigmentation, scarring, and milia (especially over dorsal aspects of second and third interphalangeal joints) persisted . Punch biopsy specimens of skin were deposited in immunofluorescence transport medium, flash frozen, and cut for manual immunofluorescence staining . The sections were probed with fluorescein - labeled anti - human antibodies specific for igg, iga, igm, c3, c5b-9, and fibrinogen . Complete blood count (including hemoglobin and mean corpuscular volume [mcv]), serum iron, total iron - binding capacity, serum ferritin, serum aspartate aminotransferase (ast) and alanine aminotransferase (alt) activities, c - reactive protein, hepatitis b surface antigen and core antibody, hepatitis c virus (hcv) antibody, hiv-1 antibody, urine porphyrin levels, and whole - blood urod activity were measured using standard clinical laboratory methods . Transferrin saturation was computed as the quotient of serum iron by total iron - binding capacity . Human leukocyte antigen (hla)-a and hla - b alleles were detected using low - resolution dna - based typing . Iron depletion therapy, defined as the periodic removal of blood to eliminate storage iron, was complete when serum ferritin was 45 quantity of iron removed by phlebotomy (qfe) was estimated as 200 mg fe per unit of blood (450500 ml). Direct immunofluorescence of skin biopsy specimens revealed linear glassy iga and igg deposition along the epidermal basement membrane zone and superficial dermal blood vessels, forming a characteristic doughnut pattern . There was no positivity for igm, c3, c5b-9, or fibrinogen . At diagnosis, hemoglobin and mcv were within respective reference limits (table 1), as were other complete blood count values (not shown). Mol / l (303 g / dl), transferrin saturation was> 96%, and serum ferritin was 2,800 ast and alt activities were 1.10 kat / l (66 iu / l) and 2.05 kat / l (123 iu / l), respectively (reference 0.67 kat / l (040 iu / l)). Nmol / l (23.2 mg / l) (reference 0.046.7 nmol / l (0.04.9 mg / l)). Hepatitis b surface antigen and core antibody, hcv antibody, and hiv antibody were not detected . Whole - blood urod activity was 1.02 relative units (normal reference 1.003.00 relative units). Urine porphyrins revealed markedly elevated concentrations of uroporphyrin and heptacarboxyl porphyrin (table 1). Concentrations of pentacarboxyl porphyrins and coproporphyrins were increased to a lesser extent (table 1). Hla - a and hla - b typing detected a*01, a*29; and b*08, b*44, respectively . Laboratory measures in woman with pct and hfe c282y / c282y pct, porphyria cutanea tarda; 7-cp, heptacarboxyl porphyrin; 6-cp, hexacarboxyl porphyrin; 5-cp, pentacarboxyl porphyrin; mcv, mean corpuscular volume; qfe, iron removed by phlebotomy . The liver specimen was interpreted as mild fatty metamorphosis, moderate chronic triaditis with mild interface hepatitis, 34 + diffuse hepatocellular iron deposition, and prominent kupffer cell iron (fig . Sections prepared with mallory's trichrome and reticulin techniques revealed moderate portal fibrosis with lattice - like pericellular fibrosis and early bridging without definite cirrhosis (fig . Abundant golden pigment is iron; inflammatory cells are visible between 5 and 7 o'clock positions . Management consisted of therapeutic phlebotomy every 1014 days, clothing to minimize sun exposure, twice - daily application of high - value ultraviolet - a and ultraviolet - b sunscreen to exposed areas of skin, cessation of alcohol and electronic cigarette use, and removal of the contraceptive vaginal ring . The present patient complied with recommendations except those regarding alcohol consumption and electronic cigarette use . There was slow resolution of active skin lesions, hyperpigmentation, and hypertrichosis . By the end of phlebotomy therapy, she had no active skin manifestations (fig . 1b) and developed pagophagia, a moderate decrease in hemoglobin and mcv in comparison with pretreatment values and near - normal urine porphyrin concentrations (table 1). Eight months after presentation, she underwent implantation of a levonorgestrel - releasing intrauterine contraceptive system (skyla). Five months after implantation of the contraceptive device, she had not experienced recurrence of photosensitive dermatosis . The present patient had clinical, biochemical, and pathologic abnormalities typical of pct (1). Affected areas other than the hands and face and facial hypertrichosis like that observed in the present patient were significantly more common in women than men among 152 consecutive patients with pct in spain (4). The present patient did not have a family history of pct, although some carriers of deleterious urod mutations do not develop pct (1). Typical of patients with sporadic pct, her whole - blood urod relative activity was not decreased . We did not measure her hepatic urod activity, which is typically decreased in sporadic pct . These observations are compatible with sporadic pct . In a study of 108 consecutive patients with pct, 19% were hfe c282y homozygotes, all had increased iron burdens, and 63% of women used estrogens (2). Thus, the present patient had three common risk factors for pct in white women of european descent: hfe c282y homozygosity, hepatic iron overload, and use of an exogenous estrogen . The prevalence of hfe c282y homozygosity is ~60-fold higher in persons with pct than in control subjects (2). C282y homozygosity was associated with an earlier onset of skin lesions in both familial and sporadic pct (5), consistent with features of the present patient . Regardless, many c282y homozygotes do not develop iron overload (3) and most c282y homozygotes do not develop pct (3). In basques with pct, the prevalence of c282y was not increased (3). In 190 german patients with sporadic pct, serum and hepatic iron, serum ferritin, transferrin saturation, and liver enzyme measures did not differ significantly between patients with or without hfe mutations (3). These observations emphasize that non - iron heritable, acquired, or environmental characteristics trigger or contribute to the pathogenesis of pct in some c282y homozygotes and other persons with common hfe mutations . Excessive iron in hepatocytes, an almost universal finding in patients with pct, is also important in pct pathogenesis . Iron excess causes production of reactive oxygen species that increase the rate at which the urod substrate uroporphyrinogen is oxidized (6). The consequent production of uroporphomethene (7) or another urod inhibitor decreases urod activity further . Her lack of menses in the year before presentation with pct may have worsened iron overload . Pct has also occurred in patients with iron overload associated with beta - thalassemia minor, beta - thalassemia major, and refractory anemia with chronic erythrocyte transfusion . Compared hepatic hamp expression in 96 patients with pct with that in 88 hfe c282y homozygotes who had marked hepatic iron overload (8). In patients with pct, hamp expression was significantly lower, regardless of hfe genotype, than that of c282y homozygotes with iron overload of similar severity but without pct, suggesting that hepatic siderosis associated with pct is caused by dysregulated hepcidin (8). In contrast, darwich et al . Observed that mean serum hepcidin levels were significantly higher in patients with pct than in patients with chronic hepatitis c without pct or in control subjects, suggesting that mechanisms regulating iron homeostasis in pct differ from those involved in other related disorders, such as hemochromatosis, hcv infection, or excessive alcohol consumption (9). Estrogen therapy in women, including oral contraceptives (1), postmenopausal hormone replacement (1), and tamoxifen for breast cancer (3), is a risk factor for pct . In men with prostate cancer there were no significant differences in serum iron and ferritin measures, liver iron grade, and hcv status in women with pct who were taking estrogens and those who were not (2). A plausible mechanism by which estrogens may act to increase pct risk is increased estrogen quinone formation and consequent enhanced generation of free radicals . The present patient used a contraceptive vaginal polymeric ring for 1 year before presentation with pct . This product is estimated to deliver 120 g of etonogestrel (a progestin) and 15 g of ethinyl estradiol (an estrogen) each day of use, on average (10). We were unable to identify reports of pct in large series of women who used this vaginal contraceptive ring or reports of pct associated with etonogestrel . On the other hand, ethinyl estradiol, a component of several oral contraceptive preparations, has been explicitly associated with pct (1). Like the use of oral contraceptives, use of contraceptive vaginal rings has been associated with increased risk of deep venous thrombosis / pulmonary thromboembolism (11). This indicates that significant amounts of active estrogen are transferred from the vaginal rings to the blood . Based on these observations, we infer that ethinyl estradiol contributed to the development of pct in the present woman . We cannot exclude the possibility that other reports of pct in women who used nuvaring have been submitted to the us food and drug administration or corresponding regulatory agencies in other countries . In contrast, transdermal estrogens were safe and effective for postmenopausal hormone replacement in four women previously treated for pct (12). The intrauterine contraceptive device selected by the patient and her gynecologist after removal of the contraceptive vaginal ring is based on levonorgestrel (a progestin). Taken by mouth as an emergency contraceptive, levonorgestrel was associated with acute porphyria but not pct (13). Cigarette smoking is common in persons with pct (1, 2) and is often associated with alcohol consumption . Smokers developed cutaneous manifestations of sporadic pct at younger ages than non - smokers, on average . Although smoking increases cyp1a2 activity, bulaj et al . Observed no correlation of histochemical evidence of cyp1a2 activity in hepatocytes of patients with expression of familial or sporadic pct (2). We were unable to identify reports of pct in persons who smoked electronic cigarettes, like the present patient . Excessive alcohol consumption was more common in men than women with pct (2) and in persons with pct who also had infections with hcv (2) or hiv (14). There was a significant positive association of alcohol intake and porphyrinuria in 1,613 non - porphyric adults in madrid after correcting for gender, age, and body mass index (15). In rats treated with hexachlorobenzene, decreased urod activity induced by ethanol predisposes to the development and progression of porphyria . Although the present patient reported that she consumed alcohol in moderation, a role of alcohol in the causation of her pct cannot be excluded . Fatty liver is relatively common in persons with pct (6), and it has been suggested that non - alcoholic fatty liver disease (nafld) predisposes to the development of pct (16). Therapeutic phlebotomy is the predominant treatment for most patients with pct because phlebotomy removes excess iron from hepatocytes (1). The present patient had hfe hemochromatosis with iron overload, for which phlebotomy is also the preferred management (3). Chelation therapy with intravenous deferoxamine, subcutaneous deferoxamine, and oral deferasirox has also been used to remove excessive iron in patients with pct and should be considered in patients with pct who are intolerant of phlebotomy (18). The rate of clinical and biochemical remission in the present patient was representative of that in other pct cases (1). Pct in the present patient was associated with three predominant risk factors: hfe c282y homozygosity, hepatic iron overload, and exposure to an exogenous estrogen via a contraceptive vaginal ring . The authors have not received any funding or benefits from industry or elsewhere to conduct this study . Both authors conceived and contributed to the manuscript, performed photography, and approved the final manuscript.
|
Electroconvulsive therapy (ect) is a strong option for treating patients with medication - resistant depression, a high risk of suicide, psychotic agitation, and other severe mental issues . However, gaines and rees1 suggested that ect increases cerebral blood flow 1.5-fold to sevenfold and raises intracranial pressure . These effects may increase the risk of intracranial hemorrhage, especially in patients with a brain tumor, an intracranial vascular abnormality, or hemorrhagic disease . Hemophilia, a hemorrhagic disease, is usually an x - linked recessive disorder induced by a deficiency of factor viii (hemophilia a) or factor ix (hemophilia b). Hemophilia a is the usual form of the disorder, and occurs in about one out of every 5,00010,000 male births . The number of patients with hemophilia b is about one - fifth that of hemophilia a. globally, the number of patients with hemophilia is estimated at about 400,000 . Although the incidence of hemophilia is low, it is possible that schizophrenia requiring ect could co - occur with hemophilia . However, only one paper reports a demonstration of the safe usage of ect in a patient with hemophilia.2 herein, we describe a second case of successful ect for medication - resistant schizophrenia in a patient with severe hemophilia a. a 26-year - old japanese man had been treated for severe hemophilia a (severe, coagulation factor viii activity <1%; moderate, 1%5%; mild, 5%40%). He was admitted to a mental hospital for auditory hallucinations, a persecution complex, world destruction fantasies, and psychomotor excitation, and was diagnosed with schizophrenia by diagnostic and statistical manual of mental disorders, fourth edition, text revision criteria . . Then haloperidol (12 mg / day) was combined with olanzapine instead of risperidone . This antipsychotic combination therapy (olanzapine 20 mg / day plus haloperidol 12 mg / day) was partly effective against the auditory hallucinations, but the patient s psychiatric state immediately deteriorated thereafter and suicidal ideation emerged . In addition, his bleeding tendency worsened and multiple subcutaneous hematomas appeared on his body . Because clozapine had not been approved in our province at that time and ect has immediate and strong effects on schizophrenic symptoms including suicidal ideation,3 the patient was transferred to our general hospital for the management of hemophilia a and for ect . After consulting with hematologists, ect was performed after the patient had been supplemented with coagulation factor viii to prevent intracranial and systematic hemorrhage . We administered factor viii concentrates (1,000 iu; kogenate fs, bayer healthcare pharmaceuticals inc ., the dose of kogenate fs was determined to keep factor viii activity at 30%40% during ect . The factor viii activity target range was recommended by hematologists based on the report by glaub et al.2 since the patient s mental state was impaired, written informed consent for the procedure was obtained from the patient s family . Bitemporal ect was administered two or three times a week . A thymatron stimulation device (somatics, lake bluff, il, usa) was used for ect; the stimulation conditions were 0.5 ms pulses, 40 hz, 0.9 a, and 252 mc . After a course of eight ect sessions, his world destruction fantasies, psychomotor excitation, and suicidal ideation were improved . However, since his auditory hallucinations and persecution complex persisted, a second course of eight treatment sessions was administered, which ameliorated the remaining psychiatric symptoms . After the 16th ect session, brain mri was performed to determine whether organic brain disease was present, and there was no sign of brain disease or bleeding . A 26-year - old japanese man had been treated for severe hemophilia a (severe, coagulation factor viii activity <1%; moderate, 1%5%; mild, 5%40%). He was admitted to a mental hospital for auditory hallucinations, a persecution complex, world destruction fantasies, and psychomotor excitation, and was diagnosed with schizophrenia by diagnostic and statistical manual of mental disorders, fourth edition, text revision criteria . However, the auditory hallucinations, persecution complex, and psychomotor excitation persisted . Then haloperidol (12 mg / day) was combined with olanzapine instead of risperidone . This antipsychotic combination therapy (olanzapine 20 mg / day plus haloperidol 12 mg / day) was partly effective against the auditory hallucinations, but the patient s psychiatric state immediately deteriorated thereafter and suicidal ideation emerged . In addition, his bleeding tendency worsened and multiple subcutaneous hematomas appeared on his body . Because clozapine had not been approved in our province at that time and ect has immediate and strong effects on schizophrenic symptoms including suicidal ideation,3 the patient was transferred to our general hospital for the management of hemophilia a and for ect . After consulting with hematologists, ect was performed after the patient had been supplemented with coagulation factor viii to prevent intracranial and systematic hemorrhage . We administered factor viii concentrates (1,000 iu; kogenate fs, bayer healthcare pharmaceuticals inc ., the dose of kogenate fs was determined to keep factor viii activity at 30%40% during ect . The factor viii activity target range was recommended by hematologists based on the report by glaub et al.2 since the patient s mental state was impaired, written informed consent for the procedure was obtained from the patient s family . Bitemporal ect was administered two or three times a week . A thymatron stimulation device (somatics, lake bluff, il, usa) was used for ect; the stimulation conditions were 0.5 ms pulses, 40 hz, 0.9 a, and 252 mc . After a course of eight ect sessions, his world destruction fantasies, psychomotor excitation, and suicidal ideation were improved . However, since his auditory hallucinations and persecution complex persisted, a second course of eight treatment sessions was administered, which ameliorated the remaining psychiatric symptoms . After the 16th ect session, brain mri was performed to determine whether organic brain disease was present, and there was no sign of brain disease or bleeding . A task force report of the american psychiatric association (apa)4 has suggested that there are no absolute contraindications to ect, but that recent stroke, cerebrovascular malformations, and space - occupying intracranial lesions are related to an increased risk of intracranial hemorrhage due to ect . This apa statement may have discouraged psychiatrists from performing ect on patients with bleeding tendencies such as in hemophilia . Mehta et al5 reported the results of a study of 35 patients receiving warfarin, an anticoagulant inhibiting the synthesis of vitamin k - dependent clotting factors such as factors ii, vii, ix, and x. the extrinsic clotting system is impaired in patients with hemophilia a, and warfarin extends the intrinsic and extrinsic clotting systems . In the study, international normalized ratio values measured on the day of ect varied notably, including subtherapeutic, therapeutic, and supratherapeutic . Glaub et al2 demonstrated that ect could be performed without bleeding or other complications when patients with hemophilia a were pre - treated with factor viii concentrates . Our report shows the safety of ect for patients with hemophilia a when they are supplemented with coagulation factor viii . Patients with hemophilia can even undergo open surgery6 with appropriate management of the condition with coagulation factors . Thus, although only two patients with hemophilia a have successfully received ect, evidence suggests that patients with hemophilia can be safely treated with ect if pretreated with factor viii . In conclusion, when a patient with hemophilia a is pre - treated with factor viii, ect may be performed safely . For patients with hemophilia
|
Children s cough is a daily concern for most of pediatricians . In the majority of cases, cough is self - limiting, but its persistence could become annoying and could impair both quality of life and social activities.1 the management of both acute and chronic cough requires a systematic and comprehensive approach . Nevertheless, according to the american food and drug administration, inappropriate prescription and use of antitussive drugs in children are being reduced when compared to those of other pharmaceutical classes.2 in the last few years, several protocols oriented to the improved identification of the causes of cough and to cough resolution were validated.3 despite the significant benefits from their application, prescribing attitudes do not always reflect the presence of a correct diagnostic evaluation of cough . Several studies have described the prescription attitudes in children suffering from respiratory problems in the usa and europe.46 the results showed a wide disagreement between guidelines recommendations and present prescriptions . In the usa, the most prescribed drugs to children aged up to 11 years were old antibiotics (amoxicillin and azithromycin), with cough, asthma, and allergy being the most frequent respiratory conditions for which patients received prescriptions.6 frequent mistakes were also observed in dosing and in the route of administration of drugs.2 the use of antibiotics for acute cough is still high across the world79 and represents a primary concern about the development of antibiotic resistance.10,11 however, treatment represents only part of the economic burden due to cough.12,13 the identification of the cause of cough is crucial in order to determine the right treatment . Although several tests can be done for investigating chronic cough and defining the correct approach to speed up diagnosis and treatment, misuse of some tests (i.e., spirometry, chest radiography, head neck computed tomography, allergic tests) may increase costs and delay both the diagnosis and the approach to the appropriate therapy.1,14,15 moreover, pediatric evaluations can be compromised by parental perceptions: parents often exaggerate symptoms and/or require prescription of specific drugs, such as antibiotics, commonly regarded as the only effective therapeutic option.16,17 therefore, we conducted a survey on a representative sample of italian pediatricians in order to investigate their approach and prescription attitudes toward acute and chronic cough . The survey was planned and carried out by italian association for cough study (aist) and national centre for respiratory pharmacoeconomics and pharmacoepidemiology, in cooperation with the italian national observatory on health of childhood and adolescence (paidoss, which is a scientific society of pediatricians with the mission to promote childhood and adolescence health). A specific questionnaire was designed in order to investigate both the perceptions and the behaviors of pediatricians toward cough in their young patients (supplementary material). The first eight questions were aimed to investigate the prevalence and the type of cough and to collect some information on pediatricians medical activity . The second part of the questionnaire included the last ten questions that were aimed to investigate the pediatricians approach to cough, such as their etiological definition, diagnostic attitude, and prescription habits . A cover letter providing background information and the aim of the study preceded the request to participating in the survey . The questionnaire was directly distributed to all the paidoss members (300 pediatricians from 15 italian regions) at the registration of the paidoss national meeting, capri, italy, 2014, and collected at the end of the meeting, when they asked for their certificate of attendance . As four questions about cough causes were open ended, we first pooled causes and treatments in order to avoid duplicate items during analysis . In order to check possible regional differences in the cultural approach to cough, italian regions were divided into three geographical areas: northern (emilia romagna, friuli venezia giulia, lombardia, piemonte, veneto), central (lazio, marche, sardegna, toscana, umbria), and southern (abruzzo, calabria, campania, puglia, sicilia). The return of the questionnaire was considered as evidence of informed consent . Means, standard deviation, minimum, maximum, and interquartile range (iqr) were used in order to describe scalar data, while absolute and relative frequencies were used in order to describe discrete data . As far as discrete data were concerned, the pearson s chi - square test was applied in order to test the overall relationship between variables, while the hierarchical log - linear model was used to compare the observed versus the expected value of each single frequency . The type of cough (dry or productive) was compared between acute and chronic cough by means of the mcnemar test since paired data were involved . Data were managed and analyzed by means of the ibm spss statistics (version 23; ibm, co., armonk, ny, usa) package, and two - tailed p values <0.05 were considered statistically significant . Means, standard deviation, minimum, maximum, and interquartile range (iqr) were used in order to describe scalar data, while absolute and relative frequencies were used in order to describe discrete data . As far as discrete data were concerned, the pearson s chi - square test was applied in order to test the overall relationship between variables, while the hierarchical log - linear model was used to compare the observed versus the expected value of each single frequency . The type of cough (dry or productive) was compared between acute and chronic cough by means of the mcnemar test since paired data were involved . Data were managed and analyzed by means of the ibm spss statistics (version 23; ibm, co., armonk, ny, usa) package, and two - tailed p values <0.05 were considered statistically significant . Approximately one - half of respondents (48.0%; n=144) were located in southern italy, while 22.0% (n=66) were from the central region and 30.0% (n=90) from the northern region . Their average seniority in the public health care service was 21.68.5 years (iqr: 1828 years; range: 140 years). The potential overall number of children referring to the 300 pediatricians surveyed was> 282,000 (range of age 314 years), with a mean of 954170 patients / pediatrician (iqr: 8501,000 patients; range: 6001,900 patients). Seniority and number of assisted children were significantly different among the three italian areas (p=0.027 and p<0.001, respectively). Even if no correlation was found between seniority and the survey responses, in northern regions, there was a lower seniority (18.810.8 years vs 22.88.1 years and 22.96.5 years in central and southern regions, respectively) and a significantly greater number of assisted children (1,031167 vs 938207 and 912136 in central and southern regions, respectively). The vast majority of pediatricians (n=298; 99.3% of respondents) reported that in winter, cough represents a true huge problem, frequently leading patients to seek for a visit . However, 194 pediatricians (64.7%) registered a high prevalence of visits for cough also in summer and spring . Most of the pediatricians (n=247; 82.3%) made more than one visit for cough to the same patient during the year . The frequency of visits to the same patient was not significantly different among the three italian areas (p=0.095, p=0.087, and p=0.126, respectively), independent of seasons . Acute cough was described as more frequently dry than productive (n=217, 72.3%, vs n=83, 27.7%), while chronic cough was more frequently productive than dry (n=176, 58.7%, vs n=124, 41.3%). Specific investigations were not frequently requested in patients with acute cough; actually, they were usually requested by only 43 pediatricians (14.3%). The most common tests were chest radiography (n=26, 60.5% of the total number of tests) and allergologic tests (n=35, 81.4%), but only eight physicians (18.6%) required spirometry . In children with chronic cough, 73.5% of pediatricians (n=219 out of 298 available responses) usually prescribed additional tests, and the most common investigations were allergologic tests (n=183, 83.6%), chest radiography (n=127, 58.0%), sweat test (n=103, 47.0%), spirometry (n=73, 33.3%), ph - metry test (n=24, 11.0%), and head neck computed tomography (n=10, 4.7%). Moreover, out of 293 available responses, allergologists and otorhinolaryngologists were the most common specialists to whom patients were addressed for a consultation (n=213, 72.7%, and n=182, 62.1%, respectively). Pneumologists and gastroenterologists were consulted only by 33.1% (n=97) and 17.7% (n=52) of the cases, respectively . However, there were some geographical differences in requests for consultations of otorhinolaryngologists (p=0.030), pneumologists (p=0.001), and gastroenterologists (p=0.006; table 1). In particular, pneumologists were significantly less frequently consulted in the southern area (p<0.001; 22.2% vs 43.7% and 43.5% in southern vs northern and central italy, respectively), whereas gastroenterologists were significantly more frequently consulted in the southern compared to the northern and the central regions (p=0.002; 25.0% vs 11.5% and 9.7% in southern vs northern and central regions, respectively). A significantly lower frequency of otorhinolaryngologist consultations was also found in northern italy (50.6%; p=0.012) in comparison to that in central and southern italy (66.1% and 67.4%, respectively). The most presumed causes of acute cough were infectious diseases, particularly airway viral infections (n=134, 44.7%), upper respiratory tract infections (urtis; n=92, 30.7%), and lower respiratory tract infections (lrtis; n=22, 7.3%; table 2). In particular, viral infections were more frequently indicated as the main cause of acute cough in the southern areas (72/144, 50.0%; p=0.012) and less frequently in central regions (22/66, 33.3%; p=0.016). Urtis were more frequently diagnosed in southern (49/144, 34.0%; p=0.034) than in northern regions (19/90, 21.1%; p=0.048), while the frequency of lrtis as the main cause of acute cough did not show any significant difference across italian areas . Allergic disorders (including asthma and rhinitis) were suggested in 14.7% of cases of acute cough (n=44) and were significantly more frequent in northern regions (21/90, 23.3%, p=0.039). Causes of acute cough among the italian areas proved significant (overall pearson s chi - square test p<0.013). Regarding chronic cough (table 3), asthma and allergic rhinitis were supposed to be present in the majority of children (n=160, 53.3%), followed by urtis (n=62, 20.7%). Viral (n=12, 4.0%) and bacterial infections (n=9, 3.0%) were only episodically indicated as the main cause of chronic cough . Lrtis (n=33, 11.0%) and gastroesophageal reflux (n=16, 5.3%) were not regarded as frequent causes of chronic cough in children . We did not find any significant difference in causes of chronic cough among the italian areas (overall pearson s chi - square test = not significant [ns]) apart from a significantly higher frequency of viral infections in central italy (n=8/66, 12.1%; p=0.002). Aerosol therapy (such as bronchodilators and/or steroids, in the vast majority of cases) proved as the most preferred route for drug administration (n=79, 26.3% of respondents). Oral corticosteroids were prescribed by 30 pediatricians (10.0%), and only 24 pediatricians (8.0%) gave no treatment for acute cough (table 4). The practice of not treating patients was significantly lower in northern regions (2/90, 2.2%; p=0.016) and significantly higher in central regions (10/66, 15.2%; p=0.004). The use of aerosol therapy and oral corticosteroids did not show any significant difference across the italian areas, while symptomatic treatments (antitussive and mucoactive drugs) were more frequent in southern regions (33/144, 22.9%; p=0.048). Antibiotics were less prescribed in southern regions (20/144, 13.9%; p=0.001), but more recommended in central regions (25/66, 37.9%; p=0.005), while the use of homeopathic and herbal remedies was higher in northern regions (22/90, 24.4%; p=0.017), but lower in southern regions (16/144, 11.1%; p=0.029). Significant differences in cough treatment were found according to the presumed causes of acute cough (p<0.001). In allergic rhinitis / asthma (n=44), aerosol therapy (n=18, 40.9%; p=0.005) and antibiotics (n=18, 40.9%; p=0.006) were the most prescribed drugs . In viral infections (n=134), symptomatics (n=33, 24.6%; p=0.012) and no treatment at all (n=20, 14.9%; p=0.046) were most recommended, while oral corticosteroids were less recommended (n=10, 7.5%; p=0.007). On the other hand, the most prescribed drugs in urtis and lrtis were symptomatics (20/92, 21.7%; p=0.011) and antibiotics (12/22, 54.5%; p=0.010), respectively . Aerosol therapy and antibiotics aerosol therapy was widely used across the italian areas, without any significant difference from each other . Aerosol was frequently prescribed when allergic rhinitis and asthma were presumed (98/160, 61.3%; p<0.001). Systemic corticosteroids were rarely used, and their prescription did not show any significant geographical difference and etiological distribution . The use of symptomatics (antitussives and mucolytics) proved homogeneously distributed across italian areas, for all causes of cough . The prescription of antibiotics proved scattered across the different regions, and antibiotics were more frequently prescribed when urtis (42/62, 67.7%; p=0.036) and lrtis (24/33, 72.7%; p=0.024) were presumed . As in the case of acute cough, the use of homeopathic and herbal remedies in chronic cough was significantly higher in northern regions (8/90, 8.9%, p=0.010), independent of the causes . Finally, gastroprotectants (such as antacids and/or proton pump inhibitors) were equally used among italian areas, particularly when the presence of gastroesophageal reflux was strongly presumed (10/16, 62.5%; p<0.001). Both in acute and in chronic cough, the most prescribed classes of antibiotics were penicillins (amoxicillin; amoxicillin / clavulanate) in 54%, macrolides (clarithromycin; azithromycin) in 25%, and cephalosporins in 19% of cases . The vast majority of pediatricians (n=298; 99.3% of respondents) reported that in winter, cough represents a true huge problem, frequently leading patients to seek for a visit . However, 194 pediatricians (64.7%) registered a high prevalence of visits for cough also in summer and spring . Most of the pediatricians (n=247; 82.3%) made more than one visit for cough to the same patient during the year . The frequency of visits to the same patient was not significantly different among the three italian areas (p=0.095, p=0.087, and p=0.126, respectively), independent of seasons . Acute cough was described as more frequently dry than productive (n=217, 72.3%, vs n=83, 27.7%), while chronic cough was more frequently productive than dry (n=176, 58.7%, vs n=124, 41.3%). Specific investigations were not frequently requested in patients with acute cough; actually, they were usually requested by only 43 pediatricians (14.3%). The most common tests were chest radiography (n=26, 60.5% of the total number of tests) and allergologic tests (n=35, 81.4%), but only eight physicians (18.6%) required spirometry . In children with chronic cough, 73.5% of pediatricians (n=219 out of 298 available responses) usually prescribed additional tests, and the most common investigations were allergologic tests (n=183, 83.6%), chest radiography (n=127, 58.0%), sweat test (n=103, 47.0%), spirometry (n=73, 33.3%), ph - metry test (n=24, 11.0%), and head neck computed tomography (n=10, 4.7%). Moreover, out of 293 available responses, allergologists and otorhinolaryngologists were the most common specialists to whom patients were addressed for a consultation (n=213, 72.7%, and n=182, 62.1%, respectively). Pneumologists and gastroenterologists were consulted only by 33.1% (n=97) and 17.7% (n=52) of the cases, respectively . However, there were some geographical differences in requests for consultations of otorhinolaryngologists (p=0.030), pneumologists (p=0.001), and gastroenterologists (p=0.006; table 1). In particular, pneumologists were significantly less frequently consulted in the southern area (p<0.001; 22.2% vs 43.7% and 43.5% in southern vs northern and central italy, respectively), whereas gastroenterologists were significantly more frequently consulted in the southern compared to the northern and the central regions (p=0.002; 25.0% vs 11.5% and 9.7% in southern vs northern and central regions, respectively). A significantly lower frequency of otorhinolaryngologist consultations was also found in northern italy (50.6%; p=0.012) in comparison to that in central and southern italy (66.1% and 67.4%, respectively) the most presumed causes of acute cough were infectious diseases, particularly airway viral infections (n=134, 44.7%), upper respiratory tract infections (urtis; n=92, 30.7%), and lower respiratory tract infections (lrtis; n=22, 7.3%; table 2). In particular, viral infections were more frequently indicated as the main cause of acute cough in the southern areas (72/144, 50.0%; p=0.012) and less frequently in central regions (22/66, 33.3%; p=0.016). Urtis were more frequently diagnosed in southern (49/144, 34.0%; p=0.034) than in northern regions (19/90, 21.1%; p=0.048), while the frequency of lrtis as the main cause of acute cough did not show any significant difference across italian areas . Allergic disorders (including asthma and rhinitis) were suggested in 14.7% of cases of acute cough (n=44) and were significantly more frequent in northern regions (21/90, 23.3%, p=0.039). Causes of acute cough among the italian areas proved significant (overall pearson s chi - square test p<0.013). Regarding chronic cough (table 3), asthma and allergic rhinitis were supposed to be present in the majority of children (n=160, 53.3%), followed by urtis (n=62, 20.7%). Viral (n=12, 4.0%) and bacterial infections (n=9, 3.0%) were only episodically indicated as the main cause of chronic cough . Lrtis (n=33, 11.0%) and gastroesophageal reflux (n=16, 5.3%) were not regarded as frequent causes of chronic cough in children . We did not find any significant difference in causes of chronic cough among the italian areas (overall pearson s chi - square test = not significant [ns]) apart from a significantly higher frequency of viral infections in central italy (n=8/66, 12.1%; p=0.002). Aerosol therapy (such as bronchodilators and/or steroids, in the vast majority of cases) proved as the most preferred route for drug administration (n=79, 26.3% of respondents). Oral corticosteroids were prescribed by 30 pediatricians (10.0%), and only 24 pediatricians (8.0%) gave no treatment for acute cough (table 4). The practice of not treating patients was significantly lower in northern regions (2/90, 2.2%; p=0.016) and significantly higher in central regions (10/66, 15.2%; p=0.004). The use of aerosol therapy and oral corticosteroids did not show any significant difference across the italian areas, while symptomatic treatments (antitussive and mucoactive drugs) were more frequent in southern regions (33/144, 22.9%; p=0.048). Antibiotics were less prescribed in southern regions (20/144, 13.9%; p=0.001), but more recommended in central regions (25/66, 37.9%; p=0.005), while the use of homeopathic and herbal remedies was higher in northern regions (22/90, 24.4%; p=0.017), but lower in southern regions (16/144, 11.1%; p=0.029). Significant differences in cough treatment were found according to the presumed causes of acute cough (p<0.001). In allergic rhinitis / asthma (n=44), aerosol therapy (n=18, 40.9%; p=0.005) and antibiotics (n=18, 40.9%; p=0.006) were the most prescribed drugs . In viral infections (n=134), symptomatics (n=33, 24.6%; p=0.012) and no treatment at all (n=20, 14.9%; p=0.046) were most recommended, while oral corticosteroids were less recommended (n=10, 7.5%; p=0.007). On the other hand, the most prescribed drugs in urtis and lrtis were symptomatics (20/92, 21.7%; p=0.011) and antibiotics (12/22, 54.5%; p=0.010), respectively . Aerosol therapy and antibiotics were the most used medications also in chronic cough (table 5). Aerosol therapy was widely used across the italian areas, without any significant difference from each other . Aerosol was frequently prescribed when allergic rhinitis and asthma were presumed (98/160, 61.3%; p<0.001). Systemic corticosteroids were rarely used, and their prescription did not show any significant geographical difference and etiological distribution . The use of symptomatics (antitussives and mucolytics) proved homogeneously distributed across italian areas, for all causes of cough . The prescription of antibiotics proved scattered across the different regions, and antibiotics were more frequently prescribed when urtis (42/62, 67.7%; p=0.036) and lrtis (24/33, 72.7%; p=0.024) were presumed . As in the case of acute cough, the use of homeopathic and herbal remedies in chronic cough was significantly higher in northern regions (8/90, 8.9%, p=0.010), independent of the causes . Finally, gastroprotectants (such as antacids and/or proton pump inhibitors) were equally used among italian areas, particularly when the presence of gastroesophageal reflux was strongly presumed (10/16, 62.5%; p<0.001). Both in acute and in chronic cough, the most prescribed classes of antibiotics were penicillins (amoxicillin; amoxicillin / clavulanate) in 54%, macrolides (clarithromycin; azithromycin) in 25%, and cephalosporins in 19% of cases . Aerosol therapy (such as bronchodilators and/or steroids, in the vast majority of cases) proved as the most preferred route for drug administration (n=79, 26.3% of respondents). Oral corticosteroids were prescribed by 30 pediatricians (10.0%), and only 24 pediatricians (8.0%) gave no treatment for acute cough (table 4). The practice of not treating patients was significantly lower in northern regions (2/90, 2.2%; p=0.016) and significantly higher in central regions (10/66, 15.2%; p=0.004). The use of aerosol therapy and oral corticosteroids did not show any significant difference across the italian areas, while symptomatic treatments (antitussive and mucoactive drugs) were more frequent in southern regions (33/144, 22.9%; p=0.048). Antibiotics were less prescribed in southern regions (20/144, 13.9%; p=0.001), but more recommended in central regions (25/66, 37.9%; p=0.005), while the use of homeopathic and herbal remedies was higher in northern regions (22/90, 24.4%; p=0.017), but lower in southern regions (16/144, 11.1%; p=0.029). Significant differences in cough treatment were found according to the presumed causes of acute cough (p<0.001). In allergic rhinitis / asthma (n=44), aerosol therapy (n=18, 40.9%; p=0.005) and antibiotics (n=18, 40.9%; p=0.006) were the most prescribed drugs . In viral infections (n=134), symptomatics (n=33, 24.6%; p=0.012) and no treatment at all (n=20, 14.9%; p=0.046) were most recommended, while oral corticosteroids were less recommended (n=10, 7.5%; p=0.007). On the other hand, the most prescribed drugs in urtis and lrtis were symptomatics (20/92, 21.7%; p=0.011) and antibiotics (12/22, 54.5%; p=0.010), respectively . Aerosol therapy and antibiotics were the most used medications also in chronic cough (table 5). Aerosol therapy was widely used across the italian areas, without any significant difference from each other . Aerosol was frequently prescribed when allergic rhinitis and asthma were presumed (98/160, 61.3%; p<0.001). Systemic corticosteroids were rarely used, and their prescription did not show any significant geographical difference and etiological distribution . The use of symptomatics (antitussives and mucolytics) proved homogeneously distributed across italian areas, for all causes of cough . The prescription of antibiotics proved scattered across the different regions, and antibiotics were more frequently prescribed when urtis (42/62, 67.7%; p=0.036) and lrtis (24/33, 72.7%; p=0.024) were presumed . As in the case of acute cough, the use of homeopathic and herbal remedies in chronic cough was significantly higher in northern regions (8/90, 8.9%, p=0.010), independent of the causes . Finally, gastroprotectants (such as antacids and/or proton pump inhibitors) were equally used among italian areas, particularly when the presence of gastroesophageal reflux was strongly presumed (10/16, 62.5%; p<0.001). Both in acute and in chronic cough, the most prescribed classes of antibiotics were penicillins (amoxicillin; amoxicillin / clavulanate) in 54%, macrolides (clarithromycin; azithromycin) in 25%, and cephalosporins in 19% of cases . The present survey provided interesting data, both in terms of the number of pediatricians surveyed (n=300) and of the geographical representativeness of the sample (15 italian regions, covering ~300,000 children). Interesting insights and numerous confirmations emerged concerning the attitudes of pediatricians toward diagnosis and treatment of cough . First, cough prevalence was reported without any clear seasonality . Although cough has been generally regarded as a winter illness due to low temperatures, present data tend to confirm the evidence from the literature that suggests that cough has an impact on the pediatricians activity throughout the year, due to allergy, smog, and gastric reflux.1820 actually, even if> 99% of the pediatricians surveyed regard cough as a winter trouble, 65% of them affirmed that cough is also highly prevailing in spring and summer . In addition, pediatricians also described acute cough as more frequently dry, while chronic cough as more frequently productive . This attitude is in accordance with international guidelines2123 since only 14% of pediatricians believe that an active intervention in this sense is needed . The attitude proved different in order to clarify the etiology of chronic cough, and approximately three - fourth of respondents claimed to ask for some investigations . A very high demand for allergological investigations was documented (84%), with a substantial discrepancy between the suspicion of allergies and the request for pulmonary function tests (33%); this is in contrast with the international guidelines that do suggest spirometry in children aged> 5 years in these cases.21,22,24 pediatricians indicated urti and viral infections as the main causes of acute cough (31% and 45%, respectively), and their belief is in agreement with the current literature.25 the analysis within the different geographical areas showed some differences in allergic diseases and asthma, which are presumed to be more prevalent in northern regions in the present survey . This evidence is in contrast with a previous survey that was carried out by focusing families and children.26 the most suspected causes of chronic cough were asthma, postnasal drip syndrome, and bronchitis, as reported in the literatures.21,22,24,27,28 a recent review by chang et al28 suggested an overestimation of asthma as the primary cause of chronic cough in children, compared to bronchitis . Allergic disease was the most frequently suggested cause of chronic cough in children (53%), and this proved supported by the high demand for consultations: 73% seek the opinion of allergologists, 62% of otolaryngologists, and only 33% of pulmonologists . Data from the present survey have some arguable aspects . While in acute, uncomplicated cough due to upper airway infections, the guidelines suggest to refrain from any treatment,21,22 in the present survey, only 8% of pediatricians prescribed no medications for acute cough, followed by symptomatic treatments prescribed very often . Even if antibiotics are recommended if a loose cough persists for> 4 weeks after an urti because it might suggest the occurrence of bacterial bronchitis, antibiotic treatment in acute pediatric cough still proves overused . Although the recognized lack of efficacy for this therapeutic strategy, neither in common cold nor in viral infections,2931 the rates of prescription proved very high in the present survey . There was an excessive use of antibiotics in acute cough, particularly in allergic rhinitis / asthma (41%) and urtis (17%). Moreover, despite the recent evidence that symptomatic treatments, such as either mucoactive or antitussive drugs, according to the type of cough, are more effective than antibiotics in acute cough,32,33 the antibiotic prescription still confirms widespread and likely led by patient / parent suggestions, as already verified in the primary care setting.34 aerosol therapy confirms as the most prescribed treatment for cough, but the nebulized drugs used are frequently corticosteroids and bronchodilators, both in acute and chronic cough, regardless of the cough etiology . However, it should be noted that the aerosol therapy and the bronchodilator use in particular do not improve the recovery from cough due to urtis in non - asthmatic children.35,36 we would finally highlight that the use of mucoactive and antitussive drugs was scarce compared to homeopathic and herbal remedies . Safer for children,31,37 even if recent data have suggested that mucoactives and antitussives may have a role in reducing acute cough in children as an alternative to antibiotics prescription, which is largely ineffective when cough is due to viral infections.32,33 the present survey has some limitations . First, the question about the causes of cough can lead to some misinterpretations, because respondents mainly indicated a general etiology for cough rather than a specific disease . For instance, several pediatricians reported allergy as a general cause of cough, while a more detailed definition of the allergy - related diseases, such as asthma, rhinitis, and eosinophilic bronchitis, would have allowed a more precise cough etiology.3141 moreover, open questions about the causes of cough introduced some problems in discriminating a wide range of acute urtis, such as sinusitis, pharyngitis, laryngitis, tracheitis, and bronchitis . In order to indicate urtis of possible viral etiology, urtis with unspecified etiology and viral infections data of the present survey tend to confirm that cough is a very common and multifaceted problem in children and that it is prevailing throughout all the year . The great majority of pediatricians tend to prescribe drugs in acute cough regardless of cough guidelines . In the management of chronic cough, they search for a possible etiology, but frequently they are not perfectly oriented . On the other hand, the extremely high requests for allergologic tests do not match with the clinical suspicion for asthma . Regarding cough s treatment, there is a strong need of promoting much more rational strategies for antimicrobial use . Actually, both the incomplete diagnostic procedures and the incorrect therapeutic approach (particularly the antibiotic misuse) can substantially affect the burden of cough . Cough is a symptom which is common to several diseases, and which represents the most frequent reason for a pediatric consultation, due to the anxiety and discomfort induced . Some clinical investigations are needed in order to precise the origin of cough, particularly when it is persisting for long periods, and causes significant limitations in patient s daily - life activities . The present questionnaire is aimed to investigate anonymously the diagnostic and therapeutic behavior of pediatricians in the presence of cough . Thank you for your valuable cooperation . Note: this is an english translation of the original version of this questionnaire, which was presented in italian . Cough is a symptom which is common to several diseases, and which represents the most frequent reason for a pediatric consultation, due to the anxiety and discomfort induced . Some clinical investigations are needed in order to precise the origin of cough, particularly when it is persisting for long periods, and causes significant limitations in patient s daily - life activities . The present questionnaire is aimed to investigate anonymously the diagnostic and therapeutic behavior of pediatricians in the presence of cough . Thank you for your valuable cooperation . Note: this is an english translation of the original version of this questionnaire, which was presented in italian.
|
Biochemically, obesity can be defined as a failure of the normal energy homeostasis mechanisms which are required to balance the intake and the expenditure of energy [1, 2]. The regulation of the size of fat stores is a complex process and involves both central and peripheral tissues [1, 3] and over 50 secreted molecules, such as the adipocytic hormones leptin and adiponectin [4, 5], gastric ghrelin [6, 7], and intestinal cholecystokinin . Many of these molecules also play a role in various diseases associated with obesity, particularly, nonalcoholic fatty liver disease (nafld) [7, 9]. Nonalcoholic fatty liver disease (nafld) is a spectrum of diseases ranging from relatively benign fatty liver (simple steatosis) to nonalcoholic steatohepatitis, or nash, characterized by inflammation and ballooning degeneration of hepatocytes, which may progress to fibrosis or cirrhosis . Nafld is considered to be the hepatic manifestation of metabolic syndrome affecting both adults and children [10, 11] and is thought to reach a prevalence of up to 30% in the general population [1113]. The association of nafld with obesity, particularly visceral obesity, has long been recognized . Although a number of pathways, such as enhanced oxidative stress, increased susceptibility to apoptosis, and insulin resistance have been implicated in the pathogenesis of nafld, little is known about the triggers of the progression to nash, hepatic fibrosis, and ultimately cirrhosis . Not all individuals with nafld progress to cirrhosis . Additionally, not all obese patients develop nash . One explanation for this differential progression maybe the contribution of nonadipose peripheral tissues to the pathogenesis of obesity - related nafld . Given that the stomach is one of the central organs of the digestive tract relaying satiety signals to the hypothalamus [14, 15] and is a source of peptides with critical roles in energy homeostasis (ghrelin), its participation in the development of obesity related nafld or its progression looks plausible . The discovery of ghrelin and its role in human metabolism has intensified the studies of hypothalamic control of the appetite and its contribution to obesity . In 2005, it was found that the ghrelin - encoding gene also encodes obestatin, which, unlike ghrelin, is involved in appetite suppression . In addition to ghrelin and obestatin, the stomach is the second largest source, after adipose tissue, of the appetite inhibiting peptide leptin [1820]. Yet, studies on the role of gastric tissue in obesity - related disorders, such as nafld, are scarce . In our previous study, we showed that the serum levels for common stomach hormones are altered in patients with advanced stages of nafld . In particular, concentrations of des - acylghrelin in serum of patients with nash were increased twofold as compared to bmi - matched controls with simple steatosis, while concentrations of ghrelin and obestatin were increased in patients with advanced liver fibrosis . Other studies showed that the levels of ghrelin are related to inflammation and reduce the severity of inflammation [21, 22]. An overproduction of the ghrelin in the patients with advanced stages of chronic liver disease may be a compensatory event or a reflection of local inflammatory responses on site of their production . Observations listed above prompted us to hypothesize that the gastric tissue in obese subjects is actively contributing to the systemic inflammation and pathogenesis of one of the complications of obesity, nafld . To investigate this, we performed comparative expression profiling for 84 genes encoding inflammatory cytokines, chemokines, their receptors and other components of inflammatory cascades in samples of gastric tissue removed during sleeve gastrectomy . This study was approved by inova institutional review board (federal assurance fwa00000573). After informed consent, 20 morbidly other chronic liver diseases were excluded by negative serology for hepatitis b and c, no history of toxic exposure and no other cause of chronic liver disease . Excessive alcohol consumption (> 10 grams / day in women and> 20 grams / day in men) was also excluded . No patients were receiving thiazolidinediones (tzds) or medications for gastritis, including proton pump inhibitors . From each patient, a discarded gastric tissue during sleeve gastrectomy was obtained and snap frozen with liquid nitrogen . Gene expression profiling experiments were performed using fundic samples collected from the remaining sleeve gastrectomy specimens . Samples were profiled for expression levels of 84 genes encoding inflammatory cytokines, chemokines, their receptors, and other components of inflammatory cascades using rt profiler pcr arrays (qiagen, usa) (see supplementary table 1 in supplementary material available online at http://dx.doi.org/10.1155/2013/684237). For each patient, a liver biopsy was performed and read by the hepatopathologist . Before histopathological evaluation, each liver biopsy specimen was formalin - fixed, sectioned, and stained with hematoxylin - eosin and masson's trichrome . The slides were reviewed following a predetermined histologic grading system; the extent of steatosis was graded as an estimate of the percentage of tissue occupied by fat vacuoles as follows: 0 = none, 1 5%, 2 = 633%, 3 = 3466%, and 4 66% . Other histological features evaluated in h & e sections included portal inflammation, lymphoplasmacytic lobular inflammation, polymorphonuclear lobular inflammation, kupffer cell hypertrophy, apoptotic bodies, focal parenchymal necrosis, glycogen nuclei, hepatocellular ballooning, and mallory - denk bodies . Patients who had hepatic steatosis (with or without nonspecific inflammation) or nash were considered to have nafld . Nash was defined as steatosis, lobular inflammation, and ballooning degeneration with or without mallory - denk bodies and with or without fibrosis . Hepatic inflammation was defined according to an extent of immune cell infiltration (lymphoplasmacytic cells, polymorphonuclear cells, and kupffer cell hypertrophy). For each category, score was assigned based on the following system: 0 = none, 1 = few, 2 = moderate, and 3 = many . Severity of total hepatic inflammation was determined based on the sum of the individual scores with advanced hepatic inflammation 3 and mild / no hepatic inflammation <3 . Severity of pericellular and portal fibrosis was determined based on a similar scoring system as follows: 0 = none, 1 = mild, 2 = moderate, and 3 = marked fibrosis . Severity of total hepatic fibrosis was determined based on the sum of the individual scores (pericellular and portal fibrosis) with a score of 3 being considered as advanced hepatic fibrosis and a score of <3 being considered as mild / no hepatic fibrosis . Total rna was extracted from fundic gastric tissue samples (n = 20) using rneasy kit (qiagen, usa) according to manufacturer's instructions . To determine the quantity and purity of the extracted rna, absorbances were measured at 260 nm (a260) and 280 nm (a280) by the genequant1300 spectrophotometer (ge healthcare, usa). Rna with sharp, clear 28s and 18s ribosomal rna (rrna) bands and the intensity of 28s rrna band approximately twice as intense as the 18s rrna band were used as parameters to evaluate the integrity of total rna . 560 ng of extracted total rna was reverse transcribed using rt first strand kit (qiagen, usa). According to manufacturer's protocol, total rna was treated to eliminate genomic dna . Both random hexamers and oligo - dt primers were used to prime reverse transcription performed as recommended by enzyme manufacturer (qiagen, usa). Quantitative real - time pcr was performed in 96 well pcr format using bio - rad cfx96 real time system (biorad laboratories, usa) with a ramp speed of 1c / sec . Inflammatory cytokines and receptor rt profiler pcr arrays (qiagen, usa) were used to simultaneously examine the mrna levels of 84 genes encoding for inflammatory cytokines, their receptors and intracellular components of inflammatory cascades along with five housekeeping genes following the manufacturer's protocol . The real - time pcr mixtures consisted of 1 l cdna and 7.5 l of rt pcr master mix (qiagen, usa) in a final volume of 25 l . The thermal profile of the rt - pcr procedure was repeated for 50 cycles: (1) 95c for 10 min; (2) 10 s denaturation at 95c and 15 s annealing at 60c (amplification data collected at the end of each amplification step); (3) dissociation curve consisting of 10 s incubation at 95c, 5 s incubation at 65c, and a ramp up to 95c (bio - rad cfx96 real time system, usa). The results of the rt profiler pcr array were further confirmed by independent qpcr experiments . For the genes with significantly altered expression levels, the primers were designed using primer3 from ncbi ((supplementary table 2). The validation was carried out using the thermal profile for 40 cycles: (1) 95c for 10 min; (2) 10 s denaturation at 95c and 15 s annealing at 60c (amplification data collected at the end of each amplification step); (3) dissociation curve consisting of 10 s incubation at 95c, 5 s incubation at 65c, and a ramp up to 95c (bio - rad cfx96 real time system, usa). The real - time pcr mixtures consisted of 1 l cdna, 5 l of ssofast evagreen supermix (bio - rad, usa), and 250 nm final concentration of primers (invitrogen, usa) in a final volume of 10 l . Values were collected for the threshold cycle (ct) for each gene, and only ct values less than 40 were considered for further analysis . Normalization of each target gene was carried out relative to five housekeeping genes [24, 25] according to the manufacturer's instructions (qiagen, usa). Average of ct values for five housekeeping genes (ct) on the same array (b2 m, hprt1, rpl13a, gapd, and actb) was calculated . The normalized ct was log transformed; resultant values were utilized for calculation of the fold change of each target gene in different cohorts . For each target gene, the fold change was used to compare the gene expression levels in two different groups within a cohort (group a and group b). In this study, group a may be the diseased state and group b the nondiseased state; group a may be the advanced diseased state and group b the mild / nondiseased state . C t values of control wells (genomic dna control, reverse transcriptase control, and positive pcr control) were examined separately for assessing the quality of each run and interpolate variability . For the validation of the pcr array results this study aimed for uncovering changes in gene expression in the stomach of patients with more advanced forms of nafld as compared to these with less advanced forms . Comparisons were performed for the following paired cohorts: mild or no hepatic inflammation versus advanced hepatic inflammation; mild steatosis versus advanced steatosis; histologic nash versus nafld without histologic nash; hepatic fibrosis versus nafld without hepatic fibrosis . Mild or no hepatic inflammation versus advanced hepatic inflammation; mild steatosis versus advanced steatosis; histologic nash versus nafld without histologic nash; hepatic fibrosis versus nafld without hepatic fibrosis . To assess the significance of gene expression differences between compared groups, univariate analyses were performed using the nonparametric mann - whitney test to determine whether two variables covary, and to measure the strength of any relationship, spearman's coefficient of correlation was used . The independent effect of significant variables (p 0.05) on advanced inflammation, nash, and steatosis was assessed using multiple stepwise regression analysis with both the backward and forward stepwise selection procedures . The multiple test corrections were carried out using benjamini - hochberg - yekutieli procedure that controls the false discovery rate under positive dependence assumptions reflecting known phenomenon of cocorrelation of expression levels for genes involved in the same cellular or organismal process . In case the positive dependent assumption would turn incorrect, assumption - free benjamini - hochberg procedure was also applied . To put our finding into perspective, both benjamini - hochberg - yekutieli approved pvalues and the results of benjamini - hochberg test were reported . When cohorts with mild (score <3) and advanced hepatic inflammation (score 3) were compared, expression levels for chemokine (c - c motif) ligand 4 (ccl4), chemokine (c - c motif) receptor 5 (ccr5), chemokine (c - x - c motif) ligand 2 (cxcl2), chemokine (c - x - c motif) ligand 6 (cxcl6), interferon 2 (ifna2), interleukin 19 (il19), interleukin-1 family member 8 (il1f8), and interleukin 8 (il8), were significantly increased (p 0.05) (table 2). Among these cytokines, ccl4, ccr5, ifna2, il1f8, and il8 were also independently and significantly correlated with hepatic inflammatory scores (p 0.05) (table 3). Chemokine (c - c motif) ligand 21 (ccl21) and chemokine (c - c motif) ligand 3 (ccl3), on the other hand, were found to be significantly correlated (p 0.05) with hepatic inflammatory scores, but did not show significant differential expression in the group - wise comparisons (p 0.05) (table 3). In patients with advanced hepatic steatosis (score 3), chemokine (c - x - c motif) ligand 14 (cxcl14), interleukin-1 family member 10 (il1f10), and interleukin 8 receptor (il8rb) had a significant differential expression (p 0.05) as compared to those with mild steatosis (score 2) (table 2). In addition, il8rb and il1f10 levels were positively correlated with a degree of steatosis (p 0.05) (table 3). Patients with presence of histologic nash as compared to those nafld patients without nash showed a significant differential expression of chemokine (c - c motif) receptor 3 (ccr3), chemokine (c - c motif) receptor 9 (ccr9), interleukin 1 receptor antagonist (il1rn), interleukin 8 receptor (il8ra), and interleukin 9 (il9) (p 0.05) (table 2). Spearman's correlation coefficient analysis showed some of the differentially expressed genes, namely, ccr3, ccr9, il1rn, il8ra, and il9 to be also positively correlated with nash (p 0.05) (table 3). Additionally, il8rb, chemokine (c - x - c motif) ligand 14 (cxcl12), and chemokine (c - x - c motif) ligand 1 (ccl1) were also positively and significantly correlated with nash (p 0.05) (table 3). In patients with hepatic fibrosis, only chemokine (c - x - c motif) ligand 17 (ccl17) was significantly upregulated (p 0.05) (table 2). A different set of genes, small inducible cytokine subfamily e member 1 (scye1), il1rn, and complement component 5 (c5), however, were positively correlated with severity of fibrosis (p 0.05) (table 3). To predict advanced hepatic inflammation, a single equation multivariate regression model was generated . In this model, only four variables ccl21, ccr5, alt, and age acted as predictors of advanced inflammation, where ccl21 (p <0.0007) and ccr5 (p <0.0064) were the strongest predictors (table 4). These four predictors explain 66% of the variance in the inflammation phenotype (r = 0.66). For understanding the effect of independent variables on pathogenesis of histologic nash, the multivariate regression generated a statistically significant model (p <0.002) with ccr3, cxcl12, il1rn, il8ra, il8rb, and interleukin 5 (il5). This model explained 75% of the variance in nash phenotype (r = 0.75). The model of advanced hepatic fibrosis (p <0.006) included only il1rn (p <0.006) as a sole component explaining 34% of the variance in fibrosis (r = 0.34). Interestingly, none of the genes showing differential regulation (p 0.05) or significantly correlated with the degree of steatosis were able to contribute significantly to the model for steatosis; hence, no models resulted from these analyses . However, it has limited capacity to store lipids . Therefore, excess lipid buildup can result in the development of nafld . One of the critical thrusts in the studies of the progression of nalfd has been the search for factors that may influence the progression of steatosis to nash and cirrhosis . According to the multiple hit model of nafld, many hits may act in parallel or in tandem contributing to this pathogenesis . Of these, gut - derived and adipose tissue inflammation, a central player in the pathogenesis of nash, can enhance the probability of progression of fibrosis to nash - related cirrhosis . In the past decade, white adipose tissue has been considered as a major source for inflammatory cytokines and chemokines in obese patients [2931]. In addition to the adipose tissue, it was suggested that other tissues, particularly, gastric and intestinal tissues may overproduce various soluble molecules and contribute to overall inflammatory background influencing distant organs . Our study is the first to show that mrnas encoding for various soluble molecules are overproduced in the gastric tissue of morbidly obese patients with advanced forms of nafld . Remarkably, there was a substantial overlap in genes with significant differential expression (p 0.05) and genes with significant correlation (p 0.05) to the same histological characteristic of nafld (supplementary figure 1). Further, distinct and notably, nonoverlapping sets of soluble molecule encoding genes change their expression along with various histological features of nafld (figure 1). Importantly, an overlap between sets of genes significantly correlating (p 0.05) with a specific histological characteristic of nafld was minimal (figure 1). Il8rb / cxcr2 is a notable exclusion with its overexpression correlating with steatosis and diagnosis of nash as well as fibrosis . Il8rb / cxcr2 is a receptor for the il8 chemokine that plays an important role in liver inflammation, regeneration, and repair [32, 33] as well as in the neutrophil accumulation in other inflammatory conditions [31, 34]. Increased levels of the gastric expression of il8rb gene indicate that in morbidly obese patients with nash - associated inflammation, il8 activation is not limited to hepatic macrophages as had been shown before, but is a system - wide feature . It is plausible that il8rb present on the resident gastric macrophages cells or on neutrophils activates the neutrophils locally upon its binding to il8 . In turn, activated neutrophils may then release additional chemokines and/or may enter the liver through portal circulation and influence the progression of nafld (figure 2). This premise is also supported by our observation that the expression of il8 gene that encodes the ligand for il8rb positively correlates with advanced hepatic inflammation (table 3). Circulatory il8 levels are reported to increase under oxidative stress and, in turn, stimulate further increase in levels of oxidant stress mediators by local recruitment of inflammatory cells (figure 2). As an expanding adipose tissue of obese individuals releases increased levels of il8 [9, 30], it may trigger increased expression of gastric il8 and its receptor il8rb . Additionally, studies have shown that free fatty acids (ffa), also increased in obese individuals, influence expression of il8 in various peripheral tissues [36, 37]. Thus, the paired increase in levels of il8 and its receptor found in the gastric tissue of obese may act to activate local as well as circulating, thus contributing towards vicious cycle of inflammation and influencing progression of nafld . The expression levels of anti - inflammatory receptor il1rn, an antagonist of il1a and il1b, were positively correlated both with the presence of nash and with fibrosis (table 3). In the regression model predicting fibrosis, expression of il1rn mrna was the only significant component that explained 34% of the variance in fibrosis . Additionally, il1rn mrna expression significantly contributed to the regression model predicting nash (table 4). These observations are in agreement with a recent report on association of serum il1ra levels and liver il1rn expression with nash . Il1ra is expressed and secreted by a number of immune cells such as monocytes, macrophages, and neutrophils as well as epithelial cells and hepatocytes . As its expression is regulated by proinflammatory cytokines, il1rn is considered to be an acute phase protein with levels elevated in many inflammatory conditions . We hypothesize that increased levels of circulating and/or local proinflammatory cytokines upregulate gastric il1rn expression either directly or via activated leukocytes (figure 2). Once upregulated, il1ra may stimulate its own gastric expression by a positive feedback loop (figure 2). This mechanism is supported by studies showing elevated circulating il1rn in patients with obesity and nafld [38, 42]. Many genes differentially expressed in the gastric tissue of patients with advanced forms of nafld encode chemokines previously shown as important players in a variety of inflammatory conditions . For example, expression levels of both ccl4 chemokine and its receptor ccr5 encoding genes showed significant upregulation in advanced hepatic inflammation (table 2) and a positive correlation with the severity of the hepatic inflammation (p 0.05) (table 3). In the multivariate regression model, ccr5 mrna level also was one of the strongest predictors of the severity of hepatic inflammation (table 4). Ccl4 attracts natural killer cells, monocytes, and a variety of other immune cells . The increased expression of ccl4 and ccr5 genes in gastric tissue could be attributed to local immune cells activated in response to upstream regulators like il1f8 (figure 2). In the present study, il1f8 gene was also upregulated in stomach tissue of patients with advanced liver inflammation (tables 2 and 5). While the role of ccl4/ccr5 in the pathogenesis of nafld remains to be sketched out, these collective findings make it an attractive target for further investigation . The complex interaction of cytokines, chemokines, and their receptors highlighted in this study suggests that the gastric tissue is an integral player in obesity - associated nafld . It seems that in obesity, an increase in inflammatory responses of adipose tissue corresponds to similar increase in the inflammation within the tissues involved in satiety response . Activated immune cells embedded in the gastric tissue may then recruit additional immune cells or be released in circulation, and hence amplify the inflammatory response and promote the development and progression of nafld (figure 2). An increase in recognition of the endocrine function of the stomach and its contributions to energy homeostasis this, in turn, may trigger a cascade of metabolic dysfunction culminating in nafld (figure 2). It remains to be determined if the complex interaction of inflammatory molecules in gastric tissue lies upstream or downstream of the intricate network of inflammatory signaling, which is the hallmark of nafld . Evidently, the stomach plays a certain role in metabolic dysfunction; its potential proinflammatory properties should not be neglected by studies of the conditions related to metabolic syndromes, including nafld . In this study, we demonstrate an altered pattern of gene expression for cytokine and chemokine encoding genes in the gastric tissue of individuals with obesity and varying degrees of hepatic inflammation and different forms of nafld . Soluble inflammatory molecules produced by the stomach appear to contribute to obesity - related nafld . Although the causal links between these signaling events remains to be determined, we propose that the fundus of the stomach is an integral player in the signaling milieu associated with both obesity - related nafld.
|
Infection by helicobacter pylori (h. pylori) is associated with gastritis, duodenal and gastric ulcer, gastric adeno - carcinoma and mucosa - associated lymphoid tissue lymphoma . In developing countries infection occurs predominantly in childhood and the infected individuals maintain h. pylori strains in their stomach for the decades . Numerous studies have suggested presence of genetic difference between h. pylori strains isolated from various geographical areas . However, some relatedness was observed between the h. pylori strains isolated in one geographical area . Concerning pathogenicity - associated markers (caga and vaca), correlation was observed between vaca s1 genotype and caga status of h. pylori and more severe gastroduodenal diseases . However, some discrepancies related to either the geography of strains, or generation of variants during infection, was observed . The studies investigating genomic diversity among h. pylori strains have employed restriction - endonuclease patterns, ribotyping, sequencing of housekeeping genes, and pfge . Pfge is a rapid method for characterization of individual strains of bacterial species and to demonstrate the clonal relation between the bacterial strains regardless of the year of isolation . This method may also be the most suitable for a local epidemiological study of the molecular relatedness among h. pylori strains isolated from unrelated patients . Previous studies on molecular relatedness of h. pylori isolated from the members of the family have shown the identical alleles found in some strains isolated from the children and parents, but not in the strains isolated from unrelated patients . The purpose of this study was to look for the degree of genomic diversity among h. pylori strains isolated from unrelated iranian children, on the basis of vaca genotype, caga status of the strains, and age, sex, as well as the pathological status of the patients . Strains were isolated from 44 pediatric patients during the periods of 19971999 (group i), 20012003 (group ii), 20052007 (group iii), and 20072009 (group iv). The reason of this strain selection was to study the molecular relatedness of h. pylori strains isolated in this area from non related patients in avoiding their clonal relation . So the patients admitted to children s medical center, tehran for their persistent upper gastrointestinal problems during 19972009, were selected . Local ethics committees approved the protocols under which the biopsies for histology and culture were obtained, and informed consent has been obtained . For isolation of primary h. pylori strains, the antral biopsies have been processed according to the previously described protocol . Briefly, the isolates were cultivated on campy - blood agar plates containing brucella agar base, 10% sheep blood, and antibiotics after enrichment in modified campy - thio medium (merck, germany). Following the initial growth in campy - blood agar plates, the pure cultures were produced from each isolate and identification was performed by gram staining, positive urease, oxidase and catalase tests . Strains identified as h. pylori, were stored in skim milk containing 15% glycerol (merck), and 10% fetal calf serum (gibson) at 70c . Histological examination of the biopsies, has been performed after h&e, and giemsa staining; h pylori density, gastritis, and inflammation were graded according to the modified sydney system to mild (mic), moderate (mac) and severe active chronic (sac) gastritis, as previously described . Chromosomal dna was extracted from 72-hour - old confluent cells by using the previously described procedure . Pcr primers and protocol for amplification of 16s rrna, caga genes as well as vaca (s1, s2, m1, and m2) alleles, were those previously described . Dna preparation and pfge was performed using the protocol adopted from the previously described procedure, with some modifications . In brief, two days bacterial cultures were harvested and suspended in one ml phosphate buffer saline, resuspended in 12 ml te buffer to obtain a turbidity equivalent to that of mcfarland no . Cell suspension was warmed to 37 c, and 150 l was mixed with an equal volume of 2% low - melting point (lmp) agarose to prepare the agarose plugs . The solidified plugs were incubated for 48 h in the lysis buffer (0.25 m edta [ph 8.0], 0.5% lauryl sarcosine, 50 l proteinase k) at 50 c . The plugs were washed three times in 10 mm te buffer containing 1 mm phenyl methyl sulfonyl fluoride for 20 min, followed by three times washing in te buffer each at 4 c . For the subsequent enzyme reaction, the te buffer was removed; the plugs were incubated with 100 l of the xbai enzyme buffer for 15 min at 36 c . The enzyme buffer was replaced with 100 l fresh enzyme solution containing 15 u of enzyme and incubated at 36 c for 4 h. after the incubation period, the plugs were washed once in te buffer and were loaded into the 1% pulsed field certified agarose gel (invitrogen). For pfge analysis, a field inversion gel electrophoresis (fige) system was used for 16 h at 4 c and 130 v. the pulse times varied from 2.4 to 3 s to examine various - sized fragments . Dna obtained from staphylococcus aureus nctc 8325 strain was used as the size marker . Forty four pediatric patients with no more than one h. pylori strain regarding vaca genotypes were used in this study . Information related to the age, sex, the date of h. pylori isolation, as well as the vaca genotype / caga status is provided in table 1 . Patients and strains - related data group i, ii, iii and iv corresponded to the strains isolated during 19971999, 20012003, 20052007, and 20072009, respectively the 26695 standard h. pylori strain produced 9 reproducible fragments on xba1 pfge gels, whereas 35 (80%) of the isolates showed 8 to 12 fragments, 4 isolates contained 5 to 7 fragments and 5 isolates showed 1314 fragments . The strains were classified according to the numbers and the size of xbai fragments on pfge gels . Association between the pfge patterns of the strains and their caga status, as well as vaca (s, m) alleles was evaluated . Relationship between the pfge pattern of the strains and sex, age and pathological status of children was also assessed . No significant relationship was observed between the patterns of pfge (number and size of the fragments) and the caga status or vaca / caga genotype (fig 1, table 2). Also, no significant relationship was observed between age, sex, and pathological status of the children and the pfge patterns of their isolates . The pfge patterns of the strains were also compared on the basis of isolation date (fig ., the patterns of pfge were also analyzed using total lab software (total lab and phoenix software, www.totallabs.com). The same conclusion was obtained concerning absence of significant relationship between the pfge patterns of the isolates and their vaca / caga genotype / status, and pathological status of the children . Fig 3 represents the relationship between pfge patterns and vaca / caga, as well as the pathological status among 12 isolates of group iii (total lab and phoenix software). Pfge profile comparing the caga - positive with caga - negative isolates numbers above of the fig represent the number of strains according to table 1 . Lanes 1, 2, 48, 10, 1213, and 1516 represent the caga - negative isolates . Lanes 3, 9, 11, 14, and 17 represent the caga - positive isolates . Lane 18: 26695 standard strain (sizes of xbai digested fragments: 370, 270, 260, 215, 200, 100, 80, and <80 kb . Pfge profile of isolates from group iv numbers above figures represent the number of strains according to table 1 . Representative dendrogram for demonstrating relationship between pfge patterns and vaca / caga and pathological status among 12 isolates of group iii performed by total lab and phoenix software . Numbers in left represent the number of strains according to the table relationship between comparable shared fragments (bands) on pfge gels and vaca / caga genotype / status of the strains comparison of the pfge patterns between the isolates of group i (199799), ii (20012003), iii (20052007), and iv showed the considerable genomic changes over time . Selection of unrelated children, favors comparison of genomic dna among non - clonally related strains . To compare the patterns of pfge among strains, we found that xba i restriction - endonuclease produced higher (514) number of fragments compared to noti (48) which allowed a better comparison of various dna fragments among strains . This is in agreement with data reporting that diversity is more frequent in countries in which h. pylori infection is highly prevalent . Most of the current information about genetic diversity of h. pylori has been obtained from genetic analysis of the sequence data obtained from h. pylori strains isolated in diverse geographical regions . In the present study, 44 h. pylori isolates from 44 different non - related individuals, were characterized in order to define the h. pylori population structure . It is a first work performed in this region demonstrating genetic diversity among h. pylori isolates from non - related patients . Numbers above of the fig represent the number of the strains according to table 1 . Lane 8: size marker staphylococcus aureus nctc 8325 strain (sizes of fragments: 674, 361, 324, 262, 257, 208, 175, 135, 80, and <80 kb, respectively). Comparison of the pfge patterns suggested that genomic diversity of the strains was not related to the genotype of vaca, status of caga and the status of gastric inflammation in children (fig . The fact that identical pfge pattern did not occur in the strains with similar pathogenicity - associated markers such as caga and vaca may suggest that the dna fragments undergoing genetic changes did not encode proteins that are involved in virulence . Comparison of multiple h. pylori strains by different methods have shown that h. pylori genome has highly plastic gene content and nearly half of the strain - specific genes may be located in each region . Numbers above figures represent the number of strains according to table 1 . Among our isolates, more relationship was observed between the strains isolated in the close period (19972009, 20012003, 20052007, and 20072009) and more difference was observed among those obtained in the distant periods (1997 and 2009) regardless of their caga / vaca status / genotype . This may be due to adaptation of h. pylori strains to variable living conditions during transmission between various host individuals over time . Comparison of 44 unrelated strains suggested that the degree of genetic diversity occurred in this region is very high but this diversity is not related to virulence determinants of the strains, sex, age and pathological status of the children . As these genomic changes may be related to adaptation of h. pylori strains to variable living conditions during transmission between various hosts, it may also increase during time in the regions with the high rate of infection such as iran . H. pylori strains isolated from children in iran are extremely diverse and this diversity is not related to vaca /caga genotype / status of the strains, as well as to sex, age and pathological status of the child patients . As more relationship existed between the strains isolated in the close period, this diversity may be related to adaptation of h. pylori strains to variable living conditions in various host, during time . T. falsafi, m.m feizabadi: design the study and write the manuscript also provide vital analytical tools n. sotoudeh: performe the majority of experiments f. mahjoub: performe the pathological examination and participate to critical reading of the manuscript.
|
Studies have reported that men are more prone to diseases and have a higher mortality rate than women . Previous investigations have shown that men adopt more inappropriate lifestyle choices, are less concerned about their health, ignore the warning signs of the disease, and also have late referral to medical centers compared with women . According to the official census published by american cancer society, prostate cancer was reported as the second leading cause of cancer death among american men after lung cancer and its incidence ranked the first among all cancers in 2013 . However, in iran, the rate of deaths from prostate cancer is found relatively higher than other types of cancers . Remarkably, with 1309 deaths in 2013, its mortality rate was estimated as 3.85 per 100.000 men in the same year . According to statistical surveys, this was higher than that of esophageal and laryngeal cancer but lower than that of gastric, lung and bronchial cancer . Based on the published statistics, its age - standardized incidence rate in iran during 2003 to 2008 was reported as 4.69, 7.16, 14.04, 16.65, and 16.02 per 100,000 men, respectively, indicating an increasing trend of the disease in iran during the mentioned years . Prostate cancer is fully and definitely treatable if diagnosed and detected early before the metastasis of the disease . Since such a cancer is often asymptomatic, it is diagnosed after its progress to the later stage that is incurable . At this stage, it has no definite treatment, so the mortality rate increases . In 2013, the american cancer society recommended that men aged older than 50 should be aware about screening for early prostate cancer detection and those who are at risk of developing the disease should receive information about such screening at earlier ages . Ethnicity, a family history of the disease, age and obesity are known as the risk factors of this cancer . Despite being asymptomatic digital rectal examination (dre) and prostatic - specific antigen (psa) are routine testing techniques for early prostate cancer diagnosis . Transrectal ultrasound (trus- guided prostate biopsy is also another most commonly used method of diagnosing the disease . Furthermore, prevention and early detection of cancer are considered as critical factors in controlling the disease and increasing the survival of patients . Therefore, the importance of public health education should be emphasized in developing countries where people have inadequate information about screening methods . Various studies have shown that men with higher levels of knowledge show higher tendency towards such screening . When counseling and education is done based on a specific protocol health belief model (hbm) has been widely used to measure the health beliefs and behaviors about cancer screening . The perceived susceptibility, severity, benefits, and barriers are four main components of the hbm . Behavior was explained by the hbm as ensuing from the combination of attitudes associated with four concepts . Perceived severity: feelings concerning the seriousness of acquiring a sickness or of leaving it untreated embody evaluations of each medical and clinical consequence (for example, death, disability, and pain) and potential social consequences (such as effects of the work, domestic life, and social relations). Perceived benefits focus on the effectiveness of healthy behavior in reducing the threat of the condition . Perceived barriers is the potential negative aspects of a particular health behavior, a kind of unconscious, cost - benefit analysis occurring when the individuals know the perceived barriers are more costly than the perceived benefits; then, they take action to do screening . For example, these barriers can be expensive, time consuming, unpleasant, painful or upsetting . In addition to the four original concepts, health motivation has also been used as part of the hbm in predicting health related behavior . Health motivation refers to a generalized state of intent that results in behaviors to maintain or improve health . The concept of health motivation used in combination with the original four hbm concepts has evidence of significant predictive ability . Therefore, in this study we used hbm focusing on prevention as a reference framework . Currently, there is a lack of consideration towards men s health, especially the middle - aged and elderly ones . Due to the increasing number of cases with prostate cancer reported by clinical specialists, which are caused by the late referral of the patients, we aimed to investigate the effect of hbm - based education with the purpose of increasing knowledge and the health belief about prostate cancer and prostate cancer screening behaviors . This study was approved by the ethics committee of shiraz university of medical sciences (ethics committee approval number: ct-92 - 6721). In this non - blinded randomized controlled trial, 210 men aged we selected our participants from the population of men who were retired from shiraz department of education, using a simple random sampling method . The researcher referred to the list of the males retired from shiraz education department, using table of random numbers . Their positive and broader insights towards research projects could facilitate easy accessibility to them for further follow - ups and evaluation of the results . Shiraz general department of retirement affairs was chosen as research setting due to the large number of referrals for welfare and administrative affairs . The sample size was calculated as 105 in each group based on the data of similar studies and using power ssc statistical software (power: 80%,: 0.05, mean difference: 1.6, loss rate=20% and sd: 3.2). Quadri- balanced block randomization method was used to randomize the participants into intervention and control groups . In this study therefore, we used two variables, a and b, for them, respectively . By taking two variables a and b in quaternary blocks, six modes of movement were possible . According to the sample size (210) then, the blocks were randomly written on paper and the researcher referred to the list of men and placed them in the blocks . Afterwards, 30 men were excluded due to their withdrawal from participation in the study, so the number of final participants was 93 and 87 in the intervention and control groups, respectively (figure 1). Consort flow diagram of participants inclusion criteria were willingness to participate in the study, giving written informed consent, no history of prostate cancer and prostatic hyperplasia with obvious clinical symptoms, age of 50 to 70 years, and lack of severe vision and hearing impairment . However, exclusion criteria were absence in training sessions and participation in similar training courses . After explaining the aims of the study, written informed consent was obtained from all the participants and their anonymity and confidentiality were guaranteed . Data were collected by the researcher and a trained research assistant through face to face interview by using three different questionnaires including demographic questionnaire, prostate cancer screening- health belief model scale (pcs - hbm) and the knowledge prostate cancer screening questionnaire . The demographic questionnaire was developed by the researcher; it included 13 questions about demographic characteristics of the participants . The questionnaire provided information about age, marital status, educational level and monthly income, history of prostate cancer and prostatic hyperplasia with obvious clinical symptoms, history of undergoing prostate cancer screening using dre and psa testing, a family history of the mentioned cancer, knowledge about the disease as well as the methods of acquiring knowledge about it for researcher . Scores ranged from 0 to 12 with higher scores reflecting a higher level of knowledge . Scores lower than 7, 7 - 9 and 10 - 12 were considered as low, intermediate, and good, respectively . Prostate cancer screening - health belief model scale (pcs - hbm)which was designed by capik and gozum (2011) included 41 items with a 5 point likert scale anchored at 1=completely disagree and 5=completely agree . The scale consisted of 41 questions and 5 sub - scales including perceived susceptibility (5 items), perceived severity (5 items), health motivations (10 items), perceived barriers (15 items), and perceived benefits (7 items). An increase in the scores for the sub - scales of susceptibility, severity, motivation and benefit and a decrease in the score for the sub - scale of barriers reflected the positive effect of the intervention . Pcs - hbm and prostate cancer screening knowledge questionnaire were translated in persian using back translation technique, which includes the use of a panel of experts and interpreters to translate the items from the source language to the target language and then they were back - translated to the source language . Then, some changes were made to adapt this instrument to iranian culture . After performing a pilot study on 30 men retired from shiraz department of education, the reliability coefficient for pcs - hbm and prostate cancer screening knowledge questionnaires was calculated, using cronbach alpha and kuder richardson 20technique . After analyzing the data, kuder richardson 20 coefficient was calculated as 0.98 for the knowledge prostate cancer screening questionnaire and cronbach s alpha was calculated as 0.83 for pcs - hbm questionnaire . To assess the prostate cancer screening behaviors of men in the intervention group, they were given referral forms for free consultation with a urologist and prostate cancer screening . Subsequently, the participation rate of men, who had not been screened within the last year, was examined one and three months after the intervention . Afterwards, the participants of the intervention group attended training workshops consisting of two four - hour sessions for two days, in groups of 15 participants . The educational program was designed based on pre - test results and structures of health belief model . Educational intervention was performed in the intervention group through lecture, group discussion with questions and answers, and brain storming . The learning process was facilitated by teaching aids, such as videos, photos and booklets . In the first session, first lecture method was employed due to little information in most of the subjects to make them familiar with prostate cancer, its anatomy, physiology, functions of prostate gland, pathology, and effective risk factors . Then, we used perceived susceptibility structure, talked about the incidence and prevalence rate of prostate cancer in iran and the world, signs and symptom of prostate cancer, and the current treatment modalities of prostate cancer . Then, with regard to adults education theory which considered free discussion as a necessary part of education, the subjects held group discussion . Then, by considering the perceived severity, those whose parents, relatives or a close friend had died as a result of prostate cancer were invited to talk about the severity of the complications of prostate cancer as someone who had experienced it . Finally, the complications of the lack of health, especially low levels of primary and secondary prevention, were discussed by the participants . In the second session, first lecture method was employed due to low level of information in most of the subjects to make them familiar with methods of prostate cancer screening . The subjects had group discussion on benefits and advantages of prostate cancer screening in prevention of prostate cancer, treatability of prostate cancer in the early stage, and cost efficacy of prostate cancer prevention . In order to help the subjects to brain storm in education, all the inhibiting obstacles in unimportant subjects complications of diagnosis of prostate cancer and positive predictive value(ppv) and negative predictive value (npv) of psa test were indicated and related strategies were mentioned . Then, the clients discussed about the ear of prostate cancer screening . The men participating in the control group received no planned educational program, but the intervention sessions were offered to this group after the study was completed . Statistical qualitative tests, analysis of covariance (ancova), chi - square, independent and paired t - test were used as appropriate . The age range of the participants was 50 - 70 years and their meansd age was 58.14.8 and 56.85.3 in the intervention and control groups, respectively . Independent t - test showed no significant difference between the two groups with respect to their age p=0.08 . There was a significant difference between the groups in terms of educational level and monthly income; those in the intervention group had a higher educational level and income compared of the participants in the control group (p>0.05). Regarding the randomized allocation of the participants, the results of ancova showed that the significant difference found between the groups in terms of income and educational level had no compounding effect on the study . The rate of the participants who had no family history of prostate cancer and no experience of undergoing dre and psa testing for prostate cancer screening was reported 87.2%, 95.6% and 85.6%, respectively . 86.1% of the men had no knowledge about such screening; however, the other respondents knew about it and reported television (48%), magazines and newspapers (20%), a family member with the same disease (12%), radio (8%), physicians (8%), and friends (4%) as their source of knowledge . According to table 1 which compares the knowledge level between the intervention and control groups before and after the intervention, 95.7% of the men in the intervention group were at low and intermediate levels before the intervention, while their levels improved to intermediate and good after the intervention nevertheless, we observed no significant changes in the control group in this regard (table 1). Comparison of knowledge level between the intervention and control groups before and after the intervention paired t - test showed a statistically significant difference in the mean score of hbm components in the intervention group after being compared with that before the intervention (p>0.05). In the control group, such difference was reported only for perceived susceptibility (p>0.05), while there was no statistically significant difference in the mean scores of perceived severity, barriers, benefits, and motivation (p>0.05). Independent t - test revealed a statistically significant difference between the intervention and control groups with respect to the mean scores of the perceived susceptibility, severity, barriers and benefits after the intervention (p>0.05) compared with before it (p>0.05). The results of the data analysis showed a statistically significant difference between the intervention and control groups regarding the mean scores of knowledge and motivation before the intervention (p>0.05). To reach a more accurate result (to control the significance effect of the mean scores of knowledge and hbm components in the intervention and control groups before the intervention), the mean difference scores were compared after the intervention . According to the result of independent t - test, a statistically significant difference was observed between the groups with respect to the mean scores of all hbm components after the intervention (p<0.001) (table 2). Comparison of the mean score (sd) of hbm components and knowledge between the intervention and control groups paired t - test indicated a significant difference in the mean score of knowledge in the intervention group after the intervention compared with before it (p<0.001), while no significant differences (despite a slight change) were observed in the control group (p=0.808). The participation rate of men in screening before the intervention, one month and three months after the intervention is shown in table 3 . The primary objective of this study was to increase participation in the screening and for this aim education based on the health belief model was implemented; then, we investigated the levels of knowledge, scores of the health belief components about prostate cancer, and the rate of participating retired men in prostate cancer screening . 86.1% of the retired men in this study had no knowledge about prostate cancer screening . Similarly, in a study which was conducted in north florida, 0.83% african american men had some knowledge about prostate cancer screening and 17% did not have any knowledge about it . Another study also indicated that 58% of male new yorkers were aware of prostate cancer screening in 2000 . In our study and another study in iran, (2007) was 67%; allen et al.s study (2010) reported 44%; and in sheridan (2012) it was reported 59% . Comparison of the results of these studies with those of our study indicates a low level of awareness about prostate cancer screening and low participation rate in prostate cancer screening among iranian men . Our findings were consistent with other studies indicating the significant increase of individuals knowledge level about prostate cancer after the intervention . A study which was done in turkey with this tool did not find a significant difference in the level of knowledge in men after an educational intervention by the web . Therefore, it can be concluded that for 50 to 70 year old men, face to face training and the group training could be more effective . In another study, it was confirmed that print arm is more effective than web arm and usual care to improve knowledge and reduce decisional conflicts about prostate cancer screening . All the aforementioned studies confirmed the importance of education and its effects on promoting the level of the individuals knowledge . We also observed a significant increase in the mean score of perceived susceptibility in the intervention group following the educational intervention and such result was similar to other studies on prostate cancer screening, diabetes mellitus and breast self - examination . Moreover, most of our participants believed that they might be at risk of prostate cancer . Perceived susceptibility could be the most powerful factor in predicting the behaviors . As to the perceived susceptibility, the belief that the disease can occur without any symptoms leads to initiation of screening behaviors . In our study, the mean score of such a component increased in the control group . Bakhtariaghdam et al . Also reached a similar result and suggested it could be due to the fact that taking the pre - test had made the respondents sensitive to the subject . However, ghaffari et al . Believed that it resulted from the curiosity of the participants in the control group to evaluate and complete the questionnaire at the pre - test stage . Similarly, we can conclude that such increase lies in the curiosity of the participants to find out more about the disease and increase their knowledge about it during the interval between pre - test and post - test phases which makes them sensitive to the subjects discussed in the questionnaire . Reminding our participants of serious complications and the chronic nature of prostate cancer and considering loss of health and the problems caused by such disease as well as high costs of treatment have been important factors which led to improvement of their level of perceived severity . Several investigations showed that evaluation of clinical outcomes by the individuals could also affect this component . Moreover, we found a significant difference between the two groups after the intervention in terms of perceived severity . This finding was in agreement with other studies on the effect of hbm - based education on osteoporosis preventive behaviors and breast self - examination . Furthermore, independent t - test showed a statistically significant difference between the intervention and control groups with respect to the mean score of perceived benefits after the intervention . Other researchers found similar results in examining the effect of hbm - based educational program on urinary tract infection and acquired immune deficiency syndrome preventive behaviors . We believe that medical and health care staff should constantly consult with men about the risk of prostate cancer progression and benefits of screening . Men should also talk with the staff about their fears and obstacles which prevent them from participating in screening programs as it can increase their responsibility for their own health . There are two factors which can facilitate the men s participation in prostate cancer screening: 1-the belief that dre and psa tests help diagnose the disease before the appearance of symptoms.2-the belief that early diagnosis and treatment can improve the prognosis of the disease . The belief that dre and psa tests help diagnose the disease before the appearance of symptoms . The belief that early diagnosis and treatment can improve the prognosis of the disease . In the incidence of preventive behaviors, perceived barriers are directly associated with early diagnosis and participation in prostate cancer screening, while education can remove such barriers and make men take action for early detection of the disease . According to both retrospective and prospective studies, perceived barriers is found to be the most powerful dimension of hbm in the expression and prediction of health protective behaviors . We observed a significant difference between the groups regarding the mean score of perceived barriers . Likewise, other researchers found a significant decrease in the dimension of perceived barriers after hbm - based educational intervention in their studies on prostate cancer screening and nutritional behaviors associated with gastric cancer . Moreover, we tried to decrease the barriers significantly by increasing the participants knowledge through education and providing free screening and consulting with a urologist . According to the results, the mean scores of health motivation appeared as significantly different between the groups . Our finding was similar to that of capk and gzm who found an increase in the motivation mean score; however, such increase was not statistically significant . Insignificant increase of motivation could be attributed to the participants low levels of knowledge and lack of sufficient information about prostate cancer and screening . Therefore, the significant increase of motivation in our study could be due to the proper knowledge level in the intervention group after training sessions and the efficiency of our educational intervention compared with internet and web - based education for men aged over 50 . Capk and gzm reported that the rate of participation in the screening increased after the educational intervention . Furthermore, another study indicated that 48% of the participants who had not been screened within the last year were referred for screening again . Similarly, weinrich et al . Observed that 71.8% of those in the intervention group participated in free screening due to educational intervention . We found out that the participation rate in such screening increased from 7.5% to 24% and 43.3% one month and three months after the intervention, respectively . Finally, we observed that 36 men, who had not been screened within the last year, participated in prostate cancer screening . One limitation of the present study was the post - test one month after the intervention . Therefore, assessing information in several time intervals after the interventions is recommended in order to examine the long - term effects of interventions on prostate cancer screening behaviors and participation in decision - making regarding the subject . It is also recommended that the follow - up periods of screening should be increased to one year . Further investigations are also required to find out the most important potential barriers to prostate cancer screening in iran . Another limitation of this study was selecting the samples from among a particular group of people such as teachers . It appears that the level of education and knowledge is so much higher than the general population . It is recommended that in future studies samples should be chosen from various groups of people such as rural ones to obtain more generalizable results . Our findings showed that the health education programs designed based on hbm could positively affect the prostate cancer preventive behaviors of our retired participants by improving their knowledge level and hbm components . Hence, we could confirm the efficacy of hbm in adopting the prostate cancer screening behaviors by the participants . Since this type of cancer is treatable in early stages, more attention should be paid to the educational design and planning based on educational theories and models so that we could increase the required knowledge about prostate cancer for early diagnosis and treatment of the disease.
|
Toxocara canis (t. canis), a common dog roundworm, is one of the causative agents of visceral larva migrans (vlm). When infective eggs of t. canis reach the human gastrointestinal tract, they enter the portal system and reach the liver . Some larvae then migrate from the liver to the lung and the heart through the systemic circulation . Myocarditis may occur in 10 - 15% of cases of vlm, and in those cases, myocarditis is accompanied by an increased level of circulating eosinophils . There have been approximately 10 cases of myocarditis associated with toxocara infection and only 2 cases were found in english publication since the year 2000 . This is the first report in korea . Here, we present case of myocarditis associated with eosinophilia caused by t. canis vlm . A 41-year - old woman presented at our hospital complaining of chest discomfort and pain . She had been healthy with no significant preceding symptoms, allergic history or past medical history . The initial examination showed the following findings; body temperature 37.8, blood pressure 94/60 mmhg, heart rate 100 beats / min and a cardiac gallop rhythm . Laboratory data on admission revealed decrease in the total white blood cell count (1040/mm), elevated enzymes (creatinine phosphokinase 236 iu / l, aspartate aminotransferase 112 iu / l, alanine aminotransferase 87 iu / l, lactic dehydrogenase 588 iu / l, troponin - i 4.070 ng / ml, ck - mb 12.32 ng / ml and probnp 8760 pg / ml). Electrocardiogram (ecg) showed a regular sinus rhythm with low voltage in all limb and precordial leads (fig . Transthoracic echocardiogram (tte) showed marked edematous left ventricular (lv) myocardium and global hypokinesis (fig . 2a), resulted in mild left ventricular systolic dysfunction (lv ejection fraction = 48%) (fig . There was no significant valvular dysfunction and small pericardial effusion without tamponade physiology was noted . Empirical treatment such as intravenous antibiotics injection, bed rest, pain control and close vital sign monitoring were performed . On the tenth day of admission, total white blood cell count (17160/mm) and eosinophil count (8430/mm) markedly increased (49% of her total white blood cell count). We started oral administration of prednisolone 1 mg / kg for 3 days and performed ventricular endomyocardial biopsy . The antibody test against parasitic infection demonstrated that toxocara immunoglobulin g (igg) was positive . Taken together, we diagnosed that she had myocarditis caused by t. canis vlm . We started oral administration of albendazol 400 mg twice a day for two weeks after oral prednisolone 1 mg / kg administration for 3 days . Tte finding showed that echogenicity of lv myocardium was markedly decreased and wall thickness was normalized (fig . 2c). After the completion of the treatment, physical examination, laboratory tests, ecg and echocardiogram showed no abnormal findings and she was able to return to work . Human toxocariasis is a helminthozoonosis due to the migration of toxocara species larvae through human organism . Many reviews from western countries indicated that children under 12 years old, who often play outside, are the most affected age group for toxocariasis.1)2) they are accidentally infected with t. canis eggs, which expelled in feces puppies and fully develop in the surrounding environment within two to four weeks . Human become infected by ingesting either embryonated eggs from soil (geophagia, pica), dirty hands or raw vegetables, or larvae from undercooked giblets . When embryonated eggs of t. canis reach the human gastrointestinal tract, they hatch and enter the portal system, reaching the liver . Some larvae then migrate to the lungs and heart through the systemic circulation.3) in this case, we could not find obvious source for t. canis infection . We assumed that she infected by ingesting embryonated eggs or larvae from raw vegetables, such as lettuce . A definitive laboratory diagnosis of human toxocaral infection can be achieved by pathology examination of various organ specimens . However, such a direct parasitologic assessment is awkward and uncommon, serologic methods are the mainstay for the diagnosis . The most commonly utilized diagnostic serologic test is the enzyme - linked immunosorbent assay with toxocara excretory secretory antigen . But when interpreting a serologic result, it should be kept in mind that the numerous seropositive individuals detected through screening of large populations in epidemiological surveys probably represent past rather than recent infection . Immunologic testing therefore, should be accompanied by a blood eosinophil count and if possible, by determination of serum total immunoglobulin e.4) a finding of both a peripheral eosinophilia and a positive serologic test result is indicative of active toxocariasis.5) myocarditis in vlm may result from direct larval invasion to the myocardium and/or hypersensitivity reactions to the parasites.6) it has been suggested that there are 3 clinical stages of eosinophilic myocarditis: acute necrotizing phase, thrombotic phase and endomyocardial fibrosis phase . Loffler's endomyocarditis is considered to correspond to the second stage of eosinophilic endomyocardial disease . The third stage probably corresponds to restrictive myocarditis.7) differential diagnoses include other types of myocarditis, churg - strauss syndrome, hypersensitivity reaction, malignant diseases, parasitic infection or hypereosinophilic syndrome . Tte finding shows diverse feature including diffuse severe hypokinesia or left ventricular focal asynergy.8) in our case, lv diastology did not showed significant dysfunction except abnormal relaxation . We think mild decreased lv systolic function, (left ventricle ejection fraction = 48%) was the reason . Thrombus also can occur and according to its characteristics, not only anticoagulation therapy but also surgical removal of the thrombus should be considered to prevent systemic embolism.9)10) therapy is primarily based upon administration of anthelmintics . Currently, 5 days or more use of albendazole 800 mg / day or 10 mg / kg / day are recommended for treatment of t. canis infection . The mechanism of its anthelmintic action is inhibition of tubulin polymerization and microtubule - dependent glucose uptake inhibition . In this case, for the control of aggravated eosinophilia, we started administration of prednisolone . Because she didn't have cardiac tamponade, cardiogenic shock or pulmonary edema, prednisolone was administered at 1.0 mg / kg / day.8) and as soon as we confirmed toxocara igg positive, albendazole was added to the medication . When a patient who has myocarditis with eosinophilia occurs, toxocara infection should be considered for possible cause.
|
As there has been a recent increase in orthodontic treatments of adult patients with aesthetic requirements, the use of ceramic brackets and resin brackets is increasing . In order to improve the aesthetics, orthodontic wires as well as brackets with tooth - colored coatings however, since the coefficient of friction of aesthetic ceramic brackets is greater than that of the metal brackets, it is necessary to consider the changes in friction between the brackets and orthodontic wires . A large frictional force is needed for managing anchorage and tooth movement in a closed - loop mechanism, while in sliding mechanisms, reduction of the frictional force is needed for preventing anchorage loss and for effective tooth movement.1 therefore, consideration of the loss of force by frictional forces is necessary for optimal clinical tooth movement . In a study by kusy and whitley,2 it was found that 12=60% of the orthodontic force is reduced by the frictional force applied during orthodontic treatment . Recently, numerous studies have examined the physical properties of aesthetic materials, including the following: the corrosion and the fracture resistance of coated wires by neumann et al.3; the mechanical properties such as stiffness (evaluated through the three - point bending test), surface roughness, and resistance of the coating of coated wires by elayyan et al.4,5; and thermo - chemical degeneration of coated wires by bandeira et al.6 however, there are insufficient studies on the evaluation of frictional changes as a result of wire coating . Jang et al.7 compared the frictional forces of rhodium - coated wires (hubit co., ltd ., futaba, japan) using 0.016-inch nickel titanium (niti) wires, 0.016 0.022-inch niti wires, and self - ligation brackets . The angles between the brackets and wires were set at 0, 3, 6, and 9. when the angles between the brackets and the wires were 3 using only a 0.016 0.022-inch 6 and 9 using all 2 types of wires, the frictional forces of the coated wires were significantly higher than those of the uncoated wires . The higher frictional forces were the cause of the destruction and separation of the surface coating material on the tension side of the wires as the angle between the brackets and the wires increased . This in vitro study aimed to compare the frictional forces of polymer- and rhodium - coated wires with those of uncoated wires in various angulations between the brackets and the wires, using self - ligation brackets (clippy - c, tomy inc .) And round and rectangular wires . One of the active types of brackets, a self - ligation bracket (clippy - c) with a 0.022 slot, -7 torque, and 0 angulation for upper premolars, was used . Uncoated wires (orthoforce; g&h orthodontics, franklin, in, usa) were used as the control group, polymer - coated wires (dany coated arch wire; dany bmt, anyang, korea) and rhodium - coated wires (sentalloy and white wire; tomy inc .) Were used as experimental groups (figure 1). For our study, we imployed three groups of wires: uncoated wires (control group); polymer - coated wires (p group); and rhodium - coated wires (r group). The wires used were 0.016-inch niti round wires and 0.017 0.025-inch stainless steel (ss) rectangular wires, and the angulations between the brackets and the wires were set to 0, 5, and 10 (table 1). Polymer - coated wires in the p group had limited coating in the anterior portion, unlike wires in the r group, which consisted of full rhodium coating on both the anterior and posterior portions . The full coating was utilized to improve the aesthetics in the anterior portion and for preventing changes in the wire thickness and frictional forces from affecting the posterior portion . However, to ease friction with the coating in a comparative experiment, we used full polymer - coated wires made to custom order that were not only coated in the anterior portion but also in the posterior portion . Each bracket was attached to the surface of the inner aluminum block (10 10 20 mm), which was custommade . After sandblasting the surface of the block, brackets were mounted on the middle of the surface using vertical and horizontal lines made with a adhesive material, transbond (3 m unitek, monrovia, ca, usa). The central part of the square space frame (10 10 mm) on the outer aluminum block (30 30 20 mm) was designed to be an exact match to the inner aluminum block and could be fixed with screws . The angles between the square framework of the outer aluminum block and the outline of the outer aluminum block were 0, 5, and 10, and we were able to reproduce exactly the angle between the brackets and the wires using the combination of inner and outer blocks . The combination of these two blocks was inserted into the adjustable block, which was made to fit the table of the universal testing machine (instron 5942; instron corp ., norwood, ma, usa). The straight part corresponding to the posterior 5 cm cut on the upper arch of the wire was used in the experiment . The tensile test was set with a crosshead speed of 5 mm / min and the load cell had a range of up to 500 n; the wire was pulled through a distance of 5 mm, and we recorded and compared the maximum frictional forces and the static frictional forces by measuring the change in frictional forces as the wire moved across the distance (figure 2). We used two types of wires, 0.016-inch niti and 0.017 0.025-inch ss, in the three groups classified according to the type of coating, and set an angle of 0, 5, and 10 between the brackets and the wires . Each tensile test was repeated five times, and a total of 90 tests were completed for the 18 sets of samples . In the test with round wires, since a lower frictional force was expected, one bracket was used five times in the same group . In the test with rectangular wires, the wires were used only once, and the tests were carried out by the same person . The maximum static frictional force was defined by measuring the maximum force at the initial extension, and the kinetic frictional force was calculated by averaging the frictional force while the wire was moved through 1 to 5 mm, for convenience (figure 3). The wire - surface tomography results, before and after the friction test, were compared for the two kinds of wires: the 0.016-inch niti wires and the 0.017 0.025-inch ss wires . The wires were cut to pieces with lengths of 10 mm, including the 5 mm portion that was in contact with the bracket, and using with an ultrasonic cleaner . Scanning electron microscopy (sem, hitachi-800; hitachi, tokyo, japan) was conducted to evaluate the morphology of the different wires . After the maximum static frictional force was recorded and the kinetic frictional force was calculated, we determined the mean frictional force and the standard deviation of the frictional force . To analyze the effects of different types of wire coatings, the size and type of wires, and the angulations between the brackets and the wires, the frictional force were analyzed initially using a one - way analysis of variance and a tukey's test with a 5% level of significance . One of the active types of brackets, a self - ligation bracket (clippy - c) with a 0.022 slot, -7 torque, and 0 angulation for upper premolars, was used . Uncoated wires (orthoforce; g&h orthodontics, franklin, in, usa) were used as the control group, polymer - coated wires (dany coated arch wire; dany bmt, anyang, korea) and rhodium - coated wires (sentalloy and white wire; tomy inc .) Were used as experimental groups (figure 1). For our study, we imployed three groups of wires: uncoated wires (control group); polymer - coated wires (p group); and rhodium - coated wires (r group). The wires used were 0.016-inch niti round wires and 0.017 0.025-inch stainless steel (ss) rectangular wires, and the angulations between the brackets and the wires were set to 0, 5, and 10 (table 1). Polymer - coated wires in the p group had limited coating in the anterior portion, unlike wires in the r group, which consisted of full rhodium coating on both the anterior and posterior portions . The full coating was utilized to improve the aesthetics in the anterior portion and for preventing changes in the wire thickness and frictional forces from affecting the posterior portion . However, to ease friction with the coating in a comparative experiment, we used full polymer - coated wires made to custom order that were not only coated in the anterior portion but also in the posterior portion . Each bracket was attached to the surface of the inner aluminum block (10 10 20 mm), which was custommade . After sandblasting the surface of the block, brackets were mounted on the middle of the surface using vertical and horizontal lines made with a adhesive material, transbond (3 m unitek, monrovia, ca, usa). The central part of the square space frame (10 10 mm) on the outer aluminum block (30 30 20 mm) was designed to be an exact match to the inner aluminum block and could be fixed with screws . The angles between the square framework of the outer aluminum block and the outline of the outer aluminum block were 0, 5, and 10, and we were able to reproduce exactly the angle between the brackets and the wires using the combination of inner and outer blocks . The combination of these two blocks was inserted into the adjustable block, which was made to fit the table of the universal testing machine (instron 5942; instron corp ., the straight part corresponding to the posterior 5 cm cut on the upper arch of the wire was used in the experiment . The tensile test was set with a crosshead speed of 5 mm / min and the load cell had a range of up to 500 n; the wire was pulled through a distance of 5 mm, and we recorded and compared the maximum frictional forces and the static frictional forces by measuring the change in frictional forces as the wire moved across the distance (figure 2). We used two types of wires, 0.016-inch niti and 0.017 0.025-inch ss, in the three groups classified according to the type of coating, and set an angle of 0, 5, and 10 between the brackets and the wires . Each tensile test was repeated five times, and a total of 90 tests were completed for the 18 sets of samples . In the test with round wires, since a lower frictional force was expected, one bracket was used five times in the same group . In the test with rectangular wires, the wires were used only once, and the tests were carried out by the same person . The maximum static frictional force was defined by measuring the maximum force at the initial extension, and the kinetic frictional force was calculated by averaging the frictional force while the wire was moved through 1 to 5 mm, for convenience (figure 3). The wire - surface tomography results, before and after the friction test, were compared for the two kinds of wires: the 0.016-inch niti wires and the 0.017 0.025-inch ss wires . The wires were cut to pieces with lengths of 10 mm, including the 5 mm portion that was in contact with the bracket, and using with an ultrasonic cleaner . Scanning electron microscopy (sem, hitachi-800; hitachi, tokyo, japan) was conducted to evaluate the morphology of the different wires . After the maximum static frictional force was recorded and the kinetic frictional force was calculated, we determined the mean frictional force and the standard deviation of the frictional force . To analyze the effects of different types of wire coatings, the size and type of wires, and the angulations between the brackets and the wires, the frictional force were analyzed initially using a one - way analysis of variance and a tukey's test with a 5% level of significance . When the angles between the brackets and the wires were 0, the maximum static frictional forces were not significantly different in all three groups (p> 0.05). When the angles between the brackets and the wires were 5, the maximum static frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the other two groups (p <0.05). When the angles the brackets and the wires were 10, the maximum static frictional forces were not significantly different between the r and p groups (p> 0.05), but they were significantly smaller in the control group compared to the other two groups (p <0.05). When the angles between the brackets and the wires were 0, the maximum static frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the other two groups (p <0.05). When the angles between the brackets and the wires were 5, the maximum static frictional forces differed significantly among the three groups (p <0.05). The control group, p group, and r group had gradually increasing maximum static frictional forces (p <0.05). When the angles between the brackets and the wires were 10, the maximum static frictional forces were not significantly different between the control group and p group (p> 0.05), but they were significantly greater in the r group compared to the other two groups (p <0.05). When the angles between the brackets and the wires were 0, the kinetic frictional forces did not differ significantly among the three groups (p> 0.05). When the angles between the brackets and the wires were 5 and 10, the kinetic frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the two other groups (p <0.05). When the angles between the brackets and the wires were 0, the kinetic frictional forces were significantly different in all three groups (p <0.05). The control group, p group, and r group had gradually increasing kinetic frictional forces (p <0.05). When the angles between the brackets and the wires were 5 and 10, the kinetic frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the two other groups (p <0.05). We used scanning electron micrographs to examine the wires and compare their surfaces before and after the friction test . Before the friction test, the surfaces of uncoated wire surfaces in the control group had fine scratches but were smooth on the whole . The wire surfaces in the p group consisted of small round adhesions . In the r group, after the friction test on the 0.016-inch niti wires, depressions were observed on the surface in the control group, cracking of the coating was observed in the p group, and no notable changes were seen in the r group (figure 5). Compared to the 0.016-inch niti wires, however, the 0.017 0.025-inch ss wires showed more pronounced changes on the surface resulting from the relatively larger amount of friction - induced surface damage . There was a severe depression on the wire surface in the control group, serious damage to the coating surface in the p group, and depressions on the surfaces of the r group (figure 6). When the angles between the brackets and the wires were 0, the maximum static frictional forces were not significantly different in all three groups (p> 0.05). When the angles between the brackets and the wires were 5, the maximum static frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the other two groups (p <0.05). When the angles the brackets and the wires were 10, the maximum static frictional forces were not significantly different between the r and p groups (p> 0.05), but they were significantly smaller in the control group compared to the other two groups (p <0.05). When the angles between the brackets and the wires were 0, the maximum static frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the other two groups (p <0.05). When the angles between the brackets and the wires were 5, the maximum static frictional forces differed significantly among the three groups (p <0.05). The control group, p group, and r group had gradually increasing maximum static frictional forces (p <0.05). When the angles between the brackets and the wires were 10, the maximum static frictional forces were not significantly different between the control group and p group (p> 0.05), but they were significantly greater in the r group compared to the other two groups (p <0.05). When the angles between the brackets and the wires were 0, the maximum static frictional forces were not significantly different in all three groups (p> 0.05). When the angles between the brackets and the wires were 5, the maximum static frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the other two groups (p <0.05). When the angles the brackets and the wires were 10, the maximum static frictional forces were not significantly different between the r and p groups (p> 0.05), but they were significantly smaller in the control group compared to the other two groups (p <0.05). When the angles between the brackets and the wires were 0, the maximum static frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the other two groups (p <0.05). When the angles between the brackets and the wires were 5, the maximum static frictional forces differed significantly among the three groups (p <0.05). The control group, p group, and r group had gradually increasing maximum static frictional forces (p <0.05). When the angles between the brackets and the wires were 10, the maximum static frictional forces were not significantly different between the control group and p group (p> 0.05), but they were significantly greater in the r group compared to the other two groups (p <0.05). When the angles between the brackets and the wires were 0, the kinetic frictional forces did not differ significantly among the three groups (p> 0.05). When the angles between the brackets and the wires were 5 and 10, the kinetic frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the two other groups (p <0.05). When the angles between the brackets and the wires were 0, the kinetic frictional forces were significantly different in all three groups (p <0.05). The control group, p group, and r group had gradually increasing kinetic frictional forces (p <0.05). When the angles between the brackets and the wires were 5 and 10, the kinetic frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the two other groups (p <0.05). When the angles between the brackets and the wires were 0, the kinetic frictional forces did not differ significantly among the three groups (p> 0.05). When the angles between the brackets and the wires were 5 and 10, the kinetic frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the two other groups (p <0.05). When the angles between the brackets and the wires were 0, the kinetic frictional forces were significantly different in all three groups (p <0.05). The control group, p group, and r group had gradually increasing kinetic frictional forces (p <0.05). When the angles between the brackets and the wires were 5 and 10, the kinetic frictional forces were not significantly different between the control group and the p group (p> 0.05), but they were significantly greater in the r group compared to the two other groups (p <0.05). We used scanning electron micrographs to examine the wires and compare their surfaces before and after the friction test . Before the friction test, the surfaces of uncoated wire surfaces in the control group had fine scratches but were smooth on the whole . The wire surfaces in the p group consisted of small round adhesions . In the r group, after the friction test on the 0.016-inch niti wires, depressions were observed on the surface in the control group, cracking of the coating was observed in the p group, and no notable changes were seen in the r group (figure 5). Compared to the 0.016-inch niti wires, however, the 0.017 0.025-inch ss wires showed more pronounced changes on the surface resulting from the relatively larger amount of friction - induced surface damage . There was a severe depression on the wire surface in the control group, serious damage to the coating surface in the p group, and depressions on the surfaces of the r group (figure 6). Frictional force is the force that resists the relative motion of surfaces sliding against each other . One type of frictional force is the static frictional force that is present until movement starts, and the other is the kinetic frictional force that appears during movement . There is controversy concerning which frictional force is more significant in clinical orthodontic treatment . In the study by drescher et al.,8 as the static friction and kinetic friction occurred at nearly the same time owing to the low crosshead speed of orthodontic tooth movement, distinguishing between the static and kinetic frictional forces was difficult . Frank and nikolai9 used only the maximum kinetic frictional force because it was difficult to reproduce the kinetic frictional force in the oral cavity . In a study by burrow,1 it was found that the static frictional force was more appropriate than the kinetic frictional force as orthodontic tooth movement is not continuous . On the other hand, kusy and whitley10 measured both static and kinetic frictional forces; tselepis et al.11 used only the kinetic fictional force after the maximum static frictional force was reached because there was a constant alternating between the static and the kinetic frictional forces as the tooth intermittently slid and bound along the arch wire during orthodontic movements . In this study, the maximum static frictional force and the kinetic frictional force were measured because we believe that frictional values may vary for a given bracket - arch wire combination as the tooth moves along the arch wire in a tipping and uprighting fashion.11 the maximum static frictional forces and the kinetic frictional forces of the coated wires were equal to or higher than those of the uncoated wires, and there was a difference in the degree of change depending on the type of coating . The r group had the greatest frictional forces and the control group had the smallest frictional forces because the surfaces of the wires had different levels of roughness owing to the coating materials . The wires of the p group had an ag coating for the white color and a parylene membrane coating on the outer surface of the ag layer . A parylene coating is generally known to be very robust, durable, and waterproof, have excellent chemical resistance, and exhibit less discoloration . It also has a great impact on the aesthetics because of its excellent light permeability and its non - toxic nature . Above all, the smooth membrane of a parylene coating can reduce the roughness of the surface, and this is why the p group had lower frictional forces than the r group in our study . A rhodium coating is used on orthodontic wires because it is white, more aesthetic than other metals, and chemically stable because rhodium is a precious metal; it also has excellent wear resistance . However, the high surface roughness of rhodium produces greater frictional forces . In this study, the differences in frictional forces according to the type of coating were due to the direct influence of the polymer and rhodium in the coating . But we must consider the surface roughness as a characteristic of the material itself, and we need to take into account that corrosion, creep and relaxation, and the manufacturing processes (polishing, heating treatment, etc .) Can affect the change in the resistance (corrosion, creep, and relaxation).9 we have to consider the changes in the thickness of the wire that result from the differences in the aesthetically superior materials that are used to coat the wire . Wires in both p and r groups had additional coatings on ready - made non - coated 0.016-inch niti wires and 0.017 0.025-inch ss wires, so fine increases in thickness appeared . In a study by iijima et al.,12 the coating thickness in the r group was 10 m, and so it did not affect the mechanical properties . Dany bmt, which manufactures the wires in the p group, explained that the changes in the wire thickness resulting from the additional coating of two polymer layers are less than 5 m unilaterally and 10 m bilaterally (figure 7). However, the wires with polymer coating were thicker than the other two wires, as measured by digital vernier calipers that can measure lengths as small as 0.01 mm . The thickness of the polymer - coated 0.016-inch niti wires was 0.41 mm; the thicknesses of the uncoated wires and rhodium - coated wires were 0.37 mm; the thickness of the polymer - coated 0.017 0.025-inch ss wires was 0.42 0.62 mm; the thickness of the other two wires was 0.040 0.61 mm . Even if the wires were the same size like the 0.016-inch and 0.017 0.025-inch wires, different thicknesses, depending on the coating materials, could change the frictional forces by affecting the binding between the brackets and the wires . Consequently, we would need additional studies to elucidate the clinical significance of the changes in frictional force according to different coating thicknesses . Changes in the frictional force according to the angle between the brackets and the wires are considered an important issue because in most cases, the orthodontic force acts at a slight angle rather than parallel to the brackets and wires during tooth movement . In a study by kusy and whitley,13 three components were found to affect frictional forces when the orthodontic wire slid . They were the static and the kinetic frictional forces, binding in the contact between the wires and the bracket's slot corner, and notching, which is a permanent deformation of the wires . In addition, the researchers suggested that the critical contact angle was 3.7, which increased the frictional force rapidly as the brackets and wire were binding when a 0.016-inch wire was used with a 0.022-inch bracket slot . To evaluate the frictional force that resulted when the angle between the brackets and wires was changed to 0, 5, and 10 in this study, the angles used included critical contact angles . Depending on the difference in angle between the brackets and wires, the maximum static frictional force and kinetic frictional force increased significantly in all cases as the angulations between the brackets and wires increased . The frictional resistance occurred at the bracket slot base when the angulation between the bracket and wire was calibrated at 0. however, as the second - order angulations increased, frictional resistance occurred on the vertical planes of the bracket slot, as well as on its base . The frictional resistance increased rapidly when the angulation between the bracket and the wire was set at 5 because the critical contact angle was 3.7. the frictional force also increased rapidly as the bracket and wire were binding if a 0.016-inch wire with a 0.022-inch bracket slot was used.13 the order of the groups regarding the values of the maximum static frictional force and kinetic frictional force was different when the angle was 10 between the brackets and the 0.016-inch niti wires . The maximum static frictional force was as follows: control group <r group = p group . The order for the kinetic frictional force was as follows: p group = control group <r group . The maximum static frictional force in the p group was greater than that of the r group, although the difference was not statistically significant . It is supposed that the degree of binding altered as the stiffness of the 0.016-inch niti wire changed according to the type of coating . It is believed that because the 0.017 0.025-inch ss wires was thick and less elastic, they exhibited different results compared to the 0.016-inch niti wires . Using sem, the different appearances of the surfaces of uncoated and coated wires could be observed . Surface roughness is the main factor that determines the frictional force, and our results showed that the r group had the roughest surface and the largest frictional force . It is considered that the frictional force was affected by the pattern and degree of coating damage during the friction test as well as by the surface roughness . Clinical studies show that coating damage can easily occur during tooth brushing or intake of food in the oral cavity, thus increasing the frictional force . The frictional forces of coated wires are equal to or higher than those of uncoated wires . However, the conditions in the oral cavity are very different from laboratory conditions because of the various tissues involved in oral functions, such as chewing, swallowing, and speaking, as well as the oral tissues that are in contact with the orthodontic appliance . Additional research on friction using conditions similar to those in the oral cavity will be needed to produce findings that have a clinically meaningful impact . In addition, to make the proper choice of coated wires, increased understanding of many factors such as abrasion resistance, discoloration, and compatibility with the teeth in the oral cavity, as well as frictional forces, is needed.
|
The research area of substituent - free group 15 element ligands in the coordination sphere of transition metal complexes has shown to be a prosperous field in chemistry . Some of these complexes possess planar e3, e4, e5 and e6 rings . From their appealing symmetry, to the lively discussion of their possible aromaticity, these main group ligands induce a fascination to chemists on their own . Among these, the ferrocene analogous sandwich complexes [cp*fe(-e5)] (e = p (1), e = as (2)) bearing a planar e5 ring as an end - deck are of special interest as ligands in supramolecular coordination chemistry, since the cyclo - e5 moieties show a large variety of coordination modes depending on the nature of the lewis acid used . While reactions of the cyclo - p5 complex 1 with strongly coordinating cu halides lead to an abundance of coordination polymers, and also spherical aggregates, the as analogue 2 has so far lead only to the isolation of coordination polymers . In these products the p atoms are mainly coordinating the cu centers via their lone pairs while the as5 ring mainly shows coordination via as as bonds . The reaction of 1 with ag ions under weakly coordinating conditions affords a soluble one - dimensional coordination polymer . Recently, we were able to show that both e5 complexes 1 and 2 reveal a similar coordination of the e5 end deck to the group 13 cations tl and in . Since investigations of the reactivity of cyclo - p5 and cyclo - as5 complexes including a direct comparison are rare, it seems worthwhile to analyze their coordination chemistry towards the unusual lewis acid trimeric (perfluoro - ortho - phenylene)mercury [(o - c6f4hg)3] (3). The latter is a planar, electron deficient molecule containing three sterically available hg atoms in close proximity . Compound 3 forms weak lewis acid / base adducts with a large variety of o, n and s donor lewis bases as well as some anions (scheme 1 a). Additionally, it readily builds up alternating binary stacks with different electron rich aromatic hydrocarbons and forms double sandwich complexes with the metallocenes [cp2ni] and [cp2fe] (scheme 1b). Accordingly, we reported the reaction of 3 with the triple decker complex [(cpmo)2(,: p6)] bearing two cp rings and a cyclo p6 middle deck . In this case, the obtained products show a one dimensional polymeric structure which is based on weak p the presented results raise the question of how the ferrocene analog cyclo e5 complexes 1 and 2 will interact with the planar lewis acid 3 . Will they form lewis acid / base adducts via the lone pairs of the group 15 elements or will they show a interaction of the aromatic e5 ligands, comparable to pure ferrocene? To address this question we reacted the cyclo - e5 complexes 1 and 2 with [(o - c6f4hg)3] (3) in ch2cl2 and subsequently determined the solid state structure of the products . To gain further insight into the hg e interactions, the electrostatic potential surfaces of the complexes additionally an atoms in molecules (aim) analysis was performed on the experimentally determined geometries . To investigate the impact of sterical demand on these compounds, we prepared a series of cyclo - p5 sandwich complexes [cpfe(-p5)] (cp = c5h5n tbun, n = 13, 6a c) with increasing sizes of the cp ligands and subsequently reacted them with compound 3. the complexes for n = 2, 3 were reported before . During this work the first solid state structure for a complex with n = 2 and a new polymorph for n = 3 were analyzed by x - ray diffraction analysis . The resulting adducts were analysed by x - ray crystallography and a hirshfeld surface analysis was performed to better compare the involved intermolecular contacts in the solid state . The complexes for n = 2, 3 were reported before . During this work the first solid state structure for a complex with n = 2 and a new polymorph for n = 3 were analyzed by x - ray diffraction analysis . For the present work all three complexes were prepared by the thermolysis of [cpfe(co)2]2 with p4 in decalin . Since [(o - c6f4hg)3] (3) forms lewis acid / base adducts with donor solvents like thf or mecn, the syntheses were all conducted in ch2cl2 to prevent any competition between the en ligand complexes and the solvent molecules . Nevertheless, in some of the reactions we could isolate two solvates of [(o - c6f4hg)3] containing only ch2cl2 (see esi). For the current study, the en ligand complexes were combined with a stoichiometric (1: 1) amount of [(o - c6f4hg)3] and the mixture was dissolved in pure ch2cl2 . After filtration, the supersaturated solution was stored at + 4 c or 30 c which afforded crystals of the compounds 4, 5 and 7a c in a matter of several hours to some days . The solid state structures of the formed assemblies are based on weak interactions of the hg atoms of [(o - c6f4hg)3] and the phosphorus or arsenic atoms of the sandwich complexes [cp*fe(-e5)]. The van der waals (vdw) radius of hg in different compounds is discussed in the literature with reported values ranging from 1.7 up to 2.2 . In the following discussion therefore, hg e distances that are within the sum of the vdw radii of 3.6 for e = p or 3.7 for e = as are highlighted by fragmented blue lines in the following fig . 1, 2 and 6 . When the starting compounds 1 and 3 are dissolved in ch2cl2, the solution shows the dark green color of the pure complex 1 . The crystals which were obtained by storing a concentrated solution at 30 c are pleochromic showing a green to brown color . The p5 ring of 1 is approaching the center of the three hg atoms of 3 with the phosphorus atom p1 and on the other side, the atom p3 is coordinating to the second hg3 moiety . The p p bond lengths are very uniform with an average value of 2.111(4), which is the same as in the starting compound 1 (2.120(5)). The angle enclosed by the cyclo - p5 plane and the hg3 plane constitutes 62.29(2). The observed assembly resembles the weak lewis acid / base adducts that are formed from 3 with several lewis bases and significantly differs from a cofacial arrangement that was found for the double - sandwich complexes formed by [cp2fe] and 3 . P distance hg1p1 of 3.2878(9) is a bit longer than the closest hg p contact (3.195(3)) found in the polymeric chains of [(o - c6f4hg){(cpmo)2(,:-p6)}]n but is comparable with other observed hg the shortest intermolecular pp distance is 3.9443(13) and all of the others lie above 4 . In summary, the best description of the solid state structure of 4 is the enclosure of two cyclo - p5 sandwich complexes by two planar molecules of 3 held together by weak hgp interactions . In cd2cl2 solution at room temperature 4 . The signal is only shifted 0.04 ppm upfield in the case of the methyl protons and 2.5 ppm downfield in the case of the phosphorus atoms compared to the free complex 1 . When cooled to 193 k, these shifts increase to 0.13 ppm upfield for the h and 7.6 ppm downfield for the p nuclei . In all of the experiments we could not resolve any coupling to the nmr active hg (i = 1/2, 16.84% natural abundance) or hg (i = 3/2, 13.22% natural abundance) nuclei . The f nmr spectrum shows two multiplets that correspond to the fluorine atoms of 3 in the ortho and para positions to the hg atoms . The mass spectrum (fd or esi) of 4 shows no adducts in the gas phase . Only the starting materials 1 and 3 can be detected . Thus, the small differences of the chemical shifts and the absence of any coupling in the nmr spectra as well as the absence of any product peaks in the mass spectrum are in good agreement with the expected weak hgp interactions . During the further investigation we also added the cyclo - as5 complex 2 to the lewis acid 3 . The brown solution of both compounds in ch2cl2 could easily be distinguished from the olive green color of the pure sandwich complex 2 . The as as bond lengths are very uniform with an average value of 2.326(6) which is the same as found in the starting compound 2 (2.327(6)). The angle enclosed by the as5 plane and the hg3 plane of 10.68(2) shows an almost parallel arrangement . The center of the hg3 triangle is not situated directly below the center of the as5 ring, but rather below the arsenic atom as1 . The resulting hg as distances show four contacts below the sum of the vdw radii with the closest one between hg2 and as2 of 3.3014(4). The assembly can best be described as the coordination of three as atoms to the hg3 platform . The observation of different assemblies for 1 and 2 with the weak lewis acid 3 was surprising, since we observed a similar -coordination mode of the e5 end - decks of 1 and 2 to the weak lewis acids tl and in previously . There is no second molecule of 3 stacked directly on top of the sandwich complex 2 to form a double - sandwich structure, as was observed for ferrocene . Nevertheless, there is a close contact (3.383(2)) between a carbon atom of the cp * ring to a carbon atom of a fluorinated phenyl ring of the next molecule of 3 which may indicate possible stabilizing -interactions between the electron rich cp * ring and the electron deficient molecules of 3 or even f h interaction to the methyl groups . In order to better understand the difference in the nature of the hg e interactions in 4 and 5, their constituent compounds 1, 2, and 3 were first subjected to optimization by dft methods. Calculations were performed using the gaussian program with the b3lyp functional and mixed basis sets: hg, cc - pvtz - pp; p / fe / as, 6 - 311++g * *; f, 6 - 31g(d); c / h, 6 - 31 g . The computed magnitudes of the respective homo lumo gaps between 1 and 3 and 2 and 3 of 3.70 and 3.36 ev suggest that efficient mixing of the homos of 1 and 2 with the lumo of 3 is not likely to be prevalent in 4 and 5 . Instead, we envisage that electrostatic and dispersion forces may play a large role in the stabilization of these adducts . To investigate the role played by electrostatic forces in 4 and 5, we decided to inspect the electrostatic potential surfaces of the individual components, as shown in fig ., a distinct accumulation of negative character is observed at the center of the e5 ring . This feature is reminiscent of that observed for simple aromatic units such as benzene or the cyclopentadienide ligands of metallocenes . A closer inspection of the surfaces shows a greater accumulation of negative character at the phosphorus atoms in 1 . This accumulation of negative character appears to be directly aligned with the phosphorus lone pairs that point outward from the center of the p5 ring . Such areas of negative electrostatic potential concentration are much less developed on the surface of the as5 ring in 2, a difference that we assign to the more electropositive character of arsenic and the more diffuse nature of its orbitals . Bearing in mind that the electrostatic potential surface at the center of the 3 is positive, the formation of the adducts 4 and 5 is driven, at least in part, by electrostatic forces as shown by the complementarity of the surfaces that come into contact in the adducts . Calculations were performed using the gaussian program with the b3lyp functional and mixed basis sets: hg, cc - pvtz - pp; p / fe / as, 6 - 311++g * *; f, 6 - 31g(d); c / h, 6 - 31 g . The side - on coordination of the phosphorus complex 1 to the center of 3 in adduct 4 can be correlated to the concentration of negative charges on each of the phosphorus atoms . Similarly, the more co - planar arrangement of the as5 ring and hg3 plane in 5 is proposed to result from the complementarity of the negative and positive electrostatic potential concentrations at the centers of the as5 and hg3 units, respectively . In an effort to further investigate the nature of the hg e interactions in 4 and 5, atoms in molecules (aim) analyses were carried out at the experimentally determined geometries . Xyz plots featuring selected bond critical points between the cyclo - e5 units and 3 are shown in fig . Relevant features of the calculated electron density distributions for selected hg e bond critical points (bcp) found in 4 and 5 are shown in tables 1 and 2, respectively . Tables of the electron density distribution features at all bond critical points found between units of 1 and 3 and 2 and 3 are provided in the esi. In 4, four bond critical points were found between the cyclo - p5 moiety of 1 and the two molecules of 3, as shown in fig . P1, which is positioned above the center of a unit of 3, shares a bcp with each of the proximal hg atoms, with the electron densities at the critical points ranging from 0.072 to 0.105 e . A critical point with a similar electron density (0.072 e) was also found between p3 and hg1 of the second unit of 3 . In 5, the aim analysis found three bcps between the cyclo - as5 moiety of 2 and 3 . The three as atoms closest to 3 (as1, as2, and as5) each share a single critical point with a proximal hg atom, with the electron densities at these critical points ranging from 0.091 to 0.109 e . The values of the electron density, (r), found at the hg e bcps in both 4 and 5 are relatively small, being similar in magnitude to those found for weak hydrogen bonds . The positive values of the laplacian of the electron density at the hg e bcps, (r bcp), are also suggestive of closed shell interactions . The relatively small magnitude of the (r) and (r bcp) values found at the bond critical points are not conclusive evidence of the weakness of the hg e interactions, as (r) values tend to become smaller with increasing diffuseness of the electrons involved . However, the positive values of h(r bcp)/(r bcp), the total energy density at the bcp relative to (r), found at the hg e bcps suggest that any donor acceptor contribution to the hg instead, we note that positive h(r bcp)/(r bcp) values are usually encountered in systems stabilized by electrostatic and/or van der waals interactions . Hence, while donor acceptor bonding cannot be entirely neglected in 4 and 5, electrostatic forces as supported by the preceding potential map analysis must play a prevalent role in the formation of these adducts . Dispersion forces, which are inherently more difficult to visualize, may also play an important role . The ellipticity values (), which provide information on the anisotropy of the electron density perpendicular to the bond path, at the hg p bcps in 4 are small and uniform, indicating that there is no preferential plane of electron density accumulation . This is a characteristic of interactions, in agreement with the orientation of the phosphorus lone pairs toward the mercury atoms . In contrast to those found in 4, the ellipticities at the hg as bcps in 5 are not uniform . The ellipticity value of 0.344 found at the bcp between hg3 and as5 is substantially larger than the values obtained for the two other hg as bcps . Considering the relative uniformity of the (r) values found for all three hg as bcps, the large ellipticity value found for the hg3as5 bcp suggests the involvement of an as as -bond in the interaction with hg3 . Whether the different assembly of the cyclo - p5 and the cyclo - as5 complexes towards the planar lewis acid 3 might be caused by packing effects due to the longer as as bonds (2.33) compared to the p considering all the presented experimental data we can assume the hgp interactions found in 4 to be weak . Both e5 complexes 1 and 2 exhibit two degenerate orbitals as their homo which are localized on the e5 rings . Consequently, we rationalized that it might be possible to direct the p5 complex to also show an almost cofacial arrangement to the molecular plane of lewis acid 3 . Therefore, we followed a synthetic approach by increasing the steric bulk of the cp ligand on the cyclo - p5 sandwich complex to induce a change of its orientation towards the hg3 plane of 3 in the solid state . For this reason we decided to compare complexes with mono-, di- and trisubstituted tert - butyl - cyclopentadienyl ligands [cpfe(-p5)] (6a), [cpfe(-p5)] (6b), [cpfe(-p5)] (6c). The compounds are obtained by reacting the suitable cp substituted dimeric iron dicarbonyl complexes [cpfe(co)2]2 with white phosphorus at elevated temperature . The determined solid state structures of 6a c are shown in fig . 5 . All three of the analyzed complexes 6a c show the expected sandwich structure with two parallel five - membered rings . The distances between the fe atom and the center of both rings increase very little when the size of the cp ligand increases . When looking at the top row in fig . 5 it can be seen that the p5 rings are in an almost eclipsed position with the cp rings in all cases . This could be explained by steric effects when looking closer at the bottom row, since two methyl groups of each tert - butyl group are pointing between two p atoms of the p5 rings . The volume of the complexes was determined by dividing the unit cell volume by the number of molecules within the cell . Here it can be seen, that each additional tert - butyl group adds about 100 to the size of the complexes (table 3). With these cyclo - p5 complexes 6a c in hand, we prepared and fully characterized the compounds 7a c formed by the reaction of the cyclo - p5 complex with [(o - c6f4hg)3] in a 1: 1 stoichiometry . The obtained compounds each exhibit a similar assembly to that found in 4, with two cyclo - p5 complexes enclosed by two molecules of 3 held together by weak hgp interactions . There are small differences in the assemblies caused by the steric demand of the cp ligands, but the general arrangement of the cyclo - p5 ring towards the molecular plane of 3 did not change dramatically, although the central phosphorus atom in 7c (fig . 6c) shows only two contacts below the sum of the vdw radii to the hg atoms of 3 . In order to better visualize the different interactions of the cyclo - p5 and the cyclo - as5 ligand towards the planar lewis acid 3 we performed a hirshfeld surface analysis of all of the described compounds . 7 shows a representation of the hirshfeld surfaces (hs) of the planar lewis acid 3 which is facing the cyclo - e5 ligands 1 or 2 derived from the solid state structures of 4 (a + c) and 5 (b + d), respectively . While the first row shows d norm values which are used to identify close intermolecular contacts mapped onto the hs, the second row displays the corresponding shape index . The yellow ellipses highlight the contact regions to the pnictogen atoms of the cyclo - e5 ligands . 7a and c exhibit a pronounced indentation of the hs in the center of the molecule for 4 . 7a additionally shows three close contacts as white to red dots in this region on the hs which arise from interaction of the three hg atoms of 3 with one p atom of the p5 ring . In fig . 7b we can identify a contact area, highlighted in yellow, which shows five small indentations for 5 instead . These can be seen even better in the representation of the respective shape index in fig . 7d, which resembles a face to face arrangement of the as5 plane to the hg3 plane . A detailed hs analysis including decomposed fingerprint plots of all of the described compounds enabled us to further analyze and compare important intermolecular distances . 8 shows the fingerprint plots of the planar lewis acid 3 in 4 and 5 with highlighted regions of contact atom pairs . The fingerprint plots of the lewis acid 3 show some similar features for all of the compounds . While the f h and c h distances naturally represent the shortest intermolecular contacts, the hg hg contacts are already at the edge of hg hg interactions and only contribute less than 2% to the hirshfeld surface . In 7c there are no hg hg contacts at all . However, the hg p and hg as distances represent short intermolecular contacts for their respective atom types below the sum of the vdw radii (see general considerations). The hg p contact area generally contributes about 45% to the hirshfeld surface in all of the cyclo - p5 compounds (4, 7a in contrast, the f h and f f contacts for example are significantly influenced by the respective cyclo - p5 complex (the rising h content of the cp ligand results in a rising f h contact area). Therefore, in accordance with the single - crystal x - ray structure analyses, it can be assumed that the observed arrangement in the solid state of two cyclo - p5 sandwich complexes enclosed by two planar lewis acidic molecules (3) is relatively stable and can resist a considerable increase in size of the adjacent ligands on the cyclo - p5 sandwich complexes . For the present work all three complexes were prepared by the thermolysis of [cpfe(co)2]2 with p4 in decalin . Since [(o - c6f4hg)3] (3) forms lewis acid / base adducts with donor solvents like thf or mecn, the syntheses were all conducted in ch2cl2 to prevent any competition between the en ligand complexes and the solvent molecules . Nevertheless, in some of the reactions we could isolate two solvates of [(o - c6f4hg)3] containing only ch2cl2 (see esi). For the current study, the en ligand complexes were combined with a stoichiometric (1: 1) amount of [(o - c6f4hg)3] and the mixture was dissolved in pure ch2cl2 . After filtration, the supersaturated solution was stored at + 4 c or 30 c which afforded crystals of the compounds 4, 5 and 7a c in a matter of several hours to some days . The solid state structures of the formed assemblies are based on weak interactions of the hg atoms of [(o - c6f4hg)3] and the phosphorus or arsenic atoms of the sandwich complexes [cp*fe(-e5)]. The van der waals (vdw) radius of hg in different compounds is discussed in the literature with reported values ranging from 1.7 up to 2.2 . In the following discussion e distances that are within the sum of the vdw radii of 3.6 for e = p or 3.7 for e = as are highlighted by fragmented blue lines in the following fig . 1, 2 and 6 . When the starting compounds 1 and 3 are dissolved in ch2cl2, the solution shows the dark green color of the pure complex 1 . The crystals which were obtained by storing a concentrated solution at 30 c are pleochromic showing a green to brown color . The p5 ring of 1 is approaching the center of the three hg atoms of 3 with the phosphorus atom p1 and on the other side, the atom p3 is coordinating to the second hg3 moiety . The p p bond lengths are very uniform with an average value of 2.111(4), which is the same as in the starting compound 1 (2.120(5)). The angle enclosed by the cyclo - p5 plane and the hg3 plane constitutes 62.29(2). The observed assembly resembles the weak lewis acid / base adducts that are formed from 3 with several lewis bases and significantly differs from a cofacial arrangement that was found for the double - sandwich complexes formed by [cp2fe] and 3 . P distance hg1p1 of 3.2878(9) is a bit longer than the closest hg p contact (3.195(3)) found in the polymeric chains of [(o - c6f4hg){(cpmo)2(,:-p6)}]n but is comparable with other observed hg the shortest intermolecular pp distance is 3.9443(13) and all of the others lie above 4 . In summary, the best description of the solid state structure of 4 is the enclosure of two cyclo - p5 sandwich complexes by two planar molecules of 3 held together by weak hgp interactions . In cd2cl2 solution at room temperature 4 shows a singlet in both the h nmr spectrum and the p{h} nmr spectrum . The signal is only shifted 0.04 ppm upfield in the case of the methyl protons and 2.5 ppm downfield in the case of the phosphorus atoms compared to the free complex 1 . When cooled to 193 k, these shifts increase to 0.13 ppm upfield for the h and 7.6 ppm downfield for the p nuclei . In all of the experiments we could not resolve any coupling to the nmr active hg (i = 1/2, 16.84% natural abundance) or hg (i = 3/2, 13.22% natural abundance) nuclei . The f nmr spectrum shows two multiplets that correspond to the fluorine atoms of 3 in the ortho and para positions to the hg atoms . The mass spectrum (fd or esi) of 4 shows no adducts in the gas phase . Only the starting materials 1 and 3 can be detected . Thus, the small differences of the chemical shifts and the absence of any coupling in the nmr spectra as well as the absence of any product peaks in the mass spectrum are in good agreement with the expected weak hgp interactions . During the further investigation we also added the cyclo - as5 complex 2 to the lewis acid 3 . The brown solution of both compounds in ch2cl2 could easily be distinguished from the olive green color of the pure sandwich complex 2 . The as as bond lengths are very uniform with an average value of 2.326(6) which is the same as found in the starting compound 2 (2.327(6)). The angle enclosed by the as5 plane and the hg3 plane of 10.68(2) shows an almost parallel arrangement . The center of the hg3 triangle is not situated directly below the center of the as5 ring, but rather below the arsenic atom as1 . The resulting hg as distances show four contacts below the sum of the vdw radii with the closest one between hg2 and as2 of 3.3014(4). The assembly can best be described as the coordination of three as atoms to the hg3 platform . The observation of different assemblies for 1 and 2 with the weak lewis acid 3 was surprising, since we observed a similar -coordination mode of the e5 end - decks of 1 and 2 to the weak lewis acids tl and in previously . There is no second molecule of 3 stacked directly on top of the sandwich complex 2 to form a double - sandwich structure, as was observed for ferrocene . Nevertheless, there is a close contact (3.383(2)) between a carbon atom of the cp * ring to a carbon atom of a fluorinated phenyl ring of the next molecule of 3 which may indicate possible stabilizing -interactions between the electron rich cp * ring and the electron deficient molecules of 3 or even f h interaction to the methyl groups . In order to better understand the difference in the nature of the hg e interactions in 4 and 5, their constituent compounds 1, 2, and 3 were first subjected to optimization by dft methods. Calculations were performed using the gaussian program with the b3lyp functional and mixed basis sets: hg, cc - pvtz - pp; p / fe / as, 6 - 311++g * *; f, 6 - 31g(d); c / h, 6 - 31 g . The computed magnitudes of the respective homo lumo gaps between 1 and 3 and 2 and 3 of 3.70 and 3.36 ev suggest that efficient mixing of the homos of 1 and 2 with the lumo of 3 is not likely to be prevalent in 4 and 5 . Instead, we envisage that electrostatic and dispersion forces may play a large role in the stabilization of these adducts . To investigate the role played by electrostatic forces in 4 and 5, we decided to inspect the electrostatic potential surfaces of the individual components, as shown in fig ., a distinct accumulation of negative character is observed at the center of the e5 ring . This feature is reminiscent of that observed for simple aromatic units such as benzene or the cyclopentadienide ligands of metallocenes . A closer inspection of the surfaces shows a greater accumulation of negative character at the phosphorus atoms in 1 . This accumulation of negative character appears to be directly aligned with the phosphorus lone pairs that point outward from the center of the p5 ring . Such areas of negative electrostatic potential concentration are much less developed on the surface of the as5 ring in 2, a difference that we assign to the more electropositive character of arsenic and the more diffuse nature of its orbitals . Bearing in mind that the electrostatic potential surface at the center of the 3 is positive, the formation of the adducts 4 and 5 is driven, at least in part, by electrostatic forces as shown by the complementarity of the surfaces that come into contact in the adducts . Calculations were performed using the gaussian program with the b3lyp functional and mixed basis sets: hg, cc - pvtz - pp; p / fe / as, 6 - 311++g * *; f, 6 - 31g(d); c / h, 6 - 31 g . The side - on coordination of the phosphorus complex 1 to the center of 3 in adduct 4 can be correlated to the concentration of negative charges on each of the phosphorus atoms . Similarly, the more co - planar arrangement of the as5 ring and hg3 plane in 5 is proposed to result from the complementarity of the negative and positive electrostatic potential concentrations at the centers of the as5 and hg3 units, respectively . In an effort to further investigate the nature of the hg e interactions in 4 and 5, atoms in molecules (aim) analyses were carried out at the experimentally determined geometries . Xyz plots featuring selected bond critical points between the cyclo - e5 units and 3 are shown in fig . Relevant features of the calculated electron density distributions for selected hg e bond critical points (bcp) found in 4 and 5 are shown in tables 1 and 2, respectively . Tables of the electron density distribution features at all bond critical points found between units of 1 and 3 and 2 and 3 are provided in the esi. In 4, four bond critical points were found between the cyclo - p5 moiety of 1 and the two molecules of 3, as shown in fig . P1, which is positioned above the center of a unit of 3, shares a bcp with each of the proximal hg atoms, with the electron densities at the critical points ranging from 0.072 to 0.105 e . A critical point with a similar electron density (0.072 e) was also found between p3 and hg1 of the second unit of 3 . In 5, the aim analysis found three bcps between the cyclo - as5 moiety of 2 and 3 . The three as atoms closest to 3 (as1, as2, and as5) each share a single critical point with a proximal hg atom, with the electron densities at these critical points ranging from 0.091 to 0.109 e . The values of the electron density, (r), found at the hg e bcps in both 4 and 5 are relatively small, being similar in magnitude to those found for weak hydrogen bonds . The positive values of the laplacian of the electron density at the hg e bcps, (r bcp), are also suggestive of closed shell interactions . The relatively small magnitude of the (r) and (r bcp) values found at the bond critical points are not conclusive evidence of the weakness of the hg e interactions, as (r) values tend to become smaller with increasing diffuseness of the electrons involved . However, the positive values of h(r bcp)/(r bcp), the total energy density at the bcp relative to (r), found at the hg e bcps suggest that any donor acceptor contribution to the hg instead, we note that positive h(r bcp)/(r bcp) values are usually encountered in systems stabilized by electrostatic and/or van der waals interactions . Hence, while donor acceptor bonding cannot be entirely neglected in 4 and 5, electrostatic forces as supported by the preceding potential map analysis must play a prevalent role in the formation of these adducts . Dispersion forces, which are inherently more difficult to visualize, may also play an important role . The ellipticity values (), which provide information on the anisotropy of the electron density perpendicular to the bond path, at the hg p bcps in 4 are small and uniform, indicating that there is no preferential plane of electron density accumulation . This is a characteristic of interactions, in agreement with the orientation of the phosphorus lone pairs toward the mercury atoms . In contrast to those found in 4, the ellipticities at the hg as bcps in 5 are not uniform . The ellipticity value of 0.344 found at the bcp between hg3 and as5 is substantially larger than the values obtained for the two other hg as bcps . Considering the relative uniformity of the (r) values found for all three hg as bcps, the large ellipticity value found for the hg3as5 bcp suggests the involvement of an as as -bond in the interaction with hg3 . Whether the different assembly of the cyclo - p5 and the cyclo - as5 complexes towards the planar lewis acid 3 might be caused by packing effects due to the longer as as bonds (2.33) considering all the presented experimental data we can assume the hgp interactions found in 4 to be weak . Both e5 complexes 1 and 2 exhibit two degenerate orbitals as their homo which are localized on the e5 rings . Consequently, we rationalized that it might be possible to direct the p5 complex to also show an almost cofacial arrangement to the molecular plane of lewis acid 3 . Therefore, we followed a synthetic approach by increasing the steric bulk of the cp ligand on the cyclo - p5 sandwich complex to induce a change of its orientation towards the hg3 plane of 3 in the solid state . For this reason we decided to compare complexes with mono-, di- and trisubstituted tert - butyl - cyclopentadienyl ligands [cpfe(-p5)] (6a), [cpfe(-p5)] (6b), [cpfe(-p5)] (6c). The compounds are obtained by reacting the suitable cp substituted dimeric iron dicarbonyl complexes [cpfe(co)2]2 with white phosphorus at elevated temperature . 5 . All three of the analyzed complexes 6a c show the expected sandwich structure with two parallel five - membered rings . The distances between the fe atom and the center of both rings increase very little when the size of the cp ligand increases . When looking at the top row in fig . 5 it can be seen that the p5 rings are in an almost eclipsed position with the cp rings in all cases . This could be explained by steric effects when looking closer at the bottom row, since two methyl groups of each tert - butyl group are pointing between two p atoms of the p5 rings . The volume of the complexes was determined by dividing the unit cell volume by the number of molecules within the cell . Here it can be seen, that each additional tert - butyl group adds about 100 to the size of the complexes (table 3). With these cyclo - p5 complexes 6a c in hand, we prepared and fully characterized the compounds 7a c formed by the reaction of the cyclo - p5 complex with [(o - c6f4hg)3] in a 1: 1 stoichiometry . The obtained compounds each exhibit a similar assembly to that found in 4, with two cyclo - p5 complexes enclosed by two molecules of 3 held together by weak hgp interactions . There are small differences in the assemblies caused by the steric demand of the cp ligands, but the general arrangement of the cyclo - p5 ring towards the molecular plane of 3 did not change dramatically, although the central phosphorus atom in 7c (fig . 6c) shows only two contacts below the sum of the vdw radii to the hg atoms of 3 . In order to better visualize the different interactions of the cyclo - p5 and the cyclo - as5 ligand towards the planar lewis acid 3 we performed a hirshfeld surface analysis of all of the described compounds . 7 shows a representation of the hirshfeld surfaces (hs) of the planar lewis acid 3 which is facing the cyclo - e5 ligands 1 or 2 derived from the solid state structures of 4 (a + c) and 5 (b + d), respectively . While the first row shows d norm values which are used to identify close intermolecular contacts mapped onto the hs, the second row displays the corresponding shape index . The yellow ellipses highlight the contact regions to the pnictogen atoms of the cyclo - e5 ligands . 7a and c exhibit a pronounced indentation of the hs in the center of the molecule for 4 . 7a additionally shows three close contacts as white to red dots in this region on the hs which arise from interaction of the three hg atoms of 3 with one p atom of the p5 ring . In fig . 7b we can identify a contact area, highlighted in yellow, which shows five small indentations for 5 instead . These can be seen even better in the representation of the respective shape index in fig . 7d, which resembles a face to face arrangement of the as5 plane to the hg3 plane . A detailed hs analysis including decomposed fingerprint plots of all of the described compounds enabled us to further analyze and compare important intermolecular distances . 8 shows the fingerprint plots of the planar lewis acid 3 in 4 and 5 with highlighted regions of contact atom pairs . The fingerprint plots of the lewis acid 3 show some similar features for all of the compounds . While the f h and c h distances naturally represent the shortest intermolecular contacts, the hg hg contacts are already at the edge of hg hg interactions and only contribute less than 2% to the hirshfeld surface . In 7c there are no hg hg contacts at all . However, the hg p and hg as distances represent short intermolecular contacts for their respective atom types below the sum of the vdw radii (see general considerations). The hg p contact area generally contributes about 45% to the hirshfeld surface in all of the cyclo - p5 compounds (4, 7a in contrast, the f h and f f contacts for example are significantly influenced by the respective cyclo - p5 complex (the rising h content of the cp ligand results in a rising f h contact area). Therefore, in accordance with the single - crystal x - ray structure analyses, it can be assumed that the observed arrangement in the solid state of two cyclo - p5 sandwich complexes enclosed by two planar lewis acidic molecules (3) is relatively stable and can resist a considerable increase in size of the adjacent ligands on the cyclo - p5 sandwich complexes . A systematic comparison of the coordination behavior of the cyclo - e5 complexes [cp*fe(-p5)] (1) and [cp*fe(-as5)] (2) towards the planar trinuclear lewis acid [(o - c6f4hg)3] (3) is presented . While one phosphorus atom of the p5 ring of 1 interacts simultaneously with all three hg atoms of 3 resembling a weak lewis acid / base adduct, the analogous cyclo - as5 complex 2 interacts with the hg atoms of 3 via only three as atoms instead showing an almost cofacial arrangement of the as5 plane to the hg3 plane of 3 in the solid state . E interactions which are in agreement with the small shifts in the nmr spectra as well as the absence of any adduct signals in the mass spectra of 4 and 5 . Large energy gaps between the homos of 1 and 2 and the lumo of 3, along with the complementarity of their respective electrostatic potential surfaces, suggests that electrostatic forces play a prominent role in the stabilization and coordination behavior of 4 and 5 . Aim analyses of 4 and 5 corroborate the observed weakness of the hg e interactions, and suggest the involvement of an as as bond in the hg as interactions present in compound 5 . Subsequently, the cyclo - p5 sandwich complexes 6a c as well as their adducts with the lewis acid 3 (7a c) were prepared and fully characterized . By determining the solid state structure and performing a detailed hirshfeld surface analysis for all of the compounds we could demonstrate that the general arrangement that was found for 4 is relatively stable and can resist a considerable increase of steric demand of the cyclo - p5 complexes . A comparison of the hs of 4 and 5 shows quite different contact areas, as expected . In conclusion the presented results show that although the characterized compounds are only supported by weak interactions instead of strong covalent dative bonds a preference of -interaction with the cyclo - p5 complex 1 and -interaction with the cyclo - as5 complex 2 is observed.
|
Ovarian stromal tumor with minor sex cord elements was first described by young and scully in 1983 . Only 11 cases of ovarian stromal tumor with minor sex cord elements have been reported till date . Only three cases of ovarian stromal tumors with minor sex cord elements with coexistent endometrial carcinoma have been reported . We report a case of a 79-year - old female who presented with post - menopausal bleeding and an ovarian tumor which was post - operatively diagnosed as ovarian fibroma thecoma with minor sex cord elements . Patient was also found to have well - differentiated endometrioid adenocarcinoma of uterus and underwent surgical staging for it . A 79-year - old woman presented with post - menopausal bleeding and pain in lower abdomen for 2 months . The obstetric history of the patient was p2l2 and the patient had attained menopause 30 years back . A firm mass was palpable in lower abdomen extending upto umbilicus . On vaginal examination, uterus size could not be made out and a large abdomino pelvic mass was palpable . Abdominal ultrasonography revealed a normal - sized uterus with endometrial thickness of 7 mm and a 20 10 cm solid mass in pelvis and lower abdomen . Patient underwent endometrial aspiration and it was reported as endometrioid adenocarcinoma (grade 1). Patient underwent staging laparotomy which revealed a 20 10 cm solid left ovarian tumor . The right ovary was normal and there was minimal ascites which was sent for cytology . On exploration, intestines, liver and biliary tract, pancreas, omentum, and fallopian tubes the patient underwent total abdominal hysterectomy with bilateral salpingo - oophorectomy, infra - colic omentectomy, and pelvic lymphadenectomy and the specimen was submitted for histopathological examination . Left ovary measured 21 14 10 cm and the cut section was homogenously fleshy with areas showing yellowish discoloration . Cut section of the uterus revealed a 4 3 cm exophytic fundal growth in the endometrial cavity infiltrating less than one - third of the myometrium . The right ovary, omentum, and bilateral fallopian tubes were grossly normal . On microscopic examination, left ovary showed features of a stromal tumor with minor sex cord elements [figure 1]. The tumor comprised mainly of fibroma - thecoma component (more than 90%) with few aggregates of granulosa cells [figure 2]. These granulosa cell aggregates were immunoreactive for inhibin [figure 3a] and calretinin [figure 3b]. Stromal tumor with minor sex cord elements, fibroma with intermingled sex cord structures sex cord structures show scant cytoplasm and a round to ovoid nucleus with a longitudinal groove resembling granulosa cells granulosa cells showing positive immunostaining for (a) inhibin and (b) calretinin multiple sections from the endometrial growth showed features of a well - differentiated endometrioid adenocarcinoma (grade i). The patient did not receive radiotherapy post - operatively and she is on regular follow - up . Ovarian bromas with minor sex cord elements are rare tumors and only 11 such cases have been reported . The predominant component in such tumors is generally broma or thecoma with sex cord elements dispersed randomly and occupy less than 10% of area of the total area of the tumor on any slide . These patients usually present with bleeding per vaginum, pain abdomen, or abdominal mass . The tumor size can range from 1 to 10 cm or ovary may be of normal size . In our patient, the gross appearance of such tumors resembles broma or a thecoma, which are solid, rm, whitish - to - yellow neoplasm . On microscopy, they are composed of spindle - shaped cells, arranged in intersecting fascicles with variable amount of collagen and intermingled sex cord elements . Sex cord components vary in appearance between fully differentiated granulosa cells and indifferent tubular structures resembling immature sertoli cells . Differential diagnoses include ovarian fibromatosis, brenner tumor, and adenofibromas . In ovarian fibromatosis, there is a proliferation of spindle - shaped cells with abundant collagen formation and focal areas of edema . The epithelial aggregates of brenner tumor are composed of transitional cells or mucinous cells . In adenofibroma, the glands are abundant, larger, and tubular and more variable in size when compared to uniform tubules of minor sex cord elements . In 1983, young and scully reported seven cases of fibromatous tumors of the ovary, of which five cases were ovarian fibroma with minor sex cord elements and the other two were luteinized thecoma and stromal - leydig cell tumor with minor sex cord elements . Two out of these seven cases also had well - differentiated adenocarcinoma in the endometrium . Zhang et al . Reported 50 cases of luteinized thecomas and stromal leydig cell tumors . They found the presence of sex cord elements with granulosa cell morphology in only two of 50 cases . A case of mucinous cystadenoma coexisting with stromal tumor with minor sex cord elements was reported by yang et al . Ovarian stromal tumor with minor sex cord elements is a rare tumor, which may be hormonally active predisposing to carcinoma endometrium . Meticulous histopathological examination is essential for identication of the sex cord elements even if potential source of estrogen like the coma is present . Patients diagnosed with such tumors need regular follow - up as the clinical behavior and risk of recurrence in these patients require further evaluation.
|
Diabetes mellitus may predispose individuals to invasive fungal infections (ifi) probably related to impaired functions of neutrophils, macrophages, cellular and humoral immunity, and iron metabolism (1, 2). Children with type 1 diabetes (t1d) who present with ketoacidosis have increased susceptibility to infections partly due to the acidic environment that is ideal for certain pathogens including invasive fungi (1, 3). Majority of the ifis in children with poorly controlled t1d and ketoacidosis are caused by zygomycoses and are invariably fatal without aggressive management (4). The key to good outcome is fast and accurate diagnosis which is usually difficult to establish due to non - specific clinical symptoms and signs and the need for invasive diagnostic procedures for confirmation of ifi (4, 5). The treatment is often challenging as it involves extensive surgical debridement of involved tissues in addition to antifungal drugs (4). The outcome is generally poor in resource constrained setups like ours but is gradually showing improvements (6, 7). The data on outcome of ifis in children with t1d is scarce and is almost confined to invasive zygomycosis (4). With an aim to determine the clinical spectrum and final outcome of children diagnosed with t1d and ifi over the last decade at our hospital, we performed a retrospective review of their medical records . The analysis of hospital data of patients with t1d diagnosed to have a confirmed ifi was conducted at advanced pediatrics center of our institute which is a tertiary care referral center located in northwest india and included the period from march, 2004 to february, 2014 . All patients were diagnosed as t1d according to the international society for pediatric and adolescent diabetes (ispad) criteria published in 2000 and revised in 2009 (8, 9). The diagnosis of associated fungal infection was based on microbiological and/or histopatholgical examination of tissue specimens . Data related to the basic demographic profile, age at the time of diagnosis, mode of initial presentation like diabetic ketoacidosis (dka), imaging details, treatment modalities, duration of hospitalization and the final outcome were noted . Ten patients (6 girls and 4 boys) amongst 524 children with t1d on follow up in pediatric diabetes clinic were treated for various ifis during the study period . The mean (sd) age of presentation was 9.1 (3.4) yrs (range 312 yrs). The predisposing factors included poor adherence to insulin therapy resulting in poor metabolic control (mean hba1c 9.3 1.2%) and presence of acidosis in 9 patients and malnourished state in all (mean bmi 12.6 1.2 kg / m). Nine patients presented with dka . The commonest presenting feature related to fungal infection with suspected rhinocerebral involvement was facial and/or orbital swelling in 5 patients, followed by serosanguineous nasal discharge and ophthalamoplegia . The most common site of fungal infection was nasal cavity and paranasal sinuses seen in 6 patients; 5 of these were due to mucormycosis while 1 had aspergillus flavus . Sinusitis involved ethmoid sinus in 5 patients and maxillary and frontal sinuses in 4 patients each (table 1table 1clinical and laboratory profiles, treatment modalities and outcome of the study cohort). Lung involvement was seen in 5 patients; 2 of these had pleural and thymic involvement in addition . All patients showed neutrophilic leucocytosis with mean leukocyte count of 12.3 10/l . Radiological investigations included contrast enhanced computed tomography (cect) scans of suspected involved sites in all patients . 1.a: soft tissue opacities in frontal and ethmoid sinuses with blocked osteomeatal complex . B: opacification of right maxillary sinus . ); 2 of these had orbital extension . 2.a & b: cect chest showing cavitatory pneumonia on right side . ); 1 patient, described elsewhere, showed empyema in addition (10). Another patient had necrotic thick walled abscess in the thymus with consolidation of apical segment of right upper lobe and small subpleural nodular lesions in the right lower lobe (11). A: soft tissue opacities in frontal and ethmoid sinuses with blocked osteomeatal complex . Confirmation of diagnosis by direct microscopy of specimen (smear / aspirate) was made in 1 patient, by histopathological examination in 5 patients and by both techniques in 4 patients . Culture on sabouraud dextrose agar grew rhizopus microsporum (rhizopodiformis) in 1 patient . The most common yield was from smear or histopathological examination of tissues obtained at the time of surgical debridement of paranasal sinuses . In 2 patients who had serosanguineous nasal discharge the identified etiological fungi belonged to the order mucorales in 9 cases (1 further identified as rhizopus microsporum) and aspergillus flavus in 1 patient . The mean time from presentation to diagnosis was 5.8 4.7 days (range 114 days). All patients were treated with either intravenous amphotericin b (conventional or liposomal) or voriconazole for a targeted duration of 46 weeks . Surgical intervention was done in 8 patients and included debridement of paranasal sinuses by either endoscopy or external approach in 5, excision of brain abscesses in 1, resection of affected lung areas in 2 and excision of thymic abscess in 1 patient . Mean duration of hospital stay was 41.7 27.2 days (range 290 days). Two out of 10 patients died; 1 with pulmonary mucormycosis suffered massive hemoptysis on day 14 of hospitalization while the other with disseminated aspergillosis died of a large bout of hematemesis and showed an intestinal perforation on autopsy . All survived children have remained well over a mean duration of 4.96 3.3 yrs (range 9 mo9 yrs) in follow up except 1 who continues to show mild restrictive pattern on pulmonary function tests . Invasive mycoses are uncommon but often lethal infections that disproportionately affect t1d patients with poor metabolic control (2, 3). Poor adherence to insulin therapy, malnourished state and episodes of ketoacidosis particularly predispose children with t1d to develop ifis (2, 3, 11, 12). Majority of our patients had all these critical factors required for development of ifis . Poor glycemic control may result in dysfunctions of macrophage phagocytosis, neutrophil chemotaxis and oxidative killing (1), and ketoacidosis may induce a temporary block in binding of iron to transferrin providing free iron which enhances growth of many ifis particularly mucormycosis (2, 13, 14). Poor compliance to therapy as evidenced by poor clinic attendance, risk taking behaviors and recurrent admissions for dka has been documented to increase susceptibility to ifis (12). Similarly malnourished state resulting either from a poor glycemic control or poor dietary management predispose diabetic children to ifis (3, 10,11,12). The presence of critical predisposing factors and an unusually high occurrence of ifis in our patients is probably a result of the prevailing healthcare situation related to the management of t1d in children in our setup (15). Late diagnosis of diabetes due to lack of awareness of parents and the primary healthcare physicians is common in india (15). Poor metabolic control is also common due to lack of comprehensive diabetes care (15, 17). There are only a few specialized centers and majority of the patients are treated by the primary care physicians who have limited knowledge about the disease and the modern treatment options (15). Additionally, poor socioeconomic status often makes even the conventional insulin therapy and blood glucose monitoring unaffordable by the parents (15). The prevention of ifis in children with t1d requires early diagnosis of diabetes before onset of ketoacidosis, meticulous glycemic control in follow up and good nutritional management . Improvements in diagnosis and care of children with t1d in our country setup will probably lower the incidence of ifis in these patients in future . Establishment of an early diagnosis of ifi is important but is often difficult due to absence of specific symptoms (5). We believe that a high index of clinical suspicion in a setting of predisposing risk factors present in our patients resulted in rapid establishment of diagnosis . Presence of subtle clinical features like dry cough, tachypnea persisting after resolution of acidosis, facial swelling, serosanguineous nasal discharge and low grade fever in poorly controlled, malnourished children who present in ketoacidosis are pointers to the presence of ifis (5, 11, 12). In patients suspected to have rhinocerebral involvement, smear examination of scrapings from nasal or sinus cavity are useful aid to rapid diagnosis . The diagnosis of pulmonary ifi is highly probable if the ct scan shows cavitary pneumonia in a child with minimal pulmonary symptoms and previously described risk factors (10). Fine needle aspiration cytology can be very useful in reaching an early diagnosis of pulmonary ifis as compared to more invasive transbronchial biopsy (10, 18). The cornerstone of management is a combination of antifungal drugs and early surgical debridement of involved tissues that may prevent extension of infection to the surrounding areas (4, 19). Treatment with antifungals alone is usually ineffective due to poor concentrations in affected tissues resulting from vascular invasion, thrombosis, occlusion and infarction (4). In our patients who had rhinosinusitis, early surgical debridement probably prevented a contiguous extension of infection into the brain . One of the 2 patients who received only antifungal therapy died; the survivor received liposomal amphotericin b which had been previously reported to be able to achieve cure even in the absence of associated surgery (20). The success rates of a multimodal treatment approach in our study are similar to those achieved across many centers around the world (4, 5, 19). The long term morbidity related to consequences of the fungal disease was also minimal and confined to the sequelae of tissue loss from radical surgeries . In conclusion, rapid and accurate diagnosis of ifis in children with t1d and a multimodal management approach involving early surgery, appropriate antifungal therapy and control of hyperglycemic state is successful in achieving a good outcome . To the best of our knowledge, ours is the largest single center data and the first study from a developing country setup on ifis exclusively in children with t1d.
|
Patients with conditions such as psoriasis, eczema, and skin cancer frequently face psychologic challenges which, in turn, impact their social functioning and the kind of life that they lead . Patients may experience fearful anticipation of interaction with others, even when symptoms are not present, and develop avoidance - coping mechanisms . This may prevent them from partaking fully, or at all, in social and recreational activities or employment . Ultimately, visible symptoms may change how patients see themselves and how they perceive their future . Multiple studies reveal consistently poorer quality of life and psychosocial functioning scores among patients with visible dermatologic skin conditions compared with those who do not have such conditions [25]. The incidence of psychosocial comorbidities among such patients is high, as evidenced by a study which found that the risks of depression, anxiety, and suicidality attributable to psoriasis were 11.8, 8.1, and 0.4 per 1000 person years, respectively (table 1).table 1the attributable risk of psoriasis for diagnosis with depression, anxiety, and suicidality mild psoriasissevere psoriasisall psoriasisdepression attributable risk per 1000 person - years11.525.511.8anxiety attributable risk per 1000 person - years8.08.18.1suicidality attributable risk per 1000 person - years0.40.40.4reproduced with permission from arch dermatol . All rights reserved adjusted for age and sex the attributable risk of psoriasis for diagnosis with depression, anxiety, and suicidality reproduced with permission from arch dermatol all rights reserved adjusted for age and sex the dermatologist can play an important role in helping patients to overcome such substantial challenges and improve their overall quality of life . We discuss several important considerations and propose strategies to assist dermatologists in addressing the important psychosocial side of treatment in patients with visible skin conditions . Studies have shown that successful treatment, which improves the patient s symptoms and changes their physical appearance, can lead to improvement in psychologic symptoms and a better quality of life [2, 6]. However, it is important to note that, sometimes, greater life satisfaction is achieved by accepting that perhaps some symptoms will remain or recur, even if a patient generally responds well to treatment . Such acceptance involves acknowledging the existence of symptoms, but frees up the patient to pursue a meaningful life that is not overly limited by their condition . It is also crucial that patients are provided with the tools to accept their remaining symptoms and to reduce the impact of these on everyday life . As a clinician, one is familiar with the broad spectrum of available treatment options and the tools used to objectively measure outcomes in a clinical and/or academic setting . Treatment may be deemed successful if improvements in physical symptoms are in line with the results one would typically observe in other patients, or those that have been reported in clinical trials . However, it is important to remember that other factors may influence the patient s own perception of treatment success . Patients have their own preferences and priorities regarding what treatment outcomes are more important to them . For example, one patient may favor reduction or elimination of signs of disease that are visible to others when wearing typical clothes (which may change with the season), whereas another patient may be more interested in reducing their level of physical discomfort . Patients satisfaction is strongly influenced by their initial expectations and the changes they were expecting to see, as well as those of their family and friends; objective measures of symptom improvement may be less important to them . Therefore, when evaluating treatment options, it is important to consider asking the patient what outcomes are most important to them and to discuss what it is reasonably possible to achieve . As such, a broad outcome measure that includes psychosocial and overall quality of life measures, in addition to symptom remission, would be of particular value ., clinicians may wish to discuss expected outcomes before treatment is initiated, including the degree of symptom improvement that can realistically be expected, the likelihood of success, and the timescales involved . This would ideally be a two - way conversation, in which the clinician could ask the patient to explain their hopes and expectations as a result of their treatment . There are several ways in which realistic expectations (i.e. Not too high and not too low) will result in the best outcome for the patient . If expectations are sufficiently high, a patient is more likely to be willing to initiate treatment and remain compliant, as they will be confident that they will eventually see an improvement in their symptoms . Similarly, if they have a tempered understanding of the expected degree of improvement, and when this may occur, they will be more likely to adhere to treatment without getting discouraged by seemingly poor results . This is especially important in the case of complicated regimens, such as those associated with frequent or inconvenient drug administration, those that involve some degree of pain or discomfort, or those in which extensive treatment is required before symptoms begin to improve . Secondly, appropriate expectations can help a patient and their family to know when they need to return to the clinician and ask for a different treatment approach . Such a dynamic, interactive relationship between the clinician and the patient can ensure that the patient s needs are being met wherever possible, and may reduce unnecessary time and costs associated with treatment that is inappropriate or ineffective for that person . Finally, focusing on the broad improvement of patient quality of life, and not just on the management of visible symptoms, may help to reduce the often excessive pressure placed on healthcare providers by patients with unrealistic expectations for improvement . This can improve the clinician's own sense of job satisfaction, as well as the overall relationship between the clinician and the patient . Impairment, however, is defined as the suffering that can be caused by symptoms, and may be physical, psychologic, and/or social . The degree of impairment caused by a given symptom is often different in different people; in fact, a patient can have a severe symptom but not be impaired by it at all . Conversely, a different patient may be greatly impaired by symptoms of relatively mild severity, with a tremendously negative impact on their life . For example, an insecure teenager may feel extremely self - conscious about minor acne and avoid some social situations, whereas a confident young adult with much worse symptoms may hardly think about them . When it comes to reducing the psychologic impact of a dermatologic condition and improving the patient s quality of life, it is crucial that we address impairment and not just symptoms . It is possible for a patient to actively refuse to be unnecessarily limited by their symptoms, rather than be passively resigned to them . However, support and encouragement are often needed in order for a patient to achieve this . As clinicians, we have the opportunity to encourage patients to live a big life, i.e. A life that is fulfilling, rewarding, meaningful, and interesting, and that has a positive impact on the world, in which the person accomplishes most of what they set out to do . In turn, the patient may strive to be the person that they want to be, regardless of their health status . Other professionals, such as nurses, psychotherapists, or counsellors, who may be involved in the wider healthcare circle of a patient, can also assist in this regard . In some cases, an overly negative response to symptoms can be indicative of low self - esteem, anxiety, or depression, which can warrant a referral to a mental health professional to help the patient cope, not only with their dermatologic condition, but also with other matters . We can help patients to redefine themselves by asking the question, what would / could you do if you did not have these symptoms? It should be emphasized that, although symptoms may affect how a patient lives their life, symptoms do not necessarily need to rule a patient s life . We can also help patients to understand that tolerating discomfort may allow them to pursue more interesting goals in life . Mental health professionals can help more limited patients to learn better coping methods to deal with sometimes debilitating discomfort . Patients should, of course, be encouraged to follow the treatment regimen, and active engagement with the clinician will enable the patient to feel that they are in control of their condition and their treatment program . However, we can emphasize to patients that it is important not to wait for complete symptom remission before pursuing a fulfilled life . Some patients restrict their social engagement because they feel self - conscious about their visible symptoms and do not know how to respond to people s questions about them, such as why they look that way, or whether the condition is contagious . Helping patients find the right words to explain their visible symptoms to others can help them feel more comfortable going out into the world . This is particularly true of situations in which the patient is likely to encounter people who are more likely to make inappropriate comments, ask personal questions, or make incorrect assumptions, such as that the condition is highly infectious . It is easier for the patient to cope and feel confident in such situations if they have an appropriate and informed range of responses prepared in advance . Patients can choose to share personal information, but they also have the right not to do so . Visible medical conditions such as psoriasis, eczema, and skin cancer often have a substantial psychologic and social impact on patients . However, through appropriate discussion and interaction with a patient, the dermatologist can play an important role in helping to reduce this impact, potentially improving the patient s overall quality of life . It is important to discuss expected outcomes before treatment is initiated, in order to ensure that realistic expectations are in place . It may also be beneficial to discuss whether total symptom relief is a necessary component to living a better life . In addition, helping patients to find the right words to explain their visible symptoms to others can help them feel less self - conscious and more confident in a public setting . Helping patients to come to terms with their condition, and helping them to build the skills required to reduce the psychosocial impact of their condition, may mean that they are more equipped to go out into the world and pursue a more meaningful life . This article is based on previously conducted studies and does not involve any new studies of human or animal subjects performed by any of the authors.
|
Central serous chorioretinopathy (cscr) is a relatively common ophthalmic disorder characterized by the development of a serous detachment of the sensory retina due to a deficient pumping function at the retinal pigment epithelium level.13 diagnosis of cscr is made using fluorescein angiography, while retinal optical coherence tomography can demonstrate shallow serous detachment.2,4 cscr typically affects adults between 30 and 50 years of age . Symptomatic patients may experience sudden onset of dim and blurred vision, micropsia, metamorphopsia, decreased color vision, and central scotoma.5 although the condition is normally unilateral, bilateral involvement have been reported in about 40% of cases.1,2 further, cscr typically occurs more frequently in young males than in females.3 thus, males show a significantly higher mean annual incidence of cscr than females, and the peak mean annual incidence occurs in men between 35 and 39 years.6 in most cases, cscr is self - limiting and resolves spontaneously in 23 months, though usually without a complete recovery of visual function.3 furthermore, some patients may suffer from persistent or recurrent cscr with subsequent progressive loss of vision.7 recurrent cscr is associated with a variety of psychiatric disorders.7 thus, the quality of life (qol) of patients with cscr may be compromised as a side effect of disturbing symptoms that occur during both acute and chronic phases of the disease.3 neither the etiology nor the pathophysiology of cscr is completely understood . Nonetheless, a range of psychological and psychophysiological variables have been found to be associated with the occurrence of cscr . For example, correlations of type a personality, systemic hypertension, and obstructive sleep apnea have been reported with cscr disease.2,8 further, almost half of patients with cscr have been reported to use exogenous steroids.9 other risk factors are pregnancy, use of antibiotics, antihistamines, alcohol, smoking, and respiratory diseases.1016 further, conrad et al17 showed that patients with cscr were more stressed as a result of inadequate coping strategies and a higher incidence of physical complaints . Several studies have shown that patients with cscr have higher scores for psychopathological symptoms when compared to healthy controls.3,17 conrad et al17 found that cscr patients had significantly higher emotional distress as measured by the global severity index compared to healthy controls . This may reflect inadequate coping strategies, as indicated in higher levels of physical complaints in the patient group.17 sahin et al3 found that cscr patients had more marked psychological symptoms and poorer qol than healthy control subjects . They also showed that the psychological status and qol of cscr patients varied with degree of loss of vision.3 siguan and aguilar5 found that patients with cscr were more likely to display tendencies to schizophrenia (84%), hysteria (83%), depression (75%), psychopathic deviance (67%), and hypochondriasis (58%) than control groups . Piskunowicz et al concluded that compared to healthy controls, patients with cscr were more insecure, reported higher levels of frustration and higher levels of anticipatory anxiety.16 in another study, greater use of psychopharmacologic drugs was identified as an independent risk factor for the development of cscr.6 in this study, not exposure to but intake of antianxiety drugs was predominantly observed in male participants . Taken together, numerous studies show an association between the occurrence of cscr and psychological and psychophysiological characteristics . Further, the study by tsai et al6 indicated that cscr may be associated with the use of antianxiety drugs, though, surprisingly, to the best of our knowledge, no study has yet examined the association between the occurrence of cscr and anxiety . In this specific context, anxiety is understood as a psychobiological process with the following characteristics: emotions such as fears and worries; anticipation of the worst, irritability, feelings of tension, loss of interests, and inability to relax; cognitions including dysfunctional thoughts of not being able to cope with issues or catastrophizing; somatic complaints such as pains, aches, weakness, and flushes; physiological alterations such as gastrointestinal pain, high heart rate, respiratory symptoms, and genitourinary symptoms; and behavioral changes such as sighing and rapid respiration, hand tremor, fidgeting, and avoidance of situations which might reduce anxiety . Given that cscr is associated with dramatically impaired vision, a human being s most important sense, we anticipate that cscr will be associated with anxiety and believe this link should be investigated . We also believe that if cscr is associated with anxiety, then this offers a good starting point for psychotherapeutic treatment, with cognitive - behavioral therapies (cbt) having proved efficacious in the treatment of anxiety . Additionally, we note that cscr is self - limiting and resolves spontaneously in 23 months . Accordingly, treating cscr - related anxiety should be particularly efficacious . Finally, if patients are experiencing cscr for a second time, they should be aware that the condition is generally fully reversible, that it resolves spontaneously within 23 months, and, consequently, they should experience less anxiety . As regards the relation between anxiety and sex, a recent review18 concluded that female adults were twice as likely as males to develop or display anxiety disorders (see also16). However, to our knowledge, it is unclear to what extent females suffering cscr will also report greater anxiety . Accordingly, a further aim of the present study was to explore to what extent anxiety scores differ between male and female patients with cscr . Based on the literature, the following two hypotheses were formulated . First, we expected higher anxiety scores in patients with cscr when compared with healthy controls . Second, we expected lower anxiety scores in cscr patients suffering from cscr for a second time . We treated as exploratory the question of whether females with cscr have higher anxiety scores than males with cscr . To address these research questions, a sample of iranian patients with cscr was assessed; a sex - and age - matched control group was assessed in parallel . Evidence concerning patients with cscr has predominantly been gathered in western countries; with the present study, we aimed to contribute to the research on cscr with a non - western sample . A total of 30 patients (mean age: 36.10 years, standard deviation = 2.34; 43% female) suffering from cscr were assessed in the farshchian hospital, hamadan, iran, between 2012 and 2013 . Of these this sample therefore allowed exploration of anxiety as a function of number of occurrences of cscr . In parallel, a control group was assessed (mean age: 35.90 years, standard deviation = 2.30; t=0.34, p=0.74, d=0.087; sex distribution: [n=60, df=1]=0.28, p=0.60). These healthy controls were recruited via word - of - mouth - recommendation and via advertisements among staff members of the farshchian hospital . To avoid possible confounders, the control group was matched for sex, age, marital status, economic circumstances, educational level, and place of residence . Table 1 gives the demographic data and statistical comparisons between the three groups . To gather demographic, cscr - related and anxiety - related data, the assessment of both patients and healthy controls involved a brief medical interview and medical analysis of cscr, focusing on current and past cscr (for patients only), and on anxiety . To assess cscr, in addition to medical history records, an ophthalmologist not further involved in the study performed fluorescein angiography and optical coherence tomography . Further, unilateral or bilateral involvement and data on loss of visual acuity and duration were assessed . Patients with a first or second cscr did not descriptively and statistically differ as regards sociodemographic variables, uni- versus bilateral involvement, loss of acuity of the current cscr, and duration of cscr (see table 1). A trained psychologist not further involved in the study performed the brief interview to assess anxiety (see below). All participants were fully informed about the purpose of the study, and provided written informed consent . The study was approved by the ethics committee of the hamadan university of medical sciences (hamadan, iran), and was conducted in accordance with the ethical standards laid down in the declaration of helsinki . The hamilton anxiety rating scale (ham - a)19 is a rating scale consisting of 14 items focusing on symptoms of anxiety . Specifically, experts ask patients about anxious mood (worries, anticipation of the worst, fearful anticipation, irritability), tension (feelings of tension, fatigability, startle response, moved to tears easily, trembling, feelings of restlessness, inability to relax), fears (of dark, of strangers, of being left alone, of animals, of traffic, of crowds), insomnia (difficulty falling asleep, broken sleep, unsatisfying sleep and fatigue on waking, dreams, nightmares, night terrors), intellectual difficulties (difficulty concentrating, poor memory), depressed mood (loss of interest, lack of pleasure in hobbies, depression, early waking, diurnal swing), somatic complaints (muscular pains and aches, twitching, stiffness, myoclonic jerks, grinding of teeth, unsteady voice, increased muscular tone), somatic complaints (sensory: tinnitus, blurring of vision, hot and cold flushes, feelings of weakness, pricking sensation), cardiovascular symptoms (tachycardia, palpitations, pain in chest, throbbing of vessels, fainting feelings, missing beat), respiratory symptoms (pressure or constriction in the chest, choking feelings, sighing, dyspnea), gastrointestinal symptoms (difficulty in swallowing, wind abdominal pain, burning sensations, abdominal fullness, nausea, vomiting, stomach rumbling, looseness of bowels, loss of weight, constipation), genitourinary symptoms (frequency of micturition, urgency of micturition, amenorrhea, menorrhagia, development of frigidity, premature ejaculation, loss of libido, impotence), and autonomic symptoms (dry mouth, flushing, pallor, tendency to sweat, giddiness, tension headache, raising of hair). Experts also noted behavior at interview (fidgeting, restlessness, or pacing; tremor of hands; furrowed brow; strained face; sighing or rapid respiration; facial pallor; swallowing, etc). Answers were scored on five - point likert scales ranging from 0 (not present) to 4 (very severe), with higher sum scores reflecting more severe anxiety (range: 056 points). The following categories were also defined: <15 points indicates mild anxiety, 1528 points indicates moderate anxiety severity, 2942 points indicates severe anxiety, and 4356 points indicates extremely severe anxiety . Reliability, validity, and sensitivity of the tool have been reported for the farsi version.20 (cronbach s alpha of the present study: 0.91). To compare the demographic data of patients and healthy controls, two student s t - tests (age and duration of cscr) and a series of tests were performed . Cscr - related information between patients with one or with two occurrences of cscr were compared with tests and t - tests . Next, an analysis of variance was performed with the factors group (patients with cscr for the first time; patients with cscr for the second time; healthy controls) and sex (female versus male), and with hamilton anxiety scale scores as the dependent variable . To explore the association between anxiety scores and cscr - related data (duration, loss of acuity) cohen s d effect sizes were reported with the following indices: d<0.50: small effect, d<0.79: medium effect, and d>0.8: large effect . For analyses of variance, effect sizes were indicated with the partial eta - squared (), with 0.0590.01 indicating small, 0.1390.06 indicating medium, and 0.14 indicating large effect sizes . A total of 30 patients (mean age: 36.10 years, standard deviation = 2.34; 43% female) suffering from cscr were assessed in the farshchian hospital, hamadan, iran, between 2012 and 2013 . Of these this sample therefore allowed exploration of anxiety as a function of number of occurrences of cscr . In parallel, a control group was assessed (mean age: 35.90 years, standard deviation = 2.30; t=0.34, p=0.74, d=0.087; sex distribution: [n=60, df=1]=0.28, p=0.60). These healthy controls were recruited via word - of - mouth - recommendation and via advertisements among staff members of the farshchian hospital . To avoid possible confounders, the control group was matched for sex, age, marital status, economic circumstances, educational level, and place of residence . Table 1 gives the demographic data and statistical comparisons between the three groups . To gather demographic, cscr - related and anxiety - related data, the assessment of both patients and healthy controls involved a brief medical interview and medical analysis of cscr, focusing on current and past cscr (for patients only), and on anxiety . To assess cscr, in addition to medical history records, an ophthalmologist not further involved in the study performed fluorescein angiography and optical coherence tomography . Further, unilateral or bilateral involvement and data on loss of visual acuity and duration were assessed . Patients with a first or second cscr did not descriptively and statistically differ as regards sociodemographic variables, uni- versus bilateral involvement, loss of acuity of the current cscr, and duration of cscr (see table 1). A trained psychologist not further involved in the study performed the brief interview to assess anxiety (see below). All participants were fully informed about the purpose of the study, and provided written informed consent . The study was approved by the ethics committee of the hamadan university of medical sciences (hamadan, iran), and was conducted in accordance with the ethical standards laid down in the declaration of helsinki . The hamilton anxiety rating scale (ham - a)19 is a rating scale consisting of 14 items focusing on symptoms of anxiety . Specifically, experts ask patients about anxious mood (worries, anticipation of the worst, fearful anticipation, irritability), tension (feelings of tension, fatigability, startle response, moved to tears easily, trembling, feelings of restlessness, inability to relax), fears (of dark, of strangers, of being left alone, of animals, of traffic, of crowds), insomnia (difficulty falling asleep, broken sleep, unsatisfying sleep and fatigue on waking, dreams, nightmares, night terrors), intellectual difficulties (difficulty concentrating, poor memory), depressed mood (loss of interest, lack of pleasure in hobbies, depression, early waking, diurnal swing), somatic complaints (muscular pains and aches, twitching, stiffness, myoclonic jerks, grinding of teeth, unsteady voice, increased muscular tone), somatic complaints (sensory: tinnitus, blurring of vision, hot and cold flushes, feelings of weakness, pricking sensation), cardiovascular symptoms (tachycardia, palpitations, pain in chest, throbbing of vessels, fainting feelings, missing beat), respiratory symptoms (pressure or constriction in the chest, choking feelings, sighing, dyspnea), gastrointestinal symptoms (difficulty in swallowing, wind abdominal pain, burning sensations, abdominal fullness, nausea, vomiting, stomach rumbling, looseness of bowels, loss of weight, constipation), genitourinary symptoms (frequency of micturition, urgency of micturition, amenorrhea, menorrhagia, development of frigidity, premature ejaculation, loss of libido, impotence), and autonomic symptoms (dry mouth, flushing, pallor, tendency to sweat, giddiness, tension headache, raising of hair). Experts also noted behavior at interview (fidgeting, restlessness, or pacing; tremor of hands; furrowed brow; strained face; sighing or rapid respiration; facial pallor; swallowing, etc). Answers were scored on five - point likert scales ranging from 0 (not present) to 4 (very severe), with higher sum scores reflecting more severe anxiety (range: 056 points). The following categories were also defined: <15 points indicates mild anxiety, 1528 points indicates moderate anxiety severity, 2942 points indicates severe anxiety, and 4356 points indicates extremely severe anxiety . Reliability, validity, and sensitivity of the tool have been reported for the farsi version.20 (cronbach s alpha of the present study: 0.91). To compare the demographic data of patients and healthy controls, two student s t - tests (age and duration of cscr) and a series of tests were performed . Cscr - related information between patients with one or with two occurrences of cscr were compared with tests and t - tests . Next, an analysis of variance was performed with the factors group (patients with cscr for the first time; patients with cscr for the second time; healthy controls) and sex (female versus male), and with hamilton anxiety scale scores as the dependent variable . To explore the association between anxiety scores and cscr - related data (duration, loss of acuity), pearson s correlations were performed . For t - tests, cohen s d effect sizes were reported with the following indices: d<0.50: small effect, d<0.79: medium effect, and d>0.8: large effect . For analyses of variance, effect sizes were indicated with the partial eta - squared (), with 0.0590.01 indicating small, 0.1390.06 indicating medium, and 0.14 indicating large effect sizes . Table 2 reports all descriptive and statistical information for the hamilton anxiety scale scores, separately for group (controls; patients: first cscr; patients: second cscr) and sex (males versus females). Figure 1 shows the hamilton anxiety rating scale scores, separately for groups and sex . Hamilton anxiety scale scores differed significantly between groups, with lower scores in the control group when compared to the two patient groups . No statistically significant correlations were observed between the anxiety scores and the loss of acuity and duration of the current cscr, the area of detachment, and the permeability and dilatation of choroid (ie, choroidal homeostasis; all rs<0.11 ps>0.60). Table 2 reports all descriptive and statistical information for the hamilton anxiety scale scores, separately for group (controls; patients: first cscr; patients: second cscr) and sex (males versus females). Figure 1 shows the hamilton anxiety rating scale scores, separately for groups and sex . Hamilton anxiety scale scores differed significantly between groups, with lower scores in the control group when compared to the two patient groups . No statistically significant correlations were observed between the anxiety scores and the loss of acuity and duration of the current cscr, the area of detachment, and the permeability and dilatation of choroid (ie, choroidal homeostasis; all rs<0.11 ps>0.60). The key findings of the present study were that, compared to healthy controls, patients suffering from idiopathic cscr experienced higher anxiety, that anxiety in patients with cscr was higher irrespective of whether cscr was experienced for the first or for the second time, and that anxiety scores did not differ between males and females . The present study adds to the literature on cscr and psychological functioning in an important way in showing that the occurrence of cscr was associated with anxiety . Two hypotheses and one exploratory research question were formulated, and each of these is considered in turn . Our first hypothesis was that patients with cscr would have higher scores for anxiety than healthy controls, and this hypothesis was fully confirmed . This result is consistent with the pattern of previous findings showing that occurrence of cscr is associated with psychological issues.3,7,16,17 however, the present study adds to the current literature in an important new way; it is the first demonstration of a link between cscr and the experience of anxiety . First, if it is accepted that vision is the most important of human senses, it is not surprising that impairment of vision is associated with anxiety, that is, with the subjective experience of threat and danger . Second, given that vision is of overwhelming importance to human survival,21 it seems somewhat surprising that, to our knowledge, there has not previously been any investigation of the association between cscr and anxiety . Third, indirect evidence for an association between anxiety and cscr is provided by the observation that abuse of anxiolytics seems common among patients suffering from cscr (tsai et al6), suggesting that anxiety is a major concern among such patients . Overall, in our opinion, the present results might be considered an advance in the understanding of psychological processes and concerns among patients with cscr . Our second hypothesis was that anxiety would be lower among patients suffering from cscr for the second time than among first - time sufferers . This suggests that experiencing cscr for a second time is not associated with an appreciation that cscr is a transitory, treatable, and readily manageable impairment of vision . Unfortunately, the present data do not provide any deeper insight into patients cognitive and emotional processes . Specifically, it was not clear why patients suffering from cscr for a second time did not display more optimism and confidence about improvement in their condition, given that, in all patients suffering from cscr for a second time, no residual or irreversible impairments of the ocular apparatus have been observed or reported in the ophthalmologic records . In other words, why had patients not learned from their first experience that suffering cscr for a second time was no reason for fear? Again, the present data do not shed any light on the underlying cognitive emotional mechanisms . Though highly speculative, we advance the following explanation . First, evidence shows that anxiety is a psychiatric disorder, which normally requires psychopharmacological and psychotherapeutic treatment . Accordingly, it is unlikely that anxiety would disappear without professional treatment and on the basis of mere experience . Second, by definition, anxiety is fueled by dysfunctional emotional and cognitive processes such as catastrophizing thinking and negative expectations, often built up over a long period of time . Accordingly, it is unlikely that experiencing cscr for only the second time would be sufficient not to trigger anxiety again . Most importantly, this assumption is further supported by the observation that no meaningful associations between anxiety scores and loss of acuity and duration of the current cscr, the area of detachment, and the permeability and dilatation of of choroid vessels (ie, choroidal homeostasis) could be observed . Third, if we take into account that patients suffering from cscr might also have personality traits such as type a personality and low stress tolerance,16,17 the underlying common factor might be anxiety . Fourth, given that cscr might also be associated with subsequent partial loss of vision,7 fear of losing vision when cscr occurs for a second time is not surprising . Finally, given that the recurrence of cscr might also be associated with impaired qol3 and increased risk of suffering from psychiatric disorders,7 the persistence of anxiety is consistent with the cognitive emotional framework surrounding impaired qol and psychiatric disorders . In our view, several factors in combination are likely to ensure that anxiety is not lower when experiencing cscr for a second time . Last, we treated as exploratory the question as to whether female patients with cscr would exhibit higher anxiety scores than male patients . It has been observed that, compared to adult males, adult females are one - and - a - half to two times more likely to suffer from anxiety.18 however, in the present study, we found no such difference . Accordingly, these results add to the current literature in a further important way by indicating that anxiety associated with cscr is not sex - biased . Despite the intriguing results, several limitations warn against overgeneralizing the results . First, the sample size was small, though the statistical indices focused on effect sizes, which are not sensitive to sample size . Second, data were gathered at one study center and a systematic bias in data collection and sample is therefore possible . Third, and most importantly, we considered only anxiety . Whereas assessing anxiety in patients with cscr was the key focus of the present study, we are fully aware that anxiety might be a comorbid symptom of further underlying dysfunctional cognitive emotional processes such as personality traits and psychiatric disorders . Fourth, in this respect, further unassessed but latent psychophysiological factors might have biased two or more dimensions in the same direction . Anxiety scores were not lower if cscr was experienced for a second time, suggesting therefore that no psychophysiological adaptation occurs with repetition of cscr.
|
Congenital myasthenic syndromes (cms) are inherited disorders of neuromuscular transmission caused by various genetic defects at presynaptic, synaptic, or postsynaptic levels . They are characterized by fatigable weakness involving ocular, bulbar, and limb muscles with the onset in the early years . Severity and progression can be variable, ranging from minimal symptoms to progressive disabling weakness . In some types of cms, sudden severe exacerbations of weakness or even acute respiratory crises they are often misdiagnosed or the diagnosis is made quite late, as symptoms can be subtle or nonspecific in the early age and may evolve over time . Electromyogram (emg) reveals a decremental response on repetitive nerve stimulation or jitter and blocking with single - fiber emg . Bulbar dysfunction as an initial presentation of cms is not widely reported in the literature . We describe three children who presented with bulbar difficulties and had either receptor - associated protein of the synapse (rapsn) or cholinergic receptor, nicotinic, and epsilon (chrne) mutations, causing postsynaptic cms . Our first patient was a caucasian girl, born at term, to healthy nonconsanguineous parents . Her first presentation was at 8 weeks of age with stridor, recurrent apneic episodes, and poor weight gain . The apneic episodes continued needing assisted ventilation after 5 weeks . On extubation, there was marked generalized hypotonia and poor sucking reflex . Extensive neurometabolic investigations, neuroimaging, laryngo - tracheo - bronchoscopy, and muscle biopsies were all normal . Anti - acetylcholine receptor (achr) and muscle - specific kinase (musk) antibodies were absent . The trial of neostigmine led to a marked clinical improvement with increased alertness, visual responsiveness, and stronger vocalizations . Molecular testing confirmed the presence of n88k mutation in the rapsn gene along with deletion at exon 7, confirming postsynaptic cms . She is currently 5 years old and continues to have recurrent apneic episodes and chest infections, though the frequency has decreased with time . Our second patient was a caucasian boy, born at term by normal delivery, to healthy nonconsanguineous parents . He presented at 6 months of age with difficulty in swallowing, choking, and pooling of secretions . Barium swallow and laryngo - bronchoscopy were normal along with the mri of the brain . The trial of neostigmine led to a marked clinical improvement with increased energy and stronger vocalization along with improved chewing and swallowing abilities . Molecular testing of the achr epsilon subunit chrne confirmed a homozygous mutation (c.554_560 del), which resulted in achr deficiency . Currently, he is 2 years old, got a normal motor development, and is on a combination of neostigmine and ephedrine . She took about an hour to complete a feed and this was associated with choking, spluttering, and coughing . She developed right eye ptosis, soon followed by the involvement of the other eye . Molecular testing of the achr epsilon subunit confirmed a homozygous mutation (c.554_560 del), which resulted in achr deficiency . Parents were reluctant to start her on neostigmine early, but by 5 months of age her symptoms had significantly increased . She was started on neostigmine with a marked improvement in her swallowing, vocalization, and activity . Our first patient was a caucasian girl, born at term, to healthy nonconsanguineous parents . Her first presentation was at 8 weeks of age with stridor, recurrent apneic episodes, and poor weight gain . The apneic episodes continued needing assisted ventilation after 5 weeks . On extubation, there was marked generalized hypotonia and poor sucking reflex . Extensive neurometabolic investigations, neuroimaging, laryngo - tracheo - bronchoscopy, and muscle biopsies were all normal . Anti - acetylcholine receptor (achr) and muscle - specific kinase (musk) antibodies were absent . The trial of neostigmine led to a marked clinical improvement with increased alertness, visual responsiveness, and stronger vocalizations . Molecular testing confirmed the presence of n88k mutation in the rapsn gene along with deletion at exon 7, confirming postsynaptic cms . She is currently 5 years old and continues to have recurrent apneic episodes and chest infections, though the frequency has decreased with time . Our second patient was a caucasian boy, born at term by normal delivery, to healthy nonconsanguineous parents . He presented at 6 months of age with difficulty in swallowing, choking, and pooling of secretions . Barium swallow and laryngo - bronchoscopy were normal along with the mri of the brain . The trial of neostigmine led to a marked clinical improvement with increased energy and stronger vocalization along with improved chewing and swallowing abilities . Molecular testing of the achr epsilon subunit chrne confirmed a homozygous mutation (c.554_560 del), which resulted in achr deficiency . Currently, he is 2 years old, got a normal motor development, and is on a combination of neostigmine and ephedrine . This patient is the younger sibling of our second case . Parents were not keen on prenatal testing . She took about an hour to complete a feed and this was associated with choking, spluttering, and coughing . She developed right eye ptosis, soon followed by the involvement of the other eye . Molecular testing of the achr epsilon subunit confirmed a homozygous mutation (c.554_560 del), which resulted in achr deficiency . Parents were reluctant to start her on neostigmine early, but by 5 months of age her symptoms had significantly increased . She was started on neostigmine with a marked improvement in her swallowing, vocalization, and activity . Cms are currently classified based on the site of defect as presynaptic, synaptic based lamina associated, and postsynaptic, with the latter being the commonest . Rapsn is one of the most frequently mutated genes in people of indo - european origin . Children usually present with episodes of generalized muscle weakness, hypotonia, and respiratory insufficiency, though the phenotypic expression can be highly variable . It is often associated with arthrogryposis multiplex congenita and structural abnormalities of the jaw and palate . An early recognition of this genotype can prevent death in a condition, which is easily treatable with a good long - term outcome . Their cohort had six children with stridor, which included four with docking protein 7 (dok7) and one with choline acetyltransferase (chat) mutation . Stridor, which was an early feature in our patient, has not been reported so far with rapsn mutation . Achr deficiency is the most common form of cms and frequently results from mutations in chrne, the gene encoding the achr epsilon subunit . More than 80 subunit mutations have been reported including nonsense, splice site, or frameshift mutations . Our second child and his younger sibling had a homozygous mutation (c.554_560 del), which resulted in a frameshift, causing a premature termination of the translational chain and achr deficiency (postsynaptic cms). This mutation, although rare (compared to the common chrne 1267delg of the achr subunit gene found in the eastern european population), has been described in a 31-year - old female . She had poor suck and ptosis in the neonatal period and bulbar dysfunction at 4 months of age . The current therapy of cms is primarily symptomatic and includes various pharmaceutical drugs and other supportive measures . The management of these children should be undertaken by a specialized multidisciplinary team comprising a pediatrician / pediatric neurologist, physiotherapist, occupational therapist, speech therapist, and a dietician . The specialist services of a pediatric gastroenterologist may be required as children with bulbar symptoms may have significant dysphagia, which may require nasogastric tube or gastrostomy feeding . In children with severe weakness of respiratory muscles, nocturnal or 24-h noninvasive ventilation may be required . For children with cms, specific molecular diagnosis can help to determine the prognosis along with genetic counseling for the families . Although rare, cms are an important and expanding group of disorders involving neuromuscular junction, often requiring a high index of clinical suspicion . These three cases highlight the fact that in any infant or young child with unexplained swallowing difficulties, the possibility of a myasthenic disorder warrants consideration . With the availability of molecular genetics these conditions can now be diagnosed early and specific treatment initiated, thus preventing morbidity and mortality.
|
What is new?the applicability of clinical practice guidelines to primary care has been questioned for individual conditions such as hypertension and depression, and concerns have been raised about guidelines promoting overtreatment of low - risk populations.until now, evidence from a systematic appraisal of the relevance to primary care of published guidelines has been lacking.nearly two - third of the research cited in support of national institute for health and care excellence guideline recommendations for primary care was of uncertain relevance to primary care patients, with little or no acknowledgment of this uncertainty.guideline development groups should more clearly identify which recommendations are intended for primary care and uncertainties about the relevance of the supporting evidence to primary care patients, to avoid potential overtreatment and adverse effects . The applicability of clinical practice guidelines to primary care has been questioned for individual conditions such as hypertension and depression, and concerns have been raised about guidelines promoting overtreatment of low - risk populations.until now, evidence from a systematic appraisal of the relevance to primary care of published guidelines has been lacking.nearly two - third of the research cited in support of national institute for health and care excellence guideline recommendations for primary care was of uncertain relevance to primary care patients, with little or no acknowledgment of this uncertainty.guideline development groups should more clearly identify which recommendations are intended for primary care and uncertainties about the relevance of the supporting evidence to primary care patients, to avoid potential overtreatment and adverse effects . The applicability of clinical practice guidelines to primary care has been questioned for individual conditions such as hypertension and depression, and concerns have been raised about guidelines promoting overtreatment of low - risk populations . Until now, evidence from a systematic appraisal of the relevance to primary care of published guidelines has been lacking . Nearly two - third of the research cited in support of national institute for health and care excellence guideline recommendations for primary care was of uncertain relevance to primary care patients, with little or no acknowledgment of this uncertainty . Guideline development groups should more clearly identify which recommendations are intended for primary care and uncertainties about the relevance of the supporting evidence to primary care patients, to avoid potential overtreatment and adverse effects . Clinical practice guidelines are an increasingly important driver of decisions about patient care . They have been defined as recommendations intended to optimize patient care that are informed by a systematic review of evidence and an assessment of the benefits and harms of alternative care options . Guidelines have traditionally been developed to simply provide guidance for clinical decision making, but they are becoming embedded in the structure of uk primary care through their translation into indicators of quality of care in a national pay for performance financial incentive scheme (the quality and outcomes framework) and through the development of quality standards to inform decisions on health care planning and commissioning . This increasing use of guidelines to develop incentives and standards for primary care may lead to more patients at lower risk of adverse outcomes receiving treatment and exposure to potential adverse effects . Groups developing guidelines about the care of primary care patients will use the current best evidence from primary care or lower risk populations where it exists . If high - quality primary care evidence is not found, the best evidence available may be from a secondary care or higher risk population . This entirely appropriate approach leads to problems when a guideline development group (gdg) assumes that the evidence from research conducted on a higher risk population can automatically be applied to a lower risk primary care population . If uncertainty about the evidence is not explicitly acknowledged, the integrity of the guideline is compromised and patient harm may result . The benefits of treatment are usually lower in populations at lower risk of adverse outcomes, whereas the risk of harm from adverse treatment effects remains constant . Patients seen in primary care typically have less severe illness than those in hospital, and so evidence from trials conducted in secondary care may have limited relevance and result in harms outweighing benefits . An example of taking evidence from a higher risk population and applying it to a lower risk population is the quality and outcomes framework indicator and national institute for health and care excellence (nice) heart failure guideline recommendation that all primary care patients with chronic heart failure (including low grade) should be offered -blockers and ace inhibitors . This indicator is supported by evidence generalized from higher risk populations (new york heart association grades iii iv), in which there is clear evidence of benefit, to lower risk populations, in which the evidence of benefit is more equivocal . The potential harm is the adverse effects of -blockers experienced by some patients, and the substantial risk of acute kidney injury from ace inhibitors, which may account for a tenth of the increase in hospital admissions because of an acute kidney injury . It is therefore uncertain what the balance of harms and benefits might be in a typical primary care patient, and a general practitioner needs to know about this uncertainty when, for example, considering prescribing a -blocker to a patient with a relative contraindication to a -blocker therapy from a comorbid condition . This vital information about uncertainty and the balance of benefits and harms is hard to find in the quality and outcomes framework guidance or nice guideline, which presents a single approach rather than acknowledging that there are several acceptable alternatives for low - risk patients . Another example where it is hard for the user of a clinical guideline to know about the balance of benefits and harms for a typical primary care patient is the quality and outcomes framework incentive to prescribe aspirin or an alternative antiplatelet to all patients with peripheral arterial disease, most of whom do not have symptoms and are managed in primary care . The evidence that antiplatelet therapy can reduce serious vascular events comes primarily from a large subgroup analysis of the antithrombotic trialists' collaboration meta - analysis in high - risk patients and a similar review conducted by nice . However, the authors caution that their results may not be applicable to low - risk patients, and others have calculated that the number of potential reductions in coronary heart disease events exceeded the number of potential precipitated adverse bleeding events only for patients with a 1% or greater annual risk of coronary heart disease events . A third example is chronic kidney disease (ckd), where there is evidence of benefit to high - risk populations but no evidence of benefit in people with early - stage ckd at a low risk of future disease . Both primary care physicians and specialists have expressed concerns about potential harms from overtreatment resulting from expanding definitions of ckd in guidelines . A small pilot study suggested that the evidence base for primary care guidelines might not be relevant to most primary care patients, with important implications for patient safety, and we wanted to systematically examine the evidence base for clinical guidelines used in primary care . We used guidelines from the nice as it has been a leading provider of evidence - based clinical guidelines in the united kingdom since 2002 . Institute of medicine's standards for trustworthy guidelines [1,1618] and with the international consensus that guidelines should be developed using an explicit and transparent process that minimizes distortions, biases, and conflicts of interest; should base recommendations on a systematic review of the existing evidence; should include experts and patient representatives on a multidisciplinary gdg; and should consider important patient subgroups and patient preferences . The development of nice clinical guidelines follows a well - established process . When a topic has been chosen, a national collaborating centre (ncc) is commissioned to develop the guideline . The ncc prepares the scope which sets out what the guideline will and will not cover and recruits the gdg . Review questions are then developed to guide the evidence review and synthesis by the technical team, which the gdg uses to formulate recommendations . We aimed to measure the percentage of primary care relevant publications in the cited evidence base for nice primary care recommendations, for all nice guideline recommendations for primary care published over 2 years . We reviewed the scope of all 45 clinical guidelines published by nice in 2010 and 2011 and excluded any guideline explicitly aimed at non five academic family physicians on the research team classified recommendations in the remaining guidelines as specific, relevant, or not relevant to primary care, using our previously piloted methods . Two reviewers independently rated each recommendation and then discussed any discrepancies by telephone and/or e - mail . If they could not reach consensus on a recommendation, it was sent to a third reviewer and then classified according to the majority view . Reviewers used the following definitions, along with examples: primary care specific recommendations inform decisions that are almost always made by primary care providers such as general practitioners and primary care relevant recommendations inform decisions that could be made by health professionals in either primary care or another setting . We included guidelines if more than 50% of the recommendations were judged relevant to primary care or if at least one recommendation was specific to primary care . We reviewed all publications cited as evidence for included recommendations and classified each publication according to whether the study population had been selected from primary care or community settings (ie, not from hospital outpatient or inpatient populations). We classified publications as unclear if we could not obtain this information from these or related publications . We considered systematic reviews as a single publication and included them if at least one study in the review had been conducted on a primary care or community population . Publications were excluded from the study and not considered further if they referred to other guidelines, nonsystematic reviews, or references that only appeared in the guideline appendices with no apparent link to the recommendations . The primary outcome was the percentage of included cited publications that were relevant to primary care . Secondary outcomes were guideline development center, primary care membership of gdg, recommendations for further primary care research, whether grading of recommendations assessment, development and evaluation (grade) was used to assess the quality of evidence, and the clarity of links from the recommendation back to the supporting evidence base . Twenty - two of the 45 guidelines were assessed as relevant to primary care (fig . 1). These 22 guidelines contained 1,185 recommendations, and the reviewers considered 777 of them to be relevant to primary care . The two independent reviewers initially rated 981 (82.8%) recommendations in the same category of specific, relevant, or not relevant to primary care, with discrepancies predominantly between the categories of primary care specific or relevant . After discussion between the two reviewers, full agreement was reached on 1,166 (98.4%) of recommendations . Of the 777 recommendations, 282 were excluded as they were based on gdg consensus in the absence of evidence or were standard clinical practice (such as a recommendation to take a history from the patient), leaving 495 (42%, range by guideline 9100%) recommendations that were both evidence based and relevant to primary care (table 1). The links in the guideline from recommendation back to supporting research sometimes appeared to have become blurred in the process of developing the guideline . The research was considered relevant to primary care in 590 (38%, range by guideline 674%) of these publications (table 1). The relevance to primary care was unclear in 67 publications, in which the research population was not clearly described in the original articles . There was a wide variation across guidelines in the percentage of both recommendations and supporting publications that were relevant to primary care . In some guidelines (eg, pregnancy and complex social factors) both the recommendations (100%) and the evidence base (74%) were judged to be relevant to primary care . Other guidelines (eg, chronic heart failure and constipation in children and young people) were relevant to primary care (68% and 72%, respectively) and yet were based on relatively little evidence from primary care (10% and 17%). Guidelines in mental health and women's and children's health had the highest percentages of supporting publications that were relevant to primary care (51% and 52%). The number of primary care providers on gdgs ranged from 0 to 4 (12% of all gdg membership; table 2). The percentage of primary care providers on gdgs was not associated with the percentage of primary care relevant studies (correlation coefficient, 0.15). Further research in primary care was called for in 6 of the 22 full guidelines . Nine of the 22 included guidelines used elements of grade to assess the quality of included evidence [2123]. Nearly two - third of the research cited in support of nice guideline recommendations for primary care was of uncertain relevance to primary care patients, with little or no acknowledgment of this uncertainty in the published guideline . Only 38% of cited publications were based on patients typical of primary care . In many guidelines, the link from evidence to recommendation was not explicit . Where evidence was available, many studies did not report the setting or population used for the research . The low percentage (38%) of studies relevant to primary care is likely to be due to the lack of suitable primary care research . This correctly requires gdgs to extrapolate from research that has been conducted on other, often higher risk, populations . The difficulty for the guideline user is not so much that the evidence is inevitably incomplete, but rather that it is not clear which recommendations are supported by primary care based relevant evidence and which by evidence from other clinical settings or by consensus of the gdg . Judgments about the relevance of the evidence to different populations made using grade's indirectness domain were useful but presented as a minor part of grade which did not come through clearly in final guidelines . Family physicians are experienced in managing clinical uncertainty and making decisions with incomplete information, and when deciding about treatment for a patient, they need to know the extent to which guideline evidence can be applied to that individual . Information about uncertainty in the research, and potential applicability to a patient in primary care, is not currently easily accessible in guidelines in the way it needs to be to improve clinical decision making in primary care and avoid accusations of guideline bias . Other authors have noted the difficulties in applying guidelines where there are important differences between trial participants and typical primary care patients in hypertension . Only one group has looked specifically at whether guidelines are supported by evidence from primary care: a group in the netherlands looked at 13 guidelines for depression and screened 804 publications, to find only two studies based in primary care . Our research is the first systematic appraisal of national guidelines, and our results show that uncertain applicability of cited research to patients in primary care is a problem shared to a greater or lesser degree by all the guidelines reviewed . Strengths of the research include that it was based on a large sample of all recent nice guidelines and used piloted methods . The estimate of 38% of evidence being based on patients typical of primary care is likely to be an overestimate rather than an underestimate, as we only included guidelines with most recommendations relevant to primary care (in which the proportion of primary care evidence is likely to be greater than in other guidelines). The biggest challenge for the research team was to classify the guidelines, recommendations, and research studies in turn as either relevant to primary care or not . We used transparent and piloted methods, but the choice between relevant and not relevant was not always straightforward, and other groups might make different decisions in the gray areas . We responded to this uncertainty using a generous definition for classifying study populations as relevant to primary care, which again would tend to make the 38% an overestimate rather than an underestimate . Future research is needed into the dynamics and approaches to reaching informal consensus used by gdgs and the influence of variable factors such as professional background and conflicts of interest . Internationally, primary and community care is usually of lower technology than hospital care, and so contextualizing research within the primary care setting is relevant to both developed and developing countries . The extent to which research in high - technology settings can be considered relevant for guideline users in low - technology settings in low- and middle - income countries is under - researched . Frameworks such as the appraisal of guidelines for research & evaluation instrument (agree ii) to assess the quality of practice guidelines and the grade tool, which includes an indirectness domain to assess the applicability to different populations, have been developed to improve the integrity of clinical guidelines . Nice and other national guideline developers contribute to and follow this good practice, have primary care membership of gdgs, try to ensure that secondary care content experts do not dominate discussions regarding recommendations for primary care, and involve the public in the process, and these frameworks and methods should continue to be developed and applied . However, despite all the good practice, it is still hard for a primary care clinician to find the information they need to guide a decision about the potential benefits and harms of treatment . Guideline developers intend to present their recommendations with enough information for the user to track back to the strength of the underlying evidence, should they need to do so, but we found that tracking back to the evidence was usually very difficult . The relevance of published clinical practice guidelines to primary care patients is still too opaque . An enhanced approach is needed to avoid the assumption of generalizability of research evidence from high - risk research populations to low - risk primary care patients and reduce potential overtreatment and avoidable harm . More explicit consideration of the primary care context is needed at all stages of development, to reduce dependence on the influencing skills of a primary care provider on the gdg . The relevance to primary care should be carefully considered at initial scoping . For relevant guidelines, the initial review questions for the evidence search should then be considered specifically for relevance to primary care, perhaps as a subgroup in the search, and negative findings reported if evidence is not found . Primary care relevance could be considered in terms of setting, severity of illness, or risk group depending on the guideline's intended audience . The guideline should be specific about where primary care research has or has not been used, including limitations or lack of evidence, and research recommendations where relevant primary care evidence is lacking should be clearly badged . Uncertainties in the evidence should always be clearly presented and not lost in the understandable desire to produce straightforward recommendations . A shift in focus during guideline development to outcomes (such as health gain) as opposed to simple processes (such as pharmaceutical prescription) has been proposed and should be encouraged . An enhanced primary care perspective could come from either greater involvement from the outset of primary care professionals with relevant content expertise where feasible or from more explicit guidance to development groups combined with systematic checks at all stages of guideline development . Checks for compliance with development manuals and frameworks such as grade and agree ii would help ensure, for example, that grade profiles properly address issues of indirectness . At least one nice committee has already started to consider research data that have been reanalyzed to show the results separately for low- and high - risk populations, with a consequent change in the decision made . Success will be when a clinical guideline user can quickly and accurately determine the broad relevance of each recommendation to their patient, including uncertainties, and can easily track back from the recommendation to the underlying evidence base, should they wish to do so.
|
Plasmodium falciparum is one of the major causes of mortality among children in rural india . States such as odisha have high childhood mortality due to p. falciparum positive malaria often occurring in various forms . Lack of awareness of atypical manifestation leads to delay in diagnosis and early management often leading to death . Upsurge of unusual features are due to development of immunity, increased resistance and injudicious use of antimalarial drugs . A 15-month - old male child was admitted with the chief complains of high - grade fever for 7 days followed by altered sensorium for 1 day . On examination, child was febrile and unconscious . The child had uneventful perinatal history, no developmental delay, and no history of seizure . Blood investigations showed hb was 5.8 mg / dl; total leucocyte count 12,400/cumm, and total platelet count 65,000/cumm . Mpict (antigen test) was positive and peripheral smear showed multiple rings of p. falciparum . Patient was treated using intravenous (iv) artesunate followed by act according to who guidelines . On follow - up fever decreased and sensorium improved, but on day 4 of the treatment child developed bilateral nystagmus with rapid component towards the right side . After ruling out all other causes of nystagmus, it was diagnosed as an early complication of cerebellar involvement due to severe malaria . A 6-year - male child was admitted with the chief complain of high - grade fever for 4 days with abnormal behavior and occasional vomiting . He had no history of hematemesis, melena, bladder bowel abnormality, abnormal movement or altered sensorium . All vitals signs were normal except for mild tachycardia . On abdominal examination, liver was around 6 cm palpable . Blood investigation suggested hb was 7.2 mg / dl while other complete blood count (cbc) parameters were normal . Patient coming from an endemic region with high - grade fever, antigenic positivity, and the absence of other risk factors for psychosis confirmed diagnosis of malaria with psychosis . Child was treated by iv artesunate with sedatives (iv lorazepam). On day 4, a 11-year - old child was presented to pediatric outpatients department with severe crampy and episodic abdominal pain with urticarial rash over face and abdomen and generalized malaise and lethargy . He had no history of recent fever, seizure, conjunctivitis, abnormal vomiting, and bowel bladder anomaly . He was treated using antihistaminic and antispasmodics (injection cyclopam, injection ranitidine, and oral cetirizine tablet). On day 2 of admission as a child was from an endemic region of p. falciparum, mpict (antigen) was performed . Iv artesunate was initiated according to who protocol along with antihistamines and antispasmodics (injection cyclopam 10 mg / dose t.d.s, injection ranitidine urticaria in a malaria endemic patient nonresponsive to antihistamine drugs is an indication of underlying malaria and should be managed accordingly . A 15-month - old male child was admitted with the chief complains of high - grade fever for 7 days followed by altered sensorium for 1 day . On examination, child was febrile and unconscious . The child had uneventful perinatal history, no developmental delay, and no history of seizure . Blood investigations showed hb was 5.8 mg / dl; total leucocyte count 12,400/cumm, and total platelet count 65,000/cumm . Mpict (antigen test) was positive and peripheral smear showed multiple rings of p. falciparum . Patient was treated using intravenous (iv) artesunate followed by act according to who guidelines . On follow - up fever decreased and sensorium improved, but on day 4 of the treatment child developed bilateral nystagmus with rapid component towards the right side . After ruling out all other causes of nystagmus, it was diagnosed as an early complication of cerebellar involvement due to severe malaria . A 6-year - male child was admitted with the chief complain of high - grade fever for 4 days with abnormal behavior and occasional vomiting . He had no history of hematemesis, melena, bladder bowel abnormality, abnormal movement or altered sensorium . All vitals signs were normal except for mild tachycardia . On abdominal examination, liver was around 6 cm palpable . Blood investigation suggested hb was 7.2 mg / dl while other complete blood count (cbc) parameters were normal . Patient coming from an endemic region with high - grade fever, antigenic positivity, and the absence of other risk factors for psychosis confirmed diagnosis of malaria with psychosis . Child was treated by iv artesunate with sedatives (iv lorazepam). On day 4, a 11-year - old child was presented to pediatric outpatients department with severe crampy and episodic abdominal pain with urticarial rash over face and abdomen and generalized malaise and lethargy . He had no history of recent fever, seizure, conjunctivitis, abnormal vomiting, and bowel bladder anomaly . He was treated using antihistaminic and antispasmodics (injection cyclopam, injection ranitidine, and oral cetirizine tablet). On day 2 of admission as a child was from an endemic region of p. falciparum, mpict (antigen) was performed . Iv artesunate was initiated according to who protocol along with antihistamines and antispasmodics (injection cyclopam 10 mg / dose t.d.s, injection ranitidine 1 ml iv bd, and oral cetirizine 5 mg bd). Urticaria in a malaria endemic patient nonresponsive to antihistamine drugs is an indication of underlying malaria and should be managed accordingly . Although orissa state has about 3.6% of the total population of the country, it accounts for 47% of p. falciparum cases and 34% of all reported deaths due to malaria . Classic symptoms of severe malaria caused by p. falciparum among pediatric patients include high - grade fever, sweating, jaundice, vomiting, nausea, and pallor . According to who criteria impaired consciousness, prostration, respiratory distress, multiple seizures, jaundice, hemoglobinuria, abnormal bleeding, severe anemia, circulatory collapse and pulmonary edema are features of severe malaria . The unusual features are due to development of immunity, indiscriminate use and increasing resistance of antimalarial drugs . Cerebellar involvement in p. falciparum malaria can occur during the acute stage of fever as sequelae of cerebral malaria among survivors or as a side effect of drugs, which is evident as delayed cerebellar ataxia . However, isolated nystagmus in children after severe malaria is very rarely reported although ataxia and tremor are commonly observed . The cerebellar symptoms are due to injury to purkinje cells as a consequence to hyperpyrexia, anemia, hypoglycemia and persistent seizures eventually leading to hemorrhages, small infarction, and the microglial infiltration in purkinje cells of the cerebellum . Paranoid, agitation, manic symptoms are observed in the acute stage although it can present as confusional state, severe agitation, delirium, delusion, hallucination and transient amnesia in children . Nevertheless these features generally disappear after treatment but can be observed in few patients following chloroquine use . Very rarely psychotic features may be the first manifestation in malaria with persistent abnormality . Cerebral malaria can disrupt neuropsychological integration during critical developmental periods resulting in several developmental delays . It is due to immunological factors, increase vascular permeability and capillary - dilatation due to cell mediators such as histamine, serotonin, heparin, and proteoglycans . As observed in our case, rarely (1.35 - 25.6% incidence rate) urticaria may also be present without fever as the primary manifestation . Although the deposition of ige in endothelial cells cause itching followed by urticaria, however this generally subsides after 12 - 48 h of antimalarial management.
|
Metastatic disease to the heart is not uncommon . A study conducted on autopsies of patients with a known non - cardiac primary malignant neoplasm revealed cardiac metastasis in 9.710.7% of cases.1 additional post - mortem studies have quoted the number of cardiac metastases in patients who had died of malignancies as high as 25%.2 despite these differing reports, cardiac infiltration is commonly found in metastatic carcinoma . Identification and characterization of metastatic cardiac disease necessitates differentiation of normal cardiac structures from the metastatic lesion . This is often difficult because of infiltration of the tumor and similar characteristics of normal and abnormal tissues . Tissue echogenicity, tissue attenuation, and differential uptake of intravenous contrast enhance our ability to differentiate abnormal from adjacent normal structure as well as characterize the abnormal tissue itself.3 metastatic cardiac neoplasms are much more likely than a primary malignant cardiac neoplasm . Most cardiac metastases spread from the lungs (in men) and breasts (in women). In other instances, they can spread by direct extension from the esophagus and mediastinum.3 we describe the echocardiographic and cardiac computerized tomography (cct) findings of a man in his 60s with an undifferentiated pancreatobiliary carcinoma and a left ventricular mass . A man in his 60s with a past medical history significant for hypertension presented to an outpatient urologist with microscopic hematuria, left flank pain, and a 10 pound weight loss over a month and a half . Investigation of his symptoms with ct scans of the abdomen and pelvis revealed an 8-cm lesion on the left upper pole of his kidney . Pending further workup, the decision was made to admit this patient to our institution for left total nephrectomy and adjuvant immunotherapy for a presumed renal cell carcinoma . The patient revealed progressive dyspnea on exertion over three months and denied chest pain, orthopnea, paroxysmal nocturnal dyspnea, or palpitations . The patient was afebrile, with a resting blood pressure of 136/83 mmhg, pulse of 91/minute, respiratory rate of 18 breaths / minute, and resting oxygen saturation of 96% in room air . On physical examination, the patient had an audible s1/s2 with a regular rate and rhythm and no murmurs, rubs, or gallops; there was no jugular venous distension . The extremities showed no clubbing, cyanosis, or edema, and the remainder of the physical examination was unremarkable . Laboratory workup was significant for a white blood cell count of 20.9 mm, hemoglobin of 10.9 g / dl, hematocrit of 34.8%, sodium of 131 mmol / l, creatinine of 1.3 mg / dl, and an international normalized ratio (inr) of 1.67 . Electrocardiogram showed normal sinus rhythm at a rate of 90 bpm with a first degree atrioventricular block, right bundle branch block, and t - wave inversions in leads i, avl, v5, and v6 . In consideration of the patient s history and symptoms, a transthoracic echocardiogram (tte) echocardiography revealed an irregular multilobulated mass (2.5 1.5 cm) infiltrating the apical lateral wall of the left ventricle (lv), with multiple highly mobile components attached to the main mass (figs . 1 and 2). There was normal left ventricular function, internal dimensions, wall thickness, and no regional wall motion abnormalities . No masses were seen in the right heart, inferior vena cava (ivc), or pericardium, and the remainder of the tte was unremarkable . Three non - contrast enhancing low attenuation foci were present within the free wall and interventricular septum of the left ventricular myocardium (figs . 1 and 2) there were also numerous nodules and masses present within both lungs, multiple heterogeneous lesions within the liver, and a large mass in the upper pole of the left kidney . At this point, with these associated findings and the realized complexity of the case, tissue diagnosis was sought with ultrasound - guided needle core biopsy of a left lobe liver mass . Biopsy of this mass was immunoreactive for ca19.9, ck7, cd10, and polyclonal cea . The morphologic characteristics of abundant sclerotic stroma and immunohistochemical characteristics suggested a poorly differentiated carcinoma consistent with pancreatobiliary origin . The patient subsequently began palliative radiation therapy and later developed a right - sided stroke, presumably from tumor emboli . He was later discharged from the hospital with the intent of undergoing palliative radiation treatment . Metastatic disease to the heart is much more common than primary cardiac tumors . In patients dying of a malignant disease, approximately 10% are found to have metastasis to the heart and pericardium.4 this figure does not include liquid tumors, including leukemias, which frequently exhibit cardiac involvement . The most common tumors that metastasize to the heart include malignancies of the lung and breast as well as lymphomas, leukemias, and melanomas . Often times, these tumors will invade the right side of the heart or the pericardium; less commonly, we can see involvement of the left side of the heart.4 typically, extra - cardiac tumors reach the heart by one of four mechanisms: hematogenous, lymphatic, transvenous extension, or direct extension.1 depending on their origin, these tumors will preferentially metastasize to specific areas of the heart . For example, tumors of the breast are likely to travel to the heart via lymphatics and will therefore usually metastasize to the pericardium . Those tumors that travel hematogenously, such as melanomas, leukemias, and lymphomas, are usually seen in the myocardium.1 less commonly, metastatic disease may be found from infradiaphragmatic tumors, such as renal cell carcinomas,5 hepatocellular carcinomas,6 adrenal carcinomas, uterine leiomyomas, and cancers of the gallbladder.7 these tumors reach the heart via transvenous extension and eventually reach the right atrium via the inferior vena cava.2 tumors of pancreatic origin that reach distant sites typically invade the liver, peritoneum, and omentum; vascular invasion via the superior mesenteric artery, inferior vena cava, celiac axis, and portal venous system is also commonly seen.8 metastatic implantation in other distant sites is exceedingly rare, with only isolated case reports.9,10 the tumor that we describe represents an infradiaphragmatic tumor of pancreatobiliary origin that has reached the left ventricular cavity, without leaving metastatic deposits in any other portion of the heart . Based on the tumor s location, one would expect that if cardiac metastasis occurred, it would be through transvenous extension to the right side of the heart . Paradoxically, this tumor, which infrequently invades the heart in any capacity, has managed to implant, exclusively, in the left side of the heart, creating a very unusual mechanism of metastatic spread . One would have to assume that this tumor invaded the pulmonary veins by means of spread from the lung, and therefore, bypassed the right heart . Alternate mechanisms would include right to left spread by means of atrial septal defect, ventricular septal defect, or patent foramen ovale . However, we have no evidence to support this theory, given the absence of these abnormalities on either transthoracic echocardiography or cct . The mass we describe appears to infiltrate the endocardial border of the left ventricular myocardium . The left ventricular masses were characterized by transthoracic echocardiography and cct, but diagnosis was inferred by hepatic fine needle biopsy.
|
Mycobacterium tuberculosis is the world's largest cause of death from a single microorganism after human immunodeficiency virus (hiv). Globally, there are almost nine million new cases of tuberculosis (tb) each year, two million of which results in death . It is estimated that about 1/3 of the current global population is infected asymptomatically with m. tuberculosis of whom 5%10% will develop clinical disease during their lifetime and approximately two million deaths are attributable annually . Tb continues to be a leading cause of mortality in spite of the availability of an effective chemotherapeutic regimen . Chemotherapy of tb consists of three or four drug regimen, administered for 69 months . The long duration of therapy results in poor compliance, produces unwanted side effects and therapeutic failure leading to emergence of multidrug resistant strains of m. Tuberculosis. [46] association with noncompliance, hiv, and increasing multidrug resistant tuberculosis (mdr - tb) appears to be a serious issue, especially for the developing nations . Extensive drug resistant tuberculosis (xdr - tb) spreading all over the world is defined as a resistance to all first - line drugs and to fluoroquinolones and all of the injectables . The xdr - tb strain is mixing with the acquired immuno deficiency syndrome (aids), causing nearly100% mortality . Development and evaluation of new chemical entity (nce) against tb is a challenging task . 8-[(4-chloro phenyl) sulfonyl]-7-hydroxy-4-methyl-2h - chromen-2-one (cshmc) used in the present study is derivative of coumarin [figure 1a] and heterocyclic analogue of dapsone (diaminodiphenyl sulfone [dads]). Coumarin has a wide range of pharmacological properties, such as anticoagulant, antibacterial, diuretic, vasodilator and antiallergic . Several coumarin substitutions have shown antitubercular activity. [1214] dapsone [figure 1b] was found to be effective in suppressing experimental infections with tubercle bacilli. [1518] minimum inhibitory concentration (mic) of dapsone against m. tuberculosis, m. avium complex (mac), and m. leprae are 50250 mg / l, 2100 mg / l, and 1.54 mg / l, respectively. [1921] metabolism of dapsone by hepatic oxidation to hydroxylamine and its subsequent reduction to amine within red cells leads to persistence of drugs in red cells and which is suspected for its hematological toxicity . An attempt was made to reduce its toxicity by replacing free amino (nh2) group with chloro group . Due to antibacterial activity against a variety of microorganisms by sulfones, it has been shown to have an antitubercular activity in vitro on culture of sensitive strain of m. tuberculosis in lowenstein the present study was planned to evaluate antitubercular efficacy and safety of cshmc in isoniazid and rifampicin - sensitive strain in guinea pigs . If infected with m. tuberculosis, they show striking similarities to natural infections in humans, thus making it a good model for testing the effects of drug therapy. [2325] chemical structure of (a) coumarin; (b) dapsone (diaminodiphenyl sulfone [dads]); (c) 8-[(4-chloro phenyl) sulfonyl]-7-hydroxy-4-methyl-2h - chromen-2-one 05/2007) was approved by the institutional animal ethics committee, government medical college, bhavnagar, gujarat, india . Isoniazid (alfa aesar, a johnson mathey company, lancaster), rifampicin (tokyo chemical industry co. ltd ., japan), purified protein derivative (ppd rt 23 tween 80; radiant parenterals ltd ., cshmc was a kind free gift sample from the department of chemistry, bhavnagar university, bhavnagar, india . M . Tuberculosis h37rv in middle brook 7h9 broth media was obtained from state tuberculosis demonstration centre (stdc), ahmedabad, gujarat, india, as a free gift sample . Hartley guinea pigs (250300 g) and swiss albino mice (2030 g) of both genders were obtained from central animal house of the institute . Male and female guinea pigs were housed in separate stainless steel cages and mice in polypropylene cages under standard condition; temperature - controlled room (24c 2c) with 12 h light: dark cycles and were given standard laboratory diet and water ad libitum . The nonpregnant, nulliparous female albino mice of 812 weeks old and 2025 g body weight were selected to find out the acute oral toxicity of the cshmc . The mice were fasted for 3 h prior to the experiment and were administered with cshmc in the range of doses 300, 1000, and 2000 mg / kg and observed for mortality up to 14 days according to oecd guidelines . Equivalent dose for guinea pig (200 mg / kg) was calculated as per ghosh . All the guinea pigs were tested with mantoux test using 0.1 ml of purified protein derivatives (ppd rt 23 tween 80) injected intradermally into the lower left side of abdomen . All the guinea pigs examined (up to 72 h) were mantoux negative and hence used for experiment . Antitubercular study was carried out on guinea pigs and they were divided into 6 groups of either gender with 6 in each group . Cultures of m. tuberculosis h37rv were harvested from a 2-week culture in middle brooke 7h9 broth media . All the guinea pigs were infected with 0.1 ml (1.5 10 cfu / guinea pig) suspension via intramuscular route in the left thigh muscle . Have produced a tuberculosis infection in guinea pigs via intramuscular route. [2931] this suspension was matched with mcfarland standard . After 30 days, infections were confirmed in 6 guinea pigs by histopathology of spleen, lung, and liver . Vi) by random allocation software version 1.0, may 2004, by simple randomization . Drugs and cshmc were administered by mouth once a day for 30 days in groups iii vi . Human equivalent dose of isoniazid (30 mg / kg) and rifampicin (60 mg / kg) was calculated by extrapolation as mentioned by ghosh . Took a human - equipotent dose of isoniazid and rifampicin in guinea pigs as 30 and 50 mg / kg, respectively . Group ii received vehicle (10% ethanol) by mouth once a day for 30 days . Group i: normal control group: did not receive the injection of m. tuberculosis h37rv and received vehicle (10% ethanol) by mouth once a day for 30 days . Group ii: disease control group: received vehicle by mouth once a day for 30 days . Group iii: standard control group: received isoniazid (30 mg / kg) by mouth once a day for 30 days . Group iv: standard control group: received rifampicin (60 mg / kg) by mouth once a day for 30 days . Group v: test compound group: received cshmc (20 mg / kg) by mouth once a day for 30 days . Group vi: test compound group: received cshmc (5 mg / kg) by mouth once a day 30 for days . Blood samples were collected in ethylene diamino tetra acetic acid (edta) and plain bulb from the carotid artery under pentobarbitone anesthesia intraperitoneally (30 mg / kg) 24 h after the last dose of drug . Edta sample was used for estimation of hemoglobin (hb), total white blood cell (wbc) count, total red blood cell (rbc) count, total platelet count, differential count (polymorphs, lymphocytes, eosinophils, monocytes), blood indices (packed cell volume, mean corpuscle volume, mean corpuscle hemoglobin, mean corpuscle hemoglobin concentration, red cell distribution width, and erythrocyte sedimentation rate). Complete blood count was analyzed by using celltac alpha cell counter (nihontohdem, japan). Serum was separated for estimation of biochemical parameters: serum glutamic oxaloacetic transaminase (sgot), serum glutamic pyruvic transaminase (sgpt), alkaline phosphatase (alp) by enzyme kinetic method, bilirubin by jendrassik grof method (total, direct, and indirect) and serum creatinine by jaff creatinine method in a fully automated analyzer . Their gross appearance was noted and they were placed in 10% formalin for 24 h. then 5 mm thick pieces of the lung, spleen, and liver were embedded in paraffin, cut into 5 mm thick sections, stained using hematoxylin - eosin dye (h and e), and finally mounted in dibutyl diesterate parathylate xylene . Each slide was coded and observer masked to evaluate histopathological changes in the lung, spleen, and liver . The guinea pig lungs were scored based on the following three criteria: (1) primary lesion (epithelioid cells and other inflammatory cells): 0, no primary lesions present; 1, single primary lesion; 2, two or more primary lesions; multifocal; 3, two or more primary lesions; multifocal to coalescing; 4, multiple primary lesions, coalescing, and extensive . (2) secondary lesion (granuloma formation, giant cells, and caseous necrosis): 0, no secondary lesion present; 1, up to 25% of lung involved; 2, up to 50% of lung involved; 3, up to 75% of lung involved; 4, above 75% of lung involved . (3) pneumonitis (alveolar wall thickness, interstitial, and peribronchial inflammation): 0, alterations in less than 10% of the fields; 1, alterations in 10%30% of the fields; 2, alterations in 30%50% of the fields; 3, alterations in 50%70% of the fields; 4, alterations in more than 70% of the fields are scored based on severity as follows: 0, none; 1, minimal; 2, mild; 3, moderate; 4, marked; and 5, severe . The spleen was scored based on two criteria (same scales as lung); (1) primary lesion and (2) secondary lesion . The liver was scored based on one criterion; ballooning degeneration: 0, no ballooning degeneration; 1, minimal enlargement in few hepatocytes; 2, mild enlargement in many hepatocytes; 3, moderate enlargement in most hepatocytes; 4, severe enlargement in most hepatocytes . The nonparametric kruskal wallis test followed by dunnett's test was used to assess statistical significance between total lesion score of lung, spleen, and liver . The hematological, liver function, and renal function parameters are expressed as mean standard error of mean (sem). Statistical differences between means were determined by one - way analysis of variance (anova) followed by dunnett's multiple comparison tests using graphpad prism software demo version . Isoniazid (alfa aesar, a johnson mathey company, lancaster), rifampicin (tokyo chemical industry co. ltd ., japan), purified protein derivative (ppd rt 23 tween 80; radiant parenterals ltd ., cshmc was a kind free gift sample from the department of chemistry, bhavnagar university, bhavnagar, india . M . Tuberculosis h37rv in middle brook 7h9 broth media was obtained from state tuberculosis demonstration centre (stdc), ahmedabad, gujarat, india, as a free gift sample . Hartley guinea pigs (250300 g) and swiss albino mice (2030 g) of both genders were obtained from central animal house of the institute . Male and female guinea pigs were housed in separate stainless steel cages and mice in polypropylene cages under standard condition; temperature - controlled room (24c 2c) with 12 h light: dark cycles and were given standard laboratory diet and water ad libitum . The nonpregnant, nulliparous female albino mice of 812 weeks old and 2025 g body weight were selected to find out the acute oral toxicity of the cshmc . The mice were fasted for 3 h prior to the experiment and were administered with cshmc in the range of doses 300, 1000, and 2000 mg / kg and observed for mortality up to 14 days according to oecd guidelines . Equivalent dose for guinea pig (200 mg / kg) was calculated as per ghosh . All the guinea pigs were tested with mantoux test using 0.1 ml of purified protein derivatives (ppd rt 23 tween 80) injected intradermally into the lower left side of abdomen . All the guinea pigs examined (up to 72 h) were mantoux negative and hence used for experiment . Antitubercular study was carried out on guinea pigs and they were divided into 6 groups of either gender with 6 in each group . Cultures of m. tuberculosis h37rv were harvested from a 2-week culture in middle brooke 7h9 broth media . All the guinea pigs were infected with 0.1 ml (1.5 10 cfu / guinea pig) suspension via intramuscular route in the left thigh muscle . Have produced a tuberculosis infection in guinea pigs via intramuscular route. [2931] this suspension was matched with mcfarland standard . After 30 days, infections were confirmed in 6 guinea pigs by histopathology of spleen, lung, and liver . Vi) by random allocation software version 1.0, may 2004, by simple randomization . Drugs and cshmc were administered by mouth once a day for 30 days in groups iii vi . Human equivalent dose of isoniazid (30 mg / kg) and rifampicin (60 mg / kg) was calculated by extrapolation as mentioned by ghosh . Took a human - equipotent dose of isoniazid and rifampicin in guinea pigs as 30 and 50 mg / kg, respectively . Group ii received vehicle (10% ethanol) by mouth once a day for 30 days . Group i: normal control group: did not receive the injection of m. tuberculosis h37rv and received vehicle (10% ethanol) by mouth once a day for 30 days . Group ii: disease control group: received vehicle by mouth once a day for 30 days . Group iii: standard control group: received isoniazid (30 mg / kg) by mouth once a day for 30 days . Group iv: standard control group: received rifampicin (60 mg / kg) by mouth once a day for 30 days . Group v: test compound group: received cshmc (20 mg / kg) by mouth once a day for 30 days . Group vi: test compound group: received cshmc (5 mg / kg) by mouth once a day 30 for days . Blood samples were collected in ethylene diamino tetra acetic acid (edta) and plain bulb from the carotid artery under pentobarbitone anesthesia intraperitoneally (30 mg / kg) 24 h after the last dose of drug . Edta sample was used for estimation of hemoglobin (hb), total white blood cell (wbc) count, total red blood cell (rbc) count, total platelet count, differential count (polymorphs, lymphocytes, eosinophils, monocytes), blood indices (packed cell volume, mean corpuscle volume, mean corpuscle hemoglobin, mean corpuscle hemoglobin concentration, red cell distribution width, and erythrocyte sedimentation rate). Complete blood count was analyzed by using celltac alpha cell counter (nihontohdem, japan). Serum was separated for estimation of biochemical parameters: serum glutamic oxaloacetic transaminase (sgot), serum glutamic pyruvic transaminase (sgpt), alkaline phosphatase (alp) by enzyme kinetic method, bilirubin by jendrassik grof method (total, direct, and indirect) and serum creatinine by jaff creatinine method in a fully automated analyzer . Their gross appearance was noted and they were placed in 10% formalin for 24 h. then 5 mm thick pieces of the lung, spleen, and liver were embedded in paraffin, cut into 5 mm thick sections, stained using hematoxylin - eosin dye (h and e), and finally mounted in dibutyl diesterate parathylate xylene . Each slide was coded and observer masked to evaluate histopathological changes in the lung, spleen, and liver . The guinea pig lungs were scored based on the following three criteria: (1) primary lesion (epithelioid cells and other inflammatory cells): 0, no primary lesions present; 1, single primary lesion; 2, two or more primary lesions; multifocal; 3, two or more primary lesions; multifocal to coalescing; 4, multiple primary lesions, coalescing, and extensive . (2) secondary lesion (granuloma formation, giant cells, and caseous necrosis): 0, no secondary lesion present; 1, up to 25% of lung involved; 2, up to 50% of lung involved; 3, up to 75% of lung involved; 4, above 75% of lung involved . (3) pneumonitis (alveolar wall thickness, interstitial, and peribronchial inflammation): 0, alterations in less than 10% of the fields; 1, alterations in 10%30% of the fields; 2, alterations in 30%50% of the fields; 3, alterations in 50%70% of the fields; 4, alterations in more than 70% of the fields are scored based on severity as follows: 0, none; 1, minimal; 2, mild; 3, moderate; 4, marked; and 5, severe . The spleen was scored based on two criteria (same scales as lung); (1) primary lesion and (2) secondary lesion . The liver was scored based on one criterion; ballooning degeneration: 0, no ballooning degeneration; 1, minimal enlargement in few hepatocytes; 2, mild enlargement in many hepatocytes; 3, moderate enlargement in most hepatocytes; 4, severe enlargement in most hepatocytes . The histopathologic score of organs are presented as median (interquartertile range). The nonparametric kruskal wallis test followed by dunnett's test was used to assess statistical significance between total lesion score of lung, spleen, and liver . The hematological, liver function, and renal function parameters are expressed as mean standard error of mean (sem). Statistical differences between means were determined by one - way analysis of variance (anova) followed by dunnett's multiple comparison tests using graphpad prism software demo version . In normal control group (group i); gross examination and histology of lung [figure 2a], spleen [figure 3a], and liver [figure 4a] of guinea pig showed the normal morphology . (a) normal control group normal alveolar morphology; (b) disease control group severe (score 6) epithelioid cells (e), lymphocyte (l), alveolar wall infi ltration (a), caseation necrosis (cn), and giant cells (g); (c e) isoniazid, rifampicin, and cshmc (20 mg / kg) treated group minimal (score 0.51) epithelioid cells and alveolar wall infi ltration with no caseation necrosis and giant cell; (f) cshmc (5 mg / kg) treated group mild (score 1.5) epithelioid cells and alveolar wall infi ltration with no caseation necrosis and giant cell histopathology of spleen (h and e stain, 40). (a) normal control group normal morphology; (b) disease control group severe (score 6) epithelioid cells (e), lymphocyte (l) infi ltrate with caseation necrosis (cn), and giant cells (g); (c e) isoniazid, rifampicin, and cshmc (20 mg / kg) treated group minimal to mild (score 11.5) epithelioid cells infi ltration with no caseation necrosis and giant cell; (f) cshmc (5 mg / kg) treated group mild to moderate (score 2.5) epithelioid cells infi ltration with no caseation necrosis and giant cell histopathology of liver (h and e stain, 40). Liver shows normal morphology; (b) disease control group a mild (score 2) ballooning degeneration (bd); (c f) isoniazid, rifampicin, and cshmc (20 and 5 mg / kg) treated group a minimal or no (score 0.5) ballooning degeneration (bd) isoniazid, rifampicin, and cshmc treated groups showed less white caseous granulomatous foci as compared with disease control group in lung and spleen by gross examination . Liver did not show any gross changes in groups ii vi . As shown in figure 2b, lesion of lung consisted of epithelioid cells, lymphocytic infiltration, multinucleated giant cells, caseation necrosis, granuloma, and pneumonitis . Isoniazid [figure 2c], rifampicin [figure 2d], and cshmc (20 mg / kg) [figure 2e] treated group had shown a minimal epithelioid cells and alveolar wall infiltration with no caseation necrosis and giant cell . The lesion of spleen consisted of epithelioid cells, lymphocytic infiltration, multinucleated giant cells, caseation necrosis, and granuloma [figure 3b]. Isoniazid [figure 3c], rifampicin [figure 3d], and cshmc (20 mg / kg) [figure 3e] treated group had minimal to mild epithelioid cells infiltration with no caseation necrosis and giant cell . As shown in table 1, isoniazid, rifampicin, and cshmc (20 mg / kg) significantly reduces the median lesion score in lung and spleen . Reduction in median lesion score of lung and spleen were not statistically significant for cshmc (5 mg / kg) [figures 2f and 3f]. Cshmc (20 and 5 mg / kg) treated group had shown a minimal or no ballooning degeneration . Isoniazid [figure 4c], rifampicin [figure 4d], and cshmc [figure 4e and 4f] significantly reduce the median lesion scores of liver [table 1]. The lesion scores of lungs, spleen, and liver were calculated in all the 5 groups after 30 days of the treatment the hemogram [table 2], liver [table 3], and renal [table 3] function parameters were monitored after 30 days of isoniazid, rifampicin, and cshmc treatment . The result indicates that cshmc did not produce any changes in hemogram, liver functions, and renal function parameters with respect to normal values . Effect of isoniazid, rifampicin, and cshmc on hemogram parameters in blood of guinea pigs after 30 days of treatment effect of isoniazid, rifampicin, and cshmc on liver and renal function parameters in blood of guinea pigs after 30 days of treatment in normal control group (group i); gross examination and histology of lung [figure 2a], spleen [figure 3a], and liver [figure 4a] of guinea pig showed the normal morphology . (a) normal control group normal alveolar morphology; (b) disease control group severe (score 6) epithelioid cells (e), lymphocyte (l), alveolar wall infi ltration (a), caseation necrosis (cn), and giant cells (g); (c e) isoniazid, rifampicin, and cshmc (20 mg / kg) treated group minimal (score 0.51) epithelioid cells and alveolar wall infi ltration with no caseation necrosis and giant cell; (f) cshmc (5 mg / kg) treated group mild (score 1.5) epithelioid cells and alveolar wall infi ltration with no caseation necrosis and giant cell histopathology of spleen (h and e stain, 40). (a) normal control group normal morphology; (b) disease control group severe (score 6) epithelioid cells (e), lymphocyte (l) infi ltrate with caseation necrosis (cn), and giant cells (g); (c e) isoniazid, rifampicin, and cshmc (20 mg / kg) treated group minimal to mild (score 11.5) epithelioid cells infi ltration with no caseation necrosis and giant cell; (f) cshmc (5 mg / kg) treated group mild to moderate (score 2.5) epithelioid cells infi ltration with no caseation necrosis and giant cell histopathology of liver (h and e stain, 40). Liver shows normal morphology; (b) disease control group a mild (score 2) ballooning degeneration (bd); (c f) isoniazid, rifampicin, and cshmc (20 and 5 mg / kg) treated group a minimal or no (score 0.5) ballooning degeneration (bd) isoniazid, rifampicin, and cshmc treated groups showed less white caseous granulomatous foci as compared with disease control group in lung and spleen by gross examination . Liver did not show any gross changes in groups ii vi . As shown in figure 2b, lesion of lung consisted of epithelioid cells, lymphocytic infiltration, multinucleated giant cells, caseation necrosis, granuloma, and pneumonitis . Isoniazid [figure 2c], rifampicin [figure 2d], and cshmc (20 mg / kg) [figure 2e] treated group had shown a minimal epithelioid cells and alveolar wall infiltration with no caseation necrosis and giant cell . The lesion of spleen consisted of epithelioid cells, lymphocytic infiltration, multinucleated giant cells, caseation necrosis, and granuloma [figure 3b]. Isoniazid [figure 3c], rifampicin [figure 3d], and cshmc (20 mg / kg) [figure 3e] treated group had minimal to mild epithelioid cells infiltration with no caseation necrosis and giant cell . As shown in table 1, isoniazid, rifampicin, and cshmc (20 mg / kg) significantly reduces the median lesion score in lung and spleen . Reduction in median lesion score of lung and spleen were not statistically significant for cshmc (5 mg / kg) [figures 2f and 3f]. Cshmc (20 and 5 mg / kg) treated group had shown a minimal or no ballooning degeneration . Isoniazid [figure 4c], rifampicin [figure 4d], and cshmc [figure 4e and 4f] significantly reduce the median lesion scores of liver [table 1]. The lesion scores of lungs, spleen, and liver were calculated in all the 5 groups after 30 days of the treatment the hemogram [table 2], liver [table 3], and renal [table 3] function parameters were monitored after 30 days of isoniazid, rifampicin, and cshmc treatment . The result indicates that cshmc did not produce any changes in hemogram, liver functions, and renal function parameters with respect to normal values . Effect of isoniazid, rifampicin, and cshmc on hemogram parameters in blood of guinea pigs after 30 days of treatment effect of isoniazid, rifampicin, and cshmc on liver and renal function parameters in blood of guinea pigs after 30 days of treatment the main drawback of antitubercular chemotherapy is the lack of patient compliance, therapeutic failure, long duration of therapy, emergence of multidrug and extensive drug resistance tuberculosis, increasing incidence of hiv and toxic side effects, such as hepatotoxicity . The xdr - tb is virtually untreatable with high mortality and now treatment of it will depend on sensitivity of drugs . The second - line drugs are less efficacious, less convenient, more toxic, and more expensive ., we investigated the antitubercular efficacy and safety of coumarin derivatives: cshmc in guinea pig model . The antitubercular efficacy was evaluated in terms of histopathological score of the organs of infected guinea pigs after daily administration of cshmc for 30 days . Higher reduction of the histopathological score of lesion from the lung, spleen, and liver with cshmc in the dose of 20 mg / kg than with 5 mg / kg suggests clearance of tubercle bacilli from the lesion in a dose - dependent manner . Cshmc-20 mg / kg had shown similar reduction in median score lesion of lung, spleen, and liver as compared to isoniazid and rifampicin . Antitubercular efficacy can be better measured by colony counting in the culture of the organs (lung, spleen, and liver) of the guinea pigs infected with m. tuberculosis . The safety of cshmc was evaluated in terms of alteration on hematological, liver and renal function parameters of the infected guinea pigs . Antitubercular drugs, such as isoniazid, rifampicin, and ethambutol have been shown to induce hematological toxicity . In the present study, no alteration in hematological parameters with nce in the dose of 20 and 5 mg / kg compared to normal control group . Most of the antitubercular drugs, such as isoniazid, rifampicin, and pyrizinamide have been shown to induce hepatotoxicity particularly when used in combinations . Levels of sgpt, sgot, alp, and total bilirubin were monitored as an index of hepatotoxicity . In the present study, no alteration in the levels of liver function parameters with cshmc in the dose of 20 and 5 mg / kg were observed compared to normal control group . No alteration in the level of renal function parameters with cshmc in the dose of 20 and 5 mg / kg were observed compared to normal control group . This study indicates the cshmc in the dose of 20 and 5 mg / kg did not show the hematological toxicity, hepatotoxicity, and nephrotoxicity . Nce is a coumarin derivative and heterocyclic analogue of dapsone (dads) was attached to it . In dads free amino group antimycobacterial effect of this compound may be due to its 8-[(4-chloro phenyl) sulfonyl] group and/or due to coumarin ring . Quantitative structure activity relationship (qsar) study remains open for the further studies . Cshmc in the dose of 20 mg / kg had shown more efficacies against the m. tuberculosis infection in guinea pigs compared with a dose of 5 mg / kg, which is comparable to isoniazid and rifampicin by histopathological data . In both doses
|
Management can be challenging, in an intensive care setting, in case a patient is afflicted with more than one microbiological infection . It may be possible for two viruses to infect the same cell and as such, there may be interaction of the pathologic pathways of the two viruses, leading to change of virulence or altered host response . We present a case of concomitant infection with dengue and h1n1 virus with an unexpected rapid recovery and milder symptoms of influenza . A 23-year - old man was referred to our institute from a peripheral hospital . The patient had a history of fever, malaise, cough, sore throat, and breathlessness since last 7 days . His platelet count was 14,000/mm and was transfused with single donor platelets . On admission, he was conscious and oriented; had blood pressure of 126/80 mmhg; pulse rate of 102/min; respiratory rate of 26/min; was febrile; and peripheral oxygen saturation was 92% on facemask with oxygen flow rate of 10 l / min . On auscultation of the chest, breath sounds were found to be decreased bilaterally in the lung bases and crackles were present in the mid zones of the lung fields . Investigations revealed hemoglobin 10.6 gm / dl; total white blood cell count 11,200/mm; platelets 60,000/mm; serum sodium 138 mmol / l; potassium 3.7 mmol / l; blood urea 124 mg / dl; and creatinine 2.6 mg / dl . Liver function test showed total bilirubin 2.7 mg / dl with directly reacting fraction at 0.6 mg / dl, serum glutamic oxaloacetic transaminase (sgot) 2560 iu / l, and serum glutamic pyruvate transaminase (sgpt) 5591 iu / l, and a prothombin time of 32 s (control 13 s). The chest skiagram (ap view) showed bilateral diffuse infiltrates and ultrasonography revealed ascites with bilateral moderate pleural effusion . Arterial blood gas analysis showed a ph of 7.38, pco2 46 mmhg, po2 69.1 mmhg, and standard bicarbonate of 26 mmol / l . Therapy with oral osaltamivir 150 mg twice daily along with azithromycin 200 mg once daily was started . The next day, the patient's condition deteriorated clinically with an increase in the respiratory rate to 36/min and a fall in oxygen saturation to 76% on facemask with 10 l / min oxygen flow . Central venous pressure - guided fluid therapy (normal saline) was started to maintain central venous pressure between 10 and 12 cm h2o . Noninvasive ventilation with positive end expiratory pressure of 10 cm and pressure support (ps) of 12 cm was administered . The patient's oxygen saturation improved to 96%-98% and respiratory rate decreased to 14 - 16/min . In the next 2 days, he was afebrile and ventilatory support was decreased to continuous positive airway pressure of 5 cm, and ps of 10 cm with inspired oxygen concentration reduced to 40% . On day 4, he had a spike of fever and platelet count decreased to 24,000/mm . The fever resolved with supportive measures and platelet counts increased spontaneously without further platelet transfusion in the next 24 h. the ventilatory support was gradually withdrawn by gradually increasing the period of nonsupported hours in between the non - invasive ventilation (niv) support and withdrawn completely from ventilator by day 6 . He was shifted out of the icu to isolation ward, kept on observation there and subsequently discharged uneventfully on day 10 . Infection of a single host by multiple pathogens may result in competition for host resources . Such an intrahost competition is predicted to shape a variety of pathogen traits, such as virulence, transmissibility, and resource partitioning that could affect epidemiology and virus population dynamics . However, literature is scarce regarding the impact of concomitant infection of dengue and h1n1 . Deregulation of proinflammatory cytokines from macrophages has been shown to be important in the pathogenesis of acute respiratory distress syndrome (ards) by influenza viruses . However, apoptosis is a host defence mechanism and the induced apoptosis of the infected cells limits the continuity of the infection . As both the infections are known etiologic factors of ards, concomitant infection with both was expected to cause severe ards in this patient . However, contrary to our expectation, the respiratory involvement was mild enough to be managed with noninvasive ventilation . Ards severity depends on release of inflammatory mediators in response to tissue damage or noxious stimuli . Ards involves stimulation of cellular and humoral immunity in an uncontrolled way, leading to a vicious cycle of tissue damage . Cpla2 (cytosolic phospholipease a2) stimulation is known as a major pathogenic pathway in the development of ards and inhibition of the cpla2 enzyme may be helpful in preventing development of ards . The respiratory epithelial cell involvement with dengue infection is associated with expression of il-6 through a nf-b - dependent pathway, and expression of chemokine rantes . Dengue virus infection also produces a state of immunosuppression, mediated through cytotoxic factor (cf) and suppressor factor produced by t lymphocytes in spleen . Cf destroys macrophages and a subpopulation of t lymphocytes, thus producing a nonspecific immunosuppression . We offer two possible mechanisms to explain the lower severity of the respiratory involvement and the faster recovery of the patient . First, dengue virus infection may have induced apoptosis in the respiratory epithelial cells, which were infected with the h1n1 virus . Second, the immunosuppression caused by the dengue viral infection decreased the signaling of the proinflammatory pathways, thereby decreasing the quantum of cellular and humoral proinflammatory mediators required for the continuity of the vicious cycle of inflammation as in ards . During the pandemic of the novel h1n12009 influenza, the outbreaks of dengue virus infections also occurred in many geographic locations, which were experiencing the pandemic of the h1n12009 . As both the viruses are circulating in the same community, at the same time, in many locations, there was the likelihood of people being afflicted by concomitant infection with both the viruses . Clinical status in case of concomitant infection with h1n1 and dengue should be cautiously interpreted . Although the severity of h1n1 may be clinically less obvious because of lesser immune response due to the immune suppression by the dengue virus, both the virus can cause some specific organ damage, which needs to be evaluated timely . Severity of h1n1 in a patient with dengue should not only be clinically evaluated but also by laboratory tests for viral load.
|
Depressive disorders affect 340 million people (approximately 9%) globally regardless of gender, culture, or ethnicity . From 1990 till present time, depression has been rated one of the leading causes of years lived with disability (ylds). For instance, depression predicts future coronary events and cardiac deaths in healthy individuals and in those with established cardiovascular disease (chd) [3, 4]. Depression has also been shown to be associated with several other physical diseases, including cancer and osteoporosis, as well as with severe psychiatric disorders such as schizophrenia . Furthermore, depression relates to low educational attainment and reduced work productivity . Identifying factors that contribute to depression and developing tools that can be applied in early prevention of depression even though some conflicting findings concerning the association between physical activity and depression exist [8, 9], prior evidence provides support for the value of physical activity in reducing depressive symptoms in both healthy and clinical populations . Literature has also indicated that even low doses of physical activity may protect against depression . The relation between physical activity and depression may also be bidirectional, as physical activity may alleviate depressive symptoms, but these symptoms may also decrease the likelihood of initiating physical activity [8, 11]. Physical activity has also been related to neurobiological functioning, which may preempt depressive mood . In addition, physical activity has been shown to be associated with the development of individual qualities such as self - confidence, emotional self - regulation, and capacity of social bonding, which, in turn, may be protective against depression [13, 14]. Several studies have indicated that regular physical activity associates with reduced risk of depression in all age groups from early childhood to late adulthood [8, 10, 15]. There is also evidence that childhood physical activity may lead to maintenance of lifetime physical activity patterns conducive to well - being (e.g.,). Many previous findings regarding the association between physical activity and depression derive from cross - sectional designs . Previous longitudinal or intervention designs cover relatively short follow - up phases of physical activity [10, 18]. Prospective studies examining the association between lifelong physical activity and depressive symptoms are very rare . It has been stated that more sophisticated methods are needed when studying the development and etiology of depression . It has also been shown that people's health behaviors may have various developmental tendencies instead of a one growth trajectory [20, 21], and some of these behavioral profiles may be more detrimental to health than others . For instance, it is theoretically possible that physical activity's decline towards later life may start earlier and/or be steeper among specific groups than in others, and thus the different physical activity profiles may associate with distinct health outcomes . The need for examinations assessing the development and decline of physical activity has been acknowledged [17, 22]. It is also essential to study whether long - term physical activity contributes to health over and above the concurrent physical activity . Furthermore, identifying people, whose behavioral tendencies associate with decreased health, might be useful for professionals who aim to adjust lifestyle interventions to targeted groups . It is also important to gain information of the behavioral determinants and contributors of good health . Growth mixture modeling provides an appropriate framework for studying developmental processes [20, 24]. The key advantage of such modeling is that it allows for the estimation of interindividual variability in intraindividual patterns of change over time [20, 24]. Current approaches to growth modeling have also been regarded as flexible for instance in terms of including partially missing data, unequally spaced measurement points, nonnormally distributed or discretely scaled repeated measures, and linearly or nonlinearly shaped trajectories . These issues, or some of these, typically emerge in developmental research . Extensive adjustment for potential confounders has been lacking in many previous studies regarding physical activity and health outcomes [16, 18]. Development of depression often depends on the interplay of multiple psychological and lifestyle related factors that ideally should be considered when examining associations between health behaviors and depression [2530]. Child's early emotional experiences (e.g., negative emotionality) may have effects on the development of depression later in life . Childhood family's socioeconomic status has been shown to be associated with the development of health behaviors and well - being . In adulthood, it has been proven that depression is related to age, and women tend to report higher levels of depression than men . Adulthood socioeconomic position, experiences of social support, body mass index, and smoking status are also associated with depression in adulthood [26, 29, 30]. We examined the potential heterogeneity in physical activity trajectories in relation to depressive symptoms over a 30-year period from childhood to adulthood in a population - based sample with six cohorts and including eight study waves . To our knowledge, this is the first study assessing physical activity and depressive symptoms in such design . Physical activity measurements were performed during participants' childhood and adulthood (from the age of 9 to 49), and depressive symptoms were assessed in participants' adulthood (participants aged from 35 to 50). To gain a comprehensive picture of the association between physical activity and depressive symptoms, the association was studied cross - sectionally, with respect to change and with respect to long - term trajectories . The objectives of this study were (1) to explore the potentially distinct trajectories of physical activity from childhood to adulthood, (2) to examine whether physical activity was associated with cross - sectional, short - term, and long - term changes in depressive symptoms in adulthood, and (3) to examine whether the physical activity trajectories contributed to depressive symptoms in adulthood to a greater degree than adulthood physical activity . The study participants were from the ongoing prospective cardiovascular risk in young finns study that began in 1980 . The original sample consisted of 3596 children and adolescents (83.2% of those invited, 1832 females and 1764 males) from six birth cohorts (aged 3, 6, 9, 12, 15, and 18). To obtain a representative sample, finland was divided into five areas based on the locations of universities with medical schools (helsinki, kuopio, oulu, tampere, and turku), and the participants were randomly selected based on their social security numbers from nearby urban and rural areas . Informed consent was requested from each participant (or from the parents of small children), and the study was approved by the local ethics committees . The study was conducted according to declaration of helsinki and american psychological association's ethical principles . The sample was followed in 8 waves, 1983, 1986, 1989, 1992, 1997, 2001, 2007 - 2008, and 2012, in which medical, psychological, and physical activity studies were conducted . Physical activity from childhood to middle adulthood was assessed in 1980, 1983, 1986, 1989, 1992, 2001, 2007, and 2011, response rate ranging from 53.1% to 72.8% (n = 19102619) of the original study participants (table 1). Depressive symptoms were measured in 2012 and 47.9% (n = 1724) of the original study subjects participated in the examination (table 1). Previous studies of sample attrition have shown that there has not been systematic selection bias regarding study participants' medical profiles or physical activity [31, 32], but some selective attrition with respect to personality and depressive symptoms exists [33, 34]. Participants who were less self - directed and less agreeable and had higher levels of neuroticism as well as depressive symptoms had discontinued the study more often than others [33, 34]. Information concerning 3- and 6-year - old children's (born in 1974 and 1977) physical activity levels is missing from this study, because they were not able to self - report their physical activity levels in 1980 . Participants, from whom physical activity was assessed, were aged from 9 to 18 in 1980 and from 34 to 49 in 2011 . From 1980 to 1989, physical activity questionnaires consisted of five questions focusing on the intensity and frequency of participants' leisure time physical activity, participation in sports - club training, participation in sports competitions, and participants' usual way of spending leisure time . From 1992 till present time, questionnaires consisted of five questions as well, assessing the intensity and frequency of leisure time physical activity, hours spent on physical activity per week, average duration of a physical activity session, and participation in organized physical activity . From 1980 to 1992, the answers for the questions were coded into 3 categories (ranging from 1 to 3), excluding the items that assessed participation in sports competitions (19801989) and participation in organized sports (1992) which had a response range from 1 to 2 . From 2001 to 2011, all responses to the questions were coded into 3 categories (response scale ranging from 1 to 3). A sum score (physical activity index) of question responses was created for each participant each year (table 1), higher scores reflecting higher physical activity level . The index has been found reliable and valid . Participants' depressive symptoms were assessed with beck depression inventory ii (bdi - ii). These symptoms were measured in 2012 when the participants were aged from 35 to 50 . Bdi - ii consists of 21 symptoms with a severity range from 0 (no symptoms) to 3 (severe level of depressive symptoms). A sum score of all items was computed for each participant (table 1), and no missing items were allowed . The reliability estimate (cronbach's) for the depressive symptom scores was> 0.90 . Bdi - ii has demonstrated to be a valid instrument [3638], and it has been regarded as an acknowledged standard in the measurement of depressive mood [3639]. It is applicable in clinical and nonclinical contexts, including in general populations [3639]. Bdi - ii correlates highly with its earlier versions, including modified bdi [36, 38], which has also been considered as a valid measure for assessing depressive symptoms in general populations . The instrument has been designed and also demonstrated to be a useful screening tool for potential depressed cases [36, 38]. Childhood, adulthood, and general (age, sex, and body mass index) covariates were controlled for in this study (table 1) [2530]. Participants' negative emotionality was reported by the primary caretaker via six questions reflecting participants' behavior in childhood (e.g., the child hits / kicks other children accidentally), on a scale from 1 (true) to 2 (not true), and average of the items was calculated for each participant . As some of the participants were adolescents in 1980, their caretakers responded to this question retrospectively . Participants' parents' socioeconomic status was assessed via two indices, educational and income levels . Parents' educational level was determined via educational information collected from participants' mothers' and fathers' (1 = below 9 years / comprehensive school, 2 = 9 to 12 years / secondary school, and 3 = over 12 years / academic education). If parents' educational information differed, we based parental educational status on the information collected from the parent with the higher educational level . If educational information was available for only one parent, family's educational status was determined using his / her educational information . Family's income level was rated in an 8-point scale [1 = <15 000 marks (~2523 euros) and 8 => 100 000 marks (~16819 euros)]. Symptoms of participants' adulthood depression were determined in 1992, 1997, 2001, and 2007 via a modified version of beck depression inventory, referred to as a modified bdi [34, 40]. Items of the measure were rated in a 5-point scale, and average of the items was computed each year for each participant . Participants' socioeconomic status (2007) was determined via two indices; education was assessed via a 3-category scale (1 = comprehensive school, 2 = secondary school, and 3 = academic level) and income level via an 8-point scale (1 = <10 000 euros and 8 => 70 000 euros). Additionally, participants' experiences of social support, body mass index, and smoking status measured in 2007 were controlled for [29, 30]. Social support was determined via a 12-question inventory using a 5-point scale, and a mean score of the items was calculated for each participant . Participants' smoking status was examined via a 5-category scale (1 = smokes a cigarette per day or more, 2 = smokes once in a week, 3 = smokes less than once in a week, 4 = has quitted smoking, and 5 = has never smoked). Physical activity questionnaires, which were designed for children and adolescents (19801989) and adults (19922011) differed slightly in their content . To assure that the findings of the present study were based on changes in physical activity and not due to a measurement artifact, a confirmatory factor model was used to examine whether the physical activity indices consisting of five indicator variables had measurement and structural invariance over time [42, 43]. Weighted least squares means and variance adjusted (wlsmv) estimation was used for all analyses . The goodness of fit for scalar invariance was assessed with comparative fit index (cfi), tucker - lewis index (tli), and root - mean square error of approximation index (rmsea). Factor scores derived from this examination were used in subsequent analyses . Within the growth mixture modeling framework, latent class growth analysis (lcga) lcga captures information about developmental processes at inter- and intraindividual levels, detecting subpopulations with distinct growth trajectories . The determination of the number of subgroups for physical activity was based on akaike's information criterion (aic). In addition, the determination of the groups was based on the classification quality estimations and practical considerations [20, 45]. Within the lcga model, the average temporal trajectories in the physical activity groups were modeled by regression equations, in which both the linear and quadratic terms were tested for the independent variable (time). The associations between physical activity factor scores (assessed from age 9 to 49) and depressive symptoms (participants aged from 35 to 50) were first examined cross - sectionally and longitudinally with linear regression analyses . Due to the potential multiple testing problem, bonferroni - corrected p values (p <0.003) thereafter, the associations between the physical activity trajectory groups and depressive symptoms measured in 2012 were examined with analyses of variance, and post hoc tests were also performed (bonferroni's method). Furthermore, we examined the longitudinal associations between physical activity levels assessed in participants' adulthood (2007, including participants aged from 30 to 45) and depressive symptoms (2012) using a linear regression . Due to the number of missing values, the variance analyses and the regression analyses in which the adulthood physical activity (2007) was used as a predictor were performed in another dataset which was imputed using the expectation - maximization (em) algorithm . Analyses were performed in statistical software programs mplus (version 7.1 and version 7.2), ibm spss (version 21), and stata (version 13). Descriptives of the original sample (n = 17243596) are shown in table 1 . Supplementary tables 1 and 2 (see supplementary material available online at http://dx.doi.org/10.1155/2016/8947375) provide descriptives of the sample in the complete (n = 648) and imputed (n = 35643596) data, respectively . Although the scalar invariance model for physical activity did not demonstrate strong factorial invariance over time, the fit for partial scalar invariance model was adequate (cfi = 0.90, tli = 0.90, and rmsea = 0.047), given partial invariance of the threshold parameters . For rmsea, values <0.05 indicate a very close model fit, and cfi and tli values close to 0.90 denote an adequate fit . Since the partial scalar invariance model was considered acceptable, factor scores were predicted for each subject to be used in subsequent analyses (supplementary table 3). Lcga suggested that a three - factor (group) solution was the best fitting model for the data based on aic indices (aic = 48915.44, 48915.39, 48901.43, 48902.85, and 48907.08 for 1, 2, 3, 4, and 5 groups, resp . ; the classification quality of the three - factor model was also adequate based on the average probability estimates (group 1 = 0.74, group 2 = 0.86, and group 3 = 0.71). Values> 0.70 delineate that the group consists of individuals with similar patterns of change . Linear parameter estimates were found for the physical activity groups (supplementary table 4). Figure 1 shows the central tendencies of the three groups, lightly (n = 371), moderately (n = 3046), and highly (n = 147) physically active groups by age . Based on the estimated marginal means, participants' physical activity levels remained relatively unchanged from childhood to adulthood in each group, although these levels appeared to diminish minimally towards middle adulthood in all participants (figure 1). The regression analyses performed in the original sample (n = 2551467) indicated that low levels of physical activity factor scores were, in most examined ages, associated with higher levels of depressive symptoms in participants' adulthood (p <0.05), although some of the associations attenuated when bonferroni - corrected p values (p <the analyses of variance in the original sample (n = 1722) indicated that the physical activity trajectory groups predicted symptoms of depression [f (2,1719 = 8.12, p <0.001, adjusted r = 0.01)]. Post hoc tests showed that highly physically active group had lower levels of depressive symptoms than lightly active group (mean difference = 3.26; p <0.001, 95%ci: 5.25 to 1.26). Highly physically active participants had lower levels of depression in comparison to moderately active ones (mean difference = 1.92, p = 0.02, 95%ci: 3.66 to 0.18). Also moderately active participants had lower levels of depressive symptoms than lightly active participants (mean difference = 1.33, p = 0.02, 95%ci: 2.48 to 0.19). Based on the analyses of variance after adjusting for the covariates [2530], the associations attenuated to nonsignificance [f (2, 631) = 2.13, p = 0.12, adjusted r = 0.25]. In particular the previous symptoms of depression measured in 1992, 1997, 2001, and 2007 attenuated the associations (for details, see supplementary table 5). We also examined the unadjusted associations in the data with full information on all study variables (n = 648), in which case the association between the physical activity trajectory groups and depressive symptoms became only marginally significant [f (2,645) = 2.76, p = 0.06, adjusted r = 0.01]. As the sample attrition might have affected this association (i.e., by reducing the statistical power), the analyses were also performed in a dataset which was imputed using em - algorithm (n = 35643596). This method was applied as the little's mcar test confirmed that the data were not missing completely at random (= 3903.02, df = 2923, p <0.001). In the imputed dataset, physical activity groups predicted the symptoms of depression [f (2,3561) = 16.74, p <0.001, adjusted r = 0.01]. Post hoc tests indicated that highly physically active group had lower levels of depressive symptoms than lightly active group (mean difference = 2.74; p <0.001, 95%ci: 3.91 to 1.56) (figure 2). Highly physically active participants had lower levels of depressive symptoms in comparison to moderately active ones (mean difference = 1.59, p = 0.001, 95%ci: 2.60 to 0.57) (figure 2). Also moderately active participants had lower levels of depressive symptoms than lightly active participants (mean difference = 1.15, p <0.001, 95%ci: 1.81 to 0.49) (figure 2). When the covariates [2530] were adjusted for, the results became nonsignificant [f (2,3547) = 0.53, p = 0.59, adjusted r = 0.47]. In particular the previous symptoms of depression measured in 1997 and 2001 attenuated the associations (for details, see supplementary table 5). Thereafter, we examined the longitudinal associations between adulthood physical activity (assessed in 2007, participants' aged from 30 to 45) and symptoms of depression (assessed in 2012). In the original sample, adulthood physical activity was associated with depressive symptoms (b = 1.10, p <0.001, 95%ci: 1.58 to 0.61, adjusted r = 0.01). When the covariates [2530] were adjusted for, the association attenuated to nonsignificance (b = 0.17, p = 0.62, 95%ci: 0.85 to 0.51, adjusted r = 0.24). In particular the previous symptoms of depression assessed in 2001 and 2007 attenuated the association (for details, see supplementary table 6). Thereafter, the analyses were performed in a sample with full information on all study variables (n = 648), in which case the adulthood physical activity was not associated with depressive symptoms (b = 0.55, p = 0.16, 95%ci: 1.31 to 0.21, adjusted r = 0.002). Due to the sample attrition, the association was studied also in the imputed data (n = 3596), and the results showed that the adulthood physical activity was associated with decreased levels of depressive symptoms (b = 1.07, p <0.001, 95%ci: 1.36 to 0.78, adjusted r = 0.01). When the covariates [2530] were adjusted for, the association attenuated to nonsignificance (b = 0.06, p = 0.57, 95%ci: 0.16 to 0.28, adjusted r = 0.47). In particular the symptoms of depression assessed in 2001 and 2007 attenuated the association (for details, see supplementary table 6). This study examined whether distinct trajectories of lifelong physical activity existed in the data and whether physical activity was related to depressive symptoms in adulthood . We also studied whether the lifelong physical activity trajectories contributed to the outcome to a greater degree than adulthood physical activity . This inspection was important, because the information whether lifelong trajectories contribute to depressive symptoms over and above the concurrent (adulthood) physical activity is lacking . Lcga revealed three distinct groups, the lightly, moderately, and highly physically active groups . Physical activity levels remained relatively similar from childhood to adulthood in each group, although the groups' physical activity levels decreased slightly towards middle adulthood . These results are in line with previous studies demonstrating the decline of physical activity with age . High physical activity associated with lower level of depressive symptoms in adulthood, which is in accord with previous research [10, 18]. Physical activity may also relate to enhanced self - confidence, emotion regulation skills, and social capacities that are associated with positive mood [13, 14]. The association between high physical activity and lower levels of depressive symptoms in adulthood, however, disappeared when covariates (age, sex, childhood negative emotionality, parents' socioeconomic status, participants' previous symptoms of depression, participants' socioeconomic status, social support, body mass index, and smoking status) were taken into account . The explanatory power of the fully adjusted models was substantially higher in comparison to the unadjusted ones (46% higher in the imputed data). These same results were found when lifelong physical activity trajectories and adulthood physical activity (assessed in 2007) were used as predictors for depressive symptoms in adulthood . Specifically, physical activity did not predict lower levels of depressive symptoms in adulthood when the experiences of previous depression were taken into account . The bidirectional nature of the association between physical activity and depression has been documented [8, 11]. Hence, it is theoretically possible that the childhood symptoms of depression preceding our first measurement have decreased the likelihood of initiating physical activity [8, 11] or that of maintaining adequate level of physical activity . Summarizing, the study indicated that lifelong physical activity trajectories or adulthood physical activity levels were not associated with the progression of depressive symptoms in adulthood . The study suggests that lifelong physical activity history does not contribute to the progression of the depressive symptoms to a greater degree than adulthood physical activity . Participants did not provide information regarding each variable across the measurement years, which diminished the complete - sample size considerably . The measurements concerning the participants' physical activity focused only on the self - reported leisure time physical activity, not total physical activity or energy expenditure . Also the depressive symptoms were assessed with self - administered questionnaires, and thus the possibility of subjective bias cannot be excluded . However, this is common in epidemiological studies by necessity . To our knowledge, comparably long follow - up studies using diagnostic interviews do not exist . Furthermore, early childhood depression was not assessed in the study, but this deficiency was retrieved to an extent by controlling for the childhood negative emotionality . The strengths of the study were the prospective, population - based study design, relatively large sample size, use of lcga, and utilization of an extensive set of covariates . In lcga, the main advantage is that it allows a researcher to model developmental processes at inter- and intraindividual levels . Such modeling has been shown to be especially useful regarding the development of health behaviors [20, 21], and the need for further studies has been recognized . However, in the case of this study, the traditional cross - sectional and longitudinal studies yielded to very similar results . This was not evident a priori, and therefore our study adds evidence regarding the etiology of depression by showing that physical activity trajectories appear not to play a special role over and above the adulthood physical activity . Furthermore, depressive symptoms were studied with a well - validated instrument, bdi - ii [3639]. We were able to study the whole variance of participants' depressive symptoms instead of categorical diagnoses . This is important when attempting to find preventive tools for depression, because functional impairment is much more strongly associated with symptom severity than with diagnostic symptom count . Also the people who have experienced symptoms of depression are at risk of getting a diagnosis . This study identified three distinct physical activity groups, the lightly, moderately, and highly physically active ones . Each group's physical activity levels remained relatively unchanged from childhood to adulthood, although the levels tended to diminish slightly towards later adulthood . Highly physically active participants from childhood to adulthood had lower levels of depressive symptoms in adulthood compared to lightly physically active ones . Furthermore, participants' adulthood physical activity assessed in 2007 was associated with decreased levels of depressive symptoms in adulthood . The associations between physical activity and depressive symptoms disappeared when the preexisting symptoms of depression were controlled for, indicating that physical activities did not associate with the progression of depressive symptoms . Thus, the study suggests that lifelong physical activity history does not contribute to the progression of the depressive symptoms to a greater degree than adulthood physical activity . Obtaining information of mental health history might benefit clinicians and other professionals in evaluating the role of physical activity in well - being.
|
Studies have shown that statins can inhibit the action of hmg - coa reductase in the liver, thereby slowing down the cholesterol production process . Clinical studies have also shown that statins can reduce the risk of heart attack, stroke, and death in patients with heart disease such as coronary artery disease and cardiovascular disease [2, 3]. In addition, researchers have reported that statins may reduce the risk of developing colon cancer, non - small lung cancer, pancreatic cancer, and esophageal cancer [47]. Although these drugs have a satisfactory safety record, the increased risk for developing new - onset diabetes mellitus during extended statin use has recently generated attention; this includes simvastatin (10%), atorvastatin (as, 22%), and rosuvastatin (18%) [811]. Have recently found that these statins reduced insulin sensitivity and pancreatic -cell function, possibly because of the effect on ca channels in -cells, glucose transporter 4 translocation, insulin receptor substrate-1 and insulin receptor expression or phosphorylation, adipocyte maturation or differentiation, isoprenoid and coenzyme q10 biosynthesis, and adiponectin and leptin levels [12, 13]. However, studies on pravastatin showed significant improvements in insulin sensitivity and -cell function [14, 15]. Therefore, demonstrating the proposed mechanisms of statins therapy during the development of new - onset diabetes may be valuable for designing a new generation of statins without the aforementioned side effects . Poly(adp - ribosyl) polymerase-1 (parp1) is a group of nuclear enzymes that has been associated with three different modes of cell death induced by dna damage, namely, apoptosis, necrosis, and parthanatos . In addition, its overactivation results in nad / atp energy depletion and eventually causes necrotic cell death [1619]. However, studies have identified a novel function of parp1 in mediating autophagy; thus, parp1 exhibits a dual role in modulating autophagy and necrosis under oxidative stress and dna damage [2022]. Autophagy is an intracellular bulk degradation system for the removal of long - lived proteins and damaged organelles such as lysosomes . Studies have indicated that autophagy may prevent neurodegeneration, aging, and tumorigenesis [2327]. By contrast, several studies have suggested that autophagy may trigger and mediate type ii programmed cell death, which has been referred to as autophagic cell death [28, 29]. Autophagy has also been demonstrated as a prosurvival mechanism against cell death, especially under stress conditions such as starvation, metabolic stress, oxidative stress, and dna damage [30, 31]. Thus, this study examined the signaling pathway linking parp1 activation to autophagy under pharmaceutical stress, as well as the functional role of autophagy in pharmaceutical stress - mediated cell death . Mouse pancreatic nit-1 cells were obtained from bcrc (bioresource collection and research center, taiwan) and cultured in f-12k medium (sigma - aldrich, usa) supplemented with 10% fbs (gibco, usa) at 37c in a humidified 5% co2 . Cells were seeded into a 96-well plate (6 10/well) on f-12k medium and treated with statin (1020 m, merck millipore, germany) for 48 h, beginning 24 h after seeding . Wst-1 solution (10 l, roche, germany) was added to each well and the cells were incubated for 1 h. the absorbance at 440 nm was measured using a microplate reader (fluostar galaxy, germany). In some experiments, the cells were pretreated with various inhibitors such as necrostatin-1 (nec-1, an inhibitor of rip1, 10 m, enzo life sciences, usa), necrosulfonamide (nsa, an inhibitor of mlkl, 1.0 m, millipore), bafilomycin a1 (baf - a1, 2 nm, sigma - aldrich), 3,4-dihydro-5[4-(1-piperidinyl)butoxyl]-1(2h)-isoquinoline (dpq, 60 m, calbiochem), z - val - ala - asp - fluoromethylketone (zvad - fmk, 2 m, biovision, usa), and mtor inhibitors (rapamycin, 20 nm, adooq bioscience, usa) before statin treatment . One - day cultured nit-1 cells were treated with statin for 48 h. the supernatants were collected and the insulin concentrations were measured using rat / mouse insulin 96-well plate assay (millipore) according to the manufacturer's instruction; the absorbance at 450 nm and 590 nm was measured by an elisa reader (fluostar galaxy). Il-6 was determined using the mouse il-6 elisa kit (bd biosciences, usa) according to the manufacturer's instruction; the absorbance at 450 nm was measured by an elisa reader (fluostar galaxy). The lower limit of detection for this elisa was 3.8 pg / ml il-6 . Nit-1 cells were seeded into a 96-well plate (6 10/well) and cultured in statin - containing medium supplemented with 1% fbs for 48 h. after applying 100 l of the lactate dehydrogenase reaction mixture using the cytotoxicity detection kit (roche), the absorbance at 490 nm was measured by an elisa reader (fluostar galaxy): cytotoxicity (%) = (exp . Nit-1 cells were seeded in 12-well plates at 4 10 cells / well and treated with statin for 48 h. subsequently, the cells were collected, fixed with cold 70% absolute ethanol, and stored at 20c overnight . Before detection subsequently, 1 ml of staining solution was added into each tube (20 g / ml of pi), followed by incubation in darkness for 30 min . Finally, the stained cells were analyzed using a flow cytometer (cytomics fc 500, beckman coulter). Cells were plated in a 6 cm culture dish at a seeding density of 5 10 cells / dish . The cells were trypsinized, collected by centrifugation, resuspended in 500 l of 1x annexin v binding buffer mixed with 1 l of annexin v (biovision) and 1 l of propidium iodide (biovision), and incubated at room temperature for 15 min in darkness . The cells were analyzed using a flow cytometer (cytomics fc 500) with a single laser emitting excitation light at 488 nm . The intracellular reactive oxygen species were assessed using the cellrox oxidative stress reagent (life technologies, usa) according to the manufacturer's instructions . Cells were plated in 12-well plates with a cell density of 8 10 cells / well and treated with statin for 48 h. after statin treatment, the cells were stained with 5 m of cellrox green reagent and incubated in darkness for 30 min . After incubation, the stained cells were analyzed using the flow cytometer (cytomics fc 500). The 2.5 10 cells were seeded in a 3.5 cm confocal dish and pretreated with various inhibitors before statin treatment . Following a 48 h treatment with statin, the cells were washed with pbs to remove dead cells and serum proteins . Immediately, treated or untreated nit-1 cells were stained with an antibody against rabbit monoclonal aif (1: 400, cell signaling) or cyto - id autophagy detection kit (enzo life sciences, farmingdale, new york, usa) and imaged via confocal microscopy using an olympus fv1200 microscope (tokyo, japan). The images were converted to 8-bit grayscale and analyzed by the imagej software . The integrated density (intden) provided a measure of intensity proportional to total volume and was calculated using area . After statin treatment, the cells were stained with mitotracker red and incubated at 37c for 30 min in darkness . The cells were washed three times with pbs to remove unbound dye and recultured in f-12k medium . The fluorescence of the bound dyes was analyzed using an olympus ix81 fluorescence microscope (tokyo, japan). Cellular atp synthesis was determined using the phosphoworks luminometric atp assay kit (aat bioquest, usa) according to the manufacturer's instructions . In brief, cells were seeded into 96-well plates and pretreated with inhibitors . After statin treatment, the cells were added with 100 l of atp assay solution and incubated for 20 min at room temperature . Nuclear and mitochondrial fractions were prepared from renal tissue using nuclear protein isolation - translocation assay kit (fivephoton biochemicals, san diego, ca, usa) and allpure mammalian mitochondria isolation kit (allbio science inc ., whole - cell lysates were prepared using ripa lysis buffer (millipore, 20188) and protein concentration was detected using a bca protein assay kit (thermo scientific). A total of 150 g of cell lysates was mixed with anti - rip3 (2 g, genetex, usa) or magsi - protein a / g beads (50 l, magnamedics, netherlands) at 4c overnight . The beads were then collected using a magnet for 2 min, washed with pbst washing buffer three times, and subjected to elution with 40 l of 1x sds loading buffer; the samples were incubated at 95c for 10 min . Protein was separated using sds - page and transferred to 0.2 m pvdf membranes (bio - rad, usa). Blots were then probed with anti - rip1, anti - rip 3, anti - mlkl (genetex), monoclonal anti - aif (cell signaling), polyclonal anti - cox4 (genetex), polyclonal anti - pcna (genetex), monoclonal anti - parp1, monoclonal anti - par (cell signaling), anti - phospho - ampk (thr172), anti - ampk, anti - phospho - p70 s6 kinase (thr389), anti - p70 s6 kinase (cell signaling, usa), mitoprofile total oxphos rodent antibody cocktail (mitosciences, or), and mouse anti - gapdh (abcam, usa). Signals were obtained using an enhanced chemiluminescence kit (millipore) and densitometry was performed using fusion - capt software (vilber lourmat, fusion fx7, france). To determine the effects of statin on the cell viability of pancreatic cells, nit-1 cells were treated with various concentrations of as or ps for 48 h by using the wst-1 assay . After treatment with as (10 m and 20 m), the cell viabilities were determined to be approximately 52.3% and 41.0%, respectively, compared with the vehicle control . Moreover, after treatment with ps (10 m and 20 m), the cell viabilities were determined to be approximately 104.9% and 98.6%, respectively, compared with the vehicle control . Accordingly, treatment with as results in the dose - dependent inhibition of cell viability in nit-1 cells, but not treatment with ps (figure 1(a)). Similarly, the reduction of cell viabilities under the 10 m and 20 m as treatment could be associated with the decreased nit-1 cell insulin secretion and increased lactate dehydrogenase (ldh) activity release, which is a cytosolic marker . Although the 20 m ps treatment resulted in less insulin secretion in the nit-1 cells, it was insufficient to change the amount of ldh activity release (figures 1(b) and 1(c)). To further examine the inhibitory effects of as or ps on cell viability the treatment of nit-1 cells with as resulted in the significantly increased accumulation of cells in the sub - g1 phase (necrotic / apoptotic cells) in a dose - dependent manner, and the treatment with 20 m as resulted in significantly fewer cells in the g0/g1 phase (p <0.05). The ps treatment did not change cell cycle parameters (figure 2(a)). Significantly increased necrosis phase (pi annexin v) percentages were found in proportion to the as treatments (15.95% and 24.08% in the presence of 10 and 20 m as, resp ., p <0.05), and the apoptotic phase (pi annexin v, data not shown) percentages were not significantly different among the groups . In addition, no significant difference was identified in the necrosis phase and apoptotic phase among the groups during the experimental period with ps treatment, compared to the vehicle control (figure 2(b)). To further confirm whether the nit-1 cell death was caused by necrosis after as treatment the il-6 expression level was significantly increased in the as - treated groups 1.3- and 1.6-fold . However, no significant differences were found in the ps - treated groups compared with the vehicle control (figure 2(c)). In addition, the as treatment of nit-1 cells induced a dose - dependent increase of intracellular ros production (p <0.05), whereas ps treatment did not result in significant differences among the groups (figure 2(d)). The results indicate that as treatment can diminish nit-1 cell viability primarily by triggering necrosis and possibly increase production of ldh, il-6, and ros . Next, we examined the inhibitor cell death response in the nit-1 cells treated with as and ps . Nec-1, nsa, and zvad - fmk are typically used as necrosis and pan - caspase inhibitors in vitro, respectively [30, 31]. After 48 h, nsa and nec-1 treatment increased the numbers of viable nit-1 cells compared with the 20 m as - treated group (61% versus 58% versus 41%, p <0.05); zvad - fmk treatment exhibited no effect on nit-1 cell viability after the 20 m as treatment . In addition, nsa, nec-1, and zvad - fmk treatments showed no significant differences when compared to the 20 m ps - treated group (98% versus 101% versus 98%, figure 3(a)). By contrast, the necrosis induced by the as treatment specifically caused the formation of the rip1-rip3-mlkl complex . The interactions between mlkl and rip1 and rip3 were significantly eliminated by nsa and nec-1; thus, the rip1 and mlkl signals appeared significantly reduced, and the rip3 signal was significantly augmented in the presence of nsa and nec-1 . The ps treatment did not induce the formation of the rip1-rip3-mlkl complex (figure 3(b)). Here, we investigated the upstream signaling pathways controlling the as- and ps - mediated cell death . Parp1 activation has been suggested to be associated with the necrotic and parthanatos cell death progress [17, 19, 32, 33]. Dpq markedly reduced the statin - associated necrotic cell death in nit-1 cells and significantly increased nit-1 cell viability in the 20 m as - treated group (58% versus 41%, p <0.05, figure 3(a)). Confocal microscopy and subcellular fractionation revealed that as - treated or ps - treated cells did not induce apoptosis - inducing factor (aif) translocation from mitochondria into the nucleus (figures 3(c)3(e), figure s1a in supplementary material available online at http://dx.doi.org/10.1155/2016/1828071), suggesting that parp1 activation plays crucial roles in as - induced necrotic cell death, not via parthanatos . Several studies have demonstrated that parp1 exhibits a dual role in modulating autophagy and necrosis under oxidative stress and dna damage, whereas parp1 activation is associated with autophagy induction in as and ps treatment . Rapamycin (rapa) is an mtor inhibitor and has been reported to promote autophagy processing, whereas bafilomycin a1 (baf - a1) is an autophagy inhibitor . The nit-1 cell viability was significantly increased when the cells were treated with 20 m as with rapa, and the cell viability decreased mildly with baf - a1 pretreatment, compared with the 20 m as - treated group (56% versus 43% versus 45%, p <0.05). Similarly, the nit-1 cells with rapa pretreatment showed considerably increased cell viability compared with the 20 m ps - treated group (125% versus 97%, p <0.05, figure 4(a), figure s1b). Ldh activity release also was measured to determine the extent of nit-1 cell death after exposure to inhibitor agents such as dpq, baf - a1, and rapa . The treatment with dpq and rapa markedly reduced ldh release after the 20 m as treatment (1.3- versus 1.2- versus 1.5-fold, p <0.05), whereas the baf - a1 treatment mildly increased ldh compared to the 20 m as - treated group (figure 4(b), figure s1c). Similarly, the baf - a1 treatment enhanced the ldh release content considerably, and the dpq treatment only slightly reduced ldh activity release . Rapa treatment can attenuate baf - a1-associated increase in the ldh activity release of nit-1 cells after 20 m ps treatment (1.3- versus 1.4- versus 1.1-fold, p <0.05). These results showed that autophagy acts as a cell survival mechanism in as - induced necrotic cell death and that ps may be able to immediately induce autophagy to prevent nit-1 cell death under pharmaceutical stress . To evaluate whether parp1 expression plays a crucial role in autophagic induction, nit-1 cells were incubated in medium containing vehicle (control), statin, statin+dpq (parp1 inhibitor), statin+baf - a1 (negative autophagy), and statin+rapa (positive autophagy) for 48 h. the cells were then stained with cyto - id green dye autophagy detection kit . Both as - treated groups showed significantly stimulated further microtubule - associated protein 1a/1b - light chain 3- (lc3-) ii accumulation, as autophagosome formation in nit-1 cells compared with the vehicle control . As+baf - a1-treated group showed significantly reduced lc3-ii expression compared with as - treated group . No significant difference was found in the number of lc3-ii between control and ps - treated or ps+baf - a1-treated nit-1 cells . Both dpq- and rapa - treated nit-1 cells showed significantly bright green fluorescence compared with only as - treated cells but only showed light green fluorescence when compared with ps - treated cells, respectively (figures 5(a)5(c), figure s2a). These findings indicated that as - treated cells significantly induced the autophagic activity; both dpq- and rapa - treated cells further enhanced the as - treated increase of autophagy flux in nit-1 cells . Parp1 is known as an energetically expensive process that leads to cellular atp depletion and contributes to necrotic cell death . Thus, atp depletion was determined in as - treated and ps - treated nit-1 cells, and the results showed that the cellular atp levels of as - treated, as+baf - a1-treated, as+dpq - treated, and as+rapa - treated nit-1 cells were significantly reduced compared with the untreated control (p <0.05). However, dpq- and rapa - treated cells showed significantly increased as - stimulated cellular atp consumption, decreasing 0.86- and 0.66-fold (p <0.05, figure 5(d), figure s2b). In addition, the rapa - treated cells similarly exhibited significantly increased ps - stimulated cellular atp consumption, but no significant difference was found in the cellular atp levels among the ps - treated groups . The results clearly indicated that as - induced parp1 activation, mtor suppression, and autophagy induction are mediated by inhibited parp1 activation and enhance cellular atp depletion . After demonstrating the prosurvival role of autophagy and the role of parp1 activation in as - induced necrotic cell death, we investigated whether the signaling pathway of parp1-ampk - mtor autophagy controls as- and ps - mediated cell survival . Treatment with as+dpq markedly blocked as - enhanced parp1 cleavage and par expression, with a simultaneous decrease in the p - ampk level and increase in p - p70s6k level (p <0.05, figure 6(a), figure s3a). As+baf - a1 was expected to inhibit parp1 cleavage and par formation; it reduced the p - ampk level, restored p - p70s6k activation, and blocked autophagy induction . Moreover, cells that were treated with rapa markedly enhanced as - induced parp1 cleavage and par and ampk activation and eliminated the phosphorylation of p70s6k to induce autophagy . Similar effects were also found in the nit-1 cells with ps+dpq, ps+baf - a1, and ps+rapa (p <0.05, figure 6(b)). The results show that parp1 exhibits dual roles in changing the outcome of nit-1 cells in response to as . Parp1 activation is the cause of necrotic cell death through atp depletion, and parp1 activation can elicit a self - protective mechanism through the induction of autophagy via the ampk - mtor signaling pathway; however, necrotic cell death still eventually occurs . Parp1-ampk activation is an important prosurvival mechanism in ps - treated cells through the suppression of mtor and activation of autophagy . We examined the mitochondrial status of the as- and ps - treated cells conjugated with mitotracker red; the accumulation of the cells is dependent on the membrane potential, and the cells are fusible into actively respiring cells . The as- and ps - treated cells showed reduced red fluorescence intensity with fewer mitochondria; for the as - treated cells, the reduction was approximately 0.5-fold relative to the control, and they contained round, discrete mitochondria and widely diffused weak cytoplasmic fluorescence (figure 7, figure s3b). Similar effects were also found in nit-1 cells treated with as+baf - a1 and ps+baf - a1 . Dpq and rapa pretreatment to some extent protected against as- and ps - induced leakage of mitotracker staining and substantially enhanced the mitochondrial morphology and staining intensity in nit-1 cells . These results indicated that as treatment reduced mitotracker staining, thereby reducing mitochondrial activity; this explains the close association between parp1 activation and mtor suppression . The detailed mechanisms of the increased risk for developing diabetes during statin therapy remain unclear . We used the mouse nit-1 insulinoma cell line as a pancreatic -cell model, which is an effective tool for analyzing -cell function and apoptosis [35, 36]. To examine whether statins mediate the outcome of nit-1 cells, we used chemical inhibitor reagents to inhibit the expression of the target gene in nit-1 cells . Our study results showed that atorvastatin treatment markedly reduced cell viability compared to untreated nit-1 cells through increasing parp1 activation and subsequently inducing necrosis and autophagy induction . This finding confirms previous findings that atorvastatin induced autophagic activity in vivo and in vitro [3740]. In 2012, lim et al . Demonstrated that pravastatin can improve renal function in csa - induced autophagic cell death through reducing lc3-ii and p62 expression ., we find that pravastatin treatment may increase parp1 activation and immediately elicit a basal self - protective autophagy mechanism in conservative nit-1 cells under pharmaceutical stress . In contrast, other studies showed that pravastatin did not result in induced autophagy activation in ovarian cancer cell, smooth muscle cell, and human rhabdomyosarcoma cell [4244]. The reason for the differences observed is that the role of pravastatin in autophagy activation and function are cell type - specific . In this study, parp1 exhibited dual roles in regulating the cell outcome in response to as or ps treatment . The findings provide a reasonable basis for the future improvement of statin - based cardiovascular disease therapies . Apoptosis has been considered to be the predominant mechanism induced by free fatty acids, cytokines, and glucose in nit-1 cells [36, 45, 46]. In addition, several studies have shown that as and ps could trigger different cells to mediate apoptosis in vitro and regulate cell growth in vivo [4750]. We found that cell death was not inhibited by the pan - caspase inhibitor zvad - fmk in nit-1 cells treated with as . The lack of apoptosis was further indicated by the absence of the apoptotic phase (annexin v / pi). Given that as killed 50%60% of nit-1 cells, these observations suggest that the effect of as - induced nit-1 cell death may not depend on apoptosis . According to the aforementioned studies, more than 50% of bladder cancer cells, t24, died 2 - 3 days after as treatment (30 m) via activated caspase 3 and cleaved parp . In another study, increased annexin v - positive cells and accumulated sub - g1 cell fractions were observed on day 3 after as treatment with an increased dose (100 m), whereas as treatment at 10 m showed a protective trend against apoptosis . Thus, mechanisms other than apoptosis might exist in as - mediated cell death, such as necrosis . In recent years, the crosstalk among autophagy, apoptosis, and necrosis has been intensively studied . Most studies showed that autophagy is cytoprotective in cells under stress and inhibits apoptosis and necrosis [21, 5356]. Moreover, necrosis is found to be typically accompanied by autophagy, but how autophagy counteracts necrosis and why autophagy cannot protect against as - induced cell death remain unclear . We found that as induces autophagy and necrotic cell death mediated by the activation of parp1 and ros . A major finding in the present study is the crucial role of ampk in as- and ps - induced autophagy and cell death, as well as the downstream of parp1 activation . Ampk is a highly conserved cellular energy sensor, and it is activated under stress conditions such as heat shock, hypoxia, ischemia, and glucose starvation [39, 57, 58]. Some evidence suggests that autophagy induction is regulated through ampk - dependent phosphorylation, which leads to the inactivation of mtor for homeostatic mitochondria and promotes cell survival [40, 59, 60]. Consistent with these findings, our results revealed that the activation of ampk leads to the suppression of mtor and induction of autophagy in nit-1 cells exposed to as and ps . Moreover, this study clearly suggested that autophagy is a cell survival mechanism in as- and ps - mediated cell death, based on the suppression of autophagy caused by baf - a1 . By contrast, the activation of autophagy caused by rapamycin protected the as- and ps - mediated cell death . Therefore, our findings suggest that targeting autophagy or parp1-ampk - mtor pathways should be considered in the development of effective statin therapies for diabetes . In conclusion, based on a literature review, this study was the first to demonstrate a novel function of parp1 in the regulation of as- and ps - induced autophagy via the parp1-ampk - mtor signaling pathway and that such autophagy serves as a cell survival mechanism against as - mediated necrosis, although it is insufficient to prevent necrosis - induced cell death (figure 8). These findings contribute to the understanding of the complex relationship among statin - related diabetes, autophagy, and cell death.
|
Only 30 - 60 per cent of patients respond properly to treatment with antidepressants, beta - blockers, statins and antipsychotic agents . Approximately two days of prolonged hospital visits are caused by adverse drug reactions (adrs), and, in the usa, about 100,000 deaths are estimated to be due to adrs every year . These data emphasise an important problem that can be mostly explained by variable pharmacokinetics due, to a large extent, to differences in the activity of cytochrome p450 (cyp) enzymes involved in the metabolism of the drugs . Variable metabolism, in turn, can be caused by variation in the cyp genes, as is the focus of the current review . There are 57 active cyp genes in the human genome, which are divided into 18 families . The first three families (cyp1 - 3) are generally involved in the metabolism of exogenous substances such as drugs, whereas cyp families with higher numbers are usually involved in the metabolism of endogenous substances . Cyp enzymes are responsible for 75 - 80 per cent of all phase i - dependent metabolism and for 65 - 70 per cent of the clearance of clinically used drugs . Variation in cyp genes results in phenotypes classically defined as ultrarapid, extensive, intermediate and poor metabolisers . An ultrarapid metaboliser (um) generally carries duplicated or multi - duplicated gene copies of the same allele, whereas intermediate (i m) and poor metabolisers (pm) characteristically carry one and two defective alleles (eg gene inactivation or deletion), respectively . The term extensive metaboliser (em) is normally used for subjects carrying two alleles giving normal activity of the cyp enzyme (also called the * 1 or consensus allele). The metaboliser phenotypes are mainly used for describing drug metabolism, but genetic variation in cyps with endogenous functions, such as in sterol, steroid, bile acid and fatty acid homeostasis, have also been well characterised, some of which give rise to disease states . Cyp3a4 accounts for about 50 per cent of all cyp - dependent drug metabolism, although individuals' capacity for cyp3a4-mediated drug metabolism is highly variable . No common genetic variants can account for this variation, despite the fact that 20 different alleles have been described . By contrast, cyp2c19 and cyp2d6 are highly polymorphic and together account for about 40 per cent of the metabolism of clinically used drugs . In addition, cyp1a2, cyp2a6 and cyp2b6 are polymorphic enzymes that significantly contribute to xenobiotic metabolism . The characterised genetic polymorphism of these enzymes provides a basis for the possibility to adjust drug dosage and choice of drug therapy according to genotype,[4 - 8] which includes avoidance of adrs, since polymorphic cyps are frequently the cause of these, either due to the formation of high levels of metabolites or because of decreased metabolism of the parent drug . Important work in the cyp area focused on the identification and characterisation of polymorphic human cyp genes, which, in turn, created the need for a unified nomenclature system . Thus, in 1999, a nomenclature committee was formed with the aim of creating a platform for present and future allele nomenclature . Thus, the human cytochrome p450 allele nomenclature (cyp - allele) website (http://www.cypalleles.ki.se/) was launched with the purpose of managing allele designations, facilitating rapid online publication and providing a summary of alleles and their associated effects . The nomenclature system chosen for the cyp - allele website was based on recognised nomenclature guidelines [9 - 13]. Currently, the website covers the nomenclature for polymorphic alleles of 29 cyp enzymes and nadph cytochrome p450 oxidoreductase (por) (see table 1). The cyp2b6, cyp2c9, cyp2c19 and cyp2d6 genes are particularly polymorphic, all with a high number of functionally different alleles . Each of the genes at the cyp - allele website has its own webpage that lists the various alleles with their nucleotide changes, molecular and functional consequences in vitro as well as in vivo, and also publications identifying or characterising the alleles . In addition, links to the national center for biotechnology information (ncbi) single nucleotide polymorphism database (dbsnp) and papers with allele frequencies are presented . The number of visits is relatively constant over time, about 36,000 per year, and the website is highly cited in publications in the field of pharmacogenomics . Polymorphic genes covered on the cyp - allele website examples of some important variant alleles are given, as well as representative substrates the designation of an allele (such as cyp2b6 * 4) ideally requires determination of all sequence variations in the gene, although sequencing the intronic regions is generally not necessary . On the website, a gene is considered as the sequence from 5 kilobases upstream from the transcription start site to 500 base pairs downstream of the last exon . If a regulatory element has been characterised at a more distant part of the gene, however, it too is considered to belong to the gene . All known sequence variations within an allele are described on the cyp - allele website, although new allele numbers are currently only designated for alleles that contain at least one functional variation causing consequences such as amino acid substitutions, translation terminations, splice defects, differential transcription rates etc . Nevertheless, the allele is required to be well characterised regarding linkage or lack of linkage of the consequential snp with other nucleotide variations, including those in exons, intron - exon junctions and flanking regions . Inferring haplotypes by program analyses is generally avoided, although such alleles have occasionally been included on the cyp - allele website . When the characterised sequence variant is found in different constellations with non - causative (eg silent) ones, the different combinations are defined as sub - alleles and receive letters in addition to the number (eg cyp2b6 * 4a, cyp2b6 * 4b). When several effective polymorphisms are present on the same allele, however, the allelic number given is based on the polymorphism that causes the most severe consequence, such as a splice defect (eg cyp2c19 * 2a), so alleles that additionally contain sequence variants with less severe effects will share the same allele number, together with an additional letter (eg cyp2c19 * 2b). Combinations of variants that are also present alone and that are considered similarly effective (eg different amino acid substitutions) are given unique allele numbers (eg cyp2b6 * 6). Notably, the earliest described alleles on the website do not follow the nomenclature system, but the allelic designations have remained, for practical reasons . When new alleles are identified, relevant information is sent to the webmaster . Inclusion criteria (http://www.cypalleles.ki.se/criteria.htm) involve complete characterisation of the gene sequence, covering exons and exon - intron junctions at the minimum, investigation of linkage with other sequence variants and potential in vitro or in vivo findings . It is advised that the authors of a manuscript that describes a novel allele contact the webmaster before submission, in order to review the data and assign a new allele name to be used in the manuscript . Usage of star allele designations that have not been approved by the nomenclature committee is strongly discouraged, because of the apparent risk of confusion and of using the same allele name for different variants . All information sent to the webmaster is kept strictly confidential until publication of the manuscript or until the authors request it to be released . Thus, there are likely to be allele names designated by the cyp - allele website that have not yet been published, further emphasising the importance of refraining from using unauthorised allele names . The webmaster (and in rare cases also the editorial and/or advisory board) reviews the submission to evaluate whether there are enough data to support a new allele designation . Only peer - reviewed data are thus published on the cyp - allele website . Papers describing additional characterisation of a known allele--with respect to, for example, in vitro or in vivo activity--are also peer reviewed and can be linked to the respective allele on the webpage . Suggestions of papers that should be included with respect to further characterisation of alleles are appreciated . Important work in the cyp area focused on the identification and characterisation of polymorphic human cyp genes, which, in turn, created the need for a unified nomenclature system . Thus, in 1999, a nomenclature committee was formed with the aim of creating a platform for present and future allele nomenclature . Thus, the human cytochrome p450 allele nomenclature (cyp - allele) website (http://www.cypalleles.ki.se/) was launched with the purpose of managing allele designations, facilitating rapid online publication and providing a summary of alleles and their associated effects . The nomenclature system chosen for the cyp - allele website was based on recognised nomenclature guidelines [9 - 13]. Currently, the website covers the nomenclature for polymorphic alleles of 29 cyp enzymes and nadph cytochrome p450 oxidoreductase (por) (see table 1). The cyp2b6, cyp2c9, cyp2c19 and cyp2d6 genes are particularly polymorphic, all with a high number of functionally different alleles . Each of the genes at the cyp - allele website has its own webpage that lists the various alleles with their nucleotide changes, molecular and functional consequences in vitro as well as in vivo, and also publications identifying or characterising the alleles . In addition, links to the national center for biotechnology information (ncbi) single nucleotide polymorphism database (dbsnp) and papers with allele frequencies are presented . The number of visits is relatively constant over time, about 36,000 per year, and the website is highly cited in publications in the field of pharmacogenomics . Polymorphic genes covered on the cyp - allele website examples of some important variant alleles are given, as well as representative substrates the designation of an allele (such as cyp2b6 * 4) ideally requires determination of all sequence variations in the gene, although sequencing the intronic regions is generally not necessary . On the website, a gene is considered as the sequence from 5 kilobases upstream from the transcription start site to 500 base pairs downstream of the last exon . If a regulatory element has been characterised at a more distant part of the gene, however, it too is considered to belong to the gene . All known sequence variations within an allele are described on the cyp - allele website, although new allele numbers are currently only designated for alleles that contain at least one functional variation causing consequences such as amino acid substitutions, translation terminations, splice defects, differential transcription rates etc . Nevertheless, the allele is required to be well characterised regarding linkage or lack of linkage of the consequential snp with other nucleotide variations, including those in exons, intron - exon junctions and flanking regions . Inferring haplotypes by program analyses is generally avoided, although such alleles have occasionally been included on the cyp - allele website . When the characterised sequence variant is found in different constellations with non - causative (eg silent) ones, the different combinations are defined as sub - alleles and receive letters in addition to the number (eg cyp2b6 * 4a, cyp2b6 * 4b). When several effective polymorphisms are present on the same allele, however, the allelic number given is based on the polymorphism that causes the most severe consequence, such as a splice defect (eg cyp2c19 * 2a), so alleles that additionally contain sequence variants with less severe effects will share the same allele number, together with an additional letter (eg cyp2c19 * 2b). Combinations of variants that are also present alone and that are considered similarly effective (eg different amino acid substitutions) are given unique allele numbers (eg cyp2b6 * 6). Notably, the earliest described alleles on the website do not follow the nomenclature system, but the allelic designations have remained, for practical reasons . Inclusion criteria (http://www.cypalleles.ki.se/criteria.htm) involve complete characterisation of the gene sequence, covering exons and exon - intron junctions at the minimum, investigation of linkage with other sequence variants and potential in vitro or in vivo findings . It is advised that the authors of a manuscript that describes a novel allele contact the webmaster before submission, in order to review the data and assign a new allele name to be used in the manuscript . Usage of star allele designations that have not been approved by the nomenclature committee is strongly discouraged, because of the apparent risk of confusion and of using the same allele name for different variants . All information sent to the webmaster is kept strictly confidential until publication of the manuscript or until the authors request it to be released . Thus, there are likely to be allele names designated by the cyp - allele website that have not yet been published, further emphasising the importance of refraining from using unauthorised allele names . The webmaster (and in rare cases also the editorial and/or advisory board) reviews the submission to evaluate whether there are enough data to support a new allele designation . Papers describing additional characterisation of a known allele--with respect to, for example, in vitro or in vivo activity--are also peer reviewed and can be linked to the respective allele on the webpage . Suggestions of papers that should be included with respect to further characterisation of alleles are appreciated . The cyp - allele website is widely used and well acknowledged within the scientific community . It serves the purpose of a unified and easily accessible nomenclature system for cyp enzymes, as well as for the cyp electron donor por . The purpose of the cyp - allele website is to facilitate rapid online publication as well as providing a summary of the characteristics of specific alleles.
|
The use of heat for both therapeutic and preventive purposes dates back to 124 bc with the introduction by asclepiads, a greek physician . Temperature is sensed in blood vessels through the trp receptors and transient receptor potential channels, or trp channels, are responsible for managing the body s response to various stimuli, such as change in temperature [26]. One type of trp channel is the trpv channel, in which the v stands for vanilloid [610]. All trpv14 channels are non - selective cation channels, moderately permeable to calcium, and are temperature sensitive [6,1015]. Trpv1 was first isolated and named in 1997 as a capsaicin receptor [1618]. Trpv1 is a heat sensor, and is activated by heat, specifically temperatures> 42c [16,1820]. While trpv4 can be activated by warmth, it can also be activated by hypo - osmolarity [18,2123]. When skin is exposed to a temperature above 42c, there is an immediate increase in circulation, controlled by sensory nerves in the skin [2426]. This is mediated by trpv1 calcium channels increasing calcium permeability, which then causes neuropeptides to be released, resulting in vasodilatation from the relaxation of smooth muscle [2729]. This vasodilatation occurs to protect the skin in the event of a rapid change in temperature that may damage the skin [3032]. Prolonged vasodilatation with exposure to heat occurs due to the influx of calcium and activation of nitric oxide synthetase mediated by trpv4 channels on vascular endothelial cells [2426]. The blood flow response to heat is impaired with ageing and diabetes [3335]. While this is well documented, much less is known about the blood flow response to free radicals . When the free radical concentration reaches a critical level, rather than increasing blood flow, they biodegrade nitric oxide and prostacyclin, a second vasodilator released from vascular endothelial cells, into inactive forms [3638]. In the presence of free radicals such as hydrogen peroxide, nitric oxide is reduced to peroxynitrite (onoo), a free radical with no influence on circulation . Bioconversion of nitric oxide to peroxynitrite is believed to be one of the mechanisms associated with the reduction in circulation at rest and during stress in older people and people with diabetes and leads to endothelial dysfunction . In a recent study, if bmi itself limits the blood flow response to stress such as heat due to high free radicals in the body, and most people with diabetes have a high bmi, some of the damage from diabetes to circulation may be due to the bmi and not diabetes itself . The purpose of the present investigation was to test the hypothesis that high bmi in itself in addition to age are the main elements causing reduced blood flow in people with diabetes . Young and old subjects with low and high bmi were examined and their response to heat was measured . These data were used to establish a multifactor regression equation to predict what blood flow should be in people with diabetes based on their age and bmi . By comparing this to the actual blood flow response to heat, the reduction in blood flow due to diabetes alone could be calculated vs. bmi and age . Ten young people age 1834 with bmi less than 20 and ten young people with bmi> 20, two groups of ten older subjects aged 3575 with low and high bmi and 20 subjects with diabetes with high bmi were investigated . No subjects were smokers and all except the subjects with diabetes were not taking cardiovascular medications and were free of cardiovascular and neurological impairments . The subjects with diabetes were free of heart disease and renal disease and were not taking beta or alpha agonists and antagonists . The initial study design was to have a group of low bmi people with diabetes, but, we could not find a matched low bmi group to the older and younger low bmi groups . The bmi was not significantly different in the low younger and low older groups and high bmi young and old groups . But the high bmi groups had significantly higher bmi than the low bmi groups (p<0.01). Skin temperature was measured with a thermistor (skt rx 202a) manufactured by biopac systems (biopac inc ., the thermistor output was sensed by an skt 100 thermistor amplifier (biopac inc ., the output, which was a voltage between 0 and 10 volts, was then sampled with an analog to digital converter at a frequency of a 1,000 samples per second with a resolution of 24 bits with a biopac mp150 analog to digital converter . The converted data was then stored on a desk top computer using acknowledge 4.1 software for future analysis . The temperature was calibrated at the beginning of each day by placing the thermistors used in the study in a controlled temperature water bath which will be calibrated against a standard thermometer . Skin blood flow was measured with a moor laser doppler flow meter (vms ldf20, oxford england). The imager uses a red laser beam (632.8 nm) to measure skin blood flow using the doppler effect . After warming the laser for 15 to 30 minutes prior to use, the laser was applied to the skin through a fiber optic probe placed above the knee on the quadriceps (figure 1). The moor laser doppler flow meter measures blood flow through most of the dermal layer of the skin but does penetrate the entire dermal layer . Blood flow is then calculated in a unit called flux based on the red cell concentration in red cell velocity with a stated accuracy of 10% . Skin temperature was controlled by a moor temperature controller (sh02) with an sho2-shp1 skin temperature module which integrated with the blood flow fiber optic probe also shown in figure 1 . This is a closed loop electric warmer (thermode) where temperature is controlled to 0.1c . The response of the skin to heat was measured by applying the heated probe to the skin for 6 minutes . Those subjects that were eligible were placed into the study and read and signed a statement of informed consent . After this period of time, the thermode was applied upon the leg above the belly of the quadriceps muscle to warm the skin to 44c . Skin temperature was measured with a thermistor (skt rx 202a) manufactured by biopac systems (biopac inc ., the thermistor output was sensed by an skt 100 thermistor amplifier (biopac inc ., the output, which was a voltage between 0 and 10 volts, was then sampled with an analog to digital converter at a frequency of a 1,000 samples per second with a resolution of 24 bits with a biopac mp150 analog to digital converter . The converted data was then stored on a desk top computer using acknowledge 4.1 software for future analysis . The temperature was calibrated at the beginning of each day by placing the thermistors used in the study in a controlled temperature water bath which will be calibrated against a standard thermometer . Skin blood flow was measured with a moor laser doppler flow meter (vms ldf20, oxford england). The imager uses a red laser beam (632.8 nm) to measure skin blood flow using the doppler effect . After warming the laser for 15 to 30 minutes prior to use, the laser was applied to the skin through a fiber optic probe placed above the knee on the quadriceps (figure 1). The moor laser doppler flow meter measures blood flow through most of the dermal layer of the skin but does penetrate the entire dermal layer . Blood flow is then calculated in a unit called flux based on the red cell concentration in red cell velocity with a stated accuracy of 10% . Skin temperature was controlled by a moor temperature controller (sh02) with an sho2-shp1 skin temperature module which integrated with the blood flow fiber optic probe also shown in figure 1 . This is a closed loop electric warmer (thermode) where temperature is controlled to 0.1c . The response of the skin to heat was measured by applying the heated probe to the skin for 6 minutes . Subjects were interviewed for inclusion and exclusion criteria . Those subjects that were eligible were placed into the study and read and signed a statement of informed consent . After this period of time, the thermode was applied upon the leg above the belly of the quadriceps muscle to warm the skin to 44c . The results for the young subjects with low and high bmi are shown in figure 1 . As shown for the entire young group, blood flow increased slowly at first and then exponentially during the 6 minute heat exposure . However, the blood flow after 1 minute 15 seconds and until the end of the experiment was greater in the low bmi group than the high bmi group (anova p<0.05). From 1 minute 30 seconds to 3 minutes, the slope of the increase in blood flow per minute was the same in both groups of subjects but the magnitude of the increase was less in the low bmi young group (slope difference was p>0.05). As an index of the blood flow increase during heat exposure, the total increase in blood flow above the resting blood flow in the last 5 minutes of heat exposure was calculated in this and all groups of subjects . For the younger group, the correlation between bmi and blood flow during the last 5 minutes of heat exposure was 0.64, a significant correlation (p<0.01) showing that blood flow was reduced as a function of bmi . The high bmi older group had a significant impairment in the blood flow response to heat after the first minute that heat was applied . Resting blood flow was not different in the low and high bmi groups (p>0.05). However, after heat was applied, there was a large difference between these groups . As was seen with the younger group, in the older group, there was a significant negative correlation between bmi and blood flow during the last 5 minutes of heat exposure . The blood flow during heat exposure was significantly higher in the high bmi younger group than the high bmi older group (p<0.05). Young and old high bmi groups were also significantly different from each other (p<0.05) but the younger group had greater blood flows during heat than that seen in the older group (p<0.05). Thus both ageing and bmi contributed to a lower blood flow response in the last 5 minutes of heat stress . This relationship is shown in the scatter diagram in figure 3 . It is a scatter diagram showing all data on the young and old subjects pooled together . The regression equation in the figure shows that bmi had a more significant effect on reducing the blood flow response to heat than did ageing . The multiple correlation coefficients for age and bmi and blood flow showed the correlation with age was 0.397 and for bmi was 0.70 . The r therefore showed that about 16% of the loss in circulation was due to age and 49% due to high bmi . These correlations were both significant (p<0.01). Using the regression equation, blood flow in the last 5 minutes of heat exposure was measured in the 10 subjects as an average of 178.4 flux in the young low bmi group as would be predicted by the regression equation in figure 3 to be 164.1 flux . For the young high bmi group, the actual blood flow measured on the 10 subjects was an average of 94.1 flux and was predicted by the regression equation to be 96.0 flux . For the older low bmi group the actual blood flow measured on the 10 subjects averaged 115.2 flux and was predicted by the regression equation to be 116.1 flux in the last 5 minutes after heat exposure . For the old high bmi group, the actual blood flow for the 10 subjects was an average of was 49.3 flux and was predicted by the regression equation to be 49.2 flux . Thus the regression equation was highly predicative of the results seen in these experiments . For the subjects with diabetes, we could not find low bmi subjects with diabetes and therefore only a high bmi group is shown . As can be seen here, diabetes in itself reduced blood flow even further (figure 4) for subjects at the same bmi and age as in figure 2 . However, when using the subject s age and bmi, the equation in figure 3 predicts the blood flow in the last 5 minutes should be 47.3 flux whereas the actual blood flow in the last 5 minutes averaged, for the 10 subjects in this group, 37.1 flux . The difference is small and supports the idea that only about 20% of the lower blood flow response to heat is due to diabetes itself . The majority of the lower blood flow response to heat is due to high bmi and ageing . Recent studies have shown that a westernized diet in asians reduces the skin blood flow in response to heat stress and occlusion due to high concentration of free radicals in blood from the type of fat in the diet . It is also well established that high concentrations of blood born free radicals are found in people with high bmi s . As people age and especially in people with diabetes, bmi is elevated . And yet, no study has examined the interrelationship between bmi and blood flow in response to stressors such as heat . Since free radicals are high in older people and people who have diabetes, it might be anticipated that diabetes and ageing would have some impact through these free radicals in the blood thereby reducing endothelial function . Thus the purpose of the present research study was to examine how much reduction in endothelial function was there in people with diabetes: 1) that was due to ageing and, 2) how much was due to bmi and, 3) how much is due to diabetes itself . Even young subjects had a reduced blood flow response to heat stress if they had a high bmi . In subjects who had diabetes, we were not able to find a low bmi group . However, for this group of subjects, the differential effects of age and diabetes could be deduced by examining the age matched controls . When the contributions of age and bmi are eliminated from the blood flow response to heat stress, bmi, and diabetes are not equal contributors to impaired endothelial function . By and large, bmi appears to be the major contributor to endothelial dysfunction, ageing contributes a small amount, and the remainder appears to be due to diabetes and poor glycemic control . Suggested ways to reduce this endothelial damage is a lifestyle change with an increase in exercise and a reduction of body weight . Exercise has been shown to increase free radicals during the actual exercise but, with training, appears to optimize the immune response, thereby, producing an overall reduction in body inflammation . This has been shown to increase blood flow to tissue in even a young population . However, this is especially true and significant with high fat diets in populations such as asians who have a poor tolerance for high fat foods and thus produce free radicals after even a single high fat meal . When asians took antioxidants there was an increase in their blood flow in response to heat stress and occlusion in spite of the high fat meal . Also, even a simple change in diet, for example, drinking green tea or taking green tea extract has been shown to reduce cellular inflammation by blocking the activation of nfkb, the nuclear sub transmitter that activates inflammation in cells . In addition, there are also many other sources of free radical scavengers in the diet . However, it should be stated that free radicals are also used for cellular communication, including in muscle during exercise . Red blood cells release nitric oxide (a fee radical) to increase the diameter of arteries if they encounter high shear stresses . Endothelial cells release nitric oxide in response to heat and other stressors to increase circulation . The mitochondria in muscle release nitric oxide to increase energy delivery to the cell through increased blood flow if the mitochondria are active . Therefore, an overdose of anti - oxidants such as vitamins a, c and e can impair exercise performance . Thus the dosage of antioxidants must be given in response to the excess free radicals found in the body . For even young people with a high bmi, one dose is needed in the diet or with supplements of antioxidants while for people with diabetes and those who have high bmi and who are older, a much greater dosage should be considered for every day . This would explain various studies showing no effect of antioxidants in younger people who are thin but increased endothelial function in younger people with a high bmi . Endothelial function in older people also seems to improve with antioxidant dosage, again supporting this hypothesis that it is free radicals that reduce endothelial function . Further research needs to be conducted on the dosage vs. diabetes and age of various antioxidants including vitamin d, an emerging modulator of the immune mechanisms . Current government recommended dosages of vitamins do not take into consideration age, race, or diabetes ., asians produce abnormally high free radicals in their blood in response to high fat foods . It would appear that with a westernized diet, this group would need even higher antioxidants in their diets . Therefore, further research is needed to enhance these significant preliminary findings and elaborate on the issues of accurate and appropriate anti - oxidant supplementation for different races, age categories and even chronic disease states (diabetes, cvd) so appropriate lifestyle adjustments can be recommended . Thus the blood flow response to stressors such as heat or occlusion is reduced with ageing and diabetes as well as blood flow to other organs . The present investigation shows that the majority of this impairment is due to body fat and not ageing and diabetes itself . The damage we associate with ageing is probably largely due to high concentrations of free radicals damaging the endothelial cells due to obesity . Thus even young people with a high bmi show significant damage to vascular endothelial function.
|
Pneumoperitoneum, the presence of free air within the peritoneal cavity outside of the viscera, results from perforation of intra - abdominal organs in 90% of cases . Approximately 515% of pneumoperitoneum cases are not due to intra - abdominal organ perforation but are the result of thoracic, gynecologic or other intra - abdominal pathologies . Thoracic injuries leading to pneumomediastinum have several etiologies, arising predominantly from mechanical ventilation - induced barotrauma, but it can also occur after cardiopulmonary resuscitation, pneumothorax, tracheal rupture, median sternotomy and blast injury . The flow of air from the thoracic cavity to the abdomen is a result of pressure differences, and intrathoracic pressures of 60 cm h2o or greater will result in subcutaneous emphysema and pneumoperitoneum from progression of air flow [3, 4]. Of 233 patients, 32 were positive for free air on radiograph; of which, 25 had a gastric perforation managed surgically . Another seven patients were without a hollow viscus intra - abdominal injury, though all had pneumothorax in common and the majority had other intra - abdominal injuries . An 82-year - old male with past medical history of diabetes mellitus and alcohol abuse arrived by ambulance after being found unresponsive at the bottom of a flight of stairs with a scalp laceration . While en route to the hospital, two unsuccessful intubation attempts were made for a glasgow coma scale (gcs) of 8 . Upon arrival in the emergency department (ed), his gcs was determined to be 3 and was intubated with use of the glidescope . Physical examination revealed decreased breath sounds on the left and crepitus over the left chest wall, suggestive of subcutaneous emphysema, and an immediate tube thoracostomy was performed prior to chest x - ray (cxr) to reduce the suspected pneumothorax . Cxr post chest tube placement demonstrated large amounts of subcutaneous emphysema (fig . 1), which was also visible on computed tomography (ct) scan along with evidence of pneumomediastinum and pneumoperitoneum (fig . 2), with pneumoretroperitoneum and pneumoperitoneum present on abdominal ct scan (fig . 3). As a result of the fall, he also sustained a fracture of the right frontal bone, fractures of the c2 and c3 vertebrae, and mild subarachnoid and subdural hemorrhage without shift . He was admitted to the surgical intensive care unit (sicu) and maintained on mechanical ventilation, remaining hypotensive, hypothermic and mildly tachypneic, becoming increasingly unstable over the next 8 h. due to the known pneumomediastinum, pneumoperitoneum and worsening instability, he was taken to the operating room for suspected viscus perforation and peritonitis . An exploratory laparotomy was performed, which revealed air within the lesser sac, but no evidence of bleeding or perforation . When closing the operative site, crepitus was also noted over the right chest wall, and a chest tube was placed into the right pleural space . Figure 1:cxr performed after thoracostomy and chest tube placement displaying areas of subcutaneous emphysema (white arrows). Figure 2:chest ct scan obtained shortly after patient's arrival displaying evidence of subcutaneous emphysema (white arrow), pneumomediastinum (black arrow) and air tracking down resulting in pneumoperitoneum (gray arrow). Figure 3:sagittal view from ct abdomen / pelvis with contrast (a) showing areas of free air in mediastinum and thoracic cavity spreading downward into peritoneum (white arrows). Pockets are visible around the aorta, pancreas and liver (white arrows), as well as the presence of subcutaneous emphysema . Cxr performed after thoracostomy and chest tube placement displaying areas of subcutaneous emphysema (white arrows). Chest ct scan obtained shortly after patient's arrival displaying evidence of subcutaneous emphysema (white arrow), pneumomediastinum (black arrow) and air tracking down resulting in pneumoperitoneum (gray arrow). Sagittal view from ct abdomen / pelvis with contrast (a) showing areas of free air in mediastinum and thoracic cavity spreading downward into peritoneum (white arrows). Pockets are visible around the aorta, pancreas and liver (white arrows), as well as the presence of subcutaneous emphysema . Postoperatively, the patient was rapidly weaned from all vasopressor agents, though he required persistent mechanical ventilation . He developed several complications including acute respiratory distress syndrome, pneumonia and acute renal failure with ongoing hyponatremia . After 22 days in the sicu, the patient's family elected to pursue inpatient hospice care as the patient remained on mechanical ventilation and was generally non - responsive . In our case, a fall caused a rib fracture that resulted in a lung laceration, leading to a pneumothorax . The macklin effect occurs when traumatic rupture of alveoli causes free air to travel along bronchovascular sheaths . However, in the setting of pneumothorax and pneumomediastinum, the intrathoracic pressure may be higher than intra - abdominal pressure . This pressure reversal forces free air from the thoracic cavity into the intra - abdominal cavity, resulting in pneumoperitoneum . Two other reports describe pneumothorax progressing to pneumomediastinum and pneumoperitoneum after a fall [5, 6], whereas the majority of other reported cases were due to higher - energy traumas than our patient's fall [5, 7, 8]. Our patient had a tube thoracostomy performed on arrival in the ed, which should have released any accumulated intrathoracic pressure prior to developing pneumomediastinum and pneumoperitoneum . Other reported cases have theorized that delayed placement of the chest tube was responsible for the pneumoperitoneum, making this case unique in that regard . Diagnosis of pneumoperitoneum is often only possible with imaging, initially on plain radiographs or by ct scans . Some have advanced the idea of nonsurgical treatment of spontaneous pneumoperitoneum in the absence of a pathological condition that necessitates surgical exploration . Hoover et al . Produced an algorithm suggesting proper management of spontaneous pneumoperitoneum (fig . 4), basing their primary recommendations for management on radiologic imaging, temperature, leukocyte count and physical examination . Our patient was hypothermic, had a leukocyte count within normal limits and was unresponsive, so a proper abdominal examination could not be performed . Per this algorithm surgical exploration however, our patient had worsening hypotension, tachycardia, hypothermia, tachypnea, acidosis with high anion gap and hypokalemia, and we felt it was pertinent to progress to laparotomy due to his decline in status . Though laparotomy did not reveal any perforations, the patient's vital signs normalized postoperatively over the next 24 h. figure 4:adaptation of the algorithm initially proposed by hoover et al . For managing spontaneous pneumoperitoneum . Adaptation of the algorithm initially proposed by hoover et al . For managing spontaneous pneumoperitoneum . Pneumoperitoneum in the absence of hollow viscus perforation is uncommon, and even rarer when caused by low - impact traumatic pneumothorax without concomitant abdominal trauma . Similar cases have resulted from higher - impact trauma that allowed for the accumulation of greater intrathoracic pressures or delay in tube thoracostomy . The combination of low - impact trauma and immediate tube thoracostomy does not favor the development of pneumothorax progressing to pneumomediastinum and pneumoperitoneum, making this case unique . The development of subsequent hemodynamic instability has not previously been described, raising the possibility that even in the absence of intra - abdominal injury, releasing pneumoperitoneum via laparotomy may be beneficial . While surgical management is not necessary for all cases of pneumoperitoneum, due to our patient's worsening status, an exploratory laparotomy was warranted and was ultimately therapeutic.
|
Patient 1 was diagnosed with hiv infection in 2005 at 13 years of age . Since the age of 8, he had complained of a persistent, nonitchy skin rash covering his face and arms . There was no family history of skin disease and no other past medical history of note . A physical examination revealed widespread flat, nonscaly, hypopigmented macules from 1 to 15 mm . The lesions were distributed on the sun - exposed areas of his upper torso, face, neck, and forearms . The genital area, other mucous membranes, scalp, and nails were unaffected . No specific treatment was available . In july 2005, he commenced combination antiretroviral therapy (cart) with nevirapine, lamivudine, and stavudine . His nadir cd4 t - cell count was 193 cells/l (8% of the total lymphocyte count). After starting cart, his cd4 t - cell count improved to 964 cells/l (25% of the total lymphocyte count) in 2008 and he remained clinically well . Figure 1.ad, physical examination of all 4 cases revealed multiple hypopigmented papules distributed on the trunk, neck, face, and upper limbs . D, physical examination of all 4 cases revealed multiple hypopigmented papules distributed on the trunk, neck, face, and upper limbs . Patient 2 was found to be infected with hiv in 2005, at the age of 12 . Since 2001 at age 8, he complained of a persistent nonitchy hypopigmented rash covering sun - exposed areas, including the legs, but with no genital lesions . The nadir cd4 t - cell count at that time was 186 cells/l (11% of the total lymphocyte count). Sixteen months later, he was clinically well and his cd4 t - cell count had improved to 479 cells/l (23%). The skin eruption remained unchanged despite the introduction of cart (figure 1b). Patient 3 was diagnosed with hiv infection in 2007 at the age of 15 . Since the age of 7, he had complained of a persistent maculopapular eruption similar in distribution and morphology to patients 1 and 2 . He commenced cart in december of 2007 with a nadir cd4 t - cell count of 180 cells/l . In 2011, his cd4 t - cell count was 414 cells/l and his skin manifestations remained unchanged (figure 1c). Patient 4 was found to be infected with hiv in 2002 when he was 13 years old, following a diagnosis of pulmonary tuberculosis . At that time, disseminated flat warts were noted involving the face and limbs with scattered truncal lesions; these had been present for several years . He commenced cart in 2006, but the nadir cd4 t - cell count was not recorded . In 2010, his cd4 t - cell count was 97 cells/l and the skin rash remained unchanged (figure 1d). All 4 patients were vertically infected with hiv: all were maternal orphans, denied previous sexual intercourse, and reported no blood transfusions or intravenous drug use . Diagnostic punch skin biopsies were taken from each patient with informed consent (table 1). The samples were split: one half was processed for light microscopy and the other half was fixed in formalin for transport, and then rinsed in phosphate buffered saline at 4c before homogenization . Tissue was digested with a 200 g / ml solution of proteinase k overnight at 37c, and dna was extracted using phenol / chloroform and ethanol precipitation . Table 1.human papillomavirus types isolatedpatientsite of skin biopsyhpv typeshpv type summary/ev typescutaneous wart associated typesgenital typeshpv types with highest signal intensities (quantitative and semiquantitative data)1neck51, 26, 16, 18, 45, 52, 53, 54hpv 1 + + + hpv 2 + + hpv 6 + 2shoulder5,191, 26, 11, 16, 18, 31, 33, 52hpv 1+++ hpv 2++3arm51, 26, 11, 16, 31, 51, 52, 66hpv 1+++ hpv 2++4neck51, 26, 11, 16, 18, 31, 52, 53, 66hpv 1+++ hpv 2++ hpv 6+abbreviations: ev, epidermodysplasia verruciformis; hpv, human papillomavirus . Human papillomavirus types isolated abbreviations: ev, epidermodysplasia verruciformis; hpv, human papillomavirus . Two comprehensive hpv typing systems were utilized in 2 separate specialist hpv research laboratories that could identify cutaneous wart associated hpv types, (ev - associated) types, and genital hpv types . First, polymerase chain reaction (pcr) was performed, followed by sequencing using primers that amplify a wide spectrum of hpv types; pgmy, gp5+/gp6 +, cp65/cp70, cp66/cp70, and ch1f / cn1r [12, 13]. Next, confirmatory hpv typing was done using a luminex - based system (cutaneous hpv) and 2 reverse hybridization line probe assays (lipa) (genital and -hpv) [1416]. The final hpv typing outcome was obtained by combining the results of all the methods used . Hpv viral load assays were available for common and genital hpv types (hpv 5 and hpv 6, 11, 16, and 18, respectively). Diagnostic punch skin biopsies were taken from each patient with informed consent (table 1). The samples were split: one half was processed for light microscopy and the other half was fixed in formalin for transport, and then rinsed in phosphate buffered saline at 4c before homogenization . Tissue was digested with a 200 g / ml solution of proteinase k overnight at 37c, and dna was extracted using phenol / chloroform and ethanol precipitation . Table 1.human papillomavirus types isolatedpatientsite of skin biopsyhpv typeshpv type summary/ev typescutaneous wart associated typesgenital typeshpv types with highest signal intensities (quantitative and semiquantitative data)1neck51, 26, 16, 18, 45, 52, 53, 54hpv 1 + + + hpv 2 + + hpv 6 + 2shoulder5,191, 26, 11, 16, 18, 31, 33, 52hpv 1+++ hpv 2++3arm51, 26, 11, 16, 31, 51, 52, 66hpv 1+++ hpv 2++4neck51, 26, 11, 16, 18, 31, 52, 53, 66hpv 1+++ hpv 2++ hpv 6+abbreviations: ev, epidermodysplasia verruciformis; hpv, human papillomavirus . Human papillomavirus types isolated abbreviations: ev, epidermodysplasia verruciformis; hpv, human papillomavirus . Two comprehensive hpv typing systems were utilized in 2 separate specialist hpv research laboratories that could identify cutaneous wart associated hpv types, (ev - associated) types, and genital hpv types . First, polymerase chain reaction (pcr) was performed, followed by sequencing using primers that amplify a wide spectrum of hpv types; pgmy, gp5+/gp6 +, cp65/cp70, cp66/cp70, and ch1f / cn1r [12, 13]. Next, confirmatory hpv typing was done using a luminex - based system (cutaneous hpv) and 2 reverse hybridization line probe assays (lipa) (genital and -hpv) [1416]. The final hpv typing outcome was obtained by combining the results of all the methods used . Hpv viral load assays were available for common and genital hpv types (hpv 5 and hpv 6, 11, 16, and 18, respectively). The histological findings in each patient s biopsy included basket - weave orthokeratosis overlying a prominent granular cell layer . Acanthosis, mild spongiosis, focal lymphocyte exocytosis, koilocytes, and occasional prickle layer keratinocytes with enlarged nuclei were also observed . These histological appearances are those of a plane wart as is typically seen in epidermodysplasia verruciformis (figure 2). The features are those of a plane wart, which is a classic histological feature of epidermodysplasia verruciformis . The features are those of a plane wart, which is a classic histological feature of epidermodysplasia verruciformis . Hpv 5, a -type (ev - associated) hpv, was detected in all biopsy samples by lipa, but very low copy numbers were detected by real - time quantitative pcr . Multiple cutaneous wart associated and genital hpv types were also isolated from each sample (table 1). Hpv types 1 and 2, usually found in plantar warts, were isolated in all samples with both pcr / sequencing and luminex techniques; all samples had high hpv 1 signals . A large number of genital hpv types were identified (7 or 8 in each sample). Hpv viral load testing was available for hpv 6, 11, 16, and 18 . However, only hpv 6 was found in levels above the detectable limit in samples from patients 1 and 3; the copy number was too low to permit accurate quantification . The histological findings in each patient s biopsy included basket - weave orthokeratosis overlying a prominent granular cell layer . Acanthosis, mild spongiosis, focal lymphocyte exocytosis, koilocytes, and occasional prickle layer keratinocytes with enlarged nuclei were also observed . These histological appearances are those of a plane wart as is typically seen in epidermodysplasia verruciformis (figure 2). The features are those of a plane wart, which is a classic histological feature of epidermodysplasia verruciformis . The features are those of a plane wart, which is a classic histological feature of epidermodysplasia verruciformis . Hpv 5, a -type (ev - associated) hpv, was detected in all biopsy samples by lipa, but very low copy numbers were detected by real - time quantitative pcr . Multiple cutaneous wart associated and genital hpv types were also isolated from each sample (table 1). Hpv types 1 and 2, usually found in plantar warts, were isolated in all samples with both pcr / sequencing and luminex techniques; all samples had high hpv 1 signals . A large number of genital hpv types were identified (7 or 8 in each sample). Hpv viral load testing was available for hpv 6, 11, 16, and 18 . However, only hpv 6 was found in levels above the detectable limit in samples from patients 1 and 3; the copy number was too low to permit accurate quantification . We describe acquired ev in 4 adolescents with longstanding, untreated vertically acquired hiv infection . In addition to identifying expected ev - associated -hpv types in skin biopsies from affected areas, hpv types 1 and 2 were detected in each biopsy, as well as 7 or more hpv types normally associated with genital lesions . Despite immune reconstitution with cart, there was no improvement in the ev lesions, from which multiple hpv strains were isolated after several years of otherwise successful treatment . Hpv 1 and 2, classically associated with plantar warts, were also isolated in skin biopsies from our patients, together with hpv 5, commonly found in patients with congenital ev . Hpv 3, a cutaneous wart associated hpv type, has previously been identified in ev lesions from 1 hiv - infected individual; by contrast, hpv 1 or 2 have not been described . Hpv infection is frequent in immunocompromised patients, but there are few reports of ev occurring in acquired immunodeficiency states [410]. Prior to this study, only 18 cases of hiv - associated ev have been reported, and only 2 described congenital hiv and ev [10, 19]. One of these 2 patients was found to be homozygous for the c912a t polymorphism in the tmc8/ever2 gene . More than 100 hpv types are recognised and classified into 3 clinical categories: anogenital or mucosal, cutaneous wart associated, and -hpv types . Classical ev results from a cell - mediated immune deficiency and an accompanying underlying genetic susceptibility to ev - hpv . This results in an inhibition of natural cytotoxic mechanisms against hpv - infected keratinocytes, leading to the development of skin lesions . Thus, is it possible that these 4 long - term survivors had an undefined, underlying genetic susceptibility, but it is more likely that they had a long - standing, acquired cell - mediated immune defect secondary to a chronic, untreated hiv infection . These vertically hiv - infected adolescents probably first experienced hpv infection in early childhood when their cell - mediated immune systems were already impaired by hiv, whereas adults who are infected with hiv later in life have robust immune mechanisms against hpv infection that were developed in childhood when their immune systems were still intact . This might explain why ev is not as common in hiv - infected adults as it is in older hiv - infected children . Close contact between these immunosuppressed children and other hpv - infected children in an hiv clinic or with hiv - infected adults with multiple hpv types is a possible explanation for the unusually high number of genital and nongenital hpv types isolated in each skin biopsy . Laboratory contamination is an unlikely explanation for the detection of hpv types 19, 45, 51, 52, 53, 54, and 66, as these types were not stored in the 2 research laboratories . Lee et al reviewed the treatment of twenty patients with congenital ev and concluded that oral retinoids (with or without interferon) were effective, as was low - dose oral retinoid maintenance . Relapses were common upon treatment cessation and caution is advised when prescribing retinoids to adolescents with child - bearing potential due to the recognized teratogenicity . Topical imiquimod, intralesional interferon, 5-fluorouracil, and cimetidine have all been used as treatment, but with variable success [1, 6, 8, 10]. Previous reports suggest that treatment of hiv - associated ev is less successful than that for classical ev . A recent treatment trial of glycolic acid in hiv - positive children in botswana showed a trend toward flattening and color normalization in flat warts, although complete resolution was observed in only 10% of patients . Response was greatest in those developing warts after starting art and those with fewer hpv types . In this resource - limited setting, alternative treatments were not available and immune reconstitution with cart had no impact on the appearance of the lesions . This group of adolescents was left with a disfiguring and potentially stigmatizing condition in high - prevalence communities where the skin condition is frequently identified as being associated with hiv infection . Classical ev is associated with a high risk of lesional transformation to squamous cell carcinoma, occurring in up to 70% of cases malignant lesions usually occur in the third and fourth decades of life, but there are case reports of carcinoma appearing as early as 15 and 17 years of age . The oncogenic potential of hpv 5 and 8 is well established but other ev - hpv, including hpv 10, 14, 20, and 47, have also been implicated [18, 22]. Both ultraviolet b and diagnostic x - ray radiation have been identified as oncogenic cofactors in hpv 5related malignancies [1, 22]. No malignancies were encountered in our series or other reported cases of hiv - associated ev, but as cart becomes more widely available, adolescents surviving to adulthood will need close dermatological surveillance . This is particularly important among this group of children with longstanding immune deficiency and high levels of sun exposure . In summary, we describe 4 hiv - infected adolescents with ev - like lesions . Preliminary results suggest that among long - term survivors of vertically - acquired hiv, this might be a common clinical hpv phenotype . It is a disfiguring condition and difficult to treat because no impact on the progression of skin disease has been observed after the administration of cart . Ev is relatively rare in hiv - infected adults but appears to be frequent in vertically - infected children, and close dermatological surveillance for potential skin malignancy is required.
|
The longevity of the world's population is increasing, and in male patients, so are the complaints of lower urinary tract symptoms (luts). Testing to diagnose luts and to differentiate between the various causes should be quick, easy, cheap, specific, not too bothersome for the patient, and noninvasive or minimally so . Conventional urodynamic evaluation consists of registering vesical and abdominal pressures during the filling phase and include the flow during the voiding phase, which is invasive, time - consuming, and expensive . Nowadays, urodynamic evaluation is the gold standard for diagnosing bladder outlet obstruction (boo), but presents some inconveniences such as embarrassment, pain, and dysuria and with 19% of cases experiencing urinary retention, macroscopic hematuria, or urinary tract infection . A greater number of resources in the diagnostic armamentarium could increase the opportunity for selecting less invasive tests on a patient by patient basis . For instance, in cases in which urodynamic studies would not provide the necessary benefit to overcome the risks of the study, less invasive tests might provide the confirmatory information needed to indicate treatment . The idea is not to replace but to provide alternatives to urodynamics that might better suit the needs of some patients and health care systems . These techniques might feasibly lend themselves to different environments, such as mobile and remote clinics . Overall, innovation in health care is how we expand our knowledge, refine practices, and provide better service . A number of groups have risen to this challenge and have formulated and developed ideas and technologies to improve noninvasive methods to diagnosis boo . These techniques start with flowmetry, increased interest in ultrasound, and finally the performance of urodynamic evaluation without a urethral catheter . Thus, slow flow can be due to lower detrusor contraction or to increased urethral resistance . By contrast, normal flow can be due to normal detrusor contraction and urethral resistance or to increased contraction of the detrusor and increased urethral resistance . In conclusion, flowmetry is not sufficient for confirming a diagnosis of boo . Research has been done to evaluate the contribution of ultrasound to identifying patients with boo . Methods such as the measurement of detrusor wall thickness (dwt), intravesical prostatic protrusion (ipp), and ultrasound - estimated bladder weight (uebw) are available . To measure the dwt, it is necessary to use a high - frequency transducer (7.5 mhz) and enlarge by approximately 10 the image of the bladder wall (fig . The measurement of the bladder wall should be at least 250 ml in the bladder . The sonographic measurements of dwt are an accurate alternative for pressure - flow measurements to assess the presence of boo . Dwt measurements show a higher diagnostic power than do measurements of maximum flow rate (qmax), average flow rate (qave), postvoid residual urine, or prostate volume . Dwt can help to assess boo noninvasively in all men and can be useful for the evaluation of boo at assessment and during treatment of bph patients . The ipp measurement is performed in the sagittal plane with the use of transducer frequencies between 3 and 6 mhz (fig . 2). The bladder should have at least 100 ml of urine for determining ipp . Ipp is defined by the distance from the tip of the prostate's protrusion into the vesical lumen to the bladder neck measured in millimeters . Ipp is divided into three stages: grade i, <5 mm; grade ii, 5 to 10 mm; and grade iii,> 10 mm . Ipp grade iii reaches 80% sensitivity and 68% specificity for diagnosing boo when compared with urodynamic evaluation . Authors have calculated the uebw from the measurement of bwt and bladder volume and found that a threshold value of 35 g best distinguishes the difference between obstructed and unobstructed bladders . However, other authors have evaluated patients with luts and found that uebw did not present any individual correlation with luts or objective measurements of boo . Schafer first described noninvasive urodynamics in 1994 when he used a condom catheter (fig . Mcrae et al . Developed a cuff to obstruct the urine flow (fig . The principle of these tests is to interrupt the flow and measure the bladder pressure . The detrusor contraction is maintained and the urethral sphincters remain open and the column of fluid from the urethra to the bladder is sufficient to measure the bladder pressure (isometric pressure) (fig . 5). In conjunction with the bioengineering department at unicamp (university of campinas), a new device consists of a urethral connector which is placed in the fossa navicularis was developed (fig . The initial model consisted of only a device to which the transducer was connected and the interruption of the flow was done by the patient himself . The mammograms utilized in conventional urodynamic evaluation are not applied in noninvasive urodynamics . Statistical analysis and logistic regression operating characteristic curve was constructed, which showed a sensitivity of 67% and specificity of 79% . A study was performed to compare the time flow, flow max, and volume between noninvasive and conventional urodynamics and the results showed no significant differences . With the objective of facilitating the realization of this study, modifications of the urethral connector were proposed . In a previous study, the system is composed of a pressure transducer, an electrical isolation enlargement board (national instruments ni usb-6215), and registered software from labview (national instruments, austin, tx, usa). With these, it was possible to test new models (fig . After various tests, version ii of the urethral connector was developed, in which the transducer is attached to the connector (fig . 8). A graph of the vesical pressure registered during a clinical exam with the urethral connector ii is shown in fig . The arrows indicate the approximated movement in which the individual is instructed to close the exit of the device . Note that the pressure slowly increases until it reaches the approximated static value, corresponding to the isovolumetric vesical pressure . The flow is stopped several times during voiding, for periods of 2 to 3 seconds, which permits greater accuracy of the vesical pressure . For the comparison of two methods, conventional and connector, the vesical pressure at maximal flow and maximal vesical pressure with the noninvasive method were used . The linear regression resulted in an angular coefficient of 2.000.49, r=0.8016, with a 95% confidence interval of 0.6190 to 3.38l . The procedure for occlusion of the flow by use of the urethral connector to avoid hydraulic shock was not adopted without reason . In a previous study, laboratory simulations showed that abrupt occlusion could cause a rapid and significant increase in the pressure . 9 was observed, with a gradual increase of pressure until a static value was reached, which corresponded to the isometric vesical pressure . According to the patients, a closing time of 2 to 3 seconds was not long enough to cause any discomfort . This has already been verified by other methods showing that there is no contraction inhibition of the detrusor during a brief interruption of the flow . The registered vesical pressure values of the urethral connector were compared with the conventional urodynamic method, and the curve can be seen in fig . The conventional method registers the pressure of a free flow, whereas the connector measures the value during an interrupted flow . Thus, although the pressures measured for each method reflect the contractile activity of the detrusor, the values are not necessarily identical . However, a linear correlation between the measured pressures is observed, which shows the sensitivity of the connector when registering the vesical pressure . Considering that the flows registered by use of both methods were not different, this suggests that the connector does not cause an increase of resistance of the urinary flow, and the necessary interruptions for measuring the vesical pressure do not significantly alter the parameters evaluated . The study of noninvasive urodynamic evaluation has generated much research; however, it has not been adopted in daily practice . It is difficult to interpret the results and it does not evaluate the phase of vesical filling and has a bit of an engineering characteristic . Because it is a noninvasive method, it should be used in the first consultation with the patient, when the symptoms have first begun to appear and not when it is time to schedule surgery . The exam most probably should be placed between the flowmetry and the conventional urodynamic study . The great advantages of using the urethral connector are as follows: minimal discomfort, minimal risk of urinary tract infection, and low cost . This method can be repeated many times, permitting the evaluation of obstruction during clinical treatment . The connector should be used to diagnose boo, for the evaluation for surgery, and in screening for treatment . In the future, noninvasive urodynamics can be used to identify patients with boo, start early medical treatment, and evaluate the results.
|
Helicobacter pylori is a spiral - shaped, gram - negative, microaerophilic and fastidious bacterium (1, 2), and infects almost 50% of the world s population (3, 4). It is the main cause of chronic gastritis, gastric and duodenal ulcers, mucosa - associated lymphoid tissue lymphoma and gastric adenocarcinoma (2, 5). In the international agency for research on cancer (iarc), h. pylori has introduced as a first class (definitive) carcinogen (6). There are several methods for the detection of h. pylori in clinical and environmental samples including culture, polymerase chain reaction (pcr), real - time pcr, histology, rapid urease test, serology, stool antigen test, and urea breath test that classified into two categories called invasive and non - invasive tests on the basis of the using endoscopy . On the basis of maastricht consensus report (florence iv), endoscopy and biopsy examination should be carried out in older patients and in patients with alarming sign and symptoms like weight loss, dysphagia, gi bleeding, abdominal mass and iron deficient anemia (7, 8). Culture, as the gold standard method for diagnosis of h. pylori can diagnose the bacterium to the genus and species level and cultivated isolates can be subjected to antibiotic susceptibility tests . However, this method is not sensitive (70% - 86%), expensive, technically challenging and time - consuming (2, 4). Polymerase chain reaction is also used to detect the h. pylori in clinical samples, but the procedure is complicated and requires expensive instrument, thermal cycler (9). The disadvantages of the rapid urease test include low sensitivity and high amount of false positive results due to production of urea by non h. pylori species (10, 11). Furthermore, in histopathology examination, insufficient number of biopsy specimens and lack of access to samples from different parts of the stomach, the necessity for conducting different staining techniques and time - consuming process may limit the application of this method (12). Molecular methods for detection of h. pylori from biopsy specimens have been used in research settings but are not applied in clinical practice . Polymerase chain reaction, as a method for detection of the bacterium from biopsy specimens, is being used in many studies (13 - 15). Furthermore, the sensitivity of pcr is reduced by very small amounts of contaminating dna (from a different sample) and inhibitors in the dna extracted from the samples (1). Loop - mediated isothermal amplification (lamp) as a new technique for specific amplification of nucleic acid has been described by notomi et al . In 2000 (16). Loop - mediated isothermal amplification overcomes some drawbacks and limitations of pcr and has been applicable widely in diagnosis test of infectious agents . The method is very specific due to the use of six primers that identify eight regions of the target sequence . The sensitivity of the method for detection of target sequences is 10 times more than pcr . The reaction time of the lamp is shorter than pcr because lamp is carried out isothermally (60 - 65c) and the amplified product is observable without the need to electrophoresis . In addition, lamp is less expensive than other molecular diagnostic methods because it does not require electrophoresis and thermal cycler . Here, positive result is shown by white insoluble magnesium pyrophosphate and can be seen with the naked eyes (17 - 19). The aim of this study was to set up a lamp test for detection of h. pylori using designed primers targeted a highly conserved region of the urec gene . In order to setting up the lamp and pcr reactions, the dna of a clinical isolate of h. pylori was used . Helicobacter pylori was cultured on enriched egg yolk columbia agar containing vancomycin (10 mg / l), trimethoprim (5 mg / l) and amphotericin b (5 the plates were incubated in microaerophilic condition and 100% humidity at 37c for 3 to 5 days . Biochemical testes such as catalase, oxidase, urease test and gram staining were used for identification and confirmation of the presumptive colonies (1, 20). The h. pylori dna was extracted using high pure pcr template preparation kit (roche, germany) according to manufacturer s instruction . Purity and concentration of the extracted dna were measured using nanodrop (thermo scientific, usa). Species specific primers were designed according to the conserved region of the h. pylori 26695 urec (glmm) gene as a template (accession no . Ae000511) (21). Sequence and properties of the forward and reverse primers were hp - urecf: 5cat cgc cat caa aag caa ag3 (605 - 625 positions in 26695 h. pylori urec gene) and hp - urecr: 5cag agt tta agg atc gtg tta g3 (798 - 819 positions in 26695 h. pylori urec gene). The primers have 100% homology with most reference strains of h. pylori in blast . Sequences of the urec of several strains of h. pylori including 26695 (nc-018939.1), hpag1 (nc-008086.1), g27 (nc-011333.1) and j99 (nc-000921.1) were retrieved from the genbank database . In order to obtain the conserved region of the urec afterward, the primers were designed using the primer explorer software version 4 (www.primerexplorer.jp) based on the conserved sequences (table 1, figure 1). Annealing position and amplification orientation of the lamp primers on the selected 214 bp target sequence of the urec . According to the protocol presented by aryan et al . Lamp reaction was carried out in a final volume of 30 l containing 0.8 m betaine (sigma - aldrich), 20 mm tris - hcl (ph 8.8), 10 mm kcl, 10 mm (nh4)2so4, 6 mm mgso4, 0.1% triton x-100, 2 mm dntp, 1.6 m each of the fip and bip primers, 0.8 m of lf and lb primers, 0.2 m of f3 and b3 primers, 8 u bst dna polymerase (new england biolabs, uk) and 3 l template dna (22). In order to set up the lamp procedure, different temperatures including 63c, 65c and 67c at different periods of time 60, 70 and 80 minutes were tested (23). Specificity of the designed primers targeted urec was evaluated by lamp and pcr methods using less than 100 ng of extracted dna from h. pylori and some other bacteria that are commonly found in biopsy samples . Any lamp reactions that had a white turbidity or a marker - like pattern after agarose gel electrophoresis was considered as positive . A pcr reaction was considered positive if a visible band with 214 bp was appeared on gel electrophoresis . In order to determine the limit of detection of lamp and pcr, first, the concentration of extracted h. pylori genomic dna was measured three times, and the mean value was considered as the real concentration . Then, a series of 10-fold serial dilutions of dna were prepared (1 ng, 0.01 ng, 1 pg, 0.01 pg, 1 fg, 0.1 fg, 0.01 fg and 1 ag). The optimal pcr and lamp reaction was carried out by one l of these samples . Ultimately, the last dilution of the h. pylori dna which yielded a detectable band or insoluble turbidity was assigned as the limit of detection of the pcr and lamp, respectively . To calculate the h. pylori copy number, which was detectable in analytical sensitivity testing the average genome size of h. pylori was considered 1.67 10 bp . In fact, 1.67 fg of the h. pylori dna is equal to a single genome . In order to setting up the lamp and pcr reactions, the dna of a clinical isolate of h. pylori was used . Helicobacter pylori was cultured on enriched egg yolk columbia agar containing vancomycin (10 mg / l), trimethoprim (5 mg / l) and amphotericin b (5 the plates were incubated in microaerophilic condition and 100% humidity at 37c for 3 to 5 days . Biochemical testes such as catalase, oxidase, urease test and gram staining were used for identification and confirmation of the presumptive colonies (1, 20). The h. pylori dna was extracted using high pure pcr template preparation kit (roche, germany) according to manufacturer s instruction . Purity and concentration of the extracted dna were measured using nanodrop (thermo scientific, usa). Species specific primers were designed according to the conserved region of the h. pylori 26695 urec (glmm) gene as a template (accession no . Ae000511) (21). Sequence and properties of the forward and reverse primers were hp - urecf: 5cat cgc cat caa aag caa ag3 (605 - 625 positions in 26695 h. pylori urec gene) and hp - urecr: 5cag agt tta agg atc gtg tta g3 (798 - 819 positions in 26695 h. pylori urec gene). Sequences of the urec of several strains of h. pylori including 26695 (nc-018939.1), hpag1 (nc-008086.1), g27 (nc-011333.1) and j99 (nc-000921.1) were retrieved from the genbank database . In order to obtain the conserved region of the urec, the retrieved sequences were aligned using clustalw2 software (www.ebi.ac.uk). Afterward, the primers were designed using the primer explorer software version 4 (www.primerexplorer.jp) based on the conserved sequences (table 1, figure 1). Annealing position and amplification orientation of the lamp primers on the selected 214 bp target sequence of the urec . Lamp reaction was carried out in a final volume of 30 l containing 0.8 m betaine (sigma - aldrich), 20 mm tris - hcl (ph 8.8), 10 mm kcl, 10 mm (nh4)2so4, 6 mm mgso4, 0.1% triton x-100, 2 mm dntp, 1.6 m each of the fip and bip primers, 0.8 m of lf and lb primers, 0.2 m of f3 and b3 primers, 8 u bst dna polymerase (new england biolabs, uk) and 3 l template dna (22). In order to set up the lamp procedure, different temperatures including 63c, 65c and 67c at different periods of time 60, 70 and 80 minutes were tested (23). Specificity of the designed primers targeted urec was evaluated by lamp and pcr methods using less than 100 ng of extracted dna from h. pylori and some other bacteria that are commonly found in biopsy samples . Any lamp reactions that had a white turbidity or a marker - like pattern after agarose gel electrophoresis was considered as positive . A pcr reaction was considered positive if a visible band with 214 bp was appeared on gel electrophoresis . In order to determine the limit of detection of lamp and pcr, first, the concentration of extracted h. pylori genomic dna was measured three times, and the mean value was considered as the real concentration . Then, a series of 10-fold serial dilutions of dna were prepared (1 ng, 0.01 ng, 1 pg, 0.01 pg, 1 fg, 0.1 fg, 0.01 fg and 1 ag). The optimal pcr and lamp reaction was carried out by one l of these samples . Ultimately, the last dilution of the h. pylori dna which yielded a detectable band or insoluble turbidity was assigned as the limit of detection of the pcr and lamp, respectively . To calculate the h. pylori copy number, which was detectable in analytical sensitivity testing the average genome size of h. pylori was considered 1.67 10 bp . In fact, 1.67 fg of the h. pylori dna is equal to a single genome . The first product of the lamp reaction was dumbbell - shaped amplicon with a molecular weight of 135 bp (figure 2). M, 100 bp dna ladder; lane 1, negative control; lane 2, positive control of h. pylori pure dna; lane 3 - 6, a positive result . The specificity of the designed primers was evaluated with pure h. pylori dna and several other bacterial species, which are commonly present in the gastric biopsy specimens . The lamp reaction was positive only with h. pylori dna and there was no observable white turbidity or ladder- like pattern in agarose gel electrophoresis with non - h . Pylori bacteria . Also, the pcr reaction was only positive with h. pylori dna and the 214 bp band was not observed with non - h . M, 100 bp dna ladder; e, empty; lane 1, negative control; e, empty; lane 2, positive control of h. pylori pure dna; lane 3, streptococcus spp . ; lane 4, bacillus spp . ; lane 5, escherichia coli; lane 6, citrobacter spp . ; lane 7, klebsiella spp . ; lane 8, enterobacte atcc 29212; lane 9, staphylococcus aureus atcc 25923; lane 10, staphylococcus epidermidis . The limit of detection of pcr and lamp for detection of h. pylori was assessed using tenfold serial dilution of pure h. pylori dna . The lowest concentration of pure h. pylori dna that yields positive reaction by lamp and 214 bp band in pcr was 10fg per reaction . Since the average genome size of the h. pylori dna is estimated 1.67 10 bp, thus, limit of detection in both methods is equivalent to approximately 6 copy numbers of h. pylori dna in each reaction . The first product of the lamp reaction was dumbbell - shaped amplicon with a molecular weight of 135 bp (figure 2). M, 100 bp dna ladder; lane 1, negative control; lane 2, positive control of h. pylori pure dna; lane 3 - 6, a positive result . The specificity of the designed primers was evaluated with pure h. pylori dna and several other bacterial species, which are commonly present in the gastric biopsy specimens . The lamp reaction was positive only with h. pylori dna and there was no observable white turbidity or ladder- like pattern in agarose gel electrophoresis with non - h . Pylori bacteria . Also, the pcr reaction was only positive with h. pylori dna and the 214 bp band was not observed with non - h . M, 100 bp dna ladder; e, empty; lane 1, negative control; e, empty; lane 2, positive control of h. pylori pure dna; lane 3, streptococcus spp . ; lane 4, bacillus spp . ; lane 5, escherichia coli; lane 6, citrobacter spp . ; lane 7, klebsiella spp . ; lane 8, enterobacte atcc 29212; lane 9, staphylococcus aureus atcc 25923; lane 10, staphylococcus epidermidis . The limit of detection of pcr and lamp for detection of h. pylori was assessed using tenfold serial dilution of pure h. pylori dna . The lowest concentration of pure h. pylori dna that yields positive reaction by lamp and 214 bp band in pcr was 10fg per reaction . Since the average genome size of the h. pylori dna is estimated 1.67 10 bp, thus, limit of detection in both methods is equivalent to approximately 6 copy numbers of h. pylori dna in each reaction . Helicobacter pylori is very common and approximately 50% of the world s population is infected by this bacterium . Considering to the fact that the worldwide spread of h. pylori infection and its associated diseases such as gastric cancer and on the other hand since it is possible to decrease risk of gastric cancer with treatment of h. pylori infection, a quick and accurate diagnosis of h. pylori infection is crucial (24). Different methods with different sensitivities are used for diagnosis of h. pylori infections in suspected patients such as histopathology, the rapid urease test, culture, fecal antigen test, serology and molecular methods like pcr and real - time pcr . Since h. pylori is not distributed evenly within the stomach tissue, bacteriological culture of the h. pylori from biopsy specimens has the least amount of sensitivity . In addition, the rapid urease test will also be affected by this condition; so, sensitivity of the test is low (1, 25). As a result, the purpose of the current study was designing, analyzing and comparing pcr and lamp targeted urec to detect h. pylori . The limit of detection obtained in pcr and lamp were less than the previous reported methods (2, 26, 27). The analytical sensitivity of pcr identified 10 fg of h. pylori dna per each reaction . Since the h. pylori genome weighs about 1.67 fg the amount of this dna is equal to 6 copy numbers of h. pylori . This means the sensitivity of pcr, using the primers designed in this research, is 8 times more sensitive than lu s study and, it is also approximately 2 times more sensitive than the research by (clayton et al . Lu s and thoreson reported a limit of detection around 5 h. pylori genomes in their research (0.01 pg and 1 fg, respectively) (26, 28). We believe that the major drawback of thoreson s research is that they miscalculated the genome weight of h. pylori as one fg . Lu s used 16srrna as target of amplification, which is less specific in comparison with urec gene . The primers used in lamp were designed on the basis of the conserved regions of the urec gene . The conserved regions of urec were identified using alignment of some standard strain urec gene by clustalw2 software . Although various genes like urea, ssa, 16srrna and urec are used as targets in molecular detection of h. pylori, urec gene was considered in this research since it is located in a completely conserved area in the h. pylori genome and the sensitivity and specificity of this gene in identifying h. pylori are more than those of 16srrna gene (26). The detection limit of the lamp with new designed primers was 6 copy numbers of h. pylori dna in each reaction . It is less than the detection limit reported by minami et al . In which the possibility of identifying the least amount of h. pylori using lamp also targeted the urec gene was equal to 10 cfu / tube (29). This means that the lamp is more sensitive in the present research rather than in the mentioned researches and it has identified a fewer number of bacteria (30 - 39). Although the obtained results from lamp absolutely conformed to that of the pcr method in this research and the numbers of bacteria identified were similar in both methods, the lamp is preferred . The lamp could be carried out in most of the hospital laboratories even with mediocre facilities as a simple, fast, efficient and easy method . Therefore, it is considered an ideal method for specific identification of h. pylori among all existing bacteria in the stomach and biopsy sample and it is suggested as a highly specific method as well . The specificity of the method depends on 3 pairs of primers, which identify 8 separate areas of the target gene while in pcr one pair of primers is used . This method can be done in 1.5 hours while in order to perform the pcr method 3 - 4 hours time is needed . The pcr method is also highly specific in identifying h. pylori; however, this method suffers limitations such as needing expensive equipment, having a complex protocol and also need to a thermo cycler machine in order to regulate a cycle of temperatures while the lamp can be carried out in a isothermal temperature without the need for thermo cycler and expensive equipment . As a result lamp with the target sequence of the urec gene is advised as a technique which is highly specialized and sensitive, quick and simple in identifying h. pylori . Therefore, this method could be used as a valuable potential method in clinics and as a routine test in laboratories, although our results are still preliminary and clinical evaluation of the method should also be performed in future.
|
In mammals, a small fraction of the genome (e.g. In human) is transcribed into messenger rnas, whereas the most represents a transcribed dark matter that does not encode for proteins . Among them, long non - coding rnas (lncrnas) are prevalently transcribed from mammalian genomes and are present in large amounts in mammalian cells (14). Evidence has accumulated that lncrnas play significant roles in numerous fundamental biological processes such as transcription, translation, cell cycle, imprinting, splicing and protein localization (57) and are highly implicated in cancer progression (814) and development of many other human diseases such as mendelian disorders, cardiovascular diseases and neurological disorders (1417). Advances in studies of non - coding rna and consequently the increasing number of lncrnas identified have resulted in the development of several lncrna - related databases . Among them, gencode, which aims at annotating all functional elements in the human genome (4), has made a comprehensive annotation of gene structure (gene loci, transcript loci, exon number and splicing boundary) of 23 898 human lncrna transcripts (version 19). Noncode (18) collects 95 135 lncrna transcripts in human obtained from published literatures and databases (version 4.0). Lncipedia (19) contains a total of 32 181 human lncrna transcripts and incorporates related statistics such as protein - coding potential, secondary structure information and microrna binding sites (version 2.1). Lncrnadb (20) focuses on collecting function annotations based on the published literatures and, to date, only about 200 lncrnas have been included in lncrnadb . Another database, rfam, centers on non - coding rna families and thus does not provide specialized information for an individual lncrna (21). It can be seen that although these existing databases offer valuable information on different aspects and different level of coverage of the lncrna universe, there is a lack of a dedicated database for human lncrnas that provides lncrna transcript details coupled with the capability to make data update and curation in a smooth and easy way . Specifically, existing databases are most dependent on expert curation and thus laborious to comprehensively update the fast growing number of newly discovered lncrnas . Wikipedia (http://www.wikipedia.org), an online encyclopedia, is an extraordinarily successful example that relies on the community knowledge in information integration and allows people from all over the world to create / edit any content . Wikipedia features collaborative information integration, huge coverage, up - to - date content as well as low - maintenance cost . Many attempts have been made in application of wiki for biological data integration (2225). For example, rfam, dedicated to rna families, has adopted the wiki technology for community curation . According to its name, lncipedia looks like a wiki resource, but in fact it is not fully open to the scientific community for data provision / edit . Considering the exponentially accumulated volume of lncrnas, it is desirable to exploit the knowledge of the broad scientific community for collaborative integration and curation of lncrna information (2630). Here this platform is wiki - based and open - content, publicly editable and aimed at community curation of human lncrnas . Unlike existing relevant databases, lncrnawiki features comprehensive integration of information on human lncrnas, cataloging 105 255 non - redundant lncrna transcripts obtained from multiple different resources . Moreover, it harnesses collective knowledge for collecting, editing and annotating information on human lncrnas and rewards community - curated efforts by quantifying contributions of users and providing explicit authorship based on their quantified contributions, aiming to exploit the knowledge of broad scientific community in addressing collectively collaborative curation of human lncrnas . Therefore, lncrnawiki has the potential to serve as an up - to - date and comprehensive knowledgebase for human lncrnas . Lncrnawiki is built based on mediawiki version 1.19.1 (http://www.mediawiki.org), which is an open source wiki engine, mysql version 5.1.58 (http://www.mysql.org) a popular and free relational database management system, and php version 5.2.17 (http://www.php.net), which is a scripting language . These were implemented on a red hat enterprise linux server . In order to make lncrnawiki more attractive for participants from the broader scientific community in tasks of collaborative curation of lncrnas authorreward (http://www.mediawiki.org/wiki/extension:authorreward), an extension to mediawiki that allows for obtaining customized functionalities (31). Authorreward quantifies participants contribution considering both edit quality and edit quantity, and provides explicit authorship based on these quantified contributions . It has been successfully demonstrated in ricewiki (32), where it has attracted more than 800 participants in collaborative curation of 600 genes . We also integrated jbrowse (version 1.11.4) (33,34) into lncrnawiki to facilitate visualization of the genomic context and transcript structure for each lncrna . We integrated lncrna sequences and annotation information (e.g. Genomic location, transcript structure) from three data sources: gencode (version 19; 23 898 human lncrna transcripts), noncode (version 4.0; 95 135 human lncrna transcripts) and lncipedia (version 2.1; 32 181 human lncrna transcripts). N in each data source, and as a result, a total of eight lncrnas in lncipedia were removed . Second, we excluded lncrnas with ambiguous naming scheme; in each data source, two or more lncrna transcripts having 100% sequence identity on the whole transcript length (based on blastn results) and occupying the same genomic location but having different ids are considered as questionable lncrnas . Consequently, 14, 20 and eight lncrnas were removed from gencode, noncode and lncipedia, respectively . Lastly, since different databases may have different naming schemes and a given lncrna transcript may accordingly have different identifiers in different databases, we performed blastn across these three data sources . Lncrna transcripts having 100% sequence identity (based on blastn results) and occupying the same genomic location were regarded as the same lncrna . Finally, we obtained a total of 105 255 non - redundant lncrna transcripts (figure 1). We also blasted these 105 255 lncrnas against lncrna sequences in lncrnadb (223 lncrnas in total as of july 21, 2014) and found only 103 lncrnas have been functionally annotated (supplementary table s1), indicating that a large number of human lncrnas are poorly annotated and need a platform for community annotation of lncrnas . Data source of lncrnawiki . Based on our previous study (7) and categories of derrien et al . (35), we classified the 105 255 non - redundant lncrna transcripts into seven groups according to their genomic location in respect to protein - coding genes, viz ., intergenic, intronic (s), intronic (as), overlapping (s), overlapping (as), sense and antisense (figure 2). The difference between our classification and derrien's (35) is that we classified lncrnas that intersect protein - coding genes into sense or antisense by considering the whole transcript sequence instead of exonic region only . Classification of lncrnas based on their genomic location in respect of protein - coding genes . Intergenic: lncrnas are transcribed from intergenic regions; intronic (s): lncrnas are transcribed entirely from introns of protein - coding genes; intronic (as): lncrnas are transcribed from antisense strand of protein - coding genes and the entire sequences are covered by introns of protein - coding genes; overlapping (s): lncrnas that contain coding genes within an intron on the sense strand; overlapping (as): lncrnas that contain coding genes within an intron on the antisense strand; sense: lncrnas are transcribed from the sense strand of protein - coding genes and the entire sequence of lncrnas are covered by protein - coding genes (intronic lncrnas are not included), or the entire sequence of protein - coding genes are covered by lncrnas (overlapping lncrnas are not included), or both lncrnas and protein - coding genes intersect each other partially; antisense: lncrnas are transcribed from the antisense strand of protein - coding genes and the entire sequence of lncrnas are covered by protein - coding genes (intronic lncrnas are not included), or the entire sequence of protein - coding genes are covered by lncrnas (overlapping lncrnas are not included), or both lncrnas and protein - coding genes intersect each other partially . Meanwhile, transcripts are grouped together by classification categories, as well as by genes . This information can be accessed at the homepage and at the bottom of the transcript page . The content of every transcript in lncrnawiki is structured into two parts: user - edit part and basic information part . The user - edit part allows users to add or delete annotations . On the contrary, the basic information portion is organized as a table and will be regularly updated by the lncrnawiki team based on the annotation information integrated from multiple different lncrna - associated sources . The lncrna information in lncrnawiki was seeded from gencode, noncode and lncipedia, yielding a comprehensive integration of 105 255 non - redundant lncrna transcripts (figure 1). This lncrna was collaboratively curated by four researchers, yielding 125 versions as of october11, 2014 . (a) whole page, containing multiple different sections . (b) brief authorship information in reward for community curation and a one - sentence summary for the description of this lncrna . It is a list of laboratories working on this lncrna derived from references and provided by the community . (e) references, which are automatically generated and formatted with the help of the it is organized structurally in the form of a table, including transcript i d, source, transcript structure, genome context, sequence information, etc . Authorreward extension that quantifies researchers contributions and provides explicit authorship according to their quantitative contributions . The cutoff core for awarding authorship is configurable and set to 1 (by default) in lncrnawiki . Basic information provides users with the basic details of lncrna such as genomic location, transcript structure and sequence . Classification, length, genomic location, exon number, exons, genome context and sequence. Source indicates the source database, as well as its version, from which this lncrna is obtained . Same with provides ids of lncrnas that are considered to be the same entry in other lncrna sequence databases . Taking into account that the genomic context of lncrnas may offer insights into their function, the classification of lncrnas based on genomic location is of great biological significance in in - depth mining and analysis (7). We classified lncrnas into seven categories considering their genomic location in respect of protein - coding genes, i.e. Sense, antisense, overlapping (s), overlapping (as), intergenic, intronic (s) and intronic (as) (figure 2a). According to the present data set, it is shown that the majority of human lncrnas belong to the categories of intergenic (59.2%) and sense (24.4%) (figure 2b). The sub - section the user - edit part includes three sections: annotated information, labs working on this lncrna and references (figure 3). It is helpful for users who do not have training in wiki techniques or curation to contribute edits and share knowledge, which simplifies editing significantly and lowers technological requirements for participation in curation of a wider community . Annotated information links to several sub - sections including regulation, diseases and evolution, providing convenience of directing users to other sub - section(s) of interest . Considering the importance and the necessity of lncrna nomenclature transcriptomic nomeclature. As most of the lncrnas have not been functionally studied, we named lncrnas based on their biological features such as genomic location, alternative splicing and expression level by basically following the rules of hgnc (36) (figure 3). Users can add new sub - sections if necessary, while those that are irrelevant can be deleted . Edit link available to each sub - section and, moreover, can be made by using application programming interface for automatic entry of information . Labs working on this lncrna contains a worldwide list of laboratories that work on this lncrna, thus facilitating collaboration and interaction in curation of this lncrna . References provides publications related to the lncrna and they are automatically formatted using the community - curated efforts are quantified and rewarded by explicit authorship, aiming to encourage more participants from the wider scientific community in collective and collaborative curation of lncrnas . In any given lncrna page, curation efforts for all participated contributors are quantified as contribution score which evaluates both quality and quantity of edits, and consequently, authorship is awarded to any contributor from the scientific community whose contribution score is greater than a cutoff score (by default, it is 1) (figure 3). Each page at the top displays the brief authorship information, including contributor name(s), lncrna i d, hyperlink to this lncrna and last update time . This information includes a pie chart to depict contribution scores for all involved contributors, edit quality and quantity for each contributor are illustrated by a histogram, and contributor names are listed in a table with contribution score, edit count, edit quality, edit quantity, last edit time and edit details . In addition, when a newly identified human lncrna is reported, any user can create a new page to add specific information for this lncrna, enabling lncrnawiki to become an up - to - date and comprehensive knowledgebase for human lncrnas . For example, we added to lncrnawiki (http://lncrna.big.ac.cn/index.php/lunar1) lunar1, a recently discovered human lncrna, immediately after the relevant paper was published online . Lunar1 is notch - regulated and it enhances mrna expression of igf1r (insulin - like growth factor receptor 1) aiming at maintenance of human t - cell acute lymphoblastic leukemia (t - all) (37). Lncrnawiki is a wiki - based database dedicated for human lncrnas, comprehensively integrating information on human lncrnas from multiple different resources and exploiting the wide scientific community to collect, edit and annotate human lncrnas . It allows not only existing lncrnas to be edited, updated and curated by different users but also newly identified lncrnas to be added by any user . As the number of lncrnas grows fast and is contrasted by the small number of expert curators focused on lncrna, lncrnawiki has the potential to serve as an up - to - date and comprehensive knowledgebase for human lncrnas . It should be noted, however, that lncrnawiki does not aim to replace traditionally expert - curated databases, but represents their important complement . Lncrnawiki relies on community intelligence to curate a wide range of lncrna - related topics, which thus can significantly reduce efforts and time of expert curators . With explicit authorship as a reward for community curation, lncrnawiki bears the promise to attract more people (especially field experts) to share their expertise and to provide edits on lncrnas of their interest . In addition, it is of great significance for authors of recent publications to curate their newly reported lncrnas and to submit their functional descriptions to lncrnawiki, facilitating information dissemination and maximizing the scope of knowledge sharing . Together, based on community curation, lncrnawiki has a potential to grow into an lncrna encyclopedia by the community, of the community and for the community . Future directions for lncrnawiki include integrating more types of data in the section of basic information (e.g. Expression level, tissue - specific expression, orthologs) from different sources and improving links to existing relevant databases, such as the lncrna - associated disease database lncrnadisease (38) and lncrna expression database nred (39). To facilitate the detection and annotation of lncrnas, we will also integrate analysis tools into lncrnawiki for lncrna detection and classification and employ automatic text mining in aid of lncrna - related literature curation . Strategic priority research program of the chinese academy of sciences [xdb13040500 to z.z . ]; national natural science foundation of china [31200978 to l.m . ]; base research fund of king abdullah university of science and technology [to v.b.b . ]; funding for open access charge: strategic priority research program of the chinese academy of sciences [xdb13040000].
|
Cone dystrophy is a type of hereditary retinal degeneration characterized by a progressive dysfunctioning of the cone photoreceptors . The possibility of cone dystrophy confined mainly in the periphery had been suggested [1, 2], and krill et al . Reported three patients with cone dystrophy, who had normal or near - normal visual acuities and normal color vision but had peripheral cone dysfunction . Peripheral cone dystrophy (pcd) is a very rare clinical entity, and its clinical characteristics have been presented in only six reports [27]. Kondo et al . Described the clinical features of three patients with pcd in which the peripheral cone system was more affected than the central cone system, and the rod system was completely preserved . Okuno et al . Reported on an elderly male patient with pcd whose symptoms had not changed for over 50 years . They concluded that the signs and symptoms of these patients were not manifested at an early stage in the more common type of pcd . The adaptive optics (ao) fundus camera can obtain images with a transverse resolution of <2 m which makes it possible to resolve individual cone photoreceptors and other retinal structures in living human eyes [810]. This technique has been used to analyze the cone photoreceptor mosaic in eyes with various inherited retinal degenerations [9, 1113]. An increase in the cone spacing, i.e., a reduction of cone density, in retinas with cone rod dystrophy has been detected by ao imaging [9, 11, 12]. The degree of reduction of the cone density was correlated with the decrease in visual function measured by multifocal electroretinography (mferg) [9, 11, 12]. A dark area in the ao fundus images was reported to be caused by disruptions of the interdigitation zone (iz; formerly called the cone outer segment tips line) in the spectral - domain optical coherence tomographic (sd - oct) images [14, 15]. We report our findings in a pcd patient who was examined by high - resolution imaging of the central and peripheral cone photoreceptors with high - resolution oct and ao analyses . The protocol of this study conformed to the tenets of the declaration of helsinki and was approved by the institutional review board of the nippon medical school . A written informed consent was signed by all participants after an explanation of the purpose of this study and possible complications . A 28-year - old japanese man (ju#0751) was diagnosed with pcd by the findings of full - field ergs and perimetry . The ophthalmological examinations included measurements of the best - corrected visual acuity (bcva), slit - lamp biomicroscopy, and dilated funduscopy . Short - wavelength autofluorescence (488 nm) and fluorescein and indocyanine green angiography (fa and icga) were performed with a confocal scanning laser ophthalmoscope (spectralis hra; heidelberg engineering, heidelberg, germany). The visual fields were obtained by goldmann kinetic perimetry (haag streit, bern, switzerland) and humphrey visual field analyzer (carl zeiss meditec, inc, dublin, ca, usa). The swedish interactive threshold algorithm standard strategy was used with program 30 - 2 of the humphrey visual field analyzer . Allen corneal contact lens electrodes with an eog - erg ganzfeld stimulator (electrophysiology system; lace elettronica, pisa, italy) according to the recommendation of the international society for clinical electrophysiology of vision (iscev). The mfergs were recorded with an mferg stimulating and recording system (veris science; electro - diagnostic imaging, inc . Redwood city, ca, usa) [17, 18]. The mean luminance of the stimulus was 103 cd / m, and the contrast was 95% . The overall stimulus area subtended approximately 40 at the cornea, and the frame rate was 75 hz . The pseudorandom stimulus presentation, the m - sequence, was at 21, and each run was divided into eight equal segments with a total recording time of about 4 min . The sd - oct images were acquired with a cirrus hd - oct (carl zeiss meditec). The b - scan retinal images were composed of 27,000/s consecutive a - scans passing through the center of the macula horizontally . In total, 1024 a - scans the total scan depth was 2 mm, the axial resolution was 5 m, and transverse resolution was 15 m . Since the single line scan sd - oct images are 6 mm long, an actual size was calculated by their pixel ratio . The 512 128 macular cube scan protocol was used to obtain the retinal thickness map . With this protocol, 128 cross - sectional b - scan images were obtained with each composed of 512 a - scans . En face oct images were obtained by swept source optical coherence tomography (dri oct-1 atlantis, topcon, japan). After the acquisition of cross - sectional b - scan images, en face oct images were reconstructed by the en - view program (topcon, japan). The flattening of the 3d - oct images based on the retinal - pigmented epithelium layer was performed, and then, a scan line was adjusted to iz zone to acquire en face images . High - resolution fundus images were taken using the flood - illuminated ao retinal camera (rtx1, imagine eyes, orsay, france). This system has been utilized to image individual cone photoreceptors [13, 1921] and other retinal structures [10, 21, 22]. The ao fundus camera illuminated a 4 square field with 850-nm infrared flashes to acquire en face images of the retina with a transverse optical resolution of 250 line pairs / mm . Successive ao images were taken at adjacent retinal locations with an angular spacing of 2 in the horizontal and vertical directions . This procedure allowed an overlap of the horizontal and vertical images of at least 2. prior to each acquisition, the focus depth was adjusted to the region corresponding to the ellipsoid zone (ez: also termed inner segment / outer segment junction) and the iz in the sd - oct images . The resulting images were stitched together by superimposing retinal vessel landmarks by an image editing software (gimp, the gimp development team; image j, national institute of health, bethesda, md). The size of each pixel was typically 0.8 m when calculated at the retinal plane, and the values were adjusted for variations in the axial length of the eye . To evaluate the cone patterns of normal controls and the patient with pcd, we used the automated cone labeling analysis software (aodetect; imagine eyes). Aodetect was developed by imagine eyes and allows researchers to obtain both the local density and a mean density within a user - defined region of interest . Aodetect also includes the program to calculate an actual length in the images by entering the axial length of the eye . The positions of the cone photoreceptors were computed by automatically detecting the central coordinates of small circular spots where the brightness was higher than the surrounding background . First, the averaged image without contrast adjustments was filtered to locate the maxima of the image . The spatial distribution of these points was analyzed using voronoi diagrams where the detected points served as generators . After automated cone labeling, the estimated cone labeling was manually verified by three investigators to minimize any potential cone under- or oversampling made by the automated software . As has been reported for similar systems, we found that our system did not always have a clear view of the individual cones within much of the central area . However, we could clearly distinguish individual cones at sites> 450 m from the fovea . Therefore, we obtained an estimate of cone density in a 50 50 m area at 600 m from the foveal center . The automated cone labeling did not identify each cone precisely in the images taken from the region with severe photoreceptor degeneration . To estimate the cone density of the patient, we manually selected circular spots of more than 4 m in the images where the brightness was obviously higher than the surrounding background level . The density of the cones was measured by three investigators separately to minimize any potential under- or oversampling of the cones . We examined the cone density at 600 m nasal from the fovea and also the axial length of 16 normal control eyes . There were 11 men and 5 women whose age ranged from 22 to 45 years (mean, 33.9 8.0 years) in this control group . We calculated the 95% confidence intervals, 95% prediction intervals, and r value of regression line of the cone density of normal controls . The ophthalmological examinations included measurements of the best - corrected visual acuity (bcva), slit - lamp biomicroscopy, and dilated funduscopy . Short - wavelength autofluorescence (488 nm) and fluorescein and indocyanine green angiography (fa and icga) were performed with a confocal scanning laser ophthalmoscope (spectralis hra; heidelberg engineering, heidelberg, germany). The visual fields were obtained by goldmann kinetic perimetry (haag streit, bern, switzerland) and humphrey visual field analyzer (carl zeiss meditec, inc, dublin, ca, usa). The swedish interactive threshold algorithm standard strategy was used with program 30 - 2 of the humphrey visual field analyzer . Allen corneal contact lens electrodes with an eog - erg ganzfeld stimulator (electrophysiology system; lace elettronica, pisa, italy) according to the recommendation of the international society for clinical electrophysiology of vision (iscev). The mfergs were recorded with an mferg stimulating and recording system (veris science; electro - diagnostic imaging, inc . The mean luminance of the stimulus was 103 cd / m, and the contrast was 95% . The overall stimulus area subtended approximately 40 at the cornea, and the frame rate was 75 hz . The pseudorandom stimulus presentation, the m - sequence, was at 21, and each run was divided into eight equal segments with a total recording time of about 4 min . The sd - oct images were acquired with a cirrus hd - oct (carl zeiss meditec). The b - scan retinal images were composed of 27,000/s consecutive a - scans passing through the center of the macula horizontally . In total, 1024 a - scans are contained in a b - scan image and 20 images are averaged . The total scan depth was 2 mm, the axial resolution was 5 m, and transverse resolution was 15 m . Since the single line scan sd - oct images are 6 mm long, an actual size was calculated by their pixel ratio . The 512 128 macular cube scan protocol was used to obtain the retinal thickness map . With this protocol, 128 cross - sectional b - scan images were obtained with each composed of 512 a - scans . En face oct images were obtained by swept source optical coherence tomography (dri oct-1 atlantis, topcon, japan). After the acquisition of cross - sectional b - scan images, en face oct images were reconstructed by the en - view program (topcon, japan). The flattening of the 3d - oct images based on the retinal - pigmented epithelium layer was performed, and then, a scan line was adjusted to iz zone to acquire en face images . High - resolution fundus images were taken using the flood - illuminated ao retinal camera (rtx1, imagine eyes, orsay, france). This system has been utilized to image individual cone photoreceptors [13, 1921] and other retinal structures [10, 21, 22]. The ao fundus camera illuminated a 4 square field with 850-nm infrared flashes to acquire en face images of the retina with a transverse optical resolution of 250 line pairs / mm . Successive ao images were taken at adjacent retinal locations with an angular spacing of 2 in the horizontal and vertical directions . This procedure allowed an overlap of the horizontal and vertical images of at least 2. prior to each acquisition, the focus depth was adjusted to the region corresponding to the ellipsoid zone (ez: also termed inner segment / outer segment junction) and the iz in the sd - oct images . The resulting images were stitched together by superimposing retinal vessel landmarks by an image editing software (gimp, the gimp development team; image j, national institute of health, bethesda, md). The size of each pixel was typically 0.8 m when calculated at the retinal plane, and the values were adjusted for variations in the axial length of the eye . To evaluate the cone patterns of normal controls and the patient with pcd, we used the automated cone labeling analysis software (aodetect; imagine eyes). Aodetect was developed by imagine eyes and allows researchers to obtain both the local density and a mean density within a user - defined region of interest . Aodetect also includes the program to calculate an actual length in the images by entering the axial length of the eye . The positions of the cone photoreceptors were computed by automatically detecting the central coordinates of small circular spots where the brightness was higher than the surrounding background . First, the averaged image without contrast adjustments was filtered to locate the maxima of the image . The spatial distribution of these points was analyzed using voronoi diagrams where the detected points served as generators . After automated cone labeling, the estimated cone labeling was manually verified by three investigators to minimize any potential cone under- or oversampling made by the automated software . As has been reported for similar systems, we found that our system did not always have a clear view of the individual cones within much of the central area . However, we could clearly distinguish individual cones at sites> 450 m from the fovea . Therefore, we obtained an estimate of cone density in a 50 50 m area at 600 m from the foveal center . The automated cone labeling did not identify each cone precisely in the images taken from the region with severe photoreceptor degeneration . To estimate the cone density of the patient, we manually selected circular spots of more than 4 m in the images where the brightness was obviously higher than the surrounding background level . The density of the cones was measured by three investigators separately to minimize any potential under- or oversampling of the cones . We examined the cone density at 600 m nasal from the fovea and also the axial length of 16 normal control eyes . There were 11 men and 5 women whose age ranged from 22 to 45 years (mean, 33.9 8.0 years) in this control group . We calculated the 95% confidence intervals, 95% prediction intervals, and r value of regression line of the cone density of normal controls . A 28-year - old man (ju#0751) first visited the department of ophthalmology of the jikei university school of medicine because of photophobia and difficulty in following objects in motion . He has had these symptoms for over 5 years, and they had become progressively worse . His non - consanguineous parents were unaffected, and he had no significant medical history . Magnetic resonance (mr) imaging and mr angiography of the brain showed no abnormalities . On the initial evaluation, the results of slit - lamp biomicroscopy were normal, and ophthalmoscopy showed mild temporal pallor of the optic disk but both maculas were normal (fig . Fa and icga did not show any hyper- or hypofluorescent regions at any phase (fig . 1fundus photographs, short - wavelength autofluorescence image, and fluorescein and indocyanine green angiograms from a patient with peripheral cone dystrophy (pcd). Fundus photographs (a, b), short - wavelength autofluorescence (c, d), fluorescein angiograms (e, f), and indocyanine green angiograms (g, h) are shown . Results from the right eye (a, c, e, g) and left eye (b, d, f, h) are shown . Mid - phase fluorescein and indocyanine green angiograms do not show any hyper- or hypofluorescent regions fundus photographs, short - wavelength autofluorescence image, and fluorescein and indocyanine green angiograms from a patient with peripheral cone dystrophy (pcd). Fundus photographs (a, b), short - wavelength autofluorescence (c, d), fluorescein angiograms (e, f), and indocyanine green angiograms (g, h) are shown . Results from the right eye (a, c, e, g) and left eye (b, d, f, h) are shown . Mid - phase fluorescein and indocyanine green angiograms do not show any hyper- or hypofluorescent regions goldmann visual field tests showed that the peripheral visual fields were full, but a relative scotoma was found within 20 of the fovea in both eyes (fig . The results of humphrey visual field analyzer with the central 30 - 2 sita - standard program showed mean deviation (md) values of 9.98 db for the right eyes (p <0.5%) and 9.78 db for the left eyes (p <0.5%). The pattern standard deviation (psd) values were 5.21 db for the right eye (p <0.5%) and 7.53 db for the left eye (p <0.5; fig . . Results of goldman kinetic perimetry (a, b) and pattern standard deviation of humphrey visual field analyzer (c, d) are shown . Results from the right eye (b, d) and left eye (a, c) are shown . Goldmann visual field tests show that the peripheral visual fields are full, but a relative central scotoma is present within 20 of the fovea in both eyes . Humphrey visual field testing (30 - 2) shows a relative central scotoma within 20 in right eye and 30 in left eye in the pcd patient . Results of goldman kinetic perimetry (a, b) and pattern standard deviation of humphrey visual field analyzer (c, d) are shown . Results from the right eye (b, d) and left eye (a, c) are shown . Goldmann visual field tests show that the peripheral visual fields are full, but a relative central scotoma is present within 20 of the fovea in both eyes . Humphrey visual field testing (30 - 2) shows a relative central scotoma within 20 in right eye and 30 in left eye in the pcd patient . The central sensitivity is preserved locally in both eyes the color vision assessed monocularly with the ishihara test (38-plate edition) and the farnsworth panel d-15 (panel d-15) was normal in both eyes . The sd - oct images showed a disruption of both the ez and iz throughout the macular region except at the foveal center (fig . The macular thickness was normal only within 1 mm diameter of the foveal center, whereas the paracentral areas were thinner (fig . The iz reflectance in the central fovea is slightly wider and brighter than normal.fig . Images of horizontal sd - oct scan (a, d, g), macular thickness maps (b, e, h), and en face sd - oct are shown (c, f, i). Images from the right eye (a c) and left eye (d f) of a patient with pcd and left eye of normal control (g i) are shown . Sd - oct shows attenuation of both the ez and iz throughout the region except for about 1 mm at the center of the fovea . The retinal thickness map shows normal macular thickness within 1 mm diameter of the foveal center, but the parafoveal areas are thinner . En face oct images of the patient show an oval, high - intensity area surrounded by low - intensity region . Note that the oct findings in both eyes of the patient are similar spectral - domain optical coherence tomographic (sd - oct) images . Images of horizontal sd - oct scan (a, d, g), macular thickness maps (b, e, h), and en face sd - oct are shown (c, f, i). Images from the right eye (a c) and left eye (d f) of a patient with pcd and left eye of normal control (g i) are shown . Sd - oct shows attenuation of both the ez and iz throughout the region except for about 1 mm at the center of the fovea . The retinal thickness map shows normal macular thickness within 1 mm diameter of the foveal center, but the parafoveal areas are thinner . En face oct images of the patient show an oval, high - intensity area surrounded by low - intensity region . Note that the oct findings in both eyes of the patient are similar en face oct images with a scan line adjusted to the level of the iz showed an oval, high - intensity area that corresponded to residual izs in the b - scan oct images (fig . The high - intensity area was surrounded by a low - intensity area corresponding to an attenuation of the iz in the b - scan oct images (fig . 3c, f). The amplitudes and implicit times of the scotopic full - field ergs elicited by 0.01 and 3.0 stimuli were normal (fig . The amplitudes of the b - waves of the photopic ergs elicited by 3.0 stimuli and the photopic light - adapted 3.0 flicker responses were markedly reduced in both eyes (fig . The results of mfergs showed slightly detectable responses in the central area of left eye; however, the amplitudes of the other area were severely reduced in the patients (fig . 4full - field and multifocal electroretinograms (ergs). Full - field and multifocal ergs recorded from normal control and the pcd patient are shown . The dark - adapted 0.01, dark - adapted 3.0, light - adapted 3.0, and light - adapted 3.0 flicker ergs of full - field ergs are shown (a). The amplitudes and implicit times of the dark - adapted 0.01 and dark - adapted 3.0 are normal . The amplitudes of the b - wave of the light - adapted 3.0 and light - adapted 3.0 flicker responses are markedly reduced in both eyes . The results of mfergs showed slightly detectable responses in the central area of left eye; however, the amplitudes of the other area were severely reduced in the patients (b) full - field and multifocal electroretinograms (ergs). Full - field and multifocal ergs recorded from normal control and the pcd patient are shown . The dark - adapted 0.01, dark - adapted 3.0, light - adapted 3.0, and light - adapted 3.0 flicker ergs of full - field ergs are shown (a). The amplitudes and implicit times of the dark - adapted 0.01 and dark - adapted 3.0 are normal . The amplitudes of the b - wave of the light - adapted 3.0 and light - adapted 3.0 flicker responses are markedly reduced in both eyes . The results of mfergs showed slightly detectable responses in the central area of left eye; however, the amplitudes of the other area were severely reduced in the patients (b) high - resolution en face ao imaging did not detect regular cone mosaics especially more than 450 m from the fovea, while the ao images of normal control showed well - ordered cone mosaic in this area (figs . The oval area of residual cone photoreceptors in the ao image was similar to the shape of residual iz in the en face oct image (fig . Sd - oct (a) and low - magnification ao (b) images are shown . The width of the sd - oct image in a corresponds to the width of the ao image in b. blue arrows in a indicate the edge of discernable ez and iz . Blue arrows in b point to the same location in a. yellow cross in b indicates the fixation point . Note that cone density of areas more than 450 m from the fovea is very low . The oval area of residual cone photoreceptors in b was similar to the shape of residual iz in the en face oct image (fig . 6sd - oct and high - magnification ao images . Magnified sd - oct images of a normal control (a) and pcd patient (b) are shown . Yellow boxes in a and b are nasal areas at 600, 450, and 300 m away from the foveal center . A montage of low - magnification ao image of normal control (c) and the patient (d) is shown . Yellow boxes in c and d are also nasal areas at 600, 450, and 300 m away from the foveal center (f). (e j) magnified view of the area outlined in c and d is shown . The area at 600 m (e), 450 m (f), and 300 m (g) nasal from the foveal center in normal control is shown . The area at 600 m (h), 450 m (i), and 300 m (j) nasal from the foveal center in the patient is shown . Regular cone mosaics are not observed especially more than 450 m from the fovea in the patient, while ao image of normal control shows well - ordered cone mosaic . Sd - oct (a) and low - magnification ao (b) images are shown . The width of the sd - oct image in a corresponds to the width of the ao image in b. blue arrows in a indicate the edge of discernable ez and iz . Blue arrows in b point to the same location in a. yellow cross in b indicates the fixation point . Note that cone density of areas more than 450 m from the fovea is very low . The oval area of residual cone photoreceptors in b was similar to the shape of residual iz in the en face oct image (fig . Magnified sd - oct images of a normal control (a) and pcd patient (b) are shown . Yellow boxes in a and b are nasal areas at 600, 450, and 300 m away from the foveal center . A montage of low - magnification ao image of normal control (c) and the patient (d) is shown . Yellow boxes in c and d are also nasal areas at 600, 450, and 300 m away from the foveal center (f). (e j) magnified view of the area outlined in c and d is shown . The area at 600 m (e), 450 m (f), and 300 m (g) nasal from the foveal center in normal control is shown . The area at 600 m (h), 450 m (i), and 300 m (j) nasal from the foveal center in the patient is shown . Regular cone mosaics are not observed especially more than 450 m from the fovea in the patient, while ao image of normal control shows well - ordered cone mosaic . Bar 100 m we also examined the cone density at 600 m nasal from the fovea and the axial length of 16 normal control eyes . The values were compared to the findings in the cone density at 600 m nasal from the fovea in the patient (fig . It is well known that there is a significant negative correlation between the axial length and cone density [24, 25], and the correlation coefficient was 0.6532 for the normal controls . The mean and standard deviation of the cone density of this normal control group were 262.8 38.5 (100 cones / mm). The cone densities of both eyes in the patient were severely decreased and well outside the standard deviation and 95% prediction interval of the normal controls (fig . There was a statistically significant negative correlation between cone density and axial length (r = 0.6532). Upper and lower limits of 95% confidence intervals, 95% prediction intervals, and regression line of normal controls are shown . The results of estimated cone density and axial length of the patient are plotted as indicated marks statistical data of adaptive optics analyses . There was a statistically significant negative correlation between cone density and axial length (r = 0.6532). Upper and lower limits of 95% confidence intervals, 95% prediction intervals, and regression line of normal controls are shown . The results of estimated cone density and axial length of the patient are plotted as indicated marks a 28-year - old man (ju#0751) first visited the department of ophthalmology of the jikei university school of medicine because of photophobia and difficulty in following objects in motion . He has had these symptoms for over 5 years, and they had become progressively worse . His non - consanguineous parents were unaffected, and he had no significant medical history . Magnetic resonance (mr) imaging and mr angiography of the brain showed no abnormalities . On the initial evaluation, the results of slit - lamp biomicroscopy were normal, and ophthalmoscopy showed mild temporal pallor of the optic disk but both maculas were normal (fig . Fa and icga did not show any hyper- or hypofluorescent regions at any phase (fig . 1fundus photographs, short - wavelength autofluorescence image, and fluorescein and indocyanine green angiograms from a patient with peripheral cone dystrophy (pcd). Fundus photographs (a, b), short - wavelength autofluorescence (c, d), fluorescein angiograms (e, f), and indocyanine green angiograms (g, h) are shown . Results from the right eye (a, c, e, g) and left eye (b, d, f, h) are shown . Mid - phase fluorescein and indocyanine green angiograms do not show any hyper- or hypofluorescent regions fundus photographs, short - wavelength autofluorescence image, and fluorescein and indocyanine green angiograms from a patient with peripheral cone dystrophy (pcd). Fundus photographs (a, b), short - wavelength autofluorescence (c, d), fluorescein angiograms (e, f), and indocyanine green angiograms (g, h) are shown . Results from the right eye (a, c, e, g) and left eye (b, d, f, h) are shown . Mid - phase fluorescein and indocyanine green angiograms do not show any hyper- or hypofluorescent regions goldmann visual field tests showed that the peripheral visual fields were full, but a relative scotoma was found within 20 of the fovea in both eyes (fig . The results of humphrey visual field analyzer with the central 30 - 2 sita - standard program showed mean deviation (md) values of 9.98 db for the right eyes (p <0.5%) and 9.78 db for the left eyes (p <0.5%). The pattern standard deviation (psd) values were 5.21 db for the right eye (p <0.5%) and 7.53 db for the left eye (p <0.5; fig . . Results of goldman kinetic perimetry (a, b) and pattern standard deviation of humphrey visual field analyzer (c, d) are shown . Results from the right eye (b, d) and left eye (a, c) are shown . Goldmann visual field tests show that the peripheral visual fields are full, but a relative central scotoma is present within 20 of the fovea in both eyes . Humphrey visual field testing (30 - 2) shows a relative central scotoma within 20 in right eye and 30 in left eye in the pcd patient . Results of goldman kinetic perimetry (a, b) and pattern standard deviation of humphrey visual field analyzer (c, d) are shown . Results from the right eye (b, d) and left eye (a, c) are shown . Goldmann visual field tests show that the peripheral visual fields are full, but a relative central scotoma is present within 20 of the fovea in both eyes . Humphrey visual field testing (30 - 2) shows a relative central scotoma within 20 in right eye and 30 in left eye in the pcd patient . The central sensitivity is preserved locally in both eyes the color vision assessed monocularly with the ishihara test (38-plate edition) and the farnsworth panel d-15 (panel d-15) was normal in both eyes . The sd - oct images showed a disruption of both the ez and iz throughout the macular region except at the foveal center (fig . The macular thickness was normal only within 1 mm diameter of the foveal center, whereas the paracentral areas were thinner (fig . The iz reflectance in the central fovea is slightly wider and brighter than normal.fig . Images of horizontal sd - oct scan (a, d, g), macular thickness maps (b, e, h), and en face sd - oct are shown (c, f, i). Images from the right eye (a c) and left eye (d f) of a patient with pcd and left eye of normal control (g i) are shown . Sd - oct shows attenuation of both the ez and iz throughout the region except for about 1 mm at the center of the fovea . The retinal thickness map shows normal macular thickness within 1 mm diameter of the foveal center, but the parafoveal areas are thinner . En face oct images of the patient show an oval, high - intensity area surrounded by low - intensity region . Note that the oct findings in both eyes of the patient are similar spectral - domain optical coherence tomographic (sd - oct) images . Images of horizontal sd - oct scan (a, d, g), macular thickness maps (b, e, h), and en face sd - oct are shown (c, f, i). Images from the right eye (a c) and left eye (d f) of a patient with pcd and left eye of normal control (g i) are shown . Sd - oct shows attenuation of both the ez and iz throughout the region except for about 1 mm at the center of the fovea . The retinal thickness map shows normal macular thickness within 1 mm diameter of the foveal center, but the parafoveal areas are thinner . En face oct images of the patient show an oval, high - intensity area surrounded by low - intensity region . Note that the oct findings in both eyes of the patient are similar en face oct images with a scan line adjusted to the level of the iz showed an oval, high - intensity area that corresponded to residual izs in the b - scan oct images (fig . The high - intensity area was surrounded by a low - intensity area corresponding to an attenuation of the iz in the b - scan oct images (fig . 3c, f). The amplitudes and implicit times of the scotopic full - field ergs elicited by 0.01 and 3.0 stimuli were normal (fig . The amplitudes of the b - waves of the photopic ergs elicited by 3.0 stimuli and the photopic light - adapted 3.0 flicker responses were markedly reduced in both eyes (fig . The results of mfergs showed slightly detectable responses in the central area of left eye; however, the amplitudes of the other area were severely reduced in the patients (fig . 4full - field and multifocal electroretinograms (ergs). Full - field and multifocal ergs recorded from normal control and the pcd patient are shown . The dark - adapted 0.01, dark - adapted 3.0, light - adapted 3.0, and light - adapted 3.0 flicker ergs of full - field ergs are shown (a). The amplitudes and implicit times of the dark - adapted 0.01 and dark - adapted 3.0 are normal . The amplitudes of the b - wave of the light - adapted 3.0 and light - adapted 3.0 flicker responses are markedly reduced in both eyes . The results of mfergs showed slightly detectable responses in the central area of left eye; however, the amplitudes of the other area were severely reduced in the patients (b) full - field and multifocal electroretinograms (ergs). Full - field and multifocal ergs recorded from normal control and the pcd patient are shown . The dark - adapted 0.01, dark - adapted 3.0, light - adapted 3.0, and light - adapted 3.0 flicker ergs of full - field ergs are shown (a). The amplitudes and implicit times of the dark - adapted 0.01 and dark - adapted 3.0 are normal . The amplitudes of the b - wave of the light - adapted 3.0 and light - adapted 3.0 flicker responses are markedly reduced in both eyes . The results of mfergs showed slightly detectable responses in the central area of left eye; however, the amplitudes of the other area were severely reduced in the patients (b) high - resolution en face ao imaging did not detect regular cone mosaics especially more than 450 m from the fovea, while the ao images of normal control showed well - ordered cone mosaic in this area (figs . 5b, 6c the oval area of residual cone photoreceptors in the ao image was similar to the shape of residual iz in the en face oct image (fig . Sd - oct (a) and low - magnification ao (b) images are shown . The width of the sd - oct image in a corresponds to the width of the ao image in b. blue arrows in a indicate the edge of discernable ez and iz . Blue arrows in b point to the same location in a. yellow cross in b indicates the fixation point . Note that cone density of areas more than 450 m from the fovea is very low . The oval area of residual cone photoreceptors in b was similar to the shape of residual iz in the en face oct image (fig . 6sd - oct and high - magnification ao images . Magnified sd - oct images of a normal control (a) and pcd patient (b) are shown . Yellow boxes in a and b are nasal areas at 600, 450, and 300 m away from the foveal center . A montage of low - magnification ao image of normal control (c) and the patient (d) is shown . Yellow boxes in c and d are also nasal areas at 600, 450, and 300 m away from the foveal center (f). (e j) magnified view of the area outlined in c and d is shown . The area at 600 m (e), 450 m (f), and 300 m (g) nasal from the foveal center in normal control is shown . The area at 600 m (h), 450 m (i), and 300 m (j) nasal from the foveal center in the patient is shown . Regular cone mosaics are not observed especially more than 450 m from the fovea in the patient, while ao image of normal control shows well - ordered cone mosaic . Sd - oct (a) and low - magnification ao (b) images are shown . The width of the sd - oct image in a corresponds to the width of the ao image in b. blue arrows in a indicate the edge of discernable ez and iz . Blue arrows in b point to the same location in a. yellow cross in b indicates the fixation point . Note that cone density of areas more than 450 m from the fovea is very low . The oval area of residual cone photoreceptors in b was similar to the shape of residual iz in the en face oct image (fig . Magnified sd - oct images of a normal control (a) and pcd patient (b) are shown . Yellow boxes in a and b are nasal areas at 600, 450, and 300 m away from the foveal center . A montage of low - magnification ao image of normal control (c) and the patient (d) is shown . Yellow boxes in c and d are also nasal areas at 600, 450, and 300 m away from the foveal center (f). (e j) magnified view of the area outlined in c and d is shown . The area at 600 m (e), 450 m (f), and 300 m (g) nasal from the foveal center in normal control is shown . The area at 600 m (h), 450 m (i), and 300 m (j) nasal from the foveal center in the patient is shown . Regular cone mosaics are not observed especially more than 450 m from the fovea in the patient, while ao image of normal control shows well - ordered cone mosaic . M we also examined the cone density at 600 m nasal from the fovea and the axial length of 16 normal control eyes . The values were compared to the findings in the cone density at 600 m nasal from the fovea in the patient (fig . It is well known that there is a significant negative correlation between the axial length and cone density [24, 25], and the correlation coefficient was 0.6532 for the normal controls . The mean and standard deviation of the cone density of this normal control group were 262.8 38.5 (100 cones / mm). The cone densities of both eyes in the patient were severely decreased and well outside the standard deviation and 95% prediction interval of the normal controls (fig . There was a statistically significant negative correlation between cone density and axial length (r = 0.6532). Upper and lower limits of 95% confidence intervals, 95% prediction intervals, and regression line of normal controls are shown . The results of estimated cone density and axial length of the patient are plotted as indicated marks statistical data of adaptive optics analyses . There was a statistically significant negative correlation between cone density and axial length (r = 0.6532). Upper and lower limits of 95% confidence intervals, 95% prediction intervals, and regression line of normal controls are shown . The results of estimated cone density and axial length of the patient are plotted as indicated marks the concept of regional cone dystrophy has been proposed by some clinicians, and eyes with regional cone dystrophy were thought to have either a central or peripheral cone dystrophy [1, 2, 26]. In eyes diagnosed with pcd, the cone system is impaired predominantly in the periphery, and the rod system is completely preserved even in areas where the cone system is impaired [1, 2]. The results of an earlier study showed that patients with pcd retained normal or near - normal visual acuities and normal color vision . Our patient had normal visual acuity, normal color vision, and normal scotopic full - field ergs in both eyes in spite of a severe impairment of the cone system . These results are consistent with the clinical characteristics of pcd . At present, there are only a few reports on the sd - oct characteristics of eyes with pcd . Reported that the parafoveal retina was thinner, but the central macular area had normal thickness [5, 6]. The sd - oct images in their patients also showed normal ez and iz throughout the macular region [5, 6]. In addition, mochizuki et al . Also reported a thinning of the outer nuclear layer (onl) in the parafoveal area . The sd - oct images from our patient showed a thinning of the parafoveal retina and attenuation of the parafoveal ez and iz . These findings are not completely consistent with earlier observations; however, our patient may have been at a more advanced stage of pcd compared to the patients reported earlier . Ao analysis showed a marked decrease in the cone density at 450 m from the foveal center in the patient . The oval area of residual cone photoreceptors in the ao image was similar to the shape of residual iz in the en face oct images . Because cone labeling and cone counting were performed manually, the estimated cone density may not be an accurate number of healthy cones . However, we noted that the cone mosaic was severely disorganized in the patient compared to normal controls, especially at 450 m from the foveal center . A comparison of the ez and iz in the oct images and the ao images of our patient showed that the disorganization of the cones in the ao images was consistent with the disrupted ez and iz in the oct images . Also, a well - organized cone mosaic in the normal controls corresponded with clearly distinguishable ez and iz in the sd - oct images . Because both the iz in the sd - oct images and the ao images focused to the iz level showed morphological feature of the same region, the ao and sd - oct findings in the case were in good agreement . Genetically, the patient s parents were unaffected and non - consanguineous which suggests an autosomal recessive inheritance . Kondo et al . Presented two siblings with pcd, but the causative gene for the pcd was not determined . Quite similar b - scan and en face sd - oct findings from each eyes of our patient suggested that the pathology was inherited rather than due to inflammation or trauma . Our findings indicate that the pcd diagnosed by full - field ergs and perimetry is due to a reduction in the density of parafoveal and peripheral cones . Because we have investigated only one patient, our study does not allow us to draw strong conclusions on why the degeneration is greater in the parafoveal cone photoreceptors with relative sparing of the central cone photoreceptors . To identify the molecular pathogenesis of pcd may clarify the mechanisms of foveal sparing of cone degeneration.
|
The exposure of the ear to noise is a known, identified factor leading to hearing loss . In various types of surgeries of the ear and ear - related conductive bones, a wide variety of devices are used that are potential sources of high - frequency noise outputs, which accounts for cochlear acoustic trauma . Drills and surgical tools (such as suctions) can especially cause noise - induced hearing loss when used on or adjacent to the ossicular chain and stapes footplate and during work on the mastoid bone, thus drill - generated noise has been ascertained as the main cause of hearing loss in the operated ear and even in the contralateral healthy ear . By drill administration during mastoid surgery, the healthy ear may be exposed to severe noise levels . It has been shown that drilling in mastoidectomy may involve exposing the ear to noise of about 100 db and the contralateral cochlea to levels 5 - 10 db lower . In this context, drill - generated noise levels and the exposure time interval may be major determinants of hearing loss levels . In a mastoid surgery procedure, higher levels of noise - induced hearing losses are expected due to longer times of exposure to drilling . In most patients, drilling in mastoid surgery may result in temporary noise - induced hearing loss, especially in the contralateral healthy ear; however, the hearing threshold recovery time in the contralateral healthy ear after acoustic trauma and its main determinants remain uncertain . The present study aimed to assess hearing threshold recovery in the contralateral healthy ear after acoustic trauma following mastoid surgery . From june 2012 to june 2014, 28 consecutive patients (13 male, 15 female) with chronic otitis media or even cholesteatoma who had been scheduled for tympanomastoidectomy of either the canal wall down type or the canal intact type, which would be decided at the operational time based on the severity of the disease, were included in this prospective survival analysis study . The patients had been selected consecutively from two hospital clinics of shahid sadoughi university of medical sciences (shahid sadoughi and shahid rahnemoon hospital clinics), but the site where the audiologist did the primary and postoperative acoustic evaluation and the hospital where each patient was operated on were the same (shahid sadoughi hospital). The main exclusion criteria for this study were as follows: an underlying ear disorder in the healthy ear; lack of regular follow - up of patients; unwillingness to participate in the study; the presence of at least 4 days in the hospital; a history of the recent usage of ototoxic medications or any type of previous otologic surgeries on each side; or a history of mnire's disease or any kind of systemic disease, including even psychological disorders . In addition, the type of surgery, side of the involved ear, and mean time of drilling were also noted by reviewing the records files of the operating room . This study was the result of a residency thesis at shahid sadoughi hospital of shahid sadoughi university of medical sciences and was approved by the ethics committee of research and the vice - chancellor of the university . Written consent forms were assigned by our patients for their informed participation in the present study (in persian). The target ear (the healthy one) was normal in each patient in all otoscopic, microscopic, and audiometric presurgical examinations . Standard pta (ac40, interacoustic, assens, denmark, headphone: tdh39) was performed before the tympanomastoidectomy and 24 h, 48 h, 72 h, and 96 h after the surgery . Pure - tone air and bone conduction audiometries for the frequencies of 250 hz, 500 hz, 1000 hz, 2000 hz, 3000 hz, 4000 hz, and 8000 hz were measured for all targeted contralateral healthy ears . Dpoae values were measured using madsen's capella equipment (gn otometrics ltd ., taastrup, denmark) by the same constant audiologist for all patients before surgery as well as 6 h after surgery and continued every 24 h to detect any significant hearing losses in the postoperative period until hearing thresholds reached their baseline measures . The data were evaluated by an optoacoustic emission (oae) software (otoscreen oae screening and noah - based software, assens, denmark). Dpoae was calculated and compared pre- and postoperatively with hearing levels at 0.5 khz, 1 khz, 2 khz, 4 khz, 6 khz, and 8 khz . The stimuli levels were pointed constant levels at l1 = 65 db spl (sound pressure level) and l2 = 55 db spl . Their ranges were evaluated and analyzed statistically . Also, the hearing threshold recovery time at each frequency was recorded . Additionally, all procedures were conducted using a similar type of drill with a drill speed of about 1700 rounds / min, and by the same surgeon (the first author). At the end of the study, all participants were also asked to state their feelings regarding hearing loss or hearing improvement at different time points after surgery . The results were reported as mean standard deviation (sd) for the quantitative variables and percentages for the categorical variables . The groups were compared using student's t - test or the mann - whitney u test for the continuous variables and the chi - square test (or fisher's exact test, if required) for the categorical variables . Changes in quantitative parameters after the exercise test compared with before the test were detected by a paired t - test or the wilcoxon signed - rank test . Kaplan - meier survival analysis was used to determine the overall survival of hearing loss . All the statistical analyses were performed using spss version 20.0 (spss inc ., chicago, il, usa). Standard pta (ac40, interacoustic, assens, denmark, headphone: tdh39) was performed before the tympanomastoidectomy and 24 h, 48 h, 72 h, and 96 h after the surgery . Pure - tone air and bone conduction audiometries for the frequencies of 250 hz, 500 hz, 1000 hz, 2000 hz, 3000 hz, 4000 hz, and 8000 hz were measured for all targeted contralateral healthy ears . Dpoae values were measured using madsen's capella equipment (gn otometrics ltd ., taastrup, denmark) by the same constant audiologist for all patients before surgery as well as 6 h after surgery and continued every 24 h to detect any significant hearing losses in the postoperative period until hearing thresholds reached their baseline measures . The data were evaluated by an optoacoustic emission (oae) software (otoscreen oae screening and noah - based software, assens, denmark). Dpoae was calculated and compared pre- and postoperatively with hearing levels at 0.5 khz, 1 khz, 2 khz, 4 khz, 6 khz, and 8 khz . The stimuli levels were pointed constant levels at l1 = 65 db spl (sound pressure level) and l2 = 55 db spl . Their ranges were evaluated and analyzed statistically . Also, the hearing threshold recovery time at each frequency was recorded . Additionally, all procedures were conducted using a similar type of drill with a drill speed of about 1700 rounds / min, and by the same surgeon (the first author). At the end of the study, all participants were also asked to state their feelings regarding hearing loss or hearing improvement at different time points after surgery . The results were reported as mean standard deviation (sd) for the quantitative variables and percentages for the categorical variables . The groups were compared using student's t - test or the mann - whitney u test for the continuous variables and the chi - square test (or fisher's exact test, if required) for the categorical variables . Changes in quantitative parameters after the exercise test compared with before the test were detected by a paired t - test or the wilcoxon signed - rank test . Kaplan - meier survival analysis was used to determine the overall survival of hearing loss . All the statistical analyses were performed using spss version 20.0 (spss inc ., chicago, il, usa). Standard pta (ac40, interacoustic, assens, denmark, headphone: tdh39) was performed before the tympanomastoidectomy and 24 h, 48 h, 72 h, and 96 h after the surgery . Pure - tone air and bone conduction audiometries for the frequencies of 250 hz, 500 hz, 1000 hz, 2000 hz, 3000 hz, 4000 hz, and 8000 hz were measured for all targeted contralateral healthy ears . Dpoae values were measured using madsen's capella equipment (gn otometrics ltd ., taastrup, denmark) by the same constant audiologist for all patients before surgery as well as 6 h after surgery and continued every 24 h to detect any significant hearing losses in the postoperative period until hearing thresholds reached their baseline measures . The data were evaluated by an optoacoustic emission (oae) software (otoscreen oae screening and noah - based software, assens, denmark). Dpoae was calculated and compared pre- and postoperatively with hearing levels at 0.5 khz, 1 khz, 2 khz, 4 khz, 6 khz, and 8 khz . The stimuli levels were pointed constant levels at l1 = 65 db spl (sound pressure level) and l2 = 55 db spl . Their ranges were evaluated and analyzed statistically . Also, the hearing threshold recovery time at each frequency was recorded . Additionally, all procedures were conducted using a similar type of drill with a drill speed of about 1700 rounds / min, and by the same surgeon (the first author). At the end of the study, all participants were also asked to state their feelings regarding hearing loss or hearing improvement at different time points after surgery . The results were reported as mean standard deviation (sd) for the quantitative variables and percentages for the categorical variables . The groups were compared using student's t - test or the mann - whitney u test for the continuous variables and the chi - square test (or fisher's exact test, if required) for the categorical variables . Changes in quantitative parameters after the exercise test compared with before the test were detected by a paired t - test or the wilcoxon signed - rank test . Kaplan - meier survival analysis was used to determine the overall survival of hearing loss . All the statistical analyses were performed using spss version 20.0 (spss inc ., chicago, il, usa). In this study, 28 patients were assessed with the mean age 35.57 11.61 years (median 32.5 years, range 16 to 62 years); of them, 46.4% were male . The healthy ear was on the right side in 39.3% and on the left side in 60.7% of patients . There was no significant statistical difference in hearing recovery time between different frequencies according to patients gender or the side of the affected ear . The mean time of drilling was 56.48 12.70 min (median 55 min, range 40 - 90 min) which was not statistically relevant to the hearing recovery time period . Regarding the level of hearing based on pta, there was a significant difference in hearing level 24 h after surgery compared to that before surgery at frequencies of 3000 - 8000 hz . Mean hearing threshold changes, considering all frequencies, were 4.2 db after 24 h, 4.26 db after 48 h (without any statistical significance at 3 khz and 4 khz), and 9 . 4 db, after 72 h of the surgery (which was only statistically considerable at 6 khz and 8 khz). Mean hearing loss in regarding each of the examined frequencies has been described in db in table 1 in detail . Mean hearing thresholds (db) at different frequencies based on the pta pta = pure - tone audiometry there was no significant change in hearing levels at 250 hz, 500 hz, and 1000 hz based on the pta or dpoae [figures 15]. Also, the difference in the level of hearing based on pta was shown in two cases 96 h after surgery at two frequencies of 6000 hz and 8000 hz, which was not statistically significant . Furthermore, according to dpoae analysis, the difference in the level of hearing was found 6 h and 24 h after surgery at frequencies of 2000 - 8000 hz . The difference in hearing levels at 48 h and 72 h after surgery compared to before surgery was significant at the frequencies of 4000 hz, 6000 hz, and 8000 hz . However, this difference was found in none of frequencies at 96 h after surgery when compared to before surgery . At the beginning of the study, if a patient forgot to smention any particular drug that he used to take for any other medical disorder, such as acne vulgaris (isotretinoin), because in his opinion, that drug was not related to the ear problem, we were forced to omit him from the study because that very drug has been proved to have significant effects on pta hearing levels . Thus, after that we tried to ask about each type of drug that has documented side effects on the outer hair cells of the cochlea from each case orally, and documented the findings in the preliminary presurgical interview and visits . Hearing levels at 250 hz according to different times after the surgery (pta) hearing levels at 500 hz according to different times after the surgery (pta) hearing levels at 1000 hz according to different times after the surgery (pta) hearing level dpoae amplitudes in 500 hz according to different times after the surgery hearing level dpoae amplitudes in 1000 hz according to different times after the surgery with respect to the survival of hearing loss based on pta, the survival rate in nonoperated ears at frequencies of 3000 hz, 4000 hz, 6000 hz, and 8000 hz was 44.4%, 36.4%, 51.7%, and 47.4%, 24 h after surgery; 11.1%, 9.1%, 10.3%, and 13.2%, 48 h after surgery; and 0%, 0%, 3.4%, and 2.6%, 72 h after surgery . At all frequencies at 96 h after surgery, the survival rate of hearing loss was determined to be 0% . In this regard, the survival rate in the nonoperated ear based on dpoae at frequencies of 2000 hz, 4000 hz, 6000 hz, and 8000 hz was 96.4%, 94.3%, 94.3%, and 99.3%, 6 h after surgery; 74.9%, 86.7%, 89.2%, and 97.5%, 24 h after surgery; 49.9%, 64.0%, 70.1%, and 82.4%, 48 h after surgery; and 25.0%, 33.1%, 38.8%, and 54.5%, 72 h after surgery, respectively . Tables 2 and 3 depict these survival percentages as the number of each patients with constant hearing loss, according to the postsurgical time at each frequency . At all frequencies at 96 h after surgery, the survival rate of hearing loss was 0% . The mean hearing recovery time for nonoperated ears based on pta was 61.98 26.76 h (at 3000 hz) [figure 6], 62.73 26.50 h (4000 hz) [figure 7], 67.08 25.90 h (6000 hz) [figure 8], and 70.70 24.13 h (8000 hz) [figure 9]. Also, the mean hearing recovery time for nonoperated ears based on dpoae was 58.58 28.39 h (2000 hz) [figure 10], 63.32 28.83h (4000 hz) [figure 11], 65.22 29.13 h (6000 hz) [figure 12], and 75.14 22.70 h (8000 hz) [figure 13]. Comparison of hearing loss and number of patients, according to the frequencies in pta pta = pure - tone audiometry number of patients with postsurgical hearing loss, according to the frequencies in dpoae dpoae = distortion - product otoacoustic emission hearing levels at 3000 hz according to different times after the surgery (pta) hearing levels at 4000 hz according to different times after the surgery (pta) hearing levels at 6000 hz according to different times after the surgery (pta) hearing levels at 8000 hz according to different times after the surgery (pta) hearing level dpoae amplitudes in 2000 hz according to different times after the surgery hearing level dpoae amplitudes in 4000 hz according to different times after the surgery hearing level dpoae amplitudes in 6000 hz according to different times after the surgery hearing level dpoae amplitudes in 8000 hz according to different times after the surgery mean hearing thresholds (expressed as db) at different frequencies based on pta and hearing loss amplitudes (spl) of patients according to the frequencies in dpoae are shown in tables 1 and 4 respectively . Comparison of hearing loss amplitudes (spl) of patients, according to the frequencies in dpoae spl = sound pressure level; dpoae = distortion - product otoacoustic emission; sd = standard deviation mean hearing loss levels [pre - and postoperation difference (in db)] of patients according to the frequencies in pta have been illustrated in table 5 . Mean hearing loss threshold pre- and postoperation difference (db) of patients, according to the frequencies in pta pta = pure - tone audiometry; sd = standard deviation with regard to the patients feelings regarding changes in hearing level, the similarity in hearing levels before and after surgery at 24 h, 48 h, 72 h, and 96 h after surgery was reported in 17.9%, 35.7%, 46.4, and 96.4% of cases respectively . The present study attempted to assess hearing loss survival originating from drilling in the healthy, nonoperated ear in patients who were undergoing mastoid surgery . In fact, we aimed to determine the time point for achieving complete healing and recovery of hearing in the healthy ear after drilling of the mastoid . The main point of the study was that the hearing recovery time in the nonoperated ear was mostly less than 72 h with, on average, 65.56 27.26 h and 65.62 25.8 h for pta and dpoae respectively . On the other hand, the survival of hearing loss in this ear lasted for less than 72 h. in fact, following the drilling in the mastoidectomy procedure, hearing loss especially at the frequencies higher than 2000 hz may occur that is mainly temporary and reversible, leading to complete recovery after 72 h. a few studies assessed the mean recovery time for recovered hearing levels . In the migirov and et al . Study, the dpoae amplitudes were significantly decreased at 2 khz and 4 khz immediately after the mastoidectomy, and still differed from the preoperative results at these frequencies on the first postmastoidectomy day . After the various individual fluctuations, the dpoae amplitudes remained decreased in some of the patients at the end of the study . In the karatas study, the amplitudes of the oaes of contralateral normal ears were found to be affected immediately after surgery, and progressive improvement was detected with full recovery in 72 - 96 h. none of the patients showed permanent deterioration in oae amplitudes . The burs used during mastoid surgery can cause temporary hearing threshold changes in the contralateral ears . The ear recovers from this adverse effect spontaneously within 72 - 96 h, postoperatively . In another study by domnech a measurable hearing loss was found in the upper limits of the audible frequencies in 9 patients (37.5%) and it was considered important in 4 of them (16.7%). This hearing loss was recorded above the upper frequency limit of conventional audiometers . On the contrary, in man and winerman's survey, no changes in hearing were found in the contralateral ear, and it was thus suggested that there may be no damage exclusively due to drill noise during mastoid surgery . Also, urquhart showed that sensorineural hearing loss soon after mastoid surgery was not due to the noise generated by the drill and concluded that in the event of any hearing loss during this period, other causes should be sought . It seems that besides noise generated by drilling, other underlying factors may affect the normal hearing threshold, but according to recent reports, demographic characteristics, type of surgery, and even the parameters of drills may not have any effect . In this study, by considering normal hearing thresholds, we considered the range of thresholds within the spectrum of less than 15 db for children and up to 25 db for adults . These ranges include different variations of hearing sensitivities among the normal population . Despite its potential strengths, our study had some limitations . First, because of including a small sample size, the assessment of survival of hearing loss in nonoperated ears could not be assessed in different subgroups, such as of patient demographics, types of surgeries, and also duration of drilling . Second, because of the probable effects of drill characteristics on hearing loss, roles of these characteristics, such as the drill's diameter and type, need to be assessed in further studies . With regard to patients feelings about changes in their hearing levels, there was a similarity in hearing level before and after surgery at 24 h, 48 h, 72 h, and 96 h after surgery . Statistically it has been demonstrated that what people feel about their hearing level has a significant relationship with their dopae hearing levels but not their pta results . This issue is comparable with the results of previous studies, which imply that dpoae is a more sensitive technique for the early diagnosis of outer hair cell functional impairments in the context of noise - induced hearing loss . In conclusion, the recovery time of hearing and thus the survival of hearing loss in the nonoperated ear is usually less than 72 h. following drilling in mastoidectomy, hearing loss, especially at frequencies higher than 2000 hz, may occur that is mainly temporary and reversible, leading to complete recovery after 72 h. the clinical impact of drill - induced hearing loss varies . Some patients with a small amount of hearing changes are completely asymptomatic, while others complain of tangible effects . Explaining this recovery time to patients helps alleviate the anxiety after mastoidectomy procedures.
|
The past and present periods of large - scale genome sequencing have brought an enormous wealth of protein sequences that makes managing, navigating and mining the data an area of research in its own right . Mutations, insertions and deletions create sequence diversity inside a domain family . On a higher level, recombination events combine domains in different architectures to give the single- or multi - domain proteins we observe . Various invaluable tools exist to reduce the diversity of proteins into a reduced set of protein domain families . Semi - automated methods such as pfam (1), prosite (2) or smart (3) extrapolate the information gained from known members of protein domain families by matching sequences to libraries of hidden markov models (hmms), profiles or patterns . Integrative projects such as interpro (4) combine various primary sources to yield a summary view on protein sequences . Fully automated methods such as prodom (5) or domo (6) apply algorithms to achieve a classification based on first principles . Previously, we have introduced the automatic domain decomposition algorithm (adda) (7), a method for clustering very large sets of protein sequences . Adda first splits sequences into domains and then organizes these domains into protein domain families . The classification is constructed in an entirely automated fashion from first principles and thus is not biased by human curation, but only limited by the applied algorithms . We have applied adda to the set of all known protein sequences that are available in the major public databases . Using all sequences for clustering has the advantage of drawing the boundaries between protein domain families in a globally consistent manner . This is in contrast to scanning methods such as pfam and smart, where novel or hypothetical sequences are scanned against a library of hmms or profiles . Matches at the borderline of significance can be due to a newly discovered remote relative or to spurious similarity . In such events,, we describe a database with a web interface that allows scientists to download and browse the results . The web interface lets a scientist explore the context of a protein sequence in the protein universe: its immediate neighbours as determined by pre - computed sequence similarity searches, and its remote homologues as determined by its domain composition . Alternatively, a scientist can browse the domain families to hunt for domain families of interest . The database contains more than 1.5 million sequences from uniprot / swiss - prot, uniprot / trembl (8), ensembl (9), ncbi genomes (10) and other sources of protein sequences . The clustering yields 2.7 million domains, which are grouped into 123 000 families . Of these, 40 000 the domain and domain family definitions result from an automated clustering procedure applied to the set of all protein sequences in the major public databases . The process starts by removing sequences with> 40% sequence identity to any other sequence from the input set (11). The remaining representative sequences are then aligned in an all - versus - all manner using the blast (12) program . Domains are defined so that a minimum number of alignments are intersected by domain boundaries and these alignments cover domains as much as possible . After splitting protein sequences, the resultant domains are grouped into families of related sequences by a single - linkage clustering algorithm . Domains joined by alignments are grouped into a family if their domain boundaries are consistent . Finally, domain boundaries are mapped from the representative sequences onto all sequences in the database . Quality control monitors two aspects of the clustering by comparing adda domains to curated databases of domain families like pfam and scop (13). The correspondence of domain boundaries is checked by computing the relative overlap between adda and reference domains . Adda tends to split conservatively; adda domains are, on average, larger than reference domains . The correspondence of domain families is measured by matching each adda family to the best matching reference family and counting the relative frequency of other reference families in the adda family (selectivity) and the relative frequency of reference domains assigned to different adda families (sensitivity). On average, an adda domain family unifies 93% of the members of a pfam family while containing only 5% contamination . In multi - domain proteins, domains of different protein families co - occur . Based on the observed architecture of protein sequences, domain families can be divided into two groups: mobile modules and associated families . Associated families either always occur in single - domain proteins or are always associated with the same domain family . In the present release, there are 9252 mobile modules and 49 455 associated families (figure 1a). While the latter tend to be specific to a single kingdom (archaea, bacteria and eukaryota), mobile modules have a larger taxonomic range (figure 1b). A domain family is declared to be structurally covered if one of its domains can be mapped onto a structure in the pdb database of protein structures (14). For each adda domain, we register the sequence overlap with domains from curated domain databases (pfam, scop and interpro). An adda domain family is classified as novel if <5% of its domains overlap with domains from the curated domain databases . Adda contains 3828 novel mobile modules that are not known to curated domain databases and for which there is no structural information available (figure 1c). Novel domain families tend to have fewer members (<200) than well - known domain families . The number of novel domains in associated families is even larger comprising 40 505 domain families . The interface allows the user to query for protein sequences by identifier, accession number or sequence similarity . Links allow the user to browse similar sequences in the direct neighbourhood of a query sequence (multiple alignments pre - computed using blast and psi - blast) and to switch to the domain families to get all related sequences beyond the immediate neighbourhood . Attributes available for querying are the size of the family, its taxonomic spread, its structural coverage, the number of associated domains (querying for mobile modules), the overlap with other domain classifications (querying for novel domain families) and others . The domain family view includes a summary overview over the protein family and links to other domain classifications . The sequences of all domains in a domain family can be downloaded for local analysis . If structures are known in the family, the domain boundaries are mapped onto the structures for visualization with rasmol (15). In the browsing section, the user finds links to precompiled domain sets of interest, e.g. All exclusively eukaryotic mobile domains or a list of domain families without known structures (structural genomics targets). In addition, a genome browser allows access to all or a selection of domain families occurring in a genome . For example, adda is linked to by the dali domain database (16) and vice versa . Links and attributes can be queried in numerous ways . One application of the database interface is to hunt for novel domain families . For example, typing sapiens into the genome browser lists 28 791 domain families in human protein sequences . The result set can be restricted to exclude domain families that have domains from archaea or bacteria and/or are not novel and not a mobile module giving 7933 domain families . Modifying the query to include only domains with more than 20 members produces 108 novel domain families that occur in human protein sequences, are specific to eukaryotes and have at least 20 members . Our aim is to push the functional annotation of proteins as far as possible using only automated methods . We are currently testing methods to split domain families into groups of orthologous proteins and automated methods to define functionally important residues in a family.
|
Bilateral ectopic pregnancy is a rare condition and is divided in two subgroups, primary and secondary, based on history of assisted reproductive technology . A 30 year old primigravid woman with history of infertility and ovulation induction presented to a hospital in kashan in year 2013 . She had vaginal bleeding, abdominal pain and ultrasound findings suggested early pregnancy . Due to high titer of -hcg, gestational trophoblastic disease was proposed and d8c was done in referral and admission to gyneco - oncology ward in tehran . Repeat sonography suggested ectopic pregnancy in left side and repeat -hcg level showed an increase of 19435 miu / ml . Bilateral ectopic gestation should be considered as a rare differential diagnosis for ectopic pregnancy . In this study, the implantation and development of fertilized ovum outside the uterine cavity is observed in approximately 2% of all pregnancies . Over 95% of ectopic pregnancies because of the increase in incidence of sexually transmitted diseases, tubal surgery and more frequent use of ovulation induction and assisted reproductive technologies (art), the incidence of ectopic pregnancies has grown in the last 30 years according to many reports from developed countries . Ectopic pregnancy is still the leading cause of pregnancy - related deaths in developed countries (1). However, bilateral tubal pregnancy is a rare clinical condition which occurs in only 1 per 200,000 pregnancies . This condition is divided in two subgroups, primary and secondary, and because of different physiopathological mechanisms, these two entities should be studied separately . However, as studies have shown, the cause of bilateral ectopic pregnancy after art is clearly different from spontaneous cases . Clinical and paraclinical findings of this condition are the same as unilateral ectopic pregnancy so the distinct diagnosis is difficult (2). In the present article, a case of bilateral tubal pregnancy a 30 year old primigravid woman has been hospitalized in kashan in year 2013 due to minimal vaginal bleeding and low abdominal pain . She had been under different treatments including sequential treatment with clomiphene, fsh and hmg in previous cycle . Her last menstrual period was 8 weeks ago . In admission, vital signs were normal . The first transvaginal ultrasound revealed a suspicious gestational sac without yolk sac in uterus and normal adnexal area was reported . Due to high level of -hcg (16000 miu / ml), without normal viable intrauterine pregnancy, dilatation and curettage had been done to clarify existence of intrauterine pregnancy or its complications or ep . Due to high level of -hcg, gestational trophoblastic neoplasm was considered in differential diagnosis besides ectopic pregnancy and it resulted in gyneco - oncology consultation . The rise of -hcg level to 21770 miu / ml, 9 days after operation resulted in referral and admission of patients to gynecology - oncology ward of our center in tehran . Positive findings in this admission to gynecooncology ward in tehran were low abdominal pain, minimal vaginal bleeding with stable vital signs similar to the ones observed in previous admission . Through re - checking the -hcg level, titer of 19435 miu / ml was observed . The next ultrasound reported a normal uterus with endometrial thickening up to 11 mm, a heterogeneous mass measuring 49 mm in left adnex, suspicious to ectopic pregnancy and two simple cysts, 69 mm in left ovary and 50 mm in right ovary . There was no free fluid in the pelvic cavity . Because of persistently high level of -hcg, surgical intervention was done . Atypical findings and diagnosis of gtn besides fp led to choice of laparatomy instead of laparascopy . Surgical findings were two bluish, 5 cm in left side and 2 cm in right side, swelling in both ampullary parts of fallopian tubes with minimal bleeding from fimbria . Two simple cysts, about 5 cm in right ovary and 4 cm in left ovary were seen . Bilateral salpingostomy was performed and some trophoblastic - like tissue was extracted and sent for pathologic evaluation separately . The patient received 50 mg / m intramuscular methotrexate due to bipateral fp and non - radical approach . Secondary bilateral ectopic pregnancy is a condition with localization of trophoblastic tissue in both tubes, following a kind of manipulation in physiology such as through the use of art drugs . The classic triad of pain, vaginal bleeding and missed period was present, similar to unilateral ectopic pregnancy . In a study, 19 secondary bilateral tubal pregnancy cases were reviewed in an attempt to examine the symptoms and signs . Diagnosis in this group was done due to discrepancy between sonography and -hcg level . In 6 out of 19 (31.6%) cases, due to involvement of both fallopian tubes, probability of rupture is higher in comparison to unilateral ectopic gestation (2). In the case of the present study, as a secondary bilateral ectopic gestation, high level of -hcg without intrauterine pregnancy suggested ectopic gestation and atypical high titer of hcg resulted in referral to a tertiary gyneco - oncology ward . In review of studies, mean gestational age at the time of diagnosis was about 6.7 weeks (5 - 9 weeks) after the last menstruation (2). Sonographic findings and -hcg level, usually, don't lead to a correct diagnosis of bilateral ectopic pregnancy . Due to ample amount of -hcg during normal gestation, its level is not diagnostic (13). In a review of hcg level in 16 cases of secondary bilateral tubal pregnancy, mean level of -hcg was 20878 miu / ml with a wide range of 27 - 226768 miu / ml . Three cases out of 16 revealed -hcg titers of 13296, 62520 and 226768 miu / ml (2, 47). In unilateral ectopic pregnancy, there is lower level of -hcg . In contrast to normal pregnancy with predictable range of -hcg in each week of gestation, in ectopic pregnancy it is more variable (2, 3). In our case, empty uterus coexisting with high level of -hcg suggested gestational trophoblastic disease (gtn) and ectopic pregnancy was less probable due to high atypical titer 21770 miu / ml hcg . High level of -hcg titer in bilateral ectopic gestation, such as above 10,000 in 3 case reports and our case and even 226768 miu / ml in a case report, proposed gtn as a reasonable differential diagnosis . However, pre - operative diagnosis of secondary bilateral ectopic pregnancy was made just in 10% of patients (2). In our case, bilateral rupture of tubes was rare . In 5 out of 19 cases in a review of secondary bilateral ectopic pregnancy, unilateral tubal rupture in operative field bilateral unruptured tubal pregnancy in ampulary portion of tubes was seen . In our case, left tube was more distended, about 5 cm and right tube was 2 cm . In the review of bilateral tubal gestation in literature including primary and secondary cases, left tubal pregnancy was larger and more prone to rupture in comparison to right one . An attempt was made to review cases of medical literature which the side and size of rupture in bilateral tubal gestation was defined (table 1). Medical treatment of these patients is not fully studied when pre - operative diagnosis is made . There are three surgical approaches for ectopic pregnancy: salpingotomy, salpingostomy and radical salpingectomy . Regarding the future plan of fertility procedures, conservation or resection of fallopian tubes might be planned in the operation field (1, 2, 810). In this case, size of right and left tube distention according to surgical findings in cases with bilateral ectopic pregnancy bilateral ectopic gestation, although rare, should be regarded as the differential diagnosis for ectopic pregnancy, especially in assisted reproductive technology cases and high titers of -hcg (more than 100000). Left tubal side of bilateral tubal pregnancy was more probable to rupture and it revealed bigger size in review of cases.
|
The actions of glutamate, the main excitatory neuro- transmitter in the mammalian central nervous system (cns), can be finely modulated by metabotropic glutamate receptors (mglurs) [1, 2]. Mglurs are g - protein coupled receptors and are divided into three groups based on sequence homology, pharmacological profile, and signal transduction mechanisms . Eight mglurs (mglur1 - 8) have been identified and classified into three groups: group i, consisting of mglur1 and mglur5, group ii, consisting of mglur2 and mglur3, and group iii, consisting of mglur4, mglur6, mglur7, and mglur8 . Group i receptors are coupled to phospholipase c (plc) activation, while group ii and iii are associated with adenylate cyclase inhibition [3, 4]. Mglurs modulate glutamatergic transmission at several levels depending on their expression at nerve terminals, postsynaptic sites, or glia [5, 6] (fig . 1). Group i mglurs are mainly located at the postsynaptic regions, where they increase neural excitability, whereas group ii and group iii are primarily located at presynaptic terminals and function as inhibitory auto- and hetero - receptors [7, 8]. While mglur6 is exclusively expressed in the retina, the other mglurs are widely distributed throughout the nervous system . Group iii is the largest group of mglurs and the least well - characterized, likely due to the lack of selective pharmacologic agents . Selective allosteric ligands for group iii mglur subtypes were recently discovered; this has made it possible to elucidate the role of each of these receptors in normal cns functioning and in models of neurologic and psychiatric disorders . Recently, a brain penetrant preferential agonist for mglur4, (2s)-2-amino-4-(hydroxy(hydroxy(4-hydroxy-3-methoxy5nitrophenyl)methyl)phosphoryl)butanoic acid (lsp1 - 2111) was identified . Preclinical studies suggest that lsp1 - 2111 has in vivo efficacy in models of parkinson s disease, anxiety, psychosis, fear learning, and memory . These studies rationalize further investigations on the therapeutic benefits of mglur modulators that can finely tune glutamatergic transmission in an effort to treat various psychiatric and neurologic conditions . Out of the group iii mglurs, mglur7 is the most widely expressed throughout the cns [7, 11, 12]. The highest density of mglur7 expression is in the olfactory bulb, hippocampus, hypothalamus, and sensory afferent pathways [11, 13 - 15]. Mglur7 receptors are mainly located within the presynaptic active zone [11, 14, 16] where they serve as auto- or hetero - receptors, inhibiting glutamate or gaba release, respectively [16, 17] (fig . 1). Mglur7 receptor activation also leads to increased signaling pathways potentiating neurotransmitter release in cerebrocortical nerve terminal preparations from adult rats . However, direct facilitation of neurotransmitter release by mglur7 has not yet been demonstrated on neurons in vitro or in vivo . In the globus pallidus and striatum, postsynaptic mglur7 receptors have also been observed on amacrine cells at retinal synapses, on olfactory bulb glomeruli, and on prefrontal cortex pyramidal neurons . So far, five splice variants of the mglur7 receptor have been characterized, called mglur7a - e . These splice variants exhibit different, but often overlapping, expression patterns [12, 23 - 25]. In addition to its cns localization, mglur7 is also expressed in peripheral tissues, such as the colon, stomach, and adrenal glands, and in hair cells and spiral ganglion cells of the inner ear . Mglur7 has low affinity for glutamate; it is recruited only under high neurotransmitter concentrations and thus acts as an auto - receptor to inhibit further glutamate release . L-2-amino-4-phosphonobutyrate (l - ap4) can bind to mglur7 at high concentrations and inhibits glutamate release via n - type ca channel inhibition (fig . Recently, studies using the selective mglur7 positive allosteric agonist n, n'-bis(diphenylmethyl)-1,2-ethanediamine dihydrochloride (amn082) and the mglur7 negative allosteric modulator 7-hydroxy-3-(4-iodophenoxy)-4h - chromen-4-one (xap044) have demonstrated that mglur7 modulates excitatory / inhibitory transmission in the hippocampus [32 - 35], thalamus, nucleus accumbens [38, 39], pag and amygdala [41 - 43]. Specifically, amn082 decreases gaba and increases glutamate levels in the nucleus accumbens and amygdala ., mglur7 facilitates glutamatergic release, likely via interactions with the exocytose machinery . Apart from gi / o - protein coupling and the consequent inhibition of adenylyl cyclase and camp formation, mglur7 also inhibits n- and p / q - type ca channels in the transfected cerebellar granule cells, brainstem, and hippocampus [46, 47]. Finally, mglur7 also modulate synaptic function through g - protein - coupled inwardly rectifying potassium channels (girks). Mglur7 activity is finely modulated: calmodulin binds to the carboxyl terminus of mglur7 in a ca - dependent manner (cam). The cam - binding domain, located at the end of the seventh trans - membrane segment, can be competitively phosphorylated by protein kinase c (pkc), which inhibits binding of the ca / cam complex to the receptor . Pkc inhibits mglur7 s effect on neurotransmitter release by preventing coupling of mglur7 receptors to their requisite g proteins . Pkc - mediated phosphorylation is also a key mechanism regulating constitutive and activity - dependent mglur7 expression . Two events, mglur7 phosphorylation by pkc and mglur7 binding to the pdz domain - containing protein pick1, lead to increased mglur7 expression . Mglur7 expression is also increased by inhibitors of protein phosphatase 1 (pp1), which counteracts the action of pkc on mglur7 . Rodent studies suggest that the interaction of mglur7 and pick1 is critical to proper neural function, as disruption of the mglur7a - pick1 complex is sufficient to induce absence epilepsy - like seizures . Mglur7 modulates gabaergic interneuron synapse development through its interaction with elfn1 protein, whose abnormal expression during development is associated with epilepsy and attention deficit hyperactivity disorders . Mglur7 also prevents nmda - induced excitotoxicity of basal forebrain (bf) cholinergic neurons; degeneration of these neurons represents an early pathological event in alzheimer's disease . This protection mechanism through mglur7 activation is selectively inhibited by -amyloid (a). A increases p21-activated kinase activity and decreases cofilin - mediated actin depolymerization through a p75(ntr)-dependent mechanism . Due to the lack of available ligands with specificity for mglur7, mglur7-knockout mice were traditionally the only tool available to examine the physiological role of mglur7 and its involvement in cognitive, affective, and sensory behaviors . Mice lacking mglur7 receptors showed reduced short - term neural plasticity in the hippocampus suggesting a role for mglur7 in the molecular mechanisms underlying cognition . In line with this evidence, mglur7-knockout mice displayed some impairments in learning and memory [58 - 60]. Specifically, these mice showed normal behavior in the t - maze but impairments in both the 4-arm and 8-arm maze tasks, which require intact working memory capacity . Intriguingly, after training, mglur7-knockout mice showed test performance similar to the their wild type counterparts, implying that training can overcome baseline differences in working memory capacity [58, 59, 61]. Similarly, mglur7-deficient mice exhibited impairments in the morris water maze, although they achieved similar performance to wild type mice after training . It has been thus proposed that mglur7 is involved in the molecular mechanisms underlying short - term working and spatial memory whereas long - term memory operates in an mglur7-independent manner [58, 62]. Mice lacking mglur7 displayed delayed extinction of a conditioned fear response in the conditioned emotional responses (cer) procedure, but the initial acquisition of fear responses appeared unaltered in these mice [62, 63]. This may be due to the different neural substrates involved in acquisition (the amygdala) and extinction (the hippocampus and prefrontal cortex) of cer . However, mglur7-deficient mice displayed reduced shock - induced freezing and impaired conditioned taste aversion, which are both amygdala - dependent paradigms [64 - 66]. The reason for these discrepant findings may be the different experimental strategies used in the two studies . The cer study used shocks that were signaled by auditory cues, and the conditioned taste aversion study used saccharin avoidance after pairing it with intraperitoneal injection of licl, an agent which causes transient visceral malaise . Mglur7-knockout mice exhibited reduced anxiety - like responses in several behavioral tests such as the elevated plus maze, staircase, marble burying, light - dark box, open field, and stress - induced hyperthermia tests . In addition, and in accordance with their anxiolytic - like phenotype, mglur7 knockout mice also displayed reduced stress responses and activity of the hypothalamic - pituitary - adrenal (hpa) axis . Mglur7-deficient mice showed increased expression of hippocampal glucocorticoid and 5-hydroxytriptamine 1a receptors (gr and 5-ht1a). Increased gr and 5-ht1a expression in response to the lack of mglur7 suggests enhanced negative feedback of the hpa axis, which is hyperactive in depressant and anxiety- like phenotypes [71, 72]. Accordingly, mglur7-knockout mice showed increased hpa suppression in response to dexamethasone and increased levels of brain derived neurotrophic factor (bdnf), both positive indexes of antidepressant activity [73, 74]. Consistently, mglur7-knockout mice exhibited antidepressant - like profiles in the tail suspension and forced swim tests [67, 75]. Mice lacking the mglur7 receptor displayed an increased seizure vulnerability and reduced anticonvulsant effects of (rs) phosphonophenylglycine (ppg), a broad spectrum group iii mglur agonist, indicating a potential neuroprotective role for mglur7 . Altogether, mglur7-knockout mouse strategies have largely contributed to uncovering the role of mglur7 in epilepsy, cognition, and emotion regulation . One critical limitation of conventional knockout strategies, however, is that the constitutive lack of a gene may lead to compensatory effects from related proteins, especially during development, and this may confound some outcome measures . To address this concern, the development of selective mglur7 ligands for direct activation / blockade of the receptor in the adult organism is critical . Mglur7 displays low affinity for the classic group iii orthosteric agonists such as l - ap4 and l - sop . Moreover, orthosteric receptor activation requires an a - amino acid moiety and distal phosphonic group, which makes these compounds too hydrophilic to penetrate the blood - brain - barrier for subsequent brain exposure . Acpt-1 can penetrate the blood - brain - barrier, but has shown the same low selectivity for mglur7 [79, 80]. The competitive group iii mglur antagonist, ly341495, shows the highest potency but is scarcely selective, since it is also a potent antagonist at group ii mglurs . Msop, cppg, and map4 are more selective for group iii mglurs but display weak potency [30, 77]. Targeting allosteric binding sites has permitted drug developers to overcome the scarce selectivity and hydrophilicity associated with orthosteric compounds . Allosteric binding sites are less conserved among the other mglur family members and do not require hydrophilic moieties . Amn082 was developed as the first selective positive allosteric modulator (pam) for mglur7 . Amn082 fully activates mglur7 [78, 84], and its action is not blocked by mglur7 orthosteric antagonists . Amn082, however, is rapidly metabolized into an active compound in vivo, which inhibits monoamine transporter activity . Consistent with the mglur7-knockout mouse phenotype, amn082 increases plasma corticosterone and adrenocorticotropic hormone (acth) levels . Amn082 has been shown to reduce fear acquisition and ltp in the amygdala, but improve fear extinction . Amn082 s effect on fear extinction is in line with the resistance to fear extinction observed in mglur7-deficient mice, whereas its effect on fear acquisition is divergent from the phenotype of mglur7-deficient mice, which displayed no abnormality in fear acquisition . Paradoxically produced anxiogenic - and anxiolytic - like effects [68, 69, 85, 88 - 90] and also demonstrated antidepressant - like activity [89, 91, 92], the latter being in contrast to the mglur7-knockout phenotype . Amn082 also facilitated nociception when microinjected into the ventrolateral pag (vl pag), central nucleus of the amygdala (cea), or nucleus tractus solitarius (nts) [40, 88, 93]. Amn082 changed the activity of neurons that respond to pain stimuli in the rostral ventromedial medulla (rvm) and decreased glutamate release into the vl pag, consistently with descending pathway inhibition and pain facilitation [40, 94 - 96]. Amn082 has been shown to facilitate nociception in some studies; however, it reduced pain responses in other studies [98, 99]. One possible explanation for the contradictory effects of amn082 is the rapid and long - lasting mglur7 receptor internalization induced by amn082, which coincides with functional antagonism . Alternatively, amn082 s scarce selectivity for mglur7 in vivo suggests the possibility of off - target involvement [83, 100]. Amn082 also reduces ethanol and cocaine intake [101, 102], facilitates the extinction of aversive memories, and increases colonic secretory function . The recent discovery of novel negative allosteric modulators (nams) for mglur7 will likely contribute to better understanding of the functional role for mglur7 in neural functioning . 6-(4-methoxyphenyl)- 5-methyl-3-pyridin-4-ylisoxazolo[4,5-c]pyridin-4(5h)-one (mmpip), a selective negative allosteric modulator for mglur7, has shown inverse agonist activity for mglur7 and good brain exposure after systemic administration [103, 104]. In vivo studies with mmpip have shown that negative allosteric modulation of mglur7 impairs cognitive performance in the object recognition and radial arm maze tasks and reduces social interaction in rodents . Mmpip has been found to be ineffective in a range of behavioral experiments aimed at investigating motor coordination, anxiety and depression - like behaviors, sensorimotor gating, seizure threshold, and nociception in healthy rodents . Later, a recent paper from our laboratory confirmed that, when administered into the vl pag, mmpip showed no effect in healthy rats but inhibited pain responses in formalin and neuropathic pain models . Mmpip altered pain thresholds by modulating the antinociceptive descending pathway at rvm levels when administered into the vl pag . Specifically, in neuropathic rats it increased the activity of antinociceptive off cells and decreased that of pronociceptive on cells, consistently with antinociception, but proved ineffective in healthy controls . This context - dependent mmpip effect was confirmed in a novel study where mmpip was shown to reverse the main symptoms of neuropathic pain in the spared nerve injury model, while remaining ineffective in control mice . In neuropathic mice, systemic mmpip administration increased thermal and mechanical thresholds, occurrence of open - arm choice in the elevated plus maze, reduced immobility in the tail suspension test, and reduced the number of marbles buried and digging events in the marble - burying test, thus demonstrating putative anxiolytic- and antidepressant - like properties . Changes in receptor expression in some supraspinal areas such as the basolateral amygdala, dorsal raphe, prelimbic cortex, pag, and hippocampus have been observed in neuropathic conditions . In line with the efficacy of mmpip in chronic pain models and its lack of effect in healthy animals, mmpip showed context - dependent activity in recombinant cell lines and inactivity under normal physiological conditions . Other selective mglur7 nams have recently been developed: 7-hydroxy-3-(4-iodophenoxy)-4h - chromen-4-one (xap044), which has shown to inhibit long - term potentiation (ltp) in the lateral amygdala in brain slices from wild type mice but not in mglur7 knockout mice, thus suggesting xap044 specific action on mglur7 . In vivo experiments have shown that xap044 is brain penetrant and, similar to mglur7 knockout mice, produces anti - stress, antidepressant-, and anxiolytic - like effects and reduces freezing in a fear conditioning paradigm . A single systemic xap044 administration reverted mechanical allodynia and ameliorated anxiety- and depression - like behaviors in a model of neuropathic pain . Interestingly, (+) -6-(2,4-dimethylphenyl)-2-ethyl-6,7-dihydrobenzo [d]oxazol-4(5h)-one (adx71743), another selective mglur7 nam, has demonstrated excellent brain exposure after subcutaneous administration and anxiolytic - like effects in the elevated plus maze and marble burying tests . The recent development of selective mglur7 nams has profoundly contributed to the delineation of a functional role for mglur7 in physiological and pathological conditions . Apart from providing a better understanding of mglur7 function at the synapse indeed mmpip, xap044, and adx71743 have demonstrated selectivity for mglur7 and behavioral effects in line with the mglur7-knockout phenotype . Mmpip and xap044 have also been tested in chronic pain conditions and co - morbid affective and cognitive disorders, thus their possible therapeutic exploitation is reasonable . A summary of mglur7 positive and negative allosteric modulators effects is presented in table 1 . The greater importance of mglur7 of all mglurs is unveiled by its wide distribution and its high evolutionary conservation . In particular, mglur7 exhibits high expression in excitatory and inhibitory synapses within the brain, which are considered critical for neurologic and pathologic disorders . Initial studies using mglur7-knockout mice have suggested that mglur7 is involved in a series of neurological and psychiatric disorders such us epilepsy, anxiety, and depression . These effects were later confirmed by similar findings obtained using selective mglur7 allosteric modulators . Moreover, some of the novel mglur7 negative allosteric modulators, apart from clarifying the function of mglur7 in fine tuning excitatory and inhibitory synapses within the cns, have confirmed the mglur7-knockout phenotype and clarified the role of mglur7 in neuropsychiatric disorders . In this context, mmpip and xap044 have also been tested in models of neuropathic pain and have shown promising anti - allodynic, anti - anxiety-, and anti - depressant - like effects . Further, these compounds have been reported to improve cognitive performance, which is deeply affected in these models of chronic pain . As a direct consequence of these findings, further studies investigating mglur7 negative allosteric modulator effects are expected to facilitate development of novel therapeutics for pain and pain - related affective and cognitive disorders.
|
Methamphetamine (ma) is used as a recreational drug for its properties which cause sense of energy and euphoria . The same amount of ma may not cause harm in some individuals, however, it also may be seriously toxic for some other individuals . Ma may cause hepatotoxicity, rhabdomyolysis, cardiotoxicity, nephrotoxicity, and neurotoxicity separately or sometimes together as multisystem toxicity, mostly as a serious condition requiring hospitalization . Nephrotoxicity generally presents as acute kidney injury, hyponatremia, and hypertension 1, 2, 3 . A 32yearold male was admitted to our facility with muscle weakness, pain, and a 1 day history of oliguria . He had a history of ma abuse 3 years ago and used the same substance orally 1 week prior to admission . Physical examination revealed acidotic breathing, paleness and bruises of the skin in the lumbar region . Laboratory findings on admission included creatinine kinase (ck) 15,000 u / l, lactate dehydrogenase (ldh) 1509 u / l, urea 284 mg / dl, creatinine 8.06 mg / dl, aspartate transaminase 456 u / l, alanine transaminase 753 u / l, and sodium 131 mmol / l, potassium 6.7 meq / l . He was diagnosed with rhabdomyolysis and acute kidney injury, and intravenous hydration treatment with isotonic saline solution was begun, based on urine output . However, because of his continuing uremic status and hyperkalemia, he underwent five rounds of hemodialysis (hd). Following bed rest, carbohydrate predominant diet, adequate fluid resuscitation, and hd, the clinical status and laboratory parameters improved significantly over the next 12 days of hospitalization (fig . 1). Creatinine kinase and lactate dehydrogenase survey of the patient during follow up . Many systems, including especially the nervous system, may be pathologically affected due to these substances . Ma generally damages dopaminergic and serotonergic nerves in central nervous system and this contributes its high abuse potential 4 . In addition to cardiovascular and neurological effects, ma abuse may result in hyperpyrexia, hyponatremia, rhabdomyolysis, disseminated intravascular coagulopathy, gastrointestinal bleeding, hepatic failure, and renal failure . Mainduced renal injury possibly occurs due to traumatic rhabdomyolysis, necrotizing vasculitis, urinary tract obstruction, hypertension, proximal tubule dysfunction, and volume depletion 5, 6 . In our case, rhabdomyolysis, acute kidney injury, hepatotoxicity, and neurotoxicity emerged after the use of ma in the acute period . After the discontinuation of the agent and appropriate treatment with hydration and hd, our patient improved significantly . In conclusion, physicians should be aware that multisystem toxicity may develop as a result of ma use and clinical suspicion, early diagnosis, and appropriate treatment may be life saving.
|
Adenomatoid odontogenic tumor (aot) is a benign, slow - growing, and noninvasive odontogenic lesion associated with an impacted tooth . The presence of so - called unique duct - like structures under microscope imparts the tumor a glandular, i.e., adenomatoid appearance . The tumor is also known as two third's tumor because about 2/3 cases occur in maxilla, about 2/3 cases are diagnosed in young females during the second decade, 2/3 cases are associated with an impacted tooth and in 2/3 cases, impacted tooth is canine . We present a case of unusually large aggressive aot in the maxilla associated with impacted third molar . A 19-year - old male reported with a chief complaint of painless mass over the left side of face and upper left back tooth region since 6 months . Initially, pea - sized and asymptomatic swelling appeared in upper left back tooth region . Three months later, swelling also appeared below left eye, initially pea - sized . He gave h / o exfoliation of multiple teeth from the same region within these 6 months . On examination, solitary, smooth, roughly spherical - shaped swelling was present on the left side of face below eye . Swelling extends from infraorbital region until malar prominence and from medial to lateral corner of left eye measuring approximately 5.0 cm 5.0 cm in maximum dimensions . There was marked obliteration of palpebral fissure of the left eye [figure 1a]. Intraorally, there was a solitary roughly oval - shaped growth in the left maxillary region, obliterating the buccal vestibule . Growth was extending from canine region till retromolar area along alveolar ridge measuring approximately 7 cm 4 cm . Overlying mucosa was erythematous, edematous, and inflamed . Both extraorally and intraorally, swelling was firm, noncompressible, nonfluctuant, nontender, nonreducible, and nonpulsatile . (b) intraoral photograph showing lesion involving palate, alveolar ridge, and buccal vestibule orthopantomogram revealed a huge, diffuse radiolucent lesion extending throughout left maxilla from canine till retromolar region . The lesion was associated with an impacted permanent upper left third molar, which was found to be present below floor of the orbit . Computed tomography scan [figure 3a c] demonstrated a large cystic expansile radiolucent lesion with flecks of calcification of varying sizes . The buccal and palatal bony expansion was remarkable, and resorption of bone with perforation was evident . Maxillary sinus was completely opaque . On the basis of these radiological findings, aot and pindborg tumor orthopantomogram showing a large radiolucent lesion involving left maxilla, and impacted upper left third molar teeth displaced below floor of orbit by the lesion (red circle) (a - c) computed tomography scan revealing the expansile radiolucent lesion with few radio - opaque flakes . There is remarkable bony expansion and thinning and discontinuity of the palatal and buccal cortices . Having accessed the tumor extraorally as well as intraorally, subtotal maxillectomy was performed, and the involved teeth were also removed [figure 4b]. The surgical defect was simultaneously reconstructed using temporalis myofascial flap [figure 4d] healing was uneventful . Six months after surgery, computed tomogram was done which revealed complete eradication of the lesion [figure 5a c]. There was no evidence of any recurrence 1 year after the surgery [figure 6a and b]. (a - d) operative photographs (a - c) six months postoperative computed tomogram shows normal healing and no signs of recurrence (a) one year follow - up photograph . (b) one year follow - up intraoral photograph with normal healing histological examination revealed a partially cyst - like cavity lined with the fibrous capsule . Rounded and rosette - like aggregates of odontogenic epithelial cells with sparse areas of eosinophilic material could be visualized . The characteristic rounded and rosette form lined with a single layer of polarised cuboidal or columnar epithelium cells giving it the adenomatoid appearance (h and e, 400) aot has three clincopathological variants, namely intraosseous follicular (73%), intraosseous extrafollicular (24%), and peripheral (3%). The intraosseous follicular type is associated with an impacted tooth as in our case, whereas the intraosseous extrafollicular type has no association with an impacted tooth and the peripheral variant is soft tissue component, attached to the gingival structures . The lesion often leads to the expansion of the involved bone and the displacement of the adjacent teeth . Owing to the slow growing and painless nature of the tumor, the patients tolerate the swelling for a long duration, sometimes years until it produces an obvious esthetic deformity . It may rarely show aggressive nature such as gaining unusually large size or extending into the intracranial space . Radiographically, the lesion often demonstrates as a unilocular radiolucency associated with an impacted tooth . In certain cases, small radiopaque spots (calcifications) differential diagnosis of aot includes dentigerous cyst, calcifying odontogenic cyst (coc), calcifying odontogenic tumor (cot) (pindborg tumor), and odontogenic keratocyst . Radiolucency with multiple radiopaque foci (particularly when the radiolucency surrounds a portion of the root or entire tooth) is suggestive of an aot rather than a coc / cot . Histologically, aot is mostly surrounded by a well - developed fibrous connective tissue capsule . The tumor is usually composed of spindle - shaped or polygonal cells forming sheets, rosettes or whorled masses in a sparse connective tissue stroma . The amorphous eosinophilic material is present between the epithelial cells as well as in the center of these rosette - like structures . The large size of this lesion has been attributed to a higher growth rate in younger patients and a delay in seeking treatment . However, in our case, the lesion was extremely large in size and expansile . Therefore, subtotal maxillectomy with simultaneous reconstruction of surgical defect with temporalis myofascial flap was planned and carried out . The case presented is rare in occurrence because of certain atypical features such as unusual large size, aggressive behavior, the involvement of maxillary third molar, third molar present below floor of orbit, significant bony expansion, and cortical perforation . Under general anesthesia, the authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
|
Our survey covered all small molecule new molecular entity (nme) drugs that are intended for systemic use and were approved by the fda between january 2013 and august 2016 . The new drug application (nda) review documents (drugs@fda, http://www.fda.gov/drugsatfda) and product labels were examined for pbpkrelated information for the 85 products that met the above criteria . There were a total of 18 products for which pbpk models were considered in the nda review documents (tables 14). In the majority of cases, pbpk models were used for the prediction of the effect of metabolic enzyme mediated drugdrug interactions (ddis; figure 1a; tables 14). Importantly, the frequency of model use is consistent with the perceived level of reliability.1, 3, 5 overview of physiologically based pharmacokinetic (pbpk) information in product labels or us food and drug administration (fda) review documents for drugs approved by the fda between january 2013 and august 2016 . (a) number of new molecular entities (nmes) with information of pbpk for respective areas of applications . (b) proportion of product labels / reviews containing pbpk information for drugs in all nmes, anticancer agents, and nmes with breakthrough therapy designation and/or accelerated approval status at the time of approval . Seven of eight nmes with pbpk and breakthrough / accelerated approval status were anticancer agents . A key caveat of our survey was that it was limited to publicly available information . The utilization of pbpk models for sponsor's internal decisionmaking and earlier stage and postapproval regulatory interactions, such as postmarketing requirement (pmr) or supplementary nda, were not captured . Pbpk models have great potential to influence decisionmaking at different stages of drug development, such as initial dosing recommendations for pediatric clinical trials, design of ddi studies, etc.5 the current evaluation should be interpreted in the context of pbpk use during the final phase in the development of a new drug, because pbpk modeling strategies and the level of model validation can vary at different stages of drug development . This survey also did not capture the potential value of cost and speed savings by using pbpk vs. conducting clinical studies . Interestingly, we observed wider acceptance of pbpk models in the field of oncology compared with other therapeutic areas (figure 1b). One possible explanation is the difficulty of conducting clinical ddi studies in oncology, due to (1) shortage of appropriate patient populations or (2) ethical and safety concerns over exposing healthy volunteers to oncology medications . The first point is supported by the observation that three of eight nmes with pbpk in the nononcology field were for rare diseases (such as eliglustat, macitentan, and obeticholic acid). Another possible explanation is that the higher levels of toxicity and narrower therapeutic windows for oncology drugs compared with drugs in other therapeutic areas warrant precise optimization of drug exposure . It is also noteworthy that 7 of 10 anticancer agents were given regulatory incentives to accelerate drug development, either with breakthrough therapy designation or accelerated approval, which may have contributed to a greater reliance on pbpk simulations . Pbpk models have been most extensively used for the prediction of the effect of ddi or pharmacogenetic effect on the pharmacokinetics of nme as a victim (figure 1a). In particular, the extrapolation of the effect of strong inhibitors or inducers to less potent perpetrators constituted the majority of the applications (11 among 13 nmes; table 1, ids 111), and all applications resulted in labeling recommendations (table 1). In these cases, existing clinical data with strong perpetrator(s) were used to anchor the pbpk model performance, namely by accurately providing fraction metabolized by a particular enzyme, which provides a higher level of confidence in ddi prediction.1, 5 for example, a fourfold dose reduction of ibrutinib was recommended for patients taking moderate cytochrome p450 (cyp)3a inhibitors based on the pbpk model validated with clinical ddi data using strong perpetrators . Pbpk models in product labels or fda review documents: new drug as a victim of ddis or genetic variations cyp, cytochrome; ddi, drugdrug interaction; i d, identification; nme, new molecular entity; pbpk, physiologically based pharmacokinetic; pmc, postmarketing commitment; pmr, postmarketing requirement; ugt1a1, udpglucuronosyltransferase 1a1 . The numbers in the reference column represent pubmed i d (if physiologically based pharmacokinetic models were published in scientific journals). The elimination pathways for all the 11 nmes involve cyp3amediated metabolism, whereas two are metabolized by cyp2d6 in addition to cyp3a . This observation is not surprising, considering that cyp3a and cyp2d6 are involved in metabolism of a large proportion of marketed drugs, and wellestablished probe perpetrators are available for these two enzymes . For two cyp3a and cyp2d6 dual substrates, aripiprazole lauroxil and eliglustat, complex interactions involving the inhibitors of these enzymes and cyp2d6 genotype anchoring of model prediction with both a strong inhibitor and an inducer has been conducted in most cases, but there were two cases in which model validation with inhibitors was used for the prediction of inducer effect (cobimetinib, panobinostat), both of which resulted in a conservative labeling language of avoiding concomitant use with the strong inducers . This may suggest that the required level of pbpk model qualification depends on the context of pbpk application . Because modification of recommended dose in the product label application of pbpk,2 the use of a certain amount of clinical pharmacokinetic data as an external validation dataset has generally been required for including dosing recommendations in the product label . The case of belinostat is intriguingalthough there were no external data, the simulation performed by the fda during the nda review resulted in label language recommending a 25% reduction in the starting dose for homozygous carriers of a genetic polymorphism of its major metabolic enzyme, udpglucuronosyltransferase 1a1 . This is likely, in part, because the recommended starting dose is equal to the maximum tolerated dose . Pmr to definitively examine the effect of pharmacogenetic alteration on belinostat pharmacokinetics and safety was included in the nda approval . Therefore, even when the pbpk approach could not obviate the conduct of a dedicated clinical study, the model can inform the optimal use of medications . The second most frequent use of pbpk modeling is to predict the ddi potency of an nme as a perpetrator (inhibitor / inducer; table 2). Four nmes (ids 1417) have successfully utilized a pbpk modeling approach to demonstrate the lack of a clinically significant effect on the metabolic pathways of interest for the particular drug . One method was to use a negative clinical ddi result with other cyp enzymes as an external validation (alectinib, panobinostat), whereas another was to use a sensitivity analysis on inhibition parameters (alectinib, canagliflozin). In the case of lenvatinib, an external model validation was seemingly not performed, presumably supported by general perception that pbpkbased prediction of mechanismbased inhibition leads to overestimation of ddis.5 these observations based on limited cases suggest that required levels of model validation could be flexible, and that we may expect wider application of pbpk in this category . Pbpk models in product labels or fda review documents: new drug as a perpetrator of drugdrug interactions cyp, cytochrome; ddi, drugdrug interaction; i d, identification; mate, multidrug and toxin extrusion transporter; nme, new molecular entity; oct2, organic cation transporter 2; pbpk, physiologically based pharmacokinetic; pmc, postmarketing commitment; pmr, postmarketing requirement . The numbers in the reference column represent pubmed i d (if physiologically based pharmacokinetic models were published in scientific journals). There were two nmes with pbpk models for which additional dedicated clinical ddi studies with cyp3a substrates were requested as pmr . For ceritinib, in addition, neither of these two nmes had supporting clinical data to verify model performance . Further examples will be needed to evaluate the ability of the pbpk approach to quantitatively predict positive ddi effects.1 most of the pbpk applications on absorptionrelated pharmacokinetic changes were exploratory and did not impact the labeling recommendation (table 3). Altered panobinostat absorption was not observed with drugs that elevate the gastric ph in pbpk simulation . Pbpk models in product labels or fda review documents: drug absorption ara, acid reducing agents; auc, area under the curve; cmax, peak plasma concentration; fda, us food and drug administration; i d, identification; nme, new molecular entity; pbpk, physiologically based pharmacokinetic; pgp, pglycoprotein . The numbers in the reference column represent pubmed i d (if pbpk models were published in scientific journals). Other pbpk applications observed in the nda review documents include prediction of the effect of hepatic impairment (hi; table 4), but pmrs were issued for three of four nmes to conduct or complete dedicated clinical studies, presumably because of the low level of reliability.1 in the case of obeticholic acid, the effect of hi on hepatic exposure was explored with pbpk simulations, and this helped to inform the dosing recommendation in patients with hi . Pbpk models in product labels or fda review documents: other areas of pbpk applications cyp, cytochrome; ddi, drugdrug interaction; hi, hepatic impairment; i d, identification; nme, new molecular entity; oatp, organic aniontransporting polypeptide; pbpk, physiologically based pharmacokinetic; pmr, postmarketing requirement . The numbers in the reference column represent pubmed i d (if physiologically based pharmacokinetic [pbpk] models were published in scientific journals). The regulatory impacts of pbpkbased predictions have been limited in areas other than metabolismbased ddis and pharmacogenetics, such as in transportermediated ddis or effect of acid reducing agents . Accumulated experience of pbpk application in these areas will help to establish the level of confidence necessary to inform regulatory decisions . Also, some degree of model validation with clinical data using the nme has generally been required for highimpact regulatory decisions.2 currently, validation of system components, such as hepatic metabolic activity in patients with renal impairment, based on other molecules that share same elimination pathways has not been considered sufficient . Such limitations have impeded the application of pbpk models to replace clinical studies for evaluating socalled intrinsic factors, such as in pediatric populations, to evaluate ethnic differences in pharmacokinetics, or in patient populations with organ impairment . The authors believe that future verification efforts of pbpkbased prediction performance with cross learning from other molecules, including both xenobiotics and endogenous biomarkers, will greatly expand the use of pbpk beyond ddi and pharmacogenetic applications and will contribute to acceleration of new drug development.
|
Stat3 is a transcription factor that is activated by extracellular ligands, e.g., the cytokines il-6, il-10, il-21, il-27, g - csf and leptin, but also by the growth factors egf and hgf, through specific binding to transmembrane receptors and the induction of receptor associated and cytoplasmic tyrosine kinases . Stat3 activation can be observed in multiple organs and cell types, e.g., in immune cells, mammary epithelial cells, adipocytes, neural cells, cardiomyocytes, hepatocytes, stem cells and tumor cells, and is correlated with such diverse cellular phenotypes as differentiation, proliferation, apoptosis regulation, angiogenesis, malignant transformation, metastasis formation and drug responsiveness . How can a single transcription factor influence so many different functions? The cellular contexts, defined by the activity of interacting signaling pathways and the epigenetic state most likely play determining roles, but the discrete levels and the duration of stat3 signaling also cooperate and contribute to the manifestation of distinct cellular outcomes . In skeletal muscle cells for example, it reaches a maximum after about 1 h of cytokine stimulation and dampening mechanisms cause a return of activated stat3 to basal levels within about 2 h. in tumor cells, a different activation pattern can be observed and strong activation of stat3 is being maintained over long periods of time . Persisting and high levels of stat3 signaling seem to be associated with cellular proliferation and transformation . Since the strength of stat3 signaling and the duration of its activation appear as central determinants of the phenotypic cellular functions of this transcription factor, these parameters are tightly controlled . Several mechanisms have been described that regulate these parameters and either affect the activation step of stat3 or the subsequent deactivation events . The diversity of the molecular mechanisms contributing to the finetuning of stat3 signaling probably reflects the importance of the quantitative aspects of this signaling pathway for the cellular physiology, but also provides vulnerability and possibilities for disturbance . Enhanced stat3 signaling output can be traced to two basic steps in the regulation of extent and duration of stat3 activation: (1) mechanisms that enhance the activation step . They can be based on genetic alterations in molecular components that result in intracellular gains of function or effects on intercellular communication events that result in the exposure of cells to high levels of kinase activating signals . (2) mechanisms and mutations that impede the negative regulation of stat3, i.e., alterations that result in a loss of function of molecular components that are involved in the downregulation, e.g., the dephosphorylation or intracellular utilization, of activated stat3 . The enhancement of stat3 upregulation can be attributed to mutational events that directly alter known pathway components: (1) c - src is a non - receptor tyrosine kinase closely related to v - src, an oncogene encoded by the rous sarcoma virus . V - src lacks the regulatory c - terminal domain of c - src that, together with several point mutations, results in a constitutively active kinase molecule with high transforming activity . Phosphorylation of stat3 has also been observed in cells upon the expression of a several other oncoproteins . (2) a somatic mutation in the jak2 tyrosine kinase (v617f) is present in most patients with myeloproliferative neoplasms, like polycythemia vera (pv), essential thrombocythemia (et) and chronic idiopathic myelofibrosis . The mutation causes a gain of kinase function, and jak2 v617f induces, for example, the expansion of erythroid progenitors accompanied by activation of stat3, stat5, akt and erk signaling in an erythropoietin - independent manner . (3) small deletions in the il-6 binding site of the gp130 subunit of the il-6 receptor have been found in cells of inflammatory hepatocellular adenomas . This results in a gain of function, il-6 independent receptor activation and stat3 signaling . About 12% of inflammatory hepatocellular adenomas express a stat variant that is constitutively activated, independently of il-6 stimulation of the cells . The mutation at position y640 occurs in the dimerization domain of stat3 and promotes its activation status . A similar observation has been made in t - cell large granular lymphocytic leukemia cells . This lymphoproliferative disorder is characterized by a high percentage of clonal cd3cd8 cytotoxic t lymphocytes (ctls) and is associated with autoimmune disorders and immune - mediated cytopenias . Forty percent of the patients with large granular lymphocytic leukemia express constitutively activated stat3 variants with mutations in the dimerization of stat3 and aberrant activation . The inappropriate activation of stat3, however, can also be explained by the deregulation of linked signaling events that are not directly attributable to distinct mutations in components of the jak stat pathway, but by deregulated expression levels of accessory protein . (1) g - csf receptor activation controls survival, proliferation and differentiation of myeloid progenitor cells via jaks . Jaks in turn control the levels of cytokine receptor expression and increased jak expression can confer growth factor independent stat3 activation and hematopoietic cell transformation . (2) elevated expression of sphingosine-1-phosphate receptor-1 (s1pr1), a g protein - coupled receptor for the lysophospholipid sphingosine-1-phosphate (s1p), has been found in tumors with activated stat3 . Stat3 induces the transcription of the s1pr1 gene and enhanced s1pr1 expression activates stat3 and il-6 expression . These reciprocal regulatory events are thought to maintain the persistent activation stat3 in cancer cells . (3) autocrine and paracrine mechanisms, especially the secretion of il-6 by tumor cells and cells of the tumor microenvironment, contribute to stat3 activation . Ras activation, e.g., induces the secretion of il-6 and can act in a paracrine fashion to promote angiogenesis and tumor growth . Similarly, egfr activation in lung carcinoma cells causes il-6 expression and secretion, and thus the paracrine and autocrine stimulation of stat3 in cells of the tumor microenvironment . Finally, stat3 activation induces il-6 gene transcription and thus establishes a positive feedback loop in tumor cells in vitro and tumor tissues in vivo . Mechanisms resulting in the enhancement of stat3 signaling are not restricted to the activation steps, but can also be founded in the molecular events governing the downregulation of activated stat3 and the cessation of signaling . These events are based on diverse components and their loss of function can result in the maintenance of the activated state and the persistence of stat3 signaling . (1) the direct reversion of stat3 activation can be accomplished by protein tyrosine phosphatases, ptp . At least three of them have been identified that can catalyze stat3 dephosphorylation, tc - ptp, shp1 and shp2 . The loss of ptp function has been observed in tumor cells with inappropriately activated stat3 . The receptor protein tyrosine phosphatase delta (ptprd), for example, is frequently inactivated in glioblastoma multiforme (gbm), head and neck squamous cell carcinomas and lung cancer . The inactivation of the ptp can be the result of intragenic deletions or of epigenetic silencing by promoter methylation . The suppressor of cytokine signaling (socs) 1 and 3 genes are stat3 targets and their products bind to jak or cytokine receptors, thereby suppressing further signaling . Socs-1 and socs-3 are strong inhibitors of jaks, with kinase inhibitory regions at their n - terminus . Hypermethylation of the socs-3 promoter and transcriptional silencing was frequently detected in lung and breast cancer and mesotheliomas . Restoration of socs-3 expression in lung cancer cells resulted in the downregulation of activated stat3, induction of apoptosis and growth suppression . Pasteurella multocida toxin (pmt) is a highly mitogenic protein that affects cellular signaling through its modulation of heterotrimeric g proteins . Enhanced stat3 activity seems to be promoted by the induction of the serine / threonine kinase pim-1, which in turn phosphorylates socs-1 . This modification disrupts the interaction with the elongin bc complex, which normally allows the socs proteins to shuttle activating components of stat signaling to the proteasome . The negative regulatory function of socs-1 is subverted by pim-1 dependent phosphorylation and results in the sustained activity of stat3 . (4) a small family of proteins, most descriptively named pias (protein inhibitors of activated stat), directly interacts with their targets, and pias3 has shown specificity for stat3 recognition . This interaction results in the inhibition of stat3 mediated gene activation most likely by blocking the dna binding activity . The expression of pias3 correlates with stat3 activation, and pias3 controls the extent and the duration of stat3 activity in normal cells . In cancer cells, the expression of the pias3 protein is post - transcriptionally suppressed and promotes the oncogenic effects of activated stat3 . (5) the lymphocyte adaptor protein (lnk) is a negative regulator of thrombopoietin and erythropoietin mediated jak2 activation . Deletion mutations in this gene were observed in patients with myeloproliferative neoplasms (mpns). These lnk mutants caused augmented and sustained thrombopoietin dependent signaling and stat3 activation due to the loss of lnk negative feedback regulation . Advanced dna sequencing technology allows the comparison of the genomes of normal cells and tumor cells and bioinformatic analysis the determination and interpretation of mutations consistently associated with cellular transformation . The investigation of dna derived from 77 patients with t - cell large granular lymphocytic leukemia, a lymphoproliferative disorder characterized by the presence of a large fraction of clonal cd3cd8 cytotoxic t lymphocytes (ctls), revealed that in 40% of the cases mutations in the stat3 gene could be detected . The mutations were all clustered in exon 21 encoding the sh2 domain of stat3 and resulted in a more hydrophobic dimerization domain . The most frequent mutation found was y640f in 17% of the cases, followed by d661v in 9%, d661y in 9% and n647i 4% . The mutant stat3 molecules were preferentially phosphorylated on tyrosine 705 and present in the nucleus of the leukemic cells . The y640f and d661v variants were further analyzed and exhibited enhanced transactivation potential for known stat3 target genes . The mutation at position 661 is very reminiscent of the stat3 variant, which was originally obtained in mutagenesis experiments and defined stat3 as an oncogene . Why would the expansion of cd8 t cells be affected by inappropriately strong stat3 signaling? Non - redundant functions in the immune system and development of lymphocytes have been assigned to stat signaling . They influence cell fate decisions of differentiating naive t cells and regulate the intensity and duration of inflammatory responses . T helper cell differentiation, th1, th2, th17 and treg, requires the functions of stat1, stat3, stat4, stat5 and stat6 and stat3 determines the differentiation of naive t cells into the regulatory (treg) or inflammatory (th17) t cell lineages . Th17 cells produce il-17, act in the host defense against bacteria and fungi and contribute to autoimmune diseases . Stat3 also regulates cell growth, apoptosis and the transcription of inflammatory genes and contributes to the development of chronic inflammatory diseases and malignant and neurodegenerative diseases . Targeted deletion of the stat3 gene in the cd4 t cell compartment of mice impaired the experimental induction of autoimmune conditions, for example, uveoretinitis or encephalomyelitis, most likely because of a reduction in the expression of activated 4/1 integrins on cd4 t cells . Insights into the role of stat3 signaling in cd8 t cells have recently be gained from studies in mice and humans in which stat3 signaling was negatively impaired through genetic manipulation of mice or a stat3 gene mutation in human patients . Cd8 t cells can be distinguishes into short lived effector cd8 t cells important for immediate pathogen control and memory cd8 t cells, which can self - renew, persist and provide for long - term immunity . Stat3 activation, through the cytokines il-10 and il-21, seems to be directly involved in the cell fate decision of activated t cells, their differentiation into functional cd8 memory t cells and the maintenance of this cell pool . These conclusions were derived from experiments in a mouse model in which the stat3 gene had been conditionally deleted in activated cd8 t cells . They were corroborated by observations in a cohort of patients with autosomal dominant hyper ige syndrome (ad - hies) in which a dominant negative mutation in the stat3 gene has been detected . These patients show a reduced number of central memory cd4 and cd8 t cells when compared with healthy controls and a decreased ability to control bacterial and viral infections . Although the systems employed to arrive at the conclusion that stat3 is a central signaling factor in the establishment and maintenance of memory cd8 t cells both rely on diminished stat3 signaling, they complement the observations reported by koskela et al . Enhanced and prolonged stat3 signaling, emanating from the mutated stat3 variant, seems to mimic the functions of il-10 and il-21 and result in the expansion of a stable cd8 memory t cell pool . This may eventually lead to t cell large granular lymphocytic leukemia, a clonal disorder of large granular lymphocytes . The observation that patients with activating stat3 mutations frequently also suffered from neutropenia and rheumatoid disorders indicate that the expansion of the cd8 t cell population can trigger adverse autoimmune reactions . The summary of the molecular mechanisms responsible for the enhanced activation and the diminished deactivation of stat3, shown in tables 1 and 2, indicates that the fine tuning of the extent and duration of stat3 activation can easily be derailed and that this deregulation is associated with diverse pathological states . The variants that have been detected in the stat3 gene in t - cell large granular lymphocytic leukemia and in inflammatory hepatocellular adenomas gene have been designated as constitutively active and the ones found in the autosomal dominant hyper ige syndrome (ad - hies) as dominant negative . The constitutively active variant is probably still partially regulated by cytokine signaling and affected by the deactivation mechanisms; similarly, the dominant negative variant is probably not entirely inactive and still has some residual activity . Such observations have also been made with hyperactive and muted variants of stat5 and emphasize the quantitative aspects of stat regulation . The presence of an inappropriately strong stat3 signal is sufficient to trigger the clonal expansion of cd8 t cells, the emergence of large granular lymphocytic leukemia and the occurrence of autoimmune disorders.
|
Currently, 106 species are accepted in this genus (denchev & denchev 2011a, 2011b, 2012, vnky & abbasi 2011, vnky 2012, savchenko et al . 2013), but this is certainly not a final number . The magnitude of host plants reported in different publications for some putative species complexes suggests that more species are likely to exist, some of which may be well - delimited morphological species, while others are probably cryptic species that could be uncovered by molecular methods . Some species of anthracoidea were recently included in molecular systematic studies (hendrichs et al . Distinct species could still be hidden under different generic names, especially under historical names that have not been reassessed in recent years (pitek 2012). Such historical names should be critically re - examined in addition to any comprehensive molecular studies directed to the description of novel anthracoidea species . Kenaica is such a neglected taxon name and a likely candidate to be a distinct member of anthracoidea . Micropoda collected in the kenai peninsula of alaska . That sedge is now accepted as a distinct species, carex micropoda, belonging to carex sect . Callistachys) (murray 2002a). Savile (1952) provided the following description of cintractia carpophila var . Zambettakis (1978) included it in anthracoidea, as anthracoidea heterospora kukkonen var . Kenaica (saville) nov . Comb ., but without any indication of the basionym or a reference to the place of its valid publication, rendering the combination invalid (art . Likewise, kukkonen (1963) and piepenbring (2000) considered this fungus to be a member of anthracoidea, but again without further treatment and any formal nomenclatural and taxonomic decisions . Vnky (2012) included this smut in two places in his monograph: first as a synonym of anthracoidea heterospora and later under excluded or invalidly published taxa, in both cases without detailed observations . The aim of the present work is to clarify the nomenclatural and taxonomic status of cintractia carpophila var . Kenaica, and to provide a detailed characterization of this smut fungus as it lacks a detailed description and any iconography . Sori and spore characteristics were studied using dried herbarium material deposited in daom, s, and wrsl . Specimens were examined either by light microscopy (lm) and scanning electron microscopy (sem) or only by light microscopy (lm). For light microscopy (lm), hand - cut sections of sori or small pieces of sori were mounted in lactic acid, heated to boiling point and cooled, then examined under a nikon eclipse 80i light microscope . Spore size range, mean spore size, and standard deviation of 50 measured spores of each investigated specimen were calculated (table 1). The spores were measured in plane view and measurements were adjusted to the nearest 0.5 m . Spore size ranges were assigned to one of the three groups distinguished by savile (1952): (1) small - sized spores, 1321(23) 917(20) m; (2) medium - sized spores, 1525(27) 1021 m; and (3) large - sized spores, 1833 1328 m . For scanning electron microscopy (sem), spores taken directly from dried specimens were dusted onto carbon tabs and fixed to an aluminium stub with double - sided transparent tape . The stubs were sputter - coated with carbon using a cressington sputter - coater and viewed under a hitachi s-4700 scanning electron microscope, with a working distance of ca . Sem micrographs were taken in the laboratory of field emission scanning electron microscopy and microanalysis at the institute of geological sciences of jagiellonian university (krakw). Detailed morphological characteristics of the holotype, isotype, and two non - type specimens of cintractia carpophila var . The internal soral structure in the holotype was typical of species of anthracoidea in that the spores were produced directly on the outer surface of the achene, and not within u - shaped cavities embedded in sterile stroma, a characteristic of cintractia (kukkonen 1963, kukkonen & vaissalo 1964, piepenbring 2000). This indicated this smut fungus was better placed in anthracoidea, as was suggested in other studies (kukkonen 1963, zambettakis 1978, piepenbring 2000). The spores were uniform in shape and size ranges between collections (table 1). Kenaica matched well the short description given by savile (1952), although the spore surface was not smooth as stated in the protologue, but smooth or very finely punctate in lm, and very finely verruculose in sem . The very fine ornamentation of spores was probably outside the limits of resolution of savile s light microscope . In general, the present examination confirms the decision of savile (1952) to consider this smut as distinct . This is in line with the conclusion of kukkonen (1963), who, however, did not formally make the transfer . Type: usa: alaska: kenai peninsula, head of palmer creek valley, 6049n, 14933w, on carex micropoda (syn . Description: sori in all or single ovaries of the inflorescence, black, globose or ovoid, about 11.5 mm diam, at first covered by a silvery membrane and perigynium that later ruptures revealing agglutinated spores, powdery on the surface, the sori are partly hidden by the perigynium and scales . Sori develop around reduced achenes that are consecutively surrounded by a thin dark layer of the remnants of achene epidermis, a hyaline layer of sporogeneous hyphae with young spores, a layer of gradually maturing dark spores, and a thin membrane of host origin . Spores usually more or less flattened, chestnut brown, reddish brown to dark brown, quite regular in shape and size, globose, subglobose or broadly ellipsoidal, small, (14.0)15.020.5(22.0) (11.5)12.018.5(20.5) sd, 18.5 1.5 15.6 1.7 m, n = 200/4], rarely enclosed by a thin, hyaline, mucilaginous sheath; wall even, 1.01.5 m thick, somewhat darker than the rest of the spore, without protuberances and light - refractive spots, but with 25 distinct internal swellings; surface smooth or very finely punctate in lm, spore profile smooth, surface very finely verruculose in sem . (nannfeldt & lindeberg 1965) and is therefore illegitimate and to be rejected (art . Also, liro s treatment cannot constitute a valid description of a new species to be attributed to him alone due to the absence of a latin diagnosis (nannfeldt & lindeberg 1965), required in the period 1 january 1935 to 31 december 2011 (art . Vnky (2012) considered uredo carpophila as an illegitimate name, which is correct, but also as a nomen nudum, which is not correct, since schumacher (1903) provided a short description of this species: kenaica is legitimate since an infraspecific name may be legitimate even if its final epithet was originally placed under an illegitimate species name . Verrucosa savile (savile 1952), was accepted as a legitimate varietal name that was elevated to the species rank as anthracoidea verrucosa (savile) nannf . The type host of a. kenaica is carex micropoda, but in addition savile (1952) assigned a single smut collection on carex deweyana (in carex sect . Zambettakis (1978) included two sem pictures of spores from a specimen on c. deweyana and they are distinctly verrucose, unlike spores of specimens on c. micropoda . Anthracoidea kenaica was previously reported from the type locality on the kenai peninsula and two other collections from the same region (savile 1952). Here the smut is newly reported from pribilof island (ak) and from mt fougner in british columbia; this last collection represents the first record of this species in canada . Kenaica cannot be treated as a synonym or variety of anthracoidea heterospora since this species is different in having spores with better developed ornamentation, thicker walls (12.5 m), and occurs on host plants belonging to carex sect . In contrast, the morphology of anthracoidea kenaica is characteristic of members of anthracoidea sect . Leiosporae, which includes species with smooth or very finely verruculose spores (kukkonen 1963). Within this section, anthracoidea kenaica may be comparable only to five anthracoidea species having spores similar in size and with a smooth or very finely verruculose (not papillate) surface: a. elynae, a. externa, a. macranthae, a. nardinae, and a. scirpi . The main morphological differences between these species include differences in wall thickness, the presence and the number of internal swellings, and the presence of a hyaline mucilaginous sheath enclosing the spores . Furthermore, all of them are restricted to host species belonging to different sections of carex, or to different genera (kobresia, trichophorum), which could be used as supportive taxonomic characters . Characters used to discriminate these five species of anthracoidea from a. kenaica (table 2) are contrasted and discussed below . Anthracoidea elynae is distinguished from a. kenaica by the mostly smooth spores with a thicker wall, fewer internal swellings, a more or less evident mucilaginous sheath, and occurrence on kobresia . The internal swellings in a. elynae are weakly visible in lm (savile 1952, kukkonen 1961, vnky 1994, 2012), and recent tem studies of spores from a romanian collection did not report internal swellings (parvu et al . In fact, the spore presented in figure 3 of the latter study has a shallow thickening on the lower flattened side, which may be interpreted as a weak internal swelling . By contrast, internal swellings of anthracoidea kenaica are prominent and clearly visible in lm . Anthracoidea externa is morphologically distinct in having absolutely smooth spores surrounded by a thick mucilaginous sheath, a thicker spore wall without internal swellings, and occurrence on species of carex sect . Anthracoidea macranthae differs from a. kenaica as it has completely smooth spores with prominent and common hyaline caps (a mucilaginous sheath) on the flattened sides, an absence of internal swellings, a somewhat thinner spore wall, and in occurring on kobresia (guo & wang 2005). Although not discussed in the protologue, the occurrence of a mucilaginous sheath in the form of hyaline caps is the most valuable diagnostic character of anthracoidea macranthae . It is distinguished by nearly smooth spores, a thicker spore wall, fewer internal swellings, and occurrence on carex sect . The type host of a. nardinae is c. nardina, but kukkonen (1963) assigned this smut to two collections on c. elynoides, which belongs to a different carex section (sect . The examination of one collection of anthracoidea on c. elynoides [plants of southern colorado, carex elynoides holm n. sp ., near pagosa peak, aug . Extracted from the isotype of c. elynoides in wrsl (phanerogamic herbarium)], had globose, subglobose to broadly ellipsoidal spores, (14.5)15.019.5 (11.0) 12.017.5 m, av . Sd, 17.2 1.2 14.8 1.7 m, n = 50, wall even, 1.01.5 m, without internal swellings, surface smooth without mucilaginous sheath], though different from those studied by kukkonen, revealed a complete absence of internal swellings typical of a. nardinae . It could be yet another distinct species or a form of a. externa without a hyaline sheath . Anthracoidea scirpi is distinguished from a. kenaica by the minutely punctate spores, which are usually surrounded by hyaline, mucilaginous sheaths on the flattened sides, a thicker spore wall, the absence of internal swellings, and occcurrence on trichophorum species (vnky 1994, 2012). Differences between smut specimens in the ovaries of carex micropoda and all aforementioned anthracoidea species from sect . Leiosporae support a. kenaica as a distinct species specialised to a host in carex sect . Host plants of these anthracoidea species are placed in one of the four / five major clades of the tribe cariceae, the so called core unispicate clade, which includes carex subgen . Leiosporae is uncertain, and the problem remains open for future studies using molecular methods . In a recent molecular phylogenetic study, by hendrichs et al . (2005), the only accessioned smooth - spored species, a. elynae, was recovered as sister to the verrucose - spored species a. curvulae on carex curvula, which is also a member of the core unispicate clade.
|
Obesity is a major public health issue, both nationally and internationally . Recent reports estimate that 35.7%approximately 72.5 million of american adults are obese (defined as body mass index (bmi) 30 kg / m) [1, 2]. Globally in the year 2000, the number of adults with excessive weight exceeded the number who were underweight for the first time in history . The world health organization reported that in 2008, 1.5 billion adults 20 years and older were overweight (defined as bmi 25 kg / m), and of those, 200 million men and nearly 300 million women were obese . Additionally, obesity is associated with chronic diseases that increase rates of morbidity and mortality, including type 2 diabetes, cardiovascular disease, stroke, hypertension, and certain types of cancer . Obesity is a consequence of multiple factors, and it is important to better understand these factors in order to identify opportunities to promote healthy behaviors, thus reducing the risk of developing obesity and related chronic diseases . One area of research has shown that marriage may be associated with body weight and obesity - related behaviors among adults . For example, research investigating the influences on individual food decisions has found that, among married couples at different stages of the life course, spousal influence was consistently rated as one of the most important sources of influence on individual food decisions [7, 8]. While some studies have found that current marital status is itself correlated with body weight and obesity, other research suggests that marital transition the act of moving from one marital status to another is also important in predicting body weight changes and the behavioral risk factors associated with weight gain . Although researchers note that there are important differences between marriage and cohabitation living with, but not legally married to, a romantic partner that may not be associated with the same health benefits seen among the married [11, 12], cohabitation is becoming a more commonly occurring relationship status and deserves further investigation . Marital transition is a relevant target for obesity research as most adults marry or cohabit . Therefore, there is a need to evaluate the body of literature focusing on marital transitions, both into and out of marriage and/or cohabitation, and their associations with body weight change . Marital transition has been defined as a change in marital status during a given time period that occurs due to entry into marriage, exit out of marriage as a result of divorce or spousal death, and remarriage following divorce or spousal death . In addition, since cohabiting can be considered a relationship status different from married, we broaden the definition of marital transition to include transitions into and out of cohabitation . The current review evaluates changes in bmi and body weight as a result of marital transition . Specific transitions into and out of marriage, including cohabitation, remarriage, divorce or separation, and widowhood, are independently evaluated to provide further clarity on the differences in body weight trends as a result of these transitions . The findings from this review highlight areas for further research, as well as opportunities to incorporate new programs, practices, and policies that seek to promote healthy weights and behaviors upon entering or leaving a marriage or cohabiting relationship . Ten databases (academic search complete, anthropology plus, cinahl and cinahl plus, econlit, medline, psychinfo, scopus, socindex, sociological abstracts, and web of science) were searched for the relevant articles published between january 1990 and december 2011 . These databases were searched because they provide most comprehensive scholarly and multidisciplinary abstracts relevant to this area of research . For this review keywords such as marri *, marry *, marital, divorc *, widow *, cohabit *, weight change, weight gain, weight loss, overweight, obes *, body mass index, adult, m?n, and wom?n were used in combination, where * and? Signify truncation and wildcard searches, respectively (to account for various endings or multiple spellings). Relevant references were extracted and examined, and a list was compiled in the form of titles and abstracts of the selected articles . Articles were included if they were longitudinal in design and compared a weight - related dependent variable before and after a change in marital status . Marital status was defined as an individual's current relationship state, such as never married, cohabiting, married, divorced / separated, or widowed; whereas marital transition was defined as a change in marital status over time . Transitions into marriage could have included never married to married, never married to cohabiting, cohabiting to married, divorced / separated or widowed to remarried, and divorced / separated or widowed to cohabiting . Transitions out of marriage could have included cohabiting to not living with a romantic partner, married to divorced / separated, and married to widowed . It should be noted that additional marital categories have been identified and reported in the literature, including single, unmarried, and not married . These terms are not precise, as they do not distinguish between never married, divorced / separated, and widowed individuals . However, the purpose of our review was to synthesize the existing literature . In order to accurately reflect the sample of articles included in this review, all terminology reported in the current paper additional articles that met the above criteria were obtained from reference lists of those retrieved from the database searches and from enquiry with researchers in the field . Searches were conducted only in the english language; all other languages were excluded . The results of the preliminary search were reviewed and relevant titles with abstracts were then retrieved . Two authors independently assessed the retrieved articles for inclusion based upon the criteria listed above . The table includes characteristics of the participants (sample size, age range, race, response rate, country), dataset from which the data came (if applicable), data collection methods, time parameters of the study or survey (year and length of the study or survey), marital transition(s) studied, key findings, and limitations as reported in the articles . A total of 1,190 abstracts were retrieved through the initial search process; 524 were excluded due to repeats, resulting in 666 abstracts identified through the initial search process . Upon review of these abstracts by two separate authors, 38 articles were identified as potentially meeting the inclusion and exclusion criteria . After reviewing the full articles, the two authors agreed that 12 articles met the criteria for inclusion in this review . Five additional articles were identified from the reference lists of the original 12 articles, and 3 more were found through the process of enquiring with researchers in the field . It should be noted that 8 out of the final 20 articles analyzed data from the same national survey or study as one or more other articles, albeit using different analytic samples (e.g., the final sample size included in the analysis), comparison groups, outcome variables, and/or baseline or follow - up time points [6, 10, 22, 2426, 32, 33]. For example, kahn and williamson [24, 26], kahn et al ., and sobal et al . Analyzed data from the national health and nutrition examination survey (nhanes i) and the nhanes i epidemiological follow - up study (nhefs), though different sample sizes were used for analysis, and each article reports different outcome measures (e.g, weight change, bmi change, major weight gain or loss, etc . ). However, umberson only included data from waves i and ii, whereas umberson et al . Both harris et al . And the and gordon - larson report findings from the national longitudinal study of adolescent health (add health) yet use different waves as baseline data, as well as different comparison groups and outcome measures . In total four articles described only transitions into marriage and/or cohabitation [17, 19, 22, 32], 2 articles described only transitions out of marriage and/or cohabitation [30, 31], and 14 articles described both [6, 10, 18, 20, 21, 2329, 33, 34]. Three articles differentiated between marriage and cohabitation [18, 22, 32], four articles focused explicitly on remarriage or cohabitation following divorce or widowhood [18, 20, 27, 34], and nine articles specifically analyzed divorce and/or widowhood [6, 10, 18, 20, 27, 2931, 34]. Of the 20 articles, 16 analyzed u.s . Data [6, 10, 18, 20, 2228, 3034], 3 were conducted in europe (scotland and finland) [17, 21, 29], and 1 reported on australian data . Articles analyzed time spans between baseline and follow - up ranging from 6 months to 23 years . Table 1 provides a summary of the study design, participant characteristics, key findings, and limitations of the articles as reported by the investigators . For the purposes of organizing the findings, articles analyzing spans of three years or less were grouped as short time spans, four to eight years as medium time spans, and nine or more years as long time spans . Results are reported by marital transition; however, direct comparisons could not be made due to differing time span durations, independent and dependent variables, comparison groups, and the years over which data were collected . Twelve articles examined the association between all transitions into marriage and changes in bmi or weight without distinguishing between marriage, cohabitation, and/or remarriage [6, 10, 17, 19, 21, 2326, 28, 29, 33]. Unless otherwise indicated, articles defined the transition into marriage as a change from an unmarried to a married state, whereby unmarried could include never married, cohabiting, divorced / separated, and/or widowed . The length of follow - up represented by these articles span from 6 months to 15 years and present mixed findings by both time and gender . Among the articles reporting on short time spans, anderson et al . Surveyed 22 scottish couples approximately three months before and three months after moving in with a partner or spouse (the period between interviews ranged from 6 to 12 months, and during this time, women gained an average of 1.54 kg (sd 1.7, p <0.001) and men gained an average of 1.63 kg (sd 2.7, p = 0.02). However, since a comparison group of never married individuals living alone was not surveyed, it cannot be assumed that the observed weight gain was solely the result of living with a partner or spouse . Analyzing a sample of 2,436 u.s . Respondents from the one - year national survey of personal health practices and consequences (nsphpc), rauschenbach et al . Found that becoming married was significantly associated with weight in women but not in men . For women, those who became married had an average weight gain of 4.89 lb (se 2.20, p = 0.04) more than their counterparts who remained married . Women and men from the healthy worker project, jeffery and rick observed that becoming married was associated with an average bmi increase of 0.96 0.30 kg / m (p <0.01) in women and 0.70 0.24 kg / m (p <0.01) in men, compared to their counterparts with no change in marital status . Craig and truswell interviewed 60 australian couples before marriage and after more than two years of marriage . Couples were not living together upon recruitment, though remarriage was not determined . Over approximately three years in addition, there was a 5% increase in the number of women classified as overweight or obese between baseline and follow - up, and an 8% increase in the number of men in this category . Again, because a comparison group was not utilized, it cannot be determined if marriage led to the weight gain . Umberson analyzed 3,616 respondents over three years from the acl survey and found that becoming married was not significantly associated with bmi in women or men, compared to their counterparts who remained unmarried . However, it should be noted that umberson compared those who became married to those who remained unmarried, whereas most other articles used consistently married individuals or those with no marital status change as the comparison group . In their analysis of 12,669 adult finns over a medium time span, rissanen et al . Found that both women (rr 2.1; 95% ci 1.4, 3.2) and men (rr 1.8; 95% ci 1.3, 2.5) who became married during the four - to - seven - year study period nearly doubled the risk of substantial weight gain (defined as> 5 kg) relative to their consistently married counterparts . Of the six articles reporting on long time spans, four analyzed data from the same study, three of which were authored by similar research teams . Among 4,836 women and men enrolled in the 10-year nhanes i and nhefs, kahn et al . Observed that women who became married gained a mean of 2.1 kg (95% ci 0.6, 3.4) more than women who were consistently married . Likewise, when looking at only those participants who had a major weight gain (defined as a bmi increase of 5.0 kg / m for women and 4.0 kg / m for men), kahn and williamson [24, 26] found that the risk of major weight gain was significantly associated with becoming married for both women (or 1.8; 95% ci 1.0, 3.1) and men (or 3.3; 95% ci 1.7, 6.3), compared to their consistently married counterparts . Similarly, kahn and williamson reported a significant mean bmi increase of 0.8 kg / m (95% ci 0.2, 1.3) more in women who became married during the 10-year time period compared to women who were consistently married over the same time period . The direction of the relationship was the same for men; however the results were not significant . Using a much larger sample of 9,403 from the same study, sobal et al . Also found that transitions into marriage (but not remarriage) were significantly associated with weight gain among women, but not men . Women who transitioned into marriage had a weight gain of 4.7 lbs (se 1.7, p <0.01) more than their counterparts who remained married during the 10-year time period . Living conditions were classified as living alone throughout the study, stopped cohabiting after entry, started cohabiting after entry, and cohabiting throughout the study . Marital status was not determined so it is unclear what percentage of cohabiting men were married . In this sample of men, entering a cohabiting relationship was not significantly related to weight change compared to those who continuously cohabited . Likewise, umberson et al . Reanalyzed data from 1,500 respondents of the acl survey, this time extending analysis to a 15-year time period . Results were similar to the original analysis: becoming married (remarriage controlled for in the analysis) was not significantly associated with bmi in women or men, compared to their counterparts who remained unmarried . Three articles, representing time spans of 5 to 23 years, examined the separate associations between marriage or cohabitation and changes in bmi or incident obesity, though did not differentiate between cohabitation following a never - married status and cohabitation following divorce or widowhood [18, 22, 32]. The two articles reporting on medium time spans found no significant relationship between beginning to cohabit and either bmi or incident obesity in women or men, however, did find a significant relationship between becoming married, increased bmi, and higher odds of incident obesity . The article reporting on a long time span found separate and significant relationships between both beginning to cohabit and becoming married, and increased bmi in men and women . Four articles, analyzing time spans of 3 to 23 years, described the specific associations between remarriage or cohabitation following divorce or widowhood and bmi or weight [18, 20, 27, 34]. Both medium and long time span articles found that men's bmi increases after remarrying or cohabiting following divorce . Span articles, one reported that women who remarried experienced a bmi increase after four years, yet three - year findings were not significant among widowed women who remarried . Likewise, divorced women who began cohabiting did not exhibit significant changes in bmi in the long time span article by averett et al . . Seven articles examined the association between all transitions out of marriage and changes in bmi or weight without distinguishing between divorce or widowhood [21, 2326, 28, 33]. Unless otherwise indicated, articles defined the transition out of marriage as a change from a married to an unmarried state, whereby unmarried could include cohabiting, divorced / separated, and/or widowed . The length of follow - up represented by these articles span from 1 to 10 years . Among the articles reporting on short time spans, rauschenbach et al . Reported no significant association between becoming unmarried and weight change in women or men over a one - year time span . However, jeffery and rick found that women, but not men, who ended a marriage over the two - year period showed a significant bmi decrease of 0.63 0.27 kg / m (p <0.01) compared to their counterparts who had no change in marital status . Likewise, umberson found that the shift from married to unmarried during a three - year span was associated with a significant bmi decrease of 0.047 kg / m (p <0.001) in women and 0.039 kg / m (p <0.01) in men compared to their counterparts who remained married . Similarly, in the long time span articles by kahn and williamson [24, 26] and kahn et al ., transitions out of marriage were associated with weight loss for both women and men . For women whose marriage ended over the 10-year period, mean weight decreased by 1 kg (95% ci 1.9, 0.2) and mean bmi decreased by 0.4 kg / m (95% ci 0.7, 0.1) relative to women who remained consistently married [25, 26]. For men, a 10-year change in mean bmi following the ending of a marriage was not significant, however, the risk of major weight loss (defined as a bmi decrease of 2.0 kg / m) was significantly associated with ending a marriage (or 1.8; 95% ci 1.0, 3.3) [24, 26]. Support these findings . For men aged 50 to 59 years who transitioned out of a cohabiting relationship during the 10-year period, weight decreased by 2.89 kg (se 1.36, p = 0.03) compared to their counterparts who continuously cohabited . Six articles, analyzing time spans of 4 to 23 years, described the relationship of divorce or separation on changes in bmi or weight [6, 10, 18, 20, 27, 29]. Articles reporting on medium time spans found a significant association between divorce / separation and bmi loss in women and men [20, 27], and no significant association between divorce and weight gain . Among the long time span articles, sobal et al . Reported no significant association between divorce / separation and weight . These trends are supported by umberson et al . And averett et al . Who found a significant, yet temporary association between divorce and bmi loss in women and/or men, with weight reversals observed after three years post - divorce or separation . Eight articles, representing time spans of 3 to 15 years, described the relationship of spousal death on bmi or weight changes [6, 10, 20, 27, 2931, 34]. With the exception of women in the article by sobal et al ., findings from all small, medium, and long time span articles support a significant association between transitions into widowhood and weight or bmi loss in women and men [6, 10, 20, 27, 2931, 34]. Of note, this association was more pronounced among recently widowed women (1 year) than among longer term widowed women (> 1 year), and among widows who had not provided caregiving assistance to their spouse than among widows who had helped their spouse with one or more activities of daily living . Overall, transitions into marriage appear to be associated with weight gain [6, 1720, 2229, 32], whereas transitions out of marriage are associated with weight loss [6, 10, 18, 20, 21, 2327, 2931, 33, 34]. Further analysis by specific marital transition, as well as stratification by gender, reveals similar patterns . Several authors suggest that weight gain after marriage or cohabitation may occur because of increased opportunities for eating due to shared, regular meals and larger portion sizes, as well as decreased physical activity and a decline in weight maintenance for the purpose of attracting an intimate partner [6, 18, 23, 32]. Married individuals are also less likely to smoke and more likely to quit smoking, and smoking cessation is associated with weight gain [6, 18]. Transitions out of marriage may lead to weight and dietary changes as a result of changes in social support, social control, stress, and depression [6, 20, 27, 33]. Reported substantially higher rates of depression and poorer social functioning, and shahar et al . The time span between baseline and follow - up greatly varied between the articles, and although significant findings were seen in short, medium, and long time span articles, it is difficult to draw definitive conclusions on the association between marital transitions and weight . The duration of study periods ranged from 6 months to 23 years, and while several articles reported multiple follow - up measurements, most compared changes in weight at two points in time . Results from two articles suggest that weight changes are temporary following a marital transition [10, 18]. Articles covering short time spans, or those with only one follow - up measurement, were not designed to determine such fluctuations [6, 17, 2034]. Most articles analyzing long time spans did not identify participants who experienced multiple transitions, which may alter weight and dietary trajectories [6, 21, 2426]. Another challenge to interpreting the results lies in how the main independent and dependent variables were conceptualized, defined, and measured . For example, rauschenbach et al . Asked participants to choose between never married, married, widowed, divorced, or separated . Within the never married and divorced groups, averett et al . More specific still is the article by the and gordon - larsen that asked unmarried participants to report whether they were single (not in a romantic relationship), dating (not cohabiting), and cohabiting . Twelve articles grouped all transitions into marriage together [6, 10, 17, 19, 21, 2326, 28, 29, 33], while six distinguished between marriage, cohabitation, and/or remarriage [18, 20, 22, 27, 32, 34]. Likewise, seven articles grouped together all transitions out of marriage [21, 2326, 28, 33], whereas nine examined divorce and widowhood separately [6, 10, 18, 20, 27, 2931, 34]. There was variety even within specified transitions, as seen in the example of remarriage . While eng et al . And lee et al . Analyzed the transition into remarriage (both divorced / separated to married and widowed to married), wilcox et al . Again, we acknowledge that grouping never married, divorced / separated, and widowed individuals together in an unmarried category complicates the interpretation of results, as transitions from or into each of these marital states may bring about different behavioral, emotional, and social changes that can affect weight . Covariates that could affect weight status and weight change also differed among articles, and this variability makes synthesizing and interpreting results challenging . While all articles considered age and gender, only half controlled for income [6, 10, 18, 22, 2426, 28, 33, 34], eight did not control for race or ethnicity [17, 1921, 23, 27, 29, 31], and five did not control for education level [2022, 27, 31]. Likewise, while 16 articles included a measure of physical activity [6, 1927, 2934], only 12 considered smoking status [6, 2022, 2427, 29, 31, 33, 34] and 8 measured dietary intake [1921, 23, 27, 29, 31, 34]. Other potential confounders, such as health status [2022, 27, 2931, 34], depression [22, 30, 31, 34], and neighborhood - level factors [6, 18, 22, 2426, 28] were each controlled for by less than half of the articles . Of particular note of the 14 articles that included premenopausal women, 8 excluded from analysis women who were pregnant at baseline, follow - up, and/or during the study period [6, 17, 22, 23, 25, 26, 29, 32], 1 controlled for pregnancy, and 5 were either unable or did not report excluding or controlling for pregnant women [10, 19, 27, 28, 33]. In addition, only eight articles considered a woman's parity [6, 18, 22, 25, 26, 28, 29, 33], and parental status was measured in a variety of ways . For example, harris et al . And rissanen et al . Controlled for births reported during the study period, while sobal et al ., kahn et al ., and kahn and williamson controlled for the total number of births and rauschenbach et al . Half of the articles analyzed measured participants' heights and weights [6, 17, 2426, 2932, 34], while the other half relied on self - reported data [10, 1823, 27, 28, 33], which tend to provide an underreporting of weight and overreporting of height . In addition, the dependent variable differed between weight change [6, 17, 19, 21, 25, 2831, 34], bmi change [10, 18, 20, 2224, 26, 27, 33], weight gain or weight loss [6, 28], weight gain or weight loss of a specific number of kilograms or pounds [25, 29, 34], and incident overweight or obesity [19, 32], among others . However, we can note patterns in direction, and overall it appears that transitions into marriage are associated with weight gain and transitions out of marriage are associated with weight loss for both genders . Results between articles are difficult to compare due to the use of different comparison groups . The most disparate example of such inconsistencies can be found in the analysis of transitions into marriage or cohabitation (but not remarriage). Those who became married or began cohabiting were compared to participants who transitioned from single (defined as not in a romantic relationship) to dating (defined as in a romantic relationship but not living together) or remained dating in the article by the and gordon - larsen, while umberson et al . Compared to those who remained unmarried (either never married, divorced, or widowed), and averett et al . Although there is overlap between these three comparison groups, some are more inclusive than others . In addition, the articles by anderson et al . And craig and truswell did not have a comparison group . It is, therefore, difficult to draw definitive conclusions across these articles, even though they all assessed the same marital transition and showed a similar pattern towards weight gain following marriage or cohabitation (with the exception of umberson et al . Who found no significant relationship). Finally, it must be mentioned that while our inclusion criteria included articles published from 1990 to present, the data for these articles were obtained over a 40-year time span, from as early as 1966 to as recent as 2004 . The percentage of married americans during this time decreased from 67.6% in 1960 to 53.6% in 2010, while the number of cohabitating couples has increased more than 15-fold during this time . In 2009, about 10% of opposite - sex couples that lived together were not married . Adults are waiting between five and six years longer to get married than 50 years ago . Similar patterns have been observed in australia, finland [40, 41], and scotland . Likewise, dietary intake and physical activity patterns have also changed during this time . A review by french et al . Reports that, since the 1970s, americans have dramatically increased intake of soft drinks and foods prepared outside the home, which are often high in added sugar and fat, respectively . Portion sizes have increased over time, whereas food cost as a percentage of income has declined, contributing to over - consumption . Furthermore, sedentary activities such as television and computer use have increased since the 1960s, and an increase in automobile use means that americans are less likely than in previous years to walk or bike for transportation . Taken together, it is possible that the relationship between marital transition and weight change has shifted over time as both period and cohort effects of marriage, diet, and physical activity may be operating in the data . Although significant results were found in articles analyzing both earlier and more recent data, we cannot determine whether the magnitude of these changes varies across the years, or to what extent these changes are associated with shifting period and cohort effects, as these effects cannot be clearly separated . First, because of variations in analytic design and duration, measures, and comparison groups, a quantitative analysis of the evidence was not possible . Data, the findings might not be generalizable to other countries where marital patterns may differ ., as studies either recruited only heterosexual couples or did not ask participants about the sex of their partners . Due to the limited number of articles that stratified results beyond gender, it is difficult to determine whether patterns differ by race, ethnicity, age, income, or other sociodemographic characteristics . In addition, many articles did not distinguish cohabitation as a unique marital status, so it is unclear whether marriage, per se, affects weight . Although our initial literature search resulted in over 600 articles, most did not analyze the relationship between a change in marital status and concomitant change in weight or bmi . This is a young but growing topic of research that cannot be clearly summarized at this point in time . However, we believe this systematic review is strengthened by the inclusion of several articles that analyzed nationally representative samples [6, 18, 22, 2426, 32]. As the percentage of u.s . Households identifying as unmarried partner households has increased over time, so too has the percentage of same - sex couples . However, as this review reveals, the literature currently lacks research about the associations between marital transitions and weight in same - sex couples . Likewise, it is possible that weight changes following marital transitions differ depending on sociodemographic characteristics . New research suggests that weight gain following marriage is most pronounced in newly married women compared to men, and for those who marry at a younger age than those who marry later in life . Further studies are, therefore, needed to explore whether all couples experience similar weight changes after a marital transition, or if these associations differ by an individual's or partner's gender, age, race, ethnicity, income, or geographic location . In order to better compare the research going forward, it is important that studies utilize similar marital status measures, covariates, and weight outcomes . Additional longitudinal studies with multiple follow - ups can allow researchers to determine if and when weight changes peak, stabilize, and reverse after a marital transition . Furthermore, multiple follow - ups can assist in identifying those individuals who experience more than one marital transition during the study period . The present review highlights the need to develop and support successful programs aimed at promoting the health benefits and preventing the health detriments related to marital transitions . Taking a life course perspective, children and adolescents should receive adequate food and nutrition education in school as an effort to introduce and improve food preparation skills prior to adulthood, cohabitation, and marriage . A recent call for the revival and modernization of home economics courses reveals the need to teach students how to choose and prepare food as part of a comprehensive, school - based obesity prevention effort . This comprehensive effort should also include daily quality physical education and adequate opportunities for all students to participate in physical activity outside of physical education courses, such as recess periods for elementary students, interscholastic sports, and walk- or bicycle - to - school programs . Later on in adulthood, transitions into cohabitation or marriage provide opportunities to engage people in adopting healthier behaviors through food and nutrition intervention programs specifically designed for couples and the newly shared household environment . Such programs have shown promise in improving both obesity - related dietary and physical activity behaviors [48, 49]. From a practice standpoint, health providers and marriage professionals including physicians, nurse practitioners, registered dietitians, psychologists, social workers, marriage counselors, family therapists, and others should gather information regarding marital transitions and the health histories of partners . For those transitioning into marriage or cohabitation, health providers and marriage professionals could then target their counseling to promote healthy behaviors, as well as refer patients to couples - based programs . Transitions out of marriage can serve as a flag to probe for symptoms of stress, depression, dietary changes, and weight loss . Referrals can also be provided for services seeking to prevent or treat these symptoms . From a policy perspective, several states provide incentives for marriage preparation, such as waiving or reducing the marriage license fee for couples that complete a premarital education course . In addition to including communication and conflict management skills, these courses highlight an opportunity to incorporate weight management techniques, food preparation methods, and tips for including physical activity into daily life . Similarly, marriage counseling programs aimed at strengthening marital relationships for temporary assistance for needy families (tanfs) recipients and low - income populations are available in some states and could be broadened to promote healthy weights within couples and families . Finally, many states mandate education for divorcing couples particularly for couples with children to discuss parenting issues and the effects of divorce on children . Again, these programs could also review how to maintain healthy habits during the transition out of marriage . Furthermore, policies and programs should be enhanced to provide the necessary social and emotional support for the aging population . As this review has highlighted, transitions into widowhood often experienced later in life are associated with weight loss, possibly as a result of changes in social support, stress, and depression . While programs such as meals on wheels and senior centers help to decrease isolation, malnutrition, and food insecurity in this population, adequate and consistent funding and support is required for these and other services as americans live longer and the number of older adults continues to grow . In conclusion, this review has found that marital transitions are associated with weight in both men and women . Although additional research is warranted to better understand this phenomenon and its impact on obesity and related behaviors, this review highlights potential opportunities to incorporate effective programs, practices, and policies which aim to promote and support healthy weights and lifestyles upon entering or leaving a marriage or cohabiting relationship.
|
Simultaneous palmar dislocation of the scaphoid and lunate is rare [17] and has been classified into two types depending on whether or not the scapholunate ligament is intact . Ten patients with dislocation of the scaphoid and lunate as a unit have been described to date, as well as six patients with divergent dislocation [16]. The patient described here is therefore the seventh with palmar - divergent dislocation of the scaphoid and lunate . In this patient, the scapholunate and lunotriquetral ligaments were sutured through the dorsal approach, the anterior capsule was sutured through the palmar approach, and the scapholunate and lunotriquetral joints were fixed with kirschner wires . To our knowledge, this is the first report in which interosseous ligaments were sutured by open surgery for divergent dislocation of the scaphoid and lunate . A 46-year - old man who fell from a height of 1.5 m onto his left hand was brought to the emergency center of our hospital and underwent a medical examination . Radiography of the wrist revealed palmar - divergent dislocation of the scaphoid and lunate (fig . 1) but with no neurovascular disturbance in the hand . Seven days after the injury, open surgery was performed through the palmar and dorsal approaches . The dorsal approach showed ruptures of the scapholunate and lunotriquetral ligaments, which were sutured with anchors . The palmar approach showed an oblique tear of the anterior capsule, which was sutured with absorbable threads . Finally, the scapholunate and lunotriquetral joints were fixed with two kirschner wires, inserted from the scaphoid to the lunate and from the triquetrum to the lunate, respectively, and the wires were buried under the skin (fig . 2). A short arm plaster splint was applied postoperatively; 2 weeks later, it was changed to a removable splint and rehabilitation was started . As kirschner wires remained in the carpal bones, range of motion (rom) exercises of the wrist were restricted to avoid wire failure . At 7 weeks, the kirschner wires and splint were removed, and the patient was started on intensive rehabilitation for an additional 3 months . At the 1-year follow - up, the patient had returned to normal life and work and had no pain in his wrist, although wrist motion was still restricted . Measurements of wrist and forearm rom showed that right / left extension was 60/50, flexion was 70/40, supination was 90/80, and pronation was 90/90. A hand dynamometer showed that grip strength in his left hand was 16 kg compared with 27 kg on the contralateral (dominant) side . Although we observed no evidence of dorsal or volar intercalated segment instability pattern deformity, radiography showed a break in arc ii of gilula s line between the lunate and triquetrum, as well as flexion deformity of the scaphoid (fig . Magnetic resonance imaging showed no evidence of avascular necrosis of the scaphoid and lunate (fig . 1radiographs at initial diagnosis showing palmar - divergent dislocation of the scaphoid and lunatefig . The scapholunate angle was 54 and the radiolunate angle 6. gilula s line was well - regulatedfig . The scapholunate angle was 67 and the radiolunate angle 0. dorsal intercalated segment instability (disi) deformity was not observed, although there was flexion of the scaphoid and a break in arc ii of gilula s line at neutral and ulnar deviationfig . 4magnetic resonance imaging at the 1-year follow - up showing no evidence of avascular necrosis of the scaphoid and lunate radiographs at initial diagnosis showing palmar - divergent dislocation of the scaphoid and lunate postoperative radiographs showing good alignment of the carpal bones . The scapholunate angle was 54 and the radiolunate angle 6. gilula s line was well - regulated radiographs at the 1-year follow - up . The scapholunate angle was 67 and the radiolunate angle 0. dorsal intercalated segment instability (disi) deformity was not observed, although there was flexion of the scaphoid and a break in arc ii of gilula s line at neutral and ulnar deviation magnetic resonance imaging at the 1-year follow - up showing no evidence of avascular necrosis of the scaphoid and lunate the patient provided written informed consent prior to inclusion in this study, which was authorized by the local ethics committee and performed in accordance with the ethical standards of the 1964 declaration of helsinki as revised in 2000 . As palmar - divergent dislocation of the scaphoid and lunate is rare, its optimal treatment remains unclear . In previous reports, two patients were treated by open reduction and cast immobilization [1, 2], two by open reduction and percutaneous pinning of the carpal bones and cast immobilization [3, 4], one by open reduction and suture of the anterior capsule and cast immobilization, and one by proximal row carpectomy (prc) (table 1). Carpal instability is severe in divergent dislocation due to ruptures of both the scapholunate and lunotriquetral ligaments . Therefore, it is difficult to stabilize the carpal bones and still retain sufficient wrist motion.table 1review of previous patients with divergent dislocation of the scaphoid and lunateauthorfollow - up (months)surgical procedureapproachimmobilization (duration)k - wire removalrange of motioncomplicationscampbell 12only open reductionpalmarcastnr ext 1/2flex 1/3 of healthy sidenonegordon 12only open reductionpalmarcast4 weeks ext 15flex 25disikupfer 42open reduction k - wire pinning (s - l)palmar & dorsalcast4 months4 monthsext 25flex 0crps disi an (scaphoid, lunate)baulot 42open reduction anterior capsule suturepalmarcast6 weeksalmost fulldisikang 18open reduction k - wire pinning (s - l / s - c)palmarcast6 weeks6 weeksalmost fullnonedomeshek 1proximal row carpectomypalmar & dorsalsplint1 month nrnran avascular necrosis, nr not recorded, k - wire kirschner wire, s scaphoid, l lunate, t triquetrum, c capitate, disi dorsal intercalated segment instability, crps complex regional pain syndrome, ext extension, flex flexion review of previous patients with divergent dislocation of the scaphoid and lunate an avascular necrosis, nr not recorded, k - wire kirschner wire, s scaphoid, l lunate, t triquetrum, c capitate, disi dorsal intercalated segment instability, crps complex regional pain syndrome, ext extension, flex flexion among the methods recommended to repair, the anterior and posterior ligaments on both sides of the lunate are combined palmar and dorsal approaches, and open reduction and percutaneous pinning of the scapholunate and scaphocapitate joints without suture of the interosseous ligaments . Although we found that suturing of the dorsal scapholunate and lunotriquetral ligaments provided a satisfactory outcome in our patient, wrist stiffness, carpal malalignment due to a break in arc ii of gilula s line between the lunate and triquetrum, and flexion of the scaphoid still remained . First, we should have sutured the palmar, not the dorsal, lunotriquetral ligament because the palmar ligament is stronger . Moreover, in addition to fixing the scapholunate and lunotriquetral joints with kirschner wires, we should have fixed the scaphocapitate joint to maximize anatomical carpal alignment . Thus, for reliable carpal stability, we recommend ligament repair and temporary joint fixation of the carpal bones . Subsequent wrist stiffness may be prevented by early removal of kirschner wires after surgery and starting wrist exercises . Indeed, it may be possible to remove kirschner wires earlier than 6 weeks when interosseous ligaments are sutured . The injury to our patient prc on a patient with a scapholunate dislocation and complete scaphoid extrusion resulted in a good clinical outcome, suggesting that prc may eliminate avascular necrosis and avoid additional surgery in patients with this type of injury . However, although prc has shown satisfactory clinical outcomes, postoperative rom and grip strength averaged 5070% and 6090%, respectively, compared with the healthy side, outcomes similar to those observed in our patient . Therefore, except when unavoidable, we recommend surgical repair, especially for active young people and manual workers, with prc considered a salvage procedure.
|
The class i elements include the long terminal repeat (ltr) retrotransposons, the non - ltr retrotransposons and the short interspersed nucleotide elements (sines) 1, 2 . The class ii elements have terminal inverted repeats with transposase - binding sites, and include the p elements found in drosophila . The best - known sines are the alu elements of primates, which are thought to have a common origin with the b1 elements of rodents 1, 3, 4 . Alu elements are the most abundant transposable elements in the human genome, being present in about 500,000 copies . These retroposons consist of two related monomers in tandem and, as the name implies, contain a restriction site for the enzyme alui . They have no open reading frames, and the factors necessary for their amplification are thought to come from long interspersed elements (lines) which code for functional reverse transcriptases with an endonuclease domain 2, 4 . The present work describes the first sine detected in the genome of the cephalochordate amphioxus . Previous studies of transposable elements in amphioxus are limited to a class i non - ltr retrotransposon (bfcr1) 5 and a class ii, non autonomous transposable element (ate-1) 6 . Amphioxus (branchiostoma) is an aquatic invertebrate with a much simpler body plan than vertebrates (e.g. No paired eyes, ears or limbs). Moreover, the amphioxus genome appears to have a similar organization as that of vertebrates but lacks the extensive gene duplications that occurred in the vertebrate lineage 7 . However, recent analyses done with large gene sets have placed amphioxus basal in the chordates with the rapidly evolving tunicates as the sister group of vertebrates 8, 9 . Amphioxus is, therefore, the most appropriate organism for comparison with vertebrates to understand how the vertebrates evolved from invertebrate chordate ancestors . The surprising finding of the present work is not that amphioxus has transposable elements or that this element is a sine, which are common in eukaryotic genomes, but that it contains three alui sites, two of which are in tandem . Thus, the finding of an alu element in amphioxus raises the question whether amphioxus and primates are an example of convergent evolution or whether they both arose from an alu element in the ancestral chordate . The transposable element was located by blastn searches of the amphioxus (branchiostoma floridae) genome sequences in the trace archives of genbank with portions of the upstream regulatory region of the foxd gene (af512537), which we had sequenced from cosmid mpmgc117o0129 available from the rzpd (http://www.rzpd.de). Sequences that were present in this cosmid, but absent from at least one of the foxd alleles in the trace archives, were suspected transposable elements . Additional copies of this transposable element were located by blastn searches of amphioxus bac clones deposited in genbank . We have previously identified a notochord - specific enhancer in the foxd gene in amphioxus (branchiostoma floridae) 10 . This enhancer encompassed 4.7 kb upstream of the atg start codon and has several binding sites for the notochord marker brachyury as well as for fox d itself, suggesting autoregulation . Subsequently, we determined that the 5' portion of this enhancer, which includes these binding sites, is essential for directing expression to the notochord [j - k .] However, just downstream of the foxd binding sites are two sites for foxa2 (hnf3), which, like brachyury, is expressed in the notochord (figure 1a). Therefore, it seemed likely that this region with the foxa2 sites is also involved in directing notochordal expression . Surprisingly, blast searches of the amphioxus genome sequences in the trace archives of genbank, which represent the two alleles of a single individual, revealed that both alleles lacked the region with the foxa2 binding sites that corresponds to 1168 to 1543 upstream of the foxd atg start codon in the clone we previously sequenced, which was from a different individual (figure 2). Moreover, we found this 375 bp region in numerous traces with flanking regions that did not correspond to the foxd gene . An estimate would be 50 - 100 copies in the genome of the individual sequenced . Figure 1b compares this sine with eight representative homologous sines found in the trace archives and in cosmid sequences, all of which are from the two alleles of the same individual . The first two of these eight sines are located in cosmids containing respectively, the tbx15/18/21 gene and the pax1/9 gene . In the former, the sine is 4200 bp upstream of the atg start codon of tbx15/18/21 and in the latter it is 40 kb upstream of the 5' end of pax 1/9 and located within an intron of a hypothetical gene coding for a cyclic nucleotide - gated cation channel . The remaining sines in figure 1 were contained in relatively short bac end sequences and genomic traces, and therefore, their location relative to particular genes cannot be determined until the full genome sequence is available . The amphioxus sine has several characteristic features of sines in general and of primate alu elements in particular, and i, therefore, term it the amphi - alu element . Sines generally are about 300 bp long with a polya tail of varying length and have similar, but not identical, left and right halves 11 - 13 . Sines typically have a region derived from trna that contains a consensus rna polymerase promoter 14 . The amphioxus element is 375 bp long, the polya tail ranges from 1 - 13 bases (figure 1b), and the right and left halves are 52% identical (clustal w alignment). Most of the copies of this element have from one to three alui sites, although they can be mutated (figure 1b). Moreover, alignments with trna sequences from sea urchin available at http://lowelab.ucsc.edu/gtrnadb/ reveal a high percentage of identities with a sea urchin trna for glutamine with an imperfect match for the rna polymerase promoter a site and a nearly perfect one for the b site (figure 3). As is typical for sines, deletions of portions of either the left arm or the right arm are common . Show that these repeats are within the alu element and not in the flanking region . Such repeats are lacking at the 3' end of the alu element and in the adjacent 3' flanking sequence . Figure 2 shows the insertion site in the foxd gene for an allele lacking amphi - alu . The potential insertion site in is between 2 t residues and is flanked by direct repeats of ctttgtt . In the clones containing the amphi - alu element, there are direct repeats in the flanking regions of some clones (e.g. Gttttattg / gtttcttg for foxd). However, direct repeats are not always present on either side of amphi - alu, raising the possibility, which can be tested when the full genome assembly is available, that some amphi - alu sines may be longer than the one in the amphifoxd allele shown in figure 1 10 . One unusual feature of amphi - alu is that the region with the highest identity to a trna is from base 199 to base 183, rather than at the 5' end 13 as is typical for sines . Although it is possible that figure 1 depicts amphi - alu in the reverse orientation, this is not likely since a varying number of a residues were present in all clones at the end designated as the 3' end in figure1b . Moreover, comparisons of the reverse strand of amphi - alu with trnas from a range of species, including sea urchin, had few matches . This raises the possibility that the amphi - alu sine is a chimeric element, but it is puzzling that in either orientation, the putative rna polymerase iii sites are not near the ends of the element . Alu elements have previously been described only in primates 15, raising the question of whether amphi - alu and primate alu elements are descended from a common ancestral alu, or whether the presence of alu sites in these two sines from primates and amphioxus represent convergent evolution . It has been argued that the fla (free left arm) alu family arose at the origin of mammals about 112 mya 15 . However, alignments of human alu elements and amphi - alu do not reveal a high level of identity; in general, amphi - alu is not as gc rich as human alu elements, and the most at - rich region is not central as in human alu elements but starts at base 290 . Morover, human alus and the related b1 elements of rodents have a 7sl rna - related region 3, 13, 16, while amphi - alu is related to a trna for asparagine . Thus, since amphioxus and vertebrate lineages are estimated to have split about 520 mya, it seems more likely that the alu sites in the amphioxus and mammalian alu elements have arisen through convergent evolution . However, there are few descriptions transposable elements in basal vertebrates such as agnathans 17 or in tunicates 18, which recent phylogenetic analyses place as the sister group to vertebrates, amphioxus being basal in the chordates 8, 9 . Alignments of a tunicate sine (cics-1), which lacks alui sites, with amphi - alu reveal only a few short regions of identity 18 . A thorough study of transposable elements in amphioxus and these animals is critical for understanding the evolutionary history of alu elements . In the three instances where complete cosmid or bac sequences were available, the amphi - alu elements were located in likely regulatory dna either upstream of the atg start codon (foxd and clone ch302 63l21) or within an intron (ch302 119j21). Human alu elements within introns have been implicated in alternative splicing and exonization whereby part of the sine is not spliced out of the mrna and can cause frame shifts and gene inactivation 2, 19 . Moreover, whether in the upstream regulatory region or in an intron, sines may provide binding sites for transcription factors and thus influence gene regulation . The amphi - alu element has probable binding sites for foxa2, which is normally expressed in the endoderm and notochord of amphioxus 20 . Its location in the foxd gene just downstream of an important enhancer (figure 1a), suggests that it might be contributing to regulation of the foxd gene in the individuals that have it in the foxd regulatory region . Alu elements have been implicated in regulation of many genes 21, 22 . To what extent such transposable elements might mediate evolution of cis - regulation in animals in nature is not known . However, it is certainly a possible mechanism for effecting large changes in cis - regulation . In summary, the finding of an alu element in the amphioxus genome that is present in the regulatory dna of some, but not all, alleles of the foxd gene and in the regulatory regions of other genes raises questions both about the evolution of sines in chordates and suggests that the insertion of such sines into regulatory dna could mediate evolution of cis - regulatory regions . There is some evidence for positive selection for such transposon - mediate changes in regulatory dna 21, 22, and it may become evident with the sequencing of the genomes of more organisms like amphioxus with relatively short life cycles are sequenced to what extent such changes in regulatory dna mediate large evolutionary changes . The amphi - alu sine from the foxd gene in an individual of branchiostoma floridae . A. schematic diagram of the upstream regulatory region showing the foxd repeat region in cosmid mpmgc117o0129, which we have shown is essential for directing expression of foxd to the notochord just upstream of the amphi - alu element, which is inserted into the foxd gene at base 1168 upstream of the atg start codon . This element contains two binding sites for foxa2 which is also expressed in the notochord, but as it is not present in two other foxd alleles, it cannot be essential for notochord expression . B. representative sequence variations of the amphi - alu sine from the foxd gene in cosmid mpmgc117o0129 and from six bac clones and two genomic traces from the trace archive database (http://www.ncbi.nlm.nih.gov/traces/trace.cgi?). The amphi - alu sine in bac ch302 63l21 is located in the presumed upstream regulatory region of the tbx15/18/21 gene and that from ch302 119j21 within an intron of a hypothetical gene coding for a cyclic nucleotide gated cation channel . Since the other sequences are either from bac end sequencing or shot - gun sequencing, it is not possible as yet to determine if they are within regulatory regions of genes . The amphi - alu sequence is shown in the reverse orientation of its insertion into the foxd locus to orient the polya stretches as polya tails (double - underlining). The 5' end of the alu element is shown as 1, the alu sites are shaded in grey, two regions corresponding to the binding sites for rna polymerase on the trna - like region are underlined and the binding sites for foxa2 are shown by thick lines over the sequence the amphifoxd genomic region lacking the amphi - alu sine from a sequence in the trace archives of genbank (gnl|ti|545126576 name: afsa504495.g2). The site corresponding to the insertion site of the amphi - alu sine in the foxd gene in cosmid mpmgc117o0129 is shown by the arrowhead . Alignment of the sea urchin (strongylocentrotus purpuratus) trna for asparagine and the corresponding region of the amphi - alu element . The regions with high identity to the a and b binding sites for rna polymerase iii are boxed.
|
It presents with various obstructive and irritative lower urinary tract symptoms (luts) like frequency, urgency, nocturia, intermittency, weak urinary stream etc . The international prostate symptom score (ipss) is a tool which is very commonly used in the evaluation of the severity of symptoms of the patients . It is a self - administered questionnaire which scores the symptoms the patient has experienced over of the preceeding 4 weeks . It helps the clinician understand the severity of patient's symptoms and can guide treatment . Hence the responses can depend upon the level of education and understanding of the patient . This can have a significant bearing on the ultimate score and can lead to improper selection of treatment . It can lead to significant distress both to the patient and to the treating physician due to the lack of optimum response by the treatment based on the ipss . The ipss questionnaire has been translated and validated in various languages but it has not been validated in any of the indian languages . We commonly employ the english version of the questionnaire . For a population that does not have english as its primary language, this issue may have a serious impact on the understanding of questions and the scoring . In this study, we evaluate the patient's ability to understand the ipss by comparing the scores when the questionnaire was self - administered versus when it was administered using the assistance of a clinician . Patients who presented with luts suggestive of bph, those who had passed at least twelfth grade school and had a reasonable command over english (assessed by their ability to have a conversation in english with the clinician) were included in the study . Those who had previously filled an ipss questionnaire or those who were <40 years of age were excluded from the study . The patients were first given the ipss questionnaire and were allowed to self - administer it . The score sheet was taken away and then a blinded clinician (2 year resident in urology), who was not aware of the score on the self administered questionnaire, assisted the patient in filling the responses (english version) by interpreting and explaining the meaning of the questions in english . The second questionnaire was administered on the same day, 4 - 5 hours after the administration of the first questionnaire . The ipss questionnaire comprises of eight questions, seven regarding the symptoms over a period of the preceedinglast 1 month and one assessing the quality - of - life . The seven questions assessing the symptoms include incomplete emptying, frequency, intermittency, urgency, weak stream, straining and nocturia . Each of these symptoms is assigned a score from 0 to 5 for a maximum 35 points . The scores of these seven questions are added to determine the severity of patient urinary symptoms as follows, mild - 0 - 7, moderate - 8 - 19 and severe - 20 - 35 . The eighth question assesses the quality of life is assigned a score of 0 - 6 . For each question, the score in both the questionnaires was noted and kappa agreement statistical test was used to assess the level of agreement between them . By convention, a kappa of 0.0 means that the agreement is no better than a chance event . Kappa scores of 0.01 - 0.20, 0.21 - 0.40, 0.41 - 0.60, 0.61 - 0.80 and 0.81 - 0.99 are interpreted as showing poor, fair, moderate, substantial and almost perfect agreement, respectively . The kappa values of the scores for each question have been shown in table 1 . No question had a perfect agreement of scores in the self - administered and the clinician assisted scoring scenarios . Only the scores of questions about weak stream and nocturia showed moderate the overall mean scores, kappa value and its interpretation for each question of the ipss questionnaire the total scores for each patient were calculated for both the clinical scenarios and they were classified into mild, moderate and severe categories as per the criteria mentioned before . It was found that total scores in the self - administered and the clinician assisted scoring agreed poorly with each other as the kappa value was 0.19 . The categorization of patient's symptoms as per the ipss questionnaire when it was self - administered compared to when it was administered by an assessor ipss questionnaire is recommended by the american urological association during the work up of a patient with luts . Apart from helping the clinician in assessing the severity of the symptoms of a patient, it also acts as a guide in selecting the appropriate mode of treatment which can vary from watchful waiting to surgery . Studies in the western population have pointed out that there can be significant misinterpretation of the ipss by the patients . Some of these studies have shown that it depends upon the level of education, with patients having a low level of education showing marked misinterpretation . The issue of non - availability of the questionnaire in a local language and its impact on the ability of a patient to self - administer a questionnaire in english has been highlighted by ogwuche et al . We also believe that a validated ipss questionnaire in an indian language may be helpful in decreasing the error in interpretation, but additional studies will be needed to prove this . It has also been reported that the error in interpretation of the ipss questionnaire can lead to miscategorization of the patients symptoms and selection of a treatment that may not be effective for him . For example, a patient who on self - administered ipss questionnaire has a score of 6 (mild symptoms) may be offered only watchful waiting while he actually may be having moderate or severe symptoms which becomes evident when the questionnaire is explained to him by a medical assistant . Johnson et al . Have pointed out that 25% of patients who self - reported a mild score on ipss actually had a moderate or severe score . In our study too, there was a misinterpretation of the ipss questionnaire by the patients . The scores for each question showed a poor agreement for five out of seven questions . There was also significant miscategorization of patients symptoms (mild / moderate / severe) when the scores on self - administered questionnaire were compared to the clinician assisted questionnaire . Thus it is important to realize that although ipss questionnaire is an important tool in the work up of patients with luts, it should not be the sole guide for the treatment offered . Our study shows that there are some questions that are more prone for misinterpretation by the patients hence assistance by a clinician may be desirable . We administered the questionnaire on the same day which might have an effect on the results as the patients might have been able to recall their responses in the first questionnaire . The second issue is that we did not stratify our results according to the level of education of the patients included in the study . It is possible that people with a higher education may have a lesser chance of misinterpretation of the questions . Our results show that our patients, who do not have english as their primary language, misinterpret the ipss questionnaire . There are significant differences in the symptom scores when the ipss is self - administered as compared to the assisted scoring . This problem can lead to errors in interpretation of the symptom severity of patients by the health care providers; may affect the choice of treatment and ultimately, the clinical outcome.
|
In the pathogenesis of chronic active hepatitis the importance of spell out then abbreviate cmi has been emphasized . The hepatitis b virus is cleared by cytotoxic t - lymphocyte if the clearing is defected, inflammation progresses . Goldyne and goldyne and stobb reported that monocytes play an important role in the regulation of several immunologic responses . Monocytes exert this regulatory function which seems to be due to the production of pge2 is known to suppress various lymphocyte functions (t - cell cytotoxicity, lymphokine production and cytotoxicity). Lymphocyte hyporesponsiveness in cirrhosis has been shown to be mediated by prostaglandins produced by monocytes, as t - cell proliferative response has been depressed in hodgkin s disease and pge2 also plays an important role in the regulation of natural killer cells . The effect of prostaglandins on the cell is thought to be mediated by their ability to bind to membrane receptors causing an increase in the intracellular cyclic adenosine 5-monophosphate (camp) levels . The authors studied plasma pge2 assay to determine relationship between the plasma pge2 and chronic active hepatitis . The study group consisted of the patients with chronic active hepatitis and hepatitis b virus carriers who had been hospitalized or visited the internal medicine department, chonbuk national university hospital from jun . 1). Group i consisted of 7 normal control subjects who had not been previously exposured to the hepatitis b virus or who were asymptomatic but exposed to hepatitis b virus previously . Gorup ii consisted of 15 patients who had been diagnosed as having chronic active hepatitis by liver biopsy and strongly suggested or had chronic active hepatitis by clinical manifestation . Group iii consisted of 8 patients who were in the recuperative stage or stable stage of chronic hepatitis . It is based on asymptomatic mild transaminase elevation (lower than 150 u / l and one - third of the previous level) which persist for 3 months and as hbeag disappeared, antihbe appeared . The aqueous layer was then exposed to 3.0 ml of 3:3:1 ethyl acetate: isopropanol: 0.1 mhcl, apparent ph 5.8 and vortexed, and a mixture of 2.0 ml of ethyl acetate and 3.0 ml of water was added . After further mixing, two phases were separated by centrifugation (2000 rpm for 5 min at ambient temperatures). 3 ml of the 3.5 ml organic phase were removed by aspiration and dried in air at 55c . After drying 0.5 ml assay buffer (0.9 nacl, 0.01 m edta, 0.3% bovine l - globulin, 0.005% tritonx-100, 0.05% sodium azide in 50 mm phosphate buffer ph 6.8) was added and the two phases were separated by centrifugation, 0.1 ml was removed by aspiration . The mean plasma pge2 level was 2.650.69 pg / ml in the control group (table 2). The mean plasma pge2 level was 9.070.89 pg / ml in 15 patients with chronic active hepatitis and was significantly higher than that of the control group (p<0.01) (table 3). The mean plasma pge2 level was 4.65 1.59 pg / ml in 8 patients in the recuperative stage or stable stage of chronic hepatitis and tended to decrease . However, this decrease was significantly different from the control group (table 4). The mean plasma pge, level was 3.50.92 pg / ml in 4 hepatitis b carriers and was not significantly different from that of the control group (p>0.05) (table 5). The above results suggest that plasma pge2 can be used for the measurement of cell - mediated immunity and follow - up study in patients with chronic active hepatitis and hepatitis b carriers . Chronic hepatitis is defined as a chronic inflammatory reaction in the liver as shown by liver function tests and histologic studies and that continues without improvement for at least 6 months . A group of european histopathologists and clinicians in zurich in 1968 separated chronic hepatitis into chronic active hepatitis and chronic persistent hepatitis . Chronic active hepatitis is marked by a chronic inflammatory infiltration involving portal zones and extending into the parenchyme with piecemeal necrosis . The pathogenesis of chronic active hepatitis is till unknown, but the patient having chronic hepatitis b would be expected to have some deficiency of cell mediated immunity . It also applies to the patients suffering from diseases that depress immunity such as renal failure, malignant disease, and especially those receiving corticosteroids or cancer chemotherapy . Hepatitis b virus is cleared by cytotoxic t - lymphocyte from infected liver cell, but in patients with a depressed cell activity, the virus is not cleared and can develope into chronic hepatitis . Thereafter, a plasma pge2 assay in patients with chronic active hepatitis and hepatitis b carriers performed for the evaluation of the origin of deficiency of cmi . In 1980 goldyne, goldyne, stobb, galanard reported that pge2 from macrophages ragulated the t - cell activity . Monocytes have a receptor to prostaglandin, so pge2 suppress the lymphocyte function & natural killer cell activity . Fisher reported that the pathogenesis of the depressed t - cell proliferative response in hodgkin s disease is monocyte - mediated suppression via prostaglandins and hydrogen peroxide . Other evidence of cmi suppression due to pge2 such as reduced monocyte function is found in cirrhosis but in the presence of indomethacine there is a significantly increased the lymphocyte response to pha - p in patients with cirrhosis . Lymphocyte hyporesponsiveness in cirrhosis has been shown to be mediated by prostaglandins produced by monocytes . The mechanism of immunoregulation of prostaglandins is that the human leukocyte posses specific and separate receptors for endogenous hormones including -adrenergics, histamine prostaglandins . This receptor has a high affinity for pge2 which increases the camp levels which cause inhibition of release of lymphokine, lymphotoxin, interleukin-2 (il-2) for the t - cell proliferation . Thereafter immunoregulatory action was performed by a decreased amount il-2 and lymphokine due to increased plasma pge2 levels . The proliferation of cells from spleen, lymph node, bone marrow may be inhibited by prostaglandin e2 . The sensitivity of various cell populations, the quantities of prostaglandins and augmentation by indomethacin suggested that prostaglandin may modulate cell function in the bone marrow and thymus . Natural killer cells are a subpopulation of lymphocytes that are cytotoxic to a variety of malignant and normal cells . Droller reported that spontaneous cytotoxicity of human peripheral blood lymphocyte against tumor cells can be inhibited . In patients associated with depressed natural killer activity, so prostaglandins suppress immune reactivities and may be an important set of regulators of natural killer cell activity . Because the above described mechanisms of immunoregulatory action of prostaglandin e2, the increased pge2 level which suppress the t, t cell proliferation, cytotoxicity was decreased . Under this state, infected hepatitis b virus cannot be cleared by cytotoxic t - lymphocyte and progressed into chronic active hepatitis . We tried the plasma pge2 level in patients with chronic active hepatitis and hepatitis b carrier because these disease seems to have defect of cmi . The results were that the plasma pge2 level in patients with chronic active hepatitis is significantly higher than that of the control group . This fact suggest that plasma pge2 level has a close reversed relationship with cmi . Because we do nt have a specific methods to predict the prognosis of chronic active hepatitis, plasma pge2 level will be helpful in evaluating the prognosis of hepatitis patient.
|
Parkinson's disease (pd) is a chronic and progressive disorder with an estimated prevalence of 2% in adults over age 60 . The study of disease progression and its determinants is of great importance to improve our understanding of the disease in order to optimize treatment . A wide variety of correlations between different subtypes of the disease and the progression of motor and nonmotor symptoms have been reported . A cohort study with an eight - year follow - up found that axial symptoms (gait and postural instability) progress more rapidly than other motor features of pd (tremor, bradykinesia, and rigidity). Likewise, a study with a nine - year follow - up reported a greater progression of motor scores in subjects with the following characteristics: male gender, older age at diagnosis, akinetic - rigid subtype, and lower baseline motor score . A slower progression of tremor in comparison to other cardinal features of pd has also been reported . On the other hand, nonmotor progression has been less studied . A study derived from the adagio study population demonstrated an increase of 10% in the movement disorder society unified parkinson's disease rating scale (mds - updrs) part i score, which evaluates nonmotor experiences of daily living (nm - edl), in the placebo group through a nine - month follow - up . Another study reported a rate of progression for nm - edl of 0.42 points per year, while progression on the motor experiences of daily living (m - edl) was reported to be of 0.8 points per year . The objective of the present study is to describe the change in motor and nonmotor symptoms assessed by the mds - updrs and the nonmotor symptoms scale (nmss) in a real - life cohort of subjects with pd after a 21-month follow - up . Subjects with pd were recruited from the movement disorders clinic of the national institute of neurology and neurosurgery (mexico city). Diagnosis was made according to the uk parkinson's disease brain bank's criteria by a movement disorder specialist . The study was submitted and obtained approval from the institutional review board and local ethics committee . Full signed consent from all participants was obtained in order to participate in the study . Levodopa equivalent daily dose (ledd) was also calculated . The spanish version of mds - updrs, the parkinson disease quality of life questionnaire (pdq-8), and the nmss were applied to all subjects at two different cut - points (initial evaluation and a follow - up visit at 21 3 months). The full 65-item mds - updrs was applied by a neurologist with expertise in movement disorders . The mds - updrs consists of four parts: part i, non - motor experiences of daily living; part ii, motor experiences of daily living; part iii, motor examination; and part iv, motor complications . The pdq-8 is a health status scale covering eight different dimensions of health - related quality of life . Each item is scored using a likert scale (never, occasionally, sometimes, and always). The nmss is a nine - domain scale for the evaluation of nonmotor symptoms in pd (cardiovascular, sleep / fatigue, mood / cognition, perceptual problems / hallucinations, attention / memory, gastrointestinal tract, urinary function, sexual function, and miscellaneous). Each domain is assessed in terms of severity (from 0: none to 3: severe) and frequency (from 1: rarely to 4: very frequent) in the last month . The score for each domain is obtained by multiplying frequency by severity; total score is the sum of the nine domains . Disease severity was categorized using the recently published triangulation - based cut - offs classification of mds - updrs severity (part i: mild 010, moderate 1121, and severe 22; part ii: mild 012, moderate 1329, and severe 30; part iii: mild 032, moderate 3358, and severe 59; part iv: mild 04, moderate 512, and severe 13). Quantitative data such as mds - updrs, nmss, and pdq-8 scores were compared using a t - test for related samples . Ordinal data (use of antiparkinsonian drugs) were compared using a mcnemar test; when more than two outcomes were present (disease severity) the mcnemar - bowker test was used . Fifty - three patients concluded the follow - up (33 women and 20 men). In all cases, loss to follow - up was due to migration out of the city resulting in unavailability to attend the follow - up visit . The mean age at the initial visit for the final sample was 64.1 14.3 years and the mean disease duration was 9.1 5.4 years . Comparison of treatment schemes between the initial and follow - up visits is shown in table 1 . The frequencies for each severity group according to the mds - updrs at the initial and follow - up visits are shown in table 2 . The comparison of total scores in the mds - updrs, pdq-8, and nmss between visits is shown in table 3 . No statistically significant difference was found in regard to disease severity according to the mds - updrs part iii between the initial and follow - up visits . Most of the patients remained in the mild and moderate disease groups, although there was a slight increase in the mild group as a consequence of clinical improvement in subjects initially classified as moderate severity . The mds - updrs part iii demonstrated a statistically significant decrease of 7.2 2.3 points (95% ci, 3.1 to 11.2, p = 0.001) between the initial and follow - up visits . When compared by disease severity, subjects with mild disease had a mean improvement of 5.7 0.1 points (95% ci, 3 to 8.4, p <0.0001); subjects with moderate disease also showed improvement although statistical significance was not reached (8 3.5 points, 95% ci 4.4 to 20.4, p = 0.159). The m - edl assessed by mds - updrs part ii did not show any statistically significant change between visits . In regard to motor complications assessed by the mds - updrs part iv, a mean increase of 0.9 0.6 points (95% ci, 0.8 to 1.6, p = 0.015) was observed . When analyzed by severity, subjects with a mild disease worsened by 0.4 0.2 points (95% ci, 0.1 to 0.8, p = 0.017). No statistically significant association was found between the mean change in the total mds - updrs score and the predominant motor phenotype (p = 0.397). When analyzed independently, no association was found between the different mds - updrs parts and predominant phenotype (part i p = 0.787, part ii p = 0.286, part iii p = 0.578, and part iv p = 0.994). No association was found between motor scores and gender (p = 0.427) or disease duration (p = 0.941). No statistically significant change in nonmotor severity as assessed by the mds - updrs part i was found between visits with most of the patients remaining in the mild severity group . Moreover, the nm - edl score did not show a statistically significant change between the initial and follow - up visits even when accounting for severity classification . Conversely, all nonmotor symptom domains in the nmss scale showed an increase in the mean score, as shown in table 4 . An increase of 14.3 11.4 points (95% ic, 0.47 to 27.4, p = 0.043) in nmss total score was found between visits . Even though there was an increase in the score of all domains, the difference was statistically significant only for the perceptual problems and hallucinations item (0.2 0.7 to 0.8 2.1, p = 0.044). When analyzing by disease severity according to the mds - updrs part i score, no statistically significant increase in nmss total score within groups the mds - updrs part i and nmss total scores showed a high correlation (r = 0.611, p = 0.01). No statistically significant associations were found between nmss scores and disease duration (p = 0.677), gender (p = 0.964), or motor phenotype (p = 0.427). No statistically significant changes were found in quality of life as assessed by the pdq-8 between visits . Pd is a progressive neurodegenerative disease . Rates of change in motor and nonmotor symptoms appear to progress differently in a nonlinear fashion with a greater increase in the m - edl in comparison to the nm - edl . Traditionally, pd severity is assessed using the hoehn and yahr staging . In this regard, the mds - updrs severity scale was preferred instead due to the fact that the hoehn and yahr scale relies mainly on the motor state . In order to evaluate the impact of nonmotor symptoms a severity classification accounting for them was needed . The recently published cut - off points for pd severity levels based on the mds - updrs had the advantage of including nonmotor symptoms . In the present study, the overall improvement of seven points in the mds - updrs part iii can be explained by several factors . Firstly, the study was carried out at a referral center and the initial evaluation was actually the first time the patient was seen at the clinic . As a consequence, it should be pointed out that although the ledd increased by 120 mg / d, the actual levodopa daily dose was slightly increased . The latter means that no major levodopa dosage adjustments were performed but also that antiparkinsonian drugs were added as expected . For instance, the use of monoamine oxidase inhibitors and the dopamine agonist ledd was doubled . It also should be emphasized that motor evaluations were performed during the on clinical state, in contrast to an off state that could be a better index of the disease natural history . On the other hand, an increase in motor complications such as on time with troublesome dyskinesia and motor fluctuations assessed in the mds - updrs part iv was found . Motor complications related to dopaminergic treatment are expected to increase with disease progression despite better motor scores . Interestingly, no difference in m - edl (mds - updrs part ii) was found between visits despite the improvement in motor scales . Moreover, health - related quality of life assessed by the pdq-8 also failed to show any improvement . In regard to the nm - edl, reported a significant worsening of nm - edl scores in the mds - updrs in the placebo group, but no change in treated patients . On the other hand, a statistically significant increase of 14% in the nmss total score was observed . Even though every nmss domain had an increase in its score, only the perceptual changes and hallucinations item had a statistically significant difference . That is, all the nonmotor symptoms worsened, but only the cumulative effect and hallucinations reached statistical significance . A possible explanation may be that the worsening in individual nonmotor symptoms was not clinically significant and as a consequence proper management was not initiated . For instance, use of antidepressants remained the same despite the increase in the mood domain score . Additionally, some symptoms like hallucinations can be an adverse effect of dopaminergic replacement therapy, as well as a consequence of disease progression . Our findings oppose the study of lang et al ., which reported a greater decline in m - edl in comparison to nm - edl based on mds - updrs parts i and ii . This study had a longer follow - up period (up to 5 years) and only included subjects with pd in early stages . It is possible that discrepancy is the result of a shorter follow - up and the inclusion of subjects with varying degrees of severity . More important is the fact that patients in our study received the best medical treatment in comparison to untreated patients enrolled in a randomized clinical trial setting . As such, our study provides a pragmatic view of the effectiveness of interventions in real - life practice . It should be highlighted that mds - updrs part i and nmss total scores had a high correlation coefficient, but the mds - updrs part i failed to show any statistically significant difference . Reported a strong convergent validity between mds - updrs part i and nmss but also a lack of concordance in patients with a high burden of nonmotor symptoms . Although it is expected that mds - updrs scores correlate with the disease duration, the patients assessed in our study had different pd durations . While this issue affects direct extrapolation, it also gives a more objective overview of daily clinical practice . Secondly, patients had different therapeutic schemes at the initial evaluation; thus final outcomes could be influenced by the optimization of the treatment rather than from disease progression . Finally, as mentioned before, all scales were applied during patients' on clinical state in order . This might not reflect the natural history of the disease and therapeutic effect should be considered . On the other hand, nonmotor symptoms did not change with treatment as much as motor scores . Also, nonmotor fluctuations were not assessed . In conclusion, we found a motor improvement during the 21-month follow - up accompanied by an increase in motor complications . Studies assessing motor and nonmotor changes over time in different stages of severity are needed.
|
In the drug - delivery field, several nanocarriers have been proposed to improve the therapeutic index of various biologically active molecules such as peptides . Indeed, in vivo administration of peptides is still limited by their poor bioavailability and susceptibility to cleavage by proteases . In order to obtain a satisfactory therapeutic effect, the peptide has to be frequently administrated at high doses leading to unwanted toxic effects, such as induction of immune response . Consequently, peptide encapsulation into site - specific delivery systems can offer solutions to the above - mentioned problems . Indeed, the nanocarriers can (i) enhance drug solubility, (ii) control drug release thus avoiding toxic side effects, (iii) improve drug biodistribution, (iv) and, if appropriate molecule is grafted on the nanocarrier surface, target a specific site of action . Several nanovectors have been used to encapsulate various therapeutic peptides such as liposomes, nanoparticles, and nano- or microgels [18]. Among these nanocarriers, liposomes are of great importance because of their relatively large carrying capacity and the possibility to entrap either hydrophilic, hydrophobic, or amphiphilic drugs . Moreover, a good knowledge of such vectors has been acquired since the first discovery of liposomes by bangham and horne attested by commercially available anticancer liposomial formulations such as doxil [10, 11]. However, despite encouraging results, a major limitation to the development of liposomes as drug carriers is their instability, especially during their transit to the site of action . Attempts to improve their stability, either by incorporation of high amount of cholesterol or by coating the liposome surface with poly(ethylene glycol), have led to limited success . Within this context, archaeosomes, made with one or more of either the ether lipids found in archaea bacteria or synthetic archaeal lipids, constitute a novel family of liposomes exhibiting higher stabilities in several conditions, such as high temperature, alkaline or acidic ph, presence of phospholipases, bile salts, and serum media [13, 14]. Therefore, because of their biocompatibility and higher stability, archaeosomes have been extensively studied for potential applications as drug / gene and vaccine delivery systems [14, 15]. Over the last decade, our research group has developed synthetic analogues of natural archaeal tetraether lipids and studied their uses in cationic archaeosome formulations as efficient gene delivery systems [1618]. Our next objective was to evaluate the potential applications of archaeosome technology for the delivery of additional hydrophilic substrates such as antitumoral peptides (project sealacian: encapsulation of natural marine peptides, extracted from scyliorhinus canicula, for their site - specific delivery). Our attention was then directed towards the preparation and the formulation of a pegylated archaeal tetraether lipid (peg45-tetraether) to provide neutral coated archaeosomes valuable as peptide nanocarriers . In order to assess the value of this new family of stealth liposomes, physicochemical characteristics (dls, cryo - tem, and hptlc), dye encapsulation and release profile for a pegylated archaeosome formulation were determined and compared to those measured from a conventional pegylated liposome formulation . 1,2-distearoyl - sn - glycero-3-phosphatidylethanolamine - n-[methoxy - poly(ethylene glycol)-2000], ammonium salt, (peg45-dspe) was purchased from aventi polar . Peg45-tetraether was synthesized according to a four - step procedure from the tetraether diol 1 available in our laboratory . All reactions were carried out under nitrogen atmosphere with dry, freshly distilled solvents under anhydrous conditions . Dichloromethane (ch2cl2) and methanol (meoh) were distilled over calcium hydride . Analytical thin - layer chromatography (tlc) was performed on merck 60 f254 silica gel nonactivated plates . A solution of 5% h2so4 in etoh or ultraviolet fluorescence was used to develop the plates . Column chromatography was performed on silica gel merck 60 h (540 m). Nuclear magnetic resonance spectra (h nmr and c nmr) were recorded on a brucker arx 400 instrument (h at 400 mhz, c at 100 mhz). Data are reported as follows: chemical shift (number of hydrogen, multiplicity, and coupling constants if applicable). The chemical shifts () are reported as parts per million (ppm) referenced to the appropriate residual solvent peak . Abbreviations are as follows: s (singlet), d (doublet), t (triplet), q (quartet), dd (doublet of doublet), and m (multiplet). High - resolution mass spectra (hrms) were performed by crmpo (universit de rennes 1) on a ms / ms zabspec tof micromass . Accurate masses are reported for the molecular ions [m+h], [m+na], [m+k], or [mh]. Hptlc plates (2010 cm, silica gel 60, 0.2 mm layer thickness, nano - adamant uv254) were purchased from macherey - nagel . Before use, the hptlc plates were prewashed with methanol, dried on a camag tlc plate heater iii at 120c for 20 min, and kept in an aluminum foil in a desiccator at room temperature . 1-o - acetyl-2,2-di - o-(3,7,11,15-tetramethylhexadecyl)-3,3-o-(1,32-(13,20-dioxa)-dotriacontane-(cis-15,18-methyliden))diyl - di - sn - glycerol 2a mixture of tetraether diol 1 (600 mg, 0.495 mmol, 1 equiv . ), acetic anhydride (151 l, 3.5 equiv .) And sodium acetate (41 mg, 1 equiv .) Was stirred under reflux for 24 h. water was added and the aqueous phase was extracted twice with ch2cl2 . The residue was purified by flash chromatography on silica gel (petroleum ether (pe)/acoet: 98: 2) to yield the monoacetate derivative 2 (305 mg, 49%) as a colorless oil . Ft - ir (cm) 2924 (ch3), 2853 (ch2), 1746 (co), 1463 (ch2), 1377 (ch3), 1115 (coc); h nmr (cdcl3, 400 mhz) 0.800.89 (31h, m), 1.021.81 (92h, m), 1.911.98 (1h, m), 2.07 (3h, s), 2.132.23 (2h, m), 3.29 (4h, d, j = 6.9 hz), 3.39 (4h, t, j = 6.7 hz), 3.43 (4h, t, j = 6.6 hz), 3.443.74 (m, 8h), 4.11 (1h, dd, j = 5.7, 11.6 hz), 4.22 (1h, dd, j = 4.1, 11.6). C nmr (cdcl3, 100 mhz) 19.61, 19.68, 19.75, 20.93, 22.63, 22.72, 24.32, 24.46, 24.48, 24.81, 26.13, 28.02, 29.53, 29.62, 29.71, 29.79, 30.03, 31.61, 32.81, 33.01, 36.73, 37.22, 37.33, 37.38, 37.43, 37.51, 38.79, 39.38, 40.12, 40.68, 63.12, 64.13, 68.61, 68.89, 68.91, 70.16, 70.19, 70.6, 70.9, 71.7, 71.9, 75.6, 76.5, 78.6, 170.9 . Hrms (esi) calcd . For c79h157o9 (m+h) 1250.1827, found 1250.1823; hrms (esi) calcd . For c79h156o9na [m+na] 1272.1647, found 1272.1650; hrms (esi) calcd . For c79h156o9k [m+k] 1288.1386, found 1288.1381 . A mixture of tetraether diol 1 (600 mg, 0.495 mmol, 1 equiv . ), acetic anhydride (151 l, 3.5 equiv .) And sodium acetate (41 mg, 1 equiv .) Was stirred under reflux for 24 h. water was added and the aqueous phase was extracted twice with ch2cl2 . The residue was purified by flash chromatography on silica gel (petroleum ether (pe)/acoet: 98: 2) to yield the monoacetate derivative 2 (305 mg, 49%) as a colorless oil . Ft - ir (cm) 2924 (ch3), 2853 (ch2), 1746 (co), 1463 (ch2), 1377 (ch3), 1115 (coc); h nmr (cdcl3, 400 mhz) 0.800.89 (31h, m), 1.021.81 (92h, m), 1.911.98 (1h, m), 2.07 (3h, s), 2.132.23 (2h, m), 3.29 (4h, d, j = 6.9 hz), 3.39 (4h, t, j = 6.7 hz), 3.43 (4h, t, j = 6.6 hz), 3.443.74 (m, 8h), 4.11 (1h, dd, j = 5.7, 11.6 hz), 4.22 (1h, dd, j = 4.1, 11.6). C nmr (cdcl3, 100 mhz) 19.61, 19.68, 19.75, 20.93, 22.63, 22.72, 24.32, 24.46, 24.48, 24.81, 26.13, 28.02, 29.53, 29.62, 29.71, 29.79, 30.03, 31.61, 32.81, 33.01, 36.73, 37.22, 37.33, 37.38, 37.43, 37.51, 38.79, 39.38, 40.12, 40.68, 63.12, 64.13, 68.61, 68.89, 68.91, 70.16, 70.19, 70.6, 70.9, 71.7, 71.9, 75.6, 76.5, 78.6, 170.9 . Hrms (esi) calcd . For c79h157o9 (m+h) 1250.1827, found 1250.1823; hrms (esi) calcd . For c79h156o9na [m+na] 1272.1647, found 1272.1650; hrms (esi) calcd . For c79h156o9k [m+k] 1288.1386, 1-o - acetyl-1-carboxy-2,2-di - o-(3,7,11,15-tetramethylhexadecyl)-3,3-o-(1,32-(13,20-dioxa)-dotriacontane-(cis-15,18-methyliden))-diyl - di - sn - glycerol 3to a solution of alcohol 2 (50 mg, 0.04 mmol, 1 equiv .) In acoet (1 ml), a 0.5 m aqueous solution of kbr (8 l, 0.1 equiv .) And tempo (1 mg, 0.2 equiv .) Were added . At 0c, a 5% aqueous solution of naocl (69 l) was then added dropwise . The reaction mixture was stirred at room temperature for 2 h, the solution was acidified until ph 3 - 4 using 5% hcl and a 25% aqueous solution of nao2cl (17 l) was added slowly . After stirring for 3 h at room temperature, the mixture was extracted with acoet, washed with a saturated aqueous solution of nacl, dried (mgso4), and concentrated under reduced pressure to give the carboxylic acid derivative 3 (45 mg, 90%) as a colorless oil . Ft - ir (cm) 2924 (ch3), 2853 (ch2), 1746 (coch3), 1733 (cooh), 1463 (ch2), 1377 (ch3), 1115 (coc); h nmr (cdcl3, 400 mhz) 0.800.89 (31h, m), 1.021.81 (92h, m), 1.911.98 (1h, m), 2.07 (3h, s), 2.132.23 (2h, m), 3.29 (4h, d, j = 6.9 hz), 3.39 (4h, t, j = 6.7 hz), 3.413.72 (m, 12h), 3.79 (1h, ddd, j = 1.0, 3.3, 10.5 hz), 4.03 (1h, dd, j = 4.1, 11.6 hz), 4.11 (1h, d, j = 5.7, 11.6 hz), 4.22 (1h, dd, j = 4.1, 11.6 hz). C nmr (cdcl3, 100 mhz) 19.61, 19.68, 19.75, 20.91, 22.63, 22.72, 24.3, 24.46, 24.48, 24.81, 26.11, 28.02, 28.79, 29.51, 29.62, 29.73, 29.82, 30.02, 31.59, 32.82, 33.01, 36.68, 36.81, 36.93, 37.04, 37.12, 37.19, 37.33, 37.38, 37.41, 37.52, 38.84, 39.37, 40.12, 40.66 63.08, 63.12, 64.15, 68.65, 68.89, 68.91, 70.16, 70.19, 70.63, 70.91, 71.72, 71.91, 75.57, 76.53, 78.59, 170.91, 171.88 . Mg, 0.04 mmol, 1 equiv .) In acoet (1 ml), a 0.5 m aqueous solution of kbr (8 l, 0.1 equiv .) And tempo (1 mg, 0.2 equiv .) Were added . At 0c, a 5% aqueous solution of naocl (69 l) was then added dropwise . The reaction mixture was stirred at room temperature for 2 h, the solution was acidified until ph 3 - 4 using 5% hcl and a 25% aqueous solution of nao2cl (17 l) was added slowly . After stirring for 3 h at room temperature, the mixture was extracted with acoet, washed with a saturated aqueous solution of nacl, dried (mgso4), and concentrated under reduced pressure to give the carboxylic acid derivative 3 (45 mg, 90%) as a colorless oil . Ft - ir (cm) 2924 (ch3), 2853 (ch2), 1746 (coch3), 1733 (cooh), 1463 (ch2), 1377 (ch3), 1115 (coc); h nmr (cdcl3, 400 mhz) 0.800.89 (31h, m), 1.021.81 (92h, m), 1.911.98 (1h, m), 2.07 (3h, s), 2.132.23 (2h, m), 3.29 (4h, d, j = 6.9 hz), 3.39 (4h, t, j = 6.7 hz), 3.413.72 (m, 12h), 3.79 (1h, ddd, j = 1.0, 3.3, 10.5 hz), 4.03 (1h, dd, j = 4.1, 11.6 hz), 4.11 (1h, d, j = 5.7, 11.6 hz), 4.22 (1h, dd, j = 4.1, 11.6 hz). C nmr (cdcl3, 100 mhz) 19.61, 19.68, 19.75, 20.91, 22.63, 22.72, 24.3, 24.46, 24.48, 24.81, 26.11, 28.02, 28.79, 29.51, 29.62, 29.73, 29.82, 30.02, 31.59, 32.82, 33.01, 36.68, 36.81, 36.93, 37.04, 37.12, 37.19, 37.33, 37.38, 37.41, 37.52, 38.84, 39.37, 40.12, 40.66 63.08, 63.12, 64.15, 68.65, 68.89, 68.91, 70.16, 70.19, 70.63, 70.91, 71.72, 71.91, 75.57, 76.53, 78.59, 170.91, 171.88 . Peg45-tetraetherto a solution of carboxylic acid 3 (16.6 mg, 0.015 mmol, 1 equiv .) And tbtu (4.6 mg, 1 equiv .) In dry ch2cl2 (1 ml) was added diea (3.4 l, 1.3 equiv .) Under a nitrogen atmosphere . After 20 min at room temperature, a solution of h2n - peg45-ome 4 (24.4 mg, 1 equiv .) In dry ch2cl2 (2 ml) was added and the reaction mixture was stirred under reflux for 12 h. a few drops of a 5% hcl aqueous solution were then added and the solvents were removed under reduced pressure . The residue was dissolved in chcl3 (1 ml) and purified on a sephadex lh-20 column eluting with a mixture of chcl3/ch3oh (9: 1) to give a white solid (41 mg, 80%) composed of the expected monoacetate derivative 5 and the starting h2n - peg45-ome 4 in a 80: 20 ratio . Ft - ir (cm) 2924 (ch3), 2855 (ch2), 1746 (coch3), 1651 (conh), 1103 (coc); h nmr (cdcl3, 400 mhz) 0.820.86 (31h, m, 10 ch3), 1.001.80 (92h, m), 1.911.98 (1h, m), 2.06 (3h, s), 2.132.23 (2h, m), 3.27 (4h, d, j = 6.9 hz), 3.363.58 (23h, m), 3.37 (3h, s), 3.593.68 (169h, m), 3.733.77 (1h, m), 3.81 (1h, dd, j = 4.1, 5.6 hz), 3.88 (1h, dd, j = 2.5, 6 hz), 4.08 (1h, dd, j = 5.6, 11.6 hz), 4.21 (1h, dd, j = 4.1, 11.6 hz), 7.03 (1h, m). C nmr (cdcl3, 100 mhz) 14.08, 19.58, 19.65, 19.72, 20.91, 22.60, 22.69, 24.32, 24.45, 24.77, 26.03, 26.07, 26.15, 27.93, 28.82, 29.3229.84, 32.76, 33.9, 36.8437.50, 38.57, 39.33, 39.70 59.00, 62.97, 68.60, 69.74, 69.83, 70.29, 70,53, 70.91, 71.53, 71.56, 71.69, 71.83, 71.89, 75.60, 77.20, 78.21, 80.50, 170.53, 170.72 . To a solution of this white solid (41 mg) in a ch2cl2/ch3oh (1: 1) mixture, was added a freshly prepared solution of ch3ona in ch3oh (0.1 m, 1 equiv . ). The reaction mixture was stirred at room temperature for 4 h. amberlite resin (ir120) was added, the reaction mixture was filtered, and the solvents were evaporated under reduced pressure . A white powder was isolated (41 mg) composed of the desired peg45-tetraether and the starting h2n - peg45-ome 4 in a 80: 20 ratio . Ft - ir (cm) 2927 (ch3), 2855 (ch2), 1652 (conh), 1103 (coc); h nmr (cdcl3, 400 mhz) 0.820.86 (31h, m, 10 ch3), 1.001.80 (92h, m), 1.911.98 (1h, m), 2.132.23 (2h, m), 3.27 (4h, d, j = 6.9 hz), 3.363.58 (23h, m), 3.37 (3h, s), 3.593.68 (169h, m), 3.733.77 (1h, m), 3.81 (1h, dd, j = 4.1, 5.6 hz), 3.88 (1h, dd, j = 2.5, 6 hz), 7.03 (1h, m). C nmr (cdcl3, 100 mhz) 14.09, 19.58, 19.65, 19.72, 22.60, 22.69, 24.32, 24.45, 24.77, 26.03, 26.07, 26.15, 27.93, 28.82, 29.3229.84, 32.76, 33.9, 36.8437.50, 38.57, 39.33, 39.70 59.00, 62.97, 68.60, 69.74, 69.83, 70.29, 70,53, 70.91, 71.53, 71.56, 71.69, 71.83, 71.89, 75.60, 77.20, 78.21, 80.50, 170.52 . To a solution of carboxylic acid 3 (16.6 mg, 0.015 mmol, 1 equiv .) And tbtu (4.6 mg, 1 equiv .) In dry ch2cl2 (1 ml) was added diea (3.4 l, 1.3 equiv .) Under a nitrogen atmosphere . After 20 min at room temperature, a solution of h2n - peg45-ome 4 (24.4 mg, 1 equiv .) In dry ch2cl2 (2 ml) was added and the reaction mixture was stirred under reflux for 12 h. a few drops of a 5% hcl aqueous solution were then added and the solvents were removed under reduced pressure . The residue was dissolved in chcl3 (1 ml) and purified on a sephadex lh-20 column eluting with a mixture of chcl3/ch3oh (9: 1) to give a white solid (41 mg, 80%) composed of the expected monoacetate derivative 5 and the starting h2n - peg45-ome 4 in a 80: 20 ratio . Ft - ir (cm) 2924 (ch3), 2855 (ch2), 1746 (coch3), 1651 (conh), 1103 (coc); h nmr (cdcl3, 400 mhz) 0.820.86 (31h, m, 10 ch3), 1.001.80 (92h, m), 1.911.98 (1h, m), 2.06 (3h, s), 2.132.23 (2h, m), 3.27 (4h, d, j = 6.9 hz), 3.363.58 (23h, m), 3.37 (3h, s), 3.593.68 (169h, m), 3.733.77 (1h, m), 3.81 (1h, dd, j = 4.1, 5.6 hz), 3.88 (1h, dd, j = 2.5, 6 hz), 4.08 (1h, dd, j = 5.6, 11.6 hz), 4.21 (1h, dd, j = 4.1, 11.6 hz), 7.03 (1h, m). C nmr (cdcl3, 100 mhz) 14.08, 19.58, 19.65, 19.72, 20.91, 22.60, 22.69, 24.32, 24.45, 24.77, 26.03, 26.07, 26.15, 27.93, 28.82, 29.3229.84, 32.76, 33.9, 36.8437.50, 38.57, 39.33, 39.70 59.00, 62.97, 68.60, 69.74, 69.83, 70.29, 70,53, 70.91, 71.53, 71.56, 71.69, 71.83, 71.89, 75.60, 77.20, 78.21, 80.50, 170.53, 170.72 . To a solution of this white solid (41 mg) in a ch2cl2/ch3oh (1: 1) mixture, was added a freshly prepared solution of ch3ona in ch3oh (0.1 m, 1 equiv . ). The reaction mixture was stirred at room temperature for 4 h. amberlite resin (ir120) was added, the reaction mixture was filtered, and the solvents were evaporated under reduced pressure . A white powder was isolated (41 mg) composed of the desired peg45-tetraether and the starting h2n - peg45-ome 4 in a 80: 20 ratio . Ft - ir (cm) 2927 (ch3), 2855 (ch2), 1652 (conh), 1103 (coc); h nmr (cdcl3, 400 mhz) 0.820.86 (31h, m, 10 ch3), 1.001.80 (92h, m), 1.911.98 (1h, m), 2.132.23 (2h, m), 3.27 (4h, d, j = 6.9 hz), 3.363.58 (23h, m), 3.37 (3h, s), 3.593.68 (169h, m), 3.733.77 (1h, m), 3.81 (1h, dd, j = 4.1, 5.6 hz), 3.88 (1h, dd, j = 2.5, 6 hz), 7.03 (1h, m). C nmr (cdcl3, 100 mhz) 14.09, 19.58, 19.65, 19.72, 22.60, 22.69, 24.32, 24.45, 24.77, 26.03, 26.07, 26.15, 27.93, 28.82, 29.3229.84, 32.76, 33.9, 36.8437.50, 38.57, 39.33, 39.70 59.00, 62.97, 68.60, 69.74, 69.83, 70.29, 70,53, 70.91, 71.53, 71.56, 71.69, 71.83, 71.89, 75.60, 77.20, 78.21, 80.50, 170.52 . Stock solutions of egg - pc (1 mg / ml) and peg45-dspe (1 mg / ml) were prepared in chcl3: ch3oh (2: 1, v / v), while stock solutions of peg45-tetraether (1 mg / ml) were prepared in chcl3 . Liposomes and archaeosomes were obtained by the hydration method as already described elsewhere [1618]. Briefly, the selected lipid solutions were mixed to yield either a mixture of egg - pc and peg45-dspe (90: 10 wt%) or a mixture of egg - pc and peg45-tetraether (90: 10 wt%) with a total lipid concentration of 1 mg / ml . The organic solvents were then evaporated using a rotary evaporator, and the lipid films thus obtained were dried under high vacuum for 2 hours at room temperature . Archaeosome or liposome formulations were sonicated at room temperature for two times 5 min with interval of 5 min using a fischer scientific sonication bath (fb 15051) at 80 khz . Peg45-tetraether (90: 10 wt%) based archaeosomes and egg - pc / peg45-dspe (90: 10 wt) pegylated liposomes: carboxyfluorescein (cf) was encapsulated in egg - pc based liposomes during the hydration phase as described elsewhere . Briefly, egg - pc / peg45-tetraether (90: 10 wt%) and egg - pc / peg45-dspe (90: 1 wt%) lipid films were prepared as described above . After drying, both lipid films were hydrated with 1 ml of a tris(hydroxyl methyl) methylamine buffer (tris buffer) at ph 7.4 containing cf at a concentration of 100 mm . The solutions were vortexed and left at 4c overnight . Both pegylated archaeosomes and pegylated liposomes containing cf were sonicated (fischer scientific sonication bath fb 15051 - 80 khz) at room temperature for two times 5 min with interval of 5 min . Nonencapsulated cf was eliminated by size exclusion column chromatography on the sephadex g-50 gel with the tris buffer as eluent . Both pegylated archaeosomes and pegylated liposomes containing cf were analyzed by dls and by fluorescence using a fluoromax-3 (horiba) spectrofluorimeter with excitation and emission wavelengths of 490 and 515 nm, respectively . The size (average diameter obtained by the cumulant result method), polydispersity and zeta potential of the formulations were measured by dynamic light scattering using a delsa nano beckman coulter apparatus at 25c . The cryo - tem analysis of pegylated liposomes and pegylated archaeosomes was realized by dr . Olivier lambert at the university of bordeaux (group chimie et biologie des membranes et nano - objets, each sample (5 l) was deposited on a grid covered with a carbon film having 2 m diameter holes previously exposed to treatment with uv - ozone . The excess of water was removed by absorption with filter paper to form a thin layer of water suspended inside the holes . This grid was then plunged quickly (em cpc, leica) in liquid ethane (178c). Rapid freezing of the thin layer of liquid water in vitreous ice (absence of crystals) preserved biological structures . Grids were then placed in a suitable object carrier for observing the samples at 170c . Observation under a microscope (fei tecna f20) was carried out in the mode low dose, limiting the effects of beam irradiation on the lipid material . Images were recorded using an ultrasensitive camera (gatan, usc 1000) 2k2k with pixel size of 14 m . The electron dose used was 1020 electrons / . The samples were filtered through 10 000 nmwl pore filters (micron ym-10, millipore corporation) by ultracentrifugation at 15 000 g for 1 hour at 15c . The supernatants were recovered, lyophilized, dissolved in 1 ml of methanol, and analyzed by hptlc using the automated hptlc system from camag (muttenz, switzerland). The samples, the appropriate lipid standard solutions and a blank solution composed by pure methanol were spotted on 20 10 cm hptlc plates using the automatic tlc sampler 4 from camag (muttenz, switzerland). Each lane was spotted 10 mm above the bottom edge of the plate and was 6 mm length with 17 mm spacing between lanes . The spotting volume was 10 l or 20 l . A maximum of 20 lanes was spotted on a single plate . After evaporation of the sample solvent, the plates were developed in a closed twin trough chamber for 2010 cm plates (camag) containing 10 ml of the mobile phase (chcl3/meoh / h2o, 18/4/0.5) in each trough . The plates were dried on a camag tlc plate heater iii at either 60c for 30 min . The hptlc plates were postchromatographic derivatizated by dipping 5 s into a primuline solution (5 mg of primuline in 100 ml of acetone / h2o (80/20) mixture). Hptlc plates were then dried at room temperature for 10 min and at 60c for 30 min on a camag tlc plate heater iii . Plates were then scanned from 6 mm above the bottom edge of the plate to the solvent front, using a camag tlc scanning densitometer . The measurements were performed in fluorescence mode at = 366 nm with a scanning speed of 20 mm / s, a slit dimension of 40.2 mm (micro) and deuterium and tungsten lamps . Data were stored online on a personal computer, and integration as well as quantification was performed with the software package cats from camag . Calibration was performed by applying standard solutions in concentration given below: egg - pc (rf = 0.04): 10 g, 7.5 g, 5 g, and 2.5 g, peg45-dspe (rf = 0.46): 2 g, 1 g, 0.5 g, and 0.25 g, peg45-tetraether (rf = 0.79): 2 g, 1 g, 0.5 g, and 0.25 g . Calibration curves were calculated for each lipid or archaeal lipid, with a linear regression mode . In order to reduce experimental errors, the amount of egg - pc and peg45-dspe in liposomes, after ultrafiltration, and of egg - pc and peg45-tetraether in archaeosomes, after ultrafiltration, were calculated from the calibration curves . Cf release profile from both pegylated archaeosomes and pegylated liposomes was measured by fluorescence using a fluoromax-3 (horiba) spectrofluorimeter with excitation and emission wavelengths of 490 and 515 nm, respectively . The fluorescence of both formulations was measured at t0, before (i0) and after (imax) triton - x-100 (2 v%) addition (total disruption of liposomial membranes) and at various times (it) until almost complete cf release at 4c and at 37c . Release of the incorporated dye was calculated using the following equation: (1)release (%) = iti0imaxi0100 . Archaeosomes made with one or more of the ether lipids found in archaea represent an innovative family of liposomes that demonstrate higher stabilities to several conditions in comparison with conventional liposomes . The definition of archaeosomes also includes the use of synthetically derived lipids that have the unique structure characteristics of archaeobacterial ether lipids, that is, regularly branched phytanyl chains attached via ether bonds at sn-2,3 glycerol carbons . The lipid membrane of archaeosomes may be entirely of the bilayer form if made exclusively from monopolar archaeol (diether) lipids or a monolayer if made exclusively from bipolar caldarchaeol (tetraether) lipids, or a combination of monolayers and bilayers if made from caldarchaeol lipids in addition to archaeol lipids or standard bilayer - forming phospholipids . The large variety of lipid structures reflects the need for archaea to adjust their core lipid structures in order to be able to ensure membrane functions despite harsh destabilizing environmental conditions (high or low temperatures, high salinity, acidic media, anaerobic atmosphere, and high pressure). In particular, specific archaeal lipid membrane properties have to be considered in view to optimize the performance of archaeosomes: (1) the ether linkages are more stable than esters over a wide range of ph, and the branching methyl groups help both to reduce crystallization (membrane lipids in the liquid crystalline state at ambient temperature) and membrane permeability (steric hindrance of the methyl side groups); (2) the saturated alkyl chains would impart stability towards oxidative degradation; (3) the unusual stereochemistry of the glycerol backbone (opposite to mesophilic organisms) would ensure resistance to attack by phospholipases released by other organisms; (4) the bipolar lipids span the membranes and enhance their stability properties and (5) the addition of cyclic structures (in particular five - membered rings) in the transmembrane portion of the lipids appears to be a thermoadaptive response, resulting in enhanced membrane packing and reduced membrane fluidity . Consequently, formulations including archaeal lipids demonstrate relatively higher stabilities to oxidative stress, high temperature, alkaline or acidic ph, action of phospholipases, bile salts, and serum media . Archaeosomes can be formed using standard procedures (hydrated film submitted to sonication, extrusion or detergent dialysis) at any temperature in the physiological range or lower, thus making it possible to encapsulate thermally labile compounds . Moreover, they can be prepared and stored in the presence of air / oxygen without any degradation . The in vitro and in vivo studies indicate that archaeosomes are safe and do not elicit toxicity in mice . Thus, the biocompatibility and the superior stability properties of archaeosomes in numerous conditions offer advantages over conventional liposomes in the manufacture and the use in biotechnology including vaccine and drug / gene delivery . However, to study in depth archaeolipid structure - archaeosome property relationships with a view of optimizing the performance of these unusual liposomes as gene / drug nanocarriers, sufficient amounts of pure natural lipids are required . Well - defined lipids are difficult to isolate from natural extracts, and chemical synthesis appears, therefore, as an attractive means of producing model lipids that mimic the natural lipids . Within this context, our group focused on the synthesis and the evaluation of chemically pure archaeal diether and tetraether lipids that retain some of the essential structural features of archaeal membrane lipids . These studies clearly showed the interest in developing archaeosome technology from synthetic tetraether lipids possessing neutral, zwitterionic, or cationic polar heads groups for in vitro and in vivo delivery applications of nucleic acids and drugs [13, 1618]. In order to propose a stealth version of synthetic archaeosomes that could increase blood circulation longevity by reducing or preventing protein binding and/or by inhibiting cell binding / uptake, an additional archaeosome formulation based on a novel synthetic tetraether lipid was developed . These stealth archaeosomes could be suitable for the encapsulation and the in vivo delivery of various bioactive molecules including peptides which are known to be highly sensitive to enzymatic or chemical degradations . Comparative studies in terms of drug - encapsulation efficacy and formulation stability between standard pegylated liposomes and pegylated archaeosomes were then investigated by following the leakage of the encapsulated aqueous dye 5(6)-carboxyfluorescein as a marker . For that purpose, an archaeosome formulation composed by 90 wt% of a classical lipid, egg - pc, and 10 wt% of a pegylated tetraether archaeal lipid, peg45-tetraether (figure 1) was selected . Indeed, previous studies relative to the use of archaeosomes as gene nanocarriers showed that the incorporation of 5 wt% to 10 wt% of tetraether archaeal lipids into bilayered vesicles led to the best efficient in vitro gene transfection properties . In parallel, a classical liposomal formulation composed by 90 wt% of egg - pc and 10 wt% of peg45-dspe, was prepared in order to evaluate the influence of the tetraether structure on the formulation properties in terms of stability, drug - encapsulation efficiency, and further on the in vivo formulation efficacy . In the present approach, the vesicle formulations were studied from a fundamental point of view, that is, through dls and cryo - tem measurements (size, polydispersity, and morphology), hptlc (lipid composition), and cf release (formulation stability) in order to assess the potentiality of pegylated archaeosomes as in vivo nanocarriers . The novel pegylated archaeal lipid (peg45-tetraether) was synthesized through the functionalization of the tetraether backbone at one terminal end . The synthesis of this unsymmetrical pegylated lipid involved the monoprotection of the starting tetraether diol 1 followed by the introduction of the poly(ethylene glycol) chain (scheme 1). The first step was carried out by an easy monoacetylation of diol 1 with sodium acetate (1 equiv .) And acetic anhydride (3.5 equiv .) To give monoacetate 2 in a 49% yield . Alcohol 2 was then oxidized in a one - pot two - step procedure under tempo catalysis conditions with naocl and naclo2 as the oxidizing agents . Fine tuning of the ph during the reaction led to a clean oxidation of 2 to carboxylic acid 3 in a yield of 90% . With acid 3 in hand, we introduced a 45-unit peg chain using commercially available h2n - peg45-ome 4 . After optimization of the coupling reaction conditions, the use of the uronium salt (o-(benzotriazol-1-yl)1,1,3,3-tetramethyluronium tetrafluoroborate (tbtu)/ n, n-diisopropylethylamine (diea) system furnished the expected pegylated tetraether (80% yield) in addition to the starting h2n - peg45-ome chain (ratio: 80: 20). It is noteworthy that the purification of the crude reaction mixture on a sephadex lh-20 column allowed the total removal of the starting carboxylic acid 3 . The final deacylation of the hydroxyl group under zempln conditions (meona, meoh) gave the targeted peg45-tetraether lipid in a quantitative yield . As described in the experimental part, formulations have been prepared using the classical lipid film hydration method followed by vesicle size reduction under sonication . The mean particle size and zeta potential of archaeosomes and liposomes particle mean diameters and polydispersity index are gathered in table 1 and show that both liposomes and archaeosomes are similar in size, lower than 100 nm, with a quite narrow dispersity (around 0.30). In the same way, the mean surface potential of archaeosomes and liposomes were comparable with slightly negative values . These results are in good agreement with several reports [21, 22] that pointed out the impact of the peg chains on liposomal size decrease and on zeta potential values close to neutrality . Most importantly, these studies revealed that the atypical structure of the tetraether did not modify the main characteristics of the resulting peg - grafted vesicle structures (shape, size). Cryo - tem was employed to investigate the morphology of the vesicles composed of pegylated lipids . The images in figure 2 show that peg - bearing archaeosomes were dispersed and spherical as for classical pegylated liposomes . The presence of an external dark circle evidenced the lipid layer surrounding the internal aqueous volume of the vesicles . It is noteworthy that no phase segregation has been evidenced meaning that the prepared formulations are quite homogenous . The sizes of the vesicles were under 100 nm and the diameter was comprised between 20 to 100 nm, which was in relatively good agreement with data obtained by dls . Indeed, dls measurements gave average diameters (cumulant results) lower than 100 nm with objects having diameters ranging from around 20 nm to around 200 nm . Besides these characteristics, it is of great interest to determine the lipid composition after formulation . For that purpose, we have used an innovative method based on quantitative thin layer chromatography, named high performance thin - layer chromatography (hptlc). The hptlc is a qualitative and quantitative analytical method allowing obtaining reproducible and reliable results . This method is used, since several years, for analysis and quantification of lipids extracted from various sources [2329]. More recently, the use of hptlc has been developed for the determination of lipid compositions of liposomes [3034] and for peptide analysis in liposomes . We have, therefore, studied possibilities to use hptlc for the determination of lipid compositions of the studied liposomes and archaeosomes . We have found conditions, described in experimental part, which allowed us to measure lipid composition . After removal of nonaggregated lipids, the supernatants were lyophilized and solubilized in methanol in order to disrupt the nanostructure leading to the recovering of nonaggregated lipids which can be further analyzed by hptlc as described in the experimental part . It is worth to note that no peak has been observed on the lane corresponding to the blank solution . Such result allowed us to conclude that peaks corresponding to the analyzed lipids (egg - pc: rf = 0.04, peg45-dspe: rf = 0.46 and peg45-tetraether: rf = 0.79) were not overestimated because of the presence of other peaks having similar rf values (figure 3(a)). Calibration curves, based on either peak height or peak area, were plotted for each lipid (figures 3(b) and 3(c)). From these calibration curves, amounts of lipids contained in each formulation studied were calculated (table 2) and compared to initial amount of lipids used to prepare liposomes and archaeosomes (table 2). Results given in table 2 demonstrated that lipid composition of the prepared liposomes and archaeosomes are very similar to the initial lipid compositions: 88/12 wt% for egg - pc / peg45-dspe liposomes instead of an initial composition of 90/10 wt% and 86/14 wt% for egg - pc / peg45-tetraether archaeosomes instead of an initial composition of 90/10 wt% . To assess vesicle stability, the kinetics of encapsulated cf release from peg - bearing liposomes and archaeosomes was studied at 4c (standard storage temperature of liposomal formulations) and 37c (human physiological temperature). The percent release of cf was calculated from the formula described in the experimental part after evaluating the initial amount of encapsulated cf . Thus, a part of the sample containing the vesicle dispersion was treated with triton x-100 for lipid membrane disruption . Then, the fluorescence analysis of the resulting sample allowed us to determine the cf concentration initially entrapped in the nanocarrier using a calibration curve beforehand established . The release profile of cf from vesicles at 4c (figure 4(a)) showed different rates of leakage between liposome and archaeosome formulations . Indeed, 45% cf release was found to be approximately 20 h for the liposome sample and 100 h for the archaeosome sample . This different behavior was dramatically increased when the formulations were studied at 37c . As shown in figure 4(b), there was a rapid leakage of cf from conventional liposomes, where almost 70% of the encapsulated marker was lost within 3 hours . On the contrary, a significant improvement in stability was noted with archaeosomes, which released only 20% during the same period . Despite their apparent identical characteristics in terms of morphology and surface potential, the presence of only 10 wt% of archaeal tetraether lipid in the liposomal formulations increased significantly the nano - object stability and allowed a slow release of the encapsulated dye at 37c . This enhanced stability could result from the membrane spanning organization of the pegylated tetraether lipids within the egg - pc bilayer membrane, forming a monolayer as previously shown with synthetic cationic tetraethers . In conclusion, we have demonstrated that small proportions of a novel synthetic pegylated archaeolipid added to a liposomal formulation increase significantly the nanovector stability and slow down the constant dye release at 37c . This result is quite promising in so far as a similar behavior could be expected for in vivo applications . This study has also shown that hptlc is a powerful method for analyzing lipid composition . Following such a fundamental work, we have recently evaluated the encapsulation of a therapeutic peptide (anticancer) extracted from marine resources into pegylated archaeosomes and the in vivo efficiency of this peptide - loaded formulation.
|
Epidermolysis bullosa (eb) refers to a group of inherited disorders that involve the formation of blisters following trivial trauma . Eb pruriginosa is a type of dystrophic eb caused by type vii collagen gene mutation, with distinctive clinico - pathological features . It is characterized by nodular prurigo - like lichenified lesions, nail dystrophy, and variable presence of albopapuloid lesions . Most cases are sporadic, but a few show autosomal dominant or autosomal recessive pattern of inheritance . In india, very few cases of eb pruriginosa have been reported . Here a 52-year - old lady presented to our outpatient department with complaints of itching and blackish discoloration of skin of both the lower limbs for more than 35 years and fluid filled lesions over the lower limbs since two years . There was no history of drug intake before the onset of lesions nor any seasonal exacerbation . Patient was a known case of diabetes since five years and on regular treatment . On examination, multiple lichenified papules to nodules were present over the lower limbs extending from the knee to the ankle joint . Lichenified papules to nodules over the shin with depigmentation and scarring on histopathological examination, epidermis showed subepidermal and intraepidermal bulla with degeneration of keratinocytes . Foci of cellular infiltrate consisting of fragmented neutrophils with occasional mononuclear cells and hemorrhage [figures 2 and 6]. H and e, 40 lichenoid papules over both shins extending on to the knee subepidermal bulla filled with fibrin and rbcs . H and e, 40 close up photomicrograph of the second patient close up photomicrograph of first patient a 34-year - old female patient came to the outpatient department with complaints of skin lesion over both the lower limbs associated with intense itching was noted since 15 years . Cutaneous examination revealed lichenoid papules over both shins extending on to the knee [figures 3 and 7]. Dermis showed perivascular mixed inflammatory cell infiltrate and cyst lined by stratified squamous epithelium [figures 4 and 5]. Close up of first patient the patient was started on topical steroids with systemic antihistamines with minimal response after one month . A 52-year - old lady presented to our outpatient department with complaints of itching and blackish discoloration of skin of both the lower limbs for more than 35 years and fluid filled lesions over the lower limbs since two years . There was no history of drug intake before the onset of lesions nor any seasonal exacerbation . Patient was a known case of diabetes since five years and on regular treatment . On examination, multiple lichenified papules to nodules were present over the lower limbs extending from the knee to the ankle joint . Lichenified papules to nodules over the shin with depigmentation and scarring on histopathological examination, epidermis showed subepidermal and intraepidermal bulla with degeneration of keratinocytes . Foci of cellular infiltrate consisting of fragmented neutrophils with occasional mononuclear cells and hemorrhage [figures 2 and 6]. H and e, 40 lichenoid papules over both shins extending on to the knee subepidermal bulla filled with fibrin and rbcs . H and e, 40 close up photomicrograph of the second patient close up photomicrograph of first patient a 34-year - old female patient came to the outpatient department with complaints of skin lesion over both the lower limbs associated with intense itching was noted since 15 years . Cutaneous examination revealed lichenoid papules over both shins extending on to the knee [figures 3 and 7]. Dermis showed perivascular mixed inflammatory cell infiltrate and cyst lined by stratified squamous epithelium [figures 4 and 5]. Close up of first patient the patient was started on topical steroids with systemic antihistamines with minimal response after one month . Eb pruriginosa is a type of dystrophic eb termed by mcgrath in 1994, though a number reports of similar condition have appeared in literature since 1946 . In the one original series of eight cases reported by mcgrath, three had family history of similar skin disease, with two showing an autosomal dominant and the other an autosomal recessive pattern of inheritance . In our cases genetic linkage studies in families with dominant and recessive dystrophic eb have confirmed tight linkage to the type vii collagen gene . Structural protein abnormalities of type vii collagen either in the helical portion or the globular end domains suggesting the possible influence of type vii collagen gene, along with some other factor, might be responsible for causing a variety of abnormalities in the collagen helix assembly dimer formation or lateral aggregation, thus resulting in a diversity of clinical features . Recent molecular analysis studies have revealed a glycine substitution within the triple helical collagenous domain of the type vii molecule, to be exclusively associated with the dominant dystrophic eb, and eb pruirigunosa . Eb pruriginosa presents either at birth with mild acral blistering and erosions, or during infancy or childhood . In adults, the lesions are chiefly lichenified plaques . In both of our cases the lesions presented in early adolescence . The condition is characterized by extremely pruritic linear lichenified or nodular prurigo - like lesions predominantly over legs, occasional trauma - induced blistering, excoriations, milia, nail dystrophy and in some case albopapuloid lesions on the trunk . Possibly, the exposure of type vii collagen is known to trigger the activation of the kinin cascade . Histopathology of the lesion of the original series showed hyperkeratosis, mild acanthosis, disruption of the dermoepidermal junction and frank subepidermal blister formation in some areas . Ultrastructurally, there were alterations in the number and structure of anchoring fibrils in the lesional and perilesional skin consistent with a diagnosis of dystrophic epidermolysis bullosa . Treatment is symptomatic and is aimed at controlling pruritus and halting the progression of cutaneous lesions . Potent topical steroids and intralesional triamcinolone have been reported to reduce the pruritus in some cases, but do not produce sustained improvement . However, successful results have been achieved with topical tacrolimus and thalidomide, as well as cyclosporine . Oral administration of cyclosporine has been reported in one case as controlling the cutaneous lesions and decreasing the pruritus . Genetic counselling and gene therapy probably remain the most promising approaches . As in other forms of dystrophic eb, a prenatal diagnosis is possible by finding a cleft / blister formation at dermo - epidermal junction by light microscopy or more precisely by electron microscopy in fetal skin biopsy taken at 15 to 18 weeks of gestation . Similarly, rapid prenatal diagnosis may be possible by using lh 7:2 monoclonal antibody staining of skin samples obtained from 18 weeks fetus at risk.
|
A 70-year - old male patient presented with painless, gradually increasing swelling in the right lower bulbar conjunctiva for 6 months followed by redness and watering for last 3 weeks . Ocular examination revealed a 14 mm 7 mm red fleshy mass in the lower bulbar conjunctiva in the right eye [fig . 1]. Clinical photograph showing 14 mm 7 mm red fleshy mass in right lower bulbar conjunctiva the conjunctival mass was clinically diagnosed to be a squamous cell carcinoma in situ, lymphoma or amyloidosis . Histopathology revealed a localized granulomatous inflammation with histiocytes around a homogeneous material along with giant cells and chronic inflammatory cells [figs . 2 and 3]. Van gieson stain demonstrated the complete absence of elastic tissue at the center of the granuloma [fig . 4]. H and e stain 100 microphotograph showing giant cells, inflammatory cells, and histiocytes in the granuloma . [h and e stain 400] microphotograph showing the absence of elastic tissue in the centre of granuloma . Annular elastolytic giant cell granuloma is a condition characterized histologically by damaged elastic fibers surrounded by numerous giant cells and absence of necrobiosis, lipid, mucin, and pallisading of the granuloma . It almost always occurs on sun exposed skin, such as face, neck, dorsum of hand, forearm, and arm and hence the previous name actinic granuloma; however there are few reports occurring in sun - protected sites . The term actinic granuloma was coined by o brien in 1975, who described similar histological features in cutaneous lesions of patients with sun - damaged skin . Subsequently this concept was disputed by ragaz and ackerman, who believed that actinic granuloma was a variant of granuloma annulare . Mcgrae postulated that actinic granuloma represented a cell - mediated immune response to actinically altered elastotic fibers with a preponderance of helper t cells in the lymphocytic infiltrate . The occurrence of conjunctival actinic granuloma in isolation is a rare entity . In the past four decades all the previous cases were females, our case being the first such lesion occurring in a male patient . The size of all the previous lesions varied between 2 and 3 mm occurring in nasal or temporal bulbar conjunctiva . In those cases the clinical differential diagnoses were pinguicula, pinguiculitis, bowens disease, and conjunctival nevus . In our case 14 mm 7 mm, a fleshy mass involving the whole of the lower bulbar conjunctiva . The clinical differential diagnoses were squamous cell carcinoma in situ, mucosa associated lymphoid tumor (maltoma), amyloidosis, and leukemic deposit . The absence of caseous necrosis excludes tuberculosis and the prominent eosinophilic response invited by fungal and parasitic lesions was not present in this case . The noninfectious granulomatous inflammation includes foreign - body giant cell reaction, granuloma annulare or pseudoheumatoid nodule, and necrobiosis lipoidica . Granuloma annulare presents with abundant mucin, partial loss of elastic fibers and radial arrangement of epithelioid histiocytes (pallisading granuloma). In necrobiosis the complete loss of elastic tissue in the central zone as documented by connective tissue stain is used as the primary basis for separating annular elastolytic giant cell granuloma from granuloma annulare and necrobiosis lipoidica . Thus actinic granuloma of conjunctiva is a distinct clinical, histological, and immunological lesion . Though rare, the clinician should consider the possibility of actinic granuloma presenting as a fish flesh mass in the conjunctiva and pathologist should consider the possibility of granulomatous inflammation in association with elastolysis and does not necessarily imply the presence of foreign bodies or infection . Regarding medical treatment hydroxychloroquine, clofazimine, dapsone, intralesional, and systemic steroid has been used in annular elastolytic giant cell granuloma (aegg) of skin.
|
Dental ectopia is characterised by the change in the normal pathway of a tooth eruption, which may occur in any region of the alveolar and basal bone . In fact, it is a rare developmental anomaly whose aetiology is unknown and controversial . One can suppose that such an eruption process can be altered by genetic factors [28], physical obstacles [9, 10], or multiple causes [3, 10, 11]. It has been demonstrated that dental ectopia is more frequently seen in girls [8, 12, 13]. The occurrence of ectopic eruption is usually unilateral [1, 4, 13, 14], but bilateral cases have been reported [13, 15], and mandibular lateral incisors are the most affected teeth, representing 30% of all cases [16, 17]. Ectopic eruption of mandibular permanent lateral incisors can result in both advanced root resorption and precocious exfoliation of the deciduous canines and first molars [1, 15, 17]. Prolonged retention of deciduous canines and lateral incisors can occur as well [4, 10, 15]. Clinically, the ectopically erupted lateral incisor shows marked distal inclination and rotation achieving up to 180 [1, 4, 7, 17, 18]. The diagnosis of such dental anomaly is crucial for establishing the treatment plan and should be carried out through both clinical and radiographic exams, although other exams such as volumetric computerised tomography and study models can be employed [1820]. If not treated early, this dental anomaly may develop into partial or complete transposition of the permanent canines [7, 18, 20]. Therefore, the objective of the present paper is to report a case of male paediatric patient with bilateral ectopia of the mandibular permanent lateral incisors and discuss both implications regarding such an anomaly and treatment outcomes . Caucasian male patient of 11 years old was brought by his mother to the paediatric dentistry clinic complaining that the child's two mandibular teeth appeared to be tilted . During the interview the mother reported no relevant previous medical history and no cases of ectopia in the family as well . On facial examination, convex facial profile and a mild mandibular retrusion were also observed (figure 1). On intraoral examination, it was observed absence of carious lesions, and all the maxillary teeth had been erupted except the third molars whereas permanent right and left lateral incisors were buccally rotated and dislocated . Mandibular arch had all the permanent teeth erupted except the third molars whereas primary left lateral incisor and right lateral incisor and canine had prolonged retention . Permanent right and left lateral incisors were found to be ectopically erupted, with crown transposing the permanent canine on the left side and positioning lingually on the right side; both lateral incisors and canines were rotated and the mandibular right second premolar was impacted . Both maxillary and mandibular dental arches had parabolic shapes with 100% overbite, overjet of 3 mm, and no crossbite . A class ii division 2 subdivision left anteroposterior relationship was diagnosed (figure 2). On radiographic examination, the presence of third molar germs in all quadrants was observed . Ectopic eruption of the permanent mandibular right lateral incisor and partial transposition of permanent mandibular left lateral incisor and left canine had been also diagnosed since the apices of the lateral incisors and canines were correctly positioned, but the coronal position was altered due to inclination of the lateral incisor (figure 3). Also, they were informed on the need for corrective orthodontic treatment in association with extraction of deciduous teeth and premolars (maxillary and mandibular ones) for aligning and levelling the dental arches as well as for correcting both ectopia and class ii division 2 relationship . Dental ectopia is characterised by abnormal or even aberrant eruption of one or more teeth, thus resulting in root absorption of the adjacent teeth . Transposition of the teeth is the more severe effect, which consists of positional switch between two adjacent teeth or eruption of one tooth into normal position already occupied by another nonadjacent tooth [5, 16, 20]. As can be seen in figure 4, such a transposition can be complete, when crowns and roots are found to be transposed and paralleled, or partial, when crowns are found to be transposed and root apices are in relatively normal positions [1, 20, 21]. No past history of ectopia was found in the patient's family whereas the meckel's cartilage remaining in the alveolar region of the canines, which may obstruct physically the normal eruptive pathway of the tooth, is another possible aetiology . The present case was particularly interesting because it reported two conditions, namely, ectopia of the mandibular lateral incisor on the right side and partial transposition of the mandibular lateral incisor on the left side . The differential diagnosis was achieved by localising the root apices of the left teeth, which had virtually normal proximal positioning despite the transposed crowns . In general, ectopic lateral incisors display both distal inclination and marked rotation [7, 13, 17]. In the present case, the left mandibular lateral incisor had 90 rotation whereas the right mandibular lateral incisor had 30 rotation, with distal inclinations of 30 and 20, respectively, in relation to the occlusal plane . Deviation in the eruption axis of lateral incisors provokes prolonged retention of the deciduous lateral incisors and even the canines [4, 13, 18], as could be seen in the present case . When ectopia is detected early, the ectopic mandibular lateral incisors can be corrected by extracting the mandibular deciduous canines and vertically positioning the affected teeth . This orthodontic movement should be retained as long as possible since tooth tends to retake their wrong position . Consequently, transposition between ectopic lateral incisor and the developing canine germ is prevented from occurring [7, 9, 15, 17, 18, 23, 24]. Radiographic examination is recommended for 68-year - old children so that the dental malpositioning can be precociously diagnosed . If treatment is delayed, as the case presented herein, there is general agreement that transposition should not be corrected in the mandibular arch because the buccal - lingual space is not enough for accommodating tooth movements, which might provoke root interference resulting in root absorption as well as damage to the supporting tissues [9, 10, 18, 20, 2527]. Treatment interventions include either alignment of the teeth in their transposed order [18, 2527] or extraction of the ectopic lateral incisor [9, 14, 15, 27], which can be prosthetically replaced if space still exists . Due to the importance of the early diagnosis in those cases of eruptive alteration, dentists should take into account the followup of both tooth eruption and formation of permanent dentition so that any change in the normal dental development can be diagnosed and readily treated.
|
Neisseria gonorrhoeae is a well - known cause of sexually transmitted diseases such as genital, pharyngeal, and anorectal infections . Bloodstream invasion, however, occurs only in 0.5 - 3% of the infections and results in disseminated gonococcal infection (dgi). We report a patient with n. gonorrhoeae bacteremia in whom massive variceal hemorrhage occurs coincidently . On june 5th, 2010, a 42-yr - old man was admitted to the hospital via the emergency room due to multiple seizures, a history of chills, myalgia over the previous 2 weeks, and 3 days of melena . The patient was treated in a primary clinic and his cough improved; however, myalgia and melena continued and worsened after 4 days . At admission, he was pale and febrile with a temperature of 38.0. intermittent fever of 37.8 - 38.0 continued until hospital day 3 . The patient had a blood pressure of 108/64 mmhg, a pulse of 86/min, and a respiratory rate of 20/min . There were no signs and symptoms related to the genitourinary systems, skin, and joints . L - tube irrigation was performed, and the aspirate was bloody and had old clots . Laboratory investigations showed a hb of 4.6 g / dl, a leukocyte count of 19.410/mm, a platelet count of 5110/mm, a c - reactive protein level of 10.56 mg / dl, prothrombin time (international normalized ratio) of 1.58, ast / alt of 56/55 iu / l, alp of 102 iu / l, bun / creatinine of 37/1.1 mg / dl, and total protein / albumin of 3.5/1.5 g / dl . Three sets of blood cultures were taken and gram - variable cocci in clusters were detected after a 25.9- to 26.9-hr incubation in aerobic vials . Initially, cocci were reported as gram - positive . In 5% co2 at 35, tiny, glistening, and raised colonies grew after overnight incubation . The colonies grew to 1 - 2 mm in diameter after a 2-day incubation on both blood agar and chocolate agar plates (fig . The bacterium was positive for catalase, oxidase, and acid production from glucose but not maltose . It was identified, with 98% probability, as n. gonorrhoeae (bionumber 464001) by the vitek neisseria - haemo - philus identification (nhi) card (biomrieux vitek, inc ., sequencing of 16s rrna covering nucleotides 30 - 1,370 of this isolate showed the greatest homology (99.9%) to the published sequence of n. gonorrhoeae strain nctc 83785 (genbank accession no . Nr_026079.1), followed by 98.6% homology to neisseria meningitidis 8013 (genbank accession no . It was resistant to penicillin, ciprofloxacin, and tetracycline; and susceptible to cefuroxime, cefotaxime, and cefepime by disk diffusion on gc agar plates after a 20- to 24-hr incubation at 35 and 5% co2 . Cefotaxime was started empirically in the emergency room, and vancomycin was added after the report of positive blood cultures of gram - positive cocci on day 2 . On day 3, fever was no longer present, and follow - up blood cultures were negative . The patient was discharged on day 8 . Urine and throat swabs were obtained when he visited the outpatient clinic on september 28th, and were cultured on modified thayer - martin agar plates and blood agar plates ., he reported that he had not had sexual contact with his wife for several months, and that he had traveled to china during the previous april . N. gonorrhoeae is a pathogenic neisseria species that mainly causes genital infections, and, less frequently, also causes pharyngeal and anorectal infections [2, 3]. Dissemination occurs in only 0.5 - 3% of the gonococcal infections [2, 3]. Disseminated infections typically present with low - grade fever, skin lesions, tenosinovitis, and migratory polyarthralgias [2, 3]. Only one case of dgi with polyarthralgias and skin lesions has been previously reported in korea . This is the second case of dgi, and, to the best of our knowledge, the first culture - proven bacteremia of n. gonorrhoeae in korea . Predisposing risk factors for dissemination include being a female, a homosexual or bisexual male, recent menstruation, pregnancy, immediate postpartum states, gonococcal pharyngitis, complement deficiencies, and systemic lupus erythematosus [2, 3, 5]. Because this patient had hbv - associated liver cirrhosis, he may have had a complement deficiency [6, 7]. Liver cirrhosis patients are susceptible to immune and nutritional deficiencies, including vitamin, protein, immunoglobulin, and complement deficiencies [6 - 8], which cause increased morbidity and mortality of infectious diseases [9, 10]. Although the patient's medical history and physical examinations related to other risk factors were not taken initially in this case, he had neither female - related risk factors nor exhibited homosexual behavior . Because the patient had no symptoms related to the skin or joints, dgi was hardly suspected, even when n. gonorrhoeae was identified from blood cultures . In this case, intermittent fever, a leukocyte count of 19.410/mm, and a c - reactive protein level of 10.56 mg / dl indicated a stage of acute inflammation . Therefore, there was on acute onset of dissemination of n. gonorrhoeae at admission without time enough to involve skin and the joints . Gonococcal bacteremia is often intermittent and only half of the patients with dgi have positive cultures from blood or synovial fluid . Positive results, with practically the same time to positivity in all three sets of blood cultures, suggested direct introduction of n. gonorrhoeae into the blood stream, or endocarditis, a rare, life - threatening condition of dgi . However, no signs or symptoms of endocarditis were observed during a 6-month follow - up . Therefore, it was speculated that asymptomatic gonococcal pharyngitis preceded dissemination, and that ruptured vessels on the esophageal mucosa were a likely route of n. gonorrhoeae dissemination . The n. gonorrhoeae isolated from this patient was penicillinase - positive, resistant to penicillin, ciproflocxacin, and tetracycline, but sensitive to cefuroxime, cefotaxime, and cefepime . This resistance pattern was consistent with the previous report of resistance rates of korean gonococcal isolates against penicillin, quinolone, tetracycline, and ceftriaxone (55.4%, 95.7%, 10 - 34%, and 0%, respectively, in 2008). For treatment of dgi, intramuscular or intrave - nous injection of 1 g ceftriaxone every 24 hr is recommend - ed and it should be continued for 24 - 48 hr after an improvement of symptoms is observed . Initial 7-day empirical therapy of cefotaxime should be sufficient to provide a bacteriological cure, and prevent progression of dgi in this case . Biochemical testing of this organism indicated n. gonorrhoeae; however, fair growth of the bacteria on blood agar as well as on chocolate agar made that identification more suspicious because it is known that some n. gonorrhoeae strains can grow, but more slowly, and less well, on commercially available sheep blood agar . This is longer than the average detection time for common gram - negative pathogens isolated from blood cultures . Severe liver cirrhosis complicated with variceal hemorrhage is clearly associated with an increased risk of bacteremia by opportunistic pathogens that live in the gastrointestinal tract, such as enterobacteriaceae and staphylococcus aureus [15 - 17]. Bacterial infections have been reported among 35 - 66% of patients with cirrhosis who have variceal hemorrhage [17, 18]. Certain strains such as por1a serovar and ahu auxotype are alleged to be prone to dissemination; however, this assumption has been challenged and these strains are rare in korea . Further phenotypic or serologic characterization of this isolate was not performed . In this case, unusual clinical conditions of the patient, combined with the microbiological characteristics of the isolates, postponed the identification of n. gonorrhoeae . Hemorrhage of esophageal varices should be considered as a risk factor for dgi in patients in which n. gonorrhoeae grows from blood cultures.
|
Congenital pulmonary vein stenosis occured due to failed incorporation of common right and/or left pulmonary vein into the left atrium . Main pulmonary artery branch or ppas should be suspected when a continuous murmur is heard or chest x - ray shows post stenotic dilatation or area of decreased vascularity . Below is a case report of a 13 year old boy who presented with a rare combination of congenital pulmonary vein stenosis along with congenital stenosis of right pulmonary artery . A 13-year - old male patient presented to cardiology outpatient department with a complaint of easy fatigability for last 2 years ., he had blood pressure of 100/70 mmhg, pulse rate of 78/min (regular), grade iii parasternal heave, and loud and palpable second heart sound in left second intercostal space . A systolic ejection murmur of grade 3/6 intensity was audible in left second intercostal space . Echocardiography with color doppler revealed moderate pulmonary artery hypertension (pulmonary artery systolic pressure of 55 mmhg (using mahan's formula), turbulent, continuous, and high velocity flow consistent with severe stenosis of both left superior and inferior pulmonary vein and also right inferior pulmonary vein as viewed in modified parasternal short axis view [figure 1]. A pressure gradient of 32 mmhg was documented at the insertion of right inferior pulmonary vein in left atrium in apical four - chamber view [figure 2]. A stenosis of the right pulmonary artery was also detected distal to the bifurcation of main pulmonary artery [figure 3]. A pressure gradient of approximately 100 mmhg was observed at the level of the right pulmonary artery in parasternal short axis view [figure 4]. Computed tomography (ct) angiogram of thorax confirmed the stenosis of three pulmonary veins as well as branch stenosis of the right pulmonary artery . Ct scan revealed dilated main pulmonary artery (diameter = 3.9 cm) and dilated left pulmonary artery (diameter = 2.7 cm). Right pulmonary artery (diameter of proximal part = 1.7 cm) had a focal narrowing in distal part (diameter = 0.49 cm). Narrowing was seen at junction of bilateral inferior and left superior pulmonary vein with left atrium . The diameter of the right inferior pulmonary vein was 2.2 mm, and left superior and inferior pulmonary vein was 3.9 mm each . Turbulent flow detected at the insertion of left upper pulmonary vein and left lower pulmonary vein seen in modified parasternal short axis view . A pressure gradient detected at the level of insertion of right inferior pulmonary vein in apical four - chamber view . It occurs due to failed incorporation of common right and/or left pulmonary vein into the left atrium . Usually, the condition is diagnosed in older infants and children, but it may be manifested as severe persistent pulmonary hypertension of the newborn . The most common cause of acquired pulmonary vein stenosis is post - radiofrequency ablation for treatment of atrial fibrillation . The condition is relentlessly progressive causing 50% death in 5 years even after successful surgery . Initial experience with cutting balloon angioplasty was successful as palliative procedure though longest interval before repeat intervention was only 6 months . Nowadays, ppas can lead to pulmonary hypertension but is likely misdiagnosed as either idiopathic pulmonary arterial hypertension or chronic thromboembolic pulmonary hypertension . Therefore, a high index of suspicion during the initial evaluation of pulmonary hypertension is essential for its prompt diagnosis and adequate treatment . A combination of predominantly left - sided pulmonary vein stenosis (as both the left upper and lower pulmonary veins were involved) with right pulmonary artery branch stenosis is very rare, and in this particular patient, development of pulmonary artery hypertension was delayed because of restricted blood flow through right pulmonary artery.
|
Hydrazone 1 (0.273 mmol), catalyst 7 (5 mol%), and mg(otbu)2 (5 mol%) were combined in a 2 dram oven dried vial and capped with a teflon / silicon septum inside of a nitrogen drybox . The vial was removed from the drybox and thf (0.25 m) was added and the vial was heated with moderate stirring in an aluminum heating block to 60 c for 1520 minutes . Unsaturated aldehyde 2 (1.5 equiv) and then tbd (10 mol%) was immediately added . The reaction was allowed to continue at 60 c and was monitored by tlc (5% meoh / chcl3) upon completion (24 h), the reaction was diluted with ch2cl2 (15 ml) and washed with a 1:1 mixture of saturated aqueous nh4cl and water (10 ml). The aqueous layer was back extracted ch2cl2 (2 15 ml) and the combined organic layers were dried over anhydrous sodium sulfate and concentrated . The brown oily residue was purified by flash column chromatography on a biotage sp-1 chromatography system using a 12100% ethyl acetate / hexanes gradient to yield the desired product 3.
|
In george lucas epic star wars saga, jedi knights battle an evil empire with light sabers . Now, scientists have started to use light from lasers and light - emitting diodes to explore new concepts for striking back at one of humanity's most threatening foes, cancer . The concept of optogenetics is based on genetically encoded effectors of cell signaling that can be rapidly and reversibly activated by light . Optogenetic approaches have their roots in neuroscience and date back more than a decade, when researchers first managed to control neuronal activity with light upon introduction of animal rhodopsin or microbial opsins into a variety of model organisms . Since then, optogenetics has transformed neuroscience through the dissection of neural circuitry and brain function in health and disease . Over the last few years an increasing number of signaling pathways that are critical for cell fate decisions and hence play major roles in cancer development and progression became amenable to manipulation by light . For instance, optically activated variants of son of sevenless 1, raf 1, rho a, rac 1, phosphoinositide 3 kinase p85, and low - density lipoprotein receptor - related protein 6 (activating the wnt pathway) have been developed and used to study cellular signaling events with an unprecedented degree of spatial and temporal precision . In recent issues of the embo journal, nature communications, and chemistry & biology, collaborative work from our groups in austria and work from the group of won do heo in korea independently describe opto - rtks, receptor tyrosine kinases (rtks) that can be controlled with light . These reports demonstrate blue light - induced, spatio - temporally precise activation of several members of this crucial cell surface receptor family . Considering the fundamental role of rtks in cancer development and angiogenesis and the clinical importance of rtk inhibitors, rtks consist of an extracellular ligand - binding domain, a single - pass transmembrane domain, and an intracellular tyrosine kinase domain . In opto - rtks, the ligand - mediated dimerization that is required and sufficient for activation of many rtks is replaced with light - induced dimerization . In all published opto - rtks, light - sensitive protein domains from diverse non - animal species were attached to the far c - terminus of the rtk, whereas the original extracellular domains were either retained or replaced by heterologous domains . Our group screened light oxygen voltage (lov) domains of photoreceptors found in plants, bacteria, and fungi and identified 3 aureochrome lov domains that are capable of activating the rtks murine fibroblast growth factor receptor 1 (mfgfr1), human epidermal growth factor receptor, and human ret proto - oncogene (fig . The heo laboratory used the photolyase homology region of cryptochrome 2 (cry2) from arabidopsis thaliana to drive the activation of the rtks neurotrophin tyrosine kinase receptor type 1/2/3 (ntrk1/2/3, also known as tropomyosin - related kinase a / b / c, trka / b / c) and human fgfr1 . The choice of light - sensing protein domains may have functional implications as the lov domains form dimers, whereas cry2 has been shown to form oligomeric complexes . Importantly, both systems demonstrate light - induced simultaneous activation of the mitogen activated protein kinase, phosphoinositide 3 kinase, and phospholipase c pathways, as expected for canonical rtk signaling and in contrast to methods designed for activation of single pathways . Furthermore, no activation of signaling in the absence of light is observed in either of the two systems . We focused on the role of fgfr1 in malignant growth and demonstrated that light - induced activation of opto - mfgfr1 was sufficient to quantitatively control cell behaviors that are directly relevant to cancer: enhanced proliferation and epithelial mesenchymal transition of cancer cells, and sprouting of blood endothelial cells . Figure 1.recently published optically controlled receptor tyrosine kinases (opto - rtks) and potential applications in cellular oncology . (a) design principles of the first opto - rtks recently described by our groups in austria and the group in korea and accessible cellular functions . Manipulated rtks include murine / human fibroblast growth factor receptor 1 (m / hfgfr1), human epidermal growth factor receptor (hegfr), human ret proto - oncogene (hret), and tropomyosin - related kinase a / b / c (trka / b / c). Activation was achieved through attaching light oxygen voltage (lov) domains of v. frigida aureochrome 1 (vfau1) or o. danica / n . Gaditana putative aureochrome 1 (od / ngpa1) to the intracellular domains (i d) of the receptors . Extracellular (ed) and transmembrane domains (td) were either retained or removed . Fluorescent proteins such as mcitrine (ci) can be further added to the protein . (b) opto - rtks can be used to test the effects of temporally or spatially defined signaling patterns on cancer - related functions . By (co-)expressing opto - rtks that respond to light of different color (depicted in blue and red) in specific cell types (e.g., epithelial cells, fibroblasts, endothelial cells, immune cells) hallmark characteristics linked to cell functions that were manipulated by light via opto - rtks in the recent publications are highlighted . Recently published optically controlled receptor tyrosine kinases (opto - rtks) and potential applications in cellular oncology . (a) design principles of the first opto - rtks recently described by our groups in austria and the group in korea and accessible cellular functions . Manipulated rtks include murine / human fibroblast growth factor receptor 1 (m / hfgfr1), human epidermal growth factor receptor (hegfr), human ret proto - oncogene (hret), and tropomyosin - related kinase a / b / c (trka / b / c). Activation was achieved through attaching light oxygen voltage (lov) domains of v. frigida aureochrome 1 (vfau1) or o. danica / n . Gaditana putative aureochrome 1 (od / ngpa1) to the intracellular domains (i d) of the receptors . Extracellular (ed) and transmembrane domains (td) were either retained or removed . Fluorescent proteins such as mcitrine (ci) can be further added to the protein . (b) opto - rtks can be used to test the effects of temporally or spatially defined signaling patterns on cancer - related functions . By (co-)expressing opto - rtks that respond to light of different color (depicted in blue and red) in specific cell types (e.g., epithelial cells, fibroblasts, endothelial cells, immune cells), an additional level of control can be achieved . Hallmark characteristics linked to cell functions that were manipulated by light via opto - rtks in the recent publications are highlighted . Using these newly - developed tools, researchers can now probe the hallmarks of cancer in new ways to obtain answers to long - standing questions . One focus may lie in decoding the dynamic intracellular wiring of signaling pathways and understanding its link to functional changes in cell behavior . Repetitive short activation of cellular signaling may result in fundamentally different outcomes compared to prolonged activation . Also, we have created variants of opto - mfgfr1 with mutations in intracellular tyrosine residues that allow us to restrict activation patterns to specific combinations of downstream effectors . The overwhelming evidence for rtk hyperactivation during all stages of cancer contrasts with the seemingly paradoxical experience of many researchers that it can be difficult to overexpress rtks in untransformed cells and even in fully malignant cancer cells without triggering apoptosis . Opto - rtks may enable detailed studies of pathway - specific temporal and spatial dose - effect relationships between rtk activation and cell fates ranging from proliferation and migration to differentiation, senescence, and apoptosis . Figure 1b illustrates possibilities for spatially or temporally restricted activation of rtks in specific loci of living cells, organotypic co - cultures, or model organisms . Since aberrant rtk signals contribute to most functional hallmarks of cancer, these experiments, combined with rapid and sensitive read - outs of cell signaling and behavior, will lead to a new understanding of key events underlying cancer in real - time and with high resolution . In high throughput formats, similar experiments may significantly improve and facilitate drug development . We expect that further advances in the field will create optically controlled variants of additional rtks that can also be activated either simultaneously or separately (e.g., by light of different colors), and will enable patterned programming of cell functions and differentiation states with far - reaching implications in stem cell research and regenerative medicine . These include in vivo illumination technology, ranging from surgical implants to transdermal illumination, and 2-photon excitation approaches . There may still be some way to go until these new tools ultimately benefit applied research and cancer treatment . Yet, analogous to developments in neuroscience, subsequent episodes in which researchers use opto - rtks for new discoveries in the field of oncology will soon follow.
|
Obesity, most often defined as a body mass index (bmi) of 30 kg / m and caused by an imbalance between energy intake and expenditure, is widely recognised as the largest and fastest growing public health problem in the developed and developing world (https://apps.who.int/infobase/publicfiles/surf2.pdf). Prevalence of the disorder in adults has more than tripled in the past decade, and obesity currently affects approximately 3035% of the general population in the usa and 25% in the uk (national audit office, 2001) (http://www.ic.nhs.uk/statistics-and-data-collections/health-and-lifestyles/obesity/statistics-on-obesity-physical-activity-and-diet-england-2010). It has been estimated that, in 2005, some 400 million adults worldwide were obese, with a total of 1.6 billion being overweight (http://www.who.int/mediacentre/factsheets/fs311/en/index.html). Of particular concern is the associated epidemic of obesity in children and adolescents; the current prevalence of 710% in these populations is predicted to at least double by 2025 (mcpherson et al ., 2007), and there is strong evidence of persistence into adulthood (freedman et al ., 2001; daniels, 2006b). Obesity is associated with substantial increases in morbidity, premature mortality, impaired quality of life and large healthcare costs (kopelman, 2000; fontaine et al ., 2003; haslam and james, 2005). The major comorbidities include type 2 diabetes, metabolic syndrome, hypertension, dyslipidaemia, myocardial infarction, stroke, certain cancers, sleep apnea and osteoarthritis (flegal et al ., 2007). Indeed, obesity is blamed as a major contributing factor in over 300,000 deaths annually in the united states, with the illness - related economic costs exceeding us$100 billion per annum (daniels, 2006a). Although prevention through education and changes to the obesogenic environment are long - term goals, treatment is required for those who are already obese . Lifestyle changes in the form of dieting and/or exercise per se do not generally produce marked or sustainable weight loss (dansinger et al ., 2005; leblanc et al ., 2011), whereas effective psychological therapies, such as cognitive behavioural therapy, cannot easily be delivered on a mass scale (e.g. Wing et al ., 2006) and bariatric surgery, such as roux - en - y bypass or gastric banding, is much more effective in terms of weight loss, comorbidity reduction and enhanced survival (kral and naslund, 2007; sjostrom et al ., 2007). However, owing to concerns about perioperative mortality, surgical complications and the frequent need for reoperation, these procedures tend to be reserved for the morbidly obese (melnikova and wages, 2006; field et al ., 2009). An alternative strategy to surgery is to develop therapeutic agents that can reduce body weight by decreasing the consumption or absorption of food, and/or by increasing energy expenditure (cooke and bloom, 2006; sargent and moore, 2009). Unfortunately, although avidly pursued for more than half a century, this strategy has thus far only shown limited success . Many new agents that were heralded as the answer to the obesity problem were hastily withdrawn owing to an unacceptable side - effects burden . Indeed, a recent review rather pessimistically concluded that the history of anti - obesity drug development is far from glorious, with transient magic bullets and only a handful of agents currently licensed for clinical use (rodgers et al ., 2010). Therefore, new treatments for obesity that are both better tolerated and more efficacious are urgently needed (halford et al ., 2010; kennett and clifton, 2010; rodgers et al ., 2010; vickers et al ., 2011). In this context, major recent advances in our understanding of the basic neurobiology of appetite and energy homeostasis have identified numerous targets for potential anti - obesity drug development (wilding, 2007; heal et al ., 2009; the aim of this commentary is to place these developments in context by reviewing the pharmacotherapy of obesity in terms of its past, present and future . To set the stage, it is important to recognise that, following preclinical identification of potentially important new therapeutic agents, human drug trials progress through several phases of development . Phase i typically focuses on tolerability, safety and pharmacokinetics; phase ii on proof of concept (mechanism, efficacy and safety); phase iii on confirmation of efficacy and side - effect profile in large - scale multi - centre trials; and phase iv on long - term monitoring and data collection following governmental approval . Application for approval from the united states food and drug administration (fda) or the european medicines agency (ema) is made after phase iii . Centrally acting sympathomimetics, such as the amphetamine derivatives desoxyephedrine, phentermine and diethylpropion, were among the earliest pharmacological agents used for weight loss (colman, 2005; wilding, 2007). They were popular in the 1950s and 1960s, but growing concerns about cardiovascular risk and abuse potential led to a marked decline in their use by the early 1970s . Although still available in many countries, phentermine and diethylpropion were largely superseded in the 1970s and 1980s by the serotonin (5-ht)-releasing agents fenfluramine and dexfenfluramine . It was known from the outset that agents of this series had the potential to produce primary pulmonary hypertension, but the risk was deemed sufficiently low against the weight loss benefits . In the early 1990s, evidence of superior efficacy over either compound given alone led to the widespread use in the united states of combined treatment with phentermine and fenfluramine (weintraub et al ., 1992). However, within only a few years, reports of cardiac valvulopathy (connolly et al ., 1997), particularly when these agents were combined with phentermine, led the manufacturers to withdraw fenfluramine and dexfenfluramine from the market . Until very recently, three agents were approved in europe for the long - term clinical management of obesity and related metabolic syndrome: sibutramine (trade names meridia and reductil), rimonabant (acomplia) and orlistat (xenical and alli). Sibutramine, a dual monoamine (noradrenaline and serotonin)-reuptake inhibitor, was introduced to clinical practice in the late 1990s (mcneely and goa, 1998; luque and rey, 2002) and is believed to achieve very modest weight loss by decreasing energy intake and increasing energy expenditure . However, cumulative clinical experience has identified some adverse effects, the most serious of which (cardiovascular risk) emerged as a result of a post - marketing clinical trial (james et al ., 2010) and led in january 2010 to the suspension of marketing authorisations by the ema (http://www.ema.europa.eu/docs/en_gb/document_library/press_release/2010/01/wc500069995.pdf). There is substantial evidence that phytocannabinoids (i.e. Cannabis and its constituents) and endocannabinoids (e.g. Anandamide) stimulate appetite in animals and humans, and that these effects are mediated via cannabinoid cb1 receptors in the brain and/or periphery (kirkham, 2009). Rimonabant, a cannabinoid cb1 receptor antagonist / inverse agonist (see box 1 for glossary) developed in the mid-1990s, suppresses appetite and weight gain in experimental animals and, in four major clinical trials, has consistently been found to produce a placebo - subtracted weight loss of 45 kg (despres et al ., 2005; van gaal et al ., 2005; pi - sunyer et al ., 2006; scheen et al ., 2006 although never approved in the united states, rimonabant (acomplia) was licensed in europe as an anti - obesity agent by the ema in june 2006 . However, by october 2008, burgeoning reports of serious psychiatric problems (such as anxiety, depression and suicide) led to suspension of marketing authorisations by the ema (http://www.ema.europa.eu/docs/en_gb/document_library/press_release/2009/11/wc500014774.pdf). This decision in turn rapidly led to the termination of several cb1-receptor - antagonist - based anti - obesity drug development programmes [including those for rimonabant, taranabant, otenabant, surinabant and ibipinabant (plieth, 2008)]. Unlike the other weight loss agents mentioned above, which reduce appetite and/or enhance energy expenditure, orlistat inhibits pancreatic lipases, thereby reducing fat absorption from the gut by 30% (borgstrom, 1988). Weight loss is relatively modest [circa 3 kg at 12 months (li et al ., 2005)], but of sufficient magnitude to have beneficial effects on cardiovascular risk, as reflected by a lowering of low - density - lipoprotein (ldl) cholesterol, blood pressure and glycaemia (broom et al ., 2002; torgerson et al ., 2004). Compared with other agents, adverse effects are limited, but include diarrhoea, flatulence, bloating, abdominal pain and dyspepsia (bray and greenway, 2007). At the time of writing, orlistat is the only weight loss agent approved for long - term clinical use in europe . A substance that binds to a receptor molecule and produces a stimulus that results in a measurable response in the tissue . A substance that binds to the same receptor as an agonist but fails to elicit a stimulus (so that no tissue response is produced). An antagonist can, however, block or reverse the effects of an agonist or inverse agonist . In tissues in which receptors exhibit constitutive activity, an inverse agonist will bind to the same receptor as an agonist, but the resulting stimulus produces the opposite response in the tissue . A substance that binds to the same receptor as an agonist, but its effects vary as a function of the presence (antagonist action) or absence (inverse agonist action) of the agonist . Despite the withdrawal of rimonabant and the demise of several cb1-receptor - antagonist development programmes, there are reasons to believe that we have not yet reached the end of the line for anti - obesity treatments targeting the cb1 receptor (for reviews, see kunos et al ., 2008; bermudez - silva et al ., 2010). First, rimonabant and related compounds are not neutral cb1 receptor antagonists, but possess significant inverse agonist activity at these sites (pertwee, 2006) (see box 1 for glossary). Recent preclinical evidence suggests that neutral antagonists might retain the weight loss advantages of rimonabant, but without the adverse effects of this agent (e.g. Cluny et al ., 2011). Second, it is known that tolerance develops to the acute anorectic effect but not the weight loss effects of rimonabant - like compounds, and that the weight loss effect might involve cb1 receptors in peripheral tissues . This would support further development of cb1 receptor antagonists that do not cross the blood - brain barrier; indeed, several such agents have recently been reported to produce weight loss in rodent models (e.g. Chen et al ., 2010; randall et al ., other realistic possibilities include the development of cb1 receptor partial agonists, allosteric modulators of cb1 receptors and agents that alter the levels of endocannabinoids (bermudez - silva et al ., 2010). The first is based on the low - dose combination of rimonabant with another anorectic agent [e.g. An opioid receptor antagonist (tallett et al ., 2008; lockie et al ., 2011), the 5-ht2c receptor agonist mcpp (ward et al ., 2008) or the gut peptide cck-8s (orio et al ., 2011)]. These drug combinations have been shown to produce at least additive anorectic effects and, in the case of rimonabant plus the opioid receptor antagonist naloxone, a significant attenuation of rimonabant - induced pruritus (tallett et al ., 2008). The second suggestion derives from recent genomic studies suggesting that variants (polymorphisms) of the cb1 receptor gene, alone or in combination with the gene for the serotonin transporter (slc6a4), contribute to the development of anxiety and/or depression in response to agents such as rimonabant (lazary et al ., these observations seem to offer the possibility of personalised medicine based on genetic screening for high - risk individuals nevertheless, the cb1 receptor remains stigmatised as a target owing to the massive disappointment surrounding acomplia, and even potentially promising alternative approaches understandably continue to face serious scepticism and a challenging regulatory climate . Table 1 lists many of the agents that are either currently or have until very recently been in the anti - obesity drug development pipeline (cooke and bloom, 2006; wilding, 2007; heal et al ., 2009; sargent and moore, 2009; vickers et al ., 2011). These treatments are aimed at diverse molecular targets in the cns and/or periphery and, in some cases, at several targets simultaneously . The large number of potential new therapies should not be surprising given a projected market size of us$3.7 billion for a safe and effective anti - obesity drug (vickers and cheetham, 2007). It is beyond the scope of this article to review all the potential therapies listed in table 1 . Instead, we focus on a subset of the most promising and/or exciting lines of enquiry . Table 1 shows that, despite successful progress up to phase iii (vickers et al ., 2011), contrave (a polytherapy) was recently turned down by the fda owing to potential cardiovascular risk . Although the federal authorities still require more evidence that drug - specific concerns are unfounded, it seems probable that contrave will be re - filed in the near future . Lorcaserin, a monotherapy, was initially rejected in 2010 owing to concerns about tumour growth in preclinical studies but, following re - file, was approved by the fda in june 2012: plans are to market the compound under the tradename belviq . Similarly, a third agent, qnexa (a polytherapy), was initially declined by the fda in 2010 owing to concerns over possible birth defects but, on re - file, was fda - approved in july 2012: this compound will apparently be marketed under the tradename qsymia . Two other compounds (cetilistat, a monotherapy, and tesofensine, a polytherapy) have reached advanced phase iii testing but have not at the time of writing been formally submitted for approval in the usa or europe . One area of substantial interest has focused on the weight loss effects of the glucagon - like peptide 1 receptor (glp-1r) agonists that are already licensed for the treatment of type 2 diabetes . Glp-1 is an endogenous gut peptide that was initially identified as an incretin hormone (kreymann et al ., 1987) and was later found to be part of the endogenous satiety cascade (turton et al ., 2006). Modest weight loss has consistently been observed when individuals are treated for diabetes (wilding and hardy, 2011), but there is evidence that higher doses of the glp-1r agonist liraglutide than are necessary for glucose lowering can produce greater weight loss of up to 10 kg in trials of up to 2 years duration (astrup et al . 2011). Unsurprisingly, an extensive programme is now underway to further test the efficacy and safety of liraglutide . Other treatments that are based largely on preclinical findings and aimed at an impressively wide range of molecular targets remain at relatively early stages of development . Traditional pharmacological monotherapies for obesity, although initially successful in achieving weight loss, are often subject to counter - regulation . This is not surprising given the multiplicity and redundancy of mechanisms involved in appetite regulation and energy homeostasis (adan et al ., 2008; vemuri et al ., it is therefore pertinent to note that two of the three treatments that were most recently submitted for fda approval (contrave and qnexa) are effectively polytherapies i.e. Combination agents that are designed to simultaneously target more than one biological mechanism and that might ultimately be more effective in producing sustained weight loss and improvements in comorbidities . Advantages of polytherapy, which actually began some 20 years ago with the phentermine and fenfluramine combination, include the use of lower drug doses, possible synergistic but at least additive weight loss, less serious side effects and reduced potential for counter - regulation (greenway et al ., 2009; padwal, 2009; roth et al ., 2010). In this context, it would seem reasonable to suggest that man - made cns - targeted agents would be more likely to engender adverse effects than would naturally occurring biological signals that normally regulate the activity of key cns circuits . Over the past few decades, basic research (for reviews, see cooke and bloom, 2006; field et al . Kennett and clifton, 2010) has identified a host of signals emanating from the gut (e.g. Cck, ghrelin, glp-1, glucose - dependent insulinotropic polypeptide, oxyntomodulin, pyy), pancreas (e.g. Insulin, amylin, pancreatic polypeptide) and adipose tissue (e.g. Leptin, adiponectin). Against this background, basic and applied research has begun to assess the therapeutic potential of combinations of these molecules either with one another [e.g. Amylin with murine leptin (trevaskis et al ., 2008)] or with a centrally acting agent [e.g. Amylin or pramlintide with either phentermine or sibutramine (roth et al ., 2008; arrone et al ., as shown in table 1, one such combination [pramlintide plus metreleptin (ravussin et al ., 2009)] entered phase ii clinical trials but the programme was stopped because of significant problems with antibody generation and skin reactions (http://www.takeda.com/press/article_42791.html). Current status of anti - obesity drugs and drug combinations another exciting recent strategy involves the development of single - peptide molecules that combine differing modes of action . For example, day and colleagues recently reported on a peptide with dual agonism at the glucagon receptor and glp-1r (day et al ., 2009). Glucagon is a pancreatic hormone with well - established thermogenic, anorectic and weight loss effects in animals (salter, 1960; woods et al ., 2006), whereas glp-1r agonism (e.g. With exenatide) is known to improve glycaemic control and weight loss in humans with type 2 diabetes (e.g. Hanssen et al ., 2009). On the basis of these observations, day and colleagues reasoned that the antihyperglycaemic property of glp-1r agonism could minimise any diabetogenic risk of excessive glucagon agonism . They further argued that the lipophilic and thermogenic properties of glucagon, in addition to the satiation - inducing pharmacology of glp-1, provided a strong scientific basis for the development of a synergistic co - agonist peptide . Consistent with this rationale, the authors report that new peptides with varying ratios of agonism both at glucagon and glp-1 receptors have potent, sustained satiation - inducing and lipolytic effects in rodents (day et al ., 2009). Detailed analysis revealed that body weight reduction was achieved by a loss of body fat arising from decreased intake and increased expenditure . The authors suggest that it is at least theoretically possible to incorporate factors other than gut hormones in an analogous single - molecule co - agonist . Furthermore, combining more than two endogenous metabolic peptides into a single molecule might lead to receptor occupancy patterns that more closely resemble physiological regulation . The development of new molecules based on this novel strategy is likely to have substantial heuristic value . Despite an inauspicious history, the pharmacological management of obesity is at an exciting crossroads . New treatments are essentially on the horizon, and novel research strategies have very recently come to the fore . However, it must be emphasised that only limited behavioural data are available on many of these treatments, including those currently undergoing regulatory approval (halford et al ., 2010; much emphasis is being placed on endpoints (reduced food intake and/or body weight) and possibly not enough on process i.e. How the endpoint has been reached . Without a much deeper understanding of molecular, physiological and behavioural mechanisms, we are likely to witness many more failed to minimise this prospect, it is essential that detailed behavioural analysis is conducted at an early stage of drug development . Given some of the molecular targets involved (e.g. Monoamine transporters, cb1 receptors, 5-ht2c receptors), such analyses should ideally include not only tests of feeding behaviour but also, for example, tests relevant to mood, sexual behaviour, and learning and memory . However, even for those agents that meet preliminary requirements for selectivity of action and potential safety profile, extensive real - world testing is likely to be required by regulators, not only showing efficacy in terms of weight loss but also demonstrating long - term benefits for diabetes prevention and treatment, cardiovascular disease, and psychiatric safety . Finally, successful discovery and development of potent and safe drugs for the prevention and treatment of obesity will probably require polytherapeutic strategies as well as vastly improved tools for the identification and characterisation of specific obese subpopulations that allow for the tailor - made development and appropriate use of personalised medicines.
|
A 20-year - old refugee from liberia was referred to our hospital because of a loud murmur ., he had been admitted to a hospital in his home country several times because of respiratory tract infections and heart problems. He had a low body weight of 45 kg at a height of 1.63 m. he was hypertensive with a 50 mmhg difference in systolic blood pressure between his upper and lower extremities: 170 vs. 120 mmhg . The electrocardiogram showed sinus rhythm 84 beats / min with signs of left ventricular hypertrophy . 1) revealed a dilated, hypertrophied and hyperdynamic left ventricle due to a large pda with a continuous left - to - right shunt . Just distal to the pda, narrowing of the aorta was visible, with an increased systolic flow velocity . The absence of a classic sawtooth pattern in the continuous wave signal from the descending aorta as well as the presence of holodiastolic flow reversal in the abdominal aorta suggested non - severe coarctation . The cardiac valves showed no abnormalities except for a mild pulmonary regurgitation with an early - diastolic flow velocity of around 3 m per second, suggestive of elevated pulmonary artery pressure . The descending thoracic aortic wall had an irregular aspect and its narrowing was most severe just distal to the pda . Right ventricular and main pulmonary artery pressures were elevated (systolic right ventricular pressure 55 mmhg, main pulmonary artery pressure 48/31 mmhg at a systemic blood pressure of 167/84 mmhg), but peripheral pulmonary artery pressures were normal . A peak - to - peak gradient of 50 mmhg was measured in the descending aorta . 1transthoracic echocardiography in patient a. a apical four - chamber view showing dilated and hypertrophied left ventricle . B parasternal view of the pulmonary trunk and arteries showing turbulent flow due to a pda with left - to - right shunting; a stenosis of the proximal right pulmonary artery is also visible (asterisk). C suprasternal view showing pda (asterisk) as well as coarctation of the aorta . D continuous wave doppler signal from the descending aorta, showing elevated systolic flow velocity of about 4 m per second . 2preoperative and postoperative magnetic resonance angiography . A preoperative magnetic resonance angiography (mra) of the aorta (sagittal plane), showing large pda (black arrow) and irregular aspect of the descending aorta with coarctation distal to the pda (white arrow). B repeat mra of the aorta after surgical correction of the pda, showing irregular aspect and (mild) residual stenosis / coarctation of the descending aorta transthoracic echocardiography in patient a. a apical four - chamber view showing dilated and hypertrophied left ventricle . B parasternal view of the pulmonary trunk and arteries showing turbulent flow due to a pda with left - to - right shunting; a stenosis of the proximal right pulmonary artery is also visible (asterisk). C suprasternal view showing pda (asterisk) as well as coarctation of the aorta . D continuous wave doppler signal from the descending aorta, showing elevated systolic flow velocity of about 4 m per second . A typical sawtooth pattern is lacking preoperative and postoperative magnetic resonance angiography . A preoperative magnetic resonance angiography (mra) of the aorta (sagittal plane), showing large pda (black arrow) and irregular aspect of the descending aorta with coarctation distal to the pda (white arrow). B repeat mra of the aorta after surgical correction of the pda, showing irregular aspect and (mild) residual stenosis / coarctation of the descending aorta the patient was referred for surgery . Closure of the ductus arteriosus was performed and the pulmonary artery was reconstructed (fig . After ligation of the pda, the pressure gradient in the descending aorta had decreased from 50 to 20 mmhg and this (mild) residual coarctation was left untreated . Whether it will need (percutaneous) treatment in the future remains to be seen . He had previously been diagnosed with severe hypertension with a poor response to medical therapy . Approximately eight years prior to referral to our hospital, echocardiography had already revealed left ventricular hypertrophy . Moreover, it showed a pda with a continuous left - to - right shunt . A murmur had never been heard . At that time when he was referred to our outpatient clinic he did not have any cardiac complaints, although his exercise capacity had gradually deteriorated over the past year . In addition to the pda, echocardiography now showed not only left, but also right ventricular hypertrophy and an estimated right ventricular systolic pressure of 57 mmhg . He was referred for treatment of his pda on the assumption that it had contributed to the development of pulmonary hypertension . It must be noted that the pda was silent and did not appear very large on echocardiographic and mri . Moreover, diastolic dysfunction due to left ventricular hypertrophy may have played an important role in the development of pulmonary hypertension as well . However, a contribution of the pda to the development of pulmonary hypertension could not be excluded and the patient was therefore accepted for percutaneous closure of the pda . Angiography of the aortic arch and the occluded pda with coil in situ can be seen in fig . In due time, echocardiography will be repeated to document whether his pulmonary artery pressure will decrease . Mri visualised the jet of the pda flow entering the pulmonary bifurcation (black arrow)fig . Mri visualised the jet of the pda flow entering the pulmonary bifurcation (black arrow) angiography of the aortic arch . Pda is usually diagnosed shortly after birth, and treated surgically or percutaneously to prevent the development of pulmonary hypertension and heart failure . The first case represents a more complex form of pda, associated with additional congenital cardiovascular anomalies and with left ventricular volume overload as one of its main characteristics . In the second patient, pulmonary hypertension was the sole reason for closure of the pda, and left ventricular dilation had not developed . A difference in shunt size is probably the main reason for this difference . In addition, it may be possible that patient b s severe left ventricular hypertrophy due to hypertension prevented left ventricular dilatation . Closure of a pda is only feasible when irreversible pulmonary hypertension has not yet developed . In adults, a, surgical correction of the pda was performed because of its large size and concomitant anomalous aortic anatomy . Pda patients who are beyond surgical or percutaneous closure should be treated according to the guidelines for eisenmenger syndrome.
|
Gene expression is well regulated by the epigenetic modification of dna and histone tails independent of their primary sequences . In particular, cytosine methylation, in which the c5 position of the cytosine base is methylated enzymatically, plays a crucial role in the regulation of chromatin stability, gene regulation, parental imprinting, and x - chromosome inactivation in females [14]. Therefore, detection of cytosine methylation is very important, and much effort has gone into developing a simple reaction for 5-methylcytosine (c) detection . For the evaluation of the methylation status of genes, several conventional methods have so far been used, such as a cleavage assay with methylation - insensitive restriction enzymes [57], hydrolysis and sequencing with a bisulfite salt [810], and immunofluorescence with anti-5-methylcytosine antibody [11, 12]. Although the conventional methods have many merits, there are many disadvantages, and methylation detection assays must be further improved through another approach . The existence of a more rapid and selective chemical reaction capable of distinguishing between methylcytosine and unmethylated cytosine on a chip has promise as a good method for efficiently analyzing the status of cytosine methylation at a specific site in a gene . The sequence - selective dna methylation - detection probe, icon (interstrand complexes formed by osmium and nucleic acids), may be effective for the development of an on - chip analysis of dna methylation [1315]. In the presence of osmium oxidants and a bipyridine ligand, 5-methylcytosine forms a stable osmium - centered complex, in contrast to unmethylated cytosine (figure 1) [1619]. Icon probes form a crosslink with a specific 5-methylcytosine in the probe - hybridizing dna mediated by osmium - centered complex formation . This function will be effective for the capture of methylated dna on a chip for sequence - selective methylation analysis . In this paper, development of an on - chip analyzing method for typing of dna methylation at a specific cytosine icon probes fixed to the bottom of microwells assisted the on - chip detection of the methylation status of a specific cytosine in the target dna . Artificial dna was synthesized by the conventional phosphoramidite method using an applied biosystems 392 dna / rna synthesizer or an nts h-6 dna / rna synthesizer . The phosphoramidite form of bipyridine - modified adenine (b) was prepared according to the synthetic protocol described in a previous paper . The 5-amino end was attached using the phosphoramidite of 5-aminomodifier c12 (glen research (http://www.glenresearch.com/index.php)). Synthesized dna was purified by reverse phase hplc on a 5-ods - h column (10 mm 150 mm, elution with a solvent mixture of 0.1 m triethylammonium acetate (teaa), ph 7.0, linear gradient over 30 min from 5% to 20% acetonitrile at a flow rate of 3.0 ml / min). A 100 l solution of synthetic dna (100 nm) in te buffer (ph 7.0) or deionized water in the presence of 10 mm 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, and 10 mm 1-methylimidazole was put into each well of nucleolink strips (nalge nunc (http://www.nalgenunc.com/)). After incubation at 50c for 5 h, the reaction mixture was removed from the well, and the well was rinsed three times with a solution of 100 mm tris - hcl (ph 7.5), 150 mm sodium chloride, and 0.1% tween20, and then three times with deionized water . The target dna sequence p53(n n) was 5-tgt gca gct gtg g gtt gat t cga cac ccc c gcc cgg cac c cgc gtc cgc g cca tgg cca t cta caa gca g tca cag cac a tga ngg agg t tgt gag g ng c tgc ccc cac c-3 (n, a 25 l solution of dna (8 nm) in 50 mm tris - hcl buffer (ph 7.7), 0.5 mm edta, and 1 m sodium chloride was added to each probe - attached well at 0c . The reaction mixture was incubated at 0c for 5 min, and then the solution was removed from the wells . A 25 l solution of 5 mm potassium osmate(vi) and 100 mm potassium hexacyanoferrate(iii) in 50 mm tris - hcl buffer (ph 7.7), 0.5 mm edta, and 1 m sodium chloride was incubated at 0c for 5 min or at 25c for 10 min . The wells were rinsed seven times with 0.4 m sodium hydroxide, 0.25% tween20 (130 l / well). After further rinsing with deionized water twice, the wells were coated with 10 mg / ml bsa in 100 mm tris - hcl (ph 7.5), 150 mm sodium chloride, and 0.1% tween20 . The process of pcr amplification was performed in a reaction solution of 1 u takara ex taq hs, 10 buffer, 2.5 mm dntp mix, and 1 m primer mix (forward, 5-agctgd514gggttgattc-3 for the exciton primer method, 5-tgtgcagctgtgggttgattc-3 for the sybr green i method; reverse, 5-actgcttgtagatggccatg-3; d514 in an exciton primer is a hybridization - sensitive fluorescent nucleotide (figure 1)). In the case of using the stain method with sybr green i fluorescence for monitoring the amplification, sybr green i dye was also added to the reaction mixture in advance . Amplifications were performed in microwells as follows: after heating at 95c for 60 s, 35 cycles of denaturation at 95c for 5 s, annealing with fluorescence monitoring at 52c for 20 s, and extension at 72c for 20 s on the corbett rotor - gene, the amplification process was monitored by the fluorescence of d514 or sybr green i through an sybr green i (470 nm/510 nm) filter . For the on - chip study, we adopted a nucleolink strip, because it is a microwell strip in which the amino - modified icon probe can be attached to well bottoms with covalent bonds . The target dna was a fragment of the human p53 gene exon 5 including mutation hotspots at cpg dinucleotides . The sequence of the icon probe was designed to form a crosslink with one of the methylated cytosines in the target dna . The icon probe was modified with an amino end for attaching to the plate and an alkyl linker and a poly c sequence for introducing enough distance between the probe and the plate . This icon probe was synthesized by the conventional phosphoramidite method by using a dna autosynthesizer . The phosphoramidite form of bipyridine - modified adenine (b) was prepared according to the synthetic protocol described in a previous paper . Synthetic dna was fixed to the bottom of each well of nucleolink strips in the presence of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and 1-methylimidazole (figure 2). Oxidative osmium complexation using icon probes is a rapid and mild reaction for detection of methylated dna, and it is not accompanied with nonspecific strand damage, in contrast to conventional bisulfite methods . Therefore, this reaction would be effective for on - chip analysis of dna methylation . The target dna was put into the wells and hybridized with the icon probes fixed in the wells . The dna samples in the wells were incubated at 0c for 5 min then at 25c for 5 min in the presence of 5 mm potassium osmate(vi) and 100 mm potassium hexacyanoferrate(iii) in 50 mm tris - hcl buffer (ph 7.7), 0.5 mm edta, and 1 m sodium chloride . After reaction, the wells were rinsed with 4 m sodium hydroxide and then coated with bsa . The fixed dna was detected using pcr amplification of a part of the crosslinking dna strand . The pcr primers were designed for the region without icon binding . For one of the primers, a hybridization - sensitive fluorescent dna was used, containing a fluorescent nucleotide d514 (figure 1) [2124]. This fluorescent dna shows very weak fluorescence in the unhybridized state, whereas it shows strong fluorescence after hybridization with the complementary nucleic acids . This fluorescence switching is controlled by an intramolecular excitonic interaction between dyes tethered to the dna . This dna shows weak fluorescence emission, whereas the pcr mixture emits strong fluorescence after pcr amplification . This system has been applied to the detection of single nucleotide polymorphisms in genome dna samples . The process of pcr amplification was performed in a reaction solution of takara ex taq hs polymerase in the presence of a mixture of dntp and primer mix . Amplifications were performed in microwells and the change in the fluorescence intensity monitored using a real - time pcr system . In the experiment for p53(c c) and p53(c c), the methylation of the target cytosine was determined from the increase in the fluorescence signal associated with the exponential growth of the pcr product . C) started first, and then the amplification of p53(c c) started several cycles later (figure 3). Washingout of uncrosslinked sample dna brought about this lag in the starting point of amplification . The amplification curve observed for p53(c c) almost overlapped that for the osmium - untreated p53(c c), suggesting that the amplification curve for unmethylated dna is due to amplification of the dna nonspecifically adsorbing to the well surface . On - chip capture of methylated dna by the icon probe at the methylation site made possible the sequence specific detection of methylation through pcr amplification . A prototype for icon - based on - chip methylation analysis makes possible sequence - specific amplification . We prepared four dna strands with different methylation sites, p53(c c), p53(c c), p53(c c), and p53(c c). The sample dna was added to the wells, in which the icon probe targeting only the c of the sample dna 5 side was fixed . After osmium treatment and bsa coating, the crosslinked dna was amplified by pcr in the presence of unlabeled primers and sybr green i. after 15 cycles of the amplification reaction, the fluorescence intensity of sybr green i was quantified on a microplate reader (figure 4). C) and p53(c c) exhibited higher fluorescence intensities compared with those from wells containing p53(c the icon probe fixed on the well bottom distinguished 5-c from 3-c and detected only methylation of 5-c regardless of methylation of 3-c . We have described a new, high - value aspect of on - chip methylation analysis through osmium - dna complexation . An icon probe fixed onto a microwell formed a crosslink with the target 5-methylcytosine and assisted the detection using pcr amplification . Although there remain further aspects to be examined toward realizing an easier - to - use methylation analysis, such as optimization of pcr conditions suitable for icon, this on - chip assay supported by the chemical basis could be an important component of the next generation of high - throughput methylation analyses.
|
Copd is a progressive disease leading to a decline in lung function over time despite the best available care . The presence of multiple comorbidities is common among copd patients, with the vast majority of patients using multiple classes of chronic non - copd medications.13 in addition to significant effects on morbidity, copd is the third leading cause of death in the world.4 unfortunately, with the exceptions of smoking cessation and oxygen therapy in hypoxic patients, no interventions to date have been able to reduce the likelihood of death in patients with copd.5 furthermore, based on current clinical trial data, the magnitude of effect of pharmacological treatments for copd has been shown to be relatively limited.6,7 in comparison to the use of short - acting bronchodilators (sabd) or placebo, the use of single long - acting bronchodilators (labd) (ie, long - acting -agonists [laba] or long - acting muscarinic antagonists [lama]) has resulted in small reductions in the rates of exacerbations and hospitalizations without significant adverse events.8,9 however, despite the entry of many new agents into the market, numerous clinical trials demonstrate that combining two labds offers only modest improvements in patient - relevant outcomes compared to the individual inhalers alone.6,1013 the effectiveness of inhaled corticosteroids (ics) in the management of copd remains controversial . Large randomized trials and subsequent meta - analyses have confirmed a modest reduction in acute exacerbations of copd (aecopd), but not a reduction in hospitalizations or clinically important improvements in health status with the addition of an ics to a labd . Most concerning, however, is a significant increase in the incidence of pneumonias in those using ics in general and compared to a labd alone.1416 based on data from the us from 2010, inhaler prescriptions for copd patients increased up to three- to fourfold compared to the previous decade.17 a study of the veterans affairs health system from 1999 to 2003 found that of newly diagnosed copd patients, 29% were prescribed three to four medication classes over the 1-year follow - up.18 a canadian study of copd prescribing patterns found that 63% of patients in quebec and ontario with mild copd had received a prescription for ics.19 these findings lead us to hypothesize that copd medications of modest efficacy are being initiated and added earlier than may be indicated . To our knowledge, there are no recent large database studies on the first initiation and sequence of addition of copd medications in the literature . We conducted a large population - based cohort study of copd patients in manitoba, canada, to characterize prescribing patterns and to evaluate the clinical appropriateness of the initiation and sequencing of copd medications . The objective of the study was to describe the utilization and sequence of addition of copd medications in manitoba between the calendar years 1997 and 2012 . A retrospective population - based cohort study of copd medication use was conducted using administrative health care data from the province of manitoba, canada, from april 1, 1997 to march 31, 2013 . Data were obtained through the manitoba centre for health policy, which maintains the province s population health research data repository . The repository contains linked administrative health care data for the population of manitoba (1.3 million, 2013). The databases used included the drug program information network, a community pharmacy - based prescription processing system that enables submission of online insurance claims by pharmacies, the medical services database that contains records of fee - for - service medical claims, provincial hospital discharge abstracts containing summary data of each hospital stay, and the manitoba health registry, from which we obtained basic demographics on individuals in our cohort . Scrambled patient identifiers are shared between these databases, enabling linkage of records and allowing for the longitudinal analysis of individual patients across the entire health care system . The eligible population included manitobans 35 years of age or older with copd . To satisfy the definition for copd, patients had to have three or more copd - related outpatient visits over a rolling 24-month window or at least one copd - related hospitalization with cohort entry from the date of first record . Copd codes were defined using the international classification of diseases, ninth revision (icd-9) codes 491, 492, and 496 or 10th revision (icd-10) codes j41, j42, j43, and j44 . This case definition has been reported to have a specificity of 95.4% for identifying patients with copd.20,21 patients with a diagnosis of asthma (icd-9 code 493 or icd-10 code j45) were excluded . A patient was considered an incident user if he or she received a prescription for a copd medication after their entry date . A first medication was defined as a prescription dispensed on or after the entry date of the copd diagnosis . If another medication was dispensed up to 7 days after the first medication, it was also considered to be a part of the first medication . Sequential medications were defined as all prescriptions dispensed 8 or more days since the start of the first medication . To determine whether the second medication dispensed was an addition or a switch, medication dispensations occurring after the second medication were checked . If the second medication was different from the first, but the next medication after the second was the same as the first, then the result was considered an addition . If the second medication was different from the first and the next medication after the second was either different from the first or the first did not occur again (ie, stopped), then the result was considered a switch . The following medications were considered for our analysis: short - acting -2 agonists (saba), short - acting muscarinic antagonists (sama), fixed - dose combination inhalers of saba and sama, laba, lama, methylxanthines, ics, and fixed - dose combination inhalers of ics and laba (table s1). For the evaluation of guideline - based appropriateness to receive an ics, in order for a patient to meet the criteria recommended by the 2008 canadian thoracic society (cts) copd guidelines for ics initiation, it was necessary to have had at least one aecopd in the past year or be inadequately controlled on a laba, lama, and an as - needed sabd.22 since it is not possible to determine adequate control using the database, having a dispensing claim for these medications an aecopd was defined as a hospital admission for copd, or a copd claim plus a prescription for antibiotics and/or systemic corticosteroids within 7 days of that claim . Antibiotic or systemic corticosteroid prescriptions with a duration beyond 21 days were considered chronic use and excluded . In order for a patient to meet the two criteria recommended by the global initiative for chronic obstructive lung disease (gold) copd guidelines for ics initiation, it was necessary to have had at least two aecopd or at least one copd hospitalization in the past year in addition to having inadequate control of copd on labds.23 to define two separate exacerbation episodes, the antibiotic and/or systemic corticosteroid prescriptions were required to be greater than 14 days apart . Test were used to compare copd medication use at the beginning and at the end of the study period . Sas version 9.4 (sas institute, cary, nc, usa) and microsoft excel 2013 (microsoft corporation, redmond, wa, usa) were used for data analysis . Approvals were obtained from the university of manitoba health research ethics board (hreb #hs18642 [h2015:231]) and the manitoba health information privacy committee (hipc #2015/201617). These committees do not require individual consent for research conducted using de - identified administrative data when reasonable safeguards to protect confidentiality and security of personal health information are in place . A total of 19,367 patients satisfied the case definition of copd from 1997 to 2012 . The median age of the population was 73 years at the time of diagnosis and did not change significantly over the study period . Fifty - seven percent of the patients were male . In total, 13,369 patients (69%) were dispensed a copd medication after their diagnosis . Of these patients, for the majority (n=8,825), the first medication dispensed was a sabd (saba alone, sama alone, or combined inhaler of both) (table 1). Laba and lama inhalers alone were uncommonly used as first medications, while ics were used in more than a quarter of patients . Over the study period, use of a sabd as first medications declined from 70.6% in those diagnosed in 1997 to 59.4% for those diagnosed in 2012 (p<0.0001). The use of laba alone remained consistently low throughout the study period, and lama use rose slightly from almost no use (0.1%) for those diagnosed in 1997 (the first lama was marketed in 2002) to 5.5% for those diagnosed in 2012 (p<0.0001). However, the use of ics as a first medication increased significantly from 23.5% in those diagnosed in 1997 to 34.4% for those diagnosed in 2012 (p<0.0001). An increase in the use of an ics in combination with a laba was most remarkable, rising from 1.2% in those diagnosed in 1997 to 27.3% in those diagnosed in 2012 (p<0.0001) (figure 1). Of those patients who were dispensed medications, 46.9% were initiated on one medication, 41.0% were initiated on two, and 12.1% were initiated on three or more first medications . Analysis of this population over time revealed that 57% of patients were initiated on one medication, 36.9% initiated on two, and 6.1% initiated on three or more first medications if diagnosed in 1997 . For diagnosis in 2012, those initiated on one medication had declined to 46.8%, those initiated on two medications rose modestly to 40.0%, and those initiated on three or more medications more than doubled to 13.3% (p<0.0001 for all three comparisons of 19972012) (figure 2). Of the 13,369 patients who started medications, 2,013 (15.1%) stopped any copd medications that were initially started and did not have any further medications initiated throughout their time in the study . Of those who stopped medications, most were sabd users (1,482), contributing to a decline in the number of sabd users from 8,825 for first medication users to 7,280 sabd users after the first series of medication changes took place . Of those changes, 952 (83.3%) involved a switch to or addition of an ics . Of these changes involving an ics, 499 (52.4%) involved a switch to or addition of a laba + ics combination . Use of ics overall decreased modestly from 3,764 patients (28.2%) to 3,329 patients (24.9%) (p<0.0001), while use of the ics + laba combination remained relatively stable with 1,966 initial users of this combination and 1,848 users after the first series of medication changes took place (p<0.0001). Again, laba and lama use in the absence of ics was minimal, accounting for 244 (1.8%) and 341 (2.6%) of patients, respectively, after the first series of medication changes were made . During the overall study period, 3,053 (52.4%) met 2008 cts criteria recommended for initiating an ics . In the analysis to determine those meeting the gold guideline criteria for initiating an ics, although the aecopd criteria were met by 2,302 patients (39.5%), only 47 (0.8%) of all ics users had been on a laba or lama prior to ics start . In this study of over 19,000 patients with copd, of those prescribed a medication after diagnosis, the majority were appropriately started on sabd alone or in combination . Although labas or lamas alone were uncommonly used as first medications, 28% of patients were started on an ics as a first medication . While use of the most basic medications, the sabds, decreased over the study period, by far the most dramatic increase in use was the combination of laba and ics, which rose from 1.2% for those diagnosed in 1997 to over 27% for those diagnosed in 2012 (figure 1). More than half of those started on medications after diagnosis were started on two or more medications . Although the use of single medications as the start of therapy decreased over time, those initiated on three or more medications more than doubled over the study period (figure 2). After subsequent changes to medication were made, laba use in the absence of ics did not increase as expected despite being the next recommended step after basic sabds according to clinical practice guidelines.22,23 of the changes made to first medications, initiation of an ics accounted for 83% of them . Only approximately half of the patients started on ics during the study period met cts recommendation criteria, while less than 1% of the patients met the international gold recommendation criteria . Consistent with current literature, the use of sabd accounted for a significant proportion of medications used in our cohort of new medication users.1,17,24 this is expected considering the reasonable relative effectiveness of these classes of medications and their place as first - line therapies in previous and current copd practice guidelines.22,23 it is also expected that laba and lama use would not be as common as first medications, considering their appropriate second - line status when symptoms fail to improve on short - acting agents . However, the use reported in our study for use of these agents without ics was very low . In a study of us national ambulatory medical care survey data from 1999 to 2010, ford et al17 also evaluated trends in copd medication prescribing visits over time, showing a low and declining proportion of visits for laba - alone prescriptions and a rise in tiotropium prescription visits from 6.3% in 2005 to 17.2% in 2010 . The reason for the infrequent use of laba alone in our study is likely the result of the availability of combination products with ics and the possible presumption by prescribers that a combination of the two agents is necessarily superior to a laba alone . This dramatic rise in combination of laba and ics prescribing was also seen in the ford et al17 study, which reported an increase in prescription visit rates from 6.2% in 2001 to 26.7% in 2010 . Although the use of tiotropium increased throughout the study period, its use remained low . The practical explanation for this is the fact that tiotropium is not covered by manitoba s deductible - based universal drug plan unless the patient has failed to improve on a 3-month trial of ipratropium first . Labas and labas combined with ics, however, are covered without exception.25 in sharp contrast to this, a large proportion of patients (28%) were started on an ics prior to trials of any other medications . As mentioned previously, this was largely driven by a dramatic rise in prescriptions for combination products containing a laba and ics . Although not specifically evaluating first medication use, an early study of the veterans affairs health system from 1999 to 2003 by solem et al18 shows some consistency with our findings, reporting that 33% of patients had received an ics over a 1-year follow - up in recently diagnosed copd patients . Our evaluation of the appropriateness of ics prescribing showed that approximately half of the patients met canadian criteria for the initiation of an ics and only a fraction of a percent met the more stringent criteria recommended by the international gold guidelines . A small prospective study in the canadian provinces of quebec and ontario by bourbeau et al19 reported that nearly two - thirds of copd patients received a prescription for an ics despite having only mild copd that was considered not applicable to guideline - recommended use . Our study of initial medication use provides a large database perspective on a concerning trend of early prescribing of medications with uncertain benefits in early copd and known harms and cost . Previous literature on the number of classes of copd medications prescribed has generally found that in prevalent users, multiple medication use is common . The previously discussed study by solem et al18 found that 29% of recently diagnosed copd patients were prescribed three to four medication classes through the 1-year follow - up of veterans affairs patients . The later study by ford et al17 based on us national survey data from 2010 reported that copd inhaler prescription visits increased up to three- to fourfold compared to the previous decade, despite overall visits remaining stable . This pattern of multiple inhaler use with an increasing trend over time is not dissimilar to our findings, which analyzed first - time medication prescriptions specifically . Not only did the majority of patients start on multiple medications, but the proportion of patients started on one medication declined over the study period, and the use of three or more initial medications increased significantly over time . The implications of this include effects on adherence, cost, and overall burden of treatment . It is well documented that there is generally poor adherence shown with the use of respiratory medications for copd and that patients on multiple inhalers or complex regimens are less persistent and adherent than those on single inhalers.17,26 a recent canadian study of copd medication costs from 2001 to 2010 reported an increase of $45 per patient per year of the study.20 considering that the vast majority of those with copd use multiple classes of chronic non - copd medications, the addition of multiple inhalers further complicates the broader medication picture, compounding the already large burden of treatment.1,2 it is important to note that 31% of the entire cohort in this study did not have medications started throughout the study period . It was intended that the highly specific inclusion criteria of multiple medical service codes would rule out most patients who were incidentally miscoded for copd when presenting with nonchronic conditions such as acute bronchitis . It is likely, however, that these scenarios would still occur on occasion and contribute to this nonmedication cohort . It is also possible that patients received samples of copd medications, but did not have the desire or need to fill future prescriptions . However, although this was an unexpected finding, a canadian survey of 1,133 patients with a self - reported diagnosis of copd found that only 75% of respondents reported taking a medication for copd.27 in addition, a study of us managed care and medicare patients by make et al24 reported that more than 60% of patients received no therapy over a 1-year observation period . It is also of interest that 15.1% of our cohort that started a medication during the study period stopped their first medication and did not start another . There are several possible explanations for this, including a recognized misdiagnosis of copd by the prescriber and subsequent discontinuation of therapy, poor adherence to medication by the patient, or a lack of follow - up for medical care despite a diagnosis of copd . To our knowledge, this study is the first to examine the initiation of first medications and the next sequential medication changes for patients with newly diagnosed copd . A main strength of our study is the longitudinal design of our study using the linked administrative database in a well - defined population over 16 years . First, determining medication use based on pharmacy dispensing claims does not allow for assessment of whether the medication was actually taken . However, although actual utilization of medications provides valuable information, it was our intention for this study to focus specifically on prescribing patterns . Similarly, studies of this nature also cannot capture medications that are prescribed but never filled by the patient . This could have the effect of potentially underestimating prescribing estimates and either overestimating or underestimating appropriateness, depending on the medication prescribed . Lastly, the diagnosis of copd was based on medical billing records, which may have led to possible misclassifications in diagnosis . It is expected, however, that our use of high - specificity case definition criteria will have minimized this . At the same time, it is likely that in this trade - off, some cases of diagnosed copd will not have been captured . The use of basic first - line medications has declined over time, replaced in large part by combination inhalers that are prescribed inappropriately early without prior trials of other medications with known efficacy . This, combined with the increasing and predominant use of multiple medications at the start of therapy, indicates a significant degree of medication burden in this already complex patient population . Despite the widespread dissemination of both canadian and gold copd treatment guidelines, clinicians in manitoba routinely prescribe steroids earlier in the treatment course than recommended . These findings highlight a need for the provision of enhanced education for prescribers to optimize evidence - based management of copd in the early stages after diagnosis while minimizing the burden of care . Groupings of copd medications used in the study analyses abbreviations: saba, short - acting -2 agonists; sama, short - acting muscarinic antagonist; laba, long - acting -2 agonists; lama, long - acting muscarinic antagonist; ics, inhaled corticosteroids.
|
The large intestine is composed of the cecum (most proximal portion, receives liquid residue from distal ileum), the colon (ascending, transverse, descending, and sigmoid), the rectum, and the anus . Approximately 1500 ml of liquid residue arrives in the large intestine daily, and normally, more than 90% of the water and electrolytes are gradually reabsorbed, resulting in formed stool.1 the motor events of the large intestine are 95% segmental (mixing waves) that facilitate the absorption of water and electrolytes, whereas the remaining 5% are propagating contractions (peristalsis).2 propagating contractions occur over a wide range of amplitudes and transit rates, from frequent low - amplitude (10 mm hg), rapidly propagating (up to 17 cm / s) waves that act like a squeegee to propel gas past other luminal contents to infrequent high - amplitude (> 100 mm hg), slowly propagating (1 cm / s) contractions that are lumen - occluding events, propelling all contents.2 this difference in wave form drives the observed differences in transit rates: gas can transit the entire gastrointestinal tract in less than 1 hour (flatulence 14 episodes per day) versus hard stools, which can require days to transit the large bowel (infrequent bowel movements).2,3 there are 2 mechanisms by which fiber supplements can improve constipation: (1) mechanical stimulation / irritation of the colonic mucosa and (2) gel - dependent / viscous water - holding capacity that resists dehydration . Both mechanisms require a fiber supplement that is relatively nonfermented, so that most of the fiber remains intact and present in stool throughout the large intestine . The first mechanism is mechanical stimulation / irritation of the gut mucosa by the particles of insoluble fiber . The mechanical stimulation / irritation results in secretion of mucous and water, resulting in larger / softer stools and faster transit through the large bowel . This mechanism is proportional to particle size and shape large coarse particles have a significant laxative effect, whereas small smooth particles do not.38 this effect was discerned by assessing wheat bran milled to different size / shaped particles versus plastic particles cut to match.6,8 the plastic particles had the same laxative effect as the wheat bran, and the magnitude of the effect was dependent upon the particle size / shape . Insoluble fiber has no water - holding / gel - forming capacity, so insoluble fiber supplements cannot be of benefit for attenuating loose / liquid stools in diarrhea . The mucosal stimulating / irritating effect of insoluble particles can actually make symptoms of diarrhea and irritable bowel syndrome (ibs) worse.9,10 the second mechanism is high water - holding capacity that resists the water - absorbing / dehydrating effects of the large bowel . Nonviscous soluble fibers, like wheat dextrin and inulin, are fermented (not present in stool throughout the large bowel) and have no water - holding capacity and thus do not provide a laxative benefit at physiologic doses.1124 wheat dextrin actually has is a constipating effect at physiologic doses (eg, 10 - 15 g / d).23 most gel - forming fibers (eg, guar gum, acacia gum, -glucan from oats, and barley) are also fermented in the large bowel, resulting in loss of their viscous / gelled nature3,4,25 and no laxative effect . Once fermented, the fiber is no longer intact and present in stool, lacking the water - holding capacity required for soluble fibers to improve stool form and symptoms in constipation, diarrhea, or ibs . In contrast to the fiber supplements discussed above, psyllium is not fermented in the gut3,26 and retains its water - holding gelled structure throughout the large bowel . Although psyllium has often been reported as fermentable, there exists a significant discrepancy between in vitro data and human (clinical) experience . Under in vitro test conditions, psyllium is mixed with stool and homogenized in high - speed mechanical blender.2729 the hydrated / gelled psyllium is exposed to rapid mechanical shearing forces that destroy the physical structure of the gel matrix, artificially rendering psyllium nonviscous / fermentable . In contrast, 5 well - controlled clinical studies show that psyllium is not fermented in the human gut.3034 the 5 clinical studies assessed the fermentation of psyllium versus a negative control (placebo), a positive control (lactulose), and/or comparative fiber supplements (eg, methylcellulose, guar gum, pectin, cellulose), assessing breath gas, flatulence, and/or short - chain fatty acid production . All 5 studies showed that the psyllium gel was not fermented.26 this retained gel allows psyllium to provide a dichotomous effect as a stool normalizer: softens hard stool in constipation (softer bulkier stools that are easier to pass, increased transit rate, improved bowel movement frequency)3,7,35 and improves the consistency of loose / liquid stools in diarrhea (formed stools, slower transit rate, decreased urgency, less frequent bowel movements)3639 in a randomized, double - blind, clinical study of 170 patients with chronic idiopathic constipation, psyllium was shown to be superior to docusate for increasing stool water content (softer stools; p = .007) and the frequency of bowel movements (p = .02).7 the american college of gastroenterology chronic constipation task force systematically reviewed the available clinical evidence regarding the use of fiber supplements in chronic constipation and concluded that there was insufficient clinical evidence to support a recommendation for calcium polycarbophil, methylcellulose, or bran but concluded that psyllium was the only fiber supplement with sufficient clinical evidence to support a recommendation for treatment of chronic constipation.40 furthermore, a recent (2013) comprehensive review on the effects of fiber in functional bowel disorders concluded that a recommendation for psyllium was best supported by the available clinical evidence.9 this conclusion was in agreement with an earlier systematic review conducted by the american college of gastroenterology task force on ibs, which also concluded that psyllium was effective for ibs.41 a high level of dietary fiber consumption (eg, replacement) has been associated with a 30% reduction in the risk of gaining weight or developing obesity.4244 as discussed in previous sections, however, care must be taken when attributing the health benefits of dietary replacement to fiber supplements . A recent comprehensive review of available clinical data concluded that resistant starch (soluble, nonviscous, fermentable; eg, wheat dextrin) had no significant effect on satiety or weight loss at physiologic doses.45 a yearlong study in 97 adolescents has been quoted as demonstrating weight loss for a prebiotic fiber supplement (soluble, nonviscous, fermentable), but a closer look at the data shows that the prebiotic fiber group (8 g / d) was not different from baseline for body mass index.46 in contrast, gel - forming fibers (eg, guar gum, pectin, and psyllium) have been shown to increase satiety and reduce subsequent energy intake.4749 a well - cited clinical study demonstrated that apples were significantly more satiating than fiber - free apple juice, even though the juice provided the same level of carbohydrate as the apples.50 pectin is the gel - forming fiber in apples and has been shown to increase satiety.51 gel - forming fibers may influence satiety by several mechanisms, including delayed degradation and absorption of nutrients in the small bowel, leading to a sustained delivery of nutrients, and delivery of nutrients to the distal ileum with subsequent stimulation of feedback mechanism like the ileal brake phenomenon (slows gastric emptying and small bowel transit) and decreased appetite.3,4,5254 studies have used an insoluble fiber or a soluble nonviscous fiber as a negative control, reinforcing the assertion that the effect on satiety is a gel - dependent phenomenon.49,5559 satiety is often assessed in short - term clinical studies as a tool or mechanism for predicting the potential for decreased energy intake and weight loss, but the end therapeutic goal is weight loss (or prevention of weight regain). A review of the effects of fiber supplements on weight loss60 identified 17 placebo - controlled clinical studies, most of which maintained subjects on energy - restricted diets and fiber supplements (mostly insoluble fiber), provided 3 times daily before meals . Fiber supplement intake ranged from 4.5 to 20 g / d, and the results showed that only 1 of 17 studies provided evidence of weight loss greater than placebo,60 supporting the previous conclusion that insoluble fiber has no significant clinical effects in the small bowel . A 6-month study compared the effects of viscosity on weight loss by assessing a viscous, gel - forming, nonfermented fiber (psyllium) versus a less viscous, readily fermented fiber (partially hydrolyzed guar gum).61 this randomized controlled clinical study included 141 patients with metabolic syndrome . Patients were maintained on a restricted diet alone (american heart association step 2 diet, negative control) or the restricted diet supplemented with psyllium or partially hydrolyzed guar gum (both dosed 3.5 g twice a day with breakfast and dinner). The control group showed gradual loss in weight over the first 4 months, followed by weight regain (figure). After 2 months, the guar gum treatment group showed a marked weight reduction (2.4 kg vs baseline), but this reversed to weight regain over the following 4 months (figure). In contrast, the psyllium treatment group showed gradual and sustained weight loss across the entire 6-month test period (figure). At 6 months, weight loss for the psyllium treatment group was 3.3 kg versus baseline, 2.1 kg versus control, and 1.76 kg versus guar gum (p <.01 for all 3 comparisons).61 the data suggest that 2 fiber characteristics, high viscosity / gel forming and nonfermented (no calorie harvest from fiber), may play key roles in the long - term weight loss.61 shows the results of a 6-month study in patients with metabolic syndrome . A restricted diet alone showed a modest weight loss over 4 months, followed byweight re - gain . In combinationwith the restricted diet, partially hydrolyzed guar gum (3.5 g bid), a less viscous readily fermented fiber, showed amarkedweight loss at 2 months followed by weight re - gain over the following 4 months . In contrast, psyllium (3.5 g twice a day), a viscous, gel - forming, non - fermented fiber supplement, inaddition to therestricteddiet, showed sustained weight loss over the 6-month study . Source: mcrorie j, fahey g. a review of gastrointestinal physiology and the mechanisms underlying the health benefits of dietary fiber: matching an effective fiber with specific patient needs . It is worth noting that the gel - forming fibers in the study above also improved other objective clinical measures of metabolic syndrome . After 6 months of treatment, both the psyllium and guar gum treatment groups showed significant improvement in fasting plasma glucose (28% vs 11%, respectively), fasting plasma insulin (20% vs 11%, respectively), hemoglobin a1c (10% vs 10%, respectively), and low - density lipoprotein (ldl) cholesterol (8% vs 8%, respectively).61 only the psyllium group exhibited a significant improvement in plasma triglyceride concentration (13.3%) and systolic (3.9%) and diastolic (2.6%) blood pressure . At the conclusion of the study, 12.5% of patients in the psyllium group no longer qualified for a diagnosis of metabolic syndrome, versus 2.1% of patients in the guar gum group and 0% of patients in the diet - alone group.61 taken together, these data support that a soluble viscous, gel - forming fiber supplement can be an effective cotherapy for treating metabolic syndrome . Although it has been clearly shown that raw gel - forming fibers (eg, guar gum, high - molecular - weight -glucan) can exhibit significant health benefits, it is important to consider how the degree of processing to make a final marketed product may alter the viscosity / gelling capacity of a fiber supplement.3,57,59,6264 for example, 2 clinical studies investigated the effects of -glucan from oat bran, either baked into bread and cookies (study 1) or provided as a raw fiber in orange juice (study 2), on serum cholesterol concentrations in 48 subjects with hypercholesterolemia.64 in the first study, subjects completed a 3-week baseline with control bread and cookies rich in wheat fiber (insoluble, negative control), followed by a randomized 4-week treatment period: remained on the control fiber products (negative control) or switched to bread and cookies enriched with -glucan (5.9 g / d). The -glucan baked into bread and cookies had no effect on serum ldl - cholesterol (not different from negative control). In contrast to these results, study 2 provided a lower dose of -glucan (5 g / d) in orange juice, which significantly decreased ldl - cholesterol concentration versus the wheat fiber control (p <.001). The authors concluded that food matrix, food processing, or both could adversely affect the cholesterol - lowering efficacy of -glucan.64 this emphasizes the importance of recognizing that not all marketed fiber supplements will provide the clinical efficacy of the original raw fiber . Another example of the importance of processing (heat and pressure) on the viscosity / gel - forming capacity of a raw fiber is a double - blind, parallel - design, multicenter clinical study that randomly assigned 386 subjects to receive cereal containing wheat fiber (negative control) or 1 of 3 oat bran cereals (high, medium, and low viscosity), equaling 3 to 4 g of -glucan daily.59 the viscosity of the -glucan was altered by the degree of processing (heat and pressure) to which the fiber was exposed in making the cereal . The results showed that cholesterol lowering was highly correlated with the viscosity of the -glucan: high viscosity (lower heat and pressure) was correlated with significant cholesterol lowering; low viscosity (higher heat and pressure) was correlated with diminished cholesterol lowering . Taken together, these studies demonstrate that the physicochemical properties of raw oat -glucan were altered by processing and the degree to which a gelling fiber is processed (hydrolysis, baking, heat / pressure extrusion into cereal shapes) before marketing should be taken into consideration before recommending a particular fiber supplement or cereal . Attempts to improve the palatability of fiber supplements can also affect the efficacy of a fiber supplement . As discussed previously, raw guar gum is normally a highly viscous, gel - forming fiber with proven gel - dependent health benefits . To improve palatability, however, a commonly marketed version is partially hydrolyzed guar gum, which is a nonviscous product that dissolves completely in water without altering viscosity . Other similar products also make claims of dissolves completely and/or no viscosity (eg, wheat dextrin, inulin), as if the nonviscous nature of the fiber represented a consumer benefit . Advertising that compares a nonviscous fiber with a gelling fiber, on the basis of relative palatability, carries an underlying implication that the 2 fiber supplements are comparable in efficacy . This implied equality is not supported by clinical data, which shows that most of fiber - related health benefits are dependent on a viscous gel . Because the term fiber supplement implies that regular (daily) consumption will provide essentially the same health benefits of a high - fiber diet, it is reasonable to require evidence of a clinically meaningful health benefit before selecting / recommending a fiber supplement . This requirement for clinical evidence is consistent with the definition of fiber provided by the institute of medicine,64 in which they differentiated between dietary fiber and functional fiber: dietary fiber is defined in this report as non - digestible carbohydrates and lignin that are intrinsic and intact in plants . Functional fiber is defined as isolated, non - digestible carbohydrates that have beneficial physiological effects in humans . Note that the institute of medicine definition requires that isolated carbohydrates (fiber supplements) have clinical evidence of a health benefit before being considered a functional fiber . This requirement is also consistent with the academy of nutrition and dietetics position paper on the health implication of dietary fiber, in which they state few fiber supplements have been studied for physiological effectiveness, so the best advice is to consume fiber in foods . Look for physiological studies of effectiveness before selecting functional fibers in dietetics practice.66 taken together, these observations emphasize the importance of being cognizant of not only the specific fiber types that exhibit characteristics closely associated with specific health benefits (eg, viscosity / gel formation) but also the degree of processing to which the final marketed product has been exposed . For a simple and reasonable test to determine if a fiber supplement can provide gel - dependent health benefits, stir a single dose of the marketed product (usually 24 g of fiber) into 120 ml of water and let it stand for 15 minutes . If the fiber supplement does not dissolve in the water, then form a highly viscous gel within the allotted time, it is unlikely to have a clinically meaningful effect on cholesterol lowering, improved glycemic control, appetite control, or other viscosity / gel - related health benefits . Sensations of slight discomfort to cramping pain may be associated with an increase in consumption of dietary fiber, particularly if the patient is constipated and/or a fiber supplement is initiated at a relatively high dose.3,4 when stool is formed, and of similar consistency, there is minimal deformation with peristalsis, so there is no significant bowel wall distention . In normal individuals, this propulsion is not typically perceived unless it causes stool to fill the rectum, stimulating an urge to defecate.3,4,67 in contrast, if a propagating contraction causes a bolus of lower - viscosity fiber - rich stool to collide with more distal formed / hard stool, the lower - viscosity fiber - rich stool deforms to cause acute dilation of the bowel, stretching mechanoreceptors and causing sensations of discomfort to cramping pain . The discomfort / pain would be transient, occurring with the frequency of propagating contractions, and relieved with a bowel movement . To facilitate long - term compliance with a fiber supplement regimen, it is important to minimize significant differences in stool viscosity . For nonconstipated subjects, this entails starting a new fiber supplement gradually, initiating dosing at no more than 3 or 4 g / d the first week, then increasing very gradually over subsequent weeks with a goal of about 10 to 15 g / d . For constipated patients, any introduction of a new fiber regimen carries a significant risk of cramping pain unless the hard stool is eliminated first . A reasonable suggestion is to first clear the hard stool from the bowel with a significant dose of an osmotic laxative (eg, polyethylene glycol). The ensuing cramping pain and potential loose stool after evacuation of the hard stool will be associated with the osmotic laxative, not a fiber supplement . Once the hard stool is cleared, gradually introduce a new fiber supplement as above . It is important to recognize the difference between replacement with dietary fiber that is intrinsic and intact in whole foods and a supplement with an isolated fiber source . Fiber supplements cannot be presumed to have the same health benefits that are associated with dietary fiber that is intact and intrinsic in whole foods . The clinically proven health benefits for fiber supplements are associated with specific characteristics (eg, viscous gel), and only a minority of marketed fiber products provide health benefits (summarized in the table). As described in part 1 of this 2-part series, the health benefits associated with fiber effects in the small bowel (eg, cholesterol lowering, improved glycemic control) are a gel - dependent phenomenon, and the degree of benefit is proportional to the viscosity of the gelling fiber . As described in part 2 of this series, the health benefits associated with fiber effects in the large bowel (eg, relief from constipation, diarrhea, ibs) are derived from 2 mechanisms: an insoluble fiber provides a mechanical stimulus proportional to particle size (eg, wheat bran softens hard stool in constipation but can exacerbate diarrhea and ibs), whereas a soluble, nonfermented gel - forming fiber retains its high water - holding capacity throughout the large bowel to provide a stool normalizing effect (ie, psyllium softens hard stool in constipation, firms loose / liquid stool in diarrhea, normalizes stool form in ibs). When recommending a fiber supplement, only a soluble nonfermenting, gel - forming fiber has been clinically proven to provide all of the health benefits typically associated with a fiber supplement
|
For instance, in 1999, john chapin s laboratory at hahnemann university in philadelphia and my own laboratory at duke university collaborated in the first experimental demonstrations of a brain - machine interface in animals . In these experiments, rats learned to use the combined electrical activity of a handful of cortical neurons to move a robotic arm in order to obtain a water reward . Around the same time, niels birbaumer at the university of tbingen in germany reported how completely paralyzed patients learned to use brain - derived signals (recorded though a classic method known as electroencephalography, or eeg) to write messages on a computer screen . Even in its initial version, this brain - computer interface was the only way for these locked - in patients to communicate with the external world . It was an early indication of bmis significant potential as new rehabilitation tools . In subsequent years, further animal experiments with bmis indicated that monkeys could learn to employ the combined electrical activity of hundreds of their cortical neurons to move multiple degree - of - freedom robotic arms, entire humanoid robots, and even avatar limbs and bodies without the need for any overt movement of their own bodies . Soon, initial clinical studies also reported that patients could rely on bmis to control the movements of computer cursors and robotic arms . As the bmi field rose to the forefront of modern neuroscience, the possibility of establishing a bidirectional dialogue between brains and artificial devices was also realized . In 2011, through a technique called cortical electrical microstimulation, my laboratory was able to deliver simple tactile messages directly into the brains of monkeys . Every time one of our monkeys used its brain activity to move a virtual hand to scan the surface of a virtual sphere, a simple electrical wave, proportional to the virtual texture of the touched object, was immediately delivered to the animal s primary somatosensory cortex, an area known to be fundamental for the definition of one s tactile perceptions . After a few weeks of training, by taking advantage of this direct and continuous inflow of tactile information into their brains, a pair of monkeys became capable of discriminating the fine texture of the virtual objects by using their virtual hands, as if they were using their own biological fingertips . We called this new paradigm a brain - machine - brain interface (bmbi, figure 1). In 2009, as a direct result of this auspicious first decade of bmi research, the duke university center for neuroengineering and the edmond and lily safra international institute of neuroscience of natal (els - iinn, in brazil) jointly created a nonprofit research consortium called the walk again project . By the end of 2012, the walk again project received a grant from the brazilian government to assemble a large international research team of roboticists, neuroscientists, engineers, and computer scientists . This international team joined with a brazilian multidisciplinary rehabilitation team, composed of physicians, psychologists, and physical therapists, to take on a very ambitious project: designing and implementing the first bipedal robotic exoskeleton whose movements could be controlled directly by human - brain activity . The central goal of the first phase of project was to allow paraplegic patients suffering from severe spinal - cord lesions to use their eeg activity to control the exoskeleton s leg movements (figure 2) and, in so doing, regain lower - limb mobility . In addition to restoring basic locomotion behaviors, the exoskeleton would be the first in its class to provide continuous sensory feedback to the user in the form of artificial tactile and proprioceptive signals . In december 2013, a group of eight patients suffering from complete and incomplete spinal - cord lesions started the training process required for achieving proficiency in controlling a brain - controlled robotic exoskeleton . Four months later, all eight were capable of commanding the exoskeleton with their brain activity alone, and all had regained the sensation of walking in a laboratory setting . The feeling of walking again was even more realistic in these patients because of the addition of two innovative technologies in the design of our exoskeleton . The first was a new type of artificial tactile sensor known as artificial skin, developed by gordon cheng at the technical university munich . These sensors were distributed across key locations of the exo s legs and feet to detect the device s movements and contact with the ground . The second was an ingenious haptic display, created by hannes bleuler s laboratory at the cole polytechnique fdrale de lausanne (epfl) in switzerland, that allowed the tactile feedback signals generated by the arrays of the artificial sensors to be delivered to the skin of a patient s forearms . For the haptic display to work properly, patients had to wear a special shirt containing a linear array of small vibromechanical elements in the distal half of each sleeve while walking with the brain - controlled exoskeleton . To celebrate a major first step toward the development of a new generation of neuroprosthetic devices, one of our patients, juliano pinto, who is paralyzed from the mid - chest down, was invited to help our team demonstrate our exoskeleton s enormous potential before the opening match of the 2014 fifa world cup in brazil on june 12 . For the first time in history, a human subject showed that a brain - controlled exoskeleton could be used to initiate the kicking of a soccer ball . The demonstration was witnessed by 70,000 fans at the itaquero stadium and an estimated 1 billion people watching on tv . Seconds after executing this historic kick, juliano reported to us that he clearly felt his leg moving in the air during the moment at which the exo s foot made contact with the surface of the ball . According to juliano s perception, it was his own body, not the exo, that executed the kick . The effort and complexity required to pull off that world cup demonstration well exemplifies the current state of the art of bmis . Over the last 15 years, and although the case has been made that bmis offer concrete hope for the future development of a variety of new neurorehabilitation tools, we are still a few years away from being able to produce neuroprosthetic devices that patients can routinely use outside well - controlled laboratory conditions . Certainly, at this point, we are very far from the braincaps imagined by science - fiction writers like clarke . Despite the uncertainty, recent experiments combining bmis with cortical electrical microstimulation effectively open the doors for more daring adventures . Indeed, i could almost bet that clarke himself would have enjoyed the opportunity to be present when miguel pais - vieira, a portuguese postdoctoral fellow in my lab, demonstrated the operation of the first brain - to - brain interface designed to link two animals brains directly (figure 3). First proposed in my 2011 book beyond boundaries: the new neuroscience of connecting brains with machines and how it will change our lives, our brain - to - brain interface (btbi) paradigm, reported in 2013, allowed a pair of rats to transmit and receive rudimentary mental sensorimotor messages . In one of the published experiments, the first rat of the pair, known as the encoder, was trained to use its facial whiskers to determine the diameter of a computer - controlled aperture placed inside a behavioral box . From trial to trial, the aperture could assume two distinct diameters, classified as narrow (x mm) or wide (y mm). The encoder s job was to use its facial whiskers to correctly judge the aperture s diameter and then indicate its value by placing its snout in one of two holes located in a nearby chamber . If the encoder nose - poked in the hole corresponding to the correct aperture diameter, it received a water reward . As the encoder used its facial hair to evaluate the opening s diameter, electrical activity recorded from neurons located in its somatosensory cortex was combined and transmitted, via cortical electrical microstimulation, to the brain of a second rat, the decoder, located in a different behavioral box . The decoder had no access to an aperture, so its facial whiskers were useless in solving the task and getting water . Yet to receive such a reward, the decoder also had to indicate, by nose poking, the diameter of the aperture touched by the encoder . To do that, the decoder had to rely solely on the simple neural message being transmitted to its brain by electrical microstimulation . After a bit of training, decoder rats became capable of using our brain - to - brain interface to successfully perform this task way above chance level . This indicated that the brain of a decoder rat could make sense of the messages broadcasted by its associated encoder rat . Interestingly, since the encoder received an extra reward allotment every time a decoder was able to correctly indicate the aperture s diameter, encoder rats adapted their behavior and cortical activity to make it easier for their counterpart to complete the task, particularly after the latter committed a series of trial errors . That further suggested to us that these rat dyads had established a new form of communication, despite the fact that neither animal was aware of its counterpart s existence . As an extra proof of the effectiveness of this btbi, we repeated these tactile - discrimination experiments by using an encoder rat placed in a laboratory in the els - iinn, in natal, brazil, while the decoder rat performed its trick in my lab at duke university, in the u.s . Despite the distance and the use of an average internet connection, the brain - to - brain interface worked as well as it did when the two animals were in the same laboratory . In a final test of our btbi, decoder rats used neuronal signals provided by the motor cortex of encoder rats to choose which of two levers to press, without ever seeing the visual cues that instructed the encoders to make the same decision in the first place . In other words, the brain - to - brain connection between the encoder and decoder rats allowed the latter to correctly make a motor decision based on visual cues experienced only by its encoder partner . During the past year, two other laboratories published studies involving brain - to - brain architectures . Moreover, a press release from a group at the university of washington indicated that the group had established a functional link between human subjects brains by combining two noninvasive techniques: eeg to record brain activity in the first subject (encoder) and transcranial magnetic stimulation (tms) to deliver an eeg - triggered signal to the second subject s (decoder s) brain . Since the group has not yet published a full scientific report, it is difficult to evaluate what was really achieved . If anything, the limited description (and video clip) provided in the press release did not fully support the claim that a true functional communication between human brains occurred . This is because, essentially, the encoder s eeg activity was simply used to trigger a magnetic stimulus in the decoder s motor cortex . As expected, every time this magnetic stimulation was delivered, the decoder subject produced an involuntary body movement . Yet as such, i do not see how two brains shared a true message in this paradigm . On the other hand, the potential methodology for doing so was unveiled, and that was certainly enough to cause a significant media and public response . We are currently investigating what kinds of social behaviors and global patterns of neuronal activity emerge when groups of animal brains are allowed to collaborate directly, through the employment of different types of brain - to - brain interfaces . The central task of each of these animal brainets is to optimize the combination of neuronal activity, sampled from multiple brains simultaneously, into a supranervous system that is responsible for attaining a common behavioral goal, such as identifying a complex tactile pattern or moving an elaborate virtual limb . The results of these studies, which are currently under review for publication, mostly focus on how btbis can enhance social interactions between animals and whether brainets could operate as a new type of computational architecture, like some sort of non - turing biological computer . In addition, these experimental paradigms allow one to study whether, in a still - distant future, artificial interfaces like these may be used to functionally reconnect brain areas where communication may have been disrupted by brain damage, such as that produced by strokes or other neurological disorders . Right now however, seeking such a path has become a hallmark of our laboratory during the past decade . During this period, we have successfully translated similarly abstract basic - science ideas into potential new therapies for untreatable epilepsy, parkinson s disease, and disabling paralysis . All of these therapies are currently undergoing clinical testing worldwide . As exciting as these animal research projects are, none of them come close to competing with the fictional wonders of clarke s braincaps ., nobody would ever consider it ethically or medically acceptable to implant nanotubes or other types of electrodes in healthy human subjects for the purpose of testing a btbi, as suggested by clarke . But even if, years or decades from now, better noninvasive technology enables us to record large - scale brain activity in real - time, at the millisecond scale, and then another efficient, noninvasive method might be used to deliver brain - derived messages to another human brain, it is highly unlikely that such a btbi would lead to the emergence of a fluid and efficient form of human communication, as long as we rely on digital computers to mediate this task . Nor do i believe that there will be a day in which braincap - like technologies will allow us to upload vast and complex information packets like a new language or a large amount of scientific knowledge, as clarke describes in his book into our brains, or to download all our memories or personal experiences into some sort of digital storage media . Apart from tasks such as motor control for which bmis can become very useful, mimicking higher - order brain functions, such as knowledge acquisition, memory storage, performance of cognitive tasks, and even consciousness, may be beyond the reach of binary logic, the basis from which all digital computers operate, no matter how simple or elaborate . An interesting corollary of this view is that we need not worry about the forecast that, in the near future, a really smart digital computer / machine will supplant human nature or intelligence . In all likelihood, this day will never come because, in a more - than - convenient arrangement, our most intimate neural riddles seem to have been properly copyright - protected by the very evolutionary history that generated our brains, as well as the very complex emergent properties that make it tick . As such, neither evolution nor neurobiological complexity can be effectively simulated by digital computers and their limited logic . In the end, this may not be so bad . Like commander poole, as much as i would love to take advantage of a brand - new braincap minus the nanotubes to learn a few new intellectual tricks in a hurry, from the perspective of someone living in the early 21st century (not the 31st), it is very difficult to imagine that any of us at this juncture in our history would, in good faith, feel comfortable in surrendering our final frontier of individual privacy, knowing that there is a chance, no matter how insignificant it may be, that an uninvited snoop may, nevertheless, want to take a peek.
|
With the availability of newer and smaller endoscopes, the utilization of endoscopy to diagnose gastrointestinal disorders in children is increasing . Pediatric upper gastrointestinal endoscopy (ugie) can be completed without sedation, by using intravenous sedation, or with general anesthesia [14]. Various medication combinations have been used for pediatric sedation, including intravenous ketamine, propofol, midazolam, fentanyl, and pethidine . The goals of sedation are to ensure patient safety, provide analgesia and amnesia, control behavior during the procedure, enable successful completion of the procedure, and quickly return the patient to pretreatment level of consciousness . In a developing country like thailand, pediatric ugie in addition, in provincial or community hospitals, general anesthesia in the main operating room remains the sedation plan of choice for pediatric ugie . At siriraj hospital, a world gastroenterology organization (wgo) endoscopy training center, there is a dedicated gastrointestinal endoscopy unit and dedicated anesthesiology service for the unit . Over the years, we have observed a change in the trend of sedation for pediatric ugie towards intravenous sedation (ivs) technique [57]. This study, therefore, is done to review our sedation practice and to evaluate the clinical effectiveness of an anesthesiologist - administered intravenous sedation outside of the main operating room for pediatric upper gastrointestinal endoscopy in thailand . This retrospective study was approved by the institutional review board of the faculty of medicine siriraj hospital, mahidol university . All pediatric patients scheduled for ugie procedures consecutively from march 2006 to october 2009 at the wgo endoscopy training center in siriraj hospital were included . Due to hospital policy, all children undergoing gie were admitted prior to the procedure . Exclusion criteria were the patients who had hemodynamic instabilities and the patients who needed endotracheal intubation . All sedations for ugie were clinically titrated to either moderate or deep sedation as defined according to american academy of pediatrics and american academy of pediatric dentistry . For all patients who underwent ivs, cardiovascular monitoring included continuous electrocardiogram, heart rate, oxygen saturation measurements and five - minute interval noninvasive blood pressure measurements from blood pressure cuff device . Ventilation monitoring included continuous respiratory rate measurements and interval observation of patterns of respiration, chest movement, and signs and symptoms of airway obstruction . End - tidal carbon dioxide (co2) monitoring with capnography or precordial stethoscope was not used during sedation . The following data was obtained: age, gender, weight, asa physical status, indications, presedation problems, successful completion of the procedure, sedation time, type of intervention, and sedative agents . The presedation problems were defined as the underlying diseases such as cardiovascular disease, hematologic disease and liver disease . The effectiveness of intravenous sedation was defined as successful completion of the procedure at the target sedation level as intended . Complications were recorded including: hypotension (defined as a decrease of blood pressure by 20% from baseline and below normal for age), hypertension (defined as an increase of blood pressure by 20% from baseline and above normal for age), bradycardia (defined as a decrease in heart rate by 30% from baseline and below normal for age), and hypoxia (defined as oxygen desaturation with spo2 <90%). Serious complication is any adverse event not easily treated or managed with medication and/or maintenance of the patient's airway resulting in endotracheal intubation including apnea and/or laryngospasm . Comparison of adverse events by asa physical status or different medication groups was done by using student t - test ., chicago, il) was used to analyze the data . A significance level of 5% during the study period, a total of 168 patients (94 boys and 74 girls), with age ranging from 4 months to 12 years, underwent 176 gie procedures with ivs . Of these, 26 ugie procedures were performed with general anesthesia (ga), and 142 ugie procedures were performed with intravenous sedation (ivs) and reviewed . All sedation was given by a staff anesthesiologist or the anesthetic personnel directly supervised by a staff anesthesiologist physically present in the endoscopy room . Anesthetic personnel included second - year residents in the anesthesiology residency program and anesthetic nurses who are well - trained in general anesthesia, intravenous sedation, airway management including intubation, and cardiopulmonary resuscitation . The equipment used for the procedures included appropriate standard pediatric endoscopes, depending on patient age and size . Patient characteristics, duration of sedation, indication of procedure, and the type of interventions are listed in table 1 . Hematologic disease, mild to moderate anemia (40.1%), liver disease, cirrhosis, portal hypertension (37.9%), and electrolyte imbalances, hypo / hyperkalemia and/or hyponatremia (12.4%) were the most common presedation problems . A total of 142 procedures, anesthesiology residents involved in 74 procedures (52.1%), and anesthetic nurses involved in 68 procedures (47.9%). Propofol was the most common sedative drugs used in all age and asa physical status groups . Mean dose of propofol (mg / kg) used in all age groups was significantly different (p = .032). However, mean dose of propofol (mg / kg) used in both asa physical groups was not significantly different (p = .365). Additionally, mean dose of fentanyl (mcg / kg), midazolam (mg / kg) and ketamine (mg / kg) in all age and asa physical status groups was not significantly different . However, the number of fentanyl used in the 02.99 years - old group (60.0%) was relatively lower than in the other groups (86.5% and 87.5%). Nevertheless, the number of ketamine used in the 02.99 years - old group (75.0%) was significantly higher than in the other groups (39.2% and 16.7%). According to asa physical status, there were no significant differences in the number of propofol, fentanyl, midazolam and ketamine used . After the patient's status had improved, the procedure was completed with ga . Respiratory complications with hypoxia occurred in seven patients (4.9%), and upper airway obstruction occurred in six patients (4.2%). Cardiovascular complications arose in 23 patients (16.2%) and mainly consisted of hypotension (14 patients) and bradycardia (9 patients). If only serious complications are included, the complication rate is none . All complications were easily treated and managed with medication and/or maintenance of the patient's airway by the staff anesthesiologist or anesthetic personnel under direct supervision of a staff anesthesiologist who was physically present in the room . There was no difference in the incidence of complications when sedated by trainees, anesthetic nurses, or anesthesiologist . The overall complications in children who had asa physical status i - ii as compared to asa physical status iii - iv were not significantly different (p = .202). In addition, one patient in asa physical status i - ii and one patient in asa physical status iii - iv developed hypoxia and hypotension . Two patients in asa physical status i - ii and one patient in asa physical status iii - iv developed upper airway obstruction and bradycardia . The emergence reactions or hallucinations, increased salivation or laryngospasm were not seen in patients receiving ketamine as part of ivs . This retrospective study demonstrates the clinical effectiveness of an anesthesiologist - administered intravenous sedation outside of the main operating room for pediatric upper gastrointestinal endoscopy in a developing country . Ivs for pediatric ugie procedure in children 12 years of age and younger is challenge and requires an experienced anesthesiologist as well as appropriate monitoring . Anesthetic personnel should remind themselves to use more sensitive equipments to detect potential complication such as end tidal co2 and carefully select more appropriate patients . Ugie procedure in children is an important and effective tool for the diagnosis and treatment of upper digestive tract diseases . The indications for upper endoscopy in the pediatric age group are similar to those for adult endoscopy . These procedures are generally performed either with ivs in the endoscopy room, or under ga in the operating room . The decision to use ga is usually based on the patients' parameters such as age, diagnosis, respiratory compromise and severity of disease . In some centers, ga is used on all infants, children and adolescents [3, 10, 11]. However, in other centers, ivs is used for the procedures . With ivs, several medication combinations have been used successfully [9, 1215]. In a developing country where pediatric ugie performed at increasing rates, the majority of cases are performed under general anesthesia in the operating room (or). At siriraj hospital, there is a dedicated endoscopy unit with dedicated anesthesia service . Over the last two years, 2006 to 2008, we performed most pediatric ugie with ivs [57]. We followed the guidelines provided by the american academy of pediatrics and american academy of pediatric dentistry and asa standards for sedation providers [4, 16]. Our previous reviews of ivs practice in pediatric population showed that it can be done safely with various sedative combinations with proper monitoring and anesthesiology service supervision . Its use in pediatric population has been shown to be safe, effective and reliable [1015]. In thailand, propofol is the most common agent used in combination with midazolam and fentanyl in this study . Additionally, we did not observe hemodynamic instability, emergence reactions, hallucinations, increased salivation or laryngospasm with the use of ketamine combining regimen . Cardiopulmonary complications account for more than half of the major complications during endoscopy, and are often related to hypoxia, especially in children less than 1 year old [20, 21]. In our study, the overall adverse event was relatively high (25.4%). Cardiovascular complications accounted for the majority (16.2%) followed by respiratory complications (9.2%). However, all complications were transient and easily treated with no adverse sequelae . Many previous studies involving the use of propofol and other combination sedative drugs have reported slightly higher adverse events [2224]. In our study, there was significant difference in the mean dose of propofol between the three aged groups . In a study by barbi and colleagues, major desaturation was noted in 0.7% of all the children, and transient desaturation that resolved sponstaneously occurred in 12% of all the procedures . Additionally, the study by yildizda et al . Demonstrated that the use of propofol and midazolam / fentanyl in 126 children had 16.6% incidence of respiratory depression as shown by high end - tidal carbon dioxide (> 50 mmhg). The high incidence of respiratory depression reflected the better detection of respiratory depression by the use of end - tidal carbon dioxide . In our study, complication rate is comparable to studies that did not use end - tidal carbon dioxide monitoring [22, 24]. Asa physical status iii - iv has been shown to be a predictor of increased risk for sedation - related complications . Several publications described the use of propofol for sedation by physicians or providers other than anesthesiologists [2427]. Consequently, there was a difference in outcomes once nonanesthesiologists use propofol . When a dedicated pediatric sedation team involving an anesthesiologist was utilized, the reported successful sedation rates were 100%, and adverse events ranged from 1.7 to 5% . A high success rate in our study is due to the procedure is performed by an experienced endoscopist and is sedated by an experienced anesthesiologist . Consequently, our center had a dedicated anesthesia service involved with sedation and the use of basic noninvasive monitoring, which includes noninvasive blood pressure monitoring, pulse oximetry, and electrocardiogram . Additionally, the safe and successful sedation is also dependent on proper preparation, evaluation, monitoring, and appropriate skills to rescue the patient, and proper recovery . This is a retrospective paper of a cohort of patients undergoing pediatric ugie with ivs . We accept that there are limitations with chart review in regards to proper and complete documentation . We also realized that with this review, the study is reflected in the variety of regimen and sedative drugs used for ivs . Therefore, the drug requirement, drug doses, and side effects varied as well . According to the design of study, we defined an alteration of blood pressure by 20% from baseline, and a decrease in heart rate by 30% from baseline as the complication . Overall, even with these limitations, we believe that the study findings are applicable to the sedation practice and to remind the physicians for sedation the pediatric patients for ugie procedures . In summary, this study shows the clinical effectiveness of an anesthesiologist - administered intravenous sedation outside of the main operating room for pediatric upper gastrointestinal endoscopy in a developing country . We also recommend the use of more sensitive equipments to detect potential complication such as end tidal co2 and carefully select more appropriate patients for pediatric ugie.
|
The multi - factorial etiology of the disease necessitates the evaluation and combination of multiple factors.1 although past caries experience has been recognized as the best single caries predictor, other factors must be assessed, especially in children who have not yet developed clinical signs of the disease.2 in very young children, several single caries risk factors have been studied . The highest accuracy (92%) was reported for the presence of upper labial plaque3 followed by mutans streptococci (ms) levels (75%).4 the combination of salivary ms and the presence of white - spot lesions has shown a prediction accuracy of 80%.5 high predictive values in preschool children have been demonstrated in statistical models when several factors, such as ms levels, sugar consumption, salivary parameters, parental background, and maternal education, have been included.6,7 the drawback of such models is, however, the difficulty of their application in routine clinical settings . Several organizations have incorporated the evidence from the literature into daily dental practice by constructing caries risk assessment models for different age groups . However, these models do not normally provide a grading scale and do not disclose the weight and importance of each caries risk factor . The cariogram is a simple and handy tool for caries risk assessment.8 this computerized program considers the interaction of ten different caries risk factors, assesses the risk for new carious lesion development within the next 12 months and graphically presents the caries risk profile of an individual . In prospective trials, the cariogram has been satisfactorily validated in teenagers9 and adults,10 although it was found to be less useful in younger schoolchildren11 and preschool children.12,13 in cross - sectional studies, the cariogram has been used to explore the caries risk profiles of adults,10,14 young adults,15,16 teenagers9,17,18 and schoolchildren.19 in only one previous cross - sectional study, the cariogram was used for 2-year - old children.20 as that study group was limited in size, it was of interest to further investigate the cariogram concept in a broader preschool setting . The aim of this study was therefore to assess the caries risk profiles in 2- to 6-year - old greek children with the aid of cariogram software and to evaluate the contribution of various risk factors among preschool children of different ages . The study group consisted of 2- to 6-year - old children attending public day care centers and kindergartens in the athens metropolitan area . The mean age of the children was 54 months, ranging between 24 and 72 months . The study included children i) who were born in greece, ii) who were cooperative for oral clinical examination, iii) who had not taken antibiotics for 15 days prior to the examination, and iv) whose parents had returned their written informed consent and a completed questionnaire . Among the 936 children who were initially eligible, 814 fulfilled the inclusion criteria and were included in the study . No dental care was routinely offered to these children, and there was no water fluoridation in this area . This was a cross - sectional study, and the protocol was approved by the ethics committee of the school of dentistry, university of athens . A letter explaining the procedures, a consent form, and a questionnaire were sent to the parents . The questionnaire consisted of closed - type questions regarding the family, demographic and socioeconomic factors, general health, oral hygiene and dietary behaviour of the child . Parents with an immigrant background and a language barrier were assisted by the child s teacher when filling out the forms . The oral examination was performed in the classroom by three calibrated examiners, under a light source, using a dental mirror and a probe . The level of oral hygiene was estimated with the visible plaque index (vpi), and the percentage of tooth surfaces with plaque was calculated for each child . Caries was recorded as cavity in the dentin and/or enamel according to who criteria21 after visual inspection of the smooth surfaces and visual and tactile inspection of the pits and fissures . Missing teeth were scored only if it was verified that the loss was due to caries . The presence of white spot lesions (wsl), chalky white spots with unbroken surfaces, was recorded separately . No radiographs were taken . To assess the degree of inter - examiner agreement, 20 children were examined by each of the 3 examiners on the same day . The degree of intra - examiner agreement was established through an examination of 20 children by each examiner, and the procedure was repeated after 4 weeks . The mean inter - examiner and intra - examiner kappa values were k=0.89 and k=0.86, respectively . Mutans streptococci levels were estimated by sampling the upper anterior teeth with a cotton swab according to the protocol proposed by twetman and grindefjord.22 the swab was rolled on a dentocult sm strip (orion diagnostica, helsinki, finland) and incubated at 37c for 48 hours . The readings were performed by a single examiner, and 30 strips were reassessed after 15 days storage at 4c . Buffer capacity was categorized as high / medium or low using a dentobuff strip (orion diagnostica). Unstimulated saliva was collected from the floor of the mouth with a pipette and placed on the strip; the color changes were registered after 5 minutes . The intra - examiner reliability was k=0.87 for the buffer test and k=0.82 for the ms test . The scored data from the clinical examinations and the questionnaire were entered in the cariogram software . The chance to avoid caries over the next 12 months salivary secretion rate was omitted as a variable, because it was considered difficult to adequately determine the stimulated saliva flow in this age group . Moreover, the scores described in the cariogram manual for adults were modified to fit the present age group, as shown in table 1 . For example, previous caries experience was scored in only two groups: those having caries and those who were caries free . Any existing systemic disease was taken into consideration only if it directly or indirectly influenced the caries process (asthma, diabetes, heart problems). The content of unfavorable carbohydrates in the diet (muffins, cookies, chocolate, honey, marmalade, juice, candies, beverages and sweetened yogurt) was extracted from the questionnaire . The diet frequency was modified by merging two categories into one and taking the frequency of 45 meals / day as normal for the age group . Medium and high buffer capacity scores were incorporated into one group . In the clinical judgment section of the cariogram was finally grouped in three levels: low chance 0%20% (high caries risk), moderate chance 21%60% (moderate caries risk), and high chance 61%100% (low caries risk). All data were processed by stata software (stata 9, stata corp lp, texas, usa). In addition to descriptive statistics, multivariate regression analysis was used to associate the cariogram variables with caries risk . The study group consisted of 2- to 6-year - old children attending public day care centers and kindergartens in the athens metropolitan area . The mean age of the children was 54 months, ranging between 24 and 72 months . The study included children i) who were born in greece, ii) who were cooperative for oral clinical examination, iii) who had not taken antibiotics for 15 days prior to the examination, and iv) whose parents had returned their written informed consent and a completed questionnaire . Among the 936 children who were initially eligible, 814 fulfilled the inclusion criteria and were included in the study . No dental care was routinely offered to these children, and there was no water fluoridation in this area . This was a cross - sectional study, and the protocol was approved by the ethics committee of the school of dentistry, university of athens . A letter explaining the procedures, a consent form, and a questionnaire were sent to the parents . The questionnaire consisted of closed - type questions regarding the family, demographic and socioeconomic factors, general health, oral hygiene and dietary behaviour of the child . Parents with an immigrant background and a language barrier were assisted by the child s teacher when filling out the forms . The oral examination was performed in the classroom by three calibrated examiners, under a light source, using a dental mirror and a probe . The level of oral hygiene was estimated with the visible plaque index (vpi), and the percentage of tooth surfaces with plaque was calculated for each child . Caries was recorded as cavity in the dentin and/or enamel according to who criteria21 after visual inspection of the smooth surfaces and visual and tactile inspection of the pits and fissures . Missing teeth were scored only if it was verified that the loss was due to caries . The presence of white spot lesions (wsl), chalky white spots with unbroken surfaces, was recorded separately . No radiographs were taken . To assess the degree of inter - examiner agreement, 20 children were examined by each of the 3 examiners on the same day . The degree of intra - examiner agreement was established through an examination of 20 children by each examiner, and the procedure was repeated after 4 weeks . The mean inter - examiner and intra - examiner kappa values were k=0.89 and k=0.86, respectively . Mutans streptococci levels were estimated by sampling the upper anterior teeth with a cotton swab according to the protocol proposed by twetman and grindefjord.22 the swab was rolled on a dentocult sm strip (orion diagnostica, helsinki, finland) and incubated at 37c for 48 hours . The readings were performed by a single examiner, and 30 strips were reassessed after 15 days storage at 4c . Buffer capacity was categorized as high / medium or low using a dentobuff strip (orion diagnostica). Unstimulated saliva was collected from the floor of the mouth with a pipette and placed on the strip; the color changes were registered after 5 minutes . The intra - examiner reliability was k=0.87 for the buffer test and k=0.82 for the ms test . The scored data from the clinical examinations and the questionnaire were entered in the cariogram software . The chance to avoid caries over the next 12 months salivary secretion rate was omitted as a variable, because it was considered difficult to adequately determine the stimulated saliva flow in this age group . Moreover, the scores described in the cariogram manual for adults were modified to fit the present age group, as shown in table 1 . For example, previous caries experience was scored in only two groups: those having caries and those who were caries free . Any existing systemic disease was taken into consideration only if it directly or indirectly influenced the caries process (asthma, diabetes, heart problems). The content of unfavorable carbohydrates in the diet (muffins, cookies, chocolate, honey, marmalade, juice, candies, beverages and sweetened yogurt) was extracted from the questionnaire . The diet frequency was modified by merging two categories into one and taking the frequency of 45 meals / day as normal for the age group . Medium and high buffer capacity scores were incorporated into one group . In the clinical judgment section of the cariogram was finally grouped in three levels: low chance 0%20% (high caries risk), moderate chance 21%60% (moderate caries risk), and high chance 61%100% (low caries risk). All data were processed by stata software (stata 9, stata corp lp, texas, usa). In addition to descriptive statistics, multivariate regression analysis was used to associate the cariogram variables with caries risk . Descriptive data for the total material and the different age groups are presented in table 1 . The caries prevalence for all children was 30%, increasing from 13% in the youngest age group to 43% among the 5- to 6-year - olds . Non - cavitated initial lesions (wsl) were recorded in 26% of the children . The vast majority (83%) reported unfavorable dietary habits (3 intakes of sweets per day); this figure was fairly stable in the different age groups . The questionnaire revealed that 62% of the 2- to 3-year - old children were exposed to systemic or topical fluoride; this value increased to 96% among the 5- to 6-year - old children . Less than satisfactory oral hygiene was recorded in 67% of all children and 23% displayed poor oral hygiene . The saliva tests showed that less than 17% had moderate or high counts of mutans streptococci and that 26% displayed impaired buffer capacity . The cariogram profiles showed that 26%, 65% and 9% of all children were assessed with high, moderate and low caries risk, respectively . To explore which of the cariogram variables best explained the caries risk levels, multivariate linear regression analysis models were calculated for the total study group (table 3) and for the different age groups . For the total sample, the most significant risk variables were insufficient fluoride exposure and the presence of white - spot lesions, followed by the previous caries experience . When regression analysis was performed for the different age groups, the most significant variable for the 2- to 3-year - olds was insufficient fluoride exposure (r=0.93, = 0.31, p<.001). For the 3- to 4-year - olds, the presence of dental plaque (r=0.91, = 0.71, p<.001) was most prominent, while for the 4- to 5- (r=0.89, = 0.163, p<.001) and 5- to 6-year - olds (r=0.91, =0.2, p<.001), the presence of white - spot lesions showed the strongest association . The present study was undertaken to gain information about the caries risk profiles of 2-to 6-year - old greek children . The cariogram is based on the interpretation of data from numerous clinical studies on adults.23 consequently, the scoring of some of the present variables was modified to fit this young age group . Two previous studies have used the cariogram in preschool children,12,13 one of which used modified variables.12 the accounting for age is most likely a key factor explaining the validity of the cariogram as a predictive tool in caries risk assessment models . The clinical examinations and scoring procedures displayed high inter- and intra - examiner agreements; the results should therefore be regarded as reliable . Whether the data from the questionnaires reflect the full truth may, however, always be debated . The large size of the present study group allowed sub - grouping with respect to age, which provided some novel and interesting information . The main results showed that 26% of the total sample had a high risk of developing caries within the coming year . In the youngest age group, the proportion of high - risk children was even higher (36%) but still somewhat lower than previously reported among swedish 2-year - olds.20 the present study was, however, the first to apply multivariate regression analysis to explore the various cariogram variables in preschool children, although a similar model was previously used for young adults.15 the regression model explained 88% of the risk variability, and an apparent age - dependent shift in the results was demonstrated . The strongest caries risk variable for the 2- to 3-year - olds was insufficient fluoride exposure, whereas neglected oral hygiene was most marked for children between 3 and 4 years old . Thus, emphasizing daily supervised tooth brushing with fluoridated toothpaste is of paramount importance for the youngest individuals residing in a non - fluoridated area and without access to regular dental care . The best form of delivering fluoride to this age group is through self - applied toothpaste and professional topical applications.24,25 the finding that previous caries experience and the presence of white - spot lesions were strong markers of caries risk, especially for children over 4 years old, was in agreement with conclusions from previous studies and systematic reviews.1,4,26 thus, parental education on detecting wsl and seeking early preventive dental care in young children is likely an important measure to prevent and control caries.27 furthermore, a review by thenisch et al suggested that the level of salivary mutans streptococci is a strong risk factor for caries.28 a recent study has also shown that the quantification of mutans streptococci levels is the most important salivary variable in cariogram predictions.29 interestingly, buffer capacity was a significant caries risk determinant in all of the models except for those applied to the 3- to 4-year - old children . The role of buffer capacity in young children remains to be comprehensively characterised.6 because the association with caries is subject to doubt, the buffer capacity of saliva is not considered as a sole accurate diagnostic method for caries detection in young children.30 the diet content of fermentable carbohydrates has not previously been applied in cariograms performed among preschool children . The frequency of carbohydrate - containing meals is generally considered an important factor for caries risk, but in this analysis, the dietary content of sugar was not among the primary caries risk variables . Several previous studies have demonstrated a correlation between the consumption of fermentable carbohydrates and caries, especially in the absence of oral hygiene and fluoride use.31 although there is no general consensus on a safe amount of cariogenic food intake,32 the frequent consumption of fermentable carbohydrates has been associated with high mutans streptococci levels33 in preschool children, as well as with high caries risk.4,26 a high level of carbohydrate consumption is deleterious not only for oral health but also for the general health of the individual, because of the risk that unhealthy dietary habits will persist throughout adulthood.34 the present study will form the basis for a suitable preventive program to be implemented for greek children early in life . The findings suggest that the preventive program should be focused on the regular use of fluoridated toothpaste and professional fluoride varnish applications rather than extensive dietary counselling . Furthermore, parental detection of white - spot lesions as well as regular check - ups and treatment should be strongly encouraged . High caries risk was found for 26% of the children examined, whereas 9% exhibited low caries risk . The most significant caries risk variables were insufficient fluoride exposure and the presence of white - spot lesions . Insufficient fluoride exposure had the strongest impact for the 2- to 3-year - old children, while impaired oral hygiene had the strongest impact for those aged 34 years, and the presence of white - spot lesions was most important among children over 4 years old.
|
Cdnas containing the sequence of human wt - ftl and human mutant ftl498499instc were introduced into the pet-28a(+) expression vector (novagen, emd chemicals inc . ). The cdnas were cloned between the bamhi and xhoi sites, downstream from and in - frame with the sequence encoding an n - terminal his6 tag . To eliminate the his6 tag (included in the expression vector), the sequence of the vector was modified by introducing the recognition sequence for cleavage by factor xa before the coding sequence of the ferritin genes . Pcr amplification of the ferritin cdnas was performed using the upstream primer f1 5-tgg atc cat cga agg tcg tat gag ctc cca gat t-3 and the downstream primer r1 5-tta tgc ctc gag ccc tat tac ttt gca agg-3. F1 contains the factor xa sequence (underlined). Pet-28a(+) carrying wt - ftl and mt - ftl cdnas was transformed into bl21 (de3) escherichia coli (invitrogen). Transformed cells were grown in luria broth medium (lb) containing 30 g / ml kanamycin (invitrogen) at 37 c up to an absorbance of 0.91.0 at 600 nm . Bacteria were induced to overexpress recombinant proteins by adding 1 mm isopropyl thio--d - galactopyranoside (icn biotechnologies) for 12 h at 25 c . Purification of recombinant wt- and mt - ftl homopolymers cells were harvested by centrifugation and frozen at -80 c . The cell pellets were suspended in 50 mm sodium phosphate, 500 mm nacl (ph 7.4), 1 mg / ml lysozyme, and a protease inhibitor mixture (complete, roche applied science) for 30 min . Bacteria were disrupted by sonication, and the insoluble material was removed by centrifugation at 21,000 g for 30 min . The soluble fraction was purified by nickel iminodiacetic acid affinity chromatography using an akta purifier system (ge healthcare). Purified protein was eluted with 250 mm imidazole in 50 mm sodium phosphate (ph 7.4), 0.5 m nacl . Recombinant proteins were diluted with 50 mm tris and 10% glycerol (v / v) down to an absorbance of 0.5 at 280 nm, and ferritins were cleaved from the his tag by digestion with factor xa protease (ge healthcare) (5 units / mg of protein). After being dialyzed against 50 mm tris, ph 8.0, for 18 h, proteins were further purified by anion exchange chromatography (mono q) using a linear nacl elution gradient in 50 mm tris (ph 8). Peak fractions were 95% pure based on sds-12% page (pierce) and coomassie blue staining . The efficiency of tag removal was confirmed by n - terminal protein sequencing analysis, and the molecular weight of the recombinant proteins was determined by matrix - assisted laser desorption / ionization - time of flight mass spectrometry . Protein concentration was determined using the bca reagent (pierce) with bovine serum albumin as standard . Gel filtration chromatography size exclusion chromatography was performed on a superose 6 10/300 gl column (ge healthcare) equilibrated with 50 mm tris, 150 mm nacl (ph 7.4) using an akta purifier . The column was calibrated with gel filtration standards (ge healthcare). Fractions were detected photometrically, and peak areas and kav values were evaluated using the unicorn 5.1 software (ge healthcare). Transmission electron microscopy (tem)ferritins were fixed using the single droplet parafilm protocol . The specimens were dropped onto a 400-mesh carbon / formvar - coated grid (nanoprobes) and allowed to absorb to the formvar for a minimum of 1 min . Excess fluid was removed using filter paper, and the unbound protein was washed, and the grids were placed on a 50-l drop of nanovan (nanoprobes) with the section side downwards . Finally, the grids were dried, placed in the grid chamber, and stored in desiccators before the samples were observed with a tecnai g2 12 bio twin (fei) transmission electron microscope . Preparation of apoferritins recombinant ftl homopolymers were treated for iron removal as described previously (14). Briefly, recombinant ferritins were incubated with 1% thioglycolic acid (ph 5.5) and 2,2-bipyridine, followed by dialysis against 0.1 m phosphate buffer (ph 7.4). We consistently achieve less than five atoms of iron per ferritin 24-mer, as determined by the colorimetric ferrozine - based assay for the quantitation of iron (15). Iron loading of apoferritins freshly prepared ferrous ammonium sulfate (0.54.5 mm) in 10 mm hcl was added to mt- and wt - ftl apoferritin homopolymers (1 m) in 0.1 m hepes buffer (ph 7.4) at room temperature (16). After 2 h, the samples were centrifuged at 14,000 g for 15 min . Iron incorporation was initially monitored by measuring absorbance of the supernatants at 310 nm (14, 17). Iron incorporation into ferritin was more precisely determined by densitometric analysis of prussian blue staining of supernatants run on nondenaturing gel electrophoresis . Apoferritins were also incubated in a molar ratio 1:3500 with ferrous ammonium sulfate and centrifuged at 14,000 g for 15 min . Pellets were resuspended in a solution containing 6 mm deferroxamine (dfx), 0.1 m hepes (ph 7.4) and incubated for 2 h at 24 c . Cd spectra of recombinant apoferritin homopolymers were obtained in 50 mm phosphate buffer (ph 7.4) at 25 c in a jasco 810 spectropolarimeter (jasco corp . ), using a protein concentration of 0.12 and 1.5 m for far - uv and near - uv, respectively . Far - uv cd spectra were recorded in a 1.0-mm path length cell from 250 to 190 nm with a step size of 0.1 nm and a bandwidth of 1.0 nm . Cd spectra of the buffer / cuvette were recorded and subtracted from the protein spectra before averaging . Secondary structure analyses were performed using dichroweb (18, 19), which allows secondary structure analyses via the software package cdpro (20). Selcon3 (21), continll (22), and cdsstr (23) programs were used for comparing variations in the amount of secondary structure between mt- and wt - ftl homopolymers . Normalized root mean square deviation values of <0.1 for the three methods meant that the experimental and simulated spectra were in close agreement . Near - uv cd spectra were recorded in a 1.0-cm path length cell from 400 to 250 nm with a step size of 1.0 nm and a bandwidth of 1.5 nm . For all spectra intrinsic protein fluorescence and thermal stability studies of homopolymers fluorescence spectra were recorded using a spectrofluorimeter (perkinelmer life sciences) equipped with a selecta ultraterm water bath for temperature control . Apoferritin spectra were obtained with excitation at 280 and 295 nm with 1.5 m protein in 1-cm path length cells and with 0.1 m phosphate (ph 7.4). Thermal denaturation was induced by increasing the temperature from 20 to 100 c at a rate of 1 c / min . To overcome the inherent difficulty in denaturing ferritin, these experiments were performed in 0.1 m phosphate buffer (ph 7.4) containing 4.0 m guanidine hydrochloride (gdnhcl). Homopolymer stability was monitored using the ratio of intrinsic fluorescence emission of 355 over 330 nm with excitation at 295 nm (24, 25) with a maximum at 330 nm signifying native ferritin (mt and wt) and 355 nm, denatured ferritin . Extrinsic fluorescence spectra were recorded using a spectrofluorimeter (perkinelmer life sciences) in 1.0-cm cuvettes at 25 c . Ans binding to apoferritin homopolymers was monitored through fluorescence enhancement with ans excitation at 360 nm and emission recorded from 600 to 400 nm . Mt - ftl apoferritins were prepared by diluting stock solutions to 1.5 m in 0.05 m phosphate buffer (ph 7.4). Stock solutions of ans (invitrogen) were prepared in water, and the concentration was determined optically at 350 nm using an extinction coefficient of 4950 m cm . Ans was added to the diluted ferritin samples and equilibrated for 30 min prior to the measurements, and spectra were background corrected . Binding of ans to ferritin was quantitated by scatchard analysis (26). Thermolysin treatment of wt- and mt - ftl apoferritin homopolymers proteolysis of recombinant mt- and wt - ftl homopolymers was initiated by adding to 10 g of ferritin a 10-fold concentrated stock solution (36.5 units / mg) of thermolysin (fluka) in hepes (0.1 m) (ph 7.0), 10 mm cacl2 to a final concentration of 0.2 mg / ml . The reaction was stopped by the addition of edta (50 mm) and laemmli sample buffer . Samples treated with thermolysin and controls without thermolysin were boiled and loaded onto sds - polyacrylamide gels (420%) (pierce). Gels were stained with coomassie blue (total protein) or blotted against the c - terminal antibodies (mt-1283 or wt-1278) (9) or against the n - terminal antibody d18 (santa cruz biotechnology, inc), which recognized both polypeptides . Astrocyte cell cultures and iron / chelator treatment primary cortical astrocyte cultures were prepared from 1-day - old mouse pups according to the procedures of saneto and de vellis (27) and cassina et al . Pups were obtained from transgenic dams homozygous for the ftl498499instc mutation in c57bl/6j genetic background (29). Briefly, cerebral cortices were removed, and the tissue was minced and dissociated in 0.25% trypsin (invitrogen) for 15 min at 37 c . Cells were collected by centrifugation and plated at a density of 2.0 10 cells in 25-cm flasks (corning glass) in dulbecco's modified eagle's medium supplemented with 10% fetal bovine serum, hepes (25 mm), penicillin (100 iu / ml), and streptomycin (100 g / ml) (invitrogen). When confluent, cultures were shaken for 48 h at 250 rpm at 37 c, incubated for another 48 h with 10 m cytosine arabinoside, and then amplified to 2.5 10 cells / cm in 75-cm flasks (corning glass). The astrocyte monolayers were> 98% pure as determined by gfap immunoreactivity . Confluent astrocyte monolayers were changed to dulbecco's modified eagle's media devoid of serum prior to treatment . Stock solutions (20 mm) of ferric ammonium citrate (fac) (sigma), and 1,10-phenanthroline (phen) (sigma) were prepared in distilled water and directly applied to the monolayer at the indicated final concentrations . Each flask was treated with either of the following: (a) vehicle (water) as control group; (b) phen at 100 m during 48 h followed by 24 h at 50 m;(c) fac 50 m during 4 days; (d) fac treatment as in c followed by phen treatment as in b in the absence of iron . Characterization of detergent - insoluble mt - ftl ferritin from astrocyte cultures cerebral cortical astrocytes cultures were homogenized in lysis buffer (3 ml of 50 mm tris - hcl (ph 7.4), 1% sds, 30 units / ml benzonase, 2 mm mgcl2) containing complete protease inhibitor mixture (roche applied science) and incubated for 15 min at room temperature . Lysates containing equal amounts of protein were ultracentrifuged at 46,000 rpm (tla 110, beckman) for 25 min at 4 c . The supernatant (sds - soluble) was removed, and the sds - insoluble pellet was resuspended in lysis buffer and then subjected to another step of centrifugation in the same conditions . The final pellet was resuspended in 5 laemmli sample buffer and heated for 10 min at 95 c . The sds - soluble, -insoluble, and total cell lysates (before sds extraction) were resolved on 420% gradient sds - page (pierce) and transferred to nitrocellulose membranes (amersham biosciences). Membranes were blocked for1 h in 70 mm tris - buffered saline, 0.1% tween 20, and 5% nonfat dry milk, followed by an overnight incubation with polyclonal antibodies (1283) against the mt - ftl polypeptide, as described previously (9, 29) at 1:10,000 . After washing, membranes were incubated with peroxidase - conjugated secondary antibody (ge healthcare) for 1 h, washed, and developed using the ecl chemiluminescent detection system (ge healthcare). The wild type ftl polypeptide (wt - ftl) consists of 175 amino acids . The p.phe167serfsx26 mutant polypeptide (mt - ftl) has 191 amino acids and a different c - terminal sequence (underlined). The boxes indicate the five -helical domains in the wt - ftl polypeptide according to protein data bank accession number 2fg4 . The mutant c - terminal sequence contains both metal - binding and hydrophobic groups . The wild type ftl polypeptide (wt - ftl) consists of 175 amino acids . The p.phe167serfsx26 mutant polypeptide (mt - ftl) has 191 amino acids and a different c - terminal sequence (underlined). The boxes indicate the five -helical domains in the wt - ftl polypeptide according to protein data bank accession number 2fg4 . The mutant c - terminal sequence contains both metal - binding and hydrophobic groups . Figure 2.mt-ftl polypeptides assemble into 24-mer homopolymers . A, elution profiles of purified wt- and mt - ftl apoferritin homopolymers from a superose 6 column at ph 7.4 in 0.05 m tris, 0.15 m nacl . The dark cores most likely represent nanovan that has penetrated in some cases the interior of the 24-mers . C, native page (38% (ph7.4)) of 0.5 m wt- and mt - ftl proteins loaded before the removal of iron and stained with coomassie blue (protein staining) and with prussian blue (iron staining). A, elution profiles of purified wt- and mt - ftl apoferritin homopolymers from a superose 6 column at ph 7.4 in 0.05 m tris, 0.15 m nacl . The dark cores most likely represent nanovan that has penetrated in some cases the interior of the 24-mers . C, native page (38% (ph7.4)) of 0.5 m wt- and mt - ftl proteins loaded before the removal of iron and stained with coomassie blue (protein staining) and with prussian blue (iron staining). Astrocyte cultures in lab - tek chambered coverglass slides (nunc) were fixed for 15 min with 4% paraformaldehyde in pbs at 4 c . Briefly, the slides were washed successively with pbs, permeabilized with 0.1% triton x-100 for 15 min, and incubated for 1 h at room temperature in blocking solution (0.1% triton x-100, 2% bovine serum albumin in pbs). The cultures were incubated overnight at 4 c with the primary antibodies diluted in blocking solution, washed with pbs, and further incubated for 1 h at room temperature with the secondary antibodies diluted in blocking solution . The slides were then washed with pbs, rinsed with distilled water, and mounted with the prolong gold antifade mounting reagent (molecular probes). Primary antibodies used were monoclonal antibody to gfap (1:400; sigma) and polyclonal antibody against mt - ftl (1283). Secondary antibodies used were alexa 488 fluor - conjugated goat anti - rabbit and alexa fluor 594-conjugated goat anti - mouse (4 g / ml; molecular probes). Images were captured with a zeiss lsm-510 confocal scanner attached to a zeiss axiovert 100 m inverted microscope . Recombinant mt - ftl polypeptides assemble into 24-mer homopolymers recombinant wt- and mt - ftl polypeptides (fig . 1) were expressed in e. coli in a soluble manner and with similar yields . Purified wt- and mt - ftl polypeptides were analyzed by gel filtration chromatography to determine their states of assembly at physiological ph . Both polypeptides eluted almost exclusively as 24-mer homopolymers, but at slightly different times (fig . Ultrastructural analysis by tem showed that both recombinant ferritins had spherical shape and a size (diameter 110) similar to that of human ferritin (fig . Nondenaturing page showed that both wt- and mt - ftl homopolymers, examined before iron removal, were able to assemble and incorporate iron in vivo during expression in e. coli (fig . 2c). Compared with wt - ftl homopolymers, mt - ftl homopolymers showed a slower electrophoretic mobility, which may be attributed to their larger size and different charge (the mt - ftl polypeptide has a + 1 net charge difference per subunit) (fig . 2c). Enhanced precipitation of mt - ftl homopolymers iron loading of apoferritin homopolymers was examined by an often used and well described procedure (14, 16, 17). In brief, wt- and mt - ftl apoferritin homopolymers were incubated aerobically with increasing amounts of iron (ferrous ammonium sulfate) up to 4500 iron atoms per 24-mer . After 2 h, proteins were separated by centrifugation into soluble and insoluble (pellet) fractions for analysis . 3a) suggested that at moderate iron loading (up to 1,000 iron atoms per ferritin 24-mer), the wt- and mt - apoferritin homopolymers incorporated similar amounts of iron indicating that both are functional ferritins . At higher iron: ferritin ratios, wt - ftl homopolymers continued incorporating iron, whereas mt - ftl homopolymers began to show macroscopically visible yellow precipitates, which were stained with prussian blue . No precipitates were observed for wt - ftl homopolymers, which remained in the soluble fraction during the iron loading experiment up to a ratio of 4500:1 of iron: ferritin . The reduction in the signal observed in native page for soluble mt - ftl homopolymers correlated with the appearance of mt - ftl in the insoluble fraction on sds - page (fig . 3b). Because the 310 nm absorbance represents both iron incorporation and hydrolysis, the soluble ferritin fractions (supernatants) were run on nondenaturing gels and stained with prussian blue to unambiguously quantitate iron incorporation into the protein . There was only a modest (10%) decrease in iron incorporation in mt - ftl homopolymers versus wild type at 1000:1 iron: ferritin loading (fig . 3c), which emphasizes iron mishandling through mutant ferritin precipitation . By tem, mt - ftl ferrous ammonium sulfate (0.54.5 mm) was added to 1 m of mt- and wt - ftl homopolymers in 0.1 m hepes (ph 7.0) for 2 h at 24 c . Samples were centrifuged for 15 min at 10,000 g to separate into soluble and insoluble fractions . A, iron uptake / hydrolysis was monitored in the soluble fractions by measuring absorbance at 310 nm . B, soluble and insoluble fractions were loaded into native gels sds - page, respectively, and stained with coomassie blue . C, iron mineralization in soluble mt- and wt - ftl homopolymers was monitored as the density of prussian blue formed in protein bands after separating unmineralized iron from the protein by electrophoresis in native gels (38%). Ferrous ammonium sulfate (0.54.5 mm) was added to 1 m of mt- and wt - ftl homopolymers in 0.1 m hepes (ph 7.0) for 2 h at 24 c . Samples were centrifuged for 15 min at 10,000 g to separate into soluble and insoluble fractions . A, iron uptake / hydrolysis was monitored in the soluble fractions by measuring absorbance at 310 nm . B, soluble and insoluble fractions were loaded into native gels sds - page, respectively, and stained with coomassie blue . C, iron mineralization in soluble mt- and wt - ftl homopolymers was monitored as the density of prussian blue formed in protein bands after separating unmineralized iron from the protein by electrophoresis in native gels (38%). Far - uv (a) and near - uv (b) spectra were recorded at homopolymer concentrations of 0.12 and 1.5 m, respectively, at ph 7.4 and 25 c in 50 mm potassium phosphate buffer . Far - uv (a) and near - uv (b) spectra were recorded at homopolymer concentrations of 0.12 and 1.5 m, respectively, at ph 7.4 and 25 c in 50 mm potassium phosphate buffer . Spectroscopic comparison of mt - ftl apoprotein homopolymers versus wt protein spectra provide molecular level information concerning protein structure and especially structural differences between similarly composed proteins . The far - uv cd spectrum of mt - ftl apoferritin showed minima at 222 and 208 nm and a maximum at 191193 nm (fig . The profile obtained was typical of a protein containing predominantly -helical motifs . Compared with the wt - ftl homopolymers, we observed a change in the secondary structure of mt - ftl, with a decrease of 15% in the total -helical content and an increase in turns and unordered structures (table 1). The profile obtained for mt - ftl homopolymers was very similar to that obtained for the wt - ftl, with the wt predominant peak at 286 nm and two other peaks at 293 and 280 nm (fig . The intrinsic fluorescence spectra exhibited an emission maximum at approximately the same wavelength (330 nm) for both wt- and mt - ferritins when both proteins were excited at either 280 or 295 nm (data not shown). Table 1deconvolution of far - uv cd spectra for wt- and mt - ftl apoferritin homopolymers into percent secondary structural contributions the analysis was performed using fitting programs contnnll, selcon3, and cdsstr available at the website dichroweb as described under experimental procedures.-helix-sheetturnsothermt-ftl continnll 0.55 0 0.1 0.36 selcon3 0.58 0 0.1 0.32 cdsstr 0.57 0 0.1 0.34 wt - ftl continnll 0.72 0 0 0.28 selcon3 0.69 0 0.1 0.3 cdsstr 0.72 0 0 0.28 aregular fraction is indicated deconvolution of far - uv cd spectra for wt- and mt - ftl apoferritin homopolymers into percent secondary structural contributions the analysis was performed using fitting programs contnnll, selcon3, and cdsstr available at the website dichroweb as described under experimental procedures . Regular fraction is indicated ans binding to mt - ftl homopolymers ans fluorescence intensity enhancement occurs upon its binding to hydrophobic sites on proteins . Ans binding assays were performed to study the occurrence of exposed hydrophobic surfaces in mt - ftl apoprotein homopolymers . In aqueous medium, ans shows an emission maximum at 515 nm, but when this reagent binds to a hydrophobic moiety, its fluorescence intensity increases severalfold, and the emission maximum is blue - shifted to 470 nm . At ph 7.4, native ferritin does not bind ans nor does it fully denatured ferritin (24, 30). However, a large increase in ans fluorescence at 470 nm was observed when ans was added to the mt - ftl homopolymers, indicating exposed hydrophobic sites (fig . A saturation curve exhibiting noncooperative binding was observed following titration of ans into mt - ftl homopolymers (fig . 5b). Scatchard analyses resulted in a linear plot with an apparent dissociation constant in the micromolar range . Decreased thermal stability of mt - versus wt - ftl apoferritin homopolymers the thermal stability of the apoferritin homopolymers was monitored by measuring the change in intrinsic fluorescence of the protein as the structure is perturbed . The unusual stability of ferritins necessitated the addition of a perturbing agent to partially destabilize the protein making it accessible to denaturation by heating (31, 32). Using established procedures (24, 25) the protein was excited at 295 nm in the presence of 4.0 m gndhcl, and the extent of denaturation was quantitated as a ratio of emission intensities . With increasing temperature, the fluorescence emission maxima shifted from 330 nm (native) to 355 nm (denatured) for both wt- and mt - ftl homopolymers (fig . Both transitions were two - state, and transition midpoint temperatures (tm) were calculated from the curves (fig . Wt - ftl homopolymers had the highest tm (90 c), which decreased markedly with mt - ftl (45 c). Without addition of denaturant, mt - ftl exhibited a tm near 75 c . Differential proteolysis of wt - versus mt - ftl homopolymers in general, limited proteolysis does not usually occur with -helices, but largely at loops and disordered protein sequences (33, 34). To investigate the possibility of exposed disordered motifs in mt - ftl homopolymers, we conducted limited proteolysis using thermolysin, which displays broad substrate specificity (35). Thermolysin selectively cleaved the mutant and generated a predominant fragment of 17 kda . The fragment showed immunoreactivity with an antibody that recognizes the protein n terminus, suggesting that the mutant homopolymer is cleaved at the c terminus . In contrast wt - ftl homopolymers were resistant to thermolysin proteolytic digestion when reacted under identical experimental conditions (fig . Chelation of iron reverses iron - induced aggregation in vitro precipitation of mt - ftl homopolymers was observed when they were loaded with iron (ferrous ammonium sulfate) at greater than 1,000 iron atoms per ferritin 24-mer, whereas wt - ftl homopolymers remained in the soluble fraction at least until loading with 4,500 iron atoms . However, the precipitation of mt - ftl homopolymers was found to be reversible . More specifically, greater than 50% of mutant homopolymers that were precipitated by treatment with 3500:1 iron: ferritin was resolubilized by incubation with the chelator dfx (fig . Chelation of iron reverses iron - induced aggregation in vivo to investigate iron - mediated aggregation in vivo, we used primary cultures of astrocytes from cerebral cortex of transgenic mice expressing the mt - ftl polypeptide . In this mouse model, the human mt - ftl polypeptide forms heteropolymers with the endogenous murine wild type ftl and fth1 polypeptides, which are seen to aggregate in neurons and glia throughout the life span of the mice (29). After treatment of the cells with fac to increase their intracellular iron stores, we observed a switch of ferritin from the detergent - soluble fraction to the detergent - insoluble fraction, suggesting a change in the solubility (fig . Addition of the lipophilic and freely cell - permeant iron chelator 1,10-phen to the fac - treated cells (fac / phen) led to a large reduction in the signal for detergent - insoluble ferritin and the reappearance of ferritin in the detergent - soluble fraction (fig . For these in vivo experiments, phen was preferred over the weakly cell - permeant dfx that was used for the in vitro experiments . Addition of phen alone did not seem to have a significant effect on the amount of ferritin present in the detergent - insoluble or -soluble fractions isolated from the cultured astrocytes . Double immunolabeling experiments showed intranuclear accumulation of ferritin as well as the presence of small, punctate ferritin deposits in the cellular cytoplasm (fig . Importantly, addition of fac to astrocytes expressing mt - ftl led to an increase in the signal for mt - ftl (fig . 9b, fac), which correlated with an increase in the amount of detergent - insoluble ferritin observed by western blot analysis . We also observed that fac treatment led to astrocyte reactivity, characterized by a redistribution of the intermediate filament gfap and the formation of long cytoplasmic processes (fig . 9b, fac) as described previously (28). Addition of phen after incubation with fac partially reversed the astrocytic reactive phenotype and decreased the cellular immunolabeling for ferritin (fig . No significant differences with the control were observed when only the chelator was added to the cell culture (fig . 9, phen). . A, ans fluorescence emission enhancement and wavelength shift caused by titration of mt - ftl homopolymers with increasing concentrations of ans . B, background and dilution corrected fluorescence emission intensity at 460 nm as a function of ans concentration . Titration was performed on 1.5 m mt - ftl homopolymer at ph 7.4 and 25 c in 50 mm potassium phosphate buffer . Binding of ans to mt - ftl apoferritin homopolymers . A, ans fluorescence emission enhancement and wavelength shift caused by titration of mt - ftl homopolymers with increasing concentrations of ans . B, background and dilution corrected fluorescence emission intensity at 460 nm as a function of ans concentration . Titration was performed on 1.5 m mt - ftl homopolymer at ph 7.4 and 25 c in 50 mm potassium phosphate buffer . A, temperature dependence of fluorescence emission spectra of mt- and wt - ftl homopolymers destabilized by 4.0 m gdnhcl . The red trace represents denatured ferritin (den) induced by incubation at ph 2.0 in 4.5 m gdnhcl . B, fluorescence emission intensity ratio (of 355 over 330 nm) to determine denaturation temperature of both apoferritin homopolymers . Scans were performed on 1.5 m ferritin homopolymer at ph 7.4 in potassium phosphate buffer with excitation at 295 nm . Homopolymers were incubated 12 h in 4.5 m gdnhcl before beginning temperature dependence experiment . A, temperature dependence of fluorescence emission spectra of mt- and wt - ftl homopolymers destabilized by 4.0 m gdnhcl . The red trace represents denatured ferritin (den) induced by incubation at ph 2.0 in 4.5 m gdnhcl . B, fluorescence emission intensity ratio (of 355 over 330 nm) to determine denaturation temperature of both apoferritin homopolymers . Scans were performed on 1.5 m ferritin homopolymer at ph 7.4 in potassium phosphate buffer with excitation at 295 nm . Homopolymers were incubated 12 h in 4.5 m gdnhcl before beginning temperature dependence experiment . Recombinant mt- and wt - ftl homopolymers (1 m) were incubated with thermolysin (0.15 units) in hepes buffer (0.1 m) (ph 7.0), 60 mm nacl, 1 mm cacl2 . After 10 min at 37 c, sample buffer was added, and the samples treated with thermolysin (+), and controls without thermolysin (-) were loaded onto 420% sds - page . Gels were stained with coomassie blue (total protein) or blotted using antibodies specific for the n terminus of ftl or the c terminus of mt - ftl or wt - ftl . Recombinant mt- and wt - ftl homopolymers (1 m) were incubated with thermolysin (0.15 units) in hepes buffer (0.1 m) (ph 7.0), 60 mm nacl, 1 mm cacl2 . After 10 min at 37 c, sample buffer was added, and the samples treated with thermolysin (+), and controls without thermolysin (-) were loaded onto 420% sds - page . Gels were stained with coomassie blue (total protein) or blotted using antibodies specific for the n terminus of ftl or the c terminus of mt - ftl or wt - ftl . In this work we investigate the protein structure and iron storage function of ferritin homopolymers formed from a light chain variant p.phe167serfsx26 that causes hf (9). Both wild type fth1 and ftl polypeptide subunits are important for the iron storage function of ferritin, with the former containing the ferroxidase site for ferrous iron oxidation and the latter containing the iron nucleation site (2, 3). However, homopolymers composed of ftl subunits have additional properties such as resistance to precipitation under iron loading and being significantly more stable to denaturation by heat and solvent (30, 36), and apparently ftl subunits are able to confer these properties upon the heteropolymer . Thus as the first approach to elucidating the effects of the mutation, we compared and contrasted wild type with mt - ftl homopolymers, which have a c terminus of altered length and composition (9). Gel filtration and nondenaturing electrophoretic analyses showed that at physiological ph, recombinant mt - ftl polypeptides were able to assemble as 24-mer homopolymers, which were ultrastructurally indistinguishable from homopolymers of recombinant wt - ftl polypeptide . However, homopolymers made of the mutant subunit showed a smaller retention time and a slower electrophoretic mobility compared with those of the wt - ftl polypeptide, consistent with the molecular mass difference . Homopolymers of recombinant wt- and mt - ftl polypeptides were able to incorporate iron in vivo in preparations obtained from e. coli, suggesting that both are functional proteins . In vitro, recombinant wt- and mt - apoferritin homopolymers incorporated similar amounts of iron up to 1000:1 iron: ferritin molar ratio over a 2-h incubation . However, at higher iron: ferritin ratios, wt - ftl homopolymers continued incorporating iron, whereas mt - ftl homopolymers began to precipitate, limiting their iron storage function . To understand this functional difference, such techniques are particularly useful in revealing differences between similarly structured proteins . In the far - uv, the cd spectra of the mt - ftl homopolymers showed a decrease (15%) in total -helical content and an increase in turns and unordered structures compared with the wt - ftl . Such a 15% decrease could be accounted for precisely by complete unraveling of the shortest -helical segment of ferritin (the e helix, located at the c terminus) or alternatively some fraction of portions of the longer helical segments a d . The e helix involvement is supported by the length and position of the mutation itself (9, 12). The cd data are in agreement with secondary structural prediction analysis (jpred) (37) and analysis for -helical context (protscale) (38), both of which are consistent with a loss of the e helical domain in the mt - ftl polypeptide . Figure 8.iron-induced aggregation of mt - ftl homopolymers and its reversal by the iron chelator deferroxamine . Mt - ftl homopolymers were incubated in a molar ratio 1:3500 with ferrous ammonium sulfate as in fig . After centrifugation, the pellet was resuspended in a solution containing 6 mm dfx, 0.1 m hepes (ph 7.4) and incubated for 2 h at 24 c . After a second centrifugation, soluble fractions were run in native gels and stained with coomassie blue for protein and with prussian blue for iron . Densitometric analysis of the protein bands was performed, and the values are shown as relative densitometric units (rdu) as a percentage of the control without iron for each protein . Wt - ftl homopolymers did not precipitate after iron treatment (not shown). Iron - induced aggregation of mt - ftl homopolymers and its reversal by the iron chelator deferroxamine . Mt - ftl homopolymers were incubated in a molar ratio 1:3500 with ferrous ammonium sulfate as in fig . After centrifugation, the pellet was resuspended in a solution containing 6 mm dfx, 0.1 m hepes (ph 7.4) and incubated for 2 h at 24 c . After a second centrifugation, soluble fractions were run in native gels and stained with coomassie blue for protein and with prussian blue for iron . Densitometric analysis of the protein bands was performed, and the values are shown as relative densitometric units (rdu) as a percentage of the control without iron for each protein . Wt - ftl homopolymers did not precipitate after iron treatment (not shown). The cd spectra of the mt- and wt - ftl homopolymers in the near - uv region, which reflects the packing environment of the tyrosines and tryptophans, were very similar . This similarity suggests that the mutation in the ftl polypeptide introduces only a minor change in tertiary and/or quaternary structures of ferritin, which is in agreement with the ability to form the assembled state observed by gel filtration chromatography and nondenaturing page . The minor spectral difference at 280 nm is likely produced by structural perturbation around tyrosine . One out of the six tyrosines in ftl is located in its c - terminal sequence (amino acid 165) and is present in the wt- and mt - ftl polypeptides . No additional tyrosines or tryptophans are introduced by the mutation to contribute spectral intensity at 280300 nm . Routine scans of the endogenous protein fluorescence with excitation at 280 and 295 nm gave no difference between wt- and mt - ftl homopolymers (data not shown). However, a structural difference between wt- and mt - ftl homopolymers was revealed by titration with the exogenous fluorophore ans, which increases its fluorescence and shifts its emission maximum upon interaction with a nonpolar environment . Ans fluorescence was enhanced in a manner indicating equilibrium binding to a hydrophobic pocket that is formed in the mutant . Taken together, the spectroscopic studies are consistent with no changes in the helix content and packing of the 4-helix bundle (a d) or in the majority of the intersubunit interactions, but with an unraveling of the e helix in the mutant such as to create hydrophobic binding sites for ans . A, immunoblot for mt - ftl ferritin from total cell extracts and their sds - insoluble and sds - soluble fractions . Transgenic astrocytes were exposed to water (ct); 50 m ferric ammonium citrate for 72 h (fac); 50 m phenanthroline for 72 h (phen); or 50 m ferric ammonium citrate for 72 h following 72 h of the iron chelator phenanthroline (50 m) (fac / phen). To verify similar loading b, confocal immunofluorescence microscopy of cultured mt - ftl - transgenic astrocytes treated as in a. cells were immunostained with anti mt - ftl antibody (green) and anti - gfap antibody (red). Note the increase in mt - ftl signal after iron treatment (fac). The signal was greatly decreased after treatment with the chelator (fac / phen). Iron - induced aggregation of cellular ferritin and its reversal by the chelator phenanthroline . A, immunoblot for mt - ftl ferritin from total cell extracts and their sds - insoluble and sds - soluble fractions . Transgenic astrocytes were exposed to water (ct); 50 m ferric ammonium citrate for 72 h (fac); 50 m phenanthroline for 72 h (phen); or 50 m ferric ammonium citrate for 72 h following 72 h of the iron chelator phenanthroline (50 m) (fac / phen). To verify similar loading, b, confocal immunofluorescence microscopy of cultured mt - ftl - transgenic astrocytes treated as in a. cells were immunostained with anti mt - ftl antibody (green) and anti - gfap antibody (red). Note the increase in mt - ftl signal after iron treatment (fac). The signal was greatly decreased after treatment with the chelator (fac / phen). A feature of ferritin 24-mers in general is their high stability to heat and to urea or guanidinium chloride exposure (2). We found that in the presence of 4.5 m gdnhcl, wt - ftl homopolymers denatured with the higher tm 90 c and mt - ftl at 45 c . Without addition of the destabilizing agent, mt - ftl denatured near 75 c, which is reduced considerably from that reported in the literature (30, 32) for the wild type, and again points toward significant destabilization of the mutant . For comparison, fth1 homopolymers are less stable to heat denaturation than ftl homopolymers, perhaps because of residues located at the intersubunit contacts along the 3- and 4-fold channels and by salt bridges within the 4-helix bundles themselves between lys-62 and glu-107 (24, 32). Indeed, native e helix conformation appears to help stabilize the subunit structure of the ftl homopolymer by making several hydrophobic contacts with apolar side chains near the start of helix b and the end of d as well as being linked by hydrogen bonds to the n - terminal ends of helices b and c (2, 6, 7, 39). Given the spectroscopic results, the difference in thermal stability observed between the wt and mutant homopolymers can be attributed to the loss of the interactions around the e helix in the mt - ftl subunit . Although the e helices are known to contribute to the exceptional thermostability of ferritin, they are not essential in the pattern of ferritin assembly (40). The data presented so far suggest that ferritin accommodates the extensive sequence alteration present in the p.phe167serfsx26 mutant without disturbing its assembly / folding pathway or spherical shell structure . Susceptibility to thermal denaturation was enhanced by the mutation, but not in the physiological range of temperature where it may be directly causative of precipitation . In wt - ftl, the helical c terminus is not accessible, being accommodated inside the spherical surface (as part of the shell structure) and forming the 4-fold pore . However, the disposition of the unraveled c terminus in the mutant was not clearly delineated by spectroscopy or denaturation studies in that it may be contained within the interior, be totally exterior to the shell, or have some intermediate conformation . To investigate the difference in c - terminal conformation between wt and mutant homopolymers, both were subjected to thermolysin proteolysis and the products analyzed by gel electrophoresis and western blot . The results showed that the c terminus of the mt - ftl homopolymer, but not the wt, was susceptible to proteolysis with 75% of the sample exhibiting loss . The n terminus was, however, not susceptible to cleavage nor were there other proteolysis products evident . These results strongly support a conformation in which at least part of the c terminus sequence of the mutant extends into the solvent far enough above the well formed, spherical exterior surface to be approached and cleaved by thermolysin for a large fraction of ferritin subunits . Alternatively, a distribution between completely external and completely internal c termini could occur . Thus, not only is the 4-fold pore disrupted, but ferritin has an amino acid sequence protruding external to the shell to interact with its surroundings (including iron). The lack of multiple thermolysin cleavage bands also attests to the intact nature of the mutant homopolymer, paralleling the wild type intactness . Changes in the c terminus in different ferritin polypeptides exhibit a variety of documented effects . C - terminal deletion of a comparable sequence in the fth1 polypeptide caused the protein to form oligomers that were unable to incorporate and keep iron in solution (14, 40), whereas lengthening of the fth1 polypeptide by addition of various amino acid sequences did not modify ferritin assembly . Interestingly, when large peptide sequences were added, they were found to be exposed outside the ferritin shell (14, 40, 4244). Insertional mutations of a mouse fth1 cdna using nucleotide sequences similar to those associated with hf produced mutant polypeptides of different lengths . In these experiments, the mutant polypeptides showed a significant alteration in protein folding, assembly, and function, which was correlated with the loss of the last helical domain that existed in the wt protein (45). Studies using recombinant mutant ftl (p.arg154lysfsx26), corresponding to the 460461insa variant (8) suggested that the recombinant polypeptide was able to assemble into ferritin shells with low efficiency and that the c terminus was exposed outside the shell (46). Analysis of ftl polypeptides with the p.phe167serfsx26 mutation suggest that this mutation is apparently not severe enough to prevent iron incorporation, but it has a c terminus exposed external to the protein shell similar to that associated with the ftl460461insa mutation and the extended fth1 polypeptides . Although ferritin formed from our mt - ftl polypeptide precipitated at iron concentration significantly below that of wild type, such precipitation was at least partially reversible . Approximately 50% of ferritin precipitated at a loading of 3500:1 iron: ferritin ratio was resolubilized using the iron chelator dfx, and that resolubilized protein contained iron . Iron - induced aggregation was also seen in vivo, but was substantially reversed by the iron chelator phen . These results argue against large scale structural disruption of the ferritin shells and are in agreement with the spectroscopic and tem data, which showed that the precipitates had the spherical shape of ferritin . Significant mutant c - terminal sequence exposure external to a well formed ferritin shell, differential iron - induced precipitation between the mutant and wild type, and reversibility of aggregation by chelation of iron lead to the model of iron - induced aggregation shown in fig . 10 . Specifically, iron can bind in widely varying affinities to several groups on the exposed c terminus of mt - ftl ferritin . The c - terminal carboxylate, the glutamates, the tyrosinate, and perhaps even the serine hydroxyl, threonine hydroxyl, and peptide backbone groups all can bind iron . The precipitation process appears to begin when an iron (or iron nucleation complexes) binds to groups on the exposed c - terminal regions of two mutant 24-mers preventing their translational motion . Additional c - terminal iron bridging (from other mutant subunits) and/or surface carboxylate (glutamate and aspartate) bridging may occur as the two ferritin shells come together tightening their interaction producing dimers . There is independent evidence of the existence of ferritin dimers in the literature (16, 47), which would agree with involvement of iron - bound carboxylate enhancing bridging . Furthermore, calorimetry studies provide evidence of a large number of weakly bound irons independent of those more tightly bound at the ferroxidase center (41). This process is greatly affected by the redox state of the iron, not just with respect to hydrolysis and formation of precipitated hydroxide complexes, which are part of the bridging and matrix of the ferritin aggregate, but also because the binding strengths of the various groups mentioned above are strongly redox - dependent with ferric iron preferring to bind to hard ligands and ferrous iron generally considered a weaker binder . Finally, the c terminus of the mutant ferritin has hydrophobic patches, which may augment the strength of the bridging interaction and perhaps hinder reversibility by iron chelation . It should be noted that this model is not limited to mutant homopolymers in that heteropolymers with a fraction of mt - ftl polypeptide subunits are not precluded from undergoing iron - induced aggregation . Figure 10.simplified model describing the steps in the iron - induced aggregation process of mutant ferritin . A, c termini of mt - ftl polypeptides extend above the spherical surface of ferritin exposing this sequence of the peptide to solvent and iron . B, sequence binds iron (or iron nucleation complexes) and through it the c terminus of a second mt - ftl polypeptide, reducing the translational motion of both 24-mers . C, additional cross - linking occurs (through iron bridges) between c termini, a c terminus and surface carboxylate, and/or eventually through carboxylates on both 24-mers forming ferritin dimers . Simplified model describing the steps in the iron - induced aggregation process of mutant ferritin . A, c termini of mt - ftl polypeptides extend above the spherical surface of ferritin exposing this sequence of the peptide to solvent and iron . B, sequence binds iron (or iron nucleation complexes) and through it the c terminus of a second mt - ftl polypeptide, reducing the translational motion of both 24-mers . C, additional cross - linking occurs (through iron bridges) between c termini, a c terminus and surface carboxylate, and/or eventually through carboxylates on both 24-mers forming ferritin dimers . We observed that ferritin precipitates obtained in vitro were composed of fully assembled 24-mers, similar to what has been reported in inclusions in patients with hf (9, 12) and in transgenic mice expressing the mt - ftl polypeptide (29). At iron: ferritin ratios above 2000:1, under the same experimental conditions in which we analyzed wt - and mt - ftl, the majority of fth1 but not wt - ftl ferritins precipitate (16). The precipitation of fth1 has been suggested to be related to extra - cavity iron hydrolysis (16). Iron - induced aggregation of fth1 (16) and mt - ftl homopolymers was not irreversible because pellets could be resolubilized by the addition of iron chelators . In vivo, we found that the addition of iron led to intracellular accumulation of ferritin in astrocytes from transgenic mice expressing the mt - ftl polypeptide (29). Detergent - insoluble ferritin is typically seen in brain extracts from patients with hf and transgenic mice expressing the mt - ftl polypeptide (29). After iron addition, astrocytic ferritin was found mostly in the detergent - insoluble fraction, indicating that iron - induced ferritin aggregation occurs in vivo and may be the mechanism underlying ferritin aggregation in patients with hf . The quantity of detergent - insoluble ferritin was significantly reduced by the addition of the iron chelator phen to the astrocyte culture, in agreement with the in vitro studies . Our data show that the ftl498499instc mutation leads to the generation of ftl polypeptides that are able to assemble into ferritin 24-mers . However, mt - ftl homopolymers have a diminished ability to sequester iron and aggregate well before wild type homopolymers as iron levels are increased . In vivo, the mt - ftl polypeptide may act as a dominant negative mutant, leading to a failure of ferritin in its iron storage function and an increase in the levels of intracellular iron . Intracellular free iron generates a positive feedback loop, in which it promotes the release of the iron regulatory proteins from the ferritin iron - responsive elements (2), overexpression of ferritin polypeptides, and the aggregation of mutant - containing ferritins as observed in patients with hf (12) and in transgenic mice (29). Thus we propose that deregulation of cellular iron metabolism and formation of ferritin aggregates, which may physically interfere with normal cellular functions (causing a gain of a toxic function), may be the key pathological mechanisms eventually leading to hf . It should be mentioned that this aggregation mechanism does not exclude other levels of iron mismanagement operating more subtly in addition to it, e.g. Iron - induced oxidative stress . Considering the numerous hydrophobic amino acids in the mutant c terminus, a peptide - based iron chelator containing one or more hydrophobic groups may more effectively hinder ferritin aggregation than a simple chelator alone.
|
Celiac artery aneurysm is a quite uncommon vascular lesion, accounting for 5.1% of all splanchnic artery aneurysms . Although rare, celiac artery aneurysm carries a definite risk for rupture and other complications . However, because of its rarity, no strong consensus concerning indications for intervention of asymptomatic celiac artery aneurysm exists in the literature . Due to more frequent use of cross - sectional imaging, the dilemma of choosing the appropriate therapeutic option has become increasingly more important . Herein, we present a case of an un - ruptured celiac artery aneurysm that was treated by surgical repair and also discuss the appropriate therapeutic strategy based on a literature review . A 72-year - old female visited our department with complaints of fever and general fatigue . The patient s medical history included type 2 diabetes mellitus with poor control and hypertension . Arrival revealed that her blood pressure was 147/62 mmhg, heart rate was 104 beats / min with regular rhythm, blood oxygen saturation was 95% under atmospheric conditions, and body temperature was 38.7 c . Blood analyses revealed 11,260 white blood cells/l with 80.6% neutrophils and 0.69 mg / dl c - reactive protein); mild hypoalbuminemia (3.3 g / dl); coagulant dysfunction (fibrin / fibrinogen degradation products; 7 g / dl fibrinogen; and 2.1 g / ml d - dimer), and severely impaired glucose tolerance (157 mg / dl and 11.2% hemoglobin a1c). She weighed 52.4 kg, was 150 cm tall, and had a body mass index was 23.3 kg / m . Inspection of the palpebral conjunctiva revealed no evidence of anemia . Chest auscultation revealed no signs of abnormal heart murmurs and no rales or other abnormal respiratory sounds . The abdomen was slightly distended and her peristalsis was normal; no tenderness was observed in the upper abdomen . She was then diagnosed with bacteremia by urinary tract infection and antibacterial medicine (cefmetazole 2 g per day) was initiated . Transesophageal echocardiography was performed to investigate infective endocarditis, revealing no vegetation at her valves . Contrast - enhanced computed tomography (ct) was performed for investigating her urological abnormalities, revealing no urological deformities but a 28 30 mm sized aneurysm at the trunk of the celiac artery (fig . The proper hepatic artery was dominantly supplied from the celiac artery, the left gastric artery being bifurcated from the celiac trunk, and the celiac artery and the splenic and common hepatic artery had a common trunk (fig . Surgical repair of the aneurysm was performed after confirmation of negative blood culture for bacteria on day 32 . Firstly, lesser omentum and crus of diaphragm were incised to expose abdomen aorta at the level of the trunk of the celiac artery . After that, the superior mesenteric artery was taped at the trunk of the small bowel mesentery . Abdominal aorta was clamped both at the head of celiac artery and at the level of renal artery to prevent blood flow . The distal celiac artery of the aneurysm was cut and 8 mm size prosthetic graft was anamotosed . Another end of the prosthetic graft was anamostosed through the dorsum of duodenum to abdominal aorta below the level of renal artery (fig.1d, e, f). Celiac artery aneurysm is an uncommon type of splanchnic artery aneurysm that carries a high risk for mortality if it ruptures . A total of 9.1% of celiac artery aneurysms are accompanied by abdominal aortic aneurysms; solitary celiac artery aneurysms not accompanied by other aneurysms are extremely rare . Etiology of celiac artery aneurysm includes infectious diseases, atherosclerosis, trauma, or congenital conditions . Other causes of celiac artery aneurysm include medial necrosis, inflammation, trauma, and median arcuate ligament syndrome . In our patient, the cause of the aneurysm was presumably derived from atherosclerosis due to the poor - controlled diabetes mellitus, hypertension, and aging . Since most patients are asymptomatic, celiac artery aneurysm is frequently incidentally discovered by imaging modalities for the investigation of other conditions or diseases . The major presentation of celiac artery aneurysm is gastrointestinal symptoms, including abdominal pain, nausea, vomiting, appetite loss, or symptoms of mesenteric ischemia . The risk of rupture of 1522 mm diameter celiac artery aneurysms is 5%; in contrast, the risk of rupture in> 30 mm diameter aneurysms is 5070% . In general, treatment is considered for asymptomatic patients when the aneurysm is larger than 20 mm in diameter, . The rudiment of operative treatment is the resection or closure of the aneurysm along with revascularization of peripheral branches that bifurcate from the celiac artery aneurysm . Surgical repair of the aneurysm with prosthetic grafts demonstrated more preferable long - term results than by using saphenous veins; thereby, prosthetic grafts might become the mainstay of surgical aneurysm repair . Surgical treatment of a celiac artery aneurysm that involves the confluence of trifurcation is challenging, with a mortality risk of 5%, . When the aneurysm is removed without the vascular reconstruction, the blood flow from the super mesenteric artery to the hepatic artery should be carefully examined before surgery . In recent years, with advances in interventional radiology, catheter embolization is also attempted . When catheter embolization is adopted, the blood flow from the super mesenteric artery to the hepatic artery should be confirmed . Clearly, if gross liver ischemia is found after aneurysm resection, revascularization of the hepatic artery is necessary, either by antegrade supraceliac aortohepatic bypass or retrograde inflow from the infrarenal segment of the aorta or the common iliac arteries . In our case, angiography confirmed that the blood flow of the proper hepatic artery was dominantly supplied by the celiac artery and the gastroduodenal artery was patent and large . Endovascular techniques, including stent implantation and embolization of aneurysms are feasible in the setting of advanced age and underlying diseases; while surgical intervention is a safe and effective method in selected cases, . In our patient, endovascular treatment was considered unsuitable because the patient just recovered from bacteremia and the possibility of an infective aneurysm could not be excluded . In addition, surgical intervention was not likely to be challenging considering the anatomical location of the aneurysm and the patient s favorable general condition . Clearly, the celiac artery aneurysm in our patient was concluded not derived from infections based on the clinical course and operative findings . A question may be raised about why this patient should have undergone ct although she did not present any abdominal complaints . Patients with urosepsis should be scrutinized with imaging modalities in search of urological abnormalities or malformations irrespective of their symptoms . Although rare, clinicians should be aware of celiac artery aneurysms and make efforts to discover them at an early stage, even during the investigation of other diseases or symptoms . Furthermore, early treatment of unruptured celiac artery aneurysm may sometimes be required to protect rupture or mesenteric ischemia from distal embolization . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request . Hiromichi naito, atsuyoshi iida, tetsuya yumoto and kohei tsukahara contributed to the study design, data collections, data analysis, writing and review . Consents, permissions, and releases were obtained where authors wished to include case details or images of patients and any other individuals in an elsevier publication.
|
Science facilities projects require the collaboration of many different parties, and an effective coordination between these individuals leads to successful outcomes . Architects with experience in designing laboratories bring expertise and creativity as they provide their clients with a variety of issues and examples to consider as decisions are made about optimal space configurations . The success of the project is dependent upon the effective teamwork between the client, the architects, and the construction management staff . In the design phase of the process, there is a recursive aspect to the exercise, as concepts get refined and translated to actual construction documents . Although the campus planning, physical plant and administration (e.g., dean of the faculty or financial affairs) staff are critical representatives of the institution, it is also important to have faculty perspectives heard as they pertain to the evolution of the program for the building . As described below, a faculty shepherd is a desirable addition to the team . This person represents the faculty and is charged with maintaining the integrity of the program as the design and construction go forward . The opportunity to provide input into the development of new spaces comes with the responsibility to provide the lab designers with as much information as possible . Descriptions of how teaching and research are accomplished, expectations of new equipment or staffing changes, and needs and desires to have shared spaces are all important issues to raise . It is important to balance the vision for new spaces with a flexibility to seriously consider suggestions from the architects, who have the benefit of knowing designs that have worked well at other institutions . For any project, one of the first considerations is how the objectives fit into the campus curricular and strategic plans . At some campuses, there might be a master plan indicating how renovations or expansions of science facilities contribute to the strategic objectives of the institution . In some cases, specific curricular programs are considered important to develop as focal points for the science offerings . In others, increases in science enrollments have occurred or buildings that were effective years ago no longer support modern science, both in terms of the increased demand on technology or laboratories that need to be renovated for safety concerns . One common driving force for renovation of science facilities is that science education has changed over the decades . One of the main changes at many institutions is the incorporation of student research as a focal point in the way in which students learn science, either in laboratory courses or in conducting independent studies . In other cases, the changes in teaching style might not match the spaces that were appropriate for teaching in a different era . For example, in some disciplines, there is less division between laboratory and lecture; new spaces are constructed to allow for a seamless transition to both types of teaching within the same spaces . Extensive faculty discussions are critical in developing an optimal set of perspectives regarding the needs and the priorities of the spaces to be developed . A self - study serves the purpose of identifying where the opportunities and needs lie . The discussions of how to build on strengths and how to deal with weaknesses have the potential to alter the educational environment for years to come . If possible, faculty discussions across departments are helpful, particularly when incorporating the opinions of younger faculty who will benefit the most from the new spaces . Benchmarking data can be helpful to the administration and trustees as they decide on the magnitude of a project . In the case where there is a possible these data are particularly relevant to faculty when there are multiple departments involved in the project . Departments have different needs, and comparative data provide the information to enable appropriate allocation . Once the appropriate determinations of total space have been made, departments might decide to partition the space in different ways . One way to accomplish this successfully is to have a faculty member serve as the shepherd of the project . Ideally, this person would be involved in all meetings with the administration, architects, and construction professionals to represent the faculty and to be responsible for ensuring that the academic program is maintained as the many decisions occur throughout the duration of the project . As a central figure, this person serves to keep all parties informed of the progress and issues that arise . Faculty shepherds become so familiar with the different faculty and departmental needs that they can be critical in keeping important program considerations at the forefront . They provide an effective way for architects to communicate with the faculty and staff, and they assist the deans in dealing with committees and meetings that would otherwise be organized by an administrator from the dean s office or physical plant . Particularly in large projects, the constituencies that need to be involved thus, several committees are helpful to have in place, each with a specific charge . For example, a general building committee would bring together a larger number of people to review progress of the design, but a health and safety committee might be responsible for reviewing and revising the policies regarding storage of and access to chemicals . In our project at hamilton, one committee consisted of representatives of the departments or areas included in the project, and this group played a fundamental role in coordinating the deliberations within the different departments regarding their teaching and research spaces . Other items require the input from other members of the campus community who will have a significant impact on the operation of the building, including those in the maintenance, registrar, information technology, and food service areas . If there are classrooms that will serve other departments, then conversations should take place with faculty from non - science departments . It is desirable to include students on many of these committees to provide their perspective on the important and desirable features of new spaces . Many faculty members are so heavily involved in their own work that they have not had the opportunity to examine the best practices and spaces at other institutions . It is well worth the investment of time and money for them to see the most interesting projects that have been constructed . When the faculty members visit these buildings, they become aware of different approaches and come up with creative ideas of their own . Although each project has its own unique features, some general characteristics can be seen in many modern science buildings . One of the trends at small colleges has been to bring several disciplines (and sometimes all of the sciences) under one roof . This serves interdisciplinary programs particularly well, but also recognizes the fact that the traditional disciplines have blurred boundaries between each other . These arrangements benefit neuroscience programs in particular, since those students typically take courses in biology, chemistry, and psychology, and the faculty and student research sometimes requires access to equipment that is housed in different departments . Modern undergraduate science education is exciting to watch, with students engaging in laboratory work, collaborative activities, and oral presentations with attractive slides (see figures 1 and 2). Buildings are energized when the activity in the classrooms and laboratories is visible to visitors passing through the building . The presence of glass in doors and walls also provides an element of safety by allowing students to be seen from hallways . Of course, there are times when visibility is counterproductive to a particular laboratory experiment or demonstration . At hamilton, a few faculty members have covered the glass windows to their laboratories with shades . In the behavioral neuroscience testing rooms, when we are conducting experiments that require privacy, these panels are easily inserted for the times when testing is taking place . At hamilton college, offices are located near laboratories to let faculty members always be in close proximity to the student research . The teaching laboratories are also in the same areas, which makes those spaces available for use for research during summer months when they are not being used for classes . When possible, shared prep rooms and support spaces allow for efficient shared access to equipment and chemical storage . Over time, faculty members will change, curricular programs will evolve, new areas of inquiry will develop, and student course selections will differ . Over many years, the distribution of faculty might change from discipline to discipline . As part of the design process, it is useful to ask how the configuration of spaces would accommodate an additional faculty member or a faculty member with a different specialty area . One objective might be to include expansion spaces that are shared and thus not designated for any particular department . As needs change and some programs become smaller and other new ones are formed, these spaces can serve different departments at different times . Flexibility can also be incorporated into the way individual spaces are arranged . For example, for wet lab bench work, it might be useful to have a shared student - faculty research lab that serves more than one faculty member . In this way, during a semester when one faculty member needs more space and another one less, their use of the area in the laboratory can expand and retract accordingly (see figure 3). For other situations, all other things being equal, a larger number of small spaces might be more helpful than fewer spaces that are larger in size . Some neuroscience teaching laboratories have incorporated both laboratory and seminar areas in the same space, and others have had adjacent rooms configured for wet lab and seminar or computer work, thus making it easy to have students engage in both types of activities in the same class period (see figures 4 and 5). If built - in benches are not required, then sturdy but moveable tables can be considered . In teaching laboratories, this can make it easy to have different configurations from semester to semester or even from week to week (see figure 6). For those classes where reconfigurations are frequent, casters might be placed on the legs of the tables . Tables with built - in outlets and umbilical cords to connect to floor boxes keep sight lines free . Behavioral neuroscience laboratories often require lighting, curtains, and cameras that are sometimes suspended from the laboratory ceilings . They are connected to the steel structure of the building, can be configured to provide power, and have tracks to make the position of equipment easy to adjust (see figure 7). Finally, although the teaching and research areas are the focus of the attention of faculty members, there are other types of spaces that create a successful academic building . When students are asked about the spaces that are the most important for them, they place good study areas at the top of the list (see figure 8). Similarly, a science center that has a caf and attractive classrooms is used by students and faculty from all disciplines and ensures that the building serves the entire campus . Modern undergraduate science education is exciting to watch, with students engaging in laboratory work, collaborative activities, and oral presentations with attractive slides (see figures 1 and 2). Buildings are energized when the activity in the classrooms and laboratories is visible to visitors passing through the building . The presence of glass in doors and walls also provides an element of safety by allowing students to be seen from hallways . Of course, there are times when visibility is counterproductive to a particular laboratory experiment or demonstration . At hamilton, a few faculty members have covered the glass windows to their laboratories with shades . In the behavioral neuroscience testing rooms, when we are conducting experiments that require privacy, these panels are easily inserted for the times when testing is taking place . At hamilton college, offices are located near laboratories to let faculty members always be in close proximity to the student research . The teaching laboratories are also in the same areas, which makes those spaces available for use for research during summer months when they are not being used for classes . When possible, shared prep rooms and support spaces allow for efficient shared access to equipment and chemical storage . Over time, faculty members will change, curricular programs will evolve, new areas of inquiry will develop, and student course selections will differ . Over many years, the distribution of faculty might change from discipline to discipline . As part of the design process, it is useful to ask how the configuration of spaces would accommodate an additional faculty member or a faculty member with a different specialty area . One objective might be to include expansion spaces that are shared and thus not designated for any particular department . As needs change and some programs become smaller and other new ones are formed, these spaces can serve different departments at different times . For example, for wet lab bench work, it might be useful to have a shared student - faculty research lab that serves more than one faculty member . In this way, during a semester when one faculty member needs more space and another one less, their use of the area in the laboratory can expand and retract accordingly (see figure 3). For other situations, all other things being equal, a larger number of small spaces might be more helpful than fewer spaces that are larger in size . One example of this might be for spaces used for behavioral testing . Some neuroscience teaching laboratories have incorporated both laboratory and seminar areas in the same space, and others have had adjacent rooms configured for wet lab and seminar or computer work, thus making it easy to have students engage in both types of activities in the same class period (see figures 4 and 5). If built - in benches are not required, then sturdy but moveable tables can be considered . In teaching laboratories, this can make it easy to have different configurations from semester to semester or even from week to week (see figure 6). For those classes where reconfigurations are frequent tables with built - in outlets and umbilical cords to connect to floor boxes keep sight lines free . Behavioral neuroscience laboratories often require lighting, curtains, and cameras that are sometimes suspended from the laboratory ceilings . They are connected to the steel structure of the building, can be configured to provide power, and have tracks to make the position of equipment easy to adjust (see figure 7). Finally, although the teaching and research areas are the focus of the attention of faculty members, there are other types of spaces that create a successful academic building . When students are asked about the spaces that are the most important for them, they place good study areas at the top of the list (see figure 8). Similarly, a science center that has a caf and attractive classrooms is used by students and faculty from all disciplines and ensures that the building serves the entire campus . Effectively designed science facilities produce long - term benefits, not only in teaching and research, but also in admissions and in the success of the institutional mission . Although the examples and descriptions mentioned above have been in the context of large renovation and expansion projects, there are lessons that can easily be applied to small projects . It is remarkable how providing appropriate furnishings to a room can change the effectiveness of the space . Regardless of the magnitude of the projects and their eventual design features, the process is critical . When all parties become involved in the discussions, then they can all contribute constructively in the difficult choices that sometimes have to be made because of budgetary limitations . The increases in the effectiveness of the spaces and in the morale of the users can be impressive.
|
Cerebral inflammation plays an important role in the pathogenesis of secondary brain injury following traumatic brain injury (tbi) [1, 2]. Proinflammatory nuclear factor kappa b (nf-b) signaling pathway has been well documented in previous studies of our laboratory [3, 4]. Increased levels of inflammatory agents with the injured brain, including tumor necrosis factor- (tnf-), interleukin-1 (il-1), interleukin-6 (il-6), and intercellular adhesion molecule 1 (icam-1), are believed to contribute to the cerebral damage . Their mediator nf-b activation enhances the transcription of proinflammatory cytokines, and the cytokines are known to in turn activate nf-b . The positive feedback is believed to serve to amplify inflammatory signals and exacerbate brain injury after tbi . Recent researches have demonstrated that nuclear factor erythroid 2-related factor 2 (nrf2), a key transcription factor that regulates the cellular antioxidant response, plays a broader role in modulating acute inflammatory response [8, 9]. Under basal conditions, nrf2 is sequestered in the cytoplasm by the cytosolic regulatory protein keap1 . In conditions of oxidative or xenobiotic stress, nrf2 translocates from the cytoplasm to the nucleus, and sequentially binds to a promoter sequence called the antioxidant response element (are), resulting in a cytoprotective response which is characterized by upregulation of a group of antioxidant enzymes and decreased sensitivity to oxidative damage [1012]. These antioxidant enzymes have also been shown to protect cells against acute inflammatory response . Numerous studies have reported that nrf2 plays a critical role in counteracting inflammation in a variety of experimental models . Nrf2 protects against allergen - mediated airway inflammation, cigarette smoke - induced emphysema, dextran sulfate sodium (dss)-mediated colitis, inflammation - mediated colonic tumorigenesis, and inflammatory responses during skin wound healing . Furthermore, nrf2 has also been reported as a crucial regulator of the innate immune response and survival during experimental sepsis . In one of our previous studies therefore, it may be reasonable to postulate that nrf2 plays an important role in limiting the cerebral inflammatory response after tbi . In our study, we evaluated the influence of nrf2 genotype on the cerebral upregulation of nf-b activity, proinflammatory cytokine, and icam-1 after tbi . Our experiments were conformed to guide for the care and use of laboratory animals from national institutes of health and approved by the animal care and use committee of nanjing university . Thomas w. kensler (johns hopkins university, baltimore, md, usa). Homozygous wild - type nrf2 (+ /+) and nrf2 (/)-deficient mice were generated from inbred heterozygous nrf2 (+ /) mice . Genotypes of nrf2 (+ /+) and nrf2 (/) mice were confirmed by pcr amplification of genomic dna isolated from the blood . Pcr amplification was carried out by using three different primers, 5-tggacgggactattgaaggctg-3 (sense for both genotypes), 5-cgccttttcagtagatggagg-3 (antisense for wild - type), and 5-gcggattgaccgtaatgggatagg-3 (antisense for lacz). Age- and weight - matched adult male mice (68 weeks, 2832 g) were separated into four groups (n = 10 per group): group i, sham wild - type (nrf2 + /+); group ii, injured wild - type (nrf2 + /+); group iii, sham - deficient (nrf2 /); group iv, injured - deficient (nrf2 /). The mice of sham and injured groups were subjected to identical anesthetic alone or experimental tbi, respectively . Five mice in each group were sacrificed for electrophoretic mobility shift assay (emsa) and enzyme - linked immunosorbent assay (elisa) analysis and the others were for immunohistochemistry study . The mouse model of tbi was employed as described with recent minor modification . The mice were anesthetized by intraperitoneal injection with sodium pentobarbital (50 mg / kg). A round, flat, and 6 mm diameter teflon impounder was centered between the ears and eyes . Tbi was induced by a 100 g weight dropped from a 12 cm height along a stainless steel string, which translated into 1200 g / cm . Brain injury - induced apnea was then treated for 3 minutes with 100% oxygen administration and chest compression to stimulate the respiration . This model is generally associated with 20% of mortality within the first 5 minutes postinjury and no delayed mortality was observed thereafter . Heart rate, arterial blood pressure, and rectal temperature were monitored, and the rectal temperature was kept at 37 0.5c (physical cooling if required) throughout experiments . At the 24 hours following sham or injury, cortex tissue was rapidly taken from the fresh brain at the site of lesion (figure 1), and stored in liquid nitrogen immediately . For immunohistochemistry, mice were perfused with cold saline (4c), followed by 4% neutral - buffered formalin . The cortex tissue was taken, stored overnight in 4% neutral - buffered formalin, and then embedded in paraffin . Briefly, frozen brain samples were homogenized in 0.8 ml ice - cold buffer a composed of 10 mmol / l hepes ph 7.9, 10 mmol / l kcl, 2 mmol / l mgcl2, 0.1 mmol / l edta, 1 mmol / l dithiothreitol (dtt), and 0.5 mmol / l phenylmethylsulfonyl fluoride (pmsf) (all from sigma chemical co., st . Louis, mo, usa). The homogenates were incubated on ice for 30 minutes and vortexed for 30 seconds after addition of 50 l 10% np-40 (sigma chemical co., mo, usa). The mixture was then centrifuged for 10 minutes (5000 g, 4c). The pellet was suspended in 100 l ice - cold buffer b composed of 50 mmol / l hepes ph 7.9, 50 mmol / l kcl, 300 mm nacl, 0.1 mmol / l edta, 1 mmol / ldtt, and 0.5 mmol / l pmsf, and 10% (v / v) glycerol and incubated on ice 30 minutes with frequent mixing . After centrifugation (12000 g, 4c) for 15 minutes, the supernatants were collected as nuclear extracts and stored at 70c for further use . Protein concentration was determined using a bicinchoninic acid assay kit with bovine serum albumin as the standard (pierce biochemicals, rockford, ill, usa). Emsa was performed using a commercial kit (gel shift assay system; promega, madison, wis, usa) following the methods in our laboratory . Consensus oligonucleotide probe (5-agttga ggggactttcccaggc-3) was end - labeled with [-p]atp (free biotech ., nuclear protein (10 g) was preincubated in a total volume of 9 l in a binding buffer, consisting of 10 mmol / l tris - hcl (ph 7.5), 4% glycerol, 1 mmol / l mgcl2, 0.5 mmol / l m edta, 0.5 mmol g / l poly-(deoxyinosinic - deoxycytidylic acid) for 15 minutes at room temperature . After addition of the 1 l p - labled oligonucleotide probe, the incubation was continued for 20 minutes at room temperature . Reaction was stopped by adding 1 l of gel loading buffer and the mixture was subjected to nondenaturing 4% polyacrylamide gel electrophoresis in 0.5 tbe buffer (tris - borate - edta). After electrophoresis was conducted at 390 v for 1 hour, the gel was vacuum - dried and exposed to x - ray film (fuji hyperfilm, tokyo, japan) at 70c with an intensifying screed . Levels of nf-b dna binding activity were quantified by computer - assisted densitometric analysis . Frozen brain samples were homogenized in 1 ml of buffer containing 1 mmol / l of pmsf, 1 mg / l of pepstatin a, 1 mg / l of aprotinin, and 1 mg / l of leupeptin in pbs solution (ph 7.2) with a glass homogenizer and then centrifuged at 12000 g for 20 minutes at 4c . The supernatant was then collected and total protein was determined by the bradford method . The levels of inflammatory cytokines were quantified using enzyme - linked immunosorbent assay (elisa) kits specific for mouse according to the manufacturers' instructions (tnf- from diaclone research, france; il-1, il-6 from biosource europe sa, belgium) and previous study of our laboratory . The paraffin - embedded sections (4 m) were used for immunohistochemical assay, which was performed with a goat antimouse icam-1(cd54) antibody (diluted 1:200, r&d systems, inc ., minn, usa), according to previous studies of our laboratory . The sections were incubated with the diluted antibody overnight at 4c in a humid chamber, washed, and blocked with 1.6% h2o2 in phosphate - buffered saline (pbs) for 10 minutes . After washing with pbs again, sections were then incubated with biotinylated second antibodies for 1 hour at room temperature . Diaminobenzidine (dab) was used as chromogen and counterstaining was done with hematoxylin . The number of positive microvessels in each section was counted in 10 microscopic fields (at 100 magnifications) and averaged for the positively immunostained vessel number of per visual field . All data were expressed as mean sem, student's t - test was used to analyze the differences between the sham and tbi groups within a single genotype as well as between genotypes . Nf-b activation in the nuclear extracts was assessed by emsa . As shown in figure 2, low nf-b banding activity (weak emsa autoradiography) tbi induced activation of nf-b in the cortex of both nrf2 (+ /+) and nrf2 (/) mice . Nrf2 (/) mice showed an increased susceptibility to tbi - induced activation of nf-b than their wild - type nrf2 (+ /+) counterparts . Concentrations of tnf-, il-1, and il-6 in the brain samples were measured by elisa . As shown in figure 3, low concentrations of tnf-, il-1, and il-6 tbi induced upregulation of tnf-, il-1, and il-6 in the cortex of both nrf2 (+ /+) and nrf2 (/) mice . Nrf2 (/) mice showed larger increase in cortical levels of tnf-, il-1, and il-6 than their wild - type nrf2 (+ /+) littermates after tbi . For assessment of the expression of icam - a in the brain after tbi, immunohistochemical study for icam-1 was performed . As shown in figure 4, few icam-1-immunostained cerebral microvessels were observed in sham - operated mice of both genotypes . At the 24 hours after tbi, the number of icam-1 positive vessels was significantly increased in the cortex of both nrf2 (+ /+) and nrf2 (/) mice . Nrf2 (/) mice showed larger increase in the number of icam-1 positive vessels than their wild - type nrf2 (+ /+) littermates after tbi . The most important finding of this study is that nrf2 (/) mice had more inflammatory cytokines tnf-, il-1 and il-6 production, icam-1 expression, and their mediator nf-b activation in brain after tbi compared with their wild - type nrf2 (+ /+) counterparts . These findings reported here suggest for the first time that nrf2 may play an important role in limiting the cerebral inflammatory response after tbi through modulating the proinflammatory nuclear factor kappa b (nf-b) signaling pathway . Activation of nf-b signaling pathway has been shown to be central to the pathophysiology of cerebral inflammatory response induced by tbi [6, 7]. Nf-b can be activated by lesion - induced oxidative stress, bacterial endotoxin, and cytokines . The functional importance of nf-b in inflammation is based on its ability to regulate the promoters of multiple inflammatory genes, including tnf-, il-1, il-6, and icam-1 . Tnf- is reported to be a major initiator of inflammation and is released early after an inflammatory stimulus . Il-6 is increased after tnf- and is considered to be an important proinflammatory cytokine in contribution to both morbidity and mortality in condition of uncontrolled inflammation . Icam-1, a member of the immunoglobulin superfamily which can be profound induced after cytokine challenge, is important in the recruitment of leukocytes during the inflammatory process . This inflammatory agent network is believed to be important in the generation of acute inflammatory response . Nf-b activation enhances the transcription of proinflammatory cytokines, and the cytokines are known to in turn activate nf-b . The positive feedback is believed to serve to amplify inflammatory signals and exacerbate brain injury after tbi . In the present study, we evaluated the influence of nrf2 genotype in the tbi - induced activation of proinflammatory nf-b signaling pathway in the brain . The results showed that disruption of nrf2 in mice caused a greater activation of nf-b signaling pathway which played a critical role in the pathophysiology of cerebral inflammatory response induced by tbi . The observed interplay between nrf2 and nf-b signaling corresponds well to the results of study on experimental sepsis, which have demonstrated that nrf2-deficient mice displayed increased nf-b activation in response to lipopolysaccharide (lps). Although numerous in vivo studies have reported that nrf2 plays a critical role in counteracting the inflammation in a variety of experimental models [1419], the findings which we have confirmed and extended in the model of tbi in the present study, the precise mechanism underlying this network is still unclear . Several lines of evidence suggest that nrf2 regulates the inflammatory response by inhibiting proinflammatory nf-b activation through maintenance of redox homeostasis . Oxidative stress from reactive oxygen species (ros) is believed to be involved in the progression of secondary brain injury following tbi . Activation of the nf-b signaling pathway has been shown to be responsive to excess ros and is important in the generation of inflammation . Nrf2, as a key antioxidant transcription factor involved in the intracellular antioxidant defense systems, has been shown to play an important role in limiting ros levels and thereby affect redox - sensitive nf-b signaling pathway involved in the inflammation [8, 1012]. The protective function of nrf2 is mainly mediated by a group of nrf2-regulated antioxidant and detoxifying enzymes . Therefore, the augmentation of cellular antioxidative or detoxification systems via activation of nrf2-regulated enzymes resulting in decreased proinflammatory cytokines production and adhesion molecules expression via inactivation of nf-b represents a possible anti - inflammatory mechanism for the attenuated inflammatory response seen in brains from nrf2 (+ /+) mice but not nrf2 (/) mice after tbi . We then in this study postulated that nrf2 regulates the tbi - induced cerebral inflammatory response may at least in part through modulating the cerebral redox status and proinflammatory nf-b signaling pathway . Additional work is necessary to elucidate the whole mechanisms involved in these complicated networks . In summary, this present study showed that nrf2 plays a protective role in tbi - induced cerebral upregulation of inflammatory agents in mice . We found that nrf2 (/) mice are more susceptible to tbi - induced cerebral nf-b activation, inflammatory cytokine tnf-, il-1 and il-6 production, and icam-1 expression, which then contributed to exacerbated brain injury after tbi . To the best of our knowledge, this is the first study that elucidates the interplay between nrf2 and proinflammatory nf-b signaling pathway in the brain following tbi . These findings raise the possibility that nrf2 will be a new therapeutic target for the treatment tbi.
|
Mucoceles of the appendix are uncommon, accounting for only 0.2 to 0.3% of appendectomy specimens . An appendiceal mucocele is a cystic dilatation of the appendiceal lumen by accumulation of mucus, and may include mucosal hyperplasia, a mucinous cystadenoma, or a mucinous cystadenocarcinoma . Frequently, the diagnosis of an appendiceal mucocele is made post - operatively because the manifestations are similar to appendicitis . Laparoscopic appendectomy is widely used for the treatment of appendicitis, but laparoscopic resection of appendiceal mucoceles is not routine . We recently managed two large appendiceal mucoceles by laparoscopic resection and report our technique herein . A 44-year - old woman sought evaluation from a gynecologist for a palpable right lower quadrant mass . The abdominal mass was found incidentally while bathing 2 months ago, and has persisted . The blood chemistries and other laboratory findings were normal . A computed tomography (ct) scan and ultrasonography of the abdomen showed a 14 5 4.5 cm cystic mass arising from the cecum (fig . The patient was referred to the department of general surgery, where we discussed the surgical options and recommended a laparoscopic resection . An 81-year - old man had a palpable right lower quadrant mass of 2 months duration and severe headaches . Brain and abdominal ct scans revealed a chronic subdural hematoma and a large, tubular, cystic appendiceal mucocele, 15 4.5 4 cm in size . After evacuation of the subdural hematoma, a laparoscopic mucocelectomy was performed 1 month later . Because the laparoscopic procedure for cases 1 and 2 was similar, only case 1 is presented in detail . After the induction of general anesthesia, a 10-mm trocar was placed through a supraumbilical incision using the open hasson technique because of the previous infraumbilical incision for the laparoscopic tubal ligation . A pneumoperitoneum was made by insufflation of carbon dioxide through the supraumbilical trocar to a pressure of 13 mmhg . One 12-mm trocar for the primary surgeon was inserted in the left lower quadrant of the abdomen . A freely - movable a 10-mm suprapubic trocar was inserted for retraction of the mucocele during the dissection and for extraction of the specimen (fig . 3). To clear the small intestine from the surgical field, the patient was placed in the left decubitus and reverse trendelenberg position . A laparoscopic bag was used for handling the mucocele because the surface of the mucocele was too slippery and tense to grasp . The primary surgeon manipulated the mucocele with the use of gravity and the laparoscopic bag wrapping the body of the mucocele, thereby reducing the risk of perforation and possible intraperitoneal spillage of mucinous content (fig . 4). Mobilization of the cecum from the lateral wall and division of the mesoappendix were performed using an ultrasurgical device (harmonic scalpel, ethicon endo - surgery, cincinnati, oh, usa). Because there was no segment of normal appendix, the base of the cecum was resected with the mucocele . Another instrument was needed to retract the ascending colon and terminal ileum during this procedure, thus another trocar site was placed in the right upper quadrant . The mucocele was moved to in the caudal direction by the laparoscopic bag, then an endoscopic stapling device (multifire endo gia, 60 mm; us surgical co., norwalk, ct, usa) was used to perform the partial resection of cecum . The specimen (fig . 5) was extracted through the suprapubic incision extended from the suprapubic trocar site and sent to a histopathologist . Frozen and permanent histopathologic evaluations of the appendicial mucocele were reported as a mucinous cystadenoma . A 44-year - old woman sought evaluation from a gynecologist for a palpable right lower quadrant mass . The abdominal mass was found incidentally while bathing 2 months ago, and has persisted . The blood chemistries and other laboratory findings were normal . A computed tomography (ct) scan and ultrasonography of the abdomen showed a 14 5 4.5 cm cystic mass arising from the cecum (fig . The patient was referred to the department of general surgery, where we discussed the surgical options and recommended a laparoscopic resection . An 81-year - old man had a palpable right lower quadrant mass of 2 months duration and severe headaches . Brain and abdominal ct scans revealed a chronic subdural hematoma and a large, tubular, cystic appendiceal mucocele, 15 4.5 4 cm in size . After evacuation of the subdural hematoma, a laparoscopic mucocelectomy was performed 1 month later . Because the laparoscopic procedure for cases 1 and 2 was similar, only case 1 is presented in detail . After the induction of general anesthesia, a 10-mm trocar was placed through a supraumbilical incision using the open hasson technique because of the previous infraumbilical incision for the laparoscopic tubal ligation . A pneumoperitoneum was made by insufflation of carbon dioxide through the supraumbilical trocar to a pressure of 13 mmhg . One 12-mm trocar for the primary surgeon was inserted in the left lower quadrant of the abdomen . A freely - movable a 10-mm suprapubic trocar was inserted for retraction of the mucocele during the dissection and for extraction of the specimen (fig . 3). To clear the small intestine from the surgical field, the patient was placed in the left decubitus and reverse trendelenberg position . A laparoscopic bag was used for handling the mucocele because the surface of the mucocele was too slippery and tense to grasp . The primary surgeon manipulated the mucocele with the use of gravity and the laparoscopic bag wrapping the body of the mucocele, thereby reducing the risk of perforation and possible intraperitoneal spillage of mucinous content (fig . 4). Mobilization of the cecum from the lateral wall and division of the mesoappendix were performed using an ultrasurgical device (harmonic scalpel, ethicon endo - surgery, cincinnati, oh, usa). Because there was no segment of normal appendix, the base of the cecum was resected with the mucocele . Another instrument was needed to retract the ascending colon and terminal ileum during this procedure, thus another trocar site was placed in the right upper quadrant . The mucocele was moved to in the caudal direction by the laparoscopic bag, then an endoscopic stapling device (multifire endo gia, 60 mm; us surgical co., norwalk, ct, usa) was used to perform the partial resection of cecum . The specimen (fig . 5) was extracted through the suprapubic incision extended from the suprapubic trocar site and sent to a histopathologist . Frozen and permanent histopathologic evaluations of the appendicial mucocele were reported as a mucinous cystadenoma . The neoplastic variety of a mucocele occurs from distention of the appendiceal lumen by mucus secreted from proliferating tumor cells . The benign form of a mucocele is a mucinous cystadenoma and the malignant form is a mucinous cystadenocarcinoma . These lesions secrete an excess of mucus while blocking outflow into the cecum, thus creating a distended appendix . The pre - operative diagnosis of an appendiceal mucocele is difficult due to the non - specific nature of the findings . The classic clinical features of an obstructive appendiceal mucocele includes right lower quadrant discomfort, a palpable mass, and x - ray findings of a filling defect in the cecum with non - visualization of the appendix . On ct and ultrasonography, a nodular, enhancing lesion in the wall of the mucocele is suggestive of malignant disease . Sometimes, it is asymptomatic and discovered incidentally at surgery or during imaging evaluation for another disease . If a mucocele is found, therapy is surgical . The appropriate type of surgical treatment is related to the dimensions and the histology of the mucocele . An appendectomy is used for simple mucoceles or cystadenomas when the appendiceal base is intact . Cecal resection is indicated for cystadenomas with a large base, and a right hemicolectomy is recommended for cystadenocarcinomas . The 10-year survival of patients with mucinous cystadenocarcinomas is 65% among patients treated by hemicolectomy, but only 37% among patients treated by appendectomy alone . While several cases of laparoscopic treatment of appendiceal mucoceles have been reported [4 - 8], many authors suggest that the laparoscopic approach should be avoided because of the increased risk of rupture and subsequent pseudomyxoma peritonei . Pseudomyxoma peritonei is caused by spillage and implantation of mucin - secreting cells into the peritoneal cavity . Thus, we reasoned that the complication rate of pseudomyxoma peritonei during laparoscopic surgery would be the same as that of open surgery if a minimal - touch technique was utilized . Reported the laparoscopic resection of a 12 cm large mucocele using gravity and position during minimal manipulation of the lesion . Also reported successful laparoscopic resection of an appendiceal mucocele and suggested that conversion to a laparotomy should be considered if the lesion is grasped traumatically or if the tumor clearly extends beyond the appendix . Recently, chiu et al . Presented a case involving the successful laparoscopic resection of an 8 cm appendiceal mucinous cystadenoma . Gonzlez moreno et al . Reported a case of an appendiceal mucinous tumor resected by laparoscopy associated with subsequent diffuse peritoneal carcinomatosis . They suggested that if distention of the appendiceal lumen is observed laparoscopically, suggesting a mucocele as a possible diagnosis, conversion to open appendectomy may be the most prudent surgical judgment . We performed laparoscopic resections of two appendiceal mucoceles using a laparoscopic bag to retain and retract the mucocele, in addition to using gravity and position, therefore we avoided grasping the tumor directly . The application of laparoscopic surgery has been more widely adopted in the treatment of gastrointestinal diseases, and in some cases laparoscopic surgery is currently the standard treatment . In the surgical treatment of appendiceal mucoceles, however, open surgery is currently the standard surgical treatment due to its well - known safety and easy accessibility . The authors are also aware of the possibility of rupture during laparoscopic dissection, and the subsequent fatal complication of pseudomyxoma peritonei . Nevertheless, if we can handle the tissue with minimal manipulation, and can secure enough safety by using various laparoscopic instruments, laparoscopic resection of an appendiceal mucocele might be an alternative surgical option to open surgery.
|
Data were collected during routine care from specialized diabetes centers in germany and austria by means of a computerized documentation called the diabetes prospective documentation initiative (diabetes patienten verlaufsdokumentation [dpv]). The dpv register started in 1995 in germany on a nationwide basis . For quality management, all centers use the same computer - based program for continuous documentation of treatment and outcome (16). Three - hundred thirty - five diabetes centers (including eight centers from austria) contributed to this analysis . Participating centers transmit anonymous, standardized, prospective data from all their diabetic patients for central validation, benchmarking, and research twice per year to the central administrative unit in ulm (germany). To ensure optimal data plausibility, all inconsistent data are reported back to the respective centers for correction every 6 months (16). Sex, age, diabetes duration, type of diabetes, migration background, bmi, height, weight, insulin requirement, and number of severe hypoglycemia and hba1c levels are documented . By march 2011, the total number of patient visits documented in the system was 2,008,389 from 242,153 diabetic patients . Total number of pediatric patient visits (younger than 20 years of age) was 870,531 from 51,307 patients; 48,368 (94%) of these patients had t1 dm, 864 (2%) had type 2 diabetes mellitus (t2 dm), and 1,930 (4%) had other types of diabetes mellitus . Analyses based on the last 12 months of care documented in each patient for 47,227 patients who fulfilled the inclusion criteria with complete data and a pediatric onset (younger than 20 years of age) of either cfrd (n = 381) or t1 dm (n = 46.846) were performed . Only records from patients 21 years of age or younger at the time of the visits were included . Migration background was defined as at least one parent not born in germany or austria . In addition, a subpopulation of patients with complete data was observed during the first (total: n = 8,805; cfrd: n = 163; t1 dm: n = 8,642) or fifth year (total: n = 6,335; cfrd: n = 42; t1 dm: n = 6,293) of diabetes . Height and weight standard deviation scores (sds) were calculated using contemporary, officially recommended national reference data for german children from kromeyer - hauschild (17). Definitions of underweight, overweight, and obesity in children and adolescents were based on bmi as follows: bmi values> 90th percentile for age and sex were defined as overweight; bmi values> 97th percentile were defined as obesity; and bmi values> 99th percentile were defined as extreme obesity . Bmi values <10th percentile for age and sex were considered underweight (18). Arterial hypertension was defined as blood pressure> 95th percentile according to the american heart association s normal values (19). Hba1c measurements from different centers were mathematically standardized to the diabetes control and complications trial reference range of 4.056.05% using the multiple of the mean method (20). Treatment regimen was categorized as insulin therapy alone, use of oral antidiabetic drugs (sulphonylureas, glinides with or without insulin), or nonpharmacological treatment with lifestyle modification only . Insulin therapy was documented as the number of daily injections or continuous subcutaneous insulin infusion (csii), daily insulin dose per kilogram of body weight, and the use of long - acting or rapid - acting insulin analogs . Data were analyzed using the sas statistical software package (version 9.3; sas institute inc ., binary variables were compared by test . Because multiple tests were performed, p values were adjusted using the bonferroni step - down correction (method of holm). To adjust for confounding effects of age, sex, and diabetes duration, multivariable mixed regression analysis was applied including a random term for treatment center in the model with cholesky covariance structure . 1), data of hba1c and bmi were calculated for a typical patient with chronological age of 15 years and 2 years of diabetes, assuming equal sex distribution . Data of hba1c and bmi calculated for a typical patient with chronological age of 15 years and 2 years of diabetes, with equal sex distribution . Data were collected during routine care from specialized diabetes centers in germany and austria by means of a computerized documentation called the diabetes prospective documentation initiative (diabetes patienten verlaufsdokumentation [dpv]). The dpv register started in 1995 in germany on a nationwide basis . For quality management, all centers use the same computer - based program for continuous documentation of treatment and outcome (16). Three - hundred thirty - five diabetes centers (including eight centers from austria) contributed to this analysis . Participating centers transmit anonymous, standardized, prospective data from all their diabetic patients for central validation, benchmarking, and research twice per year to the central administrative unit in ulm (germany). To ensure optimal data plausibility, all inconsistent data are reported back to the respective centers for correction every 6 months (16). Sex, age, diabetes duration, type of diabetes, migration background, bmi, height, weight, insulin requirement, and number of severe hypoglycemia and hba1c levels are documented . By march 2011, the total number of patient visits documented in the system was 2,008,389 from 242,153 diabetic patients . Total number of pediatric patient visits (younger than 20 years of age) was 870,531 from 51,307 patients; 48,368 (94%) of these patients had t1 dm, 864 (2%) had type 2 diabetes mellitus (t2 dm), and 1,930 (4%) had other types of diabetes mellitus . Analyses based on the last 12 months of care documented in each patient for 47,227 patients who fulfilled the inclusion criteria with complete data and a pediatric onset (younger than 20 years of age) of either cfrd (n = 381) or t1 dm (n = 46.846) were performed . Only records from patients 21 years of age or younger at the time of the visits were included . Migration background was defined as at least one parent not born in germany or austria . In addition, a subpopulation of patients with complete data was observed during the first (total: n = 8,805; cfrd: n = 163; t1 dm: n = 8,642) or fifth year (total: n = 6,335; cfrd: n = 42; t1 dm: n = 6,293) of diabetes . Height and weight standard deviation scores (sds) were calculated using contemporary, officially recommended national reference data for german children from kromeyer - hauschild (17). Definitions of underweight, overweight, and obesity in children and adolescents were based on bmi as follows: bmi values> 90th percentile for age and sex were defined as overweight; bmi values> 97th percentile were defined as obesity; and bmi values> 99th percentile were defined as extreme obesity . Bmi values <10th percentile for age and sex were considered underweight (18). Arterial hypertension was defined as blood pressure> 95th percentile according to the american heart association s normal values (19). Hba1c measurements from different centers were mathematically standardized to the diabetes control and complications trial reference range of 4.056.05% using the multiple of the mean method (20). Treatment regimen was categorized as insulin therapy alone, use of oral antidiabetic drugs (sulphonylureas, glinides with or without insulin), or nonpharmacological treatment with lifestyle modification only . Insulin therapy was documented as the number of daily injections or continuous subcutaneous insulin infusion (csii), daily insulin dose per kilogram of body weight, and the use of long - acting or rapid - acting insulin analogs . Data were analyzed using the sas statistical software package (version 9.3; sas institute inc ., binary variables were compared by test . Because multiple tests were performed, p values were adjusted using the bonferroni step - down correction (method of holm). To adjust for confounding effects of age, sex, and diabetes duration, multivariable mixed regression analysis was applied including a random term for treatment center in the model with cholesky covariance structure . 1), data of hba1c and bmi were calculated for a typical patient with chronological age of 15 years and 2 years of diabetes, assuming equal sex distribution . Data of hba1c and bmi calculated for a typical patient with chronological age of 15 years and 2 years of diabetes, with equal sex distribution . Anthropometric and clinical data of pediatric patients with cfrd or t1 dm are given in table 1 . Diabetes diagnosis was 6 years later in cfrd patients, 14.5 years (quartile 1quartile 3: 11.816.3) compared with t1 dm, 8.5 years (quartile 1quartile 3: 4.911.8) (p <0.001). A female preponderance was found for cfrd, 59.1% were female compared with 47.5% with t1 dm (p <0.001). There was no significant difference between groups for migration background (t1 dm, 15%; cfrd, 14%; p = 1.0). Cfrd patients were shorter (height sds, 1.30; 2.25 to 0.43) and had lower body weight (weight sds, 1.51; 2.49 to 0.68), resulting in a lower bmi (bmi sds, 0.85; 1.59 to 0.12) compared with t1 dm patients (height sds, 0.04; 0.72 to + 0.63; weight sds: + 0.43; 0.23 to + 1.09; bmi sds, + 0.52; 0.10 to + 1.16; all p <0.001). The rates of overweight and obesity were higher in t1 dm, with 2% of patients being extremely obese, 6% obese, 13% overweight, and only 79% of patients with normal weight . In comparison, none of the cfrd patients was extremely obese or obese, and just 1.3% of cfrd patients were overweight . In contrast, the rate of underweight was significantly higher in the cf group (31.5% vs. 3% in t1 dm). Demographic data and clinical characteristics for young t1 dm and cfrd patients glycemic control, measured by hba1c, was better in cfrd than in t1 dm (6.87% [6.008.30%] vs. 7.97% [7.119.20%]; p <0.001). There were no significant differences between the two groups with regard to diabetes complications such as retinopathy (t1 dm 1.7% vs. cfrd 3.0%; not significant) or nephropathy (t1 dm 12.6% vs. cfrd 7.7%; not significant), but 26% of t1 dm patients were hypertensive compared with only 9.7% in the cfrd group (p <0.001). Data on diabetic ketoacidosis (dka) and initial blood glucose at diabetes onset also were analyzed . None of the cfrd patients presented with ketoacidosis (ph <7.3), whereas 17% of patients with t1 dm presented with dka . Blood glucose levels at diabetes onset were documented for 35,395 patients with t1 dm and 267 cfrd patients . We found significant differences with blood glucose levels of 249 mg / dl (180.0331.0) in t1 dm and 194.0 (126.0272.0) in cfrd at diagnosis of diabetes (p <0.001). In addition, subpopulations of our patients were observed 1 year (n = 8,805) or 5 (n = 6,335) years after the diagnosis of diabetes . After 1 year of diabetes, cfrd patients also had lower hba1c (6.46% [5.847.43%] vs. 7.68% [6.70 9.30%];p <0.0001), were shorter (height sds: 1.16 [2.09 to 0.33]), and had lower body weight (weight sds: 1.61 [2.57 to 0.69]), resulting in a lower bmi (bmi sds, 1.02 [1.93 to 0.27]) compared with t1 dm patients (height sds, 0.11 [0.53 to 0.77]; weight sds, 0.26 [0.42 to 0.95]; bmi sds, 0.26 [0.40 to 0.96]; all p <0.0001). Differences in auxological parameters persist 5 years after the diagnosis of diabetes with height sds of 1.60 (2.84 to 0.69), weight sds of 1.73 (2.51 to 0.83), and bmi sds of 0.92 (1.63 to 0.40) in cfrd compared with t1 dm (height sds, 0.01 [0.67 to 0.65]; weight sds, 0.48 [0.14 to 1.11]; bmi sds, 0.57 [0.01 to 1.17], all p = 0.0001). Glycemic control, measured by hba1c, becomes similar in both groups after 5 years (cfrd 7.88% [6.679.40%] vs. t1 dm 7.89% [7.108.93%]). However, after adjustment for age and sex, a difference in hba1c was still present (cfrd 7.81 vs. t1 dm 8.36; p <0.05). All patients with t1 dm received insulin therapy (99.4% insulin alone, 0.6% in combination with metformin), whereas in cfrd 72% of patients were treated with insulin (67% insulin alone, 5% in combination with oad; p <0.001). In insulin - treated patients with t1 dm, 12% were treated with conventional therapy (one to three injections per day), 64% were treated with multiple injections (four to eight injections per day), and 23% were treated with csii . In insulin - treated patients with cfrd, 41% received conventional therapy, 54% received multiple injections of insulin, and only 5% were treated with csii (p <0.001). Fast - acting insulin analogs were used more frequently in t1 dm patients (47% vs. 39%; p <0.05). Similarly, the use of long - acting insulin analogs was significantly more frequent in t1 dm than in cfrd (37% vs. 28%; p <0.01). Treatment modalities and control in cfrd compared with t1 dm in pediatric patients insulin dose per kilogram of body weight, analyzed without adjusting for confounding effects, did not differ significantly between the two groups (t1 dm 0.82 [0.65 1.02] vs. cfrd 0.80 [0.40 1.14]; not significant). However, after adjustment for age, sex, and diabetes duration, a significant difference was present (t1 dm 0.79 vs. cfrd 0.83; p <0.05). In the cfrd group, oral antidiabetic agents (sulfonylureas, glinides) alone were used by 8% of the patients; 20% of the cfrd patients were treated with nonpharmacological therapy only (lifestyle intervention). T1 dm patients had received systemic steroids as a comedication during the course of their disease (p <0.001). Out of 46,846 patients with t1 dm, 73% were treated in diabetes centers with> 100 patients compared with 62% of 381 patients with cfrd (p <0.001). After adjustment for sex, age, and diabetes duration, this difference was no longer present (t1 dm 56.2% vs. cfrd 55.9%; not significant). In cfrd, 70% of all patients were treated at universities; however, for t1 dm only 31% of all patients were treated at universities (p <0.001). Significant differences were also found for self - monitoring of blood glucose (smbg) per day (t1 dm, 4.6; cfrd, 3.7; p <0.001) and number of visits per year (t1 dm, 3.30; cfrd, 2.12; p <0.001). In addition, we investigated differences with regard to metabolic control and bmi in cfrd patients treated with or without insulin . The corrected p values for hba1c showed significant differences, with better metabolic control in patients without insulin therapy compared with cfrd patients with insulin treatment (hba1c, 6.00% [5.566.76%] vs. 7.12% [6.148.67%]; p <0.001). However, duration of disease was significant shorter in patients without insulin treatment: 0.8 years (0.12.4) compared with 2.4 years (0.64.6; p <0.001). There was no significant difference for bmi sds between patients without insulin (bmi sds, 0.78 [1.58 to 0.12]) compared with insulin - treated patients with cfrd (bmi sds, 0.85 [1.61 to 0.12]). If not otherwise stated, then all described differences could be confirmed after data were adjusted for confounding effects of age, sex, and diabetes duration . Demographic data and clinical characteristics for young cfrd patients with and without insulin treatment all patients with t1 dm received insulin 1 year and 5 years after diabetes diagnosis . In the cfrd group, this percentage increased 5 years after diagnosis, when 88% of cfrd patients were treated with insulin . Insulin dose per kilogram of body weight, adjusted for age and sex, did not differ significantly between the groups (1 year: cfrd 0.69 vs. t1 dm 0.67; 5 years: cfrd 0.95 vs. t1 dm 0.90; both not significant). In both groups, insulin pump therapy and multiple daily injections were used more often 5 years after diagnosis compared with the first treatment year . In insulin - treated patients with t1 dm, 23.3% were treated with conventional therapy, 66% were treated with multiple daily injections, and 10.7% were treated with csii 1 year after diabetes diagnosis . After 5 years of diabetes, only 9.6% of t1 dm patients were treated with conventional therapy, 63.3% were treated with multiple daily injections, and 27.1% were treated with csii . One year after diabetes diagnosis, 59% of patients were treated with insulin, 25.2% of all patients were treated with conventional therapy, 33.1% were treated with multiple daily injections, and 6% were treated with csii . Five years after diagnosis, 88.1% of cfrd patients were treated with insulin, 33.3% were treated with conventional therapy, 52.4% were treated with multiple daily injections, and 24% were treated with csii . Similar to changes in insulin injections, use of short - acting and long - acting insulin analogs increased during the first 5 years of diabetes . In both t1 dm and cfrd, insulin analogs were used more often 5 years after diagnosis (short - acting: cfrd 45.9% vs. t1 dm 52.5%; long - acting: cfrd 40.5% vs. t1 dm 34.8; not significant) compared with the first year (short - acting: cfrd 40.1% vs. t1 dm 35.1%; long - acting: cfrd 18.8% vs. t1 dm 20.0%; not significant). Anthropometric and clinical data of pediatric patients with cfrd or t1 dm are given in table 1 . Diabetes diagnosis was 6 years later in cfrd patients, 14.5 years (quartile 1quartile 3: 11.816.3) compared with t1 dm, 8.5 years (quartile 1quartile 3: 4.911.8) (p <0.001). A female preponderance was found for cfrd, 59.1% were female compared with 47.5% with t1 dm (p <0.001). There was no significant difference between groups for migration background (t1 dm, 15%; cfrd, 14%; p = 1.0). Cfrd patients were shorter (height sds, 1.30; 2.25 to 0.43) and had lower body weight (weight sds, 1.51; 2.49 to 0.68), resulting in a lower bmi (bmi sds, 0.85; 1.59 to 0.12) compared with t1 dm patients (height sds, 0.04; 0.72 to + 0.63; weight sds: + 0.43; 0.23 to + 1.09; bmi sds, + 0.52; 0.10 to + 1.16; all p <0.001). The rates of overweight and obesity were higher in t1 dm, with 2% of patients being extremely obese, 6% obese, 13% overweight, and only 79% of patients with normal weight . In comparison, none of the cfrd patients was extremely obese or obese, and just 1.3% of cfrd patients were overweight . In contrast, the rate of underweight was significantly higher in the cf group (31.5% vs. 3% in t1 dm). Demographic data and clinical characteristics for young t1 dm and cfrd patients glycemic control, measured by hba1c, was better in cfrd than in t1 dm (6.87% [6.008.30%] vs. 7.97% [7.119.20%]; p <0.001). There were no significant differences between the two groups with regard to diabetes complications such as retinopathy (t1 dm 1.7% vs. cfrd 3.0%; not significant) or nephropathy (t1 dm 12.6% vs. cfrd 7.7%; not significant), but 26% of t1 dm patients were hypertensive compared with only 9.7% in the cfrd group (p <0.001). Data on diabetic ketoacidosis (dka) and initial blood glucose at diabetes onset also were analyzed . None of the cfrd patients presented with ketoacidosis (ph <7.3), whereas 17% of patients with t1 dm presented with dka . Blood glucose levels at diabetes onset were documented for 35,395 patients with t1 dm and 267 cfrd patients . We found significant differences with blood glucose levels of 249 mg / dl (180.0331.0) in t1 dm and 194.0 (126.0272.0) in cfrd at diagnosis of diabetes (p <0.001). In addition, subpopulations of our patients were observed 1 year (n = 8,805) or 5 (n = 6,335) years after the diagnosis of diabetes . After 1 year of diabetes, cfrd patients also had lower hba1c (6.46% [5.847.43%] vs. 7.68% [6.70 9.30%];p <0.0001), were shorter (height sds: 1.16 [2.09 to 0.33]), and had lower body weight (weight sds: 1.61 [2.57 to 0.69]), resulting in a lower bmi (bmi sds, 1.02 [1.93 to 0.27]) compared with t1 dm patients (height sds, 0.11 [0.53 to 0.77]; weight sds, 0.26 [0.42 to 0.95]; bmi sds, 0.26 [0.40 to 0.96]; all p <0.0001). Differences in auxological parameters persist 5 years after the diagnosis of diabetes with height sds of 1.60 (2.84 to 0.69), weight sds of 1.73 (2.51 to 0.83), and bmi sds of 0.92 (1.63 to 0.40) in cfrd compared with t1 dm (height sds, 0.01 [0.67 to 0.65]; weight sds, 0.48 [0.14 to 1.11]; bmi sds, 0.57 [0.01 to 1.17], all p = 0.0001). Glycemic control, measured by hba1c, becomes similar in both groups after 5 years (cfrd 7.88% [6.679.40%] vs. t1 dm 7.89% [7.108.93%]). However, after adjustment for age and sex, a difference in hba1c was still present (cfrd 7.81 vs. t1 dm 8.36; p <0.05). Treatment modalities differed between the two groups, as summarized in table 2 . All patients with t1 dm received insulin therapy (99.4% insulin alone, 0.6% in combination with metformin), whereas in cfrd 72% of patients were treated with insulin (67% insulin alone, 5% in combination with oad; p <0.001). In insulin - treated patients with t1 dm, 12% were treated with conventional therapy (one to three injections per day), 64% were treated with multiple injections (four to eight injections per day), and 23% were treated with csii . In insulin - treated patients with cfrd, 41% received conventional therapy, 54% received multiple injections of insulin, and only 5% were treated with csii (p <0.001). Fast - acting insulin analogs were used more frequently in t1 dm patients (47% vs. 39%; p <0.05). Similarly, the use of long - acting insulin analogs was significantly more frequent in t1 dm than in cfrd (37% vs. 28%; p <0.01). Treatment modalities and control in cfrd compared with t1 dm in pediatric patients insulin dose per kilogram of body weight, analyzed without adjusting for confounding effects, did not differ significantly between the two groups (t1 dm 0.82 [0.65 1.02] vs. cfrd 0.80 [0.40 1.14]; not significant). However, after adjustment for age, sex, and diabetes duration, a significant difference was present (t1 dm 0.79 vs. cfrd 0.83; p <0.05). In the cfrd group, oral antidiabetic agents (sulfonylureas, glinides) alone were used by 8% of the patients; 20% of the cfrd patients were treated with nonpharmacological therapy only (lifestyle intervention). Corticosteroid use was documented in 18% of all cfrd patients, whereas 0.3% of 47,227 t1 dm patients had received systemic steroids as a comedication during the course of their disease (p <0.001). Out of 46,846 patients with t1 dm, 73% were treated in diabetes centers with> 100 patients compared with 62% of 381 patients with cfrd (p <0.001). After adjustment for sex, age, and diabetes duration, this difference was no longer present (t1 dm 56.2% vs. cfrd 55.9%; not significant). In cfrd, 70% of all patients were treated at universities; however, for t1 dm only 31% of all patients were treated at universities (p <0.001). Significant differences were also found for self - monitoring of blood glucose (smbg) per day (t1 dm, 4.6; cfrd, 3.7; p <0.001) and number of visits per year (t1 dm, 3.30; cfrd, 2.12; p <0.001). In addition, we investigated differences with regard to metabolic control and bmi in cfrd patients treated with or without insulin . The corrected p values for hba1c showed significant differences, with better metabolic control in patients without insulin therapy compared with cfrd patients with insulin treatment (hba1c, 6.00% [5.566.76%] vs. 7.12% [6.148.67%]; p <0.001). However, duration of disease was significant shorter in patients without insulin treatment: 0.8 years (0.12.4) compared with 2.4 years (0.64.6; p <0.001). There was no significant difference for bmi sds between patients without insulin (bmi sds, 0.78 [1.58 to 0.12]) compared with insulin - treated patients with cfrd (bmi sds, 0.85 [1.61 to 0.12]). If not otherwise stated, then all described differences could be confirmed after data were adjusted for confounding effects of age, sex, and diabetes duration . Demographic data and clinical characteristics for young cfrd patients with and without insulin treatment all patients with t1 dm received insulin 1 year and 5 years after diabetes diagnosis . In the cfrd group, this percentage increased 5 years after diagnosis, when 88% of cfrd patients were treated with insulin . Insulin dose per kilogram of body weight, adjusted for age and sex, did not differ significantly between the groups (1 year: cfrd 0.69 vs. t1 dm 0.67; 5 years: cfrd 0.95 vs. t1 dm 0.90; both not significant). In both groups, insulin pump therapy and multiple daily injections were used more often 5 years after diagnosis compared with the first treatment year . In insulin - treated patients with t1 dm, 23.3% were treated with conventional therapy, 66% were treated with multiple daily injections, and 10.7% were treated with csii 1 year after diabetes diagnosis . After 5 years of diabetes, only 9.6% of t1 dm patients were treated with conventional therapy, 63.3% were treated with multiple daily injections, and 27.1% were treated with csii . One year after diabetes diagnosis, 59% of patients were treated with insulin, 25.2% of all patients were treated with conventional therapy, 33.1% were treated with multiple daily injections, and 6% were treated with csii . Five years after diagnosis, 88.1% of cfrd patients were treated with insulin, 33.3% were treated with conventional therapy, 52.4% were treated with multiple daily injections, and 24% were treated with csii . Similar to changes in insulin injections, use of short - acting and long - acting insulin analogs increased during the first 5 years of diabetes . In both t1 dm and cfrd, insulin analogs were used more often 5 years after diagnosis (short - acting: cfrd 45.9% vs. t1 dm 52.5%; long - acting: cfrd 40.5% vs. t1 dm 34.8; not significant) compared with the first year (short - acting: cfrd 40.1% vs. t1 dm 35.1%; long - acting: cfrd 18.8% vs. t1 dm 20.0%; not significant). Our data show that patients with cfrd have clear demographic and metabolic differences compared with patients with t1 dm . Previous data described female sex as a risk factor for development of cfrd (3). In our cohort, hormonal differences and later onset of cfrd in adolescence or young adulthood are possible explanations . Estrogen and its receptors are especially important regulators of body weight and insulin sensitivity (21,22). In our analysis, diabetes diagnosis was later in cfrd than in t1 dm . Our data show that patients with cfrd differ from patients with t1 dm in auxological parameters . Growth velocity was significantly lower in children with cfrd compared with controls matched for age, sex, and cf mutation (23). Reduced height and bmi are attributable to recurrent infections, exocrine pancreatic insufficiency, calorie loss because of malabsorption, and increased work of breathing . These differences in auxological parameters persist on follow - up, reflecting disease progression of cf . In t1 dm, dka is a frequent acute complication at diabetes onset and remains a major cause of hospitalization and death in children and adolescents with diabetes (24,25). Previous data described that dka also can occur at the time of initial presentation during the clinical course of cfrd, but dka is rare in children with cfrd, most likely because of the persistence of endogenous insulin secretion or because glucagon secretion also is impaired (26). In our analysis, ketoacidosis at onset was not present in patients with cfrd, in contrast to t1 dm . In contrast to t1 dm, patients with cfrd present with recurrent infections and hemolysis that influences hba1c levels, which are often falsely low in patients with cf (6,7). In our study, hba1c in cfrd was lower than in t1 dm . Further investigations are needed to establish whether therapeutic goals for hba1c should be the same for cfrd and t1 dm . Interestingly, hba1c levels became similar in t1 dm and cfrd in a subgroup of patients after 5 years of diabetes . Worsening in glycemic control in the cf group might be attributable to less follow - up visits and still less intense treatment compared with t1 dm, systemic steroids, or recurrent exacerbations . After the diagnosis of cfrd is made, the american diabetes association (ada) recommends quarterly visits to a multidisciplinary team with expertise in diabetes and cf . Furthermore, similar to treatment of other patients with diabetes, hba1c should be measured every 3 months (14). In our data, cfrd patients were followed - up less frequently in diabetes centers than t1 dm patients . Patients with cfrd were seen twice per year compared with t1 dm patients, who were seen three to four times . Fewer visits to diabetes centers for cf might be explained by additional visits to cf clinics or less intense treatment . To safely achieve glucose goals, ada recommends that all patients using insulin should perform smbg at least three times daily (27). In our analysis, smbg in cfrd was performed three to four times daily in accordance to ada guidelines . In t1 dm, smbg was more frequent, on average four to five times daily . Diabetes microvascular complications, such as retinopathy or nephropathy, have been described in case reports and small series of cfrd patients . In denmark, 36% of patients with> 10 years of duration of diabetes were reported to have retinopathy (28). In a larger series of 285 cfrd patients, none of the patients without fasting hyperglycemia had microvascular complications; in those with fasting hyperglycemia, complications were rare before 10 years of duration (29). Of the 39 patients who had cfrd with fasting hyperglycemia of> 10 years duration, microalbuminuria was found in 14% and retinopathy was found in 16% . Other studies described similar risk for development of microvascular complications compared with t1 dm (28,30). The risk is related to duration and progression of the primary disease and inversely to metabolic control of diabetes . In our cohort, this is the most likely explanation for us finding less microvascular complications in our cohort . The prevalence of diabetes microvascular complications appears to be lower in cfrd, but it remains important to screen annually for these complications, starting 5 years after diagnosis (27). Macrovascular complications have not been described among the cfrd population (29). With regard to hypertension, we found a higher risk in pediatric patients with t1 dm . Our results concur with previous data on the risk of hypertension and other cardiovascular risks in young patients with t1 dm (15). In adult cf patients, hypertension also is not uncommon, particularly after transplantation (28) or with systemic steroids . In our pediatric cohort, nevertheless, patients with cfrd should have their blood pressure measured at every routine diabetes visit, as recommended by the ada guidelines (27). Because the major cause of diabetes in cf seems to be severe insulin insufficiency, insulin therapy furthermore, acute illness, use of corticosteroids, and other therapeutic agents are associated with increased insulin resistance and altered insulin release (10,31), complicating therapy in cf patients . In our cohort, use of corticosteroids was documented in 18% of patients with cfrd . To improve weight gain and lung function, and to avoid infections, current guidelines stated insulin therapy should be started as soon as the cfrd diagnosis is made to benefit from anabolic effects of insulin (12,13). Basis bolus insulin regimen is recommended as first choice to avoid postprandial hyperglycemia (14). Recent data demonstrated efficiency of insulin pump therapy . In a group of nine adults with cfrd, 6 months of insulin pump therapy was associated with improvements in body weight, lean muscle mass, glycemic control, and a decrease in protein catabolism and hepatic glucose output as compared with their baseline status using basal subcutaneous insulin injections (32). Pumps allow easy adjustment in basal rates during episodes of increased insulin resistance or variable carbohydrate intake, such as continuous tube feeding (33). To prove a long - time benefit of insulin pump therapy compared with other treatment regimen, further studies over a longer period of time with larger patient numbers are necessary . Our subgroup analysis at 1 year or 5 years of diabetes showed that insulin pump therapy was used more frequently with increasing diabetes duration in both patient groups . This reflects intensification of diabetes therapy in response to deteriorating metabolic control . To describe differences within the cfrd patient group, we compared cfrd patients with and without insulin therapy . Patients with insulin therapy in our cohort had a longer duration of disease and their metabolic control was worse than in patients without insulin . With regard to bmi sds, no difference was found between insulin - treated or noninsulin - treated patients . We could not analyze longitudinal data once insulin therapy was started . According to published data, in addition to recommendations for insulin treatment, the available data suggest that oral antidiabetic agents are not as effective as insulin to improve glycemic control, weight, protein anabolism, pulmonary function, and survival in cfrd (3436). In small case or cohort studies of cfrd patients, oral sulfonylureas or glinides have shown limited benefit in improving insulin secretion and glycemic control . In our cohort, 8% of patients with cfrd in germany and austria are treated with oral antidiabetic agents alone, and 20% of the cf patients received nonpharmacological therapy . In t1 dm, oral antidiabetic agents were used in addition to insulin for a very small number of patients . These patients received metformin to improve glycemic control in cases of insulin resistance during puberty (37). However, a recent systemic literature study concluded that additional benefit by adding metformin in t1 dm remains unclear (38). In insulin - treated patients, insulin dose per kilogram of body weight adjusted for age, sex, and high caloric intake, including carbohydrates, insulin resistance, and use of corticosteroids in cfrd might be possible explanations for high insulin requirement in cfrd . In conclusion, the results of our multicenter analysis of current dpv data show statistically significant demographic, clinical, and treatment differences between pediatric cfrd and t1 dm patients . Cfrd shares some features with t1 dm, but it is a special entity of diabetes with specific characteristics . With progression of cfrd, treatment modalities and glycemic control become more similar to t1 dm, whereas differences in auxological parameters persist.
|
Mammals are susceptible to a wide range of infectious agents, including, but not limited to, viruses, bacteria, and protozoan parasites . While many microbes cause debilitating illnesses, are responsible for much morbidity and mortality worldwide, and garner much of the public's attention, other organisms stealthily invade their hosts, establish lifelong infection, and remarkably, cause little or no symptoms in healthy individuals . Cmvs are examples of microbes that establish asymptomatic, latent, and lifelong infections, revealing themselves only when the host's immune system is compromised . Virus survival in the face of an intact immune system is accomplished through subversion of antiviral immunity by an arsenal of virally encoded proteins, termed immunoevasins, that specifically target key molecular recognition steps necessary for an immune response . The interplay of evolutionary diversification of immunoevasins with the defense mechanisms of the host results in a dynamic balance permitting the survival of both the host and the infectious organism . Among the many viral infections of fundamental interest that have been well studied are the species - specific large dna viruses of the -herpesvirus family, of which the cmvs are representative members [1, 2]. The human cmv (hcmv) as well as its murine relative (mcmv) and other species such as the guinea pig (gpcmv), rhesus (rhcmv) [59], and chimpanzee (ccmv) [10, 11] have been the subject of recent studies designed to understand not only the basic genetics, biochemistry, and biology of these complex organisms but also to discern the immune responses of their hosts, with an ultimate goal of developing effective vaccines to alleviate pathogenic effects of the viruses . Mcmv infection is a model for hcmv infection in humans, because of similarities in viral life cycle, genome structure, and host immune response [1215]. These viruses exhibit similarities in the life cycle of acute infection, persistence and latent infection or superinfection, and reactivation under conditions of immune suppression [8, 16]. The subject of this review is a structural, genetic, and functional analysis of a set of genes and their encoded glycoproteins that have been adapted by mcmv to assure the continued survival of the virus . Because of the structural similarities of these encoded proteins to mhc - i and other mhc - i - like molecules of the host, we argue that these molecules were derived from lateral (horizontal) genetic transmission from host to virus . Hcmv is a serious and opportunistic pathogen that affects 45100% of the adult population . Seroprevalence is influenced by age, race and ethnicity, sex, and socioeconomic status where frequency of infection is highest in urban areas . Primary infections are usually asymptomatic in healthy individuals but can cause significant morbidity in immunocompromised patients such as those with aids or cancer, and in individuals undergoing therapeutic immunosuppression in the course of solid organ transplantation . Congenital infection resulting from primary maternal infection that has a rate of 14% is also a major concern, leading to long - term sequelae such as neurodevelopmental disabilities, including mental retardation and sensorineural hearing loss . Mammalian cells possess sophisticated mechanisms that telegraph their health status to the cell surface for recognition by inflammatory and immune cells . The vertebrate host responds to cmv infection using the full battery of specialized cells of the immune system: nk - cells, b cells, and t cells of both cytolytic (cd8) and helper (cd4) lineages . Aspects of both acute and chronic cmv disease may be controlled by antibodies, nk, and other cells of the innate immune system, as well as by cd8 and cd4 t cells . Such cells of the immune system can either directly kill the virus - infected cells or produce bioactive molecules that exert direct and indirect effects on the innate and adaptive arms of the immune response . Two main cellular mechanisms alert the immune system to an infected or stressed state: nk - cell and t - cell recognition and activation . During viral infection, nk - cells offer an important first line of defense that limits viral expansion at a time when specific immunity has not yet fully developed . But the virus has evolved countermeasures to balance this formidable nk surveillance (see figure 1). Following the initial nk response, the host develops adaptive cd8 and cd4 t cell responses [2022]. Viruses have two major life cycle advantages that allow them to counter the host's immune response: their rapid generation time permits them to accumulate genetic variants that allow them to subvert the immune response, and viruses with large genomes have the capacity to devote extensive amounts of genetic material to functions that may provide even slight evolutionary advantage . As a group, the cmv have genomes that are colinear as in the case of mcmv and hcmv, that may be as large as 230 kb, and that encode as many as 170 open reading frames (orfs), of which about one - third is required for essential viral functions . About half of the identified genes in mcmv although the genetic and functional analysis of all of these genes has not yet been performed, studies of many of them indicate a role in curtailing nk - cell recognition of the virus - infected cell or in interfering with antigen processing and presentation to cd8 t cells . Of particular interest to our studies of mhc - i - like molecules of the virus is the m145 family of genes (m17, m145 to m158), several of which have been shown to contribute to viral fitness . (originally denoted the m145 family, current blast searches of the protein database identify their encoded proteins as members of the) remarkably, most of these genes map to the extreme right end of the mcmv genome while the more highly conserved essential functions of the virus map to the center . Also, another set of genes, some of which play a similar role immunoevasion, map to the extreme left of the mcmv genome . These are known as the m02 family (genes m02 to m16) and some evidence suggests that they can impair t - cell receptor - mediated recognition of mhc - i / peptide complexes that lead to cd8 t - cell activation [26, 27]. During the early stages of mcmv infection, the host immune response is dominated by nk - cell activation and the resulting cytolysis of virus - infected cells . The activation of nk - cells is regulated by a balance of signals delivered through activating or inhibitory receptors . These surface molecules either bind classical mhc - i molecules or mhc - i homologues and are classified into two families: c - type lectin - like (ly49, nkg2d and cd94/nkg2) and immunoglobulin - like (kirs and lirs) as reviewed elsewhere [2830]. The infected cell initiates a complex stress response, leading to increased cell surface production of a spectrum of molecules including mica or micb, and members of the ulbp family in the human [3134], or rae-1 (,,,,), mult-1, and h60 in the mouse [3539]. These mhc - i - like stress - induced cell surface molecules are ligands for the nk - cell activation receptor, nkg2d, the best characterized nk activating receptor . Nkg2d lacks a signaling motif of its own, and thus requires association with either the dap10 or dap12 adapter molecules . In the mouse, nkg2d short pairs with either dap10 or dap12 [41, 42], while nkg2d long interacts exclusively with dap10 . Human nkg2d, by contrast, only has the l isoform and thus interacts exclusively with dap10 . The direct interaction of nkg2d with any of the nkg2d ligands activates the nk - cell and initiates its cytokine and cytolytic program, resulting in the killing of the virus - infected cell . To counter host nk surveillance, the virus has evolved strategies to attenuate the host cell expression of the nkg2d ligands, which it accomplishes through the expression of some m145 family members early in infection . In particular, the m152, m145, and m155 glycoproteins, as well as the unrelated m138, each downregulates one or more nkg2d ligands . M152, encoding the gp40 glycoprotein, not only controls the surface expression of classical mhc - i, but also downregulates surface expression of rae-1 molecules . Although this regulatory function of m152 has been recognized for several years [44, 45], evidence for direct interaction of m152 with rae-1 has only been demonstrated recently . Studies show binding of m152 with rae-1 isoforms,, and and establish a relationship between the effectiveness of rae-1 attenuation with the intrinsic affinity of the m152/rae-1 interaction . In a manner similar to that of the m152/rae-1 interaction, the m145-encoded glycoprotein downmodulates the expression of mult-1, and m155 blocks h60 surface expression . M138, originally considered a viral fc receptor, also regulates both mult-1 and h60 as well as rae-1. In addition, it also affects b7 - 1 (cd80) expression on dendritic cells (dcs) which impairs dc stimulation of ctls . The functions of these mcmv genes have been established in part by the judicious exploitation of deletion viruses such as the m152 mutant, that clearly fails to downregulate both mhc - i and rae-1 [45, 50], the m138 mutant that is deficient in h60 and mult-1 regulation, and the m155 virus that attenuates the nk response in vivo and partially restores h60 expression on virus - infected cells . The intriguing structural question raised by the paired interactions of members of the m145 family with nkg2d ligands is how precisely do these viral mhc - i - like molecules function . The high - resolution x - ray crystallographic structures of several of these viral mhc - i - like molecules are now known . These structures offer further insight not only into the function of the viral mhc - i - like molecules, but also into their evolution . Major advances in our understanding of the role of nk receptors in the immune response to viral infection derived from studies of the ly49 family in the mouse and of the kir family in the human . These are cell surface receptors, expressed primarily on nk - cells, that interact either with host classical mhc - i molecules, or, in several notable examples, with virus - encoded ligands . The ly49 family members are either inhibitory (such as ly49a, ly49c, or ly49i), or activating (such as ly49h or ly49p). Similar functions are contributed by the kirdl inhibitory receptors and the kirds activating receptors in the human, but our discussion will be confined to the mouse molecules . The inhibitory receptors, with ly49a serving as the prototype, recognize classical mhc - i on host cells, and thus deliver a tonic inhibitory signal to the nk - cell, through their cytoplasmic immunoreceptor tyrosine - based inhibition motifs (itims). With decreased mhc - i expression on the virus - infected cell, the strength of the inhibitory signal decreases, and concurrent activating signals dominate, leading to lysis of the virus - infected cell . Such a mechanism, the basis of the missing self - hypothesis has been well - characterized for the interaction of ly49a with its mhc - i ligand h-2d [52, 53]. The importance of interactions of ly49a and other inhibitory receptors with their mhc - i ligands in nk - cell education or licensing has also recently been explored [54, 55]. Some activating receptors such as ly49h, in contrast to nkg2d, which exploits stress - induced ligands, do not have known self - mhc - i ligands, but instead interact strongly with some cmv - encoded molecules . Ly49h is expressed in mcmv - resistant mouse strains and binds a viral member of the m145 family, m157, which is expressed at the cell surface as a glycophosphatidylinositol (gpi)-linked glycoprotein early in infection . Ly49h deficient mice are mcmv sensitive, and transgenic expression of ly49h confirms that this activating receptor alone can account for viral resistance . In mouse strains susceptible to mcmv infection such as 129/j, there is no ly49h gene, but rather one encoding an inhibitory receptor ly49i, that interacts strongly with m157 [56, 57]. Thus, it would appear that m157 evolved initially in the setting of hosts that expressed ly49i - like activities, resulting in improved viral survival . As the virus became more virulent, mouse evolution settled on the solution of shuffling the ly49i - binding activity (residing in its extracellular domain) onto the signaling module of an activating receptor and thus became ly49h, conferring resistance to viruses that express m157 . In experiments designed to examine the evolution of virus resistance to host nk activity, it was shown that when mcmv is passaged repeatedly through resistant ly49h mice, m157 mutations accumulate rapidly, permitting the virus to escape the nk immunosurveillance due to ly49h . Recent studies of a variety of naturally occurring m157 variants indicate that many are incapable of binding ly49h (from c57bl/6), but can interact with ly49c inhibitory receptors from several different strains . Thus, the effects of the differential interactions of ly49 activating and inhibitory nk receptors on the evolution of viral mhc - like ligands, such as m157, may prove to be even more complex than previously thought . There are some mouse strains that lack ly49h but are resistant to mcmv infection through other nk - cell - mediated mechanisms . An example is the ma / my mouse whose resistance is genetically dependent on the presence of genes encoding an activation receptor ly49p, and h-2d . Epistatic interactions of these genes (or their gene products) confer resistance to mcmv . The ly49p dependent activation of nk - cells is blocked by an antibody to h-2d [61, 62]. In addition to h-2d and ly49p, the viral resistance of ma / my also requires m04, a gene encoding gp34, a glycoprotein that escorts mhc - i to the surface and that inhibits recognition by cd8 ctl . A m04 mutant of mcmv abrogates the resistance of ma / my mice [30, 62, 63]. The mechanism by which these three gene products, ly49p and h-2d of the host, and m04 of mcmv, cooperatively generate viral resistance remains unclear . Studies of the function of the mhc - i - like genes of the cmvs have largely relied on experiments with mutant viruses with engineered deletions of the relevant genes, on detection of cell surface expression of host proteins following infection or transfection, or on immunoprecipitation (pull - down) experiments using specific antibodies . Although such experiments support the conclusions that some of these viral mhc - i - like molecules either downregulate or impair the recognition of particular ligands, they fail to explain the precise molecular mechanism(s) involved in such regulatory effects [39, 44, 50]. To this end, several laboratories have directed efforts to engineer recombinant forms of the viral mhc - i - like proteins and their ligands and to measure these interactions in well - defined in vitro systems . Specifically, the interactions of mcmv m152 and m157 [64, 65]and of hcmv ul18 have been examined in this way . The engineering, expression, and purification of soluble forms of the extracellular domains of m152 and rae-1, -1 (expressed in balb / c), and rae-1 (c57bl/6) generated the reagents for size exclusion binding assays, analytical ultracentrifugation (auc), and isothermal titration calorimetry (itc), based on the hypothesis that the ectodomains m152 and rae-1 isoforms interact directly . Recombinant m152, prepared in insect cells, interacted well with rae-1 molecules refolded from e. coli inclusion bodies . Affinities for the interactions were measured by auc with kds of rae-1 (1 m)> rae-(3 m)> rae-1 (30 m), which may be compared with the kd of the interaction of murine nkg2d with several rae-1 isoforms (340730 nm). The hierarchy of affinities of the different isoforms paralleled the effectiveness in the downregulation of rae-1 by m152 . In addition, these studies confirmed the predicted 1: 1 stoichiometry of the m152: rae-1 interaction . The interaction between m157 and ly49 nk receptors was first detected using m157-fusion proteins, or using an ly49h - reporter cell and an m157 transfectant . In experiments employing recombinant m157, ly49h, and ly49i and surface plasmon resonance (spr) as well as itc, the affinity of ly49i for m157 was determined to have a kd of 0.2 m with a 1: 1 stoichiometry, a stronger affinity than ly49's interaction with standard mhc - i ligands (180 m) [64, 68, 69]. Ul18, an hcmv molecule that interacts with lir1 (also known as ilt2 or cd85j), an inhibitory receptor expressed widely on monocytes, dcs, b cells, and some t cells and nk - cells, has also been studied quantitatively by spr methods . The interaction of lir1 with ul18 (kd ~ 10 m) is> 1000-fold stronger than that of lir1 with classical mhc - i . It is interesting to note that the physical interaction between ul18 and the human nk - cell activating receptor, nkg2c / cd94, has been estimated to have a kd of about 10 to 100 m . The quantitative measure of direct binding interactions between viral mhc - i like proteins and their ligands reflects the strength with which these evasins can compete with host protective or inhibitory mechanisms . Knowledge of the structural details of these interactions contributes to our understanding of the evolution and molecular mechanism of such viral mhc - i mimics . The first cmv gene identified as an mhc - i homolog was h301 (now known as ul18) of hcmv, which was shown to encode a protein with 20% similarity to classical mhc - i proteins . Subsequently, with the complete dna sequence determination of the mcmv genome and bioinformatic analysis of its orfs, m144 was shown to have amino acid sequence similarity to classical mhc - i proteins . Reexamination of orfs of mcmv using more recently developed computational tools suggested the existence of other genes that encode mhc - i - like molecules . Simple alignment of classical mhc - i molecules from human and mouse reveals obvious sequence similarity over 267 amino acid residues of the extracellular domain with scores of 81% similarity and 71% identity (see figure 2(a)). When ul18 and m144 are included in the sequence alignment, similarities, particularly in the conservation of cysteine residues, are still evident, although ul18 is only 24% identical with hla - a2, and m144 is about 19% identical to h-2d (figure 2(b)). However, efforts to align all the members of the m145 family from mcmv reveal profound differences in sequence and considerable problems in selecting appropriate computational parameters for the best alignment (figure 2(c)). Sequence identity scores for the m145 family as compared with the classical mhc - i molecule h-2d range from 6.2 (for m151) to 24.4% (for m144). These rather marginal sequence similarities and the inherent ambiguities in evaluating the alignments of cysteine residues the structures of three members of the m145 family (m144, m153, and m157) have been solved, as well as those of the hcmv ul18 [75, 76]. In addition, a putative evasin of the tanapox virus 2l, which, remarkably, is also an mhc - i - like molecule, has been examined in structural detail . Furthermore, structures of several other hcmv molecules, us2 and ul16, that function as immunoevasins, but are structurally related to the immunoglobulin superfamily and not related to the mhc - i family, have also been determined [78, 79]. Early studies of m144 suggested that it inhibited the recognition of virus - infected cells by nk - cells in vivo, and that m144 expression in tumor cells conferred resistance to nk - cell killing . However, these results are controversial and there remains no consensus as to the function of the m144 glycoprotein . Our lab has examined the expression and structure of m144 (pdb code 1u58) (see figure 3, table 1). Biochemical analysis of m144 revealed the lack of co - purifying bound peptides, a result confirmed by transfection studies that revealed the lack of a requirement for bound peptide for cell surface expression . The x - ray structure shows a typical mhc - i fold consisting of 1 and 2 helices supported by a floor of antiparallel strands and connected via a loop to an immunoglobulin - like 3 domain . Although m144 cocrystalized with 2-microglobulin (2 m), located in a canonical position beneath the strand floor, expression studies [42, 84] showed that there is no absolute 2 m requirement for folding and cell surface display . The 12 domain unit is stabilized by two disulfide bonds: one that is similar in orientation to that found in classical mhc - i molecules (joining the 5 strand to the 2 helix) and another unique one that links the 1 helix to 4 . The structure reveals truncated 1 and 2 helices, a narrowed groove, and a modified 2 m interface . An unstructured stretch of 13 amino acids not seen in the electron density map may be indicative of a flexible part of the molecule stabilized by a molecular partner . The structure of m153 another member of the m145 family, with unknown function, has also been determined (see figure 3, table 1). It was expressed and crystallized in the absence of 2 m, which is not required for its cell surface expression . M153 is a noncovalently associated homodimer, not only in its crystal form but also as a purified protein and as expressed at the cell surface . Its aminoterminus is somewhat longer than that of classical mhc - i molecules and is tethered to its extended h2b helix via a disulfide bond . Another novel disulfide bond closes the loop connecting two strands, and a third disulfide, similarly positioned to that of classical mhc - i, is in the 3 domain . Like m144, it has a narrow potential binding groove, not apparently large enough to engage a peptide ligand . The tight juxtaposition of the 1 and 2 helices exposes a significant portion of the sheet floor . A coiled region separates the amino from the carboxyl - terminal parts of the 2 helix . Although the function of m153 remains as a conundrum, reporter cells constructed with the m153 extracellular domains indicate that some subsets of murine lymphoid cells ligate m153 and activate the reporter through this interaction . Sequence alignment of m153 protein from different mcmv isolates identifies a conserved motif suggestive of an unchanging specific function [74, 87]. Although a definitive function for m153 has yet to be identified, m153 may play an important role in the viral life cycle as it is expressed early in infection and accumulates at the cell surface . M157, a 37 kd surface gpi - linked glycoprotein that is not required for viral replication in vitro, is the only known cmv - encoded cell surface molecule that can engage both nk activating (ly49h) and inhibitory receptors (ly49i) [56, 72]. The structure of m157 showcases a recognizable mhc - i fold with neither peptide binding groove nor 2 m association and a compactness enhanced by extensive intramolecular interactions . M157, like m153, has an extended aminoterminus, but for m157 this is a unique helical region, designated 0 (see figure 3, table 1). As with m144 and m153, the 1 juxtaposition to 2 precludes binding to a peptide antigen . Two intrachain disulfide bonds stabilize the 12 domain, and the 3 domain has a disulfide as well . 2 is joined to 3 by an extended h2b helix, similar in conformation to that of m153 . Mutagenesis and binding analysis suggest that m157 engages its ly49h or ly49i ligands through a surface distinct from that by which the homologous ly49a binds to its h-2d ligand . The hcmv ul18 is closer in structure to classical mhc - i molecules and to m144 than it is to m153 or m157 despite the fact that it is only about 25% identical in sequence to mhc - i . Ul18 requires peptide and 2 m for proper folding, and binds the host inhibitory receptor lir-1 with high affinity . The 12 domain preserves the highly conserved disulfide of mhc - i molecules, and also has a canonical disulfide bridge in the 3 domain . In addition, it links two adjacent strands of 3 with another disulfide (see figure 3, table 1). Both 3 domain disulfides are necessary for proper association with the lir-1 ligand [89, 90]. The three - dimensional structure of the 2l protein, another mhc - i homologue of the human tanapox virus, has also been determined . Tanapox is a yatapoxvirus, only distantly related to the herpesviridae to which the cmvs belong . The 2l molecule binds tnf-, in a high - affinity interaction that accounts for inhibition of immune function such as tnf - mediated cellular cytotoxicity . The x - ray structure of the complex of 2l with tnf- reveals a molecule that lacks the typical mhc - i peptide binding groove . The amino - terminal parts of the 1 and 2 helices are displaced toward the opposite helix, closing the groove . One disulfide bond links the strand floor to the 2 helix like classical mhc - i molecules, while two others stabilize the 3 domain (see figure 3, table 1). The site of interaction between 2l and tnf- is a large and complementary interface that includes residue of both the 2 and 3 domains of 2l . Thus, 2l preserves the basic mhc - i fold, lacks peptide or 2 m, and interacts with the trimeric tnf- in a novel way . Cmvs and their respective hosts have coevolved, and the origin of the most recent common root for the three families of the herpesviridae (i.e., the,, and -herpesvirinae) has been estimated to have occurred about 400 million years ago (ma). Under the selection of the host immune response although a conserved core of genes is observed for the herpesvirus genomes, there exist a number of genes, homologous to those of the host which appear to have originated in the host and to have been acquired by lateral (horizontal) transmission . There are many viral genes that on initial evaluation exhibit a very low level of nucleic acid sequence similarity to host genes, but whose orfs likely encode proteins similar to those of the host . Even more distantly related viral genes are observed, some of which encode proteins that have little or no amino acid sequence similarity to proteins from their hosts, but whose relationship to host proteins may be deduced through various secondary structure threading programs such as 3d - pssm [94, 95] or phyre [96, 97]. The viral mhc - i - like proteins fall into this latter category, revealing amino acid sequence identity as low as 6% . The evolutionary origin of many of these proteins and their encoding genes, although they seem to have been derived from the host, remains unclear, and efforts to understand their origin rely not only on nucleic acid and protein sequence comparison, but also on a knowledge of the function and structure of the expressed proteins . With the goal of understanding the function and evolution of these genes, several laboratories have determined the three - dimensional structure of representative viral mhc - i - like molecules, and the comparisons that we have summarized above confirm that m144, ul18, m153, m157 of the cmv family, and 2l of the more distantly related tanapox virus all clearly have structural features in common (see table 1). The structural similarity of each of these proteins to other mhc - i, for example, h-2d and mhc - i - like molecules is established not only by an intuitive sense based on the similarity of the location and orientation of secondary structural elements, it is strongly confirmed by quantitative computational superpositions of the crystallographic structures calculated with programs such as dali, pymol, and lsqkab . Thus, arguments for the relationship of these representative proteins and their encoding genes can be made forcefully . In addition, particularly among the rodent members of the 145 family, the amino acid sequence similarities support the notion of a common ancestor . The most difficult problem is whether or not a single evolutionary event, in which a gene encoding a vertebrate mhc - i - like molecule was captured by a single large dna virus as much as 400 ma, has given rise to the genes that encode mhc - i - like molecules identifiable in a number of viral species, or whether several independent capture events have occurred for different viruses . The observation that the hcmv protein ul18 and the mcmv protein m144 appear to be closer in structure to classical mhc - i molecules and that the other mcmv proteins, m153 and m157, are more distantly related, favors a single ancient origin . Whether such a hypothesis can withstand the identification, amino acid sequence, and structural analysis of previously unidentified cmv and other viral immunoevasins related to classical mhc - i molecules remains to be determined.
|
Plexiform neurofibroma is the term applied to a diffuse neurofibromatosis of nerve trunks, which is often associated with an overgrowth of the skin and subcutaneous tissues . It is a distinct type of neurofibroma that expands a nerve into a large tortuous mass of fibers that has a bag of worms appearance . Plexiform neurofibromas are the least common variant and usually are pathognomonic for nf i. the most commonly involved sites are the temple, upper lid, back of the neck, and the tongue . Oral manifestations of neurofibromatosis have been reported in only 4 - 7% affected persons, in which the tongue was the most commonly involved site . This systemic process, originally described by von recklinghausen, is an autosomal dominant disorder caused by a defect on chromosome 17 . Patients usually present in childhood with numerous cutaneous or subcutaneous neurofibromas, melanotic lesions in the iris called lisch nodules, caf au lait spots, and optic gliomas . Plexiform neurofibromas occur in only 17% of cases of nf i. when they occur in the setting of nf i, 91% are solitary lesions, and most of the lesions occur in the trunk, extremities, and head neck region . Histologically, neurofibroma consist of endoneural ground substance and schwann cells that extend outside the perineurium . We present a case of an isolated plexiform neurofibroma of the tongue in a 11-year - old girl not associated with neurofibromatosis . An 11-year - old girl was admitted to the department of e.n.t . Of our institute, with the complaint of inability to close the mouth because of a large, asymmetrical, protruding tongue . The girl had difficulty in swallowing, breathing, and clear speaking since early months of her life . On palpation, the right side of the tongue was hypertrophied and the movements of the tongue were normal, but she was unable to hold the tongue completely in the mouth because of its enormous size . There was also slight generalized swelling of the right side of the base of the tongue . No neck glands were palpable and functions of v, vii, x, and xii cranial nerves were intact . A magnetic resonance image was obtained to better assess the base of tongue, which revealed a 3 3 2.5 cm heterogeneously enhancing mass with infiltration in the tongue and tongue base, this lesion was hypervascular and well - circumscribed . Under general anesthesia, gross examination of the specimen revealed irregular surface which was soft in consistency [figure 1]. Histopathological examination revealed well circumscribed multiple nodular lesions composed of elongated spindle wavy cells with muscle fibers in between, these wavy cells were arranged against a myxoid background . An ophthalmologic examination was carried out which showed no eye lesions of neurofibromatosis (such as lisch nodules in the iris, ephelides on eyelids, or ectopia lentis). The skin of the whole body was examined and no caf au lait spots or frecklings of the axillary and inguinal region were observed . On plain radiograph, no bone pathology was found . After the diagnostic work - up, surgical treatment was planned . Under general anesthesia, the tumor was approached intraorally, and the biopsy report was consistent with plexiform neurofibroma . The movements of the tongue were preserved, and, in addition, a significant improvement in her speech was observed . The patient has been on follow - up for 10 months and no additional treatment has been necessary . Gross picture of neurofibroma h and e - stained section showing spindle wavy - shaped cells seperated by fibromyxoid stroma, 400 h and e - stained section showing discrete well - circumscribed collection of spindle cells with muscle fibers in between, 100 neurofibromas are benign tumors of neural origin, of which roughly 90% appear as solitary lesions . Solitary plexiform neurofibromas arising outside the context of nf i, as illustrated in the patient presented here, are quite rare, with only scattered cases reported in the literature till date . In the literature, there are only few reports of macroglossia caused by plexiform neurofibroma, and the cases are almost always associated with neurofibromatosis . Our patient had no eye lesion, no bone pathology, and no caf au lait spots or frecklings on the skin . We could not find any other signs or symptoms other than isolated plexiform neurofibroma of the tongue to make a diagnosis of neurofibromatosis, and thus it was concluded to be a case of isolated plexiform neurofibroma of the tongue . When these ill - defined tumors grow in the head and neck, they are commonly symptomatic and disfiguring, causing upper airway obstruction, swallowing or mastication difficulties, or cosmetic distortion of the face . Diffuse plexiform neurofibroma, is also known as elephantiasis neurofibromatosa, which shows overgrowth of epidermal and subcutaneous tissue along with a wrinkled and pendulous appearance . Neurofibromas of the large nerves, which appear clinically as soft, drooping, and doughy masses, are benign neoplasms composed of neurites, schwann's cells and fibroblasts within a collagenous or myxoid matrix . In contrast to schwannomas, they are nonencapsulated and engulf the nerve of origin . Plexiform neurofibromas, forming tortuous cords along the segments and branches of a nerve with a tendency to grow centripetally, are poorly circumscribed tumors . It needs to be differentiated from schwannoma which is encapsulated, while plexiform neurofibroma is noncapsulated; moreover, in schwannoma there are antony a and antony b along with prescence of verocay bodies on microscopic examination . Since neurofibromas are usually multiple lesions, the whole body must be examined and investigated . In patient with oral neurofibroma, larynx and trachea must also be examined as in such a case lesions in the upper airway may cause respiratory obstruction . Plexiform neurofibromas should be monitored frequently because 5% may turn into malignant peripheral nerve sheath tumors . Differential diagnosis of such a tongue mass must include neurofibroma, schwannoma (neurilemoma), lymphangioma, hemangioma, hamartoma, teratoma, pyogenic granuloma, nerve sheath myxoma, and cystic lesions such as mucoid cysts and dermoid cysts . The standard treatment for neurofibromas has been surgical excision and the diagnosis can only be confirmed by histological examination . Early diagnosis in such a patient is very important and these patients need regular follow - up during their lifetime to detect recurrences . Fortunately, there were no signs of recurrence or other manifestations during the follow - up period of our patient till date . We present this case for its rare site along with nonassociation with neurofibromatosis, excellent recovery, and no recurrence till date on follow - up.
|
Dexamethasone is a glucocorticoid with a relevant clinical use mainly due to its anti - inflammatory and immunosuppressive effects . However, the great number of side effects, such as hypertension, hydroelectrolytic disorders, hyperglycemia, peptic ulcers, and glucosuria, restricts the use of dexamethasone in prolonged therapy . Topical administration of dexamethasone is clinically used for the treatment of many ocular disorders, or diseases, like uveitis, allergic conjunctivitis, and corneal postoperative period, as well as for the treatment of skin disorders such as atopic dermatitis, [5, 6] allergic dermatitis, eczematous dermatitis, [6, 7] psoriasis, acne rosacea, and phimosis . Over the last years many efforts have been made not only to improve the efficacy and bioavailability of drugs but also to reduce their adverse effects by means of the development of novel drug carrier systems . In the past few decades, considerable attention has been focused on the development of new drug delivery system (ndds). When the new drug or existing drug is given by altering the formulation and administered through different route, this process is called the novel drug delivery system . Firstly, it should deliver the drug at a rate directed by the needs of the body, over the period of treatment . Conventional dosage forms including prolonged release dosage forms are unable to meet none of these . At present, no available drug delivery system behaves ideally, but sincere attempts have been made to achieve them through various novel approaches in drug delivery . An increasing number of drugs are being added to the list of therapeutic agents that can be delivered into systemic circulation, in clinically effective concentrations, via the skin portal . It has been documented and reported that unsaturated fatty acids such as oleic acid and linoleic acid have a tendency to form vesicles in the aqueous environment . After about a decade of research it was conferred that saturated fatty acids with carbon atoms in the range of 812 undergo self - assemblage into vesicles in a ph - dependent manner . Fatty acids being highly soluble tend to partition into artificial as well as natural membranes quite rapidly . It has also been documented that fatty acid vesicles enhance the absorption of therapeutic molecules through the git, probably by forming mixed micelles or through chylomicron(s), thus enhancing the bioavailability of the bioactives . It is well established fact that free fatty acids act as penetration enhancers for the bioactives through the stratum corneum . The penetration enhancement effect of fatty acid bears direct relation with the chain length; however direct relationship correlates up to carbon number 18, that is, c18 . The skin permeation property of unsaturated fatty acids is higher than the corresponding saturated fatty acid . Further, fatty acid(s) containing cis double bond exhibited higher penetration potential as compared to trans form . The problem of skin irritation, however, could be addressed by using fatty acid vesicles as drug bearing carriers such as ufasomes . It has been shown that bilayer membrane possesses a fusogenic tendency due to its capability to lower the phase transition temperature of the lipids in the biological membrane . The vesicular membrane fuses with skin lipid bilayers, releasing its contents . Thus, it is hypothesized that fatty acid vesicles will act as a suitable carrier to enhance the penetration of bioactive agents through the stratum corneum with reduced toxicity . Moreover, fatty acid vesicles seem advantageous as they are easy to prepare as well as cost effective . The present study involves the use of oleic acid vesicles to encapsulate dexamethasone and evaluates, its potential as an alternative drug delivery system for effective topical application . All other solvents used were of analytical grade, unless otherwise mentioned, and purchased from cdh . Oleic acid vesicles were formulated by film hydration method, as reported earlier by with slight modification . Different batches of ufasomes were formulated using different ratios of oleic acid, drug, and surfactant . Briefly, in a clean, dry, round bottom flask, the accurately weighed oleic acid of strength 80 mm, span 20, and dexamethasone were dissolved in methanol followed by solvent evaporation under vacuum using a rotary evaporator (perfit equipments, ambala, india) under reduced pressure at 40c to remove even the last traces of organic solvent . A dried film is formed in rotary evaporator and was left overnight for the removal of any possible traces of methanol and also to prevent the formation of emulsion due to the residual organic solvent . The dried film was then hydrated with pbs (ph 7.4) at ambient temperature for 1 h followed by sonication to form the uniform size vesicular dispersion . Optimization was performed by varying the ratios of oleic acid and dexamethasone (table 1). Unentrapped drug was estimated by using dialysis method (molecular weight cut of 12,00014,000, himedia, ltd . ). Briefly, 1% w / v of carbopol 940 was dispersed into purified water with the help of a vortex shaker (tarsons, kolkata, india) and allowed to hydrate for 4 - 5 h. the ph value of the gel was adjusted to 7.4 using triethanolamine . During preparation of the gel, the solution was agitated slowly to obviate any air entrapment . Plain drug gel was prepared by using an equivalent amount of dexamethasone solution into the previously made carbopol gel in a 2: 1 ratio under gentle mechanical mixing for 5 min . Ufasomal formulations were characterized for different parameters like drug entrapment efficiency, vesicle shape, vesicle size, and size distribution, turbidity, zeta potential, and permeation across cellophane membrane and rat skin . Fatty acid vesicles were visualized by using moragagni 268d tem with an accelerating voltage of 100 kv . A drop of the optimized formulation was placed onto a carbon - coated copper grid and it was negatively stained with 1% phosphotungstic acid (pta). The grid was allowed to air - dry thoroughly and the samples were viewed on a transmission electron microscope . A thin film of uf was spread on a slide and after placing cover slip it was observed under the optical microscope (olympus ch20i bimf, 8f03730) (figures 1(a) and 1(b)). The size and size distribution of vesicles with different composition shown in table 1 after sonication the vesicle size was determined by dynamic light scattering method (dls), using a computerized inspection system (malvern zetamaster, zem 5002, malvern, uk) and figure 2 shows vesicle size distribution of optimized formulation . For vesicles size measurement the vesicular preparation was mixed with appropriate medium (for ufasomal formulation with 7% v / v ethanol) and filtered through 0.2 m polycarbonate membrane to minimize interference from particular matter . The measurements were conducted in triplicate in a multimodal mode of 200 and each at a medium stable count rate . Entrapment efficiency of dexamethasone from the uf-1, uf-2, and uf-3 formulations were estimated using dialysis method (molecular weight cut of 12,00014,000, hi media, ltd . ). Optimized formulation was dissolved in pbs (ph 7.4) at a concentration of 1 mg / ml (the same concentration of dexamethasone as 1 mg / ml pure drug solution). This solution (2 ml in volume) was transferred to a dialysis bag (size cut off = 2.5 nm) immediately . The dialysis bag was placed in a 50 ml - beaker containing 40 ml pbs (ph 7.4). The absorbance of the outer phase was monitored at 241 nm using a spectrophotometer (systronics electronic limited, ahmedabad, india, au-2701) in order to characterize the concentration of dexamethasone . The entrapment efficiency of prepared ufasomes was determined by subtracting the unentrapped drug from the total amount of drug used for the preparation of ufasomes . One has (1)percentage entrapment= entrapped drug (g)total drug added (g) 100 . The entrapment efficiency calculated for various molar ratios oleic acid vesicles were diluted with distilled water to give a total lipid concentration of 0.312 mm . After rapid mixing by sonication for 5 minutes the turbidity was measured as absorbance at 241 nm with an uv - visible spectrophotometer . The zeta potential of the all ufasomal formulations was determined in a malvern zetasizer using reagent blank . For zeta potential measurement vesicular suspension was mixed with the appropriate medium (for ufasomes with 7% v / v ethanol) and measurements were conducted in triplicate (table 1). In vitro release behavior of dexamethasone from vesicular formulations containing oleic acid and span 20 was investigated using locally fabricated franz glass diffusion cell and through the cellophane membrane (molecular weight cut of 12,00014,000, hi media, ltd . ). Pure dexamethasone was dissolved in pbs (ph 7.4 .) At a concentration of 1 mg / ml and used as control . The prepared complex was dissolved in pbs (ph 7.4) at a concentration of 1 mg / ml (the same concentration of dexamethasone as 1 mg / ml pure drug solution). This solution (2 ml in volume) was transferred to a dialysis bag (size cut off = 2.5 mm) immediately . The dialysis bag was placed in a 50 ml - beaker containing 40 ml pbs (ph 7.4). The absorbance of the outer phase was monitored at 241 nm spectrophotometrically in order to characterize the concentration of dexamethasone (figure 3). The effect of ph on the stability and on the drug release behavior was monitored by incubating optimized vesicular dispersion with buffers of ph 8.5, 7.4, 6.5, and 5.5 . At predetermined time intervals the amount of drug leached was then calculated by the following formula: (2)%drug diffused = amount of free drugtotal drug100 . Simultaneously, the incubated vesicles were observed for any change in morphology and size using an optical microscope . As the ph of skin is 7.4 so as to make the formulation compatible with skin, the ph of the dispersion was adjusted . The unentrapped drug was separated from the formulation by dialysis method (molecular weight cut of 12,00014,000, himedia, ltd . )., 1% w / v of carbopol 940 was dispersed into purified water with the help of a vortex shaker (tarsons, kolkata, india) and allowed to hydrate for 4 - 5 h. the ph value of the gel was adjusted to 7.4 using triethanolamine . During preparation of the gel, plain drug gel was prepared by using an equivalent amount of dexamethasone solution into the previously made carbopol gel in a 2: 1 ratio under gentle mechanical mixing for 5 min . Albino rat 5 - 6 weeks old weighing 100120 g was sacrificed by chloroform inhalation . The hair of test animals was carefully trimmed short (<2 mm) with a pair of scissors and the abdominal skin was separated from the underlying connective tissue using scalpel . The excised skin was placed on aluminium foil and the dermal side of the skin was gently teased off for any adhering fat and/or subcutaneous tissue . The skin was then carefully checked through a magnifying glass to ensure that samples were free from any surface irregularities such as tiny holes or cervices in the portion that was used for transdermal permeation studies . The skin was washed with physiological buffer saline (ph 7.4) and freshly obtained skin was used in all experiments . The in vitro skin permeation of dexamethasone from different formulations the donor compartment was maintained at 37 1c with constant stirring at 125 rpm . The uf-2 (2 ml) was applied to the epidermal surface of the rat skin . Samples were withdrawn through the sampling port of the diffusion cell at predetermined time intervals over 24 hr and analyzed . The in vitro drug release study of ufasomal formulation was repeated with a cellophane membrane by using the same method as described above . Experiments were conducted to optimize the amount of dexamethasone that can be incorporated into the vesicles and to optimize the uf-2 formulation . The cumulative amount of drug permeated per unit area was plotted as a function of time, and the steady state permeation rate (jss) and lag time (lt, h) were calculated from the slope and x - intercept of the linear portion, respectively . The permeability coefficient (ps, cm / hr) and other parameters were calculated from the following equation: (3)lt = h26d, jss = pscd, where h = thickness of rat skin, cd = amount of drug in donor compartment . The enhancement ratio (er) was calculated from following equation: (4)er = transdermal flux from vesicular formulationtransdermal flux from plain drug . Determination of amount of drug deposited into the skin . In this method the in vitro drug permeation study was performed in two stages using the same locally fabricated diffusion cell . In the first stage pbs (ph 7.4) was used as the receptor medium and method as described above for skin permeation was carried out . Samples were withdrawn through the sampling port of the diffusion cell at predetermined intervals over 10 hr and analyzed . The receptor phase was immediately replenished with equal volume of fresh buffer . At the end of 10 hr the second stage used 50% v / v ethanol as the receptor solution for a further period of 12 hr and performed without any donor phase . During this stage an ethanolic receptor will diffuse into the skin disrupting the vesicular structure of any uf-2 that may have penetrated and deposited in the tissue and thus releasing both uf bound and free dexamethasone for collection by receptor fluid (figure 6). Use of 50% ethanol as receptor fluid can slightly reduce the barrier nature of stratum corneum; hence, the second stage was performed after removal of the donor to avoid any excess permeation due to penetration enhancing activity of ethanol . For the evaluation of mechanism of better skin permeation ability of optimized oleic acid vesicles, the vesicle - skin interaction of optimized ufasomal formulation (uf-2) was evaluated by scanning electron microscopy technique and ft - ir . Sem studies using rat skin was conducted in order to explain the effect of oleic acid formulation on the surface morphology of skin . Figure 7 shows the sem photomicrograph of rat skin treated with pbs (ph 7.4) acting as control, plain ufasomal gel, liposomal formulation, and plain gel . In rat skin the vesicular suspension formed networks and stacks of lipid bilayers at the interface of the stratum corneum (figure 7). Intracellular vesicular structures were observed in superficial layers of the stratum corneum and their appearance might be explained by desquamating corneocytes with a leaky membrane, through which oleic acid vesicles penetrate . After skin permeation study of 24 hr sc (stratum corneum) was cut into small circular discs . The ft - ir spectra of dexamethasone, rat skin, and dummy formulation were measured on perkin elmer, usa (model 1600) (figure 8). The data was obtained in the range of 4004000 cm for each sample . The study was carried out on male wistar rats (150200 g, n = 15) according to protocol number [iaec / ccp/12/pr-008]. Thirty minutes before the intraperitoneal injection of each compound, the basal volume of the hind paws was measured by means of a mercury plethysmometer (ugo basile). Afterwards, the gel formulations were applied topically on the rat skin at the dose of 1 mg / kg: (a) plain gel; (b) ufasomal gel formulation 0.5% w / w (1 square cm area); (c) marketed formulation topically 0.5% w / w . Thirty minutes after the treatment, carrageenin (0.05 ml of 1% suspension in saline) was injected intraplantarly into the right hind paw of each rat to induce inflammation and 0.05 ml of saline into the contralateral paw . Paw volumes up to the ankle joints were measured before and at hourly intervals for 6 h following carrageenin administration . The basal volume of each rat paw was taken as 100% and variations from this volume were given as percent difference . The purpose of the study is to determine the effect of storage at different temperature conditions on stability of ufasomes . Physical stability studies were conducted by monitoring the change in mean vesicle size and the leakage of encapsulated drug from ufasomal formulations at different time intervals up to 30 days . The formulations were placed in tightly sealed vials flushed with nitrogen gas and stored at 4 1c and ambient temperature (28 1c). Statistical analysis was carried out employing the student's t - test using the software prism (graphpad). Film hydration method was used for preparation of multilamellar oleic acid vesicles by varying ratios of oleic acid to dexamethasone followed by hydration at ambient temperature for 1 h. the thickness and uniformity of the film depends on speed of rotation . Uniform thin lipid film was formed at the rotation speed of 120 rpm while lower and higher rate of rotation resulted in detectable nonvesicular aggregated artifacts . The formed ufasomal formulations were further characterized for size, entrapment efficiency, and zeta potential studies (table 1). The photomicrographs showed that oleic acid vesicles formed were spherical in nature (figure 1(a)). Further, to detect the multilamellarity of vesicles, tem study was conducted (figure 1(b)). The size of the ufasomal formulations before sonication was observed in the range of 4 to 5 m while after sonication the vesicle size was in the range of 100200 nm . For better skin permeation hence, the result indicates that vesicle size was dependent on the composition of lipid bilayer . As the concentration of fatty acid in the oleic acid vesicular formulation however, reduction in vesicle size was observed when oleic acid concentration was increased above 15% w / w . This was due to the formation of micellar structure instead of vesicles, which has smaller size than vesicles [27, 28]. The result of the vesicle size measurement was well correlated with the report of that vesicle size decreased as surfactant concentration was increased (table 1). The mean average diameter of ufasomes and traditional liposomes vesicles was 100 nm and was transparent colloidal dispersions (figure 2) (table 1). The ufasomes were homogenized by extrusion through a 100 and 200 nm polycarbonate membrane filters which result in the formation of monodispersed particles because of the low polydispersity index, that is, less than 1 (table 1). The size of ufasomal formulation should be less than 50 nm so that it can be used for topical purpose . To support above facts we optimized and reported two parameters which can be related to stability of vesicular formulation . Sonication time of ufasomal formulation in size range of 100 nm was optimized at 40 w output frequency at various time intervals of 5, 10, 15, 20, and 25 min and the size was determined using dls method . The sonication time required for preparing ufasomal formulation of size 100 the studies carried out showed no significant difference in the entrapment efficiency; however the mean entrapment efficiency of the fatty acid vesicles was found to be increased on increasing the molar quantity of dexamethasone up to 8: 2 oleic acid - to - dexamethasone ratio (65.2 3.8%). Beyond this ratio the size of fatty acid vesicles was obtained in the range of 400 nm to 1 m . The oleic acid vesicular formulations were mostly poly disperse in nature . At 8: 2 oleic acid - to - dexamethasone ratios the dispersity was recorded to be 0.534 0.026 . The photomicrographs showed that oleic acid vesicles formed were spherical in nature (figure 2(a)). Further, to detect the multilamellarity of vesicles, tem study was conducted (figure 2(b)). Transformation of fatty acid vesicles to mixed micelles is concentration and ph dependent process and was governed mainly by progressive formation of mixed micelles within the bilayer . To support the above fact the results of turbidity measurement studies (table 1) support the fact that micelles were formed at higher concentration of fatty acid . This can be observed due to fact that at low concentration of surfactant partition coefficient favors the lipid phase and caused expansion of lipid bilayer resulting in increased turbidity of vesicle dispersion . At the same time, surfactant also causes fluidization of bilayer, which is also responsible for increasing the turbidity . After an optimum concentration, conversion of lipid vesicles into mixed micelles begins which have negligible turbidity . The fatty acid vesicles were evaluated to assess their efficacy in delivering the bioactives to and through stratum corneum of the skin . The major consideration in the formulation of fatty acid vesicles is ph of the formulation; this being a critical factor that controls the degree of ionization of fatty acid [14, 31] and is hence responsible for the formation of vesicle . The fatty acid (oleic acid) assembled into vesicles only if ph equals the pka of the acid (8.5). At this ph, ~50% of the carboxylic acid is ionized and transforms into ionized amphiphile(s) with a tendency to form vesicles / aggregates . The acid is present as ionic rcoo as well as neutral rcooh species . In such conditions each ionized group is stabilized through a strong hydrogen bond formed with the neutral molecules . The negative charge present on the ionized carboxylic group is shared between two adjacent fatty acid molecules, that is, ionized and unionized, and thus results in the formation of typical dimmers . The hydrophobic hydrocarbon chain of so formed dimmers protects itself from the aqueous compartment and thus orients to form an enclosed bilayer structure that minimizes the interaction between the hydrocarbon chain and water . The ratio of protonated and deprotonated group seems also critical in the process of vesiculation . This is possible only if the concentration of the fatty acid in aqueous dispersion exceeds the critical vesicle concentration (cvc), which is reportedly 80 mm for oleic acid . The stability of the vesicles is attributed to the strong hydrogen bond - based interactions between the protonated and deprotonated groups, namely, rcoo hoocr [13, 3335], the effect of drug: oleic acid ration on the encapsulation of the dexamethasone was studied . It was seen that the drug bearing capacity of the oleic acid vesicles depends upon the molar ratio of oleic acid and dexamethasone . The entrapment efficiency increased up to oleic acid: drug molar ratio 8: 2; beyond this ratio further increase in the amount of drug reduced the degree of drug encapsulation . Further addition of drug could have destabilized the vesicle membrane leading to the leakage of content . Since the 8: 2 vesicles showed the best physicochemical characteristics (high homogeneity, high entrapment efficiency), the respective formulation was selected for further studies . Different ufasomal formulations were subjected to in vitro drug release studies using cellophane membrane . For the optimization of drug concentration that could be incorporated into the vesicles, these ufasomal formulations were subjected to in vitro drug release through cellophane membrane and the% amount of drug permeated was calculated . Values of% amount of dexamethasone permeated across cellophane membrane are shown in figure 3 . By comparing the release from various oleic acid vesicles based formulations (prepared using different oleic acid and dexamethasone molar ratios), it was deduced that there was no considerable difference in the release in terms of kinetic pattern, although drug release exhibited a concentration - dependent behavior . These results are in agreement with the release kinetic reported by other research workers who documented that drug release from vesicles is affected by diffusion [36, 37]. The release rate of dexamethasone from ufasomes was slow, controlled and uniform than drug solution . After 4 h 98.5% drug was released from drug solution . In comparison at 8 hr, about 34.3% and, in 24 the ph - dependent stability behavior substantiates that drug diffusion across the skin may increase with a decrease in the ph of the vesicles dispersion . Thus, the increased diffusion of drug from the vesicles at low ph may have resulted due to decreased stability of the vesicles at lower ph . This further suggests that vesicles tend to fuse when they are exposed to low ph . It also provided useful information on topical drug delivery potential and characteristics of oleic acid vesicles since the ph of skin is 7.2 . It was observed that the release from vesicles is highly ph - dependent and on lowering the ph from 8.5 to 5.5, only 30% of the drug remained in vesicles to be released after 8 h of incubation in buffer of ph 5.5 as compared to residual drug estimated, that is, 71% at ph 8.5 (figure 4). The differences in drug diffusion recorded at ph 8.5 and 7.4 were not significant (p> 0.01). Therefore, further studies were continued by adjusting the ph of vesicles suspension to 7.4, since higher ph values may cause skin irritation and may not be acceptable for topical application . Simultaneously, morphological changes in vesicles size and shape were also observed with changing ph . The results displayed an increase in the size of the vesicles at low ph values (figure 5). The skin permeation study was conducted on optimized formulation prepared at 8: 2 fatty acid: drug ratio (ph 7.4) (highest entrapment efficiency and more uniform sized vesicles). To normalize the effect of ph on skin permeation, the plain ph of drug gel was also adjusted to ph 7.4 . A significant increase in the skin permeation of dexamethasone was recorded from oleic acid vesicle dispersion in comparison to plain gel (figure 6). The drug penetration following application of an equivalent amount of drug in vesicular dispersion was significantly high, that is, 34.75% . The permeation parameters were calculated by plotting a curve between cumulative amounts of drug permeated per unit area (g / cm) versus time . The transdermal permeation rate constants obtained were higher for oleic acid vesicle dispersions (18 1.48 g / h / cm) than the plain drug gel (3.8 0.8 g / h / cm) (table 2). Sem studies using rat skin were also conducted in order to explain the effect of fatty acid vesicles on the surface morphology of skin . After 24 hr application of optimized ufasomal formulation (uf-2) on to rat skin sem photomicrographs were taken . The vesicular suspension formed networks and stacks of lipid bilayers at the interface of the stratum corneum . Intracellular vesicular structures were observed in superficial layers of the stratum corneum and their appearance might be explained by desquamating corneocytes with a leaky membrane, through which liposomes penetrate . These vesicular suspensions are more flexible and can easily pass through skin pores . In comparison to control skin, vesicle treated skin was more smooth and some vesicular structures were present on the surface . The morphology of cell was changed and some partial disappearance of intercellular lipid was observed . Figure 8 shows the ftir spectra of untreated skin (control) and skin treated with optimized formulation (uf-2). In pure dexamethasone spectra, the characteristic absorption bands at 3390 and 1268 f bonds, respectively; the stretching vibration at 1706, 1662, and 1621 cm were due to c = o and double bond framework conjugated to c = o bonds . Ft - ir spectrum of untreated sc (control) showed various peaks due to molecular vibration of proteins and lipids present in sc (figure 8(a)). The absorbtion bands in the wave number of 30002700 cm were seen in untreated sc . The bands at 2922.26 cm and 2852.98 cm were due to the asymmetric -ch2 and symmetric -ch2 vibrations of long chain hydrocarbons of lipids, respectively . The bands at 2955 cm and 2870 cm were due to the asymmetric and symmetric ch3 vibrations, respectively . These narrow bands were attributed to the long alkyl chains of fatty acids, ceramides, and cholesterol which are the major components of the sc lipids . The sharp peak at 1708 cm was due to the -c = o stretching vibrations of sc proteins . There was clear difference in the ftir spectra of untreated and treated sc with prominent decrease in asymmetric and symmetric ch- stretching of peak height and area (figure 8(b)). The rate limiting step for topical drug delivery is lipophilic part of sc in which lipids (ceramides) are tightly packed as bilayers due to the high degree of hydrogen bonding . The amide i group of ceramide is hydrogen bonded to amide ii group of another ceramide and forming a tight network of hydrogen bonding at the head of ceramides . This hydrogen bonding makes stability and strength to lipid bilayers and thus imparts barrier property to sc . When skin was treated with ufasomal formulation (uf-2), ceramides got loosened because of competitive hydrogen bonding leading to breaking of hydrogen bond networks at the head of ceramides due to penetration of ufasomes into the lipid bilayers of sc . Treatment with ufasomes resulted in either double or single peak at 1708 cm (figure 8(b)) which suggested breaking of hydrogen bonds by ufasomes . Due to the best results observed in the physicochemical characterization, figure 9 shows the increase in edema volume (%) using the method of acute edema inhibition produced by carrageenin injection, as a function of time . The evaluation of the anti - inflammatory activities was performed by the comparison of uf-2 with a dexamethasone commercial injection product (decadron) used as reference . When dexamethasone was associated with fatty acid vesicles and its anti - inflammatory activity evaluated by inhibition, carrageenan edema a significant reduction of edema (p <0.10) was measured in comparison to the commercial product . Stability of the product may be defined as the capability of a particular formulation to remain with the physical, chemical, therapeutic, and toxicological specifications . The optimized formulation (uf-2) was selected for stability study on the basis of its in vitro performance and stored in tightly closed glass vials at room temperature and in refrigerator (4 2c). Following parameters were evaluated at different time intervals (10, 20, and 30 days). The formulations were stored in 10ml glass vials at refrigeration temperature (4 2c) and room temperature for a period of one month . The samples were analyzed at predetermined time intervals visually and under optical microscope for the change in consistency and appearance of drug crystals . The magnitude of drug retained within the vesicles ultimately governs the shelf life of the formulation . The fatty acid - based vesicles formulations when stored at ambient and refrigerated conditions have shown that the vesicles are stable at 4 1c . This is because the vesicles sizes at this temperature remain stable and unchanged; thus the leakage from the vesicles was minimal ., the phase transition temperature of oleic acid is exceeded; hence they tend to fuse [39, 40]. The drug leakage studies carried out also suggested better stability of fatty vesicles at refrigerated conditions . Based upon above results it can be concluded that encapsulation of drug in fatty acid vesicles can serve as potential carriers for the delivery of anti - inflammatory drug . Cost effectiveness, therapeutically viability, and sustained release behaviour along with drug retention in the deeper part of skin might be beneficial for the long - term effects of drugs . The fatty acid in addition may serve as a penetration enhancer, thus by avoiding the stratum corneum barrier potential they may lead to better permeation of the drug molecules.
|
Ventral hernias are the second most common type of abdominal wall hernias, after inguinal hernias . The majority of ventral hernias are incisional, occurring in 3% to 13% of laparotomy incisions, necessitating approximately 90 000 ventral hernia operations per year . The use of prosthetic material, such as polypropylene mesh, polytetrafluoroethylene, and marlex mesh has decreased rates of recurrence . However, wound complications with the use of mesh in open ventral hernia repair are significant . Since 1992, the laparoscopic technique has been applied to the repair of ventral hernias because of its many advantages including the absence of large subcutaneous flaps, a lower incidence of wound infection, and a reduction in postoperative pain and hospital stay . The lower recurrence rates are most likely due to the tension - free and intraperitoneal placement of the mesh . Laparoscopy offers a clear view of the entire fascial defect, which is not always possible with the open technique, especially if a thus, the entire defect is completely circumscribed with the laparoscopic technique . The surgical technique described for laparoscopic ventral hernia repair varies by surgeon . However, all techniques reported use at least 3 port sites, with one or more being 10 mm . Using this technique, either the primary surgeon or the first assistant is working in mirror - image . Between july 2002 and january of 2003, 3 patients underwent laparoscopic ventral hernia repair with mesh in which only two 5-mm ports were used for small incisional or ventral hernias . Follow - up surveillance for complications and hernia recurrence was performed in the immediate postoperative period, 1 week to 2 weeks after surgery . Additional follow - up was obtained by telephone interview 6 months to 12 months postoperatively . After the abdomen was prepped, an iodine impregnated adhesive drape dressing was placed on the patients' abdomen . Access to the abdomen was obtained in an area lateral to the hernia by using a veress needle . After exploration of the abdomen, a second 5-mm trocar was introduced under direct visualization on the opposite side of the fascial defect . Adhesiolysis was performed to free the anterior abdominal wall, and the margins of the hernia defect were circumferentially cleared to a distance of at least 4 cm . A dual, expanded polytetrafluoroethylene (eptfe) mesh (dualmesh, wl gore, flagstaff, az) was used, ranging in size from 8.5 cm to 10 cm . Once the mesh was place intracorporeally, the sutures were retrieved through the abdominal wall by using a laparoscopic suture passer . The sutures were tied extracorporeally, and the knots were buried in the subcutaneous tissues . The circumference of the mesh was then affixed, by using a 5-mm spiral tacking device, to the posterior abdominal wall at intervals of approximately 1 cm . After the abdomen was prepped, an iodine impregnated adhesive drape dressing was placed on the patients' abdomen . Access to the abdomen was obtained in an area lateral to the hernia by using a veress needle . After exploration of the abdomen, a second 5-mm trocar was introduced under direct visualization on the opposite side of the fascial defect . Adhesiolysis was performed to free the anterior abdominal wall, and the margins of the hernia defect were circumferentially cleared to a distance of at least 4 cm . A dual, expanded polytetrafluoroethylene (eptfe) mesh (dualmesh, wl gore, flagstaff, az) was used, ranging in size from 8.5 cm to 10 cm . Once the mesh was place intracorporeally, the sutures were retrieved through the abdominal wall by using a laparoscopic suture passer . The sutures were tied extracorporeally, and the knots were buried in the subcutaneous tissues . The circumference of the mesh was then affixed, by using a 5-mm spiral tacking device, to the posterior abdominal wall at intervals of approximately 1 cm . The size of the mesh used varied, based on the size of the original defect . Additionally, no recurrences were noted after a mean follow - up of 9 months (range, 6 to 12). Laparoscopic ventral hernia repair is a procedure that has gained acceptance among surgeons and patients over the last 5 years to 10 years . The documented advantages of laparoscopic surgery in general include faster recovery and return to normal activity, less postoperative pain, fewer wound - related complications, and a better cosmetic result . In addition, the intraperitoneal repair performed laparoscopically poses a significant mechanical advantage and is associated with less recurrence . We present 3 patients who underwent laparoscopic repair of a ventral hernia in which two 5-mm ports were used . These patients had no surgical complications, and the mean operating room times were acceptable . This technique offers all the advantages inherent to laparoscopic surgery, with the added benefit of the use of only two 5-mm ports . Laparoscopic repair of ventral or incisional hernias can be performed using only two 5-mm ports . This technique can be done on an outpatient basis in a safe, timely fashion.
|
Errors in the administration of chemotherapeutic agents have been reported in the literature . The majority of these reports concern the overdose of a single agent during combination chemotherapy . Mistakes are usually decimal point errors or occur by confounding drugs with similar names . Although combination chemotherapy is the treatment of choice for many forms of cancer, accidental overdose of multiple chemotherapeutic agents has not been reported so far . This 35-year - old man was diagnosed as having non - hodgkin s lymphoma in april 1986 . A cervical lymph node biopsy was compatible with the diagnosis of a low grade non - hodgkin s lymphoma which was diffuse centroblastic centrocytic according to the kiel classification . He was treated with three cycles of the chop regimen followed by daily oral leukeran for 6 months . In may 1987, progression of the disease in the abdomen trials with daily prednimustine therapy as well as 3 cycles of vp-16 therapy were unsuccessful and the disease was progressing . In november 1988, he was hospitalized for a more aggressive chemotherapy . A macop - b - type regimen of adriamycin and cyclophosphamide, alternating with vincristine and bleomycin every other week, combined with daily oral prednisone, ketoconazole and bactrim was scheduled . Due to a misunderstanding, the following doses were administered: adriamycin 50 mg / m per day and cyclophosphamide 350 mg / m intravenously for 6 days followed by vincristine 1 mg / m and bleomycin 10 mg / m intravenously for 4 days, resulting in a total of 600 mg adriamycin, 4200 mg cyclophosphamide, 80 mg bleomycin and 8 mg vincristine within 10 days . On the 10th day of chemotherapy, the patient developed fever, generalized weakness and malaise, severe oral and anal discomfort, epistaxis and loss of fresh blood per anus . The patient was severely ill, hypotensive with a bp of 110/50, pr of 114 and febrile with a temperature of 39.2c . The following laboratory data were obtained: hb 8.4 g / l, hct 25%, wbc 11.98010/1 with 97% lymphocytes and 0.8% pmn . The boen marrow aspiration on admission showed an absent normal hemopoiesis but still massive infiltration with b4, b1, hla - dr, surface igg, igd and lambda light chain positive lymphocytes compatible with the diagnosed lymphoma . He was treated with broad spectrum antibiotics, initially with kefzol, tobramycin and azlocillin, which was changed to tienamycin, amikacin and metronidazole because of persistent fever . Recombinant human granulocyte macrophage colony stimulating factor (rhgm - csf) was given 400 ug daily as a continuous infusion for 17 days . An episode of intractable severe oral mucosal bleeding leading to hemorrhagic shock was treated with an intravenous infusion of 8-ornithine - vasopressin . He required a total of 21 units of packed red cells and 14 units of single donor platelet concentrates during hospitalization . A bone marrow examination one week after admission and rhgm - csf therapy showed three lineage hemopoiesis and only a few remaining small lymphocytes . By this time, the spleen was no longer palpable and the signs of ileus had improved . During the whole hospitalization, recovery of the first granulocytes was observed after 10 days of rhgm - csf infusion, corresponding to the 26th day after chemotherapy . His wbc count was 2.210/1 with 60% pmn s and his platelet count was 2110/1 . Physical examination was normal with the exception of minimal splenomegaly and the absence of the deep tendon reflexes . The reevaluation of the disease status showed areas of lymphocytic infiltration in the bone marrow aspirates and still significant retroperitoneal, mesenteric and iliac lymphadenopathy on abdominal computed tomography . This patient was treated with 600 mg adriamycin, 4200 mg cyclo - phosphamide, 80 mg bleomycin and 8 mg vincristine within 10 days and suffered mainly from life - threatening pancytopenia, mucositis and ileus . Our major concern upon admission was adriamycin toxicity because he had received six time the scheduled dose of adriamycin on 6 subsequent days; this in combination with the other drugs . The maximum tolerated dose of adriamycin in human beings is not known . In mice, intravenous administration of adriamycin at a dose of 20 to 40 mg / kg is lethal within four days after injection . A single intravenous dose of 10 mg / kg causes a well defined acute cardiac pathology leading to diffuse chronic cardiomyopathy within fifty days . Our patient did not show any signs of acute cardiac decompensation nor signs of arrhythmia . The echocardiographic findings of minimal cardiac dilatation after discharge may be the effects of this acute overdose as well as those of the previous adriamycin therapy . Activated charcoal hemoperfusion has been suggested in reducing blood levels of adriamycin in patients with hepatic disease or accidental overdosage . Since 5 days had already passed since the last dose, we did not perform hemoperfusion . It is possible, although not certain, that rhgm - csf has accelerated granulocyte recovery in this patient . It could have been spontaneous recovery 26 days after chemotherapy and 10 days after initiation of rh - gm - csf infusion . The tumor response of this refractory lymphoma with a spleen enlarged up to the pelvis prior to therapy was impressive but not complete . It remains to be seen whether low grade lymphoma can be treated at an earlier stage with high dose chemotherapy or by allogeneic bone marrow transplantation . In conclusion, this case demonstrates the danger of prescribing anticancer agents by in experienced physicians and underlines the need for specialized institutions for such therapies in order to allow control of dose and concentration and to minimize the possibility of such an accident.
|
Esthesioneuroblastoma is an uncommon malignant neoplasm that arises from the olfactory neuroepithelium1 and is typically located in the upper nasal cavity and cribriform plate.2 in this article we report a case of esthesioneuroblastoma presenting concomitantly with a growth - hormone (gh)-secreting pituitary macroadenoma . The combined open and endoscopic management of this patient is described, and a review of the literature presented . The patient is a 52-year - old woman who presented with a 9-month history of recurrent sinusitis refractory to a repeated course of antibiotics . She was seen by an outside ear nose and throat surgeon who operated on her for suspected nasal polyps . She complained of right orbital pain postoperatively and was also treated for a postoperative sinusitis . In retrospect, she admitted to a 4-month history of anosmia, although she denied any alteration of taste . Visual acuity was 20/30 - 1 in both eyes with a very mild bitemporal hemianopia . Subsequent computed tomography and magnetic resonance imaging (mri) of the brain and sinuses demonstrated an enhancing mass along the anterior skull base with extension through the right cribriform plate, with a lobular component displacing the right gyrus rectus, along the right medial orbital wall and into the nasal cavity . (a) sagittal, (b) coronal, and (c) axial t1 weighted magnetic resonance imaging (mri) with gadolinium demonstrating anterior skull base esthesioneuroblastoma with involvement of the right lamina papyracea and extension through the cribriform plate and dura, and a noncontiguous pituitary macroadenoma . (g i) mri after a second - stage endoscopic transsphenoidal resection of pituitary macroadenoma, with reconstitution of the normal residual pituitary gland . Her preoperative insulinlike growth factor (igf)-1 level was 154.00 nmol / l (normal: 7.6025.20 nmol / l), and prolactin was mildly elevated at 36.2 g / l (normal: 3.929.5 g / l). In light of the tumor size, the right lamina papyracea destruction, and significant intradural involvement, the tumor stage was classified as t4n0m0 based on the dulguerov tnm system3 and kadish stage c.4 a recommendation of staged resection of the esthesioneuroblastoma followed by the pituitary macroadenoma was made . For the first stage, a combined open and endoscopic resection was proposed, to facilitate a true en bloc resection and to harvest a generous pericranial flap for repair . Following this, the patient would undergo stereotactic radiation to the tumor bed, and she would return electively for endoscopic resection of the pituitary macroadenoma . An extended subfrontal approach was completed first, consisting of a bicoronal incision, bifrontal craniotomy, and bilateral orbital osteotomy sparing the cribriform plate . A generous extracapsular dissection of the intradural portion of the tumor was completed as well as a wide dural incision around the tumor, including posteriorly at the posterior aspect of the planum sphenoidale . The endonasal endoscopic approach was then performed (fig . 2), consisting of a right middle turbinectomy, complete sphenoethmoidectomies, and a superior septectomy . The lamina papyracea component of tumor was resected with the aid of a handheld retractor protecting the periorbita from the orbitotomy above (video 1). The left side of the planum was drilled out as was the posterior planum, releasing the tumor as a single specimen . The dural defect was reconstructed with a free pericranial graft, and a second pedicled pericranial flap was mobilized over the dural closure prior to replacement of the orbital osteotomy and craniotomy flap . Postoperatively she developed symptomatic pneumocephalus that was thought to be secondary to lumbar drain placement . There were no other complications postoperatively, and the patient was discharged home on postoperative day 7 . The rationale for staging was to avoid potential complications during the esthesioneuroblastoma resection, such as a separate cerebrospinal fluid (csf) leak or hypopituitarism, and possibly delaying adjuvant radiation therapy . Following complete resection of the esthesioneuroblastoma and radiation therapy, the patient returned to electively manage the pituitary tumor 3) revealed a small blue cell tumor arranged in lobules and with mild nuclear pleomorphism . Sustentacular cells were present and stained positive for s-100 protein . The specimen was consistent with a hyams grade 2 esthesioneuroblastoma.5 postoperative mri confirmed gross total resection of the esthesioneuroblastoma (fig . Postoperatively, the patient underwent fractionated intensity - modulated radiation therapy to the resection area . A total of 60 gy over 30 fractions were administered, after which six cycles of carboplatin and paclitaxel were given . (a) hematoxylin and eosin preparation demonstrating a small blue cell tumor arranged in lobules and with mild nuclear pleomorphism . (d) in a second stage, a typical pituitary macroadenoma was removed . As a second stage, 8 months following the first surgery, the patient underwent a complete endoscopic transsphenoidal removal of the pituitary macroadenoma (fig . 4). There was a mild intraoperative csf leak at the end of the resection, and a right nasoseptal flap was harvested in this case to repair the sella as well as autologous fascia lata . Pathology for the pituitary tumor was consistent with a pituitary adenoma, with both prolactin and gh positivity (fig . Follow - up, there was marked improvement in her acromegalic features, the patient's facial complexion had improved and the finger breadth diminished (fig . (a) endoscopic view right nasal cavity demonstrating pristine pericranial repair of anterior skull base resection . (b) transsphenoidal resection of pituitary macroadenoma with (c) nasoseptal flap reconstruction . (b) patient 2 weeks after endoscopic resection of growth - hormone - secreting pituitary macroadenoma, demonstrating early resolution of acromegalic facies . Postoperatively, her igf-1 level normalized, from 154.00 to 22.00 nmol / l, consistent with endocrinologic cure.6 the remainder of her pituitary hormonal panel is otherwise normal . Her last ophthalmologic assessment revealed 20/20 - 1 visual acuity in both eyes with no evidence of optic neuropathy or visual field deficit . Her most recent mri demonstrated complete resection of the pituitary macroadenoma with reconstitution of the normal residual pituitary gland (fig . To our knowledge this is the first case of synchronous esthesioneuroblastoma and macroadenoma, in this case gh secreting, described in the literature . Esthesioneuroblastoma has been described as a secondary tumor occurring many years after treatment for pituitary neoplasms,7 8 presumably from radiation therapy . Several cases of primary intrasellar esthesioneuroblastoma or neuroblastoma in the absence of pituitary adenoma have also been reported.9 10 11 12 13 14 15 16 17 esthesioneuroblastoma can mimic pituitary adenomas in imaging appearance, and misdiagnoses of pituitary adenoma have been reported.18 positive immunoreactivity for neuron - specific enolase and synaptophysin are distinguishing features.2 no etiologic basis or risk factors for esthesioneuroblastoma formation have been described, although several cases have been identified following radiation therapy or exposure19 20 21 including two cases following remote radiation for pituitary adenomas.7 8 one case of esthesioneuroblastoma was described followed kidney transplant and immunosuppression therapy.22 very rarely esthesioneuroblastoma presents in association with ectopic adrenocorticotropic hormone secretion.23 patients with acromegaly have an increased risk of several neoplasms including colorectal and thyroid cancer and possibly breast, prostate, and hematologic malignancies.24 both gh and igf-1 are known to promote cellular growth and proliferation, and they may also have mitogenic, proangiogenic, and antiapoptotic properties.25 26 several authors have observed an association between high serum igf-1 levels and colorectal malignancy in acromegalic patients.27 28 29 a meta - analysis of 21 studies and 3609 cases found associations between high igf-1 levels and prostate and premenopausal breast cancer.30 in a prospective study, fasting and 2-hour gh levels were also associated with increased mortality from combined malignancies among nonacromegalic cohorts.31 other possible mechanisms of carcinogenesis include altered cellular immunity, related to an altered lymphocyte subset pattern . Colao et al found a significant reduction in cluster of differentiation (cd) 19 and 20, and an increase in cd3 from the lamina propria of polyps in patients with acromegaly.28 standard surgical management of anterior skull base malignancies including esthesioneuroblastomas is typically in the form of an open craniofacial resection . The management of malignant tumors of the anterior skull base has received considerable attention in the recent literature owing to increasing trends of purely endoscopic or combined open and endoscopic oncologic resection . In one meta - analysis of all sinonasal malignancies, no statistically significant difference in outcome between open and endoscopic resection was found for low - grade (t12 or kadish a b) malignancies.32 a second meta - analysis for esthesioneuroblastomas including 379 subjects did not demonstrate inferiority of purely endoscopic resection; however, the authors acknowledge significant sources of error from publication bias, limited follow - up duration, and more advanced tumor stage in the open craniofacial resection group.33 in a multicenter study incorporating 23 patients, complete resection was achieved in this carefully selected cohort in 17 of 23 patients.34 csf leaks occurred in 4 of 23 patients . All patients were disease free at a mean follow - up of 45.2 months . In summary, it remains to be determined whether true en bloc resection of esthesioneuroblastomas is superior to endoscopic intralesional resection, albeit with negative margins . Purely endonasal resection of anterior skull base malignancies has been generally reserved for patients with relatively earlier disease stage and no or limited skull base invasion.35 significant invasion of the fovea ethmoidalis or the cribriform plate, significant dural involvement or transdural spread,35 involvement of the soft tissues of the face,36 lateral extension over the orbital roof, extensive frontal sinus involvement, and invasion through the lamina papyracea into the intraorbital space all increase the level of difficulty of achieving a gross total resection via an endoscopic approach.37 in our case, endoscopic visualization of the inferior cuts facilitated a true en bloc resection of the esthesioneuroblastoma, without the use of facial incisions or intralesional debulking . It is generally accepted that complete resection followed by adjuvant radiation therapy reduces the rate of local recurrence in patients with esthesioneuroblastoma38 and improves disease - free survival.39 40 chemotherapy remains a matter of debate in upfront treatment, with typical indications being high - grade, recurrent, metastatic, or unresectable tumors.41 in some centers, neoadjuvant chemotherapy has been used with success prior to standard craniofacial resection 42 43 in this patient, complete resection of an esthesioneuroblastoma was achieved using a combined open craniofacial and endoscopic approach, followed by a complete endoscopic resection of a gh - secreting pituitary macroadenoma, resulting in endocrinologic cure . The relative indications and advantages of the expanded endonasal approach for anterior skull base malignancies are illustrated.
|
Preliminary tests revealed ch2cl2 as a suitable extraction solvent for the roots of k. lappacea in order to maximize the yield of lignan derivatives and to minimize the vegetable tannin content in the resultant extract . Eleven previously known lignan derivatives, comprising neolignans, norneolignans, and 7,7-epoxy lignans, were isolated using different chromatographic techniques . Identity in each case was verified by determination of the optical activity, 1d- and 2d - nmr experiments, and mass spectrometry, by comparison with published data, as 5-(3-hydroxypropyl)-2-(2-methoxy-4-hydroxyphenyl)benzofuran (1), ()-larreatricin (2), meso-3,3-didemethoxynectandrin b (3), (2s,3s)-2,3-dihydro-3-hydroxymethyl-2-(4-hydroxyphenyl)-5-(e)-propenylbenzofuran (4), 2-(2-hydroxy-4-methoxyphenyl)-5-(3-hydroxypropyl)benzofuran (5), 2-(2,4-dihydroxyphenyl)-5-(e)-propenylbenzofuran (6), (+) -conocarpan (7), 2-(4-hydroxyphenyl)-5-(e)-propenylbenzofuran (8), rataniaphenol iii (9), rataniaphenol i (10), and rataniaphenol ii (11). The topical anti - inflammatory effect of the ch2cl2 extract of k. lappacea roots as well as of the isolated lignan derivatives was determined as antiedema activity 6 h (the maximum of edema formation in control mice) after induction of dermatitis. (17) the extract exhibited a potent dose - dependent inhibition of edema, which ranged from 24% at the lowest dose (30 g / cm) to 86% for the highest administration (300 g / cm). All isolated lignan derivatives significantly reduced the edematous response from about 15% (0.1 mol / cm) to about 80% (1.0 mol / cm), in a dose - dependent manner . The same doses of the nonsteroidal anti - inflammatory drug (nsaid) indomethacin reduced the induced edema formation between 25% and 80%, while the glucocorticoid hydrocortisone showed edema inhibition from 29% to 77%, at 10 times lower doses (table 1). To evaluate the anti - inflammatory potency of the extract as well as of the isolated compounds, id50 values were assessed . The lignan derivatives showed id50 values in the range 0.310.60 mol / cm, corresponding to 80160 g / cm, which were comparable to indomethacin (id50 0.29 mol / cm, corresponding to 104 g / cm) and about 10 to 20 times less potent compared to hydrocortisone (id50 0.03 mol / cm, corresponding to 11 g / cm) (table 1). The anti - inflammatory activities of the most promising compounds, 5 and 7, at 0.4 mol / cm, a dose leading to about 50% edema reduction at 6 h, were investigated further with regard to both edema development and leukocyte infiltration up to 48 h after dermatitis induction and were compared to indomethacin (0.4 mol / cm) and hydrocortisone (0.04 mol / cm). The time - dependent effect of the test compounds on edema formation is represented in figure 1 . Control animals developed an edematous response still measurable after 48 h, with a maximum 6 h after croton oil application, followed by a progressive decrease . Compounds 5 and 7 exerted a significant inhibitory activity at each observation time, showing reductions in the ranges of 2889% and 2561%, respectively . Interestingly, despite the similar activity profile, compound 5 provoked maximum edema reduction after 3 h (89%), which declined to 29% reduction at 48 h. in contrast, (+) -conocarpan (7) exhibited a long - lasting steady anti - inflammatory effect, with a maximum response after 6 h (61%) and a still - pronounced activity at 48 h with edema reduction by 41% . The effect of an equimolar dose of indomethacin was significant only 3 and 6 h after the induction of dermatitis, when it reduced the edematous response by 84% and 76%, respectively . Indomethacin then lost its antiedematous effect substantially, as previously observed. (17) hydrocortisone (0.04 mol / cm) reduced edema formation at all observation times significantly, from 79% (6 h) to 60% (12 h) (figure 1). Effect of compounds 5 and 7 and the reference drugs, indomethacin and hydrocortisone, on the time course of the edematous response up to 48 h (controls; 0.4 mol / cm compound 5; 0.4 mol / cm compound 7; 0.4 mol / cm indomethacin; 0.04 mol / cm hydrocortisone); * p <0.05 in the analysis of variance, as compared to controls . The activity profile of the two benzofuran derivatives 5 and 7 and of the reference drugs on the whole edematous response up to 48 h was quantified by calculating the ratio between the aucs for mice treated with these compounds and the aucs of control animals . Compounds 5 and 7 reduced the global edematous response by the same extent (47%, and 45%, respectively), exerting an effect 2-fold more potent than that of indomethacin (24% reduction) but significantly lower compared to hydrocortisone (69% reduction) (see table s1, supporting information). The effect of the test compounds on leukocyte infiltration up to 48 h is represented in figure 2 . The recruitment of leukocytes in the inflamed ear tissue of control animals, measured as myeloperoxidase activity, was already detectable 3 h after induction of dermatitis . It increased up to 24 h and slightly decreased until 48 h. compounds 5 and 7 caused a significant reduction of leukocyte infiltration at all observation times, ranging from 24% to 35% and 27% to 44% inhibition, respectively . Indomethacin and hydrocortisone exerted comparable effects (2749% and 3556% reductions, respectively), which were significant at each observation time (figure 2). Effect of compounds 5 and 7 and the reference drugs, indomethacin and hydrocortisone, on the time - course of leukocyte infiltration measured as myeloperoxidase activity up to 48 h (controls; 0.4 mol / cm compound 5; 0.4 mol / cm compound 7; 0.4 mol / cm indomethacin; 0.04 mol / cm hydrocortisone); * p <0.05 in the analysis of variance, as compared to controls . The effects of the benzofurans on the global granulocyte infiltrate calculated from the aucs represented in figure 2 (32% and 37% reduction) were comparable to those of the reference drugs indomethacin (42% reduction) and hydrocortisone (51% reduction) (see table s1, supporting information). The anti - inflammatory effects of compounds 5 and 7 and of the reference compounds were evaluated additionally by the histological examination of ear tissues . Ear dermal tissue of the control mice showed degranulated mast cells visible as soon as 3 h after dermatitis induction (see figure s1b, supporting information). Dilated blood vessels and dermal swelling were also observable, becoming more evident after 6 h (figure 3b) and progressively attenuating after 9 h. moreover, an increased number of infiltrated neutrophilic granulocytes was visible after 6 h, then increasing up to 24 h (see figure s2b, supporting information) and being still sustained after 48 h. ears of mice treated with compound 5 or compound 7 (0.4 mol / cm) showed a general reduction of these vascular and cellular changes due to inflammation, including the presence of mast cells preserved from degranulation (figures 3c, s1c, s2c; 3d, s1d, s2d, supporting information). Similarly, ear tissues from mice treated with indomethacin (0.4 mol / cm) showed reduced mast cell degranulation and leukocyte infiltration at all observation times . However, after 9 h the dermal swelling was comparable to that of control mice (figure 3e, figures s1e, and s2e, supporting information). Ear biopsies from animals treated with hydrocortisone (0.04 mol / cm) revealed an attenuation of all the vascular and cellular signs of inflammation (figure 3f, figures s1f, and s2f, supporting information). Sections of mouse ears 6 h after the induction of the croton oil dermatitis (a: untreated ear; b: control; c: 0.4 mol / cm compound 5; d: 0.4 mol / cm compound 7; e: 0.4 mol / cm indomethacin; f: 0.04 mol / cm hydrocortisone). Hematoxylin and eosin staining, 25 magnification . To obtain insight into the molecular mechanism(s) of the observed in vivo effects, the k. lappacea root ch2cl2 extract was tested initially for its potential to inhibit nf-b transactivation activity in tnf--stimulated hek-293 cells stably transfected with a nf-b - driven luciferase reporter gene . Since this crude extract showed a pronounced activity (> 50% inhibition) at a concentration of 10 g / ml, ic50 values for all isolated lignan derivatives (111) were determined . Interestingly, all compounds significantly reduced nf-b - dependent luciferase activity in a concentration - dependent manner . Four compounds (5, 6, 8, and 11) were able to inhibit nf-b activation in the low micromolar range, comparably to the positive control, parthenolide (ic50 1.4 m), with ic50 values ranging from 1.4 to 6.4 m . Another four isolates (1, 2, 4, 10) showed ic50 values between 11.6 and 14.7 m . Only three compounds (3, 7, 9) exhibited low nf-b inhibition with ic50 values higher than 20 m (table 2). Although the compounds tested show different substitution patterns, no clear structure activity relationship conclusions could be deduced . Since luciferase reporter gene expression reflects a downstream event of the nf-b signaling cascade that did not permit conclusions to be made regarding direct targets of the respective test compounds, all compounds were tested also for their potential to inhibit ikk2 (inhibitor of nf-b kinase subunit beta) activity, as previously described. (18) however, none of the compounds inhibited ikk2 at a concentration of 10 m (data not shown), thereby excluding this kinase as a direct target of the lignans . For comparison, the reference compound used as a positive control in the ikk2 test, ikk2 inhibitor iv, is known to have an ic50 in the low nm range and in our hands completely suppressed ikk2 enzymatic activity to the background level when applied at a concentration of 400 nm . Since gr as well as ppar and - are known to have nf-b - antagonist action, the potential of all lignan derivatives to activate these receptors using luciferase reporter gene assays specific for ppar, ppar, and gr was assessed . Given that none of the compounds tested showed activities in any of the three assays (data not shown) at 10 m, effects at these three nuclear receptors can be excluded . For comparison, the reference compound used for gr activation, dexamethasone, induced around a 10-fold signal induction at 2.5 m . Troglitazone used as a reference ppar activator induced a 6-fold activation with an ec50 of 0.4 m, and the positive control for ppar activation, gw7647, induced a 2.8-fold activation, with an ec50 of 0.6 nm . Reactive oxygen species are known to be involved in the activation of nf-b . To check the potential radical - scavenging activity of the lignan derivatives, a dpph assay was performed . The k. lappacea root extract significantly inhibited free - radical formation with an ic50 value of 42.4 6.3 g / ml . Compounds 24, 7, 8, and 11 had no effect in this assay up to 100 m . Five compounds (1, 5, 6, 9, and 10) showed free - radical scavenging activity in a concentration - dependent manner with ic50 values ranging from 22 to 42 m . A structure activity relationship comparison revealed that all the compounds active in the dpph assay have a methoxy (1 and 9) or hydroxy (5, 6, and 10) group located at the ortho - position in relation to the benzofuran scaffold . Although these values are in the same range as the radical - scavenging activity of the positive control ascorbic acid (ic50 24.2 5.1 m) (table 2), there was no apparent correlation between the dpph - radical - scavenging potential of the compounds and their nf-b inhibitory potential . To clarify the impact of the k. lappacea lignans on further targets, the isolated constituents were investigated for their potential to interfere with another crucial pathway in the inflammatory response, namely, the arachidonic acid cascade, which is responsible for the formation of pro - inflammatory prostaglandins and leukotrienes . Important enzymes are cox-1 and -2 and mpges-1, catalyzing the formation of pgg2 and pge2, and 5-lo, which is responsible for the production of leukotrienes via the intermediate molecule 5-hpete . Initial screening experiments of the ch2cl2-soluble k. lappacea root extract (50 g / ml) revealed inhibition of cox-1 and cox-2, with inhibition rates of 82.5 8.9% and 83.9 5.8% . Four (6, 8, 9, 11) of the 11 isolated lignan constituents (50 m) inhibited these enzymes to an extent of 57.2% and 83.3% (data not shown). Ic50 value determination of the most potent substances revealed that compounds 6, 9, and 11 had no isoform - specificity since they showed almost identical ic50 values, 2.73.8 m for cox-1 and 1.77.6 m for cox-2, comparable to the reference drugs indomethacin (ic50 value cox-1, 2.1 m) and ns-398 (ic50 value cox-2, 2.1 m). In contrast, compound 8 inhibited preferentially cox-2 (ic50 value cox-2, 2.0 m; ic50 value cox-1, 18.3 m) (table 2). Accordingly, the 5-(e)-propenylbenzofuran moiety with an unsaturated furan ring and a para - hydroxy group seems to be essential for this activity . Investigation of the plant ch2cl2 extract (50 g / ml) and the 11 pure compounds (50 m) revealed a significant inhibition of leukotriene formation by the extract (69.5 4.1%) as well as by three of the 11 lignan derivatives (1, 5, 7; 80.2% to 94.6% inhibition, data not shown). (+) -conocarpan (7) showed the strongest activity, with an ic50 value of 18.4 m, followed by compounds 5 (ic50 27.2 m) and 1 (ic50 41.4 m). M), only compound 7 showed a relevant activity in the ex vivo in vitro setup (table 2). In addition to the previous experiments, the isolated lignan derivatives were assessed for their ability to interfere with mpges-1 in a cell - free assay . Therefore, an initial screening experiment with all pure compounds at a concentration of 10 m was performed, resulting in the identification of compounds 6 and 8 as potent inhibitors of mpges-1 . Both compounds blocked pge2 formation in a concentration - dependent manner, with ic50 values of 7.4 and 5.3 m, respectively (table 2). As a reference, compounds 4, 5, 7, and 911 showed moderate inhibitions, with ic50 values ranging from 11.0 to 42.0 m . The 7,7-epoxy lignans (2, 3) as well as compound 1 were regarded as inactive in this model (ic50 values> 50 m). Taken together it has been shown that several of the lignan derivatives investigated possess a pronounced topical anti - inflammatory activity in vivo, comparable to that of indomethacin, and about 7 times less compared to hydrocortisone . An attempt to clarify the mode of action of the pure compounds revealed two relevant pathways, namely, the nf-b - pathway, where almost all investigated compounds showed activity, and selected enzymes of the arachidonic acid cascade, which were influenced by only some of the benzofuran derivatives . Since the in vivo and in vitro effects determined, especially for the most in vivo active compounds, 5 and 7, did not always correspond, it can be concluded that additional inflammatory mediators might contribute to the anti - inflammatory activities observed . The elucidation of the responsible target(s) within the nf-b pathway as well as the possible impact on other inflammatory cascades is part of an ongoing study . The present findings support the medicinal use of the roots of k. lappacea in the treatment of oropharyngeal inflammation as well as the contribution of lignan derivatives to the anti - inflammatory activity of this herbal product . The actions of the pure compounds isolated on multiple targets may explain the promising anti - inflammatory activity of the ch2cl2-soluble extract of k. lappacea roots . Considering its potency (higher than indomethacin), this extract may be able to be developed as a pharmaceutical agent for the treatment of topical inflammatory processes, after suitable standardization and clinical safety evaluations . The optical rotations were measured in meoh using a perkin - elmer 341 polarimeter (wellesley, ma) at 25 c . 1d and 2d nmr experiments were recorded on a bruker drx 300 (bruker biospin rheinstetten, germany) operating at 300.13 mhz (h) and 75.47 mhz (c) at 300 k in acetone - d6 with 0.03% tms (eurisotop, gif - sur - yvette, france), which was used as internal standard . Esims were obtained on an esquire 3000 mass spectrometer (bruker daltonics, bremen, germany), using the following parameters: split, 1:5; alternating mode; spray voltage, 4.5 kv, 350 c; dry gas, 10.0 l / min; nebulizer 40 psi; full scan mode, m / z 1001500 . 690) hsccc instrument with a gilson 302/803 c pump system model 302 (villiers - la - bel, france) as well as a dionex system with a p580 pump, asi-100 autosampler, uvd 170u detector, and a gilson 206 fraction collector (semipreparative hplc) were used . All solvents used for isolation were purchased from vwr international (darmstadt, germany). Ultrapure water was produced by a sartorius arium 611 uv water purification system (gttingen, germany). Croton oil, indomethacin, hydrocortisone, tetramethylbenzidine (tmb), hexadecylammonium bromide (htab), and 96-well microtiter plates were purchased from sigma - aldrich (milan, italy). Ketamine hydrochloride (inoketam 100) was purchased from virbac srl (milan, italy). Other chemicals used for in vivo experiments were of analytical grade and purchased from carlo erba (milan, italy). Dulbecco s modified eagle s medium (dmem) containing 4.5 g / l glucose was purchased from lonza group ag (basel, switzerland). Chemicals used to measure nf-b transactivation activity were purchased from sigma - aldrich (vienna, austria). A stable nf-b luciferase 293 reporter cell line (hek-293/nfb - luc) was purchased from panomics (redwood city, ca), and the plasmid pegfp - c1 was from clontech (st - quentin - en - yvelines, france). Parthenolide was obtained from alexis biochemicals / enzo life sciences (lrrach, germany). Prostaglandin h synthase 1 and 2 and ns-398 were purchased from cayman chemical company (ann arbor, mi), while the competitive pge2 eia kit was purchased from assay designs inc . Indomethacin was purchased from icn (aurora, oh), and zileuton was a product from sequoia (oxford, uk). Dexamethasone, 2,2-diphenyl-1-picrylhydrazyl (dpph), and ascorbic acid were from sigma - aldrich (vienna, austria). Mk-886 (3-[1-(4-chlorobenzyl)-3-tert - butylthio-5-isopropylindol-2-yl]-2,2-dimethylpropanoic acid) was purchased from cayman chemical company (ann arbor, mi), and a549 cells were from dr . Dried, ground roots of k. lappacea (500 g; kl 6269) were purchased from mag . Identity as well as quality was in accordance with the monograph of the european pharmacopoeia . A voucher specimen (kl 6269) authenticated by dr . Daniel remias, university of innsbruck, austria, is deposited at the institute of pharmacy / pharmacognosy, university of innsbruck (austria). Ground roots (300 g) were exhaustively extracted with ch2cl2 in a soxhlet apparatus for five days . The extract was evaporated to dryness, yielding 16.3 g. a portion (15.5 g) of the obtained extract was separated by flash silica gel 60 (4063 m, merck, darmstadt, germany; 270 g, 50 4 cm) column chromatography, using petroleum ether / ch2cl2/etoac gradient mixtures of increasing polarity, yielding 29 fractions (a1a29). Fraction a23 (ch2cl2/etoac, 70:30; 2.3 g) was chromatographed further by flash silica gel cc (70 g, 30 2.5 cm), using a hexane / etoac gradient with an increasing amount of etoac, yielding 18 fractions (b1b18). Mg) was fractionated further over sephadex lh-20 (pharmacia biotech, uppsala, sweden) (75 1.5 cm), using a ch2cl2/acetone mixture (85:15) as mobile phase, yielding 83.6 mg of compound 5 (915975 ml elution volume) and 60.5 mg of compound 1 (11001160 ml elution volume). Fraction b5 (hexane / etoac, 65:35; 68.3 mg) was purified by sephadex lh-20 cc (40 1.0 cm), using a ch2cl2/acetone mixture (85:15) as mobile phase, affording 43.0 mg of compound 2 (3542 ml elution volume). Fraction b6 (hexane / etoac, 6535; 175.1 mg) was fractionated by sephadex lh20 cc (70 1.5 cm) using acetone as mobile phase, yielding 12 fractions (c1c12). Compound 3 (20.1621.70 min retention time; 12.2 mg) was obtained by separation of fraction c7 (260275 ml elution volume; 35.8 mg) by semipreparative hplc (phenomenex synergy max - rp column (10 m; 250 10 mm); 48% acetonitrile / methanol (75:25), 52% water, isocratic; flow 4.00 ml / min; 30 c). Fraction b7 (hexane / etoac, 6040; 82.1 mg) was purified further by sephadex lh-20 cc (75 1.5 cm) using ch2cl2/acetone (85:15) as mobile phase, resulting in 24.4 mg of compound 4 (370475 ml elution volume). Mg) was rechromatographed by sephadex lh-20 cc (70 1.5 cm) using acetone as mobile phase, yielding 12 fractions (d1d12). Fractions d9 and d10 (290350 ml elution volume; total 297.0 mg) were combined and purified by sephadex lh-20 cc (75 1.5 cm) using ch2cl2/acetone (85:15) as mobile phase, affording 64.0 mg of compound 6 (885925 ml elution volume). Fraction a11 (petroleum ether / ch2cl2/etoac, 55:42.7:2.3; 1.3 g) was further separated by sephadex lh-20 cc (70 1.5 cm) using acetone as mobile phase, resulting in 13 fractions (e1e13). Purification of fraction e6 (240250 ml elution volume; 339.7 mg) by sephadex lh-20 cc (75 1.5 cm) using a ch2cl2/acetone mixture (85:15) resulted in 265.6 mg of compound 7 (508534 ml elution volume). Fraction a10 (petroleum ether / ch2cl2/etoac, 60:38:2; 1.6 g) was rechromatographed by sephadex lh-20 cc (75 1.5 cm) using ch2cl2/acetone (85:15), affording 17 fractions (f1f17). Fraction f15 (11651260 ml elution volume; 81.6 mg) was recrystallized from acetone / hexane, yielding 33.2 mg of off - white crystals . These were further purified by semipreparative hplc (phenomenex aqua c18 column (5 m, 250 10 mm); 70% acetonitrile, 30% water, isocratic; flow 3.00 ml / min; 40 c). Purification of the collected peak (15.2517.91 min retention time, 23.1 mg) by sephadex lh-20 cc (35 1.0 cm), using acetone as mobile phase, yielded 12.0 mg of compound 8 (2452 ml elution volume). Fraction e10 (305330 ml elution volume; 294.3 mg) was further separated by sephadex lh-20 cc (70 1.5 cm), using ch2cl2/acetone (85:15) as mobile phase, resulting in eight fractions (g1g8). Compound 9 (460480 ml elution volume; 22.5 mg) was obtained by separation of combined fractions g4 and g5 (250320 ml elution volume; total 192.3 mg) by hsccc . Parameters: hexane / etoac / meoh / ch3cn, 10:3:3:5; upper phase used as mobile phase; tail to head mode; coil volume 230 ml; flow 1 ml / min; 800 rpm . Fraction a6 (petroleum ether / ch2cl2/etoac, 75:23.7:1.3; 130.5 mg) was further purified by sephadex lh-20 cc (75 1.5 cm) using a ch2cl2/acetone mixture (85:15) as mobile phase, yielding 84.7 mg of compound 10 (350430 ml elution volume). Fraction a9 (petroleum ether / ch2cl2/etoac, 65:33.2:1.8; 227.5 mg) was separated by sephadex lh-20 cc (70 1.5 cm) using acetone as mobile phase, yielding 120.3 mg of compound 11 (255335 ml elution volume). The identities of the isolated compounds were confirmed by physical and spectroscopic methods (optical rotation, 1d- and 2d - nmr, and lc - ms) and by comparison with published data . Male cd-1 mice weighing 2832 g were supplied by harlan laboratories (san pietro al natisone, italy). Topical inflammation was induced on the right ear (surface: about 1 cm) of anesthetized mice (145 mg / kg ketamine hydrochloride, intraperitoneally) applying 80 g of croton oil dissolved in 15 l of acetone . The left ear remained untreated, since preliminary experiments showed that the vehicle (acetone) neither affected the inflammatory response nor induced irritation . Control animals received only the irritant solution, whereas other animals received both the irritant and the test substances dissolved in acetone. (17) at different times after dermatitis induction, animals were sacrificed and a punch (6 mm) was taken from both ears to evaluate the edematous response . All animal experiments complied with the italian d.l . N. 116 of january 27, 1992, and associated guidelines in the european communities council directive of november 24, 1986 (86/609 ecc), concerning animal welfare and appendix a of the european convention ets 123 . Edema was quantified by the difference in weight between the punches taken from the treated and untreated (opposite) ears . The antiedema activity was expressed as percent inhibition of the edematous response in animals treated with the test substances in comparison to edema of control animals treated with the irritant alone. (17) the overall effect of the test substances on edema development up to 48 h was quantified by calculating the areas under the curves (aucs) representing the edematous response up to 48 h and, subsequently, by the ratio between the aucs of these animals and the aucs of controls . The cellular infiltrate was quantified by measuring myeloperoxidase activity, as an index of the presence of neutrophilic granulocytes, in the same plug of treated ears used to measure edema . Myeloperoxidase was extracted by htab, according to the method of bradley et al.,(21) and the enzyme activity was measured by a colorimetric assay using tmb as chromogen. (22) each ear plug, suspended in 1 ml of buffered saline (0.1 m sodium acetate buffer at ph 4.2), containing 0.1% htab (w / v), was homogenized by ultra - turrax (ika - werk, staufen, germany) for 5 s at 20 000 rpm . The homogenate was centrifuged at 15000 g for 5 min, and the supernatant was used for the colorimetric assay, because preliminary experiments revealed that the pellet contained less than 5% of total myeloperoxidase activity . In each well of a 96-well microplate, 25 l of the supernatant were mixed with 50 l of the chromogen solution (2.83 mm tmb dissolved in 0.1 m sodium acetate buffer at ph 4.2, containing 0.1% (w / v) htab). The enzyme reaction was started by adding 75 l of 0.7 mm hydrogen peroxide . After 5 min of incubation at 25 c, the reaction was blocked by 50 l of 4 m acetic acid, containing 10 nm sodium azide . The absorbance was read at 620 nm using an automated microplate reader (bio - tek instruments, winooski, vt). One unit of peroxidase activity was defined as the amount of enzyme oxidizing 1 nm of tmb / min . The global effect of the tested substances on the whole cellular infiltrate up to 48 h was quantified by calculating the aucs representing the time course of myeloperoxidase activity up to 48 h and, subsequently, the ratio between aucs of these animals and aucs of controls . Ear biopsies, fixed in 10% formalin, were dehydrated in ascending grades of ethanol, cleared in xylene, and embedded in paraffin wax . Sections (10 m) were stained with hematoxylin - eosin or giemsa and evaluated using a light microscope (zeiss axiophot, with photometrics cool snaps camera and the rs - image program). Hek-293/nfb - luc cells were maintained at 37 c and 5% co2 in dmem with phenol red supplemented with 2 mm glutamine, 100 u / ml benzylpenicillin, 100 g / ml streptomycin, and 10% fetal bovine serum . G / l) medium supplemented with heat - inactivated fetal calf serum, 10% v / v, 100 u / ml penicillin, and 100 g / ml streptomycin at 37 c and 5% co2 . Hek-293 cells stably transfected with a nf-b luciferase reporter were seeded in 10 cm dishes and transfected with 5 g of pegfp - c1 . Six hours later, the cells were seeded in 96-well plates and incubated at 37 c and 5% co2 overnight . On the next day, the medium was exchanged with a serum - free dmem and cells were treated with the respective test compounds dissolved in dimethyl sulfoxide (dmso). To avoid nonspecific effects of the solvent, one hour after the treatment the cells were stimulated with 2 ng / ml human recombinant tnf- for 6 h, and, after a lyses step, the luminescence of the firefly luciferase and the fluorescence of egfp were quantified on a geniospro plate reader (tecan; grdig, austria). The luciferase signal derived from the nf-b reporter was normalized by the egfp - derived fluorescence to account for differences in the cell number or transfection efficiency . Cyclooxygenase-1 (cox-1) and cyclooxygenase-2 (cox-2) inhibition assays were performed in a 96-well - plate format with purified prostaglandin h synthase 1 (pghs-1) from ram seminal vesicles for cox-1 and purified pghs-2 from sheep placental cotyledons for cox-2, as previously described. (23) the concentration of prostaglandin e2 (pge2), the main arachidonic acid metabolite in this reaction, was determined using a competitive pge2 eia kit . Indomethacin (ic50 cox-1, 2.1 m) and ns-398 (ic50 cox-2, 2.1 m) were used as positive controls . The bioassay for inhibition of 5-lo - mediated leukotriene b4 (ltb4) formation was carried out in a 96-well - plate format with stimulated human neutrophilic granulocytes, as described by adams et al. (24) with slight modifications. (25) zileuton (ic50 6.3 m) was used as positive control . Determination of mpges-1 activity was performed as described previously. (26) in brief, a549 cells were treated with 1 ng / ml interleukin-1 for 48 h at 37 c and 5% co2 . After cell harvesting and sonification, the homogenate was subjected to differential centrifugation at 10000 g for 10 min and 174000 g for 1 h at 4 c . The obtained pellet (microsomal fraction) was resuspended in 1 ml of homogenization buffer (0.1 m potassium phosphate buffer ph 7.4, 1 mm phenylmethylsulfonyl fluoride, 60 g / ml soybean trypsin inhibitor, 1 g / ml leupeptin, 2.5 mm glutathione, and 250 mm sucrose), and the total protein concentration was determined . Microsomal membranes were diluted in potassium phosphate buffer (0.1 m, ph 7.4) containing 2.5 mm glutathione . Test compounds, mk-886 (reference inhibitor), or vehicle was added, and after 15 min at 4 c, the reaction (100 l total volume) was initiated by addition of pgh2 (20 m, final concentration, unless stated otherwise). After 1 min at 4 c, the reaction was terminated using stop solution (100 l; 40 mm fecl2, 80 mm citric acid, and 10 m 11-pge2 as internal standard). Pge2 was separated by solid - phase extraction and analyzed by rp - hplc as described. (26) pharmacological in vivo data were analyzed by one - way analysis of variance, followed by dunnett s test for multiple comparisons of unpaired data . The dose giving a 50% inhibition of the edematous response (id50) was calculated by graphic interpolation of the logarithmic dose effect curves . To calculate the ic50 values regarding nf-b inhibition, at least three different concentrations measured in quadruplicate in three independent transfection experiments were used utilizing nonlinear regression with data analysis toolbox software (mdl information systems inc ., nashville, tn). For the determination of ic50 values in the remaining in vitro assays, samples were tested in at least three different concentrations (duplicates; at least three independent experiments). Calculation of ic50 values was performed by nonlinear regression using sigmaplot 9.0 (systat software inc.
|
A pleasant face can be a great asset to one's personality while a facial deformity can greatly affect one's social acceptance and behavior . The role of skeletal structures influencing the facial form is a recognized and accepted fact . However, one must not lose sight of the fact that the soft tissue that covers the bony surface of the face plays an equally important part in the stability of the dental arches and aesthetic harmony . Much research demonstrates that soft tissues, which vary considerably in thickness, are a major factor in determining a patient's final facial profile . With advances in the field of orthognathic surgery, a need for a specialized cephalometric appraisal system was felt which would enable a comprehensive analysis of the skeletal, dental as well as the soft tissues . This led to the development of cephalometrics for orthognathic surgery (cogs) for hard tissue and soft tissue ana ly sis . Epker and fish also developed cephalometric analysis to aid in the successful diagnosis and treatment planning of an orthognathic surgical patient . In 1999, a new cephalometric analysis was introduced by william arnett called the soft tissue cephalometric analysis (stca), which tried to amalgamate both the hard tissue and soft tissue analysis, and came up with a comprehensive analysis for patients needing orthognathic surgery . Arnett studied both hard tissue and soft tissue parameters and suggested ideal values to which patient values could be compared . He was of the opinion that the soft tissue profile is a critical guide to tooth placement, occlusal correction, and optimal facial harmony . It can also be a valuable tool in identifying subjects requiring surgery and improve the likelihood of successful outcome . Important advantage of stca over other cephalometric analysis is the use of natural head position (nhp) as reference plane . There is a plethora of cephalometric analysis, which put emphasis on hard tissue during treatment planning and uses cranial base structures as reference planes . When cranial base is used as the reference line for measuring dentofacial parameters, false findings can be generated because the cranial base is as variable as the dental and facial structures that it measures . Analysis based on nhp and the true horizontal as a reference plane should have greater clinical application than traditional methods . Most investigators have concluded that there are significant differences between ethnic and racial groups, and cephalometric standards have been developed for specific ethnic and racial groups . It is important while considering a patient's treatment goals and needs to compare the cephalometric findings with the norms for his or her ethnic group for an accurate diagnostic evaluation . The purpose of this study was to compare stca norms derived for subjects belonging to western uttar pradesh region of india with standard stca norms derived for caucasians . Thirty three adults from western uttar pradesh, india who fulfilled the selection criteria and were judged to have well balanced facial profiles and esthetics participated in the study . Subjects were selected after two stage screening procedure .first the subjects were screened based on following inclusion and exclusion criteria . Incluison criteria were pleasing facial profile, competent lips, acceptable facial symmetry, class - i canine, and molar relationships . Subjects with past history of orthodontic treatment, prosthodontic treatment, or maxillofacial / plastic surgery treatment were excluded from the study . Subjects were given a questionnaire to confirm their past medical / dental history and also their ethnicity . Since the subjects were to undergo radiographic exposure, informed consent was obtained from everyone, who participated in the study . Second screening was done by a panel consisting of an orthodontist, a plastic surgeon, and a fashion designer who judged the extra - oral photographs of selected subjects on the basis of having reasonably balanced facial profile and pleasing facial appearance . The subjects were first assessed clinically in nhp, with seated condyles and passive lips . Metallic markers were placed on various soft - tissue structures on the faces to study and relate them to the true vertical line (tvl) as described by arnett et al . A lateral headfilm was obtained with the subject innhp, with seated condyle and with passive lips . Standard 8 10 in kodak t - mat lateral radiographic headfilms (eastman kodak, rochester, ny, usa) were used for each subject on rotograph plus (villa system medical, italy) panoramic and cephalometric equipment . All exposed films were developed and fixed manually by the same technician using standard procedures . All lateral cephalometric films were traced on a transparent cellulose acetate sheet of 0.076 mm thickness by the same technician . Similar conditions of the light box and general illumination were maintained during viewing and tracing of all headfilms . The data were separated according to sex to obtain more specific and useful cephalometric normative values . Calculated values were compared between males and females within the study population and also between study population and standard stca values . Significance of difference was evaluated using student's t test and level of significance was kept at 5% . Cephalograms obtained for 33 subjects (16 males, 17 females) selected from western uttar pradesh (w.up) population were traced and stca was done . Stca values derived for subjects selected from western uttar pradesh population the obtained data was compared with standard stca norms established for white population [table 2]. Comparison of stca values for western uttar pradesh population with standard stca norms comparing dento - skeletal factors, w.up males and females had higher value for inclination of maxillary . Occlusal plane to tvl [98.78 vs 95.00 (males) and 100.09 vs 95.60 (females)] than their white counterparts . Morover, w.up females had lesser values than their white counterpart for the parameter of mandibular incisor to occlusal plane (61.65 vs 64.30). The value for overbite was less in w.up males (2.63 mm) compared with white males (3.20 mm) comparing soft tissue factors between two populations, w.up females had thicker upper lips (1.08 mm) and thinner lower lips (1.01 mm) than their white counterparts . Upper lip angle was lower in w.up females compared with their white counterparts (6.32 vs 12.10). Following facial length values were higher in white population: maxillary incisor exposure [2.0 mm (males) and 1.9 mm (females)], maxillary height [4.1 mm (males) and 2.0 mm (females)], mandibular height [4.37 mm (males) and 2.3 mm (females)], interlabial gap [1.8 mm (males) and 3.3 mm (females)], length of lower third of face [7.8 mm (males) and 4.6 mm (females)]. Morover, white males had higher values for total facial height (5.04 mm), upper lip length (1.7 mm), lower lip length (3.7 mm). W.up population had higher value (more negative to tvl) for the following parameters: orbital rims [2.13 mm (males) and 1.45 mm (females)], cheekbones [4.05 mm (males) and 4.31 mm (females)], a - point' [1.86 mm (males) and 1.78 mm (females)], upper lip anterior [2.31 mm (males) and 2.55 mm (females)], maxillary incisor [3.37 mm (males) and 3.56 mm (females)], mandibular incisor [3.04 mm (males) and 3.25 mm (females)], lower lip anterior[1.84 mm (males) and 0.29 mm (females)], b - point' [5.9 mm (males) and 5.38 mm (females)], and pogonion' [6.53 mm (males) and 5.75 mm (females)]. Moreover, nasal projection was greater [1.34 mm (males) and 1.0 mm (females)] in white population than in w.up population . Intramandibular harmony values for mandibular incisor - pogonion' harmony were higher [3.52 mm (males) and 2.27 mm (female)] in white populations while harmony values for lower - lip - pogonion' were higher [2.73 mm (males) and 1.47 mm (females)] are higher in w.up population . All three interjaw harmony values were higher in w.up population: subnasale - pogonion' harmony [5.59 mm (males) and 5.06 mm (females)]; a - point'-b - point' harmony [3.92 mm (males) and 3.6 mm (females)]; upper lip anterior'lower lip anterior' [1.54 mm (males) and 1.61 mm (females)]. Orbit to jaw harmony value for orbital rim'pogonion' harmony was higher [4.46 mm (males) and 4.0 mm (females)] in white population . Facial angle was higher [5.34 mm (males) and 4.1 mm (females)] in white population . Moreover, glabella'pogonion' harmony values were higher [6.88 mm (males) and 7.81 mm (females)] in white population . Females of white population had higher values (4.4 mm) for glabellaa - point' harmony than for females of w.up population . Our findings are discussed under the five headings of the stca: dentoskeletal factors when compared with whitehite population, following significant differences (p <0.05) were found in our study population . Both males and females had higher value for inclination of maxillary occlusal plane to tvl than their white counterparts . Moreover, females had lesser value for mandibular incisor to occlusal plane and overjet and males had lesser values for overbite compared with their white counterparts . These differences can be attributed to racial and ethnic differences between the two populations . Soft tissue structures when compared with white population, following significant differences were found in our study population . Females had thicker upper lips and thinner lower lips than their white counterparts . Moreover, upper lip angle was lower in females of our study sample . These findings suggest that females in our study had more retropositioned lips than their white counterparts . Facial lengths significant difference was noted while analyzing facial lengths between our study population and white population . Maxillary incisor exposure, maxillary height, mandibular height, interlabial gap, and length of lower third of the face are greater in white population . Moreover, total facial height, upper lip length, lower lip length were higher in white males . Orbital rims, cheek bone, nasal projection, a - point', upper and lower lips, maxillary and mandibular incisors, b - point', and pogonion' are more prominent in white population . Facial harmony comparison of intramandibular harmony reveals statistically significant higher values for mandibular incisor - pogonion' harmony in white population suggestive of more prominent chin in white population compared to our study population . Moreover, lesser value for lower lip anterior to pogonion' harmony in white population suggest more prominent chin in white population.comparison of mean interjaw relationships of facial harmony showed that all values were higher in our sample compared with stca norms . This was indicative of more convex profiles in our study population compared with white population . Moreover, mean facial angle of facial harmony values of this study were lower than those of stca further confirming more convex profile in our sample . A - point' harmony is comparable between two population, the values for orbital rim'pogonion' are significantly higher in w.up population . This suggests convex profile in our study sample is due to more retropositioned mandible and chin compared with white population . This point is further validated by higher values for glabella'-pogonion' harmony in white population . Similar findings were reported by grewal et al . For north indian population and kalha et al . For south indian population when compared with standard stca . Dentoskeletal factors when compared with whitehite population, following significant differences (p <0.05) were found in our study population . Both males and females had higher value for inclination of maxillary occlusal plane to tvl than their white counterparts . Moreover, females had lesser value for mandibular incisor to occlusal plane and overjet and males had lesser values for overbite compared with their white counterparts . These differences can be attributed to racial and ethnic differences between the two populations . When compared with whitehite population, following significant differences (p <0.05) were found in our study population . Both males and females had higher value for inclination of maxillary occlusal plane to tvl than their white counterparts . Moreover, females had lesser value for mandibular incisor to occlusal plane and overjet and males had lesser values for overbite compared with their white counterparts . Soft tissue structures when compared with white population, following significant differences were found in our study population . Females had thicker upper lips and thinner lower lips than their white counterparts . Moreover, upper lip angle was lower in females of our study sample . These findings suggest that females in our study had more retropositioned lips than their white counterparts . When compared with white population, following significant differences were found in our study population . Females had thicker upper lips and thinner lower lips than their white counterparts . Moreover, upper lip angle was lower in females of our study sample . These findings suggest that females in our study had more retropositioned lips than their white counterparts . Significant difference was noted while analyzing facial lengths between our study population and white population . Maxillary incisor exposure, maxillary height, mandibular height, interlabial gap, and length of lower third of the face are greater in white population . Moreover, total facial height, upper lip length, lower lip length were higher in white males . Significant difference was noted while analyzing facial lengths between our study population and white population . Maxillary incisor exposure, maxillary height, mandibular height, interlabial gap, and length of lower third of the face are greater in white population . Moreover, total facial height, upper lip length, lower lip length were higher in white males . Orbital rims, cheek bone, nasal projection, a - point', upper and lower lips, maxillary and mandibular incisors, b - point', and pogonion' are more prominent in white population . Significance difference is noted while analyzing projections to tvl between our study population and standard stca values . Orbital rims, cheek bone, nasal projection, a - point', upper and lower lips, maxillary and mandibular incisors, b - point', and pogonion' are more prominent in white population . Comparison of intramandibular harmony reveals statistically significant higher values for mandibular incisor - pogonion' harmony in white population suggestive of more prominent chin in white population compared to our study population . Moreover, lesser value for lower lip anterior to pogonion' harmony in white population suggest more prominent chin in white population.comparison of mean interjaw relationships of facial harmony showed that all values were higher in our sample compared with stca norms . This was indicative of more convex profiles in our study population compared with white population . Moreover, mean facial angle of facial harmony values of this study were lower than those of stca further confirming more convex profile in our sample . A - point' harmony is comparable between two population, the values for orbital rim'pogonion' are significantly higher in w.up population . This suggests convex profile in our study sample is due to more retropositioned mandible and chin compared with white population . This point is further validated by higher values for glabella'-pogonion' harmony in white population . Similar findings were reported by grewal et al . For north indian population and kalha et al . For south indian population when compared with standard stca . Comparison of intramandibular harmony reveals statistically significant higher values for mandibular incisor - pogonion' harmony in white population suggestive of more prominent chin in white population compared to our study population . Moreover, lesser value for lower lip anterior to pogonion' harmony in white population suggest more prominent chin in white population . Comparison of mean interjaw relationships of facial harmony showed that all values were higher in our sample compared with stca norms . This was indicative of more convex profiles in our study population compared with white population . Moreover, mean facial angle of facial harmony values of this study were lower than those of stca further confirming more convex profile in our sample . Comparison of orbit to jaw harmony values reveal that while orbital rim a - point' harmony is comparable between two population, the values for orbital rim'pogonion' are significantly higher in w.up population . This suggests convex profile in our study sample is due to more retropositioned mandible and chin compared with white population . This point is further validated by higher values for glabella'-pogonion' harmony in white population . Similar findings were reported by grewal et al . For north indian population and kalha et al . For south indian population when compared with standard stca . From the cephalometric study which was conducted on the 33 subjects (16 males and 17 females) selected from w.up region of india, according to arnett's stca, following conclusions were drawn: (1) compared with white population, females in our study sample had steeper maxillary occlusal plane, more proclined mandibular incisors and less protrusive lips . (2) subjects had overall decrease in facial lengths, less prominent midface and mandibular structures and more convex profile compared with white population . The findings of this study re - emphasize the need to devise orthodontic / orthognathic treatment goals based on normative values derived for individual's own racial and ethnic background, as the concept of beauty and esthetic vary between different ethnic groups and different geographic regions.
|
Astroblastoma is a rare glial tumor occurring predominantly in the cerebral hemispheres of young adults . It is difficult to determine exact number of astroblastoma cases since the number may include some that are not typical astroblastoma . However in some report it was estimated that only 0.45 - 2.8% of all neuroglial tumors were astroblastoma (2). Similar perivascular pseudorosettes may also occur partly in gemistocytic astrocytoma, anaplastic oligodendroglioma, anaplastic astrocytoma, glioblastoma, etc . Therefore, the term, astroblastoma, must be used only for the cases in which typical histological findings are observed throughout the tumor (3). A 15-yr - old female patient had presented with headache and diplopia for one year and six months, and her headache in the area of right frontal lobe had become worse for the last month . Brain mri showed a well demarcated mass, 9.7 cm in diameter, in right frontal lobe . After an injection of gadolinium, the tumor showed an inhomogenous enhancement . Within the tumor tumor cells were aligned along the fibrovascular stalk by one or two cell layers, but in some areas it was multilayered . Perivascular pseudorosettes became prominent in areas where the tumor cells were separated by artifacts (fig . Cytoplasmic processes were short and thick, of which blunt footplates were attached to the vessels (fig . Most tumor cells showed nuclear monotony with less atypism, yet a small number of them showed mild nuclear atypia . Vascular hyalinization or sclerosis was observed in some areas, but no endothelial proliferation was found (fig . Areas of anaplastic astrocytoma, gemistocytic astrocytoma, and glioblastoma were not found in any part of the tumor . Cytoplasmic processes of tumor cells composing perivascular pseudorosettes showed strong positive reaction for glial fibrillary acidic protein (gfap) (fig . The tumor cells showed diffuse strong positivity for s-100 protein, vimentin and neuron specific enolase (nse), and focal positivity for epithelial membrane antigen (ema) and cam 5.2 (fig . The tumor cells were negative for synaptophysin, neurofilament protein (nfp), pan - cytokeratin, high molecular weight keratin (hmwk) immunostains . Mib-1 labeling index accounted for 8.0% (83/1,000), and p53 positivity was 16% (159/1,000) (table 1). Six weeks after the operation, radiation therapy of 4,500 cgy was performed for a period of seven weeks . Three years and nine months after the operation visual acuity decreased slowly and the left hemiplegia developed progressively . Multiple low intensity lesions was observed in t1-weighted image, and they were considered as radionecrosis . Since bailey and bucy reported on astroblastoma for the first time in 1930, the existence of the tumor itself has been one of the most interesting subjects (4). However, from the middle of the 1980s up until today, astroblastoma has been reported as a distinct entity (1, 5 - 9). The patients ranged from 1 to 58 yr old (average, 16 yr) (1, 8, 9). Astroblastoma develops usually in cerebral hemisphere, but it can develop in the corpus callosum, cerebellum, optic nerve, brain stem, or in filum terminale (7, 11). In cerebral hemispheres, astroblastoma usually develops in cortex, subcortical area, and periventricular area, but not in the ventricle itself (11). Different from the perivascular pseudorosettes in ependymoma, those in astroblastoma have short and thick cytoplasmic processes . The cytoplasmic processes have blunt - ended footplates and are attached to basal lamina of blood vessels . In less cellular areas, typical perivascular pseudorosettes are observed even in the areas where tumor cells show solid growth patterns . The blood vessels frequently show hyalinization and even sclerosis (1, 3, 8, 10, 11). Astroblastomas are classified into low grade and high grade according to histological findings (8). The high grade astroblastomas show increased cellularity with multiple cell layers upon the vascular walls . Immunohistochemically, the tumor cells showed positivity for gfap, s-100 protein, vimentin, nse and ema coinciding with the findings in other reports (2, 6, 12 - 14). The fact that neoplastic astrocytes may be positive for nse and ema is well known (12). However, reactions to cam 5.2 reported as negative (2, 11, 12) or partly positive (13). The term' astroblastoma' is misleading in itself, since this tumor is not overtly astrocytic, nor are they' blastic' (1). Bailey and bucy believed that astroblastoma originated from astroblast, an intermediate stage between glioblasts and astrocytes (4). However, in a study by means of electron microscope it was proved that tumor cells of astroblastoma are intermediate between astrocytes and ependymal cells, and thus a possibility of tanycytes is presented as the origin of astroblastoma (7, 13, 15). Tumors showing histological findings similar to astroblastoma are ependymoma, papillary meningioma, choroid plexus tumor, etc . Ependymoma is usually a well - demarcated mass and forms perivascular pseudorosettes, which may be confused with astroblastoma . It also shows positivity for gfap, s-100 protein and vimentin and even focal positivity for cytokeratin, as astroblastoma does . However, perivascular pseudorosettes in ependymoma have thin and long cytoplasmic processes with no foot plates, which are different from the pseudorosettes of astroblastoma . And anuclear fibrillary zone is well developed around the blood vessels . Tumor cells between perivascular pseudorosettes are compact and show small ovoid monotonous nuclei with fine chromatin pattern . Papillary meningioma has perivascular papillary or pesudopapillary pattern with structures similar to pseudorosettes of ependymoma . The tumor cells of papillary meningioma show positive reaction for cytokeratin and negative reaction for gfap . In addition, papillary meningiomas usually show connection to meninges as well as typical meningioma areas . Choroid plexus tumor also shows papillary growth pattern, which may be confused with astroblastoma . Immunohistochemically choroid plexus tumor shows strong positivity for cytokeratin, while negativity or focal positivity for gfap, and characteristic transthyretin positivity (16, 17). The natural history of the astroblastoma seems to place it between the astrocytoma and glioblastoma (8). The low - grade astroblastomas are thought to have better prognosis than the high - grade astroblastomas . Anaplastic histology has been associated with recurrence and progression, suggesting the more aggressive treatment, including radiotherapy, is necessary for high - grade lesions (1, 8, 9, 16).
|
Oroantral fistula (oaf) is an abnormal communication between the oral cavity and the maxillary sinus . The chances of occurrence of oroantral communication increases, if there is an underlying peripical infection or a preexisting sinus disease . The chronic long standing nature of oaf may be due to fungal infection like mucormycosis . The sinus pathology is a predisposing factor for chronic non - healing nature of oaf . Many times this aspect is overlooked and simply the diagnosis of non - specific maxillary sinusitis is given, which leads to improper treatment . The case we present here is a 34-year - old female patient [figure 1a] who was complaining about non - healing opening in the upper left front region and exposure of root of one tooth . The lesion started as a small swelling in the left maxillary anterior vestibular area in the region of canine eminence . After few days, patient noticed the area where the swelling ruptured was not healing and instead, it was showing small aperture . The aperture went on increasing to the present size of 0.5 cm 0.5 cm . Patient revealed the history of trauma in maxillary left front teeth region during field work 2 years back . (a) a 34-year - old female patient presenting with mild to moderate swelling in left maxillary sinus area (arrow). (b) intraoral examination revealed the oroantral communication (arrow) in maxillary left anterior labial vestibule at mucogingival junction in the area of canine . (c) the dorsal surface of tongue was coated with white leathery coat with central rhomboidal shaped erythematous area (arrow). (d) the cytosmear revealed pas positive numerous long thin filaments of candidal organism (arrow). Budding yeast cells were seen scattered along the with pseudohyphae (pas, 200) extraoral examination revealed a mild swelling in the left maxillary sinus area [figure 1a]. On intraoral examination [figure 1b] oroantral communication was noticed in maxillary left anterior labial vestibule at mucogingival junction in the area of canine . The opening was around 0.5 cm 0.5 cm in size exposing the apical third portion of root of canine . The dorsal surface of the tongue was coated with white leathery coat with central rhomboidal shape erythematous area [figure 1c]. No caries was detected in all maxillary left anterior teeth . On pulp vitality test maxillary left lateral incisor and canine was found to be non - vital . The clinical diagnosis of oaf secondary to chronic periapical abscess in relation to maxillary left canine was established . The conventional approach was undertaken to close the fistula and access opening was created in maxillary left canine . Patient was followed up for observation of healing at closure of oaf and also to continue with root canal treatment of maxillary left canine . After 4 weeks of primary closure of oaf, still there were no signs of healing and instead the oaf was re - established as it was before commencing the treatment . Patient also complained of dull gnawing pain in the maxillary sinus area and more heaviness in the same region . Looking at non - healing chronic nature of oaf, the incisional biopsy from the margin of oaf was planned to seek histological changes in the region of oaf . Based on histopathological diagnosis, reclosure of oaf was planned . For chronic maxillary sinusitis antibiotics and nasal wash the patient was followed - up regularly to assess for healing at oaf and check for the status of chronic maxillary sinusitis . Patient reported with non - healing of oaf and even chronic maxillary sinusitis did not respond to treatment . This time to avoid surgical trauma, a cytological smear was prepared by swabbing the unhealed oaf . Cytosmear stained with periodic acid schiff stain, revealed a pale homogenous stroma, with abundant acute inflammatory cells . Numerous long thin filaments of candidal organism having budding yeast cells were seen scattered along with pseudohyphae [figure 1d]. Based on the cytological features, the diagnosis of oaf with superadded candidiasis was given . After about 5 - 6 weeks patient was completely all right and clinical healing was complete . There were no sign of candida organism on repeated cytological examination at the site of closure . Present case is an example for clinicians where they can learn that, sinus disease secondary to oaf is not only of bacterial origin but it could be also of fungal origin . Since there is no history of extraction of tooth, oaf would have arisen due to periapical pathology secondary to trauma . The candida organisms from oral cavity might have colonized the oaf leading to sinus pathology . Candida organisms can be easily detected at tissue level as candida hyphae at superficial epithelial surface, but sometime these superficial hyphae are washed away from tissue during processing in various chemicals . This might be the reason why candida organisms were not detected and diagnosed in biopsied tissue . Mere presence of this fungus in oral cavity is not sufficient to produce the disease . There must be actual penetration of fungus in to the tissue, although such invasion is superficial and occurs only when there is breach in the continuity of epithelium . In present case, oaf must have become reason for the colonization of candida organisms over the maxillary sinus lining . The other predisposing factors for candidiasis can be prolonged intake of antibiotics, corticosteroids; anemia, etc . Since initially patient was diagnosed with non - specific maxillary sinusitis . So inadvertent use of antibiotics could also be responsible for occurrence of superadded infection of candidiasis with oaf . According to katzenstein, sinus mycoses can be classified as non - invasive chronic mycoses (fungus ball),allergic mycosis, chronic indolent invasive mycosis, andfulminating invasive mycoses . Non - invasive chronic mycoses (fungus ball), chronic indolent invasive mycosis, and fulminating invasive mycoses . Types 3 and 4 are found in the immunosuppressed where as in immunocompetent, types 1 and 2 are common, with a granulomatous inflammatory response and necrosis . Candida organism can grow as opportunistic pathogen especially in presence of human immunodeficiency virus (hiv) infection . Since there was no hiv associated periodontal disease in patient, the remote possibility of hiv as cause for candida growth and occurrence of oaf could be ruled out . Furthermore, the mucosa of the dorsum surface of the tongue (filiform papillae) may represent a site of residual colonization and reservoir of organisms . Since patient's dorsal surface of tongue was showing white coat with central erythematous area [figure 1c]. This would have been possible source for colonization of candida organisms in maxillary sinus through oaf . The mycetes most often involved was aspergillus fumigatus (76.9%). Even after extensive literature search, no report was found for sinus formation with candida . This case is good learning lesson for clinicians and histopathologists for stepwise approach in diagnosing oaf associated with sinus disease . It is understood that sinus pathology should be primarily treated for the successful closure of oaf . For the proper treatment of sinus disease identification of causative agent (pathogen) therefore, sinus disease secondary to oroantral communication should be primarily screened for pathogen through simple cytological approach.
|
Guaifenesin (gf), 3-(2-methoxyphenoxy)-1,2-propanediol; is reported to increase the volume and reduce the viscosity of tenacious sputum and is used as expectorant for productive cough . Different methods have been reported for the analysis of gf including hplc [28], gc [9, 10], capillary electrophoresis mass spectrometry, x - ray diffraction, voltammetry . Dropropizine (dp), 3-(4-phenyl-1-piperazinyl)-1,2-propanediol, is a cough suppressant reported to have a peripheral action in nonproductive cough . Only two gc - mass spectrometry methods have been reported for the determination of dp in biological fluids [14, 15] in addition to a manufacturer procedure that involves the determination of dropropizine by measuring its uv absorbance at 237 nm in 0.05 n hcl (personal contact): bromhexine hcl (br), 2-amino-3,5-dibromo - n - cyclohexyl - n - methylbenzylamine hydrochloride; n-(2-amino-3,5-dibromobenzyl)-n - methylcyclohexylamine hydrochloride: the aim of the present paper is to develop a simple and accurate method for the determination of dropropizine and guaifenesin that permits their analysis in dosage forms without interference from excipients and other coformulated drugs . Purpald or 4-amino-5-hydrazino-4h [1,2, 4]-triazole-3-thiol reagent (ahtt) (sigma - aldrich) was prepared as 0.5% in 0.5 m hydrochloric acid . Periodic acid (winlab, uk .) Was prepared as 1 mg ml solution in 0.2 m potassium hydroxide . Reference standard guaifenesin (gf), dropropizine (dp) and bromhexine hcl (br) were kindly supplied by rameda co. for pharmaceutical industries and diagnostic reagents, eva pharma for pharmaceutical and medical appliances and eva pharma for pharmaceutical and medical appliances, respectively . 08455, claimed to contain 100 mg guaifenesin and 8 mg bromhexine hcl . 08455, claimed to contain 100 mg guaifenesin and 8 mg bromhexine hcl . Solutions of guaifenesin:0.1 mg ml solution of gf was prepared in distilled water . Aliquots of this solution were diluted to produce working solutions of 545 g ml . 0.1 mg ml solution of gf was prepared in distilled water . Aliquots of this solution were diluted to produce working solutions of 545 g ml . Solutions of dropropizine:0.1 mg ml solution of dr was prepared by in distilled water . Aliquots of this solution were diluted to produce working solutions of 1080 g ml . 0.1 mg ml solution of dr was prepared by in distilled water . Aliquots of this solution were diluted to produce working solutions of 1080 g ml . Solutions of bromhexine hcl:0.1 mg ml solution of br was prepared in methanol . Aliquot of this solution was diluted to produce working solution of 50 g ml . Agilent 1200 series isocratic quaternary pump hplc instrument connected to 1200 multiple wavelength uv detector (germany). Separation was performed on 150 4.6 mm zorbax extend - c18 column 5 m particle size (usa). Ph / mv meter with double junction glass electrode (fisher, usa). One ml of each working solution of both drugs was transferred in a test tube, then 1 ml periodic acid was added . The mixture was left at room temperature for 15 minutes for gf and 20 minutes for dr, 0.5 ml 5 m koh solution was then added followed by 1 ml of ahtt solution . The mixture was shaken and allowed to stand for about 15 minutes for gf and 20 minutes for dr . Absorbance of the resulting solution was measured at 550 nm, against blank experiment . Calibration curves relating the absorbance at 550 nm to gf or dr concentrations were plotted and regression analysis of the results was computed . An amount equivalent to 10 mg of gf was transferred into 100 ml volumetric flask, dissolved in distilled water then adjusted to volume and treated as previously mentioned under calibration procedure . The well mixed powdered content of five capsules was used in the assay . An amount equivalent to 10 mg of gf was transferred into 100 ml volumetric flask, dissolved in distilled water then adjusted to volume and treated as previously mentioned under calibration procedure . Tussapine lozenges.five tablets were grounded to a homogenous fine powder, weighed and the average mass per tablet was determined . The amount of powder equivalent to 10 mg of dr was dissolved into 70 ml of distilled water . Afterwards, the filtrate was accurately collected into 100 ml calibrated flask and diluted to volume with water . The obtained solution labeled to contain 0.1 mg ml of each drug five tablets were grounded to a homogenous fine powder, weighed and the average mass per tablet was determined . The amount of powder equivalent to 10 mg of dr was dissolved into 70 ml of distilled water . Afterwards, the filtrate was accurately collected into 100 ml calibrated flask and diluted to volume with water . The obtained solution labeled to contain 0.1 mg ml of each drug was analyzed by the proposed method as detailed under calibration . S - triazoles have been utilized to produce reagents that can react with drugs containing carbonyl group or susceptible to oxidation with periodic acid to produce carbonyl function such as diols and amino alcohols . In the present work, guaifenesin and dropropizine were converted into formaldehyde and the corresponding carboxylic acids by the selective oxidizing effect of periodic acid . The liberated aldehyde was allowed to react with 4-amino-5-hydrazino-4h [1,2, 4]-triazole-3-thiol, which is a specific reagent for aldehydic functional group . When ahtt was allowed to condense with formaldehyde followed by treatment with periodic acid and alkali addition, [1,2, 4]-triazolo-[1,2, 4,5] tetrazine-3-thiol colored product was obtained as shown in scheme 1 . As reported by jacobsen and dickinson, the reaction involves the addition of alkaline solution of ahtt to the aldehyde solution and aerating the reaction mixture to give a purple - colored product . Modified the procedure of color development by the use of periodic acid as oxidizing agent instead of aeration . In the present study, it acts as a selective oxidizing agent for polyhydroxy compounds to convert them to formaldehyde and corresponding carboxylic acids and help in the development of the purple colored product according to mimura et al . Modification . It is important to emphasize that jacobsen and dickinson used alkaline solution of ahtt (1% in 1 m naoh) for color production with aldehydes . However, this procedure was modified by using acidic solution of ahtt (0.5% in 0.5 m hcl) which offers two advantages, the first was the use of lower concentration of the reagent; the second was the higher stability of ahtt solution as mentioned by mimura et al . . As reported for colorimetric determination of some diol - containing drugs, solution of guaifenesin and dropropizine was left for some time, then 5 m koh and ahtt solutions were added whereby a purple color was developed with maximum absorption at 550 nm (figures 1 and 2). Maximum color intensity was obtained when periodic acid solution was made to react with guaifenesin for 15 minutes and dropropizine for 20 minutes . The effect of periodic acid concentration was also studied, it was found to be critical the use of 1 mg ml solution of periodic acid in 0.2 m koh produces maximum color intensity . Excess acid concentration causes a great decrease in the intensity of the produced color which may be attributed to the strong oxidizing effect of periodic acid on both drugs which may proceed to give further oxidation products . The effect of ahtt concentration was also studied where maximum intensity was obtained upon using ahtt solution of 0.5% in 0.5 m hcl . Volume of koh added was found to be critical; 0.5 ml of 5 m alkali solution was the optimum volume . Shaking of the reaction mixture for 4 - 5 minutes was essential and produced maximum color intensity after addition of ahtt solution and waiting period of 15 minutes for gf and 20 minutes for dr . Calibration curves representing the relation between each drug concentrations and absorbance of colored products were constructed . Results show linear relationship in the range of 545 g ml for gf and 1080 g ml for dr; in triplicate measurement from which linear regression equations were calculated ., the approach based on the s.d . Of the response and the slope was used for determining the detection and quantitation limits . Accuracy of the measurements was determined using the calibration standards of two drugs, where mean percentage of 100.58 for gf and 100.22 for dr were obtained, results are shown in table 1 . Accuracy was also assessed by the recovery of added standard, three concentrations each in duplicate to know concentration of dosage forms using the proposed colorimetric method . Results of mean% recovery for added standards in each formulation are reported in table 2 . Repeatability and reproducibility of the instrumental response (absorbance of the formed color) were checked during method development and they were assessed from five replicate determinations of sample solutions of gf and dr at the concentration of 30 g ml . The proposed method was applied for the determination of both drugs in their pharmaceutical formulations; results presented in table 2 revealed that there is no interference from excipients, additives or coformulated drugs such as bromhexine hcl present in muclear capsules along with guaifenesin . In addition the recoveries of the studied drugs from their formulations were almost the same as the recoveries of the pure added when applying the standard addition technique . Results obtained by the proposed method were statistically compared with those obtained from the reported hplc method for gf and uv manufacturer method for dr . The calculated t and f values are less than the tabulated ones indicating no significant difference between the proposed and reported methods with respect to accuracy and precision at 95% confidence limit (table 2). The proposed colorimetric method is selective for polyhydroxy aliphatic compounds, simple and rapid as it takes from 15 to 20 minutes for the sample to be ready for measurement . The short duration of the assay and its specificity were clear bonuses for routine analysis of guaifenesin and dropropizine in their pharmaceutical formulations and in - process quality control.
|
Bilateral cystic nephromas are very rare with five cases described in the english literature . Though rhabdomyosarcoma is a very common soft tissue sarcoma that occurs in children, rhabdomyosarcoma affecting the penile urethra is extremely rare . Here, we present a case of bilateral cystic nephroma who subsequently developed embryonal rhabdomyosarcoma of the penile urethra . A 4-month - old male child presented in 2009 with the right flank mass that was progressively increasing for 2 months . Examination revealed a soft, cystic, mobile, nontender, bimanually palpable and ballotable mass in the right lumbar region . Imaging (ultrasonography and computed tomography) revealed two well - circumscribed multilocular noncommunicating cystic lesions, the larger one arising from the middle and lower pole of the right kidney, and a smaller one from the upper pole of the left kidney . A diagnosis of bilateral cystic nephroma / bilateral cystic partially differentiated nephroblastoma (cpdn) was made on the basis of the imaging . He was well for a period of 2 years when he developed a polypoidal mass protruding from the external urethral meatus . He was categorized as stage 1 rms and complete excision of the penile urethra with eight cycles of the postoperative vincristine, actinomycin - d, and ifosfamide was administered . The child is doing well more than 2 years after excision of the urethral rhabdomyosarcoma . Bilateral cystic nephromas are extremely rare benign renal neoplasms with five cases described in the english literature . For the diagnosis of cystic nephroma, the other seven being solitary lesion; multilocular lesion; noncommunication of the cyst with the renal pelvis; noncommunication of the cysts with each other; loculi lined by epithelium; intralocular septa devoid of renal parenchyma; and if residual renal tissue was present, it should be normal . These criteria were modified by boggs and kimmelstiel to include the presence of immature renal tissue in the intervening septa . More recently elimination of unilaterality from the diagnostic criteria has been proposed in consideration of the increasing numbers of bilateral cystic nephroma . Cpdn is a lesion with low malignant potential, which is radiologically and grossly indistinguishable from cystic nephroma . Differentiation between the two is based on histological confirmation of the presence of blastemal cells within the septa . Differentiation from cystic wilms is based on the absence of solid elements other than septa in cystic nephroma . However, an association of bilateral cystic nephroma with pleuropulmonary blastoma has been described with dicer-1 mutation being implicated as the cause . Germline mutation in dicer-1 causes a variety of cancers, the most common being pleuropulmonary blastoma, cystic nephroma, and ovarian sertoli - leydig cell tumors . Dicer-1 gene expresses a protein that plays an important role in regulating the activity of other genes by aiding the formation of micro rna . Since bilateral cystic nephroma and urethral rhabdomyosarcoma are extremely rare lesions, their occurrence in the same child is unlikely to be coincidental . Dicer-1 mutation could be the cause of this association, but the genetic analysis could not be done due to financial reasons.
|
Foot and mouth disease (fmd) is an economically important disease of cloven - hoofed livestock such as cattle, sheep, and other domestic animals in addition to several wild - life species . The causative agent of the fmd is the foot and mouth disease virus (fmdv). The disease is considered one of the most important barriers to the worldwide trade of livestock and animal products . Fmdv isolates sampled from the world have been categorized into seven different serotypes, a, o, c, asia1, and south african territories 1 (sat1), sat2, and sat3, according to antigenic levels; and a large number of variants have appeared within each serotype . Out of the three serotypes (o, a, and asia1) found to be prevalent in iran in recent years, serotype a has been found to be more antigenically and genetically diverse than the others . The fmdv possesses a single - stranded rna molecule consisting of about 8,200 nucleotides within an icosahedral capsid composed of structural proteins . The open reading frame encodes a single polyprotein which can be cleaved into four structural proteins (vp4, vp2, vp3, and vp1) and eight non - structural proteins (l, 2a, 2b, 2c, 3a, 3b, 3c, and 3d polymerase [3d]). In general, mutations or deletions in structural proteins may help the fmdv to evade immune responses of the host whereas mutations or deletions in non - structural proteins can inhibit viral replication and protein processing . The fmdv usually infects cells by binding to integrin receptors via a long flexible loop (g - h loop) of vp1 (1d). The sequence of this loop contains a conserved arginineglycine - aspartic acid (rgd) tripeptide motif which is characteristic of ligands that bind to integrin receptors . The vp1 protein is encoded by the vp1 coding region of viral rna; this coding region is 627~639 bp long and produces a protein containing 209~213 amino acid residues depending on the serotype . This gene contains a taa stop codon and is responsible for encoding a protein containing 470 amino acid residues . Similar to other picornaviruses, the fmdv 3d protein is a viral - encoded rna polymerase . Among the different fmdv serotypes and subtypes, both the nucleotide and amino acid sequences of 3d uninterrupted co - circulation of the virus in the environment and the absence of viral polymerase proofreading activity during the replication process lead to the appearance of various genetic isolates . Analysis of the viral genome sequence is a crucially important approach for monitoring field isolates in areas where the disease is endemic . Previous studies have shown that iran has one of the highest reported rates of fmd cases per year . In iran, fmd is largely controlled by vaccinating cattle and sheep with vaccines prepared against isolates that are likely to be encountered in the region . Spread of the disease is promoted by the presence of large populations of susceptible animals, low vaccination rates, prevalence of multiple serotypes (including serotypes a, asia1, and o), and unlimited movement of susceptible animals in the country . Furthermore, there is endemic co - circulation of multiple genotypes of type a virus . The high incidence of fmd has allowed the identification of new variants of the virus over the last 7 years . The general objective of this study was to determine the nucleotide sequences of genes encoding vp1 and 3d proteins of a type a fmdv (a / iran87) highly adapted to cell culturing, and to compare them to other corresponding sequences available in the genbank database . The razi vaccine and serum research institute (iran) generously provided samples of the fmdv used for our study . Clinical specimens of fmdv which included samples in tongue epithelium tissue were collected in 1987 from infected calves displaying clinical symptoms of fmd in an iranian field located in tehran . The a / iran87 strain was initially detected and isolated nearly more than two decades ago . Thus, the highly passaged virus investigated in this study was not virus isolated from the field . The tissue samples were used to infect baby hamster kidney 21 (bhk-21) cells . The virulent isolate was passaged in ba (cell line derived from pig kidney) and bhk-21 cell monolayers . Propagation steps included six passages in ba cells and then four passages in bhk-21 cells . Thereafter, it has been used for the development of fmd vaccines during the past years as a vaccine seed . The infected cell culture supernatant from the ~150th passage was clarified and stored at -70 before use . Total rna was extracted from fmdv - infected bhk-21 cells using an rnx plus kit (cinnagen, iran) according to the manufacturer's instructions . Briefly, the cell culture was centrifuged at 85,000 g at 4 for 2 h. the pellet was resuspended in 200 l of pbs, mixed well with 400 l of rnx reagent, and incubated at room temperature for 5 min . The pellet was washed with 75% ethanol and dissolved in 20 l of rnase - free water . Rt - pcr was carried out in 50 l of reaction mixture containing 10 l of 5 reaction buffer, 4 l of mixed dntps (2.5 mm each), 1 l of amv enzyme (titan one tube rt - pcr system kit; roche diagnostic, germany), 1 l of each primer (10 pmol each), 4 l of rna template, 2.5 l dtt, 3 l 25 mm mgcl2, and 23.5 l of h2o . The following conditions were used for amplification: 42 for 30 min, 94 for 3 min; 30 cycles of 94 for 30 sec, 52 for 30 sec, 72 for 40 sec; then followed by 72 for 5 min . The vp1 and 3d coding regions of fmdv (621 and 690 bp, respectively) were amplified using standard methods with a one - step rt - pcr system and specific primer combinations . 5'-gacatgtcctggtgcatctg-3' for 3d, and forward: fmg13 5'-accaggatgatgattggcag-3' and reverse: fm15 5'-tttcactcctacggtgtcgc-3' for vp1 . Amplified pcr products of the expected length were separated by electrophoresis in a 1% agarose gel, stained with ethidium bromide, and visualized under a uv transilluminator . After successful amplification of the target dna sequences, fragments were purified using a gel extraction kit (roche, germany) following the recommendations of the supplier . Ligation was performed with plasmid vector ptz57r / t (fermentas, germany) in 0.165 g, 0.18 pmol ends and 0.54 pmol ends purified pcr fragment in 1 ligation buffer, polyethylene glycol (peg 4000), 5 units of t4 dna ligase, and up to 30 l of deionized water at 22 for 16 h. the ligated products were used to transform chemically competent cells (xl1-blue cells) and white colonies grown on lb plates were randomly selected . The cloned pcr products were purified using plasmid purification kit (roche diagnostics, germany) according to the manufacturer's instructions and sequencing was carried out in both directions using a t7 promoter primer (mwg biotech, germany). The published sequences of 66 fmdv type a isolates recovered from different parts of the world were included in this analysis and compared to the corresponding sequence of the a / iran87 isolate . Reference fmdv sequences were obtained from the national center for biotechnology information (ncbi, usa). The sequences used for each gene were first examined to exclude ambiguous sequences which were incomplete or frame - shifted . To determine the degree to which genetic diversity was observed in the vp1 and 3d proteins, multiple alignments and comparisons of the predicted amino acid sequences of isolates were carried out (fig . Nucleotide sequence homology / divergence was calculated using the megalign project of the dnastar software package (ver 5.1; dnastar, usa; data not shown). The histories of the type a fmdv field isolates, including year of isolation, accession number, and geographical distribution, are presented in table 1 . The nucleotide sequences of the vp1 and 3d coding regions of a / iran87 have been submitted to genbank (accession no . Total rna was extracted from fmdv - infected bhk-21 cells using an rnx plus kit (cinnagen, iran) according to the manufacturer's instructions . Briefly, the cell culture was centrifuged at 85,000 g at 4 for 2 h. the pellet was resuspended in 200 l of pbs, mixed well with 400 l of rnx reagent, and incubated at room temperature for 5 min . The pellet was washed with 75% ethanol and dissolved in 20 l of rnase - free water . Rt - pcr was carried out in 50 l of reaction mixture containing 10 l of 5 reaction buffer, 4 l of mixed dntps (2.5 mm each), 1 l of amv enzyme (titan one tube rt - pcr system kit; roche diagnostic, germany), 1 l of each primer (10 pmol each), 4 l of rna template, 2.5 l dtt, 3 l 25 mm mgcl2, and 23.5 l of h2o . The following conditions were used for amplification: 42 for 30 min, 94 for 3 min; 30 cycles of 94 for 30 sec, 52 for 30 sec, 72 for 40 sec; then followed by 72 for 5 min . The vp1 and 3d coding regions of fmdv (621 and 690 bp, respectively) were amplified using standard methods with a one - step rt - pcr system and specific primer combinations . Amplified pcr products of the expected length were separated by electrophoresis in a 1% agarose gel, stained with ethidium bromide, and visualized under a uv transilluminator . After successful amplification of the target dna sequences, fragments were purified using a gel extraction kit (roche, germany) following the recommendations of the supplier . Ligation was performed with plasmid vector ptz57r / t (fermentas, germany) in 0.165 g, 0.18 pmol ends and 0.54 pmol ends purified pcr fragment in 1 ligation buffer, polyethylene glycol (peg 4000), 5 units of t4 dna ligase, and up to 30 l of deionized water at 22 for 16 h. the ligated products were used to transform chemically competent cells (xl1-blue cells) and white colonies grown on lb plates were randomly selected . The cloned pcr products were purified using plasmid purification kit (roche diagnostics, germany) according to the manufacturer's instructions and sequencing was carried out in both directions using a t7 promoter primer (mwg biotech, germany). The published sequences of 66 fmdv type a isolates recovered from different parts of the world were included in this analysis and compared to the corresponding sequence of the a / iran87 isolate . Reference fmdv sequences were obtained from the national center for biotechnology information (ncbi, usa). The sequences used for each gene were first examined to exclude ambiguous sequences which were incomplete or frame - shifted . To determine the degree to which genetic diversity was observed in the vp1 and 3d proteins, multiple alignments and comparisons of the predicted amino acid sequences of isolates were carried out (fig . Nucleotide sequence homology / divergence was calculated using the megalign project of the dnastar software package (ver 5.1; dnastar, usa; data not shown). The histories of the type a fmdv field isolates, including year of isolation, accession number, and geographical distribution, are presented in table 1 . The nucleotide sequences of the vp1 and 3d coding regions of a / iran87 have been submitted to genbank (accession no . Genetic comparison of the field isolates to the vaccine strain is of significant importance for testing the usefulness of the existing vaccine strain as well as selecting new vaccine strain(s). During virus circulation, amino acid substitutions accumulate at the different positions of the protein sequence . In the present study, a highly passaged field isolate of fmdv (a / iran87) named mardabad or a87 isolate was selected for genetic analysis . Sequences of the protein coding regions (vp1 and 3d) from the high - passage cell - adapted vaccine strain were determined by pcr amplification and sequencing . Comparison of the amino acid sequences revealed amino acid changes in both structural and non - structural proteins . The number of sequence differences exhibited by each of the isolates showed that a / iran87 contains four amino acid substitutions at positions 17, 26, 50, and 57 in the 3d coding region (fig . 1). There is clear evidence of novel amino acid substitutions (alaser, aspglu, gluasn, and alagly) in two domains of the 3d protein . Comparison of the vp1 protein among different variants showed that a - iran - vaccinal contained a change at position 179 . 1a shows that amino acid changes among the vp1 genes of the field isolates consist of numerous nucleotide substitutions and deletions compared to the consensus sequence . Comparison of the predicted amino acid sequences of vp1 region in the field isolates revealed amino acid deletions in three iranian vaccine isolates (a - iran - vaccinal, a iran04, and a / iran87). As shown in fig . 1a, deletions occurred within the 13 amino acid positions (168 to 180) of the vp1 region . Three - dimensional analysis of 3d protein showed that the aspglu substitution occurred in a beta sheet located in a small groove of the protein . The variations were not distributed uniformly along the genes; there were areas of high and low incidence of nucleotide sequence variation (data not shown). The region of the vp1 gene between amino acids 157 and 183 contained a high degree of variation and encoded an important immunogenic site on the viral surface . Consequently, nucleotide changes in this region are most likely involved in the appearance of new antigenic variants . The vp1 and 3d nucleotide sequences of the selected fmdv - a subtypes isolated from outbreaks in iran and other countries were used to construct a fmdv - a vp1 and 3d - based sequence similarity tree . 2 shows a phylogenetic tree that was constructed based on the sequence alignment of 35 genomes of the vp1 region and 42 genomes in the 3d region which are distinctly divided into different lineages . As depicted in fig . 2a, the a / iran87 isolate clustered with a saudi arabian and five iranian isolates into a branch separate from other type a isolates . 2b demonstrates that a / iran87 and all isolates examined in the present study originated from different geographical areas and did not cluster in relatively similar lineages based on 3d sequences . All the field isolates shared comparatively lower homology (90~93%) with the a / iran87 isolate in the 3d coding region (data not shown). The topology of the phylogenetic tree indicated that there was no remarkable similarity between a / iran87 and all other isolates in the 3d coding region . Space - filling and worm styles of the three - dimensional structures of the 3d and vp1 proteins from the a / iran87 isolate were observed . Analysis of the 3d protein structure showed that the aspglu substitution occurred in a beta sheet located within a small groove of the protein . In order to examine the long amino acid deletion in the three - dimensional structure of the vp1 protein, homology - based modeling of the protein domains it indicated that, 13 amino acid deletions in the vp1 protein of a / iran87 isolate caused a change in three - dimensional structure of protein in the g - h loop region . Detailed knowledge of the molecular characteristics of the major fmdv immunogenic components would be useful for monitoring various processes like evolution, genetic diversity, and virus origin, and for developing protective vaccines . Among the fmdv serotypes, fmdv variants also appear during continuous infection of animals on farms or proliferation in cell cultures . Furthermore, genetic diversification among fmdv subtypes can be caused by events occurring during recombination . Along with above mechanisms, there is continuous co - circulation of multiple genotypes of fmdv type a which may lead to recombination; this progresses gradually between closely related isolates when multiple viral genotypes exchange of different genomic regions between fmdvs by recombination is directly linked to fmdv diversification . Recombination, particularly in the structural protein - coding region, may offer selective advantages to the virus . This can be great concern to areas where multiple fmdv genotypes co - circulate . The presence of extensive antigenic variation among different fmdv isolates can hinder vaccination against fmdv . Genetic polymorphisms amongst different type a subtypes demonstrated that four nucleotides in the 3d coding region of isolate a / iran87 (49, 78, 148, and 170) were changed from g to t, c to a, g to a, and c to g, respectively, resulting in amino acid substitutions ala17ser, asp26glu, glu50asn, and ala57gly, respectively . In contrast to the a / iran87 isolate, the remaining 41 isolates showed no corresponding changes at these positions . Analysis of the sequence data revealed that the a / iran87 isolate also contained 30 nucleotide deletions in region 501~540 of the vp1 nucleotide sequence, which led to long amino acid deletions (rgdlgslaarvaa) in the g - h loop . It should be noted that the rgd sequence was deleted from the g - h loop . The three - dimensional and antigenic structures of many different serotypes of the fmdv have been examined . In spite of losing the rgd sequence and acquiring a asp26glu substitution in a beta sheet located in a small groove of the 3d protein, the virus grew in a bhk-21 suspension cell culture and exerted cytopathic effects after 16~18 h. since this strain is used as a vaccine strain, it may be inferred that the rgd does not have a key role in the virus binding to cells during infection . Was found to be deleted, such a natural deletion in vp1 gene of fmdv is a novel phenomenon and has not been previously reported in compared isolates . The vp1 capsid protein contains a mobile loop between the g and h strands on the virus surface; this protein not only contains the major immunodominant epitopes of the virion but also a highly conserved rgd amino acid sequence motif . Several studies using different approaches have indicated that naturally developed fmdv isolates attach to cells via the highly conserved rgd motif . Fmdvs have been shown to use multiple rgd - dependent integrins of the v subgroup to initiate infection; these include v3, v6, v1, and v8 . On the other hand, these viruses are capable of entering cells via non - integrin pathways . Tissue culture - adapted fmdvs are able to utilize heparan sulfate (a glycosaminoglycan found on the cell surface) as a receptor for entering the cells . It has recently been found that fmdv can utilize unknown receptors except for integrin and heparan sulfate . This indicates the presence of other receptors and possible alternative mechanisms for viral particle entrance into the cells . This conclusion is also supported by the finding that destruction of the g-h loop rgd motif by site - directed mutagenesis created viruses which were able to replicate and assemble, but were not capable of initiating further infection cycles because of their inability to interact with cell receptors . Previous findings from studies of synthetic peptides suggested that the carboxy - terminus of the vp1 protein situated in the vicinity of the rgd motif is required for rgd - mediated cell binding . The g - h loop of the vp1 protein on the viral particle surface is considered to be the dominant epitope for several fmdv types and the most variable part of the particle . Antibody - based responses against the loop have the ability to neutralize fmdvs in vitro and are protective in vivo . For example, replacing the whole or partial g - h loop leads to the doubling of antibody titers against type a virus . New findings in this field are in complete agreement with a previous report documenting that the only mutation which did not increase heterologous responses was deletion of the rgd - motif (3a). In another study, the rgd sequence was deleted from a genetically engineered fmdv (type a12), thereby rendering the virus particles incapable of binding to cell surfaces . Protective immunity in cattle has been obtained by utilizing particles from which the receptor binding site was deleted as a vaccine, revealing that this deletion has no significant effect on the antigenic properties of viruses with the rgd sequence . Many reports have suggested that fmdv subtypes can be obtained in the field by immune selection during outbreaks of fmdv which have not been effectively neutralized in animal populations with incomplete immunization . Thus, key changes in protein sequences that give rise to differences in immunogenicity and virulence can be seen among viruses isolated from partially immunized animals . In addition, it is possible that other significant changes take place when the virus moves from one host cell type to another . For instance, this may occur when fmdv spreads from one species to another (from cattle to swine and then back to cattle) or when fmdv cultured in bhk cells infects animal herds . For a number of years, it has been observed that fmdv easily adapts to many different tissue culture cell types . A recent report on a single passage of subtype a12 (avr1) in bhk cells showed that some viral variants selected from this passage contained amino acid changes at residues 148 and 153 of the vp1, including ones that have a limited capability for eliciting cross - neutralizing antibodies . The rapid generation of immunogenically distinguishable variants among fmdv subtype a viruses may affect the large - scale production of vaccines in bhk cells . Adaptation for growth in tissue culture can be used to select viruses that have antigenic and cell attachment site(s) different from those of the parental virus . Amino acid residues 134~158 form a g-h loop structure which contains the main fmdv immunogenic epitope . In fmdv type c, mutation of residues 138~140 and 148~150 in the vp1 region has been shown to affect fmdv antigenicity . Mutation frequency in the vp1 gene sequence of the fmdv has been estimated to be 1.6 10~6.4 10 substitutions for each nucleotide per year . G - h loop - specific antibody responses are known to play a major role in immunity induced by the current fmdv vaccines . Considering the high sequence variability of this loop within and among the serotypes, it will be valuable to direct immune responses against other protective epitopes that are not as variable . Residues 140~160 of vp1 have been previously shown to induce neutralizing antibodies against fmdv types o and a . Due to a novel deletion of the 13 amino acid region including the rgd motif in the vpi capsid protein of a / iran87, the effect of this motif in receptor binding and cell infection must be determined . This protein was initially called the fmdv infection - associated antigen since antibodies to this antigen are be detected in serum from recovery animals . The 3d position is located at the c - terminus of the polypeptide next to the 3c gene product . The 3d coding region produces a 470-amino acid protein with a molecular weight of ~55 kda . The pivotal role of 3d in the viral replication process is attributed to the fact that the 3d gene is highly conserved, particularly in the functional motifs . Since rna polymerase is necessary for viral replication, the degree of sequence identity among the 3d genes is much greater than that of vp1 gene sequences . A wealth of three - dimensional structural information is currently available for a large number of rna - dependent rna polymerases from different families of positive- and double - stranded rna viruses, including three different members of the picornaviridae family . Considering the fact that this strain can infect bhk-21 cells and has been used as a vaccine strain for nearly two decades, it may be concluded that deletion of rgd has no critical role in virus binding to cells during the initiation of infection . The findings of the current study demonstrated that the cell - adapted vaccine strain a / iran87 containing 13-amino acid deletions in the vp1 protein can be considered as a novel variant of fmdv type - a.
|
Breast - conserving surgery and radiation therapy are the standard alternatives to mastectomy for eligible women with stage 0, i, or ii breast cancer [1, 2]. Survival outcomes are equivalent to women who undergo initial mastectomy, and the long - term rates of ipsilateral breast tumor recurrence (ibtr) are on the order of 5% to 15% [36]. For those who develop a clinically isolated ibtr after breast - conserving surgery and whole - breast radiation, salvage mastectomy three - quarters of local recurrences are clinically solitary [7, 8], with an average size of 1 - 2 cm [914]. Therefore, many ibtr appear amenable to additional attempts at breast - conserving surgery . Breast conservation has many potential benefits on patient self - image, sexuality, and quality of life compared to mastectomy . However, second attempts at breast conservation with surgery alone have been associated with high risks of second ibtr of 1848% [13, 1619]. Arguments against reirradiation to improve local control include concerns for radiation resistance of the recurrent tumor, acute toxicity, poor cosmesis, or risk of serious late effects . It is not possible from the few available retrospective studies of external beam boost radiation to conclude whether local control after salvage breast conservation surgery is improved by conventional re - irradiation [16, 20, 21]. However, the rationale for postexcision radiation should be the same as in the initial adjuvant setting to address the risk for microscopic residual disease in the region of the excision cavity that exists even when surgical margins are negative . And these early reports have demonstrated low risks of complications in selected patients . Accelerated partial breast irradiation (apbi) is radiation confined to the immediate area around an excision cavity rather than to the whole breast volume . In the setting of a clinical trial, apbi has been proposed as an alternative to salvage mastectomy for selected patients with favorable ibtr after breast - conserving surgery and whole - breast irradiation [21, 22]. Apbi has the potential of improving local tumor control compared to breast - conserving surgery alone . The use of hypofractionation and the accelerated treatment time with pbi could improve the tumor control of tumors that have recurred after prior conventional 2 gy fractionation by overcoming effects of intrinsic radioresistance, repair or rapid repopulation . Apbi may reduce risk of toxicity of conventional re - irradiation by limiting the volume of breast tissue and neighboring normal tissue treated to high cumulative doses . Proper patient selection for an ibtr of limited extent and favorable biology would be essential for treatment by apbi to have a chance of securing local control . A favorable profile of ibtr for such a trial of apbi would need to include isolated recurrences that are unifocal and limited in size so that a repeat breast - conserving surgery could obtain negative margins and maintain good cosmesis . In addition, the area of involvement would need to be limited in size without multifocality or multicentricity for a focused treatment such as apbi to have a reasonable chance for local control . Tumors with a short interval to recurrence after radiation, less than 2 years being a typical cutoff, would more likely have an aggressive biology with a poorer prognosis due to a high incidence of systemic progression [6, 19]. To better identify candidates who could have been eligible for a salvage apbi protocol, we studied the clinical and pathologic characteristics of 157 ibtrs after salvage mastectomy to identify factors associated with a favorable recurrence profile . We retrospectively reviewed a prospective database of 3310 consecutive women with early - stage breast cancer treated with breast - conserving surgery and radiation therapy from 1980 to 2005 . Patient demographics, tumor characteristics, and treatment - related information were entered prospectively and the data were maintained and updated by a single data manager . The collection, storage, and retrieval of data were done in compliance with the hospital's institutional review board and the health insurance privacy and portability act . Inclusion criteria for this study were primary breast cancer; american joint committee on cancer 6th edition initial cancer stages 0, i, or ii; initial treatment with whole breast radiation therapy; a clinically isolated ibtr; and treatment for ibtr by mastectomy . Exclusion criteria included male breast cancer, t3-t4 disease, stage iv disease, mastectomy for initial treatment, and no radiation therapy as part of the patient's initial treatment . All patients were treated initially by breast - conserving surgery followed by whole - breast radiation (4650 gy), with or without regional nodal radiation, and a boost to the tumor bed (1018 gy). The total dose was generally determined by the final margin status after lumpectomy: 60 gy for a negative margin, 64 gy for a close margin, and 66 gy for a positive final margin . The study endpoint was a classification as a favorable ibtr defined as an isolated first site of recurrence; unifocal; invasive or in situ; less than or equal to 2 cm in size; no skin involvement; and more than 2 years from initial treatment . Chi - square test, wilcoxon's test, and generalized estimating equations were used for univariate and multivariate analyses . The characteristics of the 157 patients in the study population are summarized in table 1 . At the time of their initial diagnosis and treatment patients were approximately equally divided between pre- and postmenopausal status and laterality of the breast cancer . The interval to recurrence was 2 years in 8% and> 2 years in 92% . Ibtr was confined to the same quadrant as the initial tumor in 55% of patients, a different quadrant in 33%, was diffuse or multicentric in 6%, and skin was involved in 3% . Histologically, most patients presented with invasive ductal carcinoma (77% of primary tumors and 57% of ibtr). Receptor status was considered hormone sensitive (er or pr positive) or insensitive (er and pr negative). This was available for only 39% of the ibtr compared to 72% of the initial tumors . The differences in characteristics between the initial tumor compared to the subsequent ibtr are shown in table 3 . There were more palpable tumors at time of initial diagnosis (55%) compared with ibtr (41%). The method of detection was physical examination only in approximately 20% at time of initial diagnosis and ibtr . More ibtr were detectable on mammogram alone compared to the initial tumors (55% versus 40%). Pathologic t stage at initial diagnosis and clinical t stage of ibtr were predominantly t1, 65% and 57%, respectively . Among patients with known receptors, the percentage of hormone sensitive tumors was 78% of initial tumors and 67% of ibtr (table 3). For patients initially hormone sensitive, the ibtrs was hormone sensitive in 37 of 41 (90%). For patients known to be initially hormone insensitive, the ibtr was sensitive in 9 of 20 (45%). Among the 90 patients with a clinical t1 ibtr, pathology from salvage mastectomy was available for 75 patients . In 71 of 75 patients (95%) with clinical t1 ibtr for those with pathologic data, the ibtr were clinical stage t1 or dcis in 77% and pathologic tis or t1 in 70% . The median tumor size at time of both initial diagnosis and ibtr was 1 cm . The characteristics of the initial tumor versus the ibtr were analyzed to determine predictors of pathologic t1 size at time of salvage mastectomy . There was no significant correlation between the studied initial tumor characteristics and subsequent pathological size of ibtr . Clinical t stage at recurrence was the only independent predictor of having a t1 pathologic recurrence stage . Approximately 1020% of patients with stage i or ii invasive breast cancer will develop an ibtr by 10 years after breast - conserving surgery and rt [36, 2428]. In general, ibtr rates have been decreasing due to improvements in patient selection for initial treatment with breast - conserving surgery and whole breast radiotherapy, surgical and radiation techniques, and the use of systemic therapy [29, 30]. Our study population of only 157 ibtr from an initial population of over 3,000 patients (less than 5%) after a median followup of 140 months is consistent with this reported decreasing risk of ibtr in other studies . Current recommendations for surveillance of patients following breast - conserving therapy include monthly patient self - examination, examination by a physician every 4 to 6 months for 5 years and then annually, and mammography 6 months after radiation and then annually . In the current study, we found that 80% of ibtr were detectable on mammography, and the median size was 1 cm . We have insufficient numbers of patients with ibtr t2 or larger to analyze for significant characteristics that could be prospectively identified . If there were a common independent factor that predicted for a large size of ibtr with current methods of physical examination and mammography, then a more intensive surveillance could be recommended for such patients . Mastectomy is the standard treatment for patients with a clinically isolated ibtr after whole - breast irradiation . Salvage mastectomy is associated with local control rates of approximately 8595% [8, 13, 17, 19, 3134]. A change in this paradigm for salvage therapy needs to be approached with caution so that new treatments for ibtr with lower rates of local control do not become commonplace . However, in the setting of a clinical trial, for women who find mastectomy unacceptable or are medically poor candidates, identification of other salvage treatment modalities for ibtr may be appropriate . However, second attempts at breast conservation with surgery alone have been associated with high risks of second ibtr of 1848% [13, 1619]. There is a limited published experience with giving further rt after prior whole - breast irradiation after salvage breast - conserving surgery for ibtr . In the study of kurtz et al ., 11 of 50 patients who had recurrences away from the original tumor bed were given additional radiation after wide excision . Second local failures occurred in 36% of the patients treated with further irradiation, compared with 31% of those treated with wide local excision alone . Deutsch and colleagues reported on a series of 39 women treated for ibtr by repeat wide local excision and treatment to an electron field around the lumpectomy bed with an additional 50 gy . There were no reported serious sequelae from the additional radiation . In the setting of a clinical trial, apbi has been proposed as an alternative to salvage mastectomy for selected patients with favorable ibtr after breast - conserving surgery and whole - breast irradiation [21, 22]. Hannoun - levi et al . Reported on 69 patients with ibtr who were treated by a second breast - conservation surgery and interstitial brachytherapy . Factors associated with better local control were an interval to recurrence of 36 months or greater and use of a greater number of catheters for the implant . This suggests that improved methods of radiation technique that optimize dose coverage may lead to better rates of local control in future studies . In addition to optimized apbi techniques, improved patient selection could result in improved rates of local control after salvage breast conservation for ibtr . A favorable profile of ibtr for apbi would need to be isolated, unifocal, and limited in size . Selection of tumors with a longer interval to recurrence would also include ibtr with less aggressive biology and patients with better chances for long - term survival . We identified approximately 70% of patients with these favorable ibtr characteristics after initial breast - conserving surgery and whole - breast radiation . The clinical estimation of tumor size was the most significant independent factor predictive of having pathologically confirmed favorable ibtr at salvage mastectomy . This favorable subset of patients could be a pool of eligible candidates for a clinical trial of salvage breast conservation in this setting . The radiation therapy oncology group is currently studying salvage breast - conserving surgery and apbi in this favorable subset of patients . Patient selection includes ibtr 3 cm or less in size, without imaging evidence of multicentricity, and an interval to recurrence of greater than 1 year . Our data suggests that over 70% of patients with ibtr will be eligible for enrollment given that our selection criteria for most favorable ibtr are more strict than the rtog trial eligibility.
|
Large numbers of plastic and reconstructive surgical procedures are performed every year to repair soft tissue defects that result from deep burns, tumor resections and hereditary and congenital defects such as romberg's disease and poland syndrome (1). Despite the increasing clinical demand, the optimal strategy for the reconstruction of soft tissue defects remains a challenge in plastic and reconstructive surgery (2, 3). They have the capacity to proliferate indefinitely (self renewal) or giving rise to tissue specific committed progenitors or differentiated cells (4, 5). Recently, a number of attempts have been made in vitro and in vivo to differentiate adipose tissue using mesenchymal stem cells (611). The capacity of stem cells to differentiate into endothelial cells and adipocytes upon receiving proper stimuli may be promising for developing vascularised fat graft for reconstructive purposes (12). Various stem cells such as mesenchymal stem cells / marrow stromal stem cells (msc), hematopoietic stem cells (hsc), multipotent adult progenitor stem cells (mapcs), umbilical cord blood stem cells (ucbsc), and embryonic stem cells (es) have the potency to differentiate into the adipocyte cells (1317). The human endometrium is a dynamic tissue, which undergoes cycles of growth and regression with each menstrual cycle . Endometrial regeneration also follows parturition and extensive resection and occurs in postmenpausal women taking estrogen replacement therapy . It is likely that adult stem / progenitor cells are responsible for this remarkable regenerative capacity (1821). It has been demonstrated that human endometrium contains a low number of enscs which seem to belong to the family of the mesenchymal stem cells . These cells are engaged in the monthly restructuring and remodeling of human endometrium (2123). The functionalis, comprising the upper two thirds contains glands and basalis containing the basal region of the glands . The functionalis is shed by each menses but basalis stable and used for generating the new functionalis each month (21). The human endometrium is a dynamic remodeling tissue undergoing more than 400 cycles of regeneration, differentiation and shedding during a woman's reproductive years (22). Each month 410 mm of mucosal tissue grows within 410 days in the proliferative stage of the menstrual cycle under the influence of increasing circulating estrogen levels . It has been hypothesized that adult stem or progenitor cells are responsible for the cyclic regeneration of the endometrial functionalis each month . These adult stem cells reside in the basalis, and are present in the atrophic endometrium of postmenopausal women (23). Since endometrial stromal cells are easy to isolate, expand rapidly from patients without leading to major ethical and technical problems, and produce a higher overall clonogenicity, they have a unique potential as therapeutic agents as autologous graft (1, 18). Therefore, endometrium may be an alternative source of msc - like cells for tissue engineering purposes, obtainable with no extra morbidity than that required for other sources of stem cells (22, 23). In the our previous study, we have shown enscs can differentiate to neural and adipocyte cells and we used oilred o staining for illustration of adipocyte differentiation (24). In this study we assayed ppara specific marker for adipocyte with rt - pcr . The major aim of the present study was to obtaine growth curve and doubeling time for enscs, then to investigate the ability of enscs to differentiate in vitro toward adipocyte in the presence of adipogenic - promoting media . The adipogenic differentiation was demonstrated by cellular morphology, oil red o staining and rt - pcr for ppara . This study was down in cell culture laboratory, department of tissue engineering, school of advanced technologies in medicine, tehran university of medical sciences in early 2011 . Human endometrial tissues were obtained from tehran reproductive aged women referred to the imam khomeini hospital for infertility treatment . A written informed consent form (according to instruction of tehran university of medical sciences research assistant) describing the procedures and aims of the study was obtained from each donor in compliance with regulations concerning the use of human tissues . Endometrial samples were obtained from the fundal region of the uterine cavity using an endometrial sampling device . The biopsy tissue was washed in dulbecco's phosphate buffered saline (dpbs), minced and digested in hank's balanced salt solution (hbss) (gibco, usa) containing 4-(2 hydroxyethyl)-1 piperazineethanesulfonic acid (hepes) (25 mm), collagenase a (1 mg / ml, gibco, usa) for 3045 min at 37 c with agitation . Resultant dispersed cell solutions were then passed through 70, 40 m sieves (bd biosciences, usa) to remove glandular epithelial components . The cells were then centrifuged and mononuclear cells were separated by ficoll (gibco, usa) and washed in pbs . The isolated cells were cultured in dmem/ f12 medium (gibco, usa) containing 10% fbs, 1% antibiotic penicillin / streptomycin (gibco, usa) and 1% glutamine (gibco, usa) and then incubated at 37 c in 5% co2 (18, 24). To detect surface antigens, first, cells were washed with hbss + 2% bsa twice and incubated with the specific antibody conjugated with fluorescein isothiocyanate (fitc) or phyco erythrin (all from santa cruz) at concentrations recommended by the respective manufacturers . Cells were incubated for 20 min and analyzed by flow cytometry (partec, germany). The antibodies used were: sh2 (cd105, endoglin), cd90 (thy-1) (mesenchymal markers), cd146 (endometrial stem cell marker), cd34 (hematopoietic marker), cd31 (endothelial marker), and fitc conjugated mouse igg1, pe - conjugated mouse igg1 were used for negative control . The number of population doublings (pdn) and the time required by cells for each population doubling (pdt) were calculated by hemocytometer counts for each passage according to the following formulae and growth curve was obtained after 7 days: pdn = log (n1/n0)x 3.31 where n1 is the cell number at the end of cultivation period, n0 is the cell number at culture initiation, and ct is the cell culture time . Cells derived from whole isolates of endometrium were expanded and passaged in dmem with 10% fbs . Adipogenic differentiation was induced in the third passage cells by plating the enscs at 210 cells per cm, allowing the cells to reach confluence and then incubating for a further 48 hr . The media was then changed to dmem supplemented with 10% fbs as described above and the following hormones were added: insulin (10 g / ml), dexamethasone (1 m), indomethacin (200 m) and isobutylmethylxanthine (0.5 mm) all from sigma, usa (18). Media were changed every 4 days and differentiation medium every 34 days for 28 days . Oil red o stain was used to confirm the presence of lipid in differentiaed cells . Cells were washed with pbs, fixed in 2% paraformaldehyde, 0.2% gluteraldehyde in pbs for 15 min and then rinsed with pbs . Then they were stained with oil red o (reconstituted in iso - propanol) (sigma, usa) for 10 min and rinsed in 60% isopropanol followed by pbs (10). Rt - pcr analysis was done to monitor the expression of activation of peroxisome proliferator activated receptor- ppar during the programming of enscs into adipocytes cell lineage . First, whole total rna was extracted from differentiated cells 28 post treatment by trizol reagent (invitrogen, usa) according to the manufacturers instructions . Subsequently, 5 g of total rna was transcribed into cdna by using moloney - murine leukemia virus (mmlv) superscript ii reverse transcriptase (promega) and random hexamer primers . This study was down in cell culture laboratory, department of tissue engineering, school of advanced technologies in medicine, tehran university of medical sciences in early 2011 . Human endometrial tissues were obtained from tehran reproductive aged women referred to the imam khomeini hospital for infertility treatment . A written informed consent form (according to instruction of tehran university of medical sciences research assistant) describing the procedures and aims of the study was obtained from each donor in compliance with regulations concerning the use of human tissues . Endometrial samples were obtained from the fundal region of the uterine cavity using an endometrial sampling device . The biopsy tissue was washed in dulbecco's phosphate buffered saline (dpbs), minced and digested in hank's balanced salt solution (hbss) (gibco, usa) containing 4-(2 hydroxyethyl)-1 piperazineethanesulfonic acid (hepes) (25 mm), collagenase a (1 mg / ml, gibco, usa) for 3045 min at 37 c with agitation . Resultant dispersed cell solutions were then passed through 70, 40 m sieves (bd biosciences, usa) to remove glandular epithelial components . The cells were then centrifuged and mononuclear cells were separated by ficoll (gibco, usa) and washed in pbs . The isolated cells were cultured in dmem/ f12 medium (gibco, usa) containing 10% fbs, 1% antibiotic penicillin / streptomycin (gibco, usa) and 1% glutamine (gibco, usa) and then incubated at 37 c in 5% co2 (18, 24). First, cells were washed with hbss + 2% bsa twice and incubated with the specific antibody conjugated with fluorescein isothiocyanate (fitc) or phyco erythrin (all from santa cruz) at concentrations recommended by the respective manufacturers . Cells were incubated for 20 min and analyzed by flow cytometry (partec, germany). The antibodies used were: sh2 (cd105, endoglin), cd90 (thy-1) (mesenchymal markers), cd146 (endometrial stem cell marker), cd34 (hematopoietic marker), cd31 (endothelial marker), and fitc conjugated mouse igg1, pe - conjugated mouse igg1 were used for negative control . The number of population doublings (pdn) and the time required by cells for each population doubling (pdt) were calculated by hemocytometer counts for each passage according to the following formulae and growth curve was obtained after 7 days: pdn = log (n1/n0)x 3.31 where n1 is the cell number at the end of cultivation period, n0 is the cell number at culture initiation, and ct is the cell culture time . Cells derived from whole isolates of endometrium were expanded and passaged in dmem with 10% fbs . Adipogenic differentiation was induced in the third passage cells by plating the enscs at 210 cells per cm, allowing the cells to reach confluence and then incubating for a further 48 hr . The media was then changed to dmem supplemented with 10% fbs as described above and the following hormones were added: insulin (10 g / ml), dexamethasone (1 m), indomethacin (200 m) and isobutylmethylxanthine (0.5 mm) all from sigma, usa (18). Media were changed every 4 days and differentiation medium every 34 days for 28 days . Oil red o stain was used to confirm the presence of lipid in differentiaed cells . Cells were washed with pbs, fixed in 2% paraformaldehyde, 0.2% gluteraldehyde in pbs for 15 min and then rinsed with pbs . Then they were stained with oil red o (reconstituted in iso - propanol) (sigma, usa) for 10 min and rinsed in 60% isopropanol followed by pbs (10). Rt - pcr analysis was done to monitor the expression of activation of peroxisome proliferator activated receptor- ppar during the programming of enscs into adipocytes cell lineage . First, whole total rna was extracted from differentiated cells 28 post treatment by trizol reagent (invitrogen, usa) according to the manufacturers instructions . Subsequently, 5 g of total rna was transcribed into cdna by using moloney - murine leukemia virus (mmlv) superscript ii reverse transcriptase (promega) and random hexamer primers . Human enscs could be isolated easily by their adherence to plastic flask . After plating for 24 hr about 10 days later, these cells developed to many clusters, and could be used for subculture . These cells are relatively elongated or spindle - shaped cells (figure 1a and 1b). In order to determine a clonal population of cells, we derived cell lines by single - cell plating in 24 well plates, which revealed clonogenic potential (figure 1c and 1d). The cells grew at a doubling time of approximately one doubling every 49.9 hr based on quantification of cell number using microscope counting and growth curve obtained after 7 days (figure 1). Morphology of cultured enscs; a: morphology of freshly isolated ens cells; b: fibroblast - like morphology of enscs after 2 weeks cell culture; c: clonal population of enscs after plating in 24 well plate 1 week after cloning; d: the same population 2 weeks after cloning . Growth curve for enscs after 7 days cell culture (100 magnification) the immunophenotype was based on the flow cytometry analysis of a subset of mesenchymal stem cell markers (cd146, cd90 and cd105), hematopoietic marker (cd34) and endothelial marker (cd31). The flow cytometric analysis showed that isolated cells were positive for cd146, cd90, cd105 and were negative for cd31, cd34 (figure 2). Flow cytometric analysis of isolated enscs for mesenchymal stem cell markers (cd90, cd105 and cd146), hematopoietic marker (cd34), endothelial marker (cd31). As shown in figure 2 the isolated cells are positive for cd90, cd105 and cd146 and are negative for cd31, cd34 after only 12 days of adipogenic induction, small lipid droplets (arrows in figure 3) were observed within enscs treated with differentiation - promoting medium (figure 3b) whereas there was no lipid droplet in non - treating group at day 12 (figure 3a). At day 21, in the presence of differentiation medium the size of the lipid droplets increased to occupy most of the cytoplasm, consistent with differentiation of ensc into adipocytes (figure 3c). Adipogenic differentiation was further confirmed by oil red o staining at the end of the experiment (28 days). Lipid droplets in differentiating ensc were positively stained with oil red o in the presence of differentiation medium (figure 3d and 3e). To investigate the expression of adipocyte marker in the level of mrna, rt - pcr was carried out (figure 4). The ppar gene as a specific marker of adipocyte was expressed in the level of mrna in 28 days pt . Enscs before (a) and after differentiation into adipocytes at 12 days pt (b) and at 21 days pt (c), as demonstrated by light microscopy (a, b, c), oil red o staining to demonstrate lipid accumulation at 28 days pt (d, e). Arrows in b and c show adipocyte cells (100 magnification) adipocyte - related gene expression analysis of enscs 28 days pt using rt - pcr . Human enscs could be isolated easily by their adherence to plastic flask . After plating for 24 hr about 10 days later, these cells developed to many clusters, and could be used for subculture . These cells are relatively elongated or spindle - shaped cells (figure 1a and 1b). In order to determine a clonal population of cells, we derived cell lines by single - cell plating in 24 well plates, which revealed clonogenic potential (figure 1c and 1d). The cells grew at a doubling time of approximately one doubling every 49.9 hr based on quantification of cell number using microscope counting and growth curve obtained after 7 days (figure 1). Morphology of cultured enscs; a: morphology of freshly isolated ens cells; b: fibroblast - like morphology of enscs after 2 weeks cell culture; c: clonal population of enscs after plating in 24 well plate 1 week after cloning; d: the same population 2 weeks after cloning . Growth curve for enscs after 7 days cell culture (100 magnification) the immunophenotype was based on the flow cytometry analysis of a subset of mesenchymal stem cell markers (cd146, cd90 and cd105), hematopoietic marker (cd34) and endothelial marker (cd31). The flow cytometric analysis showed that isolated cells were positive for cd146, cd90, cd105 and were negative for cd31, cd34 (figure 2). Flow cytometric analysis of isolated enscs for mesenchymal stem cell markers (cd90, cd105 and cd146), hematopoietic marker (cd34), endothelial marker (cd31). As shown in figure 2 the isolated cells are positive for cd90, cd105 and cd146 and are negative for cd31, cd34 after only 12 days of adipogenic induction, small lipid droplets (arrows in figure 3) were observed within enscs treated with differentiation - promoting medium (figure 3b) whereas there was no lipid droplet in non - treating group at day 12 (figure 3a). At day 21, in the presence of differentiation medium the size of the lipid droplets increased to occupy most of the cytoplasm, consistent with differentiation of ensc into adipocytes (figure 3c). Adipogenic differentiation was further confirmed by oil red o staining at the end of the experiment (28 days). Lipid droplets in differentiating ensc were positively stained with oil red o in the presence of differentiation medium (figure 3d and 3e). To investigate the expression of adipocyte marker in the level of mrna, rt - pcr was carried out (figure 4). The ppar gene as a specific marker of adipocyte was expressed in the level of mrna in 28 days pt . Enscs before (a) and after differentiation into adipocytes at 12 days pt (b) and at 21 days pt (c), as demonstrated by light microscopy (a, b, c), oil red o staining to demonstrate lipid accumulation at 28 days pt (d, e). Arrows in b and c show adipocyte cells (100 magnification) adipocyte - related gene expression analysis of enscs 28 days pt using rt - pcr . The enscs are new source of mesenchymal stem cells (2125). In the present study, our findings showed that enscs expressed cd146, cd105 and cd90 . In our previous study, we didn't survey cd146 (24), but in this study we have shown that enscs are positive for cd146 in agreement with schwab et al . And gargget et al . The result showed that the enscs in presence of adipogenic - inducing medium obtained an adipocyte fate 28 days pt . The enscs - derived adipocyte cells could express adipocyte marker such as ppar, associating with remarkable morphological modifications . These data support the possibility of wider applications of enscs in cell therapy of soft tissue defects that result from deep burns and tumor resections and congenital defects . Previous studies concerning long - term follow up of animals treated with endometrial regenerative cells, and the karyotypic normality of these cells after extended passage (68 doublings) confirmed lack of tumorigenicity (2628). Endometrial msc were recently isolated from human endometrium by their coexpression of two perivascular cell markers, cd146 and pdgf - receptor- (pdgf - r) (2023). The cd146 + pdgf - r+ cells underwent multilineage differentiation into adipogenic, myogenic, chondrogenic and osteoblastic lineages when cultured in appropriate induction media (20, 23). We found that single, freshly isolated endometrial stem cells self - renewal, have high proliferative potential, and undergo adipogenic differentiation media can differentiate into adipocyte cells in vitro, suggesting that they are similar to bone marrow mscs . This suggests that they are responsible for monthly endometrial tissue regeneration, preparing the endometrium for steroid hormone - initiated differentiation into a receptive environment for embryo implantation . Both epithelial progenitor cell and msc - like populations were identified . The entire endometrial functionalis layer, which is shed each month during menstruation, is likely replenished from these endometrial stem cells, supposed to reside in the basalis (23). Endometrial stem cells demonstrated substantial proliferative capacity (49.9 pds), greater than most human bone mar - row, dental pulp, and adipose cfu - f (20 pds) and fetal muscle cells (40 pds) (2932). Enscs should also contribute to the development of novel regenerative therapies for reconstruction of soft tissue defects after tumor resections, extensive deep burns and lipodystrophy . Adipose tissue engineering strategies have commonly involved the use of seeding preadipocytes on appropriate polymeric scaffolds . Recently, a number of attempts have been made in vitro and in vivo to engineer adipose tissue using mesenchymal stem cells (3335). 2008, show that bone marrow mesenchymal stem cells (bm - msc) can use for adipose tissue engineering . They used pluronic f12 hydrogel in vitro for differentiation of bm - mscs to adipocytes (36). We purpose that enscs may apply in scaffolds for tissue engineering . In our study, the data clearly demonstrated enscs can be differentiated into adipocytes phenotype in vitro . We have shown that after 12 days of induction, small lipid droplets appeared within enscs treated with differentiation medium, and the size of the lipid droplets increased at 21 days pt . Besides the morphological evidence, we have also demonstrated that the adipocyte - like phenoltypes derived from enscs express ppar in mrna level in 28 pt . It may be concluded that the enscs in the plastic and reconstructive surgical procedures for repairing soft tissues defects are more convenient than other sources of stem cells due to the following properties . First, obtaining bone marrow stem cells in the clinic is invasive, because of the requirement for anesthesia whereas enscs can be obtained by a simple, safe and painless procedure such as pop smears, in contrast to bone marrow aspiration . Second, enscs produce a higher overall clonogenicity of 1.25% in comparison to the clonogenic activity of stromal cells in bone marrow . Third, bone marrow mscs are not perfect seeding cells for the elderly patients since these cells lose their differentiation capacity significantly with increased donor age . Fourth, karyotypic normality of the endometrial stromal cells after extended passage (68 doublings) demonstrated lack of tumorigenicity (37, 38). Adult human endometrium contains rare epithetlial progenitors and mscs, likely responsible for its immense regenerative capacity, which may provide a readily available source of mscs for cell - based therapies . We speculate that endometrial adult stem cells can differentiate into adipocytes cell when they are exposed to adipogenic induction media . The enscs are attractive alternative candidate for repairing soft tissue defects, because they exhibit several important and potential advantages over other stem cells and enscs have provided potential alternative cells for adipose tissue engineering . The underlying mechanisms of these differences are unclear and further studies are needed to determine whether this may be of importance in further understanding of determinants of cell fate within the adipocyte lineage.
|
Bladder cancer (bca) is the fifth most common cancer in the united states . In 2012, it is projected that 73,510 people will be diagnosed with bca and 14,880 will die from the disease . Muscle invasive bc (nmibc), about 30% of patients will either initially present or later progress to muscle invasive bladder cancer (mibc). Radical cystectomy (rc) with urinary diversion (ud) is the ultimate curative treatment . Diagnosis of bca in patients aged <40 years is rare and is extremely rare in patients <30 years of age . However, cases of bca have been previously reported in pediatric and young adult patients [4, 5]. Our aim is to report our experience with a young adult patient with mibc and review the literature for the natural history and outcome . A 28year old caucasian male patient with 10 pack year smoking history with no family history of bca presented to the emergency department with gross hematuria and left flank pain . The patient underwent computerized tomography (ct) of the abdomen and pelvis without contrast due to an elevated creatinine . Ct showed a 6 cm fungating mass at the left posterior wall of the bladder extending to the left ureteral orifice and left hydronephrosis . No abnormal laboratory findings were noted except for a serum creatinine of 1.73 mg / dl . The patient was initially managed by left nephrostomy tube placement and subsequent transurethral resection of bladder tumor (turbt). During cystoscopy, multiple large masses originating from the left side of the trigone extending to the prostatic urethra and the right ureteric orifice were noted (figure 2). No attempt was made to obtain muscle bites secondary to the large volume of disease . Serum creatinine was 1.6 mg / dl following nephrostomy tube placement . The patient was counseled about the possibility for restaging turbt, rc, and urinary diversion by either ileal neobladder or ileal conduit . The patient then elected to undergo rc and ileal conduit urinary diversion as the patient had elevated serum creatinine and was reluctant to perform cic . Urothelial carcinoma of the bladder in the first three decades of life is extremely rare . Invasive disease and only 1.7% had high grade tumor . Since the vast majority of young patients with bca present with non muscle invasive low grade disease, these patients have lower progression and recurrence rates compared to older patients . This further suggested that the nature of bca in the younger population is different compared to elderly patients . On the otherhand, yossepowitch and dalbagni found no difference in grade or stage upon comparing 74 patients <40 years of age to 75 patients> 65 years of age . However, when focusing on only bca patients diagnosed in the first two decades of life, it is evident that these patients had a relatively indolent behaving bca . Nevertheless, aggressive bca has been reported in children a 31 month old and a 14 year old . Exposure to polycyclic aromatic hydrocarbons (pahs) is responsible for 10% to 15% of cases as a result of bladder carcinogenesis . Genetic predisposition to bca has been suggested by reports of multiple case families with bca . However, it is unclear whether it resulted from a genetic predisposition or common environmental exposure among family members . As in elderly patients, radical cystectomy is the curative intervention for patients with mibc, recurrent high grade superficial bca, and high grade t1 disease . Prostate and seminal vesicles sparing rc in addition to nerve sparing procedure can be a valuable option for those patients . Preservation of urinary continence by performing a nerve sparing procedure and orthotopic neobladder urinary diversion is preferred to attain a proper quality of life and body image . In our patient, ileal neobladder urinary diversion was not performed due to the patient's unwillingness to perform cic and the fear of chronic renal insufficiency considering the elevated baseline creatinine, (1.73) which remained elevated (1.6) following nephrostomy tube placement . This tendency is more pronounced in patients presenting in the first three decades of life and is likely to decrease with age . Quality of life and fertility preservation is particularly significant in young patients undergoing radical cystectomy and urinary diversion . Our case demonstrates a rare example of a high grade t2 transitional cell carcinoma in a 28 year male.
|
A number of diseases affect the biliary tree (cholangiopathies), though the pathological mechanisms involved and the anatomical level of the biliary tree affected vary . For example, small interlobular bile ducts are mainly affected by a th1-dominated microenvironment and cell - mediated immune response in pbc, while a th2-dominated microenvironment and increased numbers of regulatory t cells are the major features of igg4-related sclerosing cholangitis which affects mainly the extrahepatic bile ducts . Ischemic damage to the biliary tree is a serious complication in liver transplantations . In this special issue, cholangiopathy with respect to genetics, pathogenesis, and pathology will be discussed in detail . Herein, the anatomy and physiology of the biliary tree, basic injuries to biliary epithelial cells, basic forms of bile duct damage, and etiological classifications of cholangiopathy are reviewed . The former include the right and left hepatic ducts and their confluence and the common hepatic and bile ducts, while the latter include the bile ducts proximal to the right or left hepatic duct . The intrahepatic branching of the bile ducts is best visualized on a cholangiograph or biliary injection cast (figures 1 and 2). The extrahepatic bile duct is lined by high columnar epithelial cells, and its wall is composed of dense collagenous tissue harboring scattered smooth muscular elements . The intrahepatic bile ducts can be classified as large and small, though there is no sharp delineation of the various segments [1, 5]. The large type consists of the right and left hepatic bile ducts and their first to third branches (segmental and area bile ducts). They are lined by a tall columnar epithelium and surrounded by a dense hypocellular collagenous duct wall . In contrast, small intrahepatic bile ducts, the branches of the large intrahepatic bile duct, are classified into septal and interlobular bile ducts which are visible only under a microscope . While the septal ducts (> 100 m in diameter) are lined by tall columnar cells with basal nuclei, the interlobular bile ducts are lined by cuboidal cells . The fibrous ductal wall is evident in the former like large intrahepatic ducts, but not in the latter . The interlobular bile ducts are connected to the bile canalicular network by ductules (<20 m diameter) lined by no more than a few minimally differentiated cuboidal cells and the canals of hering, which are lined partly by biliary epithelium and partly by hepatocytes . Bile ductules are very reactive anatomical elements in the liver, and proliferating bile ductules are reportedly involved in the fibrous progression of various chronic liver diseases and are easily identifiable by immunostaining of biliary cytokeratin (ck 7 and 19). Peribiliary glands, the third biliary component, are present within the fibromuscular walls of extrahepatic bile ducts and also along the large intrahepatic bile ducts [1, 5, 7]. Peribiliary glands around the large intrahepatic bile ducts (figure 3) are subdivided into intramural glands, nonbranching tubular glands, and extramural ramified glands . The latter lie in the periductal connective tissue and, in a three - dimensional model, have a linear distribution along the opposite sides of the bile ducts and indirectly drain into the bile duct lumen via their own conduit . Pancreatic acini without langerhans' islets are found intermingled with peribiliary glandular acini and are probably an intrinsic component of these glands . The extrahepatic stem cell niches are the peribiliary glands deep within the walls of the bile duct [6, 8]. The individual anatomical components of the biliary tree each have a rather characteristic antigen, probably reflecting a site - specific function [9, 10]. For example, the becs lining large bile ducts are columnar and mucus is detectable in the supranuclear cytoplasm, but mucin is not detectable in the interlobular bile ducts and bile ductules . In contrast, in the adult liver, the becs of intrahepatic large bile ducts constantly express muc3, a membrane - binding type, whereas those of small bile ducts do not . Muc6 is constantly and focally expressed in becs in the intrahepatic large bile ducts in normal liver . The expression of muc1, muc2, and muc5 was infrequent in normal livers but increased in hepatolithiasis . This study disclosed that the normal biliary tree has a specific expression of blood group antigens at different levels and that this expression is altered under pathologic conditions . In normal livers, large and septal bile ducts expressed a and b antigens in patients with comparable blood groups and also expressed h antigen frequently in patients with blood group o, a, or b and infrequently in patients with type ab . Lea and leb are expressed in becs at any level in secretors . As for cytokeratin, ck7 and ck19 are expressed in becs of the biliary tree and also in peribiliary glands, while epcam is expressed in bile ductules . The intrahepatic and extrahepatic biliary tract is supplied by a network of fine vessels called the peribiliary vascular plexus (pbp) which exclusively derives from hepatic arterial branches [1113]. The pvp can be histologically divided into the inner, intermediate, and outer layers, with respect to the bile duct walls . These three layers are well and poorly developed in the large intrahepatic bile ducts and septal bile ducts, respectively, although the pbp around the interloblar bile ducts and bile ductules consists of scattered capillaries with no discernible layers . This plexus has a fern - like appearance around the bile duct under the scanning electron microscope . The pbp drains into the sinusoids through radicular portal veins or communicates with portal venous branches through internal roots or directly into the hepatic sinusoids in animals and probably in humans . The inner layer, a layer of capillaries, is found just beneath the basement membrane of the epithelial layer and is regularly distributed like a chain . Ultrastructurally, the inner capillary layers are composed of fenestrated endothelial cells, and the number of fenestrae with a thin diaphragm is rather high on the capillary side facing the bile duct epithelium . These observations suggest that the pbp, particularly the inner layer, may participate in the physiology of the bile ducts, particularly in the exchange of substances between blood in the peribiliary vascular plexus and bile in the bile ducts and in the supply and drainage of substances to and from the biliary epithelia . The biliary tree is lined by specialized epithelial cells called becs or cholangiocytes and is not only a conduit of bile secreted by hepatocytes and cholangiocytes but also a conduit of the peribiliary glands . The bile ducts and peribiliary glands play a number of physiological roles in the biliary system, contributing to about one - third of total bile secretion, participating in bile acid and water reabsorption, and secretion via transporters, and also mediating immune responses including innate immunity . The primary hepatic bile secreted by hepatocytes is modified by becs via a series of secretory and absorptive processes that provide additional bile water (becs secrete ~40% of daily bile production in humans) or secrete hco3 to induce an alkakine state . Becs also interact with the immune system and microorganisms and are also involved in drug metabolism . To accomplish these functions, becs display morphological and functional heterogeneity along the biliary tree . The biliary tree is essentially sterile under normal conditions, but bile is potentially contaminated by bacterial components such as pathogen - associated molecular patterns (pamps) including lipopolysaccharide (lps) and bacterial dna originating from intestinal flora, which are actually detectable in bile of patients with chronic inflammatory biliary diseases . In this context, the biliary tract is equipped with defence mechanisms, which are physical (bile flow and biliary mucus), chemical (bile salts), and immunological, such as secretory iga . Becs also express toll - like receptors (tlr) and intracellular adaptor molecules and secrete antibiotic peptides and (pro)inflammatory cytokines, thereby participating in the defense of the bile ducts . Nonspecific bactericidal enzymes such as lactoferrin and lysozyme are also detected in the intrahepatic biliary tree, peribiliary glands, and bile . Human -defensins (hbds) and cathelicidin, another antimicrobial peptide contributing to innate immunity at mucosal surfaces, are expressed in the biliary tree . Is constitutively expressed in the biliary epithelium, while hbd-2 is expressed in large intrahepatic bile ducts in extrahepatic biliary obstruction, hepatolithiasis, and, to a lesser degree, pbc and psc, suggesting a response to local infection or bacterial components, cytokines such as il-1 and tnf-, and/or active inflammation . Trefoil factor family (tff) 1, 2, and 3 peptides expressed at the apical surface of the epithelium play a major role in mucosal repair . Iga is known to be secreted into bile by binding with the secretory component (sc), and secretory iga (siga) functions in a number of ways to protect the biliary tract . Biliary intraepithelial lymphocytes (biels), which are markedly increased in immune - mediated cholangitis, are occasionally encountered in normal intrahepatic bile ducts . Most of them are positive for cd8, some are positive for cd57, and these cells may participate in biliary innate immunity . Several pathologic agents and stress affect the intrahepatic and extrahepatic biliary tree including viral, bacterial, and even parasitic infections, oxidative stress, and immunological assaults, as well as biliary epithelial injuries from necrosis, apoptosis, and hyperplasia, and also bile duct damages . In some biliary diseases such as primary biliary cirrhosis (pbc) and chronic ductopenic allograft rejection, the ongoing apoptosis of becs is important for progressive bile duct loss . In h&e stained sections, eosinophilic, shrunken slender cells with pyknotic nuclei in the biliary epithelial layer and fragmented and condensed nuclei in the bile duct lumen can be regarded as apoptotic bodies [2, 15]. Electron microscopically, shrunken becs with a condensed cytoplasm and pyknotic nuclei are a marker of apoptosis . Apoptosis of becs can be confirmed using in situ nick - end labelling and immunostaining of single stranded dna, both of which detect dna fragmentation . In contrast, the coagulative or lytic necrosis of the biliary epithelium is occasionally encountered in toxic cholangiopathy . Senescent becs show characteristic features such as an eosinophilic cytoplasm, cellular and nuclear enlargement, multinucleation, and an irregular arrangement with uneven nuclear spacing . Actually, these cells also express cellular senescent markers such as the cell cycle regulators, p16 and p21, and increased activity of senescence - associated -galactosidase (sa--gal). Recent studies showed that cellular senescence has at least two pathological effects in the development of biliary diseases: impaired regeneration and senescence - associated secretory phenotypes (sasps). Impaired regenerationsenescent cells no longer have the ability to proliferate and they are irreversibly arrested at the g1 phase of the cell cycle . The expression of senescence - related markers is increased in becs during early chronic rejection in chronic liver allograft and pbc . Cellular senescence of becs is involved in impaired regeneration and eventual and progressive bile duct loss in pbc and ductopenic chronic rejection [21, 22]. A relatively insufficient proliferative response of becs due to cellular senescence (see below) is also responsible for the progressive loss of bile ducts due to apoptosis . Senescent cells no longer have the ability to proliferate and they are irreversibly arrested at the g1 phase of the cell cycle . The expression of senescence - related markers is increased in becs during early chronic rejection in chronic liver allograft and pbc . Cellular senescence of becs is involved in impaired regeneration and eventual and progressive bile duct loss in pbc and ductopenic chronic rejection [21, 22]. A relatively insufficient proliferative response of becs due to cellular senescence (see below) is also responsible for the progressive loss of bile ducts due to apoptosis . Senescence - associated secretory phenotypesaccumulating evidence suggests that senescent cells remain metabolically active and play an important role in modulating the microenvironment around them by secreting cytokines, chemokines, growth factors, and profibrogenic factors . For example, senescent becs of pbc expressing ccl2 and cx3cl1 may be involved in the recruitment of monocytes and possibly t lymphocytes into portal tracts, around injured and senescent becs, and thereby responsible for the development of immune - mediated cholangitis such as pbc [19, 23]. Accumulating evidence suggests that senescent cells remain metabolically active and play an important role in modulating the microenvironment around them by secreting cytokines, chemokines, growth factors, and profibrogenic factors . For example, senescent becs of pbc expressing ccl2 and cx3cl1 may be involved in the recruitment of monocytes and possibly t lymphocytes into portal tracts, around injured and senescent becs, and thereby responsible for the development of immune - mediated cholangitis such as pbc [19, 23]. The homeostasis of physiological and pathological biliary epithelia operates through a balance between cell loss and cell renewal . Cell loss in the biliary epithelium is mainly due to apoptosis or senescence and mostly regulated by the bcl-2 family of proteins or senescence - associated factors such as p16 and p21 . The biliary epithelial cells of bile ductules or small bile ducts may be replenished by bile ductular cells or hepatic progenitor cells in the canal of hering, though such processes may be unlikely in the intrahepatic large bile ducts . As mentioned, the peribiliary glands themselves or progenitor cells located in these glands may be involved in renewal of the biliary epithelium of intrahepatic large bile ducts and extrahepatic bile ducts and also proliferation of the epithelia lining these bile ducts [7, 8]. Inhibition of the apoptotic or senescent process in the biliary epithelia may cause hyperplasia with an increased risk of neoplastic transformation . Hyperplasia of lining epithelia of the septal and large bile ducts manifests as micropapillary projections or as a stratification of the epithelium with or without dilatation of the duct lumen . Peribiliary glands, intramural or extramural, also show hyperplasia and proliferation and participate in the secretion of neutral, carboxylated, and sulphated mucins into the bile duct lumen . When prominent, in particular with clonorchis sinensis infections or hepatolithiasis, the term adenomatous hyperplasia or chronic proliferative cholangitis has been used . As for the proliferation and hyperplasia of bile ductules and small interlobular bile ducts, they appear tourtous and increase in their number in the portal tracts . Some of these lesions are included in the so - called ductular reactions . Several kinds of metaplasia are reported in the biliary epithelium of the intra- and extrahepatic biliary tree, usually in cases of chronic biliary diseases such as hepatolithiasis, parasitic cholangitis, and primary sclerosing cholangitis (psc). Gastrointestinal metaplasia resembling pyloric glands and goblet cells is not infrequently seen in chronically inflamed large bile ducts and peribiliary glands . This change is associated with the aberrant expression of gastric type mucus core protein (muc) 5ac and muc6 and also intestinal type muc2 . The so - called intramural glands with a gastric pyloric gland - like appearance are increased in long - standing biliary diseases and may reflect invagination of the biliary epithelium with gastrointestinal metaplasia . Goblet cells are occasionally encountered among bile duct - lining cells and also in peribiliary glands . The expression of other molecules in intrahepatic large bile ducts, such as reg i and trefoil factors, appears to be related to intestinal or gastric metaplasia . While pancreatic acinar metaplasia is also reported infrequently in psc, its differentiation from heterotopic pancreatic acini is controversial . Hepatocytic metaplasia occurs in interlobular bile ducts and bile ductules in various pathological situations but remains of unknown significance . Squamous metaplasia is rarely encountered in long - standing inflammation of large bile ducts such as psc or in the lining of biliary cysts . Chronic biliary diseases such as hepatolithiasis and psc are occasionally complicated by cholangiocarcinoma . In such cases, dysplastic or early such biliary epithelial lesions are known as dysplasia or atypical hyperplasia of the biliary epithelium and characterized by atypical, enlarged, and hyperchromatic nuclei, an increased nucleocytoplasmic ratio, and a loss of polarity [5, 26]. Usually either micropapillary or flat lesions affect a portion or the circumference of the bile duct . These lesions were proposed to be called biliary intraepithelial neoplasm (bilin), and this terminology was recently adopted by who . They are divided into three grades according to cellular and structural atypia; bilin-1, bilin -2, and bilin -3 . In bilin-1, cellular / nuclear atypia are mild or moderate but not enough for overt malignancy, and cellular polarity is minimally disturbed and corresponding to low - grade dysplasia . In bilin-2, cellular / nuclear atypia are evident but not marked enough for overt malignancy, and the disturbance of cellular polarity is mild or focal, corresponding to high - grade dysplasia . Blin-3 shows cellular / nuclear atypia corresponding to overt malignancy, and cellular polarity is diffusely disturbed, corresponding to a so - called carcinoma in situ of the biliary tract . Bilin-1, bilin -2, and bilin -3 are seen in both large intrahepatic and extrahepatic bile ducts, peribiliary glands, and gallbladder and considered to reflect a multistep neoplastic transformation of the biliary epithelium . In the biliary tree, there are several types of bile duct damage such as cholangiopathies and cholangitis . It occurs along the biliary tree, and the term cholangitis is used for inflammatory damage to bile ductules . Suppurative cholangitis implies the presence of numerous polymorphonuclear cells around and within the wall as well as within the lumen of the ducts . This may involve ducts of any size and is occasionally associated with abscess formation cholangitic abscess . A microbial infection is often responsible, but the change also occurs in the presence of sterile bile, particularly after bile extravasation . The release of chemokines or cytokines is the likely cause in some cases . Nonsuppurative cholangitis includes a spectrum of bile duct inflammation which may be granulomatous cholangitis, lymphoid cholangitis, fibrous cholangitis, and pleomorphic cholangitis according to the predominant type of inflammatory reaction present . This type involving the interlobular bile ducts constitutes the hallmark of pbc and is also found in drug - induced liver disease and sarcoidosis . Lymphoid cholangitis refers to a close association between duct branches, usually interlobular bile ducts, and lymphocytic aggregates, which may show a follicular arrangement . This is found in pbc and psc with concomitant bile duct destruction or in nonbiliary disorders, in particular autoimmune and viral hepatitis c. pleomorphic cholangitis is associated with inflammatory cell infiltration . All other types of cholangitis are found in cah, pbc, psc, and other liver diseases . Fibrous cholangitis (also called sclerosing cholangitis) with evident ductal fibrosis develops as a consequence of long - standing bile duct inflammatory, obstruction, or ischemic injury; it can be obliterative or nonobliterative . The former is characteristic of psc, though, in our experience, it may be seen in acquired forms of sclerosing cholangitis too . Becs of obliterative type are actually lost in fibrous lesions, appearing as a fibrous core . Sclerosing cholangitis with bile duct obliteration suggests a diagnosis of psc in adults . In long - standing sclerosing cholangitis and also in other biliary diseases such as ischemic cholangitis, the bile duct wall shows a marked deposition of collagen fiber (bile duct sclerosis). The affected bile ducts in sclerosing cholangitis show a marked increase in the number of c - kit receptor - expressing mast cells which secrete fibrogenic factors such as histamine, basic fibroblast growth factor (bfgf), and/or tumour necrosis factor - alpha (tnf-). The biliary epithelium itself produces and secretes fibrogenic substances such as bfgf, transforming growth factor - beta (tgf-), and platelet - derived growth factor (pdgf), as well as basement membrane proteins and extracellular matrix proteins . In biliary atresia, becs of the affected bile ducts variably express mesenchymal markers such as vimentin and might have acquired phenotypes of mesenchymal cells, though distinct morphological epithelial mesenchymal transition (emt) of biliary epithelium is hardly recognizable [28, 29]. In all forms of bile duct sclerosis, a marked attenuation of the peribiliary vascular plexus is seen within the sclerotic duct wall, but it remains unknown whether these changes are secondary to, or responsible for, the bile duct fibrosis . The balance of cell death or dropout due to apoptosis or necrosis and the regeneration of lining biliary epithelia is important for the maintenance of bile ducts, and apoptotic activity that exceeds the proliferative response of bile duct cells results in progressive ductopenia . Ductopenia is defined as a loss of bile ducts from the portal tract in which hepatic arterial branches and bile ducts of similar size run parallel . Thus, portal tracts without evident bile ducts indicate a loss of bile ducts . Immunostaining of biliary cytokeratins such as ck7 and ck19 is helpful for the recognition of bile ducts . Ductopenia is usually defined as the absence of interlobular bile ducts in at least 50% of portal tracts . Ductopenia is typically found during chronic liver allograft rejection with chronic cholestasis and also the advanced stages of pbc . Mucin is impacted in the duct lumen and this is occasionally marked, leading to leakage and extravasation with the formation of mucus lakes . Drainage of mucin from papilla of vater is also a clinical manifestation of mucobilia, as seen in intraductal papillary mucinous neoplasms of the pancreas . Mucobilia is usually found in the neoplastic bile ducts and nonneoplastic bile ducts of intraductal papillary neoplasms of the bile duct (formerly known as biliary papillomatosis) or mucin - producing bile duct tumors [26, 30]. When such changes are encountered in nonneoplastic biliary diseases such as psc and hepatolithiasis, usually microscopic neoplastic biliary lesions are found in the affected bile ducts . In cases of hemobilia, impacted erythrocytes recent endoscopic or surgical biliary manipulations in association with a primary or secondary malignancy may be underlining diseases for hemobilia . To date, many pathological terms such as oval cell proliferation, intermediate cells, and atypical bile ductular proliferation have been used to describe the increased ductule - like cells or clusters of small epithelial cells different from mature hepatocytes in the portal tract or the periportal area . This is a reaction of the ductular phenotype, possibly but not necessarily of ductular origin, commonly seen in many kinds of acute and chronic hepatobiliary diseases . Recently, an international working group proposed the term ductular reaction for this lesion . Ductular reaction implies a reaction of ductular phenotype, possibly but not necessarily of ductular origin . The epithelial component of a ductular reaction may actually derive from several sources: not only from the proximal branches of the biliary tree but also from the circulation (often if not always from bone marrow) and from biliary metaplasia of hepatocytes . Reaction encompasses the complex of stroma, inflammatory cells, and other structures of diverse systems, all of which participate in the reactive lesion . Bile ductular reaction is usually characterized by increased numbers in the periportal and portal areas and a common and frequent process in a number of hepatobiliary diseases . There are several reports that bile ductules are very reactive anatomical elements in the liver, and proliferated bile ductules are involved in the progression of various chronic liver diseases . Our recent studies showed that bile ductular cells in pbc, psc, and also nafld may undergo cellular senescence, and these cells could produce and secrete biologically active molecules and thereby be involved in hepatic fibrogenesis and other pathologic features of the liver . Ductal plate malformations (dpms), which are different from reactive changes of bile ducts or ductules, develop as a result of a remodeling failure of the ductal plate followed by the development of intrahepatic bile ducts . Dpms are characterized by increased numbers of abnormal bile duct - like structures and show a bridge - like structure in the dilated lumen and bulbar protrusion of biliary epithelia . Dpms are observed in congenital hepatic fibrosis and caroli's disease, biliary atresia, and other fibropolycystic liver diseases . Diseases that mainly target the biliary tree (cholangiopathies) can be divided into several categories according to the pathogenetic mechanism involved (table 1). However, in many cholangiopathies, more than one pathogenetic mechanism is operative . The biliary tree could be affected by immunological assaults, and lymphoplasmacytic infiltration is evident around the damaged bile ducts . Primary biliary cirrhosis (pbc) and primary sclerosing cholangitis (psc) are representative immune - mediated cholangiopathies . There is a mixture of immunocompetent cells in the affected bile ducts, and cd3 +, cd4 +, and cd8 + t cells that bear the t - cell receptor / are predominant in pbc, supporting that th1 immune response - predominant cytotoxicity and/or cytokine release are involved in the pathogenesis of the bile duct lesions of pbc . Hla - class ii antigens are aberrantly expressed in the affected bile ducts of pbc, psc, and chronic allograft rejection . Biliary innate immunity is also involved in the pathogenesis of cholangiopathies in patients with pbc and biliary atresia (ba). Becs possess an innate immune system consisting of the toll - like receptor (tlr) family and recognize pathogen - associated molecular patterns (pamps). In pbc, cd4-positive th17 cells characterized by the secretion of il-17 are implicated in the chronic inflammation of bile ducts, and the presence of th17 cells around bile ducts is causally associated with the biliary innate immune responses to pamps . In ba characterized by a progressive, inflammatory, and sclerosing cholangiopathy, dsrna viruses are speculated to be an etiological agent and to directly induce enhanced biliary apoptosis via the expression of tumor necrosis factor - related apoptosis - inducing ligand (trail). Moreover, the epithelial - mesenchymal transition (emt) of biliary epithelial cells is also evoked by the biliary innate immune response to dsrna . In addition, intrahepatic small bile ducts and bile ductules are a main target in graft - versus - host disease and also hepatic allograft rejection . Upregulation of regulatory t cells (tregs) associated with th2 predominance is reportedly important in the pathogenesis of igg4-related sclerosing cholangitis . The anatomical level of the biliary tree affected is different among these immune - mediated cholangiopathies . Interestingly, the peribiliary glands are also involved in psc, graft - versus - host disease, and igg4-related sclerosing cholangitis . The biliary tree is affected by several types of infectious diseases, such as bacterial, fungal, protozoan, parasitic, and viral cholangitis . Stagnation of bile due to biliary stenosis or obliteration is followed by bacterial cholangitis, frequently with sepsis or abscess formation . Parasitic infections are also reported in the biliary tract including the liver, and liver flukes such as clonorchis sinensis and opisthorchis viverrini are endemic in east asia, particularly northern thailand and some parts of korea, and cholangiocarcinoma is a serious complication of parasitic cholangitis . Hepatolithiasis is predominantly a disease of the far east and is causally also related to infectious cholangitis, especially bacterial cholangitis [27, 34]. Mucin plays an important role in the development of hepatoliths, which are formed within the intrahepatic large bile ducts . Clinically, patients may present acutely with recurrent bacterial cholangitis and its possible complications, such as liver abscesses and septicemic shock, or with chronic complications, such as cholangiocarcinomas and intraductal papillary neoplasms . Pathologically, it is characterized by pigmented calcium bilirubinate stones within dilated intrahepatic bile ducts featuring chronic inflammation, mural fibrosis, and proliferation of peribiliary glands, without extrahepatic biliary obstruction . A transient viral infection such as type a rhesus rotavirus and type 3 reovirus is reported as an initiating mechanism of biliary atresia (ba), particularly perinatal type . Genetic alterations affecting the biliary tree manifest as biliary dilatation, bile duct paucity, obstruction, proliferation, stone formation, and so on . Caroli's disease with congenital hepatic fibrosis (chf) is a representative genetic cholangiopathy . Caroli's disease with chf belongs to autosomal recessive polycystic kidney disease (arpkd) with ductal plate malformation characterized by a disordered remodeling of the intrahepatic biliary tree . Disordered cell kinetics, including the apoptosis of biliary epithelial cells (becs), may be significantly related to ductal plate malformation, and laminin and type iv collagen levels were reduced in the basement membrane of intrahepatic bile ducts of arpkd; such a reduction is an additional factor for the dilatation of bile ducts . For example, alagille syndrome with a mutation in a ligand for the notch protein is characterized by paucity of intrahepatic bile ducts and other anomalies . Cystic fibrosis (cf) due to a mutation in the cystic fibrosis transmembrane conductance regulator (cftr) is associated with focal biliary fibrosis, and the bile duct and ductules are filled with pink and amorphous secretions . Low phospholipid - associated cholelithiasis (lpac) is characterized by a low biliary phospholipid concentration with symptomatic and recurring cholelithiasis, and lpac syndrome is associated with mutations of the adenosine triphosphate - binding cassette, subfamily b, member 4 (abcb4) gene encoding the hepatobiliary phospholipid translocator multidrug resistance protein 3 . This causes recurrent cholelithiasis, continuous irritations of the biliary tract with cholangitis, chronic cholestasis, and even biliary cirrhosis . Ischemic cholangiopathy is defined as focal or extensive damage to bile ducts due to an impaired blood supply . Most causes of bile duct ischemia are iatrogenic, though some systemic vascular diseases also cause this type of cholangiopathy . This entity may be observed in various circumstances and is of clinical importance for practitioners involved in gastroenterology, oncology, abdominal surgery, and liver transplantation . Ischemic bile duct injury may occur when small hepatic arteries or the peribiliary vascular plexus are injured or when all possible sources of arterial blood supply are interrupted . Ischemic biliary injury may take the form of bile duct necrosis, bile leakage, biloma, bile duct fibrosis, or stenosis . Bile duct necrosis and bilomas develop predominantly where there is an abrupt and complete interruption of the arterial blood supply, for example, when ha thrombose in a liver transplant recipient . On the contrary, fibrous stenoses develop where there is progressive injury to the hepatic arterioles, for example, after several courses of intra - arterial chemotherapy . When biliary drainage or reconstruction is not possible or has failed, liver transplantation is the only potential cure . Bile ducts, particularly interlobular bile ducts, are occasionally affected by drug - induced hepatobiliary damage, various bile duct injuries, various types of cholangitis, and bile duct loss (drug - induced cholangiopathy). This type of cholangitis is not infrequently associated with cholestasis . Some cases presenting with progressive ductopenia and cholangitis and prolonged cholestasis mimic pbc and also psc . While the mechanism of drug - induced cholangitis remains speculative, immune - mediated processes including hypersensitivity may be operative . Some forms of drug - induced cholangiopathy develop after hepatic arterial infusion of floxuridine (fudr) (floxuridine- (fudr-) induced cholangiopathy). Ischemic changes to the peribiliary vascular plexus may be at least partly involved in this type of cholangiopathy . Although becs have low metabolic activity compared with hepatocytes, cytotoxic or cytopathic bile duct injury has been produced experimentally or accidentally by toxic substances such as -naphthylisothiocyanate, 4,4-diaminodiphenylmethane, and paraquat (toxin - induced cholangiopathy). In conclusion, the anatomy and physiology of the biliary tree, basic injuries to biliary epithelial cells, basic forms of bile duct damage, and etiological classification of cholangiopathy were reviewed.
|
We used protein sequences from the swiss - prot database release 45.0 (http://www.ebi.ac.uk/swissprot) for training and testing purposes in this study . To obtain high - quality datasets, we filtered the data as follows: (1) include sequences only from the animal species that have experimentally derived annotations for subcellular localization . (2) remove sequences with ambiguous and uncertain annotations, such as by similarity, potential, probable, possible, and so on . (3) remove sequences known to exist in more than one subcellular localization, such as those that shuttle between the cytoplasm and the nucleus . These localizations include (the number of sequences are shown in parentheses): cyt - cytoplasm (2,673), end - endoplasmic reticulmn (794), exc - extracellular / secretory compartment (7,077), gol - golgi complex (253), lys - lysosome (179), mit - mitochondrion (2,019), nuc - nucleus (4,112), pla - plasma membrane (5,273), and pox - peroxisome (185). From these datasets, we separated a subset of 3,749 proteins belonging to human . Three classes of features of amino acid sequences were used in the current study, including composition, transition, and distribution . Composition is a reference to the proportions of amino acid types contributing to the protein sequence . Transition represents the frequency with which specific amino acid types are followed or preceded by other amino acid types within the sequence . Distribution captures the dissemination of specific amino acid types within specific portions of the sequence (or the entire sequence). These feature types have been used in previous ml algorithms to characterize amino acid sequences based on hydrophobicity, nvwv, polarity, polarizability, and charge (table 1). Based on numerical attributes characterizing amino acid composition, transition, and distribution along with the categories just outlined (table 1), a common lisp algorithm (33) was used to generate a vector of size 125 for each protein . A matrix consisting of a vector of each of the proteins (figure 6b) was thus generated and used as a training set for ml (32). Based on the data, predictive classifications (based on instances derived from the training set alone as well as the training set in conjunction with ten - fold cross validations) were made by using j48, svm, mlp, and nb classifier . The mp algorithm (25) was used along with boxplots (35) in these studies to help establish effects . The mp procedure fits an additive model: response variable = common value+row effect+column effect+residualwhere the common value is constant throughout the table; the row effect is constant by rows; the column effect is constant by columns; and the residuals or remaining effects represent departures of each data array element from the purely additive model . Mp works iteratively on a data table, alternatively finding and subtracting column medians and row medians until all columns and rows have zero medians . The residuals, row effects, or column effects may then be illustrated graphically by the way of a stem - and - leaf display or boxplot . Boxplots depict the distribution s central tendency (median), spread (fourth - spread), skewness (based on the relative positions of the median, lower fourth, and upper fourth), tail length, as well as outliers . The r language (http://www.r-project.org/) statistical environment was used to implement the eda aspects of the study . Furthermore, for each subcellular compartment, boxplots (36) were generated for each amino acid category and feature . Gka conducted the machine learning and exploratory data analysis experiments and co - wrote the draft manuscript . Sml conceived the original idea of using this approach of protein characterization, wrote the initial code implementing it and wrote portions of the manuscript . Cg collected the dataset used for the experiments, wrote the code for cleaning up the data to render them useful for the experiments, co - wrote and edited the various drafts of the manuscript . We used protein sequences from the swiss - prot database release 45.0 (http://www.ebi.ac.uk/swissprot) for training and testing purposes in this study . To obtain high - quality datasets, we filtered the data as follows: (1) include sequences only from the animal species that have experimentally derived annotations for subcellular localization . (2) remove sequences with ambiguous and uncertain annotations, such as by similarity, potential, probable, possible, and so on . (3) remove sequences known to exist in more than one subcellular localization, such as those that shuttle between the cytoplasm and the nucleus . These localizations include (the number of sequences are shown in parentheses): cyt - cytoplasm (2,673), end - endoplasmic reticulmn (794), exc - extracellular / secretory compartment (7,077), gol - golgi complex (253), lys - lysosome (179), mit - mitochondrion (2,019), nuc - nucleus (4,112), pla - plasma membrane (5,273), and pox - peroxisome (185). From these datasets, we separated a subset of 3,749 proteins belonging to human . Three classes of features of amino acid sequences were used in the current study, including composition, transition, and distribution . Composition is a reference to the proportions of amino acid types contributing to the protein sequence . Transition represents the frequency with which specific amino acid types are followed or preceded by other amino acid types within the sequence . Distribution captures the dissemination of specific amino acid types within specific portions of the sequence (or the entire sequence). These feature types have been used in previous ml algorithms to characterize amino acid sequences based on hydrophobicity, nvwv, polarity, polarizability, and charge (table 1). Based on numerical attributes characterizing amino acid composition, transition, and distribution along with the categories just outlined (table 1), a common lisp algorithm (33) was used to generate a vector of size 125 for each protein . The breakdown of the elements of each vector is outlined as in figure 6a . A matrix consisting of a vector of each of the proteins (figure 6b) was thus generated and used as a training set for ml (32). Based on the data, predictive classifications (based on instances derived from the training set alone as well as the training set in conjunction with ten - fold cross validations) were made by using j48, svm, mlp, and nb classifier . Was used along with boxplots (35) in these studies to help establish effects . The mp procedure fits an additive model: response variable = common value+row effect+column effect+residualwhere the common value is constant throughout the table; the row effect is constant by rows; the column effect is constant by columns; and the residuals or remaining effects represent departures of each data array element from the purely additive model . The residuals, row effects, or column effects may then be illustrated graphically by the way of a stem - and - leaf display or boxplot . Boxplots depict the distribution s central tendency (median), spread (fourth - spread), skewness (based on the relative positions of the median, lower fourth, and upper fourth), tail length, as well as outliers . The r language (http://www.r-project.org/) statistical environment was used to implement the eda aspects of the study . Furthermore, for each subcellular compartment, boxplots (36) were generated for each amino acid category and feature . Gka conducted the machine learning and exploratory data analysis experiments and co - wrote the draft manuscript . Sml conceived the original idea of using this approach of protein characterization, wrote the initial code implementing it and wrote portions of the manuscript . Cg collected the dataset used for the experiments, wrote the code for cleaning up the data to render them useful for the experiments, co - wrote and edited the various drafts of the manuscript.
|
Netrin family proteins play essential roles in the development of the axonal pathway and neuronal migration during embryonic development of the vertebrate nervous system (1 - 3). The commissural neurons in the embryonic spinal cord project their axons to the ventral side of the spinal cord, and cross midline to give rise to commissural axons (4). They attract the developing commissural axons (4, 5), and the commissural neurons express the netrin receptor, deleted in colorectal cancer (dcc) (6). Dcc is the receptor that signals a chemoattractive response to netrin (6, 7). Thus, netrin is a bifunctional molecule, and some of the repulsive actions of netrin appear to be mediated by other receptors, namely, the unc5h family of receptors (9, 10). Thus far, four members of the unc5h family, unc5h1 - 4, have been reported (11, 12). It was recently reported that netrin and its receptors are expressed in the adult nervous system (12 - 14). For example, the neuronal and non - neuronal cells in the adult spinal cord express both netrin and the receptors, that is, dcc and unc5h (12, 14). In addition, netrin and the netrin receptors continue to be expressed in the adult optic nerve and retina (15). Although the expression of netrin and its receptors in the adult nervous system indicates that netrin is possibly involved in the function of adult neurons, it remains uncertain whether netrin has any functions in the axonal growth, particularly in the regenerative growth, of mature neurons . Here we observed that the adult dorsal root ganglion (drg) expresses mrnas of three members of the unc5h family and that netrin has an inhibitory effect on the regenerative axonal growth of cultured drg neurons . For explant cultures, lumbar drgs were removed from 40 - 50 days old male sprague - dawley rats . The rats were used after our college ethics committee approved the protocol, stating that it fulfilled the animal care guidelines established by the korean academy of medical sciences . After the dissection of a drg into 3 - 4 explants under a stereomicroscope, the explants were cultured in matrigel (bd bioscience, san jose, ca, u.s.a .) In dulbecco's modified eagle's medium (invitrogen, carlsbad, ca, u.s.a .) Supplemented with 10% fetal bovine serum (invitrogen). Recombinant netrin-1 (500 ng / ml, r&d systems, minneapolis, mn, usa) was treated for 36 - 48 hr . After fixation with 4% paraformaldehyde (pfa), the axons were stained with anti--tubulin (tuj1) antibody (1/2,000, covance, irvine, ca, u.s.a .) As previously described (16). Alexa 488-conjugated anti - mouse igg (1/800, promega, madison, wi, u.s.a .) Was used as the secondary antibody . The fluorescent signals were examined under a laser scanning confocal microscope (carl zeiss, hamburg, germany), and the signals were analyzed using the ks 400 image system (carl zeiss). Quantification of the axon projections from the drg explants was carried out; the number of explants (n) in each group in an experiment was 25 - 30 . They were graded from 0 - 3: no axons, 0; axons growing in a pole of the explant, 1; axons growing at more than one area or throughout the explants, 2; and greater axonal outgrowth (usually greater than 1/2 of the explant length) throughout the explants, 3 . Dissociated neuronal cultures with drgs were established using a standard protocol (17). In brief, l3-l5 drgs from adult rats were dissected and transferred into ca- and mg - free hank's buffered salt solution (cmf - hbss) containing gentamycin (10 g / ml). Enzymatic digestion of the drgs was initiated by the addition of 0.125% collagenase type i (sigma, st . Louis, mo, u.s.a .) Diluted in cmf - hbss, and incubating them at 37. after 30 min, the drgs were incubated in 0.25% trypsin for 25 min at 37. after enzymatic digestion, the cells were dissociated by mechanical trituration through a fire - polished glass pipette . The cells (2000 per well) were plated into one well per eight - well plate (labtek, nunc, rochester, ny, u.s.a .) Coated with poly - l - lysine (500 g / ml), and cultured for 36 - 40 hr in the presence or absence of netrin-1 . The neurites were quantified after immunostaining of the neurons with an anti--tubulin antibody . A cell with neurites longer than the cell body diameter was defined as a neurite bearing cell, and the number of such cells was counted . The length of the longest neurite in a group of randomly selected 180 - 200 neurons was measured using the lsm 510 image analysis program (carl zeiss). The neurite lengths between the groups were compared using the student's t - test . The mrna expression of dcc and unc5h1 - 4 was examined by rt - pcr . The total rna was isolated from adult spinal cords and drgs by using trizol reagent (invitrogen), according to the manufacturer's instruction . First - strand cdna was synthesized in 20 l reaction mixtures with 1 g of the total rna using the m - mulv reverse transcriptase (new england biolabs, ipswich, ma, u.s.a . ). Primers for amplification and the size of pcr products are as follows: dcc forward; 5'-aagaatggagatgtggtgattcc-3', dcc reverse; 5'-ccagttgtcaccctctctggag-3'(size of the pcr product: 325 bp), unc5h1 forward; 5'-caccaccactaccacctaccagg-3', unc5h1 reverse; 5'-cccgaggaagttgaagg tccc-3'(241 bp), unc5h2 forward; 5'-cgaccctaaaagccgcccc-3', unc5h2 reverse; 5'-gggatcttgtcggcagagtcc-3'(318 bp), unc5h3 forward; 5'-aggctg ctcctgactcagatg-3', unc5h3 reverse; 5'-gggtctagaattggagaattgg-3'(313 bp), unc5h4 forward; 5'-catagaggagcctgaagatg-3', unc5h4 reverse; 5'-acggaagctttcctactctt-3'(218 bp), rat gapdh forward; 5'-tgccgcctggagaaacctgc-3', rat gapdh reverse; 5'-tgagagcaatgccagc ccca-3'(172 bp). The pcr cycling consisted of an initial 5 min at 94, followed by (30 - 32) cycles of 60 sec at 94, 45 sec at 54 - 62, and 60 sec at 72, with a final incubation of 5 min at 72. the pcr products were visualized by ethidium bromide staining (1 g / ml), and the relative intensity (ri) index of the dna bands from three independent experiments was analyzed using a luminescent image analyzer (las-3000, fujifilm, tokyo, japan). The generation of unc5h1 and unc5h2 crna probes was performed using an in vitro transcription kit with digoxigenin-11-utp (roche diagnostics, nutley, nj, u.s.a . ). The plasmids containing the fragments of the unc5h1 and unc5h2 which had been generated by rt - pcr were used as templates for the in vitro transcription . For in situ hybridization, frozen drg sections from adult sprague - dawley rats (5 rats) were cut into 18 m thickness by using a cryostat (frygocut, leica, gallen, switzerland). The sections were then fixed in 4% pfa for 10 min, washed three times with phosphate - buffered saline (pbs), and finally acetylated for 10 min . After prehybridization, the sections were incubated with the hybridization buffer (50% formamide, 4ssc, 0.1% chaps, 5 mm edta, 0.1% tween-20, 1.25denhartdt's solution, 125 g / ml yeast trna, 50 g / ml heparin, and 200 ng of digoxigenin - labeled probes) for 18 hr at 57. the amount and size of the transcribed crna were estimated with rna gel electrophoresis . Non - specific hybridization was removed by washing in 2saline - sodium citrate buffer (ssc) for 10 min at room temperature and the treatment with rnase a (10 g / ml), followed by final washing with 0.1ssc at 57 for 15 min . For immunological detection of digoxigenin - labeled hybrids, the sections were incubated with anti - digoxigenin alkaline phosphatase (roche diagnostics, 1:1,500) for 1 hr, and the color reaction was developed using 4-nitroblue tetrazolium chloride (330 g / ml) and 5-bromo-4-chloro-3-indolyl phosphate (175 g / ml). For explant cultures, lumbar drgs were removed from 40 - 50 days old male sprague - dawley rats . The rats were used after our college ethics committee approved the protocol, stating that it fulfilled the animal care guidelines established by the korean academy of medical sciences . After the dissection of a drg into 3 - 4 explants under a stereomicroscope, the explants were cultured in matrigel (bd bioscience, san jose, ca, u.s.a .) In dulbecco's modified eagle's medium (invitrogen, carlsbad, ca, u.s.a .) Supplemented with 10% fetal bovine serum (invitrogen). Recombinant netrin-1 (500 ng / ml, r&d systems, minneapolis, mn, usa) was treated for 36 - 48 hr . After fixation with 4% paraformaldehyde (pfa), the axons were stained with anti--tubulin (tuj1) antibody (1/2,000, covance, irvine, ca, u.s.a .) As previously described (16). Alexa 488-conjugated anti - mouse igg (1/800, promega, madison, wi, u.s.a .) Was used as the secondary antibody . The fluorescent signals were examined under a laser scanning confocal microscope (carl zeiss, hamburg, germany), and the signals were analyzed using the ks 400 image system (carl zeiss). Quantification of the axon projections from the drg explants was carried out; the number of explants (n) in each group in an experiment was 25 - 30 . They were graded from 0 - 3: no axons, 0; axons growing in a pole of the explant, 1; axons growing at more than one area or throughout the explants, 2; and greater axonal outgrowth (usually greater than 1/2 of the explant length) throughout the explants, 3 . Dissociated neuronal cultures with drgs were established using a standard protocol (17). In brief, l3-l5 drgs from adult rats were dissected and transferred into ca- and mg - free hank's buffered salt solution (cmf - hbss) containing gentamycin (10 g / ml). Enzymatic digestion of the drgs was initiated by the addition of 0.125% collagenase type i (sigma, st . Louis, mo, u.s.a .) Diluted in cmf - hbss, and incubating them at 37. after 30 min, the drgs were incubated in 0.25% trypsin for 25 min at 37. after enzymatic digestion, the cells were dissociated by mechanical trituration through a fire - polished glass pipette . The cells (2000 per well) were plated into one well per eight - well plate (labtek, nunc, rochester, ny, u.s.a .) Coated with poly - l - lysine (500 g / ml), and cultured for 36 - 40 hr in the presence or absence of netrin-1 . The neurites were quantified after immunostaining of the neurons with an anti--tubulin antibody . A cell with neurites longer than the cell body diameter was defined as a neurite bearing cell, and the number of such cells was counted . The length of the longest neurite in a group of randomly selected 180 - 200 neurons was measured using the lsm 510 image analysis program (carl zeiss). The neurite lengths between the groups were compared using the student's t - test . The mrna expression of dcc and unc5h1 - 4 was examined by rt - pcr . The total rna was isolated from adult spinal cords and drgs by using trizol reagent (invitrogen), according to the manufacturer's instruction . First - strand cdna was synthesized in 20 l reaction mixtures with 1 g of the total rna using the m - mulv reverse transcriptase (new england biolabs, ipswich, ma, u.s.a . ). Primers for amplification and the size of pcr products are as follows: dcc forward; 5'-aagaatggagatgtggtgattcc-3', dcc reverse; 5'-ccagttgtcaccctctctggag-3'(size of the pcr product: 325 bp), unc5h1 forward; 5'-caccaccactaccacctaccagg-3', unc5h1 reverse; 5'-cccgaggaagttgaagg tccc-3'(241 bp), unc5h2 forward; 5'-cgaccctaaaagccgcccc-3', unc5h2 reverse; 5'-gggatcttgtcggcagagtcc-3'(318 bp), unc5h3 forward; 5'-aggctg ctcctgactcagatg-3', unc5h3 reverse; 5'-gggtctagaattggagaattgg-3'(313 bp), unc5h4 forward; 5'-catagaggagcctgaagatg-3', unc5h4 reverse; 5'-acggaagctttcctactctt-3'(218 bp), rat gapdh forward; 5'-tgccgcctggagaaacctgc-3', rat gapdh reverse; 5'-tgagagcaatgccagc ccca-3'(172 bp). The pcr cycling consisted of an initial 5 min at 94, followed by (30 - 32) cycles of 60 sec at 94, 45 sec at 54 - 62, and 60 sec at 72, with a final incubation of 5 min at 72. the pcr products were visualized by ethidium bromide staining (1 g / ml), and the relative intensity (ri) index of the dna bands from three independent experiments was analyzed using a luminescent image analyzer (las-3000, fujifilm, tokyo, japan). The generation of unc5h1 and unc5h2 crna probes was performed using an in vitro transcription kit with digoxigenin-11-utp (roche diagnostics, nutley, nj, u.s.a . ). The plasmids containing the fragments of the unc5h1 and unc5h2 which had been generated by rt - pcr were used as templates for the in vitro transcription . For in situ hybridization, frozen drg sections from adult sprague - dawley rats (5 rats) were cut into 18 m thickness by using a cryostat (frygocut, leica, gallen, switzerland). The sections were then fixed in 4% pfa for 10 min, washed three times with phosphate - buffered saline (pbs), and finally acetylated for 10 min . After prehybridization, the sections were incubated with the hybridization buffer (50% formamide, 4ssc, 0.1% chaps, 5 mm edta, 0.1% tween-20, 1.25denhartdt's solution, 125 g / ml yeast trna, 50 g / ml heparin, and 200 ng of digoxigenin - labeled probes) for 18 hr at 57. the amount and size of the transcribed crna were estimated with rna gel electrophoresis . Non - specific hybridization was removed by washing in 2saline - sodium citrate buffer (ssc) for 10 min at room temperature and the treatment with rnase a (10 g / ml), followed by final washing with 0.1ssc at 57 for 15 min . For immunological detection of digoxigenin - labeled hybrids, the sections were incubated with anti - digoxigenin alkaline phosphatase (roche diagnostics, 1:1,500) for 1 hr, and the color reaction was developed using 4-nitroblue tetrazolium chloride (330 g / ml) and 5-bromo-4-chloro-3-indolyl phosphate (175 g / ml). We examined whether netrin-1 regulates axon outgrowth of adult drg neurons using three dimensional cultures and dissociated neuronal cultures . For three dimensional explant cultures, we cultivated lumbar drgs from adult rats for 36 - 48 hr in matrigel . The purified protein of netrin-1 (500 ng / ml) was sufficient to significantly block the regenerative neurite outgrowth from the explants . We scored the neurite outgrowth as described in material and methods, and found that the difference was significant (2.330.32 vs. 1.750.21, p<0.05). We also analyzed the effect of netrin-1 on the neurite outgrowth of adult drg neurons in dissociated cultures . Tuj1 expression in cultured neurons was confirmed by immunostaining with an anti - tuj1 antibody, and fig . 1d shows that the number of tuj1 positive neurons that have neurites (defined as a process longer than the cell body diameter) decreased from 76.846.2% (control) to 53.96.2% (netrin-1; p<0.05). We also examined the distribution of neurite length of the longest neurite within neurite - bearing cells, and found that the neurite length was also significantly decreased by netrin-1 treatment (fig . Thus, netrin-1 decreased both the number of process - bearing cells as well as the lengths of the neurites of the cells in acutely dissociated neurons . Since the intracellular camp level is known to modulate the actions of netrin in some neurons, we attempted to investigate the possible effect of db - camp and forskolin on the inhibitory function of netrin in the adult sensory neuron . However, we could not observe any significant effects (data not shown). To identify netrin receptor genes that are expressed in the adult drg we then compared the gene expression patterns of netrin receptors in the adult drg with the patterns in the adult spinal cord, that have already been revealed in a previous study (12). This experiment showed that unc5h1 - 3 mrnas, but not dcc mrna, are expressed in the adult drg (fig . The low level of dcc mrna expression was observed only in the adult spinal cord . Among unc5hs, the unc5h1 and unc5h2 showed a relatively high level of mrna messages in the adult drg . The expression of unc5h4 mrna was not detected in adult drg, whereas a low level of unc5h4 mrna expression was found in the spinal cord . In order to understand the cellular localization of the unc5h mrnas 3). Because unc5h1 and unc5h2 are major genes among the unc5 family that are expressed in the adult drg, we performed in situ hybridization histochemistry with unc5h1 and unc5h2 antisense crna probes . Consistent with the result of the rt - pcr, this experiment clearly showed that unc5h1 and unc5h2 are abundantly expressed in the adult drg . Two mrna messages were primarily localized in sensory neurons regardless of the cell size, even though we could not completely exclude the mrna expression in the non - neuronal cells in the drg . However, the sense probes did not label any positive structures in the adult drg sections . Together, these data indicate that unc5h receptors are expressed not only in the adult spinal cord but also in the adult drg and that unc5h receptors may be involved in the inhibition of neurite outgrowth from adult drg neurons via netrin-1 . In the present study, we found that netrin treatment inhibits the regenerative axon growth of adult drg neurons . It has been reported that netrin may play a role in peripheral nerve regeneration (14, 18 - 20). Madison et al . Reported that netrin expression in the adult sciatic nerve is dramatically increased after sciatic nerve injury (19). According to this report, netrin induction the glial origin of netrin was also demonstrated in the adult optic nerve (15). Therefore, netrin secreted from schwann cells or other glial cells in injured nerves may affect the regeneration of peripheral nerves either directly by acting on neurons or indirectly by regulating the glial cell behavior . Our data that show the expression of unc5h1 - 3 mrna in the sensory neurons of the adult drg may support the idea that netrin, present in the sciatic nerve, regulates nerve regeneration directly through the receptors expressed in the peripheral sensory neurons . (21), which revealed the expression of unc5h mrna in the embryonic drg neurons and the inhibition of neurite outgrowth from the embryonic drg by netrin treatment . It was recently reported that netrin-1 in the dorsal part of the embryonic spinal cord acts as an inhibitory cue for primary sensory axons during development, thereby facilitating appropriate formation of sensory neural networks (21). However, the participation of netrin in spinal cord regeneration remains uncertain . In the adult spinal cord, netrin expression is known to be increased after the spinal cord injury, and inflammatory cells in the wound region are responsible for the high levels of netrin mrna expression after the injury (14). In the present study, we demonstrated that netrin-1 inhibits neurite outgrowth from adult drg neurons . Thus, our data put forth an interesting hypothesis that netrin in the wounded area of the spinal cord may inhibit or repel the regenerative axonal growth from drg neurons into the dorsal column after spinal cord injury in adult rats . Alternatively, netrin may be involved in the axonal retraction after the injury . In this sense, netrin could be a novel inhibitory molecule for spinal cord regeneration . The dominant expression of unc5h as compared to dcc expression in the adult drg is similar to the expression pattern of unc5h in the adult spinal cord . Therefore, the expression of the attractive netrin receptor, dcc, appears to be downregulated either by the turn - off of gene transcription (23) or by the ubiquitin - mediated degradation during development (17). On the other hand, unc5h expression continues and even increases with postnatal neuronal maturation in the drg . According to the previous studies, unc5h1 and unc5h3 mrna expression was observed in the drg during embryonic development (21, 24), and a mutation in unc5h3 resulted in the aberrant projection of drg axons . Because unc5h, the receptor mediating the repulsive function of netrin, is mainly found in the adult drg and spinal cord neurons, netrin in the adult neurons may be a neurite - inhibitory molecule . Thus, it could be possible that the inhibitory response of adult drg neurons to netrin is attributable to unc5h receptors . However, further studies are required to elucidate the in vivo function of netrin / unc5h signaling in the adult nervous system.
|
Aki remains an immense clinical problem that is associated with high morbidity and mortality rates and affects a growing number of hospitalized patients . There is not only significant physical injury to millions of individual patients but also a large economic impact to society as evidenced by increased length of hospital stay and higher costs . To put the economic burden into perspective, aki is estimated to cost the national health service (nhs) in the uk (excluding costs in the community) between 434 million and 620 million per year (nhs kidney care estimate) because of prolonged hospitalizations and short- and long - term morbidities . In 2005, chertow and colleagues estimated that the annual costs for hospital - acquired aki were approximately $10 billion in the us . Aki is the descriptive term for the clinical condition that occurs when the renal excretory function is critically and acutely decreased to a point at which the body accumulates uremic waste products and becomes unable to maintain electrolyte, acid - base, and water balance . In clinical terms, aki is measured as an increase in serum creatinine, a biomarker that is universally used but that has considerable diagnostic limitations given its variability, dependence on body muscle mass, and delay in accumulation . Aki is a clinical entity and has various etiologies that include interstitial nephritis, rapidly progressive glomerulonephritis, obstructive nephropathy, and renovascular complications but is frequently the consequence of ischemic and toxic insults and also occurs commonly in the setting of sepsis . In sepsis, the circulation is hyperdynamic and blood flow is altered, though not necessarily in the ischemic range, while the glomerular filtration rate drops rapidly . The pathophysiology of sepsis - associated aki is very complex and involves an intricate interplay of inflammation, oxidative stress, microvascular dysfunction, and further amplification of injury by the secretion of chemokines and cytokines by tubular cells . In laboratory science, the pathophysiology and therapy of aki are most commonly investigated in animals with ischemia / reperfusion injury induced by clamping of both renal pedicles . Other less commonly used models include toxic injury models (for example, cisplatinum and folic acid) and a sepsis model using cecal ligation and puncture . Accordingly, most knowledge regarding the pathophysiology of aki has been derived from preclinical studies in rats and mice with ischemia / reperfusion - induced aki . One of the major obstacles that has hampered therapeutic progress in aki is the fact that effective interventions in animals were obtained in otherwise healthy animals but that most patients who develop aki present with significant co - morbidities such as older age, underlying chronic kidney disease (ckd), and diabetes conditions that are not considered in animals . In addition, aki in most patients occurs as a syndrome of multiple coexisting etiologies, including ischemia, toxicity, and functional impairment, whereas animal models used for the study of its pathophysiology and therapy are generally monocausal and simplistic and often exhibit species - specific characteristics . Aki is the clinical endpoint of a number of processes resulting in a decrease of the glomerular filtration rate, a measure of global renal function . Important components of the injury process include apoptosis, necrosis, reactive oxygen species, and micro - vessel damage causing local ischemia, endothelial dysfunction, leaks, and inflammation (see figure 1). Several stages of aki have been delineated: initiation, extension, maintenance, and recovery phases; however, in the clinical situation, these are not clear - cut and often appear overlapping . Apoptosis and, to a lesser extent, necrosis of renal cells are the main forms of cell death caused by injury . However, recently identified new pathways of programmed cell death summarized under the term necroptosis also contribute to a variable degree to tissue damage . Necroptosis has been recognized as a regulated process under ischemic conditions with at least three pathways involved: receptor - interacting protein kinase 3 (rip3)-dependent necroptosis, cyclophilin d - dependent pathways, and a pathway involving the poly (adp - ribose) polymerase - calpain axis . Recently developed approaches for translational profiling, based on transgenic animal models, facilitate a detailed approach to the identification of injury - induced changes in gene expression patterns . These data show that a wide network of genes is activated at 24 hours after injury and is characterized by strong expression of anti - apoptotic and anti - necrotic pathways as well as the upregulation of genes involved in cell movement and formation of cell junctions . These findings confirm the clinical observation of the robust regenerative potential of the tubular epithelium . In addition, these data show that components of the normal tubular physiology are rapidly downregulated post - injury . Acute kidney injury is most commonly caused by ischemic or toxic injury and occurs in the setting of sepsis . Components of the pathophysiology include inflammatory responses as well as tubular and vascular damage and its consequences . It is not unusual that the kidney fully recovers its function, as measured by serum creatinine levels, even in cases in which patients become dialysis dependent for weeks . Although clinical recovery appears complete, as measured by serum creatinine, there is structural and subclinical damage, which is undetectable by current clinical methods but which enhances susceptibility to injury as well as development of progressive ckd . Tubular cells are capable of activating a number of cytoprotective mechanisms, which include the expression of heat shock proteins and cell cycle regulatory proteins such as p21 . Surviving tubular cells facilitate recovery and repair through proliferation and migration after injury, resulting in the repopulation of denuded nephron segments . Autophagy, a process of self - clearing of broken - down subcellular components that are fed into the lysosomal degradation pathway, is induced after injury and has been described as a renoprotective mechanism used by tubular cells . Protection of the kidney can be induced experimentally through ischemic preconditioning whereby a sublethal ischemic insult prevents greater damage from future ischemic episodes through a number of proposed and observed mechanisms, including nitric oxide induction, cellular kinases, heat shock proteins, and neurogenic pathways, all of which augment cellular resistance to injury . This phenomenon was described about a century ago in the kidney in the setting of uranium - induced injury . This experimental finding has been tested in clinical trials with some promising but preliminary results . The histopathology of aki in humans is a largely uncharted territory because of the rarity of biopsies performed in the acute phase of injury . Acute tubular necrosis is a misnomer given that necrosis is very localized to some small focal areas and that the cell death processes involved include apoptosis and desquamation of viable cells in addition to small focal necrotic areas . Human aki differs considerably from the ischemia / reperfusion mouse model, in which large areas of kidney cortex are essentially no longer perfused, resulting in cortical necrosis . In the human situation, blood flow never fully ceases and damage occurs mainly from focal mismatches of oxygen delivery by impaired microcirculation and increased demand due to cellular stress . Questions regarding the extent of damage as well as the cell types affected by damage (that is, distal versus proximal tubular cell types) have remained controversial . Again, this debate is based primarily on data of rodent models since human aki and particularly the deeper sections of the kidney (including the medulla) are rarely biopsied in the acute setting . The few data available in the human situation paint a very different picture compared with animal models . A large study by liao and pascual from 1996 reported 748 cases of aki, with acute tubular necrosis (45%) being the most frequent cause, followed by prerenal failure (21%), acute - onset chronic renal failure (12.7%), and obstructive acute renal failure (10%). However, the total number of renal biopsies performed in this study was low (6.1%). A study from 2008 analyzing the spanish registry of glomerulonephritis found that 16.1% of all biopsies (n = 2,281) were diagnosed with acute renal failure and diagnoses were quite different, with vasculitis (23.3%), acute tubulointerstitial nephritis (11.3%), and crescentic glomerulonephritis types 1 and 2 (10.1%) as leading diagnoses among aki cases . Although the study was obviously limited by a strong selection bias given that most patients with aki were never biopsied in this glomerulonephritis registry, the data underscore the existence of a large knowledge gap regarding the actual histopathology of human aki . Although human data are sparse, the inflammatory component, as evidenced by infiltrating leukocytes, is rather small and most leukocytes are found within the vasa recta . In contrast, in the mouse model of aki, inflammation is a prominent part of the injury cascade . Mouse ischemic aki is characterized by extensive infiltrates of inflammatory cells, which contribute to injury propagation by secreting pro - inflammatory cytokines and factors . Different leukocyte populations, including t and b cells, natural killer cells, t - regulatory cells, dendritic cells, and macrophages, have all been described to play various roles in the pathophysiology of and recovery from aki . Most of the studies investigating leukocyte populations have been conducted in mouse models, and this is largely because of the ready availability of immunodeficient mice as well as bone marrow transplantation models . In contrast to the mouse model, the rat model exhibits prominent apoptosis of tubular cells as the major pathophysiological component and leukocytes play a minor role . A recent study by sutton and colleagues demonstrates the dilemma between models impressively: in mice, p53 inhibition is detrimental by enhancing the inflammatory component; this is in contrast to the rat model, in which p53 inhibition is protective, mainly by reducing the amount of tubular cell apoptosis . Tubular regeneration has been described as originating from surviving tubular cells that are depolarized and de - differentiated and that proliferate, migrate, and re - differentiate to repopulate denuded tubular segments . Studies have shown that tubular cells of the s3 segment exhibit a particularly robust proliferative response in response to acute injury . These cells promptly re - enter the cell cycle and thereby contribute to the repair of injured nephron segments . Observations regarding the spontaneous contribution of stem cells from extra - renal sources, including bone marrow - derived stem cells, to kidney regeneration have been published . However, careful lineage - tracing studies have shown that their contribution is either absent or at the most minimal, thereby suggesting that intrinsic renal cells carry out the repair of the injured kidney [26 - 28]. Based on these observations, further debate regarding the mechanism of kidney repair following aki is focused on the existence and role of kidney - specific stem / progenitor cells versus regeneration carried out mainly by surviving tubular cells that do not express stem cell markers . A leading hypothesis posits that all differentiated proximal tubule epithelia have the capacity to proliferate during repair by a mechanism of reversible dedifferentiation and self - duplication . On the other hand, it has been postulated that stem / progenitor cells of intratubular origin are the main executioners of tubular regeneration . The terms stem and progenitor cells are frequently used interchangeably, but, in general, the term progenitor cells refers to a more restricted population of cells that might not be able to differentiate into a whole array of cells . Carefully designed studies using the six2-cre driver, a genetic tool for the irreversible marking of a population of cells defined by a specific marker, were carried out to lineage - trace and thus assess the contribution of intrinsic tubular cells to nephron repair . The latter was confirmed, and no evidence for a role of extrarenal cells in this process was detected . This study, however, was unable to exclude the existence of intratubular stem or progenitor cells . More recent publications, using sophisticated lineage - tracing methods, have provided evidence that all tubular cells are equally able to contribute to regeneration after injury, thereby providing indirect evidence against the existence of a distinct progenitor cell population . For a long time, the belief was that recovery from aki is complete and leads to a restitutio ad integrum . Indeed, renal function, as measured by serum creatinine levels, frequently normalizes close to or to pre - injury levels, suggesting the return of normal kidney function . However, animal studies have shown that there is ultrastructural damage from incomplete tubular repair and persistent inflammation and deposition of extracellular matrix, together resulting in functional defects such as a decrease in urinary concentrating ability as well as salt sensitivity . These defects contribute to continuous tissue damage by hypoxia as a result of micro - vessel rarefication, ultimately resulting in slowly progressive interstitial fibrosis and loss of function . The notion that kidney function is not back to pre - injury baseline levels is backed by large epidemiological databases showing that aki is a trigger for subsequent declining kidney function, with a large proportion of patients progressing to advanced - stage ckd and eventually end - stage renal disease (esrd). Opponents of this hypothesis posit that the most vulnerable patients would have progressed to esrd without a triggering episode of aki, since the same risk factors that predispose to aki are responsible for progression of ckd . These risk factors include, but are not limited to, the metabolic syndrome, obesity, hypertension, diabetes, and cardiovascular diseases . By the same token, the very same risk factors also predispose to the development of aki, which blurs the lines between causality and association . Thus, it comes as no surprise that the patients with the lowest level of kidney function were the most likely to progress to esrd . An important component of ckd development after aki is maladaptive repair carried out by fibroblasts, pericytes, and myofibroblasts, with resultant interstitial renal scar formation and progressive nephron loss . Tubular epithelial cells contribute to this process by cell cycle arrest and subsequent production of transforming growth factor - beta, thereby further fueling the process of progressive fibrosis . However, the types of cells causing progressive fibrosis after aki are still being debated . Obvious candidates include epithelial cells, resident fibroblasts, bone marrow cells, endothelial cells, and pericytes . Several groups identified epithelial - mesenchymal transition as a major profibrotic mechanism in ckd . Accordingly, proximal tubular epithelial cells transform into fibroblast - like cells and thereby initiate and promote interstitial fibrosis . Lineage - tracing studies, however, have not been able to reproduce this finding and identified pericytes as the main contributors to the fibrotic cell populations . Yet the definitive origin of myofibroblasts responsible for extracellular matrix deposition aki remains a major contributor to morbidity and mortality in hospitalized patients, and effective interventions to reduce mortality are currently not available . The current research focus is on the epidemiology and cellular substrate of the chronic kidney damage resulting from an episode of aki . Answers regarding the cells that are responsible for the progressive interstitial fibrosis after aki have obvious therapeutic relevance . The pathophysiology of aki is highly complex and involves multiple cellular systems, including the endothelium, tubular cells, and leukocytes . Given the complex pathophysiology of aki and the various comorbidities of affected patients, effective interventions need to be directed at all major pathophysiological components of this serious complication . Given the multitude of pathophysiological components, it appears that targeting only one or a few of the principal pathomechanisms of aki would likely be ineffective, as clinical trials in the past have shown.
|
The study was conducted at the copenhagen neuromuscular center, rigshospitalet, denmark, in collaboration with the danish national rehabilitation centre for neuromuscular diseases . One hundred nineteen patients registered with a diagnosis of cm aged older than 5 years were invited . The age limit of 5 years was chosen, as the functional tests used were not validated for younger patients and because we wanted to focus on older cms . All participants completed questionnaires concerning symptoms and medical history . A neurologist (n.w .) And a physiotherapist (u.w .) Examined all patients . Muscle strength was evaluated using a transformed 11-point medical research council (mrc) scale (010). After initial evaluation, participants with phenotypic characteristics atypical for cm (adult onset, fast progression, creatine kinase 600 u / l, dystrophy as the main histologic finding, or alternative disease explanation) were excluded . Participants with a cm phenotype, but other genetic etiology, were excluded in the course of the genetic evaluation . The study was approved by the local ethics committee (protocol h - c-2009 - 017), and all participants or their parents provided informed consent . All participants were tested sequentially for mutations in skeletal muscle alpha actin 1 (acta1) and tropomyosin 2 + 3 (tpm2 + 3) genes, as no definite histologic or clinical phenotypes are established for these genes, and the tests were readily available . Core histology (central core disease [ccd]) elicited testing of the ryanodine receptor 1 (ryr1) gene and the selenoprotein 1 (sepn1) gene . Cnm or pronounced ophthalmoplegia leads to assessment of the genes dynamin 2 (dnm2), myotubularin 1 (mtm1), amphiphysin (bin1), and ryr1 . Rigid spine patients went through sepn1 testing . Pronounced contractures led to the investigation of collagen vi genes (not considered cm by the authors). The remaining unclassified patients were examined for aberrations in neb and ryr1, and if no mutations were found, exome sequencing was performed in the majority (broad institute, boston or nijmegen university, holland) with subsequent assessment of genes involved in myopathy . The exons and flanking sequences of acta (nm_001100.3), tpm2 (nm_003289.3), and tpm3 (nm_152263.2) were pcr amplified and sanger sequenced using bigdye v1.1 on an abi3130 sequencer . The neb (nm_004543.4) and ryr1 (nm_000540.2) genes were sequenced using a custom ampliseq targeting approach on an ion pgm (thermo fisher). Areas with low (<30x) or missing coverage were sanger sequenced . The study was approved by the local ethics committee (protocol h - c-2009 - 017), and all participants or their parents provided informed consent . All participants were tested sequentially for mutations in skeletal muscle alpha actin 1 (acta1) and tropomyosin 2 + 3 (tpm2 + 3) genes, as no definite histologic or clinical phenotypes are established for these genes, and the tests were readily available . Core histology (central core disease [ccd]) elicited testing of the ryanodine receptor 1 (ryr1) gene and the selenoprotein 1 (sepn1) gene . Cnm or pronounced ophthalmoplegia leads to assessment of the genes dynamin 2 (dnm2), myotubularin 1 (mtm1), amphiphysin (bin1), and ryr1 . Pronounced contractures led to the investigation of collagen vi genes (not considered cm by the authors). The remaining unclassified patients were examined for aberrations in neb and ryr1, and if no mutations were found, exome sequencing was performed in the majority (broad institute, boston or nijmegen university, holland) with subsequent assessment of genes involved in myopathy . Dna was isolated from blood . The exons and flanking sequences of acta (nm_001100.3), tpm2 (nm_003289.3), and tpm3 (nm_152263.2) were pcr amplified and sanger sequenced using bigdye v1.1 on an abi3130 sequencer . The neb (nm_004543.4) and ryr1 (nm_000540.2) genes were sequenced using a custom ampliseq targeting approach on an ion pgm (thermo fisher). Areas with low (<30x) or missing coverage were sanger sequenced . Twenty - five were excluded, leaving a total of 82 in the study . Of the excluded, 14 displayed a phenotype inconsistent with cm; 3 of these were subsequently confirmed with limb - girdle muscular dystrophy, type 1c (lgmd1c), lgmd2l, and lgmd2a . Eleven had a phenotype compatible with cm, but an alternative genetic etiology was identified in 10, and dna was missing in 1 (figure 1). Acta1 = skeletal muscle -actin 1; ad = autosomal dominant; ar = autosomal recessive; ck = creatine kinase; cms = congenital myasthenic syndrome; des = desmin; dnm2 = dynamin 2; dok7 = downstream - of - kinase 7 myasthenic syndrome; lgmd = limb - girdle muscular dystrophy; mtm1 = myotubularin 1; neb = nebulin; rapsn = receptor - associated protein of the synapse myasthenic syndrome; ryr1 = ryanodine receptor 1; scn4a = sodium channel 4a; sepn1 = selenoprotein 1; tpm2/3 = tropomyosin 2/3; ttn = titin . * of these 6, 1 had lgmd2l, 1 lgmd2a, and 1 lgmd1c . Forty - one had specific histology; 14 (17%) had cores (3 multimini core disease), 15 (18%) had cnm, and 12 (15%) nemaline myopathy (nm). The remaining 41 had more unspecific histology; 27 (33%) had congenital fiber - type disproportion (cftd) or type i predominance (t1), and 14 (17%) had unspecific myopathic biopsies . In 2, biopsy material was unavailable (table 1). Histologic findings vs genotype a genetic diagnosis was reached in 46 (56.1%) (tables 1 and 2). Eighteen had mutations in ryr1 (22.0%) (13 heterozygous and 5 compound heterozygous), 6 had mutations in dnm2, and 6 in neb . Three or less had mutations in acta1, tpm2, tpm 3, mtm1, sepn1, scn4a, or ttn genes (tables 1 and 3). Twenty - one participants had a particular clinical / histologic phenotype leading to a genetic diagnosis . Twenty - five patients had no clinical or histologic clues, and genetic etiology was identified by single gene testing in 20 and by whole - exome sequencing (wes) in 5; 3 with recessive ryr1 mutations, 1 with mutation in ttn, and 1 with mutation in scn4a . Chance of identifying genetic etiology according to histology characteristics of patients with or without genetic diagnosis the diagnostic yield was highly dependent on histologic findings (table 2); if only participants with cores, cnm, or nm were evaluated, a genetic etiology was identified in 83% . If cftd / t1 were included, the number decreased to 63% . A genetic etiology was identified in 3/14 (21%) with unspecific histology, 9/27 (33%) with cftd / t1, 12/12 (100%) with nm, 9/14 (64%) with cores, and 13/15 (87%) of participants with cnm . The 10 participants with a phenotype compatible with cm, but alternative genetic etiology had collagen myopathy, desminopathy, or congenital myasthenic syndrome (cms) (figure 1). Seven of 10 had unspecific or cftd histology, whereas the remaining 3 had more specific histology: one with desminopathy had cores, another with desminopathy had rods, and one collagen vi had centronuclear changes (table 2). The age of genetically unresolved (27.8 16.7) and resolved (28.0 14.6) patients was identical . The genetically unresolved had generally more unspecific histology and were less severely affected (tables 2 and 3). A total of 48 different mutations were identified of which 31 were listed in the human gene mutation database (hgmd) or clinvar as pathogenic . The remaining 17 were absent from the hgmd or clinvar and to our knowledge have not been associated with disease before . Twelve of these were identified in recessively inherited disorder; 8 were predicted to result in premature stop codons or frameshifts and 4 were missense mutations . The 4 missense mutations were identified in sepn1, ryr1, and scn4a, respectively, where mutations very often are missense and were predicted to be potentially pathogenic by sift, polyphen2, align - gvgd, and mutationtaster in silico prediction softwares and were absent from the exac database compiling information of more than 120,000 alleles (exac.broadinstitute.org), and from a danish control cohort of 2000 wes . Of the 4 variants, 2 were identified along with a known pathogenic mutation, whereas the remaining 2 were identified in sepn1 in a patient with a clear clinical presentation of a selenoprotein deficiency . Where family members were available, the remaining 5 novel variants were all missense variants in ryr1 located in the well - known hot - spot region for the dominantly inherited ryr1 disorder . From the detailed muscle examination, some patterns of weakness could be recognized for particular genotypes (table 3, figure 2). The acta1 patients were generally very weak in proximal, distal, and respiratory muscles, although 1 adult patient did not follow this pattern . By contrast, the tpm2/3 patients had few mrc measurements below 7, but despite this had the same decrease in respiratory function as the acta1 patients . Neb patients typically had preferential affection of the shoulder girdle and pronounced ankle dorsiflexor weakness with mrc of just 12, but comparatively mild respiratory involvement . As expected, dominant and recessive ryr1 patients differed in severity, with recessive patients being more severely affected . The mtm1 patients were more severely affected than the others, but hand function was relatively better than that in the acta1 patients . The respiratory involvement in the mtm1 and sepn1 patients exceeded that in all other groups . Contractures were not prevalent, but were noted in some neb, ryr1, dnm2, mtm1, ttn, and sepn1 patients (table 3). Average time of walking ability was calculated in groups with more than 3 patients and exceeded the world health organization defined normal limit of 18 months in patients with mutations in acta1 (30 months), tpm2/3 (20 months), and ryr1 (21 months, 2 never walked), whereas patients with mutations in neb (15 months) and dnm2 (14 months) fell within normal development . Four patients (a genetically unresolved participant aged 26 years, 1 dnm2 patient aged 69, an ryr1 patient aged 55 years, and a ttn patients aged 13 years) died during the study period from 2009 until now . For medical research council (mrc); information on work history was available in 42 of the 46 genetically verified cases; 36 attended school or worked part or full time . No participant had clinical evidence of cardiac involvement, and ecg performed in nearly all participants was unremarkable . Twenty - five were excluded, leaving a total of 82 in the study . Of the excluded, 14 displayed a phenotype inconsistent with cm; 3 of these were subsequently confirmed with limb - girdle muscular dystrophy, type 1c (lgmd1c), lgmd2l, and lgmd2a . Eleven had a phenotype compatible with cm, but an alternative genetic etiology was identified in 10, and dna was missing in 1 (figure 1). Acta1 = skeletal muscle -actin 1; ad = autosomal dominant; ar = autosomal recessive; ck = creatine kinase; cms = congenital myasthenic syndrome; des = desmin; dnm2 = dynamin 2; dok7 = downstream - of - kinase 7 myasthenic syndrome; lgmd = limb - girdle muscular dystrophy; mtm1 = myotubularin 1; neb = nebulin; rapsn = receptor - associated protein of the synapse myasthenic syndrome; ryr1 = ryanodine receptor 1; scn4a = sodium channel 4a; sepn1 = selenoprotein 1; tpm2/3 = tropomyosin 2/3; ttn = titin . * of these 6, 1 had lgmd2l, 1 lgmd2a, and 1 lgmd1c . Forty - one had specific histology; 14 (17%) had cores (3 multimini core disease), 15 (18%) had cnm, and 12 (15%) nemaline myopathy (nm). The remaining 41 had more unspecific histology; 27 (33%) had congenital fiber - type disproportion (cftd) or type i predominance (t1), and 14 (17%) had unspecific myopathic biopsies . In 2, a genetic diagnosis was reached in 46 (56.1%) (tables 1 and 2). Eighteen had mutations in ryr1 (22.0%) (13 heterozygous and 5 compound heterozygous), 6 had mutations in dnm2, and 6 in neb . Three or less had mutations in acta1, tpm2, tpm 3, mtm1, sepn1, scn4a, or ttn genes (tables 1 and 3). Twenty - one participants had a particular clinical / histologic phenotype leading to a genetic diagnosis . Twenty - five patients had no clinical or histologic clues, and genetic etiology was identified by single gene testing in 20 and by whole - exome sequencing (wes) in 5; 3 with recessive ryr1 mutations, 1 with mutation in ttn, and 1 with mutation in scn4a . Chance of identifying genetic etiology according to histology characteristics of patients with or without genetic diagnosis the diagnostic yield was highly dependent on histologic findings (table 2); if only participants with cores, cnm, or nm were evaluated, a genetic etiology was identified in 83% . A genetic etiology was identified in 3/14 (21%) with unspecific histology, 9/27 (33%) with cftd / t1, 12/12 (100%) with nm, 9/14 (64%) with cores, and 13/15 (87%) of participants with cnm . The 10 participants with a phenotype compatible with cm, but alternative genetic etiology had collagen myopathy, desminopathy, or congenital myasthenic syndrome (cms) (figure 1). Seven of 10 had unspecific or cftd histology, whereas the remaining 3 had more specific histology: one with desminopathy had cores, another with desminopathy had rods, and one collagen vi had centronuclear changes (table 2). The age of genetically unresolved (27.8 16.7) and resolved (28.0 14.6) patients was identical . The genetically unresolved had generally more unspecific histology and were less severely affected (tables 2 and 3). A total of 48 different mutations were identified of which 31 were listed in the human gene mutation database (hgmd) or clinvar as pathogenic . The remaining 17 were absent from the hgmd or clinvar and to our knowledge have not been associated with disease before . Twelve of these were identified in recessively inherited disorder; 8 were predicted to result in premature stop codons or frameshifts and 4 were missense mutations . The 4 missense mutations were identified in sepn1, ryr1, and scn4a, respectively, where mutations very often are missense and were predicted to be potentially pathogenic by sift, polyphen2, align - gvgd, and mutationtaster in silico prediction softwares and were absent from the exac database compiling information of more than 120,000 alleles (exac.broadinstitute.org), and from a danish control cohort of 2000 wes . Of the 4 variants, 2 were identified along with a known pathogenic mutation, whereas the remaining 2 were identified in sepn1 in a patient with a clear clinical presentation of a selenoprotein deficiency . Where family members were available, the remaining 5 novel variants were all missense variants in ryr1 located in the well - known hot - spot region for the dominantly inherited ryr1 disorder . From the detailed muscle examination, some patterns of weakness could be recognized for particular genotypes (table 3, figure 2). The acta1 patients were generally very weak in proximal, distal, and respiratory muscles, although 1 adult patient did not follow this pattern . By contrast, the tpm2/3 patients had few mrc measurements below 7, but despite this had the same decrease in respiratory function as the acta1 patients . Neb patients typically had preferential affection of the shoulder girdle and pronounced ankle dorsiflexor weakness with mrc of just 12, but comparatively mild respiratory involvement . As expected, dominant and recessive ryr1 patients differed in severity, with recessive patients being more severely affected . The mtm1 patients were more severely affected than the others, but hand function was relatively better than that in the acta1 patients . The respiratory involvement in the mtm1 and sepn1 patients exceeded that in all other groups . Contractures were not prevalent, but were noted in some neb, ryr1, dnm2, mtm1, ttn, and sepn1 patients (table 3). Average time of walking ability was calculated in groups with more than 3 patients and exceeded the world health organization defined normal limit of 18 months in patients with mutations in acta1 (30 months), tpm2/3 (20 months), and ryr1 (21 months, 2 never walked), whereas patients with mutations in neb (15 months) and dnm2 (14 months) fell within normal development . Four patients (a genetically unresolved participant aged 26 years, 1 dnm2 patient aged 69, an ryr1 patient aged 55 years, and a ttn patients aged 13 years) died during the study period from 2009 until now . For medical research council (mrc); gray bars left side, black bars right side . Bottom: forced vital capacity (fvc) in percentage of expected normal values . Information on work history was available in 42 of the 46 genetically verified cases; 36 attended school or worked part or full time . No participant had clinical evidence of cardiac involvement, and ecg performed in nearly all participants was unremarkable . As only survivors from the early childhood were included, the information gathered is helpful for health care personal caring for older children and adults because existing knowledge has been obtained preferentially from pediatric cohorts . The study is also a prospective, national study of phenotypes and genotypes in cm . Therefore, unlike previous retrospective studies, the study is less affected by selection bias and strengthened by a systematic data collection by just 1 neurologist and physiotherapist . The report presents new data on national prevalence, distribution of histologic subtypes and genotypes, and expands the description of phenotypic characteristics . This is lower than most previous studies, which determined the prevalence by chart reviews or databases to about 4:100,000 and focused on the pediatric population . The exclusion of children not surviving to 5 years in our study could account for some of the discrepancy . A previous study reported that 12% of their patients with cm died before the age of 6 years . Patients with mutations in those genes may therefore be underrepresented in our material if extrapolated to a general population . The total prevalence, however, is probably not much influenced by this, as we, compared to previous studies, have included more elderly persons and in that way compensate for the lack of young children . Another explanation for our lower prevalence estimate could be that the prospective evaluation in our study may have eliminated more wrongly diagnosed patients . This is, however, probably not the main explanation for the discrepancy, as most of the studies were very thorough in the attempt to avoid misdiagnosis . Alternatively, our very stringent inclusion criteria may have omitted a few cms with atypical features like high creatine kinase . Of the 15 excluded cases because of atypical features, however, 10 had definitely not cm, as alternative etiologies were identified or they turned out to be asymptomatic family members . Citizens in denmark are easily traceable, as they are centrally registered, and therefore, the lower prevalence in our study is not likely caused by problems in identifying patients . A number of inherited muscle diseases, such as some limb - girdle muscular dystrophies and myotonic dystrophy type 2, differ markedly in prevalence in denmark vs other countries, and this could also be the case for cms . In support of this, cm has the same low prevalence in northern england (1.37:100,000, including bethlem myopathy with a prevalence of 0.77) as in denmark, where the genetic influence from historic viking invasions is great . A london - based study observed a different pattern of histology, as the majority of their patients had ccd, whereas histologic findings of cores, cnm, nm, and cftd / t1 were more evenly distributed among our patients . This difference in histology also points to a different genetic background and supports that not only the prevalence but also the genetic make - up of cm varies among geographic regions . Concurring with this hypothesis, the genetic etiology in the london - based study was very different from ours . They found ryr1 mutations in 59% and dnm2 in 0% of their cms, whereas ryr1 mutations were observed in 22% of our cases and dnm2 mutation in 7.3% . The difference in ryr1 mutations in our population is probably not explained by different age distribution, as ryr1 patients usually survive past early childhood . The dnm2 patients, however, are relatively mildly affected and may go unrecognized for years, which would make them underrepresented in a very young population . This discrepancy, however, could relate to differences in testing strategies, where we sequenced all nonrepetitive coding sequences of neb, whereas only a single frequent deletion was assessed in the previous study . Also, the genetic background may influence the distribution of genetic etiology . Two recent studies (same group) describing retrospective data in mostly pediatric patients reported the genetic cause in 67%79% . Our lower diagnostic rate can partly be explained by methods of selecting patients, as we included many patients with unspecific myopathic biopsies and that subgroup only had a genetic etiology identified in 21% of cases . Leaving the patients with unspecific myopathic histology out, we found a genetic etiology in 63% if cftd / t1 was included, and 83% without cftd / t1 . Differences in the success rate of identifying genetic etiology are therefore most likely caused by differences in histology among the included cohorts . An alternative explanation might be that our patients were older than those in previous studies and that those who die before age 5 years often have mutations in acta1 or mtm1, which are relatively easy to identify . The chance of identifying genetic etiology was highly dependent on histology . A much higher percentage with a specific histology like cores, nm, or cnm had a genetic etiology identified . In the subgroup with confirmed cm and nm, genetic etiology was identified in 100% . However, the specificity of cm is not 100%, as 1 patient with desmin mutation also had nm . Nm in patients with desmin mutations has only been reported in a few cases, but was attributed to the known protein accumulation in desminopathy . Specific histology for cm, however, was only found in 3/10 patients with a phenotype compatible with cm, but with alternative genetic diagnoses (cms, desminopathy, colvi, or xii). A patient with selenoprotein deficiency had nemaline bodies in 2 muscle fibers . Although this might be an incidental finding, this patient was grouped together with the nms . The detailed physical examination performed in this study suggests some new clinical clues to the genetic etiology . In the genetically resolved nemaline / cftd / t1 group, however, in contrast to the neb patients, patients affected by tpm2 and 3 aberrations had a disproportionately higher respiratory affection, and half of the neb patients had almost paralytic ankle dorsiflexion coexisting with mrc 78 in proximal muscles and a relatively preserved hand function . The preferential weakness of ankle dorsiflexors in some neb patients is well established . The only patient with combined cftd and pronounced ophthalmoplegia had recessive ryr1 disease . The recessive ryr1 patients also exhibited a marked proximal - distal gradient in weakness, which was shared by the mtm1 patients, but the mtm1 patients had a much more noticeable respiratory affection . Severe ophthalmoplegia was, in agreement with a recent consensus statement, exclusively observed with recessive ryr1, dnm2, and mtm1 mutations . Ccd was almost synonymous with dominant ryr1 mutations, and these patients had much the same extremity affection as sepn1 patients, and both groups had a tendency to scoliosis . The sepn1 patients, however, had much more respiratory and axial involvement as known for this condition . Mutations in dnm2 lead to cnm with ptosis and a lower extremity distal affection in all cases, but otherwise a relatively mild phenotype . Although these clinical clues are not 100% consistent, we believe that they contribute importantly when planning a genetic test strategy or interpreting test results . Ten patients were initially judged to have a phenotype compatible with cm, but turned out to have mutation in a gene not strictly belonging to the genes recognized as genes inducing cm; 3 had mutations in the collagen vi gene, 3 in the collagen xii gene, 2 in the desmin gene, and 2 had cms . The delineation of cm is not generally agreed upon, but we have, in line with others, chosen not to include collagen myopathies, as they typically have a progressive course and more contractures than other cms . On follow - up, the widespread contractures in the 3 collagen vi patients led to the identification of mutations in the collagen vi genes, and in the patients with desmin mutations, the course showed to be much more progressive than was the impression at the initial visit . Hence, in retrospect, the collagen vi myopathies and the desmin patients should not have been included . By contrast, there were no red flags in the phenotype of the collagen xii patients and the patients with cmss . The prevalence would not have been significantly different if these patients were included, as the total patient number compared to the complete population is still very small . In contrast to most previous studies, we included many adult patients with very early - onset weakness . We confirmed that for the majority, the disease course is nonprogressive and many patients are still engaged in an active work life . Taken together, this study adds new knowledge about the geographic variation in prevalence, distribution of subtypes, and clinical characteristics in an older population with cm that may influence strategies for diagnostic testing and counseling of patients . Nanna witting: study concept and design, acquisition of data, analysis and interpretation of data, and drafting of manuscript . Ulla werlauff: study concept and design, acquisition of data, analysis and interpretation of data, and critical revision of manuscript for intellectual content . Morten duno: acquisition of data, analysis and interpretation of data, and critical revision of manuscript for intellectual content . John vissing: study concept and design, analysis and interpretation of data, and critical revision of manuscript for intellectual content . Dr . Witting received research support from the danish council for independent research in medical sciences, the augustinus foundation, the jascha foundation, the novo nordisk foundation, and the gangsted foundation . Vissing has received research support, travel support, and speaker honoraria from genzyme / sanofi and ultragenyx pharmaceuticals; has served on the editorial boards of neuromuscular disorders and the journal of neuromuscular diseases; has received research support from atyr pharma, the danish medical research council, the augustinus foundation, the novo nordisk foundation, and the lundbeck foundation; and has acted as a consultant on advisory boards for genzyme / sanofi, lundbeck, ultragenyx pharmaceuticals, novo nordisk, atyr pharma, sarepta, and alexion pharmaceuticals within the last 3 years.
|
Dronedarone is a relatively new antiarrhythmic drug and is held to be less proarrhythmic than comparable compounds, although its proarrhythmia potential in humans has not been sufficiently evaluated . We describe a so far unreported dronedarone effect, namely a significant alteration of both the morphology and the duration of the qrs complex on electrocardiogram (ecg) in a 41-year old patient with symptomatic paroxysmal atrial fibrillation . Dronedarone is a derivate of the potent antiarrhythmic drug amiodarone that was designed to have less toxic side effects (1). Although dronedarone was approved following reports of an improved safety profile, more recent studies have cast doubt on its safety (1 - 2 - 3). However, dronedarone is still held to be less proarrhythmic than comparable compounds, although its proarrhythmia potential in humans has not been sufficiently evaluated (1). We describe a hitherto unreported dronedarone effect, namely a significant alteration of both the morphology and the duration of the qrs complex on ecg . A 41-year old patient was admitted to our emergency unit because of a highly symptomatic attack of paroxysmal atrial fibrillation (af) that a few hours later spontaneously converted into sinus rhythm . Atrial fibrillation had been first diagnosed in this patent in 2008 and the af episodes had been becoming more frequent in the months immediately preceding hospital admission . On admission, it should be noted that, during sinus rhythm, the ecg was normal showing an unremarkable qrs morphology and a qrs duration of 85 msec (fig . Clinically, the patient was in a good state of health . His risk profile consisted of grade 1 obesity (body mass index 30.9 kg / m) and arterial hypertension that was well controlled by a combination therapy of an ace - inhibitor and a beta - blocker . Routine blood tests, including kidney, liver and thyroid function analysis, were all within normal values . Coronary artery disease had been previously excluded by coronary angiography in 2011, and a recently performed transthoracic echocardiography revealed a structurally normal heart exhibiting normal systolic and diastolic function . After giving informed consent, the patient was reluctant to undergo an invasive approach and preferred pharmacological rhythm management with dronedarone . According to our standard approach for af patients admitted to our institution, the initiation of antiarrhythmic therapy, regardless of the antiarrhythmic drug, is always performed in the hospital setting . During the hospital stay, the patients are not restricted to bed rest but are allowed to be ambulant while being continuously monitored using ecg telemetry . In addition, 12-lead standard ecg is registered in each patient on a daily basis . In the index patient, after two doses of dronedarone (400 mg each), a marked prolongation of qrs duration with a left bundle branch block pattern was documented on the 12-lead ecg (fig ., the qrs complexes again showed a normal morphology and a normal duration of 90 msec (fig . Subsequently, the patient refused further attempts at pharmacological rhythm control, but requested a catheter ablation of atrial fibrillation that had recurred . Therefore, circumferential pulmonary vein isolation was successfully performed . Return to normal qrs - width after dronedarone withdrawal and self - limiting episode of atrial fibrillation . Three months later, at the first follow - up visit in our rhythmology outpatient clinic, the patient was free of af and continued to show a narrow qrs - complex . Dronedarone is a multichannel blocker exhibiting all of the 4 vaughan williams classes of action (4). In fact, qt - interval prolongation, increased frequency of ventricular premature beats, and episodes of atrial flutter have all been reported as potentially proarrhythmic side effects of dronedarone (2, 3). Mechanistically, this phenomenon may be explained by a reduction in the maximum slope of the action potential upstroke due to an increased inhibition of the fast na(+) inward current by dronedarone (4, 5). Thus, a widened qrs complex may be indicative of slowed impulse conduction in the ventricles and may herald potential proarrhythmia . Therefore, careful telemetry monitoring appears to be mandatory, particularly during the period following the first administration of dronedarone.
|
Peri - renal sepsis in the setting of chronic renal failure requiring an emergency nephrectomy is rare . There is a single case report of overwhelming mrsa urosepsis in a patient with stag horn calculus who required an emergency nephrectomy . Pyelonephritis accounts for 34 hospital admissions per 10 000 females, with normal renal function, and the incidence in patients with chronic pyelonephritis is not known . In patients with chronic kidney disease who are anuric, it is difficult to establish the diagnosis of renal or peri - renal sepsis . Cross - sectional imaging may remain inconclusive early in the illness and at times take 23 weeks to become apparent . Worsening abdominal pain with severe lactic acidosis and without peritonitis usually heralds a major intra - abdominal vascular event . While a similar presentation has been described in the setting of stone disease and mrsa sepsis, to our knowledge, this is an index case where severe peri - renal sepsis presented with life - threatening metabolic acidosis in the absence of any obvious predisposing case and possibly secondary to a fully sensitive s. aureus infection . Metastatic sepsis from infective endocarditis is a well - recognized complication, and we postulate that despite adequate antibiotic therapy, this may have been the source of sepsis in this case . The interesting features that this case illustrates are that the absence of common conditions causing an acute abdomen, obscure renal or peri - renal sepsis should be considered as a possible source in anuric patients with chronic kidney disease, and that surgical management with a nephrectomy may prove necessary after failure of conservative management.
|
Early detection of a hearing problem with a diagnostic tool like newborn hearing screening test is important . Early detection can bring improvements in hearing ability and language development of children by promoting the use of rehabilitation strategies including hearing aid and cochlear implant . Auditory neuropathy is characterized by abnormal auditory brainstem response (abr) and normal otoaoustic emission (oae) responses . Although auditory neuropathy manifests as various patterns in pure tone and speech audiometry, most patients have very poor word discrimination function.1) we present a case of auditory neuropathy improved in a child who was diagnosed with moderate hearing loss by abr testing at 16 months of age, but who presented normal pure tone threshold and speech discrimination score 3 years after wearing hearing aids . A six - year - old boy presented to the outpatient clinic with abnormalities of hearing and language development . No congenital anomalies were evident at birth . However, he was not able to speak until 16 months of age and his response to external sound stimuli was slow . He showed no abr - response to 65 db nhl click stimuli at 16 months age . Since then he had worn a hearing aid in the right ear (fig . 1). At 25 months of age, aided hearing threshold was about 30 db hl in sound field pure tone audiometry (fig . He wore the hearing aid for another 2 years . At 5 years, 10 months of age, he visited our hospital for a hearing evaluation . His parents related that his hearing function seemed to have improved with time, because he had no difficulty communicating with others without a hearing aid . Abr test showed no click sound response in both ears at 90 db nhl (fig . Transient evoked otoacoustic emission showed response reproducibility of 88% (right ear) and 95% (left ear), and normal distortion product otoacoustic emissions responses were reported (fig . However, normal pure tone threshold was evident at both ears; speech reception threshold was 22 db (right ear) and 26 db (left ear) and speech discrimination score was 96% (right ear) and 88% (left ear) (fig . 4). He was recommended to stop wearing the hearing aid . A language development test conducted at 7 years, 4 months of age revealed an age equivalent of 6 years on expressive vocabulary test and 5 years on receptive vocabulary test . The concept of auditory neuropathy was first introduced by starr, et al.1) in 1996 to describe 10 patients, including infants and adolescents, showing normal oae results, abnormal abr results and poor speech discrimination score . Auditory neuropathy is characterized by the auditory pathway lesion in the inner hair cells, the junction between the inner hair cells and the nerve, and the spiral ganglion or the auditory nerve in the presence of normal outer hair cell function ., auditory neuropathy is described as peripheral neuropathy resulting from the demyelination of auditory nerves . Demyelinating lesions decrease the speed of neurotransmission, which in turn impairs nerve stimulation responses of the brain stem and decreases the synchronized activity of the entire auditory nerve activity, leading to unusual waveforms.1,2) auditory neuropathy accounts for nearly 2.4 - 15% of all childhood sensorineural hearing loss . Auditory neuropathy most often occurs in both ears among infants aged 2 years or younger although it can occur in adults.3) more recently, auditory neuropathy has been increasingly referred to as auditory neuropathy spectrum disorder in recognition of its heterogeneity . These risk factors include hypoxia, preterm birth, hyperbillirubinemia, ototoxic medication use and neurological diseases, such as mitochondrial disease . Especially, hyperbilirubinemia is a leading cause of auditory neuropathy.4) infants with one of these risks need to undergo oae testing, especially when they have a poor abr roche, et al.5) reported the relationship of radiologic findings with auditory neuropathy in 118 patients; radiologic abnormalities were observed in 64% and 23% of patients examined using magnetic resonance imaging (mri) group and computed tomography, respectively . The most common abnormality in mri is the absence of the auditory nerve, followed by brain lesion . Mri is the most important radiologic tool in deciding on a course of treatment and assessing the prognosis of auditory neuropathy . In this case, the treatment for childhood auditory neuropathy includes hearing aids, language therapy and regular hearing test - based monitoring . Also, cochlear implant can be considered in case of poor outcomes.6) kim, et al.7) compared outcomes of six children with auditory neuropathy and four children with sensorineural hearing loss after cochlear implant, and reported no difference in hearing recovery outcomes between the two groups . Fulmer, et al.8) also reported no significant difference in hearing improvement following cochlear implant in 10 patients with auditory neuropathy and 10 patients with sensorineural hearing loss . For infants, abr waveforms can be improved with time, so hearing conditions should be tested and examined regularly . Dunkley, et al.9) introduced a case in which a child showed pure tone threshold average of 35 db hl and normal word discrimination test 5 years after the diagnosis of audiometry neuropathy based on abr waveforms of 50 db nhl with normal oae at 1 week of age . Psarommatis, et al.10) also chronicled the improvement of auditory neuropathy in 20 children of 25 patients who had abr waveforms of more than 75 db nhl and normal oae . Of the 20 children, 12 exhibited abr less than 40 db nhl and one child had 50 db nhl but normal results in other hearing tests . Berlin, et al.11) studied 260 children with auditory neuropathy and found that 13 (5%) had no problem in language development and ended up needing no treatment, even hearing aids . The patient in the present case also showed typical clinical features of auditory neuropathy including non - response for abr in addition to normal oae results . However, hearing improved to the extent that he had normal hearing for puretone and speech audiometry, and language development was only mildly delayed compared to other children in the same age group . We suggest following observation on a regular basis and reassessment of audiologic status and language development.
|
Knowledge management, based on information transfer between experts and analysts, is crucial for the validity and usability of data envelopment analysis (dea). To design and develop a methodology: i) to assess technical efficiency of small health areas (sha) in an uncertainty environment, and ii) to transfer information between experts and operational models, in both directions, for improving expert s knowledge . A procedure derived from knowledge discovery from data (kdd) is used to select, interpret and weigh dea inputs and outputs . Based on kdd results, an expert - driven monte - carlo dea model has been designed to assess the technical efficiency of sha in andalusia . In terms of probability, sha 29 is the most efficient being, on the contrary, sha 22 very inefficient . 73% of analysed sha have a probability of being efficient (pe)> 0.9 and 18% <0.5 . Kdd techniques make the transfer of information from experts to any operational model easy and results obtained from the latter improve expert s knowledge.
|
Scfe occurs in 10 per 100,000 in some regions of the united states with the incidence continuing to increase . Percutaneous screw fixation is a well - accepted treatment for this disorder for over 20 years but management of complications is not well elucidated in the literature . We describe a case where a traumatic unstable scfe that was initially treated with closed reduction and fixation with a single transphyseal screw went on to hardware failure with recurrence of the deformity . The complication was successfully treated with closed reduction and re - cannulating the fractured screw within the epiphysis and extracting it using a conical extraction screw commonly referred to as an easy out . Follow - up at 9 months demonstrates a fused physis and no signs of avascular necrosis of the femoral head . Percutaneous management of scfe screw breakage is possible utilizing specialized instruments and a precise and gentle manipulation preventing the need for more invasive treatments with their obligatory potential complications profile . Slipped capital femoral epiphysis (scfe) is a relatively common disorder of the adolescent hip affecting as many as 10 per 100,000 in some regions of the united states . The incidence is increasing with a two and a half times increase over a two decades period presumably following the current obesity epidemic observed in western countries . The slip occurs through the hypertrophic zone of the physis with the metaphysis sliding / displacing anterosuperior while the epiphysis remains held in place within the acetabulum; thus, producing a retroverted proximal femur . The true etiology of scfes is not well understood but many epidemiological risk factors have been well delineated . The average age at presentation for girls is 12 years old and for boys is 13.5 years old with boys being affected more often [58.8%]. The age at presentation is lower in those with a concurrent endocrinopathy: hypothyroidism, growth hormone deficiency, or hypogonadism being the most common . Almost 2/3 of those with a scfe have a weight greater than or equal to the ninetieth percentile for their age . [2, 6] there is a strong racial frequency: pacific islanders [4.5], african ancestry [2.2], native americans and hispanics [1.1], caucasians [1.0] indonesian - malay [0.5], and for indo - mediterranean peoples [0.1]. Scfes are unilateral in 77.7% and bilateral in 22.3% with 82% of those with a subsequent contralateral slip occurring within 18 months of the initial slip . The risk of bilaterality can be as high as 100% in those with an endocrinopathy . Additional seasonal variations with increased rates of scfes observed in northern latitudes above 40 degrees (roughly new york city) in autumn and fall suggests a more complex pathology than simple increased sheer forces in obese children . Once identified percutaneous fixation of the scfes has been a well - accepted treatment for this disorder for over 20 years . Other treatment methods including femoral neck and shaft osteotomies, open bone peg epiphysiodesis, spica casting and surgical dislocation with reduction and fixation all demonstrating varying degrees of good results . Single screw fixation of scfes using a 6.5 or 7.0 mm cannulated screw is probably the most commonly utilized technique with some surgeons preferring more robust fixation obtained with two tran - physel screws . Biomechanical testing has demonstrated that the second tran - physel screw increases the fixation stiffness by 33% at the risk of additional complications . Complications associated with percutaneous screw fixation are not uncommon and consist of pin protrusion, chondrolysis, avascular necrosis, fracture, infection, slip progression and hardware fracture . The majority of the sources that report hardware failure as a complication of percutaneous scfe pinning do not present how these cases were managed . Many simply state they did not cause a major issue with several leaving the proximal broken hardware in place . [15, 17, 19] the technique most commonly noted to address the fractured hardware was over drilling, a technique that sacrifices considerable healthy bone increasing the risk of avascular necrosis and or fracture . Consequently; we present a case where a single screw was utilized to fix an unstable scfe that experienced hardware failure at approximately 3 weeks with recurrence of the slip displacement and how we addressed the complication . We report the case of a 13-year - old boy who fell down during a skiing trip . He developed left hip pain that prevented him from weight bearing on the affected limb . The patient was caucasian, had a body mass index (bmi)<20 and no history of endocrinopathy . The patient was evaluated by an orthopaedic surgeon who diagnosed him with an acute unstable scfe and took the patient to surgery for a percutaneous in - situ fixation . The procedure was uncomplicated with appropriate center - center positioning of the screw within the head and epiphysis [fig 1a and b]. The patient returned home with his family at the conclusion of their vacation and followed up with a local orthopaedic surgeon (senior author). Initial anterior - posterior (a) and lateral (b) post - operative x - rays demonstrating proper center - center position of the transphyseal screw and minimal scfe displacement . Anterior - posterior (c) and lateral (d) x - ray demonstrating hardware failure and progression of the scfe . Initial anterior - posterior (a) and lateral (b) post - operative x - rays demonstrating reduction of the scfe and three parallel percutaneous screw fixation . At 3 weeks he was ambulating without difficulty when he developed recurrent pain and inability to weight - bear . New x - rays were obtained that demonstrated failure of the hardware with progression of the scfe displacement, with a grade 3 slip angle measured at 60 degrees [fig 1 c and d]. The patient was taken back to surgery for hardware removal and revision closed reduction and percutaneous pinning of the scfe . Surgical dislocation of the hip with hardware removal, open reduction and pinning was the also listed on the consent if the closed procedure failed . Insitu pinning and remodeling was deemed unlikely to have a successful outcome due to less then 3 years remaining until the patient turned 16 and the patient already achieving nearly the same height as his father and skeletally mature older brother . The patient was brought to the operating room and placed on a fracture table in the supine position . Under fluoroscopic guidance minimal traction was applied to the left leg through the boot harness and the leg was internally rotated so that on both ap and lateral images the long axis of the screw shaft and the distal screw fragment within the epiphysis were co - axial . A guide wire was then threaded back through the screw allowing the cannulated screw driver to be easily seated within the screw head and the proximal screw fragment was removed . A cannulated conical extraction screw (synthes (r) screw extraction set) commonly referred to as an easy out device (fig 3) was then inserted over the guide - wire into the fractured distal screw fragment within the epiphysis through tract left after the removal of the proximal screw fragment . The sharp reversed threads of the of the conical extraction screw / easy out allows this device to gain purchase in the fractured screw fragment and then back the screw fragment out . Once the screw fragment was removed from the epiphysis three trans physeal 7.0 mm screws were placed for improved fixation strength of the scfe . (b) standard screws advance with clockwise rotation so having the conical extraction screw / easy out reverse threaded advancement is with a counter - clockwise motion and as it grips the fractured screw fragment it will reverse or back out the standard clockwise threaded screw fragment . At 2 weeks post - op the patient had all restrictions lifted and returned to normal activities without pain . Follow - up at 9 months demonstrated a fused physis and no signs of avascular necrosis of the femoral head . With obesity epidemic in westernized countries and the growing population of children participating in high impact activities the current increased rate of scfes should not be expected to plateau in the near future . [2, 6,20] as a result; those orthopaedic surgeons who treat pediatric patients need to be well versed in the treatments of scfes as well as the management of the complications that can occur with each treatment . Developing a diverse set of approaches is invaluable to getting the best possible result for each patient . The case presented here reviews a technically challenging technique for the removal of retained fractured hardware from the epiphyseal fragment of a scfe while maintaining as much native bone stock as possible . The original center - center position of the trans - physeal screw allowed for optimal purchase in the distal fragment but when the screw failed the optimal position for fixation had been violated, compromising repeat fixation in this area . Additional fixation was needed in the surrounding intact bone but the retained fractured hardware could potentially adversely affect the placement of the new hardware . So removal of the screw fragment was deemed necessary . If the screw had failed but the physis had fused or not displaced leaving the fragment in place could have been considered . The initial fixation in this case was ideal, with placement of a single percutaneous screw in the center - center position of the epiphysis . However; in this case the fixation was insufficient to control the sheer forces across the physis with loading during weight bearing . The literature supports the use of a single percutaneous screw vs multiple screws for the stabilization of scfe s, secondary to an increased risk of iatrogenic injury with the multiple screw approach . Removing a cannulated screw from a scfe can have a complication rates greater than 50% in some reports . The difficulties seem to stem from the use of partially threaded screws which once threaded in the hip and left for a period of time have their thread tracts encroached upon by the surrounding bone, leaving the screw with no way to be backed out . [12, 19] with titanium screws the bio - compatibility allows for even greater osseous integration at the bone screw interface to the point where the torque / force imparted to the screw during attempted removal can result in screw breakage . It is a presumed understanding of this potential complication and the desire to facilitate the removal of the hardware in the future that led the primary surgeon s decision to utilize a fully threaded screw . The bending strength of a rod is proportional to the radius to the 4th power so small reductions in the radius between a fully threaded screws core radius and a shank radius on a partially threaded screw can produce significant bending and sheer strength differences . The biomechanical studies have shown that there is a 33% increase in the construct strength when 2 screws are utilized but no additional proportional increase with 3 or more screws . However, karol et al s study was performed in bovine femurs without any potential cavity defect within the epiphysis . It was our assertion that with the failure of the primary fixation and repeat slip the bone within the center of the epiphysis would have been compromised would no longer provide adequate fixation and multiple additional point of fixation would be needed around the periphery of the epiphysis . Consequently; 3 screws were utilized in a fashion similar to that commonly used for femoral neck fractures . Two points for further study would: 1) to try and define at what absolute body weight or bmi is an additional 33% fixation stiffness (2nd screw) needed to prevent cut - out or hardware failure and 2) what screw number and configuration is optimal in a simulated revision setting where the central area of the epiphysis has a cavitry lesion . Percutaneous management of scfe screw breakage is possible utilizing specialized instruments and a precise and gentle manipulation preventing the need for more invasive treatments with their obligatory potential complications profile . It is important to remember to approach new problems with an open mind . If it is possible to reach a goal with a delicate finesse technique through an indirect approach this may be in the patient s best interest or at least worth the attempt before committing to the more invasive procedure.
|
Certain parts of the alveolar ridge are sensitive to the pressure of hard prosthetic materials, due to thin overlying mucosa.1 when the shock absorbing behaviour of mucosa is diminished, masticatory impact forces are directly transmitted to the underlying tissue . As a result, there is an increased burden on the residual ridges.2 soft lining materials are able to form an absorbing layer on the part of denture in contact with the oral mucosa and this allows less traumatic occlusal force transmission.1 these properties make soft denture lining materials useful for treating patients with ridge atrophy or resorption, bony undercuts, bruxing tendencies, congenital or acquired oral defects, xerostomia and dentures opposing natural dentition.3 the result is that wearing the complete prosthesis becomes more comfortable for the patient . Contemporary elastic materials are used for short and long term application in the oral cavity and are divided into acrylic and silicone types . Depending upon polymerization techniques, these can be further divided into room temperature and high temperature polymerizing resilient denture liners.1 the resilient lining materials present problems during clinical use, such as weakening of bond between lining and denture, loss of resiliency, colour alterations, and porosity . The loss of resiliency may be due to the leaching out of the plasticizer and other components.4 simultaneously water is absorbed until equilibrium is reached thereby, increasing surface roughness of the resilient denture liners.5 it has been seen that rougher surfaces enhance adhesion of microorganisms onto resilient lining materials and may allow fungal growth.6 patients using removable prosthetic restorations lined with an elastic material should, therefore, carry out regular cleansing procedures to prevent such infection.1 denture plaque control using mechanical and chemical methods is essential for maintenance of good oral hygiene of denture wearers.7 however, mechanical cleansing (brushing) is not advisable for soft denture liners since it can damage the resilient lining.8 chemical cleansing by denture cleansers is the first choice for denture plaque control of tissue conditioners.7 the solutions used for denture cleaning can be divided according to their chemical composition: alkaline peroxide, alkaline hypochlorites, acids, disinfectants and enzymes . Peroxide cleansers are the most commonly used denture cleansers.9 they are dispensed in powder or tablets forms, which become alkaline solutions of hydrogen peroxide when dissolved in water.10 hypochlorites are useful as denture cleansers because they remove stains, dissolve mucin and other organic substances and are bactericidal and fungicidal . This study was aimed to determine the effect of two chemically distinct denture cleansers and water on the surface hardness of acrylic and silicone based soft denture liners at various time intervals . The study was conducted in maharishi markandeshwar college of dental sciences and research, mullana, ambala, haryana, india . Two commonly used commercial resilient liner materials, based on their chemical composition (silicone- and acrylic - based soft liners) were selected for the study . Total of hundred and twenty cylindrical specimens were made of the dimensions 15 mm 10 mm (according to astm: d-2240 - 64t)3 with the help of a custom made metal mold (fig . Base of the mold was placed on a glass slab covered with cellophane sheet to facilitate separation of mold from the glass slab . Soft denture liners were manipulated according to manufacturer's instructions and expressed into the mold (fig . The mold was then covered from the top by a cellophane sheet and another glass slab was pressed tightly against the mold to remove excess material and to shape the specimens according to the dimensions of the mold . Once the material was set, the specimens were removed from the mold and excess was trimmed using a bp blade . Group a (control), group b (sodium hypochlorite) and group c (sodium perborate) comprising of 40 specimens each (fig . Each group was divided further into 4 subgroups: subgroup i, ii, iii and iv (consisted of 10 specimens each) to be tested at a time interval of 1 week, 1 month, 3 months and 6 months respectively . Each subgroup was again divided into two minor subgroups: minor subgroup a - consisted samples made of acrylic based soft denture liner and minor subgroup b - consisted of samples made of silicone based soft denture liner (table 2). Specimen in group a (control) were cleansed daily by rinsing with water and then were stored in artificial saliva for the entire period of the study . Specimens in group b were immersed in 0.5% sodium hypochlorite solution for ten minutes daily, rinsed in water and stored in artificial saliva at room temperature . Specimens in group c were cleansed in a solution of sodium perborate denture cleansing tablets (dissolved in 250 ml water as recommended by the manufacturer). Specimens of all 3 groups were tested at 1 week, 1 month, 3 months and 6 months time interval at central institute of plastics engineering & technology (cipet), panipat, haryana . The specimens were tested using a shore a durometer which was calibrated in accordance with astm d-2240 under the spring force of 822 gf (8.06 n) (fig . Three readings were noted for each sample and the mean of those readings was taken (table 3). These readings were then subjected to one - way anova, post hoc test and pair - t test for statistical analysis . Insignificant differences were observed in mean values of surface hardness of samples for all groups after 1 week . After 1 month highly significant changes were noted in surface hardness for acrylic samples when mean values for control group are compared to those of sodium hypochlorite group and sodium perborate group . Insignificant differences were seen in mean values between sodium hypochlorite and sodium perborate group . For silicone samples insignificant differences were seen in mean values of surface hardness between all groups at 1 month . At 3 months insignificant differences in mean values of surface hardness were seen for all groups . At 6 months insignificant differences in mean values of surface hardness of samples were seen for acrylic samples . For silicone based soft denture liners insignificant differences were seen in mean values of surface hardness of samples for all groups except between sodium hypochlorite and control group, which showed highly significant difference in mean values (table 4). In control group differences seen in mean values for surface hardness of acrylic samples at all time intervals were very significant, except between 1 week and 1 month . Also highly significant changes were noted for mean values of surface hardness of acrylic samples at all time intervals in sodium hypochlorite and sodium perborate group (table 5). Silicone samples in control group showed no significant differences in mean values for surface hardness between 1 week, 1 month and 3 months . Highly significant differences were seen between means of 6 months when compared to 1 week, 1 month and 3 months . In sodium hypochlorite group, differences in mean values were insignificant between 1 week and 1 month, and 1 month and 3 months . Highly significant differences were seen between 1 week and 3 months . At 6 months, results were highly significant in comparison to 1 week, 1 month and 3 months . In sodium perborate group mean values for silicone samples showed insignificant differences between 1 week and 1 month . Statistically significant differences were seen in mean values between all other time intervals (table 5). Comparative evaluation between silicone and acrylic samples revealed insignificant differences in mean values for surface hardness of acrylic - based and silicone - based soft denture liners in control group at 1 week . At 3 months and at 6 months highly significant differences were seen in mean values of acrylic - based and silicone - based soft denture liners in all groups indicating much better performance of silicone - based soft liners after 6 months (table 6). Currently the most commonly used materials are plasticized acrylics and silicone rubber which are either chemically or heat polymerized.10 silicone rubber material is composed of dimethyl siloxane polymer which is a viscous liquid, cross linked to provide good elastic properties . These materials excel in their resiliencies, whereas, acrylic soft resin materials are acrylic co - polymers to which plasticizers may be added . These materials may absorb water, swell and harden because of plasticizer leaching.11 this hypothesis is supported by hadary and drummond12 who evaluated two soft denture lining materials with distinct chemical composition to determine whether compositional variations manifest themselves in property differences . The results revealed that acrylic - based soft liner had higher solubility and sorption than silicone - based and on this basis concluded that silicone based products may provide better clinical success . Denture plaque control using mechanical and chemical methods is essential for maintenance of good oral hygiene of denture wearers . It has been reported that soft denture liners can be deeply penetrated by candida albicans.6 brushing (mechanical plaque control) is not advisable for resilient denture liners, because it can damage the resilient lining.9 furthermore, ultrasonic treatment is not effective for removal of denture plaque7 . This is supported by hermann et al.13 who in their study observed that mechanical brushing promoted wear abrasion of soft liners . Only chemical treatment by denture cleansers can be applied to such soft material.6 alkaline peroxide (or sodium perborate) and sodium hypochlorite denture cleansers are the most commonly used denture cleansers . Alkaline peroxide cleansers are commercially available as powder or tablets which become alkaline solutions of hydrogen peroxide when immersed in water . Sara et al.14 studied the effectiveness of denture cleansers on soft denture liners and concluded that sodium perborate denture cleanser proved to be most effective . Hypochlorites are known to have bactericidal and fungicial property and act on stains, dissolve mucin and other organic substances.10 de freitas fernandes et al.15 and ferreira et al.16 in their study concluded that the best results were found for the treatment with 0.5% naocl for 10 minutes in comparison to other cleansers . The present study was conducted for determining and comparing surface hardness of one silicone - based and one acrylic - based soft denture liner over a period of 6 months when cleansed daily . In control group, silicone - based soft denture liners have shown a few changes in surface hardness for the first 3 months but highly significant changes were observed in surface hardness at 6 months, whereas, acrylic - based soft denture liners showed minor changes in surface hardness for 1 month, after which they showed significant increase in surface hardness at all time intervals . These results are supported by mese and guzel5 who evaluated the effect of storage duration on the hardness and tensile bond strength of 2 acrylic resin - based and 2 silicone - based resilient liners . They concluded that after 6 months hardness values of all resilient liners evaluated were higher with increased duration of immersion . The hardness values of acrylic resin - based liners showed greater change than those of silicone products . In sodium hypochlorite group, highly significant increase in surface hardness was noticed for acrylic samples for all time intervals . In case of silicone samples, increase in surface hardness was insignificant between 1 week and 1 month, and 1 month and 3 months, however, highly significant changes were seen between 1 week and 3 months . At 6 months results were highly significant in comparison to 1 week, 1 month and 3 months . In sodium perborate group, acrylic - based soft liners showed highly significant increase in surface hardness at all time intervals . In case of silicone samples highly significant increase in surface hardness was seen at all other time intervals at 1 week, all samples showed insignificant change in surface hardness for control, sodium hypochlorite and sodium perborate group . At 1 month sodium hypochlorite and sodium perborate were seen to have highly significant affect on surface hardness of acrylic samples as compared to control group, whereas, silicone based soft liners showed insignificant changes in surface hardness in control, sodium hypochlorite and sodium perborate group . This result is supported by the findings of broek et al.1 who determined the effect of storage in disinfectants and artificial saliva on a series of commercial soft lining materials for dentures . It was observed that the acrylic materials became less elastic on storage for up to 28 days whereas the silicone materials showed no change in elastic properties, irrespective of cleansing treatment . At 3 months, no significant change was seen in surface hardness values of acrylic and silicone samples for control, sodium hypochlorite and sodium perborate group, but at 6 months sodium hypochlorite has shown highly significant increase in surface hardness of silicone samples in comparison to control group, whereas, sodium perborate has not shown any significant changes in comparison to control group and sodium hypochlorite group . In case of acrylic based soft denture liners, these results are supported by goll et al.17 who in their study concluded that sodium hypochlorite denture cleansers caused more damage to surface properties of soft liners than sodium perborate denture cleansers . The present study is also in accordance with the study conducted by mante et al.18 who evaluated in vitro changes in hardness of four sealed resilient lining materials and revealed that immersion in alkaline peroxide denture cleanser showed only a mild effect on the hardness of the soft reline agents . Acrylic based soft liners showed highly significant increase in surface hardness than silicone - based soft liners for sodium hypochlorite and sodium perborate groups, but, no significant differences were observed for control group at 1 week and 1 month . After 3 months and 6 months, among both the soft liners tested in the study, silicone -based soft liners performed significantly better than acrylic - based soft liners for all groups . Similar results were obtained in study by mancuso et al.19 tested hardness and color stability of liner materials based on acrylic resin and silicone after 2000 thermal cycles . It was concluded that hardness of silicone soft liners was less affected than acrylic resin - based liners . All the materials tested in the study showed an increase in surface hardness with time irrespective of the cleansing method . However, no significant difference was observed among control, sodium hypochlorite and sodium perborate groups . Overall results indicated that silicone - based soft denture liners performed significantly better than acrylic - based soft denture liners . The nutrient - rich environment of the oral cavity does not fully match the in vitro nature of the present study . Therefore, the behavior of denture lining materials in this study may only partially predict the clinical performance . Despite increasing usage of soft liners in prosthetic dentistry and the importance of cleansing to prevent cross contamination, factors such as absorption and solubility, roughness, bond strength, color stability and viscoelastic properties need to be further investigated to define the best cleansing procedure for these materials . Within the limitations of this study, it can be concluded that chemical denture cleansers can be used daily to cleanse soft denture liners without adversely affecting their surface hardness . Silicone - based soft liners showed better compatibility with cleansing solutions and maintained their resiliency better thereby, proving to be more promising for long term usage.
|
This study aims to model the financial benefits of implementing an electronic medical record (emr) system for hospitals in low - income settings . To date the limited attention given to analyzing financial soundness has been couched solely in high - income settings . We quantify three areas of significant potential cost savings of an emr system based on non - emr data from a hospital in lilongwe, malawi: (1) length of stay; (2) transcription time; and (3) laboratory use . Advocates of the use of emr in low - income settings have primarily emphasized their potential to improve quality of care,1 benefits that mainly accrue to patients and the community . However, these benefits are realized at a significant cost to healthcare organizations; these costs are cited as a primary barrier to adoption of emr in the usa, and represent a more significant obstacle in low - income settings.2 so far, there has been little consideration of the financial benefits of emr in the literature, much less their potential cost savings in low - income settings . In this paper we present a prospective analysis of some of the main categories in which a hospital - wide emr system could generate financial benefits in a low - income setting, modeled on an emr system in development in a hospital in lilongwe, malawi . While there is interplay between clinical and financial outcomes, analyses of emr in low - income settings emr in these settings have been shown to reduce wait times and medication order errors.3 financial analyses of emr systems in high - income countries have identified cost savings due to reductions in transcription and chart pulling, drug expenditures and adverse drug events, more efficient laboratory and radiology testing, and more accurate billing.2 49 these savings can be classified as either non - personnel related, such as meals, which will generate immediate savings, or personnel costs, such as transcription time, which will not be realized immediately . The distinction between high - income and low - income settings is important because the impact of an emr system is a function of factors such as resource availability, scale, and existing inefficiencies in the paper - based workflow . For example, an emr in lilongwe must adapt to low computer literacy rates, limited healthcare budgets, inadequate staffing, electric power disruptions, and inadequate security, none of which are significant challenges in the usa.10 these differences are all likely to contribute to a very different financial scenario for an emr in a low - income setting . For example, financial benefits due to reductions in malpractice premiums and insurance reimbursement are more relevant in the usa, while reductions in drug stockouts are a more significant consideration in malawi . This paper adds to the emr valuation literature by considering the financial, rather than clinical, benefits of an emr system in a low - income, rather than a high - income, setting . Baseline information about the paper - based system in the lilongwe hospital was paired with estimated cost savings from analyses of emr in western hospital settings . In the absence of comparable data from low - income settings when multiple studies have been found we have used the most modest improvements to maintain the conservative nature of the model . Throughout, there is an emphasis on the economies of scale of this emr system; each component of the emr generates benefits beyond the immediate department . Kamuzu central hospital (kch), located in lilongwe, malawi, is a government - operated tertiary referral hospital with 710 beds ., it treated 275 880 patients, with an average bed occupancy of 83%.11 kch employs 176 physicians and clinical officers (similar to nurse practitioners) and 262 nurses . The hospital has long - standing shortages of both staff and supplies,12 factors that affect how fully the benefits of an emr system are realized . Resource constraints are relevant to this analysis because they affect the ability of the hospital to capture the financial benefits; non - personnel savings are naturally more easily realized than personnel - related savings, and this difference is compounded by the existing staff shortages . For example, the hospital complement is supposed to have 532 nurses, indicating a shortage of over 50% in 2010.13 these issues are compounded by similar shortages in surrounding health centers, which increase the number of patients seeking treatment at kch and the amount of primary care that is provided . In 2001 the non - governmental organization baobab health trust implemented a prototype of the emr in operation at kch.14 over the following decade the emr was iteratively developed, beginning with a pediatric module and expanding to include patient registration, radiology, laboratory specimen management, inpatient admission / discharge, and chronic disease management for hiv / aids and non - communicable diseases.15 16 additional modules currently under development include a laboratory management system, and computerized provider order entry for ordering medications . The kch emr has approximately 70 touchscreen clinical workstation appliances (workstations) deployed at the point of care in the ambulatory setting that enable health workers to retrieve medical records using barcode scanners.16 two central servers within kch store the emr data on a local network supported by a centralized power backup system . We estimated a one - time cost for the full implementation of all modules of the emr that included initial software configuration to accommodate clinical workflow, followed by routine operating costs such as electricity and consumables . A 2010 internal analysis identified 13 potential areas of cost savings from the emr system at kch.11 we attempted to re - analyze in greater detail the four areas with the largest potential benefit: length of stay; transcription time; adverse drug events; and laboratory use . We collected data from several departments to quantify a baseline under the paper - based system . The hospital administration provided data on patient volume and length of stay, the laboratory supplied data on test volume and supply orders, and interviews with staff such as nurses and clinical officers gave insight into the daily workflow . We chose to exclude the category of adverse drug events from this analysis, as we did not have the data to support this initial study; we are currently independently studying this category in more detail . Costs and projected savings are modeled in us$. We chose the hospital as the unit of analysis to capitalize on the returns to scale of the emr system and account for the relationships among the different hospital departments . Furthermore, because the decision to invest in an emr system was made at the hospital level, and its sustainability is the responsibility of the ministry of health, it seemed relevant to analyze the effect of the emr system on the hospital's budget . However, it is also possible to extend the theory that economies of scale are important in realizing the financial benefit of emr and analyze potential financial benefits at a higher level of organization, such as at the district, zonal, and national levels . For example, one of the natural consequences of an emr is the collection of large amounts of data . These data can easily be aggregated to generate routine reports required by the ministry of health, and thus additional cost savings may also be realized at higher levels . In the usa, a business case analysis conducted by kaiser permanente estimated that approximately 35% of net benefits identified from the introduction of an emr are attributable to a reduction in the average length of stay resulting from efficiency gains.17 electronic communication of orders and results between clinical and ancillary departments (laboratory, radiology, pharmacy) are cited as a driver of efficiency gains.18 evidence of the impact of emr on hospital length of stay varies widely . An early study conducted on an internal medicine service in a large urban hospital in the usa showed a 0.89 day (10.5%) reduction in length of stay resulting from electronic ordering.19 the government accountability office benchmark for length of stay reduction associated with an emr is 30%.18 thus far, we have found no study measuring the impact of emr on length of stay in a low - income setting . Length of stay at kch averaged 4.82 days in 201011, but varied significantly by ward . For example, the male surgical ward averaged 18.6 days per stay, while it was only 2.18 days in the maternity ward . Our analysis includes all non - paying inpatient wards at kch . While there are challenges that contribute to length of stay that the emr system may not directly benefit, such as pharmaceutical and blood shortages, communication lapses also contribute to longer stays in the hospital; for example, if a patient's laboratory results are ready but have not been picked up in time for rounds, the patient stays admitted until the next opportunity for rounds, which may be 23 days due to limited rounding at the weekend (b. gondwe, personal communication, 2012). To maintain the conservative nature of this model, we assumed a 10.5% reduction in length of stay for inpatients and consider only cost savings associated with meal provision and time saved for clinical staff . The hospital provides meals to a patient at a cost of malawi kwacha 350, or approximately us$1.75, per day . In calculating a reduction in nurse and clinician time required we assume that approximately 60% of their time is spent managing inpatients (t. bui, personal communication, 2012). Transcription activities are those that involve transferring information from one place to another . In the usa, emr systems have been found to reduce transcription time by 2850%, largely through the partial elimination of dictation.2 18 dictation is not a relevant part of the kch workflow, but medical staff spend a significant amount of time engaged in indirect care, defined as discussing cases with colleagues, reading and writing patient charts, and prescribing medications.20 time is also spent in the compilation of mandatory reports for the ministry of health, admission registration, and chart creation . A study of three hiv clinics in uganda found that providers spent approximately 34% less time during the workday engaging in indirect patient care after the implementation of an emr system.20 a similar study at a rural health center in kenya found a two - thirds reductions in inter - clinic personnel contact time as a result of the implementation of the mosoriot medical record system.21 anecdotal evidence of the time burden of indirect care under a paper - based system is provided for hospital antiretroviral therapy clinics in ethiopia, where providers cite the excessive time spent in activities such as error checking with pharmacists and consultations with laboratory technicians.22 based on interviews conducted in 2010, we estimated that doctors, laboratory technicians, nurses and some administrative staff spend approximately 1 h per working day on transcription.11 the integration of barcodes and label printing into the emr system reduces transcription time by eliminating the need to write information that has previously been entered elsewhere in the system . We attribute a reduction of 17 min per employee per working day (28%) in transcription time to the emr system . Laboratory data are involved in 70% of medical diagnoses and can significantly affect the success and cost of patient treatment.23 in the usa, emr have been found to reduce test orders by 715%.2 24 some of this reduction is attributed to improved access to health records; it has been estimated that 13.7% of laboratory tests are ordered because of lack of access to earlier results.25 the hiv / aids pandemic has triggered investment in laboratory capacity building with some emphasis on information systems to improve laboratory workflow in several low and middle - income countries, including cte d'ivoire, haiti, malawi, peru, rwanda, south africa, vietnam and zambia.2629 however, for the benefits of information systems in this setting to be fully realized the management of laboratory information must extend beyond the walls of the laboratory, starting at the point the clinician requests the laboratory investigation and finishing at the time the clinician makes a decision based on the test result.27 smaller health centers must send specimens to centralized laboratories for tests to be completed, further complicating the process and creating additional delays . The increasing dependence on expensive pcr testing in hiv management in malawi means that more laboratory testing needs to be centralized.30 the 11-step process and associated information management challenges of centralized laboratory testing for early infant diagnosis of hiv has been described in this context.26 benefits resulting from the use of information systems to support the management of laboratory information have been demonstrated in low - income countries such as zambia and rwanda, commonly finding a reduction in turnaround time and fewer results that do not reach clinicians.28 31 a 65% reduction in the delay of accessing tuberculosis results as well as the detection of duplication of laboratory testing has been demonstrated in peru.32 in this model we limit cost savings from the emr system to benefits realized in two areas: fewer samples redrawn due to better labeling, and fewer tests ordered due to improved access to past test results . A study examined 3549 samples sent to the kch laboratory for testing during a 4-week period, identifying whether they were correct and complete or needed to be redrawn; if the latter, the reason(s) the sample was inadmissible were recorded.33 overall, 18% of samples sent to the laboratory were discarded due to paperwork and labeling errors . Similar challenges associated with incomplete laboratory request forms and associated wastage and delays in processing laboratory specimens have been described in south africa.34 while an emr system should completely eliminate documentation and labeling errors, the model assumed a 50% reduction in wasted samples due to documentation and labeling problems . Improving clinicians access to medical history, specifically recent laboratory tests, should reduce the number of duplicate tests ordered . We make the conservative assumption that an emr would reduce the number of tests conducted at kch by 7% . Based on information provided by the kch laboratory, we estimated the cost of a sample to be us$1, and the cost of the test to be us$3; both figures account for employee time and materials . The investment cost of the emr system is calculated at us$337 847, and includes hardware, software configuration, project management, installation and training; these costs are outlined in table 1 . In representing the costs of the comprehensive emr system implementation, we excluded software development costs because the software is freely available and open source.16 while the level of emr deployment at kch is significant (approximately 70 workstations), costs described here are not incremental and assume no existing infrastructure . Costs are extrapolated from the actual installation of the emr system at kch, and include 151 workstations and two servers . Each workstation included a touchscreen computer, label printer, and barcode scanner . The hardware, network electronics and power backup system are described in detail in a previous publication.16 project management cost is an estimated 1 year salary for a local project manager who coordinates the system implementation . Training includes the costs for providing half - day training sessions for clinical staff who will use the emr, and salary for local software support staff who provide training full time for an estimated 6 months during emr implementation . Installation includes the cost of a team of three local hardware technicians who install all system hardware over a period of 4 weeks . Software configuration includes 1 month of salary for one local software support staff and one software developer who configure the software modules to support the clinical workflow within each point - of - care setting . The yearly operating costs are estimated to be us$29 824, and include consumables (eg, labels) (us$9258), electricity (us$9656), hardware and software maintenance (us$5910), and recurrent training (us$5000). In year 3, the operating cost is higher (us$47 424) due to the cost of replacing the batteries (us$17 600). Investment costs for the emr system at kch emr, electronic medical record; kch, kamuzu central hospital . The benefits and costs outlined here are summarized over time in table 2, and the 5-year financial outlook is shown in table 3 . To maintain the conservative nature of this analysis, we assume that no benefits are realized in the first 6 months of use . This choice recognizes that benefits of the emr will accrue gradually, and that any initial efficiency improvements are likely to be offset by productivity losses . Costs and benefits are discounted on a yearly basis at a 5% annual percentage rate, the assumed cost of capital for the hospital . Five - year return on emr implementation * discounted yearly at 5% to reflect the cost of capital . The estimated reductions in the various categories are determined based on a mixed - methods approach, using the existing (western) literature, data from kch, and interviews with kch administration and staff . In table 4 we present variations on the assumptions in table 3 to examine how the financial outlook changes when the benefits vary . First, we examine how the outlook changes when we assume only half of western the reductions identified in emr in the model . Second, because savings associated with consumables are more quickly realized than those associated with personnel, we distinguish between personnel and non - personnel cost savings by removing personnel cost savings from our original analysis . In the usa, a business case analysis conducted by kaiser permanente estimated that approximately 35% of net benefits identified from the introduction of an emr are attributable to a reduction in the average length of stay resulting from efficiency gains.17 electronic communication of orders and results between clinical and ancillary departments (laboratory, radiology, pharmacy) are cited as a driver of efficiency gains.18 evidence of the impact of emr on hospital length of stay varies widely . An early study conducted on an internal medicine service in a large urban hospital in the usa showed a 0.89 day (10.5%) reduction in length of stay resulting from electronic ordering.19 the government accountability office benchmark for length of stay reduction associated with an emr is 30%.18 thus far, we have found no study measuring the impact of emr on length of stay in a low - income setting . Length of stay at kch averaged 4.82 days in 201011, but varied significantly by ward . For example, the male surgical ward averaged 18.6 days per stay, while it was only 2.18 days in the maternity ward . Our analysis includes all non - paying inpatient wards at kch . While there are challenges that contribute to length of stay that the emr system may not directly benefit, such as pharmaceutical and blood shortages, communication lapses also contribute to longer stays in the hospital; for example, if a patient's laboratory results are ready but have not been picked up in time for rounds, the patient stays admitted until the next opportunity for rounds, which may be 23 days due to limited rounding at the weekend (b. gondwe, personal communication, 2012). To maintain the conservative nature of this model, we assumed a 10.5% reduction in length of stay for inpatients and consider only cost savings associated with meal provision and time saved for clinical staff . The hospital provides meals to a patient at a cost of malawi kwacha 350, or approximately us$1.75, per day . In calculating a reduction in nurse and clinician time required we assume that approximately 60% of their time is spent managing inpatients (t. bui, personal communication, 2012). Transcription activities are those that involve transferring information from one place to another . In the usa, emr systems have been found to reduce transcription time by 2850%, largely through the partial elimination of dictation.2 18 dictation is not a relevant part of the kch workflow, but medical staff spend a significant amount of time engaged in indirect care, defined as discussing cases with colleagues, reading and writing patient charts, and prescribing medications.20 time is also spent in the compilation of mandatory reports for the ministry of health, admission registration, and chart creation . A study of three hiv clinics in uganda found that providers spent approximately 34% less time during the workday engaging in indirect patient care after the implementation of an emr system.20 a similar study at a rural health center in kenya found a two - thirds reductions in inter - clinic personnel contact time as a result of the implementation of the mosoriot medical record system.21 anecdotal evidence of the time burden of indirect care under a paper - based system is provided for hospital antiretroviral therapy clinics in ethiopia, where providers cite the excessive time spent in activities such as error checking with pharmacists and consultations with laboratory technicians.22 based on interviews conducted in 2010, we estimated that doctors, laboratory technicians, nurses and some administrative staff spend approximately 1 h per working day on transcription.11 the integration of barcodes and label printing into the emr system reduces transcription time by eliminating the need to write information that has previously been entered elsewhere in the system . We attribute a reduction of 17 min per employee per working day (28%) in transcription time to the emr system . Laboratory data are involved in 70% of medical diagnoses and can significantly affect the success and cost of patient treatment.23 in the usa, emr have been found to reduce test orders by 715%.2 24 some of this reduction is attributed to improved access to health records; it has been estimated that 13.7% of laboratory tests are ordered because of lack of access to earlier results.25 the hiv / aids pandemic has triggered investment in laboratory capacity building with some emphasis on information systems to improve laboratory workflow in several low and middle - income countries, including cte d'ivoire, haiti, malawi, peru, rwanda, south africa, vietnam and zambia.2629 however, for the benefits of information systems in this setting to be fully realized the management of laboratory information must extend beyond the walls of the laboratory, starting at the point the clinician requests the laboratory investigation and finishing at the time the clinician makes a decision based on the test result.27 smaller health centers must send specimens to centralized laboratories for tests to be completed, further complicating the process and creating additional delays . The increasing dependence on expensive pcr testing in hiv management in malawi means that more laboratory testing needs to be centralized.30 the 11-step process and associated information management challenges of centralized laboratory testing for early infant diagnosis of hiv has been described in this context.26 benefits resulting from the use of information systems to support the management of laboratory information have been demonstrated in low - income countries such as zambia and rwanda, commonly finding a reduction in turnaround time and fewer results that do not reach clinicians.28 31 a 65% reduction in the delay of accessing tuberculosis results as well as the detection of duplication of laboratory testing has been demonstrated in peru.32 in this model we limit cost savings from the emr system to benefits realized in two areas: fewer samples redrawn due to better labeling, and fewer tests ordered due to improved access to past test results . A study examined 3549 samples sent to the kch laboratory for testing during a 4-week period, identifying whether they were correct and complete or needed to be redrawn; if the latter, the reason(s) the sample was inadmissible were recorded.33 overall, 18% of samples sent to the laboratory were discarded due to paperwork and labeling errors . Similar challenges associated with incomplete laboratory request forms and associated wastage and delays in processing laboratory specimens have been described in south africa.34 while an emr system should completely eliminate documentation and labeling errors, the model assumed a 50% reduction in wasted samples due to documentation and labeling problems . Improving clinicians access to medical history, specifically recent laboratory tests, should reduce the number of duplicate tests ordered . We make the conservative assumption that an emr would reduce the number of tests conducted at kch by 7% . Based on information provided by the kch laboratory, we estimated the cost of a sample to be us$1, and the cost of the test to be us$3; both figures account for employee time and materials . The investment cost of the emr system is calculated at us$337 847, and includes hardware, software configuration, project management, installation and training; these costs are outlined in table 1 . In representing the costs of the comprehensive emr system implementation, we excluded software development costs because the software is freely available and open source.16 while the level of emr deployment at kch is significant (approximately 70 workstations), costs described here are not incremental and assume no existing infrastructure . Costs are extrapolated from the actual installation of the emr system at kch, and include 151 workstations and two servers . The hardware, network electronics and power backup system are described in detail in a previous publication.16 project management cost is an estimated 1 year salary for a local project manager who coordinates the system implementation . Training includes the costs for providing half - day training sessions for clinical staff who will use the emr, and salary for local software support staff who provide training full time for an estimated 6 months during emr implementation . Installation includes the cost of a team of three local hardware technicians who install all system hardware over a period of 4 weeks . Software configuration includes 1 month of salary for one local software support staff and one software developer who configure the software modules to support the clinical workflow within each point - of - care setting . The yearly operating costs are estimated to be us$29 824, and include consumables (eg, labels) (us$9258), electricity (us$9656), hardware and software maintenance (us$5910), and recurrent training (us$5000). In year 3, the operating cost is higher (us$47 424) due to the cost of replacing the batteries (us$17 600). Investment costs for the emr system at kch emr, electronic medical record; kch, kamuzu central hospital . The benefits and costs outlined here are summarized over time in table 2, and the 5-year financial outlook is shown in table 3 . To maintain the conservative nature of this analysis, we assume that no benefits are realized in the first 6 months of use . This choice recognizes that benefits of the emr will accrue gradually, and that any initial efficiency improvements are likely to be offset by productivity losses . Costs and benefits are discounted on a yearly basis at a 5% annual percentage rate, the assumed cost of capital for the hospital . Five - year return on emr implementation * discounted yearly at 5% to reflect the cost of capital . The estimated reductions in the various categories are determined based on a mixed - methods approach, using the existing (western) literature, data from kch, and interviews with kch administration and staff . In table 4 we present variations on the assumptions in table 3 to examine how the financial outlook changes when the benefits vary . First, we examine how the outlook changes when we assume only half of western the reductions identified in emr in the model . Second, because savings associated with consumables are more quickly realized than those associated with personnel, we distinguish between personnel and non - personnel cost savings by removing personnel cost savings from our original analysis . The calculations presented compare the known costs of deploying an emr system with a conservative estimate of its cost savings . A breakdown of the annual cost savings is shown in table 2 . Given 43 484 inpatients with an average length of stay of 4.82 days, a 10.5% reduction in length of stay would save us$128 645 in food and personnel costs per year . Reducing transcription time by 17 min (28%) each workday for all doctors, laboratory technicians, nurses and some administrative employees the reductions in laboratory samples and duplicate tests would save the hospital us$91 187 each year . The benefits from reductions in length of stay, transcription, and laboratory samples are estimated at us$284 395 per year . The yearly financial return for the first 5 years of use is shown in table 3 ., the emr pays for itself in less than 3 years, and over a 5-year period the hospital saves us$613 681 . This model serves as a proof of concept that emr can have financial, in addition to clinical, benefits in low - income settings . These results highlight the coupled nature of clinical and financial outcomes, as well as the more general relationships among various hospital departments . Despite initially juxtaposing the clinical and financial impacts of emr in motivating this research for example, improvements in length of stay due to an emr, while generating cost savings for the hospital, should raise the quality of care . The financial benefits build upon the natural economies of scale associated with expanding an emr across all departments of the hospital . For example, installing the emr laboratory system reduces length of stay in the inpatient wards by improving diagnostic efficiency and the communication of pre - surgical laboratory tests . The significant correlation among these areas, due to their tight relationships in providing care, is why this analysis focused only on small pieces of each category . For example, food and personnel costs were the only considerations in calculating length of stay savings, ignoring the contributions of other departments such as laboratory, radiology and pharmacy . The goal of this paper was to examine the financial impact of an emr system in a low - income setting . Even with discount rates as high as 31%, the break - even point would be realized in the third year of use, which is important given that discount rates in low - income settings tend to be higher than those in high - income areas.35 the list of financial benefits modeled is not comprehensive, suggesting that this estimate represents a lower bound on the financial return of this emr system . Furthermore, this analysis does not consider factors such as the residual value of the equipment . Other previously cited benefits, such as chart handling and more efficient drug procurement, are also likely to be realized at kch, but adequate data did not exist to explore these categories . To avoid overlap and maintain the conservative nature of this analysis, the results suggest that over a relatively short time horizon the emr system generates cost savings for the hospital, the equivalent of the annual salaries of over 70 physicians . The next natural step is to analyze each of these areas in more detail, acknowledging the relationships among them and collecting more data to quantify these benefits better . These results can be aggregated to the level of the hospital, and can take advantage of the implementation of the emr modules currently in development . By acknowledging the complexity of categories such as length of stay and laboratory testing, the benefits of an emr system in a low - income setting such as kch will be more clearly articulated . While we believe the role and the effects of emr systems are different in low - income and high - income country settings, table 4 examines the robustness of our findings to other sets of assumptions . To permit better comparison, the break - even month is calculated, assuming that the annual savings and costs are realized in equal monthly increments . Over 5 years scenario 1 presents the financial analysis conducted earlier in this paper . In acknowledgement that the assumed reductions may not be realized at kch, scenario 2 assumes that kch realizes only half of the reductions; a net financial gain from the emr system is realized during the fourth year after implementation . Finally, in scenario 3 we distinguish between personnel cost savings and non - personnel cost savings by focusing on the latter . Non - personnel cost savings, such as a reduction in food expenses due to shortened length of stay, are more easily realized than personnel cost savings, such as a reduction in transcription, which imply a reduction in the work force necessary to provide the same level of service . Kch, like other health facilities in the area, faces a long - standing staff shortage . Therefore, while it may not be feasible to reduce the existing staff level, or hire additional staff, the emr would allow employees to be repositioned into critical, currently unfilled roles within the ministry of health . In this way, the savings in length of stay, transcription time, and laboratory use can be thought of as a reduction in the staff time required to perform the same level of care, thus allowing that saved time to be redirected to other tasks currently affected by the staff shortage . Ignoring personnel costs significantly lowers the 5-year value of the emr system, and profit is not realized until the fifth year of implementation . The results of this prospective analysis suggest that emr can be financially sound investments in low - income settings . It strove to be conservative enough in its assumptions to serve as a lower bound estimate of the financial impact of this system and required simplification of the contributing factors to avoid overlap; more comprehensive analyses of each component are planned . This paper provides a framework for these further studies, which can improve the model by substituting its assumptions for evidence; this model can also be applied to cost savings analyses of emr in other low - income hospital settings . Understanding the benefits of emr in low - income settings is a burgeoning area of research that so far has focused on the clinical effects, but the adoption of emr in any setting also depends on articulating the financial soundness of the initial investment . Although this means that implementing an extensive emr system would require a long - term approach to budgeting, the timing of such an undertaking may be right; the objectives of the 2011 malawi health sector strategic plan reflect a similarly long time - horizon and articulate goals that overlap well with the known strengths of emr . These aims included interest in systems for laboratory information, revenue management, continuous monitoring and evaluation, and improved vital registration.36 these results suggest that the dialogue surrounding emr in low - income settings should focus on how, rather than whether, to make these investments.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.