text
stringlengths 0
868k
|
|---|
Infantile postural asymmetry (far better known as congenital muscular torticollis) is characterised predominantly by asymmetric movement patterns, such as trunk convexity and unilateral restriction in head turning1,2,3 . To direct the focus on the trunk, the designation infantile postural asymmetry the expected cause of infantile postural asymmetry is an intrauterine - acquired asymmetric fixation, possibly modified by mechanisms throughout birth4, 5 . The prevalence of this idiopathic form of infantile postural asymmetry is estimated to be 1525%6,7,8 . Since 1992 infantile postural asymmetry and plagiocephaly have become more frequent2, 4 due to the launch of the back to sleep campaign to reduce the risk of sudden infant death . The symptomatic form due to neuromuscular and skeletal disorders is fairly rare1, 9 . Infantile postural asymmetry occurs frequently with additional asymmetric features, such as hip dislocation, subluxation of the atlanto - axial joint, shortening of the sternocleidomastoid muscle, strabism and deformational plagiocephaly3, 5, 9, 10, 13 . To allow for unrestricted symmetric movements and to prevent a fixed torticollis, scoliosis and head deformity, there are different methods with are based largely on empirical evidence and supported by few studies; they include stretching, positioning, handling, physical, manual and microcurrent therapy8, 11,12,13,14 . There is also a randomised trial which supports the therapeutic efficacy of osteopathic treatment15 . In many countries neurodevelopmental treatment (ndt) and vojta therapy are used for the treatment of infantile asymmetry3, 5, 16 . However, there have not yet been any therapeutic trials in infants with postural asymmetry for these approaches . To evaluate the efficacy of vojta therapy versus ndt in infants with postural asymmetry, we performed a randomised controlled trial (rct) using a standardised video - based asymmetry scale2, 17 . This study was carried out from 2008 to 2012 at the centre of developmental neurology, frankfurt, germany . All local paediatricians were asked to refer infants with postural asymmetry and a post - term age of six to eight weeks . Eligible for study participation were otherwise healthy infants who had an asymmetry score of at least 12/24 points diagnosed by a paediatrician, had not yet been treated for their asymmetry and had had a pregnancy duration of at least 32 weeks2 . In addition, their parents had to provide written informed consent and had to have basic knowledge of the german language . Infants with an extreme pelvic obliquity (icd-10 m 95.5), which does not allow evaluation of the spine in the supine position, were excluded from the study . Furthermore infants were excluded from this study if they had significant underlying diseases or a treatment before or during the study according to other concepts . The study protocol was approved by the ethical committee of the martin luther university (mlu) halle - wittenberg and the hessen state chamber of physicians, germany (approval number mc 95/2008). A comparative study of vojta therapy against placebo was not allowed for ethical reasons because vojta therapy is an officially recognized treatment modality for infant asymmetry in germany and paid by health insurance . After written informed consent was obtained and the caregivers agreed to publication, the eligible infants were assigned to two groups using block randomisation . The sealed and sequentially numbered envelopes were not opened by the study coordinator until the family came to the first therapy session . Infants of the first group were treated according to the vojta method, whereas infants in the second group received elements of ndt, such as handling and positioning . Both groups were treated for 45 minutes twice a week for eight weeks at the centre of developmental neurology, frankfurt by experienced and certified vojta and ndt physiotherapists . Developed by vaclav vojta, the vojta method is well known as reflex locomotion and can be divided into reflex crawling and reflex rolling (phases 1 and 2). By stimulating special reflex points, the physiotherapist can trigger these motor patterns . Reflex crawling is performed in a prone position, whereas reflex rolling is induced from a supine (phase 1) and side - lying (phase 2) position . During this stimulation of motor patterns, the ndt group of infants received techniques opposing their preferred posture with the aim of activating synergistic muscles . Parents were shown how to massage an infant to harmonise muscular imbalance and how to initiate special positioning during sleep, thereby antagonizing asymmetry . They were also trained to increase the prone position time during daytime (4 5 minutes). Further exercises in the ndt group comprised handling according to the bobath concept, which includes recommendations for a specific positioning of the infant during everyday procedures, such as washing, feeding, picking up and laying down, in addition to the accommodation of the baby and the parental carrying20 . The primary outcome was to evaluate the therapeutic effects of the two methods and to test if vojta therapy might be superior to ndt in reducing infant postural asymmetry . Before and eight weeks after intervention, postural asymmetry was quantified using a standardised video - based asymmetry scale developed by philippi et al.2, 17 . Therefore a tripod with the video camera was set up at the end of treatment mat, exactly two meters above the infants . On the treatment mat, a cross was painted, in order to assess the longitudinal axis (spine) and a horizontal axis (shoulder girdle). Recording commenced with the infant s head being held for a brief period of time in the middle supine position . A head turn was then induced by presenting noises, toys or the physiotherapist s face, and moving them from one side to the other . After at least two turns to each side, the infant was put in the prone position with its head held for a brief time in the middle prone position, and the same procedures were repeated2 . That means, the four items of this assessment comprise convexity of the trunk and restriction in head rotation in the prone and supine position during a maximal head turn induced by optic and acoustic stimuli to the right and left side of the infants . The range of the scale is set with a maximum of 4 6 = 24 points for maximum asymmetry and a minimum of 4 1= 4 points for symmetry . For each infant, this procedure was videotaped and analysed by three experienced and trained physical therapists (table 1table 1.characteristics of the physical therapistspt 1pt 2pt 3genderfemalefemalefemaleage (years)433553experience from getting the physio license20 years12 years22 yearsreceive vojta certification2001 - --1999receive ndt certification199720081995other certificationcastillo moralessystemic family therapy), who were blinded to the therapeutic method used . The three video scorers had contact neither to the treating physical therapists nor to the parents throughout the whole study . They did not know if the video was recorded before or after treatment and which treatment was used . The treating physical therapist and the parents were not blinded for the therapy method . The secondary outcome was the compliance of the parents, which was ensured through two appointments a week at the treatment centre and supervision of their manual therapy skills . The parents had to be present at 12 of the 16 possible appointments at the treatment centre to avoid elimination from the study . In addition, the frequency of therapy at home and the behaviour of the infants during these treatments were evaluated with a structured parent questionnaire . Questionnaire parents were ask if the crying of their infants affected the duration and frequency of their exercises at home and if crying and behaviour changed over time . The statistical analysis was performed with spss 18.0 and an intention - to - treat - model used for the evaluation . The main thesis is tested on a statistical significance of 0.05 using a multivariate analysis of variance (manova) within all three scorers over all four items . An increase or decrease of four points (out of 24) was determined to be the minimum for clinical relevance . The changes in an infant s behaviour were evaluated with the questionnaire through a four - point likert scale every two weeks . A correlation analysis between therapy and screaming behaviour the estimation of the number of subjects needed for this therapy study was performed with the software nquery advisor and sas / iml . A previous study about osteopathy and infantile postural asymmetry was used as the reference for the estimation15 . The group difference in the asymmetry reduction before and after treatment should be at least four points on the asymmetry scale . Based on a power of 80, a significance level of 5%, an estimated treatment effect of 4 points and a standard deviation (sd) of 3.5 points, 15 infants were needed for each group . A list of block randomisation was created with a computer - based random number generator at the institute of medical epidemiology, biometry and informatics at mlu . An independent person sent the order of allocation in closed, opaque and numbered envelopes to the investigator, who opened them after receipt of parental consent . Because the envelopes were kept in a locked cabinet until opening, confidentiality was ensured . Twenty - six infants exceeded maximal age of eight weeks during the referral and decision process . Thirty - seven infants were found to be eligible and randomly assigned to the two groups, 19 receiving vojta therapy and 18 receiving ndt (fig . Consort flow diagram: order of study randomisation was successfully performed as shown by similar baseline criteria in both groups (table 2table 2.baseline demographic and clinical characteristicscharacteristicsvojta therapy(n=19)ndt(n=18)mean (sd) age, weeks7.16 (0.77)7.61 (0.61)gender, male / female, n16 / 310 / 8mean (sd) growth, cm51.50 (3.4)50.38 (3.3)posture awake, nall positions54no prone position1414posture asleep, nsupine1712supine, side24prone02parental carrying, n<1 h / week2126 h / week221 h / day151224 h / day03plagiocephaly, n169twin birth, n13mean birthweight, g (range)3,321 (2,3604,390)3,101 (1,5304,310)mean asymmetry score points (sd)18.47 (1.72)18.35 (2.06)n: subjects; sd: standard deviation; h: hours; cm: centimeter; g: gram) there were no protocol violations, such as dropouts or change of group affiliation . N: subjects; sd: standard deviation; h: hours; cm: centimeter; g: gram within an eight - week treatment either with vojta therapy or ndt, an average four - point reduction of postural asymmetry was achieved . The mean difference (pre - post) between both groups was 2.96 points (95% ci [5.01; 0.91]), a statistically significant improvement in favour of vojta therapy (p=0.025) (fig . 2.total score difference (tsc) in the vojta and ndt group represented as box plots . A negative tsc represents an improvement, while a positive tsc indicates deterioration . Total score difference (tsc) in the vojta and ndt group represented as box plots . A negative tsc represents an improvement, while a positive tsc indicates deterioration . A discordant value is marked by a circle in the vojta group, the asymmetry score dropped from 18.47 points (sd 1.72) to 10.72 points (sd 2.77) (7.75 points 95%ci [6.43; 9.08]) and in the ndt group from 18.35 points (sd 2.06) to 13.56 points (sd 3.53) (4.79 points 95%ci [3.12; 6.47]) (fig . 3fig . 3.manova regarding the difference in the primary outcome criteria before and after treatment (pre - post)). Manova regarding the difference in the primary outcome criteria before and after treatment (pre - post) the changes of the supine position contributed more to the results than those of the prone position . The mean changes were 1.18 points (p<0.001; 95% ci [0.082; 0.840]) in head rotation supine, 0.81 points (p=0.011; 95% ci [0.105; 0.921]) in spinal convexity supine, 0.47 points (p=0.094; 95% ci [0.107; 0.744]) in head rotation prone and 0.50 points (p=0.230; 95% ci [0.105; 0.610]) spinal convexity prone . Despite the recommendations of the physical therapists to treat their infants four times a day, parents in the vojta group treated their infants on average 2.21 times / day for 10.5 minutes . They attended on average 15.63 from 16 possible appointments with their children at the treatment centre . Parents in the ndt group treated their infants on average 2.44 times / day for 10.9 minutes . Thirty - four of 37 parents (91.9%) reported similar or less frequent crying of their infant after eight - week treatment, whereas three parents (8.1%) noticed more frequent crying (one of the ndt group, two of the vojta group). Infantile postural asymmetry in seven - week - old infants both in the ndt group and the vojta group showed clinically relevant improvement after an eight - week treatment interval consisting both of home treatment carried out by the parents twice a day for 10 minutes on average and the therapy at the treatment centre, which was performed twice a week for 30 minutes on average . With the same duration and frequency of treatment, there was statistically significant improvement in the vojta group . This study is the first rct to show the effects of vojta therapy and ndt on infantile postural asymmetry . The significant effect achieved through vojta therapy compared to ndt may be explained by its more intensive muscle activation due to relatively precisely guided movement responses to triggered reflexes . In contrast, ndt allows for more variation of muscle activation; as a result, muscles which need activation may be missed because stronger muscles take over the work of weaker ones . A further strength of our study is that outcome was measured objectively by a standardised video - based score evaluated by independent raters, who were blinded for treatment and clinical data . Although infants cry during vojta treatment, the acceptance of the parents in this study was good and did not influence compliance . It is assumed that crying during vojta therapy is more likely an expression of the infant s unwillingness to activate weak muscles rather than an expression of pain . This assumption is supported by the fact that crying stops as soon as the training ceases and by the report of parents that crying caused by pain sounds different . Parents who cannot bear the baby s crying under vojta therapy obtained with ndt a second, effective method but during the study period reached slightly less symmetry . Compared with other measures8, 10, 11, 14, 15 both methods show very good results . In physical therapy usually parents do less home therapy than recommended; this was also the case in our study . Nevertheless, in our study physical therapy performed twice a day for ten minutes by the parents was sufficient in order to be effective . Parents also have to perform home therapy if they apply other recommended approaches for torticollis like stretching8, 10, 11 . However, stretching is sometimes a difficult experience for both parents and infants as it is often rather painful . A novel therapy, kinesiology tape14, seems to be a promising treatment option according to a first pre - post study . It cannot be proven in the end that the natural course would not have achieved the same effect over time . A further limitation is the missing placebo group, which could not be implemented for ethical reasons . From two historical study groups (n=12 and n=16) of infants with postural asymmetry who were not be treated for 4 weeks at the age of 612 weeks, we know that there was a minimal change of their postural asymmetry score (1 point on average)15 . This may indicate that initiating physical therapy is more beneficial than waiting . In the treat - or - not - to - treat debate, there are two further important clinical aspects which might offer a good argument to treat those infants early . Infants with fixed movement restriction in cervical rotation are limited in their age - related participation because they cannot explore the environment as they would like to and need to . In untreated infants, torticollis and spine convexity may become more fixed over time and the risk of scoliosis and headaches increases . With early treatment we have the chance to relax the asymmetrically tensed - up spine muscles more easily and quickly; later on, however, the treatment of fixed torticollis, scoliosis and headache will be more extensive . Our study supports the beneficial effect of physical therapy on infants with infantile postural asymmetry and indicates that physical therapy may be a good complement to stretching and other treatments . Our data suggest that effectiveness can be attained by ten minutes of home therapy twice a day and one 30-minute - treatment per week by the physical therapist . Our results show that therapy compliance was comparable in ndt and vojta therapy; however, the total effect was greater in the vojta group . This good result of physiotherapy measures in the treatment of infantile postural asymmetry should now be examined with a greater numbers of participants, maybe in multicentre studies . This study was partially funded by physio germany (german association of physical therapy zvk e. v.). This study was partially funded by physio germany (german association of physical therapy zvk e. v.).
|
Air pollution is a risk factor for various diseases including eye irritation, respiratory infections, and heart disease [13]. Conjunctiva is sensitive to environmental particles considering the direct contact of conjunctiva with the outside environment . Conjunctiva protects the ocular from outsides deleterious agents, helps lubricate the eye by producing mucus and tears, and contributes to the immune balance of ocular surface . The importance of conjunctiva and a high prevalence of conjunctivitis merit an investigation on the effect of air pollutant on conjunctivitis . The environmental pollution, especially the air quality, has deteriorated in the past decades in china mainly due to the rapid industrialization in the country . Overall, no more than 5 cities among the 500 largest cities of china meet the air quality guidelines recommended by the world health organization . Recently, seven cities in china were ranked among the 10 most polluted cities in the world . The current study aims to evaluate the effect of air pollution on the occurrence of nonspecific conjunctivitis through analyzing the patients diagnosed as nonspecific conjunctivitis in jinan city and the air pollution level of jinan city . Data was collected from two eye centers in jinan city: central area and east area of shandong provincial hospital, shandong university . Patients presenting to the outpatients clinic between june 2014 and may 2015 with symptoms and signs of nonspecific conjunctivitis were included . Outpatient visits for nonspecific conjunctivitis were selected according to a previously published report and the international classification of diseases (icd-9) diagnostic codes . The following codes were included: 372.00, 372.01, 372.10, 372.11, 372.20, and 372.30 (for nonspecific acute conjunctivitis, serious conjunctivitis except viral infection, chronic conjunctivitis, simple chronic conjunctivitis, blepharoconjunctivitis, and other undefined conjunctivitis, resp . ). The following cases were excluded: patients with other ocular diseases including corneal abnormalities, conjunctivitis before the initiation of the study, xerophthalmia, and systemic immune disease . Air pollution data was harvested from the state environmental protection administration of china and expressed as air quality index (aqi). The aqi was composed by the index of particulate matter (pm10 and pm2.5), nitrogen dioxide (no2), sulfur dioxide (so2), ozone (o3), and carbon monoxide (co). The linear regression analysis was used to evaluate the relationship between number of clinic visits per day and aqi from the same day up to 4 prior days . The aqi within 1 day, 2 days, 3 days, and 4 days were calculated as the mean of the aqi on presenting day and 1 day, 2 days, 3 days, and 4 days prior to presentation and were expressed as aqi1, aqi2, aqi3, and aqi4 . A total of 15373 patients living in the air - quality - monitoring area of jinan city were enrolled in this study . The average number of patients with nonspecific conjunctivitis per day was 42 (2271), and the average aqi was 125 (56500) (figure 1). The aqi0 (p = 0.023), aqi1 (p = 0.049), and aqi2 (p = 0.050) had a positive relation with the number of patients per day (figure 2). However, the aqi3 (p = 0.229) and aqi4 (p = 0.101) did not have a significant relation with patient numbers per day (figure 2). The aqi (p = 0.001) as well as the number of patients per day (p = 0.013) in autumn and winter (october to march) was higher compared to that in spring and summer (april and september). In the present study, the aqi was harvested from 15 areas of jinan district covering 3000 km and 4 million people . Previous studies have demonstrated the effect of air pollution on respiratory disorders [8, 9]. A similar reaction to exogenous stimuli between conjunctival mucosa and respiratory mucosa has been proposed in the past [10, 11]. Chang et al . Reported a positive relation between air pollution and outpatient visits for nonspecific conjunctivitis in taiwan area . The different components of air pollutants have different effects on the occurrence of conjunctivitis . In present study, we reported that the occurrence of conjunctivitis has positive relation with the aqi on presenting day and the aqi within one day before the day of presentation . A limitation of our study is that we did not investigate the effect of different components of pollutants on causation of conjunctivitis . Present study observed a variety of conjunctivitis types within icd-9 code but did not predefine various forms of infections and allergic or physiological changes in tear film disorders except with the icd codes . More study should be done to elucidate the correlation between these various types of conjunctivitis and the various air quality measurements that were monitored . Present study revealed that the aqi in autumn and winter is higher than that in spring and summer . A high aqi in autumn and winter in jinan may be due to more coal consumption for heating, use of firecrackers consumption from spring festival to lantern festival, and a more difficult spread of pollutants due to low temperature . This study was carried out in an area with heavy air pollution, in which a variety of health disorders are related to pollutants . Although present study has revealed a relation between air pollution and conjunctivitis, more detailed investigations should be carried out to elucidate the effect of age and sex on the ophthalmic response to pollutant and the clinical treatment . Furthermore, the relationship between conjunctivitis and dry eye [12, 13] merits the investigation of effect of air pollution on dry eye and other more severe ophthalmic disorders related to dry eyes dry eye, such as microbial keratitis and the decline in quality of life.
|
They say passing a kidney stone is the worst pain you could ever have . I still feel it now, intense as ever, 10 years later . Dan vento is talking about the time his daughter suffered a relapse of an uncommon form of cancer called osteosarcoma . But a year later, jennifer s left knee began to swell and hurt again, then her thigh, then her back . The cancer not only had returned but was now all over jennifer s body, and it had happened so quickly that even the doctors were caught off guard . Metastatic tumors invaded jennifer s bones, obstructed her airways and destroyed her vision . Overnight, their little girl had become unrecognizable, from the cancer and from the aggressive treatments a swollen, lumpy mass with tubes and iv lines hooked up to beeping machines . They stood by, feeling as if the cancer were ripping through their bones too . It was almost a relief at first; the ventos could nt bear watching their daughter suffer another day . But when they saw jennifer in the little coffin, when they saw the coffin lowered into the ground, when they saw the earth covering the coffin from that day on, their pain would never end . I tried to be strong for my wife and kids, dan vento explained . If they saw me crumble, how would they be able to keep going? But despite the strong facade, vento was crumbling . I felt weak and lightheaded all the time, like i might pass out, and needed to grab onto something though not physically imposing he was short and stocky he was a self - made man from the bronx who owned a successful chain of grocery stores and always got whatever he wanted, at work and at home . When jennifer died, however, he did nt seem to want much anymore and found it increasingly difficult to concentrate . Is what dan vento experienced as he watched his daughter suffer, when he buried her, and now, 10 years later, still entangled in grief pain? He certainly thinks so and uses the word just as he did when he spent an agonizing night in the er with kidney stones . So do many other people who undergo similar trauma, as well as those who suffer pain in psychiatric illnesses like depression and schizophrenia . Scientists who study pain and doctors who treat pain consider the experience a strictly physical phenomenon, in the sense that it can only be caused by injury to the body . Pain occurs when receptors on nerve cells in the skin and internal organs detect potentially damaging stimuli, a pinrick, for example, or high temperatures (melzack and wall 1983, pp . The nociceptors (from the latin nocere, to injure) then signal the brain, which assesses the threat and coordinates a series of protective responses . This highly effective biological warning system that prevents further damage and aids in healing is something we ca nt live very well without . Just think of patients who are unable to feel pain, those with genetic defects and those with diseases that affect nerve transmission like diabetes and leprosy; the benefits of life without pain are easily outweighed by the negatives of progressive injury to the body and premature death (see brand and yancey 1997). Dan vento has suffered no physical injury . Nor have patients who experience the psychic pain that accompanies acute depression . Nor have cancer patients (and their parents) who experience the overwhelming fear and anxiety and isolation that accompany the physical symptoms of their illnesses . Their nociceptors, at least with respect to these particular feelings, remain silent, sending no distress signal to the brain . Therefore, their feelings are not really pain but something categorically different, what the professionals prefer to call suffering or anguish (cassell 1991, pp . 3046). And therefore, one will find no mention of grief or depression in medical classification schemes of pain . Even psychiatrists are wary of speaking about pain in their patients, reserving it only for those rare and strange cases of psychogenic pain or somatoform pain disorder that is, physical - like pain localized to a part of the body that has not been injured, the modern - day equivalent to what freud termed hysteria or conversion reaction (dsm 3, rev . ; american psychiatric association 1987). The bottom line is that the psychological pain experienced by dan vento and millions of patients with acute depression is an oxymoron or, at best, a metaphor . How can there be such a gulf between the layperson and the expert, especially with regard to such a common part of life? And if the experts are right, how could ordinary people like dan vento as well as our language professionals celebrated writers like william styron and joan didion, for example, who wrote so eloquently about pain in depression (darkness visible) and grief (the year of magical thinking)have gotten things so wrong? Unless of course they havent . Unless it s not the layperson but the expert who is confused . Perhaps one s instinctive tendency to see pain more broadly, as a category that incorporates both physical and psychological varieties, may be more enlightened than the expert s narrower conception . Perhaps there are good reasons for speaking of pain in the setting of grief or depression or schizophrenia or divorce or the nonphysical suffering that accompanies illness . In the first place, there is a wealth of subjective evidence what people feel and think and then convey to others through language . When we ask people about certain aversive emotional experiences and listen to their words, we find that they not only use the generic word pain to label these experiences, but also describe them in the same ways they describe physical pain . Now pain of any kind is notoriously difficult to express . There are problems conceptualizing the experience because it is perceptually inaccessible (we ca nt see or touch pain) and because, unlike other inner states, it is not always linked to external objects that we can see or touch (like the person who makes us angry or the dog that makes us scared) (scarry 1985, pp . One is forced to think about pain indirectly, through metaphor: we imagine a more knowable object linked to the pain and then speak of the experience in terms of that object . By far the most common metaphor used to describe physical pain is the weapon (scarry 1985, pp . Lengthy lists of similar adjectives can be found on the mcgill pain questionnaire, created in the 1970s to help patients communicate their feelings to doctors . Pain can be described as piercing, drilling, burning, grinding, throbbing, stinging, squeezing, and so on . Each of the descriptors implies the presence of a weapon or weapon - like object that can injure the body the drill that drills, the fire that burns . And since most patients have never been stabbed or shot or are not being stabbed or shot at the moment of pain, they are using these terms figuratively to objectify what would otherwise be difficult to pin down and represent; now they could see pain and describe how it feels by talking about knives and guns and the damage they can do the body . Dan vento, silenced for so long by the incapacitating pain of loss, will eventually open up to a psychiatrist . It felt like a bomb, he explained, that exploded inside of him, obliterating everything in his body . At other times, he felt the damage was occurring more slowly and methodically, as if there were a swarm of parasites eating away at his organs . But either way, the result was the same for vento: he was being emptied out from the insidegutted was the word he used until all that was left was a big, raw gaping wound . When her husband died and she was flooded with grief, joan didion saw giant waves . In her memoir, she writes that she felt as if she were being battered by destructive waves, paroxysms, sudden apprehensions that weaken the knees and blind the eyes and obliterate the dailiness of life (didion 2005, pp . 2728). For kay redfield jamison, a psychiatrist who suffers from manic depression, it spins around her mind faster and faster, out of control, until it explodes, splattering blood everywhere (jamison 1996, p. 80). Listening to the language of pain of all kinds, we discover a shared felt structure that the weapon metaphor effectively captures (biro 2010, pp . Whether triggered by grief and depression or kidney stones and spinal injury, pain reads like a story in three parts:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\text{weapon}} \to {\text {injury}} \to {\text {withdrawal}}. $$\end{document} in pain we feel as if there must be some weapon - like object (bomb, swarm of parasites, giant wave, centrifuge) that is moving toward and threatening us; that when it strikes, it will injure, possibly even destroy us; and that we must get away from it or shield ourselves at all costs . Even when there is nothing coming at us, when there is no injury, when we remain motionless, we feel the movement, the injury and the desire to run . Whatever happens that makes us feel these things the loss of a loved one or the physical destruction of cancer we experience pain . The subjective evidence for the existence of emotional pain is compelling, especially since there is no objective way to verify and characterize someone else s pain . Although we can attach a person to a functional magnetic resonance imaging (fmri) device, observe the blood flow to pain centers in the brain and then infer its presence, the only definitive test is a person s word: i feel pain or i do nt . Actually, most experts grudgingly acknowledge the inescapably subjective nature of pain . In an addendum to their universally accepted definition of painan unpleasant sensory and emotional experience associated with actual or potential tissue damagethe international association for the study of pain (iasp 2007) concedes that people do report pain for strictly psychological reasons and that, since such reports ca nt be distinguished from instances where there is a physical cause, they should be taken at face value: if people regard their experience as pain and if they report it in the same ways as pain caused by tissue damage, it should be accepted as pain . But despite the concession, the iasp does not make room for the pain experienced by dan vento, joan didion, or kay redfield jamison on their extensive classification schemes of pain disorders . While complex regional pain which affects somewhere of the order of 626 people in 100,000 (de mos et al . 2007)appears on the list, the vastly more common pain occurring in grief or depression does not . For physicians and scientists that will only pay lip service to the subjective argument, however, there is now mounting objective evidence for broadening our notion of pain . Since the introduction of gate control theory in the 1960s, the link between tissue damage and pain has progressively weakened . We now have a better understanding why there can be severe injury and no pain (wounded soldiers in battle) and, conversely, no injury and severe pain (migraine, fibromyalgia). This happens, as prominent pain scientists ronald melzack and patrick wall have explained, because there are psychological factors one s culture and past experiences, our emotional and cognitive states, the context of pain that can intensify or dampen the nociceptor signal before it registers in higher brain centers (melzack and wall 1983, pp . Moreover, many cases of chronic pain seem to occur without any direct nociceptor stimulation at all . Neuropathic pain results when a dysfunctional nervous system fires spontaneously or misinterprets ordinary sensory stimuli as noxious (woolf and mannion 1998). In tic dolouroux, for example, the movement of a feather across the face can trigger spasms of intense pain . A second strand of evidence comes from our growing understanding of how the brain processes pain . Most important for this discussion, there are distinct areas in the brain that process the sensation of pain (its quality, location, intensity) and our feelings about the sensation (the narrative of its aversiveness) (price 2000). Further, the sensory center (in the somatosensory cortex) and the affective center (in the anterior cingulate and insula cortices) are not only spatially apart but dissociable: that is, a person can have the sensation of pain but not feel pain (grahek 2007, pp . We can observe this in patients undergoing minor surgery with medication that makes them indifferent to being cut with a scalpel . Even more dramatic is a rare group of patients whose affective pain centers (or the connections to those centers) have been destroyed . In the case of pain asymbolia, patients can still sense a needle prick (because the nociceptor signal registers in the somatosensory cortex) but will laugh at its insignificance (because the signal is not processed by the anterior cingulate cortex). These instances of disconnect between the sensation and the feeling of pain tell us that despite the complexity of pain which involves sensations and behavior, feeling, cognition and memory the critical component is feeling . If we do nt have the feelings that dan vento had when the kidney stone was passing through his ureter that something bad was happening to him, that that something was damaging his body, and that he must do whatever he could to avoid further damage then pain loses its biological value . Because they laugh at pain rather than run from it, pain asymbolia patients will likely fare no better than patients with congenital or acquired pain insensitivity . In fact, i would argue that if we do nt feel pain, there s no point using the term at all . Leprosy patients, soldiers on the battlefield, sedated patients undergoing surgery, pain asymbolia patients they may experience unpleasant sensations but they do nt feel pain and do nt take protective measures . Everything is contingent on the feeling of pain . If tissue damage is not necessary to feeling pain and if there is a special affective center in the brain devoted to such feeling, why ca nt that center be activated by means other than the nociceptor pathway? Why is nt it possible that noxious psychological stimuli stimuli that threaten the emotional well - being of a person, like the loss of a child or the pain of depression or the suffering of cancer patients find their way to the anterior cingulate gyrus, making us feel the same way we do when we experience physical pain? Naomi eisenberger and her colleagues at ucla have recently developed a clever model of psychological pain that can be studied objectively (eisenberger et al . Normal subjects played a video ball - tossing game while their brains were monitored by fmri . When the subjects were excluded from the virtual game, they experienced distress that correlated with increased blood flow to the anterior cingular and insular cortices, exactly the same pattern that would have occurred had they been stuck by a needle . The greater the social distress generated, the more active these affective pain centers became . Studies done on saddened and grieving subjects produced similar results (gundel et al . 2003). It appears that the layperson s intuition about pain is being borne out by science; psychological pain seems to run on the same neural tracks as physical pain . And why should nt it? Just as physical stimuli that can damage our bodies prompt certain feelings and responses, so too should psychological stimuli that can damage our psyche like the loss of a child or the intrinsic symptoms of depression . Just as we need to rest the body to protect ourselves from further harm, so too should we protect the mind . Is this just a semantic issue, a disagreement between two sets of language users that, in the end, does nt have any adverse consequences? It matters because the disagreement reflects a much larger issue: the rigid mindset of the scientific community, which sees the world in a certain way and wo nt allow for deviation, even from dissenters within its own ranks . Science focuses its spotlight exclusively on the objective world, what can be studied, quantified, and explained . Because it seems resistant to such inquiry, the subjective realm has been traditionally off limits, something that can only be appreciated on much looser terms by the humanities and the because of their position in the intellectual hierarchy, there is a trickle - down effect, which carries over to the practical science of medicine and to the culture at large . In the case of pain, there is only one kind, the real or physical kind that can be objectively verified by observing nociceptor activity or finding lesions on a cat scan . Other experiences that may feel like pain but cannot be linked to tissue damage are not pain . Much more subjective and less transparently material, they are therefore derivative, less important, and better labeled something else (suffering or anguish). While psychological pain may be unpleasant, the fact remains that it is in our heads, not our bodies . As we continue to unfold the logic of the objectivist (and dualistic) paradigm which has now thoroughly permeated our cultural consciousness those who suffer without any physical corroboration to show for it inevitably begin to appear suspect . They are either crazy (mentally ill), deceitful (because there is no real pain) or weak (everything is painful to such people). They do nt need pain doctors or pain medication, but psychiatrists and priests . Disregarding for a moment that that all pain is in the headeven dan vento s kidney stone pain, which he localized to the right side of his pelvis the truth is that psychological pain is often more intense and dangerous than the real thing . For dan vento, his bout with kidney stones, among the most painful of all medical conditions, was nothing compared to the pain of grief . Similarly, lucy grealy tells us in her memoir, autobiography of a face (1995), that she would much rather face the pain of cancer and its treatments than the far worse pain of feeling deformed and lonely (pp . 7, 170, 186). In fact, many such sufferers welcome, even court, physical pain, feeling that it actually alleviates their emotional pain to a degree . And when, unalleviated, the pain becomes too much to bear, some will choose to end it by ending life . Suicide rates are significantly higher in the setting of grief and depression than they are in the setting of physical pain (schneidman 1998). In addition to relegating psychological sufferers to second - class status, sufferers of chronic pain conditions like migraine, lower back pain, and fibromyalgia find themselves somewhere in limbo between real pain and the derivative, mental kind . On the one hand, their pain seems physical (because it is localized to a part of the body), but on the other, it has more in more in common with psychological distress (because there is no detectable injury). For a long time, medicine had no idea what to do with these patients, and so they drifted from doctor to doctor without finding relief . Although their lives have improved with the introduction of pain specialists and pain clinics, chronic pain patients are still often tormented by the insidious logic of the objectivist perspective (see heshusius 2009, pp . Some, in fact, resort to self - mutilation to legitimize their pain in the face of ongoing skepticism from family members and doctors: you see now, they will say, pointing to their slashed arms, the pain is not in my head, it s real (see padfield 2003, pp . I bring up the seriousness of psychological pain and the limbo - like situation of chronic pain conditions because, like the work of a growing number of scientists, it goes against the grain of the prevailing mindset . Perhaps, then, we should change this mindset and broaden our outlook . Instead of privileging one type of pain over another, let s approach them in a more inclusive, democratic spirit, in which all pains are created equal . Or better yet, let s view pain as occurring on a continuum or spectrum that runs from one ideal (pain linked solely to physical injury) to another (pain linked solely to psychological injury). It accommodates our belief that the feeling of pain can arise from injury to the body as well as injury to the mind . It also accommodates our experience of the considerable overlap between the two varieties, that there is never pure physical or pure psychological pain but always combinations . Those suffering from grief and mental illness often have somatic complaints: dan vento felt the loss of his daughter in his gut; william styron s descent into depression was accompanied by sleeping and breathing problems (styron 1992, pp . At the same time, patients in physical pain inevitably suffer emotionally; cancer patients routinely feel terrified, helpless and lonely (cherney et al . Moreover, the benefits of adopting a broader perspective go beyond validating and valuing our lived experiences . There are practical implications . For science, it would mean more support for the transformative work of researchers like joseph ledoux and antonio damasio into the subjective realm of feelings and emotions (ledoux 1996; damasio 1999) after all, these experiences are as material as the beating of the heart and the dna molecule, even though at the moment we do nt precisely know how to translate neural activity (brain language) into mental states (mind language). Now that we know it shares neurological substrates with physical pain, scientists will no doubt look to extend the work of eisenberger by finding the nociceptor pathways of psychological injury: how are feelings of grief or depression detected and transmitted to the anterior cingular cortex? And how could the signals be modifed? Dan vento s prolonged grief what psychiatrists classify as complicated grief has much in common with certain chronic pain states . In both instances, the injury has long past and yet the reverberating pain circuit, no longer serving any biological purpose, continues . Are there similar mechanisms at work here, and might they be manipulated to help vento escape from his self - destructive rut? There would also be changes in the clinical realm, improving the way doctors treat pain . Some patients may require more attention to the body; others, to the mind; the majority, to both . Here take, for example, the placebo effect in clinical trials, in which a fake pill has been shown to relieve pain on the order of 1530% of cases . Most investigators view the phenomenon as a contaminant that must be eliminated to assess the efficacy of the real drug . But why not switch frames, as benedetti (2009) has urged, and focus just as diligently on the reality of the psychological factors that are equally effective, in some cases even more so (pp . 6, 30)? Why not try to harness and enhance these factors to help patients? This same novel way of thinking led dewall et al . (2010) to administer physical pain medication (acetaminophen) to people suffering from psychological hurt, and not unsurprisingly, it seemed to work . One of the greatest twentieth - century thinkers, ludwig wittgenstein, showed that paying attention to ordinary language can help advance philosophy . He also showed that clinging dogmatically to a certain picture can lead to conceptual illness (wittgenstein 1958, sect . 115). If we can thoroughly break with our unhealthy (and inaccurate) dualistic legacy and truly see that mind and body are inextricably connected, then we must agree with dan vento, joan didion, and many other sufferers that psychological pain exists and is just as important and worthy of our attention as physical pain . They are two sides of the same coin and should be spoken of and treated as such.
|
Early breast cancer detection, accurate diagnosis, and personalized therapies have become goals of clinical medicine in the genomic era, and in the last few decades molecular genetics advances have contributed greatly to the development of those goals . The ability to identify genomic characteristics, determine copy number variations, or measure rna and mirna with a variety of technologies provided the medical field with tools to explore the molecular make up of any sample and compare physiologic and pathologic states from any human tissue . However, the accuracy of such techniques depends largely on the purity of the samples provided for analysis . At the same time microdissection techniques have increased the purity of samples, enabled us to study the earliest stages of disease development, and allow separation of different tissue constituents, for example, separating epithelial tissue from the surrounding stroma in a breast lesion . A consequence of increased targeting ability is a corresponding decrease in the amount of nucleic acid available for research . In the breast cancer research field, examples of areas that deal with small lesions and limited samples are the study of breast carcinoma in situ which is a presumed precursor to invasive breast carcinoma and a growing clinical problem [1, 2] and establishing the role of the stroma or myoepithelial cells in the development of pre - invasive and invasive lesions . Some breast lesions like atypical ductal hyperplasia and flat epithelial atypia are of much interest to pathologists and clinicians as they are upgraded to carcinoma about 1020% of the time in subsequent studies; however opportunities to study such lesions are limited because they are often discovered incidentally in biopsies, and therefore the amount of samples available for research is very small . In breast cancer research, correlation of molecular characteristics with outcomes helps identify predictive and prognostic variables that are of great value in clinical practice, unfortunately, most of the time that information can only be obtained after lengthy periods of followup to record whether or not the outcome of interest develops . Conversely, there are millions of ffpe samples worldwide, many associated with detailed clinical data that makes them a precious resource for survival studies and prognostic and predictive marker development . Therefore, technologies that can be used on ffpe tissues without being limited by the amount of sample are very valuable . Array cgh (acgh) is being widely used to identify the areas of genomic gain and loss that occur in different types of lesions and offers high - throughput capability, high resolution, and precise mapping of aberrations [36]. Several microarray platforms have been developed and used for acgh including cdna arrays [79], oligonucleotide arrays [10, 11], bac arrays [1217], and most recently snp arrays [1821]. Unfortunately, in order to be useful in the molecular pathology lab, this type of molecular analysis requires an abundant supply of high - quality genomic dna from clinical specimens, not only for the array cgh analysis but also to validate results using an independent technique such as q - pcr . To facilitate molecular analysis of small specimens, several methods of whole genome amplification dop - pcr has been modified and used for several different types of molecular analysis including chromosomal cgh [2428], high - resolution (hr-) cgh [29, 30], genotyping [31, 32], loh analysis, mutation detection, array cgh [3537] and more recently for methylation profiling of trace amounts of dna [38, 39]. Although dop - pcr has been widely accepted as a method of whole genome amplification, it is known that it introduces amplification bias . While some have been successful using dop - pcr on ffpe tissues, others have found that dop - pcr is not well suited for archived specimen analysis . Artifactual amplification at chromosomes 1p, 3, 13q, and 16p as well as preferential amplification of shorter alleles has been reported . Consider dop - pcr a useful amplification method if researchers monitor carefully storage conditions and accept a multiple displacement amplification (mda) and modifications of mda such as restriction- and circularization - aided rolling circle amplification (rca - rca) and mda using the large fragment of bst dna polymerase have been used on ffpe tissue as a method of wga for acgh [4648]. The disadvantage of these methods, which employ a polymerase, is that they may not perform well with degraded dna extracted from ffpe tissues, and the efficiency and accuracy of mda vary with the cell type . A recent review on the mda method using nonfixed samples reports that it introduced pronounced skewing when evaluating ribosomal rna . To deal with mda bias, some have suggested combining two mda reactions, one denatured and one nondenatured, aiding copy number analysis and subsequent genotyping . The methods based on producing representative amplicons by ligation - mediated pcr (lm - pcr) [52, 53], balanced pcr amplification, and adaptor - ligation pcr of randomly sheared genomic dna (prsg) have all performed well for array cgh [44, 54, 55] where the random - primed amplification (rpa) has been used successfully with ffpe tissues for array cgh and found to be superior to degenerate oligonucleotide - primed amplification for array - based cgh . Other technologies recently marketed for whole genome amplification include a linker - adapted pcr - based proprietary kit that was shown to be superior to mda, dop - pcr, random priming, and rca - rca methods for ffpe samples, omniplex which reports good results on wga of ffpe tissue prior to snp analysis and repli - g which is marketed as a wga kit that uses the previously known phi29 dna polymerase method and adds a ligation step prior to amplification . In 1999, klein et al . Published a ligation - mediated method of whole genome amplification paired with chromosomal cgh that was specifically designed for the analysis of genomes of single cells and (single - cell comparative genomic hybridization).this method has been used successfully for cgh analysis of ffpe specimens [41, 60] and for cgh analysis of single cells [61, 62]. Scomp was found to be superior to dop - pcr for global amplification of very small amounts of dna from microdissected ffpe samples . While several groups have demonstrated that it is possible to perform wga on ffpe samples, few have critically assessed the resulting dna for reproducibility and fidelity of replication on a genome - wide scale . We have tested several methods of wga, systematically analyzed their performance, and selected the two best performing, scomp and dop - pcr, for further assessment . The degree of wga effect on identification of genomic alterations was quantified and compared between the methods . This assessment is a necessary validation step of wga methods and, we believe, provides invaluable information for scientists using ffpe samples for acgh studies . 20 g of genomic dna from the uacc-812 breast cancer cell line (atcc, http://www.atcc.org/) was extracted using the qiamp dna mini kit (qiagen, canada) according to the manufacturer's instructions . Dna from the cell line and human placenta was digested with 2.5 u each of rsai and alui restriction enzymes (invitrogen) in a final volume of 100 l . The digested dna ranging in size from 100 to 10,000 base pairs was cleaned using the qiaquick pcr purification kit (qiagen, canada) and quantitated using a dyna quant fluorometer (amersham biosciences). For ffpe samples, multiple 5 m thick sections of paraffin blocks were deparaffinized and stained for 30 sec in haematoxylin prior to microdissection . Tumor areas were isolated in a dissecting stereo microscope using 18 g needles and h&e - stained slides for guidance (under supervision of a pathologist, s. j. done). Microdissected tissue was incubated in lysis buffer for 72 hr, and dna was extracted using the qiamp dna mini kit . Degenerate oligonucleotide primed (dop-) pcr was performed by two methods . First, using the dop - pcr master kit (roche) according to the manufacturer's instructions; second, according to the protocol of huang et al . Briefly, 10100 ng of genomic dna was amplified by thermo sequenase (amersham biosciences) in a low - stringency preamplification step (5 cycles), followed by regular pcr amplification in less stringent conditions . For both methods, several replicate reactions were pooled together (n = 57 based on the sample size, i.e, amount of material available) and a negative control (template: water) was used to ensure absence of contamination . The resulting amplified dna was purified using the qiaquick pcr purification kit (qiagen, canada) and quantified using a dyna quant fluorometer (amersham biosciences). The initial steps of the scomp procedure were performed according to the protocol provided by dr . Genomic dna was digested with 2 u msei (new england biolabs) for 3 hours in one - phor - all buffer (amersham) in a final volume of 5 l . Base pairing of the adaptor nucleotides was done in a final volume of 3 l using 0.5 l one - phor - all buffer, 0.5 100 m lib1 oligonucleotide (5-agtgggattcctgctgtcagt-3), and 0.5 l 100 m ddmse11 oligonucleotide (5-taactgacagcdd-3) in a mj research pt100 thermocycler programmed for a gradient of 65c to 15c ramped down at 1c per minute . 1 l t4 dna ligase (40 u/l) (roche), 1 l of 10 mm atp and the msei digested genomic dna was added and allowed to incubate at 15c overnight . For pcr amplification the following was added to the ligation mix: 3 l expand long template buffer 1 (roche), 2 l 10 mm dntps, 35 l h2o and 1 l expand - long - template polmix (3.5 u/l). Thermocycler conditions were as follows: 1 cycle, 68c for 3 mins; 15 cycles 40 sec at 94c, 30 sec at 57c, 1 min 30 sec + 1 sec / cycle at 68c; 8 cycles 40 sec at 94c, 30 sec at 57c + 1c / cycle, 1 min 45 sec + 1 sec / cycle at 68c; 22 cycles 40 sec at 94c, 30 sec at 65c, 1 min 53 sec + 1 sec / cycle at 68c; 1 cycle 3 min 40 sec at 68c . Several reactions were pooled together (n = 57 as above). A negative control (template: water) was used for all steps to ensure there was no contamination . Following pcr amplification, the resulting products were cleaned with the qiaquick pcr purification kit (qiagen, canada) and quantitated using a dyna quant fluorometer (amersham biosciences). 2 - 3 g of dna was labelled by random priming (bioprime dna labeling kit, invitrogen) in 3 separate reactions with either cy3 or cy5 . Labeled products were mixed in appropriate combinations in dig easy hyb (roche) hybridization buffer and hybridized for 1624 hours at 37c in a humidified chamber in duplicate to the human 19 k single - spot cdna arrays from the clinical genomics centre, uhn (university health network microarray centre, http://www.microarrays.ca/), which contain 19,008 human ests / genes with map positions identified for ~11,000 cdna clones with the median distance between mapped positions 73.4 kb, where 93% of the clones spaced <1 mb and 99% <3 mb . The photomultiplier gain for each laser was adjusted to give an average ratio of cy3 to cy5 of 1 and to minimize the number of saturated pixels . Images were then analyzed using the genepix pro 3.0 software (axon instruments, usa). Each subgrid on each array was independently normalized by equalizing the cy3 intensities with respect to the cy5 intensities, while excluding spots flagged as anomalous or absent by the quantifying software . Log2 ratios were assigned to each spot and the profiles were centered by the median value and scale normalized by the median of absolute values . Pcr was performed according to the abi7700 protocols using the quantitect sybr green pcr kit (qiagen, canada). Dna from normal placenta was used as reference and relative gene quantity was calculated by the delta - delta ct method . First, we tested wga methods using higher - quality dna from the uacc-812 cell line and human placenta . Three independent runs of dna from the cell line amplified by scomp and dop methods were compared by correlation with nonamplified controls (pearson). Since scomp was giving consistently better results, an additional five samples amplified by this technique were tested . The data was summarized by a pseudocolor matrix generated using the matlab r12 (mathworks inc, natick, ma, usa) software to display pair - wise correlations among individual samples (figure 1). Significance analysis of microarrays (sam; http://www-stat.stanford.edu/~tibs/sam/) was used to identify significantly amplified or deleted genes among the amplified and nonamplified datasets . A binary tree - structured vector quantization (btsvq; available at http://www.cs.toronto.edu/~juris/btsvq/downloads.html) btsvq combines a partitive k - means clustering and a self - organizing maps (soms) algorithm in a complementary way, to achieve clustering of both samples and genes . A moving average of microarray data (sliding window of 20 data points, figure 2) was used to search for genomic alterations previously reported in uacc-812 cells . Initially, three samples were amplified by scomp and dop methods and compared to nonamplified controls . Then, since scomp performed better, three additional samples amplified by scomp were added to the analysis . All profiles were analyzed by pearsons correlation of nonsegmented acgh data between amplified samples and corresponding nonamplified controls . We also counted the number of individual cdna spots concordant as gain or loss between the test and corresponding control samples as well as between the duplicate runs of nonamplified control dna . Additionally, the profiles were analyzed as whole genomes by arranging clones in the genomic sequence (national center for biotechnology information, build 201 and university of california, santa cruz, build hg18) and identifying genomic alterations by the circular binary segmentation algorithm (dnacopy package ver . Duplicate runs of nonamplified control samples were used to establish reference values for each type of analysis . The segmentation algorithm was used to identify contiguous segments of statistically uniform individual data points . The segments of amplified samples and the segments of nonamplified controls were screened to identify regions of overlapping concordant gains and losses . The lengths of the concordant regions were summed, and the percentage of concordantly identified genome length was calculated for each amplified sample . Then, peaks of genomic alterations were visualized by moving average as described above, and the peaks of amplified samples of the same sign and position as the peaks of control samples were recorded as concordant without restrictions for amplitude . Percentages of concordant / discordant peaks were calculated per amplified sample . We have evaluated four major pcr - based methods of wga and investigated their suitability for processing ffpe clinical samples . The methods include two variations of dop - pcr [23, 27], scomp [41, 59], and t7-based linear amplification of dna (tlad). We did not investigate methods based on multiple displacement amplification (mda) using dna polymerase [43, 45, 46], because the enzyme may not be suitable for ffpe clinical samples due to fragmentation of the template genomic dna . Our preliminary tests eliminated two of the four methods . The dop - pcr master kit (roche, mannheim, germany) performed well with good - quality genomic dna from our cell line, however, failed to amplify genomic dna extracted from ffpe tissue . In addition, it was often subject to contamination in the negative control, which was of significant concern given the low quantities of genomic dna we expected to use (as low as 10 ng). The tlad protocol was laborious and costly, and there was significant loss of template dna in the initial steps due to many purification steps . Although tlad did significantly amplify the amount of starting material up to 100x in our hands, the cgh arrays failed due to what appeared to be poor labeling efficiency of the resulting products . The remaining dop - pcr protocol and scomp performed well during preliminary tests and were further analyzed by acgh . Both modified dop - pcr and scomp performed equally well at amplifying genomic dna from cell lines as well as from ffpe material . Starting with as little as 10 ng of genomic dna, we were able to get as much as 2 - 3 g from the modified dop - pcr protocol and scomp with products ranging in size from 10 to 10,000 bp, and 100 to 1,500 bp respectively . The negative controls (template: water) in both cases showed little or no product formation . When product formation was detected in the negative control lane, the products from that experiment were not used for analysis . The cells have been shown to harbor several regions of amplification including 1q, 8q, 13q, 17q, and 20q and amplification of the dna topoisomerase ii (top2) gene . Our acgh profiles of control samples showed alterations of the expected regions, including those on chromosomes 1, 8, and 17 shown in figure 2 . To validate the microarray data by an independent molecular method, we performed q - pcr on 15 genes found to be amplified by corresponding cdna clones in amplified or nonamplified material, as well as 7 random genes . The relative ratio of uacc-812 to placenta was calculated for cdna clones of acgh and compared to relative gene quantity determined by q - pcr . For nonamplified dna, loss / gain was confirmed in 18 out of 22 samples with correlation of absolute values r = 0.62 (pearson), for scomp - amplified in 19/22 (r = 0.75), and 9/22 (r = 0.22) in the dop - amplified experiments (table 1). Initially, we tested and compared dop and scomp methods using three samples in a group and then expanded the number of scomp amplified samples to further test the technique as it showed greater fidelity . Scomp - amplified samples showed higher correlation with the nonamplified controls than dop - amplified samples . As expected, the self / self hybridizations of dna from placenta correlated well with each other and did not correlate with the nonamplified, scomp - amplified, or dop - amplified dna from uacc-812 cells . The dop - amplified samples had the lowest correlation between each other and with the control samples . Although nonsegmented profiles of both wga methods showed similar correlation with corresponding controls (table 2), there was a trend for a greater number of concordant spots within the scomp samples . The mean percentage of cdna spots concordant with the controls for gain / loss assignment was 65.7, 68.5, and 71.7% for dop, scomp, and reference duplicate control runs, respectively, where difference between the groups was not statistically significant . Among the cdna clones assigned discordantly opposite to the controls as gain or loss, there were clones discordant recurrently in all samples within the groups of scomp, dop, or duplicate control samples: 2.53, 1.56 and 1.61%, respectively (difference not significant). The difference with the log2 values of the control or duplicate runs was similar between the groups: 0.25, 0.26, and 0.21, respectively (difference not significant). Since the purpose of acgh is identification of regions of genomic gain or loss rather than values of individual cdna clones, we aimed to assess regions of gains / losses identified by segmentation and moving averages (figure 3). The median number of segments per sample was similar between the groups: 41, 40, 41, 37 for all, control, scomp, and dop samples, respectively, where the median number of segments of gain was 20, 25, 20, 20, and segments of loss 20, 15, 21, 17 . There was 42.5% genome length concordance between segments identified in dop and corresponding nonamplified controls, which were significantly lower than the 78.6% reference length concordance (reference: duplicate runs of nonamplified samples, p <0.01, mann - whitney). For the same ffpe samples, scomp - amplified dna showed segmentation patterns similar to the nonamplified controls with a concordance rate of 68.5%, which was not significantly different from the reference runs (table 2). A similar advantage of the scomp method was observed by comparing peaks of genomic alterations: scomp samples had 84.4% concordant peaks compared to 72.2% of dop - amplified samples, where the latter was significantly lower than the reference concordance rate . To better assess the preferred wga amplification method, we added more samples to the scomp group . Overall, 67.8% of detected segments and 84.4% of peaks identified in scomp amplified samples were concordant with those of nonamplified controls . Our aim was to compare and validate whole genome amplification methods for acgh of microdissected ffpe tissue . Scomp was particularly promising because it has been successfully used for analysis of single cells isolated from a breast cancer cell line, disseminated tumour cells in minimal residual cancer in the bone marrow, dna extracted from archival material, and circulating melanoma cells . In all cases there dop - pcr on the other hand is a well - established, technically straightforward method that is widely accepted as a method of wga . Dop - pcr - generated dna has been used for many applications, including acgh [68, 69]. In both of these publications previously, stoecklein et al . Had shown that scomp was preferable to dop - pcr for use with formalin - fixed samples; however, it was only validated using chromosomal cgh . We compared the techniques and tested further the better performing method by a high - resolution acgh . To initially test the methods, we used better - quality dna extracted from fresh samples and found scomp superior to dop - pcr (figure 1). To validate the acgh platform before further analysis, we used quantitative pcr (q - pcr) and tested 22 genes in the three groups of data nonamplified, scomp - amplified, and dop - amplified . The highest agreement was in the nonamplified and scomp - amplified datasets (table 1). The profiles of the samples amplified by both techniques had similar correlation with the controls; however, there was a trend for the dop group to have a higher percentage of discordant individual spots . Only a small proportion of the discordant spots were observed repeatedly within the samples of each group, which we interpreted as indication of the artifacts being predominantly random and not specific for cdna clone sequence, spot position within the array, or other factors specific for amplification method or the microarray platform . After reliability of the acgh platform and amplification techniques were evaluated, we proceeded to experiments with ffpe specimens . In these experiments, acgh analysis showed consistently better performance of the scomp technique compared to dop - pcr . Since acgh has been successfully used in breast cancer research to characterize breast cancer cell lines and identify regions of common genomic alterations in different cancer subtypes [65, 70], we used current approaches of acgh analysis to study the effect of wga on accurate detection of alterations . The segmentation algorithm we used has been successfully employed in multiple acgh studies [7173] and is becoming a routine tool for denoising acgh data from clinical samples . To avoid biases we intentionally did not use cut - offs to filter segments or peaks by the degree of significance . Scomp showed higher fidelity and allowed identification of the genomic alterations detected in nonamplified samples by both segmentation and moving average analyses at rates close to the reference values . The difference between median rates of the scomp and the reference group was 11% and 10% for the segmentation and moving average analyses, respectively . Although they may serve as estimates of artifacts introduced by scomp amplification, the differences were not statistically significant . The dop method showed significant alterations of the profiles introducing 36% and 22% of discordant segmentation and peak identification over the reference values (table 2). Our concordance rates are representative of the techniques, and the actual rates are expected to vary with quality of samples and acgh platforms used . Combined, our results show that of the methods tested scomp is the most suitable method for wga of ffpe tissues and delivers results similar to nonamplified samples . Understanding the genomic characteristics and evolution of breast cancer lesions is a necessary step to answer many of the questions posed in the clinical setting, including which lesions are more likely to develop local recurrence or metastasis and therefore who would benefit from adjuvant therapy . Unfortunately, the lesions of interest are usually small and the availability of genomic dna for research extremely limited . Use of existing breast archival ffpe material is optimized by microdissecting samples to obtain homogeneous histologically defined cell populations from small - volume lesions . Wga cannot be avoided in these settings, and our data show that scomp has the potential to be an invaluable tool for breast cancer research.
|
, the disorder is characterised by lisch nodules, optic gliomas, choroidal hamartomas and congenital hypertrophy of the retinal pigment epithelium (chrpe). It appears that reduction of neurofibromin expression can lead to abnormalities in the differentiation and migration of melanoblasts and melanocytes which gives rise to characteristic caf - au - lait spots of the skin . Caf - au - lait spots are characterised by increased levels of epidermal melanogenesis and increased numbers of epidermal melanocytes which contain abnormally large pigment granules, known as macromelanosomes . In the eye, lisch nodules consist of masses of melanocytes . Congenital hypertrophy of retinal pigment epithelium, a rare feature of patients with nf-1, consists of focal areas of pigment epithelial cells that are more densely packed with pigmented granules . Retinal pigment epithelium (rpe) also contains melanin . It can be hypothesized that changes in neurofibromin expression are leading to some melanin changes also in rpe of patients with nf-1 . It has been described in patients with albinism that the reduced level or absence of retinal pigment is associated with changes detectable by eog - the most commonly used electrophysiological test of rpe function . Our initial eog results suggested that dysfunction of the rpe may be a characteristic feature of individuals with nf-1 . In order to verify our preliminary findings we performed the eog examination in a two - fold larger group of patients diagnosed with nf-1 . The eogs were performed on 36 patients (67 eyes; 22 males, 14 females; mean age: 26.6 10.9 years; mean refractive error: -0.21 0.72 d) who fulfilled the national institutes of health clinical diagnostic criteria for nf-1 and compared to 32 healthy subjects . Ocular findings in a group of patients with nf-1 are as follows: snellen visual acuity - 20/20, lisch nodules - (65/67) 97% of analysed eyes, choroidal hamartoma - (5/67) 7.4%, chrpe (congenital hypertrophy of the retinal pigment epithelium) - (4/67) 5.9%, optic nerve glioma - (3/67) 4.4%, normal colour vision and visual field measured by kinetic perimetry . The two groups were similar as far as age, sex and refractive error were concerned . Electro - oculography (utas e-2000) was performed according to the standard for eogs of the international society for clinical electrophysiology of vision (iscev) standardisation committee . In the eog examination, patients' pupils were dilated (10% neo - synephrine, 1% tropicamide) and a stimulus intensity equal to ca . 1/2) was used, which has been recommended as a standard for the light adaptation phase in this case . We analysed the values of the lowest potential reached during the dark phase (dark - trough amplitude in v, dta), dark - trough latency (dtl) measured in minutes, the highest potential reached during light exposure (light - peak amplitude in v, lpa), light - peak latency (lpl) in minutes and the ratio of the light - peak amplitude to dark - trough amplitude (arden index, ai). Statistical analysis was performed using parametric (shapiro - wilk test, student t - test) and non - parametric (mann - whitney test) tests with a significance level of p 0.05 . This study was approved by the committee of medical ethics of the medical university in szczecin . Descriptive statistics and statistical analysis of the eog parameters for two study groups (nf-1 patients and normal controls) are shown in table 1 . The student t - test and the mann - whitney test revealed significant differences in the variables dta (p <0.001), ai (p <0.001), and lpl (p <0.001). Figure 1 illustrates an example of an nf-1 patient with supernormal ai on eog examination . Eog in nf-1 patients - descriptive statistics and statistical analysis (36 patients) n - number of eyes; m - arithmetic mean; min - minimum value; med - median; n - normal distribution; sd - standard deviation; max - maximum value * * * - p <0.001 for the nf-1 group, the mean dta (305.0 81.2 v) was significantly lower than that of the control group (408.1 112.9 v) and the mean ai (3.42 0.62) was significantly higher (2.45 0.37). The mean lpl for the nf-1 group (7.6 1.1 min) was significantly lower than that of the control group (8.4 1.3 min). The mean lpa of the nf-1 group (971 229 v) was lower than that of the normal subjects (982 242 v); this difference was not statistically significant . The mean dtl for the nf-1 group (11.6 2.2 min) was almost the same as that of the control group (11.7 2.0 min). Supernormal eogs (ai> mean+2sd - more than 3.19) were detected in 58.3% (21/36) of patients, 58.2% (34/67) of eyes . The results of our studies suggest that dysfunction of rpe as measured by eog is present in patients with nf-1 . Enlargement of the analysed eyes of patients with nf-1 (from 35 to 67 eyes) did not change significantly the eog results obtained in a group of patients with nf-1 published previously . We observed a supernormal eog (increased ais) in 58% of analyzed eyes in individuals with nf-1 . Detection of changes by eog and in parallel small changes in erg what was shown previously indicating that the occurrence of abnormalities was mainly in the rpe . The dark - trough potential is a result of polarisation differences between the apical and basal membranes of rpe cells . The significantly lower amplitude of this potential suggests that the mechanisms underlying polarization differences are altered in nf-1 . This variation in membrane potentials results from differences in the types and distribution of transport mechanisms between the two rpe membranes . Primarily kchannels generate the apical membrane potential with smaller contributions from the electrogenic na / kpump and nahco3cotransporter . It is reasonable to expect that changes in any of above transport mechanisms can occur in nf-1 . As mentioned in the introduction pigmented cells contain particularly high amounts of calcium, reflecting the enormous calcium binding capacity of melanin . The data obtained in the current study suggest that supernormal eogs in nf-1 patients are a result of changes in calcium levels caused by melanin abnormalities, which is related to the reduction in expression of neurofibromin . This disorder is characterised by congenital reduction or total absence of pigment in hair, skin and eyes . This finding also supports the hypothesis that eog changes in nf-1 patients are associated to neurofibromin - mediated melanin alterations . It is well known that in many ocular disorders electrophysiological changes can occur independently of alterations detectable by ophthalmoscopy . Also in our patients abnormal eogs were observed in individuals without characteristic nf-1 fundus changes detectable during routine examination . Nf-1 can be unequivocally diagnosed by the detection of nf-1 gene mutations by dna / rna analyses . Molecular analysis of large genes like nf-1 are still complex, time consuming and expensive . Due to cost implications genetic analysis of nf-1 has to be limited to the groups of pre - selected patients that have a high probability of carrying mutations . In order to identify such groups it is important to find as many independent clinical features as possible that are closely correlated with nf-1 disease expression . The high frequency of supernormal eogs in patients with nf-1 suggests that this type of analysis might be useful in the initial identification of patients with nf-1 who do not present with the typical spectrum of disease symptoms.
|
It is now widely recognized that the acquisition and storage of information require long - lasting modifications (i.e., plasticity) of synaptic transmission among neurons [13]. Long - term potentiation (ltp) and long - term depression (ltd) constitute two forms of synaptic plasticity that are thought to play important roles in learning and memory encoding, as well as the developmental fine - tuning of synaptic connectivity [28]. Both ltp and ltd have been observed in a large number of brain regions (e.g., hippocampus, neocortex, amygdala, striatum, and cerebellum) and the induction and maintenance mechanisms have been characterized in great detail [47, 9, 10]. Usually, different types of electrical stimulation protocols are used for the induction of either ltp or ltd . While ltp is effectively generated by brief (in the order of seconds) bursts of high - frequency stimulation (hfs; e.g., 100200 hz), the induction of ltd typically requires more prolonged (e.g., 1030 min) trains of low - frequency stimulation (lfs; 13 hz), which has been shown to elicit homosynaptic ltd in the hippocampal ca1 field [1214], the primary visual cortex (v1) [15, 16], and the amygdala, among others (for reviews, see [6, 7, 11]). It is important to note, however, that the effectiveness of lfs to induce ltd appears to depend on several factors, including the age of the animal [18, 19] and the type of experimental preparation used (i.e., in vitro versus in vivo). The initial studies showing successful ltd induction in v1 (and other areas) all employed in vitro slice preparations [1215, 19]. Interestingly, the ability to elicit ltd is significantly reduced when the same lfs protocols are applied to the intact brain . Jiang et al . Used lfs (900 or 1800 pulses at 1 hz) of either the lateral geniculate nucleus (lgn), cortical white matter, or layer iv of v1 to induce ltd at layer ii / iii synapses of v1 in intact, anesthetized rats; neither of the two lfs protocols elicited ltd, regardless of stimulation site . Similarly, hager and dringenberg examined four different lfs protocols, applied to the lgn, and found that none of them was able to induce ltd in v1 of urethane - anesthetized rats . Even the strongest stimulation protocol used, consisting of 900 bursts (3 pulses / burst at 20 hz) delivered at 1 hz, only caused a transient depression for about 20 min following lfs delivery . Similar results have also been obtained in the hippocampal formation [22, 23]. The studies summarized above suggest that forebrain synapses display a relatively high resistance to the induction ltd under in vivo compared to in vitro conditions . One of several, plausible explanations for this discrepancy lies in the fact that different levels of spontaneous synaptic and/or spiking activity influences the effectiveness of lfs to alter synaptic connectivity, as recently proposed by benuskova . Spontaneous neural activity can be expected to differ substantially between various experimental preparations (e.g., in vitro, in vivo anesthetized, in vivo conscious, and behaving) and might therefore constitute one of the factors that account for the difference in ltd induction seen in prior work . Here, we examined if manipulating the levels of spontaneous, cortical activity alters the probability and/or magnitude of ltd at v1 synapses induced by lfs of the lgn; as discussed, prior work has demonstrated a high degree of resistance of this fiber system against ltd induction in vivo [20, 21]. The experiments were conducted in rats under very deep urethane anesthesia, a condition that reduces spontaneous activity, as indexed by a burst - suppression pattern of electrocorticographic (ecog) activity and long (up to several seconds) periods to cessation and neuronal firing (down - states) at the level of the cortex and lgn [2528]. To increase background neuronal activity, animals received electrical stimulation of the brainstem pedunculopontine reticular formation (rf), which exerts a powerful activating effect over the forebrain by eliciting generalized ecog activation and increasing the discharge rates of cortical neurons [2932]. Experiments were conducted in accordance with the published guidelines of the canadian council on animal care and approved by the queen's university animal care committee . All efforts were made to minimize animal suffering and the number of animals used for these experiments . Experiments were conducted on adult (250500 g) male long - evans rats (obtained from charles river laboratories, inc ., st . Rats were housed as groups (up to four rats / cage) in a standard colony room (12: 12-hour reverse light cycle, lights on at 19:00) and had free access to food and water . The surgical and electrophysiological procedures were carried out under deep urethane anesthesia (a total dose of 2.0 g / kg, which was administered intraperitoneally [i.p .] As four 0.5 g / kg doses every 1520 min, supplemented as necessary; urethane obtained from sigma - aldrich, oakville, ontario, canada). Following anesthesia induction, the animal was mounted in a stereotaxic apparatus (david kopf, tujunga, ca, usa) and the local anesthetic marcaine (hospira healthcare corporation, montreal, quebec, canada; 5 mg / kg, administered as 2 - 3 subcutaneous [s.c .] Injections) was applied to the scalp 15 min prior to the start of the surgery . Throughout all procedures, body temperature was monitored and maintained at 36 - 37c with an electric heating blanket . Furthermore, visual stimulation was reduced by placing hemostats across the closed lids of both eyes . For the surgery, an incision was made to expose the skull and small skull holes were drilled above the following brain areas (all measurements in mm from bregma point): v1 (anterior - posterior [ap] 7.5, lateral [l] + 3.6); lgn (ap 4.1, l + 4.1); and pedunculopontine tegmental rf (ap 8.0, l 2.0). Two additional holes were drilled in the skull over the prefrontal cortex to place a ground and reference connection (jewellery screws attached to miniature connectors). A concentric bipolar stimulation electrode (sne-100, rhodes medical instruments, david kopf, tujunga, ca, usa) was then lowered into each the lgn (ventral [v] 4.8 to 5.1 mm from the skull surface) and the rf (v 7.0). Furthermore, a monopolar recording electrode (125 m diameter teflon - insulated steel wire) was placed in the superficial layers of v1 (v 0.8 to 1.2). Final, ventral depths of the lgn and v1 electrodes were adjusted to yield fpsp recordings in v1 with maximal amplitude in response to single - pulse (0.2 ms duration) lgn stimulation . Stimulation of the lgn and rf (0.2 ms pulses for both) was provided by connecting the electrodes to separate stimulus isolation units delivering constant current output (lgn stimulation: ml 180 stimulus isolator controlled by a powerlab 4/25 t system, adinstruments, toronto, ontario, canada; rf stimulation: model 2100 isolated pulse stimulator, a - m systems, inc ., carlsborg, wa, usa). The fpsps (evoked by single - pulse lgn stimulation) and spontaneous background ecog activity in v1 were differentially recorded (using the same v1 electrode) against the reference connection in the bone over the prefrontal cortex . Both signals were amplified (bioamp, adinstruments), digitized (10 khz for fpsp, 100 hz for ecog), and stored for subsequent offline analysis using scope (v. 4.1.4; adinstruments) and chart (v. 5.5.6) software for fpsps and eeg, respectively . Following final electrode adjustments, each rat was left to stabilize for approximately 20 min . Subsequently, an input - output curve was established by stimulating the lgn at intensities of 0.11.0 ma (in 0.1 ma increments) and the stimulation intensity found to produce 5060% of the maximal fpsp amplitude was used for the remainder of the experiment . The fpsps in v1 were then recorded every 30 s until a stable baseline (30 min) was established (between 95% and 105% of average fpsp amplitude over three consecutive 10-minute intervals). Following baseline recordings, one group (lfs group, n = 8) of animals received lfs of the lgn, consisting of 900 stimulation bursts repeated at 1 hz, with each burst consisting of 3 pulses delivered at 20 hz . Previous work has shown that this protocol is effective in inducing transient depression of synaptic strength between the lgn and v1 in urethane - anesthetized rats . A second group of rats (lfs + rf group, n = 8) received lfs (the same as above), paired with stimulation of the rf (900 bursts, with each burst consisting of 25 pulses at 100 hz; always 0.3 ma intensity and 0.2 ms pulse duration; 10 ms latency between first lgn and first rf pulse). Three additional groups received lfs + rf stimulation and were given one of the following drug treatments: (a) scopolamine (1 mg / kg, n = 6); (b) mecamylamine (0.5 mg / kg, n = 6); or (c) scopolamine + mecamylamine (10 and 5 mg / kg, respectively; n = 4)., 20 min prior to the onset of baseline fpsp recordings . A final group (rf group, n = 6) received rf stimulation (the same as above) without lfs of the lgn . Following delivery of the stimulation protocol, single - pulse stimulation of the lgn resumed and fpsp were recorded (every 30 s) for another 90 min . Upon completion of the experiment, animals were perfused through the heart with 0.9% saline (~50 ml), followed by a 10% formalin solution (~100 ml). The brains were harvested and stored for a minimum of 24 h in 10% formalin, after which they were sectioned via a cryostat (40 m slices). The sections were mounted on glass slides and then used to verify electrode placements, using a digital microscope and rat brain atlas . The accuracy of placements was determined by an experimenter who was blind to the experimental results . The fpsps in v1 were analyzed using scope software (v. 4.1.4, ad instruments). The amplitude of the negative peak of the fpsp was computed offline by calculating the voltage difference between the activity immediately prior to the stimulus artefact and that of the maximum peak negativity . These amplitude values were then averaged over 10-minute intervals and normalized by dividing them by the average baseline amplitude of each animal . The ecog recorded in v1 was analyzed offline using chart software (v. 5.5.6, ad instruments). Two 30-second epochs were analyzed, one immediately prior to the onset of lfs delivery (baseline ecog) and one during lfs delivery (halfway during the 15 min lfs protocol). The raw ecog signal was band - pass filtered (0.1 to 5 hz) to attenuate stimulation - related, high - frequency artifacts in the recording . The filtered ecog signal was then subjected to power spectral analysis using chart software (fast - fourier transformation, size 512, cosine - bell function applied). All data are expressed as mean standard error of the mean (sem). Statistical comparisons were made using mixed - model analyses of variance (anova) and, where statistically appropriate, pairwise post hoc comparisons using the spss software package (version 21.0, spss inc ., il, usa). Single - pulse stimulation of the lgn consistently evoked fpsps in the superficial layers of the ipsilateral v1, with fpsps consisting of a large amplitude (up to 0.5 mv) negative component with a latency to peak of about 1518 ms (figure 1, insert). These fpsp characteristics are consistent with those reported in previous work using similar electrode configurations [21, 34]. Application of lfs (lfs group, n = 8; lfs consisting of 900 stimulation bursts repeated at 1 hz; each burst containing 3 pulses delivered at 20 hz) resulted in a significant reduction of fpsp amplitude, with normalized (to baseline) amplitude decreasing to 0.74 (i.e., 74% of baseline) 20 min after lfs delivery (figure 1). Subsequently, fpsp amplitude showed a gradual increase but remained below baseline levels throughout the entire 90 min recording period after lfs application, with normalized fpsp amplitude at 0.8, 0.93, and 0.83 of baseline levels at 30, 60, and 90 min following lfs delivery (figure 1). The mean normalized amplitude of the lfs group over the entire 90 min period after lfs delivery was 0.84 (i.e., 84%) of baseline amplitude, indicative of successful ltd induction in this group of animals (figure 1). This interpretation was supported by an anova, which revealed a significant effect of time on fpsp amplitude in rats receiving lfs, f(11,77) = 4.9, p <0.001 . Furthermore, at the end of the experiment (i.e., 90 min after lfs), fpsp amplitude was still significantly suppressed relative to all three baseline values (p <0.05, pairwise comparisons), even though there also was one post - lfs time point (60 min after lfs) where amplitude no longer differed from any of the baseline fpsp amplitude values (figure 1). Figure 2 depicts normalized fpsp amplitude of individual animals at six time points throughout the experiment . Note the depression of fpsp amplitude in most rats receiving lfs immediately (first 10 min) after stimulation (figure 2). Furthermore, depression was maintained for the large majority of rats (7/8 at 10, 30, 50, and 70 min after lfs; 8/8 at 90 min after lfs) throughout the entire recording period after lfs application (figure 2). A second group of rats (lfs + rf group, n = 8) received lfs, paired with stimulation of the pedunculopontine tegmental area of the rf (900 bursts, each burst consisting of 25 pulses at 100 hz, 0.3 ma intensity, and 10 ms latency between lgn and rf bursts). Surprisingly, in this group, fpsps did not show any evidence of synaptic depression, with normalized fpsp amplitude in the range of 0.99 to 1.07 (mean of 1.03) of baseline levels over the 90 min recording period following lfs + rf stimulation (figure 1). An anova comparing the lfs and lfs + rf groups revealed a significant main effect of group, f(1,14) = 5.6, p = 0.033, as well as a significant group time interaction, f(11,154) = 2.3, p = 0.043 (huynh - feldt correction applied), but no main effect of time, p = nonsignificant (ns). These statistical results confirm that lfs - induced ltd was reversed by combined lfs + rf stimulation . Inspection of individual animals showed that about half of the rats receiving lfs + rf stimulation showed some depression, while the other half exhibited an increase in fpsp amplitude over the 90 min after simulation (figure 2). The apparent block of ltd induction by pairing lfs with rf stimulation could be due to synaptic potentiation elicited by the rf stimulation protocol . This possibility was examined by testing a group of rats (rf group, n = 6) that received rf stimulation (the same protocol as above) without lfs applied to the lgn . In these animals, fpsps remained stable over the entire recording period, with normalized fpsp amplitude fluctuating in the range of 0.92 to 1.05 (mean of 0.97) of baseline over the 90 min following rf stimulation (figure 1). An anova comparing the lfs + rf and rf groups did not reveal a significant group effect, f(1,12) = 0.3, p = ns, or group time interaction, p = ns, providing further confirmation that lfs was ineffective when combined with rf stimulation . Plots of individual animals showed that, at most time points, about half of the rats in this group showed depression, while the other half exhibited facilitation of fpsp amplitude (figure 2). Together, these observations indicate that rf stimulation blocks lfs - induced ltd and that this effect is not due to synaptic enhancement elicited by rf excitation . One of the major, neurochemical systems controlled by the rf is the cholinergic neurons of the brainstem and basal forebrain, with rf stimulation eliciting widespread release of acetylcholine (ach) from the cortical mantle [3537]. Thus, it is possible that the effect of rf stimulation to block ltd in v1 following thalamic lfs is due to the release for ach . This hypothesis was tested by treating separate groups of rats with either the muscarinic receptor antagonist scopolamine (1 mg / kg, i.p . ; n = 6), the nicotinic receptor antagonist mecamylamine (0.5 mg / kg, i.p . ; n = 6), or a combination of these two drugs at very high doses (10 mg / kg scopolamine + 5 mg / kg mecamylamine, i.p . ; n = 4; all drugs given 20 min prior to the onset of baseline recordings). Surprisingly, rats given either scopolamine or mecamylamine still showed the blockade of synaptic depression elicited by paired lfs - rf stimulation (figure 3(a); normalized amplitude means over 90 min following stimulation of 1.11 and 1.03 for the scopolamine and mecamylamine group, resp . ). In fact, rf stimulation continued to block synaptic depression even when the two drugs were administered concurrently at much (10x) higher doses (figure 3(b); amplitude mean of 1.11). Thus, it appears unlikely that the lack of drug effectiveness was due to the use of insufficient doses or some compensatory interaction between muscarinic and nicotinic receptors . Separate anovas did not reveal any significant group effects when the lfs + rf (no drug) group was compared with lfs + rf rats receiving scopolamine, f(1,12) = 0.85, p = ns, mecamylamine, f(1,12) = 0.003, p = ns, or a combination of the two drugs, f(1,10) = 0.42, p = ns . These data suggest that muscarinic and nicotinic receptor activation is not necessary for the effect of rf stimulation to block the induction of ltd in v1 by thalamic lfs . Individual animals are plotted in figure 2, which shows that there was a trend for the majority of rats to exhibit increases in fpsp amplitude over the course of the experiment . To verify that lfs and pedunculopontine tegmental rf stimulation altered ongoing, cortical activity under deep urethane anesthesia, the ecog was dominated by large amplitude (up to 1 mv), slow oscillations (figure 4(a)). Often, these slow oscillations were interrupted by longer (up to 1 s) periods of strongly suppressed activity, as indicated by flat, isoelectric signals in the ecog (figure 4(a)). Power spectral analysis revealed that the peak power was concentrated in the frequency band between 0.6 and 0.8 hz (figure 5(a)). During lfs of the lgn, ecog activity showed more prominent, continuous large amplitude activity and isoelectric periods were abolished (figure 4(b)). Closer inspection of the ecog revealed that each stimulation burst evoked a (usually positive - going) wave in the superficial v1 . Spectral analyses showed that lfs resulted in an increase in power in the 0.6 to 2 hz range but also around 2.7 hz (figure 5(a)), as well as a slight upward shift in peak power to 0.8 and 1.0 hz (figure 5(a)). Similar observations were made in rats that received only rf stimulation (figure 4(c)), which resulted in a pronounced increase of power around 1 hz and a concurrent suppression (67%) of very low - frequency power around 0.6 hz (figure 5(b)). Rats that received lfs + rf stimulation showed distinct patterns of ecog activity during stimulation . Prior to stimulation, these animals also exhibited large, slow activity, with peak power around 0.6 hz (figure 5(c)). During stimulation, however, the ecog switched to a complex, rhythmic activity pattern (figure 4(d)), with a suppression (of 89%) of the low - frequency (0.6 hz) power peak and the emergence of a novel, maximal power peak around 1 hz (figure 5(c)). Furthermore, additional power peaks emerged at 1.8 hz, 2.7 hz, and 3.5 hz (figure 5(c)). Thus, combined lfs and rf resulted in the appearance of more complex, rhythmic activity in v1, including a significant amount of activity in higher frequency bands than those normally present under deep, surgical anesthesia . Interestingly, treatment with either scopolamine, mecamylamine, or both drugs in combination (the same doses as reported above) did not result in a clear attenuation of the evoked activity during lfs and rf stimulation . Scopolamine - treated rats exhibited peak power between 0.4 and 0.6 hz prior to stimulation (data know shown). During stimulation, this power peak was suppressed by 41% (89% suppression in untreated rats, see above), indicating a reduced effectiveness of stimulation to suppress very low - frequency activity during muscarinic receptor blockade . However, rats still exhibited the appearance of novel power peaks (at about 1 hz, 1.8 hz, and 2.7 and 3.5 hz), similar to the effect seen in untreated animals . Similarly, rats given mecamylamine showed peak power between 0.4 and 0.8 hz prior to stimulation, which was suppressed by 21% during lfs + rf delivery . Again novel power peaks emerged at the frequencies seen in untreated rats (data not shown). Similar observations were also made in rats that received concurrent treatment of scopolamine and mecamylamine (figure 4(e)), which also exhibited the characteristic frequency peaks elicited by lfs + rf stimulation (figure 5(d)). Together, these data demonstrate that muscarinic and nicotinic receptor blockade reduces the effectiveness of lfs + rf stimulation to suppress very low (<1 hz) frequency power in the ecog . However, these drugs do not prevent the emergence of the more complex activity in v1 that results from repeated burst stimulation of the lgn and rf . The experiments summarized above demonstrate that a strong lfs protocol (see), when applied to the lgn, is effective in inducing ltd in v1 of rats under deep urethane anesthesia . Interestingly, this effect was reversed when lfs was coupled with stimulation of the pedunculopontine tegmentum of the brainstem rf, a major activating centre of the entire forebrain [2932]. The reversal of ltd was unaffected by high doses of scopolamine and mecamylamine, indicating that cholinergic receptor activation is not required for the effect of rf stimulation to block ltd induction . Background ecog activity was profoundly altered by lfs + rf stimulation, which caused a suppression of very low (less than 1 hz) frequency activity and appearance of several, novel peaks in the power spectrum (between 1 and 3.5 hz). Again, muscarinic and/or nicotinic receptor blockade was not effective in blocking this evoked activity during lfs + rf stimulation, even though these drugs reduced the effectiveness of this stimulation protocol to suppress very low (<1 hz) frequency power in the ecog . Together, these data suggest that ongoing, cortical activity may exert an important gating function for plasticity induction at neocortical synapses, with lower activity levels providing a permissive state for the induction of ltd . Both ltp and ltd are now recognized to play important roles in experience - dependent fine - tuning of synaptic connectivity and information storage in neural circuits [28]. In the thalamocortical visual system, ltp and ltd mediate, at least in part, ocular dominance shifts induced by monocular deprivation [8, 38]; the fact that blockade of ltd mechanisms in v1 neurons is sufficient to inhibit ocular dominance plasticity is suggestive of a critical role of ltd in this phenomenon . Surprisingly, however, there are a number of reports of unsuccessful attempt to induce ltd, particularly under in vivo conditions [2023]. For example, jiang et al . Were unable to elicit ltd of field potentials in v1 in rats in vivo using a standard lfs protocol (1 hz stimulation for 15 min) that was highly effective when applied to v1 slice preparations . Similarly, hager and dringenberg were unable to induce ltd in v1 of urethane - anesthetized rats using a variety of ltd induction protocols that are effective under in vitro conditions . Several mechanisms have been proposed to account for the resistance of forebrain (hippocampal, neocortical) synapses against the induction of ltd . Jiang et al . Found that the presence of brain - derived neurotrophic factor in vivo exerts a potent, inhibitory effect on ltd induction in the intact brain . Recently, benuskova, using computational models based on experimental data on ltd induction in dentate gyrus granule cells, suggested that a specific level of ongoing, spontaneous spiking activity is required to elicit ltd, an assumption consistent with experimental observations . Thus, different levels of spontaneous, neural activity may perform important gating functions for the induction of ltd at forebrain synapses . To examine the role of varying level of spontaneous activity, we deliberately aimed to induce very deep levels of anesthesia, resulting in a burst - suppression pattern of ecog activity in v1 (see figure 4). During this state, synaptic and spiking activity is strongly reduced, as indicated by prolonged (up to 1 s) pauses in firing and strongly hyperpolarized (down - state) membrane potentials of cortical neurons [2527]. Under these conditions, lfs was effective in eliciting stable (for> 90 min) ltd in v1 . Interestingly, the same lfs protocol induced only transient (around 20 min) depression in a prior study that employed a lower dose of urethane than the one used here (2 g / kg versus 1.5 g / kg in). Thus, it is possible that the stronger suppression of cortical activity by a larger anesthetic dose (see [26, 27]) produced a state more conducive to the induction of synaptic depression, even though contributions of other factors (related or unrelated to the level of anesthesia) cannot be excluded . To further probe this issue, we directly manipulated cortical activity by excitation of the brainstem rf, a major activating system of the forebrain [2932]. While application of lfs alone strongly enhanced low (~0.32 hz) frequency power, paired lfs + rf stimulation reduced low - frequency power and resulted in the appearance of novel power peaks in the range between 1.8 and 3.5 hz . Thus, combined lfs and rf stimulation potently altered ecog activity by concurrently suppressing very slow activity and entraining novel, rhythmic activity in frequency ranges higher than those normally present under deep urethane anesthesia (see present results and [2932]). Most importantly, thalamic lfs became ineffective in eliciting ltd when it was delivered with rf stimulation . Ecog fluctuations largely reflect synchronized excitatory and inhibitory synaptic currents that summate in the extracellular space and give rise to local field potential that can be detected by extracellular recording electrodes [4143]. Thus, it appears that, during rf stimulation, the enhanced synaptic activity of cortical networks hinders the induction of ltd in v1 neurons . However, patterns of spiking activity may also play an important role in gating ltd induction, given that spiking activity of neocortical neurons is closely linked to rhythmic oscillations of extracellular (synaptic) currents [4143]. Given that rf stimulation results in the widespread release of ach throughout the cortical mantle [3537], we tested whether blockade of muscarinic and/or nicotinic receptors altered the effect of rf stimulation to block the induction of ltp in v1 . Interestingly, neither scopolamine nor mecamylamine, administered alone or together in very high doses, was able to reverse the blockade of ltd induction by rf stimulation . While these results may seem surprising, it is noteworthy that these drug treatments also failed to block the evoked ecog patterns elicited by lfs + rf stimulation (see figures 4 and 5), even though both drugs reduced the effectiveness of rf stimulation to suppress very low (<1 hz) frequency activity, an observation consistent with a role of both muscarinic and nicotinic receptors in ecog / eeg regulation . Overall, these data strengthen the proposed relation between synaptic activity levels and the probability of ltd induction, in that both the appearance of faster, cortical activity and the inhibition of ltd by rf stimulation were preserved during cholinergic receptor blockade . Furthermore, the observation that drug treatments reduced the suppression of very low (<1 hz) frequency power without affecting the blockade of ltd induction suggests that changes in very slow activity may not be a critical contributor to the effect of rf stimulation on ltd induction noted in our experiments . Our finding that reduced (by deep urethane anesthesia) and enhanced (by rf stimulation) cortical background activity can facilitate and suppress, respectively, synaptic depression is consistent with several investigations . Showed that reduced levels of background activity increased the probability to elicit shorter - term (in the order of minutes) synaptic depression in neocortical networks in vivo . Similarly, short - term depression of v1 synapses elicited by paired - pulse stimulation in vitro was strongly inhibited when slices were perfused with elevated - potassium medium to elicit spontaneous activity . Together, these data indicate that a state of lowered neural activity may be permissive for the induction of synaptic depression across a variety of time scales (from seconds to hours) in neocortical networks . Furthermore, given that typical slice preparations exhibit relatively little or no spontaneous activity (e.g.,), this interpretation can also account for the higher effectiveness of lfs to elicit ltd under in vitro compared to in vivo conditions, as discussed above . As an important extension of the current experiments, future work could manipulate cortical activity by more naturalistic sensory stimulation, rather than by means of electrical (present study) or chemical manipulations (e.g.,). If background activity does, indeed, exert the gating function proposed here, then visual stimuli (e.g., full - field flashes or moving, sinusoidal gratings) and dark exposure should inhibit and facilitate, respectively, ltd induction in v1 . However, it is worth noting that the eyes of our animals remained closed throughout the experimental procedures, raising the possibility that the lack of visual input contributed to the successful ltd induction in rats that received lfs without coupled rf stimulation . At the same time, our data and interpretations appear to contradict the model by benuskova, proposing that spontaneous activity is required to elicit ltd . It is important to note, however, that our recordings of v1 activity during delivery of thalamic lfs revealed a pronounced enhancement of synaptic activity in the range of about 0.32 hz compared to spontaneous (pre - lfs) activity . Thus, it is conceivable that this activity level is in the permissive range required to elicit ltd at neocortical synapses . When spontaneous activity is increased (present data) or decreased (see) to levels outside this permissive window, ltd is blocked, as seen when lfs was paired with rf stimulation . A possible explanation for this effect might be that synaptic and spiking activity elicited by relatively infrequent (~1 hz) lfs is now embedded in a more active network . Under these conditions, lfs may lose the ability to relay information about the relative timing of firing of individual pre- and postsynaptic neurons, the main determinant of plasticity induction and direction (i.e., potentiation versus depression), according to spike - time - dependent plasticity (stdp) rules [4749]. Future experiments that systematically and independently manipulate spontaneous activity of pre- and postsynaptic neurons and assess the consequences on ltd induction are required to assess this hypothesis . The concurrent application of a gabaa - receptor agonist and a gabab - receptor antagonist has recently been shown to result in the inhibition of postsynaptic responses, while largely preserving the activity of presynaptic inputs [50, 51]. Thus, this pharmacological approach might be useful in determining the respective roles of spontaneous pre- and postsynaptic firing on ltd induction in thalamocortical sensory (and other) pathways under in vivo conditions . In summary, the present experiments show that stimulation of the brainstem core increases cortical activity and inhibits the induction of ltd in v1 . Both effects were resistant to the blockade of cholinergic (muscarinic and nicotinic) receptors . Thus, we propose that increased levels of ongoing, neural activity may limit the ability to elicit depression at cortical synapses.
|
Jack (35), a college teacher and a father of two children aged 5 and 13 years, has been a jehovah s witness as long as he can remember . His youngest child has accompanied him to religious meetings, but the 13-year - old has never been a part of the jehovah s witness community . The family doctor came to see him, and suspected that jack suffered from appendicitis . Jack insisted on going there by taxi, not ambulance . In the pre - operation consultation with jill, an experienced surgeon he has never been admitted to a hospital ward before . At the end of the consultation he mentions that he is a jehovah s witness . Surgeon jill assures jack that the procedure is low - risk, that she has never even considered blood transfusion during appendectomy . He adds that he has a standard declaration from the jehovah s witness community signed by two of the elders . He forgot to bring it, thoughi guess what will be, will be, he says with a faint smile . Jill says it makes no difference: i would only be interested in your signature anyway . They part cordially, and soon jack is prepared for the operation . During the procedure jill punctures an artery by accident . Startled looks are exchanged, instruments are monitored . It s my call, jill says, surgeon jill is upset and even considers omitting from the journal that jack received blood . ? She curses the jehovah s witness policy for a minute, pities jack s children, blames herself . Medical errors are commonplace, but fatal errors if she had only asked him properly in advance the two kids where are they now did she care properly for jack, or is proper caring impossible given the jehovah s witness standpoint? How does one retrieve an informed consent or at least some kind of understanding under such circumstances? Obviously, jill cared for jack s well - being . She discussed the matter with him, she understood where he was coming from, and she respected his view . The best way of caring for jack was simply to make him feel at ease . If the operation had gone as planned, her conduct would never have been questioned . On the contrary, jack would shortly have been out of the hospital, grateful to the surgeon who removed his pain and respected his standpoint to boot . The first impression is therefore that jill s conduct was impeccable, but ethics is about thinking at least twice . We will therefore first identify and discuss the relevant background stories, or master narratives next, we will evaluate the core narrative (i.e. The jack & jill case) from two perspectives, so as to broaden our understanding of what happens . Finally, we will focus on closure, that is, discuss different courses of action and the endings they entail, and which will have the greatest acceptability . Blood is a rich notion, signalling kinship and conflict, holiness and impurity; sometimes life itself . . Massive loss of blood follows in the wake of violence, sickness and suffering, and ultimately leads to loss of life . But the story of how doctors have compensated for blood loss is long and interesting, too . Not only because it adds to the drama already present, but because it introduces a novel set of problems . As jack and jill seem to hold different views on blood transfusion, we need to study the master narratives that allow for this difference of opinion.2 without knowing their opinions, it is difficult to know what is at stake . After william harvey successfully demonstrated heart - driven blood circulation in 1648, scientific attempts to transfer blood between animals or humans were soon made . Although some degree of success is recorded, the characteristics of blood were not well understood . Only after karl landsteiner s description of different blood groups began receiving attention in 1909, did direct blood transfusion become a standard therapeutic means . During ww1, techniques for storing and transfusing blood were developed and refined . With anticoagulants and refrigeration, blood, components of blood are stored, and much research is put into creating artificial blood products . Blood transfusion is considered as a safe and efficient way of increasing blood volume or the oxygen - carrying capacity of blood during or after surgery . Therefore, surgeon jill always keeps a unit or two of blood handy when operating . Not that she always needs it . Quite often, jill gives the patient a unit for boosting the number of red blood cells after an intervention . Most of the time as mild allergic reactions, but sometimes side - effects can be lethal . The chance, however, of contracting hepatitis or hiv infection through blood transfusion is one in two million units . However, that is not to deny that sometimes the patient would be better off by not being given blood . Maybe better techniques or advance planning would lessen the need for blood transfusion, thus minimising the risk of side - effects and shortage of blood . That blood transfusion is an asset is indisputable, but whether today s practice is optimal remains a question . Jehovah s witnesses know that transfusions save lives, but they contest that lives ought to be saved in this manner ., a statement that the watchtower society the authority for jehovah s witnesses interprets as including the practice of blood transfusion . You are not to eat any blood, either of bird or animal, in any of your dwellings . And later, in leviticus 17:10, the vengeful lord claims that and any man from the house of israel, or from the aliens who sojourn among them, who eats any blood, i will set my face against that person who eats blood and will cut him off from among his people . Similar passages are found in acts (15:1920) and in deuteronomy (12:2325), where the lord identifies blood with life: only be sure not to eat the blood, for the blood is the life, and you shall not eat the life with the flesh . Few non - witnesses would drink the blood of another human being . However, some have pointed out that the old testament hardly addresses modern blood transfusion . You do not really eat through the cardiovascular system.3 consequently the ban on blood transfusion rests on a misunderstanding . But if eating is interpreted broadly, for instance as assimilating a substance, the watchtower society s standpoint still makes sense . And face it, if you should not eat blood, then you are certainly not to take it intravenously! Blood is life itself and should not be transferred from one person to another like some commodity . This is sometimes hard to accept for health care workers, for surgeons that have to let perfectly saveable patients die . But some things are more important than living to deny blood transfusions seems to be the ultimate test of faith . This is where the true believers can be separated from those who put themselves first.4 the ban on blood transfusion seems to be written in stone, but as with the mainstream story, exceptions and reservations can be found . This is not surprising as the stakes are high, and the risks and benefits are matters of faith, although the watchtower seems to emphasise the medical benefits of not receiving blood on their homepage . As a group, they are the best educated consumers the surgeon will ever encounter . However, advanced techniques and methods seldom apply to emergency situations involving massive loss of blood . It would certainly be tough to expel a witness from the religious community on the grounds that he or she received blood as a last measure . Being too hard on the sinner would certainly contradict other teachings of the bible . Today, those who receive blood are not disfellowshipped if the witness claims weakness of will after the fact . In light of less absolutist view on blood products the watchtower society accepts the use of blood products like albumin, epo, haemoglobin and blood serums to some degree, and makes this a matter of conscience for each witness: [w]hen it comes to fractions of any of the primary components, each christian, after careful and prayerful meditation, must conscientiously decide for himself given the consequences this policy has had, it is perhaps no surprise that the end point of this slippery - slope is hard for many witnesses to accept . In the past the watchtower has taken a similar stand on other medical practices, only to abandon its position later . This was the case with vaccines, which were held to be a direct violation of the everlasting covenant that god made with noah after the flood [5, p. 293 the jehovah s witness story is, in other words, not as absolutist as it may seem at the first glance . Jack may be a fundamentalist on this issue, it may even be his chance to prove himself to himself and to his community even to his children . Doubts and discussions about blood transfusion exist among jehovah s witnesses, but overemphasising the ambiguities may lead us to overread the jehovah s witness master narrative . Underreading.5 these are the two most important pitfalls in explaining the context of the case . This example shows that master narratives are not stereotypes, but complex and sometimes amorphous . Knowledge of these complexities provides us with a repertoire of possibilities and angles for discussing relevant matters . The core case about jack and but it is also more difficult because jack is dead and we cannot know what he his motives and thoughts or even if he had a stable opinion at all . We can investigate jill s, but her memory may be coloured by the tragic outcome . We will consider this by taking the core case as reconstructed above . In order to gain understanding we have to consider the story from three points of view: an intentional (stated overtly), symptomatic (e.g. What is not said), and adaptive (e.g. Imagining other possible trajectories). An intentional reading addresses what is openly stated, and from this perspective the story seems straightforward . She also intends to respect her patient s wishes and make the experience as painless as possible . Therefore, she soothes anxious patient jack in the pre - operative consultation, and she responds readily to his signalling of religious conviction . She is comfortable that this is a correct interpretation, because the only reason jack would bring up his religious affiliation would be in connection with a possible blood transfusion . He wants the surgeon to know that he is a jehovah s witness, and that he possesses an advance will declaring that he does not want blood transfusion . Jack was anaesthetized, jill was not reckless she cannot quite explain why it happened . When it did, the intention to save his life proved stronger than the intention to cater to his wishes . It aims at pointing out what is communicated indirectly, what the interlocutors will not or cannot tell . Admittedly, this involves some degree of guesswork, and the danger of overreading is always present . We therefore need to argue our case perhaps more carefully than was the case in our intentional reading . In the conversation between jack and jill there are some issues that can be seen to be hinted at, understated, or implicitly understood . Why did nt jack say explicitly that he did nt want a blood transfusion under any circumstances? What did his repeated statement what will be will be mean? And why did nt jill raise the question of what to do in emergencies? To address the latter question first: would she have talked about the what - ifs to a non - witness patient? She was completely confident that jack would not need it, so we have no reason to believe that she would have raised the issue . But as a surgeon she knows that complications may occur . Good patient care implies a dose of relevant ifs and buts, without scaring the patient unnecessarily . If jack (or any other patient) had asked her directly about the risks, we have no reason to believe that she would not have volunteered any information . The case does not really reveal whether jack is following the traditional jehovah s witness line . He has signed a hypothetical contract, but he did not bring it . Maybe this simple fact should have made jill venture into an exchange of opinion? Does he usually carry it? Admittedly, discussing the declaration could have upset jack . Maybe jill, subconsciously, likes to keep her options open? If we have not discussed it, then i make the decisions . Or, maybe she considers even hinting at religious views as too paternalist? A win win situation . But jack s anxiety may stem from the unfamiliarity of the hospital situation, or from being anesthetised and brought under the knife for the first time . Introducing maybe he feels that there are so much at stake that he is about to reconsider his stand on blood transfusion . Although this is not the time to abandon his beliefs, maybe he wanted to discuss it with an outsider . Jill had been aware that some witnesses accept a wide range of blood products, she might have felt that this was a topic that ought to be discussed with jack . Maybe if she had known that quite a few patients even accept whole blood, without wanting any fuss made about it, well, maybe she would have approached jack differently . It would perhaps have been a near - impossible discussion to initiate, given jack s pain . Nevertheless is this a gross overreading, or do we have any evidence to say that jack has ambiguous thoughts on the issue? At first glace, he simply states that he is a jehovah s witness, and that he has a valid declaration . However, saying that he left his declaration / statement at home may indicate that he did not forget it, but more or less deliberately left it . He did nt say he was sorry that he forgot this piece of paper, or that he could produce it somehow, or that the hospital could call . He just mentioned it, and then jill hurriedly assured him that the procedure is low - risk, and that she has never even considered blood transfusion during appendectomy . Maybe jack feels that he cannot go further without coming close to denouncing his stand actively . If it is low - risk, it may not be worth problematising his religious policy . What will be will be . Seeing him calm down, jill ends the conversation, thereby cementing her view of him as a stereotypic jehovah s witness . If jack wants to express doubts, he must explain that not all jehovah s witnesses are absolutist in this regard and that he, even if he has co - signed the declaration, considers survival to be more important, at least as long as he has small children so understanding that the timing is all wrong, he puts his life in the hands of fate . There are at least two symptoms in the text, indicating that jack wants to discuss outside of the box . Before we discuss this topic further, let us have a closer look at the third way of reading . In an adaptative reading, we alter conditions and utterances and study what difference such changes make: what if jill had asked, if jack instead of x had said y, what if this was a pre - planned procedure? And so forth . This resembles standard scientific experimentation and enhances our understanding of the case, and why we think things matter . We may come to agree that some type of action is right or wrong, good or bad, better or worse . In the present case we may even conclude that even with the sparse information jill had, she should have acted differently in order to secure relevant information . Retrospective wisdom, perhaps, but the point is to learn from the experience, not to judge jill . Let us assume that this is a crisis for jack, a last opportunity to revise or suspend his standpoints he might not be fully aware that this is the case . He feels that this is the time, but maybe he cannot voice this opinion all by himself, he can only manage to send some subtle signals . Is jill justified in just repeating that jack is a jehovah s witness and assuming that he is in line with the traditional view a stereotype? Is she justified in trying to make jack act out of character, in challenging his religious beliefs, in the name of what is most convenient for herself and her team? Let us recapitulate the first part of the conversation between jack and jill: jack: i have never really been to a hospital before i ve been here before, but never as a patient jill: i know what you mean, jack . You go about your everyday life, and suddenly you are a patient the good news is that we wo nt keep you long . I m glad that you, you seem to know your business you, you know that i am a jehovah s witness? I have never even considered blood transfusion during appendectomy, so you should be alright . But, uh, i forgot to bring it what will be, will be jill: do nt let that bother you, jack . Anyway, soon you ll be on the mend jack: yes, i guess what will be, will be (he smiles faintly). (they exchange smiles and jill leaves the room) (they exchange smiles and jill leaves the room) let us consider some other paths the story could have taken: second part (1): jill thinks jack s forgetfulness is a sign that he accepts blood transfusions: jill: since you brought it up like that, does that mean that you are flexible with regard to religion on this point or more precisely, blood transfusion jack: no, no, i ve been a jehovah s witness all my life, i m not copping out now . She is not comfortable with the situation, but she feels that it was jack s conviction that killed him . Second part (2): jill is familiar with jack s master narrative and tries to make him reconsider: jill: keeping some blood units handy makes it easier for us and it s safer for you . I know this is difficult for you, but i also know that the wts is changing its attitude . In some years after all, vaccines pose no problem anymore . I know that you ve got a lot to live for and i understand it perfectly if you do nt want to take any unnecessary risks he says that jill forced her values upon him at a difficult moment, and that his life is ruined . Second part (3): jill scouts the territory, pressuring jack mildly: jill: jack, although appendectomy is a straight - forward intervention, you know that there is, as always, a slight risk that something unforeseen can happen given the circumstances, i know i have to bring this up with you jill: (she leaves ample time for jack to speak) i know, or at least i think i know where you re coming from, and i fully respect it . In some regards your stand makes us improve our medical services . That is a good thing . However, in case something unforeseen happens during the operation, i will use my best judgment . You ll be just fine, jack the accident happens, but jill is better prepared . Maybe there is no happy ending to be had, but in all these alternative endings some nagging doubts are at least eliminated . Therefore, they probably represent better courses of action than the original one, which left jill uncertain of how to act in an emergency . Are these narratives also examples of better caring than the original case? I would venture to say yes, with the possible exception of (1). The way she asks him seems too direct, even provocative, unless strong non - verbal signs indicated that this approach was acceptable . Then she secures the information with a closed question (and no exceptions are allowed, right?). If caring requires us to attempt to participate in the other s story, closure comes too soon here . She is certainly not forming a better relationship with jack by proceeding in this manner . Jill puts pressure on jack through her interpretation of the validity of his master narrative . After doing so one may well argue that this is exactly what she tries to do in the first place . She saves his life, so from the perspective of medical care (and her hippocratic oath) she does the prudent thing . Given the circumstances, jack will probably not be expelled from his religious community, and jill must probably assume blame for what happened . She will probably not receive anything but a mild warning from her superiors . Rigging the scene so that she will be the one to blame may not be the worst kind of caring, at least not if jack learns to live with the wrong done to him . Moreover, the seriousness of the situation may justify a no - nonsense approach . The third scenario differs from the last one in that issues are merely hinted at . Is she justified in acting upon a weak nod when jack was able to speak? If jack died, how would she answer if his next of kin inquired we hope no blood transfusion took place? Could she justify saying her caring for him is based on his silence and his nods . As was the case in (2), she should be ready to assume the blame if necessary, but there is nothing that indicates that she does not take care of his interests . After all, jack has no death wish he calls for the doctor and accepts surgery . Of course, jill also takes care of her own interests she is there to save lives . That is why she chose to become a physician, and it is what she has sworn to do . It is against her reflexes and professional pride not to do everything she can to save lives . In addition, she feels safer a better surgeon if there are no constraints present . She also knows that what is a question of either - or on paper, may be negotiable in practice . She knows that people change when they are experiencing crises . As rita charon writes: old family secrets, long - time troubling issues, deeply felt but unexpressed emotions all muted or somehow removed from the surface of daily lives over the years often become visible and expressed in ways that they are at no other time during our lives . Serious illness can be, and often is, a time of profound change in the lives of patients and those closest to them [3, p. x]. It is part of being a carer for a human being in crisis to inquire into such matters, but how? Maybe she is too blunt in (2), too cautious in (3). Blood is a rich notion, signalling kinship and conflict, holiness and impurity; sometimes life itself . Massive loss of blood follows in the wake of violence, sickness and suffering, and ultimately leads to loss of life . But the story of how doctors have compensated for blood loss is long and interesting, too . Not only because it adds to the drama already present, but because it introduces a novel set of problems . As jack and jill seem to hold different views on blood transfusion, we need to study the master narratives that allow for this difference of opinion.2 without knowing their opinions, it is difficult to know what is at stake after william harvey successfully demonstrated heart - driven blood circulation in 1648, scientific attempts to transfer blood between animals or humans were soon made . Although some degree of success is recorded, the characteristics of blood were not well understood . Only after karl landsteiner s description of different blood groups began receiving attention in 1909, did direct blood transfusion become a standard therapeutic means . During ww1, techniques for storing and transfusing blood were developed and refined . With anticoagulants and refrigeration, blood, components of blood are stored, and much research is put into creating artificial blood products . Blood transfusion is considered as a safe and efficient way of increasing blood volume or the oxygen - carrying capacity of blood during or after surgery . Therefore, surgeon jill always keeps a unit or two of blood handy when operating . Not that she always needs it . Sometimes it is just a precaution; to counteract the unforeseen . And quite often, jill gives the patient a unit for boosting the number of red blood cells after an intervention . Blood transfusion introduces the risk of side - effects . Most of the time as mild allergic reactions, but sometimes side - effects can be lethal . The chance, however, of contracting hepatitis or hiv infection through blood transfusion is one in two million units . However, that is not to deny that sometimes the patient would be better off by not being given blood . Maybe better techniques or advance planning would lessen the need for blood transfusion, thus minimising the risk of side - effects and shortage of blood . That blood transfusion is an asset is indisputable, but whether today s practice is optimal jehovah s witnesses know that transfusions save lives, but they contest that lives ought to be saved in this manner . The lord bans eating blood, a statement that the watchtower society the authority for jehovah s witnesses interprets as including the practice of blood transfusion . You are not to eat any blood, either of bird or animal, in any of your dwellings . And later, in leviticus 17:10, the vengeful lord claims that and any man from the house of israel, or from the aliens who sojourn among them, who eats any blood, i will set my face against that person who eats blood and will cut him off from among his people . Similar passages are found in acts (15:1920) and in deuteronomy (12:2325), where the lord identifies blood with life: only be sure not to eat the blood, for the blood is the life, and you shall not eat the life with the flesh . Few non - witnesses would drink the blood of another human being . However, some have pointed out that the old testament hardly addresses modern blood transfusion . You do not really eat through the cardiovascular system.3 consequently the ban on blood transfusion rests on a misunderstanding . But if eating is interpreted broadly, for instance as assimilating a substance, the watchtower society s standpoint still makes sense . And face it, if you should not eat blood, then you are certainly not to take it intravenously! Blood is life itself and should not be transferred from one person to another like some commodity . This is sometimes hard to accept for health care workers, for surgeons that have to let perfectly saveable patients die . It is no doubt hard for the patients themselves . But some things are more important than living to deny blood transfusions seems to be the ultimate test of faith this is where the true believers can be separated from those who put themselves first.4 the ban on blood transfusion seems to be written in stone, but as with the mainstream story, exceptions and reservations can be found . This is not surprising as the stakes are high, and the risks and benefits are matters of faith, although the watchtower seems to emphasise the medical benefits of not receiving blood on their homepage . Therefore, they accept and vigorously pursue medical alternatives to blood . Jehovah s witnesses actively seek the best in medical treatment, said dr . As a group, they are the best educated consumers the surgeon will ever encounter . However, advanced techniques and methods seldom apply to emergency situations involving massive loss of blood . It would certainly be tough to expel a witness from the religious community on the grounds that he or she received blood as a last measure . Being too hard on the sinner would certainly contradict other teachings of the bible . Today, those who receive blood are not disfellowshipped if the witness claims weakness of will after the fact . In light of less absolutist view on blood products, this seems reasonable . In the new millennium, the watchtower society accepts the use of blood products like albumin, epo, haemoglobin and blood serums to some degree, and makes this a matter of conscience for each witness: [w]hen it comes to fractions of any of the primary components, each christian, after careful and prayerful meditation, must conscientiously decide for himself given the consequences this policy has had, it is perhaps no surprise that the end point of this slippery - slope is hard for many witnesses to accept . In the past the watchtower has taken a similar stand on other medical practices, only to abandon its position later . This was the case with vaccines, which were held to be a direct violation of the everlasting covenant that god made with noah after the flood [5, p. 293]. The jehovah s witness story is, in other words, not as absolutist as it may seem at the first glance . Jack may be a fundamentalist on this issue, it may even be his chance to prove himself to himself and to his community even to his children . Doubts and discussions about blood transfusion exist among jehovah s witnesses, but overemphasising the ambiguities may lead us to overread the jehovah s witness master narrative . Underreading.5 these are the two most important pitfalls in explaining the context of the case . This example shows that master narratives are not stereotypes, but complex and sometimes amorphous . Knowledge of these complexities provides us with a repertoire of possibilities and angles for discussing relevant matters . The core case about jack and jill is easier to handle because it involves few people . But it is also more difficult because jack is dead and we cannot know what he his motives and thoughts or even if he had a stable opinion at all . We can investigate jill s, but her memory may be coloured by the tragic outcome . To gain understanding we have to consider the story from three points of view: an intentional (stated overtly), symptomatic (e.g. What is not said), and adaptive (e.g. Imagining other possible trajectories). An intentional reading addresses what is openly stated, and from this perspective the story seems straightforward . She also intends to respect her patient s wishes and make the experience as painless as possible . Therefore, she soothes anxious patient jack in the pre - operative consultation, and she responds readily to his signalling of religious conviction . She is comfortable that this is a correct interpretation, because the only reason jack would bring up his religious affiliation would be in connection with a possible blood transfusion . He wants the surgeon to know that he is a jehovah s witness, and that he possesses an advance will declaring that he does not want blood transfusion . Jack was anaesthetized, jill was not reckless she cannot quite explain why it happened . When it did, the intention to save his life proved stronger than the intention to cater to his wishes . It aims at pointing out what is communicated indirectly, what the interlocutors will not or cannot tell . Special wordings or omissions are common markers of such suppressed information . Admittedly, this involves some degree of guesswork, and the danger of overreading is always present . We therefore need to argue our case perhaps more carefully than was the case in our intentional reading . In the conversation between jack and jill there are some issues that can be seen to be hinted at, understated, or implicitly understood . Why did nt jack say explicitly that he did nt want a blood transfusion under any circumstances? What did his repeated statement what will be will be mean? And why did nt jill raise the question of what to do in emergencies? To address the latter question first: would she have talked about the what - ifs to a non - witness patient? She was completely confident that jack would not need it, so we have no reason to believe that she would have raised the issue . But as a surgeon she knows that complications may occur . Good patient care implies a dose of relevant ifs and buts, without scaring the patient unnecessarily . If jack (or any other patient) had asked her directly about the risks, we have no reason to believe that she would not have volunteered any information . The case does not really reveal whether jack is following the traditional jehovah s witness line . He has signed a hypothetical contract, but he did not bring it . Maybe this simple fact should have made jill venture into an exchange of opinion? Does he usually carry it? Admittedly, discussing the declaration could have upset jack . Maybe jill, subconsciously, likes to keep her options open? If we have not discussed it, then i make the decisions . Or, maybe she considers even hinting at religious views as too paternalist? A win win situation . But jack s anxiety may stem from the unfamiliarity of the hospital situation, or from being anesthetised and brought under the knife for the first time . Introducing maybe he feels that there are so much at stake that he is about to reconsider his stand on blood transfusion . After all, he is a single parent . Although this is not the time to abandon his beliefs, maybe he wanted to discuss it with an outsider . Jill had been aware that some witnesses accept a wide range of blood products, she might have felt that this was a topic that ought to be discussed with jack . Maybe if she had known that quite a few patients even accept whole blood, without wanting any fuss made about it, well, maybe she would have approached jack differently . It would perhaps have been a near - impossible discussion to initiate, given jack s pain . Nevertheless is this a gross overreading, or do we have any evidence to say that jack has ambiguous thoughts on the issue? At first glace, he simply states that he is a jehovah s witness, and that he has a valid declaration . However, saying that he left his declaration / statement at home may indicate that he did not forget it, but more or less deliberately left it . He did nt say he was sorry that he forgot this piece of paper, or that he could produce it somehow, or that the hospital could call . He just mentioned it, and then jill hurriedly assured him that the procedure is low - risk, and that she has never even considered blood transfusion during appendectomy . Maybe jack feels that he cannot go further without coming close to denouncing his stand actively . If it is low - risk, it may not be worth problematising his religious policy . What will be will be . Seeing him calm down, jill ends the conversation, thereby cementing her view of him as a stereotypic jehovah s witness . If jack wants to express doubts, he must explain that not all jehovah s witnesses are absolutist in this regard and that he, even if he has co - signed the declaration, considers survival to be more important, at least as long as he has small children so understanding that the timing is all wrong, he puts his life in the hands of fate . There are at least two symptoms in the text, indicating that jack wants to discuss outside of the box . Before we discuss this topic further, let us have a closer look at the third way of reading . In an adaptative reading, we alter conditions and utterances and study what difference such changes make: what if jill had asked, if jack instead of x had said y, what if this was a pre - planned procedure? This resembles standard scientific experimentation and enhances our understanding of the case, and why we think things matter . We may come to agree that some type of action is right or wrong, good or bad, better or worse . In the present case we may even conclude that even with the sparse information jill had, she should have acted differently in order to secure relevant information . Retrospective wisdom, perhaps, but the point is to learn from the experience, not to judge jill . Let us assume that this is a crisis for jack, a last opportunity to revise or suspend his standpoints he might not be fully aware that this is the case . He feels that this is the time, but maybe he cannot voice this opinion all by himself, he can only manage to send some subtle signals . Is jill justified in just repeating that jack is a jehovah s witness and assuming that he is in line with the traditional view a stereotype? Is she justified in trying to make jack act out of character, in challenging his religious beliefs, in the name of what is most convenient for herself and her team? I ve been here before, but never as a patient jill: i know what you mean, jack . You go about your everyday life, and suddenly you are a patient the good news is that we wo nt keep you long . I will then find your appendix and make sure it wo nt bother you again . I m glad that you, you seem to know your business you, you know that i am a jehovah s witness? I have never even considered blood transfusion during appendectomy, so you should be alright . But, uh, i forgot to bring it what will be, will be jill: do nt let that bother you, jack . Anyway, soon you ll be on the mend jack: yes, i guess what will be, will be (he smiles faintly). (they exchange smiles and jill leaves the room) (they exchange smiles and jill leaves the room) let us consider some other paths the story could have taken: second part (1): jill thinks jack s forgetfulness is a sign that he accepts blood transfusions: jill: since you brought it up like that, does that mean that you are flexible with regard to religion on this point or more precisely, blood transfusion jack: no, no, i ve been a jehovah s witness all my life, i m not copping out now . She is not comfortable with the situation, but she feels that it was jack s conviction that killed him . Second part (2): jill is familiar with jack s master narrative and tries to make him reconsider: jill: keeping some blood units handy makes it easier for us and it s safer for you . I know this is difficult for you, but i also know that the wts is changing its attitude . In some years after all, vaccines pose no problem anymore . I know that you ve got a lot to live for and i understand it perfectly if you do nt want to take any unnecessary risks he says that jill forced her values upon him at a difficult moment, and that his life is ruined . Second part (3): jill scouts the territory, pressuring jack mildly: jill: jack, although appendectomy is a straight - forward intervention, you know that there is, as always, a slight risk that something unforeseen can happen given the circumstances, i know i have to bring this up with you jill: (she leaves ample time for jack to speak) i know, or at least i think i know where you re coming from, and i fully respect it . In some regards your stand makes us improve our medical services . That is a good thing . However, in case something unforeseen happens during the operation, i will use my best judgment . Jack: [nods again, almost imperceptibly] jill: i m sorry i needed to raise the issue . As i said, this is a routine operation . You ll be just fine, jack the accident happens, but jill is better prepared . Maybe there is no happy ending to be had, but in all these alternative endings some nagging doubts are at least eliminated . Therefore, they probably represent better courses of action than the original one, which left jill uncertain of how to act in an emergency . I would venture to say yes, with the possible exception of (1). The way she asks him seems too direct, even provocative, unless strong non - verbal signs indicated that this approach was acceptable . Then she secures the information with a closed question (and no exceptions are allowed, right?). If caring requires us to attempt to participate in the other s story, closure comes too soon here . She is certainly not forming a better relationship with jack by proceeding in this manner . Jill puts pressure on jack through her interpretation of the validity of his master narrative . After doing so, she says that she will try not to influence his choice at all . One may well argue that this is exactly what she tries to do in the first place . She saves his life, so from the perspective of medical care (and her hippocratic oath) she does the prudent thing . Given the circumstances, jack will probably not be expelled from his religious community, and jill must probably assume blame for what happened . Rigging the scene so that she will be the one to blame may not be the worst kind of caring, at least not if jack learns to live with the wrong done to him . The third scenario differs from the last one in that issues are merely hinted at . Is she justified in acting upon a weak nod when jack was able to speak? If jack died, how would she answer if his next of kin inquired we hope no blood transfusion took place? Could she justify saying her caring for him is based on his silence and his nods . As was the case in (2), she should be ready to assume the blame if necessary, but there is nothing that indicates that she does not take care of his interests . After all, jack has no death wish he calls for the doctor and accepts surgery . Of course, jill also takes care of her own interests she is there to save lives . That is why she chose to become a physician, and it is what she has sworn to do . It is against her reflexes and professional pride not to do everything she can to save lives . In addition, she feels safer a better surgeon if there are no constraints present . She also knows that what is a question of either - or on paper, may be negotiable in practice . She knows that people change when they are experiencing crises . As rita charon writes: old family secrets, long - time troubling issues, deeply felt but unexpressed emotions all muted or somehow removed from the surface of daily lives over the years often become visible and expressed in ways that they are at no other time during our lives . Serious illness can be, and often is, a time of profound change in the lives of patients and those closest to them [3, p. x]. It is part of being a carer for a human being in crisis to inquire into such matters, but how? Maybe she is too blunt in (2), too cautious in (3). As mentioned in the introduction, there is an ongoing discussion about whether ethics of care is an ethical theory in its own right or simply an addendum to traditional theories . Providing a definite answer to this question is perhaps not so important . If some line of ethical reasoning works, i.e. Produces useful insights and perspectives, we ought to develop it further . Ethics of care is a relatively new branch of ethics and all its features have not been firmly established and developed . Here but such a claim hinges on the idea that narrative reasoning is somehow intrinsic to ethics of care, and not simply a tool that can be used for any old theory . If consequentialism or deontology had been our point of departure we would most likely have overlooked the issues troubling surgeon jill . Performing benthamite felicific calculus [9, p. 19ff] or asking jack to rank his preferences would simply not have been very helpful . We would, somehow, have had to ask jack to estimate the weight of his religious and parental obligations, in addition to those he holds towards himself . Going for a signed testimony under the circumstances fares little better than jill s assumption that jack is completely in line with jehovah s witness policy on this issue, because he considers himself a jehovah s witness . Checking out the universalisability of the maxims of jill s actions would have fared little better than the benthamite attempt . Patient autonomy is well taken care of, right up to the point where she has to make decisions on a shaky foundation . These theories would be perfect if jack s views and opinions were written in stone coherent, consistent, stable . My claim is that we would do even better if we could allow for greater complexity . The problem is that in order to become privy to jack s complex attitudes and sensitive information knowing when to withdraw and when to proceed jill must form a professional, trusting relationship with jack . If not, she will not be granted access to his sensitive information . Jack must trust that jill will act in his best interests and must entrust her with the necessary information . In the original narrative, jill might have been right, but she can never know for sure . Caring as mere stereotypical assumption is not good enough . In alternatives (2) and (3), jill at least came closer . Proper caring requires communicative skills, the ability to scrutinise and contextualise the narratives of the other (e.g. The patient), to catch the drift of the other s life story . This may amount to merely being able to apply some conversational techniques, but in practice it requires the (ethical) skill of putting oneself in the place of the other, of filling in the blanks where the other cannot or will not speak, and of securing this information, somehow . To be able to imagine acceptable trajectories . An additional feature ties the narrative approach to caring, and thus also to an ethics of care . Narratives are not only therapeutic means, they are often therapy itself . Listening to the other, and demonstrating the willingness and ability to facilitate, mirror, interpret and understand the words and narratives of the other, are often in themselves therapeutic activities and a direct expressions of caring . It is simply difficult to imagine caring without the carer understanding the spoken or broken narrative of the other . As narrativity and narrative skills are thus inseparable from caring, an ethics of care must have the resources to receive, evaluate even create narrative elements . Through tracing the relevant master narratives, reading the intentions, the symptoms, and evaluating alternative (adaptive) endings of the jack and jill story, we have seen one way of doing ethics of care narratively . A narrative approach is, of course, helpful to other methods of ethics, too, but it is a intrinsic part of an ethics of care.
|
During the early years that followed the discovery of x - ray, radiographers were unintentionally, incautious when dealing with it because of its unknown biological harmful effects . Many cases of cancer, sterility and death due to x - ray / radiation toxicity were documented during the early years of the 20 century . For example, in 1907, 6 out of 11 cases with x - ray - induced caners died . Moreover, many early workers in the field of dentistry suffered from radiation - induced ulceration, dermatitis and malignant tumors in their fingers . With strict compliance to the radiation protection guidelines, issued by the international commission on radiological protection (icrp), diagnostic radiography is considered a safe practice ., no other reports addressing the disastrous effects of x - ray radiation have been documented in the literature since 1960s . The present report, however, documents a case of thumbs carcinoma of a dental radiographer due to his neglect of radiation protection guidelines . In august 2010, a 49-year - old male working as a dental radiographer, lost his distal phalanges of both thumbs as a result of development of squamous cell carcinoma, due to neglect of the guidelines of protection related to x - ray imaging . He was appointed in 1994 by the radiology division, primarily as an in - charge clerk within the oral medicine department (faculty of dentistry, damascus university). As a school graduate with an intermediate certificate, his main task was merely to monitor the radiographic equipment . Given that there was only one radiographic technician at that time, it was decided in 1995 to train him on how to use the dental x - ray machines and how to radiograph patients . He was warned about the radiation risks and thoroughly educated on the appropriate protection standards . On the other hand, he was accustomed to handling the periapical films with his thumb fingers . In 2003 although it was asymptomatic, he considered it as a traumatic ulcer and hence willingly neglected it for a period, which under normal circumstances would be considerably enough for such an ulcer to heal . Subsequently he then experimented with various courses of local and systemic antibiotic, but the ulcer did not show any signs of healing . Based on his judgment, it was asymptomatic and unprogressive, and accordingly he perceived to be a normal exfoliation, the result of his long - term handling of chemical processing solutions . In august 2010 (after 15 years of handling dental x - ray), he noticed a discharge oozing from his right thumb . By that time, he also took notice of a similar ulcer in his left thumb . He consulted the professors in the department who in turn referred him to a general surgeon . On plane hand radiographs, an erosion of the distal phalanges of both thumbs was clearly evident [figures 1 and 2]. Consequently, the surgeon planned to excise the discharging ulcerative lesion of the right thumb and to submit it for histopathological diagnosis, which clearly revealed squamous cell carcinoma grade ii [figure 3]. Based on such a diagnosis, the surgeon decided to excise the distal phalanges of both thumbs with tumor free - margins [figure 4]. Out of ethical consideration, the radiographer was well - informed about the intent to publish his case and hereby he signed an informed consent . Plane hand radiograph reveals bone erosion in the right thumbs distal phalanges plane hand radiograph reveals bone erosion in the left thumbs distal phalanges histopathologic microphotographs reveal squamous cell carcinoma ([a] 40 and [b] 100) early x - ray machines needed to be set and repeatedly adjusted . To achieve this, radiographers would place their hands between the actively radiating tube and the film plate to check if the apparatus was functioning and that it was well focused on the film . By practicing this for 12 years, dr . Kells was the first victim of dental x - ray radiation with numerous cancerous tumors on his fingers . By that time, the icrp published guidelines for radiation protection that have been updated from time to time . In syria, the atomic energy commission adopted these guidelines and has since strictly emphasized the importance of their application by public and private institutions . One of the guidelines clearly states that the film should never be hand held by a member of the dental practice staff, even for patients with special needs . Holding periapical films in the patient's mouth is still practiced in modern dentistry, but, fortunately, is not common . Sixty per cent of australian dentists never do this, but 25% will do so less than once every month, and 1.5% might do so more than 10 times a month . The radiation - risk is the function of the radiation dose which is expressed as an effective dose . The national commission for radiation protection in the united states reports that the mean effective dose received by dental workers is 0.2 msv / year . Similarly, the national radiological protection board, in the uk estimates a mean level of <0.1 msv / year . In dose limit terms for workers, the current effective dose limit is 100 msv in any consecutive 5 years with a maximum of 50 msv in any year . These limits are based on guidance from the icrp, with the effective dose limit being set at a level at which the stochastic risk is considered to be at the limit of acceptability . The probability of radiation - induced stochastic effects for the whole population is 7.3 10 /sv . The working load in the radiology division within the faculty ranges between 100 and 150 patients a day . Hence, the radiographer in the current report received a fraction of about 600900 sv / day; 13.219.8 msv / month; 158237 msv / year and 2.43.6 sv in 15 years . Overall, he was at a greater risk of getting a stochastic effect by 2.43.6 times compared to the whole population, as the probability of radiation - induced stochastic effect for this case ranges from 18 10 to 26 10 /sv . Some authorities claim that any dose of radiation has the potential to induce malignant changes, and there is no threshold dose below which radiation is predictably safe . The risk of induction of fatal cancer or serious hereditary ill - health from dental intra - oral radiography was estimated to be 1 in 10 million (10) per exposure . This increased the risk of inducing fatal cancer or serious hereditary ill - health to 46 in 100 (10). However, the risk - estimates depend on the shape and length of the collimator or position indicating devices (pids). The short and pointed cones with closed - end, such as that which had been used by the radiographer in this report for 13 years (fiad, dr 554, italy), have the greatest probability of a stochastic effect (1 in 26 10) in comparison to the rectangular or round ones . The latter, which are open - ended and have been used for the last 2 years of the radiographer's work (ardet s.r.l buccinasco [mi] orix 70, italy), have a probability of a stochastic effect ranging from 1 in 4.6 10 to 1 in 23 10 according to the length . Overall, the shielded open - end pids, both round and rectangular in shape, have become more widely used during the past 40 years because of the reported decrease in patient exposure that is achieved . In general, dental radiography has a little dose and risk for the individual patient and dental workers provided that the principles of protection are applied; it is less dangerous in comparison to a few days of natural background radiation to which we are all constantly exposed . Dental radiography doses and risks are minimal unless dealt without being cautious, which is the case of the radiographer presented here.
|
Since the first description was more than 20 years ago, arrythmogenic right ventricular cardiomyopathy (arvc) is increasingly recognized from pathology to diagnosis . The main pathologic feature is the gradual replacement of the right ventricular myocardium by fibrous tissue and fat . Patients with arvc often die at a young age due to the fatal ventricular arrhythmias whereas arvc of an elder person is rare and different from that of young people . In this report, an unusual case of arvc with a long, natural history in a middle - aged woman is presented . A 54-year - old woman was presented with progressive weakness, severe edema, and moderate shortness of breath on exertion for 9 years . Subsequently, she was found to have monomorphic ventricular tachycardia (vt) with left bundle branch block - type morphology . Rest electrocardiogram displayed atrial fibrillation rhythm, epsilon wave, and negative t - waves in leads v1 to v4 [figure 1]. It could be found from the echocardiography that there was severe dilation of the right ventricle, with a poor right ventricular (rv) systolic function and severe tricuspid valve regurgitation and an electrophysiological study showed vt of a right ventricular outflow tract or rv apex origin . As a diagnosis of arvc was most likely, the patient underwent a magnetic resonance imaging scan which revealed diffuse areas of fat tissue at the right ventricular wall especially at the free wall [figure 3]. At the same time, multiple small aneurysms were also found . Based on the clinical presentation and work--up, a definite diagnosis of arvc was made . She was treated with various antiarrhythmic agents and angiotensin - converting enzyme inhibitors (aceis), diuretics, and -blockers . Despite aggressive medical therapy, her clinical conditions continued to deteriorate, and the tricuspid valve repair was performed because of severe tricuspid valve regurgitation . The general and cardiac biopsy findings demonstrated diagnosis was consistent with arvc [figure 4]. (b) 12-lead ecg with inverted t - waves and postexcitation epsilon wave in leads v1 to v4 echocardiography image in the parasternal long axis showing severe dilation of the right ventricle and severe tricuspid valve regurgitation mri showing the dilation of rv and transmural fibrofatty replacement in the rv free wall (a) a gross photograph demonstrating the right ventricular with extensive fatty replacement primarily involving the lateral wall . (b) typical histologic features of arvc, ongoing myocyte death with early fibrosis and adipocyte infiltration arvc is a heart muscle disease which is characterized by prominent, severe ventricular arrhythmias . However, the criteria have been found to be poorly sensitive and specific, especially in the early stage of the disease . The new criteria continues with these same categories: global or regional dysfunction and structural alternations; tissue characterization of the wall; repolarization abnormalities; depolarization abnormalities; and arrhythmia and family history . The categorization provides more measurable criteria removing some of the interpretation in the old criteria . Arvc is an important cause of sudden cardiac death in people less than 65 years of age . They include chest discomfort, palpitations, presyncope, syncope, and unexplained heart failure . Although the right ventricle is mainly involved in arvc, the left ventricle may be progressively affected thus resulting in biventricular failure . The heart muscles of the patient in our case were replaced by fibrous tissue and fat . The electrophysiological study carried out on the patient showed that there were a lot of low - voltage districts in the heart . And this caused the failure of radiofrequency catheter ablation (rfca) on vt . So the treatment of arvc is yet focused on icds for the prevention of sudden cardiac death . Heart transplantation is unusual in arvc but it has been performed at the end stage of heart failure . Because of cardiac myocyte loss (fat and fibrous tissue replacement) in the right ventricle, the patient would benefit when she accepted an operation of heart transplantation, not the tricuspid valve repair for her severe heart failure . Heart failure may be more obvious in elder patients . Although arvc is an inherited disease of the heart muscles involving the right ventricle, the left ventricle may be progressively affected thus resulting in a biventricular failure.
|
T2d is a long term condition requiring lifestyle changes, such as dietary changes and increases in physical activity as well as medication - taking, to control it and avoid life - threatening complications . As such, the illness is self - managed with the ultimate aim to keep blood glucose levels within set targets . Studies have shown that a multitude of psychosocial barriers exist for people living with t2d in performing clinically recommended behaviours and self - management [1, 2]. Nam et al . Suggest that better understanding of the relationships between the multifactorial barriers to t2d management as well as the mechanisms which mediate and moderate t2d management is required . In particular, understanding how these mechanisms might influence how people living with t2d perceive their illness and experience self - management is important, as is their impact on their health outcomes [3, 4]. Life was as key a concern for people self - managing diabetes as meeting their day - to - day self - management needs . Kelleher developed a typology of how t2d was managed based on the amount of restriction a person felt when self - managing . Further work by maclean explored the factors that people living with diabetes took into consideration when deciding to adhere or not adhere to self - management dietary advice . Maclean identified individual, diabetes - related, and contextual factors which shaped adherence to clinically recommended behaviours . The notion of restrictions that t2d self - management places on day - to - day living is a key premise of numerous other studies . Well - being concerns in an attempt to live with the restrictions of self - management has been a consistent finding in t2d - related patient experience research . Studies have also attempted to uncover factors that contribute to people being able to respond and manage diabetes - related concerns strategically, that is, exploring how people act purposively to avoid the restrictions of self - management ., for example, identified three self - management types: proactive managers (self - directed, independently maintaining metabolic control); passive followers (followed self - care regime but did no autonomous, preemptive action); nonconformist patients (who did not follow recommended self - care practices). However, other studies have expanded the notion of people living with diabetes beyond the purposive, self - directed action of overcoming restrictions to demonstrate how self - management of t2d is influenced by social networks and health service - related factors which hinder or facilitate self - management [1014]. These studies demonstrate patients' experiences of self - management built around their everyday social contexts . Through focusing on patients experiences of self - management, what all of the above studies lack is an indication of the motivators which influence the self - management strategies that people adopt (i.e., why they choose to self - manage in a given way) and the impact of these strategies on the criteria that people living with t2d employ to measure the success of self - management practices . The aim of this study was to explore patient participants' self - management practices and, in particular, how they impact their day - to - day lives and their motivation for engaging in self - management practices . The study's research question(s) are as follows.what motivates t2d patients to engage in self - management activities?how do t2d patients assess whether their self - management practices are successful or unsuccessful? What motivates t2d patients to engage in self - management activities? How do t2d patients assess whether their self - management practices are successful or unsuccessful? Participants were recruited from a monthly drop - in diabetes patient and public involvement group, a voluntary service - user led, peer - support group for people living with t2d which was sponsored by the local health provider . A group - based approach was taken to capture naturally occurring diversity of people living with t2d and to ensure all participants self - identified as self - managing . Qualitative data were collected using three separate methods of data collection to maximize participation, capture irregular attendees, and allow for triangulation between methods . Participants were given the choice of participating through focus groups and/or one - to - one semistructured interviews and/or filling out open - ended questionnaire . In total thirty - seven (n = 37) members of the participation group were recruited as participants from a potential sample of n = 166 group members . In terms of recruitment to data - collection method, twenty - five (n = 25) one - to - one interviews were conducted, 6 questionnaires were returned, and 11 people attended 3 focus groups (n = 3, 3, and 5 attendees). Only five (n = 5) participants participated in more than one method; one questionnaire participant went on to do a one - to - one interview, and 4 focus group participants also went on to do one - to - one interviews . Saturation point occurs where adding participants to the existing sample is unlikely to generate any new ideas; this is estimated to occur anywhere from the 12th to around 25th interview . To ensure rigour, transcripts were also read by two researchers (ss and pn) and the thematic framework was developed keeping agreed themes, by negotiating and agreeing on the content (assigning quotations to themes), as well as the development of new themes (or subthemes) where there was disagreement . Using framework analysis, quotes from the transcripts were then assigned to themes; hence the illustrative quotes given below are examples selected from, but commensurate with, all comments in a given theme . Although they are small from a quantitative, experimental paradigm, using samples of this size has been shown to be an efficient, practical, and robust strategy to obtain rich data, explore understanding, and identify emerging themes in qualitative, in - depth semistructured interview designs [1925]. Ethical clearance was gained from kings college nhs hospital research ethics committee (reference number 06/q0703/137) and procedures regarding signed informed consent, anonymity, confidentiality, and right to withdraw were adhered to throughout . The second and third sections provide answers to our respective research questions by considering patient motives for and styles of self - management . The vast majority of participants (86 per cent, n = 32) were aged 60 +, reflecting the increased incidence of t2d amongst older people . Sixty - five per cent (65%; n = 24) of participants self - reported being white with the remaining participants self - reporting being black african or caribbean . Only n = 6 (16%) participants were living in a household with an above average household income, and those with higher household incomes were the only participants educated to degree level or higher . In contrast, n = 7 (22%) of participants lived in households with an income which fell below 8,000 per annum (p.a .) And these participants were most likely to have education to primary school level only . The majority of participants were educated to secondary school level (51%; n = 19). Participants were asked to focus on their personal reasons or motives for self - managing . Five different motives for self - managing were identified from participants' accounts.concern about the anticipative effects of t2d.wishing to stay well . Maintaining independence . Reducing the need for healthcare professionals . Improving quality of life . These motives for self - managing t2d also shaped patients' criteria for whether they considered their efforts as successful and/or unsuccessful . Motives, which were not necessarily mutually exclusive, and associated measures of success are explored below . This motivator is related to concern about anticipated negative effects of t2d, for example, fears of symptom onset or set - backs in any progress they had made with self - management as well as of physical effects such as pain and bodily deterioration.because you are concerned about your health and something going wrong . Cos if you do not you'll be on dialysis for hours and i wouldn't like to be like that . [] though its long term 10, 20 years down the line . Focus group #3 participant #1 because you are concerned about your health and something going wrong . Cos if you do not you'll be on dialysis for hours and i wouldn't like to be like that . [] though its long term 10, 20 years down the line . Focus group #3 participant #1 these anticipatory effects were often magnified where participants had previously seen the course of t2d in others, most commonly family members.i've got a brother, well he died and he got an amputation in canada . So you know these things, so you think of trying to avoid these things . Focus group #3 participant #3 i've got a brother, well he died and he got an amputation in canada . So you know these things, so you think of trying to avoid these things . Focus group #3 participant #3 this motive saw the adoption of self - management to avoid the anticipated effects of t2d and hence was an explicitly preventative motive, with successful management implicitly measured as avoiding any (further) progression and/or increased severity in the condition . (ii) staying well . The second motive identified was maintaining current levels of health . For example, the following participant had gone from tablets to injecting insulin since her diagnosis 14 years earlier.when i was first diagnosed, i did not understand, i wondered why my weight was up and down, why my blood sugars were so high, then i put on weight and couldn't lose it, i was using my tablets as background cover when it was insufficient, it should have been spotted [] but now insulin gives me more control and i feel well better in myself too.interview participant #5 when i was first diagnosed, i did not understand, i wondered why my weight was up and down, why my blood sugars were so high, then i put on weight and couldn't lose it, i was using my tablets as background cover when it was insufficient, it should have been spotted [] but now insulin gives me more control and i feel well better in myself too . Interview participant #5 participants with complications and comorbidities frequently accepted that a return to previous levels of health may not be possible and adjusted to maintaining their current health status.i just have to be careful with what i eat . I cannot do as much physically as i did before.interview participant #15 i just have to be careful with what i eat . Interview participant #15 this motive for self - managing was implicitly behaviourally rewarded with participants following self - management behaviours in order to maintain, or gain, their perceived optimal health as a pay - off . Successful management was implicitly framed by the degree to which maintaining or improving health status was attained . Maintaining independence is related to participants wishing to maintain the smooth running of their lives without needing help or worrying others.i, you know, i find that my family become a bit morbid, they seem to think, how shall i put, that, they seem to think that i am special because i have this condition, [] i test my sugar myself at least once a week because now it's very, it's very even - it never goes up or down . So to tell you the truth i have been doing pretty well on my own - they do not need to worry.interview participant #11 i, you know, i find that my family become a bit morbid, they seem to think, how shall i put, that, they seem to think that i am special because i have this condition, [] i test my sugar myself at least once a week because now it's very, it's very even - it never goes up or down . So to tell you the truth i have been doing pretty well on my own - they do not need to worry . Interview participant #11 successful management was also assessed in terms of the smooth running of household routines, and stability in the household, for example, stable divisions of labour.i say: what you put in you get out, so i look after myself and make sure i do my sugar levels, and take my tablets . Nobody else is going to do it for you are they? [] i've got my washing machine in there, i sit and i wash, he [husband] irons . We've worked it all out.interview participant #10 i say: what you put in you get out, so i look after myself and make sure i do my sugar levels, and take my tablets . Nobody else is going to do it for you are they? [] i've got my washing machine in there, i sit and i wash, he [husband] irons . We've worked it all out . Interview participant #10 (iv) minimising use of health professionals and health services . A key motivating factor was avoiding the use of healthcare professionals and/or an associated disillusionment with the quality of health services . Particular emphasis was given to avoiding hospitalisation or nursing and residential homes in later life.that's why i do more exercise, because i do not want to have a heart attack and end up like my mum did, because my mum ended up in a nursing home, and she was in and out of hospital because they weren't looking after her properly, and i do not want to be like that . I do not want my family to have to go through all that.interview participant #11 that's why i do more exercise, because i do not want to have a heart attack and end up like my mum did, because my mum ended up in a nursing home, and she was in and out of hospital because they weren't looking after her properly, and i do not want to be like that . Interview participant #11 participants also identified the need to take responsibility for their own care because they felt there was a lack of continuity in their care, for example, seeing a different doctor at each check - up or poor quality of services.you have got to build up trust with people and i just feel that my care chops and changes . Interview participant #16 you have got to build up trust with people and i just feel that my care chops and changes . Interview participant #16 some participants were also averse to healthcare professionals, using their infrequent clinical encounters as evidence of successful self-management.i run a lot of my life as if you know, like a scientific experiment . I know what works and what does not - how much to eat, and how much insulin to get through [] [my doctor] knows where i'm coming from, i do not have too much contact beyond what is necessary . We just touch base, how are you doing?interview participant #14 i run a lot of my life as if you know, like a scientific experiment . I know what works and what does not - how much to eat, and how much insulin to get through [] [my doctor] knows where i'm coming from, i do not have too much contact beyond what is necessary . ? Interview participant #14 (v) improving quality of life and access to health services . Finally were those for whom improving the quality of life was a key motivator to self - management . These participants' motives were not rooted in fear of ill health, dependency, or maintaining optimal health.i know i got diabetes, and i can get on and do something about it [] they [other people living with t2d] get it in their heads that they are sick and they give up . I can still do all the things i did before, and i am not going to you know sit around feeling sorry for myself.interview participant #10 i know i got diabetes, and i can get on and do something about it [] they [other people living with t2d] get it in their heads that they are sick and they give up . I can still do all the things i did before, and i am not going to you know sit around feeling sorry for myself . Interview participant #10 rather, these participants sought to gain greater day - to - day freedoms . This frequently involved being assertive with healthcare professionals to secure their service entitlements:patients do not always get what they are entitled to - but they often get what they deserve because they do not question anything so i have got to be really assertive.interview participant #5i am my own person, and the medical profession aren't there to tell you what to do . They're fools to themselves.interview participant #3 patients do not always get what they are entitled to - but they often get what they deserve because they do not question anything interview participant #5 i am my own person, and the medical profession aren't there to tell you what to do . Interview participant #3 here, the notion of maintaining or improving health was expanded to include improving quality of life through mastery of self - management skills, improvement of personal circumstances, and acquiring the resources required to enhance self - management . This motive to self - manage also involved positive comparisons with the normoglycaemic population to gauge how un / successful their self - management was.i do not really consider myself ill, everybody has diabetes nowadays . Interview participant #5 i do not really consider myself ill, everybody has diabetes nowadays . Interview participant #5 what is clear from the motivators described above is that there are a variety of positive and negative motivators for self - management and that two or more motivating factors may be at work simultaneously . Furthermore, the criteria of the success or failure of self - management which people living with t2d use are dependent on the motivations behind the self - management actions taken . These are related to self - managing t2d.through routinisation.as a burden.as maintenance.through delegation.through comanagement.through autonomy . Through routinisation . Through comanagement . Self - managing t2d through routinisation involved developing routines that provided a buffer against the ramifications and/or potential progression of t2d.most of the inconveniences become less obvious to you, you stop noticing them . They become part of your life, like catching the train in the morning, or brushing your teeth . My colleagues must notice it my strange routines and foibles, but i have to be quite meticulous in planning things, so they must find it strange . Even if i do cheat, a glass of wine or little piece of something sweet . Then, i have to make sure i have to get home in time or have insulin on hand, i have a plan and a routine.interview participant #14 most of the inconveniences become less obvious to you, you stop noticing them . They become part of your life, like catching the train in the morning, or brushing your teeth . My colleagues must notice it my strange routines and foibles, but i have to be quite meticulous in planning things, so they must find it strange . Even if i do cheat, a glass of wine or little piece of something sweet . Then, i have to make sure i have to get home in time or have insulin on hand, i have a plan and a routine . Interview participant #14 participants did not expand their behavioural repertoire as they were confident in the buffering effects of their routine.what i am taking away from having diabetes is how to care for oneself, the importance to stick to a routine, to check your routine.interview participant #7participants who self - managed through routinisation (solely) equated being satisfied with their self - management when it was routinised in a way that minimised disruption to their day - to - day life . I still get around, still do my work, and i can still look after myself i suppose . I go to sleep and when i wake up - i'm the same you have to get on.interview participant #5 what i am taking away from having diabetes is how to care for oneself, the importance to stick to a routine, to check your routine . Interview participant #7 i still get around, still do my work, and i can still look after myself i suppose . I go to sleep and when i wake up - i'm the same you have to get on . Interview participant #5 as such, routinisation of self - management was attained as a style of self - management in and of itself (as was the case with seven, n = 7, participants) mostly by those who had been diagnosed in the past year . The main motives for having routinised self - management arrangements were (1) wishing to stay well and (2) avoiding the anticipative effects of t2d . Routinisation also formed the basis of the other styles of self - management discussed below . (ii) self - managing t2d as a burden . For some participants having established a self - management routine, the day - to - day self - management tasks were perceived as burdensome . This was largely due to these participants perceiving the manifestations of t2d as immune to self - directed care activities . Equally people managing t2d as a burden developed a routine to respond to t2d but hoped that more could be done clinically to prevent further deterioration or progression of the condition . In seeking help, their motives were to (1) maintain a current level of health, (2) avoid being too dependent on others, and (3) maintain their existing independence . Underpinning this was the belief that more of the burden and responsibility of care could and/or should be borne by others such as healthcare professionals.when you start to, when i started on tablets and because my blood sugar keep getting higher, i want you know, positive treatment for it, but they increased the tablet, they only increased my tablets from year after year until i had a heart problem, i've now got a pacemaker and i have to do all of this [manage diabetes].interview participant #20 when you start to, when i started on tablets and because my blood sugar keep getting higher, i want you know, positive treatment for it, but they increased the tablet, they only increased my tablets from year after year until i had a heart problem, i've now got a pacemaker and i have to do all of this [manage diabetes]. Interview participant #20 hence, participants experiencing self - management as a burden perceived certain aspects of treatment as beyond their control and responsibility.and they [healthcare professionals] just keep saying: i can do this or do that and your blood sugars are all over the place - and asking me what i am going to do about it . And they are supposed to tell me!focus group #2, participant #2 and they [healthcare professionals] just keep saying: i can do this or do that and your blood sugars are all over the place - and asking me what i am going to do about it . And focus group #2, participant #2 six (n = 6) participants, three of whom were restricted in mobility and the ability to live independently, discussed self - managing t2d as predominantly an experience of being burdened and saw additional support and resources as the solution . The four (n = 4) oldest participants interviewed were in this category, and all had low incomes (less than 10k p.a .) And all four (n = 4) managed comorbidities . This suggests that age, severity of t2d, and income may play a part in shaping this style of t2d management . Self - management routines were followed with the aim of keeping the progression of symptoms and complications at bay . Hence, amongst these participants there was a tendency to measure successful self - management by comparison with others living with t2d.i think it helps to see other people, because as i said mine is not so serious, so at least, when you listen to other people, then you probably know what to expect, and to see whether you can avoid some of the things.interview participant #3 i think it helps to see other people, because as i said mine is not so serious, so at least, when you listen to other people, then you probably know what to expect, and to see whether you can avoid some of the things . Interview participant #3 participants who were diet - controlled and/or currently experienced no symptoms or complications in particular showed this style of self-management.i'm alright, healthy even just wear and tear you'd expect, and if you stick at it [diet] you do not have no worries.interview participant #21 i'm alright, healthy even just wear and tear you'd expect, and if you stick at it [diet] you do not have no worries . Interview participant #21 this style of management was also common in those who had previously been hospitalised but had then subsequently recovered.of course, at some point in the future i may need insulin injections which, again i just do what i have to, and tune the rest out, otherwise i worry and the stress is not good.focus group #3, participant #3 of course, at some point in the future i may need insulin injections which, again i just do what i have to, and tune the rest out, otherwise i worry and the stress is not good . Focus group #3, participant #3 despite not tallying with any specific sociodemographic characteristics, this style of t2d management was predominantly reported by people (n = 9) who had been diagnosed for over a year and were diet - controlled and was common in those who had been diagnosed with t2d as a result of screening or hospitalisation . Although these participants used their encounters with healthcare professionals and use of health services to gauge self - management success (i.e., no progression in severity or symptoms), their motives for self - management, as such, were informed and reinforced by minimal use of healthcare services; that is, they used the minimal use of services as a personal indicator of successful t2d management . This style of self - management emerged when certain aspects of managing t2d, such as monitoring blood sugar or managing medications, were passed on by participants, to somebody else . Management of t2d was seen by these participants as more appropriately dealt with by a delegate, for example, where the spouse / carer takes charge of cooking, or a family member made sure medicine was taken appropriately . Male participants tended to dominate this category with four out of the five participants (n = 5) in this subgroup being men.i have to eat the right food but i do not drink, i do not smoke, i have cut down on my sugar, i have cut down on my starch and i eat a lot of fruit []when i go to the doctor they check my blood sugar and ask how i am coping with the diabetes . My wife cooks for me and checks if i have taken my tablets every day . Interview participant #9 i have to eat the right food but i do not drink, i do not smoke, i have cut down on my sugar, i have cut down on my starch and i eat a lot of fruit []when i go to the doctor they check my blood sugar and ask how i am coping with the diabetes . My wife cooks for me and checks if i have taken my tablets every day . Interview participant #9 participants also delegated certain aspects of t2d management to healthcare professionals:i am coping a bit at the moment, but as far as you say about the blood testing, i think it will give me more stress to do all this testing than not do it . And i have a really good diabetic nurse at the doctor's surgery who takes my bloods and puts me on the right road most of the time . Interview participant #3 i am coping a bit at the moment, but as far as you say about the blood testing, i think it will give me more stress to do all this testing than not do it . And i have a really good diabetic nurse at the doctor's surgery who takes my bloods and puts me on the right road most of the time . And interview participant #3 the motives of these participants were similar to those in the previous group (self - management as maintenance) in relation to maintaining current health and concerns about anticipative effects, but their strategy was different, as key aspects of care were delegated to others . These participants also sought to maintain their independence, and any disruption to the delegated routine was seen as compromising this.if i did not have him [husband] i do not how i would manage in here.interview participant #6 if i did not have him [husband] i do not how i would manage in here . Interview participant #6 the main difference between managing t2d through safekeeping and managing t2d as maintenance was that a delegated other was tasked with ensuring the routines of t2d were met, and, providing there were no disruptions in this arrangement, t2d was then seen as being managed successfully . This style of t2d management is related predominantly to accounts of the quality of the relationships patients established with healthcare professionals . Managing t2d through comanagement entailed patient participants being able to discuss the ramifications of certain treatment options and self - management activities with healthcare professionals . These participants also established clear demarcations of responsibility with healthcare professionals, and within the household . Participants engaged in comanagement reported a benefit in healthcare professionals who listened to their personal concerns and then worked out appropriate care and treatment options based on this.i have great confidence in my nurse - mostly because she agrees with me anyway! We have a bit of a laugh and she said there is obviously something wrong with you when you cannot take this drug and you cannot take that drug and we thought it would all be easy and of course it's not been as i have had a few problems with the drug . But no, she comes up with recommendations and suggestions and we work it out really . Interview participant #4 i have great confidence in my nurse - mostly because she agrees with me anyway! We have a bit of a laugh and she said there is obviously something wrong with you when you cannot take this drug and you cannot take that drug and we thought it would all be easy and of course it's not been as i have had a few problems with the drug . But no, she comes up with recommendations and suggestions and we work it out really . Interview participant #4 hence, motives for self - management within this group were to (1) stay well, (2) improve health, and (3) reduce the need for healthcare professional involvement . Only six (n = 6) of the thirty - seven (n = 37) patients interviewed reported experiencing this type of relationships with healthcare professionals . Participants often reported wanting to comanage with healthcare professionals but felt, however, that professionals did not listen or were dismissive of their concerns, and/or there was a lack of continuity of care to allow this type of arrangement to occur.i just, i just feel that, you know, when i go to the hospital or to my doctor i just feel that i should be seen by somebody, i mean i should, i know it's maybe asking for too much but i should not be seen by a different doctor every time because it does not give a full understanding of my condition . They start you back from the beginning and it annoys me . Interview participant #20 i just, i just feel that, you know, when i go to the hospital or to my doctor i just feel that i should be seen by somebody, i mean i should, i know it's maybe asking for too much but i should not be seen by a different doctor every time because it does not give a full understanding of my condition . They start you back from the beginning and it annoys me . Interview participant #20 the practice of comanagement styles of self - management came with time, as all those reporting this style of self - management had been diagnosed for a year or more . This style of self - management is the one which most closely reflected the tenets of the currently popular empowerment approach to managing t2d care . Hence, it is important to note that only a small minority of participants employed this style of self - management . Patient participants who self - managed t2d autonomously demonstrated an ability to explicitly manage t2d on their own and managed t2d in a style that ensured their autonomy was maintained . These participants were often calculative in their assessment of, and ability to, respond to their own t2d needs.you see some of the older people at the participation group, and they do not really understand the information or know what they are doing, and they ask the same questions every week it's just not getting through to them . For me, personally i have never felt better . Insulin gives me more control, and means i can do more than sit around worrying about diabetes . [] so, that's what you have to do, you have to grab the reins.interview participant #14 you see some of the older people at the participation group, and they do not really understand the information or know what they are doing, and they ask the same questions every week it's just not getting through to them . For me, personally i have never felt better . Insulin gives me more control, and means i can do more than sit around worrying about diabetes . [] so, that's what you have to do, you have to grab the reins . Interview participant #14 in terms of relationships with healthcare professionals, those self - managing t2d autonomously described a need to be assertive . This allowed them to develop ways to gain leverage over care and treatments which afforded the individual more direct control over their t2d management . Gaining this type of control involved these participants managing t2d strategically and keeping abreast of latest treatments and research into t2d.i have excellent control and all illness creates problems of one sort or another so if you want to cut down on the number of problems - you need to keep your knowledge up to date . If your knowledge is stuck at some point in the past you cannot assume that your doctor is up to speed, you just cannot.interview participant #20 i have excellent control and have had excellent control since the beginning . All illness creates problems of one sort or another so if you want to cut down on the number of problems - you need to keep your knowledge up to date . If your knowledge is stuck at some point in the past you cannot assume that your doctor is up to speed, you just cannot . Interview participant #20 frequently, healthcare professionals were seen as a means to an end by these participants and contact with healthcare professionals was minimized . This lack of contact in itself was used as a measure of successful self - management. [my doctor] knows where i'm coming from; i do not have too much contact beyond what is necessary . I can discuss most things with him.interview participant #14 [my doctor] knows where i'm coming from; i do not have too much contact beyond what is necessary . Interview participant #14 managing autonomously was frequently framed in the context of being normal . The aim of self - management was frequently to engage in activities that the nondiabetic population engage in, that is, to overcome the ramifications and restrictions of t2d.people's jaws drop when i tell them that i drink wine and eat chocolate cake . It's a revelation to them, some are new to injecting, and haven't come round to it . My doctor is in despair at my experiments, i find that the dosage is important and how rapid the insulin is, but you can inject in different places for different effects too.interview participant #23 people's jaws drop when i tell them that i drink wine and eat chocolate cake . It's a revelation to them, some are new to injecting, and haven't come round to it . My doctor is in despair at my experiments, i find that the dosage is important and how rapid the insulin is, but you can inject in different places for different effects too . Interview participant #23 all of the participants falling in this category (n = 4) had professional qualifications (but not all with degrees and professional qualifications fell into this category). All had been diagnosed 2 years or more, and three were insulin - dependent and managed other illnesses . The four patient participants in this category had the highest incomes of all those taking part in the study . This suggests that this style of t2d self - management was facilitated by income and the access to social and personal resources that this economic advantage conferred . The interrelationship between motivators, measures of successful self - management, and styles of self - management are present in table 1 . The results suggest that attaining a routine is the foundation for all types of self - management . How and why the routines are maintained, the exact nature of the routine, and who is involved in the self - management process vary across groups . It is also important to note that motives for self - management inform how self - management is approached and, thus, informed the goals of people's self - management efforts and ultimately their self - management style . Establishing a routine is often the first stage for newly diagnosed participants but, once established, motives for self - managing, as well as resources available and the circumstances that people find themselves in, all shaped the management styles adopted, supporting the notion that self - management is embedded in, and shaped by, social resources, not wholly determined by an individual's will . These findings also suggest that we need to look beyond what people do, to understand why they are acting in the ways that they are, and, further, that there are multiple ways of measuring the success of self - management that stem from the motivators behind the actions . This builds on the work of lawton which highlighted the need to understand the factors which mediate and moderate successful and unsuccessful management of chronic illness, suggesting that for people living with t2d there is not one but multiple criteria for successful management . Whilst research has tended to focus solely on the degree of purposive action a person shows when self - managing, how people overcome the restrictions of t2d and learn how to fit t2d into their lives, and/or the social support available for self - management which limits exploration of how people both mediate between their personal circumstances and self - management routines . Further, work conducted by us and others [10, 2729], respectively, shows that criteria for successful self - management differ amongst patients . Thus, we have a complex picture where there is great variability not only in the motives behind self - management, but also in how these motives shape criteria for assessing successful management and, hence, self - management styles . However, as with all qualitative data there are limits to the generalisability of the findings due to the small sample . The study would benefit from testing whether the styles of management developed can be quantified and measured in a larger population . Equally, as the respondents all came from one group some cross - contamination of reporting may have occurred . This is a limitation of any group - based sampling method, but the sampling ensured that all participants were consciously self - managing t2d . Given the diversity in styles of self - management styles identified it appears that this effect was minimal and a diverse range of people and opinions were captured . The self - management styles identified here highlight the importance of how sociocontextual factors influence the ways that people self - manage t2d . The resources that are available to people living with t2d affect the expectations of what can be achieved, thus feeding into their motives for self - management . This, in turn, affects the criteria that are used to judge the success of the self - management practices adopted and influences the style of self - management that people living with t2d engage in . If healthcare professionals wish to understand how and why people living with t2d self - manage in the ways that they do, we need to understand the interrelation of other factors, such as the health system, healthcare professionals, and the social and economic resources available to people . The findings from this study give us a way to start making these links using the perspective of those living with t2d . This must be combined with gaining an understanding of how self - management occurs in social life, rather than seeing self - management as a process of individual adherence or compliance.
|
Molecular photochromism and high photostability are among the crucial requirements for optically driven molecular memories, photoswitches, and data processing materials . In this context special attention is paid to aromatic schiff bases whose photochemistry is governed by an ultrafast excited - state intramolecular proton transfer (esipt). In these molecules, the decay of the initially formed excited - state tautomer to the ground state can either lead back to the original species by proton transfer or trap a portion of the excited molecules in a ground - state metastable photochromic form . Basic prerequisites for an efficient molecular photoswitch are the presence of at least two stable photochromic forms in the ground electronic state, lack of overlap between their absorption bands in the relevant excitation region, and radiationless decay routes from the franck condon regions of both isomers leading to the other switching form . In the literature there are two main groups of chemical compounds investigated in the context of molecular photoswitching, which differ in their internal conversion mechanism: ring opening ring closure versus cis esipt - exhibiting aromatic schiff bases introduce a novel way to optically driven switching control: here, the cis trans photoisomerization is enabled (at least from one side) by the initial excitation of an enol - form allowing for a chemical bond rearrangement through proton transfer (pt). Chemical structures relevant for the photoswitching process and general scheme of the photochemistry of salicylidene methylamine . In recent years the photophysics of aromatic schiff bases has been intensively studied both experimentally and theoretically, and much progress has been made toward an understanding of the underlying mechanisms . However, in the context of molecular photoswitching, there are still important questions to be answered . In this paper we investigate the photochemistry and photoswitching properties of an isolated molecule containing the minimal schiff base chromophore despite its simple structure, sma has been studied less than other model aromatic schiff bases, such as salicylidene aniline (sa) or larger systems of similar type . From the experimental side, the enol - form of sma has been identified as the most populated ground - state isomer, and the photochromic behavior observed in solution has been attributed to the formation of the keto - form . The available experimental data (absorption and transient absorption spectra recorded in some nonprotic solvents) indicate that no fluorescence signal is found upon uv vis excitation in the absorption band of the enol - form of sma . Moreover, only a very weak emission is observed for lower - energy excitation in the absorption band of the keto - form . This suggests that sma undergoes a barrierless esipt process followed by efficient nonradiative internal conversion to the electronic ground state . Theoretical investigations of sma photophysics performed so far include static energy landscape calculations and wave packet photodynamics simulations of the esipt process . These studies confirm barrierless pt in the first singlet excited state of sma and point to the presence of a conical intersection arising from cc double bond rotation as the main route for radiationless decay to the ground state . In this work we present results of semiempirical on - the - fly photodynamics simulations for the two sma tautomers relevant to photoswitching: the global minimum enol - form and the photochromic keto - form (denoted later as and; for chemical structures see figure 1). Our main goal is to investigate the full switching cycle and to determine the characteristic time scales and photoproduct distributions of both the forward and back switching transformations . The semiempirical calculations were performed using the om2/mrci method, as implemented in the mndo99 code . During dynamics simulations, all required energies, gradients and nonadiabatic coupling elements fock (hf) formalism was applied in the self - consistent field (scf) treatment (i.e., the orbitals were optimized for the leading configuration of the s1 state with two singly occupied orbitals). The active space in the multireference configuration interaction (mrci) calculations included 10 electrons in 10 orbitals (see the supporting information for plots of these orbitals). In terms of the scf configuration, it comprised the four highest doubly occupied orbitals, the two singly occupied orbitals, and the four lowest unoccupied orbitals . Three configuration state functions were chosen as references for the mrci treatment, namely the scf configuration and the two closed - shell configurations derived therefrom (i.e., all singlet configurations that can be generated from the homo and lumo of the closed - shell ground state). The mrci wave function was built by allowing all single and double excitations from these three references . This semiempirical om2/mrci approach has been recently shown to perform well in a comprehensive general evaluation of excited - state properties and in a number of recent excited - state studies . In trajectory surface - hopping dynamics the initial conditions are usually generated by wigner sampling, which defines initial coordinates and velocities based on classical or quantum harmonic vibrational modes, or by employing canonical classical molecular dynamics (md) simulations, in which the canonical distribution is satisfied with the use of a thermostat . Here, we adopted the second approach applying the nose - hoover chains algorithm (with a chain length of 10) for thermostatting . We used the default characteristic time of 0.01 ps for the thermostat and a time step of 1 fs for nuclear motion . For both target molecules (and isomers), 4 ps of equilibration dynamics were followed by a 100 ps production run, from which 600 initial atomic coordinates and velocities were randomly selected for each molecule . The starting points for the subsequent om2/mrci nonadiabatic dynamics were chosen from this set on the basis of the computed s0 to s1 transition probabilities and the vertical excitation energies . A total of 321 surface - hopping trajectories for the isomer and 333 for the isomer were run up to 1 ps with all relevant energies, gradients, and nonadiabatic coupling vectors being computed on - the - fly as needed . For points with an s1 s0 energy gap of less than 10 kcal / mol, the time step was chosen to be 0.2 fs for nuclear motion and 0.0005 fs for electronic propagation . The unitary propagator evaluated at the middle point was used to propagate electronic motion . The empirical decoherence correction (0.1 au) proposed by granucci et al . Was employed . The final evaluations were done for the 259 and 306 trajectories that finished successfully and satisfied our energy continuity criterion (no changes greater than 30 kcal / mol between any two consecutive md steps). The scc - dftb sampling with the nose - hoover chains technique was done with chemshell 3.4 and the nonadiabatic om2/mrci dynamics simulations were conducted with mndo99 . For specific validation of the om2/mrci method for sma, the relevant isomers (see figure 1) were optimized in the ground and first excited states . The first excited state is always of * character in the om2/mrci calculations . For full geometrical structures and corresponding ab initio results the om2/mrci results are consistent with the previously calculated energy landscape . In the ground state the conformer is confirmed to be the most stable form and all other isomers, except for, are found to be planar as indicated by the given dihedral angles . In the first singlet excited state the isomer does not correspond to a minimum but transfers the oh proton to the n atom upon geometry optimization, forming the isomer in a barrierless esipt process . In the course of the excited - state optimization the conformer relaxes to the ci2 conical intersection . The calculated vertical excitation energies to the s1 state are reasonably close to the published values obtained from high - quality ab initio methods (cc2/aug - cc - pvtz on mp2/cc - pvdz geometries), which are documented in the supporting information for easy reference . Vertical energy profiles for sma calculated at the om2/mrci and cc2/aug - cc - pvtz levels (see text). For further validation, vertical potential energy profiles were calculated at the om2/mrci level and compared with corresponding ab initio data . The profiles were computed for the variation of three geometrical parameters most relevant to sma photochemistry: the c1c7nc8 dihedral angle relating isomers and (denoted as cn from now on), the oh distance relating isomers and, and the c2c1c7n dihedral angle relating isomers and (denoted as cc from now on). For each point on the profile, the corresponding parameter was constrained to a fixed value and a full ground - state optimization was carried out for all other degrees of freedom . The energy of the first excited state was then obtained from a single - point calculation . The profiles obtained from the semiempirical om2/mrci calculations and from single - point ab initio cc2/aug - cc - pvtz calculations on mp2/cc - pvdz geometries are very similar to each other and agree with regard to all important features pertinent to sma photochemistry . In particular, they show a barrierless proton transfer path in the first excited state and exhibit only very small barriers for the excited - state deactivation via ci1 and for the ground - state proton back transfer . The small bumps in the regions near the conical intersections are due to minor sudden changes in the optimized geometries . After vertical excitation to the first singlet excited state, both the enol - form and the keto - form of sma undergo an ultrafast deactivation to the ground state . In both cases the average state populations during the and photodynamics are plotted in figure 3 against the simulation time . The data are fitted by a sigmoid function (see eq 1) which provides an approximate decay time . The lifetime of the excited state is defined as the point at which half of the trajectories have decayed to the ground state . The parameter k denotes the fraction of trajectories that decay until the end of the simulation.1 the deactivation of the isomer may be realized through two different phototransformations (i) the esipt process followed by cc bond twist or (ii) the photoisomerization around the cn bond (direct cis trans transformation). 150 fs which makes it slower by around 50 fs in comparison with the excited - state decay of the form (see figure 3). Within the total simulation time of 1 ps, the internal conversion to the ground state is very efficient for both sma forms less than 6% (9%) of the trajectories are left in the excited state for the () photodynamics, respectively . The slightly higher number of such trajectories in the case may be attributed to the very flat shape of the s1 potential energy surface (pes) in the franck condon region and the lack of excess kinetic energy from esipt (compared with the case). Average state populations for the two sets of trajectories (left: isomer; right: isomer). Figure 4 and figure 5 show the time evolution of key parameters characterizing the photodynamical trajectories of the and isomers, respectively . The plots for the two sample runs include: the dihedral angle of cc and cn rotations, the oh and nh distances, the s0 and s1 energies relative to the global ground - state minimum of the isomer, and the energy gap between these two states . Blue vertical lines mark the hopping events between the two energy surfaces, while the red lines indicate an intramolecular proton transfer . To facilitate the analysis of the graphs, the geometrical structures present at each stage of the dynamics are indicated by a corresponding label (i.e.,,,, or). After photoexcitation occurs an ultrafast proton transfer to the n atom (finished within 30 fs) accompanied by a clear reduction of the s1/s0 energy gap . A subsequent rotational motion takes the system toward the ci1 conical intersection, where it hops to the ground state at a simulation time of ca . 700 fs); cc rotation is not feasible in the ground state, because during s1 s0 deactivation the * orbital localized at the cc bond becomes unocuppied and thus the energy barrier for cc rotation rises significantly . The ground - state proton transfer from the nitrogen back to the oxygen atom then occurs at ca . 850 fs, regenerating the isomer and restoring the interstate energy gap to its initial value . At this point, top left: dihedrals, horizontal dashed lines mark multiples of 180; top right: distances; bottom left: state energies; bottom right: energy difference . The trajectory starting from the isomer in figure 5 shows a faster, single - step deactivation involving only cc bond rotation (there is no need for esipt to open the route toward the ci). 70 fs and thereafter exhibits a similar behavior as on the previously discussed trajectory . A difference between the two and simulations can be seen in the oh and nh stretching amplitudes, which should be associated with the ease of proton back transfer in the ground state . After roaming on the s0 pes in the vicinity of the isomer for ca . 350 fs, the proton is transferred from the n back to the o atom, and the system ends up in the form . Top left: dihedrals, horizontal dashed lines mark multiples of 180; top right: distances; bottom left: state energies; bottom right: energy difference . In line with a previously proposed scheme, we have analyzed the sma isomers observed during the dynamics simulations in terms of photochemical classes . Depending on the values of the three key internal degrees of freedom (cn dihedral, cc dihedral, and oh distance) we assign the starting, hopping, and final structures from each trajectory to the,,, or sets (for precise class definitions see the supporting information). Within one particular photochemical class all sma conformers are interconvertible by rotations around single bonds that usually require only little energy . All class members have similar uv absorption spectra which are, however, distinct from those of different - class representatives . Figure 6 shows results of such a structure population analysis for the photodynamics . At the starting point, the two key dihedral angles do not differ much from the optimum values of 0 and 180 of the initial isomer (left panel). By contrast, the hopping points (middle panel) have twisted structures, with at least one of the two key dihedral angles differing strongly from 0 and 180. these hopping points are concentrated in two areas: cc 90 and cn [120 160] and cn 90 and cc [0 30]. This reflects the competition between two internal conversion pathways proceeding through the ci1 and ci2 conical intersections . The first one, involving esipt followed by cc bond rotation, happens much more frequently than the second one, involving cn bond photoisomerization (ca . Condon point to ci1 is essentially barrierless and initiated by the ultrafast esipt process, while at the same time there is a small barrier on the route to the alternative ci2 conical intersection . In the right panel with the final structures (final points of the simulation) 7:3:9:1 . Evidently, the switching forms and are strongly preferred over the other two structures . The small amount of the form represents the photoproducts of the alternative deactivation mechanism via ci2 . On a somewhat longer time scale, the initially produced isomers are expected to undergo a nearly barrierless ground - state proton back transfer transforming them into the photochemical class . The collected data also allow an estimate of the splitting ratio at both conical intersections . Comparing the overall number of final structures classified as and that arise from hopping around ci1 with the number of final isomers, one gets a 1:1 ratio . An analogous analysis for the ci2 conical intersection (involving the and structures coming from the deactivation at ci2) also gives a 1:1 ratio . Again, the trajectories start in the vicinity of the initial minimum (left panel). All the hopping points lie close to the ci1 conical intersection (middle panel). Condon region of the isomer by cc bond rotation (note that ci2 cannot be accessed from the structure). At the end of the simulation (right panel) most of the trajectories end up as or isomers, with a photoproduct distribution::: of ca . 4:5:1:0 . Thus, the overall splitting ratio estimated for ci1 equals 9:1 for the photodynamics . Dihedral angle distribution of key structures in the trajectories starting from the isomer . Color code for assignment to isomers: green; red; violet; blue . Dihedral angle distribution of key structures in the trajectories starting from the isomer . Color code for assignment to isomers: green; red; violet; blue . The product distribution in the two photodynamics simulations gives valuable information about the expected photoswitching efficiency the extent of the initial - to - final transformation at the end of the simulation may be considered as one of its possible measures . Comparison of the::: ratio for the onward (photodynamics) and backward (photodynamics) switching shows better performance of the latter . The initial - to - final conversion (counting the population as future class) amounts to 50% for the and to 90% for the phototransformation . These percentages almost perfectly reflect the splitting ratio at ci1 the conical intersection responsible for the dominant internal conversion mechanism in sma . Therefore, it is worthwhile to focus attention on the structural bifurcation at ci1 . The splitting ratio may be explained in terms of the interplay between the effects of momentum conservation and coupling to the local density of states . The first factor, understood as favorable continuation of the rotational motion driving the system to a conical intersection, always supports direct passing through the ci and, thus, the photoswitching . The second one, a purely quantum effect, enters the dynamics through vibrational mode relaxation that occurs after the hop to the ground state . This vibrational cooling is more efficient for the more pronounced (deeper and/or wider) of the minima adjacent to the splitting ci point, which in our case is the isomer . One should notice that in the photodynamics these two effects act against each other leading to a rather even splitting distribution, while in the case they act in the same direction and thus favor formation of the isomer . Figure 8 shows the time evolution of the photochemical class populations for both photodynamics: after excitation of the form, one observes an ultrafast to transformation (esipt) occurring mainly in the first 30 fs of the simulation; this is in very good agreement with previous theoretical results and with experimental findings for similar systems . 50 fs after the excitation, the population of the form starts to grow which, after rising to a 5% value, stays constant until the simulation ends . This confirms, as expected, that in the s1 state an intramolecular ballistic transfer of a light proton occurs faster than a rotation around the cn bond . Consequently, the internal conversion through ci1 plays a predominant role in sma photodynamics . Further analysis of the left panel of figure 8 (100 fs <t <200 fs) shows that the population, after reaching its maximum arising from the esipt process, decreases rapidly . At the same time 70 fs after the pt) the amount of isomer starts to grow with a similar rate . This reflects the internal conversion process with a bifurcation between the and forms and is consistent with the previously estimated s1 excited - state lifetime . After 200 fs the population stabilizes at its final value, and one observes an almost linear decrease (increase) in the population of the () isomer, which continues until the end of the 1 ps simulation . Assuming this trend to continue, the full switching process would be finished around 1.6 ps after the initial photoexcitation of the isomer, which is again in agreement with experimental observations for analogous schiff base systems . From the right panel of figure 8 one may learn about the time characteristics of the back - switching process starting with an excitation of the form . At the very beginning the system stays close to the initial structure and then, again after ca . This happens through internal conversion at ci1 with bifurcation between these two forms, similarly as in the previously discussed photodynamics . Population of the isomer initializes the subsequent to transformation, which again proceeds almost linearly with time . Concomitantly, the population reached after the s1 to s0 deactivation remains constant, and no traces of the form are observed . In analogy to the analysis for the case, the overall switching time scale may be estimated as ca . 2.0 ps . In this paper we investigated the full photoswitching cycle of an isolated sma molecule by means of the semiempirical on - the - fly photodynamics simulations . For the two isomers that play a crucial role in the switching (and), we find a very efficient internal conversion (90% nonradiative decay of the excited state) that indicates excellent photostability and promising switching efficiency of sma . The computed time scales characterizing the crucial phototransformations of this model schiff base system are all in the ultrafast regime (1 ps and subpicosecond). The simulations predict that the switching process is reversible in sma and that the competing photoisomerization around the cn bond plays only a minor role in the photochemistry of this system . The detailed analysis of structural time evolution provides direct insight into the internal conversion and switching mechanisms . The strong dependence of the splitting ratio at the ci1 conical intersection on the photoswitching direction probably originates from the ground - state pes topology of the and switching forms . ; cyan +; violet; blue . The esipt - based photoswitching mechanism in sma involves pronounced reorganization of the electron density accompanied by only minor changes in its geometrical structure . This should allow for switching selectivity due to the strong photochromism and should also ensure structural stability, which are both important factors in the design of molecular electronics devices . In summary, we believe that aromatic schiff bases may have advantages over many previously proposed molecular photoswitching systems because of their ultrafast photochemistry, high photostability, and good excitation selectivity, and that they may thus be considered as promising candidates for future photodriven molecular electronics materials.
|
Bladder is the most common site in the urinary system to be afflicted by cancer . At presentation, approximately 30% of bladder cancers (bca) are muscle invasive; radical cystectomy (rc) remains the treatment of choice in these cases . However, in select patients, partial cystectomy (pc) may offer equivalent oncological control with superior quality - of - life . Pc, when indicated, has most commonly been performed via an open - approach as it permits gross evaluation of the excised specimen and intraoperative assessment of surgical margins . However, techniques of laparoscopic pc (lpc) with or without robotic - assistance have been described . . Reported on 4 and 3 cases of robot - assisted pc (rapc), respectively, establishing the feasibility of rapc in management of bladder neoplasms . Although, performing pc minimally - invasively may reduce the morbidity of the procedure there is a theoretical risk of inadequate surgical resection that has not been addressed in these previous reports . Accordingly, in the current study, we sought to test the feasibility, safety, and reproducibility of a novel' modification' of rapc that recapitulates the open technique and allows for intraoperative surgical margin assessment . Further, we report on perioperative, oncological, functional, and quality - of - life outcomes in patients undergoing rapc . Between 2008 and 2013, 7 patients consented to undergo rapc, with the latter 5 undergoing modified - rapc (m - rapc) using the gelpoint device (applied medical, rancho santa margarita, ca, usa). We have previously demonstrated the efficacy of this technical modification in assessing and reducing positive surgical margins (psms) during robotic radical prostatectomy and robotic partial nephrectomy . In the current study, we extend the same principle to the management of bca . For each patient age at surgery, sex, body mass index (bmi), history of abdominal surgery, risk factors for bca, tumor characteristics, perioperative outcomes evaluated included surgery times, blood loss, surgical margins, hospital stay and complications . Disease recurrence and survival endpoints were also assessed, with a minimum and median follow - up of 12 and 38.9 months, respectively . Lastly, at the time of the last follow - up patients were surveyed to assess regret and satisfaction with treatment using previously validated questionnaires . Regret was assessed by the following 3 questions: (1) the man / woman's wish that he / she could change his / her mind about the kind of treatment he / she had received; (2) his / her feeling that he / she would be better if he / she had chosen another treatment; (3) whether he / she was bothered by the fact that others received different treatment for their bca (the responses were: " none of the time, " " a little of the time, " " some of the time, " " most of the time " or " all of the time " - no regret was defined as " none or a little of the time "). Satisfaction was assessed by the following 3 questions: (1) how would you rate your overall satisfaction with your treatment choice? ; (2) how would you rate your satisfaction with regards to urinary control? ; (3) how would you rate your satisfaction with regards to cancer control? (the responses were: " extremely satisfied, " " satisfied, " " unsure, " " dissatisfied " or " extremely dissatisfied " - satisfaction was defined as " extremely satisfied or satisfied "). In the 5 patients undergoing m - rapc, the gelpoint device allowed for rapid specimen extraction without compromising the pneumoperitoneum . After induction of general anesthesia, the patient was placed in supine position and the gelpoint access port was inserted supraumbilically through a 4- to 5-cm vertical incision . Next, the gelseal cap, prepared with a 12-mm camera port and a 10-mm low profile port (fig . Linear incisions were made in the gelseal at a tangent to the 10-mm port on the gelseal cap to facilitate specimen retrieval postextirpation . The patient was then placed in steep trendelenburg and 5 additional trocars were inserted under direct vision . Two 8-mm robotic ports for the left and right robotic arms were inserted along the left and right paramedian lines at the level of the umbilicus, respectively . A 12-mm assistant port was inserted near the right iliac - fossa along the anterior axillary line, and two 5-mm assistant ports were placed; one for suction in the epigastrium between the gelpoint and the right robotic port, and the other for the left side assistant in the left iliac fossa (fig . Subsequently, the robot was docked in the side - dock position, along the left foot end, to permit intraoperative cystoscopy . Robotic instruments included a fenestrated bipolar grasper in the nondominant hand and monopolar curved scissors in the dominant hand; the latter instrument was exchanged for a robotic needle driver during reconstruction . Depending on tumor location (table 1), the bladder exposure varied . For cases in which the tumor was located at the dome or the anterior wall of the bladder, the bladder was taken down caudally up to the level of the endopelvic fascia freeing the pedicle lateral to the umbilical ligament . In cases where the tumor was located at the lateral wall or near the ureteral orifice, the procedure began with medialization of the sigmoid colon followed by identification of the ureter at the iliac vessel crossing . Next, the bladder was filled with normal saline and a flexible cystoscope was introduced for intraoperative tumor localization (fig . A robotic ultrasound - probe (bk medical, peabody, ma, usa), passed through the 12-mm assistant port, was also utilized for tumor localization in 2 cases allowing for further confirmation and precise localization of the tumor within the bladder (fig . When tumor location necessitated vascular pedicle control, this was achieved with hem - o - lock clips, and the superior vesical and inferior vesical arteries were clipped and ligated in succession . Following this, using cystoscopic assistance, with or without the robotic ultrasound - probe, the margins of the tumor were delineated and the detrusor muscle was scored circumferentially to achieve a 10- to 20-mm margin (fig . 4a after excision, the tumor was placed in an endo - catch bag (ethicon surgery inc ., three steps were routinely performed to reduce the potential seeding of the abdominal cavity by cancerous cells; first, the bladder was drained before entering the mucosa, second, the incised area was held up (with the help of stay sutures) until the defect was sutured closed, and lastly, the excised specimen was captured and placed directly into an endo - catch bag without allowing it to touch / rest on adjacent tissue . Immediately following excision and extraction of the specimen, the surgeon examined the specimen on - table (fig . Frozen - sections were taken from areas that appeared suspicious for a psm on direct visualization and palpation (fig . 5c), and after being carefully marked for anatomical orientation, were sent for frozen - section analysis (table 2). If frozen - section yielded unfavorable pathology, more tissue was excised from the in situ complementary site and sent for permanent section . The bladder was then closed in 2 layers using a 3 - 0 barbed suture and left to closed drainage . The robot was then undocked and the fascia and the skin were closed in a standard manner . Post operative cystography was performed on all patients on postoperative day 7 prior to foley catheter removal . Statistical analyses were performed using stata - se 12 software (statacorp - lp, college station, tx, usa). Student t - test was used for continuous variables and a p - value of <0.05 was considered significant . Institutional review board between 2008 and 2013, 7 patients consented to undergo rapc, with the latter 5 undergoing modified - rapc (m - rapc) using the gelpoint device (applied medical, rancho santa margarita, ca, usa). We have previously demonstrated the efficacy of this technical modification in assessing and reducing positive surgical margins (psms) during robotic radical prostatectomy and robotic partial nephrectomy . In the current study, we extend the same principle to the management of bca . For each patient age at surgery, sex, body mass index (bmi), history of abdominal surgery, risk factors for bca, tumor characteristics, neo - adjuvant therapy and operative details were recorded . Perioperative outcomes evaluated included surgery times, blood loss, surgical margins, hospital stay and complications . Disease recurrence and survival endpoints were also assessed, with a minimum and median follow - up of 12 and 38.9 months, respectively . Lastly, at the time of the last follow - up patients were surveyed to assess regret and satisfaction with treatment using previously validated questionnaires . Regret was assessed by the following 3 questions: (1) the man / woman's wish that he / she could change his / her mind about the kind of treatment he / she had received; (2) his / her feeling that he / she would be better if he / she had chosen another treatment; (3) whether he / she was bothered by the fact that others received different treatment for their bca (the responses were: " none of the time, " " a little of the time, " " some of the time, " " most of the time " or " all of the time " - no regret was defined as " none or a little of the time "). Satisfaction was assessed by the following 3 questions: (1) how would you rate your overall satisfaction with your treatment choice? ; (2) how would you rate your satisfaction with regards to urinary control? ; (3) how would you rate your satisfaction with regards to cancer control? (the responses were: " extremely satisfied, " " satisfied, " " unsure, " " dissatisfied " or " extremely dissatisfied " - satisfaction was defined as " extremely satisfied or satisfied "). In the 5 patients undergoing m - rapc, the gelpoint device allowed for rapid specimen extraction without compromising the pneumoperitoneum . After induction of general anesthesia, the patient was placed in supine position and the gelpoint access port was inserted supraumbilically through a 4- to 5-cm vertical incision . Next, the gelseal cap, prepared with a 12-mm camera port and a 10-mm low profile port (fig . Linear incisions were made in the gelseal at a tangent to the 10-mm port on the gelseal cap to facilitate specimen retrieval postextirpation . The patient was then placed in steep trendelenburg and 5 additional trocars were inserted under direct vision . Two 8-mm robotic ports for the left and right robotic arms were inserted along the left and right paramedian lines at the level of the umbilicus, respectively . A 12-mm assistant port was inserted near the right iliac - fossa along the anterior axillary line, and two 5-mm assistant ports were placed; one for suction in the epigastrium between the gelpoint and the right robotic port, and the other for the left side assistant in the left iliac fossa (fig . Subsequently, the robot was docked in the side - dock position, along the left foot end, to permit intraoperative cystoscopy . Robotic instruments included a fenestrated bipolar grasper in the nondominant hand and monopolar curved scissors in the dominant hand; the latter instrument was exchanged for a robotic needle driver during reconstruction . Depending on tumor location (table 1), the bladder exposure varied . For cases in which the tumor was located at the dome or the anterior wall of the bladder, the bladder was taken down caudally up to the level of the endopelvic fascia freeing the pedicle lateral to the umbilical ligament . In cases where the tumor was located at the lateral wall or near the ureteral orifice, the procedure began with medialization of the sigmoid colon followed by identification of the ureter at the iliac vessel crossing . Next, the bladder was filled with normal saline and a flexible cystoscope was introduced for intraoperative tumor localization (fig . A robotic ultrasound - probe (bk medical, peabody, ma, usa), passed through the 12-mm assistant port, was also utilized for tumor localization in 2 cases allowing for further confirmation and precise localization of the tumor within the bladder (fig . When tumor location necessitated vascular pedicle control, this was achieved with hem - o - lock clips, and the superior vesical and inferior vesical arteries were clipped and ligated in succession . Following this, using cystoscopic assistance, with or without the robotic ultrasound - probe, the margins of the tumor were delineated and the detrusor muscle was scored circumferentially to achieve a 10- to 20-mm margin (fig . The bladder mucosa was then entered and the tumor was excised circumferentially without energy . After excision, the tumor was placed in an endo - catch bag (ethicon surgery inc ., three steps were routinely performed to reduce the potential seeding of the abdominal cavity by cancerous cells; first, the bladder was drained before entering the mucosa, second, the incised area was held up (with the help of stay sutures) until the defect was sutured closed, and lastly, the excised specimen was captured and placed directly into an endo - catch bag without allowing it to touch / rest on adjacent tissue . Immediately following excision and extraction of the specimen, the surgeon examined the specimen on - table (fig . Frozen - sections were taken from areas that appeared suspicious for a psm on direct visualization and palpation (fig . 5c), and after being carefully marked for anatomical orientation, were sent for frozen - section analysis (table 2). If frozen - section yielded unfavorable pathology, more tissue was excised from the in situ complementary site and sent for permanent section . The bladder was then closed in 2 layers using a 3 - 0 barbed suture and left to closed drainage . The robot was then undocked and the fascia and the skin were closed in a standard manner . Post operative cystography was performed on all patients on postoperative day 7 prior to foley catheter removal . Statistical analyses were performed using stata - se 12 software (statacorp - lp, college station, tx, usa). Student t - test was used for continuous variables and a p - value of <0.05 was considered significant . Institutional review board the mean age was 72.5 years; 71.4% of the patients were men (n=5). No patient had a psm; a potential psm was prevented (case 6) by virtue of m - rapc, as a positive intraoperative frozen - section lead to further tissue excision from the complementary site on the bladder, with subsequent negative surgical margin (nsm) (on the outer side) on final pathology . One patient developed lymphocele postoperatively requiring drainage (clavien - dindo grade iiia). At a median follow - up of 38.9 months, all patients but one were recurrence free . This patient (case 6) was a high - risk patient who had developed bca secondary to cyclophosphamide therapy for skin lymphoma, and presented with high - grade multiple urothelial carcinomas (ucs) clustered together at the dome (table 1). He developed a superficial recurrence 6 months postsurgery and was managed successfully with transurethral resection of the bladder tumor . He was tumor free at 9-month cystoscopy but had a recurrence again at 12 months . He died the subsequent week from an unrelated condition (lewy - body disease). Zero percent of the patients expressed regret and 0% expressed dissatisfaction (in all 3 domains for both the questions). As the incidence of bca continues to rise in the united states and worldwide, pc has gained attention as a potential treatment option for selected patients with muscle invasive bca . To decrease the burden of surgical morbidity, a minimally - invasive approach to pc has been suggested . Reported the first case of minimally - invasive pc in a female patient, establishing its feasibility . Mariano et al followed suit and reported a case series of 6 patients diagnosed with uc undergoing lpc, with only a single case of recurrence at a median follow - up of 30 months . Further established its safety but highlighted that the technical demands of the procedure may limit its adoption . Tareen et al . Reported primarily on the utility of rapc in management of benign bladder neoplasms (3 out of 4 cases) while all 3 patients in study by allaparthi et al . Underwent rapc for a malignant indication . In our study also, all 7 patients underwent rapc for a malignant indication and we believe this represents the largest experience of rapc in patients with cancer of the bladder . The biggest drawback of rapc, to date, has been the inability to retrieve tissue specimens prior to undocking the robot . Intraoperative tissue evaluation is important as it allows the surgeon to inspect the specimen margins grossly as well as send tissue for preliminary pathology review ensuring nsms . The significance of achieving nsms was demonstrated by ashley et al . In their study of 130 patients undergoing pc; the authors noted that in multivariable analysis, nsm was one of only 2 predictors that were significantly associated with improved survival . The m - rapc technique overcomes the aforementioned drawback of standard - rapc, and provides the surgeon with the ability to extract the specimen without undocking the robot and send tissue for frozen - section analysis during cystorrhaphy / pelvic lymphadenectomy . By performing cystorrhaphy / pelvic lymphadenectomy while waiting for the results of frozen - section analysis allows the procedure to be completed in a timely fashion . Accordingly, we did not note any increase in operative (p=0.67) or console time (p=0.81) for the five m - rapc cases as compared to the 2 standard rapc cases (table 2). Further, all seven patients had favorable perioperative outcomes including minimal blood loss, 1- to 2-day hospital stay, unremarkable cystograms and negative tissue margins . Long - term oncological outcomes were also favorable with only 1 patient experiencing a superficial recurrence at a median follow - up of 38.9 months, corroborating previous findings . Lastly, we show that patients undergoing rapc have excellent functional outcomes and quality - of - life (table 2), which to the best of our knowledge has not been reported before for pc patients . The issue of satisfaction and regret becomes important when several potentially equally - efficacious choices exist for management of a particular disease; in such scenarios, clear portrayal of risk and benefits of each approach and involving patient in the decision making process might lead to higher patient satisfaction and lower regret post - therapy . This is demonstrated in our study by example of patient 6, as despite having an early recurrence, the patient expressed no regret or dissatisfaction . Despite its merits, first, the study represents a retrospective review of prospectively collected data and thus is subject to the biases inherent to retrospective study designs . Second, the regret and satisfaction survey results were not obtained at a constant time - interval from the date of surgery for each patient, which might have confounded the survey results . Lastly, the sample size is limited . However, this study was done with the aim of testing the feasibility and safety of our new modification to rapc and reporting the early outcomes in the initial patients . Nonetheless, keeping in mind these drawbacks and in an effort to overcome them, we hope to pursue a prospective development study (ideal phase 2a study) in the near future following the ideal (idea, development, exploration, assessment and long - term monitoring) guidelines of surgical innovation proposed by the balliol collaboration . In conclusion, the m - rapc technique is technically feasible, safe, and reproducible; further, rapc leads to favorable oncological, functional and quality - of - life outcomes in patients eligible for pc.
|
Periodontal diseases are inflammatory conditions of bacterial origin that involve large proportions of inflammatory cells and the sequential activation of different components of the host immune and inflammatory response, aimed at defending the tissues against bacterial aggression, reflecting the essentially protective role of the response . Neutrophils protect the host tissues by killing various pathogenic bacteria either by non - oxidative or oxidative means in an intracellular or extracellular environment . Non - oxidative killing is mediated by various lysosomal enzymes, peptides and proteins, including lysozyme, bactericidal / permeability - increasing proteins, cationic proteins, defensins and lactoferrin . Generation of reactive oxygen species (superoxide, hydrogen peroxide, hydroxyl radicals and hypochlorous acid and chloramines) contributes in oxidative killing of the invading microorganisms . Numerous researchers have reported that any loss of the neutrophil defense, either due to deficiency in numbers or functions, predisposes an individual to a higher risk of periodontitis . These findings were further corroborated by investigations into various systemic conditions that exhibited impaired peripheral neutrophil number or functions and severe and early form of periodontal disease . These systemic conditions included chediak - higashi syndrome, cyclic neutropenia, leukocyte adhesion deficiency, papillon lefevre syndrome, down's syndrome, actin dysfunction syndrome and diabetes mellitus, to name a few . However, it has also been demonstrated that the defensive inflammatory host response may lead to increased destruction of host connective tissue and perpetrate the loss of periodontal structures . Ample research has demonstrated that in localized aggressive periodontitis (lap), neutrophils are hyperactive and primed and appear to release enhanced levels of oxygen radicals, inflammatory mediators such as cytokines and matrix - degrading enzymes . This hyperactivity and reactivity of neutrophils destroys the adjacent host tissues and contributes to the destructive changes observed in inflammatory periodontitis . The various neutrophil functions investigated for deficiency in lap include chemotaxis, phagocytosis and intracellular killing, leukotriene b4 synthesis, superoxide generation and signal transduction abnormalities . The data from various laboratories in different parts of the world have yielded conflicting results, although most of the laboratories report defective chemotactic and phagocytic function and increased production of reactive oxygen species . There are very few published studies on the prevalence of lap in an indian population, and none on the prevalence of neutrophil functional abnormalities associated with lap in an indian population . The purpose of the present investigation was to examine neutrophil chemotaxis, phagocytosis, intracellular killing and superoxide ion generation in a group of patients with lap compared with healthy subjects in the indian population . In total, 20 patients (11 male and nine female) were selected from the out - patient department of periodontics based on their periodontal conditions . These patients were divided into two groups, one group comprising 11 patients (five male: six female, mean age group 22 years), diagnosed clinically and radiographically by two different investigators as having lap . The other group consisted of nine healthy individuals (six male: three female, mean age group 21 years) referred for routine oral prophylaxis procedures without any form of periodontal disease other than mild marginal gingivitis . A standard proforma consisting of demographic information (name, age, sex, address and occupation), medical and past dental history and gingival index of loe and silness (1963) was recorded for the control group and clinical attachment loss (cal) was recorded for the test group [table 1]. Laboratory analysis in the form of complete hemogram was performed blind to the clinical diagnosis and showed normal hemoglobin levels, with no other abnormality in total or differential white blood cell (wbc) count . Bleeding time and clotting time were within normal limits . Data on demographics, clinical attachment loss and gingival index of the test and control groups all the subjects included in the study were non - smokers, systemically healthy and did not undergo any form of periodontal therapy for at least 6 months prior to the initiation of the study . A written consent was obtained from all the individuals participating in the study . Six milliliters of whole blood was drawn under strict aseptic conditions from the anticubital vein of each patient in two separate vials, one of which contained heparin, and transported to the laboratory . After a total and differential count of wbcs, the blood in the plain vial was incubated at 37c for 2 h and the serum was separated for use in the nbt test for superoxide generation . The blood collected in the vials containing heparin was mixed with an equal quantity of minimum essential medium (mem containing hank's balanced salt solution) and 3 - 5 ml of 6% dextran in 0.15 m sodium chloride (himedia labs, mumbai, india). After this, the supernatant, rich in leukocytes, was collected in test tubes and centrifuged at 5000 rpm for 10 min . The resultant supernatant was discarded and the sediment was gently washed with phosphate - buffered saline and centrifuged at 3000 rpm for 10 min . Differential wbc count of the resultant leukocyte - rich cell pellet yielded a neutrophil population of 85 - 87% . This cell pellet was then suspended in mem for use in chemotaxis, phagocytosis and microbicidal assays . The chemotaxis assay assembly consisted of a lower compartment filled with the chemo - attractant casein (in hank's balanced salt solution; himedia labs). The upper compartment was made up of a syringe with 5 m pore size calcium acetate filter paper glued at one end and containing the cell suspension . It was placed inside the lower compartment and allowed to stand undisturbed for about 1 h at room temperature . After this, the cell contents in the upper compartment were emptied and the compartment was immersed in 70% methanol such that the glue melted . The filter paper strip was carefully removed, stained with hematoxylene and fixed on a glass slide to observe under the microscope . For the phagocytic assay, candida albicans was grown on sabouraud's 2% dextrose broth for 48 h at 37c to obtain organisms in the yeast phase only . The candida cells were mixed with the neutrophil - rich cell suspension and kept undisturbed for about 30 min at 37c . The supernatant was then discarded and smears were prepared with the sediment, air dried and stained with giemsa stain . The remaining sediment from the phagocytosis assay was mixed with 2.5% sodium deoxycholate (himedia labs), which lysed the leukocytes but did not damage the candida cells . After about 5 min, 4 ml of 0.01% methylene blue, which stains the ingested candida cells, was added to the tubes and centrifuged at 1500 rpm for 10 min . The supernatant was discarded and wet smears were prepared from the sediment for immediate microscopic observation in a modified neubauer's chamber . Superoxide generation was measured by using the nbt test, which is a qualitative screening test and utilizes stimulated and unstimulated neutrophils for evaluation . Escherichia coli (e. coli) endotoxin (himedia labs) was used to stimulate the cells . Briefly, 100 l of whole blood was added to 100 l of nbt (himedia labs) and 100 l of e. coli endotoxin . The assembly was incubated at 37c for 20 min and then at room temperature for a further 20 min . The test for all the samples was performed in duplicate and the control was tested simultaneously with addition of mem instead of e. coli endotoxin . In total, 20 patients (11 male and nine female) were selected from the out - patient department of periodontics based on their periodontal conditions . These patients were divided into two groups, one group comprising 11 patients (five male: six female, mean age group 22 years), diagnosed clinically and radiographically by two different investigators as having lap . The other group consisted of nine healthy individuals (six male: three female, mean age group 21 years) referred for routine oral prophylaxis procedures without any form of periodontal disease other than mild marginal gingivitis . A standard proforma consisting of demographic information (name, age, sex, address and occupation), medical and past dental history and gingival index of loe and silness (1963) was recorded for the control group and clinical attachment loss (cal) was recorded for the test group [table 1]. Laboratory analysis in the form of complete hemogram was performed blind to the clinical diagnosis and showed normal hemoglobin levels, with no other abnormality in total or differential white blood cell (wbc) count . Bleeding time and clotting time were within normal limits . Data on demographics, clinical attachment loss and gingival index of the test and control groups all the subjects included in the study were non - smokers, systemically healthy and did not undergo any form of periodontal therapy for at least 6 months prior to the initiation of the study . A written consent was obtained from all the individuals participating in the study . Six milliliters of whole blood was drawn under strict aseptic conditions from the anticubital vein of each patient in two separate vials, one of which contained heparin, and transported to the laboratory . After a total and differential count of wbcs, the blood in the plain vial was incubated at 37c for 2 h and the serum was separated for use in the nbt test for superoxide generation . The blood collected in the vials containing heparin was mixed with an equal quantity of minimum essential medium (mem containing hank's balanced salt solution) and 3 - 5 ml of 6% dextran in 0.15 m sodium chloride (himedia labs, mumbai, india). After this, the supernatant, rich in leukocytes, was collected in test tubes and centrifuged at 5000 rpm for 10 min . The resultant supernatant was discarded and the sediment was gently washed with phosphate - buffered saline and centrifuged at 3000 rpm for 10 min . Differential wbc count of the resultant leukocyte - rich cell pellet yielded a neutrophil population of 85 - 87% . This cell pellet was then suspended in mem for use in chemotaxis, phagocytosis and microbicidal assays . The chemotaxis assay assembly consisted of a lower compartment filled with the chemo - attractant casein (in hank's balanced salt solution; himedia labs). The upper compartment was made up of a syringe with 5 m pore size calcium acetate filter paper glued at one end and containing the cell suspension . It was placed inside the lower compartment and allowed to stand undisturbed for about 1 h at room temperature . After this, the cell contents in the upper compartment were emptied and the compartment was immersed in 70% methanol such that the glue melted . The filter paper strip was carefully removed, stained with hematoxylene and fixed on a glass slide to observe under the microscope . For the phagocytic assay, candida albicans was grown on sabouraud's 2% dextrose broth for 48 h at 37c to obtain organisms in the yeast phase only . The candida cells were mixed with the neutrophil - rich cell suspension and kept undisturbed for about 30 min at 37c . The supernatant was then discarded and smears were prepared with the sediment, air dried and stained with giemsa stain . The remaining sediment from the phagocytosis assay was mixed with 2.5% sodium deoxycholate (himedia labs), which lysed the leukocytes but did not damage the candida cells . After about 5 min, 4 ml of 0.01% methylene blue, which stains the ingested candida cells, was added to the tubes and centrifuged at 1500 rpm for 10 min . The supernatant was discarded and wet smears were prepared from the sediment for immediate microscopic observation in a modified neubauer's chamber . Superoxide generation was measured by using the nbt test, which is a qualitative screening test and utilizes stimulated and unstimulated neutrophils for evaluation . Escherichia coli (e. coli) endotoxin (himedia labs) was used to stimulate the cells . Briefly, 100 l of whole blood was added to 100 l of nbt (himedia labs) and 100 l of e. coli endotoxin . The assembly was incubated at 37c for 20 min and then at room temperature for a further 20 min . The test for all the samples was performed in duplicate and the control was tested simultaneously with addition of mem instead of e. coli endotoxin . The results of the present study demonstrated that lap patients exhibited defective neutrophil function as compared with healthy subject as measured by neutrophil chemotaxis, phagocytosis, microbicidal activity and superoxide generation . Chemotaxis assay was performed along with phagocytosis assay, candidacidal assay and nbt test for superoxide generation on the same day and at the same time for each patient and control sample . A non - parametric mann observation and results of neutrophil function test in lap patients as compared with healthy individuals in an indian population the neutrophil chemotactic response to casein was recorded as the mean distance traveled in micrometer (m) by the neutrophils toward the chemoattractant . For neutrophils in lap patients, the mean distance traveled was 107.63 m (sd + 25.98 m) while that for neutrophils in healthy subjects was 127.44 m (sd + 10.24 m) [graph 1]. The difference between the two means was found to be statistically significant (p <0.05), indicating that neutrophil chemotaxis was significantly depressed in lap patients as compared with healthy subjects . Neutrophil chemotaxis assay the phagocytosis of the candida cells by neutrophils was evaluated and recorded as the mean particle number (mpn) of candida cells ingested by neutrophils . The mean mpn in lap patients was 3.18 (sd + 0.75) while that in healthy subjects was 4.61 (sd + 0.485). The difference between the means of the two groups was found to be statistically highly significant (p <0.01), indicating that neutrophil phagocytosis was highly significantly reduced in lap patients as compared with healthy subjects[graph 2]. Neutrophil phagocytosis assay the intracellular killing of candida cells was recorded as the percentage of candida cells killed after ingestion by neutrophils . The mean percentage of cells killed by neutrophils in lap patients was observed to be 23.27% (sd + 3.32%) while that in healthy subjects was 27% (sd + 2.23%). The difference between the two means was statistically significant (p <0.05), which can be interpreted as significantly reduced neutrophil microbicidal activity in lap patients as compared with healthy subjects [graph 3]. Neutrophil candidacidal assay the superoxide generation from both endotoxin - stimulated and unstimulated cells in both the groups was observed and recorded as% positive non - lymphoid cells . The results demonstrated that the mean% positive non - lymphoid cells in lap patients were 64.72% (sd + 7.55) and that for the healthy subjects was 53.22% (sd + 8.66). The difference between the two means was found to be statistically significant (p <0.01), indicating that superoxide generation by neutrophils in lap patients was highly significantly elevated than in control subjects [graph 4]. The neutrophil chemotactic response to casein was recorded as the mean distance traveled in micrometer (m) by the neutrophils toward the chemoattractant . For neutrophils in lap patients, the mean distance traveled was 107.63 m (sd + 25.98 m) while that for neutrophils in healthy subjects was 127.44 m (sd + 10.24 m) [graph 1]. The difference between the two means was found to be statistically significant (p <0.05), indicating that neutrophil chemotaxis was significantly depressed in lap patients as compared with healthy subjects . The phagocytosis of the candida cells by neutrophils was evaluated and recorded as the mean particle number (mpn) of candida cells ingested by neutrophils . The mean mpn in lap patients was 3.18 (sd + 0.75) while that in healthy subjects was 4.61 (sd + 0.485). The difference between the means of the two groups was found to be statistically highly significant (p <0.01), indicating that neutrophil phagocytosis was highly significantly reduced in lap patients as compared with healthy subjects[graph 2]. The intracellular killing of candida cells was recorded as the percentage of candida cells killed after ingestion by neutrophils . The mean percentage of cells killed by neutrophils in lap patients was observed to be 23.27% (sd + 3.32%) while that in healthy subjects was 27% (sd + 2.23%). The difference between the two means was statistically significant (p <0.05), which can be interpreted as significantly reduced neutrophil microbicidal activity in lap patients as compared with healthy subjects [graph 3]. The superoxide generation from both endotoxin - stimulated and unstimulated cells in both the groups was observed and recorded as% positive non - lymphoid cells . The results demonstrated that the mean% positive non - lymphoid cells in lap patients were 64.72% (sd + 7.55) and that for the healthy subjects was 53.22% (sd + 8.66). The difference between the two means was found to be statistically significant (p <0.01), indicating that superoxide generation by neutrophils in lap patients was highly significantly elevated than in control subjects [graph 4] the dual role of neutrophils, as defenders and perpetrators, in the periodontal disease process has been well established over the past few years and has recently been reviewed thoroughly . Although there are conflicting and contradictory reports of defective neutrophil function from various laboratories around the world, the majority of reports agree that certain neutrophil functions such as adhesion, chemotaxis, phagocytosis and intracellular killing are deficient in periodontitis in general, and in lap in particular . The majority also agree that the neutrophils in lap are in a hyperactive, primed state . This hyperactivity may be attributed to circulating factors, genetic make - up of an individual or environmental effects . These hyperresponsive neutrophils are considered as one of the major reasons for the periodontal tissue destruction seen in lap . The conflicting reports by different laboratories around the world may be attributed to the genetic heterogeneity among the populations studied . The present investigation was aimed to assess neutrophil chemotaxis, phagocytosis, intracellular killing and superoxide generation in lap patients in an indian population . The results of the present study indicate that neutrophils in lap patients exhibit significantly depressed chemotaxis than in healthy subjects . These observations were in conjunction with various earlier reported observations of defective chemotactic function in lap neutrophils . Possible mechanisms underlying the reduced chemotactic response have been studied in the past, and include defective calcium influx factor activity, decreased diacylglycerol (dag) kinase activity with concomitant increase in protein kinase c (pkc) and dag, reduced levels of a surface glycoprotein gp110 and possibly elevated levels of proinflammatory cytokines such as tnf- and il-1 in the serum of lap patients . Also, patients with reduced chemotaxis showed a significant reduction in both c5a and fmlp binding sites on the cells, the probable reason being reduction in the reduced receptor density on the cell surface because of the hereditary nature of the disease or aberrant fpr expression . The present study also reports a highly significant decrease in phagocytosis and intracellular killing in lap neutrophils, corroborative of the earlier reports of defective phagocytic function in lap neutrophils . To measure phagocytosis accurately, it is necessary to distinguish between ingested particles trapped intracellularly and surface - bound particles adhering to the plasma membrane . Using c. albicans, it is possible to make this distinction by the uptake of trypan blue dye by the extracellular, but not the intracellular, heat - killed candida cells . Chemotaxis and phagocytosis are both modulated by a variety of receptors and involve several activation pathways, of which one of the most important is activation of protein kinase c (pkc) and regulation of dag and dag kinase . The mechanisms underlying defective neutrophil phagocytosis and intracellular killing, although not as thoroughly studied, have emphasized on intrinsic cellular or cytoskeletal defects of neutrophils, interference of a. actinomycetemcomitans with phagosome and lysosome fusion by ljp neutrophils and suppression of lactoferrin release, reduced phagocytosis of some strains of p. gingivalis and a. actinomycetemcomitans by neutrophils from subsets of aggressive periodontitis patients along with elevation of superoxide production and signal transduction abnormalities such as chronic pkc activation due to elevated levels of dag . Also reported that defects in lysosomal - associated membrane protein-2 (lamp-2) result in impaired phagosomal maturation and formation of the phagolysosome in the neutrophils of lamp-2-deficient mice . In general, various investigations into neutrophil functions in lap emphasize that chronic activation of pkc and subsequent downregulation of dag kinase may result in neutrophil functional abnormalities such as decreased chemotaxis, reduced phagocytosis and microbicidal activity . The present study also investigated superoxide generation by neutrophils from lap patients when stimulated by endotoxins . Periodontal diseases are largely gram negative infections and, to simulate the local environment in the gingival sulcus, the present study employed the nbt assay that uses e. coli, a gram negative organism that possesses very potent lipopolysaccharide, to induce neutrophil priming . The superoxide generation was observed to be highly significantly elevated in lap individuals . These observations were consistent with those of shapira et al . And hurttia et al . It is hypothesized that reactive forms of oxygen produced in vivo can inactivate protease inhibitors present in biological fluids thus increasing the activity of proteases . Besides this makes it possible to presume that such reactive forms of oxygen produced by neutrophils are particularly important factors causing tissue damage . The prevalent observation regarding elevated superoxide generation in lap neutrophils is elevated levels of dag and reduced levels of dag kinase in the neutrophils from lap patients . The hyperactivity and reactivity of peripheral blood neutrophils from periodontitis patients may be a constitutive feature of the cells themselves, or a constitutive characteristic of the host in relation to the elaboration of priming agents into plasma . Rates of reactive oxygen species production are important determinants of oxidative stress, a phenomenon that is associated with periodontitis . Chapple and matthews also suggested a dual role for neutrophils in the production of oxidative tissue damage, involving a potentially reversible fc-receptor - mediated hyperreactivity and a constitutional hyperactivity relative to baseline oxygen radical release . Conflicting results of the present study with observations of some of the earlier studies may be partly attributed to differences in the racial and ethnic background of the individuals studied, differences in methodologies employed to perform the neutrophil function assays and in the interpretation of data obtained from these assays . The limitations of the present study may also include use of c. albicans and e. coli as indicator organisms in neutrophil function assays . Although not associated with periodontal diseases, these are most commonly employed in the laboratory for neutrophil assays . The phagocytic response of neutrophils to heat - killed c. albicans may differ from that to commensal organisms such as a. actinomycetemcomitans . Similarly, as e. coli is not a commonly isolated organism from periodontal pockets in ap, the response of neutrophils to the e. coli endotoxin challenge may vary from that to commonly isolated organisms such as a. actinomycetemcomitans or p. gingivalis . Further studies using organisms associated with periodontal disease for neutrophil function assays are required to more specifically elaborate the neutrophil function in lap . The limitations of the present study included the small sample size, which may not be representative of an indian population, and diagnosis of lap based on clinical and radiographic investigations excluding more conclusive microbiological diagnosis . In conclusion, the findings of the present study support the earlier observations that impaired neutrophil functions such as deficient neutrophil chemotaxis, phagocytosis and intracellular killing and increased superoxide generation are associated with lap, and may also serve as predisposing factors for lap in the indian population . Research has indicated a more prominent role of oxidative damage to periodontal tissues due to increased superoxide generation by lap neutrophils . However, further studies with a large sample size are required to (1) elaborate on more a direct association of microbiological, immunological and genetic factors predisposing to aggressive periodontitis, (2) ascertain the cause - and - effect relationship of defective host factors such as defective neutrophil functions and aggressive periodontitis in the indian population and (3) develop therapeutic strategies aimed at reducing this neutrophil - mediated oxidative damage and restore the antibacterial properties of the neutrophils for a healthy periodontal support structure.
|
Is magnified by the high prevalence of risk factors and by health systems which are often unable to effectively deliver the acute and long - term care these patients require [1, 2]. A recent review of the global impact of traumatic brain injury (tbi) identified that opportunities to adequately address this burden are compromised by limited epidemiological data on the causes and characteristics of these injuries . This gap is particularly apparent in pacific island countries and territories which are infrequently the focus of global public health attention . The traffic - related injury in the pacific project was developed to understand the burden of injury in three pacific nations the fiji injury surveillance in hospitals (fish) system was established as part of this project to capture all fatal and serious non - fatal (hospitalised) injuries in viti levu, the main island of fiji, during a 12-month period . Using this database, we describe the incidence and characteristics of head injuries resulting in hospital admission or death . We conducted a population - based review of primary admissions to hospital (> 12 h) or deaths as a result of a primary diagnosis of head injury identified from the fish dataset during a 12-month period from october 1, 2005, to september 30, 2006 . The fish system was piloted and refinements were made prior to the 12-month surveillance period . Cases were classified as a head injury if the medical notes described injuries to the head including intracranial injuries, skull fractures, and loss of consciousness . Fish was established in all trauma - admitting hospitals on the island of viti levu, home to around 70% of fiji's resident population (2007 census estimates 840,000). The two main ethnic groups on viti levu are the indigenous fijians (i - taukei, n = 353,895; 54.4%) and indians (n = 260,008; 40.0%). The fijian population has a younger age structure than the indian population (014-year - olds 32.0 vs. 22.8% and 45-year - olds 19.2 vs. 25.3%, respectively). A 1-page, 23-item injury surveillance form adapted from the who injury surveillance guidelines was used to collect data from patient folders and, where available, the electronic patient information system (patis). The information gathered included: demographic data (name, age, gender, and ethnicity), injury details (place of occurrence, activity, cause, intent, and alcohol and other substance use), length of stay, and outcome of injury event recorded in terms of nature of injuries and definitive outcome (dead on arrival, discharged, died while admitted). Data collection was carried out by pathologists, hospital nurses, and final - year medical students located at the surveillance hospitals . Following data collection, the injury surveillance forms were checked and validated against patient folders and patis records, and the data were entered into epi info version 3.3.2 . All data management and analysis were conducted using microsoft excel version 12.1.7 statistical software . Age- and ethnic - specific rates for head injury fatalities and admissions to hospital were calculated per 100,000 for people resident in viti levu using the fiji bureau of statistics 2007 census data . Using the fiji national population as the reference standard, comparisons of head injury rates by ethnicity and gender were age and gender standardised, as relevant . Results are presented as rates, means, and percentages with 95% confidence intervals (ci) where applicable . Ethical approval for the study was obtained from the fiji national research ethics committee and the university of auckland ethics committee . During the 12-month injury surveillance period, 2,233 individuals either died or were admitted to hospital as a result of injury . Of these, 276 cases (12.4%) had a primary diagnosis of head injury recorded in the fish database . The overall rate of head injuries was 42.4/100,000 (95% ci 37.7, 47.7). Over three quarters of cases were male (table 1). The age - standardised rate for males for all head injuries (60.5/100,000 (95% ci 52.1, 68.8)) was more than three times the female rate (18.4/100,000 (95% ci 13.7, 23.1); p <0.001). There were no significant differences in the age - standardised rate by ethnicity for the two leading ethnic groups (fijian 40.3/100,000 (95% ci 33.8, 46.9) vs. indian 37.5/100,000 (95% ci 30.1, 44.9)). Head injuries most commonly occurred among those aged 1529 years, followed by children aged 014 years; head injuries were least common among older adults (45 years and older). Of the three leading causes of injury, road traffic crashes had the highest rate of head injury (16.1/100,000 (95% ci 13.1, 19.2)), followed by falls (12.0/100,000 (95% ci 9.3, 14.6)) and hit by person or object (10.6/100,000 (95% ci 8.1, 13.1)). (n = 50/246), during the surveillance period . Two thirds (n = 33/50) of the head injury deaths occurred prior to arrival at the hospital . The crude annualised fatality rate was 7.7/100,000 (95% ci 5.6, 9.8) (table 1). The overall fatality rate for males was nearly four times that for females (p <0.001). There were no significant differences in fatality rates by ethnicity between fijians and indians (p = 0.85), the two main ethnic groups in fiji (table 1). These differences remained not statistically different following age standardisation to the fiji national population . The highest head injury fatality rate was seen among those in the 3044-year age group, and the lowest was observed among children . The leading external causes for head injury - related deaths in fiji were road traffic crashes, followed by being hit by person or object and falls (table 1). With the exception of 2 deaths due to falls, all head injury deaths among indians (n = 19/21) resulted from road traffic crashes . Among fijians, around one half of the head injury deaths were due to road traffic crashes (n = 14/27), 7 were as a result of being intentional), 5 were due to falls, and in 1 patient the cause of death was unknown . Highway / road / street the most common location . Among fatal head injury cases aged 18 years and over, almost one third (n = 14/44) were coded as likely to have involved alcohol . 2,059 people in fiji had an injury - related admission to hospital, of which 226 (11.0%) were as a result of head injury, corresponding to an annual hospitalisation rate of 34.7/ 100,000 (95% ci 30.4, 39.5) (table 1). The median age of patients admitted to the hospital with a head injury was 22.5 years (range 096). The highest rates of admission to hospital were in the 014- and 1529-year age groups . The injury hospitalisation rate for males was more than three times that for females (p <0.001). The median length of hospital stay for those with head injuries as principal diagnosis was 2.0 days (range 1107) compared to 3.0 days (range 0161) for those without head injury . Eight percent of patients with a principal diagnosis of head injury died, compared to 3% of patients without this diagnosis (p <0.001). The leading external cause for head injuries resulting in admissions to hospital were road traffic crashes followed by falls and hit by person or object (table 1). Almost three quarters of head injuries due to hit by person or object were recorded as intentional injuries (n = 47, 72.0%). Hospitalisation rates for head injury due to road traffic crashes, falls, and being hit by person or object were almost three times higher in males than females (fig . The greatest gender difference was seen for patients hit by person or object in the 1529-year age group where rates were nine times greater among males than females (19.8 vs. 2.2/100,000). The cause of head injury differed by age group, with falls being the leading cause in 014-year - olds (20.8/100,000 (95% ci 14.9, 28.2)), road traffic crashes in 1529-year - olds (15.4/100,000 (95% ci 10.5, 21.8)), and hit by person or object in those aged 3044 years and 45 years and older (13.8/100,000 (95% ci 8.6, 21.1) and 9.9/100,000 (95% ci 5.6, 16.1), respectively). Overall, there were no significant differences in the rates of admission to hospital following a head injury between the two major ethnic groups (p = 0.3) (table 1). However, fijians had higher rates of admissions to hospital for falls (14.1/100,000 (95%ci 10.6, 18.5) vs. 8.5/100,000 (95% ci 5.5, 12.5)) and hit by person or object (11.1/100,000 (95% ci 7.8, 14.9) vs. 7.3/100,000 (95% ci 4.5, 11.2)), and indians had higher hospitalisation rates for road traffic crashes (15.8/100,000 (95% ci 11.5, 21.2) vs. 10.2/100,000 (95% ci 7.2, 13.9)) (fig . 2). As noted for deaths, road traffic crashes accounted for a higher proportion of hospital admissions due to a head injury among indians (n = 41, 49.4%) than fijians (n = 36, 27.7%). Over three quarters of hit by person or object incidents among fijians were coded as intentional (n = 30/39) compared to around two thirds of these incidents among indians (n = 13/19). Travelling was the most common activity at the time of head injury resulting in hospital admissions, and highway / road / street was the most common location for head injuries to occur . Males were most likely to sustain a head injury on the highway / road / street (n = 76, 43.4%) followed by at home (n = 54, 30.9%). The reverse pattern was seen for females (at home n = 24, 47.1%; on the highway / road / street n = 22, 43.1%). Among the 148 hospitalised head injury cases aged 18 years and over, 32 (21.6%) were coded as likely to have involved alcohol . Fifty individuals died of head injury, equating to 20.3% of all injury deaths (n = 50/246), during the surveillance period . Two thirds (n = 33/50) of the head injury deaths occurred prior to arrival at the hospital . The crude annualised fatality rate was 7.7/100,000 (95% ci 5.6, 9.8) (table 1). The overall fatality rate for males was nearly four times that for females (p <0.001). There were no significant differences in fatality rates by ethnicity between fijians and indians (p = 0.85), the two main ethnic groups in fiji (table 1). These differences remained not statistically different following age standardisation to the fiji national population . The highest head injury fatality rate was seen among those in the 3044-year age group, and the lowest was observed among children . The leading external causes for head injury - related deaths in fiji were road traffic crashes, followed by being hit by person or object and falls (table 1). With the exception of 2 deaths due to falls, all head injury deaths among indians (n = 19/21) resulted from road traffic crashes . Among fijians, around one half of the head injury deaths were due to road traffic crashes (n = 14/27), 7 were as a result of being intentional), 5 were due to falls, and in 1 patient the cause of death was unknown . Highway / road / street the most common location . Among fatal head injury cases aged 18 years and over, almost one third (n = 14/44) were coded as likely to have involved alcohol . During the 12-month injury surveillance period, 2,059 people in fiji had an injury - related admission to hospital, of which 226 (11.0%) were as a result of head injury, corresponding to an annual hospitalisation rate of 34.7/ 100,000 (95% ci 30.4, 39.5) (table 1). The median age of patients admitted to the hospital with a head injury was 22.5 years (range 096). The highest rates of admission to hospital were in the 014- and 1529-year age groups . The injury hospitalisation rate for males was more than three times that for females (p <0.001). The median length of hospital stay for those with head injuries as principal diagnosis was 2.0 days (range 1107) compared to 3.0 days (range 0161) for those without head injury . Eight percent of patients with a principal diagnosis of head injury died, compared to 3% of patients without this diagnosis (p <0.001). The leading external cause for head injuries resulting in admissions to hospital were road traffic crashes followed by falls and hit by person or object (table 1). Almost three quarters of head injuries due to hit by person or object were recorded as intentional injuries (n = 47, 72.0%). Hospitalisation rates for head injury due to road traffic crashes, falls, and being hit by person or object were almost three times higher in males than females (fig . The greatest gender difference was seen for patients hit by person or object in the 1529-year age group where rates were nine times greater among males than females (19.8 vs. 2.2/100,000). The cause of head injury differed by age group, with falls being the leading cause in 014-year - olds (20.8/100,000 (95% ci 14.9, 28.2)), road traffic crashes in 1529-year - olds (15.4/100,000 (95% ci 10.5, 21.8)), and hit by person or object in those aged 3044 years and 45 years and older (13.8/100,000 (95% ci 8.6, 21.1) and 9.9/100,000 (95% ci 5.6, 16.1), respectively). Overall, there were no significant differences in the rates of admission to hospital following a head injury between the two major ethnic groups (p = 0.3) (table 1). However, fijians had higher rates of admissions to hospital for falls (14.1/100,000 (95%ci 10.6, 18.5) vs. 8.5/100,000 (95% ci 5.5, 12.5)) and hit by person or object (11.1/100,000 (95% ci 7.8, 14.9) vs. 7.3/100,000 (95% ci 4.5, 11.2)), and indians had higher hospitalisation rates for road traffic crashes (15.8/100,000 (95% ci 11.5, 21.2) vs. 10.2/100,000 (95% ci 7.2, 13.9)) (fig . As noted for deaths, road traffic crashes accounted for a higher proportion of hospital admissions due to a head injury among indians (n = 41, 49.4%) than fijians (n = 36, 27.7%). Over three quarters of hit by person or object incidents among fijians were coded as intentional (n = 30/39) compared to around two thirds of these incidents among indians (n = 13/19). Travelling was the most common activity at the time of head injury resulting in hospital admissions, and highway / road / street was the most common location for head injuries to occur . Males were most likely to sustain a head injury on the highway / road / street (n = 76, 43.4%) followed by at home (n = 54, 30.9%). The reverse pattern was seen for females (at home n = 24, 47.1%; on the highway / road / street n = 22, 43.1%). Among the 148 hospitalised head injury cases aged 18 years and over, 32 (21.6%) were coded as likely to have involved alcohol . In viti levu, fiji, head injury accounts for around 12% all of injury - related admissions to hospitals and for 20% of all injury - related deaths . Two thirds of deaths as a result of head injury occurred before arrival to the hospital . The in - hospital case fatality rate was much higher among patients with a principal diagnosis of head injury compared to those without (8 vs. 3%). Road traffic crashes are the leading cause of head injury resulting in death and admissions to hospital . Males are overrepresented in both fatal and non - fatal head injuries . Among the two major ethnic groups, fijians have higher rates of admissions to hospital for falls and hit by person or object, and indians have higher hospitalisation rates for road traffic crashes . Alcohol use was likely to be involved in 22% of hospitalised head injury cases aged 18 years or older . Data on the external causes of head injury in pacific low- and middle - income countries are scant . The examination of population - based data in this study for both fatal and non - fatal moderate - to - severe head injuries by external causes, locations where the injury occurred, and activity at the time of injury provides insight into the characteristics and immediate outcomes of these events that can aid in the development of injury prevention and control programs in fiji . The review period of 12 months restricted the ability to examine trends in rates and causes of injury over time . The use of broad age bands limited the ability to investigate patterns of injury that may differ by age, for example infants and toddlers, preschool children, and school - age children . However, we were still able to contrast overall patterns of injury to published data . An important limitation of this study is that information on the socio - economic status or the site of injury or residence of the injured person with respect to urban / rural locality was not collected . This study did not explore the magnitude of head injuries of all severities in viti levu . It is well established that the use of hospital - based data excludes people in the mild spectrum of head injury who are treated in a community setting or who do not seek medical attention [7, 8]. There is a possibility that some of those with moderate head injuries from the more socially disadvantaged and isolated areas may have not sought medical treatment or were treated in a community setting . Only one injury was recorded for each individual (generally the most serious or life - threatening injury); therefore, patients with less severe head injuries or those with head injury as a component of more severe injuries to other body regions would not be apparent in these data . In addition, in 6.9% of the cases the nature of the injury was not specified, which is likely to have resulted in an underestimation of the actual burden of head injuries in fiji . Previous studies have identified differences in head injury outcomes between rural and urban settings [9, 10]. A study from nepal found that patients in rural areas took on average 30 h longer to obtain definitive neurosurgical care than their urban counterparts . While the present study could not examine these differences, the limited availability of emergency medical facilities in rural fiji mean these differences are also likely to exist in fiji . Our study found that head injuries resulting in hospital admissions or death were more common among males than females, a finding consistent with many other international studies [1, 12, 13, 14, 15, 16, 17, 18]. The higher head injury fatality rate among 3044-year - olds in this study is in contrast to studies in middle- and high - income countries that have reported those aged 60 years and over experience the highest rates of tbi - related fatality [1, 19, 20]. The highest age - specific hospital incidence was noted among children and adolescents . Us data indicate children aged 04 years and adolescents aged 1519 years are more likely to sustain a tbi resulting in an emergency department visit, hospital admission, and death combined than other age groups . A south african study of hospital admissions for tbi reported the highest incidence among those aged 1524 years . Due to the relatively low numbers of cases in the older age groups (65 years and older) in the present study, these age groups were collapsed (45 years and over); therefore, we were unable to explore specific patterns of distributions in older adults . High tbi - related hospitalisation rates in the older age group have previously been noted in developed countries [19, 23, 24]. Road traffic crashes accounted for a substantial proportion of head injuries in this study, a finding consistent with previous studies from pacific low- and middle - income countries [15, 25, 26] as well as with other international studies from australia, china, india [1, 28], tunisia, and italy . A global review of tbi - related outcomes reported that road traffic crashes accounted for 62% of these injuries . In contrast, in finland and the usa falls are the leading cause of injury resulting in head injury hospitalisation . Falls in the present study were the leading cause of head injuries in children resulting in hospital admissions (53.5%), which is consistent with a nepalese study reporting that 61% of hospital admission among children was due to falls . The differences in the causes of head injury by ethnicity in the current study are curious . Fijians had higher rates of admissions to hospital for falls and hit by person or object than indians, while the hospitalisation rate for road traffic crashes was higher among indians . Explanations for these differences could be many, including different lifestyles (e.g. Kava use among fijians) and socio - economic status, and are worthy of further exploration in aetiological studies . The high proportion of head - injured individuals dying prior to arrival at hospital (66%) in this study is of concern . Research indicates that nearly two thirds (65%) of the mortality associated with head injury is due to secondary brain injury from hypertensive and hypoxic episodes . High - quality emergency medical services and trauma systems in high - income countries have significantly improved the outcomes following injury [32, 33]. A study investigating factors contributing to poor outcome in trauma patients in pakistan identified multiple issues including inadequate pre - hospital care, inappropriate inter - hospital transfer, limited hospital resources, and an absence of integrated and organised trauma care . Reviewing the access to and quality of pre - hospital and emergency care available to trauma patients in fiji could help elucidate the issues underlying the observation of the high pre - hospital mortality found in this study . In fiji, head injury is an important public health problem with uncertain but potentially significant longer - term consequences . The findings of this study reveal the need for better data on long - term disabilities, trauma care and rehabilitations services, and, importantly, concentrated efforts to prevent head injuries, particularly those due to road traffic crashes, falls, and interpersonal violence.
|
The distribution of sandflies correlated with the appearance of cases of leishmaniasis in endemic regions, especially in forested areas . However, with human intervention and the disappearance of their natural habitat, some species appear to have adapted to degraded habitats, contributing to expansion of their spatial distribution and the spread of leishmaniasis [13]. The main factors involved in the transmission of tegumentary leishmaniasis are related to deforestation, urbanization, the presence of domestic animals, and the development of agriculture, particularly the cultivation of cocoa, banana, and coffee . While some species of sandflies have disappeared, others have become more abundant and have adapted to synanthropic environments by changing their behavior [510]. In particular, this expansion has replaced traditional crops with crops that are more productive, which has led to changes in sandflies populations related to altered patterns of dispersal and spatial distribution of these species in new areas [1014], because these changes may involve a greater risk of transmission [3, 15]. Thus, an understanding between habitat variation and sandflies populations is essential, and to examine whether these changes can increase the risk of transmission of leishmania, we studied populations of sandflies in a conserved area and two distinct agroecosystems . The agroecosystems located in the parroquia cao el tigre, zea municipality, merida, venezuela, were studied . These regions have an average elevation of 300400 meters above sea level, covering an area of 135 km, which includes 9,595 inhabitants, a tropical rainforest climate, and temperatures that range between 25 and 30c . The main economic activities of the region are agriculture and cattle . According to methods previously described in the literature, indicators associated with ecoepidemiological levels were recorded using a data sheet that identified the environmental and anthropogenic variables related to the presence of sandflies . These variables included the climatic conditions (elevation, temperature, and relative humidity), the presence of natural or anthropogenic water bodies, dominant vegetation stratum, crops and animals present, and the level of human interference (e.g., logging, burning, and use of fertilizer). The aspects observed concern the vegetation and the presence of both dwellings and animal shelters . Three agroecosystems were selected with varying degrees of ecological disturbance: (1) a conserved area, predominantly forest, characterized by abundant primary vegetation; (2) a fragmented area in which primary vegetation was partially replaced by cocoa crops without management; and (3) a disturbed area with complete replacement of primary vegetation, resulting from the degradation caused by human activity related to citrus cultivation, specifically oranges (figure 1). Captures of adult sandflies specimens were performed for 12-month period, from january 2012 to january 2013 at three agrosystems . The captures were conducted at the peridomicile areas, using one shannon traps, three cdc traps, six sticky traps, and direct suction with an oral grabber . Sampling was conducted after sunset, when sandflies are most active, between 18:30 h and 20:00 h; with minimum of one capture by months each collection agrosystem . Shannon traps were conducted in peridomicile areas with three collectors, the cdc light traps were placed in proximity of houses (poultry houses, breeding pigs, tree, etc . ), and sticky strips (white paper sheets 21.6 27.9 cm coated with castor oil) were placed indoors or outdoors in proximity of houses . The traps were distributed over 1 ha of the agrosystems and arranged in transect with at least 20 m of distance between each trap . To determine the presence of leishmania promastigotes, the digestive system was extracted via the dissection of live females and examined using phase contrast microscopy at 400x magnification . We then performed rapid identification of fresh sandflies individuals, and body or representative segments were subsequently cleared in nesbitt solution for 24 hours and were prepared and mounted on slides using berlese's medium to identify females for corroboration of the species by comparative external and internal morphology . The methods used were based on community structure, proportional abundance, dominance index, and margalef's index which was used to calculate biodiversity . An analysis of the different captures among and agrosystems was conducted using a cluster analysis which was performed using pcord.5 software (license belonging to icae). The comparison for the different agrosystems was conducted using analysis of variance (anova) which was performed with a level of significance of 0.005, tukey's test . To investigate the possible association between species distribution and ecosystems a simple correspondence analysis was carried out using the ibm spss statistical software package, which is publicly available for download at http://ibm-spss-statistics.softonic.com . The ecoepidemiological characteristics and the degree of disturbance of the 3 agroecosystems are summarized in table 1 . The shannon traps, cdc light traps, sticky traps, and direct suction captured 94.7%, 2.2%, 1.2%, and 0.9% of the sandflies, respectively . L. gomezi was the most abundant species in the area, present in all environments studied . According to the abundance values of sandfly specimens collected, l. gomezi, l. ovallesi, l. walkeri, l. trinidadensis, and l. panamensis were the main species identified in the 3 agroecosystems . These species were found at different abundance levels, although l. panamensis was only detected in the conserved forest (table 2). Cluster analysis was performed to assess the segmentation of each capture, and we identified 2 groups of homogeneous captures with 46% similarity . The anova results showed significant differences between the populations of sandflies identified in each agroecosystem (one - way anova, f = 551, df = 16, p = 0.000). To further evaluate these differences, a post hoc tukey's test was performed for paired agroecosystems, specifically between forest and cocoa agroecosystems and cocoa and orange agroecosystems (table 3). The highest values of diversity and species richness occurred in the most conserved agroecosystem, the forest (2.26 and 14, resp . ). Moreover, the values for diversity and species richness decreased with an increasing degree of ecological disturbance, as observed with the cocoa (1.80 and 9) and orange agroecosystems (1.32 and 7, resp . ). The dominance level was 0.34 in the forest and increased with an increasing degree of ecological disturbance, with the highest value corresponding to the orange grove agroecosystem (0.64) (figure 3). The simple correspondence analysis between sandflies species and agroecosystems identified a strong association between l. gomezi and l. atroclavata with disturbed agroecosystems and a strong association between l. ovallesi, l. walkeri, l. shannoni, l. hernandezi, l. panamensis, l. migonei, l. cayenensis, and l. pilosa with conserved agroecosystems; species such as l. trinidadensis, l. olmeca nociva, and l. spinicrassa showed no association with any agroecosystem (: 124.7; df = 30; p = 0.005) (figure 4). In the conserved agroecosystem, l. gomezi, l. ovallesi, and l. walkeri demonstrated natural infection with leishmania species, which were identified as the subgenera leishmania and viannia . Human encroachment on forest ecosystems is driven by logging and agricultural conversion, resulting in sharp and rapidly moving gradients between the relatively cool and humid primary forest and the cultured land, which show strong insolation, higher temperature, and lower humidity . Tropical areas are characterized by a great diversity and wide distribution of sandflies fauna [19, 20]. In brazil, it has been reported that the devastation of natural areas, which includes natural habitats for sandflies, increases the adaptability of these species to environments with human intervention, as observed by the increasing number of cases of leishmaniasis in urban environments . It is likely that habitat degradation and climate change greatly impact the abundance and richness of sandflies . The results of this study highlight differences in the sandflies population composition and structure across 3 agroecosystems, characterized by the different degrees of ecological disturbance that were surveyed . Few studies on sandflies have focused on this aspect, as most reports have been limited to epidemiological studies and the documentation of naturally infected species . In addition, other studies have focused on how the population composition changes in different areas, such as the home and peridomestic or wild environments [2224], or according to the type of capture method used . The results are in concert with others who have proposed that changes in habitat may have a marked impact on the sandflies populations [510]. The relationship between leishmaniasis and agricultural activity has been recorded and the relationship between coffee cultivation and the transmission of leishmania by sandflies has been recorded in venezuela, colombia, brazil, and mexico [11, 2629]. This could be explained by the suitability of shade - grown coffee plantations for the resting and breeding of sandflies . Moreover, this type of agroecosystem presents high biodiversity and promotes the presence of many vertebrates, which in turn act as reservoirs of leishmania and potential feeding sources for sandflies [30, 31]. In this study, the effect of human intervention was reflected in the disturbed agroecosystems as an increase in dominance and a decline in diversity and species richness, relative to less ecologically disturbed areas such as the conserved agroecosystem, where dominance is lower and diversity and species richness are greater . These results are supported by those of previous studies [3, 21, 32]. Most diversity and species richness in the forest, conserved area, could be caused by higher accumulation organic material to accumulate as a result of the decomposition of leaves and vegetation waste lying on the soil favoring larval development . Environments with significantly disturbed wilderness areas cause certain species to adapt to these new spaces, as observed in our study . Moreover, our results show that anthropogenic modification can favor certain species to colonize these disturbed environments, such as was reported for l. longipalpis and l. flaviscutellata in urban areas of brazil . Few species are able to adapt to high levels of anthropogenic disturbance, consequently, demographic parameters such as mortality and birth rates for each species are affected differently, and ecosystem structure and dynamics are in turn affected; yet based on the abundance values, our results suggest that l. gomezi was the species with the greatest ability to exploit disturbed environments [3, 35]. Both l. gomezi and l. ovallesi have been considered as important vectors of leishmania . The type of agroecosystem affected the abundance of l. gomezi and l. ovallesi which have an important effect on the probability of humans being bitten by one of these two vectors . L. gomezi has been reported to have a marked preference for biting humans around homes where vegetation is scarce, and this species has also been known to invade the inside of the home [36, 37]. These findings suggest a greater risk of transmission of the disease in these areas . The abundance of l. ovallesi, a species that transmits leishmania braziliensis, has also been confirmed as a vector of leishmania mexicana in venezuela, and in conserved areas such as forests, a potential natural habitat and fragmented areas with cocoa plantations confirm the association of this species with woody vegetation [3840]. The sympatric relationship between l. ovallesi and l. gomezi is comparable to what was reported in brazil between l. intermedia and l. neivai, where l. ovallesi is the species with a greater dependence on conserved areas than l. gomezi, predominated near the peridomiciles, indicating a process of adaptation, mainly to this environment of less dense vegetation . L. gomezi and l. ovallesi as predominant species of primary forest, as the deforestation extended, there was a tendency for l. ovallesi to disappear, suggesting that this species is more dependent on the primary forest than l. gomezi . In the conserved forest agroecosystem, l. gomezi, l. ovallesi, and l. walkeri demonstrated natural infection with leishmania of the subgenera leishmania and viannia, and this seems to indicate that these species may be transmitting the leishmaniasis agent in the forest agroecosystem area . If these areas have a greater diversity of sandflies species, it would be expected that there would be a greater coexistence of various species of leishmania, given the specificity between the sandflies vector and leishmania . Moreover, the increased abundance of l. gomezi in disturbed agroecosystems indicates that this species has adapted to new environments modified by humans . The altered environments favor adaptation of l. gomezi; these results suggest that the transmission pattern may be changing . This study provides a basis for further in - depth studies to assess how anthropogenic changes can modulate vector composition and distribution and could also help to explain how this might affect the transmission of tegumentary leishmaniasis in merida and potentially disease risks . These results clearly show that sandflies fauna exhibited changes in species number as well as population structure in degraded environments . As a result, changes in the determinants of transmission can lead to the development of new outbreaks.
|
The pathogenesis of human cancer is characterized by a multistep process involving multiple molecular alterations leading to dysregulation of a variety of signaling pathways (hanahan and weinberg 2011). Acute myeloid leukemia (aml) is a clonal disorder of hematopoietic stem cells characterized by disrupted maturation and uncontrolled proliferation of immature progenitor cells and subsequent suppression of normal hematopoiesis (lwenberg et al . Normal hematopoietic stem cells (hsc) are defined by their ability to exert self - renewal and multilineage differentiation and maturation . In contrast, leukemic stem cells appear to be transformed hscs with a loss of control of both proliferation and maturation through accumulating genetic and epigenetic aberrations (huntly and gilliland 2005). Important genetic findings in aml comprise chromosomal translocations involving different transcription factors and activating point mutations in multiple signal transduction pathways (tenen 2003). Furthermore, the ineffective hematopoiesis in aml is thought to be the result of dysregulation between the blasts and the surrounding hematopoietic microenvironment consisting of a variety of cells, including bone marrow stromal cells and their products, especially cytokines and extracellular matrix (ecm) molecules (mayani 1996). This bone marrow microenvironment supports and regulates the proliferation and differentiation of hematopoietic cells (bhatia et al . However, the role of the microenvironment itself in aml has not yet been well characterized . Dna methylation of cpg islands associated with gene promoter regions is the most extensively studied epigenetic mechanism, which is not only crucial for the regulation of gene expression during normal mammalian development but also contributes to silencing of cancer - related genes in tumorigenesis (herman and baylin 2003; esteller 2008). Recent advances in the rapidly evolving field of cancer epigenetics have shown extensive reprogramming of every component of the epigenetic machinery in cancer including dna methylation, histone modifications, nucleosome positioning, and non - coding rnas, specifically microrna expression (sharma et al . 2010). Additionally, epigenetic changes play an important role as an alternative mechanism of transcriptional inactivation of cancer - related genes in hematopoietic malignancies . These aberrations may thus contribute to enhanced proliferation and self - renewal, differentiation arrest as well as impaired apoptosis of leukemic blasts (galm et al . Patterns of dna methylation are non - random and tumor type specific, and this could also be shown in aml (figueroa et al . 2010). Inter--trypsine inhibitors (itis) are a family of plasma protease inhibitors consisting of one light chain (bikunin) and a variable set of two homologous heavy chains (itih1 - 5) which are linked by chondroitin sulfate, a glycosaminoglycan . Itihs stabilize the ecm by covalently binding to hyaluronic acid, which is a major component of the ecm, forming so - called cable - like structures (enghild et al . Itis can be found at high concentrations in human plasma as well as in other compartments especially in the connective tissue (zhuo et al . Itis have been found to have inhibitory effects on tumor progression and metastasis in vitro owing to the protease inhibiting function of bikunin and the stabilization of the ecm by the itihs (kobayashi et al . Itih5 is a novel member of the itih family and the only itih gene with a cpg - rich promoter region . Aberrant dna hypermethylation associated with transcriptional silencing of the putative tumor suppressor gene itih5 has previously been found in breast cancer and reportedly has a negative prognostic impact in this disease (himmelfarb et al . 2008). In this study, using a candidate gene approach, we determined the methylation status of the promoter - associated cpg island of itih5 in leukemia cell lines and primary aml patient samples . After informed consent was given, bone marrow (bm) and peripheral blood (pb) specimens (72 bm and 32 pb) were obtained at the time of diagnosis during routine clinical assessment of 104 patients with aml, who presented at the university hospital aachen, germany, between 1995 and 2008 . Mononuclear cells from bm and pb were separated by density gradient centrifugation prior to further analysis . Table 1characteristics of the patient cohorttotal number of patients, n104age (years, median and range)60.4 (21.089.1)gender, n male50 female54source of material, n bm72 pb32fab subtype, n m05 m134 m214 m427 m4eo11 m512 m71karyotype, n favorable16 intermediate60 unfavorable14 no data14laboratory parameters (median and range) wbc (10/l)21.4 (0.9354) hemoglobin (g / l)91 (41142) platelet count (10/l)60.5 (3680) ldh (u / l)496 (1393761)fab french american british, wbc white blood cell, ldh lactate dehydrogenase characteristics of the patient cohort fab french american british, wbc white blood cell, ldh lactate dehydrogenase we obtained the aml cell lines kg1a, hl-60, and gdm-1 as well as the hodgkin s lymphoma cell lines l-428, l-540, and l-1236 from the german collection of microorganisms and cell cultures (dsmz, braunschweig, germany). Cells were routinely cultured in rpmi 1640 (invitrogen, karlsruhe, germany) supplemented with 1020% fetal calf serum (biochrom ag, berlin, germany). For demethylation studies, the aml cell lines hl-60 and kg1a were incubated with or without a final concentration of 1.0 m 5-aza-2-deoxycytidine (dac; sigma, st . Louis, mo, usa) for 96 h. genomic dna was isolated from cell lines and primary tissues using standard methods . A purification of leukemic blasts prior to further analysis was not performed owing to the high sensitivity of the methylation - specific polymerase chain reaction (msp) technique (herman et al . Approximately 1 g dna was sodium bisulfite - modified and subjected to msp with primers specifically recognizing the unmethylated or the methylated sequence of the itih5 gene, respectively . Although msp primers and reaction conditions for the itih5 gene have been published previously (veeck et al . 2008), we decided to design new primers annealing closer to the transcription start site (fig . The bold double - headed arrow shows the region amplified by msptable 2msp primer sequences specific for the itih5 promoter regionprimerprimer sequenceamplicon length (bp)itih5 u senseg ttg gag ttt tgg gtg ttg taa agt141itih5 u antisenseccc aac tct aca cct ctt ctt acaitih5 m sensettg gag ttt tgg gcg ttg taa agc139itih5 m antisensecca act cta cgc ctc ttc cta cg schematic representation of the human itih5 promoter region . The bold double - headed arrow shows the region amplified by msp msp primer sequences specific for the itih5 promoter region overall survival curves were plotted according to the method of kaplan and meier and compared using the log - rank test . Survival was calculated from the date of diagnosis until the patients death or last visit . Correlations between variables were analyzed using the fisher s exact two - sided test . A p value <0.05 was considered to be statistically significant . All calculations were performed using the sas statistical software version 9.1.3 (sas institute inc ., cary, nc, usa). After informed consent was given, bone marrow (bm) and peripheral blood (pb) specimens (72 bm and 32 pb) were obtained at the time of diagnosis during routine clinical assessment of 104 patients with aml, who presented at the university hospital aachen, germany, between 1995 and 2008 . Mononuclear cells from bm and pb were separated by density gradient centrifugation prior to further analysis . Table 1characteristics of the patient cohorttotal number of patients, n104age (years, median and range)60.4 (21.089.1)gender, n male50 female54source of material, n bm72 pb32fab subtype, n m05 m134 m214 m427 m4eo11 m512 m71karyotype, n favorable16 intermediate60 unfavorable14 no data14laboratory parameters (median and range) wbc (10/l)21.4 (0.9354) hemoglobin (g / l)91 (41142) platelet count (10/l)60.5 (3680) ldh (u / l)496 (1393761)fab french american british, wbc white blood cell, ldh lactate dehydrogenase characteristics of the patient cohort fab french we obtained the aml cell lines kg1a, hl-60, and gdm-1 as well as the hodgkin s lymphoma cell lines l-428, l-540, and l-1236 from the german collection of microorganisms and cell cultures (dsmz, braunschweig, germany). Cells were routinely cultured in rpmi 1640 (invitrogen, karlsruhe, germany) supplemented with 1020% fetal calf serum (biochrom ag, berlin, germany). For demethylation studies, the aml cell lines hl-60 and kg1a were incubated with or without a final concentration of 1.0 m 5-aza-2-deoxycytidine (dac; sigma, st . A purification of leukemic blasts prior to further analysis was not performed owing to the high sensitivity of the methylation - specific polymerase chain reaction (msp) technique (herman et al . G dna was sodium bisulfite - modified and subjected to msp with primers specifically recognizing the unmethylated or the methylated sequence of the itih5 gene, respectively . Although msp primers and reaction conditions for the itih5 gene have been published previously (veeck et al . 2008), we decided to design new primers annealing closer to the transcription start site (fig . 1). Dark gray bars indicate location of the three promoter - associated cpg islands . The bold double - headed arrow shows the region amplified by msptable 2msp primer sequences specific for the itih5 promoter regionprimerprimer sequenceamplicon length (bp)itih5 u senseg ttg gag ttt tgg gtg ttg taa agt141itih5 u antisenseccc aac tct aca cct ctt ctt acaitih5 m sensettg gag ttt tgg gcg ttg taa agc139itih5 m antisensecca act cta cgc ctc ttc cta cg schematic representation of the human itih5 promoter region . The bold double - headed arrow shows the region amplified by msp msp primer sequences specific for the itih5 promoter region overall survival curves were plotted according to the method of kaplan and meier and compared using the log - rank test . Survival was calculated from the date of diagnosis until the patients death or last visit . All calculations were performed using the sas statistical software version 9.1.3 (sas institute inc ., cary, nc, usa). Msp analysis revealed that the itih5 promoter region was fully hypermethylated in the aml cell lines hl-60, kg1a, and gdm-1 as well as in the hodgkin s lymphoma cell lines l-428, l-540, and l-1236 (fig . 2). The demethylating agent dac for 96 h at a 1.0 m concentration induced a partial promoter demethylation (fig . We then analyzed the itih5 methylation status in mononuclear cells obtained from 104 patients with newly diagnosed aml . The frequency of aberrant methylation among the primary patient samples was 14.4% (15 of 104; fig . 2representative msp analyses of the itih5 gene in cell lines (aml: kg1a, hl-60, gdm-1; hodgkin s lymphoma: l-428, l-540, l-1236). Dna from peripheral blood cells of healthy donors, in vitro methylated dna, and water served as controls . Lane u amplified product with primers recognizing the unmethylated itih5 sequence, lane m amplified product recognizing the methylated itih5 sequencefig . 3representative msp analyses of the itih5 gene in aml cell lines hl-60 and kg1a after treatment with 1 m dac for 96 h. dna from peripheral blood cells of healthy donors, in vitro methylated dna, and water served as controls . Lane u amplified product with primers recognizing the unmethylated itih5 sequence, lane m amplified product recognizing the methylated itih5 sequencefig . Dna from peripheral blood cells of healthy donors, in vitro methylated dna, and water served as controls . Lane u amplified product with primers recognizing the unmethylated itih5 sequence, lane m amplified product recognizing the methylated itih5 sequence representative msp analyses of the itih5 gene in cell lines (aml: kg1a, hl-60, gdm-1; hodgkin s lymphoma: l-428, l-540, l-1236). Dna from peripheral blood cells of healthy donors, in vitro methylated dna, and water served as controls . Lane u amplified product with primers recognizing the unmethylated itih5 sequence, lane m amplified product recognizing the methylated itih5 sequence representative msp analyses of the itih5 gene in aml cell lines hl-60 and kg1a after treatment with 1 m dac for 96 h. dna from peripheral blood cells of healthy donors, in vitro methylated dna, and water served as controls . Lane u amplified product with primers recognizing the unmethylated itih5 sequence, lane m amplified product recognizing the methylated itih5 sequence representative msp analyses of the itih5 gene in primary aml patient samples . Dna from peripheral blood cells of healthy donors, in vitro methylated dna, and water served as controls . Lane u amplified product with primers recognizing the unmethylated itih5 sequence, lane m amplified product recognizing the methylated itih5 sequence among clinical prognostic parameters, we found no significant correlation between hypermethylation of itih5 and cytogenetics (table 3), elevated serum levels of lactate dehydrogenase, french american british subtype, gender, age, peripheral blood cell counts, and overall survival (os; p = 0.08; fig . Notably, median wbc was elevated in patients with itih5 hypermethylation compared to those without, though the difference was not statistically significant (73.3 10/l vs. 49.9 10/l, p = 0.24). Table 3association between the itih5 methylation status and cytogenetic findings in the patient cohortcytogenetic riskitih5 hypermethylation (%) total number of patients (n = 104)14.4% (15/104)favorable risk (n = 16)18.8% (3/16) inv(16) (n = 11)27.3% (3/11) t(8;21) (n = 5)0%intermediate risk (n = 60)11.7% (7/60)unfavorable risk (n = 14)7.1% (1/14)karyotype n.a . 5survival curves of patients with primary aml according to the itih5 methylation status at diagnosis (p = 0.08). In a total of 104 patients analyzed, 15 showed aberrant itih5 promoter hypermethylation association between the itih5 methylation status and cytogenetic findings in the patient cohort survival curves of patients with primary aml according to the itih5 methylation status at diagnosis (p = 0.08). In a total of 104 patients analyzed, 15 showed aberrant itih5 promoter hypermethylation recent advances in the field of epigenetics have shown that human cancer cells harbor global epigenetic abnormalities in addition to numerous genetic alterations (sharma et al . Dna hypermethylation is the one which has been most extensively studied . With regard to our findings, we conclude that promoter hypermethylation of itih5 is a novel epigenetic event in aml that may contribute to leukemogenesis by interfering with the interaction between the ecm and the leukemic clone . It has been shown that in the bm of aml patients, the ecm is enriched in hyaluronic acid, although the impact of this alteration still remains poorly defined (sundstrm et al . Since there was a trend toward an association between increased wbc and itih5 promoter hypermethylation, we hypothesize that epigenetic dysregulation of itih5 may result in an impaired interaction between the leukemic clone and its surrounding ecm in the bm . This may potentially lead to either increased peripheral wbc or a higher turnover of leukemic cells . Additionally, the os curve implies a slight advantage for patients who carry a hypermethylated itih5 promoter region, though this difference was not statistically significant . However, since little is known about the interaction between leukemic blasts and their surrounding ecm, further studies are required to better understand the functional consequences and the impact of a dysregulation of the blast matrix interaction on the pathogenesis and the course of aml as well as the function of itih5 in this setting . Additionally, our cell line data indicate that epigenetic dysregulation of itih5 may also play a role in the pathogenesis of hodgkin s lymphoma . Epigenetic silencing of cancer - related genes has been shown to be reversible . Consequently, epigenetic alterations are potential targets of great interest for a molecular targeted therapy in human malignancies (gilbert et al ., we have shown that treatment of the aml cell lines kg1a and hl-60 with the demethylating agent dac resulted in partial demethylation of the itih5 promoter region thus allowing the restoration of a potentially silenced gene expression . The use of the demethylating agents 5-azacytidine and dac has already been approved for the treatment of myelodysplastic syndromes (kantarjian et al . The partial reversal of the itih5 promoter hypermethylation may contribute to the beneficial effect of an epigenetically targeted therapy in aml . Further studies are warranted to assess the impact of itih5 promoter hypermethylation on itih5 expression levels . Since our patient cohort only consisted of 104 patient samples and was heterogeneous for age, risk factors, and treatment regimens, no definitive conclusion can be retained from these data regarding the prognostic impact of itih5 promoter hypermethylation . Therefore, the analysis of a larger number of well - characterized patient samples may be useful to further clarify the possible role of aberrant itih5 methylation as a biomarker in aml . Consequently, additional studies are necessary to elucidate the functional role of epigenetic dysregulation of itih5 in leukemogenesis.
|
Behet's disease (bd) is characterized by recurrent aphthous stomatitis, genital ulcers, and various skin lesions . Bd can also involve other systems such as ocular, gastrointestinal, articular, neurological and cardiovascular systems . The frequency of cardiovascular involvement is estimated to be 4 - 46%.1)2) common vascular manifestations are thrombophlebitis and arteritis, which occur in as many as one - third of the patients.3) aseptic endocarditis is a rare manifestation of bd and is mostly found in the form of intracardiac thrombus or endomyocardial fibrosis.3)4) nonrheumatic tricuspid valve stenosis (ts) is extremely rare, and to our knowledge, it has never been reported in the english literature in patients with bd . We describe a case of a female bd patient with aseptic tricuspid valve (tv) endocarditis presenting as ts . A 39-year - old female was admitted to kyungpook national university hospital with a 3-month history of dyspnea on exertion and abdominal distension . Signs of right heart failure such as pitting edema, palpable liver and neck vein distension were noted on physical examination . She had been diagnosed with bd four years ago . Although her previous clinical courses fluctuated, she did not show any signs or symptoms of bd since one year before admission . At the time of admission, evidence of bd disease exacerbation was absent; esr 20 mm / hr (reference 0 - 20 mm / hr), ferritin 71.50 ng / ml (reference 13 - 150 ng / ml). Transthoracic echocardiography (tte) showed normal left ventricular function, normal aortic and mitral valve function, morphology, and a moderate to large amount of pericardial effusion . However, precise evaluation of right heart was difficult on tte due to poor echo window . Transesophageal echocardiography showed severe ts with an ill - margined echogenic mass, and a mild to moderate amount of pericardial effusion (figs . 1 and 2). Any other possible causes of ts, such as cardiac tumors, carcinoid syndrome, marantic endocarditis, and wegener's granulomatosis were not detected . Symptoms of right heart failure gradually progressed despite the appropriate steroid and immunosuppressive therapy.5) she was operated for ts . The thickened tv was removed and was replaced with an artificial valve (edwards - mira 31 mm). Pathologic examination showed valvulitis consisting of fibrinoid necrotic material and inflammatory cells (figs . 3 and 4) these pathologic findings were consistent with those of previous reports presenting aseptic endocarditis in bd.6)7) after the tv replacement, she remained free from symptoms of right heart failure with immunosuppressive therapy and anticoagulant therapy . Endocarditis in bd may be limited to the valve leaflets or may spread to the ventricular or atrial wall and can result in serious complications, such as valvulopathy, organized thrombus or endomyocardial fibrosis.3)4)9) however, most cases of endocarditis in bd were detected in the form of organized thrombus or endomyocardial fibrosis.3)4) not only an intracardiac thrombus but also a massive endomyocardial fibrosis could cause serious functional obstruction of the tv.3)4)9) however, overt ts due to valvulitis has not been reported, even though the affected valve leaflets could either be thickened or replaced by fibrous tissues . Also, we could not find any evidence of other combined sequelae of endocarditis, such as intracardiac thrombosis, endomyocardial fibrosis or valvulopathy of other valves . Mcdonald et al.10) reported for the first time, a case of endocarditis involving the normal mitral and aortic valves in a patient with bd . Histologic examination of these valves showed mononuclear infiltration with a few polymorphonuclear leukocytes and no fibrin deposits . Madanat et al.6) reported a case of bd and endocarditis with left atrial thrombosis mimicking myxoma . Postoperative pathologic examination revealed yellowish valvulitis involving the mitral valve leaflet with deep ulcerations on the valve surface, covered by fibrinous and necrotic masses with a significant growth of granulation tissue . In other case reports of endocarditis in bd, several granulomas were found within the central portion of the vegetations and polymorphonuclear cells and lymphocytes infiltrated the small vessels near the vegetations.7) in our case, the pathologic examination showed vegetations, consisting of fibrinoid necrotic material, granulation tissue, and inflammatory cells, which were predominantly mononuclear cells . Therefore, ts was caused due to valvulitis as a possible sequelae of endocarditis in bd . As in this case, the cardiac lesions in bd might progress insidiously in the absence of concurrent signs or symptoms of bd, or they were even diagnosed at autopsy.10)11) therefore, it might be difficult to detect endocarditis in the early stage . These findings suggest that screening for cardiac involvement is required for early detection of endocarditis or other heart diseases in patients with bd.
|
Melioidosis is predominantly a tropical disease and most cases are reported during the rainy season in endemic area . It is characterized by abscess - formation in the lung, liver, spleen, skeletal muscle and prostate with the lung being the most commonly involved organ . The clinical features are variable from rapidly progressing septicemia to chronic debilitating abscess - forming disease . Understanding about melioidosis is important in tuberculosis endemic areas, because its progression and roentgenographic findings are so similar to tuberculosis that it is not rare for melioidosis to be misdiagnosed as tuberculosis . The patient was a 50-yr - old man who was diagnosed with melioidosis on bronchoscopic washing culture and whose symptoms improved after treatment with high dose ceftazidime . A 50-yr - old man visited our hospital because of intermittent fever associated with cough, sputum, generalized myalgia and general weakness for about four weeks . He had lived in indonesia for twenty years for business, and visited a local hospital in indonesia and was treated for typhoid fever without improvement of symptoms . Initial chest radiograph and computed tomography (ct) images showed multiple satellite nodules in the left lower and upper lobes, and judging from that roentgenographic examination, tuberculosis was the most probable diagnosis (fig . 1). Bronchoscopy showed no endobronchial lesion and washing cytology and culture were also negative . Three months later we rechecked chest radiograph and ct findings, and found new infiltration in the left lower lobe and improvement of lesions in the left upper and lower lobes (fig . Laboratory findings included white blood cell count of 5,240/l and hemoglobin value of 11.6 g / dl . Iga was 227 mg / dl (normal range: 90 - 400 mg / dl) and anti - neutrophilic cytoplasmic antibodies with cytoplasmic staining pattern (canca) was negative . However, secretion was seen in left lower lobe, so washing cytology and culture was done . Cytology was negative but a species of bacteria grew on blood agar media (fig . 3). It was gram - negative, non - spore forming and showed as a safety pin shaped organism on microscopic examination (fig . Api20ne strip and vitek gni card (biomerieux, inc ., hazelwood, u.s.a . ), the organism was identified as burkholderia pseudomallei (1). On dna sequencing of 16s ribosomal rna, it was compatible with b. pseudomallei with 100% homology and formed a characteristic rugose colony on blood agar . We prescribed ceftazidime 2 g intravenously every 8 hr and he did not complain of intermittent fever any more . After one week of intravenous ceftazidime, he was discharged with oral amoxicillin - clavulanate (750 mg every 8 hr). One month later the cough and sputum were almost disappeared but his general weakness persisted although it was also improving . Four months later we rechecked chest ct to show an improvement of infiltration in left lower lobe . He said his condition was as good as his previous state before suffering from melioidosis . One month later, we stopped administrating oral antibiotics to him, which resulted in him taking amoxicillin - clavulanate for total five months . The endemic area includes southeast asia, north australia, madagascar, and guam (2). In northeast thailand, melioidosis accounts for 20% of all community - acquired septicemias, and causes death in 40% of treated patients . Melioidosis was first described by whitmore in 1911 and more than 100 cases had been reported by 1917 (3). Since then, with sporadic cases being reported during and after world war ii and many soldiers fighting in vietnam suffering from this disease, western countries began to take an interest in melioidosis . B. pseudomallei is a motile aerobic, non - spore - forming and gram - negative bacillus . The colonies develop a rugose appearance, and take up crystal violet dye from the medium . Although it is gram - negative bacterium, it is usually resistant to aminoglycoside, 1st & 2nd cephalosporin, macrolide, rifamycin and colistin, but is susceptible to ampicillin / sulbactam, chloramphenicol, tetracycline, bactrim, 3rd cepha and carbapenem (4). B. pseudomallei is a soil saprophyte and can be recovered readily from water and wet soils in rice paddy fields . For example, in thailand the organism can be cultured readily from more than 50% of rice paddies (5). It presents as a febrile illness, ranging from an acute fulminant sepsis to a chronic debilitating localized infection . The lung is the most commonly affected organ, either presenting with cough and fever resulting from a primary lung abscess or pneumonia . Seeding and abscess formation can arise in any organ, and the liver, spleen, skeletal muscle and prostate are common sites . Localized pulmonary melioidosis often cannot be differentiated from tuberculosis on clinical and chest radiography findings . First, some melioidosis cases have rapid clinical and roentgenographic progression within a few days . Second, melioidosis usually responds to treatment well and has apparent roentgenographic improvement within 1 - 2 weeks . Third, parapneumonic effusion develops in 5 - 15% of cases, but the amount is not large and associated pulmonary infiltration is always present . In contrast, tuberculosis pleurisy in which a large amount of pleural fluid is present without underlying pulmonary infiltration is common . Diagnosis of melioidosis is made by isolation of b. pseudomallei from any site; for example blood, sputum, abscess fluid and throat swab . Since splenic abscess is much less common in other diseases, its presence is more likely to suggest melioidosis . The antibiotic of choice is ceftazidime (40 mg / kg intravenous injection every 8 hr), while other 3rd generation cephalosporin is less effective (9). Four - drug combination is usually recommended as oral antibiotics, and those are chloramphenicol (40 mg / kg per day in four divided doses), doxycycline (4 mg / kg per day in two divided doses), trimethoprim - sulfamethoxazole (10 mg and 50 mg / kg per day, respectively, in two divided doses). High dose ceftazidime followed by long term oral antibiotics is considered to be most effective treatment . The distribution and frequency of melioidosis is probably greatly underestimated (10). In tuberculosis endemic areas, it is important to understand melioidosis and differentiate this disease from tuberculosis because the treatment of the two diseases is completely different.
|
We used data from the third national health and nutrition examination survey (nhanes iii) mortality follow - up file (7). For this database, the national center for health statistics linked nhanes iii participants aged 17 years by probabilistic matching to the national death index to determine mortality status through the year 2000 . For a selected sample of nhanes iii records, overall, 20,042 adult nhanes iii participants were eligible for matching, of whom 3,384 were identified as deceased (7). The mean observation time between the nhanes iii survey and ascertainment of mortality status was 7.58 years (95% ci 7.177.99). The underlying cause of death was based on icd-9 codes from 1986 to 1998 and on icd-10 codes from 1999 to 2000 . Death was classified from heart disease for icd-9 codes 390398, 402, and 404429 and icd-10 codes i00i09, i11, i13, and i20i51 . Nhanes iii was conducted between 1988 and 1994 and used a stratified multistage sampling design with oversampling of mexican americans, african americans, and individuals over age 60 years . The survey consisted of multiple components including a household interview, a physical examination, and laboratory tests . Information on medical history was obtained during the household interview, and a total of 1,507 adults reported a diagnosis of diabetes . Women who reported only gestational diabetes this study was approved by the institutional review board at the va puget sound medical center . Physical activity was based on a self - report during the month before the survey . Individuals were classified as inactive if they did not report engaging in any of the following activities during the previous month: walking, jogging, bike riding, swimming, aerobics, dancing, calisthenics, gardening, lifting weights, or other physical activity outside of their occupation . Individuals were considered to fulfill national recommendations for physical activity if they reported five or more episodes per week of moderate - intensity physical activity, or three or more episodes per week of vigorous - intensity physical activity . Individuals reporting some physical activity during the preceding month but not at the recommended levels were classified as obtaining insufficient physical activity (8). Current smokers were defined as people who had smoked> 100 cigarettes during their lifetime and were still smoking . Physical examination included measuring height, weight, blood pressure, and a blood draw . A1c levels were classified as <6%, between 6 and 7%, between 7 and 8%, and 8% to correspond to recent american diabetes association treatment guidelines (1). Individuals were considered to have hypertension if they had a measured blood pressure of 140/90 mmhg or reported being told by their physician that they had high blood pressure and were on an antihypertensive medication . Bmi was calculated as the weight in kilograms divided by the squared height in meters (9). The national heart, lung and blood institute's definition for the cutoff points between normal weight (bmi 18.524.9 kg / m), overweight (bmi 2529.9 kg / m), and obese (bmi 30 kg / m) were used (9). Demographic information including age (in years), sex, race / ethnicity (white, african american, hispanic, or other), education (less than high school, high school, or more than high school), and annual income were obtained at baseline during the interview portion of nhanes iii . Each observation was weighted to account for the unequal probability of selection that resulted from the survey cluster design, nonresponse, and oversampling of certain populations . Sampling weights were used to calculate population estimates, and sampling strata and clustering within primary sampling units were accounted for to estimate variances and test for significant differences . All analyses thus took into account the complex survey design and weighted sampling probabilities and were performed using stata statistical software (release 11; stata corporation, college station, tx). We calculated hazard ratios (hrs) using cox proportional hazards regression with attained age at the time of censoring as the time scale (10,11). We divided data into three age strata (age 1750, 5165, and> 65 years). Analyses were stratified by age - group, such that stratified estimates (equal coefficients across strata but with a baseline hazard unique to each stratum) were then obtained . Participants were censored at the end of the follow - up period if they were still alive . Cox proportional hazard models were used to estimate the combined effect of risk factors associated with mortality, controlling for sociodemographic factors (annual income, race / ethnicity, sex, and education). We calculated the par% for mortality among individuals with diabetes of known risk factors, including glycemic control, hypertension, hyperlipidemia, smoking, and physical inactivity . Par% was calculated as prevalence among decedents [(hr 1)/hr] 100%, where prevalence refers to the prevalence of the risk factor among individuals who died, and the hazard ratio (hr) is a multivariable - adjusted hazard ratio for mortality (12). Par% can be interpreted as the percentage by which mortality rates could be lowered in all individuals with diabetes if the given exposure was abolished, assuming that the observed association is causal . Physical activity was based on a self - report during the month before the survey . Individuals were classified as inactive if they did not report engaging in any of the following activities during the previous month: walking, jogging, bike riding, swimming, aerobics, dancing, calisthenics, gardening, lifting weights, or other physical activity outside of their occupation . Individuals were considered to fulfill national recommendations for physical activity if they reported five or more episodes per week of moderate - intensity physical activity, or three or more episodes per week of vigorous - intensity physical activity . Individuals reporting some physical activity during the preceding month but not at the recommended levels were classified as obtaining insufficient physical activity (8). Current smokers were defined as people who had smoked> 100 cigarettes during their lifetime and were still smoking . Physical examination included measuring height, weight, blood pressure, and a blood draw . A1c levels were classified as <6%, between 6 and 7%, between 7 and 8%, and 8% to correspond to recent american diabetes association treatment guidelines (1). Individuals were considered to have hypertension if they had a measured blood pressure of 140/90 mmhg or reported being told by their physician that they had high blood pressure and were on an antihypertensive medication . Bmi was calculated as the weight in kilograms divided by the squared height in meters (9). The national heart, lung and blood institute's definition for the cutoff points between normal weight (bmi 18.524.9 kg / m), overweight (bmi 2529.9 kg / m), and obese (bmi 30 kg / m) were used (9). Demographic information including age (in years), sex, race / ethnicity (white, african american, hispanic, or other), education (less than high school, high school, or more than high school), and annual income were obtained at baseline during the interview portion of nhanes iii . Each observation was weighted to account for the unequal probability of selection that resulted from the survey cluster design, nonresponse, and oversampling of certain populations . Sampling weights were used to calculate population estimates, and sampling strata and clustering within primary sampling units were accounted for to estimate variances and test for significant differences . All analyses thus took into account the complex survey design and weighted sampling probabilities and were performed using stata statistical software (release 11; stata corporation, college station, tx). We calculated hazard ratios (hrs) using cox proportional hazards regression with attained age at the time of censoring as the time scale (10,11). We divided data into three age strata (age 1750, 5165, and> 65 years). Analyses were stratified by age - group, such that stratified estimates (equal coefficients across strata but with a baseline hazard unique to each stratum) were then obtained . Participants were censored at the end of the follow - up period if they were still alive . Cox proportional hazard models were used to estimate the combined effect of risk factors associated with mortality, controlling for sociodemographic factors (annual income, race / ethnicity, sex, and education). We calculated the par% for mortality among individuals with diabetes of known risk factors, including glycemic control, hypertension, hyperlipidemia, smoking, and physical inactivity . Par% was calculated as prevalence among decedents [(hr 1)/hr] 100%, where prevalence refers to the prevalence of the risk factor among individuals who died, and the hazard ratio (hr) is a multivariable - adjusted hazard ratio for mortality (12). Par% can be interpreted as the percentage by which mortality rates could be lowered in all individuals with diabetes if the given exposure was abolished, assuming that the observed association is causal . Overall, 1,507 adults with diabetes were eligible for mortality follow - up . For nhanes iii participants with diabetes, 865 were assumed to be alive by virtue of not being identified in the national death index, and 642 were deceased during the follow - up period . Overall, 53% of deaths were from cardiovascular disease, 17% were from cancer, and 29% were from other causes of death . The population characteristics of the sample and cumulative mortality by exposure group are displayed on table 1 . Older individuals and individuals with less education were more likely to have died in the follow - up period . Table 2 displays the results of the cox proportional hazard model for death and the par% for each risk factor . Among adults with diabetes, the hrs for all - cause mortality were significant for individuals who had an a1c 8% (hr 1.65, 95% ci 1.112.45) or reported no regular physical activity (1.58, 1.242.02) or current tobacco use (1.77, 1.152.73). 8%, 16.4% for no regular physical activity, and 7.5% for current tobacco use . Population characteristics and cumulative mortality of individuals with diabetes in nhanes iii proportional hazards analysis results from all - cause mortality: nhanes iii mortality follow - up par% = prevalence among decedents [(hr 1)/hr]. In this nationally representative sample of individuals with diabetes, we found three statistically significant risk factors for all - cause mortality . We estimate that mortality rates could be decreased by 15.3, 16.4, and 7.5%, respectively, if the following risk factors were eliminated: having an a1c of 8%, physical inactivity, or current smoking . There is evidence from several observational studies that higher levels of physical activity confer protection against premature coronary disease and early mortality . In a study using the nhanes mortality data, rask et al . (5) also showed a similar effect of smoking and physical inactivity on mortality . This study did not focus specifically on individuals with diabetes or present par% (5). In a study of women with diabetes, the age - adjusted relative risk for cardiovascular disease was 0.54 (95% ci 0.390.76) for women who performed 4 h of moderate or vigorous exercise per week (14). Wei et al . (15) reported that the relative risk of mortality was 1.7 (95% ci 1.22.3) in 1,263 men with diabetes with low levels of physical activity followed on average for 12 years . In a national study, u.s . Adults with diabetes who walked at least 2 h / week had a 39% lower all - cause mortality (16). Previous studies have shown that cigarette smoking is strongly associated with an increased risk of coronary heart disease among individuals with diabetes, even more so than individuals without diabetes, and quitting smoking decreases this excess risk substantially (17). Our results are consistent with other studies that have identified a protective effect of moderate glucose control (3,18). (3) used nhanes iii data to examine a1c level and subsequent mortality among adults in the u.s . These authors reported that among individuals with diabetes, having an a1c of 8% was associated with higher all - cause mortality risk (hr 1.68, 95% ci 1.032.74), compared with adults with an a1c of <6%, which is similar to our findings . However, this study did not examine the effect of physical activity or present population - attributable risks (3). Despite clinical trial data to support blood pressure and lipid control among individuals with diabetes (19,20), these factors were not significant in our study, although the hazard ratios were in the expected direction . These nonstatistically significant findings may be a result of insufficient power in the current study . In addition, since nhanes iii data were collected, the complexity of care for individuals with diabetes has increased, including the use of antihypertensive and antilipemic agents (21). Our results are consistent with older hnanes data from 1982 to 1984 on risk factors for mortality from all causes and from coronary heart disease among individuals with diabetes (4). This study reported that age, male sex, severe overweight (defined as a bmi 31.1 kg / m for men and 32.3 kg / m for women), and nonleisure time physical inactivity were associated with coronary heart disease mortality among persons with diabetes . Neither cholesterol nor hypertension were found to be associated with coronary heart disease mortality in this population of individuals with diabetes (4). Limitations of our study include the potential biases introduced by the self - report of health conditions and level of physical activity . Because we do not know the actual duration of physical activity and do not have information on nonleisure physical activity, total activity levels may be underestimated . In addition, estimates of par% from observational data make an implicit assumption of causality: that abolishing exposure would, in fact, reduce risk to the level observed among unexposed individuals . We could also over- or underestimate par% because of the assumption that the prevalence of other risk factors would remain the same if one of them were changed (22). In practice, a particular intervention aimed at one risk factor could alter population levels of other risk factors, either favorably or unfavorably . Par% also assumes that the other risk factors not included in our regression model are uncorrelated with the target exposure; in fact, risk factors may cluster within people . Unlike measures of association such as relative risk, par% depends on both the strength of the association between the exposure and disease and the prevalence of the exposure in the population (6). In contrast, the relative risk offers a measure of the strength of association between the risk (e.g., degree of hyperglycemia) and mortality for the average individual . Par% can assess the potential benefit to be gained for a population rather than for individual - level interventions . In conclusion, we found significant associations between physical inactivity, smoking and poor glycemic control, and all - cause mortality among individuals with diabetes . Previous reports have demonstrated poor adherence to physical activity recommendations by individuals with diabetes (23) and low rates of physical activity and smoking cessation counseling by physicians (21). Clinicians and health systems may consider prioritizing their care to include avoidance of tobacco and increasing physical activity levels among all patients with diabetes (24). Population - based programs (e.g., quality improvement efforts) for individuals with diabetes may consider prioritizing these areas, especially given limited improvements in mortality rates among individuals with diabetes over the past 2 decades (25).
|
A single dna molecule is a long chain of nucleotides (base pairs). There are four such nucleotides which are represented by the set of symbols {a, t, g, c}. It is generally accepted that genomes of two humans are almost 99% identical at dna level . However, at certain specific sites, variation is observed across the human population which is commonly known as single nucleotide polymorphism and abbreviated as snp . The nucleotide involved in a snp site is called allele . If a snp site can have only two nucleotides, it is called biallelic . If it can have more than two alleles it is called a multiallelic snp . From now on, we will consider the simplest case where only bi - allelic snps occur in a specific pair of dna . The single nucleotide polymorphism (snp) is believed to be the most widespread form of genetic variation . The sequence of all snps in a given chromosome is called haplotype . Haplotyping an individual deals with determining a pair of haplotypes, one for each copy of a given chromosome . This pair of haplotypes completely define the snp fingerprints of an individual for a specific pair of chromosomes . Given the two sequences of bases, haplotyping is straight forward and just needs to iterate through both the sequences and remove all the common alleles from them . But haplotyping becomes difficult when we want to construct haplotypes from sequencing data for higher reliability . Sequencing data for a genome does not contain the complete sequences of bases for a specific chromosome, rather it provides a set of fragments of arbitrary length for the whole genome . Therefore, the actual problem of haplotyping is to find two haplotypes from the set of overlapping fragments of both the chromosomes, where fragments might contain errors and it is not known which copy of the chromosome a particular fragment belongs to . The problem of haplotyping has been studied extensively . The general minimum error correction (mec) problem was proved to be np - hard . It was also proved to be np - hard even if the snp matrix is gapless using a reduction from the max - cut problem . Hapcut and refhap are two of the most accurate algorithms in this regard . In this paper, we give a heuristic algorithm for individual haplotyping based on minimum error correction . The complexity of each iteration is o(mk) for an snp matrix of dimension (m, k). The algorithm is inspired from the famous fiduccia and mattheyses (fm) algorithm for bipartitioning a hypergraph minimizing the cut size . Extensive simulations indicate that hmec outperforms the genetic algorithms of wang et al . In terms of both reconstruction rate and running time, and it has better (in most cases) or comparable accuracy and significantly smaller running time than that of hapcut, which is the most accurate heuristic algorithm available . We also compared hmec with some other algorithms such as speedhap, fasthare, mlf, 2 distance mec, and shr-3 using the hapmap - based instance generator and comparison framework [14, 15]. The rest of the paper is organized as follows . In section 2, we present some definitions and preliminary ideas . In section 3, we report on an extensive performance study evaluating hmec with other available techniques in section 5 . Let f be the set of m fragments produced from two copies of the chromosome . Each fragment contains information of nonzero number of snps in s. because the snps are bi - allelic, let the two possible alleles for each snp site be 0 and 1, where they can be any two elements of the set {a, t, g, c}. Since all the nucleotides are the same at the sites other than snp sites, we can remove these extraneous sites from all the fragments and consider the fragments as the sequences of the snp sites only . Thus each fragment f f is a string of symbols {0,1,} of length k where all the fragments can be arranged in an m k matrix m = {mij}, i = 1,, m, j = 1, k, where row i is a fragment from f and column j is a snp from s. this matrix is called the snp matrix as follows (1)|110100011101011101001001110100010101101010110101101011| the consecutive sequence of s that lies between two nonhole symbols is called a gap . A gapless snp matrix is the one that has no gap in any of the fragments . In (1), the first, second, and third rows have no gaps while each of the fourth and sixth rows has one gap ., mm can be viewed as an ordered set of m fragments where a fragment mi = mi1, mi2,, mik is an ordered set of k alleles . A fragment mi is called to cover the jth snp if mij {0,1} and called to skip the jth snp if mij = . Let ms and mt be two fragments . The distance between two fragments, d(ms, mt), is defined as the number of snps that are covered by both of the fragments and have different alleles . Hence, (2)d(ms, mt)=j=1kd(msj, mtj), where d(x, y) is defined as (3)d(x, y)={1,if x and y and xy;0,otherwise . In (1), the distance between the second and the third fragment is two, as they differ in the seventh and ninth snp sites (columns). Two fragments ms and mt are said to be conflicting if d(ms, mt)> 0 . Let p(c1, c2) be a partition of m, where c1 and c2 are two sets of fragments taken from m so that c1c2 = m and c1c2 = . In figure 1(b), an arbitrary partition corresponding to the snp matrix of figure 1(a) is shown . A snp matrix m is an error - free matrix if and only if there exists a partition p(c1, c2) of m such that for any two fragments x, y ci, i {1,2}, x and y are non - conflicting, that is, d(x, y) = 0 . The partition in the figure 1(b) is not error free since d(m1, m2)> 0 in c1 and d(m5, m6)> 0 in c2 . For an error - free snp matrix, a haplotype hi, i {1,2} is constructed from its corresponding fragment class ci using the following formula: (4)hij={1,if at least one fragment in ci has a 1 in jth snp;0,if at least one fragment in ci has a 0 in jth snp;,if all the fragments in ci skips jth snp; where ci is called the defining class of haplotype hi, and hij, where i {1,2} and j = 1, k, denotes the jth element of the haplotype hi . If a matrix m is not error - free, there will be no error - free partition p. for such a matrix m, there will be at least one conflicting pair of fragments in each of the classes for all possible partitions . Therefore it is impossible to construct a haplotype that is non - conflicting with all the fragments in its defining class of fragments . If we are given a partition p(c1, c2) and two haplotypes h1 and h2 constructed from p then the number of errors e(p) that needs to be corrected can be calculated by the following formula: (5)e(p)=i=12fcid(f, hi). The mec problem asks to find a partition p that minimizes the error function e(p) over all such partitions of an snp matrix m. in this section, we give our heuristic algorithm based on minimum error correction which we call hmec . Construction of a haplotype from an erroneous class c requires correction of snp values, that is, alleles, in the fragments . Therefore, for each snp site, the haplotype should take the allele that is present in the majority of the fragments . Let nj(c) be the number of fragments of a collection c that have 0 in the jth snp . Therefore, to minimize the number of errors e(p) for a specific partition p, the haplotype should be constructed according to the following methodology: (6)hij={1,if nj1(ci)>nj0(ci);0,if nj0(ci)nj1(ci) and nj0(ci)0;,if nj1(ci)=nj0(ci)=0; where i {1,2} and j = 1,2,, k. in figure 1(c), two haplotypes h1 and h2, associated with the partition p in figure 1(b), are constructed in this way . This algorithm starts with a current partition pc = p(m,) and iteratively searches a better partition . In each iteration, the algorithm performs a sequence of transfer of fragments from their present collection to the other one so that the partition becomes less erroneous . The transfer of a fragment from one collection to the other can increase or decrease the error function e(p). Let the partition before transferring a fragment f be pp and the partition resulted is pn . We define the gain of the transfer as gain(f) = e(pp) e(pn)., m} be an ordering of all the fragments in a partition p in such a way that fragment fi will precede fragment fj if all the fragments before fi in f have already been transferred to form an intermediate partition pi and gain(fi) gain(fj) over pi . We also define the cumulative gain of a fragment ordering f up to the nth fragment as cgain(f, n) = i=1gain(fi). Here gain(fi) = e(pi) e(pi+1). The maximum cumulative gain, mcgain(f), the algorithm finds the current ordering fc of pc and transfers only those fragments of fc that can achieve the mcgain(fc) and the fragment that is the last to be transferred is referred as fmax . Thus the algorithm moves from one partition to another reducing the error function by an amount of mcgain(fc). The algorithm continues as long as mcgain(fc)> 0 and stops whenever mcgain(fc) 0 . First, to find fc in each iteration, the algorithm repeatedly transfers the fragment that is not transferred previously in this iteration and has maximum gain over all such fragments . To accomplish this, we use a locking mechanism . At the beginning of each iteration, all the fragments are set free . The free fragment with maximum gain is found out and tentatively transferred to the other collection . The algorithm then finds the next free fragment with maximum gain in p1 and transfer and lock that fragment to create the p2 . Thus, free fragments are transferred until all the fragments are locked and the order of the transfer (fc) is stored in the log table along with the cumulative gains (cgain). Mcgain is the maximum cgain and fmax is the fragment corresponding to mcgain in the log table . After finishing all such tentative transfers, current partition of the next iteration, the algorithm checks the log to find the mcgain(fc) and fmax, and rollback the transfer of all the fragments that were transferred after fmax . While tentatively transferring a free fragment, the algorithm needs to find the fragment with maximum gain among the free fragments (which are not yet transferred). = e(pp) e(pn) for a fragment, we need to calculate two error values of two different partitions: the present intermediate partition and the next partition which will be resulted if f is transferred . Each of these error function requires calculation of two new haplotypes from their corresponding collections (see figure 2). Although e(pp) and the haplotypes of pp can be found from the previous transfer, calculation of e(pn) requires construction of haplotypes of pn . Since, the difference between pp and pn is only one transfer, we can introduce differential calculation of haplotypes hi, i {1,2} of next partition from the haplotypes of hi, i {1,2} of present partition . For this purpose, the algorithm stores nj(ci) and nj(ci) values of the present partition . After a transfer these values will either remain same or be incremented or decremented by 1 . That is why it is now possible to construct hi, i {1,2} in o(k) time . To compute e(pn) from the haplotypes requires o(mk) time . Thus running time to compute the e(pn) as well as to compute gain(f) is o(mk + k). For each intermediate partition pi, i = 1,, n, we need to compute gain measures for m i unlocked fragments to find the maximum one . The transfer of this fragments requires updating of nj(ci) and nj(ci), i {1,2} and j = 1,2, finally, there will be m such transfer in each iteration and maximum m rollbacks . Thus each iteration will require o(m(m(mk + k) + k) + mk) ~ o(mk) running time . We consider that the current partition pc = p1 is the partition given in figure 1(b) for the snp matrix m of figure 1(a). All the intermediate partitions pi, i {1,, 7} are shown sequentially and the gains of each fragment over the intermediate partitions are shown on the right of each partition . For example, the fragment with the maximum gain in p2 is fragment 6 which has gain two . After each transfer,, the ordering fc of the fragments is 2,6, 5,1, 4,3 which is also the order of locking of the fragments . All the tentative transfers after fmax have to be rolled back so that the p3 becomes the next pc . We now give an approximate gain measure to make our algorithm faster . For large snp matrix, we can use an approximation in the calculation of the gain(f) by using only the fragment f and not using the m 1 other fragments . Hi is the haplotype of f's present collection ci of partition pp, and hj is the haplotype of f's next collection cj of partition pn . This function ignores the effect of fragments other than f on gain(f), but reduces the run time of gain calculation to o(k). In this section, we demonstrate the performance of our algorithm using both real biological and simulated datasets . We compared our algorithm with gmec and hapcut . We performed the simulation using the data from angiotensin - converting enzyme (ace) and public daly set to compare with gmec, and used the huref data to compare with hapcut . We also compared hmec with some other algorithms (speedhap, fasthare, mlf, 2 distance mec, shr-3) using rehap website interface, which is an hapmap - based instance generator and comparison framework . In this section, we compare the performance of our algorithm with the genetic algorithm, which we call gmec, described in . We first sample the original haplotype pair into many fragments with different coverage and error rates . Coverage rate indicates the percentage of the total columns of the snp matrix that have been sampled out . We varied the error rate while number of fragments and coverage rate were kept constant . Also, coverage was varied while number of fragments and error rate were kept constant . Notice that the way we introduced error and controlled the coverage rate is not necessarily same as that of . Therefore, the reconstruction rates of the branch and bound algorithm described in, which is an exact algorithm, should not be compared with those of hmec . Angiotensin - converting enzyme catalyses the conversion of angiotensin i to the physiologically active peptide angiotensin ii, which controls fluid - electrolyte balance and systematic blood pressure . Because it has a key function in the renin - angiotensin system, many association studies have been performed with dcp1 (encode angiotensin - converting anzyme). Completed the genomic sequencing of the dcp1 gene from 11 individuals and reported 78 snp sites in 22 chromosomes . We generate 50 fragments from each of these haplotype pairs with varying coverage and error rate . We perform the simulation for three different coverage rates (25%, 50%, and 75%). For each of these coverage rates, we perform our simulation for different error rates such as 5%, 10%, 15%, 20%, 25%, 30%, and 50% . In every case figure 5 illustrates the comparison that bears the clear testimony to the superiority of our algorithm . For most instances, the reconstruction rate achieved by our algorithm is 100% or greater than 98% . Only for a few cases with very high error rate and low coverage value we also perform the experiment for different coverage rates while keeping the error rate constant . Also, our algorithm clearly outperforms the genetic algorithm except for very low coverage value (which is unrealistic). In this section, daly et al . Reported a high - resolution analysis of a haplotype structure across 500 kb on chromosome 5q31 using 103 snps in a european derived population which consists of 129 trios [18, 20]. We performed the experiment exactly in the same way that we did for angiotensin - converting enzyme . Experimental results suggest that hmec is much better than the genetic algorithm . Again, for most cases, the reconstruction rate achieved by our algorithm is 100% or greater than 98% . For every instance one of the very important advantages of our algorithm is that it takes very short time to reconstruct the haplotypes ., we perform the simulation by varying the length (length denotes the number of snp sites in the haplotype pair) of the haplotypes while fixed the value of the coverage rate and the error rate at 50% . Since haplotypes with such varying lengths are not available, we rely on the simulated data . Clearly, hmec is much faster than gmec . For example, while hmec can reconstruct a haplotype with 936 sites in a fraction of a second, gmec takes 72 seconds . It computes max - cut on the graph to find the position to flip and iterates until no improvement in mec score is achieved . Experimental results suggest that although hapcut is reliable, its running time is too large to be a realistic choice for whole genome haplotyping . We used the filtered huref data from levy et al . To evaluate the performance . We generated several test data sets varying the coverage and error rate, and tested the performance of hmec and hapcut on these data sets . Experimental results indicate that the reconstruction rates of both hapcut and hmec are reasonably good . Notice that hapcut is only better than hmec for very low (and thus unrealistic) coverage values (5% and 10% coverage). Furthermore, hapcut is significantly slower than hmec . For an instance, with 35% coverage and 40% error rate, hapcut takes 215.5 seconds where hmec takes only a fraction of a second (see table 5). Therefore, although generally hapcut provides reliable reconstruction rate, on large dataset, it is an unrealistic choice due to its time consuming operations . On the other hand we created the allele matrix from the rehap error matrix and fed the matrix to both hmec and hapcut algorithms . Hmec consistently produces higher reconstruction rate than hapcut (see table 6). Also, the running time of hmec is clearly much better than hapcut . We also compared hmec with some other well - known algorithms such as speedhap, fasthare, mlf, 2 distance mec, and shr-3 using hapmap - based instance generator and comparison framework [14, 15]. The results are shown in table 7 and table 8 that suggest that no single method clearly outperforms the others in all cases . However, reconstruction rates achieved by hmec are the highest or very close to the highest . This bears a clear testimony to its suitability as a practical tool for individual haplotyping . In this paper, we present a heuristic algorithm (hmec) based on minimum error correction that computes highly accurate haplotypes significantly faster than the known algorithms for haplotyping . The algorithm is inspired from the famous fiduccia and mattheyses (fm) algorithm for bipartitioning a hyper graph minimizing the cut size . We report on an extensive performance study evaluating our approach with other available techniques using both real and simulated datasets . Comprehensive performance study shows that our algorithm outperforms (in most cases) or matches the accuracy of other well - known methods, but runs in a fraction of the time needed for other techniques . High accuracy and very fast running time make our technique suitable for genome - wide scale data . For example, small groups of fragments that are declared to be in the same haplotype can be identified . Probabilistic methods like expectation maximization (em) also deserve some consideration over such optimization problems . In the near future
|
A 74-year - old man startled his dog and sustained a penetrating bite to his hand . A few days later, the patient developed fever, chills and weakness, resulting in a fall . Significant comorbidities included chronic obstructive pulmonary disease, hypertension, dyslipidemia and idiopathic dilated cardiomyopathy, grade 3 left ventricle . Physical examination revealed a temperature of 40c, with bronchial breath sounds and crackles heard in the left chest; the bite wound appeared improved . Blood cultures grew coagulase - negative staphylococcus, which was considered to be a contaminant, and gram - negative coccobacilli were later determined to be pasteurella dagmatis . Treatment was initiated with oral azithromycin 500 mg per day and intravenous ceftriaxone 1 g every 24 h for five days . Two sets of blood cultures were drawn 5 h arpart from the patient on the day of admission using bd bactec plus aerobic / f and anaerobic / f bottles (becton, dickinson and company, canada). Three bottles produced gram - negative coccobacilli with beaded ends in 14 h to 34 h, and one anaerobic / f bottle also produced gram - positive cocci in clusters, which were subsequently identified as coagulase - negative staphylococci; this organism was considered to be a contaminant . The subcultures on blood agar plates produced tiny grey - brown creamy colonies, which did not grow on macconkey agar . The gram - negative coccobacilli were initially identified as pasturella pneumotropica by the vitek 2 system, software version 06.01 (biomerieux, france) using the gn card, with bionumber 0001010210040001 and an excellent identification (probability 99%). Unusual bacteria such as this are routinely sent to the local reference laboratory (public health ontario, toronto, ontario) for confirmation of identification and susceptibility testing . The susceptibility profile of the bacterium was interpreted by clsi m45-a2 (1) (table 1).the biochemical characteristics (table 2), 16s ribosomal rna (rrna) gene polymerase chain reaction (pcr) and sequencing (below), as well as matrix - assisted laser desorption / ionization time - of - flight mass spectrometry (maldi - tof ms) were used for identification of the bacterium . Traditional biochemical testing was performed on the isolate and based on its profile was determined to be p dagmatis (2) (table 2). Because this organism is not often encountered, alternate identification methods were also used to ensure a correct identification . A 736-base pair amplicon was generated (primers, forward: 5agtttgatcctggctcag3; reverse: 5 ggactaccagggtatctaat3) and sequenced using routine methods (3). The sequence was analyzed using national center for biotechnology information basic local alignment search tool (4) and results were interpreted using clsi mm18-a guidelines (5). The pcr product was 99% similar to six deposits within the nr / nt database with 99% to 100% coverage . Sequences with high levels of homology to the query sequence included the type strain of p dagmatis, atcc 43325/ccug 12397 (99%; nr_042883.1 and m75051.1) and the type strain of pasteurella stomatis, ccug 17979 (99%; nr_042888.1). Based on clsi mm18-a interpretation guidelines (5), due to the low level of demarcation of the sequence of the 16s rrna gene between these species, the unknown bacteria may only be identified as p dagmatis or p stomatis . However, based on the biochemical profile (table 2), this organism could not be p stomatis (which is urease and maltose negative, because the organism in question is urease and maltose positive); therefore, in the present case, the identification of the organism was p dagmatis . Two sets of blood cultures were drawn 5 h arpart from the patient on the day of admission using bd bactec plus aerobic / f and anaerobic / f bottles (becton, dickinson and company, canada). Three bottles produced gram - negative coccobacilli with beaded ends in 14 h to 34 h, and one anaerobic / f bottle also produced gram - positive cocci in clusters, which were subsequently identified as coagulase - negative staphylococci; this organism was considered to be a contaminant . The subcultures on blood agar plates produced tiny grey - brown creamy colonies, which did not grow on macconkey agar . The gram - negative coccobacilli were initially identified as pasturella pneumotropica by the vitek 2 system, software version 06.01 (biomerieux, france) using the gn card, with bionumber 0001010210040001 and an excellent identification (probability 99%). Unusual bacteria such as this are routinely sent to the local reference laboratory (public health ontario, toronto, ontario) for confirmation of identification and susceptibility testing . The susceptibility profile of the bacterium was interpreted by clsi m45-a2 (1) (table 1).the biochemical characteristics (table 2), 16s ribosomal rna (rrna) gene polymerase chain reaction (pcr) and sequencing (below), as well as matrix - assisted laser desorption / ionization time - of - flight mass spectrometry (maldi - tof ms) were used for identification of the bacterium . Traditional biochemical testing was performed on the isolate and based on its profile was determined to be p dagmatis (2) (table 2). Because this organism is not often encountered, alternate identification methods were also used to ensure a correct identification . A 736-base pair amplicon was generated (primers, forward: 5agtttgatcctggctcag3; reverse: 5 ggactaccagggtatctaat3) and sequenced using routine methods (3). The sequence was analyzed using national center for biotechnology information basic local alignment search tool (4) and results were interpreted using clsi mm18-a guidelines (5). The pcr product was 99% similar to six deposits within the nr / nt database with 99% to 100% coverage . Sequences with high levels of homology to the query sequence included the type strain of p dagmatis, atcc 43325/ccug 12397 (99%; nr_042883.1 and m75051.1) and the type strain of pasteurella stomatis, ccug 17979 (99%; nr_042888.1). Based on clsi mm18-a interpretation guidelines (5), due to the low level of demarcation of the sequence of the 16s rrna gene between these species, the unknown bacteria may only be identified as p dagmatis or p stomatis . However, based on the biochemical profile (table 2), this organism could not be p stomatis (which is urease and maltose negative, because the organism in question is urease and maltose positive); therefore, in the present case, the identification of the organism was p dagmatis . Single colonies of fresh organisms grown overnight were prepared using a modified formic acid extraction procedure and analyzed using the bruker maldi biotyper (bruker daltonics, germany) in duplicate using standard settings . The query spectra had a high level of similarity> 2.0 (2.0 is an acceptable score for species - level identification) to p dagmatis spectra within the routine commercial database . The top five matches were to spectra from different strains of p dagmatis within the commercial database . It is a gram - negative coccobacillus belonging to the pasteurellaceae family, which is fermentative, aerobic, nonmotile, oxidase positive and penicillin - sensitive . This organism has been isolated from both dogs and cats as normal flora, and also reported as a pathogen in human infections . It was previously labeled as pasteurella gas, pasteurella new species 1 or p pneumotropica type henriksen, and was eventually reclassified as p dagmatis (6). Bacteria from the pasteurellaceae family cause zoonotic infections in humans, with p multocida and p canis being the most common pasturella species reported in human infections (7,8). Infections caused by pasteurella species are typically introduced by animals, particularly cat or dog bites, but also occasionally by other animals, and often manifest as skin or soft tissue infections (79). Sometimes, animal contact is not prominent in the initial patient history (10,11) (table 3). The most probable route of transmission of p dagmatis infection in the present case was most likely the bite and licking of the patient s traumatized skin by his dog, as has been previously described (11,12). Continuous shedding of p dagmatis from asymptomatic animals (eg, in dog urine) and whether it can be an indirect route of infection to human remains to be investigated . While pasteurella species are well recognized for causing skin or soft tissue infections, p dagmatis can also cause more serious disease, including infective and prosthetic valve endocarditis (10,14,15), septicemia (11,12,16), peritonitis (17), vertebral osteomyelitis (18,19), chronic bronchiectasis (20) and pneumonia (21), mainly in immunocompromised patients . A small number of case reports describing systemic human p dagmatis infections are listed in table 3 . Interestingly, while pasturella species infrequently cause systemic infectious disease, in our review of the literature, when p dagmatis infections are reported, they appear to be frequently associated with severe disseminated infection including bacteremia . Coinfections of p dagmatis with another pasturella species have also been observed (9,12,22); therefore, it is important for the laboratory to test multiple morphotypes from the plate to ensure that> 1 pasturella species is not present . Similar to other pasturella species, p dagmatis is typically highly susceptible to many antibiotics, particularly, the beta - lactams (table 1). Early suspicion and timely laboratory diagnosis of pasturella infection are crucial for a favourable clinical outcome . Several reports have demonstrated that the vitek 2 gn card misidentifies p dagmatis as p pneumotropica or p canis, despite an excellent identification probability (9,15,23,24). This is most likely because p dagmatis has not been included in the system database; as well, there has been a nomenclature change because p dagmatis was formerly grouped with p pneumotropica, type henriksen . In a study that included 66 clinical pasturella isolates and used soda gene sequencing as a reference method, zangenah et al (24) revealed that vitek 2 only identified approximately 50% of pasturella isolates correctly, while conventional biochemical tests and maldi - tof ms were able to correctly identify 94% and 89%, respectively . Interestingly, in the zangenah et al (24) study, two p dagmatis isolates were not identified by vitek ms maldi - tof (biomerieux, france) and this limitation was also observed in our study (data not shown). The biological and genetic profiles among p dagmatis, p pneumotropica and p stomatis are very similar (table 2); both a commercial biochemical identification system and the sequence analysis of a portion of the 16s rrna gene were unable to differentiate between these species . Correct identification was made using maldi - tof ms (maldi biotyper, bruker, germany) and was also supported by comparing the key biochemical characteristics among p dagmatis, p pneumotropica and p stomatis (table 2). It is probable that many clinical isolates of p dagmatis have been misidentified due to the limitation of commercial biochemical identification systems, such as vitek 2 . Misidentification may have contributed to an underestimation of the frequency of this organism in clinical samples; however, the growing use of maldi - tof ms systems for microorganism identification in routine clinical microbiology laboratories may allow for a more accurate picture of how frequently p dagmatis causes infections . Correct identification is important for diagnosis and therapeutic management, and epidemiological monitoring of the transmission of pasturella species, particularly for the systemic infections such as in the present case . Unfortunately, most routine methods available at hospital laboratories cannot identify the organism correctly . P dagmatis can cause severe animal - associated infections in humans, mainly in immunocompromised individuals . To our knowledge, this is the first systemic p dagmatis infection reported in canada . Clinical outcomes rely on early accurate laboratory confirmation and timely administration of effective antibiotic treatment . Conventional identification of p dagmatis using vitek 2 can be misleading, probably due to the absence of this organism from the database; 16s rrna gene sequence analysis and maldi - tof ms systems represent excellent options for identifying rarely encountered or difficult to identify organisms, such as members of the pasturellaceae family . The present study re - emphasizes the need for continuously improving the database of automatic microbial identification systems.
|
Rhabdomyolysis is characterized by muscle necrosis and the release of intracellular muscle contents into the systemic circulation . The spectrum of the syndrome ranges from asymptomatic serum muscle enzymes elevation to life - threatening extreme enzyme elevations, electrolyte imbalances, and acute renal failure . We report an elderly lady with a combination of risk factors who developed rhabdomyolytic acute renal failure . A 65-year - old lady was suffering from type 2 diabetes for the past 30 years, hypertension for the past 20 years, and coronary heart disease for the past 10 years . The medications included clopidogrel 75 mg / day, amlodipine 10 mg / day, frusemide 40 mg bds, and insulin . A week before presenting to us, a cardiologist had added atorvastatin 10 mg / day to her prescription . She presented to us with complaints of severe generalized myalgia, difficulty in assuming upright posture from sitting position, and difficulty in walking of 1 week duration . She also complained of swelling of feet, face, nausea, loss of appetite and noticed decreased urine output, and reddish discoloration to urine for the last 3 days . There was no fever, history of trauma, viral exanthem, severe exercise, seizure, uncontrolled blood glucose, and use of herbal medication preceding the illness . On examination, she was well - built and well - nourished, and had pedal edema and facial puffiness . She was afebrile with pulse rate of 60 beats per min and blood pressure of 160/90 mm hg . Neurological examination showed 2/5 power in all four limbs, absent deep tendon reflexes, and muscle tenderness with no sensory involvement . Urinalysis showed glucose 2 +, ketone bodies negative, blood positive, red blood cells nil, and white blood cells 1 - 2/hpf . Her hemoglobin was 11.4 g / dl, total leukocyte count 18, 300 per mm, platelet count 5.0 lakh per mm, esr 20 mm after 1 h, electrocardiogram showed tall peaked and widened t waves with proximal limb steeper than distal limb, and the chest radiograph was normal . Ultrasound abdomen showed right kidney 9.3 3.7 cm and left kidney 9.2 3.2 cm . The urine and blood cultures were sterile, hiv, hbsag, anti - hcv antibodies, anti - hav igm, and anti - hev igm were negative . Myalagia, reddish discoloration to urine, deterioration of renal function, elevated sgot, creatinine kinase, and increased urine myoglobin led to the diagnosis of rhabdomyolysis . Levothyroxine replacement was initiated at a dose of 50 g / day, increased after 15 days to 100 g / day . The following three risk factors for the onset of rhabdomyolysis were identified: use of statin, undiagnosed hypothyroidism, and co - administration of amlodipine and clopidogrel . Frusemide was stopped as she had hypokalemia before the onset of illness which was again a risk factor for rhabdomyolysis . After seven sessions of hemodialysis the urine output improved and serum creatinine stabilized at 3.2 mg / dl . However, it is difficult to directly compare the incidence of statin myopathy in clinical trials with real world clinical practice given the inconsistent definitions . The common risk factors for the development of a statin - induced myopathy include high dosages, increasing age, female sex, renal and hepatic insufficiency, diabetes mellitus and concomitant therapy with fibrates, cyclosporine, macrolide antibiotics, warfarin, and digoxin . Individual statins differ in their risk of inducing rhabdomyolysis, with some patients developing this syndrome when switching from one statin to another . It is probable that genetic factors play a role in the pathogenesis of this syndrome . The temporal relation between statin therapy and the onset or resolution of myopathy is not fully defined . A retrospective study of 45 patients with statin myopathy at a tertiary center revealed a mean therapy duration of 6.3 months before symptom onset and a mean duration of 2.3 months for symptom resolution after discontinuation of statin therapy . Patients in primo study developed muscle symptoms after a median of 1 month after initiation of statin therapy, ranging up to 12 months after initiation . Hypothyroidism was reported as a predictor of statin - associated myopathy (or 1.71; ci, 1.10 - 2.65) in primo study . The likely mechanisms of renal impairment in hypothyroidism are the reduction in glomerular filtration rate due to the lower cardiac output and renal blood flow, thyroxine may mediate tubular secretion of creatinine, hypothyroidism may increase creatinine release from muscle, and rhabdomyolysis . It is possible for two different substrates of the same metabolizing enzyme to compete for catalytic sites on the same enzyme; through competitive inhibition, one substrate may gain access to these sites whereas the other is excluded . This process results in metabolism of the drug that successfully accesses the catalytic sites of the enzyme, whereas the excluded drug is metabolized at a significantly slower rate . In the present patient the present patient provided a caution that hypothyroidism and interaction with other drugs should be considered when patients were going to be initiated on statins.
|
Breast cancer is the most common cancer and leading cause of cancer death among women worldwide.1 among danish women, breast cancer accounted for 29% of all incident cancers, and was the cause of 16% of all cancer deaths among women during the period 19992006.2 to improve survival of danish patients with breast cancer, nationwide biannual mammographic screening was introduced in 2007 and offered to women between 50 and 69 years of age.3 cancer stage is an important predictor of prognosis, with 5-year survival of 98% for localized breast cancer decreasing to 27% for metastatic disease.4 therefore, analyses of temporal changes in stage - specific incidence and mortality from breast cancer are important for evaluating the effectiveness of early detection and treatment programs . Cancer registries are valuable resources for monitoring cancer incidence and survival . The danish cancer registry (dcr) has recorded incident cases of cancer on a nationwide basis since 1943 and has been shown to have accurate and almost complete ascertainment of cancer cases . The international classification of disease revision 7 (icd-7) was used until 2003 to categorize cancer sites, and has been converted to the international classification of disease revision 10 (icd-10).5,6 the dcr includes information on diagnosis, cancer type, topography, morphology, and stage according to the tumor, node, metastasis (tnm) classification.7 information on tnm classification may be prone to underreporting and misclassification, eg, of tumor size (t) and lymph node (n) status.8 missing information may potentially lead to biased results, if the missing information is not random . Thus, to draw valid inferences from stage - specific analysis, completeness needs to be quantified . Currently, there is a lack of studies on completeness of tnm classification in the dcr . Therefore, we conducted this study to evaluate completeness of tnm classification for breast cancer . In addition, we aimed to determine whether the completeness varied by gender, patient age, calendar period, cancer stage, or level of comorbidity . All residents are provided with free, tax - supported medical care . Since 1968, the danish civil registration system has assigned a unique 10-digit personal identification number to all danish residents,9 encoding date of birth and gender . This number is used in all danish registers, allowing unambiguous individual - level data linkage . From the dcr, we identified all patients with a primary diagnosis of invasive breast cancer (icd-10 code c50) between 2004 and 2009.5,6 tumor stage was recorded as local, regional, or distant in the dcr until 2003.5 since 2004, stage has been recorded using the tnm classification.7 from the dcr, we also obtained information on date of diagnosis, age, and gender . Data on the presence of comorbidity were obtained from the danish national patient registry (dnpr).10 this registry contains data on all admissions to nonpsychiatric hospitals in denmark since 1977 and outpatient contacts since 1995, including the personal identification number, date of admission / contact and discharge, and diagnosis codes (icd-10 from 1994 and onwards). We defined pre - existing comorbidity using the charlson comorbidity index (cci), based on hospital diagnoses within 10 years preceding the date of breast cancer diagnosis . The cci is based on disease categories which are each weighted according to the adjusted risk of one - year mortality.11 excluding breast cancer, we defined the level of comorbidity as low (cci score 0), medium (cci score 12), and high (ccc score 3). We calculated the completeness and corresponding 95% confidence intervals, of the tnm registration overall, by each component individually (ie, t, n, and m), and according to the stage categories (see appendix). To reduce the prevalence of patients with breast cancer of unknown stage, we converted the tnm classification into summary staging using an algorithm that allowed categorization of tumors with certain missing tnm stage components into localized, regional, distant, and unknown stage (see appendix). Missing data were allowed if the information available on other t, n, or m components provided sufficient and meaningful information to stage the tumors . Unknown category represented tumors of high t class, which are known to have considerable risk of lymph node or distant metastasis, but lacked information of either or both . Completeness was defined as the number of individuals with tnm recordings, and defined stage categories, divided by the total number of patients . We stratified completeness by gender, age (039 years, 4059 years, 6079 years, and 80 years), year of cancer diagnosis, and cci score (low, medium, high). Analyses were performed using sas (version 9.2; sas institute inc, cary, nc). From the dcr, we identified all patients with a primary diagnosis of invasive breast cancer (icd-10 code c50) between 2004 and 2009.5,6 tumor stage was recorded as local, regional, or distant in the dcr until 2003.5 since 2004, stage has been recorded using the tnm classification.7 from the dcr, we also obtained information on date of diagnosis, age, and gender . Data on the presence of comorbidity were obtained from the danish national patient registry (dnpr).10 this registry contains data on all admissions to nonpsychiatric hospitals in denmark since 1977 and outpatient contacts since 1995, including the personal identification number, date of admission / contact and discharge, and diagnosis codes (icd-10 from 1994 and onwards). We defined pre - existing comorbidity using the charlson comorbidity index (cci), based on hospital diagnoses within 10 years preceding the date of breast cancer diagnosis . The cci is based on disease categories which are each weighted according to the adjusted risk of one - year mortality.11 excluding breast cancer, we defined the level of comorbidity as low (cci score 0), medium (cci score 12), and high (ccc score 3). We calculated the completeness and corresponding 95% confidence intervals, of the tnm registration overall, by each component individually (ie, t, n, and m), and according to the stage categories (see appendix). To reduce the prevalence of patients with breast cancer of unknown stage, we converted the tnm classification into summary staging using an algorithm that allowed categorization of tumors with certain missing tnm stage components into localized, regional, distant, and unknown stage (see appendix). Missing data were allowed if the information available on other t, n, or m components provided sufficient and meaningful information to stage the tumors . Unknown category represented tumors of high t class, which are known to have considerable risk of lymph node or distant metastasis, but lacked information of either or both . Completeness was defined as the number of individuals with tnm recordings, and defined stage categories, divided by the total number of patients . We stratified completeness by gender, age (039 years, 4059 years, 6079 years, and 80 years), year of cancer diagnosis, and cci score (low, medium, high). Analyses were performed using sas (version 9.2; sas institute inc, cary, nc). A total of 26,350 (99.5%) breast cancer patients were women, and 138 (0.5%) were men . There was a slightly better registration for women than for men (85.4% versus 81.2%). There were no major changes in tnm completeness during the six - year study period, though completeness was slightly lower in 2009 compared with previous years . Completeness declined markedly with advancing age, from 91.3% among patients aged 039 years to 57.0% among patients aged 80 years and older . Completeness also declined with increasing cci score, from 87.9% among patients with a low level of comorbidity to 69.7% among patients with high levels of comorbidity . Similar patterns were found for the individual components of the tnm classification, although the n and m recordings had somewhat more missing values than t. these data are presented in table 1 . Using the algorithm allowing inclusion of some tx, nx, and mx codes in the classification of tumor stage (appendix) decreased the number of unknown tumors from 3867 when not allowing any x s in the definite stage categories to 2551 using the algorithm allowing some x s in these categories (data not shown). Thus, with our algorithm, the proportion of tumors with unknown stage was reduced from 14.6% to 9.6% . Similar to the primary analyses of tnm completeness, the proportion of tumors of unknown stage was highest among older patients and those with high cci scores . The proportion of patients with localized breast cancer at the time of diagnosis increased from 43.2% in 2004 to 49.8% in 2009 . In this nationwide study, we found reasonable completeness of tnm registration in the dcr . The completeness was relatively constant during the study period, except for a slight decline from 2008 through 2009, which was due to a delay in the recording of tnm . However, we found that completeness varied substantially with patient age and level of comorbidity . When we applied a stage algorithm allowing some missing tnm components in the various categories, the proportion of cases with definite staging increased . The main strengths of our study included the population - based design and use of nationwide data from the dcr, which has virtually complete ascertainment of breast cancer.12 however, we only examined completeness of tnm registration, and our study did not allow for estimation of the accuracy of tnm registration . Furthermore, the impact of classifying some unknown stage breast tumors into categories with known tumors may not be appropriate for all purposes . Moreover, we may have misclassified comorbidity due to inaccuracy of hospital and outpatient diagnoses as well as lack of information on comorbidities diagnosed in primary care . Even so, a recent study reported consistently high positive predictive values for all of the cci diseases based on diagnoses recorded in the dnpr.13 compared with other cancer sites, the proportion of unstaged breast cancer patients is typically relatively low,8 though other studies, in agreement with our findings, have shown declining completeness of tnm registration with increasing age and comorbidity score.8,14 in particular, yancik et al15 found that women older than 70 years underwent fewer lymph node dissections than younger women . Other studies have also shown that elderly breast cancer patients and patients with comorbidity are less likely to receive breast cancer treatment according to treatment guidelines and have a poorer prognosis than younger patients with no severe comorbid conditions.16,17 the reasons are likely multifactorial, and may include less complete diagnostic assessment related to age, comorbidity and disabilities, patient preferences, apparent signs of distant metastases obviating the need for staging in treatment decisions, or competing medical conditions requiring treatment prior to cancer therapy . However, cautious interpretation of our results is necessary, as age and comorbidity are usually correlated . For example, a breast cancer case who for various reasons was not treated surgically might be coded nx, although axillary lymph node biopsy revealed positive lymph node metastases . As a second example, for breast cancer treated with curative intent surgery, no other diagnostic work - up other than a lung x - ray is performed . These cases are likely registered as m0 by most surgeons, although some might prefer to denote them as mx . Because completeness was lower among the elderly and those with a high level of comorbidity, the data on tnm stage was not missing at random . Consequently, study results may potentially be biased when staging constitutes the exposure or a confounding factor, and this may lead to incorrect conclusions . Thus, patients with missing data on tnm stage should be carefully handled in the statistical analyses, eg, by applying missing imputation methods,18 or bias analysis.19 for instance, population - based cancer registry data is important for monitoring the effectiveness of mammography screening programs . Stage - specific analyses are especially crucial, and stage - recording practices may affect the evaluation of screening program and trends in stage - specific incidence and prognosis . However, most patients with screening mammography - detected breast cancer undergo surgery, and consequently have high tnm completeness . In conclusion, our study showed that completeness of tnm registration for breast cancer varied differentially with age and level of comorbidity . Therefore, careful consideration should be given to the methodological implications in studies of cancer - related outcomes using data from the dcr.
|
Patients with acute cholangitis are at risk for developing severe infection that can be fatal unless appropriate medical care is provided at an early stage . Advances in antibiotic therapy and acute care as well as a wide diffusion of expertise in biliary endoscopy have resulted in reduction of morbidity and mortality from acute cholangitis . However, it remains a life - threatening disease and early determination of disease severity is essential to select appropriate therapy, particularly the timing of biliary decompression . In 2007 this meeting resulted in the introduction of the new tokyo guidelines (tg07) for diagnosis and severity assessment of acute cholangitis . Diagnostic and severity assessment criteria need to be updated periodically based on new information, criticisms, and suggestions for improvement . For instance, ever since charcot reported a patient with severe acute cholangitis as a case of hepatic fever in 1877, charcot s triad has been widely considered to be one of the most important diagnostic criteria [26]. However, charcot s triad has extremely low sensitivity despite its high specificity . In addition, false positive cases of acute cholecystitis are not unusual with this classic diagnostic triad . With experience we and others found potential shortcomings in tg07 . Consequently, the tokyo guidelines revision committee was assembled and gathered a large number of cases of acute cholangitis from tertiary care centers in japan . These cases acted as a gold standard to assess diagnostic and severity criteria such as tg07 . The present study has confirmed limitations of tg07 and presents updated tg13 criteria which have improved sensitivity and specificity and which importantly, unlike the criteria in tg07, allow severity assessment at the time of presentation so that biliary drainage or other procedures can be performed without delay . In the present multicenter study, 1,432 patients were enrolled with biliary tract abnormalities and suspected acute cholangitis between january 2007 and july 2011 . Choledocholithisis or biliary stricture was confirmed by direct cholangiography (i.e., endoscopic retrograde cholangiopancreatography (ercp), percutaneous transhepatic cholangiography). The establishment of guidelines for diagnosis and severity assessment in a disease requires that there is diagnostic certainty by which to assess criteria . For acute cholecystitis this may be provided by pathologic examination of excised gallbladders; however, pathologic specimens are not available in acute cholangitis . Our approach in this study was to gather data from 794 patients who were considered to have had acute cholangitis based on one of the following three criteria: (1) presence of purulent biliary leakage; (2) clinical remission due to bile duct drainage; or (3) remission achieved by antimicrobial therapy alone in patients in whom the only site of infection was the biliary tree . For comparison we also gathered data from 638 patients who had other biliary tract abnormalities (table 1).table 1clinical characteristics of patientsacute cholangitis (n = 794)other disease (n = 638)etiology;choledocholithiasis (n = 402)malignant tumor (n = 392)choledocholithiasis (n = 178),obstructive jaundice caused by malignant tumor (n = 241)acute cholecystitis (n = 219)age71.7 11.868.5 12.3sex(male: female)490:304307:331charcot triad147 (18.5%) 26 (4.1%) abdominal pain435 (54.8%) 309 (48.4%) presence of purulent biliary leakageclinical remission due to bile duct drainageremission achieved by antimicrobial therapy alone in patients in whom the only site of infection was the biliary treethe gold standard for acute cholangitis in this study was that one of the following three conditions was present clinical characteristics of patients presence of purulent biliary leakage clinical remission due to bile duct drainage remission achieved by antimicrobial therapy alone in patients in whom the only site of infection was the biliary tree the gold standard for acute cholangitis in this study was that one of the following three conditions was present using these patients, we adjusted diagnostic criteria to have the highest sensitivity and specificity for acute cholangitis . For establishment of new severity assessment criteria, we examined variables reported in the literature either as predictive of poor prognosis in acute cholangitis or of need for urgent biliary drainage (table 2). These variables were then used to construct a grading system that would permit determination of the level of severity at the time of diagnosis so that those patients who need urgent biliary decompression could receive treatment without delay.table 2prognostic factors in acute cholangitisprognostic factorpositive valuereferenceshyperbilirubinemia>2 mg / dl>2.2 mg / dl>2.93 mg / dl>4 mg / dl[11, 12]>5.26 mg / dl>5.56 mg / dl>8.1 mg / dl,> 9.2 mg / dl>9.1 mg / dl>10 mg / dlhypoalbuminemia<3.0 g / dl[10, 13, 18]acute renal failurebun (> 20>64 mg / dl)creatinine (> 1.5>2.0 mg / dl)[8, 9, 11, 19, 20]shock[8, 12, 13, 19]reduced platelet count<1,00,000<1,50,000/mm[13, 18, 20]endotoxemia / bacteremia[9, 10, 14, 20]high fever>38 c>39 c>40 cmedical comorbidity[8, 11, 13, 18, 19]elderly patient50 years old60 years old70 years old[19, 21]75 years oldmalignancy as etiology[9, 11, 14]prolonged prothrombin time14 s[10, 22]15 sleukocytosis12,00020,000[16, 17]current smokingyes[21, 22] prognostic factors in acute cholangitis for confirming the advantage of these revisions, updated diagnostic criteria and severity assessment criteria also were retrospectively assessed by the present multicenter analysis . Analysis of the 1,432 cases of biliary tract diseases showed that charcot s triad had low sensitivity (26.4%) but high specificity (95.9%) for acute cholangitis, with 11.9% of cases of acute cholecystitis demonstrating charcot s triad . On the other hand, the sensitivity and specificity of tg07 diagnostic criteria were 82.6 and 79.8%, respectively, while 11.9% of cases acute cholecystitis would have fit the diagnostic criteria for acute cholangitis if tg07 criteria were applied (table 3). Furthermore, tg07 diagnostic criteria for acute cholangitis were found to have insufficient sensitivity for making an early diagnosis of life - threatening acute cholangitis.table 3retrospective comparison of various diagnostic criteria of acute cholangitis in a multicenter study in japancharcot s triad (%) tg07 (%) the first draft criteria (with abdominal pain and history of biliary disease) (%) tg13 (%) sensitivity26.482.695.191.8specificity95.979.866.377.7positive rate in acute cholecystitis11.915.538.85.9 retrospective comparison of various diagnostic criteria of acute cholangitis in a multicenter study in japan it seemed that the shortcomings of tg07 might be related to inappropriate combination of such items as clinical context and manifestations, laboratory data and imaging findings . Therefore, for tg13, categories of diagnostic items were constructed based on the three main clinical manifestations used in the diagnosis of acute cholangitis: (a) fever and/or evidence of inflammatory response, (b) jaundice and abnormal liver function tests, and (c) abdominal pain, a history of biliary diseases, biliary dilatation, or other biliary manifestations . The presence of a finding in all three of these categories has been considered to be diagnostic of acute cholangitis . Abdominal pain and a history of biliary tract disease, however, are also common indicators of other biliary problems such as acute cholecystitis and even acute hepatitis . Acute cholecystitis application of the first draft criteria of tg13 (which included abdominal pain and a history of biliary tract disease) to patients with acute cholecystitis resulted in 38.8% of patients with acute cholecystitis meeting the criteria for diagnosis of acute cholangitis . However, despite a high sensitivity for acute cholangitis of 95.1% for these diagnostic criteria the specificity of (66.3%) was disappointingly low (table 3). In the next iteration of the diagnostic criteria, abdominal pain and this resulted in the best outcome in terms of high sensitivity and specificity for acute cholangitis and low false positive rate for acute cholecystitis (table 3) and these were the diagnostic criteria which were adopted for tg13 (table 3). The final tg13 diagnostic criteria are shown in table 4 . To make a definitive diagnosis one item from each of the three categories (a c) suspected diagnosis can be made when there is one item present from the a list and one item from either the b or c list . By establishing suspected diagnosis, early biliary drainage or source control of infection among patients with acute cholangitis can be provided without waiting for a definitive diagnosis.table 4tg13 diagnostic criteria for acute cholangitisa . Evidence of the etiology on imaging (stricture, stone, stent, etc. )suspected diagnosis: one item in a + one item in either b or cdefinite diagnosis: one item in a, one item in b and one item in ca-2 abnormal white blood cell counts, increase of serum c - reactive protein levels, and other changes indicating inflammationb-2 increased serum alp, r - gtp (ggt), ast, and alt levels threshholdsa-1feverbt> 38 ca-2evidence of inflammatory responsewbc (1,000/l)<4, or> 10crp (mg / dl)1b-1jaundicet - bil 2 (mg / dl)b-2abnormal liver function testsalp (iu)>1.5 std*gtp (iu)>1.5 std*ast (iu)>1.5 std*alt (iu)>1.5 std*other factors which are helpful in diagnosis of acute cholangitis include abdominal pain (right upper quadrant (ruq) or upper abdominal) and a history of biliary disease such as gallstones, previous biliary procedures, and placement of a biliary stentin acute hepatitis, marked systematic inflammatory response is observed infrequently . Virological and serological tests are required when differential diagnosis is difficultalp alkaline phosphatase, r - gtp (ggt) r - glutamyltransferase, ast aspartate aminotransferase, alt alanine aminotransferase * std upper limit of normal value tg13 diagnostic criteria for acute cholangitis other factors which are helpful in diagnosis of acute cholangitis include abdominal pain (right upper quadrant (ruq) or upper abdominal) and a history of biliary disease such as gallstones, previous biliary procedures, and placement of a biliary stent in acute hepatitis, marked systematic inflammatory response is observed infrequently . Virological and serological tests are required when differential diagnosis is difficult alp alkaline phosphatase, r - gtp (ggt) r - glutamyltransferase, ast aspartate aminotransferase, alt alanine aminotransferase * std upper limit of normal value one of the items in category a involves determination of the presence of abnormal laboratory tests . Thresholds for declaring positivity test might be set at the upper limit of normal for the tests . The disadvantage of this approach is that minor abnormalities in the tests are not uncommon in acute cholecystitis . The normal upper limit range of the liver function tests differs from facility to facility . Instead, the threshold was set at 1.5 times the upper limit of normal in a facility . We then conducted a multicenter analysis to compare this threshold with two other types of threshold in terms of the diagnostic ability for acute cholangitis . When the threshold was set at 1.5 times the upper limit, both sensitivity and specificity were similar to those at which another two types of threshold were applied (table 5). From the above results, it was considered appropriate and practical that the threshold was set at 1.5 times the normal upper limit for the liver function test in the particular facility.table 5comparisons of various cut - offs for laboratory testing results for the diagnosis of acute cholangitis in japanthresholds for positivity of testadoptionlimit of this test (low)limit of this test (high)t - bil (mg / dl)2samesamealp (iu)>1.5 std400500gtp (iu)>1.5 std100150ast (iu)>1.5 std50100alt (iu)>1.5 std50100wbc (1,000/l)<4, or> 10samesamecrp (mg / dl)1samesamebt>38 csamesamesensitivity91.8% 93.0% 92.7% specificity77.7% 77.9% 77.9% positive rate in acute cholecystitis (n = 219)5.9% 9.1% 8.7% std upper limit of normal value comparisons of various cut - offs for laboratory testing results for the diagnosis of acute cholangitis in japan std upper limit of normal value the use of tg07 severity assessment criteria in actual clinical situations has shown that use of these criteria was inefficient in separating moderate cases (grade ii) from mild cases (grade i) at the time of initial diagnosis . In tg07, grades ii and i were only assessed after observation of the initial treatment courses . In this treatment strategy, urgent biliary drainage can be indicated for cases assessed as moderate. The present multicenter analysis showed that many cases (46.8%, 258 of 551 cases) of grade ii or i underwent urgent biliary drainage in the same manner as grade iii . In these cases, differentiation between grade ii and grade i was impossible, because the definition of grade ii in tg07 was ambiguous (table 6).table 6timing of biliary drainage among patients with acute cholangitis diagnosed with tg07multicenter analysis of acute cholangitis for revision of tg07 severity criteria of acute cholangitistiming of drainage / treatment for etiologygrade iiigrade iigrade itotalwithin 24 h41258(grade ii or i)2972448 h954063after 48 h2013012162drainage ()2396101total72 (11.6%) 551 (88.4%) (grade ii or i)623 timing of biliary drainage among patients with acute cholangitis diagnosed with tg07multicenter analysis of acute cholangitis for revision of tg07 severity criteria of acute cholangitis given these insufficiencies of tg07 in clinical practice, a revision was sought which might improve severity assessment strategies upon diagnosis in order to allow selection of those patients who needed immediate source control of infection . Since there had been no scientifically based definitions of moderate cases except for the consensus - based tg07 we needed a new definition of what constituted moderate cases needing early source control in tg13 . To improve tg07 we examined items reported as predictive factors of poor prognosis among patients with acute cholangitis and factors associated with the need for urgent biliary drainage (table 2). Furthermore, factors that endoscopic gastroenterologists value in determining the timing of biliary drainage were integrated except for the factors that define grade iii cases (severe cases). Presence or absence of endotoxemia and/or bacteremia, and malignancy as etiology cannot be assessed upon the diagnosis of acute cholangitis and were therefore not included . Medical comorbidities such as diabetes mellitus and neurological diseases were considered as severity factors; however, due to their wide disease spectrum, it was decided that it was impractical to include co - morbidity in tg13 . The criteria selected for moderate severity were leukocytosis high fever, age> 75 years, hyperbilirubinemia, and hypoalbuminemia . The presence of any two of the five positive criteria will classify the disease as grade ii (moderate). The revised assessment criteria for acute cholangitis are shown in table 7.table 7tg13 severity assessment criteria for acute cholangitisgrade iii (severe) acute cholangitisgrade iii acute cholangitis is defined as acute cholangitis that is associated with the onset of dysfunction at least in any one of the following organs / systems 1 . Cardiovascular dysfunctionhypotension requiring dopamine 5 g / kg per min, or any dose of norepinephrine 2 . Hematological dysfunctionplatelet count <1,00,000/mmgrade ii (moderate) acute cholangitis grade ii acute cholangitis is associated with any two of the following conditions: 1 . 0.7)grade i (mild) acute cholangitisgrade i acute cholangitis does not meet the criteria of grade iii (severe) or grade ii (moderate) acute cholangitis at initial diagnosisearly diagnosis, early biliary drainage and/or treatment for etiology, and antimicrobial administration are fundamental treatment for acute cholangitis classified not only grade iii (severe) and grade ii (moderate) but also grade i (mild)therefore, it is recommended that patients with acute cholangitis who do not respond to the initial medical treatment (general supportive care and antimicrobial therapy) undergo early biliary drainage or treatment for etiologystd lower limit of normal value tg13 severity assessment criteria for acute cholangitis early diagnosis, early biliary drainage and/or treatment for etiology, and antimicrobial administration are fundamental treatment for acute cholangitis classified not only grade iii (severe) and grade ii (moderate) but also grade i (mild) therefore, it is recommended that patients with acute cholangitis who do not respond to the initial medical treatment (general supportive care and antimicrobial therapy) undergo early biliary drainage or treatment for etiology std lower limit of normal value we performed a multicenter analysis using the tg13 severity assessment criteria for acute cholangitis in real clinical settings . Of the 623 cases of acute cholangitis where severity grading was retrospectively made clear, there were 72 grade iii cases (11.6%), 216 grade ii cases (34.7%) and 335 grade i cases (53.8%). Furthermore, the grade ii cases requiring urgent or early biliary drainage accounted for 46% of the acute cholangitis cases . An examination of grade i cases where biliary drainage had been carried out within 24 h and within 48 h found 140 cases (41.8%) and 181 cases (54.0%), respectively . It was surprising that so many patients with grade i criteria had undergone biliary drainage . However, on further analysis it was found that almost all grade i cases that had undergone early biliary drainage were due to biliary obstruction such as common duct stones . These types of interventions accounted for 135 of 140 cases (94.8%) within 24 h and 41 cases (100%) within 48 h, respectively . The number of grade i cases that had undergone biliary drainage as an urgent treatment to control infection were small (table 8).table 8timing of biliary drainage among patients with acute cholangitis diagnosed with tg13multicenter analysis of acute cholangitis for revision of tg07 severity assessment criteria for acute cholangitistiming of drainage / treatment for etiologygrade iiigrade iigrade itotalwithin 24 h41116140 (135)2972448 h91341 (41)63after 48 h204894162drainage ()23960101total72 (11.6%) 216 (34.7%) 335 (53.8%) 623 () indicates the number of cases that have early drainage and treatment of etiology timing of biliary drainage among patients with acute cholangitis diagnosed with tg13multicenter analysis of acute cholangitis for revision of tg07 severity assessment criteria for acute cholangitis () indicates the number of cases that have early drainage and treatment of etiology of the 110 cases of acute cholangitis that met the charcot s triad, 13 cases (11.8%) have been classified as grade iii, and 52 as grade ii (47.3%), respectively . Furthermore, approximately 80% (59 of 72 cases) of grade iii cases in tg13 failed to satisfy charcot s triad (table 9). Charcot s triad was not found to be associated with disease severity.table 9tg13 severity assessment criteria and charcot s triadseverity grading of tg13charcot s triadyes (n = 110)no (n = 513)grade iii13 (11.8%) 59 (11.5%) grade ii52 (47.3%) 164 (32.0%) grade i45 (40.9%) 290 (56.5%) tg13 severity assessment criteria and charcot s triad analysis of the 1,432 cases of biliary tract diseases showed that charcot s triad had low sensitivity (26.4%) but high specificity (95.9%) for acute cholangitis, with 11.9% of cases of acute cholecystitis demonstrating charcot s triad . On the other hand, the sensitivity and specificity of tg07 diagnostic criteria were 82.6 and 79.8%, respectively, while 11.9% of cases acute cholecystitis would have fit the diagnostic criteria for acute cholangitis if tg07 criteria were applied (table 3). Furthermore, tg07 diagnostic criteria for acute cholangitis were found to have insufficient sensitivity for making an early diagnosis of life - threatening acute cholangitis.table 3retrospective comparison of various diagnostic criteria of acute cholangitis in a multicenter study in japancharcot s triad (%) tg07 (%) the first draft criteria (with abdominal pain and history of biliary disease) (%) tg13 (%) sensitivity26.482.695.191.8specificity95.979.866.377.7positive rate in acute cholecystitis11.915.538.85.9 retrospective comparison of various diagnostic criteria of acute cholangitis in a multicenter study in japan it seemed that the shortcomings of tg07 might be related to inappropriate combination of such items as clinical context and manifestations, laboratory data and imaging findings . Therefore, for tg13, categories of diagnostic items were constructed based on the three main clinical manifestations used in the diagnosis of acute cholangitis: (a) fever and/or evidence of inflammatory response, (b) jaundice and abnormal liver function tests, and (c) abdominal pain, a history of biliary diseases, biliary dilatation, or other biliary manifestations . The presence of a finding in all three of these categories has been considered to be diagnostic of acute cholangitis . Abdominal pain and a history of biliary tract disease, however, are also common indicators of other biliary problems such as acute cholecystitis and even acute hepatitis . Acute cholecystitis application of the first draft criteria of tg13 (which included abdominal pain and a history of biliary tract disease) to patients with acute cholecystitis resulted in 38.8% of patients with acute cholecystitis meeting the criteria for diagnosis of acute cholangitis . However, despite a high sensitivity for acute cholangitis of 95.1% for these diagnostic criteria the specificity of (66.3%) was disappointingly low (table 3). In the next iteration of the diagnostic criteria, abdominal pain and this resulted in the best outcome in terms of high sensitivity and specificity for acute cholangitis and low false positive rate for acute cholecystitis (table 3) and these were the diagnostic criteria which were adopted for tg13 (table 3). The final tg13 diagnostic criteria are shown in table 4 . To make a definitive diagnosis one item from each of the three categories (a c) suspected diagnosis can be made when there is one item present from the a list and one item from either the b or c list . By establishing suspected diagnosis, early biliary drainage or source control of infection among patients with acute cholangitis can be provided without waiting for a definitive diagnosis.table 4tg13 diagnostic criteria for acute cholangitisa . Evidence of the etiology on imaging (stricture, stone, stent, etc. )suspected diagnosis: one item in a + one item in either b or cdefinite diagnosis: one item in a, one item in b and one item in ca-2 abnormal white blood cell counts, increase of serum c - reactive protein levels, and other changes indicating inflammationb-2 increased serum alp, r - gtp (ggt), ast, and alt levels threshholdsa-1feverbt> 38 ca-2evidence of inflammatory responsewbc (1,000/l)<4, or> 10crp (mg / dl)1b-1jaundicet - bil 2 (mg / dl)b-2abnormal liver function testsalp (iu)>1.5 std*gtp (iu)>1.5 std*ast (iu)>1.5 std*alt (iu)>1.5 std*other factors which are helpful in diagnosis of acute cholangitis include abdominal pain (right upper quadrant (ruq) or upper abdominal) and a history of biliary disease such as gallstones, previous biliary procedures, and placement of a biliary stentin acute hepatitis, marked systematic inflammatory response is observed infrequently . Virological and serological tests are required when differential diagnosis is difficultalp alkaline phosphatase, r - gtp (ggt) r - glutamyltransferase, ast aspartate aminotransferase, alt alanine aminotransferase * std upper limit of normal value tg13 diagnostic criteria for acute cholangitis other factors which are helpful in diagnosis of acute cholangitis include abdominal pain (right upper quadrant (ruq) or upper abdominal) and a history of biliary disease such as gallstones, previous biliary procedures, and placement of a biliary stent in acute hepatitis, marked systematic inflammatory response is observed infrequently . Virological and serological tests are required when differential diagnosis is difficult alp alkaline phosphatase, r - gtp (ggt) r - glutamyltransferase, ast aspartate aminotransferase, alt alanine aminotransferase * std upper limit of normal value one of the items in category a involves determination of the presence of abnormal laboratory tests . Thresholds for declaring positivity test might be set at the upper limit of normal for the tests . The disadvantage of this approach is that minor abnormalities in the tests are not uncommon in acute cholecystitis . The normal upper limit range of the liver function tests differs from facility to facility . Instead, the threshold was set at 1.5 times the upper limit of normal in a facility . We then conducted a multicenter analysis to compare this threshold with two other types of threshold in terms of the diagnostic ability for acute cholangitis . When the threshold was set at 1.5 times the upper limit, both sensitivity and specificity were similar to those at which another two types of threshold were applied (table 5). From the above results, it was considered appropriate and practical that the threshold was set at 1.5 times the normal upper limit for the liver function test in the particular facility.table 5comparisons of various cut - offs for laboratory testing results for the diagnosis of acute cholangitis in japanthresholds for positivity of testadoptionlimit of this test (low)limit of this test (high)t - bil (mg / dl)2samesamealp (iu)>1.5 std400500gtp (iu)>1.5 std100150ast (iu)>1.5 std50100alt (iu)>1.5 std50100wbc (1,000/l)<4, or> 10samesamecrp (mg / dl)1samesamebt>38 csamesamesensitivity91.8% 93.0% 92.7% specificity77.7% 77.9% 77.9% positive rate in acute cholecystitis (n = 219)5.9% 9.1% 8.7% std upper limit of normal value comparisons of various cut - offs for laboratory testing results for the diagnosis of acute cholangitis in japan std upper limit of normal value analysis of the 1,432 cases of biliary tract diseases showed that charcot s triad had low sensitivity (26.4%) but high specificity (95.9%) for acute cholangitis, with 11.9% of cases of acute cholecystitis demonstrating charcot s triad . On the other hand, the sensitivity and specificity of tg07 diagnostic criteria were 82.6 and 79.8%, respectively, while 11.9% of cases acute cholecystitis would have fit the diagnostic criteria for acute cholangitis if tg07 criteria were applied (table 3). Furthermore, tg07 diagnostic criteria for acute cholangitis were found to have insufficient sensitivity for making an early diagnosis of life - threatening acute cholangitis.table 3retrospective comparison of various diagnostic criteria of acute cholangitis in a multicenter study in japancharcot s triad (%) tg07 (%) the first draft criteria (with abdominal pain and history of biliary disease) (%) tg13 (%) sensitivity26.482.695.191.8specificity95.979.866.377.7positive rate in acute cholecystitis11.915.538.85.9 retrospective comparison of various diagnostic criteria of acute cholangitis in a multicenter study in japan it seemed that the shortcomings of tg07 might be related to inappropriate combination of such items as clinical context and manifestations, laboratory data and imaging findings . Therefore, for tg13, categories of diagnostic items were constructed based on the three main clinical manifestations used in the diagnosis of acute cholangitis: (a) fever and/or evidence of inflammatory response, (b) jaundice and abnormal liver function tests, and (c) abdominal pain, a history of biliary diseases, biliary dilatation, or other biliary manifestations . The presence of a finding in all three of these categories has been considered to be diagnostic of acute cholangitis . Abdominal pain and a history of biliary tract disease, however, are also common indicators of other biliary problems such as acute cholecystitis and even acute hepatitis . Acute cholecystitis application of the first draft criteria of tg13 (which included abdominal pain and a history of biliary tract disease) to patients with acute cholecystitis resulted in 38.8% of patients with acute cholecystitis meeting the criteria for diagnosis of acute cholangitis . However, despite a high sensitivity for acute cholangitis of 95.1% for these diagnostic criteria the specificity of (66.3%) was disappointingly low (table 3). In the next iteration of the diagnostic criteria, abdominal pain and the history of biliary diseases this resulted in the best outcome in terms of high sensitivity and specificity for acute cholangitis and low false positive rate for acute cholecystitis (table 3) and these were the diagnostic criteria which were adopted for tg13 (table 3). The final tg13 diagnostic criteria are shown in table 4 . To make a definitive diagnosis one item from each of the three categories (a c) suspected diagnosis can be made when there is one item present from the a list and one item from either the b or c list . By establishing suspected diagnosis, early biliary drainage or source control of infection among patients with acute cholangitis can be provided without waiting for a definitive diagnosis.table 4tg13 diagnostic criteria for acute cholangitisa . Evidence of the etiology on imaging (stricture, stone, stent, etc. )suspected diagnosis: one item in a + one item in either b or cdefinite diagnosis: one item in a, one item in b and one item in ca-2 abnormal white blood cell counts, increase of serum c - reactive protein levels, and other changes indicating inflammationb-2 increased serum alp, r - gtp (ggt), ast, and alt levels threshholdsa-1feverbt> 38 ca-2evidence of inflammatory responsewbc (1,000/l)<4, or> 10crp (mg / dl)1b-1jaundicet - bil 2 (mg / dl)b-2abnormal liver function testsalp (iu)>1.5 std*gtp (iu)>1.5 std*ast (iu)>1.5 std*alt (iu)>1.5 std*other factors which are helpful in diagnosis of acute cholangitis include abdominal pain (right upper quadrant (ruq) or upper abdominal) and a history of biliary disease such as gallstones, previous biliary procedures, and placement of a biliary stentin acute hepatitis, marked systematic inflammatory response is observed infrequently . Virological and serological tests are required when differential diagnosis is difficultalp alkaline phosphatase, r - gtp (ggt) r - glutamyltransferase, ast aspartate aminotransferase, alt alanine aminotransferase * std upper limit of normal value tg13 diagnostic criteria for acute cholangitis other factors which are helpful in diagnosis of acute cholangitis include abdominal pain (right upper quadrant (ruq) or upper abdominal) and a history of biliary disease such as gallstones, previous biliary procedures, and placement of a biliary stent in acute hepatitis, marked systematic inflammatory response is observed infrequently . Virological and serological tests are required when differential diagnosis is difficult alp alkaline phosphatase, r - gtp (ggt) r - glutamyltransferase, ast aspartate aminotransferase, alt alanine aminotransferase * std upper limit of normal value one of the items in category a involves determination of the presence of abnormal laboratory tests . Thresholds for declaring positivity test might be set at the upper limit of normal for the tests . The disadvantage of this approach is that minor abnormalities in the tests are not uncommon in acute cholecystitis . The normal upper limit range of the liver function tests differs from facility to facility . Therefore, a fixed threshold is not practical . Instead, the threshold was set at 1.5 times the upper limit of normal in a facility . We then conducted a multicenter analysis to compare this threshold with two other types of threshold in terms of the diagnostic ability for acute cholangitis . When the threshold was set at 1.5 times the upper limit, both sensitivity and specificity were similar to those at which another two types of threshold were applied (table 5). From the above results, it was considered appropriate and practical that the threshold was set at 1.5 times the normal upper limit for the liver function test in the particular facility.table 5comparisons of various cut - offs for laboratory testing results for the diagnosis of acute cholangitis in japanthresholds for positivity of testadoptionlimit of this test (low)limit of this test (high)t - bil (mg / dl)2samesamealp (iu)>1.5 std400500gtp (iu)>1.5 std100150ast (iu)>1.5 std50100alt (iu)>1.5 std50100wbc (1,000/l)<4, or> 10samesamecrp (mg / dl)1samesamebt>38 csamesamesensitivity91.8% 93.0% 92.7% specificity77.7% 77.9% 77.9% positive rate in acute cholecystitis (n = 219)5.9% 9.1% 8.7% std upper limit of normal value comparisons of various cut - offs for laboratory testing results for the diagnosis of acute cholangitis in japan std upper limit of normal value the use of tg07 severity assessment criteria in actual clinical situations has shown that use of these criteria was inefficient in separating moderate cases (grade ii) from mild cases (grade i) at the time of initial diagnosis . In tg07, grades ii and i were only assessed after observation of the initial treatment courses . In this treatment strategy, urgent biliary drainage can be indicated for cases assessed as moderate. The present multicenter analysis showed that many cases (46.8%, 258 of 551 cases) of grade ii or i underwent urgent biliary drainage in the same manner as grade iii . In these cases, differentiation between grade ii and grade i was impossible, because the definition of grade ii in tg07 was ambiguous (table 6).table 6timing of biliary drainage among patients with acute cholangitis diagnosed with tg07multicenter analysis of acute cholangitis for revision of tg07 severity criteria of acute cholangitistiming of drainage / treatment for etiologygrade iiigrade iigrade itotalwithin 24 h41258(grade ii or i)2972448 h954063after 48 h2013012162drainage ()2396101total72 (11.6%) 551 (88.4%) (grade ii or i)623 timing of biliary drainage among patients with acute cholangitis diagnosed with tg07multicenter analysis of acute cholangitis for revision of tg07 severity criteria of acute cholangitis given these insufficiencies of tg07 in clinical practice, a revision was sought which might improve severity assessment strategies upon diagnosis in order to allow selection of those patients who needed immediate source control of infection . Since there had been no scientifically based definitions of moderate cases except for the consensus - based tg07 we needed a new definition of what constituted moderate cases needing early source control in tg13 . To improve tg07 we examined items reported as predictive factors of poor prognosis among patients with acute cholangitis and factors associated with the need for urgent biliary drainage (table 2). Furthermore, factors that endoscopic gastroenterologists value in determining the timing of biliary drainage were integrated except for the factors that define grade iii cases (severe cases). Presence or absence of endotoxemia and/or bacteremia, and malignancy as etiology cannot be assessed upon the diagnosis of acute cholangitis and were therefore not included . Medical comorbidities such as diabetes mellitus and neurological diseases were considered as severity factors; however, due to their wide disease spectrum, it was decided that it was impractical to include co - morbidity in tg13 . The criteria selected for moderate severity were leukocytosis high fever, age> 75 years, hyperbilirubinemia, and hypoalbuminemia . The presence of any two of the five positive criteria will classify the disease as grade ii (moderate). The revised assessment criteria for acute cholangitis are shown in table 7.table 7tg13 severity assessment criteria for acute cholangitisgrade iii (severe) acute cholangitisgrade iii acute cholangitis is defined as acute cholangitis that is associated with the onset of dysfunction at least in any one of the following organs / systems 1 . Cardiovascular dysfunctionhypotension requiring dopamine 5 g / kg per min, or any dose of norepinephrine 2 . Hematological dysfunctionplatelet count <1,00,000/mmgrade ii (moderate) acute cholangitis grade ii acute cholangitis is associated with any two of the following conditions: 1 . 0.7)grade i (mild) acute cholangitisgrade i acute cholangitis does not meet the criteria of grade iii (severe) or grade ii (moderate) acute cholangitis at initial diagnosisearly diagnosis, early biliary drainage and/or treatment for etiology, and antimicrobial administration are fundamental treatment for acute cholangitis classified not only grade iii (severe) and grade ii (moderate) but also grade i (mild)therefore, it is recommended that patients with acute cholangitis who do not respond to the initial medical treatment (general supportive care and antimicrobial therapy) undergo early biliary drainage or treatment for etiologystd lower limit of normal value tg13 severity assessment criteria for acute cholangitis early diagnosis, early biliary drainage and/or treatment for etiology, and antimicrobial administration are fundamental treatment for acute cholangitis classified not only grade iii (severe) and grade ii (moderate) but also grade i (mild) therefore, it is recommended that patients with acute cholangitis who do not respond to the initial medical treatment (general supportive care and antimicrobial therapy) undergo early biliary drainage or treatment for etiology std lower limit of normal value we performed a multicenter analysis using the tg13 severity assessment criteria for acute cholangitis in real clinical settings . Of the 623 cases of acute cholangitis where severity grading was retrospectively made clear, there were 72 grade iii cases (11.6%), 216 grade ii cases (34.7%) and 335 grade i cases (53.8%). Furthermore, the grade ii cases requiring urgent or early biliary drainage accounted for 46% of the acute cholangitis cases . An examination of grade i cases where biliary drainage had been carried out within 24 h and within 48 h found 140 cases (41.8%) and 181 cases (54.0%), respectively . It was surprising that so many patients with grade i criteria had undergone biliary drainage . However, on further analysis it was found that almost all grade i cases that had undergone early biliary drainage were due to biliary obstruction such as common duct stones . These types of interventions accounted for 135 of 140 cases (94.8%) within 24 h and 41 cases (100%) within 48 h, respectively . The number of grade i cases that had undergone biliary drainage as an urgent treatment to control infection were small (table 8).table 8timing of biliary drainage among patients with acute cholangitis diagnosed with tg13multicenter analysis of acute cholangitis for revision of tg07 severity assessment criteria for acute cholangitistiming of drainage / treatment for etiologygrade iiigrade iigrade itotalwithin 24 h41116140 (135)2972448 h91341 (41)63after 48 h204894162drainage ()23960101total72 (11.6%) 216 (34.7%) 335 (53.8%) 623 () indicates the number of cases that have early drainage and treatment of etiology timing of biliary drainage among patients with acute cholangitis diagnosed with tg13multicenter analysis of acute cholangitis for revision of tg07 severity assessment criteria for acute cholangitis () indicates the number of cases that have early drainage and treatment of etiology of the 110 cases of acute cholangitis that met the charcot s triad, 13 cases (11.8%) have been classified as grade iii, and 52 as grade ii (47.3%), respectively . Furthermore, approximately 80% (59 of 72 cases) of grade iii cases in tg13 failed to satisfy charcot s triad (table 9). Charcot s triad was not found to be associated with disease severity.table 9tg13 severity assessment criteria and charcot s triadseverity grading of tg13charcot s triadyes (n = 110)no (n = 513)grade iii13 (11.8%) 59 (11.5%) grade ii52 (47.3%) 164 (32.0%) grade i45 (40.9%) 290 (56.5%) tg13 severity assessment criteria and charcot s triad the use of tg07 severity assessment criteria in actual clinical situations has shown that use of these criteria was inefficient in separating moderate cases (grade ii) from mild cases (grade i) at the time of initial diagnosis . In tg07, grades ii and i were only assessed after observation of the initial treatment courses . In this treatment strategy, urgent biliary drainage can be indicated for cases assessed as moderate. The present multicenter analysis showed that many cases (46.8%, 258 of 551 cases) of grade ii or i underwent urgent biliary drainage in the same manner as grade iii . In these cases, differentiation between grade ii and grade i was impossible, because the definition of grade ii in tg07 was ambiguous (table 6).table 6timing of biliary drainage among patients with acute cholangitis diagnosed with tg07multicenter analysis of acute cholangitis for revision of tg07 severity criteria of acute cholangitistiming of drainage / treatment for etiologygrade iiigrade iigrade itotalwithin 24 h41258(grade ii or i)2972448 h954063after 48 h2013012162drainage ()2396101total72 (11.6%) 551 (88.4%) (grade ii or i)623 timing of biliary drainage among patients with acute cholangitis diagnosed with tg07multicenter analysis of acute cholangitis for revision of tg07 severity criteria of acute cholangitis given these insufficiencies of tg07 in clinical practice, a revision was sought which might improve severity assessment strategies upon diagnosis in order to allow selection of those patients who needed immediate source control of infection . Since there had been no scientifically based definitions of moderate cases except for the consensus - based tg07 we needed a new definition of what constituted moderate cases needing early source control in tg13 . To improve tg07 we examined items reported as predictive factors of poor prognosis among patients with acute cholangitis and factors associated with the need for urgent biliary drainage (table 2). Furthermore, factors that endoscopic gastroenterologists value in determining the timing of biliary drainage were integrated except for the factors that define grade iii cases (severe cases). Presence or absence of endotoxemia and/or bacteremia, and malignancy as etiology cannot be assessed upon the diagnosis of acute cholangitis and were therefore not included . Medical comorbidities such as diabetes mellitus and neurological diseases were considered as severity factors; however, due to their wide disease spectrum, it was decided that it was impractical to include co - morbidity in tg13 . The criteria selected for moderate severity were leukocytosis high fever, age> 75 years, hyperbilirubinemia, and hypoalbuminemia . The presence of any two of the five positive criteria will classify the disease as grade ii (moderate). The revised assessment criteria for acute cholangitis are shown in table 7.table 7tg13 severity assessment criteria for acute cholangitisgrade iii (severe) acute cholangitisgrade iii acute cholangitis is defined as acute cholangitis that is associated with the onset of dysfunction at least in any one of the following organs / systems 1 . Cardiovascular dysfunctionhypotension requiring dopamine 5 g / kg per min, or any dose of norepinephrine 2 . Hematological dysfunctionplatelet count <1,00,000/mmgrade ii (moderate) acute cholangitis grade ii acute cholangitis is associated with any two of the following conditions: 1 . 0.7)grade i (mild) acute cholangitisgrade i acute cholangitis does not meet the criteria of grade iii (severe) or grade ii (moderate) acute cholangitis at initial diagnosisearly diagnosis, early biliary drainage and/or treatment for etiology, and antimicrobial administration are fundamental treatment for acute cholangitis classified not only grade iii (severe) and grade ii (moderate) but also grade i (mild)therefore, it is recommended that patients with acute cholangitis who do not respond to the initial medical treatment (general supportive care and antimicrobial therapy) undergo early biliary drainage or treatment for etiologystd lower limit of normal value tg13 severity assessment criteria for acute cholangitis early diagnosis, early biliary drainage and/or treatment for etiology, and antimicrobial administration are fundamental treatment for acute cholangitis classified not only grade iii (severe) and grade ii (moderate) but also grade i (mild) therefore, it is recommended that patients with acute cholangitis who do not respond to the initial medical treatment (general supportive care and antimicrobial therapy) undergo early biliary drainage or treatment for etiology std lower limit of normal value we performed a multicenter analysis using the tg13 severity assessment criteria for acute cholangitis in real clinical settings . Of the 623 cases of acute cholangitis where severity grading was retrospectively made clear, there were 72 grade iii cases (11.6%), 216 grade ii cases (34.7%) and 335 grade i cases (53.8%). Furthermore, the grade ii cases requiring urgent or early biliary drainage accounted for 46% of the acute cholangitis cases . An examination of grade i cases where biliary drainage had been carried out within 24 h and within 48 h found 140 cases (41.8%) and 181 cases (54.0%), respectively . It was surprising that so many patients with grade i criteria had undergone biliary drainage . However, on further analysis it was found that almost all grade i cases that had undergone early biliary drainage were due to biliary obstruction such as common duct stones . These types of interventions accounted for 135 of 140 cases (94.8%) within 24 h and 41 cases (100%) within 48 h, respectively . The number of grade i cases that had undergone biliary drainage as an urgent treatment to control infection were small (table 8).table 8timing of biliary drainage among patients with acute cholangitis diagnosed with tg13multicenter analysis of acute cholangitis for revision of tg07 severity assessment criteria for acute cholangitistiming of drainage / treatment for etiologygrade iiigrade iigrade itotalwithin 24 h41116140 (135)2972448 h91341 (41)63after 48 h204894162drainage ()23960101total72 (11.6%) 216 (34.7%) 335 (53.8%) 623 () indicates the number of cases that have early drainage and treatment of etiology timing of biliary drainage among patients with acute cholangitis diagnosed with tg13multicenter analysis of acute cholangitis for revision of tg07 severity assessment criteria for acute cholangitis () indicates the number of cases that have early drainage and treatment of etiology of the 110 cases of acute cholangitis that met the charcot s triad, 13 cases (11.8%) have been classified as grade iii, and 52 as grade ii (47.3%), respectively . Furthermore, approximately 80% (59 of 72 cases) of grade iii cases in tg13 failed to satisfy charcot s triad (table 9). Charcot s triad was not found to be associated with disease severity.table 9tg13 severity assessment criteria and charcot s triadseverity grading of tg13charcot s triadyes (n = 110)no (n = 513)grade iii13 (11.8%) 59 (11.5%) grade ii52 (47.3%) 164 (32.0%) grade i45 (40.9%) 290 (56.5%) tg13 severity assessment criteria and charcot s triad the main goals of diagnostic and severity assessment criteria are to allow early establishment of diagnosis and selection of the most appropriate management plan for the stage of the disease . This was attempted for acute cholangitis in tg07 where the guidelines were based on available literature and input of experts at a consensus conference held in tokyo in 2006 . At that meeting, diagnostic criteria were presented combining blood tests and diagnostic imaging together with charcot s triad . However, there is a report showing that the sensitivity was low (63.9%) for making a definite diagnosis of acute cholangitis . It is well established that guidelines need periodic assessment and revision; however, in the case of tg07 this was particularly so because of shortcomings that became evident through application in clinical practice and as a result of new information in the literature . As in tg07, initial iterations were produced in japan with modifications incorporating the input of experts from around the world . A particularly vexing problem in studies of acute cholangitis is how to set a gold standard for the disease against which to compare diagnostic and severity grading criteria . Unlike diseases such as acute cholecystitis there is no organ or tissue with which absolute diagnosis of acute cholangitis can be achieved pathologically . An important step in generation of tg13 was to adopt the three gold standard diagnostic criteria suggested in the literature and by experience . This then permitted the gathering of a large number of example cases by which to refine and judge the adequacy of the new criteria . While this was an arduous task it seems that the results support this approach in dealing with these issues . Another novelty in our approach is that the diagnostic criteria were not judged simply against normal individuals but included patients with other biliary tract diseases especially acute cholecystitis . The early iterations of the diagnostic criteria for tg13 included abdominal pain and a history of biliary tract disease; however, it was found that inclusion of these criteria resulted in a schema with low specificity and a high false positive rate in cases of acute cholecystitis . When these variables were dropped the results improved dramatically . It may seem odd to have diagnostic criteria which eliminate abdominal pain as a symptom of acute cholangitis but the benefit of eliminating confusion with other biliary tract disease if pain is included outweighs any advantage of including it . The new tg13 diagnostic criteria have fewer variables and are arranged in more logical categories . The thresholds for laboratory tests have been selected to permit worldwide use as they do not depend on absolute values but on 1.5 times the upper limit of normal of any laboratory . As such these criteria should be amenable to use on handheld devices further improving the ability to rapidly diagnose the condition . Ideally, a definitive diagnosis should be available at the time of presentation . If the requirement for a definitive diagnosis results in delay of biliary drainage with progression to more severe stages of the disease or death under observation the purpose of a definitive diagnosis is subverted . At the present state of knowledge our data suggest that the decision to proceed to early biliary drainage can and should be made on suspected diagnosis and severity grading as outlined in the paper as both of these can be determined at presentation . The effect of this strategy can be determined as the criteria for diagnosis are evaluated in the future . The severity grading has also been revised based on new information available in the literature . The criteria for severe cases have not been modified but those in the important moderate group have been updated . As noted all five criteria in the moderate group are determinable at presentation . In practice the diagnostic criteria and severity grading would be used in tandem at the time of presentation . If a patient fit the suspected criteria, severity grading would be performed . Those falling into the moderate and severe categories would be candidates for urgent biliary decompression, while those in the mild category would be treated initially with antibiotics . Many of the latter patients would still have biliary drainage within the first 48 h for control of the cause of acute cholangitis such as extraction of common duct stones . A diagnosis of acute cholangitis has traditionally been made by charcot s triad . According to several reports, charcot s triad was observed for only 9% except in cases of acute cholangitis, but cases of acute cholangitis presenting all of charcot s triad accounted for only 5070% [3, 814, 2426]. We also continued to examine the utility of charcot s triad because of the prominence of this diagnostic triad in this disease . We found that charcot s triad shows very high specificity the presence of the charcot s triad strongly suggested the presence of acute cholangitis . However, due to the low sensitivity, it is not applicable in making a diagnosis of acute cholangitis . Also as noted the triad presents new diagnostic and severity grading systems based on a large patients base and a reasonable gold standard . These criteria allow early diagnosis and severity grading of the disease and should be clinically useful in the management of this severe disease . Tg13 introduces a new standard for the diagnosis, severity grading and management of acute cholangitis . As compared with charcot s triad and tg07, validity of the diagnostic criteria
|
Microfluidics is the science and technology that deals with fluids usually in the range of microliters (10) to picoliters (10). Since microfluidics typically deals with fluids in the microliter scale, it has several advantages, including low consumption of samples, short analysis time, and high sensitivity [1 - 4]. The portability and fast processing speed of microfluidic devices also allows for in situ and real - time analysis . Polydimethylsiloxane (pdms) is commonly used for molding microfluidic chips because it is a transparent and biocompatible elastomer . The fabricating process of pdms - based microfluidic devices, which is based on soft lithography, consists of the following steps: (1) master fabrication steps, including spin coating of a photoresist film, exposure, and development to form the mold on a silicon substrate; (2) device fabrication steps, including pouring the pdms on the master, punching holes with a biopsy punch, and bonding the pdms structure to glass . Recently, paper - based microfluidic devices have been proposed as cheap, portable, and disposable devices [5 - 7]. Ever since this emerging discipline was introduced in the early 1990s, microfluidics has grown rapidly in the field of biomedical applications . Microfluidic devices are very useful tools for molecular separation, biochemical assays, drug screening, chromatography, and migration assays [10 - 14]. Lap - on - chip and organ - on - chip based on microfluidic devices have also been widely used for high - throughput screening applications . Microfluidic devices have not been widely used in urological research yet . However, some pioneering studies have been reported for bladder and prostate cancer detection, urine analysis, and sperm characterization . In this review, we will summarize research works that use microfluidics and discuss its application in urology . Microfluidics has been considered a promising tool to analyze cancer cells and tumor function owing to its high sensitivity, high throughput, and less material consumption . Microfluidic devices offer various microenvironments for cell culture, from 2-dimensional to complex 3-dimensional systems, and the complex coculture system . Various microfluidic platforms have been developed to understand cancer cell migration and metastasis under various conditions, such as varying chemical gradients and mechanical constraints (fig . 1). A microfluidic device to detect metastatic cancer cells based on their size and deformability was also fabricated . A microfluidic device has been developed for prostate and bladder cancer research for various procedures, including biomarker detection, characterization of cancer cells in various microenvironments, and circulating tumor detection . Prostate cancer is the most common type of cancer among males and the sixth most common cause of death in males . A prostatic - specific antigen (psa), which is one of the available biomarkers of prostate cancer, is widely used for the screening of prostate cancer . However, the conventional psa test has drawbacks, such as excessive sample consumption, restrictive control of the analytes in the reaction chamber, and lack of multiplexing capabilities . Therefore, the use of a microfluidic device has been considered an efficient approach to overcome these drawbacks . The microfluidic enzyme - linked immunosorbent assay was integrated with photodetectors to sense the free isoform of the psa with labeled antibodies by using all 3 detection modes . This integrated system showed enhanced reliability in signal acquisition and refined sensitivity even for low detection limits . This platform allowed for quick screening and contemporary detection of free and total psa using 2 different antibodies that are immobilized on a single chip . Bladder cancer is a common urologic cancer that has the highest recurrence rate among all other malignancies . The microfluidic - based microenvironment is a good model to investigate the tumor growth, metastasis, and dynamic interplay between the cells . The mitochondrial - related protein expression in the bladder cancer cells was investigated in coculture conditions using a microfluidic chip . A chip for the coculture of bladder tumor cells and fibroblasts was composed of 2 cell culture pools for human skin fibroblasts and the human bladder tumor cells . The pools were connected using microchannels and peripheral perfusion channels . Using this coculture system, it was observed that the high - energy metabolites transferred to adjacent tumor cells in a specified direction . To study the effects of the microenvironment on bladder cancer, the microfluidic device based on 4 types of cells coculture system was suggested . This system consisted of perfusion equipment, matrigel channel units, a medium channel, and four indirect contact culture chambers in which the 4 types of cells (stromal cells, fibroblasts, endothelial cells, and macrophages) could be cultured simultaneously . The changes in urine composition, such as the changes in the levels of glucose, albumin, creatinine, and uric acid, may provide information about organ dysfunctions, drug abuse, and exposure to chemicals and toxins . Conventional methods to examine urine samples are physical (color, odor, etc . ), biochemical, and microscopic examinations . Microfluidic devices are typically used in the manipulation of fluids with a small quantity of sample, under a precisely controlled flow rate . Therefore, they are very useful devices for urine sample pretreatments and sensing urinary molecules . Liquid extraction as a sample pretreatment device prior to carrying out gas chromatography analysis of the amphetamine - type stimulants in the urine (fig . The interface between the organic solvent and alkalized urine was stabilized by using the microchannels modified by a capillary - restricted modification method . Microfluidic devices have been used for the detection of urinary macromolecules, including protein, virus, and bacteria . Demonstrated the cost - effective detection of the bk virus (viral load) from nonpretreated urine samples using microfluidic devices . A detection sensitivity of as low as 12 viral copies was obtained by the integration of a small volume genetic amplification (polymerase chain reaction). Microfluidic devices for urinary micromolecules, including creatinine, galactose, and inorganic ions have also been demonstrated by several groups . For analyzing urinary creatinine, a microfluidic system based on a 2-point alkaline picrate kinetic reaction the microchip was connected to 2 syringes for delivering the samples, and it was connected to a miniature fiber optic spectrophotometer for measuring the absorption light at 510 nm . The integration of microfluidic devices with different approaches, including electrophoresis, optics, and immunoassays, was successfully used for detecting drugs and metabolites in urine samples . Caffeine and theophylline could be effectively separated using the microchannel electrophoresis integrated with electrochemical detection, and illicit drugs were detected with a high accuracy using the microfluidic device with an ultraviolet detection function . Many microfluidic systems have been proposed for quantifying sperm quality and sorting sperm by their motility . According to the principle, the microfluidic device for sperm sorting can be categorized into the following 3 groups: passively driven devices, flow - driven devices, and combined devices for thermotaxis and chemotaxis . The principle of passively driven devices is that motile sperm can be collected within a specific period of time in the outlet of the microfluidic channels, while less - motile sperm are left behind in the microchannels . In flow - driven devices the sperm are segregated into different channels depending on their motility and are counted thereafter . The combined microfluidic device with a chemoattractant was fabricated with a straight channel connected to a bi - branch channel . The sperm motility under the chemical gradient was monitored, and the chemotaxis was analyzed by using the ratio of the sperm collected in different branches . Microfluidics has been considered a promising tool to analyze cancer cells and tumor function owing to its high sensitivity, high throughput, and less material consumption . Microfluidic devices offer various microenvironments for cell culture, from 2-dimensional to complex 3-dimensional systems, and the complex coculture system . Various microfluidic platforms have been developed to understand cancer cell migration and metastasis under various conditions, such as varying chemical gradients and mechanical constraints (fig . 1). A microfluidic device to detect metastatic cancer cells based on their size and deformability was also fabricated . A microfluidic device has been developed for prostate and bladder cancer research for various procedures, including biomarker detection, characterization of cancer cells in various microenvironments, and circulating tumor detection . Prostate cancer is the most common type of cancer among males and the sixth most common cause of death in males . A prostatic - specific antigen (psa), which is one of the available biomarkers of prostate cancer, is widely used for the screening of prostate cancer . However, the conventional psa test has drawbacks, such as excessive sample consumption, restrictive control of the analytes in the reaction chamber, and lack of multiplexing capabilities . Therefore, the use of a microfluidic device has been considered an efficient approach to overcome these drawbacks . The microfluidic enzyme - linked immunosorbent assay was integrated with photodetectors to sense the free isoform of the psa with labeled antibodies by using all 3 detection modes . This integrated system showed enhanced reliability in signal acquisition and refined sensitivity even for low detection limits . This platform allowed for quick screening and contemporary detection of free and total psa using 2 different antibodies that are immobilized on a single chip . Bladder cancer is a common urologic cancer that has the highest recurrence rate among all other malignancies . The microfluidic - based microenvironment is a good model to investigate the tumor growth, metastasis, and dynamic interplay between the cells . The mitochondrial - related protein expression in the bladder cancer cells was investigated in coculture conditions using a microfluidic chip . A chip for the coculture of bladder tumor cells and fibroblasts was composed of 2 cell culture pools for human skin fibroblasts and the human bladder tumor cells . The pools were connected using microchannels and peripheral perfusion channels . Using this coculture system, it was observed that the high - energy metabolites transferred to adjacent tumor cells in a specified direction . To study the effects of the microenvironment on bladder cancer, the microfluidic device based on 4 types of cells coculture system was suggested . This system consisted of perfusion equipment, matrigel channel units, a medium channel, and four indirect contact culture chambers in which the 4 types of cells (stromal cells, fibroblasts, endothelial cells, and macrophages) could be cultured simultaneously . The changes in urine composition, such as the changes in the levels of glucose, albumin, creatinine, and uric acid, may provide information about organ dysfunctions, drug abuse, and exposure to chemicals and toxins . Conventional methods to examine urine samples are physical (color, odor, etc . ), biochemical, and microscopic examinations . Microfluidic devices are typically used in the manipulation of fluids with a small quantity of sample, under a precisely controlled flow rate . Therefore, they are very useful devices for urine sample pretreatments and sensing urinary molecules . Liquid extraction as a sample pretreatment device prior to carrying out gas chromatography analysis of the amphetamine - type stimulants in the urine (fig . The interface between the organic solvent and alkalized urine was stabilized by using the microchannels modified by a capillary - restricted modification method . Microfluidic devices have been used for the detection of urinary macromolecules, including protein, virus, and bacteria . Demonstrated the cost - effective detection of the bk virus (viral load) from nonpretreated urine samples using microfluidic devices . A detection sensitivity of as low as 12 viral copies was obtained by the integration of a small volume genetic amplification (polymerase chain reaction). Microfluidic devices for urinary micromolecules, including creatinine, galactose, and inorganic ions have also been demonstrated by several groups . For analyzing urinary creatinine, a microfluidic system based on a 2-point alkaline picrate kinetic reaction the microchip was connected to 2 syringes for delivering the samples, and it was connected to a miniature fiber optic spectrophotometer for measuring the absorption light at 510 nm . The integration of microfluidic devices with different approaches, including electrophoresis, optics, and immunoassays, was successfully used for detecting drugs and metabolites in urine samples . Caffeine and theophylline could be effectively separated using the microchannel electrophoresis integrated with electrochemical detection, and illicit drugs were detected with a high accuracy using the microfluidic device with an ultraviolet detection function . Many microfluidic systems have been proposed for quantifying sperm quality and sorting sperm by their motility . According to the principle, the microfluidic device for sperm sorting can be categorized into the following 3 groups: passively driven devices, flow - driven devices, and combined devices for thermotaxis and chemotaxis . The principle of passively driven devices is that motile sperm can be collected within a specific period of time in the outlet of the microfluidic channels, while less - motile sperm are left behind in the microchannels . In flow - driven devices the sperm are segregated into different channels depending on their motility and are counted thereafter . The combined microfluidic device with a chemoattractant was fabricated with a straight channel connected to a bi - branch channel . The sperm motility under the chemical gradient was monitored, and the chemotaxis was analyzed by using the ratio of the sperm collected in different branches . Although a microfluidic system has many advantages, it is still a relatively new technology in the field of urology research . Recently, some successful implementations of microfluidic devices have been demonstrated for cancer diagnosis, urine analysis, and sperm sorting . However, more promising microfluidic systems and research works are required for such systems to be applied in the clinic . Therefore, it is important to continue the development of this new technology in cooperation with the relevant users.
|
Because many prenatal disorders involve more than one organ, an important clue of prenatal diagnosis is to look for multiple anomalies . Therefore, finding a specific lesion commands detailed examination of the fetus to rule out a possible involvement of other organs . This approach is clinically important as identifying multiple lesions may impact on diagnosis, prognosis, and pregnancy / postnatal management . The aim of the present work was to report on two cases in which digestive tract occlusion or perforation was found to be associated with brain hemorrhage . In one fetus, finding this association modified the prognosis and the outcome of pregnancy, while in the other, it influenced the postnatal management . A 39yearold pregnant woman was referred to our multidisciplinary center of fetal medicine at 26 weeks of gestation for reevaluation of fetal intestinal dilatation and ascites . An amniocentesis performed at 21 weeks due to mother age was normal for a female fetus . On ultrasound (us), a meconial pseudocyst in the left flank of the fetus, ascites, and slight bowel dilatation (7 mm) were found (fig . The doppler study was normal for the umbilical artery and ductus venosus but it showed slight daily changes in the resistive index of the medial cerebral artery from 0.84 to 0.75 . Performed at 31 weeks, a sudden increase in bowel dilatation (15 mm) was observed . The mri performed on the next day, confirmed the presence of meconial pseudocyst, small bowel dilatation, and unused microcolon which likely developed in the context of perforation secondary to small bowel atresia . Because the mri reference scan showed an abnormal hyperintense t1 cerebral lesion, a focused brain mri was performed the week after, at 32 weeks . This examination demonstrated intraventricular hemorrhage and extensive intraparenchymal frontoparietal ischemic lesions, consistent with the diagnosis of grade 4 brain hemorrhage (fig . These lesions had most probably been overlooked at least on the us scan performed on the day before the first mri . A 26week and 4day axial us abdominal scan of the fetus 1 showing the meconial pseudocyst (between crosses) and the ascites (arrow). A 31week t2 weighted mri coronal slice of the brain of the same fetus showing the periventricular parenchymal ischemic lesions (arrow), the hemosiderin deposits in the subependymal region (arrow head), and the ex vacuo dilatation of the frontal horn of the lateral ventricle: grade 4 hemorrhage . After multidisciplinary discussion and complete information of the parents, they elected termination of pregnancy at 34 weeks because of the risk of cerebral palsy and poor abdominal prognosis . A 25yearold pregnant woman came to our fetal medicine center for routine second trimester us at 22 weeks . The amniocentesis revealed neither genetic anomalies nor infection . On subsequent us performed at 25 weeks, an intraventricular brain hemorrhage (fig ., we observed a progressive dilatation of the bowel loops and resolution of the effusions . The colon that should be clearly visible on third trimester us was never seen suggesting proximal bowel atresia . A comprehensive mri performed at 31 weeks investigated both regions, the fetal brain mri confirmed the grade 2 hemorrhage without parenchymal lesions and the abdominal mr sequences demonstrated a distal small bowel atresia with unused microcolon (fig . The loops dilatation increased to 30 mm diameter with heterogeneous content and slight abdominal effusion suggesting parietal damage . A caesarian delivery was performed on the same day giving birth to a 2620 g baby girl with good apgar score . The neonatal surgery confirmed an isolated distal small bowel atresia, with proximal intact loops, the atretic segment was resected, and a double ileostomy was done . A 25week axial us scan of the head of the fetus 2 showing subependymal hemorrhage (arrow) and the hyperechogenic wall of the lateral ventricle (arrow head): grade 2 hemorrhage . A 31week t2 weighted mri coronal scan of the fetus 2 showing normal fluid filled proximal loops (arrow) and dilated intermediate and distal loops attesting of the distal small bowel occlusion . We report on two cases of prenatal diagnosis of digestive tract occlusion or perforation that were found to be associated with brain hemorrhage; this significantly impacted on prognosis in one case and on postnatal management in the other . Different theories have been proposed to explain digestive tract atresia: for example, lack of vacuolization of the solid cord stage of intestinal development or ischemic insult to the midgut due to mesenteric vascular accident 1, 2 . The atresia can be isolated but may also be associated with meconium ileus, apple peel atresia, volvulus, or abdominal wall defect 3, 4 . Cystic fibrosis should be excluded as it is an associated condition in 740% of cases 5, 6 . Concomitant extraintestinal anomalies are less frequent, though one study reported extra abdominal malformations like congenital heart disease, down's syndrome, anorectal and vertebral anomalies, neural tube defect, microcephaly, and vesicoureteral reflux 7 . To our knowledge, the association of meconial peritonitis or ileal atresia with brain hemorrhage has never been described prenatally . A vascular insult responsible of the gut atresia could be associated with blood flow disturbance leading to cerebral hypoperfusion and subsequent injury 8, 9 . In case 1, the appearance of the brain ischemic lesion on mri at 31 weeks was compatible with vascular insult going back to a few weeks earlier . Experimental studies in fetal sheep 10 have shown that cerebrovascular immaturity may impair the ability to maintain constant cerebral blood flow over a wide range of changes in arterial blood pressure; this might also apply to human foetuses . Periventricular and subependymal regions that corresponded to the affected zones in our two fetuses are of greater susceptibility because of high metabolism and watershed vascular regions 11 . Another hypothesis explaining the rare association of meconial peritonitis and brain hemorrhage may be an intravascular meconial dissemination leading to endovascular occlusions by squamous cells . A neonatal case has been published associating meconium peritonitis, periventricular leukomalacia, and pulmonary hypertension leading to neonatal death secondary to respiratory insufficiency . Necropsy disclosed disseminated intravascular occlusions by squamous cells 12 . A case of twintotwin transfusion syndrome has also been reported; one twin presented meconium peritonitis and intravascular disseminated coagulation that led to intrauterine death of the other twin . These two possible pathogenic mechanisms could cause vascular disruption of the blood supply in multiple organs and hence explain the association we describe in the present report . These two rare cases associating digestive tract occlusion or perforation and brain hemorrhage give us the opportunity to emphasize the need for careful screening of the fetal brain in such acute abdominal conditions . Because brain lesions may be delayed, neonatologists and pediatricians should also be vigilant and prescribe transfontanellar us whenever a newborn has a history of bowel ischemia and/or perforation.
|
Design of primers for rt: we used clustalw to align the orfs and utrs of the 124 na - type prrsv strains for which complete genomic sequences were registered in public databases (ddbj / embl / genbank) (table s1 and fig . 1.phylogenetic relationships of 124 na - type prrsv strains obtained from public nucleotide databases (ddbj / embl / genbank). The phylogenetic tree was constructed according to the neighbor - joining method after using clustalw to analyze the nucleotide sequences of orf5 of these 124 strains . Strains were isolated from japan (closed circle), china (open triangles), the united states (open boxes) and south korea (open diamond). Bootstrap trials were conducted 1,000 times, and values exceeding 90% are shown at nodes . ). We then designed degenerate consensus rt primers within the conserved regions thus identified (table 1table 1.oligonucleotide primers used in this studyuseprimer namesequence (53)position (nt)cort - mdaorf1a_r1cgtccaccggagyggctcttc368 348orf1a_r2tgccarccrcarttcccktc1,507 1,488orf1a_r3gcgartcaaacycacaagca4,152 4,133orf1a_r4ggcgtccargcatgycccat6,292 6,273orf1a_r5tcytcrtaraacmcrtcacc7,366 7,347orf1b_r1gccatrgarttcytrgcvgggta8,550 8,528orf1b_r2atgtcaaadacrtarcaatg10,407 10,388orf1b_r3tacacrtcygtyartgtrca11,475 11,456gp2_rgcggtacrtyckrcgcgacaccat12,413 12,390gp5_rtcbgcygaaactytggtta14,361 14,343m_rtgccacccaacacgaggc14,839 14,822rt - pcr5utr_fatgwcgtataggtgtkggctctatg1 253utr_racggycvccctaattgaatagg15,361 15,340primer positions are described according to the genomic sequence of the reference strain edrd-1 (ab288356.1).). Phylogenetic relationships of 124 na - type prrsv strains obtained from public nucleotide databases (ddbj / embl / genbank). The phylogenetic tree was constructed according to the neighbor - joining method after using clustalw to analyze the nucleotide sequences of orf5 of these 124 strains . Strains were isolated from japan (closed circle), china (open triangles), the united states (open boxes) and south korea (open diamond). Bootstrap trials were conducted 1,000 times, and values exceeding 90% are shown at nodes . Primer positions are described according to the genomic sequence of the reference strain edrd-1 (ab288356.1). Preparation of genomic rna and cdna of viruses: viruses sequenced in the current study were strains edrd-1 (an na - type reference strain in japan [15, 29], cluster iii), nagasaki 11 - 14 (isolated in 2011, cluster i), jam2 (aomori 00; isolated in 2000, cluster ii), yamagata 10 - 7 (isolated in 2010, cluster iii) and aomori 10 - 5 (isolated in 2010, cluster iii) (fig . 2fig . The phylogenetic analysis was performed according to the neighbor - joining method by using the nucleotide sequences of orf5 determined according to clustalw . Bootstrap trials were conducted 1,000 times, and values exceeding 80% are shown at nodes . Closed circles indicate the strains sequenced by the cort - mda method in this study . ). Briefly, porcine alveolar macrophages and the monkey kidney cell line marc-145 were used for virus propagation . Propagated prrsv strains in supernatants of the infected cell cultures were concentrated by sucrose density - gradient centrifugation, and viral genomic rna was extracted with trizol reagent (life technologies, tokyo, japan). Approximately 1 g of the resulting rna was reverse - transcribed into first - strand cdna by using the consensus oligonucleotide primers (table 1) and superscript iii kit (life technologies) according to the manufacturer s instructions . The phylogenetic analysis was performed according to the neighbor - joining method by using the nucleotide sequences of orf5 determined according to clustalw . Bootstrap trials were conducted 1,000 times, and values exceeding 80% are shown at nodes . Closed circles indicate the strains sequenced by the cort - mda method in this study . Amplification and fragmentation of viral cdna: a 4-l aliquot of the first - strand viral cdna underwent multiple displacement amplification by using a repli - g ultrafast mini kit (qiagen, tokyo, japan) according to the manufacturer s instructions . A 10-l aliquot of the 20 l amplified dna product was digested with 1 unit s1 nuclease (promega, tokyo, japan) in 50 l of 1 s1 nuclease buffer at 37c for 30 min . The reaction was terminated by adding 1 l 0.3 m tris0.05 m edta (ph 8.0) and incubating for 10 min at 70c . The resultant dna was fragmented in a sonicator (duty cycle, constant; output control, 4; sonifier 250, branson ultrasonics, danbury, ct, u.s.a .) For 5 sec . The fragmented dna solution then was desalted (amicon ultra-0.5 ml 50k, merck millipore, billerica, ma, u.s.a . ). The ends of the fragmented dna were repaired and blunted by using 5 l 10 t4 dna polymerase buffer (life technologies), 12.5 l 2 mm dntp mixture and 10 units escherichia coli dna polymerase (life technologies) at room temperature for 1 hr, followed by treatment with 5 units of t4 dna polymerase (life technologies) at 37c for 5 min and at 75c for 20 min . A 25-l aliquot of the blunted dna was treated with 1 unit of calf intestine alkaline phosphatase (promega) and 1 unit of shrimp alkaline phosphatase (promega) at 37c for 1 hr . Approximately 1 to 2 kb of the dephosphorylated fragments were size - selected by using 1% seakem gtg agarose (cambrex, rockland, me, u.s.a .) And then extracted from the gel by using ultrafree da (merck millipore). Chloroform extraction, precipitated with ethanol and resuspended in 10 l of nuclease - free h2o . Shotgun sequencing: purified dna fragments were cloned into pcr4 blunt - topo (life technologies) according to the manufacturer s instructions, and 1 l of the resulting plasmid was introduced into dh10b (life technologies). Details regarding electroporation conditions, plasmid extraction, sequencing conditions and the sequence assembly method have been described previously [14, 22]. Briefly, plasmid dna from 192 clones cultured in terrific broth containing ampicillin was extracted and sequenced by using m13 - 40 (5- gttttcccagtcacgacgttg 3) and m13-reverse (5- ggaaacagctatgaccatg 3) primers . The chromatograms were basecalled by using phred [5, 6] and assembled by using cap3 . Evaluation of accuracy of the cort - mda method: we first evaluated the cort - mda method by sequencing edrd-1 [15, 29]. We obtained a contiguous sequence of 13,331 bp in length, comprising 257 shotgun reads and covering more than 86% of the entire reported edrd-1 genomic sequence (genbank accession number, ab288356.1). Because the sequence thus obtained lacked the 5- and 3-ends of the viral genome, we conducted pcr amplification using the consensus rt primers and edrd-1-specific primers (table s2) and sequenced the amplification products . Combining the data obtained by cort - mda shotgun sequencing with those from the pcr analysis yielded 15,311 bp of genomic sequence (excluding nucleotides corresponding to the consensus rt primers at both ends of the genomic sequence) (ab811785.1). The sequence of edrd-1 obtained by our cort - mda method was perfectly identical with that obtained by rt - pcr, which required 43 primer pairs (table s3). The edrd-1 virus sequenced in this study had 33 nucleotide substitutions in comparison with the sequence registered in ddbj / embl / genbank (ab288356.1), because of mutations acquired during in vitro passage (table 3table 3.mutations revealed through cort - mda sequencing of the edrd-1 strain relative to the reference sequence (ab288356.1) registered in public databases (ddbj / embl / genbank)nucleotideregionamino acidpositionreferencecort - mdareferencecort - mda158tc5-utr248gaorf1aee856acorf1ada864ctorf1ahy1,866ctorf1all1,879tcorf1ava2,165tcorf1aaa2,682gaorf1aek3,246tcorf1asp3,850ctorf1asf3,994caorf1asy4,998gaorf1ags5,822ctorf1add6,043tgorf1alr6,983tcorf1all7,897tcorf1bss7,962atorf1bhl8,033gaorf1bvi8,368gaorf1bkk8,650ctorf1bvv9,886ctorf1bgg11,104tcorf1bhh11,305gaorf1baa11,308ctorf1bss12,594taorf2yn13,368*ctorf3vvorf4sf13,746ctorf4ff13,837ctorf5ii13,874gaorf5dn13,996gaorf5ll14,598gaorf6vv15,059tgorf7ydpositions are indicated according to those in the reference sequence . * position 13,368 belongs to both orf3 and orf4; the corresponding respective amino acids are indicated . ). In addition, we found 2 subpopulations that had a and g, respectively, at nucleotide position 13,850 (ab811785.1) in the edrd-1 virus sequenced here . The mutated locations and nucleotides, including position 13,850, were identical between those obtained by the cort - mda method and rt - pcr (data not shown), demonstrating the accuracy of the sequence by the cort - mda method and its potential application to detecting ongoing mutations in the viral genome . * position 13,368 belongs to both orf3 and orf4; the corresponding respective amino acids are indicated . Applicability of the cort - mda method to various prrsv strains: next, we evaluated the applicability of the cort - mda method by sequencing 4 prrsv field strains belonging to various clusters classified according to their orf5 sequences [11, 28]. Viruses nagasaki 11 - 14 (isolated in 2011, cluster i), jam2 (aomori 00 isolated in 2000, cluster ii), yamagata 10 - 7 (isolated in 2010, cluster iii) and aomori 10 - 5 (isolated in 2010, cluster iii) underwent sequencing by the cort - mda method (fig . 2). More than 78% of the 384 shotgun sequencing reads were available for assembly (data not shown); this assembly generated either 1 (jam2 and yamagata 10 - 7) or 2 (aomori 10 - 5 and nagasaki 11 - 14) major contigs for each isolate and covered an estimated 80% to 94% of the entire prrsv genome (table 2table 2.summary of the assemblies of shotgun sequencing reads generated by the cort - mda methodstrainnumber of readslength (bp)position (nt)*edrd-125713,3311,831 15,161nagasaki 11 - 14877,081524 7,6051216,4178,712 15,128jam223312,3582,319 14,677yamagata 10 - 727714,458597 15,054aomori 10 - 51849,400964 10,370272,98810,616 13,606*positions of the contigs are indicated relative to the reference sequence edrd-1 (ab288356.1).). Sequencing of gaps between contigs and unread regions in the 5- and 3-utrs by pcr provided contiguous genomic sequences of 15,313 bp for nagasaki 11 - 14 (ab811786.1), 15,306 bp for jam2 (ab811787.1), 15,308 bp for yamagata 10 - 7 (ab811788.1) and 15,286 bp for aomori 10 - 5 (ab811789.1) (excluding pcr primer sequences at both ends of the genomic sequences). Dot - plot analyses by pipmaker of the 4 viral genome sequences thus obtained against the edrd-1 genome indicated that there were no inversions or low - similarity regions between the compared sequences (fig . S1). The data shown here demonstrate the robustness and applicability of the method for sequencing of na - type prrsvs in various clusters . * positions of the contigs are indicated relative to the reference sequence edrd-1 (ab288356.1). The cort - mda method for determining the genomic sequences of na - type prrsv isolates had several advantages in comparison with other sequencing methods . The cort - mda method requires far fewer oligonucleotide primers for amplification and sequencing of the prrsv genomes . Previous methods require numerous strain - specific primers for step - by - step primer walking [16, 19, 29]. The cort - mda method provides a simplified sequencing procedure involving only 11 consensus primers, which can be used for strains from multiple clusters . If unread regions remain after sequencing by the cort - mda method, only a few additional strain - specific primers are required to obtain the entire genomic sequence . Laborious iteration of sequencing is not required . The prrsv genomic sequence that we obtained by using the cort - mda method was highly accurate . Our method precisely detected mutations in the edrd-1 genome that were generated during passage, and these mutations were confirmed by the conventional pcr - based sequencing method . In this regard, our cort - mda method was able to detect ongoing mutations in the prrsv genome, indicating that the method can be applicable to tracing prrsv genomes, which are unstable and accumulate numerous mutations during a limited number of generations [8, 26, 30]. Most importantly, the cort - mda method is robust and versatile regardless of the genetic background of the na - type prrsv to be sequenced . Coding sequences of the prrsv genomes determined by the cort - mda method in this study showed identities from 84.0% (jam2 vs. yamagata 10 - 7) to 88.8% (edrd-1 vs. aomori 10 - 5), demonstrating that the method is applicable for sequencing viral genomes that are more than 10% divergent at the nucleotide level . The consensus primers for our method were designed by using the 124 full - length genomic sequences of na - type viruses, including isolates derived from the united states, china, korea and japan and several strains known to be hp - prrsvs . Therefore, our method likely can be used to determine the genomic sequence of any na - type prrsv virus strain, regardless of its country of origin and even if the strain is newly emerged . Our rapid, convenient and robust method for the sequencing of prrsv genomes will help greatly to elucidate the genetic factors that affect the pathogenicity of prrsvs by enabling detailed comparisons between the genomic sequences and virulence of different strains . The cort - mda method presented here includes a step for purification by ultracentrifugation through a sucrose gradient . However, if the ultracentrifugation step is dispensable, the method will obtain broader applicability, particularly in the case of samples derived from the field . Samples collected in the field or from piggeries under epidemic conditions of prrs such as viremic plasma from pigs reared in conventional environments are often contaminated with rna derived from other microorganisms and host animals . In the cort - mda method, the prrsv genome is converted into cdna, which is much more stable during transportation to laboratories than is the rna genome and can be amplified to the amount appropriate for shotgun sequencing . Furthermore, because of selective amplification of viral cdna by using prrsv - specific consensus primers, the cort - mda method can be modified for rna samples that are not highly purified . Further improvement of the cort - mda method may reduce the need for complicated sample - handling measures at the often insufficiently equipped facilities near epidemic areas . We conducted shotgun sequencing of the amplified viral cdnas according to the sanger method . The method thus presented can be conducted with traditional sequencers and computers without high specification . However, it is worth considering the use of next - generation sequencing technology, which is becoming popular and is potentially more cost - effective than is our current method . In addition, establishment of a cort - mda based sequencing method for eu - type prrsv strains is worth considering . A random pcr cloning approach that generated partial genomic sequences for an eu - type prrsv strain with an unknown genetic background was reported recently . However, the genomic sequence (before filling of gaps) obtained by using the random pcr cloning method was less than half of the entire prrsv genome, and the method s robustness in regard to viruses derived from various clusters has not been well confirmed . Development of the cort - mda - based sequencing method for eu - type strains will be beneficial for dissecting prrs outbreaks, because na- and eu - type strains cause analogous clinical signs and can be epidemic simultaneously in the same location . Regardless of the type or cluster to which the strain belongs, cort - mda based methodology will facilitate rapid identification of the prevailing prrsv isolate on an affected farm.
|
Goats are one of the most important livestock species in the world, mostly because of their meat and milk production . According to ibge (2010), the brazilian goat population was estimated at 9.31 million heads, with 90% of the animals being raised in the northeastern region of the country . In recent years, there have been increases in herd size and productivity (lopes et al ., 2012), but management practices still face many challenges, particularly with pedigree record keeping, which is of fundamental importance for adequate operation of production farms and genetic improvement programs . Correct pedigree information is essential for performing genetic evaluations, as errors lead to incorrect estimates and low accuracies of estimated breeding values (see maichomo et al ., 2008). Pedigree errors of about 10% may lead to reductions in selection response of two to three percent in dairy cattle (visscher et al ., 2002), while different studies have reported observed pedigree errors of up to 23% in cattle in several countries (christensen et al ., 1982; ron et al ., 1996; banos et al ., 2001; weller et al ., 2004; jimnez - gamero et al ., microsatellite markers have been used extensively for parentage control in different species and are recommended by the international society for animal genetics (isag) as they are highly abundant and informative, relatively inexpensive to use, and generate satisfactory results in tests for paternity exclusion (luikart et al ., 1999;, 2001; curi and lopes, 2002; carneiro et al ., 2007;, 2007; bolormaa et al ., 2008; reis et al ., 2008; carolino et al ., 2009;, 2010; zhang et al ., 2010; adamov et al ., 2011; saberivand et al ., 2011; estimated pedigree errors of more than 25% in gir cattle have been observed (baron et al ., 2002), while in sheep these have reached 15.5% (barnett et al ., 1999). Due to this, the brazilian ministry of agriculture livestock and supply (mapa) issued in 2004 norms requiring dna testing for herdbook registration of livestock, along with accreditation instructions for laboratories performing animal genetic identification with dna fingerprinting methods . Eight microsatellite markers (oarcp49; oarfcb11; oarae129; oarfcb304; maf214; omhc1; sps0113; d5s2) were listed at the time as required for both sheep and goat genotyping . Souza et al . (2012) evaluated the efficiency of this panel in a sample of santa ins hair sheep and obtained lower combined probabilities of exclusion (pec) than with other panels proposed by the authors . (2010) validated a panel of 11 microsatellite markers for paternity testing of brazilian goats, with combined probabilities of exclusion (pec) of paternity of 0.999591 and 0.988375, in cases where the maternal genotype was known or unknown, respectively . When used to evaluate a group of registered goats, this particular set of markers detected 10% of paternity errors . Although this was a recent study, none of the markers used are present in the list sanctioned by mapa in 2004 . The present study was performed to evaluate the efficiency of a panel of 16 microsatellite markers, including the eight recommended by mapa (2004), in parentage testing of brazilian goats from four commercial and four naturalized breeds . This study is part of the brazilian dairy goat breeding plan (dgbp), an initiative coordinated by embrapa goat and sheep, and has as partners universities and the association of goat and sheep breeders of minas gerais state (caprileite / accomig). The main objective of this plan is to structure a community based dairy goat national databank and conduct progeny tests for the main dairy goat breeds raised in the country (fac et al ., 2011; a total of 120 samples of genomic dna from locally adapted goat breeds: canind (ca, n = 16), marota (ma, n = 23), moxot (mo, n = 22) and repartida (re, n = 16); as well as samples from commercial breeds: saanen (sa, n = 17); alpine (al, n = 06), anglo nubian (an, n=04) and mambrina (mb, n = 16); were used . Of these, 102 samples were derived from the dna and tissue gene bank maintained by embrapa recursos genticos e biotecnologia and were used to create the allele frequency databank (training dataset) for obtaining the parentage estimates . The remaining 18 samples were obtained from the association of goat and sheep breeders of minas gerais (caprileite / accomig). A total of six known trios from the saanen (n = 4) and alpine (n = 2) breeds were also included . The trios were formed each by a buck, doe and kid, and the trios were independently sampled throughout the farms covered by acoomg . A total of 16 microsatellites were used in the study: eight markers were recommended by mapa (mapa, 2004), five were derived from the fao / isag panel (isag, 2010) for goat parentage testing, and three were derived from the fao (2011) panel recommended for studies with genetic diversity in sheep and goats (table 1). Amplification of the markers was carried out using the master mix kit for pcr - multiplex (qiagen), following manufacturer s recommendations, using 4.5 ng genomic dna and 0.050.15 m of each primer, at a final volume of 5 l . Amplification conditions were: 95 c for 15 min, 35 cycles at 95 c for 5 min, 57 c for 90 s and 72 c for 1 min, followed by a final extension step of 72 c for 30 min . Information regarding expected allele sizes for each marker, fluorescent label, multiplex and type of marker in the mapa-2004 and complementary panels (pc) are presented in table 1 . Amplified fragments were separated in an automated sequencer (abi prism 3100, applied biosystems), and generated data was analyzed with genescan v.3.1 and genotyper v.3.7.0.1 (applied biosystems) software for allele and genotype calling . Cervus v.3.0.3 software (marshall et al ., 1998) was used to obtain estimates of allele number (na), observed (ho) and expected (he) heterozygosity (nei, 1978), polymorphism information content (pic) (botstein et al ., 1980), and frequency of null alleles (fan) for each marker . The probability of exclusion considering only offspring and probable sire (pe1) and a known parent (pe2), and the probability of identity (pi) were estimated for each marker and for three distinct marker panels: panel 1 - all 16 markers; panel 2 - eight markers recommended by mapa (2004); and panel 3 - seven markers with highest pic and pi (ilsts87; omhc1; tcrvb6; mcm527; inra172; oarfcb11; oarae129). An exact test using a markov chain implemented in genepop software (raymond and rousset, 1995) was used to test for hardy - weinberg equilibrium (hwe) at each marker (guo and thompson, 1992). The test (delta) in cervus (marshall et al ., 1998) was used to estimate the confidence of informed paternity . Two simulations for each panel were carried out for correct identification of the probable sire: (1) identification of sire without dam information, and (2) no parental information . In the simulations, 10,000 progeny were used considering the same number of male and female candidates (n = 5) and with 100% of candidate parents sampled . The proportion and minimum quantity of markers genotyped were 91% and 10 markers, respectively, when considering the full panel . For the reduced panels, the minimum number of markers genotyped was six (mapa, 2004) and five (most informative markers), respectively . The genotyping error was set at 1%, and strict and relaxed confidence levels were specified as 95% and 80%, respectively . A paternity test was carried out wherein the most probable sire was confirmed based on lod scores greater than zero and the true sire presenting the highest lod score . All 16 markers amplified polymorphic fragments in the eight tested breeds (table 2) of the training dataset . In some breeds, the markers sps0113 (alpine), oarcp49 (moxot, anglo nubian, marota and mambrina), ilsts11 (repartida), and d5s2 (marota and mambrina) showed amplification problems, generating outlier allelic patterns . To avoid genotyping errors, some genotypes of the referred markers were excluded from further statistical analysis . The number of alleles varied from four (sps0113, d5s2 and oarcp49) to 18 (oarfcb11). D5s2 presented the lowest values for all parameters analyzed and was the only marker which remained in hwe (p> 0.05), while all other markers showed significant deviations from hwe (p <0.05). The highest expected heterozygosity (he) was found for markers tcrvb6 (0.83) and omhc1 (0.83). Three markers were found to be the most informative, with highest probabilities of exclusion and identity, and pic (oarfcb11, omhc1, and tcrvb6). Panel 3 showed the highest number of alleles (10.43), ho (0.66), he (0.80), pic (0.77) and pit (87.26%). Although panel 1 showed a lower estimated mean number of alleles, higher ho, he, and pic estimates were observed in comparison with panel 2 . Estimated pec1 and pec2 were higher for panel 1 than for panels 2 and 3 (table 3). In general it was observed that locally adapted brazilian breeds showed higher values than commercial breeds for every genetic index used (table 4). For the probability of identity brazilian caninde (ca) and repartida (re) breeds showed values higher than the mean for he, pic, for he, pic, as well as pec1 and 2 (probability of exclusion 1 and probability of exclusion 2), while the moxoto (mo) breed showed the highest number of alleles (5.25). For the parentage test validation it was possible to obtain results from five of the six trios analyzed, and in 100% of the cases the correct father was assigned for each of the five trios with a strict level of confidence (95%), and with either panel 1 or 2 . Panel 3 could only be used to solve 80% of the cases (four trios) at a 95% restricted confidence level . No incompatibilities between genotypes of all five trios were observed with panel 2, while for the other two panels, the marker oarfcb304 showed small inconsistencies in two trios . Nevertheless, these issues did not significantly affect the combined exclusion power of the panels (table 3). Goat parentage verification tests are becoming routine in brazil as the sector is experiencing a production growth and a re - organization of the main actors of the supply chain (farmers, government and breed associations). The microsatellite panel sanctioned by mapa in 2004 for sheep and goat parentage verification in brazil was based on available literature at the time (luikart et al ., 1999; arranz et al ., 2001; stahlberger - saitbekova et al ., 2001; tomasco et al ., 2002; rychlik et al ., 2003) and did not consider updates developed by the international society of animal genetics and the genetic diversity of brazilian breeds . Souza et al . (2012) evaluated this panel in santa ins sheep and found that some of the used markers were not very informative due to the low number of observed alleles, pic, and consequently, the low individual and combined probability of exclusion of the markers in the panel . Markers sps0113, d5s2 and oarcp49, which are part of the mapa 2004 recommended panel, showed the lowest numbers of observed alleles in the present study (table 2), and therefore should be replaced by more informative markers . The lowest number of alleles (na = 4) was observed for markers d5s2, sps0113 and oarcp49, which were all part of the mapa 2004 recommended panel . Markers ilsts11, ilsts87, tcrvb6, inra63, inrabern172, sps0113, oarfcb11, oarae129 and oarfcb304, five of which are included in the mapa 2004 panel, showed fan greater than 0.05 (table 2) and, according to marshall et al . (1998), should not be used for paternity testing as they tend to have reduced heterozygosity . High frequencies of null alleles lead to high rates of genotyping errors of heterozygotes, resulting in incorrect exclusions of dam - offspring or sire - offspring pairs . Panel 3 showed a he of 80%, while in panels 1 and 2 observed values were close to 70% (table 3). The lowest heterozygosity estimates (ho and he) were seen for d5s2 (0.053 and 0.054), which remained in a state of hwe, while the other markers showed differences in observed and expected genotype frequencies that led to significant hwe deviations (p <0.05; table 2). These deviations may be due to matings of closely related animals, as well as other unknown population sub - structuring . The mean pic value was highest for panel 3 (0.77), which also showed the highest mean number of observed alleles (10.43, table 3). As the pic value is totally dependent on microsatellite frequencies this should not be the only parameter used for selection or exclusion of a marker for use in a panel for genetic analysis (moazami - goudarzi et al ., 1994). The effectiveness of the panel was also analyzed by the probability of exclusion (pe) which is a parameter widely used for verification of pedigree (arajo et al ., 2010; stevanovic et al ., 2010; zhang et al ., 2010; adamov et al . The analysis for the panel of 16 markers confirmed paternity with pec1 and pec2 equal to 99.98% and 99.99%, respectively (table 3). In the other evaluated panels, pec1 and pec2 were less than 99.98%, confirming exclusion probabilities obtained by souza et al . (2012) for santa ins sheep (99.708% and 99.799 for pec1 and pec2, respectively) using the mapa 2004 panel, and above 99.99% for both probabilities when the number of markers was increased to 23 . In commercial goat breeds, the lower values obtained for the parameters studied (nam, he, pic, pec1 and pec2) may be the result of selection pressure that resulted in a loss of genetic diversity when compared with these parameters in brazilian local adapted goat breeds, as well the low number of founder animals analyzed . Among specialized goat breeds, only the mambrina (mb) showed optimal pec2 (99.99%), while for all brazilian goat breeds pec2 was above 99.9% (table 4). (1999) found that the probability of exclusion reached 99.99% for saanen (sa). (2010) observed an exclusion probability greater than 99.99% with 11 markers in three goat breeds (saanen, alpine and moxot). The obtained probability of identification (pi) estimates were> 99.99% in all studied breeds . Therefore, the three panels may be useful for identification of any individual belonging to these breeds (table 4). However, to minimize costs and time, markers with the lowest probabilities of identity (d5s2 and oarcp49) should be excluded from further studies . Panel 1 showed adequate paternity exclusion power in the evaluated goat breeds and could be used efficiently to verify and estimate parentage error rates in herds included in the national dairy goat genetic evaluation and breeding programs led by embrapa . In addition, any of the three evaluated panels could be efficiently used for individual identification, as all three panels showed accuracy above 99.9% . In the second semester of 2012, mapa published a new list of 17 microsatellites (mapa, 2012) from which a minimum of eleven markers should be used for parentage testing . This new panel maintained three markers used in the original panel and contains five markers from the fao diversity (2011) or isag paternity (2011) panels . Three of the markers in the full panel studied here (oarfcb11, ilsts087 and mcm527) are included in this new mapa panel . However, three other makers (omhc1, oare129 and oarfcb304), which were part of the original mapa 2004 panel, have been removed from the newer list . Markers included in the mapa 2012 panel, such as srcrsp5, inrabern172 and inra63 presented low pic (<0.7) and pi (<0.9) in the present study, which corroborates results reported by arajo et al . Markers (oarcp49 and d5s2) indicate in our study to be highly informative in the tested breeds, were removed from the new panel (mapa 2012), while other markers found to be less informative (srcrsp5, ilsts005, inrabern172 and inra63) were maintained . Changes in established parentage verification panels can lead to major financial impacts for farmers, as reproductively active animals that have been genotyped with the old panel have to be re - tested with the new additional markers . Mcclure et al . (2012) addressed these issues, emphasizing that new genotyping requirements can face major limitations, especially when considering historic animals without a viable dna source due to culling, death, or change in ownership of the animal . Recent advances in the use of genomic technologies are profoundly impacting several livestock industries around the world . The widespread use of low - cost high density snp marker panels in routine genetic evaluations and breeding programs are driving a paradigm shift to a new structure in which microsatellite marker data is no longer needed for paternity testing . Studies validating imputation methods to transpose microsatellite data from historical animals to snps contained in commercial panels now routinely used for testing registered cattle and sheep have been reported (mcclure et al ., 2012). Although this transition should be slower for goats, it can be expected that these new technologies should be fully embraced within less than ten years.
|
This analysis was conducted in the context of an ongoing observational study of early events in the natural history of type 2 diabetes in which a cohort of women recruited at the time of antepartum screening for gdm is undergoing longitudinal metabolic characterization in pregnancy and the postpartum period . The study protocol has been previously described in detail (6,7). In brief, standard obstetrical practice at our institution involves universal screening for gdm in all pregnant women at 2428 weeks gestation by 50-g glucose challenge test (gct), followed by a diagnostic oral glucose tolerance test (ogtt) if the gct yields an abnormal result . In this study, regardless of the gct result, all study participants undergo a 3-h 100-g ogtt to determine their glucose tolerance status in pregnancy . At 3 months postpartum, participants undergo reassessment by 2-h 75-g ogtt . The study protocol has been approved by the mount sinai hospital research ethics board, and all participants have provided written informed consent . For the current analysis, the study population was restricted to women of caucasian, asian, or south asian ethnicity because these are the three groups for which canadian - based ethnicity - specific birth weight centiles are available (8,9). The analysis was further restricted to only those women with singleton pregnancies (n = 562) because multiple gestation pregnancy (i.e., twins) can affect fetal growth . As previously described (6), the antepartum 3-h 100-g ogtt determined glucose tolerance status in pregnancy as follows: 1) gdm (defined as 2 glucose values above the national diabetes data group [nddg] diagnostic criteria on the ogtt) (10), 2) gestational impaired glucose tolerance (defined as only 1 glucose value above nddg thresholds), and 3) normal glucose tolerance (ngt; no glucose values above nddg thresholds). At delivery, data on obstetrical outcome were entered into a database that tracks labor and delivery outcomes at mount sinai hospital . Lga was defined as sex - specific birth weight for gestational age above the 90th percentile of canadian fetal growth curves for the ethnic group under study (caucasian, asian, or south asian) (8,9). Macrosomia was defined as birth weight 4,000 g. at 3 months postpartum, participants returned for a 2-h 75-g ogtt, on which glucose tolerance status was defined according to canadian diabetes association guidelines (11). Prediabetes refers to impaired glucose tolerance, impaired fasting glucose, or combined impaired glucose tolerance and impaired fasting glucose (11). Interviewer - administered questionnaires were completed and physical examination was performed, including measurement of blood pressure, weight, and waist circumference, as previously described (6). All ogtts were performed in the morning after an overnight fast, with venous blood samples drawn for measurement of glucose and insulin at fasting and at 30, 60, and 120 min (and 180 min in pregnancy) after ingestion of the glucose load . At both baseline and follow - up, glycemia was assessed by glucose tolerance status and by the total area under the glucose curve (aucgluc) during the ogtt . The primary measure of whole - body insulin sensitivity was the insulin sensitivity index (isogtt) of matsuda and defronzo (12). Isogtt is defined as 10,000/[(fpg fpi) (g i)], where fpg is fasting plasma glucose, fpi is fasting plasma insulin, g is mean glucose during the ogtt, and i is mean insulin . Insulin sensitivity (primarily hepatic) was also determined by the inverse of the homeostasis model of assessment of insulin resistance (1/homa - ir). Homa - ir was calculated as (fpg fpi)/22.5 (13). The primary measure of -cell function was the insulin secretion - sensitivity index-2 (issi-2), an ogtt - derived measure that is analogous to the disposition index and defined as the product of 1) insulin secretion measured by the ratio of the area under the insulin curve (aucins) to aucgluc and 2) insulin sensitivity measured by isogtt (14). The insulinogenic index divided by homa - ir (insulinogenic index / homa - ir) provided a secondary measure of -cell function (with insulinogenic index defined as the ratio of the incremental change in insulin during the first 30 min of the ogtt to the incremental change in glucose over the same time period) (15). Continuous variables were tested for normality of distribution, and natural log transformations of skewed variables were used, where necessary, in subsequent analyses . The study population was stratified into the following three groups based on glucose tolerance status on the antepartum ogtt and the presence / absence of lga delivery: 1) women with neither gdm nor lga delivery (nongdm), 2) women without gdm but with lga delivery (nongdm lga), and 3) women with gdm . In both tables 1 and 2, continuous variables were compared across the groups by analysis of variance, and categorical variables were compared by or fisher exact test . For continuous variables, pairwise comparisons were performed with the bonferroni method to determine if significant differences existed between any pair of groups . 1d) were compared between groups by analysis of covariance, after adjustment for age, months postpartum, ethnicity, family history of diabetes, breastfeeding, and waist circumference . Logistic regression analysis was performed to determine whether gdm and nongdm lga predicted postpartum prediabetes / diabetes, after adjustment for age, months postpartum, ethnicity, family history of diabetes, breastfeeding, waist circumference, and study group . Lga, and gdm women data for continuous variables are medians followed by interquartile range in parentheses, with the exception of age, which is presented as mean sd . P values refer to the overall differences across groups as derived from anova for continuous variables (parametric test for normally distributed variables and nonparametric test for skewed variables) and test or fisher exact test for categorical variables . Lga, and gdm women data for continuous variables are medians followed by interquartile range in parentheses . P values refer to the overall differences across groups as derived from anova for continuous variables (parametric test for normally distributed variables and nonparametric test for skewed variables) and test or fisher exact test for categorical variables . . Adjusted mean levels of fasting glucose (a), aucgluc (b), isogtt (c), and issi-2 (d) by group at 3 months postpartum, adjusted for age, time since delivery, ethnicity, family history of diabetes, breastfeeding status, and waist circumference . Overall p values are p <0.0001 for each of a, b, and d, respectively, and p = 0.0006 for c. * p <0.05 for the indicated pairwise comparison . As previously described (6), the antepartum 3-h 100-g ogtt determined glucose tolerance status in pregnancy as follows: 1) gdm (defined as 2 glucose values above the national diabetes data group [nddg] diagnostic criteria on the ogtt) (10), 2) gestational impaired glucose tolerance (defined as only 1 glucose value above nddg thresholds), and 3) normal glucose tolerance (ngt; no glucose values above nddg thresholds). At delivery, data on obstetrical outcome were entered into a database that tracks labor and delivery outcomes at mount sinai hospital . Lga was defined as sex - specific birth weight for gestational age above the 90th percentile of canadian fetal growth curves for the ethnic group under study (caucasian, asian, or south asian) (8,9). Macrosomia was defined as birth weight 4,000 g. at 3 months postpartum, participants returned for a 2-h 75-g ogtt, on which glucose tolerance status was defined according to canadian diabetes association guidelines (11). Prediabetes refers to impaired glucose tolerance, impaired fasting glucose, or combined impaired glucose tolerance and impaired fasting glucose (11). Interviewer - administered questionnaires were completed and physical examination was performed, including measurement of blood pressure, weight, and waist circumference, as previously described (6). All ogtts were performed in the morning after an overnight fast, with venous blood samples drawn for measurement of glucose and insulin at fasting and at 30, 60, and 120 min (and 180 min in pregnancy) after ingestion of the glucose load . At both baseline and follow - up, glycemia was assessed by glucose tolerance status and by the total area under the glucose curve (aucgluc) during the ogtt . The primary measure of whole - body insulin sensitivity was the insulin sensitivity index (isogtt) of matsuda and defronzo (12). Isogtt is defined as 10,000/[(fpg fpi) (g i)], where fpg is fasting plasma glucose, fpi is fasting plasma insulin, g is mean glucose during the ogtt, and i is mean insulin . Insulin sensitivity (primarily hepatic) was also determined by the inverse of the homeostasis model of assessment of insulin resistance (1/homa - ir). The primary measure of -cell function was the insulin secretion - sensitivity index-2 (issi-2), an ogtt - derived measure that is analogous to the disposition index and defined as the product of 1) insulin secretion measured by the ratio of the area under the insulin curve (aucins) to aucgluc and 2) insulin sensitivity measured by isogtt (14). The insulinogenic index divided by homa - ir (insulinogenic index / homa - ir) provided a secondary measure of -cell function (with insulinogenic index defined as the ratio of the incremental change in insulin during the first 30 min of the ogtt to the incremental change in glucose over the same time period) (15). Continuous variables were tested for normality of distribution, and natural log transformations of skewed variables were used, where necessary, in subsequent analyses . The study population was stratified into the following three groups based on glucose tolerance status on the antepartum ogtt and the presence / absence of lga delivery: 1) women with neither gdm nor lga delivery (nongdm), 2) women without gdm but with lga delivery (nongdm lga), and 3) women with gdm . In both tables 1 and 2, continuous variables were compared across the groups by analysis of variance, and categorical variables were compared by or fisher exact test . For continuous variables, pairwise comparisons were performed with the bonferroni method to determine if significant differences existed between any pair of groups . Adjusted mean levels of fasting glucose (fig . 1d) were compared between groups by analysis of covariance, after adjustment for age, months postpartum, ethnicity, family history of diabetes, breastfeeding, and waist circumference . Logistic regression analysis was performed to determine whether gdm and nongdm lga predicted postpartum prediabetes / diabetes, after adjustment for age, months postpartum, ethnicity, family history of diabetes, breastfeeding, waist circumference, and study group . Lga, and gdm women data for continuous variables are medians followed by interquartile range in parentheses, with the exception of age, which is presented as mean sd . P values refer to the overall differences across groups as derived from anova for continuous variables (parametric test for normally distributed variables and nonparametric test for skewed variables) and test or fisher exact test for categorical variables . Lga, and gdm women data for continuous variables are medians followed by interquartile range in parentheses . P values refer to the overall differences across groups as derived from anova for continuous variables (parametric test for normally distributed variables and nonparametric test for skewed variables) and test or fisher exact test for categorical variables . P <0.05 for nongdm vs. gdm . Adjusted mean levels of fasting glucose (a), aucgluc (b), isogtt (c), and issi-2 (d) by group at 3 months postpartum, adjusted for age, time since delivery, ethnicity, family history of diabetes, breastfeeding status, and waist circumference . Overall p values are p <0.0001 for each of a, b, and d, respectively, and p = 0.0006 for c. * p <0.05 for the indicated pairwise comparison . Table 1 shows the antepartum characteristics and obstetrical outcomes of the nongdm (n = 364), nongdm lga (n = 46), and gdm (n = 152) groups . The groups differed slightly in weeks gestation at the time of the antepartum ogtt, which was highest in the nongdm group (p = 0.0003). They did not differ with respect to age, parity, previous history of gdm, or smoking exposure . There were differences between the groups in established risk factors for gdm, including ethnicity (p = 0.0185), family history of diabetes (p = 0.0022), and prepregnancy bmi (p = 0.0054). In addition, gestational weight gain up to the ogtt differed among the three groups, being lowest in the women with gdm (p = 0.0001). As would be expected in pregnancy, there were significant overall differences across the three groups with respect to glycemia (gct, fasting glucose, and aucgluc), insulin sensitivity (isogtt and 1/homa - ir), and -cell function (issi-2 and insulinogenic index / homa - ir) (all p <0.0001), consistent with the metabolic features of hyperglycemia, insulin resistance, and -cell dysfunction that characterize gdm . However, it is important to note that these significant differences across the groups were driven primarily by pairwise differences between the gdm and nongdm groups and between the gdm and nongdm lga groups . Indeed, the only significant differences between the two nongdm groups were higher fasting glucose and lower issi-2 in the nongdm lga women, albeit in the absence of differences between these two groups in the other measures of glycemia (gct and aucgluc) and -cell function (insulinogenic index / homa - ir), respectively . At delivery, birth weight was highest in the nongdm lga women, reflecting both the group definitions and the effect of glucose - lowering treatment in women with gdm . The groups differed in the length of gestation, which was lowest in the gdm women (overall p <0.0001). At 3 months postpartum (table 2), there were differences between the groups in waist circumference and systolic blood pressure (p = 0.0363 and p = 0.0033, respectively), but not in bmi, diastolic blood pressure, smoking, breastfeeding, and months since delivery . Of note, there were significant overall differences across the groups for all parameters of postpartum glucose homeostasis: isogtt, 1/homa - ir, issi-2, insulinogenic index / homa - ir, fasting glucose, and aucgluc (p <0.0001 for all except 1/homa - ir at p = 0.0052). As before, however, these overall differences were driven by significant pairwise differences between the gdm women and 1) the nongdm group and 2) the nongdm lga group, respectively . Indeed, there were no significant differences in glycemia, insulin sensitivity, and -cell function between the two nongdm groups at 3 months postpartum . To further evaluate postpartum metabolic function in women with nongdm lga, we next compared adjusted mean levels of fasting glucose, aucgluc, isogtt, and issi-2 between the groups, after adjustment for age, time since delivery, ethnicity, family history of diabetes, breastfeeding, and waist circumference (fig . 1a, adjusted mean fasting glucose differed across the groups (p <0.0001). Specifically, adjusted fasting glucose was higher in the women with gdm compared with each of the nongdm groups (both p <0.05) but was not significantly different between the nongdm and nongdm lga women . Moreover, the very same pattern was observed for aucgluc, which was again significantly higher in the gdm group but not different between the two nongdm groups (fig . This pattern of gdm differing from the nongdm groups, which themselves were similar to one another, was also apparent with respect to whole - body insulin sensitivity . Indeed, when compared with the gdm women, mean adjusted isogtt was significantly higher in the nongdm and nongdm lga groups, respectively (both p <0.05), but did not differ between these two groups (fig . In addition, 1/homa - ir, which reflects primarily hepatic insulin sensitivity, was not significantly different between the groups (p = 0.08). Finally, with respect to -cell function, mean adjusted issi-2 was higher in the nongdm and nongdm lga women, as compared with gdm (both p <0.05), with no significant difference between the two nongdm groups (fig . These findings were mirrored by those for insulinogenic index / homa - ir, which was again higher in the nongdm and nongdm lga women compared with gdm (both p <0.05), with no difference between the nongdm groups (p = 0.99). 1 were unchanged when these adjusted analyses were repeated with adjustment for bmi rather than waist circumference (supplementary fig . 1 were repeated with exclusion of the four women who were using progesterone - only birth control, the findings again remained unchanged (data not shown). It thus emerges that at 3 months postpartum, the metabolic function of women with nongdm lga is better than that of women with gdm but not different from that of women who had neither gdm nor lga delivery . At 3 months postpartum glucose tolerance status differed across the three groups (p <0.0001), with the gdm group showing the highest prevalence of prediabetes / diabetes (table 2). To account for the potential influence of covariates on the relationship between study group and postpartum dysglycemia, we performed logistic regression analysis of dependent variable glucose intolerance at 3 months postpartum (i.e., prediabetes / diabetes). On this analysis, gdm independently predicted postpartum glucose intolerance (odds ratio 4.1 [95% ci 2.56.8]; p <0.0001), after adjustment for age, months postpartum, ethnicity, family history of diabetes, breastfeeding, and waist circumference . Lga was not a significant predictor of postpartum glucose intolerance (odds ratio 1.7 [0.74.1]; p = 0.65). Table 1 shows the antepartum characteristics and obstetrical outcomes of the nongdm (n = 364), nongdm lga (n = 46), and gdm (n = 152) groups . The groups differed slightly in weeks gestation at the time of the antepartum ogtt, which was highest in the nongdm group (p = 0.0003). They did not differ with respect to age, parity, previous history of gdm, or smoking exposure . There were differences between the groups in established risk factors for gdm, including ethnicity (p = 0.0185), family history of diabetes (p = 0.0022), and prepregnancy bmi (p = 0.0054). In addition, gestational weight gain up to the ogtt differed among the three groups, being lowest in the women with gdm (p = 0.0001). As would be expected in pregnancy, there were significant overall differences across the three groups with respect to glycemia (gct, fasting glucose, and aucgluc), insulin sensitivity (isogtt and 1/homa - ir), and -cell function (issi-2 and insulinogenic index / homa - ir) (all p <0.0001), consistent with the metabolic features of hyperglycemia, insulin resistance, and -cell dysfunction that characterize gdm . However, it is important to note that these significant differences across the groups were driven primarily by pairwise differences between the gdm and nongdm groups and between the gdm and nongdm lga groups . Indeed, the only significant differences between the two nongdm groups were higher fasting glucose and lower issi-2 in the nongdm lga women, albeit in the absence of differences between these two groups in the other measures of glycemia (gct and aucgluc) and -cell function (insulinogenic index / homa - ir), respectively . At delivery, birth weight was highest in the nongdm lga women, reflecting both the group definitions and the effect of glucose - lowering treatment in women with gdm . The groups differed in the length of gestation, which was lowest in the gdm women (overall p <0.0001). At 3 months postpartum (table 2), there were differences between the groups in waist circumference and systolic blood pressure (p = 0.0363 and p = 0.0033, respectively), but not in bmi, diastolic blood pressure, smoking, breastfeeding, and months since delivery . Of note, there were significant overall differences across the groups for all parameters of postpartum glucose homeostasis: isogtt, 1/homa - ir, issi-2, insulinogenic index / homa - ir, fasting glucose, and aucgluc (p <0.0001 for all except 1/homa - ir at p = 0.0052). As before, however, these overall differences were driven by significant pairwise differences between the gdm women and 1) the nongdm group and 2) the nongdm lga group, respectively . Indeed, there were no significant differences in glycemia, insulin sensitivity, and -cell function between the two nongdm groups at 3 months postpartum . To further evaluate postpartum metabolic function in women with nongdm lga, we next compared adjusted mean levels of fasting glucose, aucgluc, isogtt, and issi-2 between the groups, after adjustment for age, time since delivery, ethnicity, family history of diabetes, breastfeeding, and waist circumference (fig . 1a, adjusted mean fasting glucose differed across the groups (p <0.0001). Specifically, adjusted fasting glucose was higher in the women with gdm compared with each of the nongdm groups (both p <0.05) but was not significantly different between the nongdm and nongdm lga women . Moreover, the very same pattern was observed for aucgluc, which was again significantly higher in the gdm group but not different between the two nongdm groups (fig . This pattern of gdm differing from the nongdm groups, which themselves were similar to one another, was also apparent with respect to whole - body insulin sensitivity . Indeed, when compared with the gdm women, mean adjusted isogtt was significantly higher in the nongdm and nongdm lga groups, respectively (both p <0.05), but did not differ between these two groups (fig . In addition, 1/homa - ir, which reflects primarily hepatic insulin sensitivity, was not significantly different between the groups (p = 0.08). Finally, with respect to -cell function, mean adjusted issi-2 was higher in the nongdm and nongdm lga women, as compared with gdm (both p <0.05), with no significant difference between the two nongdm groups (fig . These findings were mirrored by those for insulinogenic index / homa - ir, which was again higher in the nongdm and nongdm lga women compared with gdm (both p <0.05), with no difference between the nongdm groups (p = 0.99). 1 were unchanged when these adjusted analyses were repeated with adjustment for bmi rather than waist circumference (supplementary fig . 1 were repeated with exclusion of the four women who were using progesterone - only birth control, the findings again remained unchanged (data not shown). It thus emerges that at 3 months postpartum, the metabolic function of women with nongdm lga is better than that of women with gdm but not different from that of women who had neither gdm nor lga delivery . At 3 months postpartum glucose tolerance status differed across the three groups (p <0.0001), with the gdm group showing the highest prevalence of prediabetes / diabetes (table 2). To account for the potential influence of covariates on the relationship between study group and postpartum dysglycemia, we performed logistic regression analysis of dependent variable glucose intolerance at 3 months postpartum (i.e., prediabetes / diabetes). On this analysis, gdm independently predicted postpartum glucose intolerance (odds ratio 4.1 [95% ci 2.56.8]; p <0.0001), after adjustment for age, months postpartum, ethnicity, family history of diabetes, breastfeeding, and waist circumference . Lga was not a significant predictor of postpartum glucose intolerance (odds ratio 1.7 [0.74.1]; p = 0.65). In this study, we demonstrate that women who deliver an lga infant in the absence of gdm do not exhibit the postpartum metabolic dysfunction that is characteristic of women with gdm . Specifically, compared with women with lga group had lower levels of glycemia (fasting glucose and aucgluc), higher whole - body insulin sensitivity, and better -cell function at 3 months postpartum, after adjustment for covariates . Moreover, there were no significant differences in any of these postpartum metabolic parameters between the nongdm altogether, these data argue against the oft - applied clinical assumption that a history of previous lga delivery is indicative of undiagnosed gdm . Previous studies show that even in the absence of established gdm in their mothers, macrosomic infants display elevated cord insulin and c - peptide levels (16,17). These elevated cord levels are indicative of fetal hyperinsulinemia and, hence, support the possibility of undetected maternal glucose intolerance during the pregnancy (16,17). In practice, in the early gestational assessment of a pregnant woman, a reported history of prior delivery of an lga infant is considered a clinical risk factor for gdm in the current pregnancy (35). This is based on the assumption that the previous macrosomia was due to undiagnosed gdm . In this context, it is important to recognize that both gdm and even milder gestational glucose intolerance identify women with chronic defects in -cell function and insulin resistance, both during and after pregnancy (6,18). As such, it follows that this assumed undiagnosed gestational glucose intolerance in women with a macrosomic infant should predict the presence of postpartum metabolic dysfunction . To date, however, there has been limited study of this question . In a study of 122 women evaluated at 48 hours postpartum, bukulmez and durukan (19) found that nongdm women with macrosomic infants had higher glucose levels than women with neither gdm nor infant macrosomia . (20) compared the fasting metabolic profile of 18 women with lga infants against that of 18 women with appropriate - for - gestational - age infants, carefully matched for maternal age, bmi, parity, and 2-h glucose level on the antepartum ogtt . It should be noted that they found no differences in fasting glucose, a1c, insulin, or lipids between these two groups . First, this study is prospective, such that all participants were systematically assessed by an ogtt both in late pregnancy and at 3 months postpartum, thereby enabling ascertainment of glucose tolerance status both during and after pregnancy . Second, insulin sensitivity and -cell function were evaluated on these ogtts, thereby obtaining insight on the pathophysiologic hallmarks of gdm . Lastly, in comparison with the prior studies, the current study has a much larger sample size consisting of 562 women, stratified into positive control subjects (women with established gdm) and negative control subjects (women with neither gdm nor lga delivery). In the context of this study design, we demonstrate that the postpartum metabolic profile of women delivering an lga infant in the absence of gdm is similar to that of their peers with neither gdm nor lga delivery and very different from that of women with established gdm . Although not specifically addressed by the current study, it is likely that the clinical assumption that an lga infant reflects undiagnosed maternal glucose intolerance may have been more appropriate in the past, when the prevalence of overweight / obesity was lower . When the pedersen hypothesis (i.e., that maternal hyperglycemia causes macrosomia through fetal hyperglycemia and hyperinsulinemia) (21) was first forwarded in 1952, at that time, maternal hyperglycemia was the primary determinant of fetal overgrowth (2,21,22). In the setting of the current obesity epidemic, however, catalano and hauguel - de mouzon (2) have suggested that maternal adiposity, rather than glycemia, is likely now the predominant factor contributing to excessive fetal growth, a concept supported by recent analyses (23,24). Indeed, our findings also support this position, for we were unable to demonstrate postpartum defects in carbohydrate metabolism in nongdm lga women . Furthermore, it follows from these data that the practice of interpreting a previous lga delivery as presumptive evidence of undiagnosed gdm may no longer be appropriate in the modern setting . Our study is limited by the use of surrogate indices of insulin sensitivity and -cell function . However, direct measures such as clamp studies would be difficult to implement in a study of this size (n = 562) because of their cost, invasiveness, and time requirement (particularly for new mothers). Moreover, we have used two established and validated measures for both insulin sensitivity and -cell function, with generally consistent results observed in each case (1215). A second limitation is the possibility of misclassification, in that some women in the nongdm groups could have developed gdm later in the pregnancy (i.e., after the ogtt) and, hence, were not appropriately classified as belonging to the gdm group . Nongdm women with an lga infant do not display the postpartum metabolic dysfunction of women with established gdm, specifically dysglycemia, insulin resistance, and -cell dysfunction . Furthermore, these women are not metabolically distinct from their peers with neither gdm nor lga delivery . Thus, an lga delivery in the absence of gdm is not necessarily indicative of undiagnosed gestational glucose intolerance but, rather, may be due to the influence of other factors, such as obesity . These data suggest that the long - standing clinical assumption that delivery of an lga infant reflects undiagnosed maternal hyperglycemia may no longer be appropriate in modern practice.
|
Neonatal group b streptococcus (gbs) infection ranging from 0.5 to 2 per 1000 live birth is the result of vertical transmission to the infant during delivery in colonized mothers . Attempts at identifying gbs colonized pregnant women near term by assessing the risk factors for gbs, failed to diagnose all cases . Universal screening of all pregnant women for gbs at 3537 weeks of gestation is currently recommended by the centers for disease control and prevention (cdc) in the usa . Despite the variation in the adherence to cdc recommendations among different centers around the world, antimicrobial prophylaxis, offered to women colonized with gbs intrapartum (after onset of labor or after rupture of membranes), lead to more than 70% reduction in early - onset gbs infection in neonates . However, due to the variation in the rate of gbs colonization during pregnancy, the emergence of resistant colonizing strains and the virulence potential of these strains, intrapartum screening of gbs genotypes along with their antimicrobial resistance profiles, and virulence encoding genes become desirable . Fortunately, gbs resistance to penicillin has not been reported so far; however, rare gbs clinical strains with reduced sensitivity for penicillin have been recorded . On the other hand, early studies on gbs isolates from pregnant women, showed antimicrobial resistance as high as 18%, 8%, and> 80% for erythromycin, clindamycin, and tetracycline respectively . The severity of neonatal disease in gbs infections could be determined mostly by a number of virulence factors encoded among others by the cps gene cluster coding for the capsule, the scpb gene coding for surface enzyme scpb (a c5a peptidase) which causes impairing of neutrophil recruitment and binds fibronectin to promote bacterial invasion of epithelial cells, the bca gene coding for alpha - c protein, a surface protein that helps the bacteria to enter the host cells, the lmb gene coding for lmb (laminine - binding protein), a surface protein that plays a role in invasion of damaged epithelium, the cyle gene coding for -hemolysin, a toxin that plays a role in tissue injury and systemic spread of the bacteria and contributes to meningitis, and the rib gene encoding the surface rib protein mostly present in invasive strains . Other virulence factors involved in the process of gbs pathogenesis include beta - c protein which is encoded by bac gene . Beta - c protein function is comprised of interaction with iga - fc portion causing the inhibition of phagocytosis and binding factor - h to maintain its role in inhibiting the complement activation via the alternative pathway . Other important virulence factors of gbs are the fibrinogen - binding proteins: fbsa and fbsb . It protects the pathogen from opsonophagocytosis, and promotes its adherence to epithelial cells and to the human brain microvascular endothelial cells (hbmec) thus helping it to cross the blood brain barrier and developing meningitis [18, 19]. Fbsb protein, encoded by fbsb gene, is also a surface protein that helps in gbs invasion of the epithelial cells . Finally, cell - surface - associated protein (cspa) is a surface protein encoded by cspa gene . It is involved in maintaining the pathogen survival in the host by escaping the immune system . In this study, genotypes were correlated to some of the virulence genes and the antimicrobial susceptibility profiles . This information is useful to identify particular gbs strains with high virulence potential, with resistance to routinely administered antimicrobial agents, and possibly linked to particular geographical areas . Seventy six gbs isolates were cultured from specimen taken from the vaginas of pregnant women between 35 and 37 weeks of gestation, attending private clinics in two tertiary care centers in beirut, lebanon, between october 2007 and july 2008 . The first center (a) is located in the western part of the urban city of beirut, and the second one (b) in the eastern part of beirut . These two hospitals serve two different populations, in the sense that patients attending the hospitals come from 2 different geographical areas, with very minimal intermingling between them . However, the local health care systems of the two areas are similar, and patients have similar antibiotics consumption habits . The 76 gbs isolates consisted of 47 (61.8%) isolates obtained from the first tertiary care center and 29 (38.2%) isolates obtained from the second tertiary care center . Isolates were identified using conventional methods on the basis of colonial morphology, gram staining, haemolysis, and latex agglutination test with specific antisera using the slidex strepto plus (biomerieux, marcy l'etoile; france). Antimicrobial susceptibility testing was performed by the disk - diffusion (kirby - bauer) method on mueller - hinton agar (difco laboratories, detroit, michigan) supplemented with 5% sheep blood, using suspensions of 0.5 macfarland from fresh bacterial cultures . The test was done using the following antimicrobial agents: penicillin, cefepime, ceftriaxone, chloramphenicol, clindamycin, erythromycin, levofloxacin, and tetracycline . Dna was extracted from all isolates using the illustra bacteria genomicprep mini spin kit (ge healthcare uk ltd, buckinghamshire, england) according to the manufacturer's instructions . Total dna of the 76 gbs isolates was used to amplify five virulence factors encoding genes: cyle, rib, lmb, bca, and scpb by pcr using specific primers . Standard pcr conditions were used to amplify cyle, lmb, and scpb, rib, and bca gene . Amplicons were subjected to electrophoresis on 2% agarose (sigma) gels in 1 tris - borate - edta buffer ph 8.3 (tris base 0.089 m, boric acid 0.089 m, and edta 0.002 m) at 120 v for 45 minutes . Agarose gels were stained with ethidium bromide (sigma) and photographed using a uv - transilluminator and an olympus digital camera with digi - doc it program . Genotyping using random amplified polymorphic dna (rapd) analysis was performed on all the isolates to determine strain diversity . Rapd was performed with the ready - to - go rapd analysis beads kit (ge healthcare uk ltd, buckinghamshire, england) and the gbs 2 primer, using sprint, thermo electric thermal cycler . Antimicrobial susceptibility testing showed the following: all gbs isolates were susceptible to penicillin g, cefepime, ceftriaxone, and levofloxacin . The following percentages of isolates, 4%, 11.8%, 15.8%, and 86.8%, were resistant to chloramphenicol (chl), clindamycin (cli), erythromycin (ery), and tetracycline (tet) respectively . Six antimicrobial resistance (ar) profiles of isolates were detected: a (resistant to cli, ery, chl, and tet; 4.0%), b (resistant to cli, ery, and tet; 6.6%), c (resistant to cli and tet; 1.3%), d (resistant to ery and tet; 5.3%), e (resistant to only tet; 69.7%), and f (susceptible to all; 13.2%). Genotyping of all the isolates detected seven gbs clusters i, ii, iii, iv, v, vi, and vii with the following prevalence percentages: 18.4%, 13.2%, 19.4%, 7.9%, 11.8%, 11.8%, and 17.1%, respectively . A dendrogram of the seven clusters of genotypes the most common cluster was iii (19.7%) and the least prevalent was iv (7.9%). The data show a prevalence of certain genotype clusters in both tertiary care centers while other genotype clusters were merely confined to a particular tertiary center (table 2). Similarly, certain ar profiles were prevalent in both centers, whereas others were restricted to one center . Pcr detection of the virulence genes showed that cyle, lmb, scpb, bca, and rib genes were positive in 99%, 96.1%, 94.7%, 56.6%, and 33% of the gbs isolates respectively . There was a wide prevalence of the cyle, lmb, and scpb genes among the total isolates, and hence all 3 genes were evenly distributed among the genotype clusters . Table 3 shows the prevalence of bca and rib genes among the gbs genotype clusters . Sixty eight isolates out of 76 (89.5%) have either the bca or the rib gene and 8 isolates out of 76 (10.5%) have neither bca nor rib detected . Neonatal gbs infection is a serious complication of the vertical transmission of the bacteria, from the mother to the newborn, at the time of vaginal delivery . This is why universal screening for gbs vaginal colonization in pregnant women near term is recommended . Fortunately, gbs resistant to penicillin has not been reported all around the world, and the drug of choice, in treating the infection, is still penicillin [7, 9]. However, the problem arises in cases, allergic to penicillin, where alternate antimicrobial agents such as cli and ery are commonly administered . However, de azavedo et al . Found that 18%, 8%, and> 80% of gbs isolates in pregnant women were resistant to ery, cli, and tet . In our study, 11.8%, 15.8%, and 86.8% of the gbs isolates, were resistant to ery, cli, and tet respectively, indicating percentages similar to previous studies . The prevalence of this relatively high ar percentages, leads to the recommendation of requesting a sensitivity antibiogram for gbs cultured from women allergic to penicillin . Genotyping of all the gbs isolates, utilizing rapd analysis determined a total of 7 genotype clusters . The most common was genotype cluster iii (19.7%) and the least common was iv found in 7.9% of all isolates . A correlation between ar and genotype clusters, showed an association between them (table 1). Resistance to chl was restricted to genotype clusters v, vi, and vii, whereas resistance to both cli and ery was found only in genotype clusters i, ii, and vii . All the gbs isolates resistant to cli are also resistant to ery, indicating a correlating pattern of resistance amongst the genes responsible for this phenotype . This can be expected since cli resistance in gbs is nearly always based on the presence of an ermb gene conferring resistance to macrolides, lincosamides, and streptogramin b . An important finding in this study was the correlation between the prevalence of particular genotype clusters with certain ar profiles in a given medical center . This observation denotes that high prevalence of certain genotype clusters resistant to certain antimicrobial agents in a particular medical center entails the practice of caution by extrapolating the ar findings from one medical center to others . Another observation is that bca and rib genes were not present concomitantly in the same genome . Rib protein encoded by the rib gene shares several properties with -c protein encoded by bca gene . Both proteins are resistant to trypsin digestion and belong to the same family of bacterial surface proteins with repetitive structures showing a 47% identity, their n - terminal sequences are related and are 61% identical to each other . Further investigations are still needed to be performed in order to discover the functional relationship between bca and rib to determine if they have homologous functions.
|
Although s. pneumoniae is the most common cause of community - acquired pneumonia (cap) in many countries, there are considerable geographic differences in the incidence of other pathogens . Tuberculosis (tb) is often overlooked as a cause of cap, particularly when it presents as an acute illness (2). Although the presentation of pulmonary tb as acute pneumonia is not unusual, its manifestation as acute respiratory distress syndrome (ards) is rare . Ards is a severe form of diffuse alveolar injury . The american - european consensus conference (aecc) (1994) defined ards as an acute condition characterized by bilateral pulmonary infiltrates and severe hypoxemia in the absence of evidence for cardiogenic pulmonary edema . The severity of hypoxemia necessary to make the diagnosis of ards was defined by the ratio of the partial pressure of oxygen in the patient s arterial blood (pao2) to the fraction of oxygen in the inspired air (fio2). Ards was defined by a pao2/fio2 ratio of less than 200, and, in acute lung injury (ali), by a ratio less than 300 (3). Recently, a panel of experts redefined the definition (berlin definition) (2011) and categorized ards into three levels: mild (pao2/fio2 200300), moderate (pao2/fio2 100200), and severe (pao2/fio2 100) (4). Even though ali and ards are well recognized complications in patients with severe tb, such as miliary tb or tb bronchopneumonia, sparse epidemiological data are available on this entity . Most patients who develop ali / ards have underlying chronic medical conditions or hiv infections, and their diagnoses were delayed (5). Herein, we present a rare case of a previously healthy young patient with acute pulmonary tuberculosis in the form of tb pneumonia that was complicated by ards . A 21-year - old woman, a radiology technician student, presented with acute respiratory failure due to progressive respiratory symptoms, including productive cough and dyspnea that started seven days before presentation . At the time of her admission to the hospital her initial vital signs were as follows: bp = 110/70 mmhg, hr = 122/min, rr = 40/min, and temperature = 40 c . Lung examination revealed bilateral coarse crackles . Because she presented during the influenza season and because the symptoms were compatible with severe pneumonia, a broad spectrum of antibiotics and oseltamivir were started, and she was intubated and received mechanical ventilation . There was no history of previous illness or recent travel and no family history of note . Arterial blood gas revealed hypoxemia (pao2 = 24.3 mmhg), hypercapnia (paco2 = 55.1 mmhg), and respiratory acidosis (ph = 7.25, hco3: 26). The hiv test was negative . Based on an initial pao2/fio2 ratio of less than 100 on ventilator setting that included peep and characteristic diffuse bilateral infiltrates on chest x - ray (figure 1), acute respiratory distress syndrome (ards) bacterial and fungal cultures of respiratory secretions showed no growth after seven days . A real - time pcr test on respiratory specimens for influenza a and b was negative . Accordingly, diagnosis of ards secondary to pulmonary tuberculosis was made, and the patient received anti - tuberculous drugs and intravenous hydrocortisone 100 mg three times per day . The patient continued to improve gradually during the first week, and she was successfully weaned and extubated on her seventh day in the hospital . Her chest infiltrates gradually resolved during the first week, but left lower- and mid - zone consolidation remained (figure 3). She remained hospitalized in the infectious ward and received o2 therapy plus anti - tuberculous drugs for another 15 days . Corticosteroids were stopped . During this period she remained mildly tachypnic and hypoxic . On the 24 day after presentation, she was discharged with stable vital signs and no hypoxia in the room air . A 21-year - old woman, a radiology technician student, presented with acute respiratory failure due to progressive respiratory symptoms, including productive cough and dyspnea that started seven days before presentation . At the time of her admission to the hospital her initial vital signs were as follows: bp = 110/70 mmhg, hr = 122/min, rr = 40/min, and temperature = 40 c . Lung examination revealed bilateral coarse crackles . Because she presented during the influenza season and because the symptoms were compatible with severe pneumonia, a broad spectrum of antibiotics and oseltamivir were started, and she was intubated and received mechanical ventilation . There was no history of previous illness or recent travel and no family history of note . Arterial blood gas revealed hypoxemia (pao2 = 24.3 mmhg), hypercapnia (paco2 = 55.1 mmhg), and respiratory acidosis (ph = 7.25, hco3: 26). The hiv test was negative . Based on an initial pao2/fio2 ratio of less than 100 on ventilator setting that included peep and characteristic diffuse bilateral infiltrates on chest x - ray (figure 1), acute respiratory distress syndrome (ards) bacterial and fungal cultures of respiratory secretions showed no growth after seven days . A real - time pcr test on respiratory specimens for influenza a and b was negative . Accordingly, diagnosis of ards secondary to pulmonary tuberculosis was made, and the patient received anti - tuberculous drugs and intravenous hydrocortisone 100 mg three times per day . The patient continued to improve gradually during the first week, and she was successfully weaned and extubated on her seventh day in the hospital . Her chest infiltrates gradually resolved during the first week, but left lower- and mid - zone consolidation remained (figure 3). She remained hospitalized in the infectious ward and received o2 therapy plus anti - tuberculous drugs for another 15 days . Corticosteroids were stopped . During this period she remained mildly tachypnic and hypoxic . On the 24 day after presentation, she was discharged with stable vital signs and no hypoxia in the room air . This case features a rare manifestation of pulmonary tuberculosis in a previously healthy young woman with acute presentation of tuberculous pneumonia complicated by ards . Tuberculous pneumonia is defined as nodular lesions resulting from air - space consolidation due to endobronchial spread to lobar or multilobar locations (5). M. tuberculosis is an important cause of community - acquired pneumonia (cap) in developing countries . Tb can present as an acute process and should be included in the differential diagnosis of cap . It may mimic classic bacterial pneumonia or masquerade as an atypical pneumonia, with non - productive cough and systemic symptoms . Missed diagnosis is common, as illustrated in report from baltimore in which 16 of 33 patients (48%) with culture - confirmed pulmonary tb were treated initially for presumed cap (1). The incidence of tb being diagnosed among patients presenting with clinical and radiological signs of a cap has varied in different series . Previously, studies from china, japan, kenya, and sub saharan africa also demonstrated high prevalence of pulmonary tb (920.5%) in patients who presented with cap (611). M. tuberculosis was the second most common pathogen (12%) identified in the study performed by levy et al ., only patients who presented with features of acute pneumonia were included; those with chronic illness or typical radiologic changes suggestive of tb were excluded . A similar high incidence of tb (10%) among subjects presenting with acute pneumonia was reported in france (7). Although presentation of pulmonary tb as acute pneumonia is not unusual, its manifestation as ards is rare . This complication is associated with a very high mortality (4080%) despite treatment (5). Even in a large study from india that was conducted by agarwal et al, tb accounted for only 4.9% of patients (9 of 187) who were admitted with a diagnosis of ards over a 7-year period, of whom two patients died . The lower mortality rate in this study could be attributed to the fact that all subjects were started empirically on anti - tb therapy with the median time to initiation of therapy being three days . Tracheal aspirate sent for ziehl - neelsen staining did not indicate that there were acid - fast bacilli in any of the patients of this study (13). In another study by sharma et al . In india, of 2,733 tb patients treated during 19802003, 29 (1.06%, i.e., 1.21 patients / year) developed ards (14). Another large retrospective study conducted by deng et al . In china over a five - year period (20062010) showed that, among 16,238 patients who were admitted to the respiratory departments with a diagnosis of pulmonary tb, 471 patients were diagnosed as having miliary tb, of whom 85 developed ards and were admitted to the icu during the study period . The mortality rate in this study was 47.1%, and the mean duration of mechanical ventilation was 8.5 3.0 days in all patients (15). Another study from south korea described 67 patients with ards caused by miliary tb admitted to the icu during 19992008 . All - cause mortalities in the icu and the hospital were 58.2 and 61.2%, respectively . In their study, 28.4% of the patients were older than 71, but clinical outcomes in these patients did not differ significantly from outcomes in younger patients (16). (17) found that higher psi scores were independently associated with the presence of concomitant pulmonary tb in both health care associated pneumonia (hcap) and cap patients . In the study performed by levy et al . (18), the incidence rate of 1.5% was reported for acute respiratory failure among hospitalized patients who presented with tuberculous cap . Although ards invariably occurs in patients with severe tb, such as miliary tb or tb bronchopneumonia (5), its occurrence in tuberculous pneumonia and cavitary pulmonary tb also was described (5). In the study of agarwal et al ., radiography of eight of nine patients with tb and ards revealed miliary nodules, and consolidation was observed in only one patient (13). Seven out of 29 patients with tb and ards in the study of sharma et al . Had pulmonary tb, and 22 had miliary tb (14). Several predisposing factors for development of ards in tb patients and several prognostic factors in these patients have been described . According to the study of deng et al ., the duration of time to diagnosis, time from diagnosis to mechanical ventilation, and time to anti - tuberculosis therapy were significantly shorter in survivors than for non - survivors . Diabetes mellitus, increased ast, alt, and d - dimer, decreased hemoglobin, and albumin were found to be independent predictors of the development of ards in the setting of miliary tb (15). In the study reported by sharma et al ., the presence of miliary tb, duration of illness beyond 30 days at presentation, absolute lymphocyte count less than 1625/mm and serum alt greater than 100 iu / l were independent predictors of the development of ards . Patients with apache ii scores> 18, those with apache ii scores <18 in the presence of hyponatraemia, and those with pao2/fio2 ratios <108.5 were likely to die (14). Showed that the sequential organ failure assessment (sofa) score on the day that ards is diagnosed is a valuable prognostic indicator (16). The case presented is special in its manifestation from several clinical perspectives, including lack of underlying medical condition or immune defect and development of ards in non - miliary and non - disseminated tuberculosis . In conclusion, the diagnosis of tb should be considered in all patients who present with cap in our region . It has been suggested that, in a patient with unexplained ards, a history of fever of more than 15 days duration and elevation of serum alkaline phosphatase should arouse the suspicion of disseminated tb as the underlying cause (5). It also has been suggested that, in patients with ards of obscure etiology where the clinical features suggest tb as the inciting cause, anti - tb therapy should be started empirically, and the diagnosis actively pursued later (13). Both primary and reactivation tb may present as an acute illness and mimic cap . As a result of the impressive mimicry of tb, the diagnosis must be considered, at least initially, in all cases of acute pneumonitis, especially in regions where tuberculosis is endemic.
|
Patients with spinal cord injuries (sci) have motor and sensory disorders, resulting in disabilities in daily activities1 . Although they should receive intensive care and rehabilitation treatment after injury, most patients experience disorders (e.g., impingement syndrome, osteoarthritis, bursitis, paralysis, parasthesia) in their upper extremities, trunk, or lower extremities due to physiological and physical changes . They experience functional disorders in ambulation, particularly with respect to activities of daily living (adl)2, 3 . Due to these ambulatory disorders, spinal cord injury patients often use wheelchairs and learn to perform basic adl (e.g. Propulsion, lifting, transfer) in relation to the use of a wheelchair . These patients often suffer upper extremity pain due to performance of adl almost exclusively by the upper extremities (overall upper extremity pain prevalence rates: 58.5%; shoulder: 71%, elbow: 35%, wrist: 53%, hand: 43%)4, and such pain impedes the performance of adl5 . Among the basic adl, transfer is a task that is performed by each patient 1520 times per day, on average . This is the most burdensome task for the musculoskeletal system, the nervous system, and the cardiovascular system among wheelchair related adl . In particular sitting pivot transfer (spt) is the most frequently used transfer method using the upper extremities . Using this method, the hip is moved from the initial seat (iseat) to the target seat (tseat) using the trailing hand (th) and the leading hand (lh) while both lower extremities maintain contact with the floor as an axis6 . One is a translational strategy in which the head and the hip move horizontally in the same direction, and the other is a rotational strategy in which the head and the hip move while rotating in different directions using both feet as a pivot2 . During spt movements, the shoulder is in a position of internal rotation and abduction, which will invariably cause shoulder impingement unless other aids are used6 . Although there are many shoulder pain treatment methods, the shoulder cannot take any rest because of transfer movements, which are essential for patients adl . Recently, some studies have been conducted of methods for minimizing shoulder injuries through dynamic analyses of transfer movements . According to a recent study, spt is the most efficient and imposes the lowest loads on individual joints when the wheelchair moves horizontally without any variation in floor height compared to when there are differences in height between the position of the wheelchair and the floor on which the wheelchair moves8 . A previous study using kinematic analysis of spt movements reported that, in an experiment conducted to measure loads on the shoulder joint in three different positions, anterior trunk positions mobilized large muscles around the shoulder and the mobilization of muscles reduced the risk of rotator cuff impingement2 . The maximum flexor momentum at the shoulder joint during spt movements is known to be approximately 1.45 nm / kg at the th and approximately 1.36 nm / kg at the lh of patients and approximately 1.56 nm / kg in healthy adults9 . Joint reaction force is known to be always higher at th than at lh, and joint loads are known to be higher during transfer to higher seats10 . In a recent study of human movement, it was reported that the destabilizing force (df), which tends to make movements, was determined by the height of the center of mass (com), center of pressure (cop), base of support (bos), and the reaction force and shear force acting on the floor11 . In a study of the df and stabilizing force (sf) occurring in spt movements, it was reported that low df and high sf were shown, and that the low df and high sf were related to the securing of stability against the risk of falls12, 13 . Nevertheless, no study to date has been conducted on changes in loads on the lower extremities during actual spt in relation to decreases in bos and increases in the height of the com . Studies of transfer methods that will reduce the burden on the upper extremity will contribute to the relief of shoulder pain eventually leading to the prevention of paraplegic patients shoulder pain . Therefore, the purpose of the present study was to examine the effects of different heights of the hands of the supporting arms on the loads on the shoulder joint during transfer movements in order to seek effective and safe transfer methods . The subjects of the present study were recruited from among students, who voluntarily wanted to participate in the study, attending in hallym college located in chuncheon - si . Based on the principles of the declaration of helsinki, research ethics, the purpose and contents of the study were sufficiently explained to the subjects before they participated in the experiment, and they were required to submit their written informed consent . The subjects had no history of musculoskeletal system disease of their upper extremity . Among the recruited subjects, only 18 adult males participated in the experiment: excluding those who could not lift their trunk because their upper extremity muscle strength was not sufficient to perform spt movements and those who could not wear the tight suit for motion analysis were excluded . The iseat and tseat of the device specially designed for spt were made from 30 50 cm sized 3.2 mm thick steel plates, and the plates for th and lh were made using 60 50 cm sized steel plates of the same thickness as the seats . For height adjustment, hand jerks that could endure at least 2,000 kgf were fixed by welding between the steel plates . Thereafter, 1 cm diameter holes were drilled at the four corners of the welded steel plated using a laser . Long steel bolts were inserted through the holes to fix the upper and lower steel plates of the iseat and tseat . The th and lh plates were fixed with bolts in order to minimize vibration or shaking caused by loads during transfer movements . Then, 20 cm high aluminum profiles were fastened to the two fixed steel plates using bolts so that the final height could be adjusted to between 35 cm and 65 cm . Prior to the experiment, audio - visual education on the rotational strategy among spt method was conducted along with a verbal explanation . The subjects moved from the iseat at a height of 50 cm to the tseat at the same height at an angle of 90. the subjects adopted a posture with the th located as close as possible to the hip on the iseat and the lh located as close as possible to the tseat . To keep the same hand positions for all subjects, the shape of a hand was printed and attached to the positions of the th and the lh on the force plates (fig . The trailing hand and the leading hand were placed on the hand shaped marks attached to the force plates and the initial seat and the target seat were placed immediately next to the two hand positions . The leading hand were placed on the hand shaped marks attached to the force plates and the initial seat and the target seat were placed immediately next to the two hand positions . The angle between the two tables was set to 90 after the verbal order start, the subjects moved from the iseat to the tseat by lifting their hips solely using the strength of their arms . At this time, the subjects were instructed to limit the activity of their lower extremities maximally . Then, the subjects performed the same movement after reducing the height of the th and the lh plates by 10 cm . The height of 50 or 40 cm was randomly selected to eliminate order effects . The subjects took a sufficient rest of one minute between each movement . During the spt movements, if a subject complained of pain in any part of the upper extremity, the experiment was immediately stopped . In the present study, the time labeled at which loading occurred on the force plate below the lh after the verbal order start was labeled event1, and the time at which the loading became 0 at the th plate, when the transfer to the tseat had been completed, was labeled event2 . The angles of the movements of the upper extremity and the trunk were measured using a motion analyzer (oqus100, qualisys, sweden). Before the experiment, the study subjects wore upper and lower body stockings that clung to their body shapes, and 15 mm diameter reflective markers, that could be recognized by infrared cameras, were attached to the c7 and t10 vertebrae, jugular notch, xiphoid process of the sternum, head (left / right forehead and rear head), acromion, upper arms, humeral lateral epicondyles, wrist lateral / medial epicondyles of the wrists, 2nd metacarpal heads, and asis and psis . The light signals reflected individual markers were recorded using six cameras and qtm (qualisys, sweden) at a rate of 100 frames per second . The body joints and segments in the obtained data were labeled, and the kinematics of individual joints and segments were quantitatively analyzed using visual 3d software (c - motion, usa). To reduce measurement errors, the markers for motion analysis force plates (9260aa6, kistler, switzerland) were used to measure the external force generated by the upper extremities while spt movements were being performed . The voltages measured at different loads were amplified through an amplifier (5233a2, kistler, switzerland) and transmitted to the computer through an a / d board (usb-2533, measurement computing corporation, usa). Then, the values of the force applied to the force plates by external loads were calculated using qtm motion analysis software program . Kinetic data were sampled at 1,000 hz to align with the kinematic data . The kinematic data measured between event1 and event2 of each subjects were evenly divided into 101 frames (0 to 100 frames) and normalized to each subject s height and weight values . Each subject s spt movements were measured five times and the average was used in the analysis . Statistical analysis was conducted using pasw ver . 18.0 (spss, ibm, usa). The paired t - test was used to compare kinetic and kinematic data between the two heights of the th and lh . The group means (standard deviation) of age, height, weight of the participants were 21.11 (1.71) years, 1.78 (0.04) meters, 74.28 (9.40) kilograms, respectively . The maximum flexion of the trunk was significantly larger when the hand position was low 75.14 (7.95) than when the hand position was normal 53.12 (13.50) (p=0.000). The maximum ranges of lateral flexion when the hand positions were low and normal were 48.04 (9.37) and 42.82 (9.74), respectively, and the difference was significant (p=0.022). The maximum ranges of rotation when the hand positions were low and normal were 0.26 (9.72) and 17.89 (11.24), respectively, and the difference was significant (p=0.000; table 1table 1.means (sd) of the peak trunk angles of each hand heightcomponenttrunkhlhnpeak angle (degree)flexion75.1 (8.0)53.1 (13.5)lateral flexion (left)48.0 (9.4)42.8 (9.7)rotation (left)0.3 (9.7)17.9 (11.2)hl: low hand height (40 cm), hn: normal hand height (50 cm), * p<0.05). Hl: low hand height (40 cm), hn: normal hand height (50 cm), * p<0.05 the maximum flexion angles of the shoulder joint when the hand positions were low and normal were 51.55 (10.25) and 40.89 (11.35), respectively, at the th (p=0.000) and 32.03 (8.87) and 18.68 (7.29), respectively, at the lh (p=0.000). The differences in the angles between the two hand heights were significant at both the th and at the lh . The maximum abduction angles were not significantly different between the two hand heights at the th, but showed significant differences at the lh, with values of 15.60 (10.53) and 13.51 (8.04) when the hand positions were low and normal, respectively (p=0.027). The maximum rotation angles were not different between the two hand heights at the th, but they showed significant differences at the lh, with values of 74.79 (14.22) and 64.90 (11.20) when the hand positions were low and normal, respectively (p=0.000; table 2table 2.means (sd) of the peak shoulder angles of each hand heightcomponenttrailing handleading handhlhnhlhnpeak angle (degree)flexion51.6 (10.3)53.1 (13.5)32.0 (8.9)18.7 (7.3)abduction16.6 (8.6)42.8 (9.7)15.6 (10.5)13.51 (8.0)rotation (internal)37.5 (19.3)17.9 (11.2)74.8 (14.2)64.9 (11.2)hl: low hand height (40 cm), hn: normal hand height (50 cm), * p<0.05). Hl: low hand height (40 cm), hn: normal hand height (50 cm), * p<0.05 the values of anterior / posterior force measured at the force plates below the th and lh when the hand positions were low and normal were 8.98 (1.96)% (bw) and 7.89 (1.96)% (bw), respectively, at the th, and the difference was significant (p<0.05), but there was no significant difference at the lh . The values of lateral / medial force showed significant differences between the two hand heights at the th with values of 7.96 (2.33)% (bw) and 8.92 (2.92)% (bw), respectively (p<0.05), but did not show any significant difference at the lh . The values of vertical force did not show statistically significant difference between the two hand heights at the th or the lh (table 3table 3.means (sd) of the peak forces of each hand heightcomponenttrailing handleading handhlhnhlhnpeak force (% bw)posterior9.0 (2.0)7.9 (1.7)0.1 (0.5)0.1 (0.3)lateral8.0 (2.3)8.9 (2.9) 1.4 (1.8)1.3 (0.8)vertical44.7 (6.0)45.4 (4.9)43.2 (7.2)45.2 (6.5)bw: body weight, * p<0.05). The purpose of the present study was to analyze the movements of the shoulder joint and the trunk at different heights of the th and the lh in spt movements to provide reference data for effective and safe transfer methods for spinal cord injury, paraplegia, and lower extremity amputation patients . Reported that during transfer to seats of different heights, trunk flexion of 6871 appeared at the initial hip lifting, that trunk flexion facilitated spt movements during which the hip was lifted and moved, and that trunk flexion affected balance and stability in spinal cord injury patients with weakened erector spinae muscle or neurological disorders with upper extremity muscle strength8 . Advised that the degree of trunk flexion increased the time of hip lifting for the entire spt movement14 . Finley noted that patients who complained of shoulder impingement showed smaller trunk flexion angles, and that smaller angles were associated with the formation of small trunk flexion moments at the beginning of the initial phase of hip lifting after injury6 . In the present study, when the hand height was in the lower position (40 cm), trunk flexion essentially increased to use the lower hand position as the weight - bearing surface . Positive effects could be expected from this in that trunk flexion generally acts as propulsion during hip lifting at the beginning of transfer movements . Another movement that indispensably appears along with trunk flexion in spt movements is rotation . Trunk rotation occurs in the opposite direction to the seat that would move around the th . According to a study conducted by forslund et al.15, trunk rotation of 41 can occur at the maximum in females, and 32 can occur at the maximum in males . The difference was assumed to be attributable to differences in shoulder widths and pelvis sizes between the genders . In the present study, rotation was shown to be smaller by 17.73 on average when the hand height was lower . This is assumed to be associated with the increase in trunk flexion appearing when the hand height is low . In addition, increases in trunk rotation are thought to affect shoulder joint angles and the strength of the surrounding muscles directly . In previous spt movement analysis studies, maximum shoulder joint flexion was 36, abduction was 50, and internal rotation was 15306, 16, 17 . It is known that during transfer movements, complicated upper extremity movement combinations reduce the subacromial space and eventually affect the rotator - cuff muscle and soft tissues (e.g. Bursae) around the shoulder joint resulting in shoulder impingement . The angles of flexion and abduction at low hand positions in the present study were different from those reported by previous studies . Flexion should increase when the bearing surface is low, and larger flexion and abduction angles should occurs to compensate for the bent trunk (fig . : trunk flexion angle at hn,: trunk flexion angle at hl). : trunk flexion angle at hn,: trunk flexion angle at hl since trunk rotation movements occur around the axis of the th at the beginning, of spt movements, internal rotation of the th shoulder is inevitable . In a study conducted by finely et al ., patients with shoulder impingement were identified as utilizing more internal rotation than other patients during spt movements6 . Also, a study conducted by riek et al . Reported that internal rotation of 49 occurred at the th of spinal cord injury patients . In the present study, internal rotation at the th occurred more frequently when the hand was low, and this seems to increase the risk of shoulder impingement17 . However, gagnon et al.8 advised that the maximum angle of internal rotation might vary with hand position when spt movements began . Therefore, this problem might be resolved by studies seeking the hand position that can minimize internal rotation of the shoulder . Forslund et al.15 reported that when sci patients transferred to a seat that was 7 cm higher, the maximum vertical reaction force at the th was always higher than that at the lh, and that this seemed to be a natural phenomenon because the th is closer to the body to initiate movements at the beginning of the movement . They reported that the average vertical reaction force at the th was 32% (bw), and that it was 24.5% (bw) at the lh . In a study conducted by gagnon et al.18, the values were 44.5% (bw) at the th and 39.6% (bw) at the lh, similar to the values of the present study, 43.2% (bw) at the th and 41.3% (bw) at the lh . Advised that the maximum vertical reaction force was different between male and female spinal cord injury patients because in the case of males, force was delivered from the th to the lh while in the case of females, force was exerted on both hands almost simultaneously because males were stronger than females18 . In the present study, since all of the subjects were males, the subjects exerted more force at the th when they transferred and a relatively smaller vertical reaction force was observed at the lh . When the hand positions were low, the movement accordingly began with the trunk more bent, and this seems to have acted as a dynamic advantage for vertical reaction force in the phase of hip lifting during transfer movements . With regard to the shearing force (anterior / posterior, medial / lateral) measured at the force plates, the anterior shearing force was found to be higher when the hand position was lower than the seat position, and the lateral shear force was found to be higher when the hand height was the same as the height of the seat . When the hand position is low, greater movement to bend the trunk forward occurs . In reaction to the forward bending of the trunk, relatively more anterior and relatively smaller lateral forces act . This is associated with the destabilizing force that decreases when the hand height decreases due to the com becoming farther from the bos as the hand height decreases . Duclos et al.11 advised that if the destabilizing force is large, the movement of the center of pressure (cop) to the outside of the bos would become more difficult, and that if the com is high, the destabilizing force would be reduced allowing movements to be made with a smaller force . Given that when the hand is lower, the vertical reaction forces at the th and the lh as well as the lateral force are smaller, it is our opinion that when the bearing surface for the arm is lower, transfer movements can be made with smaller force, and, in particular, the vertical loads and lateral loads on the shoulder joint can be reduced . Limitations of the present study include the fact that the experiment was not conducted with spinal cord injury patients with shoulder pain, and that data were not obtained through measurements in actual transfer environments, but were obtained in a laboratory setting . Furthermore, since the experiment was conducted with only healthy male, the results cannot be generalized to both sexes, and even though the subjects were educated not to use their lower extremity, they might not have been able to control their lower extremities as completely as actual patients . Taken together, our results indicate that as the hand position becomes lower, trunk flexion increases . This would act as a dynamic advantage (propulsion) for the movement to lift the hip, thereby reducing the vertical reaction force and shear force acting on the shoulder joint, thereby reducing the load on the shoulder joint . Through the present study, the position of the supporting arms during spt movements lower than the seat position was identified to have biomechanical advantages over the position of the supporting arms at the same height as the seat position . The results of the present study can be applied as guidelines for effective and safe methods for quadriplegia or spinal cord injury patients spt, and can be utilized as reference data when considering the appropriate heights of aids for wheelchairs.
|
There has been a shift towards new roles for art galleries as places for learning and such settings are seeking ways to reach out to more diverse audiences, including persons living with dementia . Researchers believe that, as a brain is being progressively affected by dementia, an individual can still experience the drive to be creative . In addition, studies have shown that engaging in creative activities can provide therapeutic benefits by relieving stress, improving creativity, and increasing resilience, suggesting a link between social and creative activities and the preservation of cognitive functions . Creative activities, such as art appreciation and art making, are not only therapeutic to the person engaging in them, they are also social activities that strengthen social ties among participants . Art gallery - based program for persons with dementia have been described in the literature more recently and, among other benefits, have reported on enhanced social engagement . One of the earliest took place at new york s museum of modern art where persons with mild dementia living in the community attended a 90-minute tour once per month accompanied by their family members . At the national art gallery of australia, eight persons with moderate - to - severe dementia attended an art gallery program weekly for six weeks to discuss artwork with gallery educators . They were highly engaged in the moment and showed more positive affect than usual, but effects were not long lasting . A study of six persons with mild - to - moderate dementia, who participated in viewing of paintings followed by art making at london s dulwich picture gallery in the united kingdom (uk), revealed increased attention and engagement along with improved episodic memory and verbal fluency . Thirteen persons with mild - to - moderate dementia and their carers participated in eight two - hour weekly sessions at two distinct art galleries in the uk . The behavioural health program (bhp) is an inpatient program, serving patients in the middle - to - late stages of dementia who require assessment and treatment of behavioural issues . In 2009, a new building was designed specifically for this population at the st . Peter s hospital site of hamilton health sciences in hamilton, ontario . To enhance the quality of life for these patients, a donor purchased pieces of art from the art rental and sales program at the art gallery of hamilton (agh) for display on the unit . To select these artworks, bhp staff, art gallery staff, and the patients on the program worked collaboratively . Over a series of visits, artworks were brought to the hospital and shown to the patients . Through facilitated discussion, patients then selected the artworks for purchase and the relationship between the agh and the bhp evolved into the artful moments pilot program . The artful moments pilot program, which was inspired by the museum of modern art (moma) in new york city s meet me at moma program, differs from the meet me at moma program in that it focused on persons in the middle - to - late stages of dementia who exhibit challenging behaviours; included both art making and art appreciation; and occurred in both the art gallery and hospital setting . In this paper, we report the qualitative findings from the artful moments pilot program that were based on observations of eight persons with dementia from the bhp, and written comments from their respective care partners . The research questions were as follows: does an arts - based program (art appreciation and art making) facilitate positive engagement in the moment for persons in the middle - to - late stages of dementia?what is the impact of the artful moments intervention on care partners (unpaid family members and paid staff) who participated in the program? Does an arts - based program (art appreciation and art making) facilitate positive engagement in the moment for persons in the middle - to - late stages of dementia? Artful moments intervention on care partners (unpaid family members and paid staff) who participated in the program? The behavioural health program (bhp) is an inpatient program, serving patients in the middle - to - late stages of dementia who require assessment and treatment of behavioural issues . In 2009, peter s hospital site of hamilton health sciences in hamilton, ontario . To enhance the quality of life for these patients, a donor purchased pieces of art from the art rental and sales program at the art gallery of hamilton (agh) for display on the unit . To select these artworks, bhp staff, art gallery staff, and artworks were brought to the hospital and shown to the patients . Through facilitated discussion, patients then selected the artworks for purchase and the relationship between the agh and the bhp evolved into the artful moments pilot program . The artful moments pilot program, which was inspired by the museum of modern art (moma) in new york city s meet me at moma program, differs from the meet me at moma program in that it focused on persons in the middle - to - late stages of dementia who exhibit challenging behaviours; included both art making and art appreciation; and occurred in both the art gallery and hospital setting . In this paper, we report the qualitative findings from the artful moments pilot program that were based on observations of eight persons with dementia from the bhp, and written comments from their respective care partners . The research questions were as follows: does an arts - based program (art appreciation and art making) facilitate positive engagement in the moment for persons in the middle - to - late stages of dementia?what is the impact of the artful moments intervention on care partners (unpaid family members and paid staff) who participated in the program? Does an arts - based program (art appreciation and art making) facilitate positive engagement in the moment for persons in the middle - to - late stages of dementia? What is the impact of the artful moments intervention on care partners (unpaid family members and paid staff) who participated in the program? Ethics approval for the study was obtained from the hamilton integrated research ethics board) (reb#:13 - 105). All participants, through their substitute decision makers, understood that they could withdraw at any time . A consent form accompanied a letter of information and both were approved by the research ethics board . Each patient s substitute decision maker (sdm) signed the consent form and was given a copy after the study was explained and any questions answered . A qualitative descriptive design incorporated both observation of persons with dementia and questionnaires administered to care partners as sources of data . The study population consisted of older adults in the middle - to - late stages of dementia who were in - patients on the bhp at st . The 63-bed bhp is designed for the assessment and treatment of behavioural and psychological symptoms of dementia in older adults . Participant recruitment was facilitated by advertising flyers that were posted on the program s two units . Artful moments pilot program classes at any one time, so patients whose families expressed interest on their behalf were enrolled until capacity was met . Others who had expressed interest were added to a waiting list, and when a participant was discharged to long - term care and a space became free, a patient from the waiting list was able to join . To prepare for the intervention, the team of artist - instructors from the agh attended a half - day session and a full - day workshop facilitated by clinical staff . The half - day session focused on understanding dementia, including the importance of enhancing the remaining abilities of persons with dementia . The workshop was an established evidence - based curriculum known as gentle persuasive approaches (gpa) in dementia care . Gpa is offered across canada to staff who work with persons with dementia in long - term, complex, and acute care . It is designed to prepare staff to deliver person - centered care to persons exhibiting challenging behaviours . In turn, the agh staff provided five two - hour sessions to the bhp staff that introduced them to art appreciation and art - making strategies in several media, along with training in facilitating discussions about art . Artful moments used a combination of art appreciation and hands - on art - making activities to facilitate positive engagement in older adults with dementia . The arts - based activities provided opportunities for sharing among program participants, care partners, and staff from both st . Moments provided meaningful, individualized, and engaging activities that encouraged participants to be creative, to express themselves, and to try something new . The focus was on enhancing the person s strengths and abilities rather than overemphasizing the deficits associated with the condition . About one visit per month occurred at the agh to view art in the exhibition spaces (art appreciation) and to do specially designed hands - on art activities (art making). The other visits took place on the bhp where the artist - instructors from the agh came to facilitate art appreciation and art making . Approximately one hour was spent on art appreciation and one hour on art making during each session, with each activity complementing the other . For example, after visiting the tanenbaum african collection and discussing the role of masks in west african society (art appreciation), the art - making session focused on making masks . Table 1 shows the schedule of sessions and the topics covered by the gallery educators and artists . Topics for the art appreciation and art making sessions the engagement of persons with dementia was measured by direct observation using the affect and engagement rating scale (modified philadelphia affect rating scale). This scale was recommended to the bhp team by the team from the meet me at moma program . It measures interest, pleasure, sadness, anxiety, and anger through observations of certain behaviours displayed by the program participants (such as looking at the art under discussion to demonstrate interest) while they are taking part in the art appreciation and art making . - long art appreciation session and each hour - long art - making session, four program participants were selected through a random draw . The engagement of these four randomly selected program participants was observed systematically by trained staff observers using the structured scale . Three of the four were observed on a rotating basis by one observer using a standard observation schedule which involved observing each of those program participants over two 10-minute periods during the hour . That is, participant a was observed for 10 minutes, followed by b and c for 10 minutes each, and then back to participant a. observations were recorded every two minutes during the 10-minute period using the structured scale . The fourth selected program participant was observed for the full hour (full observation) by the second observer . In addition to noting the presence or absence of behaviours on the scale, observers wrote detailed comments and observations that contributed to the qualitative data for this study . A speech - language pathologist, two occupational therapists, and one clinical nurse specialist comprised the pool of trained observers . If not selected as observers for a particular session, they were on hand to provide education and intervention to families when a participant had difficulty with the art - making component, for example, initiating the activity . Sometimes they coached the agh team and provided tips such as the importance of giving positive feedback, the use of the hand - over - hand technique, and other key communication strategies . Engagement of the participants was also measured indirectly from the perspective of the care partners (both family and staff) who completed a questionnaire at the end of each session . This questionnaire was adapted from the survey developed for the meet me at moma program and offered care partners the opportunity to rate the experience and add written comments about the session . Qualitative content analysis has been defined as a dynamic form of analysis of verbal data that is oriented toward summarizing the informational contents of the data . All observers notes from the affect and engagement rating scale and care partner responses from the questionnaire they completed at the end of each session were read repeatedly to achieve immersion and gain a full understanding of the entire data obtained from the sessions . Once a full understanding of the data was achieved, important words from the data that appeared to capture key thoughts or concepts were highlighted . The initial analysis commenced as the first author noted his thoughts and impressions about the data obtained . During this process, codes that represented groups of key thoughts were derived directly from the text data . Once the initial coding scheme was finalized, the codes were sorted based on how closely related they were to one another . Finally, the emergent categories from the data were grouped into meaningful clusters that represented the major findings (or themes) from the study . These included an audit trail of all decisions related to participant enrolment, data collection, analysis, and writing . Ethics approval for the study was obtained from the hamilton integrated research ethics board) (reb#:13 - 105). All participants, through their substitute decision makers, understood that they could withdraw at any time . A consent form accompanied a letter of information and both were approved by the research ethics board . Each patient s substitute decision maker (sdm) signed the consent form and was given a copy after the study was explained and any questions answered . A qualitative descriptive design incorporated both observation of persons with dementia and questionnaires administered to care partners as sources of data . The study population consisted of older adults in the middle - to - late stages of dementia who were in - patients on the bhp at st . The 63-bed bhp is designed for the assessment and treatment of behavioural and psychological symptoms of dementia in older adults . Participant recruitment was facilitated by advertising flyers that were posted on the program s two units . Artful moments pilot program classes at any one time, so patients whose families expressed interest on their behalf were enrolled until capacity was met . Others who had expressed interest were added to a waiting list, and when a participant was discharged to long - term care and a space became free, a patient from the waiting list was able to join . To prepare for the intervention, the team of artist - instructors from the agh attended a half - day session and a full - day workshop facilitated by clinical staff . The half - day session focused on understanding dementia, including the importance of enhancing the remaining abilities of persons with dementia . The workshop was an established evidence - based curriculum known as gentle persuasive approaches (gpa) in dementia care . Gpa is offered across canada to staff who work with persons with dementia in long - term, complex, and acute care . It is designed to prepare staff to deliver person - centered care to persons exhibiting challenging behaviours . In turn, the agh staff provided five two - hour sessions to the bhp staff that introduced them to art appreciation and art - making strategies in several media, along with training in facilitating discussions about art . Artful moments used a combination of art appreciation and hands - on art - making activities to facilitate positive engagement in older adults with dementia . The arts - based activities provided opportunities for sharing among program participants, care partners, and staff from both st . Peter s and the agh . Artful moments provided meaningful, individualized, and engaging activities that encouraged participants to be creative, to express themselves, and to try something new . The focus was on enhancing the person s strengths and abilities rather than overemphasizing the deficits associated with the condition . About one visit per month occurred at the agh to view art in the exhibition spaces (art appreciation) and to do specially designed hands - on art activities (art making). The other visits took place on the bhp where the artist - instructors from the agh came to facilitate art appreciation and art making . Approximately one hour was spent on art appreciation and one hour on art making during each session, with each activity complementing the other . For example, after visiting the tanenbaum african collection and discussing the role of masks in west african society (art appreciation), the art - making session focused on making masks . Table 1 shows the schedule of sessions and the topics covered by the gallery educators and artists . The engagement of persons with dementia was measured by direct observation using the affect and engagement rating scale (modified philadelphia affect rating scale). This scale was recommended to the bhp team by the team from the meet me at moma program . It measures interest, pleasure, sadness, anxiety, and anger through observations of certain behaviours displayed by the program participants (such as looking at the art under discussion to demonstrate interest) while they are taking part in the art appreciation and art making . - long art appreciation session and each hour - long art - making session, four program participants were selected through a random draw . The engagement of these four randomly selected program participants was observed systematically by trained staff observers using the structured scale . Three of the four were observed on a rotating basis by one observer using a standard observation schedule which involved observing each of those program participants over two 10-minute periods during the hour . That is, participant a was observed for 10 minutes, followed by b and c for 10 minutes each, and then back to participant a. observations were recorded every two minutes during the 10-minute period using the structured scale . The fourth selected program participant was observed for the full hour (full observation) by the second observer . In addition to noting the presence or absence of behaviours on the scale, observers wrote detailed comments and observations that contributed to the qualitative data for this study . A speech - language pathologist, two occupational therapists, and one clinical nurse specialist comprised the pool of trained observers . If not selected as observers for a particular session, they were on hand to provide education and intervention to families when a participant had difficulty with the art - making component, for example, initiating the activity . Sometimes they coached the agh team and provided tips such as the importance of giving positive feedback, the use of the hand - over - hand technique, and other key communication strategies . Engagement of the participants was also measured indirectly from the perspective of the care partners (both family and staff) who completed a questionnaire at the end of each session . This questionnaire was adapted from the survey developed for the meet me at moma program and offered care partners the opportunity to rate the experience and add written comments about the session . Qualitative content analysis has been defined as a dynamic form of analysis of verbal data that is oriented toward summarizing the informational contents of the data . All observers notes from the affect and engagement rating scale and care partner responses from the questionnaire they completed at the end of each session were read repeatedly to achieve immersion and gain a full understanding of the entire data obtained from the sessions . Once a full understanding of the data was achieved, important words from the data that appeared to capture key thoughts or concepts were highlighted . The initial analysis commenced as the first author noted his thoughts and impressions about the data obtained . During this process, codes that represented groups of key thoughts were derived directly from the text data . Once the initial coding scheme was finalized, the codes were sorted based on how closely related they were to one another . Finally, the emergent categories from the data were grouped into meaningful clusters that represented the major findings (or themes) from the study . These included an audit trail of all decisions related to participant enrolment, data collection, analysis, and writing . Table 2 presents the demographic profile of the eight program participants who were involved in the study . They were older males with severe cognitive impairment who were dependent for their activities of daily living . The frequency of their usual behaviours is detailed in table 2, along with additional demographic data including type of dementia, educational level, and previous interest in art . One participant attended all 27 sessions that were offered, and the other seven attended 26, 25, 11, 11, 10, 9, and 5 sessions, respectively (see table 3). Demographic characteristics of program participants once or twice a week; several times a week; mean mmse score is based on seven participants . Adl = activities of daily living; cmai = cohen mansfield agitation inventory; mmse = mini - mental state exam . Attendance and length of observations of the eight program participants three participants could not regularly be accompanied by a family member, so a care provider from the bhp (usually a nurse, therapeutic recreationist or therapy assistant) partnered with the participant . A total of 471 10-minute observations took place over the 27 sessions for an average of 590 minutes per participant (range 1101160 minutes). Respondents were spouses (88 questionnaires completed), formal care providers (28 questionnaires completed), and other family members (11 questionnaires completed) care partners availability and involvement at the sessions meant that they helped program participants engage in the art appreciation and art - making activities . Care partners were observed using strategies such as coaching, demonstrating, modelling, and offering encouragement to help engage their partners . Being part of a group activity with other participants seemed to contribute to engagement as program participants watched others doing art activities . Program participants not only demonstrated their strengths, but were encouraged to express themselves both verbally and creatively, and they appeared to take opportunities to share their thoughts and opinions with their care partners, staff, and other participants in the program . Analysis of the data indicated that there may have been a validation of personhood as program participants seemed to enjoy the appreciation they were receiving for their efforts and responded positively to other participants, care partners, or staff admiring their art . Artful moments experience as an opportunity for building meaningful relationships with other program participants including other care partners . Care partners reported that the program helped them to focus on accomplishing a task with the person with dementia . Artful moments. One care partner wrote that she was able to better help her husband eat after learning how to help him with painting; another spouse commented that she learned strategies that improved her ability to interact with her husband . Table 2 presents the demographic profile of the eight program participants who were involved in the study . They were older males with severe cognitive impairment who were dependent for their activities of daily living . The frequency of their usual behaviours is detailed in table 2, along with additional demographic data including type of dementia, educational level, and previous interest in art . One participant attended all 27 sessions that were offered, and the other seven attended 26, 25, 11, 11, 10, 9, and 5 sessions, respectively (see table 3). Demographic characteristics of program participants once or twice a week; several times a week; mean mmse score is based on seven participants . Adl = activities of daily living; cmai = cohen mansfield agitation inventory; mmse = mini - mental state exam . Attendance and length of observations of the eight program participants three participants could not regularly be accompanied by a family member, so a care provider from the bhp (usually a nurse, therapeutic recreationist or therapy assistant) partnered with the participant . A total of 471 10-minute observations took place over the 27 sessions for an average of 590 minutes per participant (range 1101160 minutes). Respondents were spouses (88 questionnaires completed), formal care providers (28 questionnaires completed), and other family members (11 questionnaires completed). Care partners availability and involvement at the sessions meant that they helped program participants engage in the art appreciation and art - making activities . Care partners were observed using strategies such as coaching, demonstrating, modelling, and offering encouragement to help engage their partners . Being part of a group activity with other participants seemed to contribute to engagement as program participants watched others doing art activities . Program participants not only demonstrated their strengths, but were encouraged to express themselves both verbally and creatively, and they appeared to take opportunities to share their thoughts and opinions with their care partners, staff, and other participants in the program . Analysis of the data indicated that there may have been a validation of personhood as program participants seemed to enjoy the appreciation they were receiving for their efforts and responded positively to other participants, care partners, or staff admiring their art . Artful moments experience as an opportunity for building meaningful relationships with other program participants including other care partners . Care partners reported that the program helped them to focus on accomplishing a task with the person with dementia . Artful moments. One care partner wrote that she was able to better help her husband eat after learning how to help him with painting; another spouse commented that she learned strategies that improved her ability to interact with her husband . This paper presents results from the artful moments pilot study, an innovative collaboration between st . Artful moments was developed for persons in the middle - to - late stages of dementia who exhibit behavioural symptoms, and for their care partners . The program used a combination of art appreciation and art making, two activities that are designed to complement each other, to facilitate engagement in the moment for persons with dementia . Like the meet me at moma program at the museum of modern art (moma) in new york city and other similar programs using art as an intervention for persons with dementia, artful moments has shown that arts - based programming can be an effective way to engage people with dementia . The pilot study findings suggest that care partner availability and involvement in art, as well as involvement in group activities with other participants, may promote positive engagement for persons with dementia . Consistent with previous findings, participants seemed reassured by the presence of their care partners at the art sessions, thereby showing willingness to participate in activities . Studies have shown that persons with dementia often feel silent and express that their voice is ignored . In this study, artful moments opened up new possibilities for care partners by making it possible to see the creative side of the person with dementia . The program enhanced communications and made it easier to engage meaningfully with other program participants including other care partners . By working together to participate in arts, persons with dementia and their care partners were able to spend time together to engage in activities that promote mutual enjoyment . This had the effect of helping to strengthen the relationships between participants and care partners, especially family care partners . Care partners reports of feeling less stressed is another positive outcome of the artful moments intervention . This may suggest a possible role for art appreciation and art making in reducing caregiver burden, which has been defined as the extent to which caregivers perceive that caregiving has had an adverse effect on their emotional, social, financial, physical, and spiritual functioning . This was minimized by observers positioning themselves unobtrusively and, since participants with dementia did not understand the nature of the study (their sdms had provided consent), it is unlikely they changed their behaviour in the presence of observers . In addition, the convenience sample of participants was recruited from only one setting, and findings may not be consistent with other settings . Only eight persons with dementia and their care partners participated in this pilot study . Finally, all the participants were male and results could vary with female participants . Despite these limitations, however, the current study contributes to the growing evidence of the value of arts in dementia care . The program provided meaningful, individualized, and engaging activities that encouraged participants to be creative and to express themselves, and demonstrated the unique collaboration between a health - care team, and art gallery educators and artists . Further research into the effectiveness of the educational interventions for the clinical and art gallery staff offered at the beginning of the project is warranted . Artful moments used a combination of art appreciation and hands - on art - making activities to facilitate positive engagement in older adults in the middle - to - late stages of dementia . The program offered activities and a structure that promoted the positive aspects of caregiving, provided a person - centered approach, and created activities that care partners could share with persons with dementia . Participating in art activities seemed to help care partners shift their focus away from the negative to the more positive aspects of caregiving, such as the satisfaction in seeing the person with dementia find renewed interest and joy in an activity . Future studies should focus on determining the essential elements of this arts - based program, as it is currently unclear what actually contributes to the outcomes observed in this and other studies . Whether the location (art gallery versus hospital) made a difference is not well understood . As well, additional studies focusing on family care partners could help shed further light on the impact of art interventions on reducing stress or caregiver burden.
|
We assembled snp array data from 29,589 unrelated people and 222 nuclear families genotyped at 490,000910,000 snps from the candidate gene association resource (care), studies at the children s hospital of philadelphia (chop), the african american breast cancer consortium, the african american prostate cancer consortium and the african american lung cancer consortium . To build a recombination map, we used hapmix to localize candidate crossover positions, and implemented a markov chain monte carlo (mcmc) that used the probability distributions for the positions of the filtered crossovers to infer recombination rates for each of 1.3 million inter - snp intervals . We also implemented a second mcmc that models each individual s set of crossovers as a mixture of a shared (s) map similar to the european decode map and an african - enriched (ae) map, and then assigns each individual an ae phenotype corresponding to the proportion of their newly detected crossovers assigned to the ae map . We imputed genotypes at up to three million hapmap2 snps using mach, and then tested each of these snps for association with the ae phenotype and other recombination - related phenotypes . We identified 2,454 candidate african - enriched hotspots with increased recombination rates in the yri vs. ceu maps, and in the ae vs. s maps, and searched for motifs enriched at these loci, thus identifying a degenerate 17-bp motif . To study the structure of prdm9, we measured the length of the prdm9 zinc finger array and genotyped rs6889665 in yri, ceu and the care nuclear families; we also carried out imputation based on 1000 genomes project short read data to infer the alleles individuals carry, among 29 previously characterized in a sequencing study of prdm9.
|
Medical costs in the united states have risen rapidly and substantially, making health care expenditure one of the most troubling economic and social problems for the u.s.a . The local, state and federal governments as well as citizens are generally aware of the magnitude and seriousness of the problems of health care costs to individuals and their families, to communities, and to the nation . According to the national coalition on health care (1), the u.s.a . Has the highest health care expenditures compared to other industrialized nations . In fact, the u.s.a . Annual health care expenditures constitute a significant portion of the u.s . Gross domestic product (gdp). For instance, health care expenditures in the u.s.a . Reached $2 trillion in 2005 and are projected to reach $4 trillion or 20% of the gdp by 2015 (1). In addition to this health - care cost problem, the numbers of elderly adults and population are growing along with increased longevity and more demands for different health care services resulting from changes in lifestyles . According to the u.s.a . Census bureau (2), 35.9 million people were aged 65 and older as of july 2003 and this number is expected to double within the next 25 years . By 2030, almost 1-outof- 5 americans, about 72 million people, will be 65 years or older . Worldwide, the number of adults older than 65 years is also expected to increase from 420 million in 2000 to 974 million by 2030 . Apparently, there are two severe problems facing the u.s.a . Health care system (and perhaps those of other developed countries): enormous health care expenditures and the large growing number of elderly adults who need frequent and more health examinations and monitoring, which in turn drive up the health care cost further . While the sky - rocketing health care expenditures are the result of various issues such as increased and uncontrollable charges from health care providers and increased cost of medicine, it is believed that implementing advanced technologies for medical practices and health treatments not only will help reduce medical costs, but will also improve the treatment for patients from medical professionals . For instance, the use of advanced robotic, wireless and information technologies can assist surgeons to perform remote surgeries quickly, accurately and safely on individuals located far away from the surgeons (3). Therefore, it is crucial that not only advanced health care techniques and devices are developed and deployed, but also that technologies potentially leading to improvement in health care are introduced to the health - care professionals and organizations . Technologies, in general, and sensing, imaging, and wireless communications, in particular, have advanced considerably in the past decade which in turn can affect not only health care costs, but can also influence health examinations and monitoring . For instance, advances in sensing, imaging, and wireless communications have opened the door for possible wireless, fast, accurate and remote monitoring, examination and diagnosis of the inside of the human body . These advances have led to the development of advanced medical techniques and equipment such as magnetic resonance imaging (mri) (4) and endoscopic ultrasound (5). In order to push forward medical technologies, improvement in health care techniques to that end, it is imperative that advances in technologies be utilized wisely and properly for medical applications . One of the most significantly advanced technologies in the past decade is radio - frequency identification (rfid), which has profound impact on various applications from consumer to military applications . Rfid technology dates back to the 1940s as a military technology for identifying aircraft in world war ii (6). The recently declining cost along with improved sensitivity and durability of rfid systems has made these systems increasingly interesting for the distribution and retail industry . In fact, rfid has been identified as potential technology to replace the currently dominant upc bar - code system (7). Rfid is very attractive for medical applications and if properly utilized can potentially lead to breakthroughs in the way medical examinations and monitoring of patients are conducted . In this paper, we present several ideas of using rfid technology for personal health examination and monitoring . Our main objective is not to present specific rfid systems for these medical practices, which are outside the scope of our research and requires significant collaborated efforts between different disciplines, but to give ideas that can possibly lead to significant improvements in medical examinations and monitoring of patients . It is hoped that this paper will provide medical professionals and students some overview of what rfid technology can potentially do for medical applications, effectively motivating and facilitating them to utilize this valuable technology not only for the improvement of patient treatments, but also to possibly develop particular rfid devices, in collaboration with other disciplines such as biomedical and electrical engineering, for specific medical needs . Understanding the basics of rfid helps medical professionals, such as medical doctors, not only to properly utilize the technology for medical practices, but also to possibly improve it for specific medical needs . 1 shows a general rfid system consisting of a tag (or transponder derived from transmitter / responder) and a reader (or interrogator). The basic objectives of a rfid system are to acquire, store, process, and report specific data or information about objects at an appropriate time and location, determined by users or operators, via wireless means . Detailed information on rfid as described in this section can be found in the rfid handbook by klaus finkenzeller (8). In operation, the tag is attached to the object to be sensed, monitored, imaged, or identified . For instance, tags about the size of a large grain of rice are implanted under the skin of a dog, cat, or other animal for identification purposes (9). Implantable tags of about 11 millimeters long and 1 millimeter in diameter can also be placed under the skin of hands and arms in humans for identification, physiological characteristics, health, nationality, etc . Particularly, as noted in (8), alzheimer s patients, mentally ill patients and people with communication difficulties could benefit from implanted rfid chips for identification purposes . Data can be pre - programmed or written (during operation by the reader) into the tag to provide instructions for the tag to perform certain functions or identification of the object . The tag acquires and stores certain data from the object for various functions such as monitoring the object s activities . The tag is typically programmed so that it automatically activates when it is within the interrogation zone of readers . However, the tag can also be activated at any time by the user or operator . The receiver includes circuits used for specific functions, such as collecting temperature of the object, and is used to receive, store and possibly process specific information of an object onto which the tag is attached (with help of dsp) as well as receive information sent by the reader . Not all tags require transmitter, receiver, antenna or dsp, nor do they conduct the same functions; depending on the applications, some of the components or functions are not needed . For instance, in applications where only data reading is needed, such as object identification, a receiver is not contained in the tag . A reader may include a communication device to enable the transmission of retrieved data to other systems, such as a pc and/or other portable devices like pda for storing, processing and display or further communication with other media such as the internet, from which the information can be retrieved by remote offices . The dsp controls the reader, processes and stores retrieved information, and provides interface with other possible communication devices for transmission or reception of information . All rfid functions are carried by radio waves at various frequencies depending on the application . These include low frequency band from 100 - 500 khz, intermediate frequency band from 10 - 15 mhz, and high frequency bands from 850 - 950 mhz and 2.45 - 5.8 ghz (8). Higher frequency provides a broader choice of different types of antenna (13), which is the main component influencing the overall size of the rfid system . Higher frequency also results in smaller antennas and hence smaller systems (8). In applications involving media with substantial losses, such as the inside of the human body, lower frequency bands may be needed to facilitate the transmission and reception of signals . Typical rfid systems have practical read distances ranging from about 5 cm up to a few meters depending on the chosen frequency and antenna (8). Personal health care and treatment for patients depends largely on the ability to assess their health condition . Accurate and reliable assessment of health condition is essential not only for personal health, but also for the planning of health maintenance, including treatment . It is, indeed, one of the most important tasks in health care and preventive medicine . Current personal health examination and monitoring typically involves data collection using devices and equipment connecting to the body via wires this kind of health examination and monitoring is normally carried out periodically in certain durations and thus may not represent an optimum or completely desirable solution for patients who are constantly in need of examination and monitoring, such as those having severe problems . As will be seen in the following, the use of rfid allows personal health examination and monitoring to be wirelessly conducted either periodically or continuously, which should benefit medicine significantly, not only in cost reduction but also in enhanced treatment of patients, as compared to what is available now . 2 illustrates an idea of personal health examination and monitoring using the rfid technique . It shows tags attached to the body s skin and readers located externally to the body . Different tags may be used for different functions, such as reading the lung s temperature, measuring the blood flow, measuring the heart rate, etc . ). The readers may be placed at various locations for instance, at different places in the house of the person being monitored or in a medical facility . The tag performs specifically instructed functions and transmits the data collected to the readers . The tags can also receive instructions from the readers to perform additional functions or to modify some preprogrammed functions, such as changing the time or duration of the data collection period . The readers transfer the received data to a router, a pc or pda which is connected to the internet . The pc or pda is also used to store the data and can analyze and display them in a useful format, such as heart - beat waveforms, for immediate use by someone such as an in - house care taker . The information transmitted to the internet can be viewed by different authorized remote offices such as a doctor s office, an emergency facility, etc . The reader can also be configured as a mobile handheld device to be operated by a medical professional, such as a nurse, to read the patient s tag data on his / her visit to the doctor s office . Information from this portable reader is transmitted wirelessly to a pc for data storage, processing, diagnosis and display . Additional functions such as data analysis and display can be built into this portable reader to provide patient s information directly to the medical professional without using a pc . It should be noted that medical professionals from remote offices can also control the readers to act upon the tags through commands transmitted to the readers via the internet, as needed for proper actions . Another idea for personal health examination and monitoring using the wireless rfid technique has tags implanted onto certain body s parts and readers attached to the body s skin . As described in the other idea illustrated in fig . 3, the tags perform various functions on the human s parts and transmit the collected information to the readers, which are connected to the router, pc, or pda wirelessly . This idea requires the use of implantable tags and is thus more difficult to be implemented . However, it is more effective for examination and monitoring because tags have direct contact with the parts to be monitored and can accommodate a wider range of monitoring than those used in fig . Wider range of monitoring is possible since more implantable devices can be placed at different places in the body for monitoring while only a limited number of parts can be monitored using tags attached to the body s skin . A potential problem of this approach is the transmission of collected data from the implanted tags to the readers partly or completely across the body, whose media have very high loss (15) and hence attenuate substantially the transmitted signals that carry the collected data . These signals may thus be too weak to be detected by the readers . Another potential problem is the radiation exposure inside the human body which might cause other health issues . This potential health effect indeed needs extensive study before the deployment of implantable tags . This concern, however, is expected to be less than that with cell phones if the radio signal reaching the implantable tags is limited to much less than that currently used by cell phones, which is possible since the rfid range is only a fraction of what is used for cell phones . Implantable tags should not allow radiation exposure exceeding a safe level, nor put patients at further risk for other problems such as infections after they are approved by an authorized government health organization such as the food and drug administration (fda), which regulates medical devices in the u.s.a . In fact, in 2004, the fda approved an rfid tag for implantation in humans as a means for accessing a person s health records (17). Implantable rfid chips designed for animal tagging are now being used in humans (10,11). Most importantly, this approach should be used only for those in dire conditions, such as patients in the situation that have no other choices for monitoring purposes, due to the need of patients operation and implantation . Implantable tags require special materials and packaging for them not to cause detrimental effects to the body upon implantation . Development of such tags requires significant interdisciplinary collaboration between different disciplines such as electrical engineering, biomedical engineering, and medicine . 4 shows an application of rfid in examining and monitoring many patients simultaneously in a medical facility . Each patient carries tags that are either attached externally to the body or implanted inside the body and can be identified with a unique i d preprogrammed into his / her tags . This arrangement not only improves the examination and monitoring of patients significantly but also substantially reduces the use of the financial and personal resources, thus offering a very efficient and cost - effective health assessment and monitoring system . Although periodic personal health inspections and monitoring are important, there is a significant interest and need not only to examine but also to monitor health condition continuously . Continuous monitoring of the health of patients provides instantaneous information on the state of patients, effectively and significantly improving health care, especially for elderly patients or those experiencing deteriorating health . This can effectively help medical professionals to respond quickly and more efficiently in emergencies, helping prevent many potentially catastrophic events . Additionally, continuous monitoring supplies valuable, complete and accurate health condition of the patients . This information will allow medical professionals to conduct long - term studies of the patients health condition and gain invaluable knowledge not only of the patients but also of particular illnesses . The information can also make feasible more accurate prediction of the patients future health conditions thus allowing optimum treatment plans to be made . Continuous monitoring of personal health conditions wirelessly from a remote location further offers more convenience, lower cost and facilitates improved care for patients, particularly out - patients or those living in rural areas that are inconvenient and difficult to access to health care facilities, or in emergency situations . It should be particularly noted that the constant monitoring of patient well - being does not take into account the non - measurable aspects such as pain, but the use of the proposed rfid techniques should not duplicate the function of a nurse working with the patient for pain . As with any technology and its intended applications, the cost of the proposed rfid systems can be approximately broken down into two categories: rfid system development cost and implementation cost . For system development cost, existing tags and readers developed for consumer applications consumer tags and readers are relatively inexpensive - a tag can cost as low as a few u.s . Cents (18) and a reader can cost around 100 u.s . Dollars (19). Specially designed implantable tags are needed in one of our proposed ideas and, for these tags, new research and development needs to be conducted . We expect that the cost of these implantable tags, once fully developed and mass produced, should be very similar to that of the existing tags . The primary cost of developing the proposed rfid systems lies in the integration and testing of the rfid systems for the particular application of personal health examination and monitoring . All these development costs, however, are born by biomedical - equipment development companies just as in the development of any other medical equipment . This cost mainly consists of the cost for purchasing readers and tags, cost of maintenance and for the rfid sensor networks to be installed in medical facilities as proposed in fig . The prices of the readers and tags, as discussed earlier, are inexpensive . The rfid system is basically a wireless device and its maintenance is also relatively inexpensive . The installation cost for rfid sensors in a medical facility is very similar to the installation of other in - building wireless networks such as wi - fi hotspots for internet access (20). Nevertheless, presently, the actual cost for implementing the proposed rfid sensor network is not available, as this system is new and has not been implemented for medical practices . A major concern with the use of rfid technology in the medical field is its ethical aspects . For instance, it may be possible to gather sensitive data about a patient without consent through reading of the tags at a distance without his or her knowledge . Furthermore, tags can be used for nonconsent surveillance of the patient or other purposes . Additionally, patient data transmitted through air or the internet can also possibly be stolen without consent . These privacy issues, however, may be completely or partially resolved with proper encryption methods . In general, the ethical concerns can possibly be addressed with better and more secured technologies for rfid . We have presented several ideas using rfid technology, one of the most significantly developed and advanced technologies in the past decade, for personal health examination and monitoring . These ideas demonstrate that health examination and monitoring of patients can be done wirelessly at any time and any place without interfering with the patients normal activities and should therefore be attractive once developed and deployed for the medical field . It is believed that implementing the rfid technology would not only help reduce the enormous and significantly growing medical costs in the u.s.a ., but also help improve the health treatment capability as well as enhance the understanding of long - term personal health and illness . It is hoped that these ideas will serve as a way to illustrate potential use and advantages of the rfid technology for medical applications . Potential applications and advantages of the rfid as well as other advanced electronic technologies for medicine are enormous and if properly developed and implemented, can have tremendous impacts on the medical field . In essence, they allow us to see farther, wider and clearer into patients bodies, which is one of the ultimate objectives of medical professionals and most desirable capabilities in medical treatments . Applications of these technologies to medicine seem to be limited only by our imagination with creativity, numerous applications of these technologies in the medical field can be derived.
|
The prediction of a protein structure from its primary sequence is one of the most interesting problems in computational biology (1). Native proteins usually fold much too fast (by at least tens of magnitude) to involve an exhaustive search (2). It is a classical puzzle of the protein folding that biological proteins could not have originated from random sequences . Despite a tremendous amount of efforts and progresses over many decades, the problem remains essentially unsolved . In 1963, anfinsen and his colleagues made a remarkable discovery that the amino acid sequence of a protein was fully sufficient to specify the molecule s ultimate 3d shape and biological activity (3). For most single domain proteins, the information coded in the amino acid sequence is sufficient to determine the three - dimensional folded structure, which is the minimum free energy structure . Based on this theory, the protein is described by the complete list of the atoms in a molecule, with connectivities, bond lengths, angles, and force constants between all pairs of atoms (4). This all - atom model involves complex energy force and needs astronomical computational time . To understand the folding mechanism, it is useful to study simplified models such as the hydrophobic - hydrophilic model introduced by dill 5 ., 6 .. lattice protein folding models have been playing important roles in theoretical studies of protein folding (7). In these models, a protein is represented by a self - avoiding chain of beads placed on a discrete lattice, with two types of beads used to mimic hydrophobic and polar (hp). The advantage of hp lattice models is that they are simple enough to be amenable to thorough theoretical study, which can provide fruitful insights to feed back to or test against realistic models and experiments . The biological foundation of this model is the believed theory that the first - order driving force of protein folding 8 ., 9 . Is due to a hydrophobic collapse in which those residues that prefer to be shielded from water (hydrophobic residue) are driven to the core of the protein, while those that interact more favorably with water (polar residues) remain on the outside of the protein . Previous papers researched the problem of protein folding on the cubic lattice model whose goal was to find the fold with the maximum number of contacts between non - covalently linked hydrophobic amino acids . Yet, a significant drawback of the cubic lattice is the parity problem . In this paper, we present a triangular lattice model that overcomes the shortcomings of the cubic lattice model . Based on this model, we enumerated all possible compact structures and hp sequences . For a 333 cubic lattice model of size n=27, the total number of compact structures is 103,346 and the number of all possible hp sequences is 2 . In the enumeration study, if the energy of every sequence folded into every compact structure is valued, the total number of evaluation will be 2103,3461.3910 . For the triangular models of size 3 + 4 + 5 + 4 + 3 and size 4 + 5 + 6 + 5 + 4, the computation is 220,4861.0710 and 21,474,7822.4810 the algorithm decreased the computation by computing the objective energy of tree non - leaf nodes . The parallel experiments proved that the fast tree search algorithm yielded an exponential speed - up factor of (1.486log2mlog2maxop), in which m is the number of different compact construct strings, maxop is the optimal string bound per leaf . The methods currently used for the tertiary structure modeling are based on cubic lattice models to enumerate the minimization of the energy as a function of the topological contacts . As previously stated, the quadrate lattice model exists a defect referred as the parity problem, in which only the residue in the even position of the primary sequence and another one in the odd site can form the topological contact . The non - bonded neighbor ca nt be made between two even residues or two odd residues . We generated and enumerated all the compact self - avoiding walks on the triangular lattice model of size 4 + 5 + 6 + 5 + 4 (figure 1). The second is the two - mirror symmetry, of which one is the axial reflection and the other is the diagonal reflection . So we got the differently directed 5,903,128/4=1,475,782 self - avoiding walks with this model . Among the 1,475,782 paths, we obtained reversal symmetries of 738,189 pairs and head - tail symmetries of 596 pairs (figure 1), so the number of different compact structures in this model was 738,189 + 596=738,785 . It is energetically favorable for hydrophobic amino acids to occupy core sites, where there is low exposure to water . In this model, we denoted a sequence of amino acids by i, and took only two types of amino acids, hydrophobic and polar . The energy of a sequence folded into a structure was taken to be the sum of the contributions from each amino acid upon burial away from water: e=i=1nisi, where si is a structure - dependent number characterizing the degree of burial of the i amino acid in the chain . Larger si corresponds to a smaller surface area accessible to the solvent . For a structure on a 3d lattice, there are four different kinds of sites: center, face, edge, and corner . Therefore, in principle, there could be four different values of si . On a 2d lattice model, we took only two values for si, and defined a string si for each structure with si = 1 if the i site is a core and si = 0 if it is a surface (figure 1). Out of the 1,475,782 compact structures, the number of distinct structure strings was 219,093, among which there were 25,825 lattice conformations, and each represented exactly one structure . Each structure string has exactly ten 1 s and fourteen 0 s . Our goal was to find a target structure string {sj}, which had unique and minimum energy corresponding to the target sequence string {i}. It is obvious that the target structure string must possess a certain similarity with the target sequence string . According to the observation, we organized the structure string into a binary tree and clustered similar structure strings into the same tree node (figure 2). The algorithm decreased the computation by computing the objective energy of non - leaf nodes to locate the target structure string . The distinct structure strings was 219,093 in the model of 4 + 5 + 6 + 5 + 4 . There were thus 109,656 distinct strings that we kept in the calculation excluding the reversal structure strings . Each node of the tree represented a subset of these strings and maintained the following three kinds of information . First, a structure string would have the value 1 at the i position if and only if all the strings corresponding to this node have 1 s at the i position . Second, a structure string would have the value 1 at the i position if and only if there is a table entry in this node that has a 1 or 0 at the i position . Third, each string in a node would have 1 s at some undecided positions . For each string, missing ones are the sum of these 1 s . By construction, each string has exactly ten 1 s, so the number of missing ones is equal to 10 minus the sum of known ones . That is, missing ones are single integers no greater than 10 for each node . We splited each node at the position that made two child nodes as tightly clustered as possible, and measured this clustering for each child as the entropies for each site, with the tightest clustering corresponding to the minimum entropy . Specifically, for each node we regarded the site of minimum entropy s of its set of structure strings as a branch point (10):s = min{(pilogpi+qilogqi)},in which pi is the probability of the i position being 1, and qi is the probability of the i position being 0 . Those nodes partition the strings in the parent according to the value of the given position i: one child has the entire parent strings where i=1 and the other child has all of the strings where i=0 . Each leaf node at the end of the tree contains a small list of structure strings in the following experiments we defined the parameter as max . Given a sequence string {i} and a node of the tree, we hoped to obtain the bounds of all structure strings represented by the node . Clearly, for all strings in the node the upper bound can be expressed by: bupper = min{i*(u+k),i*k+m}. Given such a tree, where the root corresponds to all of the structure strings, the question here is how to search the tree . We computed the upper bound of the sequence string according to previous formula, and called this the objective value . If there are any leaf nodes that achieve this objective, go to next sequence . If not, repeat with the reversed version of the sequence strings . Again, if we achieve the objective value, go to next sequence . If not, decrease the objective value by 1 and try again . Given an objective value, we searched the tree as follows, starting at the root node . If the upper bound on the node indicates that objective value is unachievable, backdate and search other nodes . If one string or none has been found that satisfies the objective, backdate and search other nodes, else if two strings have been found that achieve this objective, exit and transfer the next sequence string . If the current search node is not a leaf node, try each of the child nodes . We first tried the child that matches {i}. The following experiments proved that only this step would yield a speed - up factor 1.782 in the model of size 4 + 5 + 6 + 5 + 4 . Using the fast search tree, we were able to completely enumerate all possible hp sequences and compact structures in the 4 + 5 + 6 + 5 + 4 triangular lattice model . For every sequence, we rapidly computed the energy value of all the compact structures, found the structure with the minimal energy value, and recorded the minimal energy value and energy value of the first excited state (the second minimal energy value). The overall computation is highly parallelizable because each sequence can be done independently . In order to implement the calculation of ground states for all sequences in parallel, it is useful to divide the sequences into groups and use these groups as the unit of parallelism . We performed our computations with all 2 + 2 hp sequences excluding reversed strings, which produced 129 groups . These 129 groups were executed on the legend group deepcomp1800 -p4 xeon 2 ghz -myrinet/ 512 large array multiple processors, which is a collection of 24 computers, each containing two intel pentium pro microprocessors of 2 ghz . Every machine ran the linux operating system and had at least 512 mb of memory . We divided the space of sequences into 129 groups fi (0 i <129). Num denotes the sign of group with the initial value of 0; parameter count denotes the number of performed group with the initial value of 0 . The operation of main processor p0 includes: (1) take out m groups f0, f1,, fm1, send the groups to processor p1, p2,, pm, respectively; num = m; count=0; (2) perform the data of fnum group, count added by 1 and num added by 1; (3) receive the result of processors pi (1 i m); count added by 1; (4) if num <n1 (n denotes the number of groups), send the data of fnum group to processor pi, else notify processor pi to exit; num added by 1; (5) if num <n1, transfer to step 2; if count equals to n, transfer to step 6; (6) collect the results of all the other processors pi (1 i m) and exit . The operation of other processors pi (1 i m) includes receiving the group sent by the main processor p0, performing the fast tree search, and sending the result to the main processor p0 . Each leaf node at the end of the tree contains a small list of structure strings . We considered the maximum structure string number (max) per leaf as a variant in our experiment . The creating tree time (tt), search time (tc), and total time (total = tt+tc) through the experiment the computation time showed in figure 3 is the cpu time and its unit is second . It is obvious that search time and total time are the lowest when max is 8 . The reason is that when creating the tree, every node needs to search all the structure strings and the number of nodes in the tree increases exponentially as max decreases, so the creating tree time increases exponentially . At the same time, futile search is eliminated by computing the objective value and aim structure string is located rapidly; hence the search time decreases exponentially . This is because when max is small, the leaf node contains less structure strings, but information in its parent node is enough to describe that (figure 4), so continuous bisection will increase the computation of objective energy value, which makes search time increase . When max equals to the total number of structure strings, there is only a node in the tree and the situation equals to enumerate all the structure strings . The experiments proved that the fast tree search algorithm yielded an exponential speed - up factor of (1.486log2mlog2maxop) in the 4 + 5 + 6 + 5 + 4 triangular lattice model, in which m is the total number of distinct structure strings, and maxop is optimal max . Whenever a ground state structure string is found for a sequence, the reversed sequence necessarily has the reversed structure string as a ground state . We excluded the reversed structure string and reversed sequence string in order to simplify and statistically analyze the process . There were totally 109,656 such structure strings unrelated by rotational, reflection, or reverse labeling symmetries . For a given sequence, the ground state structure is found by calculating the energy of all compact structures . We completely enumerated all the ground states of all 2 + 2 possible sequences, and found that only 181,375 sequences have unique ground states, and then we calculated the designability of each compact structure . There are structures that can be designed by an enormous number of sequences, and there are poor structures that can only be designed by a few sequences . The number of structures decreases monotonically as the number of sequences increases (figure 5). The result offers the evidence that the highly designable structures can tolerate more mutations during evolution because these structures can be designed by more different sequences . Under different designability situations, we obtained that the ratio of sequences with the ground state energy 10, 9, 8, and 7 among 181,375 non - degeneracy sequences was 62.64%, 33.50%, 3.83%, and 0.32%, respectively . The statistical relationship between the sequences with ground state energy 10, 9, 8 and the designability is shown in fig . From the figure we can find that the sequences with the ground state energy 10 account for 95% in the structure of the highest designability, while those with the ground state energy 9 and 8 account for 5% and 0, respectively; the sequences with the ground state energy 10 account for 52% in the structure of the lowest designability, while those with the ground state energy 9 and 8 account for 37% and 11%, respectively . This indicates that the compact structures of highly designability are, on average, thermodynamically more stable than other structures . Considering a structure string to be a chain of 0 s and 1 s linked by n1 links of three types, 0 - 0, 1 - 0 or 0 - 1, and 1 - 1, with n00, n10 or n01, and n11 being the numbers of such links, respectively, we analyzed the relationship between designability and n01 (figure 8). When n01=10, the structures of high designability occur more frequently (figure 8a), and the relatively high frequency of low designability structures are due to the large number of structure strings with designability 1 (ns=1). The tendency is approximately the same as n01=12 (figure 8a), except lower frequency . When n01= 8, 9, 11 (figure 8b), the structures of high designability occur less frequently while the structures of low designability occur more frequently . The tendencies of n01= 6, 7, 13 (figure 8c) are approximately the same as each other and have no much effect on the designability . The occurrence of such kind of phenomenon is because that the structures of high designability have regular secondary structures . In the top twelve structures of high designability (figure 9), the number of n01 should be in a suit scope to form a regular second structure; it is appropriate to form a regular helix structure when n01=10 . There is no regular sheet in the structures of high designability because of the energy computation simplification of the lattice model . We suppose that each dot in the 24d hypercube represents the sequence and structure in the lattice model . In the hp model, the energy of a sequence folded into a particular structure is the hamming distance between their binary strings . Hence, the number of sequences that fold uniquely to a particular structure the designability of the structure is the set of vertices lying closer to that structure than to any others . It happens that in the hypercube the smallest hamming distance between two structures is approximately proportional to the difference in their respective n10 numbers . This is evident in figure 10, where the smallest hamming distance is plotted against the difference in n01 for all the pairs among the 25,825 binary structures on a 4 + 5 + 6 + 5 + 4 lattice, and is consistent with results given by li et al . (11) in which x(p) (the degree of clustering of hydrophobic residues) is analogous to n01 . To see whether what we have observed so far has anything to do with real proteins, we compared five sequences, p15, each being a concatenation of a set of real proteins or (4 + 5 + 6 + 5 + 4) lattice binary peptides . P1, the representative non - redundant 350 proteins culled from protein data bank (pdb; www.rcsb.org/pdb/); p2, the sections in p1 that fold into helices; p3, the sections in p1 that fold into sheets; p4, the 2,919 peptides mapped to the highest designabilities; p5, the 2,077 peptides mapped to the lowest designabilities . Firstly we defined the frequency distribution function as: fi(l)(m)=fi(l)fi(l)z, in which fi(l)(m) denotes the frequency of the m binary word of length l occurring in sequence pi and there are 2 words of length l. fi(l) denotes the average frequency of fi(l)(m):fi(l)=mfi(l)(m)2l.z=(m(fi(l)(m)fi(l))2)1/2 denotes the normalized frequency distribution function . The pairwise overlaps were defined as: oij(l)=m=12lfi(l)(m)fj(l)(m),where i = 2, 3; j = 4, 5; l = 4 ~ 14 . The relationship between pairwise overlaps of different sequences it is seen that p4 (p5) is positively (negatively) correlated with p3 . For all values of l, the strongest correlation occurs between the model sequence of high designability (p4) and the real protein sequence rich in sheets (p3). The sequence of low designability is strongly correlated with the sequence rich in helix (p2), and the strong correlation occurs between the two model sequences of high (p4) and low (p5) designabilities . The strong correlation between p2 and p5 is to some extent an artifact of the lattice model . Since we only considered the simple structure string, fractional compact structures will be washed out due to path degeneracy . In the opinion of algorithm, we created the cluster tree by using the relationship between structure strings . The algorithm decreased the computation by computing the objective energy of non - leaf nodes . The parallel experiments proved that the fast tree search algorithm yielded an exponential speed - up in models of size 4 + 5 + 6 + 5 + 4 . In this paper, we have presented the two - dimensional triangular lattice model to study the designability of protein folding . Through enumerating all the possible compact structures and hp sequences, we found that different compact structures have rather different designability . The compact structures of high designability exhibit lower ground state energy, showing that these structures are, on average, thermodynamically more stable than other ones . The research offers strong evidence that compact structures of high designability are more regular and geometrically symmetric . In the opinion of structure, the triangular lattice model has no parity problem and its surface is more similar to the natural proteins, therefore it is possible to get more information from the research of highly designable compact structures on triangular lattice models.
|
Psoriatic arthritis (psa) is a frequent inflammatory disease that affects both peripheral and axial joints, enthuses, and the skin (psoriatic dermatitis, ps). It is usually seronegative for rheumatoid factor and it has been included in the spectrum of the spondyloarthropathies (spa). According to the traditional moll and wright classification,1 psa clinical subsets, often overlapping, can be classified as follows: peripheral joint arthritis (polyarticular, oligoarticular, distal, or mutilans) and inflammatory axial disease . Enthesitis, dactylitis, and uveitis are common features that are shared with the other spondyloarthropathies such as ankylosing spondylitis (as), reactive arthritis (rea), and spa associated with inflammatory bowel disease (ibd).2 psa pathogenesis is believed to be deeply influenced by genetic susceptibility,35 immune system imbalance, and environmental triggers . It is mainly mediated by t cells6 interacting with antigen - presenting cells (apc) and other cells of the inflammatory milieu,7 giving rise to the inflammatory cascade that leads to joint damage and repair mechanisms . In this context, increasing evidence has recently suggested the importance of a new subset of t lymphocyte, named th17 according to its signature cytokine.8 the initial treatments of psa are non - steroidal anti - inflammatory drugs (nsaids), steroid intraarticular injections if a single joint is affected, shortly followed by one or more disease - modifying anti - rheumatic agents (dmards) in peripheral joint disease subsets . In clinical practice, and according to international and national guidelines,9,10 the most widely used dmards are methotrexate (effective both in skin and joint manifestations), sulfasalazine, leflunomide, and cyclosporine a.1115 in non - responders and in the axial subset, anti - tnf agents are indicated in order to suppress inflammation and stop structural changes . It is recommended not to delay the switch from a traditional dmard to the biologic treatment when needed in order to avoid erosive changes and joint damage.9,10 however, a proportion of patients does not respond or develop side effects to traditional or biologic dmards; therefore, alternative drugs with different mechanisms of action are needed . Among the new molecules which have been recently proposed to the clinical community, apremilast is the most promising and attractive because of its novel mechanism of action . Biologic dmards available for chronic arthritis specifically target a single cytokine, receptor, or surface antigen in order to influence the inflammatory cascade and milieu . Another approach is to act at an earlier point, interfering with intracellular signaling that controls gene expression of cytokines and inflammatory mediators involved in the disease mechanisms . Second intracellular messengers, such as cyclic adenosine monophosphate (camp), are involved in responses to various stimuli (endogenous and exogenous) in almost all types of cells, such as lymphocytes, monocytes, apcs, and various cells involved in immune responses . The intracellular concentrations of camp represent the balance of formed and degraded camp by means of the activity of the adenylyl cyclases (mainly activated via g protein - coupled receptors [gpcrs]) and the family of phosphodiesterases (pdes), some of them expressed in a tissue - specific distribution.14 phosphodiesterase-4 (pde4) is well - expressed in dendritic cells, t cells, macrophages, and monocytes.1618 pde4 is also expressed in keratinocytes, smooth muscle cells, vascular endothelium, and chondrocytes.17,19,20 it is noteworthy that pde4 is also expressed in the central nervous system, and particularly in the area postrema which controls the emetic reflex21 (see also side effects of inhibitor compounds). The reduction in intracellular concentration of camp, by means of pde4, induces the secretion of pro - inflammatory cytokines and decreases the synthesis of anti - inflammatory mediators . On the other hand, inhibition of pde4 determines the increase of camp and the inhibition of the secretion of cytokines, such as tumor necrosis factor- (tnf-), interferon gamma (ifn-), and interleukin-1 (il-2) from immune cells,22 and the increase in cytokines such as il-10, which are characterized by anti - inflammatory properties.23 on the basis of the important role of pde4 in regulating the balance of inflammatory cytokines, specific molecules have been investigated as potential therapeutic drugs capable of modulating this enzymatic activity; among these, apremilast has emerged as the most successful one and has been proposed for the treatment of psoriasis and psa . Apremilast specifically inhibits the enzymatic activity of pde4, and therefore influences the expression of several pro- and anti - inflammatory cytokines.24 pro - inflammatory signals, such as those derived by toll - like receptors in monocytes and dendritic cells, activate transcription factor nuclear factor - kappa b (nf-b) and the expression of pro - inflammatory cytokines such as il-23, tumor necrosis factor- (tnf-), and interferon gamma (ifn-). Moreover, gpcrs trigger the activation of adenylyl cyclase, resulting in an increased concentration of camp.16,17,2224 in monocytes and dendritic cells, camp is degraded to amp mainly by pde4 . Pde4 inhibition by apremilast increases intracellular camp levels, which regulates the activation of protein kinase a (pka). Pka activation induces the phosphorylation of transcription factors such as camp responsive element - binding protein (creb), camp responsive element modulator (crem), and activating transcription factor 1 (atf-1). These transcription factors also bind to cre sites within promoters of il-10, increasing il-10 expression . Transcriptional co - activators such as creb - binding protein (cbp) or the homologous protein p300 are also involved in these processes, resulting in inhibition of nf-b transcriptional activity, and reduced expression of il-23, tnf-, and ifn-. The decreased production of inflammatory mediators reduces cellular infiltration in the target tissue and the activation and proliferation of keratinocytes and synoviocytes in the psoriatic skin and synovium . This may reduce epidermal thickening in psoriasis and decrease synovitis and articular damage in the affected joints . Direct effects of apremilast on keratinocytes and synoviocytes are also under investigation (see figure 1).16,17,2224 following early evidence of the therapeutic potential of apremilast in the treatment of psa, schett et al performed a phase ii randomized, double - blind, placebo - controlled clinical trial in order to study the efficacy and safety of apremilast in active psa.25 two hundred and four patients with active psa, defined as having at least three swollen joints and at least three tender joints at the time of recruitment, were involved in the study . All patients had discontinued immunosuppressant drugs, including traditional and biologic dmards (with the exception of methotrexate) and phototherapy in patients with extensive skin involvement, according to a definite scheduled washout period, before being treated with apremilast . Stable therapy with methotrexate, corticosteroids, and/or nonsteroidal anti - inflammatory drugs (nsaids) was permitted . Recruited patients were randomized in three arms to receive placebo, apremilast 20 mg twice daily (bid), or apremilast 40 mg once daily (qd) for 12 weeks . Following the first 12 weeks, all patients could exit the trial, enter a 4-week observational phase or enter into a 12-week treatment extension phase . Patients originally randomized to receive placebo rather than active drug were re - randomized to apremilast 20 mg bid or 40 mg qd treatment arms . The primary endpoint was clinical response as measured by acr 20 (american college of rheumatology 20% improvement response) at week 12, while secondary endpoints were: evaluation of psa response criteria (psarc), disease activity score28 (das28), acr 50, acr 70, functional assessment of chronic illness therapy - fatigue (facit - f), health assessment questionnaire - disability index (haq - di), pain visual analog scale (vas), 36-item short - form health survey (sf-36), and assessment of the incidence of side effects and general safety issues.25 one hundred and sixty - five patients completed the treatment phase at week 12 (out of 204). Almost half of the patients (43.5%) receiving apremilast 20 mg bid (p<0.001) and 35.8% of patients receiving 40 mg qd (p=0.002) reached an acr 20 response compared with 11.8% in the placebo group . At week 24 (end of the treatment extension phase), more than 40% of all treatment groups fulfilled the acr 20 response criteria . Reported adverse effects were mild or moderate and included diarrhea, headache, nausea, fatigue, and nasopharyngitis . On the basis of these results, the authors concluded that apremilast, at the dosage of 20 mg twice per day or 40 mg once a day was effective and well - tolerated in the treatment of active psa.25 on the basis of the promising results of this phase ii study, four phase iii studies (psoriatic arthritis long - term assessment of clinical efficacy [palace]) were designed and conducted in order to assess the long - term clinical efficacy and safety of apremilast . In all these trials, around 500 patients were randomized into three arms to receive apremilast 30 mg bid, apremilast 20 mg bid, or placebo . After 24 weeks of treatment, patients might enter, on a voluntary basis, an extension phase where patients in the placebo arms were re - randomized to one of the apremilast active drug arms . In the extension phases, the recruited patients are planned to be followed for 2 or 4.5 additional years, in the palace 4 trial and palace 1, 2, 3 trials, respectively . Secondary endpoints include acr 50, acr 70, health - related quality of life questionnaire, and assessment of treatment safety . Treatment with methotrexate, leflunomide, or sulfasalazine was allowed in palace 1, 2, and 3, while patients in palace 4 were dmard therapy- nave . The results of these trials have been presented at international meetings and published only in abstract form.2630 the data publicly available in october 2013 support the efficacy of apremilast in the long term (52 weeks), showing that in patients who received apremilast from baseline, an acr 20 response was achieved by 63% and 54.6% in the apremilast 20 mg and 30 mg arms, respectively . At week 52, pasi-75 (psoriasis area and severity index score) was achieved by 25% and 37% of patients who received apremilast 20 mg and 30 mg bid, respectively, compared with baseline (palace 1).27 preliminary results from palace 2, 3, and 4 studies3133 are shown in table 1 . Long - term data also confirm the efficacy of apremilast in treating typical manifestations of psa such as enthesitis and dactylitis . Pooled results from three phase iii rct were analyzed by gladman et al28 and presented at the acr 2013 annual meeting, demonstrating that in patients randomized to apremilast and completing 52 weeks of study, a mases (maastricht ankylosing spondylitis enthesitis score) score of 0, indicating no pain at any of the entheses assessed, was achieved by 41.4% and 37.4% of patients treated with 20 or 30 mg bid, respectively.34 at week 52, dactylitis count decreased to 0 in 66.9% and 65.9% of patients (apremilast 20 or 30 mg, respectively). The authors concluded that apremilast confirmed its efficacy in the treatment of psa, including improvements in enthesitis and dactylitis . Further evidence of the efficacy of apremilast in the treatment of psoriatic skin dermatitis comes from a phase ii randomized study, performed by papp et al: patients treated with apremilast at 10 mg, 20 mg, and 30 mg bid reached pasi-75 in a dose - dependent fashion (11%, 29%, and 41%, respectively, compared to 6% in the placebo group).35 moreover, gottlieb et al demonstrated a reduction in epidermal thickness, t cells, and cd11c cell infiltration in patients with psoriasis only, following treatment with apremilast.36 the overall safety and tolerability of apremilast was well assessed in a pooled analysis of palace 1, 2, and 3 performed by mease et al.29,30 no new safety findings were identified compared with previous reports from early time points assessment . The most commonly reported side effects were diarrhea (14.3%), nausea (12.6%), and headache (10.1%), which were dose - dependent, as well as upper respiratory tract infection (10.3%) and nasopharyngitis (7.4%). The majority of adverse effects were mild / moderate and discontinuation of treatment due to side effects was low (7.5% and 8.3% in patients receiving apremilast 20 or 30 mg bid, respectively) and occurred mainly in the first 24 weeks of treatment . Nausea and diarrhea were predominantly mild and occurred mainly in the first 2 weeks of treatment . The majority of cases resolved within 4 weeks despite continued therapy . Remarkably, incidence rates of serious infections, major adverse cardiac events, or occurrence of malignancies were comparable to the incidence in the placebo group . There were no clinically relevant changes in laboratory markers, suggesting that laboratory monitoring may be not indicated . Of note, no novel or reactivation cases of tuberculosis (tb) were reported in the apremilast treatment groups and tb screening was not required per protocol . In summary, apremilast demonstrated a satisfactory safety profile and was generally well - tolerated for up to 52 weeks with no concerns in the long - term exposure . The good safety profile and tolerability of apremilast is also confirmed in other clinical studies, including those performed in patients with skin psoriasis without joint involvement.3538 the precise pathogenesis of psa is still under investigation, but the evidence so far available supports an important role of the individual s genetic background, environmental triggers, and an imbalance in the adaptive and acquired immune system resulting in the production of inflammatory mediators . New therapeutic approaches have been proposed, among them the use of modulators of intracellular signals and gene transcription such as pde4-inhibiting compounds, being pde4 involved in degrading camp and therefore altering the activity of transcription factors such as creb and nf-b . The reduction of the inflammatory mediators like tnf- and il-23, and the increase of anti - inflammatory mediators like il-10 have proved beneficial in animal models and clinical trials . The data available on the pde4 inhibitor apremilast, summarized in this review, support its role as an immunoregulator, as well as its clinical efficacy, good tolerability, and safety profile in the treatment of psa.
|
Blood is an invaluable, life - sustaining fluid . Without a sufficient amount of blood, the cells of the human body could not receive adequate oxygen and nutrients they need to survive . Large volume of blood could be lost as a result of numerously varying serious conditions such as road traffic accidents, obstetric and gynecological hemorrhages, surgery, trauma, chemotherapy, and long - term therapies as well as anemia of medical or hematologic conditions or cancer . Because of these blood transfusion is considered as an integral and essential element of a health care system . Besides, blood transfusion is one part of complex medical and surgical interventions which improves the life expectancy and life quality in patients with a variety of acute and chronic conditions . Therefore, blood transfusion is now considered as an indispensable component of medical management of many diseases . Blood donation is philanthropic deed in which the blood of a healthy person had been drawn voluntarily for the purpose of transfusion . The donated blood can be life - saving for individuals who have lost large amounts of blood because of serious accidents, as well as for individuals who have become severely anemic or have very low platelet counts and certain hematological disorders such as leukemia . Besides, children being treated for cancer, premature infants, and children having heart surgery need blood and platelet transfusions to survive . World health organization (who) recommends countries to focus on young people to achieve 100% nonremunerated voluntary blood donation by 2020 . It also recommends that all countries should be self - sufficient in all blood products and that all blood donation should be voluntary, anonymous, and nonremunerated . According to its 2011 report, 107 million blood donations are collected globally; approximately half of these are collected in the high - income countries, home to 15% of the world's population . Blood donation rate in high - income, middle - income, and low - income countries was 39.2, 12.5, and 4.0 donations per 1000 population, respectively . In low - income countries, up to 65% of blood transfusions are given to children under five years of age, whereas, in high - income countries, the most frequently transfused patient group is over 65 years of age, accounting for up to 76% of all transfusions . Compared to the 2004 report, 7.70 million blood donations incensement was noticed from voluntary unpaid donors in 2011 . However, majority of countries still collect more than 50% of their blood supply from replacement or paid donors . About 234 million major operations are performed worldwide every year; 63 million people undergo surgery for traumatic injuries, 31 million for treating cancers, and another 10 million for pregnancy - related complications . For all of these procedures, moreover, the demand of blood for patient management has been growing dramatically due to the sophistication and advancement of clinical medicine . However, the demand and supply have not yet balanced; the demand is escalating . Despite recommendations that all blood donations should be voluntary and nonremunerated, replacement and paid donors are common throughout sub - saharan african countries . Surprisingly, 38 african countries collected fewer than 10 donations per 1000 people . There have been gross inadequacy and inequity in access to blood safety in who african region [7, 8]. Concurrently, in sub - saharan african countries, the need for blood transfusions is high because of maternal morbidity, malnutrition, and a heavy burden of infectious diseases such as malaria . In ethiopia, the national requirement for blood in ethiopia is between 80,000 and 120,000 units per year, but only 43% is collected . The percentage of blood collected from vbd and the average annual blood collection rate are extremely low . Out of the 44 who african countries that reported the percentage of voluntary nonremunerated blood donation (vnrbd), only 22% of blood is being donated by vbd in ethiopia; the country is classified among countries that have least number of vbd (group c, countries with <50% vbd). Adult population are potential source of great interest not only for the blood they could supply but also because of the information on the subject giving blood which could promote the spread of healthy lifestyles and acquisition of greater awareness about one's own health and contribute to the development of a mature, responsible, and civic attitude . Voluntary, nonremunerated blood donations are the cornerstone of a safe adequate supply of blood and blood components [12, 13]. Thus, the objective of this research was to assess knowledge, attitude, and practice towards blood donation among adult population in gondar town, northwest ethiopia . Community based cross - sectional study was conducted in gondar town, northwest ethiopia, from february to may 2015 . The source populations were all adults who were residing in study area at least for 6 months and who were available during data collection period . Those adults who were critically ill and had mental problems were excluded from the study . The independent variables were sociodemographic variables like sex, age, educational status, marital status, religion, and self - perceived health status . Single population proportion formula, [n = (z/2)p(1 p)/d], was used to calculate the sample size . Due to the lack of published information showing the knowledge, attitude, and practice of blood donation in this particular study area, we took 50% to get the maximum sample size by considering 95% confidence interval, marginal error (d) of 5%, and design effect of 2 . Then, the final sample size was determined to be 768 . In the first stage of the sampling, three administrative areas (subcities), lideta, maraki, and gebriel, were selected by using simple random sampling technique from the total 12 subcities . In the second stage of sampling, sanita ketena from lideta subcity, ketena two from maraki subcity, and, systematic sampling technique was employed to select households from each of the ketenas / kebeles . The numbers of households sampled from the selected ketenas and kebeles were determined using proportionate - to - population size . There were a total of 4603 households in three selected kebeles / ketenas: 1800 in sanita ketena of lideta subcity, 1960 in ketena two of maraki subcity, and 843 in kebele 14 of gebriel subcity . The interval (k) value was calculated for each selected kebele / ketena by dividing the total households in each selected kebele / ketena to the corresponding proportional sample size calculated for each ketena / kebele . . Then other households were selected at every kth interval . Whenever more than one eligible adult was found in the same selected household, only one of them was chosen using the lottery method for interview . In the case no eligible candidate was identified in a selected household or the selected household is closed even after revisit, the sampling process continued to the next household in the clockwise direction until getting an eligible person . Knowledge about blood donation was assessed using 13 general questions which are deemed to be known by general population like place of blood donation, importance of blood donation, and eligibility for blood donation . Each response was scored as 1 for correct response and 0 for incorrect response . Knowledge scores for individuals were calculated and summed up to give the total knowledge score . Participants who correctly responded to more than 50% of knowledge assessing questions were considered as having adequate knowledge about blood donation, whereas those who scored <50% were considered as having inadequate knowledge about blood donation . Similarly, 14 attitudes related questions were asked, and the responses of each question were scored as 1 for correct response and 0 for incorrect response . The attitude scoring ranges from 14 (largest) to 0 (smallest). Attitude scores for individuals were calculated and summed up to give the total attitude score . Participants who correctly responded to more than 50% of attitude assessing questions were considered as having good attitude towards blood donation, whereas those who scored 50% were considered as having poor attitude towards blood donation . The practice was assessed by asking about history of previous donation and the frequency of donation . The practice was scored from largest (the number of times a donor donated previously) to smallest 0 (never donated before). The data were entered using epi info version 3.5.1 and then cleaned and analyzed using spss version 20 software package . Data cleaning was carried out by running frequency of each categorical variable and cross tabulation of different categorical variables . Descriptive results were summarized as percentage, means, and standard deviations and presented in table . The association of the independent variable with the categorical outcome variable was measured by calculating odds ratio with p value and 95% confidence interval using bivariate and multivariate logistic regression . All independent variables with p value less than 0.2 were included in the multivariate models to identify factors associated with knowledge, attitude, and practice towards blood donation . Besides, the relationships between knowledge, attitudes, and practice scores were examined using bivariate correlation analysis . The research was conducted after ethical approval letter was given from research and ethical committee of school of biomedical and laboratory science, university of gondar . In addition, after explaining the importance of study, permission letter was taken from each of the kebeles / ketenas administrators, and an informed consent was obtained from each study participant . From a total of 768 participants, 430 (56%) were male and 338 (44%) were female . More than half of the participants (n = 402 (52.3%)) were in the age range of 2025 years . About 354 (46.1%) and 189 (24.6%) of the study participants had attained or have been attaining secondary and higher education, respectively (table 1). From the total study participants, 436 (56.8%) had adequate knowledge towards blood donation . Majority (n = 704, 91.8%) of the study participants heard the idea of blood donation previously . About 678 (88.3%) study participants thought that the importance of blood donation is to save life, while 24 (3.1%) of them believed that it is to get health assurance (table 2). More than three - fourths, 630 (82%), of the respondents had good attitude towards blood donation . Nearly all, 741 (96.5%), of the participants thought that blood donation is important (table 3). Less than one - quarter, 141 (18.4%), of the respondents had an experience of blood donation, while the rest of the participants, 627 (81.6%), never donated blood before . Of those who donated before, 86 (61%) were voluntary donors, while the rest 39% of them were replacement donors . The major reasons mentioned for not donating blood among nondonors were perception of not being fitted to donate blood (21.2%), lack of information on where, when, and how to donate blood (17%), fear of being anemic after blood donation (12.6%), and fear of health risk after donation (12.3%) (table 4). In bivariate logistic regression, age, occupation, marital status, educational status, and self - perceived health status were significantly associated with adequate knowledge about blood donation, while, in multivariate logistic regression controlling confounders, secondary educational status (aor = 2.28; 95% ci: 1.51, 3.44) and higher educational status (aor = 2.88; 95% ci: 2.01, 4.12) were significantly associated with adequate knowledge towards blood donation (table 5). In bivariate logistic regression marital status, religion, and self - perceiver health status were significantly associated with attitude of the participants, while in multivariate logistic regression religion was the factor which was significantly associated with attitude towards blood donation (table 6). In bivariate logistic regression analysis, age, sex, religion, marital status, and self - perceived health status were statistically associated with blood donation practice of the respondents, while in multivariate logistic regression analysis, participant's age, sex, religion, and self - perceived health status were found to be significantly associated with practice of blood donation (table 7). In addition, we had tried to assess the correlation between knowledge, attitude, and practice scores of the study participants . Knowledge and attitude scores of the participants achieved significant but weak positive correlation (r = 0.238; p = 0.01). Similarly, knowledge and practice scores of the participants had shown statistically significant positive correlation, even though it is weak (r = 0.26; p = 0.01). Moreover, the attitude and practice scores of the participants had fair positive correlation (r = 0.31; p = 0.01). In this study, an attempt has been made to assess the level and factors associated with knowledge, attitude, and practice of adults on blood donation . From the total study participants, 436 (56.8%) had adequate knowledge regarding blood donation . The result is higher than a study done in jordan aimed at investigating knowledge and attitude of blood donors and barrier concerning blood donation among 500 blood donors which reported that 28.6% of them had adequate knowledge . The possible reason for this discrepancy might be due to the difference in the sample size . In this study, more than three - fourths (88.3%) of the participants knew that the importance of blood donation is to save life . The result was higher than a study conducted in democratic republic of congo among 416 participants to assess the knowledge, attitude, and practice of the general population showing that only 183 (44.1%) of them responded that the importance of blood donation is to save life . The difference might be due to variation in sample size and also variation in age of the study participants . In our study, only adult age group, 2040 years old, were included, whereas in the study of democratic republic of congo participants were in the age range of 1865 years . In the current study, multivariate logistic regression showed that educational status was the only variable that significantly associated with the knowledge of participants . Participants who attended or had been attending secondary education (aor = 2.9; 95% ci: 1.51; 3.44) and higher education (aor = 2.9; 95% ci: 2.01; 4.12) were more likely to have adequate knowledge towards blood donation . Thus, as the level of education increases, participants' knowledge towards blood donation also increases . Majority 630 (82%) of the study participants have good attitude towards blood donation . About 282 (36.7%) of them had a perception that blood donation causes anemia . This result is in line with a study conducted in mekelle city in which 370 (45.9%) of the study participants believed that blood donation causes anemia . In this study, religion was the only variable significantly associated with the attitude of the participants using multivariate logistic regression . Those participants who were catholic and jewish (aor = 0.16; 95% ci: 0.05, 0.51) were less likely to have good attitude towards blood donation . Being catholic and jewish reduces the attitude towards blood donation by 84% compared to being orthodox christian by religion . This needs further in - depth behavioral study to explore the reason why being catholic and/or jewish by religion reduces blood donation perception . In the current study, less than one - fourth, 141 (18.4%), of the study participants had the experience of blood donation . The result is in agreement with studies done in trinidad and tobago (18.8%) and north central nigeria (22.6%). On the contrary, it is lower than studies conducted in saudi arabia (58.2%), iran (26%), and southern brazil (32%). In saudi arabia, iran, and southern brazil studies, the study participants were in the age of range of 1850, in the age range of 1865, and above 20 years of age, respectively . However, in our study, the study's population were within the age range of 2040 years . Probably, individuals with age above 40 become socially responsible, and they do have increasing tendency to donate blood as supported by zago et al . . Among donors, the rate of previous blood donation is higher than study done in saudi arabia (26.4%). The result is in contrast to studies done in north central nigeria and saudi arabia in which replacement donors were more frequent than voluntary donors . More than half, 432 (68.9%), of nondonors stated wrong perception like fear of being anemic, fear of weight loss, fear of health problem, perception of not being fit, and lack of information on where, when, and how to donate blood as a major reason for not donating . This result is consistent with study conducted in trinidad and tobago . In current study, multivariate logistic regression showed that participant's age, sex, religion, and self - perceived health status were significantly associated with the practice of participants . Those participants in age ranges of 3135 years (aor = 2.61; 95% ci: 1.6; 4.86) and 3640 years (aor = 3.8; 95% ci: 2.0; 7.31) were more likely to donate blood as compared to participants in age range of 2025 years . The possible reason for this might be due to the fact that participants at age range of 3040 years are in late adulthood stage so that they are assumed to be socially proactive and donate blood . This had also been supported by study done in southern brazil which revealed that individuals in the age range of 3049 had higher tendency to be loyal blood donors . In this study, the result is in line with a study conducted in togo which showed that majority (61%) of blood donors were male . Males were two times more likely to donate blood compared to females (aor = 1.7; 95% ci: 1.14; 2.54). This is in agreement with the study done in yazd, iran, which reported that significantly higher proportions of men were donors compared to women . The possible reason for this difference with regard to donation practice between women and men might be related with knowledge difference . Culturally, the society is male dominated; and there is disparity in access to education between women and men in ethiopia . Moreover, our data showed that significant difference was observed in knowledge score between women and men: men had higher score than women (= 22.4; p value = 0.049). In this study, study participants with excellent self - perceived health status were two times more likely to donate blood as compared with those with good self - perceived health status (aor = 2.23; 95% ci: 1.4; 3.62). People who feel they are healthy are more confident and suitable for donating blood . In this study, knowledge and attitude scores of the participants had shown significant positive correlation even if the correlation is weak (r = 0.238; p = 0.01). Likewise, knowledge and practice scores of the participants had shown positive but weak correlation (r = 0.26; p = 0.01). This result is in line with a study which was conducted in the city of yazd to assess the level of knowledge, attitude, and practice regarding blood donation . Meanwhile attitude and practice of the participants have fair (r = 0.31; p = 0.01) positive correlation . Thus, as the attitude of the participants increases the level of practice also increases . In the current study, the major reasons mentioned by nondonors for not donating blood were perception of not being fitted to donate blood, lack of information on where, when, and how to donate blood, fear of being anemic after blood donation, and fear of health risk after donation . Even though the extent of the problem varies with race, sociocultural values, and socioeconomic status of the population on which the studies focused, the blood donation barriers reported by nondonors in our study are nearly in agreement with other studies [2426]. This problem needs massive public health advocacy about the importance and related risk of blood donation to ensure steady supply and availability of safe blood for transfusion . In general, the study revealed that the proportion of adults who had adequate level of knowledge about blood donation and good attitude towards blood donation is high . However, the level of blood donation practice was low; and perception like not being fitted to donate blood, fear of being anemic after blood donation, fear of health risk after donation, and lack of information on where, when, and how to donate blood were the major reason for not donating blood . Regarding factors affecting attitude towards blood donation, religion was the only variable which remained to be significantly associated with attitude . Besides age, sex, religion, and self - perceived health status were statistically significant variables that affect blood donation practice . The limitations of this study are similar to most of studies done on knowledge, attitudes and practices . One of the inherent limitations of such type of studies is that responses might be influenced by socially desirable traits and there might be the possibility of both interviewer and recall bias . The other limitation of this study is that the result cannot be inferred to other populations in the country because in multicultural countries knowledge, attitude, and practices regarding blood donation might be greatly influenced by tradition and sociodemographic factors of the population in different parts of the country . Recommendations . National blood bank agency, district blood banks, who, and other organizations working on assuring safe and adequate blood supply should design strategies and tailored programs that promote blood donation practice . Besides, large scale in - depth behavioral studies need to be conducted to explore the distal and proximal societal factors that affect the communities' perception towards blood donation and blood donation practice.
|
Age - related ocular diseases such as cataracts will assume increasing importance in the public health of the polish nation . Cataracts are a common cause of visual acuity (va) loss and reduced quality of life in the elderly population.1 over the last few years, life expectancy in poland has been increasing steadily, and forecasts for the future are optimistic . For men, this rate is predicted to grow from the current 70.4 years to 77.6 years by 2035, while for women, we can expect an increase from 78.8 years to 83.3 years (compared with 56.0 and 61.6 years, respectively, in 1950).2 the occurrence of cataracts is strongly related to aging; however, there is little information in the literature on the final visual results and safety of cataract surgery and intraocular lens (iol) implantation in the group defined as very elderly.3,4 in a study of 802 consecutive cataract operations, berler found that patients> 88 years of age were at increased risk of complications compared with those under 88.5 syam et al also found a higher incidence of complications, in a retrospective study of perioperative complications of cataract surgery in a group of very elderly patients, although the studied group was small (34 eyes from 21 patients).6 the number of patients eligible for cataract surgery is predicted to increase as a result of greater surgical safety and an increase in the proportion of elderly people in the population.7 furthermore, visual impairment leads to reduced quality of life, poorer general health, and increased mortality.8,9 cataracts are one of the conditions responsible for impaired vision in the very elderly . The decrease of vision is a serious risk factor for loss of balance, perhaps leading to falls and injury . Many risk factors for falling among elderly people have been identified in epidemiological studies, including poor vision.10 hip fractures in the elderly are commonly caused by falls . The authors established that cataract surgery is an effective intervention to reduce the risk of falls in elderly patients with cataract - related visual impairment.1113 the aim of our study was to retrospectively evaluate the effectiveness and safety of cataract surgery and iol implantation in patients aged 90 years or older, whom we define as very elderly . Visual outcomes and their relation to the coexisting disorders and to the complications were analyzed . The study was retrospectively conducted between 2008 and 2010 at university hospital no 5 of the medical university of silesia . The study involved a total of 122 patients (122 eyes) with senile cataracts . All operations were performed by surgeons from the special cataract clinic, who are all highly experienced in phacoemulsification (phaco). In this study we included patients> 90 years old, who had significant bilateral cataracts causing impairment of visual functions not correctable by glasses (best corrected visual acuity [bcva] worse than 0.7), or with unacceptable glare, polyopia, or reduced quality of vision attributable to cataracts . The exclusion criteria were age under 90 years, a preoperative bcva of 0.7 or better, a baseline endothelial cell density of less than 1500 cells / mm, uncontrolled glaucoma, and physical or mental disability that would make it difficult to perform the surgery . The mean age of the patients was 91.2 2.3 years (range 90100 years old). Surgery was performed on 43 men (mean age 90.4 years) and 79 women (mean age 91.5 years). Phaco was done on 113 of 122 eyes and 9 of 122 eyes had extracapsular cataract extraction (ecce). Phaco was developed in 1967 by charles d kelman and is now the most common technique used in developed countries.14 it involves the use of ultrasounds to emulsify the cataractous lens through a small incision (1.83.2 mm). Ecce involves the removal of the cataractous lens while the posterior capsule is left intact to allow implantation of an intraocular lens . The type of anesthesia used depended on the preference of the surgeon and general condition of the patient . These included topical drop anesthesia in 110 of 122 patients, sub - tenon s and peribulbar anesthesia in 10 of 122 patients, and general anesthesia only in two cases because of inability to understand verbal commands . During the clinical examination on the day of surgery, ocular comorbidity was defined as: coexisting ocular disease identified preoperatively that was likely to limit the final va outcome . The primary outcome measures were postoperative bcva, intraocular pressure (iop) using goldmann applanation tonometry, and intraoperative and postoperative complications . Postoperative va and iop were analyzed on the first postoperative day, 3 months, and 6 months after surgery . The statistical analysis was carried out using the statistica 10.0 pl (statsoft, inc ., tulsa, ok, usa) with student s t - test performed for normal distribution (preoperative iop between patients with and without coexisting glaucoma, pre- and postoperative iop in both groups) of the results in the study groups, or the mann whitney u test in non - normal distribution (postoperative iop between patients with and without coexisting glaucoma). Analysis of variance (anova) with tukey s hsd post - hoc test was applied to compare the first day, 3 months, and 6 months after surgery . For all statistical tests, all subjects gave an informed consent before participating in the study, and research followed the tenets of the declaration of helsinki . Phaco was developed in 1967 by charles d kelman and is now the most common technique used in developed countries.14 it involves the use of ultrasounds to emulsify the cataractous lens through a small incision (1.83.2 mm). Ecce involves the removal of the cataractous lens while the posterior capsule is left intact to allow implantation of an intraocular lens . The type of anesthesia used depended on the preference of the surgeon and general condition of the patient . These included topical drop anesthesia in 110 of 122 patients, sub - tenon s and peribulbar anesthesia in 10 of 122 patients, and general anesthesia only in two cases because of inability to understand verbal commands . During the clinical examination on the day of surgery, ocular comorbidity was defined as: coexisting ocular disease identified preoperatively that was likely to limit the final va outcome . The primary outcome measures were postoperative bcva, intraocular pressure (iop) using goldmann applanation tonometry, and intraoperative and postoperative complications . Postoperative va and iop were analyzed on the first postoperative day, 3 months, and 6 months after surgery . The statistical analysis was carried out using the statistica 10.0 pl (statsoft, inc ., tulsa, ok, usa) with student s t - test performed for normal distribution (preoperative iop between patients with and without coexisting glaucoma, pre- and postoperative iop in both groups) of the results in the study groups, or the mann whitney u test in non - normal distribution (postoperative iop between patients with and without coexisting glaucoma). Analysis of variance (anova) with tukey s hsd post - hoc test was applied to compare the first day, 3 months, and 6 months after surgery . For all statistical tests, all subjects gave an informed consent before participating in the study, and research followed the tenets of the declaration of helsinki . In the group of 122 eyes, 41 (33.6%) had no ocular comorbidity identified before surgery . The 81 eyes (66.4%) with ocular comorbidity included 54 (44.3%) with age - related macular degeneration, 26 (21.3%) with glaucoma, 15 (12.3%) with pseudoexfoliation syndrome, 8 (6.6%) with corneal opacity, 15 (12.3%) with hypertensive retinopathy, and 9 (7.4%) with diabetic retinopathy . The bcva was 0.1 in 94 of 122 eyes (77.1%), between 0.20.4 in 24 of 122 eyes (19.7%), and between 0.50.7 in four of 122 eyes (3.3%). The postoperative bcva 3 months after surgery was 0.8 in 23 of 122 eyes (18.9%), between 0.50.7 in 28 of 122 eyes (22.3%), and between 0.20.4 in 33 of 122 eyes (27.1%). Va improved in 100 of 122 eyes (82.0%), remained the same in 20 of 122 eyes (16.4%), and decreased in two of 122 eyes (1.6%), mainly because of coexisting age - related macular degeneration (amd). We found significant difference between pre- and postoperative va on the first day, 3 months, and 6 months after cataract surgery . We also found significant difference between va measured on the first day and 3 months after surgery, but there was no difference between the 3-month and 6-month postoperative va . We did not observe significant differences in va between patients operated on with phaco and ecce between 3 months and 6 months after surgery . We found significant difference in preoperative iop between patients with and without coexisting glaucoma (17.7 3.4 mmhg versus 14.8 2.4 mmhg, p = 0.002). On the first postoperative day we observed a decrease of iop in the group of glaucoma patients (14.2 2.4 mmhg), but there was no difference in iop compared to patients without glaucoma (14.5 2.5 mmhg). Postoperative iop had significantly decreased in glaucoma patients compared to the preoperative period (17.7 3.4 mmhg versus 14.2 2.4 mmhg, p = 0.002). We found no difference in iop on the first day, 3 months, and 6 months after surgery . The most frequent complications following cataract surgery in very elderly patients in our study were posterior capsule tear without vitreous loss and corneal decompensation . Both were found in three patients (2.5%). A dropped nucleus and vitreous loss cataracts are one of the most frequent reasons for visual impairment around the world . Cataracts in very elderly patients can cause progressively painless vision loss . Because of the demographic shift in developed countries toward older age, the prevalence of cataracts in the population as a whole has increased . It is difficult to perform cataract surgery on an elderly patient owing to additional difficulties like coexisting systemic disorders, the difficulty of patient cooperation during surgery, higher incidence of hard nucleus, smaller pupil size and high rate of pseudoexfoliation syndrome . We found little evidence to support the hypothesis that age alone is a risk factor for the intraoperative complications of phaco cataract surgery . The lack of data on very elderly patients may be due to the relatively few patients of this age who have undergone cataract surgery . Guzek et al had only 84 patients> 80 years of age in a group of 1000 cases of cataract surgery;15 davison conducted a study of 2839 patients wherein only 1.3% of the patients were aged 90 years.16 many elderly people have ocular and systemic comorbidities . In a uk national cataract surgery survey, one in three participants had a pre - existing ocular condition that could significantly affect cataract surgery outcomes.17 in that study, amd was present in 15% of the participants, glaucoma in 10%, and diabetic retinopathy in 3% . The prevalence of these conditions, as expected, increased with age . In the medical research council assessment and management of older people in the community trial, the authors found that in both men and women aged 90 years, amd is the most important cause of visual loss (55.6% and 53.7%), and cataracts were the cause of visual loss in 33.3% and 24.1%, respectively.1 berler found that in patients under 88 years, 90.5% of eyes with complicated cataract surgery achieved a va> 6/12, compared with only 40% of complicated cataract cases when patients were> 88 years old.5 in a previous study, westcott et al found that age is a significant determinant of visual outcome, with the odds of a patient with no comorbidity achieving acuity va of> 6/12 being 4.6 times higher in the 6069 year old age group than in those> 80 years old.18 our study supports these observations and others . Lundstrm et al have shown improvement in va in 84.3% of patients> 85 years.19 similarly, a study carried out by applegate et al has shown improved va in a majority of the patients (88%) above 70 years old following cataract surgery.20 our study showed that postoperative va improved in 84% of cases . Va remained the same in 16.4% and deteriorated in 1.6% of the cases; this deterioration was attributed in 62.2% of the cases to the underlying advanced amd . The incidence of early postoperative iop increase is reported to be 2.3%8.9% in all cataract extractions.21 in another study, kim et al found more frequent (22.0%) increased iop on the first postoperative day following cataract surgery.22 the extent of such an early iop increase was reported to be related to anterior chamber inflammation and prostaglandin release, capsulorhexis size, or residual viscoelastic material in the anterior chamber.23 in contrast to the results of that study, in our study s group of elderly patients we did not find that cataract surgery resulted in an increase of the iop on the first postoperative day, 3 months, and 6 months after surgery; we also found significant decrease of the iop in patients with preoperatively existing glaucoma . It is not surprising that amd was the primary cause of visual impairment in the studied group of patients after cataract surgery that is consistent with results presented by other authors.5 in the newest study, owen et al report the prevalence of late amd standardized to the uk population aged 50 years or older was 2.4%, increasing to 4.8% in those aged 65 years or older, and 12.2% in those aged 80 years or older.24 in another study, jonasson et al found a higher prevalence of amd in the studied group.25 the prevalence of early amd was 12.4% for those aged 6674 years and 36% for those aged 85 years . The authors concluded that persons aged 85 years have a 10-fold higher prevalence of late amd than those aged 7074 years.25 surgery is an effective treatment for age - related cataract - induced visual loss, though some clinicians suspect that such an intervention may increase the risk of worsening underlying amd, and thus may have deleterious effects on vision . Casparis et al found no significant difference in the development of amd between groups in the immediate cataract surgery group versus patients in the delayed surgery group.26 the authors suggested that the immediate surgery group fared better with quality of life outcomes than the delayed surgery group;26 however, even in patients with amd, where central vision is lost, the peripheral visual field necessary for confident navigation can be improved by cataract surgery, and can improve quality of life for very elderly patients . In a series of studies, it was found that reduced contrast sensitivity and visual field size, rather than va, were more strongly associated with falls and fractures in elderly people.27,28 although 27.7% of the amd patients have not obtained a significant improvement of bcva, in contrast to some previous studies we also have not observed a deterioration of va in an observation period of 6 months.29,30 the results of the study showed that when systemic conditions are stable both phaco and ecce with iol implantation for very elderly patients are effective and safe . Restoration of visual function, especially in people with severe va reduction, has a positive impact on the psychological state of patients.
|
Amyotrophic lateral sclerosis (als) is a progressive degeneration of motor neurons in the brain and spinal cord whose cause is unknown . It is also unclear whether the motor neuron degeneration begins in the perikaryon (cell body) as a neuronopathy and proceeds anterogradely, or along the axon as an axonopathy and proceeds retrogradely . Brain motor neurons, mostly in the primary motor cortex (upper motor neurons), project their axons caudally along the corticospinal tract (cst) through the brainstem to the spinal cord where they synapse onto anterior horn cells (lower motor neurons). Progressive degeneration of these two motor neuron pools results in als with upper motor neuron (umn) signs (hypertonicity, hyperreflexia, and pathologic reflexes) and lower motor neuron (lmn) signs (muscle fasciculations, atrophy, and weakness) both being required for diagnosis . A certain percentage of als patients present with umn - predominant disease, and few or no clinically detectable lmn signs . By el escorial criteria, they are usually initially categorized as possible or, at most, probable with laboratory support als because of the limited extent of lmn findings . As disease progresses, their lmn dysfunction may remain either limited in degree or become more extensive . Independent of this observation, a relatively small percentage of als patients display bilateral hyperintensity of the corticospinal tract (cst) on t2- and proton - density-(pd-) weighted mri sequences . Such hyperintensity can be seen anywhere along the rostrocaudal extent of the intracranial cst extent from just beneath the primary motor cortex, corona radiata, and centrum semiovale, but it tends to be most prominent in the posterior limb of the internal capsule and cerebral peduncles . A single study in 1994 of three als patients with cst hyperintensity who at postmortem had demyelination and wallerian degeneration in the posterior limb of the internal capsule (ic). Unexpectedly, we have identified other als patients with similar umn - predominant clinical presentations but without cst hyperintensity . The reason for this variability between presence or absence of cst hyperintensity and the essentially identical umn - predominant clinical features is unclear but may reflect a different location of maximal pathology in the nonhyperintense group cst (e.g., in spinal cord), or intracranial pathologies with distinct axonal / periaxonal characteristics . Previous brain mri reports of hyperintensity of cst in als have been qualitative using conventional t2- and pd - weighted as well as flair - weighted sequences . Because such qualitative approaches depend on several factors, including quality of mr image, limits of visual detectability, and the interpreter's experience, more quantitative mr methods would validate these findings and potentially provide insights into pathogenesis of the cst hyperintensity . Diffusion tensor imaging (dti) is a relatively recently described modality based on the freedom with which water molecules (protons) move randomly within tissue, with intact myelinated axons providing the greatest restriction to movement between them (high anisotropy). Because dti signal is dependent on microscopic - level events, it has the potential of detecting tissue pathology at / near submacroscopic levels, even before the changes are visible by conventional mri . Identifying pathologic changes noninvasively at early stages would shorten time to diagnosis and allow timely therapeutic intervention . Because the cst and other subcortical white matter in als brain are usually normal in appearance by conventional mri, dti should still be able to detect abnormalities . Furthermore, the organization of subcortical myelinated motor axons as compact parallel bundles (e.g., cst) can be ideally interrogated by dti because its metrics will reflect whether they are intact (healthy) or disrupted (degenerating). Therefore, the main goal of this study was to use dti obtained at 1.5 t as part of routine clinical neuroimaging of als patients with predominant umn signs for quantitative evaluation of the intracranial cst, which in one group was hyperintense on t2- and pd - weighted sequences . This would allow us to determine where abnormalities in dti metrics occur along the cst in our umn - predominant als patients, and whether quantitative differences are detectable corresponding to the qualitative presence or absence of cst hyperintensity . We hypothesized that motor neuron degeneration in umn - predominant als is anterograde, arising primarily in the perikaryon as a neuronopathy . If this is the case, dti metrics would be expected to be more abnormal at more rostral levels of the cst intracranially . Second, we hypothesized that cst hyperintensity in als brain reflects a more extreme case of such anterograde degeneration that has unique tissue characteristics detectable by dti . By testing these hypotheses, we hope to have a better understanding of cst degeneration in umn - predominant als patients and to identify quantitative dti measures which may be useful in objectively differentiating disease subtypes . 1.5 t mri data obtained as part of clinical neuroimaging evaluation was approved by the institutional review board at the cleveland clinic to be stored and analyzed as deidentified images after patients had provided verbal consent . Dti data were analyzed in the following patient groups: (1) 10 neurological controls (7 men, 3 women) aged 51.1 7.3 years (mean sd, range 2880 years), (2) 21 umn - predominant als patients (14 men, 7 women) with cst hyperintensity on t2/pd - weighted images (cst+) aged 52.3 11.02 years (range 3275 years), and (3) 26 umn - predominant als patients (14 men, 12 women) without cst hyperintensity identified on t2/pd - weighted images (cst) aged 59.5 12.1 years (range 3276 years). Umn - predominant als patients were defined as those with either no lower motor neuron signs or, if present, then restricted to only one neuraxial level (bulbar, cervical, or lumbosacral) at the time of mri . Duration of symptoms prior to mri in the cst+ group was 9.6 5.5 months (mean sd) and in the cst group was 36.4 44.2 months; the large standard deviation is due to two outlier values in the latter group of 148 and 180 months . El escorial diagnostic criteria assigned to each patient after their clinical evaluation were converted to a numeric form as follows: possible = 1, probable with lab support = 2, probable = 3, and definite = 4 . This el escorial criteria score in the cst+ group was 1.81 0.98 (mean sd) and in the cst group was 1.37 0.82 . Dti data were obtained on a 1.5 t system (siemens symphony, erlangen, germany) using echo planar imaging (epi) sequence along 12 diffusion - weighted (b = 1000 s / mm) directions and one b0 = 0 s / mm . Imaging parameters were 30 slices, 4 mm thick, with 1.9 1.9 mm in - plane resolution; pulse sequence parameters were tr = 6000 ms, te = 121 ms, epi factor = 128, number of averages = 6, and scan time = 7.54 minutes . Gradient - echo field map images were acquired to correct for geometrical distortion caused by susceptibility artifacts . Field map imaging parameters were 30 slices, 4 mm thick, 4 mm slice gap, tr = 500 msec, tes = 6.11, and 10.87 msec . T2-and pd - weighted images were obtained using dual - echo fse sequence whose imaging parameters were number of slices = 40, contiguous, slice thickness = 4 mm, and in - plane resolution = 0.9 0.9 mm; pulse sequence parameters were repetition time (tr) = 3900 ms, te = 26 ms and 104 ms, echo train length or turbo factor = 7, and number of averages = 1; total scan time = 3.5 minutes . Dti images were first corrected for susceptibility artifacts and eddy current distortions using fsl fugue and eddy current distortion correction algorithm in fsl (http://www.fmrib.ox.ac.uk/fsl/) [57]. The b - matrix was rotated in order to preserve the correct orientation information after eddy current and oblique angle corrections [8, 9]. The above preprocessed dti images were then processed using dti studio open software (https://www.mristudio.org/). Dti matrix for each voxel element was calculated based on multivariate linear least square fit . Maps of diffusion metrics, namely, fractional anisotropy (fa), mean diffusivity (md mms), axial diffusivity (ad, || mms), and radial diffusivity (rd, mms), were obtained . Virtual nerve fibers were reconstructed using the fiber assignment by continuous tracking (fact) algorithm, described in detail elsewhere . Fiber tracking parameters were initiated from every voxel with fa = 0, threshold for termination 0.2, and a bending angle of 41. after above steps, both control and als patients' cst fiber tracts on both left and right sides were reconstructed (tractography) following wakana et al . 's method by placing first roi caudally in cerebral peduncle and the second rostrally just below the primary motor cortex . Four regions of interest (rois) were identified a priori at specific levels along the cst (using b0 = 0 and fa images) for dti measures, including cerebral peduncle (cp), posterior limb of the internal capsule (ic), and centrum semiovale at top of lateral ventricle (lv) and subjacent to primary motor cortex (mc). Dti metrics of fa, md, ad, and rd were measured in each roi after superimposing each subject's own cst tractography mask on their dti maps . Values were then compared between als patients and controls and also between the patient groups . Figure 1 shows the left cst mask superimposed on a subject's fa color map . Statistical comparisons for each of the dti metrics across control and patient groups were carried out using spss 16.0 (spss inc ., chicago, ill, usa). Based on data meeting the assumptions of anova, one of the following statistical methods was used with a significance level of p <0.05 . One - way anova followed by tukey's post hoc test was carried out when the assumptions of both normality and equal variance were met . If the equal variance assumption was violated, the welch anova followed by the dunnett t3 post hoc test was employed . When both normality and equal variance assumptions were violated, the kruskal - wallis nonparametric approach followed by the bonferroni correction of the mann - whitney test was used . Clinical parameter of symptom duration prior to mri was correlated with dti metrics in all the 4 rois along the cst using spearman's correlation method after correcting for multiple comparisons using false discovery rate (fdr). Because abnormalities of dti values along the cst may represent degeneration or related pathology, we assessed whether such metrics correlated with pathologic umn signs (spasticity, hyperreflexia, and pathologic reflexes), as identified by neurologic examination performed at clinical evaluation near / at time of mri . Because cst fibers decussate below the lowest roi analyzed for dti metrics (at the cervicomedullary junction), the intracranial cst corresponds to the contralateral side of body reflecting umn signs . In order to detect a side - to - side asymmetry in cst dti values which may correspond to asymmetry of umn signs, ratios of side - to - side dti values (right to left) for fa, md, ad, and rd in all the 4 rois along cst were calculated in control and in both the als patient groups . For this analysis, all als patients (both cst+ and cst groups) were categorized by their umn - predominant body signs being primarily right sided or left sided, based on their clinical evaluation at time of mri . Patients with predominantly right body umn signs should have more abnormal left cst dti metrics, and vice versa . For example, a patient with mostly right body umn signs would have lower fa and ad values in the left cst, so right to left ratio would be greater than or equal to 1, whereas a patient with mostly left body umn signs would have lower fa and ad values in the right cst, so right to left ratio would be less than or equal 1 . Because an inherent asymmetry was observed between right and left cst dti values even in controls, the mean right to left ratio from control values was used as a threshold to estimate the number of als patients above (with more right body umn signs) or below (with more left body umn signs) it . A percentage value was then calculated of patients whose ratios were abnormal dti values in cst relative to control, which represents the degree of correspondence between abnormal dti values in cst and the appropriate side of body with pathologic umn signs, as shown in table 1 . Mean fa, md, ad, and rd values for each roi along the cst and their significant differences (based on parametric and nonparametric tests depending on data meeting the assumptions of the test as described in methods) between the 3 groups are given in figures 25 . Fa showed significant difference between control and the als groups at right ic and left mc . However, no significant differences in fa values were observed between als subgroups in any of the 4 rois (figure 2). Md values showed no significant differences in any of the 4 rois among the 3 groups (figure 3). Axial and radial diffusivities showed significant differences only between control and als cst hyperintense groups and only at the level of ic (figures 4 and 5). The cst was found to be truncated above the lv level, most prominently on the right compared to left in 12 subjects (of 21, 57%) in the hyperintense cst group; of these, cst was truncated on the right in 8 (of 12) and bilaterally in 4 . Similarly, cst truncation was observed in 6 subjects in the nonhyperintense cst group (of 26, 23%); of these, truncation was on the right in all . Figures 6(a) and 6(b) show cst tractography extending to the cortex in a typical control subject and a truncated cst in an als subject . Because the same dti processing methodology was employed across all subject groups, we also investigated whether the absence of cst above the lv level in some patients may have lead to not detecting significantly different dti metrics in the mc . Since tractography was used to identify the fibers to be measured, missing values at the mc level in patients with truncated cst could underestimate differences in dti metrics between groups . To correct for this possibility, mori's cst atlas was superimposed on the fa map, and values were measured in all 4 rois along the cst . This did not change the results, and still no significant differences were observed in fa values at the mc level of control and als groups even when identifying the cst using mori's atlas . We further investigated whether the quality of dti scans obtained at 1.5 t, that is, resolution, anisotropic voxel dimension, and signal / noise ratio, contributed to the cst truncation problem . 3 t dti data were collected on another set of als patients with (in 1 patient) and without (5 patients) cst hyperintensity and in control subjects (5 patients). Imaging parameters of 3 t data were almost identical to those of our 1.5 t data except that at 3 t voxels they were isotropic (2 2 2.5 mm) resulting in improved resolution, and signal to noise ratio was higher . Cst tractography and analysis on 3 t data were performed in an identical manner to the 1.5 t data . Although the number of studies at 3 t was limited, we found similar cst truncation in 2 of 5 als cst hyperintense patients and none in controls . Symptom duration prior to mri was significantly shorter (p <0.0003) in als patients with cst hyperintensity (median = 13 months) than in those without cst hyperintensity (median = 31 months). No significant difference was found in el escorial criteria scores between either of these two groups . No significant correlation was obtained between symptom duration prior to mri and dti metrics on any of the 4 rois along cst . Fractional anisotropy (fa) abnormalities seen in this study of cst at the level of internal capsule agree well with previous als studies [8, 1317], although reaching significance only on the right . We also found significantly lower fa values in als patients at the subcortical motor cortex level on the left . The reason for this side - to - side variability is unclear . In general, fa values were reduced in both cst hyperintense (cst+) and cst nonhyperintense (cst) als groups when compared to controls, but they were not significantly different between the als groups . The cst+ group did, however, have lower fa values than the cst group . Of note, axial diffusivity (ad) and radial diffusivity (rd) values were significantly different at the ic level only between controls and the cst+ group and not the cst group . Such differences in ad and rd abnormalities may reflect microanatomical pathologic differences in the cst in these two groups of als patients . It is known that fa may not be as reliable a measure as individual ad and rd, from which fa is calculated . Beaulieu showed that fa value changes result from either decreased ad, increased rd, or changes in both . He also demonstrated in animal and human studies that ad is reflective of axonal integrity and rd is reflective of myelin integrity, with abnormalities in these dti metrics representing their degeneration . Such interpretations should, however, be interpreted with caution in the present study, as they are likely oversimplifications, and further studies would be required for confirmation . Nonetheless, the aforementioned suggests that ad and rd are more representative of microanatomical integrity than is fa . In general, fa, ad, and rd values were different between cst+ and cst als groups but failed to reach statistical significance . Lack of significant differences in md values in all rois along the cst in this study generally agrees with other als studies [19, 20], although some dti studies in als have found md abnormalities at the ic level [2123]. Reasons for this discrepancy may include pooling als patients of multiple clinical phenotypes into a single group in other studies, variable dti data acquisition and processing parameters (our processing included oblique angle and susceptibility artifact corrections, not used in previous dti studies in als), and use of roi - based approach (our study used tractography of patient's own cst which is more accurate and reproducible). Furthermore, since als results in not only axonal / myelin degeneration (which would result in decreased fa and increased md) but also gliosis [14, 24], the net diffusion revealed by md may not be higher than control values . If this is the case, md values would be expected to be higher in patients with shorter disease duration (and presumably less time for gliosis) than longer disease duration . The fact that we found fa, ad, and rd abnormalities in the cst primarily at the ic level and not caudally at the cp level, and some abnormalities rostrally, suggests a degenerative process that may begin at midpoint along the subcortical myelinated motor axon . Although interpreting such dti metrics as proof of axon / myelin loss is inaccurate, it indicates that cst microanatomy is sufficiently abnormal to result in perturbed water (proton) diffusion . Supportive evidence that these dti abnormalities at the ic level are related to the cst neurodegenerative process includes fa values showing 85% correspondence with left body umn - predominant clinical signs and radial diffusivity as well as md showing 94.4% correspondence with right body umn - predominant clinical signs . Only correspondence with a 75% or greater threshold was chosen, to insure only a 25% correspondence occurred by chance . Furthermore, the preponderance of cst virtual fibers truncated at the subcortical motor cortex (mc) level in the cst+ over the cst als patients (and never in control subjects) also suggests disease - specific changes rather than artifact in data acquisition or processing . How this cst virtual fiber truncation corresponds to axonal pathology is unclear and invites further study . Failure to detect significant changes in dti metrics of the cst at the lv level could be due to effects of the superior longitudinal fasciculus whose fibers cross perpendicularly at that level . This region in control subjects also has decreased uniformity of fiber tracts (unpublished observations), consistent with crossing fibers (as measured by westin's linear and planar indices). Duration of als symptoms prior to mri was shorter in cst+ than in cst group, which may reflect faster disease progression, although this is uncertain . In an early neuroimaging - pathologic study, yagishtia et al . Found cst hyperintensity on mri corresponds to demyelination and axon degeneration suggesting a different pathology from patients without cst hyperintensity . Other studies reported that als patients with cst hyperintensity had rapid clinical decline initially, shorter disease duration, and faster disease progression . In a separate study evaluating 112 als patients over a 10-year period who had undergone at least one brain mri, we found those with cst hyperintensity (n = 35) had significantly more rapid disease progression and shorter survival than those without cst hyperintensity (n = 77). It is therefore possible that als patients with cst hyperintensity have different underling pathology from those without cst hyperintensity, which results in faster disease progression . In the context of similar or slightly worse fa and ad / rd abnormalities at the ic level of the cst, this suggests a more rapidly evolving disease process in the cst+ group . Although correlations between duration of symptoms and individual dti metrics at each of the rois along the cst did not reach statistical significance after correction for multiple comparisons (false discovery rate correction), there was a trend for correlation of fa, ad, and rd abnormality at ic and lv levels with disease duration when although the dti changes we observe between these als patient groups are small, they support differences visualized by qualitative t2/pd images and suggest they result from real microanatomic pathologic changes, such as inflammation, demyelination, axon loss, or gliosis . However, detailed studies correlating cst changes detected by dti and t2/pd with postmortem histopathology will be required to determine what causes the imaging abnormalities we have found . To our knowledge this is the first study to use dti to quantitatively evaluate the cst after its virtual reconstruction by tractography and classify umn - predominant als patients into groups based on the presence or absence of cst hyperintensity . Dti performed at 1.5 t as part of routine clinical brain mr imaging demonstrates abnormalities in fa and related parameters predominantly at the ic level of the cst in umn - predominant als patients compared to control subjects . In addition, patients with cst hyperintensity have abnormalities of the ad and rd components of fa, while those without cst hyperintensity do not, suggesting differences in tract microanatomy . Furthermore, subcortical truncation of virtual cst fibers generated by tractography occurs more frequently in als patients who have cst hyperintensity than those who do not, again suggesting divergent pathology . Predominance of dti abnormalities at the ic level and rostrally suggests an anterograde process arising from a neuronopathy of motor neurons forming the cst . Identification of these dti abnormalities in umn - predominant als patients from routine clinical scans demonstrates feasibility of acquiring useful quantitative information with a 1.5 t magnet system . Future dti studies at 3 t with larger control subject group will confirm these findings.
|
The use of combined chemo- and radiotherapy for childhood cancer treatment has led to an increased survival rate and posed new challenges concerning health problems, organ damage, and quality of life after anticancer therapy . Gonads are particularly exposed to the deteriorating effects of certain chemotherapeutics and radiotherapy; on the other hand, when survivors reach adulthood, they wish to have their own biological children [13]. Fertility after anticancer therapy is a very important problem known by oncologists and endocrinologists as well as by cancer survivors themselves . In women, gonadotoxic therapy damages the primordial follicles in the ovaries, which can lead to premature menopause . Very aggressive therapy such as myeloablative therapy prior to bone marrow transplantation (bmt) or surgery / ovariectomy can lead to total sterility, whereas indirect irradiation of the ovaries and chemotherapy can result in a lowered ovarian reserve [46]. In the last years, the measurement of anti - mllerian hormone (amh) has been used as an informative marker of the ovarian reserve . Amh is a product of granulosa cells of preantral and early antral follicles, capable of growing . In healthy women, amh measurement is useful for the determination of the reproductive life span and the time of future menopause [7, 8]. The aim of our study was to determine the ovarian reserve in young women after anticancer treatment during childhood and adolescence, using the protocols with different degrees of gonadotoxicity . We recruited 83 young women, cancer survivors, from the department of pediatric oncology and hematology (outpatient clinic), medical university of bialystok . At diagnosis, they were from 0.9 to 17.8 years old (x = 10.5 5.21), and, at examination, they were 18.78 4.98 years old . They had been treated for hodgkin lymphoma, hl (n = 22), wilms tumor (n = 11), soft tissue sarcoma, sts (n = 7), neuroblastoma (n = 2) germinal tumors (n = 7), acute myeloblastic leukemia (n = 4), acute lymphoblastic leukemia (n = 22) chronic myeloblastic leukemia (n = 2), and non - hodgkin lymphoma (n = 6). They were all treated according to international protocols; 20 received irradiation for the infradiaphragmatic area (10 with hl), irradiation for the central nervous system (cns)9 patients with leukemia, 6 received bone marrow transplantation (1total body irradiation, tbi12 gy). All patients were classified according to a possible degree of gonadotoxicity proposed by wallace et al . ; the risk of disturbed fertility or infertility depends on diagnosis, stage, and type of treatment (alkylating agents, radiotherapy to the pelvis / ovaries). The probability of infertility in the low risk group is less than 20% and in the medium risk group between 20 and 80%, whereas, in the high risk group, is greater than 80% . At diagnosis, forty - five patients were in tanner stage t1 - 2, n = 5 in t3, and n = 33 in t4 - 5 . On examination, one female presented with primary amenorrhea, 65 had normal, regular menses, and 17 had irregular menses or oligomenorrhea (11 were classified as high risk group, 2 as low risk, and 4 as middle risk group). Six patients have their biological children (five treated for hl, one treated for non - hodgkin lymphoma, nhl). Details concerning diagnosis, age at the time of therapy, type of therapy, the interval between the end of therapy, and measurements of hormone levels are presented in table 1, taking into consideration the risk groups proposed by brougham and wallace . Serum concentrations of fsh, lh, and e2 were measured in the same laboratory using the commercially available immunoenzymatic kits; serum amh levels were determined with the eia amh / mis kit (immunotech, beckman coulter company / marseille, france). All hormonal measurements were performed in the early follicular phase (24 days of menstrual cycle) and stored at 80c . We found higher fsh and lower amh levels in the entire group as compared to the control group (p = 0.001; p = 0.001, resp . ), whereas the mean levels of estradiol and lh were normal . When the study group was subdivided according to the risk of gonadotoxicity, the levels of fsh were elevated only in the high risk group (18.11 28.7 miu / ml versus 5.36 1.89 miu / ml, p = 0.005), whereas, in the middle and low risk groups, they were comparable with the control group . Amh values were lower than those in the control group in all the three risk groups (hr group 14.14 13.26 pmol / l (p = 0.001); mr group 14.82 16.2 pmol / l (p = 0.019); lr group 19.44 13.96 pmol / l (p = 0.053)). Mean serum lh and estradiol values did not differ between the risk groups and control (see table 2). The hr group was analyzed separately: patients diagnosed with hl irradiated and nonirradiated for the infradiaphragmatic region, patients treated for solid tumors with radiation to the infradiaphragmatic area, and patients after bone marrow transplantation . In these subgroups, amh values were lower than those in the control group, being the lowest in patients after bone marrow transplantation (3.37 2.32 pmol / ml). Fsh levels were the highest in females after bmt (42.55 26.55 miu / ml) and elevated in females treated for hl with inverted y irradiation . The values of lh and estradiol did not differ between the hr group and control (except the patients after bmt) (see table 3). There were 19 females (22.9%) in the study group with elevated fsh levels (> 10 miu / ml), amh lower than 12.5 pmol / l, and normal lh levels; 12/19 derived from the hr group . Lowered amh levels (yet with normal fsh and lh) were observed in 43 patients (51.8%). We found no influence of age at the time of treatment (before puberty, during or after puberty), although amh was lower in patients treated after puberty (13.04 12.06 pmol / l) than during puberty (15.43 13.65 pmol / l) and before puberty (18.52 14.93 pmol / l). Combined anticancer treatment has improved the prognosis for young patients and at the same time has enabled us to recognize different late effects of the treatment . Diminished fertility or infertility and early menopause are the major side effects lowering life quality among cancer survivors . According to childhood cancer survivor study (ccss), premature menopause occurs in 8% survivors and depends on age, dose of irradiation to the ovaries, and cumulative dose of alkylating agents . Brougham and wallace classified the most common cancers treated during childhood and adolescence according to the risk of subfertility resulting from gonadotoxicity . The high risk group includes patients after tbi, megachemotherapy, tumors located in pelvis and irradiated, metastatic soft tissue sarcomas, and hodgkin lymphomas treated with alkylating agents . The risk of impaired fertility in this group is more than 80%, as compared to less than 20% in the low risk group . Our knowledge concerning the toxicity of anticancer treatment enlarges, and treatment protocols change, not only for better outcome and improved survival but also for a reduction in side effects . We categorized our patients according to the type of malignancy and treatment, mainly the area of radiotherapy and total dose of alkylating agents . To evaluate ovarian function in males, it is easier to evaluate gonadal function by analyzing spermiograms and hormone measurements; in females, assessment of oocyte depletion and premature ovarian failure is more difficult . Amh seems to be very useful to determine the ovarian reserve, better than the evaluation of the antral follicle count by vaginal ultrasonography or the measurement of fsh and inhibin b. the amh level is relatively constant from mid - childhood to early adulthood, without fluctuations between pubertal stages [7, 1113]. Elevated fsh levels were observed only in the hr group, whereas lower amh (compared to the control group) was found in the total cohort independently of risk group . More than half (51.8%) of the patients had low amh levels, whereas 22.9% presented with elevated fsh values . Abnormalities were most pronounced in patients after bmt, who had very low amh values and elevated fsh . Total body irradiation and/or high doses of alkylating agents, such as cyclophosphamide or busulphane, led to ovary dysfunction . Similar results have been reported by miyoshi et al ., who found low amh levels in 53% and high fsh in 30% of childhood cancer survivors . The treatment for hl also leads to high risk of premature menopause [16, 17]. De bruin et al . Found a 12-fold higher risk of early (before the age of 40) menopause in hl survivors treated with procarbazine as an element of chemotherapy as compared to those irradiated for the supradiaphragmatic areas or paraaortic nodes . Like in our study, van beek et al . Found that hormone levels were not influenced by age at treatment (before versusduring puberty). Different results have been presented for women treated at an age older than 30 years since amh levels fall gradually due to a reduced oocyte pool [20, 21]. In the patients treated for hl, lower amh values were noted for the irradiated and nonirradiated infradiaphragmatic areas, whereas elevated fsh levels were observed only in irradiated females . Those who are irradiated for the infradiaphragmatic region received 3 or 4 cycles with procarbazine (mopp), and those who are nonirradiated received only two cycles . In the former patients treated for solid tumors, irradiated for the abdomen, also presented with lower amh levels; in that group, only one female was irradiated (44 gy) for the pelvic area irradiation directly for the ovaries, especially in the total dose> 15 gy, seems to be the most important factor deteriorating gonadal function, although according to wallace et al . The ld50 for human oocyte is <2 gy . We observed lowered amh levels not only in the hr group but also in the mr or lr group, which indicates that all types of anticancer treatment affected gonadal function, even when low doses of chemotherapeutics were used . Patients treated for acute lymphoblastic leukemia, classified to the low risk group, show subtle ovarian disorders (lower estradiol levels) and some of them are infertile after anticancer treatment . In a prospective study performed during and after cytotoxic treatment, brougham et al . Observed progressive lowering of amh during treatment and recovery in the low and middle risk groups between 2 and 12 months following therapy completion, thus indicating possible restoration of the pool of growing oocytes . This recovery was not observed in the high risk group, suggesting a profound loss of the primordial follicle pool . Sixty - five out of 83 survivors had normal regular menstrual cycle, one had primary amenorrhea, and 17 had irregular menses or oligomenorrhea; the latter group included patients after bmt after hl treatment (hr group). The group with normal menstrual cycles contained patients with lower amh levels and with a diminished ovarian reserve . We found elevated fsh in the early follicular phase with normal lh and estradiol levels; this situation is characteristic of premature ovarian failure and can appear even 20 years prior to menopause [19, 27, 28]. Taken together, lowered mean amh values in the entire cohort and a monotropic rise in fsh indicate the possibility of premature menopause . Six patients had their biological children; five were treated for hl and were classified to the hr group . The peak incidence for hl is observed in older adolescents, most often over 15 years of age . Our results show the utility of amh measurement as an early, sensitive marker of a reduced ovarian reserve in young cancer survivors . Patients after conditioning therapy prior to bmt as well as patients treated for hl, independently of age at treatment (prepuberty or puberty), are at the highest risk of gonadal damage and early menopause.
|
Serum specimens from the patients were tested at the centers for disease control and prevention (cdc) in serial fourfold dilutions by indirect fluorescent antibody (ifa) testing for reactivity to b. microti (11), wa1 (8), and b. divergens antigens . The antigen sources were human isolates of b. microti and wa1 and a bovine isolate of b. divergens (the purnell strain from the republic of ireland) that had been passaged in gerbils (mongolian jirds; meriones unguiculatus) and adapted to culture in bovine erythrocytes . The serum specimens were also tested at the clinical institute of hygiene of the university of vienna by ifa for reactivity to b. divergens antigens (from a bovine isolate from hanover, germany, that had been passaged in jirds); the dilutions of serum that were tested were 1:16, 1:64, 1:256, 1:1,000, and 1:4,000 . Five jirds, which are competent hosts for b. divergens (13), were injected intraperitoneally with 0.5 ml of 1-day old, refrigerated, pretreatment blood from the austrian patient . The jirds were monitored periodically (at least weekly; 26 times in 17.5 weeks) for parasitemia by examination of diff quik - stained (dade ag, ddingen, switzerland) smears of blood obtained either by tail snip or, at the end of the monitoring period, by cardiac puncture after anesthesia with ketamine . The blood obtained by cardiac puncture was also examined by polymerase chain reaction (pcr) (see below). Dna was extracted from edta - stabilized whole blood from the two patients by using the qiaamp dna blood mini kit (qiagen inc ., the complete 18s ribosomal rna (18s rrna) gene was amplified by pcr, with a pair of generic apicomplexan 18s rrna - specific primers: cryptof, the forward primer (5-aacctggttgatcctgccagt-3), and cryptor, the reverse primer (5-gcttgatccttctgcaggttcacctac-3). Pcr was conducted with the amplitaq gold dna polymerase (applied biosystems, foster city, ca). The conditions for pcr included 95c for 15 min, followed by 45 cycles of denaturation at 94c for 30 s, annealing at 65c for 30 s, and extension at 72c for 1.5 min . Final extension was done at 72c for 9 min, followed by a hold step at 4c . Amplification products were purified by using the strataprep dna purification kit (stratagene, la jolla, ca). In addition, dna provided us that had been extracted from two isolates of b. odocoilei (i.e., the brushy creek and engeling isolates), a parasite of white - tailed deer (odocoileus virginianus) (15,16), and from b. divergens [purnell strain]) was analyzed . Both strands of the pcr products were sequenced by using a set of internal primers . Sequencing reactions were conducted with the abi prism bigdye terminator cycle sequencing kit (applied biosystems), and reactions were analyzed on the abi 377 or abi 3100 automatic dna sequencer (applied biosystems). The resulting sequences were assembled by using the program seqman ii (dnastar, inc . The genbank accession numbers for the complete sequences we generated of the 18s rrna gene for the various organisms are as follows: b. odocoilei, ay046577; b. divergens, ay046576; and eu1, ay046575 . The complete sequences of the 18s rrna genes for b. bigemina, b. bovis, b. caballi, b. divergens, b. gibsoni, b. odocoilei, and babesia sp . (isolated from bos taurus) were retrieved from the genbank database (see figure 1 legend for genbank accession numbers) and aligned with the sequence for eu1 by using the program clustal w version 1.83 (17). The 18s rrna sequence for theileria annulata was included as the outgroup for the phylogenetic analysis . This analysis was performed with the following programs: the phylip package, which includes versions 3.5 of consense, dnadist, dnaml, neighbor, and seqboot (18); and version 5.73c of tree - puzzle (19). The phylogenetic trees inferred by these programs were drawn by using the program treeview, version 1.6.6 (20). The trees were statistically evaluated by using bootstrap (18) and quartet puzzling methods (19). The tree was computed by using the quarter puzzling maximum likelihood method of the tree - puzzle program and was oriented by using theileria annulata as the outgroup . The genbank accession numbers for the sequences used in the analysis are as follows: babesia bigemina a, x59604; b. bovis, l19077; b. caballi, z15104; b. divergens (purnell isolate), ay046576; b. gibsoni (genotype asia 1), af175300; b. odocoilei (brushy creek and engeling isolates), ay046577; babesia sp . (isolated from bos taurus), u09834; eu1 (the etiologic agent of infection in the two cases described here), ay046575; and theileria annulata, m64243 . The italian and austrian patients were 55- and 56-year - old men, respectively, who had undergone splenectomy in the 1980s because of stage ia hodgkin s disease . The italian patient had recently begun chemotherapy (table footnote) for stage iiia diffuse large b - cell lymphoma, which had been diagnosed in june 1998 . Both men lived in small towns and hunted avocationally (table); neither had pets . Only the austrian patient recalled tick exposure a tick bite while hunting about 2 weeks before he noticed his urine was dark . Neither patient had traveled extensively: the italian patient had never left italy, and the austrian patient had been in barbados (1998) and turkey (1999). Ifa, indirect fluorescent antibody; pcr, polymerase chain reaction; cdc, centers for disease control and prevention . Non - hodgkin s lymphoma developed in the italian patient (diagnosis: june 1998). Chemotherapy, begun on september 23, 1998, was stopped prematurely on october 14, after he became febrile . His chemotherapeutic regimen included daily prednisone (75 mg) and weekly administration of various drugs in rotation . He received 4 of the intended 12 weeks of therapy, which included doxorubicin and cyclophosphamide during odd - numbered weeks (weeks 1 and 3) and vincristine and either methotrexate (week 2) or bleomycin (week 4) during even - numbered weeks . Although the possibility that he became infected by blood transfusion could not be excluded because he had been transfused before blood smears were examined, his febrile illness and hemolytic anemia preceded the transfusions . Laboratory values were from hospital admission (october 18, 1998, for the italian patient, and july 25, 2000, for the austrian patient), unless otherwise specified . Values for the austrian patient are from testing performed at the hospital to which he was transferred after a brief (<24-hour) stay at a local hospital . Earlier on july 25, at a local hospital, his hemoglobin value was 16.2 g / dl, which had been his approximate baseline value during the previous 10 months . Ifa testing of serum specimens from both patients was negative for antibodies to b. microti . A specimen from the italian patient (february 15, 1999) was negative for antibodies to wa1 . Plasma exchange was performed on october 23, when he mistakenly was thought to have thrombotic th the two cases ranged in severity from quite mild (austrian case) to moderately severe (italian case). The salient clinical details of their cases and the relevant laboratory values are provided in the table . Fever occurred only in the italian patient (maximum of 39c), which initially was considered a reaction to one of his chemotherapeutic agents (i.e., bleomycin). He also had marked anemia, for which he received blood transfusions (table). Both patients had thrombocytopenia, elevated serum lactate dehydrogenase and bilirubin values, and dark urine from hemoglobinuria . Babesiosis was diagnosed by noting parasitic inclusions in erythrocytes on peripheral blood smears (table; figure 2). The intervals between onset of the symptoms that ultimately were attributed to babesiosis and confirmation of the diagnosis ranged from 2 days (austrian case) to 10 days (italian case). Subsequent testing of serum specimens from both patients showed ifa reactivity to b. divergens but not to b. microti antigens; serum from the italian patient was also tested for reactivity to wa1 antigens and was negative . Attempts to obtain an isolate of the parasite that infected the austrian patient, by injecting specimens of his blood into jirds, were unsuccessful; the smears of blood from periodic tail snips and pcr analysis of blood obtained by cardiac puncture of the jirds were negative . Both patients responded to antimicrobial therapy for babesiosis: the austrian patient was treated with clindamycin, and the italian patient was treated with both clindamycin and quinine (table). Panel of computer - generated electronic images of photomicrographs of babesia - infected erythrocytes on a giemsa - stained smear of peripheral blood from the patient who became infected in austria . The electronic images were edited for uniformity of color, without changing the form or size of the organisms . The image on the far right shows a tetrad (maltese - cross form). Three glass slides of the actual blood films have been deposited in the obersterreichisches landesmuseum, biologiezentrum, linz (i.e., biology center of the upper austrian museum, linz), with the accession number 2002/9 . (eu1), patient 001, austria, krems land, july 25, 2000 . Amplification of the complete 18s rrna gene, by using generic protozoan primers and the babesia dna extracted from the patients as the templates, yielded a specific product of approximately 1,700 base pairs for each patient . Sequence analysis showed that the 18s rrna gene was 1,727 bases long and that the pcr products from the two patients had identical sequences . Blast (available from: url: http://www.ncbi.nlm.nih.gov/blast/) search showed that the sequence, although clearly from a babesia sp . In phylogenetic analysis, eu1 clusters together with b. odocoilei, and these two organisms form a sister group with b. divergens (figure 1). The clustering of these organisms was identical, regardless of which phylogenetic method was used . Support for the internal branch leading to the b. divergens, b. odocoilei, and eu1 group was 100% with both quartet puzzling and bootstrap distance analysis; for the internal branch separating b. divergens from b. odocoilei and eu1, the support was 100% for quartet puzzling and 88% for bootstrapped distance analysis . The alignment of the sequences used to construct the phylogenetic tree (figure 1) is available from the authors upon request . Because the complete 18s rrna sequences in genbank that were previously determined for various bovine isolates of b. divergens were not identical, we reanalyzed the complete 18s rrna gene from isolates (cultures or dna) from ireland (purnell; genbank accession no . U16370), germany (u07885), and northern ireland (z48751) that were provided to us . The sequences of the 18s rrna gene we obtained for these isolates were identical, which suggests that no variability is present in this gene among geographically distinct bovine isolates of b. divergens (slemenda et al ., data). In contrast, the eu1 and b. divergens 18s rrna sequences differed by 31 bases . Similarly, our sequences of the 18s rrna gene for both isolates of b. odocoilei (i.e., brushy creek and engeling isolates) were identical to each other (genbank accession no . Ay046577) and to the b. odocoilei sequence with the genbank accession no . U16369 (14). Serum specimens from the patients were tested at the centers for disease control and prevention (cdc) in serial fourfold dilutions by indirect fluorescent antibody (ifa) testing for reactivity to b. microti (11), wa1 (8), and b. divergens antigens . The antigen sources were human isolates of b. microti and wa1 and a bovine isolate of b. divergens (the purnell strain from the republic of ireland) that had been passaged in gerbils (mongolian jirds; meriones unguiculatus) and adapted to culture in bovine erythrocytes . The serum specimens were also tested at the clinical institute of hygiene of the university of vienna by ifa for reactivity to b. divergens antigens (from a bovine isolate from hanover, germany, that had been passaged in jirds); the dilutions of serum that were tested were 1:16, 1:64, 1:256, 1:1,000, and 1:4,000 . Five jirds, which are competent hosts for b. divergens (13), were injected intraperitoneally with 0.5 ml of 1-day old, refrigerated, pretreatment blood from the austrian patient . The jirds were monitored periodically (at least weekly; 26 times in 17.5 weeks) for parasitemia by examination of diff quik - stained (dade ag, ddingen, switzerland) smears of blood obtained either by tail snip or, at the end of the monitoring period, by cardiac puncture after anesthesia with ketamine . The blood obtained by cardiac puncture was also examined by polymerase chain reaction (pcr) (see below). Dna was extracted from edta - stabilized whole blood from the two patients by using the qiaamp dna blood mini kit (qiagen inc ., valencia, ca); the dna was stored at 4c . The complete 18s ribosomal rna (18s rrna) gene was amplified by pcr, with a pair of generic apicomplexan 18s rrna - specific primers: cryptof, the forward primer (5-aacctggttgatcctgccagt-3), and cryptor, the reverse primer (5-gcttgatccttctgcaggttcacctac-3). Pcr was conducted with the amplitaq gold dna polymerase (applied biosystems, foster city, ca). The conditions for pcr included 95c for 15 min, followed by 45 cycles of denaturation at 94c for 30 s, annealing at 65c for 30 s, and extension at 72c for 1.5 min . Final extension was done at 72c for 9 min, followed by a hold step at 4c . Amplification products were purified by using the strataprep dna purification kit (stratagene, la jolla, ca). In addition, dna provided us that had been extracted from two isolates of b. odocoilei (i.e., the brushy creek and engeling isolates), a parasite of white - tailed deer (odocoileus virginianus) (15,16), and from b. divergens [purnell strain]) was analyzed . Both strands of the pcr products were sequenced by using a set of internal primers . Sequencing reactions were conducted with the abi prism bigdye terminator cycle sequencing kit (applied biosystems), and reactions were analyzed on the abi 377 or abi 3100 automatic dna sequencer (applied biosystems). The resulting sequences were assembled by using the program seqman ii (dnastar, inc . The genbank accession numbers for the complete sequences we generated of the 18s rrna gene for the various organisms are as follows: b. odocoilei, ay046577; b. divergens, ay046576; and eu1, ay046575 . The complete sequences of the 18s rrna genes for b. bigemina, b. bovis, b. caballi, b. divergens, b. gibsoni, b. odocoilei, and babesia sp . (isolated from bos taurus) were retrieved from the genbank database (see figure 1 legend for genbank accession numbers) and aligned with the sequence for eu1 by using the program clustal w version 1.83 (17). The 18s rrna sequence for theileria annulata was included as the outgroup for the phylogenetic analysis . This analysis was performed with the following programs: the phylip package, which includes versions 3.5 of consense, dnadist, dnaml, neighbor, and seqboot (18); and version 5.73c of tree - puzzle (19). The phylogenetic trees inferred by these programs were drawn by using the program treeview, version 1.6.6 (20). The trees were statistically evaluated by using bootstrap (18) and quartet puzzling methods (19). The tree was computed by using the quarter puzzling maximum likelihood method of the tree - puzzle program and was oriented by using theileria annulata as the outgroup . The genbank accession numbers for the sequences used in the analysis are as follows: babesia bigemina a, x59604; b. bovis, l19077; b. caballi, z15104; b. divergens (purnell isolate), ay046576; b. gibsoni (genotype asia 1), af175300; b. odocoilei (brushy creek and engeling isolates), ay046577; babesia sp . (isolated from bos taurus), u09834; eu1 (the etiologic agent of infection in the two cases described here), ay046575; and theileria annulata, m64243 . The italian and austrian patients were 55- and 56-year - old men, respectively, who had undergone splenectomy in the 1980s because of stage ia hodgkin s disease . The italian patient had recently begun chemotherapy (table footnote) for stage iiia diffuse large b - cell lymphoma, which had been diagnosed in june 1998 . Both men lived in small towns and hunted avocationally (table); neither had pets . Only the austrian patient recalled tick exposure a tick bite while hunting about 2 weeks before he noticed his urine was dark . Neither patient had traveled extensively: the italian patient had never left italy, and the austrian patient had been in barbados (1998) and turkey (1999). Ifa, indirect fluorescent antibody; pcr, polymerase chain reaction; cdc, centers for disease control and prevention . Non - hodgkin s lymphoma developed in the italian patient (diagnosis: june 1998). Chemotherapy, begun on september 23, 1998, was stopped prematurely on october 14, after he became febrile . His chemotherapeutic regimen included daily prednisone (75 mg) and weekly administration of various drugs in rotation . He received 4 of the intended 12 weeks of therapy, which included doxorubicin and cyclophosphamide during odd - numbered weeks (weeks 1 and 3) and vincristine and either methotrexate (week 2) or bleomycin (week 4) during even - numbered weeks . Although the possibility that he became infected by blood transfusion could not be excluded because he had been transfused before blood smears were examined, his febrile illness and hemolytic anemia preceded the transfusions . Laboratory values were from hospital admission (october 18, 1998, for the italian patient, and july 25, 2000, for the austrian patient), unless otherwise specified . Values for the austrian patient are from testing performed at the hospital to which he was transferred after a brief (<24-hour) stay at a local hospital . Earlier on july 25, at a local hospital, his hemoglobin value was 16.2 g / dl, which had been his approximate baseline value during the previous 10 months . Ifa testing of serum specimens from both patients was negative for antibodies to b. microti . A specimen from the italian patient (february 15, 1999) was negative for antibodies to wa1 . Plasma exchange was performed on october 23, when he mistakenly was thought to have thrombotic th the two cases ranged in severity from quite mild (austrian case) to moderately severe (italian case). The salient clinical details of their cases and the relevant laboratory values are provided in the table . Fever occurred only in the italian patient (maximum of 39c), which initially was considered a reaction to one of his chemotherapeutic agents (i.e., bleomycin). He also had marked anemia, for which he received blood transfusions (table). Both patients had thrombocytopenia, elevated serum lactate dehydrogenase and bilirubin values, and dark urine from hemoglobinuria . Babesiosis was diagnosed by noting parasitic inclusions in erythrocytes on peripheral blood smears (table; figure 2). The intervals between onset of the symptoms that ultimately were attributed to babesiosis and confirmation of the diagnosis ranged from 2 days (austrian case) to 10 days (italian case). Subsequent testing of serum specimens from both patients showed ifa reactivity to b. divergens but not to b. microti antigens; serum from the italian patient was also tested for reactivity to wa1 antigens and was negative . Attempts to obtain an isolate of the parasite that infected the austrian patient, by injecting specimens of his blood into jirds, were unsuccessful; the smears of blood from periodic tail snips and pcr analysis of blood obtained by cardiac puncture of the jirds were negative . Both patients responded to antimicrobial therapy for babesiosis: the austrian patient was treated with clindamycin, and the italian patient was treated with both clindamycin and quinine (table). Panel of computer - generated electronic images of photomicrographs of babesia - infected erythrocytes on a giemsa - stained smear of peripheral blood from the patient who became infected in austria . The electronic images were edited for uniformity of color, without changing the form or size of the organisms . The image on the far right shows a tetrad (maltese - cross form). Three glass slides of the actual blood films have been deposited in the obersterreichisches landesmuseum, biologiezentrum, linz (i.e., biology center of the upper austrian museum, linz), with the accession number 2002/9 . (eu1), patient 001, austria, krems land, july 25, 2000 . Amplification of the complete 18s rrna gene, by using generic protozoan primers and the babesia dna extracted from the patients as the templates, yielded a specific product of approximately 1,700 base pairs for each patient . Sequence analysis showed that the 18s rrna gene was 1,727 bases long and that the pcr products from the two patients had identical sequences . Blast (available from: url: http://www.ncbi.nlm.nih.gov/blast/) search showed that the sequence, although clearly from a babesia sp ., was not identical to any complete 18s rrna sequences in the genbank database . In phylogenetic analysis, eu1 clusters together with b. odocoilei, and these two organisms form a sister group with b. divergens (figure 1). The clustering of these organisms was identical, regardless of which phylogenetic method was used . Support for the internal branch leading to the b. divergens, b. odocoilei, and eu1 group was 100% with both quartet puzzling and bootstrap distance analysis; for the internal branch separating b. divergens from b. odocoilei and eu1, the support was 100% for quartet puzzling and 88% for bootstrapped distance analysis . The alignment of the sequences used to construct the phylogenetic tree (figure 1) is available from the authors upon request . Because the complete 18s rrna sequences in genbank that were previously determined for various bovine isolates of b. divergens were not identical, we reanalyzed the complete 18s rrna gene from isolates (cultures or dna) from ireland (purnell; genbank accession no . U16370), germany (u07885), and northern ireland (z48751) that were provided to us . The sequences of the 18s rrna gene we obtained for these isolates were identical, which suggests that no variability is present in this gene among geographically distinct bovine isolates of b. divergens (slemenda et al . In contrast, the eu1 and b. divergens 18s rrna sequences differed by 31 bases . Similarly, our sequences of the 18s rrna gene for both isolates of b. odocoilei (i.e., brushy creek and engeling isolates) were identical to each other (genbank accession no . Ay046577) and to the b. odocoilei sequence with the genbank accession no . U16369 (14). We investigated the first reported human cases of babesiosis in italy and austria and have provided molecular evidence that the etiologic agent was a previously uncharacterized babesia organism, which we refer to here as eu1 . The organism was found in countries in europe not previously known to have zoonotic babesiosis and had novel molecular characteristics for the genetic marker we analyzed, the complete 18s rrna gene . Sequence analysis of this gene provides an objective and precise means of species identification and phylogenetic classification . The dna sequences of the 18s rrna gene were identical for the babesia organisms from the two patients, which indicates that they were infected with the same organism . Each of the organisms was sequenced in a different country, which indicates that the findings were not artifactual . The phylogenetic analysis (figure 1) indicates that eu1 is most closely related to but distinct from b. odocoilei, which infects white - tailed deer (15,16) and is not known to infect humans . Eu1 and b. odocoilei form a sister group to b. divergens, a bovine parasite that has been considered the main babesia pathogen of humans in europe . We have demonstrated that no variability exists in the 18s rrna sequences among several geographically distinct bovine isolates of b. divergens (slemenda et al . Data), which is the organism to which the name b. divergens legitimately applies, and showed that eu1 clearly is not b. divergens . Eu1 is also distinct from the mo1 parasite, which caused a fatal human case of babesiosis in missouri in 1992 and was thought then by the investigators to be b. divergens like but distinct from it (10). The sequence provided in the publication about mo1 (10) was for only a 128base pair fragment; in that region, the eu1 and mo1 sequences differ by four bases, and three positions in the mo1 sequence were unresolved . The dna sequences available in genbank for b. divergens in europe are from cattle not humans . To our knowledge, molecular data have been reported for only one of the purported human cases of b. divergens infection in europe, a case on the canary islands (22,23). However, the data were for an incomplete 18s rrna sequence (genbank accession no . Af435415), and therefore were not suitable for the phylogenetic analysis we performed of complete 18s rrna sequences . Nevertheless, the sequence for the case on the canary islands differs by 18 bases with the sequence for eu1 and by 1 base with the b. divergens sequence from cattle (ay046576) in the 369-base - long region of the gene that could be compared . In the absence of molecular data, we are not certain which organisms have caused the human cases of babesiosis in europe that have been attributed to b. divergens . The evidence that particular human cases were caused by b. divergens has varied in quantity, quality, and type . The evidence typically has included various combinations of morphologic data, from examination of blood smears; serologic data (usually, but not always, from ifa testing); and data concerning whether jirds or cattle injected with the patient s blood become parasitemic . Although these techniques are useful for detecting babesia infection, they do not necessarily provide reliable species identification (e.g., because of serologic cross - reactivity between eu1 and b. divergens in ifa testing [table]). Although some of the human cases attributed to b. divergens may truly have been caused by the bovine b. divergens, others might have been caused by eu1 . The cases of eu1 infection we reported likely would have been attributed to b. divergens had only the traditional methods of characterization, without molecular analysis, been used . Our molecular characterization also showed that eu1 is not closely related to the other babesia (or babesia - like) agents known to have infected humans (most notably, b. microti and the wa1- and ca1-type parasites). B. microti, together with b. rodhaini, cytauxzoon felis, and b. equi, is ancestral to the theileria spp . And perhaps also to the babesia sensu stricto group (depending on which tree topology is used) (24). Reclassification of the b. microti group to a new family has been proposed (24). The wa1- and ca1-type parasites, which have caused human cases of babesiosis in the western united states (8,9), also form a well - defined group, whose position in the phylogeny of the piroplasms is uncertain (25). Although eu1 represents a zoonotic pathogen with previously unreported molecular characteristics, whether it represents a new species per se awaits further evidence . Eu1 might constitute a new species in the sense that it was never previously recognized or characterized in any way or one that was characterized but not with molecular data (e.g., was misnamed b. divergens or some other babesia sp . ). Because dna sequence data are not available for most of the babesia spp . Found over the past century in nonhuman animals and because data about the morphologic features and host specificity of a parasite are inadequate for definitive species identification, we cannot exclude the possibility that eu1 is one of the many previously described babesia spp . Of nonhuman animals, some named and some not, that were not known to be zoonotic . Although the serologic cross - reactivity between eu1 and b. divergens could have resulted in diagnostic confusion in the past, cross - reactivity between these two organisms also could be advantageous . The b. divergens ifa could be a useful tool for testing serum from persons who might be infected with eu1 or who participate in serosurveys to determine the prevalence and geographic distribution of eu1 infection . Unfortunately, our attempts to obtain an isolate of eu1 by inoculation of jirds were unsuccessful . One consequence is that we did not generate the homologous antigen needed for development of an ifa assay for eu1 . Therefore, we could not contrast the degree of reactivity of our patients serum specimens with antigens from eu1 and b. divergens . The importance of determining whether the etiologic agent of a particular case of babesiosis is eu1 rather than b. divergens or some other babesia sp . Depends in part on whether the clinical manifestations of infection and the response to antimicrobial therapy differ . However, the range in severity of the two cases, from quite mild (austrian case) to moderately severe (italian case), is of interest, particularly because the two patients were similar in some respects (i.e., both were asplenic men in their mid - fifties). Factors that likely placed the italian patient at increased risk for a more severe case included immunosuppressive chemotherapy for lymphoma and the 10-day interval between the onset of fever and the diagnosis of babesiosis (table). Largely from data for b. microti infection in the united states, combination therapy with either clindamycin and quinine or atovaquone and azithromycin is recommended for treatment of babesiosis (28), with the addition of exchange transfusion in some situations in severely ill patients . Some in vitro data and anecdotal clinical data for purported zoonotic cases of b. divergens infection suggest that therapy with clindamycin alone, in combination with exchange transfusion, when indicated, might be effective for treating b. divergens infection (4,29,30). However, no clinical trials in humans have evaluated the effectiveness of any antimicrobial regimens for treatment of babesia infection not caused by b. microti . The public health importance of infection with eu1, including such factors as its biology, geographic distribution, ecology, prevalence, risk factors for infection and disease, clinical manifestations, tick vector, and animal reservoir host(s), is not yet known and may take years to determine . The italian patient likely became infected in a garden habitat and the austrian patient in a garden or forest habitat . Of interest, an incomplete 18s rrna sequence (genbank accession no . Af373333) for a babesia sp . Found in i. ricinus ticks was recently reported by investigators in slovenia (31), which borders italy and austria . The sequence was reported for only 364 bases and corresponds to positions 433796 of the complete 18s rrna sequence for eu1 . In this part of the gene, however, the relatedness of the two organisms cannot be determined without the complete 18s rrna sequence for the organism from the ticks . The occurrence of two identified cases of eu1 infection in humans in different countries (i.e., italy and austria) and years (i.e., 1998 and 2000) indicates that eu1 is not restricted to one geographic area or time.
|
The study protocol was approved by the ethics committee of the medical university of vienna and followed the guidelines set forth in the declaration of helsinki . All patients signed written informed consent prior to inclusion and passed a screening examination including physical and ophthalmological examination during the 10 days before the study day . A total of 80 individuals aged> 18 years were included in this observer - blinded, controlled, parallel - group study . Three groups were composed: group 1 included 20 patients with type 1 diabetes with no signs of diabetic retinopathy or mild nonproliferative diabetic retinopathy . Group 2 included 40 patients with mild essential systemic hypertension at rest and/or with serum cholesterol levels 0.65 hypertension was defined as a blood pressure meeting the criterion of hypertension grade 1 of the world health organization blood pressure classification, with systolic blood pressure (sbp) from 140 to 159 mmhg and diastolic blood pressure (dbp) from 90 to 99 mmhg . Blood pressure was measured at two different occasions in a sitting position . As a control, 20 healthy subjects with sbp <140 mmhg, dbp <90 mmhg, serum cholesterol levels <0.55 mmol / l, and normal ocular findings were included in group 3 . Care was taken that the control group was comparable in age and sex distribution to the patient groups . Further exclusion criteria for all subjects were ametropia> 3 dpt, other relevant ocular abnormalities, a clinically relevant illness prior to the study, pregnancy or lactation, and a patient or family history of epilepsy . Participants had to abstain from beverages containing alcohol or caffeine for 12 h before the study . The diameters of one temporal retinal artery and vein between 1 and 2 disc diameters from the margin of the optic disc were continuously measured using the dynamic vessel analyzer (dva; imedos, jena, germany). The dva comprises a fundus camera (ff 450; carl zeiss meditec, jena, germany), a digital video camera, and a personal computer with analyzing software for the determination of retinal vessel diameters that are analyzed from digitized images . After selection of the measurement location, the dva is able to follow the vessels during movements within the measurement window . Retinal vessel diameters were measured for 4 min . For the second minute, full - field flickering light with a frequency of 12.5 hz was used for stimulation by square wave pattern modulation of the fundus camera illumination at a contrast ratio of 25:1 . To measure fmd, each subject was in the supine position with the left arm supported on a foam block and a pneumatic cuff placed on the upper arm proximal to the measurement area . A high - resolution ultrasound system with a 7.0-mhz transducer (vivid seven pro; ge vingmed ultrasound, horten, norway) was used to measure the brachial artery diameter . The probe was fixed in an adjustable swivel arm to maintain an identical position during the experiments . The brachial artery was scanned in a longitudinal section proximal to its bifurcation, which was used as an anatomical marker . Baseline diameter of the brachial artery was assessed as the mean of 1 min of continuous measurement . Thereafter, the cuff on the upper arm was inflated to suprasystolic pressure (250 mmhg) for 4.5 min . All subjects were studied under dilated pupil after instillation with tropicamide (mydriaticum agepha-gtt; agepha, vienna, austria). After a 20-min resting period in a sitting position, baseline measurements of arterial blood pressure and pulse rate were performed . Thereafter, retinal vessel measurements including flicker stimulation were performed . Intraocular pressure (iop) was measured after the flicker experiment . Iop was measured with a slit - lamp mounted goldmann applanation tonometer (haag - streit, bern, switzerland). Before each measurement, sbp, dbp, and mean arterial blood pressures (map) were measured on the upper arm by an automated oscillometric device (hp - cms patient monitor; hewlett packard, palo alto, ca). Pulse rate was automatically recorded by the same unit from a finger - pulse oxymetric device . Baseline values were calculated as an average of the last 20 s before start of the flicker stimulation . Flicker response was calculated as an average of the last 20 s of the stimulation period . Flow - mediated dilatation of the brachial artery was expressed as percentage change of diameter measured 60 s after cuff deflation compared with baseline . An anova model was used for significance testing of the retinal vessel response to flicker stimulation and to fmd over time within the groups as well as between the three groups . Pearson product - moment correlation coefficient was calculated to assess correlation between the variables . To adjust for multiple testing, for all calculations, a p value <0.05 was considered as the level of significance . The diameters of one temporal retinal artery and vein between 1 and 2 disc diameters from the margin of the optic disc were continuously measured using the dynamic vessel analyzer (dva; imedos, jena, germany). The dva comprises a fundus camera (ff 450; carl zeiss meditec, jena, germany), a digital video camera, and a personal computer with analyzing software for the determination of retinal vessel diameters that are analyzed from digitized images . After selection of the measurement location, the dva is able to follow the vessels during movements within the measurement window . Full - field flickering light with a frequency of 12.5 hz was used for stimulation by square to measure fmd, each subject was in the supine position with the left arm supported on a foam block and a pneumatic cuff placed on the upper arm proximal to the measurement area . A high - resolution ultrasound system with a 7.0-mhz transducer (vivid seven pro; ge vingmed ultrasound, horten, norway) was used to measure the brachial artery diameter . The probe was fixed in an adjustable swivel arm to maintain an identical position during the experiments . The brachial artery was scanned in a longitudinal section proximal to its bifurcation, which was used as an anatomical marker . Baseline diameter of the brachial artery was assessed as the mean of 1 min of continuous measurement . Thereafter, the cuff on the upper arm was inflated to suprasystolic pressure (250 mmhg) for 4.5 min . All subjects were studied under dilated pupil after instillation with tropicamide (mydriaticum agepha-gtt; agepha, vienna, austria). After a 20-min resting period in a sitting position, thereafter, retinal vessel measurements including flicker stimulation were performed . Intraocular pressure (iop) was measured after the flicker experiment . Iop was measured with a slit - lamp mounted goldmann applanation tonometer (haag - streit, bern, switzerland). Before each measurement sbp, dbp, and mean arterial blood pressures (map) were measured on the upper arm by an automated oscillometric device (hp - cms patient monitor; hewlett packard, palo alto, ca). Pulse rate was automatically recorded by the same unit from a finger - pulse oxymetric device . Baseline values were calculated as an average of the last 20 s before start of the flicker stimulation . Flicker response was calculated as an average of the last 20 s of the stimulation period . Flow - mediated dilatation of the brachial artery was expressed as percentage change of diameter measured 60 s after cuff deflation compared with baseline . An anova model was used for significance testing of the retinal vessel response to flicker stimulation and to fmd over time within the groups as well as between the three groups . Pearson product - moment correlation coefficient was calculated to assess correlation between the variables . To adjust for multiple testing, for all calculations, a p value <0.05 was considered as the level of significance . Was significantly increased compared with the other groups (anova, p <0.001) (table 1). Map and total cholesterol were increased in group 2 (anova, p <0.003). Average baseline vessel diameters were slightly increased in type 1 diabetes (anova, p = 0.018). A detailed summary of concomitant medication can be found in online appendix table a1 (available at http://care.diabetesjournals.org/cgi/content/full/dc08-2130/dc1). Baseline data of the three participating groups data are means sd, unless otherwise indicated . * significant differences (p <0.05, anova). In the healthy group, stimulation with flicker light induced a vasodilatation of 7.0 2.3% in retinal arteries (anova, time effect, p <0.001) (fig . 1) and a dilatation of 6.8 3.4% (p <0.001) in retinal veins . In patients with type 1 diabetes, retinal arterial diameters increased by 2.9 2.8% (p <0.001) and retinal veins by 4.6 2.0% (p <0.001). Patients with systemic hypertension and/or hypercholesterolemia showed a vasodilatation of 4.3 2.8% (p <0.001) in retinal arteries and a vasodilatation of 6.0 2.4% (p <0.001) in retinal veins . Thus, flicker - induced dilatation was reduced in patients with type 1 diabetes and patients with systemic hypertension and/or hypercholesterolemia compared with healthy control subjects . This effect was significant at a level of p <0.001 for retinal arteries and at a level of p = 0.045 for retinal veins (anova, effect between groups). Group means sd . * significant differences (p <0.05, anova). Fmd of the brachial artery was 4.3 3.0% in the healthy group (anova, time effect, p <0.001) (fig . 1). In both patients with type 1 diabetes and patients with systemic hypertension and/or hypercholesterolemia, fmd was significantly attenuated to 2.6 1.7% in group 1 (anova; time effect: p <0.001; effect between groups: p = 0.045) and to 2.4 2.4% in group 2 (time effect: p <0.001; effect between groups: p = 0.045). Again, fmd of the brachial artery was not significantly different between the two patients groups . A correlation between fmd and flicker - induced vasodilatation in retinal arteries (r = 0.3, p = 0.044) was found (fig . No correlation, however, was observed between fmd and flicker response in retinal veins (data not shown). Flicker - induced vasodilatation was negatively correlated with plasma cholesterol levels (r = 0.33, p = 0.044) but not with age (r = 0.33, p = 0.08) (fig . There was also no significant correlation between fmd and age (r = 0.35, p = 0.081) or cholesterol (r = 0.22, p = 0.090) after p value adjustment . Given that patients with diabetes are known to have a reduced flicker response, the type 1 diabetic group has been excluded in the latter analyses . Correlation analysis between fmd and flicker response of retinal arteries (r = 0.3, p = 0.044). Correlation analysis between flicker - induced vasodilatation and plasma cholesterol levels (r = 0.33, p = 0.044) (a), between fmd and age (r = 0.35, p = 0.081) (d), and vice versa (r = 0.33, p = 0.08) (b) (r = 0.22, p = 0.090) (c). In the healthy group, stimulation with flicker light induced a vasodilatation of 7.0 2.3% in retinal arteries (anova, time effect, p <0.001) (fig . 1) and a dilatation of 6.8 3.4% (p <0.001) in retinal veins . In patients with type 1 diabetes, retinal arterial diameters increased by 2.9 2.8% (p <0.001) and retinal veins by 4.6 2.0% (p <0.001). Patients with systemic hypertension and/or hypercholesterolemia showed a vasodilatation of 4.3 2.8% (p <0.001) in retinal arteries and a vasodilatation of 6.0 2.4% (p <0.001) in retinal veins . Thus, flicker - induced dilatation was reduced in patients with type 1 diabetes and patients with systemic hypertension and/or hypercholesterolemia compared with healthy control subjects . This effect was significant at a level of p <0.001 for retinal arteries and at a level of p = 0.045 for retinal veins (anova, effect between groups). Fmd of the brachial artery was 4.3 3.0% in the healthy group (anova, time effect, p <0.001) (fig . 1). In both patients with type 1 diabetes and patients with systemic hypertension and/or hypercholesterolemia, fmd was significantly attenuated to 2.6 1.7% in group 1 (anova; time effect: p <0.001; effect between groups: p = 0.045) and to 2.4 2.4% in group 2 (time effect: p <0.001; effect between groups: p = 0.045). Again, fmd of the brachial artery was not significantly different between the two patients groups . A correlation between fmd and flicker - induced vasodilatation in retinal arteries (r = 0.3, p = 0.044) was found (fig . No correlation, however, was observed between fmd and flicker response in retinal veins (data not shown). Flicker - induced vasodilatation was negatively correlated with plasma cholesterol levels (r = 0.33, p = 0.044) but not with age (r = 0.33, p = 0.08) (fig . There was also no significant correlation between fmd and age (r = 0.35, p = 0.081) or cholesterol (r = 0.22, p = 0.090) after p value adjustment . Given that patients with diabetes are known to have a reduced flicker response, the type 1 diabetic group has been excluded in the latter analyses . Correlation analysis between fmd and flicker response of retinal arteries (r = 0.3, p = 0.044). Correlation analysis between flicker - induced vasodilatation and plasma cholesterol levels (r = 0.33, p = 0.044) (a), between fmd and age (r = 0.35, p = 0.081) (d), and vice versa (r = 0.33, p = 0.08) (b) (r = 0.22, p = 0.090) (c). Given that impaired endothelial function has been observed to be an early feature in several systemic and ocular vascular - related diseases, much attention has been paid to the development of methods to noninvasively assess endothelial function in humans . As one of the most widely used techniques, the ultrasound - based fmd has been shown to give a reliable estimate of endothelium - dependent vasodilatation (10). Fmd is based on the capacity of blood vessels to self - regulate vascular tone in response to changes of shear stress caused by changes in blood flow . This regulation is dependent on endothelium - derived no (14) and can therefore be used as a marker for endothelial function . Reduced fmd has been found in patients with mild systemic hypertension (15), hypercholesterolemia (16), and diabetes (17), indicating for an impaired endothelial function in these patient groups . Additionally, it has been shown that fmd can predict future cardiovascular events (18). However, the technique of fmd is hampered by the limited spatial resolution of the ultrasound systems currently available . In addition, measurement of fmd requires significant training and involves a subjective component when data are evaluated . It has been shown that flicker response is significantly diminished in patients with glaucoma or diabetes (5,8). Even more importantly, a reduced response has also been observed in patients with systemic hypertension, indicating a potential insight into vascular function in general (7), because an increase of blood pressure or iop alone does not influence the flicker response (19,20). These results support the hypothesis that the observed changes reflect long - term alterations of the vasculature . The hypothesis that flicker - induced vasodilatation may at least partially reflect endothelial function has also been encouraged by the observation that flicker - induced vasodilatation is mainly dependent on an intact no synthesis (9). Endothelial dysfunction due to abnormal release or action of no is a well - recognized early feature of vascular damage, as it has been reported previously in vascular - related diseases like diabetes, hypercholesterolemia, systemic hypertension, and atherosclerosis (16,21,22). Our findings of greater baseline vessel diameters in patients with diabetes are in good accordance with earlier studies (23). However, given that our measures were done only in one single artery and vein and not in all visible vessels, our data do not represent total cross - sectional retinal vessel diameters . This result is again a hint that endothelial dysfunction is involved in reduced flicker - induced vasodilatation, because cholesterol and oxidized ldl in particular are clearly associated with endothelial cell dysfunction (24) and reduced bioavailability of no . Evidence has been provided that reduction of serum cholesterol increases fmd and may therefore be beneficial for endothelial functions (22,24). Whether this also holds true for flicker - induced vasodilatation has yet to be clarified . Correlations between fmd and age or plasma cholesterol, as observed earlier (16), and between flicker - induced vasodilatation and age failed to reach level of significance after adjustment for multiple testing . Our study was, however, not designed for these outcome analyses, and a larger sample size may be required to investigate these issues . The present study provides evidence that in patients with type 1 diabetes and in patients with systemic hypertension and/or hypercholesterolemia, both fmd and flicker - induced vasodilatation are reduced compared with healthy volunteers . However, our study failed to show a strong correlation between fmd and flicker - induced vasodilatation . What could be the reason for the differing responses between the two vascular beds? Whereas the diameter increase in fmd is caused directly by the augmented shear stress in the endothelium and the connected tissue, flicker response is basically the vascular answer to increased neural activity in the retina . This may be of special importance in patients with diabetes or glaucoma, since it cannot be ruled out that in these patients decreased neural activity may partially account for the decreased flicker response . Second, it has to be noted that the properties of the vascular beds investigated differ significantly . Whereas flicker stimulation investigates arteries in an order of 150250 m, thus, the weak correlation between fmd and flicker may indicate that the stimulation answer in the conduit arteries and in the smaller retinal arteries do not carry the same information, although both are diminished in patients with endothelial dysfunction . This phenomenon is also known from other experiments showing that fmd and endothelium - dependent vasodilatation assessed with an invasive technique that mainly reflects the endothelial function of resistance arteries are both independently related to the risk of coronary heart disease (25). Flicker - induced vasodilatation may provide additional information to these techniques because of the smaller size of vessels assessed ., it provides excellent reproducibility and sensitivity (12). On the other hand, it is easily performed and quick, although pupil dilatation is required with the fundus camera used in the present experiments . Most importantly, the system does not include a subjective component once an optimal fundus image is achieved . As a limitation of the study, no information is available about blood nitrate concentration . Although none of the subjects under study was under nitrate medication, we cannot fully exclude that a nitrate - rich diet may influence fmd or flicker - induced vasodilatation . In summary, our data indicate that in both patient groups with endothelial dysfunction as assessed with fmd, flicker responses are diminished . The reason why no major correlation was found between fmd and flicker - induced vasodilatation needs to be the subject of further studies . Furthermore, whether flicker stimulation may also serve as a predictor for risk of systemic diseases, as it has been shown for fmd, has yet to be investigated in longitudinal studies . The system is, however, a candidate for assessing endothelial function in clinical routine because it induces minimum discomfort to the subject, provides good reproducibility and sensitivity, and does not include a subjective component.
|
Polyvinyl chloride (pvc) is one of the most commonly manufactured plastics in the world, used in a wide variety of products including packaging, pipes, automotive parts, construction materials and furniture . Pvc is polymerized from vinyl chloride (vc) monomer, which is one of the highest production volume chemicals globally with a current annual worldwide demand of approximately 16 billion pounds which is increasing at an approximate 3% annual rate . Up to 98% of vc is used in the production of pvc . Unfortunately, vc is a well - established animal and human carcinogen . It is most strongly associated with liver cancer, in particular the rare, sentinel neoplasm of liver angiosarcoma (las), a malignant tumor of the endothelial cells of the liver . However, vc has also been identified as a cause of hepatocellular carcinoma (hcc), the corresponding malignant tumor of the parenchymal cells of the liver . It has also been associated with non - malignant health effects, including in the liver and other organs, as well as other malignancies (e.g., lung and brain), although these other carcinogenic associations remain much more controversial . For example, national institute for occupational safety and health (niosh) has estimated that 81,000 workers employed in more than 3,700 worksites are potentially exposed to vc in the us; worldwide estimates are much higher with more than 2,200,000 workers probably exposed to vc ., elevated levels of vc have been found not only in the air near vc manufacturing and processing facilities but also in the vicinity of many hazardous waste sites and municipal landfills, either due to the direct disposal of vc or from the microbial degradation of other chlorinated solvents to form vc . In some cases, dangerously high levels have been detected (up to 44 ppm; compared to a us environmental protection agency reference concentration of 0.04 ppm) in the air at some of these landfills . General population exposures may also occur from tobacco smoke, drinking water from pvc pipe, and food and beverages from pvc packaging and bottles, although probably at much lower levels . However, these are some of the reasons that authorities in the field of chemical safety have warned that vc is very much still a cause of concern in occupational and environmental health . Within the plastics industry, vc is an also an excellent model for the study of chemical carcinogenesis via genotoxic mechanisms because it is a well - known dna - reactive chemical, for which much has been learned about the molecular biology of its pathways of action [figure 1]. It should be noted that although the mutagenic pathways for vc carcinogenesis have been the best studied and are thus the focus here, it is quite possible that other mechanisms could contribute significantly to vc carcinogenesis through more indirect pathways, including, for example, through epigenetic dysregulation of gene expression or alterations in immune surveillance . The molecular biologic and molecular epidemiologic pathways of vc carcinogenesis vc is a gas so the most significant exposures are respiratory . Following inhalation exposure, phase i metabolism is primarily via the cytochrome p-450 isoenzyme 2e1 (cyp2e1) to generate the reactive intermediates chloroethylene oxide (ceo) and chloracetaldehyde (caa) which are further metabolized in phase ii reactions by glutathione - s - transferases (gsts) and aldehyde dehydrogenase 2 (aldh2) to end - products for ultimate excretion . However, ceo and caa can readily interact with cellular macromolecules, including dna, to produce promutagenic effects . Because ceo tends to react much more rapidly with nucleic acids than caa, it is usually regarded as the most relevant electrophile for the generation of dna adducts and consequent mutagenic effects; the greater biological relevance of ceo is also supported by comparisons of the adduct profile of vc with that of 2,2-dichloroethyl ether, which only produces caa as a metabolite.vc biotransformation to ceo probably occurs principally in hepatocytes, but the epoxide can also reach and react with adjacent sinusoidal lining cells, so that mutagenic effects can occur in parenchymal liver cells and non - parenchymal endothelial cells, providing a logical rationale for the association between vc exposure and las as well as hcc . The major vc - associated liver dna adduct is 7-(2-oxoethyl)guanine, comprising up to 98% of all adducts formed . However, this adduct is eliminated from the dna with a very short half - life, principally by chemical depurination, and is not considered to be promutagenic . On the other hand, three etheno dna adducts are also formed in much less abundance, but they are known to be promutagenic . These are: n,3-ethenoguanine (g); 1,n - ethenoadenine (a); and 3,n - ethenocytosine (c). It should be noted that these etheno - dna adducts can also be found in tissues from unexposed humans and animals because they can be produced endogenously through the interaction of lipid peroxidation - derived aldehydes and hydroxyalkenals . However, vc exposure can increase the level of these adducts 10 - 100 fold over background in the hepatocytes and non - parenchymal liver cells of exposed animals . There are several potential mechanisms by which the vc - induced adducts could be repaired before they have a chance to cause mutations . The 1,n-a adducts are recognized and removed by 3-methyl adenine dna glycosylase which is part of the base excision repair (ber) pathway; this is accomplished by hydrolyzing the n - glycosidic bond between the damaged base and deoxyribose, leaving an abasic site in the dna . The ber apparatus includes numerous other proteins that complete the repair at the abasic site once the adduct is removed . The x - ray cross - complementing-1 (xrcc1) protein is critical to this process since it acts as a scaffold protein in this pathway and appears to regulate and/or enhance the activity of other ber proteins, which include an apurinic / apyrimidinic endonuclease (ape1), poly (adp - ribose) polymerase-1 (parp-1), poly (adp - ribose) polymerase-2 (parp-2), dna polymerase (pol) and dna ligase iii (lig iii). Ap endonuclease is responsible for cleaving the phosphodiester bond at the abasic site created by the glycosylase . Parp-1 and to a lesser extent parp-2 participate in the repair process by catalyzing ribosylation of a number of dna - bound proteins, thereby decreasing the affinity of these proteins for dna, and allowing the repair machinery to access the damaged site . Parp-1 and parp-2 can homo- and hetero - dimerize and interact with pol, lig iii and xrcc1 . Pol, the polymerase involved in short patch repair, provides two essential activities, deoxyribophosphodiesterase activity which releases the 5 sugar phosphate group, and gap - filling synthesis, where one nucleotide is added to the 3 oh . Finally, lig iii seals the nick in an atp - dependent manner . Although xrcc1 has not been demonstrated to contain enzymatic activity of its own, it is necessary for coordinating and regulating the early and late stages of ber through protein interaction modules such as the brca1 carboxy terminus (brct) domains . As discussed below, alterations in any of these proteins, particularly xrcc1, that could affect the efficiency of ber might be expected to result in an increase in the a adduct levels at any given level of vc exposure . The 3,n - ethenocytosine adduct is also repaired with high efficiency by ber via the thymine dna glycosylase . As a result, both the a and c adducts have reasonably short half - lives in the range of one day . In contrast, the n,3-ethenoguanine adduct has been shown to have a considerably longer half - life, in the range of 150 days, suggesting that it is not very efficiently repaired . This is consistent with the results of in vitro studies that indicate that etheno - guanine adducts are poorly repaired by ber . Thus, if they are repaired at all, it is likely to be by a different dna repair pathway . Like ber, ner occurs in a series of steps: damage recognition, unwinding and demarcation of the dna, excision of the single - stranded fragment containing the damaged site, and dna re - synthesis . Ner is accomplished primarily through the action of proteins of the xerodermapigmentosum family of genes which are categorized into seven different groups (a - g). Xpb and xpd are dna helicases that function as subunits of the transcription factor iih complex (tfiih) to promote dna bubble formation at the damaged site by unwinding the dna as xpa complexes with rpa proteins for demarcation . As discussed below, alterations in any of these proteins, particularly xpd, that could affect the efficiency of ner might be expected to increase the g adduct levels at any given level of vc exposure . The promutagenic properties of etheno - dna adducts that are not fully repaired by one or another of the dna repair pathways have been well - documented in experimental systems in vitro, as well as in vivo in bacterial and mammalian cells . The g adduct generates g->a base changes; the a adduct generates a->g, a->t and a->c base changes; and the c adduct generates c->a and c->t base changes . These experimental results are consistent with the tumor mutational spectra identified in exposed animals and humans in oncogenes and tumor suppressor genes, although there are both important similarities and differences between the patterns seen in the animal tumors and the human tumors . Both hccs and asls in vc - exposed rats were found to have mainly a->t transversions in the cancer - related h - ras and p53 genes . For example, seven of eight vc - induced hccs in vc - exposed rats had an a->t transversion at codon 61 of h - ras; 11 of 25 asls and one of eight hccs in vc - exposed rats had mutations in p53, all but one of which were base pair substitutions with nine at a: t base pairs (5 a->t, 2 a->g, 2 a->c) and three at g: c base pairs (all g->a), and two of the a->t transversions occurred at the same site (the first nucleotide of codon 253). On the other hand, asls in vc - exposed humans have been found to have exclusively a->t transversions in p53 (three of six, including one at the first nucleotide of codon 255 which corresponds to the same mutation in codon 253 seen in rats). Of note, studies of p53 mutations in 21 human asls that were not associated with vc exposure, only two had mutations, neither of which were a->t transversions . Studies of vc - associated hccs have also found frequent p53 mutations, occurring in 11 of 18 cases, although only two of these were a->t transversions . Both asls and hccs in vc - exposed humans have been found to have primarily g->a transitions in the k - ras oncogene at codons 12 and 13 . For example, in studies of vc - associated hccs, 5 of 12 tumors were found to have k - ras mutations at codons 12 and 13, three of which were g->a transitions . Even more striking, in studies of k - ras gene mutations in vc - associated asls, g->a transitions were found in 23 of 33 tumors with the vast majority of these (17 of 23) occurring at codon 13 . Again of note, studies of k - ras mutations in 24 asls that were not associated with vc exposure did find g->a transitions in seven cases, but all of them were at codon 12, indicating that the codon 13 mutation may be relatively specific for vc - induced asls . Interestingly, in studies of both asls and hccs in vc - exposed humans, five cases were also found to contain k - ras mutations in the histologically normal adjacent tissue, three of which were g->a transitions and two of which occurred at codon 13; likewise, at least one case of a non - dysplastic pre - angiosarcomatous liver lesion has been found to contain the characteristic g->a transition at codon 13 of k - ras . These results suggest that these vc - associated mutations, particularly the codon 13 k - ras mutation, may be a relatively early event in vc carcinogenesis, and thus the occurrence of these mutations may be useful biomarkers of cancer risk in exposed individuals, as discussed below . The g->a transition at codon 13 of k - ras results in the substitution of an aspartic acid (asp) for the normal glycine (gly) at amino acid residue 13 in the encoded p21 protein product . This substitution is believed to be oncogenic, having been identified in other human tumors as well . The oncogenic mechanism of action of this substitution is thought to be through the production of a conformational change in p21 which may be responsible for altering its intrinsic gtpase activity, thus affecting signal transduction within the cell leading to uncontrolled growth and division . Similarly, the a->t transversions at various codons of p53 produce their corresponding amino acid substitutions in the encoded p53 protein product, all changes that have been shown to cause the protein to adopt its so - called malignant conformation with a concomitant loss of its normal tumor suppressor activity . These protein changes provide a useful indicator of the pathogenic consequences of the occurrence of the corresponding mutations as well as convenient intermediate biomarkers of the vc effect to study the molecular epidemiology of vc carcinogenesis in exposed human populations . It has been shown that the mutant ras - p21 protein containing asp for gly at amino acid residue 13 can be distinguished from the wild - type protein and other mutant ras - p21 proteins immunologically with a mouse monoclonal antibody specific for this protein . For cells in culture that contain the mutant ras gene, it is possible to use this monoclonal antibody to detect mutant ras - p21 expression in the cells by immunocytochemistry and in the extracellular supernatant by immunoblotting . In analogous situations in vivo, mutant asp 13 ras - p21 can be detected in tumor tissue by immunohistochemistry and in the serum by immunoblotting of vc - exposed workers with asls known to contain the mutant ras gene but not in the serum of vc - exposed workers with asls that do not contain the mutation or in unexposed controls . An analogous, although slightly more complicated situation occurs with p53 . As noted, all of the vc - induced mutations in the p53 gene have been shown to cause a similar conformational change in the encoded p53 proteins that result in the exposure of a common epitope, which is normally not immunologically detectable in the wild - type protein . Thus, these mutant p53 proteins can be distinguished from wild - type p53 immunologically with a mouse monoclonal antibody that binds to this mutant - specific epitope . For cells in culture that contain the mutant p53 genes, it is possible to use this monoclonal antibody to detect mutant p53 protein expression in the cells by immunocytochemistry and in the extracellular supernatant by immunoblotting or by enzyme - linked immunosorbent assay (elisa). In the analogous situation in vivo, mutant p53 can be detected in the tumor tissue by immunohistochemistry and in the serum by immunoblotting or elisa of vc - exposed workers with asls known to contain the mutant p53 genes but not of vc - exposed workers with asls that do not contain the mutations or in unexposed controls . In some cases of mutant p53-positive tumors, it is known that individuals can also develop an antibody response to the mutant p53 which can obscure the detection of the mutant p53 protein itself . However, it is also possible to detect these auto - antibodies to mutant p53 using an elisa . Thus, the detection in serum of mutant p53 protein and/or an antibody response to mutant p53 protein can be used together to best identify individuals who have a p53 mutation in their tumors . Based on the above evidence, it seems that these serum biomarkers for mutant ras - p21 and mutant p53 accurately reflect the occurrence of the corresponding mutational changes in the target tissue of vc - exposed workers . Further support for this is provided by the case of an asl with multiple serum samples over time for which the levels of these serum biomarkers seemed to parallel the clinical course of the disease in terms of tumor burden . In addition, these biomarkers have been identified not only in vc - exposed workers with asls but also in vc - exposed workers with non - malignant (but potentially pre - malignant) angiomatous lesions and in vc - exposed workers without any apparent neoplastic disease, even in workers exposed below the current permissible exposure limit of 1 ppm. [43032] in a large cohort of french vc workers, the presence of these biomarkers was found to occur with a highly statistically significant dose - response relationship with regard to estimated, cumulative vc exposure, supporting the claim that the generation of the biomarkers was indeed the result of the exposure . Similar results with these biomarkers have been noted in several other vc workers cohorts around the world. [3439] to date in these various studies, at least five vc - exposed biomarker - positive workers without asl have developed subsequent liver lesions presumed or confirmed to be asl, also suggesting that these biomarkers may have predictive value for the subsequent occurrence of cancer . However, at any given level of vc exposure, some workers will have none, one or both mutant biomarkers . One possible explanation for this inter - individual variability is genetic differences in the proteins that metabolize vc or repair the dna damage it produces . For example, in the aforementioned french vc worker cohort we have identified the cyp2e1 c2 allele as a significant contributor to genetic variability in the metabolism of vc, since it is statistically significantly associated with an increased occurrence of either or both of the mutant ras - p21 and mutant p53 biomarkers even after controlling for potential confounders including cumulative vc exposure, and the gene - environment interaction between the polymorphism and vc exposure was approximately additive . Studies in other vc worker populations have found similar effects of the cyp2e1 polymorphism on these biomarkers, as well as other biomarkers of dna damage such as micronuclei and sister chromatid exchanges or non - specific liver damage. [4152] this is consistent with recent experimental results from studies of lymphoblasts from individuals of different genotypes exposed in vitro to vc . Cells with the c2c2 cyp2e1 genotype were found to have approximately 2.5 times higher gene expression than those with the wild - type c1c1 genotype [figure 2], which resulted in an approximate 2.1-fold increase in etheno - dna adduct generation in the polymorphic cells compared to the normal cells at the same level of vc exposure [table 1]. Other polymorphisms in the phase ii vc metabolic pathway including aldh2, gstm1 and gstt1 have also been implicated in modulating vc - induced dna damage in some but not all vc worker populations. [3340475054] quantitative pcr of cyp2e1 expression in lymphoblasts from individuals with c1c1 and c2c2 genotypes etheno - dna adduct levels in lymphoblast dna after treatment with vc with and without watercress as noted, another potential source of inter - individual variability in the susceptibility for vc - induced mutagenesis could derive from genetic differences in the dna repair pathways for ber and ner . As described above, vc - induced a and c adducts would be expected to be repaired by the ber pathway, in which the xrcc1 protein plays the major role of coordinating the activity of the repair machinery . Xrcc1 is known to contain three common polymorphic sites that might be expected to have an effect on xrcc1 structure and function because they occur in or near important protein domains . For example, the polymorphism at amino acid residue 194, which results in the substitution of a tryptophan for the normal arginine, occurs in the xrcc1 n - terminal domain from amino acid residues 1 - 195 that has been observed to mediate its interaction with the palm - thumb domain of pol. A second polymorphism at amino acid residue 280, which results in the substitution of a histidine for the normal arginine, occurs in the region between the n - terminal domain and the brct1 domain of the protein and close to the nuclear localization signal site and thus could affect the relationship between these two critical domains and/or the protein's localization ability . The third and most common polymorphism in xrcc1 occurs at amino acid residue 399, resulting in the substitution of a glutamine for the normal arginine, within the highly conserved central brct1 domain from amino acid residues 315 - 403, which has been associated with the functioning of parp1, parp2 and ape1 . In the aforementioned french vc worker cohort, we have been able to identify the effect of these xrcc1 polymorphisms on the occurrence of the mutant p53 biomarker, but not the mutant ras - p21 biomarker, even after controlling for potential confounders including cumulative vc exposure. [5961] the difference in effect on the two biomarkers is expected, since, as noted the a adducts that result in the mutant p53 biomarker are repaired by ber but the g adducts that result in the mutant ras p21 biomarker are not, so changes in xrcc1 might affect the former but should not affect the latter . Among these three xrcc1 polymorphisms, however, the most significant effect on the mutant p53 biomarker was attributable to the residue 399 polymorphism . In this case, individuals who were homozygous variant gln - gln at 399 had a statistically significant 1.9-fold risk of occurrence of the mutant p53 biomarker compared to homozygous arg - arg wild - type individuals, even after controlling for potential confounders including cumulative vc exposure, and the gene - environment interaction between the polymorphism and vc exposure appeared to be potentially supra - multiplicative . Studies in other vc worker populations have found similar effects of the xrcc1 polymorphisms, particularly the 399 polymorphism, on the mutant p53 biomarker, as well as other biomarkers of dna damage . For example, molecular modeling of the brct1 domains of the normal and polymorphic forms of xrcc1 demonstrates that the 399 substitution produces significant conformational changes in this domain, including the loss of secondary structural features such as -helices that can be critical for mediating protein - protein interactions that would allow xrcc1 to coordinate ber . Also, studies of lymphoblasts from individuals of different genotypes exposed in vitro to the reactive metabolites of vc showed that cells with the xrcc1 399 homozygous variant gln - gln genotype had an approximate fourfold decrease in efficiency of repair of a dna adducts compared to cells with the homozygous wild - type arg - arg genotype [table 2], resulting in an approximate 1.8-fold increase in mutation frequency in the polymorphic cells as measured by the hprt assay . Etheno - dna adduct levels in lymphoblast dna after treatment with vc - reactive intermediates and repair as discussed above, g dna adducts do not appear to be repaired well by ber and polymorphisms in xrcc1 do not appear to affect the occurrence of the mutant ras p21 biomarker that results from the g adducts in vc - exposed workers, so other dna repair pathways may be involved . Ner is another important dna repair pathway that is critically dependent upon the xpd protein, which is also know to contain at least two common polymorphic sites, namely at amino acid residues 312 (asp->asn) and 751 (lys->gln). The 751 site is assumed to be particularly important for xpd function since it occurs in the c - terminal domain of the protein which has been suggested to interact with the p44 helicase activator protein of the tfiih complex; also, it is been shown that an xpd mutation that results in the loss of the final 17 c - terminal amino acids, including residue 751, results in the clinical disease phenotype of trichothiodystrophy . In the aforementioned french vc worker cohort, we have been able to identify the effect of these xpd polymorphisms on the occurrence of both mutant biomarkers, although the most marked and statistically significant effect was on the mutant ras - p21 biomarker . In this case, individuals who were homozygous variant at either residue 312 or 751 had a statistically significant 2.6 - 3.0-fold increased risk of occurrence of the mutant ras p21 biomarker compared to homozygous wild - type individuals, even after controlling for potential confounders including cumulative vc exposure . Furthermore, in the case of the residue 751 polymorphism, the gene - environment interaction between the polymorphism and vc exposure, as well as the gene - gene interaction between the xpd and cyp2e1 polymorphisms, appeared to be potentially multiplicative . Once again, studies in other vc worker populations have found similar effects of the xpd polymorphisms on other biomarkers of dna damage . For example, molecular modeling of the normal and polymorphic forms of xpd demonstrates that these substitutions produce discrete conformational changes in the protein which could affect its function [figure 3]. Also, studies of lymphoblasts from individuals of different genotypes exposed in vitro to the reactive metabolites of vc showed that cells with the xpd 751 homozygous variant gln - gln genotype had an approximate fivefold decrease in efficiency of repair of g dna adducts compared to cells with the homozygous wild - type lys - lys genotype [table 3]. Based on mutational spectrum studies in caa - exposed human cell lines, the resultant increase in g dna adducts would especially result in an increase in g->a transitions consistent with those found in the tumors of vc - exposed workers, as noted above . Superposition of the backbone structures of the wild - type (yellow) and polymorphic (red) forms of the xpd protein from molecular dynamics modeling etheno - dna adduct levels in lymphoblast dna after treatment with vc - reactive intermediates and repair a thorough understanding of the molecular biology and molecular epidemiology of vc carcinogenesis can provide the basis for new molecular approaches to the prevention and treatment of vc - induced cancers . For example, the results of the molecular epidemiology of the mutant biomarkers could be used for improved primary prevention of vc - induced cancers by refining the risk assessment that is used as the basis for determining acceptably safe permissible exposure limits for vc . Since 1974 the permissible exposure limit for vc - exposed workers has been 1 ppm, as an 8-h time - weighted average, based on extrapolations from animal experiments . This would be the equivalent of a maximum cumulative dose of 40 ppm - years over a 40-year working lifetime . Unfortunately, as noted above, we have found statistically significantly increased occurrences of the vc - induced mutant biomarkers even in workers exposed only below the permissible exposure limit of 1 ppm (i.e., with cumulative vc exposures less than 40 ppm - years). This might suggest that the current permissible exposure limit is not adequately protective against carcinogenic effects . However, cohorts of workers exposed to less than 40 ppm - years of cumulative vc exposure can be stratified into two sub - groups . Workers with 10 - 40 ppm - years of cumulative exposure have been found to have a statistically significantly increased occurrence of the mutant biomarkers at a rate which is actually not statistically different from workers with more than 40 ppm - years of cumulative vc exposure, whereas workers with less than 10 ppm - years of cumulative exposure did not have a statistically significantly increased occurrence of the mutant biomarkers compared to unexposed controls . Thus, a risk assessment based on biomarkers might suggest a permissible exposure limit of 0.25 ppm as being more adequately protective of workers health by preventing the occurrence of these cancer - related mutations . In individual workers who are already exposed to vc at higher levels, there may be additional avenues for secondary prevention and treatment of vc - induced disease . For example, one approach to secondary prevention could be based on personalized prevention derived from knowledge of each worker's susceptibility from genetic and other factors . As noted above, the level of activity of cyp2e1 in phase i metabolism of vc can have a significant impact on the amount of dna damage produced at any given level of vc exposure . Many different individual factors can affect the level of expression and hence the level of activity of cyp2e1 including genetics (e.g., the c2 allele), alcohol consumption, diet (e.g., cruciferous vegetables) and medications (e.g., isoniazid). Although most of these factors increase the expression and activity of cyp2e1, certain vegetables act to decrease its activity . For instance, it has been demonstrated in controlled clinical studies in humans that ingestion of small amounts of watercress (rorippa nasturtium - aquaticum) can effectively inhibit cyp2e1's metabolic activity . One proposed mechanism for this effect is due to the fact that watercress is a rich source of glucosinolates, including gluconasturtiin, which is metabolized by intestinal microflora to phenyllethylisothiocyanate, a known cyp2e1 inhibitor . Cell culture studies have suggested an anticarcinogenic effect from isothiocyanate exposure, and some dietary studies in animals and humans have associated increased isothiocyanate consumption with decreased cancer risk . Most significantly, a recent randomized, crossover, controlled clinical trial of low - dose watercress for a limited period of time was shown to statistically significantly decrease end - points of gross dna damage (as measured in peripheral lymphocytes by the comet assay) by 17%, with the effect being greatest in those individuals with exogenous carcinogen exposure (i.e., cigarette smokers). These results suggest that watercress may be a potential nutri - genomic intervention to counter the toxico - genomic effects of the vc - cyp2e1 gene - environment interaction by inhibiting cyp2e1 activity at any given level of vc exposure and cyp2e1 status (i.e., genetically determined or personally induced) to decrease the formation of reactive intermediates responsible for the production of the dna adducts that cause the carcinogenic mutations in vc - exposed individuals . Studies of lymphoblasts from individuals of different cyp2e1 genotypes exposed in vitro to vc showed that the addition of watercress was able to reduce the dna damage as measured by the increased level of etheno - dna adducts back close to baseline both in homozygous wild - type and homozygous variant individuals, although more watercress was needed to achieve this effect in the latter case as would be expected based on the epidemiologic and gene expression results noted above [table 1]. Although much less is currently known about methods for altering dna repair activity, similar approaches to secondary prevention based on augmenting dna repair may be possible; for example, a recent study in mice has suggested that selenocystine administration did not protect against immediate dna damage following ionizing radiation exposure but was nevertheless protective because it enhanced the rate of repair of the induced dna damage . For vc - exposed individuals who have already experienced the vc - induced mutations, different molecularly targeted a synthetic peptide analogue for a control region of p53 has been demonstrated to cause mutant p53 to revert to normal function, reinstating its ability to cause cell death in cancerous cells and pre - cancerous cells that contain a p53 mutation both in cell culture and in animal models . This peptide has also been shown to effectively kill mutant p53 haend cells in culture that are derived from an angiosarcoma in a vc - exposed worker . Thus, this approach could potentially be used as chemotherapy for vc - exposed workers who have asls with p53 mutations as well as chemoprophylaxis for vc - exposed workers who do not yet have asls but are at high risk of developing asls in the future due to their increased susceptibility as evidenced by their increased rate of mutant p53 biomarkers . For example, the compound l--(5-hydroxy-2-pyridyl) alanine can cause permanent reversion of human cancer cell lines with k - ras mutations, including those that contain the vc - induced asp 13 mutation, to a normal cellular phenotype that will no longer grow in soft agar and will no longer produce tumors in nude mice . Once again, such an approach could potentially be used as chemotherapy for vc - exposed workers who have asls with k - ras mutations as well as chemoprophylaxis for vc - exposed workers who do not yet have asls but are at high risk of developing asls in the future due to their increased susceptibility as evidenced by their increased rate of mutant ras - p21 biomarkers . The success of these approaches could be effectively monitored by following these same mutant biomarkers . A detailed understanding of the molecular biology of vc carcinogenesis has provided new ways of studying the molecular epidemiology of vc carcinogenesis in exposed humans, which in turn have provided the basis for new approaches to the prevention and treatment of vc - related cancer . This model could also have much broader implications; since other potential carcinogenic exposures in the plastics industry and elsewhere share some of the same molecular biologic pathways of metabolism and repair as vc similar molecular epidemiologic biomarkers could be useful for monitoring their carcinogenic process, and since many different types of common human cancers contain either or both p53 and k - ras mutations similar molecularly targeted approaches to chemotherapy and chemoprophylaxis could have wide applicability . Paul wesley brandt - rauf, office of the dean, school of public health university of illinois at chicago 1603 west taylor street, room 1145 chicago, il dr . Yongliang li, division of environmental and occupational health sciences, school of public health, university of illinois at chicago, chicago, il 60612 dr . Changmin long, division of environmental and occupational health sciences, school of public health, university of illinois at chicago, chicago, il dr . Regina monaco, division of environmental and occupational health sciences, school of public health, university of illinois at chicago, chicago, il
|
Hydrophobic match or mismatch in transmembrane (tm) helices (or proteins) refers to the match or mismatch between the length of the hydrophobic core of the helix and the native thickness of the hydrocarbon region of the membrane (figure 1). Positive mismatch refers to a situation in which the helix is longer than the membrane thickness (figure 1a), and negative mismatch refers to a situation in which it is shorter (figure 1c). Hydrophobic mismatch is a fascinating example of mutual protein membrane interaction . In cell membranes, hydrophobic mismatch is one of the mechanisms driving the formation of microdomains (lipid rafts), in which membrane lipids and proteins of compatible length diffuse laterally and cluster together . Microdomains usually have important functional implications, for example in cell division and signal transduction . Moreover, hydrophobic mismatch is thought to be important in cellular processes such as the sorting of lipids and tm proteins into cellular compartments . This notion is supported by a recent survey that found differences in the lengths of tm helices from various cellular organelles, which were compatible with the differences in the thicknesses of the respective lipid bilayers . Helix - membrane configurations with (a) positive hydrophobic mismatch, (b) perfect match, and (c) negative hydrophobic mismatch . The helix is represented as a cylinder, with the hydrophobic core in purple and the hydrophilic termini in white . (a) at positive mismatch, the tm helix tilts and the membrane expands to match the helix hydrophobic core . (b) at perfect match, the helix tilts because of the favorable increase in precession entropy, and the membrane thins so that the polar helix termini can remain in the lipid headgroup region rather than partition into the hydrocarbon region of the membrane . (c) at slight negative mismatch (lower left panel), the tm helix tilts and the membrane thins locally as in perfect match . In cases of excessive mismatch, the helix adopts a surface orientation rather than forcing the membrane to thin beyond its elastic limit (lower right panel). Both tm helices and lipids adapt to mismatch by minimizing the exposure of the polar side chains and backbone of the helix to the hydrophobic membrane environment while maximizing the favorable interaction between the hydrophobic amino acids and the lipid . Several means of system adaptation to both positive and negative mismatch have been observed in experiments . In positive mismatch, the helix tilts from the membrane normal and decreases its effective hydrophobic length (figure 1a). Another adaptation to positive mismatch is kinking or flexing of the tm helix . Alternatively (or jointly), the acyl chains of the phospholipids surrounding the helix can stretch . The helix may also migrate to membrane regions with a better match to its hydrophobic length and/or interact with other tm helices / proteins . In cases of negative mismatch, the acyl chains have been shown to contract and reduce the bilayer thickness (figure 1c). In extreme cases of negative mismatch, where tm orientation involves severe membrane deformation, the helix can be oriented in parallel to the membrane surface and reside at the water membrane interface . Recent molecular dynamics (md) simulations have demonstrated that tilting of tm helices occurs also at perfect match (figure 1b) and negative mismatch (figure 1c). Using potential of mean force calculations, i m and co - workers have attributed tilting under such conditions to the gain in precession entropy associated with the rigid - body translational - rotational motion of the tilted helix in the membrane . The authors demonstrated that, due to the precession entropy gain, tm helices tilt at least 10 from the membrane normal even under negative mismatch conditions . For instance, under negative mismatch conditions, helix lipid interactions are energetically unfavorable and oppose the tilt . This might be related to the fact that under such conditions tilting involves a desolvation free energy penalty due to the transfer of the polar helix termini from the aqueous phase into the hydrocarbon region of the membrane . To avoid the associated free energy penalty, the membrane thins . The reduction in the entropy of the lipid chains due to membrane thinning can be balanced by the increase in precession entropy . Incorporating this free energy balance, we present below a simple theoretical model, an equation of state, for estimating the tilt angle according to the helix length and membrane thickness . The theoretical model integrates insights gained from monte carlo (mc) simulations using the method presented in refs (1317) and below . We use the equation of state to estimate the tilt angles of 17 synthetic peptides of the walp / kalp / gwalp series of different lengths (table 1) in six membrane types with various native thicknesses (table 2). The peptides feature hydrophobic cores, composed of alanine and leucine amino acids, flanked by lysine (in kalp peptides) or tryptophan residues (in walp and gwalp peptides). The results agree with experimental data, previous calculations, and our mc simulations . The lengths of their hydrophobic cores were estimated assuming a translation of 1.5 per residue along the helix axis, as in a perfect -helix . The width of the hydrophobic core is calculated as described in ref (22). The peptide was described in a reduced way; each amino acid was represented by two interaction sites, corresponding to the -carbon and side chain . The membrane hydrophobicity was represented as a smooth profile, corresponding to the native thickness of the hydrocarbon region . The total free energy difference between a peptide in the aqueous phase and in the membrane (gtot) was calculated as1where gcon is the free energy change due to membrane - induced conformational changes in the peptide . At constant (absolute) temperature t, it can be calculated as gcon = e ts, where e is the internal energy difference between the peptide in water and in the membrane . The internal energy is a statistical potential derived from available three - dimensional (3d) protein structures . The energy function assigns a score (energy) to each peptide conformation according to the conformation s abundance in the protein data bank . Common conformations are assigned high scores (low energy), while rare conformations are assigned lower scores (higher energy). S refers to the entropy difference between the water and membrane - bound states, while the entropy (s) in each state is determined by the distribution of the virtual bond rotations in the reduced peptide representation . Gdef is the free energy penalty associated with fluctuations of the membrane thickness around its native (resting) value, calculated following the estimation of fattal and ben - shaul . Their calculations were based on a statistical - thermodynamic molecular model of the lipid chains . Their model fits a harmonic potential of the form gdef = l, where l is the difference between the native and actual thickness of the membrane and is a harmonic - force constant related to the membrane elasticity and is equal to = 0.22 kt /, where k is the boltzmann constant . In the model, the membrane is allowed to deform within its elastic range, that is, 20% of its native thickness . Gcoul stands for the coulombic interactions between titratable residues of the peptide and the (negative) surface charge of the membrane . Chapman theory that describes how the electrostatic potential depends on the distance from the membrane surface in an electrolyte solution . We used electrostatically neutral membranes, corresponding to the zwitterionic lipid phosphatidylcholine, so gcoul = 0 . Gsol is the free energy of transfer of the peptide from the aqueous phase to the membrane . It takes into account electrostatic contributions resulting from changes in solvent polarity, as well as nonpolar effects, both resulting from differences in the van der waals interactions of the peptide with the membrane and aqueous phases, and from solvent structure effects . Gimm is the free energy penalty resulting from the confinement of the external translational and rotational motion of the peptide inside the membrane . Glip is the free energy penalty resulting from the interference of the peptide with the conformational freedom of the aliphatic chains of the lipids in the bilayer while the membrane retains its native thickness . The latter three terms, i.e., gsol, gimm, and glip, are calculated using the kessel and ben - tal hydrophobicity scale . The scale accounts for the free energy of transfer of the amino acids, located in the center of a polyalanine -helix, from the aqueous phase into the membrane midplane . In order to avoid the excessive penalty associated with the transfer of charged residues into the bilayer, in the model the titratable residues are neutralized gradually upon insertion into the membrane, so that a nearly neutral form is desolvated into the hydrophobic core . To calculate the free energy change in eq 1, we conducted mc simulations of the peptide in water and in membrane environments . In water, the peptide is subjected solely to internal conformational modifications . In one mc cycle, the number of internal modifications attempted is equal to the number of residues in the peptide . In the membrane, each mc cycle includes additional external rigid body rotational and translational motions to allow the peptide to change its location in the membrane and its orientation with respect to the membrane normal . A helical peptide in a membrane typically adheres to one of the two following configurations: tm orientation with the helices principal axis roughly along the membrane normal or surface orientation with the axis approximately in parallel to the membrane surface . The transition between the two configurations is associated with a high free energy barrier . Thus, for simulations in the membrane environment, each of the two configurations is used as the initial orientation for three independent simulations of 500 000 mc cycles . Simulations in water (i.e., without the membrane) are also carried out in three independent runs of 500 000 mc cycles each . We conducted mc simulations with 16 peptides of the walp and kalp series interacting with six membrane types of varying thicknesses . The results for walps, which are more commonly used in experiments and md simulations, are presented below (figure 2), and the results for kalps are presented in the supporting information (figure s1). Throughout the simulations, the peptides were, in essence, helical in both the aqueous and membrane environments (figure s2), which is anticipated for these peptides, composed mostly of ala and leu, two amino acids with high helix propensity . Mc simulations and comparison to the theoretical model . The results were obtained from mc simulations of eight walp peptides (table 1) interacting with membranes of six different types (table 2). The standard errors are marked; in many cases, the error bars are smaller than the symbols . (a) the dependence of the tilt angle on the hydrophobic mismatch . A tilt angle of 0 corresponds to a helix with its principal axis perpendicular to the membrane plane; a tilt angle of 90 corresponds to a helix with its principal axis parallel to the membrane plane . The inset shows the theoretical dependence of the tilt angle of walp21 on the hydrophobic mismatch (solid curve) in comparison to the values obtained from the mc simulations (triangles). (c) location of the flanking residues in the membrane vs hydrophobic mismatch . For clarity, the data for only three peptides are shown . Z is the shortest distance between the average position of the -carbon of the flanking residue and the boundary of the hydrocarbon region of the membrane . (d) correlation between the theoretically predicted tilt angles of walps and the values estimated from the mc simulations; theoretical_tilt = 0.97 mc_tilt + 0.6, r = 0.99 . The values based on the mc simulations were reproduced from a. figure 2a shows the dependence of the helix tilt angle on the hydrophobic mismatch . As anticipated, helices whose hydrophobic cores were longer than the membrane thickness were in tm orientation with their principal axes tilted with respect to the membrane normal . In cases of negative mismatch, the helices assumed a tilted tm orientation as well, provided that the difference between the length of the helical peptide and the thickness of the bilayer did not exceed approximately 10 . To accommodate helical peptides of greater negative mismatch in tm orientation, the membrane would be forced to deform beyond its elastic limit, which was not allowed in the simulations . Water interface as helices with their principal axes approximately parallel to the membrane surface (e.g., figure s3), in line with previous experimental studies . Within the boundaries of the elastic region of the membrane, the tilt angle decreased as the mismatch decreased, with a minimal value of 10 at a mismatch of 10 . We compared the tilt angles calculated in the mc simulations to the available data, obtained using various experimental techniques and md simulations . Results for walps are shown in table 3; table s1 shows results for kalps . Good agreement was observed in all cases, but it is noteworthy that in some cases the range of tilt values obtained in previous studies is rather large . In particular, the range of tilt values obtained in previous studies of walp23 in dmpc and dlpc membranes exceeds 20 (table 3). The method used is listed in parentheses . Where possible, the values are shown as average standard deviation . Besides helix tilting, an additional possible mechanism of adaptation to hydrophobic mismatch is stretching and contraction of the acyl chains of the lipids surrounding the peptides . We estimated the membrane adaptation as the average deviation of the thickness of the hydrocarbon core during the simulation from its initial value, deduced from x - ray studies of pure (peptide - free) lipid bilayers . For helical peptides that were too short to span the membrane and resided on the surface, the membrane thickness fluctuated around the initial native value, as it should . Interestingly, membrane thinning of up to 1 was detected also when the helix s hydrophobic core was up to 5 longer than the thickness of the hydrocarbon region of the membrane (figure 2b). Finally, helices with hydrophobic tm cores that were more than 5 longer than the membrane thickness caused the membrane to expand slightly to improve the fit to their long tm cores (figure 2b). Clearly, the changes in the membrane thickness upon incorporation of a tm helix are small and might appear to be negligible in view of the implicit and crude representation of the membrane in the model . However, the same pattern was repeatedly observed in simulations of various peptide - membrane systems, consolidating the observation . We inspected the membrane location of the trp (lys) residues at the edges of the hydrophobic core of each walp (kalp) peptide, namely, the residues in the third positions from the n- and from the c - termini of the peptides . Figures 2c and s1c show the average deviation of the -carbons of these residues from the nearest membrane boundary as a function of the hydrophobic mismatch . When the hydrophobic mismatch was strongly negative, the c of these residues remained at the membrane boundary . However, as the mismatch became less negative, the c position extended farther away from the boundary into the polar headgroup region . At a positive mismatch of around 5, the c positions of trp saturated at their maximal values of 3 (figure 2c) from the membrane boundary, and lys saturated at a value of 4 (figure s1c). Using figures 2c and s1c, we estimated peff, i.e., the length of the helix interacting with lipid chains, to be used in the theoretical model (table s3). Here, we develop a simple theoretical model as a closed - form expression to estimate the dependence of, the angle at which the principal axis of the tm helix tilts from the membrane normal, on the length of the hydrophobic core of the helix (p), on the effective length of the helix, i.e., the length of the helix portion that interacts with the lipid chains (peff, peff <p), and on the native (peptide - free) thickness of the hydrocarbon region of the membrane (l). First, we deal with the two limiting cases: helices that are substantially longer, or shorter, than the native thickness of the lipid bilayer . For (p l) 5, i.e., positive mismatch of 5 or more, the hydrophobic effect dominates, and is determined mostly by the tendency of the hydrophobic core of the helix to be buried in the hydrocarbon region of the membrane (figure 1a). Because of the low free energy penalty of membrane expansion, the membrane may slightly expand; indeed, our mc simulations showed that it expands by approximately 1 (figure 2b). In addition, the ends of the hydrophobic core of the helix extend out of the hydrocarbon region of the membrane such that only peff interacts with the lipids (figure 2c). The other limit addresses the case of large negative mismatch, i.e., when the hydrophobic core of the helix is substantially shorter than the hydrocarbon region of the membrane (figure 1c, lower right panel). In this case, the membrane would need to deform beyond its elastic range (20% of its native thickness) to accommodate the helix in tm orientation, which is energetically unfavorable . Thus, when peff is less than 80% of the membrane s native thickness, the helix resides in surface orientation, and = 90, i.e., when peff <0.8l, cos = 0 . L <5 and peff 0.8l . According to the mc simulations and previous calculations, tm helices tilt even at negative mismatch (figure 1c, lower left panel), in spite of the free energy penalty due to membrane deformation (gdef). The driving force for this is the free energy gain from the increase in precession entropy (ts). Here, we exploit the balance between these opposing contributions to derive an expression for . We make several assumptions . First, in accordance with the mc simulations, we assume that the peptide adopts, in essence, the same (helical) conformation regardless of the tilt angle, and that its internal energy (e) is independent of the tilt . Additionally, we assume that all residues are preserved in the same local environment, i.e., the hydrocarbon or headgroup region of the lipid bilayer or the aqueous phase . We also limit the possible changes in the thickness of the hydrophobic region of the membrane to up to 20% of its native value . Finally, we assume that helix librations in the membrane (maximum amplitude denoted as) are independent of the tilt (figure 3). Under these assumptions, eq 1 reduces to the free energy balance:2 the precession entropy gain associated with tm helix tilting in the membrane . (a) schematic illustration of the spherical surface area corresponding to the precession entropy of a hypothetical helix that spans the membrane vertically . Helix librations around the membrane normal, with a maximum amplitude of, generate rotational entropy that is proportional to the dark cap - like surface area . (b) the precession entropy of a helix, which is tilted at an angle from the normal, is larger (larger area). Assuming that is independent of, the rotational entropy of the tilted helix corresponds to the dark belt - like area . The helix is represented as a cylinder with the hydrophobic core in purple and hydrophilic termini in white . L is the native (peptide - free) width of the hydrocarbon region of the membrane . Peff is the length of the portion of the helix s hydrophobic core that spans the hydrocarbon region of the membrane . Figure 3 illustrates the precession entropy (s) of the helix in vertical vs tilted configurations; in each case, the entropy is proportional to the logarithm of the shaded area in the corresponding panel of the figure . This estimation of the precession entropy is somewhat different from the derivation of i m and lee . In particular, it includes the contribution of helix librations also in the vertical orientation . In the vertical configuration, the precession entropy is proportional to the surface area of a small sector of a sphere calculated as 2rh, where r = 1/2peff is the sphere s radius and h is the height of the small sector (figure 3a). The surface area of the sphere sector is 1/2peff(1 cos). For a helix tilted by, the entropy corresponds to a larger belt - like section of the same sphere (figure 3b). The surface area of the belt - like section is the difference between the areas of two sphere sectors, denoted, respectively, by 2r(1 using r = 1/2peff and one of the trigonometric identities, the area of the belt - like section can be written as peff sin sin . For negative mismatch, one has to compare between two alternative states: in the first state, the (short) tm helix is in vertical orientation, and the membrane thins to match its hydrophobic core (figure 4a, i). The precession entropy of this state corresponds to the area of the small sphere sector of figure 3a . In the alternative state, the helix tilts away from the normal, and the membrane thins further (figure 4a, ii). Here, the precession entropy is higher and corresponds to the area of the larger belt - like region in figure 3b . Substitution in eq 2 gives3where the left - hand side is associated with the precession entropy and the right - hand side with the membrane deformation . In eq 3, is a harmonic - force constant reflecting the membrane elasticity . For a cylinder of radius 5, approximating the helix, = 0.075 kt / . The derivation of eq 3 with respect to gives a simpler expression:4 derivation of the theoretical model . (a) two hypothetical configurations of the system at (small) negative mismatch: (i) the helix is in vertical orientation, and the membrane thins to match the helix s hydrophobic length . (ii) driven by the precession entropy gain, the helix tilts by from the normal, and the membrane thins further . (b) two alternative configurations of the system for (small) positive mismatch in the range of 05: (i) the helix is tilted by an angle from the membrane normal to match the native width of the hydrocarbon region of the membrane . (ii) driven by the precession entropy contribution, the tilt angle increases to (>), and the membrane slightly thins . The helix is represented by a cylinder, with the hydrophobic core in purple and the polar termini in white . The membrane normal is marked by the vertical dashed line; the helix s principal axis is marked by the solid line . The mc simulations indicated that the tilt is driven by the precession entropy also in cases of positive mismatch of up to about 5 . In this respect, this notion is based on the trends of membrane adaptation (figure 2b) and the location of the flanking hydrophilic residues relative to the membrane s hydrophobic core (figure 2c). In both cases, different patterns were observed for different degrees of mismatch, and the border between them was at a positive hydrophobic mismatch of approximately 5 rather than at a perfect match . Figure 4b shows two hypothetical helix - membrane configurations for a small positive hydrophobic mismatch in the range between 0 and 5 . In the first, the membrane retains its native thickness, and the helix tilts by an angle from the membrane normal to match the width of the hydrocarbon region of the membrane (figure 4b, i). In the alternative configuration, the membrane thins, and the tilt angle increases to its final value of (>) to facilitate the favorable increase in helix precession entropy (figure 4b, ii). Substitution in eq 2 gives5conveniently, the derivation of eq 5 with respect to leads to eq 4 . To summarize:6 equation 6 can be viewed as an equation of state of the helix in the lipid bilayer . To understand it better, we plotted as a function of, l, and peff in the physiologically relevant region of parameter space (figure 5). The tilt angle decreases with an increase in; i.e., the membrane rigidity limits the tilt, as anticipated . Additionally, the tilt angle increases with increases in peff and with decreases in l, as it should (figure 5a). To explore these relations further, we plotted as a function of peff / l at constant (figure 5b). This revealed a linear relation between and the peff - to - l ratio at constant peff l, with an increase in when the helix length decreases (and the membrane thins). The increased tilt for shorter helices (in thinner membranes) is due to the decrease in the perturbation to the lipid; the lipid chains are shorter . The theoretical tilt angles agree well with previous calculations and measurements (tables 3 and s1). To examine the equation of state further, we compared the results to mc simulations of various peptides within lipid bilayers over a broad range of hydrophobic mismatch scenarios . (a) the dependence of on peff and l, for three different values . The tilt angle () was calculated using the second line of eq 6 in the range 15 <peff <50 and 20 <l <40, using the appropriate limitations on l and peff (i.e., (p l) <5 and peff 0.8l). Clearly, the dependence of on is marginally weak . The dependence of on peff / l for = 0.075 kt / . The tilt angle increases with an increase in peff at the same l (symbols with the same color). Interestingly, there is a linear relation between and the peff - to - l ratio at constant (peff l). Figure 2a (inset) shows the good correlation between the theoretical model and mc simulations for the walp21 peptide in bilayers of various thicknesses, and figure 2d shows that the agreement extends throughout the walp series (correlation coefficient of 0.99, slope of about 1, and small intercept). Similar agreement was obtained also for the kalp series (figures s1a and s1d). Interestingly, in both cases, the minimal tilt angle was approximately 10, in agreement with previous calculations . In addition, we also studied gwalp23, a representative peptide from the newly introduced series of gwalp peptides, which feature a single trp residue at their termini (table 1). The tilt values obtained via the theoretical model correlated well with the mc simulations and available data (figure s4, table s2). We presented a theoretical derivation of an equation of state relating the tilt of a tm helix to the helix length and bilayer thickness . The equation of state (eq 6) was utilized to investigate 17 peptides of various lengths interacting with membranes of six different thicknesses, covering hydrophobic mismatch in the range of approximately 25, much broader than ranges used in previous studies . The tilt angles calculated using the theoretical model correlated well with our mc simulations and with data from previous experiments and calculations (tables 3 and s1). In this respect, it is important to note that the first nuclear magnetic resonance (nmr) studies in walp and kalp peptides reported very small tilt angles . However, more recent publications have shown that this is because the nmr experiments were interpreted using an overly simplified model of helix motion; interpretation of the same data using several dynamic models revealed larger tilt angles that are closer to those obtained in computational studies, including our theoretical model and mc simulations . The proper model for interpretation of the nmr data is debatable, but clearly the external helix motion in the membrane should be considered . The equation of state captures the thermodynamic determinants of tilting of all hydrophobic -helical peptides, regardless of their sequences . It provides a back - of - the - envelope estimate of the tilt angle of any arbitrary peptide, given the peptide s (effective hydrophobic) length and the membrane thickness . It could be useful for the design and interpretation of experiments, as well as for preparation of initial peptide - membrane conformations to be used, for instance, in mc or md simulations . This way, the initial configuration of the system should be close to its energetic minimum, which should facilitate rapid convergence . Although the theoretical tilt estimation agreed with the available data, one should keep in mind that the crude estimation has inherent limitations . The equation of state is based on the balance between the precession entropy and gdef, but other terms in eq 1 may also contribute . For instance, the helix may tilt even further, inserting the polar termini deeper into the membrane core, and the precession entropy may compensate for the associated desolvation penalty . In addition, the assumptions made to derive the theory clearly simplified the mechanisms affecting helix tilt . For instance, the model assumes that the internal energy (e) is independent of the tilt . In fact, at larger tilt angles, the side chains of the helix become more restrained, thus causing entropy reduction . Similarly, the assumption of the same helix librations in the vertical and tilted configurations is questionable . Moreover, the equation of state does not include possible specific peptide lipid interaction . Finally, the theoretical model assumes that the helix can be approximated by a perfectly symmetrical cylinder with no preference to any rotational angle around the principal axis . The results of the theoretical model and mc simulations are compatible with previous systematic studies of hydrophobic mismatch, performed using explicit md simulations and potential of mean force calculations . In particular, our simulations fully agree with previous calculations showing that the helix tilt from the membrane normal is at least 10, regardless of the extent of the hydrophobic mismatch . Regarding membrane adaptation, there are some discrepancies between the studies . I m and kim reported membrane thinning up to 7 and membrane thickening up to 5 . Kandasamy and larson, simulating kalp peptides, demonstrated membrane thinning of up to 6 and thickening of up to 3, values closer to our estimations (figures 2b and s1b), as well as to previous experimental assessments . Regardless of the exact values, the three studies agree that the magnitude of membrane - thinning is larger than that of thickening, as anticipated . Additionally, kandasamy and larson demonstrated that in kalps the lysine side chains extend further into the lipid polar headgroup region as the hydrophobic mismatch increases . We observed a similar effect in the flanking trp residues in walps (figure 2c) and in the flanking lys residues in kalps (figure s1c). Kandasamy and larson attributed this phenomenon to specific interactions between the lipids phosphate oxygen atoms and ammonium groups of the flanking lys side chains . Peptide interactions in the balance between precession entropy gain and free energy penalty driving the tm helix tilt; they did not demonstrate the exact nature of these interactions . In contrast, our theoretical model is based on the balance between the precession entropy and nonspecific helix lipid interactions . Peptide interactions are also not taken into account in our mc simulations, and yet the results of both the theoretical model and simulations agree well with experimental data . Peptide interactions play only a secondary role, at least for the walp / kalp / gwalp peptides . The theoretical model, derived from the mc simulations, showed that if the effective length of the helix is shorter than the minimal thickness of the bilayer, the helix resides at the water membrane interface . Clearly, the situation is slightly more complicated than this . A surface configuration of a hydrophobic helix such as a walp or kalp is energetically favorable irrespective of the hydrophobic mismatch . In contrast, the free energy of membrane association of a helix in tm configuration depends on the hydrophobic mismatch (figure s3). Therefore, regardless of the hydrophobic mismatch, the peptide partitions between the two configurations, and the partition ratio depends on the free energy of the two states . A similar trend was demonstrated for polyleucine peptides, either ln or ggpg - ln - gpgg, where n is the number of leu residues, as well as for peptides with the sequence of the form kk-(la)n - kk . In both walps and kalps, the helices surface and tm configurations differ from each other in their helical content . In contrast, the surface configuration has lower helical content with decreased helicity in the helix core (figure s2). This is because formation of a perfect -helix in the surface configuration involves insertion of the polar trp or lys side chains and helix termini into the membrane core, which is energetically unfavorable . This is in agreement with the all - atom molecular dynamics simulations of ulmschneider and colleagues . It has been suggested that walps tilt to a larger degree compared with kalps of similar length, since trp residues partition deeper into the headgroup region than do lys residues . This proposition is guided by the difference in the free energy penalty of transfer of trp and lys from the aqueous phase into the membrane (1.3 versus 7.4 kcal / mol in the hydrophobicity scale used here). The transfer free energy difference is not taken into account explicitly in the theoretical model, but it is considered implicitly since it affects the effective hydrophobic length of the helix peff (table s3). Application of a paired t - test to the mc simulations showed that the tilt angles of the walps were larger than those of the kalps at a confidence level of 0.95 . However, the average difference was only 2.8, which is probably below the resolution of the mc model because of the use of a reduced representation for the peptide . Following previous works on tilting under hydrophobic mismatch conditions, we demonstrated that precession entropy can contribute to the tilting of tm helices under conditions of perfect match and negative mismatch, despite the unavoidable membrane deformation . We utilized the energy balance between the precession entropy s and free energy of membrane deformation gdef to derive an equation of state describing the dependence of the tilt on the helix length and membrane thickness . The theoretical tilt values are similar to measurements, previous md simulations, and our mc simulations . Thus, the equation of state can be used for a quick estimation of the helix tilt . Notably, our simple theoretical model managed to reproduce the tilt angles observed for 17 different peptides in membranes of various thicknesses . This supports the model s underlying assumption, namely, that the tilt is determined by the free energy balance between the helix precession entropy and lipid perturbation . However, one should take into account that the 17 peptides are synthetic and very similar to each other . It may well be that in reality more free energy contributions should be taken into account.
|
Various -glucans have been extracted from various sources such as fungi, baker's yeast, barley, oats, and seaweed . The physicochemical properties of -glucans differ depending on characteristics of their primary structure, including linkage type, degree of branching, molecular weight, and conformation (e.g., triple helix, single helix, and random coil structures) [1, 2]. -glucans extracted from barley, which mainly contains -(1,3 - 1,4)-d - glucan, have been demonstrated to reduce blood lipid levels, including cholesterol and triglyceride levels [35]. The mechanisms by which -glucans reduce blood lipid levels have been shown to include prevention of cholesterol reabsorption by adsorption, elimination of bile acid by adsorption, an increase in bile acid synthesis, and suppression of hepatic cholesterol biosynthesis by short - chain fatty acids produced by fermentation with intestinal bacteria [68]. Claims that barley products reduce the danger of coronary heart disease have been endorsed by the food and drug administration of the united states . In addition, -glucans extracted from barley have also been reported to possess various other biologic activities, for example, reducing blood glucose level, enhancing insulin response, protecting against stress ulcers, and restraining allergic reactions . Furthermore, -glucans extracted from barley have been used in health products as a diet food, because glucan is a dietary fiber . Thus, -glucans extracted from barley have been used extensively as supplements and food additives . Whole grain products are recommended for healthy diets, as they are recognized sources of dietary fiber . Furthermore, ragaee et al . Demonstrated the antioxidant activity of various cereals such as barley, millet, rye, and sorghum . Oxidative stress is considered one of the primary causal factors for aging and various diseases such as arteriosclerosis, cardiovascular disease, cerebral diseases, diabetes, inflammatory diseases, and cancer [14, 15]. It is thought that scavenging of reactive oxygen species (ros) is important for the prevention of these diseases . If it were to be shown that -glucan, a natural component of grain, exerts antioxidant activity, the utility of -glucan as a polymeric excipient for supplement or food additive would increase further . Therefore, the aim of the present study was to examine the antioxidant activity of -glucan to assess potential new health benefits associated with -glucan as a polymeric excipient for supplement and food additive . The effects of the extraction source, extraction method, and molecular size of -glucan on antioxidant activity were also investigated . Furthermore, the antioxidant activity of -glucan was compared with that of polymers that are commonly used as food additives . -glucans extracted from barley using different extraction methods and of different molecular sizes, contained more than 70% -(1,3 - 1,4)-d - glucan (figure 1(a)), and -glucan isolated from black yeast (aureobasidium pullulans), which contained more than 85% -(1,3 - 1,6)- d - glucan (figure 1(b)), were donated by adeka co. (tokyo, japan). -glucan extracted from oats, with an unknown composition, was purchased from megazyme international ireland ltd . Gelatin, pectin from apple, pectin from citrus, curdlan, gellan gum, and xanthan gum were purchased from wako pure chemical industrial ltd . Concentrations of 0.52.0 w / v% of -glucans or other polymers were prepared by dissolving the molecules in ion - exchanged water . Chitosan was dissolved in 0.1 m acetate buffer solution (ph 4.5), because chitosan did not dissolve in ion - exchanged water . Antioxidant activity against hydroxyl radicals in the solution was determined using a radical catch kit (aloka co. ltd ., the kit measures the amount of hydroxyl radicals generated by the fenton reaction with hydrogen peroxide catalyzed by cobalt using luminol luminescence . Briefly, 50 l of cobalt chloride reagent, 50 l of luminal reagent, and 20 l of sample solution were mixed, and, after preincubation at 37c for 5 min, 50 l of hydrogen peroxide reagent was added . The amount of luminescence generated from 80 seconds to 120 seconds after the addition of hydrogen peroxide reagent was detected with a luminescence reader (accuflex lumi 400; alola co. ltd ., was estimated using the following equation: (1)radical scavenge (%) = amount of hydroxy radical scavengedamount of hydroxy radical generated100 . As shown in figure 2, the hydroxyl radical scavenging activity of -glucan differed between different sources of -glucan . In particular, -glucan extracted from barley showed the strongest hydroxyl radical scavenging activity . On the other hand, the hydroxyl radical scavenging activity of -glucans extracted from black yeast or oats was fairly low . Furthermore, 0.1 w / v% of -glucan extracted from barley scavenged approximately 60% of the hydroxyl radicals in the system, and the hydroxyl radical scavenging activity of the -glucan increased gradually with an increase in -glucan concentration (figure 3). -glucans extracted from both barley or oats were found to comprise mainly -(1,3 - 1,4)-d - glucan (figure 1(a)). On the other hand, -glucan extracted from black yeast comprised mainly -(1,3 - 1,6)-d - glucan (figure 1(b)). In addition to these differences in linkage type, the properties of -glucans are influenced by the degree of branching, molecular weight, and conformation [1, 2]. Although the mechanisms by which -glucan scavenges hydroxyl radicals are not yet clarified, the different structures of -glucan, which may be associated with the source and extraction method of obtaining -glucan, may influence antioxidant activity . First, the barley was crushed and then extracted under neutral, acidic (50 mm citrate buffer aqueous solution (ph 4.0)), or alkaline (50 mm carbonate buffer aqueous solution (ph 9.0)) conditions with warm water at 50c . After solid - liquid separation, the liquid phase was condensed . The hydroxyl radical scavenging activity of -glucan extracted from barley using the different extraction methods is shown in figure 4 . The hydroxyl radical scavenging activity of -glucans extracted under an acid condition or an alkali condition was slightly higher compared with that when -glucans were extracted under a neutral condition with warm water . The -glucans extracted from barley used in this study comprised more than 70% -(1,3 - 1,4)-d - glucan, but also contained other components (i.e., proteins, lipids, saccharides, and dietary fiber). The hydroxyl radical scavenging activity of almost pure -(1,3 - 1,4)-d - glucan, which was obtained by repeated recrystallization of -glucan extracted under neutral conditions with warm water (50c), was 43 1% . Although the possibility that other components contributed to the radical scavenging activity of -glucan cannot be completely ruled out, this finding shows that the greater part of the hydroxyl radical scavenging activity was caused by -(1,3 - 1,4)-d - glucan . However, -glucan extract is generally used without further refinement for supplements or food additives . These findings demonstrate that -glucans extracted using a variety of extraction methods, from acidic to alkaline conditions, have high radical scavenging activity . The molecular weight of -glucan extracted from barley with warm water is 40,000100,000 da; the oligomer prepared from the macromolecule -glucan by enzymatic degradation with lichenase has a molecular weight of approximately 2,000 da (as described by the manufacturer (adeka co., tokyo, japan)). As shown in figure 5, the hydroxyl radical scavenging activity of -glucan was reduced with a decrease in molecular size . However, antioxidant activity was reduced only by about half, even when molecular weight was reduced by about 1/201/50 . This finding indicates that -glucan exerts hydroxyl radical scavenging activity across a wide range of molecular sizes . The hydroxyl radical scavenging activity of various polymers was determined and compared with that of -glucan . In this experiment, the hydroxyl radical scavenging activity of 1% xanthan gum could not be determined due to its high viscosity; therefore, 0.5% was used . As shown in figure 6, pectin from apple or citrus, chitosan, and xanthan gum showed hydroxyl radical scavenging activity . However, the hydroxyl radical scavenging activity of each of these polymers, which are used as food additives, was inferior to that of -glucan extracted from barley . The polymers pullulan, dextrin, and curdlan, which are copolymers of glucose, were also assessed . Pullulan is a linear -1,4: 1,6-d - glucan consisting predominantly of repeating maltotrioses (consisting of 3 d - glucose molecules linked with -1,4 glycosidic bonds) linked by -1,6-glucosidic bonds . Dextrin is also a -1,4-d - glucan or -1,6-d - glucan, whereas curdlan is a linear -1,3-d - glucan consisting of -(1,3)-linked d - glucose residue . Hydroxyl radical scavenging activity was not observed for curdlan, though curdlan is a -glucan; further, no antioxidative activity was observed for pullulan or dextrin . This finding indicates that the hydroxyl radical scavenging activity of -glucan is affected by the primary structure of the molecule, including linkage type, degree of branching, molecular weight, and conformation . Hydroxyl radicals have the strongest reactivity and oxidation power among ros . The ability to scavenge ros is a precious property for the prevention of various diseases and aging . In this study, it was shown that -glucan extracted from barley exerts significant antioxidant activity, in addition to the various biologic activities previously described . The amount of antioxidant activity of -glucan was influenced by the different physiologic properties (e.g., structure and molecular size) of -glucan, which varied depending on the source and extraction method used . Furthermore, the hydroxyl scavenging activity of -glucan was significantly higher than that of various polymers that are used as food additives . These results indicate that -glucan has promise as a polymeric excipient for supplement and food additive with antioxidant and other benefits, which may contribute to enhancing health and beauty.
|
Efforts have been ongoing in many countries to develop integrated ecosystem - based assessments using physical chemical properties, biological abundance and diversity, and/or chemical characterisation to define the ecological quality of aquatic environments . (2008) was produced after the international meeting, ecosummit 2007ecological complexity and sustainability, with representation from africa, asia, australia, europe and north america . This publication discusses the regulations produced in some countries to protect and/or restore marine ecosystems, and the need for early warning behavioural endpoints are the subject of the present review and help address this need . As pointed out by the above authors, in the usa, the national oceanic and atmospheric administration s (noaa) national status and trends programme responds to the requirements of the clean water act with the mussel watch project, bioeffects assessments and the national estuarine eutrophication assessment / assessment of estuarine trophic status . The ecological condition and impact of humans on estuaries is investigated by the environmental protection agency (epa) and noaa . There is also a national coastal assessment program and regional results on coastal habitat, benthic, fish tissue contaminants, water quality and sediment indices . In the european union, several directives were adopted over time to protect estuaries and coasts (borja et al . The environmental quality standards rely on the concentrations of contaminants as quality objectives for comparing the state of sites . In some cases, contaminants concentrations in sediment are considered in conjunction with biomonitoring (borja et al . 2004, 2006; crane 2003). The ecological integrity is judged using water or sediment in toxicity tests . In other cases, contaminants concentrations are used to assess the ecological status of a location (rodrguez et al . Detailed descriptions of analytical approaches, targeted xenobiotics (i.e. Polycyclic aromatic hydrocarbons (pah), polychlorinated biphenyls (pcb), mercury (hg), cadmium (cd), lead (pb) and polybrominated diphenylethers pbde) and background concentrations expected to be reached by 2020 can be found on web - based oslo and paris convention for the protection of the marine environment of the north east atlantic (ospar) documents published in the past few years (e.g. Roose and brinkman 2005; allan et al . Borja and dauer (2008) describe the four corners of environmental quality assessment as: (1) assessing ecological integrity, (2) evaluating if significant ecological degradation has occurred, (3) identifying the spatial extent and location of ecological degradation and (4) determining causes of unacceptable degradation in order to guide management actions . The identification of cause represents a major issue that has been addressed in toxicity identification evaluation (tie) or in effects evaluation analysis studies . (2007) provide a wealth of references on this aspect of risk assessment and outline the critical role played by chemical analyses . The importance of chemical analyses is also apparent in the work described in a large section of the present manuscript (section 7). Toxicology studies aim to determine whether harmful substances are affecting the health of organisms and to assess the state of an ecosystem . Ideally, these assessment tools should promote the sustainability of ecosystems and pinpoint early symptoms of exposure in order to stop the progression of environmental degradation whilst conditions are still reversible . This protection can be accomplished if causes associated with effects are both quantifiable and can be used to generate preventive guidelines . The guidelines should be protective of as many species as possible and should be flexible to ensure the generation of new data that would provide maximum protection (ospar 2002). The steps needed to investigate and validate an approach used in toxicity assessment have been outlined by atema et al . The authors identified a sequence of research efforts when describing their studies regarding the behaviour of lobsters exposed to oil . The four aspects of the required knowledge were outlined as: (1) an ecological background on the studied animals, (2) investigations of effective test methodologies, (3) defining the detailed experimental conditions that will lead to obtaining the best response data and (4) field measurements to confirm the laboratory results . The choice of species also requires consideration, though in that study lobster was selected because of its economic importance at the contaminated site (section 6.2). When toxicity tests are viewed within a legal context as needed to implement regulations, they are also accepted based on the ease and expense of performing them, the acquisition of irrefutable proof of harm and financial implications of the lost or threatened resource . Perhaps for those reasons, environmental risk assessment initially focused on a simple and straightforward endpoint, lethality or survival (lc50 representing the lethal concentration to 50% of a population) and alternatively narcosis . Narcosis induced by non - ionic lipophilic organic contaminants correlates with a body burden of 28 mol / g, with some variability due to the lipid content of the studied species (mccarty and mackay 1993). Over time, additional population level effects, growth and reproduction have become accepted in toxicity tests and adopted in the regulatory process . Lethality, growth and reproduction are meant to reflect the outcome of chronic field exposure at the population level of complexity . Behaviour is slowly gaining more recognition due to its 101,000 times higher sensitivity than the conventional lc50 (hellou et al . Behaviour is an organism - level effect defined as the action, reaction or functioning of a system under a set of specific circumstances . It results from the integration of conditions to which organisms are exposed and represents an acute cumulative effect . Behavioural endpoints can consist of a variety of activities (table 1; clotfelter et al . 2004) that could be potentially ranked according to the time leading to the response or the relativity of the early warning . E1: rapid response that would be expected as immediately protectivee2: a sign of an impact that is less immediate than e1 and can progress furthere3: behaviour after longer exposure with worse expected consequencestable 1potential behavioural responses elicited by the exposure of a species to contaminantsresponseexample of rankingavoidance / escapee1balance, righting abilitye2burrowingfear responsefeedinglocomotione3mating, courtship responsememory learningnesting, offspring protectionrespiratione3risk takingranking illustrates the response of i. obsoleta to harbour sediments (section 7), where e1 precedes e2 which in turn precedes e3 e1: rapid response that would be expected as immediately protective e2: a sign of an impact that is less immediate than e1 and can progress further e3: behaviour after longer exposure with worse expected consequences potential behavioural responses elicited by the exposure of a species to contaminants ranking illustrates the response of i. obsoleta to harbour sediments (section 7), where e1 precedes e2 which in turn precedes e3 table 1 outlines a variety of available behavioural endpoints and provides a ranking of the behavioural response observed in snails, ilyanassa obsoleta (section 7.4). Ranking can change relative to the species under consideration . For example, in the case of fiddler crabs exposed to tributyltin (weis and perlmutter 1987), escape was not displayed and therefore burrowing would represent e1 and can lead to changes in mating (e2) and therefore on the reproductive success (e3, section 6.1). The faster effect, e1, such as avoidance or escape can be viewed as a sign displayed readily by organisms as a defence mechanism that reflects a first signal before succumbing to less rapid e2 symptoms and to potentially an e3 response after longer duration with more detrimental effects (table 1). This ranking or time relationship between different behavioural symptoms is further described in section 6 . Many studies propose what the laboratory observations indicate about long - term effects in the field . The importance of relating acute toxic effects to those detected in chronic exposures is well recognised and emphasised in a recent publication (solomon et al . Interrelating short - term and long - term effects is a goal that should be widely supported . (2010) propose the development of a comprehensive multilevel toxicity testing approach using the amphipods gammarus spp . And discuss behavioural studies in that context . If toxicity research is based on ecological studies and chemical data, then the measured changes obtained from laboratory exposures could be applied more readily to interpret field studies . The latter approaches have adopted the concept of sediment quality (long and chapman 1985) in which the abundance and diversity of a benthic community, priority pollutants in sediments and lab - based toxicity tests are measured to assess the quality of contaminated sites . Results of triad studies can be challenging to interpret, and numerous recommendations have been made to improve this approach as could be needed (chapman and hollert 2006). For example, difficulties can be related to the choice of an appropriate reference site mimicking the habitat of the contaminated one, to making a link between the presence and bioavailability of contaminants to associate a cause to toxic effects, or to questioning the ecological relevance of the commonly used survival tests . Investigating the body burden of an impacted organism could offer an additional tier to add or consider relative to the original triad studies (section 7). Early studies involving the response of fish to the presence of metals, surfactants, pesticides as well as other chemicals such as ph or chlorine were reviewed by hara (1973, 1982, 1994, 2006). The discussion was directed to chemoreception with an emphasis on the senses of smell and taste . A phenomenal amount of studies on the behaviour of fish and the physiological aspects of the response of olfactory and gustatory cells using natural and anthropogenic chemicals were used in this groups work . (1987), placing levels inducing avoidance side by side with those associated with conventional toxicity tests . Although that review is more than two decades old, it was already pointed out that avoidance was not predicted by, and more sensitive than survival, growth or reproduction endpoints but that further lab tests could help predict observations in the field . (1965) demonstrated that levels associated with escape were lower in the lab than in the field (2.3 vs 1721 g / l) when testing the response of salmon to copper (cu), but the small difference was understandable in view of the wider context of the environmental variables . A book co - authored by many specialists covered numerous topics within behavioural ecotoxicology (dellomo 2002), including aquatic and terrestrial species, a variety of chemicals, modes of action, as well as case studies . The importance of using behaviour in site - specific environmental assessments as applied under various us regulations, such as the clean water act, natural resource damage assessments and oil pollution act was the topic of a chapter by little (2002) who suggested a role for behavioural ecotoxicology in determining the restoration of sites with a focus on resident species . Little (2002) encouraged the development of telemetry for field assessments and the production of well - defined methodologies such as those outlined by the american society of testing and materials . These additional tools would help in the adoption of behavioural toxicology in investigations . Pinpointing the mechanism of action of a toxic response would help in understanding, diagnosing, quantifying and perhaps predicting effects . In their review of behaviour relative to exposure to endocrine disruptors (edr), including the effect of legacy chemicals such as the well - known ddt and pcb, zala (2004) described the link between the central nervous system, symptoms of behavioural modifications and endocrine disruption . The mechanism of action for different chemicals and animals including birds, mice, monkeys and rats was discussed when known, such as being associated with an oestrogen receptor, androgen receptor or altered hormone metabolism . Defining the mechanism of action to understand toxicity has been recommended by many work groups, including one from an epa workshop on edr (kavlock et al . 1997), and it is now well recognised that the sensitivity of behavioural responses varies with species and age along with the intensity, frequency, duration and timing of the exposure . The literature is in fairly good agreement that behavioural ecotoxicology is developing sensitive tools to investigate toxic effects and that behaviour results from the integration of complex biochemical and physiological processes . As well, that these studies can be especially useful when encompassing a range of toxic endpoints, since results are not always predictable when trying to apply knowledge gained with one species to another one or between chemicals . Copper can be produced from mining, antifouling paints, as a fungicide, wood preservative and in vehicle brake pads . In crabs, exposure to cu can cause a series of deleterious outcomes starting with escape (hebel et al . 1997) and progresses to a reduction in feeding and possibly sex hormones, then changes in cardiac function and respiration followed by cellular damage leading to death . When examined together, this succession of toxic endpoints would demonstrate the importance of escape behaviour as an early warning signal and the link to population - level effects . In fish, escape was most sensitive and associated with 0.16.3 g / l of cu that varied with ph (7.38.4; atchinson et al . 1987). Ventilation and coughing were detected at higher exposure levels (948 g / l) of cu . In chronic exposures, the lowest observed effects concentration associated with cu and different fish species was in the same range of concentrations as the latter symptoms (1740 g / l). As would be expected in shorter 96-h exposures, higher doses of cu were detrimental (751,000 g was performed on two species of trout in relation to a superfund site associated with an acid mine system with cu, cd, pb and zn (hansen et al . 1999). These four metals were present at a consistent ratio in the river, and exposures were performed to examine the behaviour of fish since the abundance of four species, including rainbow trout, had decreased between 1979 and 1983 from 1,200 to 25 trout per kilometre downstream from the mine . Rainbow trout avoided the four metals mixture at 101,000% of concentrations detected in the river, with complete avoidance at the 50% level . In comparison, brown trout were less affected at the same tested concentrations and displayed a u - shaped response, indicating less susceptibility to avoiding exposure . This study demonstrated that rainbow trout were more sensitive to the presence of these metals than brown trout and that the escape response provided a powerful explanation for the species distribution in the river . The influence of the range of ph associated with precipitation and of fish acclimation times were considered in the experiments and did not affect the interpretation of results . As well, the authors pointed out that damage to the chemoreception neurons was not observed and could not explain the avoidance . In contrast to cu, mercury at 0.2 g / l induced attraction in fish, whereas avoidance of iron was initiated at 4,250 g / l (atchinson et al . This portrays the complexity of a field situation in which it would be impossible to make a conclusion regarding cause, if only behaviour is examined as an endpoint . Measures of chemicals in the field and as residues in species of concern would be decisive in interpreting effects, with a laboratory component needed to validate the observed response (hecker and hollert 2009). The latter aspect of body burden would provide support for bioavailability (section 7). Tributyltin is an organometallic compound commonly used in the past as an antifouling in paints . Weis and perlmutter (1987) investigated its effects on the escape, burrowing and righting ability of crabs exposed for 1, 2 and 3 weeks to sand spiked at three concentrations . Escape from contamination was not observed for any treatment, but burrowing behaviour increased in males and decreased in females . Females righting ability also increased relative to control in all exposures and at each period in time . Males did not display this behavioural change, but their limb regeneration was reported to be affected, with more deformities reported in a different study (weis et al . Fiddler crab burrowing was also impacted by exposure to other contaminants, and this behaviour is important in hiding from predators, for mating and moulting (weis and perlmutter 1987). They were undertaken because of a spill that took place in narragansett bay, massachusetts, where lobster fisheries have been of paramount importance . The work investigated changes in behaviour and chemoreception in animals exposed to the water - soluble fraction of the oil . 1982) outlined the behavioural endpoints that were shown to be caused by oil exposure . They included changes in feeding, growth, the search for a mate, loss of equilibrium and coordination, reproduction and reaction towards predators, each obviously leading to population decline . In a study by lee et al . (1981), nesting behaviour and lipid content of a marine amphipod, amphitoe valida, were tested during a 6-day exposure and over variable depuration times . Nesting ability was examined every day relative to exposure dose and decreased over time and with higher exposure to water - soluble oil (525%). Lipid content of the animals did not vary at the end of 6 days of exposure, except for the higher dose, but decreases were apparent after 4 and 5 weeks of recovery . During the uptake period, survival was similar between control and exposed amphipods . However, survival decreased steadily with exposure level during the additional day of recovery . The above demonstrated the importance of investigating effects during and post - exposure, along with the sensitivity of behaviour relative to the more common survival endpoint . Concern with emerging contaminants (ec) such as pharmaceuticals and personal care products arose from field and then lab studies that associated endocrine disruption (ed) with the presence of a female hormone, 17-estradiol and the active ingredient in the birth control pill, 17-ethynylestradiol in uk estuaries (ternes and siegriest 2004). Very few behavioural studies with aquatic species have used pharmaceuticals or other ec, a class of chemicals with diverse structures that have been analysed most often in influents and effluents of sewage treatment plants, with detected levels of most of these compounds commonly in the nanogram per litre range, but with some exceptions up to 1 g / l (fent et al . Endpoints of feeding, ventilation and locomotion were studied using three pharmaceuticals, an anti - epileptic carbamazepine, a non - steroidal anti - inflammatory, ibuprofen and an antidepressant acting as a serotonin reuptake inhibitor, fluoxetine (de lange et al . Changes in feeding were detected in freshwater amphipods at low exposure, whilst increased ventilation was apparent in some cases at 1100 ng / l and increased locomotion at doses reaching up to 10 ng / l (de lange et al . (2009) studied predator avoidance behaviour of larval fish exposed to four antidepressants including fluoxetine . These compounds target brain neurotransmitters, and a close relationship exists between mammals and teleosts . There was reduced avoidance displayed by larval fish exposed to the mixture of four compounds regardless of a variety of combinations of exposure levels . A lack of escape would limit survival and future reproductive success, leading to diminished fish populations . Another study involving the active ingredient of the birth control pill spiked at an environmentally relevant concentration of 15 ng / l examined the nesting behaviour of three - spinned stickleback (bell 2001). This behaviour contrasted with control that increased aggressiveness with time, and the latter was previously associated with reproductive success and the fitness of males . The level of male and female hormones in plasma of fish was also measured, and a discussion of the effect of the hormone - mimicking chemical on the endogenous natural products was proposed as leading to changes in behaviour . The environmentally realistic level of exposure tested with the most potent ed indicated toxic effects in a small fish used in biomonitoring (bell 2001). The sensitivity of early stages of development was indicated when testing antidepressants (painter et al . More studies need to be pursued using ec at the concentrations expected in the field and to determine if e1 type symptoms would be protective of species important to a site receiving sewage effluents or a remediated site . Tie type approaches would be valuable in providing a better understanding of the role of ec and edr present in complex environmental mixtures, as might be needed for better specific remediation . Copper can be produced from mining, antifouling paints, as a fungicide, wood preservative and in vehicle brake pads . In crabs, exposure to cu can cause a series of deleterious outcomes starting with escape (hebel et al . 1997) and progresses to a reduction in feeding and possibly sex hormones, then changes in cardiac function and respiration followed by cellular damage leading to death . When examined together, this succession of toxic endpoints would demonstrate the importance of escape behaviour as an early warning signal and the link to population - level effects . In fish, escape was most sensitive and associated with 0.16.3 g / l of cu that varied with ph (7.38.4; atchinson et al . 1987). Ventilation and coughing were detected at higher exposure levels (948 g / l) of cu . In chronic exposures, the lowest observed effects concentration associated with cu and different fish species was in the same range of concentrations as the latter symptoms (1740 g / l). As would be expected in shorter 96-h exposures, higher doses of cu were detrimental (751,000 g was performed on two species of trout in relation to a superfund site associated with an acid mine system with cu, cd, pb and zn (hansen et al . 1999). These four metals were present at a consistent ratio in the river, and exposures were performed to examine the behaviour of fish since the abundance of four species, including rainbow trout, had decreased between 1979 and 1983 from 1,200 to 25 trout per kilometre downstream from the mine . Rainbow trout avoided the four metals mixture at 101,000% of concentrations detected in the river, with complete avoidance at the 50% level . In comparison, brown trout were less affected at the same tested concentrations and displayed a u - shaped response, indicating less susceptibility to avoiding exposure . This study demonstrated that rainbow trout were more sensitive to the presence of these metals than brown trout and that the escape response provided a powerful explanation for the species distribution in the river . The influence of the range of ph associated with precipitation and of fish acclimation times were considered in the experiments and did not affect the interpretation of results . As well, the authors pointed out that damage to the chemoreception neurons was not observed and could not explain the avoidance . In contrast to cu, mercury at 0.2 g / l induced attraction in fish, whereas avoidance of iron was initiated at 4,250 g / l (atchinson et al . This portrays the complexity of a field situation in which it would be impossible to make a conclusion regarding cause, if only behaviour is examined as an endpoint . Measures of chemicals in the field and as residues in species of concern would be decisive in interpreting effects, with a laboratory component needed to validate the observed response (hecker and hollert 2009). The latter aspect of body burden would provide support for bioavailability (section 7). Tributyltin is an organometallic compound commonly used in the past as an antifouling in paints . Weis and perlmutter (1987) investigated its effects on the escape, burrowing and righting ability of crabs exposed for 1, 2 and 3 weeks to sand spiked at three concentrations . Escape from contamination was not observed for any treatment, but burrowing behaviour increased in males and decreased in females . Females righting ability also increased relative to control in all exposures and at each period in time . Males did not display this behavioural change, but their limb regeneration was reported to be affected, with more deformities reported in a different study (weis et al . Fiddler crab burrowing was also impacted by exposure to other contaminants, and this behaviour is important in hiding from predators, for mating and moulting (weis and perlmutter 1987). 2 fuel oil . They were undertaken because of a spill that took place in narragansett bay, massachusetts, where lobster fisheries have been of paramount importance . The work investigated changes in behaviour and chemoreception in animals exposed to the water - soluble fraction of the oil . 1982) outlined the behavioural endpoints that were shown to be caused by oil exposure . They included changes in feeding, growth, the search for a mate, loss of equilibrium and coordination, reproduction and reaction towards predators, each obviously leading to population decline . In a study by lee et al . (1981), nesting behaviour and lipid content of a marine amphipod, amphitoe valida, were tested during a 6-day exposure and over variable depuration times . Nesting ability was examined every day relative to exposure dose and decreased over time and with higher exposure to water - soluble oil (525%). Lipid content of the animals did not vary at the end of 6 days of exposure, except for the higher dose, but decreases were apparent after 4 and 5 weeks of recovery . During the uptake period, survival was similar between control and exposed amphipods . However, survival decreased steadily with exposure level during the additional day of recovery . The above demonstrated the importance of investigating effects during and post - exposure, along with the sensitivity of behaviour relative to the more common survival endpoint . Concern with emerging contaminants (ec) such as pharmaceuticals and personal care products arose from field and then lab studies that associated endocrine disruption (ed) with the presence of a female hormone, 17-estradiol and the active ingredient in the birth control pill, 17-ethynylestradiol in uk estuaries (ternes and siegriest 2004). Very few behavioural studies with aquatic species have used pharmaceuticals or other ec, a class of chemicals with diverse structures that have been analysed most often in influents and effluents of sewage treatment plants, with detected levels of most of these compounds commonly in the nanogram per litre range, but with some exceptions up to 1 g / l (fent et al . Endpoints of feeding, ventilation and locomotion were studied using three pharmaceuticals, an anti - epileptic carbamazepine, a non - steroidal anti - inflammatory, ibuprofen and an antidepressant acting as a serotonin reuptake inhibitor, fluoxetine (de lange et al . Changes in feeding were detected in freshwater amphipods at low exposure, whilst increased ventilation was apparent in some cases at 1100 ng / l and increased locomotion at doses reaching up to 10 ng / (2009) studied predator avoidance behaviour of larval fish exposed to four antidepressants including fluoxetine . These compounds target brain neurotransmitters, and a close relationship exists between mammals and teleosts . There was reduced avoidance displayed by larval fish exposed to the mixture of four compounds regardless of a variety of combinations of exposure levels . A lack of escape would limit survival and future reproductive success, leading to diminished fish populations . Another study involving the active ingredient of the birth control pill spiked at an environmentally relevant concentration of 15 ng / l examined the nesting behaviour of three - spinned stickleback (bell 2001). This behaviour contrasted with control that increased aggressiveness with time, and the latter was previously associated with reproductive success and the fitness of males . The level of male and female hormones in plasma of fish was also measured, and a discussion of the effect of the hormone - mimicking chemical on the endogenous natural products was proposed as leading to changes in behaviour . The above examples on ec are representative of the available data . The environmentally realistic level of exposure tested with the most potent ed indicated toxic effects in a small fish used in biomonitoring (bell 2001). The sensitivity of early stages of development was indicated when testing antidepressants (painter et al . More studies need to be pursued using ec at the concentrations expected in the field and to determine if e1 type symptoms would be protective of species important to a site receiving sewage effluents or a remediated site . Tie type approaches would be valuable in providing a better understanding of the role of ec and edr present in complex environmental mixtures, as might be needed for better specific remediation . The importance of choosing experimental species relevant to the food web and that can be used in field investigations is an important consideration in designing studies . The mud shrimp, corophium volutator, and mud snail, i. obsoleta, play an important role in the bay of fundy, nova scotia, canada, an area within the gulf of maine with relatively pristine intertidal beaches away from urbanisation . These amphipods have been the subject of ecological and toxicological investigations, whilst the snails are abundant at the same locations, therefore worthy of intercomparison for application in studies of the abundance of a benthic community . These two invertebrates are preyed on by sand pipers, grey whales, tomcod, winter flounder, snow crab and other fish . These two species were used in our behavioural research interrelating toxicity and chemistry (escher and hermens 2002; barron et al . (1999) provided the background for the approach adopted testing harbour sediments . When the amphipods eohaustorius estuaries were offered two choices of sediments, the one containing pah was avoided over a 2- or 3-day exposure period . (2001) examining the link between acute tests measuring lc50 and the composition of marine benthic communities reported no decrease in the abundance of polychaetes and molluscs to concord with a decrease in survival of amphipods . However, the abundance of arthropods, crustaceans and amphipods were in agreement with the toxicity tests . Halifax harbour sediments were devoid of amphipods, with the odd worm detected in grabs, but mussels were abundant and few snails were seen at the water line . This raised our interest in the bioavailability and toxicity of sediment - bound contaminants to amphipods . The first investigations with mud shrimp pursued lethality; however, no reduction in survival was observed over 10-day exposures . Amphipods always survived (> 80%) if fed 2 days before being placed on contaminated harbour sediments for 10 days (hellou et al . It was also discovered fortuitously that if the feeding of the animals was omitted the friday prior to the monday exposure, the animals would perish . In that case, the transparent animals had dark particles visible in their stomach, and the fingerprint of the amphipods extract was identical to that of the sediments, confirming that consumption of particles took place . Effects similar to the ones being used at the time with field mussels collected in the harbour (hellou et al . 2008), i.e. Lipid content, growth and reproduction, were observed in amphipods . Amphipods were exposed to sediments collected in the vicinity of the sites where mussels were exposed to soluble and particle - bound contaminants in the water column . Changes in behaviour are somewhat logical to accept from a human perspective when faced with sewage . Behavioural effects appeared promising to pursue with amphipods, relatively easy to explain and understand . Field sediments were mixed in various proportions with those collected along with the amphipods from a non - urbanised beach . Animals were examined for their preference between two choices, the pristine or harbour - derived mixed sediment . Avoidance was detected above a narrow range of pah in sediments (hellou et al . 2008). In the case of five out of seven sediments collected near numerous raw sewage discharges, amphipods avoided sediment containing pah at concentrations labelled as probable effects levels (> 50% probability of toxicity) by the canadian council of ministers of the environment (hellou et al . Two samples further away from sewage effluents did not display the concentration - escape link . The same trends in ranking the quality of harbour sites were obtained with lab amphipod and field - collected mussel . Since our expertise was to analyse the fates of pah, i.e. Bioaccumulation and biotransformation, the bioavailability of the priority pollutants to amphipods was pursued . The ability of this species to transform reactive chemicals was assessed by exposing them to several single pah and the presence of transformation products examined in tissue extracts; however, only bioaccumulation was detected . The lowest per cent of harbour sediment mixed with the amphipods native sediments and generating an escape response were then used in exposures and the animals analysed . The sum of detected pah in tissue extracts were of 0.31.1 nmol / g or about 1,000 times lower than those associated with lc50 (hellou et al . This difference in body burden explained why animals did not perish when exposed to harbour sediments and demonstrated that avoidance is 1,000 times more sensitive than survival . It can easily be called an e1 signal and would possibly prevent chronic exposure and more signs of toxicity . In a follow - up study, sediments were spiked with a mixture containing the seven abundant pah detected in harbour sediments . An avoidance response was apparent when each pah was> 100 ng / g . Their body burden was two to seven times lower than observed with the avoided harbour sediments . This difference would likely mean that there are more chemicals available from the sediments that are associated with the escape (hellou et al . Numerous other non - ionic hydrophobic or lipophilic ec are discharged in sewage effluents, such as phthalate esters, non - ylphenol ethoxylates, musks, polybrominated diphenyl ethers, other fluorinated and chlorinated chemicals, as well as edr . Questions regarding the identity and level of additional xenobiotics would need attention if behaviour is to be used in risk assessment of harbour sediments and the connection to body residue validated . In studies performed by our group to investigate the toxicity of the pesticides atrazine, azinphos methyl, carbofuran and endosulfan, variably weak behavioural responses were detected in amphipods (hellou et al .,> 20% of the animals died before a preference for uncontaminated sediments was apparent . Using the fungicide chlorothalonil, a u - shaped response demonstrated an attraction for contaminated sediments, especially when amphipods were started on spiked sediments at mid concentrations (2.5, 12.5 and 125 ng / g) relative to the wider range of 0.01- to 10,000-ng / g exposure (hellou et al . The reported properties of these biocides had revealed a short half - life (days). This research reinforced the importance of analysing the media when examining toxicity, as well as the differences in the response of a species exposed to different types of contaminants . According to experiments performed by changing the salinity of seawater, in contrast, snails survived readily; however, there was an increase in retracted snails . The tolerance of snails is interpreted to be due to their ability to retract within the shell, a defence mechanism that is absent in amphipods . These gastropods would therefore survive more than crustaceans with a freshwater input due to rain or perhaps snow melt or river overflow . The behavioural response of mud snails relative to harbour sediments was also studied (marklevitz et al . Experiments were modified with time going from using two sediments overlaid with seawater to only one sediment overlaid with variable amounts of seawater or to using only seawater (hellou et al . 2010). Unlike the mud shrimp which spend all of their time in sediments, the snails reside on diverse substrates in contact with one or more media: air, water or sediments . The behaviour of snails reported in the literature had more visually informative endpoints, required less manipulations and observations could be noted frequently in time . Three stages of stress response starting with escape could be observed with snails, progressing to animals being flipped over on their shell with soft tissue protruding, then retracted within their shell . Moreover, unlike the amphipods that could only be used in the summer and early fall, and became dormant and fragile when manipulated during the colder months, the snails could be handled in fall and winter . Snails offered two choices of sediments avoided harbour sediments, and the response was statistically more pronounced between the 48- and 72-h period (marklevitz et al . The snails also moved away from sediments containing solvent extracts obtained from harbour sediments or containing a mixture of the seven abundant pah tested with amphipods . Three natural products present in harbour sediments were also tested for their effect on behaviour . A general lack of preference from a dose response perspective was witnessed when offering a fatty acid methyl ester, cholesterol and coprostanol between 0.0007 and 1.2 mg / g . Coprostanol, a sewage marker deriving from the degradation of cholesterol in the digestive system of mammals, was avoided at 0.05 mg / g . These chemicals are present at varying levels in harbour sediments along with many other non - polar anthropogenic chemicals and would be detected in the tested solvent extracts . In order to pursue the fate of pah in snails and a potential link to behaviour, it was important to determine if biotransformation took place along with bioaccumulation . It was discovered that three species of gastropods, a large commercial one, neptunea lyrata, a large but poisonous species, buccinum undatum, plus the small intertidal snails, i. obsoleta, produced up to eight metabolites (beach et al . The most commonly used combustion - derived pah, pyrene (py), ubiquitous in environmental compartments and abundant in harbour sediments, was used in these investigations along with its more toxic oxidation product produced by sunlight as well as by microorganisms, 1-hydroxypyrene, pyoh . Two modes of exposure were attempted over a range of concentrations and behaviour examined alongside . In a series of experiment, animals were provided with one portion of py - spiked fish, whilst in another, snails were placed on py - spiked sediments containing the innate detritus material, bacteria and algae, representing the food that would be available in the field . The animals were analysed 3 days after beginning the exposures, and bioaccumulation plus transformation occurred according to a specific balance in proportions of py and derivatives (erskine et al . A statistically significant linear regression was drawn between the amount of py and the sum of the two major transformation products detected in extracts of fed snails . This trend of changing proportions demonstrates a limited capacity within the animals to handle anthropogenic chemicals and was observed with larger snails (beach and hellou 2010). It is used by animals to produce more water - soluble and more easily eliminated derivatives of the initial lipophilic compounds . Stressed animals with retracted soft tissue were detected when the balance of proportions of products was not observed . Stressed snails compared to healthy animals displayed different relative amounts of transformed and initial py . Under conditions with a fast feeding uptake lasting minutes, the production of five times more transformation products was associated with stressed snails . When uptake was over a longer period of time as in the sediment exposure, the presence of twice the level of transformation products in tissue extract was apparent in stressed relative to healthy animals . These experiments associated a visually simple - to - track toxic effect with the complex fate of a pah . They raise questions about the toxic mode of action of other aromatic molecules present in harbour sediments and in other animals that biotransform molecules . Stress was only seen in animals that were exposed in the fall and not in the summer . The biotransformation capacity of the snails was also higher in the fall relative to summer . The interpretation of the mode of action of the behavioural toxicity detected in snails is lacking the detail that would be provided by using more sensitive instrumentation where the eight produced derivatives, rather than just three abundant ones, could be quantified, to potentially link structure with toxicity, in order to compare and possibly predict toxicity between species and make an informed risk assessment at the ecosystem level . The studies presented in this section relate to working on relevant mixtures of contaminants present in harbours where the analysis of sediments for priority pollutants indicated a high probability of toxicity . The escape behaviour of amphipods reflected e1 early warning of toxicity in acute exposures . This was only associated with a subset of sediments, five out of seven, that ranked above sediment quality guidelines according to the analysis of pah priority pollutants . The amphipods body burden of abundant pah proved bioavailability and perhaps a mode of action . Exposure to pah - spiked sediments indicated that they represent a fraction of the cause of escape in the five samples and perhaps a larger per cent in other matrices . Experiments with mud snails amplified the complexity of pursuing the mode of action in behavioural ecotoxicology and the need to invest resources in questions that affect ecosystem health . (1999) provided the background for the approach adopted testing harbour sediments . When the amphipods eohaustorius estuaries were offered two choices of sediments, the one containing pah was avoided over a 2- or 3-day exposure period . (2001) examining the link between acute tests measuring lc50 and the composition of marine benthic communities reported no decrease in the abundance of polychaetes and molluscs to concord with a decrease in survival of amphipods . However, the abundance of arthropods, crustaceans and amphipods were in agreement with the toxicity tests . Halifax harbour sediments were devoid of amphipods, with the odd worm detected in grabs, but mussels were abundant and few snails were seen at the water line . This raised our interest in the bioavailability and toxicity of sediment - bound contaminants to amphipods . The first investigations with mud shrimp pursued lethality; however, no reduction in survival was observed over 10-day exposures . This amphipods always survived (> 80%) if fed 2 days before being placed on contaminated harbour sediments for 10 days (hellou et al . It was also discovered fortuitously that if the feeding of the animals was omitted the friday prior to the monday exposure, the animals would perish . In that case, the transparent animals had dark particles visible in their stomach, and the fingerprint of the amphipods extract was identical to that of the sediments, confirming that consumption of particles took place . Effects similar to the ones being used at the time with field mussels collected in the harbour (hellou et al . 2008), i.e. Lipid content, growth and reproduction, were observed in amphipods . Amphipods were exposed to sediments collected in the vicinity of the sites where mussels were exposed to soluble and particle - bound contaminants in the water column . Changes in behaviour are somewhat logical to accept from a human perspective when faced with sewage . Behavioural effects appeared promising to pursue with amphipods, relatively easy to explain and understand . Field sediments were mixed in various proportions with those collected along with the amphipods from a non - urbanised beach . Animals were examined for their preference between two choices, the pristine or harbour - derived mixed sediment . Avoidance was detected above a narrow range of pah in sediments (hellou et al . 2008). In the case of five out of seven sediments collected near numerous raw sewage discharges, amphipods avoided sediment containing pah at concentrations labelled as probable effects levels (> 50% probability of toxicity) by the canadian council of ministers of the environment (hellou et al . Two samples further away from sewage effluents did not display the concentration - escape link . The same trends in ranking the quality of harbour sites were obtained with lab amphipod and field - collected mussel . Since our expertise was to analyse the fates of pah, i.e. Bioaccumulation and biotransformation, the bioavailability of the priority pollutants to amphipods was pursued . The ability of this species to transform reactive chemicals was assessed by exposing them to several single pah and the presence of transformation products examined in tissue extracts; however, only bioaccumulation was detected . The lowest per cent of harbour sediment mixed with the amphipods native sediments and generating an escape response were then used in exposures and the animals analysed . The sum of detected pah in tissue extracts were of 0.31.1 nmol / g or about 1,000 times lower than those associated with lc50 (hellou et al . This difference in body burden explained why animals did not perish when exposed to harbour sediments and demonstrated that avoidance is 1,000 times more sensitive than survival . It can easily be called an e1 signal and would possibly prevent chronic exposure and more signs of toxicity . In a follow - up study, sediments were spiked with a mixture containing the seven abundant pah detected in harbour sediments . An avoidance response was apparent when each pah was> 100 ng / g . Their body burden was two to seven times lower than observed with the avoided harbour sediments . This difference would likely mean that there are more chemicals available from the sediments that are associated with the escape (hellou et al . Numerous other non - ionic hydrophobic or lipophilic ec are discharged in sewage effluents, such as phthalate esters, non - ylphenol ethoxylates, musks, polybrominated diphenyl ethers, other fluorinated and chlorinated chemicals, as well as edr . Questions regarding the identity and level of additional xenobiotics would need attention if behaviour is to be used in risk assessment of harbour sediments and the connection to body residue validated . In studies performed by our group to investigate the toxicity of the pesticides atrazine, azinphos methyl, carbofuran and endosulfan, variably weak behavioural responses were detected in amphipods (hellou et al . 2009c). In the case of endosulfan,> 20% of the animals died before a preference for uncontaminated sediments was apparent . Using the fungicide chlorothalonil, a u - shaped response demonstrated an attraction for contaminated sediments, especially when amphipods were started on spiked sediments at mid concentrations (2.5, 12.5 and 125 ng / g) relative to the wider range of 0.01- to 10,000-ng / g exposure (hellou et al . The reported properties of these biocides had revealed a short half - life (days). This research reinforced the importance of analysing the media when examining toxicity, as well as the differences in the response of a species exposed to different types of contaminants . According to experiments performed by changing the salinity of seawater, amphipods are less tolerant than snails (hellou et al . 2009a). The survival of amphipods determined that 12 corresponded to lc50 in 1-day exposures . In contrast, snails survived readily; however, there was an increase in retracted snails . The tolerance of snails is interpreted to be due to their ability to retract within the shell, a defence mechanism that is absent in amphipods . These gastropods would therefore survive more than crustaceans with a freshwater input due to rain or perhaps snow melt or river overflow . The behavioural response of mud snails relative to harbour sediments was also studied (marklevitz et al . Experiments were modified with time going from using two sediments overlaid with seawater to only one sediment overlaid with variable amounts of seawater or to using only seawater (hellou et al . 2010). Unlike the mud shrimp which spend all of their time in sediments, the snails reside on diverse substrates in contact with one or more media: air, water or sediments . The behaviour of snails reported in the literature had more visually informative endpoints, required less manipulations and observations could be noted frequently in time . Three stages of stress response starting with escape could be observed with snails, progressing to animals being flipped over on their shell with soft tissue protruding, then retracted within their shell . Moreover, unlike the amphipods that could only be used in the summer and early fall, and became dormant and fragile when manipulated during the colder months, the snails could be handled in fall and winter . Snails offered two choices of sediments avoided harbour sediments, and the response was statistically more pronounced between the 48- and 72-h period (marklevitz et al . The snails also moved away from sediments containing solvent extracts obtained from harbour sediments or containing a mixture of the seven abundant pah tested with amphipods . Three natural products present in harbour sediments were also tested for their effect on behaviour . A general lack of preference from a dose response perspective was witnessed when offering a fatty acid methyl ester, cholesterol and coprostanol between 0.0007 and 1.2 mg / g . Coprostanol, a sewage marker deriving from the degradation of cholesterol in the digestive system of mammals, was avoided at 0.05 mg / g . These chemicals are present at varying levels in harbour sediments along with many other non - polar anthropogenic chemicals and would be detected in the tested solvent extracts . In order to pursue the fate of pah in snails and a potential link to behaviour, it was important to determine if biotransformation took place along with bioaccumulation . It was discovered that three species of gastropods, a large commercial one, neptunea lyrata, a large but poisonous species, buccinum undatum, plus the small intertidal snails, i. obsoleta, produced up to eight metabolites (beach et al . The most commonly used combustion - derived pah, pyrene (py), ubiquitous in environmental compartments and abundant in harbour sediments, was used in these investigations along with its more toxic oxidation product produced by sunlight as well as by microorganisms, 1-hydroxypyrene, pyoh . Two modes of exposure were attempted over a range of concentrations and behaviour examined alongside . In a series of experiment, animals were provided with one portion of py - spiked fish, whilst in another, snails were placed on py - spiked sediments containing the innate detritus material, bacteria and algae, representing the food that would be available in the field . The animals were analysed 3 days after beginning the exposures, and bioaccumulation plus transformation occurred according to a specific balance in proportions of py and derivatives (erskine et al . A statistically significant linear regression was drawn between the amount of py and the sum of the two major transformation products detected in extracts of fed snails . This trend of changing proportions demonstrates a limited capacity within the animals to handle anthropogenic chemicals and was observed with larger snails (beach and hellou 2010). It is used by animals to produce more water - soluble and more easily eliminated derivatives of the initial lipophilic compounds . Stressed animals with retracted soft tissue were detected when the balance of proportions of products was not observed . Stressed snails compared to healthy animals displayed different relative amounts of transformed and initial py . Under conditions with a fast feeding uptake lasting minutes, the production of five times more transformation products was associated with stressed snails . When uptake was over a longer period of time as in the sediment exposure, the presence of twice the level of transformation products in tissue extract was apparent in stressed relative to healthy animals . These experiments associated a visually simple - to - track toxic effect with the complex fate of a pah . They raise questions about the toxic mode of action of other aromatic molecules present in harbour sediments and in other animals that biotransform molecules . Stress was only seen in animals that were exposed in the fall and not in the summer . The biotransformation capacity of the snails was also higher in the fall relative to summer . The interpretation of the mode of action of the behavioural toxicity detected in snails is lacking the detail that would be provided by using more sensitive instrumentation where the eight produced derivatives, rather than just three abundant ones, could be quantified, to potentially link structure with toxicity, in order to compare and possibly predict toxicity between species and make an informed risk assessment at the ecosystem level . The studies presented in this section relate to working on relevant mixtures of contaminants present in harbours where the analysis of sediments for priority pollutants indicated a high probability of toxicity . The escape behaviour of amphipods reflected e1 early warning of toxicity in acute exposures . This was only associated with a subset of sediments, five out of seven, that ranked above sediment quality guidelines according to the analysis of pah priority pollutants . The amphipods body burden of abundant pah proved bioavailability and perhaps a mode of action . Exposure to pah - spiked sediments indicated that they represent a fraction of the cause of escape in the five samples and perhaps a larger per cent in other matrices . Experiments with mud snails amplified the complexity of pursuing the mode of action in behavioural ecotoxicology and the need to invest resources in questions that affect ecosystem health . It seems obvious from the above examples that behaviour can change relative to an acute exposure to contaminants and that it is more sensitive than survival . Information combining results of toxicity tests and the body burden of animals could offer the ability to identify the chemicals that should be reduced in amount to improve the state of a site . Age and reproductive stage can affect behavioural results; when energy is placed in reproduction, less energy can be dedicated to behaviour . Seasonal variations are especially pronounced with cold - water marine organisms and hinder the repetitive use of the above species at any time of the year . Behaviour can be specific to a species and endpoints other than escape help to interpret effects . Behavioural tests are relatively fast, simple to perform, noninvasive, cheap and, as described in many studies, with a high ecological relevance . These characteristics are essential when designing toxicity tests and the development of integrated behavioural tools with chemical and toxicological aspects should be supported and expanded for the management of sustainable ecosystems.
|
Rheumatoid arthritis (ra) is a chronic, progressive, inflammatory autoimmune disease in which the body's immune system mistakenly attacks the joint . The disease produces an inflammatory infiltrate of immune cells as well as a series of destructive events such as synovial hyperplasia, pannus setting, bone and cartilage erosion, and joint destruction . It results in swelling and pain in the joints and around them [1, 2]. In ra, activation of innate immunity in early disease, followed by the appearance of adaptive immune responses ultimately leads to a destructive phase . The pathophysiology of ra implies the existence of t and b cells, various immune modulators (cytokines and effector cells), and signalling pathways . The complex interaction of immune modulators causes joint damage starting at the synovial membrane and covering most structures . This disequilibrium between pro- and anti - inflammatory cytokine activities facilitates the induction of autoimmunity, chronic inflammation, and joint damage . It is less known, though, how cytokines are organized within a hierarchical regulatory network and which cytokines may qualify as best targets for clinical intervention a priori [35]. Ra pathogenesis is caused by b cells not only through antigen presentation, but also through the production of antibodies, autoantibodies, and cytokines [2, 5]. There are no disease - specific diagnostic features in ra and patients can have a wide range of manifestations . The diagnosis of ra is given by a combination of symptoms, signs, serologic tests, and radiologic findings, as established by the american college of rheumatology . Since early inflammatory arthritis is a clinically heterogeneous disease, cytokine networks are known to play a critical role in the pathogenesis of rheumatoid arthritis; a panel of pro- and anti - inflammatory cytokines and associated autoantibodies were measured to identify the biologically based subsets of early rheumatoid arthritis (era). It requires assessment, not only of the current clinical picture but also of the potential for change . Therefore, identifying the early rheumatoid arthritis (ra) is a crucial step in controlling the progress of the disease . . Early diagnosis of rheumatoid arthritis (ra) is essential, because there is strong evidence that early treatment with one or more disease - modifying antirheumatic drugs improves the evolution [10, 11]. When dmards therapy is introduced early in patients, function and radiological outcome in the long term are better than cases when it is delayed . Our research objectives were to assess the concentrations of il-13 and il-17 in serum of patients with era, the investigation of correlation between the concentrations of these cytokines and disease activity score and the concentration of some autoantibodies in relation to the control group, and the evaluation of the utility of il-13 and il-17 concentration measurements as markers of disease activity . We accomplished a study which included 30 patients diagnosed with early rheumatoid arthritis, gender ratio 6 m/24 f, and mean age 56.22 years; in parallel, we investigated a control group that included 28 persons unaffected by early rheumatoid arthritis or other diseases . Controls were matched for sex, age at the time point of blood sampling, and area of residence (rural or urban). Early ra patients fulfilled the american college of rheumatology (acr) 1987 revised criteria for the classification of ra . They were all investigated, diagnosed, and included in the studied group, following the revised classification criteria of the american college of rheumatology, in 2010 . All patients accomplished the inclusion criteria for early rheumatoid arthritis (two or more swollen joints dating more than 2 weeks, but less than 12 months from onset). We excluded, from the start of the study, patients with other autoimmune diseases, those who received treatment with dmards, glucocorticoids, or / and vitamins, the women during pregnancy, and persons with diabetes mellitus or metabolic syndrome . The study cohort comprised patients firstly evaluated for early arthritis because we aimed to investigate era patients to find a better and faster way of discrimination between affected and unaffected cases . Based on the das28 results, the 30 era patients were subdivided into three groups: mild (2.6 <das28 3.2), moderate (3.2 <das28 5.1), and severe (5.1 <das28). Serum samples were collected from 30 patients and from 28 controls (healthy persons) and analyzed for concentrations of il-13 and il-17, anticyclic citrullinated peptide antibodies (anti - ccp), rheumatoid factor igm isotype (igm - rf), anti - cardiolipin igg isotype (igg - acl), anti - ra33, erythrocytes sedimentation rate (esr), and c - reactive protein (crp). Blood samples were obtained from all subjects into tubes without additives by venous puncture in a fasting state in the morning . Peripheral venous blood was collected into separator vacutainers and allowed to clot for 30 minutes at room temperature . The test tubes were centrifuged at 3.000 g for 10 minutes, and serum samples were further divided into aliquots and stored at 80c, until assessment . Before testing, frozen probes were brought to room temperature, avoiding freezing - unfreezing cycles . The analysis of serum parameters was based on a quantitative sandwich elisa, according to the manufacturer's instructions . Igg anti - ccp 3.1 and igg - acl autoantibodies were determined by elisa, using quanta lite-inova diagnostics kits, usa (autoantibodies seropositivity was defined as a titer> 20 the investigation of serum igm - rf concentrations was achieved using elisa - aescu germany kits (positive> 15 u / l) and of anti - ra33 antibodies using elisa - kit human, wiesbaden, germany (positive results> 25 u / ml). For hscrp dosage, drg elisa international inc . Serum concentrations of il-13 and il-17 were measured in patients with early, untreated inflammatory arthritis and in control persons, using elisa techniques with invitrogen corporation kits (camarillo, ca, usa). The values obtained were expressed in pg / ml . In looking for a method of measuring serum cytokine, concentrations were taken into account studies that show good stability for samples stored at 70c until dosage . All the procedures were followed in accordance with the ethical standards of the institutional responsible committees for human studies and with the helsinki declaration of 1975, as revised in 2008 . For realisation of this study, we obtained the approval of the committee of ethics and academic and scientific deontology of the university of medicine and pharmacy from craiova number 76/2014 . Patients' data, management system, and data processing were performed using microsoft excel and data analysis module; statistical analysis was done using graphpad prism 5 . The significance of differences between groups was examined with a mann - whitney u test or kruskal - wallis, when multiple comparisons were made . Correlation analysis between the concentration of il-13 and il-17 and the degree of disease activity (das28), as well as the concentration of some autoantibodies, crp and esr, were conducted with a pearson's test . The diagnostic values of studied markers were evaluated using receiver operating characteristic (roc) curves analysis . The performance was expressed as the area under the roc curve (auc, area under roc curve) together with 95% confidence interval (95% ci) and p statistics for the difference between calculated auc and auc = 0.5 (weak discriminative marker). Cut - off values corresponding to the highest accuracy were determined and for various threshold values investigated at each marker, we calculated the sensitivity (sn), specificity (sp), and youden index (sensitivity + specificity 1). Among the 30 patients, initially diagnosed with era, 80% were female (sex ratio: 24 female/6 male), with age, mean stdev 55.77 10.87 years . In controls there was no significant difference in age between the two groups (table 1). In our study, we found that both il-13 (18.20 pg / ml, 95% ci: 16.4719.92) and il-17 (17.87 pg / ml, 95% ci: 12.9922.75) concentrations in the serum of patients suffering from era were higher than those in the control group (4.80 pg / ml, 95% ci: 3.895.71, p <0.0001, and 4.20 pg / ml, 95% ci: 3.365.05, p <0.0001, resp . ). We also found differences in serum concentrations of il-13 and il-17 in subgroups of era disease patients with different clinical activity stages . The concentrations of il-13 in the severe and moderate groups were statistically higher than in the mild and control groups (p <0.05). There were no statistical differences between severe and moderate groups . Also, in the case of il-17 serum concentrations increased proportionally with the disease activity of era, the highest concentrations were in patients with severe activity disease (figure 2). Statistically significant differences were observed between both the moderate and the severe groups and a mild group (p <0.05), as well as between the group with moderate disease activity and the control group (p <0.001). In the studied cohort of patients, we observe statistically significant differences in the concentrations of crp and the levels of esr between patients with era and the control group (crp / control group, p <0.0001; esr / control group, p <0.0001) (table 1). Analyzing the relationship between serum levels of crp and esr and different disease activity stages, we observed only statistically significant differences between severe and moderate group (p <0.0379) (table 2). Our study showed different profiles of igg anti - ccp and igm - rf concentrations in serum of patients suffering from era in different clinical activity stages . Igg anti - ccp and igm - rf concentrations were increasing along with the disease activity . In both cases, there were statistically significant differences between severe groups and moderate and mild groups (igg anti - ccp: severe versus moderate group, p = 0.0011, severe versus mild group, p = 0.0030; igm - rf: severe versus moderate group, p = 0.0014, severe versus mild group, p = 0.0039). There was a weak, statistically not significant correlation between il-17 and igm - rf (r = 0.320, p = 0.085). There was a significant positive correlation between the concentrations of il-17 and crp (r = 0.366, p = 0.047) and a significant negative correlation between the concentrations of il-13 and crp (r = 0.334, p = 0.041). Disease activity score, das28, was strongly positively correlated with levels of esr (r = 0.967, p 0.001) and weakly positively correlated with concentrations of anti - ra33 autoantibodies (r = 0.404, p = 0.027). Concentrations of anti - ccp autoantibodies positively correlated fairly well with crp and igm - rf, and concentrations of anti - ra33 positive correlated with levels of esr . Comparing the roc curves for the studied parameters in the patients with era indicated that il-13 has a higher diagnostic utility than il-17, crp, esr, igm - rf, and anti - ccp as markers of disease activity (table 4). Roc analysis revealed that il-13 concentration indicated era presence with 100% accuracy using the concentration of 10.73 pg / ml as an optimal cut - off value for discrimination between patients with era and controls (95% ci: 0.9621.000, p <0.0001). The likelihood ratios of positive and negative results obtained on the basis of optimal threshold values specific for era were as follows: lr(+) = 28.00 and lr() = 1.12 with sensitivity and specificity equal to 100 and 100%, respectively; youden index was 1.00 (figure 3). In case of il-17, the calculated cut - off value for discrimination between patients with era and controls was 9.40 pg / ml and using this value the diagnostic accuracy of il-17 was 90.2% (95% ci: 0.8090.995, p <0.0001). The likelihood ratios of positive and negative results obtained on the basis of optimal threshold values specific for era were as follows: lr(+) = 24.27 and lr() = 1.14 with sensitivity and specificity equal to 86.67 and 100%, respectively; youden index was 0.866 . In the studied cohort of patients, crp and esr have discriminative power towards diagnosis of era (sensitivities for both crp and esr were found to be lower in comparison to the il-13; diagnostic accuracy of crp was 96.9 and 94.8%, resp . We also noticed that although they have a specificity less than il-13 and crp, autoantibodies igm - rf and anti - ccp have a good tendency to discriminate patients with era from healthy ones (diagnostic accuracy 98.1 and 94.7%, resp . ). Chronic inflammatory and autoimmune diseases are the result of an interplay between genetic factors and environmental ones that culminate in the phenotypes of the established disease . Owing to the prevalence and accessibility of joint samples for laboratory investigation, ra has been a suitable model for the study of numerous inflammatory and immune - mediated conditions . The formulation of a definition for early ra was difficult, but the majority of the rheumatologists use the term early for symptoms shorter than three months . There was a tendency to accept the involvement of fewer affected joints [9, 16]. Changing from health to established disease in ra is generally clearly understood.early rheumatoid arthritis (ra) and very early ra are major targets of research and clinical practice [15, 17]. We found a predominance (80%) of women in patients affected by era, finding which are congruent with the results of other studies having identified a female predominance in ra [9, 15, 18]. Both pro- and anti - inflammatory cytokines were found elevated in ra patients over controls claiming opinion that cytokine networks play critical rolls in the pathogenesis of rheumatoid arthritis [4, 7, 1928]. The present study reveals that levels of serum il-13 and il-17 cytokines were significantly higher in era patients than in age- and sex - matched healthy persons . Our results are related to the cell - mediated immune response intervention in disease onset . A broad range of inflammatory processes that are involved in the pathophysiology of rheumatoid arthritis are regulated by cytokines . The imbalance between pro- and anti - inflammatory cytokine activities favours the induction of autoimmunity, chronic inflammation, and thereby joint damage [5, 27]. Some cytokines, such as tumour necrosis factor- (tnf-) alpha, il-17, and (il)-1, function by promoting inflammatory responses and by inducing cartilage degradation . Others such as il-4, il-10, and il-13 are mainly anti - inflammatory molecules [18, 20, 25]. Even if present in rheumatoid joints, in progressive ra anti - inflammatory cytokine levels are too low to neutralize the deleterious effects of proinflammatory cytokines . The suppression of both the secretion and action of il-17 by il-13 is of potential clinical importance [1922]. Il-13 is a protein, secreted by activated t cells, that modulates b cell function in vitro and plays an important part in their proliferation and differentiation; the high local il-13 levels were observed in patients with ra, correlated with b lymphocyte proliferation . Interleukin 13 induces interleukin-4-independent igg4 and ige synthesis and cd23 expression by human b cells . Some researchers support a role for il-13 as an in vivo antiangiogenic factor and provide a rationale for its use in ra to control pathologic neovascularization . Treatment with th2 cytokines (il-4, il-10, and il-13) was tested in many animal models of arthritis based on the th1 bias of t cells, showing considerable promise . In patients suffering from ra, disruptions in self - tolerance lead to abnormalities such as recognition of citrullinated antigens by t and b cells . The proportion of lymphocyte differentiation in ra is skewed towards the th1 phenotype, to the detriment of the th2, th17, and t regulator (treg) ones . Imbalances appear in the main cytokine systems including il-1, tnf, il-6, il-18, il-15, il-33, il-22, and il-13 . However, the destruction of the joint in ra is caused not only by these cytokine imbalances but also by matrix production dysregulation responsible for cartilage damage . Il-17 levels fall after administration of anti - inflammatory cytokines such as il-4 or il-13 . Il-13 levels were significantly higher in patients with early ra (p <0.001) than in reference group, suggesting the different pathogenic mechanisms involved in joint inflammation . Serum il-13 values increased in ra have been reported in many works [20, 22, 28]. Lower interleukin 13 levels were communicated in patients with arthritis by some investigators as barra and contributors and woods et al . . Assume that the production of rf and antinuclear antibodies by b cells could depend on different cytokines action . In their study, il-13 serum levels correlated with those of rf in ra patients and they suggested that il-13 may be involved in the pathogenesis of autoimmune rheumatic diseases, with a relevant role on rf production . We found that detection of il-13 in era patients was not affected by rheumatoid factor igm (r = 0.206, p = 0.274), a fact revealed by other researchers too . Interleukin 13 inhibits the production of proinflammatory cytokines, chemokines, and hematopoietic growth factors by activated human monocytes . The increase of biologically active il-13 in ra supports the hypothesis that il-13 regulates immune cell (including dendritic cell) activity and indicates how the varied anatomical distribution of cytokines may play a role in the ra disease process . The differential regulation of circulating il-13 and m - csf levels by tnf antagonists further implies discrete roles in the tnf - cytokine network in ra [33, 34]. . Showed that il-13 was present in 27 out of 28 serum samples from patients with ra, indicating that this cytokine is constantly present in rheumatoid joints . Detected increased levels of the th2 cytokines il-4 and il-13 in synovial samples from early ra patients . Il-13 causes b cell proliferation and differentiation, including ige production, and the expression of certain adhesion molecules on endothelial cells . All these biological properties of il-13 are shared with il-4, but in contrast to il-4, il-13 does not act on t cells . Besides the increased values of il-13, we detected circulating il-17 levels significantly higher in patients with era (p <0.001) when compared to those in the reference group . Strong correlations of serum il-17a levels with anti - ccp were found by rou et al . . Th17 with decreased circulating levels in era seems to be a marker of anti - ccp seropositivity . Considering the complexity and heterogeneous nature of ra, it is unlikely that only cytokines investigation may provide sufficient discrimination; predicting the era is better with a combination of biomarkers . Il-17 has several sources: th17 cells, which are a subset of cd4+helper t cells, mast cells, nk cells, and t cells; all of them contributing to the pathogenesis of inflammatory arthritis [39, 40]. In a recent study comparing individuals before the onset of symptoms (defined as prepatients) and after the onset of ra with matched control subjects, kokkonen et al . Showed that il-17 was present at its highest concentrations in prepatients, and the level had decreased within 7.7 months following the onset of disease . Il-17a was detected at higher levels in early disease compared with late, established disease . Reported il-17a levels significantly higher in synovial fluid (sf) and serum from era patients compared to osteoarthritis (oa). In other previous studies, there were higher serum and sf il-17a levels in ra patients as compared to healthy controls, which suggests that the cytokine is mainly produced locally in the inflamed joint . Other results sustain that despite the significant increases in th17 and il-17 cd4 + t cells in the blood of ra patients, these did not correlate with esr, crp, or das28, suspecting that the presence of il-17 producing cd4 + t cells in the blood from patients with established ra is of limited use as a biomarker to indicate disease activity . In our study, there were significant correlations (r = 0.366, p = 0.047) found between il-17 and crp serum levels, but not with esr or disease activity score, supporting partially arguments of these investigators . In another work, leipe et al . Demonstrated that th17 cells play an important role in inflammation in human autoimmune arthritides, both at the onset and in established disease . They claim that the levels of il-17 are connected to the systemic disease activity at both the onset and the progression of ra . Taken together, these data suggest that il-17 may be a key activator of t cell - driven inflammation and thus may contribute to the pathogenesis of ra [46, 47]. It can be asserted that il-17 represents a member of the proinflammatory cytokine family produced by ra synovium and inhibited by some th2 cytokines . In this way, il-17 contributes to the active, proinflammatory pattern characteristic to ra, whose production and function are regulated by il-4 and il-13 . Reduction of synovial inflammation may be protective through a direct effect on il-17, inducing proinflammatory effects . Thus, il-17 appears to represent a target for treatments of ra [48, 49]. Overexpression of il-17 has been shown to be associated with a number of pathological conditions . Since il-17 was found at high levels in the synovial fluid around the affected cartilage in patients with inflammatory arthritis, it is assumed that this determines the direct effect on articular cartilage . Il-17 functions as a direct and potent inducer of matrix breakdown and an inhibitor of matrix synthesis in articular cartilage explants . It was observed that individuals in whom ra later developed had significantly increased concentrations of several cytokines, closer to the onset of symptoms, and that there exists a relationship between th1, th2, treg, and th17-cytokines and the presence of anti - ccp antibodies . Sensitivity, though, was not increased by the combination of anti - ccp antibodies and these cytokines [18, 41, 51, 52]. Because we know the statistical limits of the present study, the relatively small number of patients, we propose in the future longitudinal studies with regular serum analysis to determine more precise roles of il-17, il-13, and autoantibodies in ra pathogenesis . With il-13 and il-17 serum concentrations increasing proportionally with the disease activity of era, the highest concentrations were in patients with severe activity disease . Based on the results of this study, we can conclude that the presence of higher il-13, il-17, igm - fr, and anti - ccp serum levels in patients, compared to those of controls, confirms that these markers, found with high specificity, might be involved in the pathogenesis of era . Il-13 and il-17 might be of better usefulness in the prediction of era activity status than igm - rf and anti - ccp . Investigation of the association between cytokine profile and autoantibodies status may lead to prognostic and treatment decisions in era patients . The basis for the new therapies in patients with ra is represented by inhibiting the action of proinflammatory cytokines by using specific cytokine inhibitors or anti - inflammatory cytokines . The combination of il-17 and anti - ccp autoantibodies may have the potential as biomarkers in early ra, especially for their clinical utility.
|
The interaction of ultraviolet or visible light of a specific wavelength with certain molecules or photosensitizing chemicals leads to a delayed type hypersensitivity reaction that causes photocontact dermatitis . The primary investigation for the detection of photodermatitis is the photopatch test, which helps in the investigation and detection of specific allergens that cause photodermatitis in a susceptible individual . It involves exposure of the skin to appropriate amounts of an allergen implicated in causing photoallergic contact dermatitis and recording the subsequent response with and without light exposure . The primary indication for the test would be dermatitis predominantly limited to sun exposed sites of uncertain aetiology . The antigens used in the photopatch series include sunscreens, nonsteroidal anti - inflammatory drugs (nsaids), and fragrances; specific antigens are added based of information provided by the patient . Although various differences exist in the procedure, irradiation doses, interpretation, and antigens of photopatch test, only 4%20% of patients undergoing photopatch tests show clinically positive relevant results . Common photosensitizing agents include chemicals present in sunscreens, antiseptic agents, fragrances, and nonsteroidal anti - inflammatory drugs . In india, parthenium hysterophorus is probably the most common cause of photoallergic contact dermatitis and airborne contact dermatitis . The diagnosis of a photodermatitis is based on the history and clinical examination and is confirmed by photopatch testing . It is important to rule out other causes of photoexposed site reactions such as connective tissue disease, drugs, allergic contact dermatitis, and pophyrias while investigating a patient of suspected photoallergy . There is no indian standard photopatch test series available, and studies carried out in india have used european or scandinavian photopatch test trays, which may not be relevant for indian patients . Hence we have used a combination of photopatch test and uv - irradiated indian standard series (iss) in our study, to detect light - induced antigens in patients with photosensitive dermatitis . This study was done as a hospital - based, descriptive, observer blinded study . A total of 35 patients were included in the study during a one year period between september 2012 and october 2013 . Clearance from the ethical committee was obtained and written informed consent was taken from all patients involved in the study . Patch and photopatch testing was performed on all the patients using the iss and photopatch series . 1- control, 2- potassium dichromate, 3- neomycin sulfate, 4- cobalt chloride, 5- benzocaine, 6- formaldehyde, 7- paraphenylenediamine (ppd), 8- parabens, 9- nickel sulfate, 10- colophony, 11- gentamicin, 12- mercapto mix, 13- epoxy resin, 14- fragrance mix, 15- mercaptobenzothiazole, 16- nitrofurazone, 17- polyehyleneglycol-400, 18- chlorocresol, 19- wool alcohols, 20- balsam peru, 21- thiruram mix, 22- chinoform, 23- black rubber mix, and 24- p - tbp f resin . The photopatch series consisted of: 1- benzophenone-3, 2- benzophenone-4, 3- eusolex 232, 4- butylmethoxydibenzoyl methane (parsol 1789), 5- para amino benzoic acid, 6- 3(4 methyl benzyliden) camphor, 7- octyltriazone, 8- octyl methoxycinnamate, 9- ibuprofen 5%, 10- piroxicam 5%, 11- ketoprofen 2.5%, 12- isomyl 4-methoxycinnamate 10%, 13- fragrance mix 8%, and 14- parthenium . The patients included in the study presented with dermatitis predominantly affecting sun exposed areas or with a history of photosensitivity . Clinically suspected cases of phototoxic or photoallergic contact dermatitis secondary to drugs, chemicals, or airborne antigens were also included in the study . Patients on systemic immunosuppressants, oral steroids, exfoliative and active dermatitis, pregnant or lactating women, and those below 18 years of age were excluded from the study . Those with photosensitivity due to conditions such as connective tissue disease and genetic disorders with photosensitivity were also excluded . A detailed history was taken with regard to onset, duration and progression of disease, type and distribution of lesions, and presence of any comorbid conditions . All patients that fit the criteria for inclusion were subjected to a thorough clinical examination . Photographs of the patch test sites were taken at each reading to document positive reactions . Both sets of patches were applied in duplicate on the patient's back, on either side of the spine by the standard method . After 24 h, the tapes were carefully removed and squares representing each chamber were marked using a marker pen . Readings were recorded after a gap of half an hour, into the respective proformas . After noting relevant readings, one side was closed with an opaque black cloth and the other side was irradiated with 14 j / cmsq of uva . The selection of side to be irradiated was done in a randomized, observer - blinded manner . A distance of 15 cm was kept between the patient's back and irradiation source . Readings were then recorded after 48 h. at the end of the protocol, two sets of readings were obtained considering the day of patch application as day 0 . First reading was at 24 h after application of patches, followed by uva irradiation (day 1). The patch test results were evaluated using the international contact dermatitis research group (icdrg) grading . Photopatch test was interpreted according to the standard photopatch criteria . According to the criteria, if only the irradiated side shows a positive reaction, it is labeled as a photoallergic reaction . If both sides show a positive reaction with the irradiated side showing greater than 1 + positivity, it is termed as a contact dermatitis with photoaggravation . If both sides show equal reaction after irradiation, a contact allergy is the result . Out of the 35 patients included in the study, 10 (29%) were females and 25 (71%) were males and all patients were outdoor workers . Majority (66%) of patients belonged to the age group ranging from 35 to 65 years . A total of 24 (69%) patients had positive patch or photopatch test results . Majority of these patients 21 (60%) had features of chronic dermatitis confined mainly to the sun - exposed areas with a history of photosensitivity . The remaining 14 (40%) patients presented with a history of photosensitivity with dermatititis present both in sun - exposed and covered areas . Twelve patients among the total study population had a positive history of atopy with ige levels above 1000 iu / ml . The highest number of photopatch reactions was noted with parthenium, with 18 (51%) patients showing positive results . The detailed results of the 18 patients with a positive photopatch test suggestive of photodermatitis are shown in table 1 . Out of the 18 patients, 9 (50%) showed contact allergy, 4 (22%) had photoallergy, and 5 (28%) had contact dermatitis with photoaggravation to p. hysterophorus . Five patients among the 18 patients had coexistent contact dermatitis to other antigens in the iss . Detailed results of the 18 patients who showed positive photopatch test results six patients had contact dermatitis without any photoaggravation or photoallergy to varied antigens such as potassium dichromate, chinoform, fragrance, para - phenylenediamine, nickel, and cobalt . In our study, p. hysterophorus was the leading allergen with 51% of the study population showing a positive reaction . This is expected due to the widespread presence of parthenium in the locality and surrounding areas . In a similar study carried out by jindal et al ., 30 patients were subjected to photopatch testing along with some antigens obtained from the standard series . Fourteen positive tests to several allergens were obtained with fragrance mix being the leading antigen (30%), followed by para - phenylenediamine (20%) and p. hysterophorus (17%). Sharma and kaur found 78% of patients with airborne contact dermatitis to have parthenium sensitivity . In another study done by sharma et al . Three patients showed photoallergic reaction and another 3 showed photoaggravation out of 19 patients . In our study 4 patients showed photoallergy and 5 patients showed contact dermatitis with photoaggravation . The major antigens in p. hysterophorus are sesquiterpene lactones . Some of the identified lactones are parthenin, hymenin, ambrosin, and coronopilin . Parthenium is established to cause both photoallergy and contact dermatitis with photoaggravation . In a study done by kar et al ., it was observed that parthenium plays a significant role in the initiation and spread of air borne contact dermatitis and chronic actinic dermatitis (cad). A 20-year analysis of antigens causing photoallergic contact dermatitis done in new york showed 11.6% positivity to plant derivatives including sesquiterpene lactone mix . The coexistence of allergic contact dermatitis (acd) with cad is well known . In most of these cases about 75% of patients with cad show a positive patch test response to one or more allergens . Among the various plant antigens, sesquiterpene lactones obtained from plants of the compositae family are the most common causative antigens apart from fragrance, rubber, metals, colophony, chromates, and sunscreens . The second most common allergens in our study were fragrance mix and potassium dichromate . In our study, photoallergy due to fragrance can be due to the perfume compound itself of the fixative agent such as musk ambrette . In a study done by panja et al ., fragrance mix was the leading photosensitizer . Metals such as nickel, cobalt, and dichromates are common sensitizing agents . Three patients (30%) showed positive patch test reactions, to nickel and cobalt in our study . These sensitizers are found in jewelry, watches, cement, leather, and dyes . Chronic exposure to these allergens in the presence of ultraviolet radiation facilitates increased immune recognition and aggravation of pre - existing dermatitis . Various differences exist in the pattern of antigen positivity depending on the area and population under study . The positivities obtained in western literature are to certain antigens not so frequently encountered in the indian scenario . In a recent study from the united states, sunscreens and anti - microbial agents were the predominant antigens and a decreased incidence in fragrance induced photoallergic contact dermatitis was found . The most common positive antigens in photopatch tests in western studies were sunscreens and drugs such as nsaids . No positivity to sunscreens was detected in our study, probably due to infrequent use in the given population . The leading allergens in the scandinavian multicentric photopatch study were musk ambrette and para amino benzoic acid . One patient showed positive reaction to ppd . In a study done by jindal et al . 6 out of 20 patients showed contact allergy to ppd with two patients having photoaggravation . Although ppd is known to cause photoallergic reactions, our patient did not exhibit the same . In our study, six patients had contact dermatitis to various antigens such as nickel, cobalt dichromates, and ppd . Although these sensitizers have been implicated in photoaggravated contact dermatitis, none of our patients showed such a response pattern . Photodermatitis is prevalent in india, and prompt identification of the causative antigens will alleviate the morbidity associated with this condition . Photoallergic contact dermatitis is largely underdiagnosed in our country due to lack of availability of proper photopatch protocols . Parthenium was found to be the leading cause of photodermatitis in our study causing photoallergy, contact dermatitis with photoaggravation, and contact allergy . Among the 18 parthenium - positive patients, five had coexistent contact dermatitis to other antigens in the iss . In this context, patch testing with both iss and photopatch series could lead to clinically relevant results . It is advantageous as it is noninvasive, simple to carry out, and can be performed on an outpatient basis . Thus, patch testing with combined iss and photopatch series can be efficacious in the detection of antigens causing photosensitive dermatitis . A 24- and 48-h photopatch test reading was taken . Our inability to take delayed readings at 72/96 h or even one week may have resulted in false - negative results.minimal erythema dose or med is the least amount of uv radiation required to produce perceptible erythema on light exposed skin . 48-h photopatch test reading was taken . Our inability to take delayed readings at 72/96 h or even one week minimal erythema dose or med is the least amount of uv radiation required to produce perceptible erythema on light exposed skin . A 24- and 48-h photopatch test reading was taken . Our inability to take delayed readings at 72/96 h or even one week may have resulted in false - negative results.minimal erythema dose or med is the least amount of uv radiation required to produce perceptible erythema on light exposed skin . 48-h photopatch test reading was taken . Our inability to take delayed readings at 72/96 h or even one week minimal erythema dose or med is the least amount of uv radiation required to produce perceptible erythema on light exposed skin.
|
The work of wu and colleagues is in accordance with the recent concept of sepsis - induced immunosuppression . There is now agreement that many severe septic patients survive the first critical hours of the syndrome but eventually die later in a state of immunosuppression that is illustrated by patients' difficulty to fight the primary bacterial infection, decreased resistance to secondary nosocomial infections and reactivation of viral infections normally solely pathogenic in the immunocompromised host . Consequently, immunostimulatory therapies might be used to restore immune functions in the most immunodepressed patients . In the absence of any specific clinical signs of immune failure, however, it is beforehand critical to determine the best biological tools (markers of septic patients' immune failure) enabling patient stratification . The most frequently assessed biomarker in the field to date is undeniably the measurement of hla - dr expression on circulating monocytes (mhla - dr). There appears to be general consensus that diminished mhla - dr is a reliable marker for the development of immunosuppression in critically ill patients . Indeed, decreased expression of this marker is regularly reported to be associated with higher mortality / risk for nosocomial infections in critically ill patients . More than 100 articles on this topic have been published in different icu conditions, including sepsis, trauma, burns, and stroke . It is becoming increasingly clear that the critical point after injury is the recovery of normal mhla - dr . Schematically, mhla - dr rapidly returns to normal values (generally in less than 1 week) in injured patients with uneventful recovery, whereas this parameter remains constantly decreased in patients with adverse outcome/ secondary septic complications . In line with this hypothesis, wu and colleagues showed that low mhla - dr was associated with increased mortality in severe sepsis . Most importantly, the authors propose that, more than a single value at a given time point, the dynamic change of mhla - dr over time would be a better predictor of mortality . Indeed, in their study, single measurements of mhla - dr within the first week after patient admission (either days 0, 3 or 7) had no predictive value regarding mortality . In contrast, results expressed as dynamic parameters (that is, between two time points) provide excellent predictive values, especially calculated between days 0 and 3 or between days 0 and 7 (areas under the curve of 0.92 and 0.94, respectively, in receiver operating characteristic analysis). Most importantly, after multivariate analysis, the authors show that these two parameters remain the sole independent predictors of mortality with an elevated significant odds ratio . Overall, the present results confirm the concept that patients who do not start to restore normal immune functions are those who are going to die . These results are in agreement with two recent studies in which a weak slope of mhla - dr recovery was associated with increased risk of secondary infections in a mixed icu population and in trauma . This outcome could have important consequences in patient management, by potentially allowing for the administration of tailored therapies aimed at restoring immune functions based on dynamic changes of immunological parameters . First, the study is monocentric in a small cohort of surgical patients (that is, not necessarily representative of the whole septic population) that present with relatively elevated mhla - dr values (> 50%) in comparison with results from the literature (usually below 50% in severe septic patients). This moderate severity and the lack of statistical power due to the small size of the cohort may explain surprising results after multivariate analysis (sequential organ failure assessment and acute physiology and chronic health evaluation ii scores were not significantly different between survivors and nonsurvivors, odds ratio with very large confidence intervals). Indeed, the standardized recommended method for expressing mhla - dr results is as numbers of antibodies bound per cell and not as the percentage of positive cells . As an example, the authors suggest that a difference of 4.8% in mhla - dr between days 0 and 3 is of significance . Although most probably correct from a statistical perspective, this threshold is hardly applicable in routine / technical practice because such a small percentage difference could be due to measurement variability by flow cytometry . Overall and beyond these limitations, appropriately acknowledged by the authors, this study confirms that after injury (for example, severe sepsis) survivors tend to progressively normalize mhla - dr, contrary to non - survivors . This biologic parameter could thus provide critical information when assessed as a dynamic variable over time . This potential aspect now deserves to be validated in multicentric clinical studies using standardized flow cytometry protocols.
|
Takotsubo cardiomyopathy, or transient apical ballooning syndrome, is a non - ischemic cardiomyopathy that mimics the onset of an acute myocardial infarction . Its incidence was recently reported to be 1.72.2% among patients presenting with acute coronary syndrome . Takotsubo is also called broken heart syndrome because a strong emotional psychological stress may act as a potential trigger . Originally described in japan in 1990, its eponym was coined using the two japanese terms tako (octopus) and tsubo (pot), due to the resemblance between the cardiac apical ballooning (hallmark of the syndrome) and the octopus trap (a kind of ceramic pot) used by japanese fishermen . The acute functional and instrumental abnormalities accompanying takotsubo cardiomyopathy occur in the absence of significant coronary alterations, and could be completely recovered within a few weeks up to two months . If promptly recognized and correctly managed, despite the severity of its onset and the potentially life - threatening characteristics (those of a cardiogenic shock), this syndrome normally presents a good prognosis with low morbidity and in - hospital mortality rates,, . This paper reports a rare case of association between takotsubo and hip fracture surgery, which has been described only by two previous studies, . The female patient we describe, an 81-year - old caucasian woman living at home with a son, was completely independent in katz s basic activities of daily living (adl = 6/6) and lawton s instrumental activities of daily living scales (iadl = 8/8) before the hospitalization . Her clinical history evidenced osteoporosis with multiple previous vertebral incomplete collapses, in treatment with oral calcium and vitamin d, hypertension controlled with ramipril, and dyslipidemia for which she took statins . She had no cognitive decline (normal score at iqcode questionnaire), allergies, or weight loss . The woman was admitted during night time in the emergency department (ed) of san gerardo university hospital after an accidental fall at home, reporting trauma of the right hip . 1a) and partial collapse of multiple vertebrae, the latter without evidence of recent fractures . No significant abnormalities were reported at the blood examinations (i.e., blood count, electrolytes, liver and kidney function indexes, protein electrophoresis, coagulation parameters, blood gases) or at the standard electrocardiogram (ecg, fig . The patient was firstly admitted in the orthopedic ward, and then transferred to the orthogeriatric unit (ogu, within the geriatric ward) the day after, once the geriatricians confirmed the eligibility criteria for admission . The comprehensive geriatric assessment did not reveal cognitive deterioration or delirium (4at score = 2/12). The pain was on average well controlled with the standard protocol of treatment (acetaminophen 1 g three times intravenously / day). Score = 2), which was performed 60 h after the admission . Ten minutes after the injection of cement, when the orthopedic surgeons were performing haemostatic maneuvers and a check of joint movements, the surgical act was complicated by severe bradycardia and cardiogenic shock with consequent cardio - pulmonary arrest . Without perturbing the sterility of the surgical site, the patient was placed supine and promptly treated with cardiopulmonary resuscitation maneuvers, oro - tracheal intubation, and intravenous administration of atropine and epinephrine, obtaining return of spontaneous circulation after 7 min . Upon restoration of spontaneous circulation, the surgical procedure was completed with saline washing, local instillation of tranexamic acid, layered suture, and plain medication with plaster . The first suspected diagnosis, considering the time relationship with cement injection, was bone cement implantation syndrome (bcis). The patient was then transferred from the operating theater to the intensive care unit (icu), where dopamine (5.33 mcg / kg / min, increased to 16 mcg / kg / min) and norepinephrine (0.060.13 mcg / kg / min) were administered intravenously reaching treatment maximization . Hydroelectrolytic solutions (3500 ml) were infused to increase the circulating volume and furosemide 40 mg iv was administered to stimulate the diuresis . In the absence of clinical benefits, due to the persistence of hypotension (systolic blood pressure = 80 mmhg, mean arterial pressure = 50 mmhg) and the presence of sinus tachycardia, the anesthetist added bisoprolol 1.25 mg four times / day . The echocardiography revealed akinesia of the apex and the mid segment of the septum, extending to the anterior and infero - lateral cardiac wall, accompanied by apical ballooning and significant reduction of the left ventricular ejection fraction (lvef = 25%30% during amine iv infusion). Additional examinations excluded the presence of cerebrovascular diseases, myocarditis, hypertrophic cardiomyopathy, and pheocromocytoma . These results oriented toward a diagnosis of takotsubo syndrome, so that the cardiologist prescribed iv treatment with heparin (2000 ui in bolus + 20,000 ui in 24 h), gradually reduced and discontinued the aminic support, and positioned an intraortic balloon pump . The day after surgery, despite an observed initial reduction of the troponin t levels (ctnt = 185 ng / ml after 24 h, 154 ng / ml after 32 h), the echocardiography showed further reduction of the lvef (20%) with apical akinesia in toto . The finding of anemia (hb = 8.5 g / dl, mcv = 78.5 fl) was corrected with the transfusion of 2 units of concentrated red blood cells . On the second post - operative day, considering the persistence of low cardiac output and atrial tachycardia, the patient started iv treatment with levosimendan 0.1 mcg / kg / min for 7 h, amiodarone 907 mcg / day and metoprolol 2 mg, with gradual amelioration of cardiac output and heart rate . During the third post - operative day we discontinued iv treatment with heparin, we removed the intraortic balloon pump and the oro - tracheal device, supporting the patient with low - intensity oxygen by mask . Therapy with acetylsalicylic acid 100 mg / day and captopril 6.25 mg three times / day was initiated . On the fourth post - operative day we report a single episode of hyperactive delirium occurred during the night, efficiently managed with the administration of haloperidol 2 mg intramuscular + quetiapine 50 mg per os . During the fifth post - operative day she was transferred to the cardiology icu, where she underwent echocardiography re - evaluation that showed significant restore of the contractile function (lvef = 56%). On the seventh post - operative day the patient was transferred back to the ogu, where she started specific physical therapy oriented towards passive and active mobilization of the right leg, achievement and maintenance of the standing position, and ambulation with the support of a walker . Before discharge, the hemoglobin levels were stabilized (hb = 12.3 g / dl). During the hospital she was discharged sixteen days after the operation and the takotsubo syndrome, in good physical and mental conditions (mmse score before discharge = 25/30), able to walk (walker + supervision) without pain in the surgical area . The follow - up performed two months after surgery revealed absence of cardiac symptoms and good recovery of the walking ability with a walking stick . We suggested to continue strengthening the lower limb muscles with domiciliary physiotherapy and allowed walking without any aid . At the 6-month follow - up, the woman was still asymptomatic from a cardiovascular point of view . She reached a functional level comparable with the pre - fracture status (katz s adl = 6/6, lawton s iadl = 7/8). She was able to walk without aids at home, but she needed a walking stick when going outside because of a residual fear of falling . Finally, the echocardiogram confirmed good cardiac function (lvef = 55%) in the absence of other abnormalities . Her son, the caregiver living with her, confirmed an overall good functional and nutritional status and no signs of cognitive decline compared with the pre - fracture status . The patient fulfills several criteria for a diagnosis of takotsubo syndrome: physically stressful event as a trigger, female elderly patient (at higher risk than young subjects and males), apical ballooning with akinesia (echocardiogram), st - segment alterations immediately after the onset (electrocardiogram), lack of significant coronary artery stenosis, recovery of the left ventricular function . Indeed, approximately 90% of the cases occur in the female population, mostly between 58 and 75 years of age, though it is not uncommon among older individuals, . In this case report, the symptomatology seemed to be triggered by the injection of pressurized cement during the hemiarthroplasty procedure, mimicking a bcis of grade 3 (the more severe grade) with acute myocardial infarction, accompanied by the classic instrumental cardiac findings . Bcis was previously reported to be a sporadic adverse event of bone cement injection, still incompletely understood, and was defined only recently . It is characterized by the association of multiple signs of different severity, which contribute to a heterogeneous presentation: hypoxia, hypotension, alteration of vascular pulmonary resistance, cardiac arrhythmias, and cardiac arrest . However, in this case, the coronary angiography did not show major obstructions or arterial abnormalities, and the echocardiography did not demonstrate the presence of emboli, thus suggesting a different diagnosis and orienting the physicians toward takotsubo cardiomyopathy . This is the second case of takotsubo we recently encountered in our medical practice, the first being described in 2012 in an 80-year - old woman with severe alzheimer s disease . Pathophysiological mechanisms underlying takotsubo are still not well understood, and the reported cases suggest a number of potential etiologies . In several cases a multifactorial mechanism might be involved, and different variants of the classic takotsubo syndrome have been progressively described,, . Altogether, a single pathophysiological mechanism does not clarify the existence of several takotusbo s variants . Hip fracture and the related surgery are even more stressful experiences: healthcare professionals working in this area should be aware of the severe physical (pain, immobility, functional disability) and psychological / emotional (transfers, total dependence, anxiety) burden that affects the geriatric population . Strength of our approach was the availability and coordination of multiple specialists as consultants 24/24 h, with the geriatrician as the primary attendant according to our orthogeriatric protocol of co - management . These allowed to set up promptly the necessary support therapies and instrumental evaluations in order to identify the potentially life - threatening diagnosis . Limitations include the initially wrong diagnostic orientation and the resources required to complete the differential diagnosis before confirming the takotsubo . Despite being a rare condition, takotsubo syndrome is a possible differential diagnosis of the bcis, which recently emerged regardless its severity as a frequent complication of surgical orthopedic procedures involving the pressurized injection of bone cement, with a prevalence of about 2530%, . Moreover, porto et al . Recently reviewed the correlation between neurologic disorders and transient left ventricular dysfunction, called neurogenic stunned myocardium and characterized by findings which resemble the classic takotsubo cardiomyopathy . The authors concluded that the available literature suggests treating them as different entities . To the best of our knowledge, the association of takotsubo syndrome with hip fracture in the preoperative phase or after surgery has been rarely reported (two cases)., the correct management of elderly subjects could potentially reduce the stress experience related with hip fracture . Promoting the gentle care informed consent for the acquisition of data to present in this case report was obtained during the hospitalization, and signed by the patient itself . The consent form is stored in the archive of san gerardo university hospital (monza, italy). Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request . All demographic and patient - specific personal information have been de - identified according to the italian law for the privacy and protection of personal information (codice in materia di protezione dei dati personali, d. lgs . Dp, mc, and gb took care of the patient during the hospitalization and obtained informed consent for this report.
|
(itbl) are often used as synonyms for hilar or intrahepatic diffuse bile duct strictures, necrosis, ecstasies, or dilatations (see figure 1) [1, 2]. The reported incidence of itbl after olt varies between 1.4% and 20% [35]. This complication encounters for major morbidity and mortality, creates high costs, and aggravates organ shortage [7, 8]. A recent study on 1113 liver transplant patients showed no relevant donor or recipient risk factor of itbl . There are only two studies evaluating the impact of chemokine receptors (ccr) on the development of itbl [6, 9]. In moench's study on 146 olt patients ccr-532 mutation was evaluated and correlated with a significant increased incidence of itbl . A recent study on 137 pediatric liver transplants failed to show an association between ccr-532 and biliary complications . Ccr-532 is a single base - pair deletion of ccr-5 that leads to a nonfunctional receptor . The clinical impact of this mutation was first described for homozygous ccr-532 caucasians being highly resistant to hiv-1 infection . If there was an immunological cause for itbl, a nonfunctional ccr might be relevant for this complication . Experimental studies correlated a nonfunctional ccr-5 with less acute rejection episodes in lung, heart and islet cell transplantation . The aim of this study was to re - examine a correlation of ccr-532 genotype with the susceptibility of itbl within our patients . All patients were transplanted at the transplant center of the humboldt university of berlin between 03/2002 and 03/2005 and were included during routine follow - up examination . 11 patients with the established diagnosis of itbl, that were transplanted earlier than 03/2001, were selectively included into this study due to the low incidence of itbl of only 4.0% within our patients . The diagnosis of itbl was made within the first year after transplantation in 82% of the patients . The following demographic data were extracted from the hospital records and evaluated: age, gender, underlying liver disease, blood group, child - pugh score (cps), model for end stage liver disease score (meld score), initial immunosuppression, cytomegalovirus infection (cmv), hla match, donor age and gender, donor serum sodium, cause of brain death and length of stay on intensive care unit (icu) prior to organ harvesting . 154 patients received a cadaver graft, 15 patients received a graft from a living donor . Itbl was defined as nonanastomotic intra- or extrahepatic biliary strictures without any history of hepatic artery complications, abo, incompatibility or other known causes of bile duct damages . In all cases patency of the hepatic artery recurrence of primary biliary cirrhosis (pbc) or primary sclerosing cholangitis (psc) and vanishing bile duct syndrome were ruled out in all cases by liver biopsy . Diagnosis of itbl was always established with endoscopic retrograde cholangiography or percutaneous transhepatic cholangiography . All genotype analyses were performed at the johannes gutenberg university of mainz, department of transplantation surgery . For analysis of the ccr-5 genotype, genomic dna was prepared from 200 l peripheral blood using the qiaamp dna blood kit (qiagen, cologne, germany). 2.5 l of dna were amplified by pcr using the following ccr-5 specific primers: ccr - sense, 5-caaaaagaaggtcttcattacacc-3 and ccr-5-antisense, 5-cctgtgcctcttcttctcatttcg-3. The pcr mixture was composed of 2.5 l 10 x pcr buffer (roche molecular systems, mannheim, germany), 0.5 l of 12.5 mmol / l dntp (peqlab, erlangen, germany), 2.5 l of each sense and antisense primer (10 mol / l), and 1.25 u amplitag dna polymerase (roche molecular systems) in a total volume of 25 l . Forty pcr cycles were run on a genius thermocycler (techne, cambridge, uk), using the following temperature profile: initial denaturation, 94c 3 minutes; amplification, 94c 1 minute, 64c 1 minute, and, 72c 1 minute (40 cycles); terminal elongation, 72c 9 minutes . The size of the wild - type product was 189 base pairs (bp), and the ccr-532 allele yielded a product of 157 bp . Descriptive statistics were used to summarize the donor and recipients characteristics . For independent variables, cross tabulations and chi - square tests were performed . Nonparametric variables were evaluated with fisher's exact test, and asymptotic significance was calculated . All calculations were performed in association with the department of biometrical medicine of the humboldt university of berlin . A total number of 169 liver transplant recipients were available for genotyping and complete data analysis . Gender and age were equally distributed between wild - type group (wt / wt) and heterozygous ccr-532 group (wt/32). The observed genotype frequency was as expected assessed by hardy - weinberg equilibrium in the study population . There were no differences between wt / wt group and wt/32 group regarding to cps score, meld score or blood group (table 1). There were no statistical significant differences in the composition of underlying liver disease of group wt / wt and wt/32 . Initial immunosuppression was tacrolimus based in 82.6% in the wt / wt group compared to 84.8% in the wt/32 group . Cmv infection that demanded ganciclovir treatment was present in approximately 30% in the wt / wt and wt/32 group and in both homozygous patients . Donors of group 32/32 were younger (35.7 years versus 46.5 years and 48.5 years). Mmol / l in the wt/32 group and 155.5 mmol / l in the 32/32 group . Data of causes of brain death and length of stay on the icu prior to organ harvesting are shown in table 2 . Incidence of itbl was 11.2% in this study due to the selection of patients with itbl that were additionally included into this evaluation . Homozygous 32 patients developed no itbl compared to 11.2% and 12.1% of homozygous wild - type patients and heterozygous patients, respectively . The rate of retransplantation was 3.0% in both wt / wt and wt/32 group (see table 3). Retransplantation of the heterozygous patient was indicated due to chronic ductopenic rejection following olt for psc . In the wt / wt group, the problem of genetic association studies and complex clinical syndromes or diseases must be addressed . One can always question the usefulness of these studies that are often even small in sample size ., it seems important to undertake replication studies for reported associations between genetic polymorphisms and diseases, especially in diseases of major clinical importance . In this study, the distribution of heterozygous 32 and homozygous 32 mutation was very consistent with the published data of the global distribution of this gene polymorphism [10, 16]. Heterozygous and homozygous genotypes occur in caucasian population in 15%20% and 1%, respectively . This seems important due to the small number of patients included in this study and the possible bias by including selected patients with the diagnosis of itbl into the study cohort . Despite increasing success rates in clinical olt over the past decades, itbl remains a major cause for recipient morbidity and mortality [15]. Up till today, only risk factors for itbl could be identified in various clinical studies . The length of cold ischemic time was correlated with the development of itbl [14]. Immunological causes seem to play only a minor role in the pathogenesis of itbl . Described a single base - pair deletion in the coding region of the chemokine receptor-532, ccr-532, to be a significant risk factor for the development of itbl . In moench's study on 146 olt patients ccr-532 was a significant risk factor for itbl (incidence of itbl in ccr-532 patients was 30% versus 11.7% in ccr-5 wild - type patients) and was correlated with a decreased survival rate after olt . The different incidence of itbl of the study by moench and this study may be a reason for the different findings, even though both investigators used the same definition of itbl . Donors were younger in this study with 38.2 16 (non - itbl patients) and 42.9 17 (itbl) versus 46 14 (non - itbl) and 52 14 (itbl) in moench's study . However, cold ischemic time was shorter in moench's investigation (564 minutes (itbl) and 538 minutes (non - itbl) versus 637 minutes (itbl) and 558 minutes (non - itbl)). The use of arterial back table perfusion was also routinely done for all organs that were harvested by a team of our own . Analyzed ccr-532 polymorphism in 137 pediatric patients but showed no correlation with biliary complications . The incidence of itbl varies between 1.4% and 20% according to the literature, which might be a problem of different definition of this disease [35]. The rate of itbl in our olt patients (2100 patients between 1988 and 2004) is 4.0% . In the presented study on 169 olt patients the overall incidence of itbl was 11.7%, but only due to a selective inclusion of patients with the established diagnosis of itbl . This practice of patient recruitment may be criticized, but we think it is justified according to our low incidence of itbl . Itbl rate in ccr-532 patients was virtually equal to the one in ccr-5 wild - type patients . No statistically significant differences regarding itbl or retransplantation were observed . Why would ccr-532 mutation promote the development of itbl? Ccr-532 is a 32-base - pair deletion within the coding region of ccr-5, which results in a frame shift and generates a nonfunctional receptor . Homozygous expression of ccr-532 is associated with a reduced risk of asthma and with a reduced severity of rheumatoid arthritis [17, 18], multiple sclerosis [19, 20], and primary biliary cirrhosis (pbc). In other words, the nonfunctional nature of ccr-532 protects the individual from autoimmune diseases where ccr-5 seems to play a central pathophysiological role . These data do not backup the theory, that immunological risk factors are dominant in the development of itbl . Likewise, a correlation of a reduced survival rate with ccr-532 would not be consistent to the literature, where ccr-532 mutation is associated with an increased survival in renal, lung, heart and islet cell transplantation . In contrast to those findings, ccr-532 is strongly associated with an increased severity of psc . Patients suffering from psc have been described as carrying a higher risk for itbl, with a reported significantly increased incidence of 15.8% to 25% [1, 8, 23]. Another study reported psc as the only independent risk factor for itbl with an incidence of 31% compared with 9% of the control group . However, the problem of differentiation between itbl and recurrence of psc must be addressed . Recurrence rates of 8.6% to 25% were described for psc after olt [2527]. The diagnose of recurrence of psc is based on cholangiographic findings of intrahepatic, hilar and/or exrahepatic strictures, duct irregularities and on the histopathological picture of fibrous cholangitis and/or fibro - obliterative lesions with or without ductopenia, biliary fibrosis, or biliary cirrhosis . Most of these findings are neither pathognomonic for either recurrence of psc nor itbl . All patients with itbl in this study underwent percutaneous liver biopsy, and our pathologists ruled out psc recurrence . Since two of three studies failed to show an association between itbl and ccr-532 gene polymorphism, a general recommendation for screening of olt patients for ccr-532 does not seem to be justified.
|
Granulomatosis with polyangiitisis (gpa) is an idiopathic systemic form of vasculitis characterized by involvement of the upper and lower airways and the kidneys . The exact cause of gpa is unknown, but it seems to have characteristics of an autoimmune disease . Ent manifestations are present in the vast majority of patients (73 - 99%), and are usually among the first symptoms . Occasionally, ear conditions are the first and only manifestations . Therefore, ent physicians have a determining role in recognizing the early onset of this disease and starting the proper therapy . Current first line induction therapy for gpa consists of cyclophosphamide with glucocorticoids, which is successful in most (70 - 90%) patients . Although a few patients presenting with otologic symptoms and treated with conventional therapy, such as cytotoxic drugs and steroids, have been described, this case was a rare and meaningful report in otology to date of a patient presenting with unilateral facial nerve palsy and bilateral profound sudden sensorineural hearing loss with vertigo . We describe here a patient with a resistant fulminant generalized form of gpa initially presenting as bilateral sudden sensorineural hearing loss and facial palsy . A 47-year - old man visited our hospital due to symptoms of facial paralysis on the left side and abrupt hearing disturbance with dizziness in both ears three days earlier . In physical examination, 1). At the time of visit to our hospital, impedance audiometry (grason - stadler gsi 33 middle - ear analyzer; viasys, conshohocken, pa, usa) was b - type on both sides; and pure tone audiometry (grason - stadler gsi 61 clinical; nicolet biomedical, madison, wi, usa) was 95 db on the right side and off scale on the left side (fig . Tests of auditory brainstem response found that the right side formed a v - wave at 80 nhl, whereas the left side did not form a v - wave at 90 nhl . Computed tomography scans (general electric medical systems, milwaukee, wi, usa) showed dense fluid in both external ears and middle ears but no facial canal dehiscence (fig . Simple chest x - rays showed multiple nodules in both lung fields, while ct of the chest showed that chest cavity was filled with multiple nodules (fig . Immunological tests showed significantly higher than normal proteinase-3 anti - neutrophil cytoplosmic antibodies (anca) representing c - anca . A definitive diagnosis required a lung biopsy sample . Following discharge from the hospital, the patient began coughing severely and developed a continuous fever of about 38. in addition, hearing ability again deteriorated . Chest ct showed increased size and number of nodules in the fine structure of the lungs (fig . A lung biopsy sample was obtained, and he was started on high - dose intravenous steroids 500 mg / day for three days . After six days, c - reactive protein (crp) tended to decrease from 18.04 to 4.36, but he showed no improvement in other symptoms including fever . A lung biopsy taken on day six showed necrotizing granulomatous inflammation with intra alveolar hemorrhagic exudates and capillaritis (fig . The patient was started on 1000 mg / day cyclophosphamide, along with steroids, two - week interval . However, erythrocyte sedimentation rate, crp and fever all remained high . He was therefore administered four infusions of rituximab (mabthera; roche pharma, basel, switzerland, 500 mg each), an anti - cd20 monoclonal antibody, at two week intervals, along with concurrent iv cyclophosphamide (endoxan; bukwang pharm, seoul, korea, 500 mg twice a month for 3 months). After rituximab administration, symptoms including cough, fever, and otologic symptoms, improved significantly . To improve hearing, he received seven intratympanic injections of steroids through the ventilation tubes in each ear . After four months, pure tone audiometry improved on the right side to 32 db (fig . 2b) but did not improve on the left side, and left side facial paralysis improved from hb grade 5 to hb grade 2 . Written informed consent was obtained from the patient who participated in this case . Gpa is a relatively rare disease, so treatment focusing on local symptoms in the absence of an accurate diagnosis may have no effect, or even worsen the disease, with the possibility of a secondary infection . Thus, an accurate initial diagnosis and subsequent treatment with steroids and, if necessary, immunosuppressive drugs, are important . The american college of rheumatology (acr) criteria for confirming the diagnosis of gpa was found to have a sensitivity of 88.2% and a specificity of 92% . A diagnosis of gpa requires at least two of the following four criteria: 1) hematuria (more than 5 red blood cells per visual field or the presence of erythrocyte casts), 2) changes in chest radiographs, 3) ulceration of the mouth and/or nose, and 4) positive histopathological examination . In addition about 80 - 90% of these patients are positive for anca, which damage vascular endothelium and cause its necrosis . In evaluating our patient, we initially focused on the areas usually involved in gpa, including the upper and lower airways and the kidneys . A lung biopsy sample taken from our patient showed necrotizing granulomatous inflammation with intraalveolar hemorrhagic exudates and capillaritis . He also had intranasal inflammation and nodules and cavities in the chest, thereby satisfying more than two of the four acr criteria . Otologic involvement may include otitis media with effusion, chronic otitis media, sensorineural hearing loss, vertigo, and/or facial palsy . Proposed mechanisms include cochlear nerve compression by an adjacent granuloma, cochlear immune - complex deposition, and local vasculitis involving cochlear vessels . Progression is generally rapid; however, the condition is occasionally reversible with glucocorticoids or cytotoxic agents . Our patient presented with the otologic symptoms of unilateral facial palsy and bilateral sudden sensorineural hearing loss with vertigo . Hearing loss was likely due to recurrent serous and/or suppurative otitis media and/or sensorineural hearing loss . Sensorineural and conductive hearing loss occurred with similar frequencies, 47% and 33%, respectively, but the latter showed a better response to treatment, indicating a poorer prognosis in patients with sensorineural hearing loss . The right side hearing threshold in our patient improved to 32 db, but left side showed no improvement . Facial nerve palsy in association with gpa is rare, being present in about 5% of patients, either alone or in combination with hearing loss; rarely, facial nerve palsy may be the presenting feature . Facial nerve palsy is secondary to compression of the nerve in the middle ear, especially in the presence of a dehiscent facial nerve canal or due to vasculitis . Differential diagnosis is important in patients with facial nerve palsy; other diseases should be considered, such as chronic otitis media and systemic vascular diseases, including sarcoidosis, polyarteritis nodosa and tuberculosis . The standard treatment for systemic gpa is an immunosuppressive drug such as cyclophosphamide to alleviate the disease, along with a glucocorticoid . If these regimens are ineffective, the patient should be treated with rituximab, a chimeric monoclonal antibody directed against cd20 that induces b cell apoptosis and depletion in peripheral blood . The importance of anca in the pathogenesis of gpa suggests that rituximab reduces anca by depleting b cell concentrations . This study describes a patient with a rare type of multi - organ involved, treatment resistant, fulminant form of gpa initially presenting as bilateral profound sudden sensorineural hearing loss with vertigo and unilateral facial palsy and illustrates the dramatic effects of rituximab.
|
The incidence of such infections is estimated to be 510% of patients admitted to tertiary care hospitals, although this may go up to 28% in the intensive care unit (icu). Nosocomial infections contribute to 0.710% of deaths compared to 0.14.4% of all the deaths occurring in hospitals . Nosocomial infections are most commonly acquired as a result of surgical wounds, urinary tract infections (utis) and lower respiratory tract infections and may be cross - infections or endogenous . Modern diagnostic procedures such as biopsies, endoscopic examinations, catheterization, intubation / ventilation and surgical procedures increase the risk of infection by microorganisms like escherichia coli that are normally innocuous but may become pathogenic when the body's immunological defenses are compromised . E. coli is the most common pathogen causing diarrhoea, neonatal septicemia, uti, bacteraemia and urosepsis . It is responsible for 80% of community - acquired utis and 30% of nosocomial infections . E. coli is one of the leading causes of bloodstream infections and comprises 1737% of all bacteria isolated from patients with bloodstream infections . Such bloodstream infections with extraintestinal e. coli are frequently associated with patients who have undergone major surgeries; who were admitted to hospitals for long durations; or who had a peripheral or urinary catheter . E. coli in the bloodstream can trigger vigorous host inflammatory response, leading to sepsis associated with high morbidity and mortality . A phylogenetic analysis indicates discrete origins of a diverse natural populations of the pathogenic e. coli that can be classified into major phylogenetic groups a, b1, b2 and d . The commensal strains usually belong to groups a and b1, whereas the extraintestinal pathogenic strains belong to groups b2 and d . The intestinal e. coli are mixture of all the phylogenetic groups and may act as a reservoir for the pathogenic isolates . The pathogenicity of intestinal or extraintestinal e. coli may be attributed to its genetic virulence markers . Strains of groups b2 and d often carry virulence factors (vfs) that are lacking in a and b1 . The reason for a commensal strain becoming virulent may be attributed to the multiple strategies of genome plasticity wherein the random point mutations were incorporated for adaptive pathogenic environments . The vfs in e. coli are required to overcome host defenses, invade host tissues and trigger a local inflammatory response . E. coli virulence and phylogeny are intertwined because vfs from both the host and the environment shape its genetic structure . To date, no single virulence factor has been demonstrated as being specific, unique or definitive to cause a particular disease . Virulence is multifactorial because it depends on both the characteristics of microbe and the susceptibility of the host . On the basis of functional groups, the e. coli vfs can be categorized as adhesins, such as p fimbriae (papg), type 1 fimbriae (fimh), s fimbriae (sfa) and a fimbriae (afa); toxins, such as hemolysin a (hlya) and cytotoxic necrotizing factor 1 (cnf1); iron uptake, such as aerobactin (aer); protectins, such as serum resistance (trat); and others, such as pathogenicity - associated islands (pais) and tir - containing protein of e. coli (tcpc) [1618]. Reported a susceptibility of the e. coli isolates from blood of urosepsis patients to diverse antibiotics according to the prevalence of vfs and phylogenetic groups . The e. coli phylogenetic grouping and their correlation with the vfs in disease conditions is well established; however, a correlation between phylogenetic groups and virulence profile of the blood and faecal e. coli isolates is not known . Most of the previous studies compared the virulence properties of e. coli isolates from disease condition with those from healthy individuals; however, the potential of faecal e. coli isolates (usually commensals) to cause the disease in a compromised host is unknown . Therefore, in order to understand the host susceptibility, we investigated the blood e. coli isolates from the patients diagnosed with sepsis and compared them with the faecal e. coli isolates from patients without sepsis admitted to the icu . We found that the prevalence of the e. coli isolates among the pathogenic groups b2 and d was significantly higher than the commensal groups a and b1 in faecal e. coli isolates . The overall prevalence of e. coli isolates among pathogenic groups was similar to commensal groups faecal e. coli isolates, indicating that this group of patients has a higher chance of contracting a severe form of infection . In addition, an overall prevalence of vfs among all the phylogenetic groups was higher in the blood e. coli isolates . However, the high prevalence of aer, trat and pai among faecal e. coli isolates indicated that the host environment may have an important role to play for a differential expression of these virulence genes to induce pathogenicity in the hospital setting . A knowledge of such virulence patterns and their correlation with phylogenetic groups is critical for our understanding of bacterial infection and is indispensable to the development of devising related novel therapeutic strategies . Blood samples (n = 78) were collected from patients with sepsis admitted to the icu of vardhman mahavir medical college (vmcc) and safdarjung hospital, new delhi, india, from february 2011 to august 2013 . The samples were selected from patients who had shown a clinical response arising from a nonspecific insult, which include more than two of the following: multiple positive blood culture results; bacteremia associated with systemic symptoms; temperature> 38.5c; hypotension (systolic blood pressure <90 mm hg); and leucocytosis (white blood cell count 13 000/mm). In addition, randomly selected faecal samples (n = 83) were collected from patients admitted to the icu (on day 1) for cardiovascular surgeries and road transport accidents who were not diagnosed with sepsis at vmcc and safdarjung hospital during the same period of time . A total of 161 blood and faecal e. coli isolates (table 1) were screened for e. coli positivity by standard biochemical procedures . The e. coli isolates were grown as lactose - positive colonies on macconkey blood agar medium in the department of microbiology at vmcc and safdarjung hospital . Thereafter, the samples were subcultured on tryptone soy broth by incubating at 37c for 18 hours . A portion of the broth containing bacterial isolates was pooled and processed for isolation of the bacterial genomic dna by the standard sodium acetate precipitation method . A triplex pcr was performed using a bacterial genomic dna as template and primers specific to chua and yjaa genes and the tspe4.c2 dna fragment, as described elsewhere (table 2). For pcr amplification, a 25 l reaction containing 1 l template dna, 2 mm mgcl2, 0.5 mm dntps, 0.5yu of taq polymerase (promega) and 0.3 pmol/l of forward and reverse primers each in 1 pcr buffer was set up . The reaction conditions included one cycle of initial denaturation for 5 minutes at 94c and thereafter 35 cycles of denaturation for 30 seconds at 94c, annealing for 30 seconds at 55c and an extension of 5 minutes at 72c . The positive control was e. coli strain cfto73 obtained from atcc (no . 700928), and the negative control was pcr master mix without dna template . A phylogenetic grouping (a, b1, b2 and d) of e. coli isolates from patients with and without sepsis was determined on the basis of triplex pcr data by making a dichotomous decision tree based on an amplification of chua and yjaa genes and the tspe4.c2 dna fragment, as previously reported . The fragment size of the chua and yjaa genes and the tspe4.c2 dna fragment was 279, 211 and 152 bp, respectively . Group b2 was designated with a positivity of chua and yjaa genes; group d with a positivity of chua gene and a negativity of yjaa gene; group b1 with a positivity of tspe4.c2 dna fragment and a negativity of chua gene; and group a with a negativity of chua gene and tspe4.c2 dna fragment . The presence of virulence genes encoding p fimbriae (papg), type 1 fimbriae (fimh), s fimbriae (sfa), a fimbriae (afa), cytotoxic necrotizing factor 1 (cnf1), hemolysin (hlya), aerobactin (aer), serum resistance (trat) and pathogenicity - associated island marker (pai) was evaluated by performing a pcr using gene - specific primers (table 2). Using a bacterial genomic dna from patients with and without sepsis as the template, a pcr amplification was performed for each gene in a standard 25 l reaction . The reaction conditions included one cycle of initial denaturation for 5 minutes at 94c and thereafter 35 cycles of denaturation for 30 seconds at 94c, annealing for 30 seconds at specific temperature (table 2) and an extension of 5 minutes at 72c . The positive control was e. coli strain cfto73 obtained from atcc (no . 700928), and the negative control was pcr master mix without dna template . The z test was used to compare the virulence factor's prevalence among the blood and faecal e. coli isolates . A one - way anova nonparametric test the isolates were previously approved by the institutional ethical committee of vardhman mahavir medical college (vmcc) and safdarjung hospital, new delhi, india (s.no-vmmc/sjh/ethics/sep-11/29). As per the guidelines, an informed written consent was taken from all the adult subjects included in this study . E. coli commensal strains belong to groups a and b1, whereas extraintestinal pathogenic strains belong to groups b2 and d . We observed no significant difference in the prevalence of phylogenetic groups a (19.2%), b1 (26.5%), b2 (30%) and d (24%) (p 0.47) (fig . 1, table 3) in the faecal e. coli isolates, whereas phylogenetic groups b2 (25.6%) and d (47.4%) were found to be more prevalent (p 0.0001) among the blood e. coli isolates (fig . 1, table 3). Individually, we did not find any significant difference in the prevalence of phylogenetic group a in blood (17%) and faecal (19.2%) e. coli isolates; however, group b1 was found to be significantly higher in the faecal e. coli isolates (p 0.0008) (fig . 1, table 3), as previously described . Contrary to expectation, we did not find any significant difference in the prevalence of phylogenetic group b2 from blood and faecal e. coli isolates . However, phylogenetic group d (47.4%) was more prevalent in blood (p 0.002) compared to faecal e. coli isolates (fig . 1, table 3), thus corroborating earlier observations of extraintestinal pathogenic strains belonging to group d . E. coli phylogenetic grouping and its correlation with the vfs in various disease conditions has been previously described . The combined virulence profile of all the nine vfs (papg, fimh, sfa, afa, cnf1, hlya, aer, trat and pai) among the phylogenetic groups (a, b1, b2 and d) of the blood e. coli isolates was found to be significantly higher than the faecal isolates (p 0.002; fig . 2a, dotted lines). Relatively higher levels of vfs among the faecal e. coli isolates suggest the entry of commensal e. coli into the bloodstream, thus enhancing its pathogenicity . We investigated a possible link between strain phylogeny and individual virulence genes among blood and faecal e. coli isolates . Our data showed that the adhesin coding genes papg and fimh were the most prevalent (90100%) among all the phylogenetic groups in blood e. coli isolates, and fimh was equally (80100%) high in the faecal isolates (fig . 0.0001) was observed in the prevalence of papg between blood and faecal e. coli isolates . The overall prevalence of sfa in the blood e. coli isolates was higher in groups b1 and b2 compared to groups a and d (p <0.0001). Afa in the blood e. coli isolates was higher in groups a and d compared to groups b1 and b2, whereas it was varied for the faecal e. coli isolates . Of the toxin - coding genes studied, the overall prevalence of cnf1 in the blood e. coli isolates was higher in groups b1 and b2 compared to groups a and d (p <0.0001), whereas hlya was very low in both groups . A significant difference was found in the prevalence of aer in groups b1 and b2 (p <0.01) of blood and faecal e. coli isolates; however, the reverse scenario was seen for the group d. the prevalence of trat in groups b1, b2 and d was higher in faecal e. coli isolates compared to blood isolates (p <0.05). The prevalence of pai in groups a and b1 was found to be higher in the blood e. coli isolates (p <0.05); however, the prevalence of group d was significantly higher in faecal e. coli isolates (100%) compared to the blood isolates (35%, p <0.002) (fig . Interestingly, an unexpected high expression of the virulence genes among the faecal e. coli isolates indicates the role of these genes in the development of infection . The prevalence of the adhesin and toxin categories that is, papg, sfa, afa, cnf1 and hlya among blood e. coli isolates was found to be significantly higher than faecal isolates, indicating their significant association to the pathogenic conditions (fig . However, no significant difference was observed in the prevalence of fimh among the blood and faecal e. coli isolates, as we expected . Surprisingly, no difference was observed in the prevalence of aer, trat and pai among the blood and faecal e. coli isolates, indicating a role of the host environment in stimulating the bacteria to acquire these virulence genes (fig . The prevalence of the e. coli isolates with respect to the papg, sfa, afa, cnf1 and hlya in the phylogenetic groups (a, b1, b2 and d) belonging to the blood e. coli isolates was higher compared to faecal e. coli isolates . However, no discrete difference in the prevalence of the e. coli isolates with respect to aer, trat and pai was observed among various phylogenetic groups (fig . Instead, a high prevalence of fimh, aer, trat and pai among the faecal e. coli isolates suggests an effect of external environment to induce bacterial pathogenicity . Characterization of e. coli is important for both clinical and epidemiologic implications . A community- or hospital - acquired e. coli infection is the primary cause of neonatal meningitis, uti, urosepsis and sepsis, but reports of e. coli causing bloodstream infections are limited . The pathogenic e. coli strains belong to phylogenetic groups b2 or d, out of which b2 isolates are more prevalent among the intestinal pathogenic strains whereas the commensal one belongs to group a or group b1 . Irrespective of the presence or absence of virulence genes or factors, the status of the host can be critical for the development of an infection . Studying bacterial isolates from different diseased hosts like pyelonephritis, cystitis and asymptomatic bacteriuria (abu) is common, but for sepsis it is not known . Genetically, extraintestinal pathogenic e. coli harbours a variety of vfs, which gathered into pathogenicity - associated islands and enhance the capacity of e. coli to cause systemic infections . However, it is still not clear how strains with apparently low virulence can cause sepsis, not only in compromised but also in noncompromised hosts . It is conceivable that these strains may possess unrecognized vfs or specific vfs that may facilitate bacteraemia . Previous studies described papc and aer as the minimal prerequisite for bacterial passage from kidney infection into the bloodstream . The role of e. coli vfs in the pathogenesis of sepsis in relation to the site of its primary infection is virtually unknown . Virulence properties of the isolates belonging to phylogenetic groups a and b1 were not analysed . To understand the role of commensal intestinal e. coli as a potential source for pathogenic and e. coli populations, we investigated the phylogenetic groups and virulence profile of the blood and faecal e. coli isolates from patients with and without sepsis, respectively, admitted to the icu . The faecal isolates were not collected from the same sepsis patients because such patients will definitely have an effect on their gut flora and would not have acted as a suitable control . We established phylogenetic grouping of e. coli isolates into four groups: a, b1, b2 and d . No significant difference was observed in the prevalence of the commensal and pathogenic phylogenetic groups in the blood and faecal e. coli isolates . However, group b1 was more prevalent in the faecal e. coli isolates, suggesting they may have been acquired from the hospital environment by these patients . A high prevalence of e. coli in the group d blood isolates corroborates the nature of the e. coli as an extraintestinal pathogenic strain . The aberrant observation of high prevalence of groups b2 among the faecal e. coli isolates may be attributed to hospital - acquired infections . A collective high prevalence (54%) of groups b2 and d among the faecal e. coli isolates may be ascribed to the varied bacterial characteristics, antibiotic usage or genetic factors of the host . The observed difference in distribution of e. coli phylogenetic groups between pathogenic and commensal e. coli populations was similar to those in an earlier study that compared faecal and urine isolates from different host population cohorts . Because faecal flora is considered to be the natural reservoir of pathogenic strains in extraintestinal infections, the phylogenetic distribution of commensal e. coli isolates from healthy individuals could provide an important comparison of and insight into the spread of the potential pathogenic lineage . Previous reports indicated that group b2 e. coli strains are rare in faecal samples, which is contrary to our data . This implies that acquiring the group b2 strain in faecal samples is important in the risk of infection . In a similar phylogenetic study among patients with utis, group b2 dominated in the uropathogenic strains, while they also accounted for about 50% of the rectal specimen . The high percentage of group b2 and group d in the faecal e. coli isolates prompted us to ask how frequently the virulent b2 pathogens that are routinely carried by healthy humans would affect the disease dynamic in this population . In order to find possible link between strain phylogeny and individual virulence genes, we analysed an overall virulence profile (papg, fimh, sfa, afa, cnf1, hlya, aer, trat and pai) of blood and faecal e. coli isolates . The aggregate score of the virulence was found to be higher in blood than in faecal e. coli isolates . We observed a variable expression of virulence genes among the commensal (a and b1) and pathogenic (b2 and d) groups of blood and faecal e. coli isolates . An unexpected high expression of the virulence genes among the faecal e. coli isolates indicated a role of these genes in the development of infection and suggested that the challenged host environment (such as the presence of catheters or hospital - acquired infections, or even poor hygiene due to infrequent urination of the patient, leading to a high vulnerability) may have altered the bacterial pathogenicity . In e. coli extraintestinal infections, phylogenetic group b2 was found to be predominant and more virulent than other phylogenetic groups . An ascending route was proposed to be the major pathway of e. coli causing utis . In addition to the virulence factors, host factors such as obstructions and immune - compromising conditions may favour the development of uti among such patients . Out of the vfs examined in this study, papg, sfa, afa, cnf1 and hlya were found to be more prevalent in the blood than the faecal e. coli isolates . Our data suggest that the adhesin coding gene fimh was the most prevalent among all the phylogenetic groups of blood and faecal e. coli isolates . Fimh - mediated biofilm formation is known to facilitate bacterial colonization of urinary catheters and other medical implants an unfortunately common problem for hospitalized individuals . An unexpected high expression of the virulence genes aer, trat and pai among the faecal e. coli isolates indicates their role in the development of infection . A high prevalence of these virulence genes may have led to the entry of commensal e. coli into the bloodstream, leading to sepsis . Hlya and trat are known to predict the bacterial pathogenicity among both compromised and noncompromised hosts . The prevalence of adhesin and toxin (papg, sfa, afa, cnf1 and hlya) genes was significantly higher in the e. coli isolates from the blood compared to faecal e. coli isolates, indicating a possible association to the pathogenic conditions . The high prevalence of adhesins in blood and faecal e. coli isolates than the expression of toxins or other virulence factors is arguably the most important determinant of pathogenicity . Surprisingly, no difference was observed in the prevalence of fimh, aer, trat and pai among the e. coli isolates of both these groups, indicating a role of the host environment in stimulating the bacteria to acquire these vfs and thus inducing the bacterial pathogenicity . The analysis of virulence gene expression suggested a variable prevalence of aer, trat and pai in the phylogenetic groups among blood and faecal e. coli isolates . The unusual high prevalence of pai in the faecal e. coli isolates in our study indicates its role in making these patients vulnerable to severe infection . These observations suggest that the faecal e. coli isolates may transform a nonsepsis condition into sepsis in a hospital environment . In addition, the similar prevalence of aer, trat, and pai in blood and faecal e. coli isolates is contrary to the findings of previous studies in e. coli strains from urosepsis . In summary, we report for the first time a correlation of phylogenetic groups with important virulence markers in blood and faecal e. coli isolates from patients with and without sepsis admitted to the icu . The high prevalence of all the vfs studied in the blood and faecal e. coli isolates and a similar prevalence of aer, trat and pai indicate their role in the sustenance and development of infection . The specific association of hlya and cnf1 in the blood and faecal e. coli isolates indicate that the host environment may have an important role to play for a differential expression of virulence genes, thereby causing pathogenicity among these isolates in hospital settings . Therefore, our data suggest that faecal isolates could become pathogenic in the immunocompromised patients under challenging host conditions . Our study also indicates that patients prone to a severe form of infection in the hospital environment may be identified on the basis of their virulence profile . Further investigation is required to determine the interplay of these vfs and concurrently identifying the mechanisms regulating the expression of these traits in sepsis and nonsepsis e. coli isolates in order to improve the management of infectious diseases.
|
A 54-year - old male patient with a height of 170 cm and weight of 77 kg visited a private hospital due to a headache and weakness in left muscle that started the day before his hospital visit . During the examination, the patient showed decreased consciousness, and internal hemorrhaging in the cerebral ventricle was observed in the ct scan, hence he was transferred to our hospital . When he arrived at the emergency room, the patient was semi - conscious and had difficulty in breathing, and his glassgow coma scale (gcs) showed severe head trauma with a total score of 8 or lower . The head ct scan revealed worsened stage of hemorrhage in the cerebral ventricle, so he was immediately intubated and transferred to the icu . A day after entering the icu, the hemorrhaging in the patient was still worsened according to the ct scan and he was in a semi - comatose state; therefore, an extra ventricular drainage (evd) was done to decrease the pressure in the brain and hematoma aspiration was also carried out . In addition, an emergency tracheostomy was done at the same time since long term mechanical ventilation was expected . Preoperative vitals were a blood pressure of 150/80 mmhg, a heart rate of 100/min, a respiration rate of 24/min, a body temperature of 38, and a spo2 of 97% . After administering 0.2 mg of glycopyrrolate after complete loss of consciousness, muscle relaxation was achieved with 8 mg of vecuronium . Alfentanil at a concentration of 1.0 mg was administered to minimize hemodynamic changes when replacing the tube and at the same time anesthesia was maintained with o2 supply of 1 l / min, air supply of 2 l / min, and 2.0 vol% of sevoflurane . Considering the difficulty in maintaining airway characteristics in head surgery, the previously intubated polyvinylchloride (pvc) plain tube was replaced with a reinforced tube . The patient's vitals immediately after intubation were blood pressure of 130/70 mmhg, a heart rate of 95/min, and a spo2 of 98% . Starting from the evd, the operation proceeded smoothly and the tracheostomy was done in 2 hours and 30 minutes . Ten minutes after starting the tracheostomy, the fio2 increased to 1.0 . While adjusting for bleeding around the tracheal cartilage with monopolar coagulation before inserting the tracheostomy tube, a fire of about 15 cm in size suddenly started perpendicular to the direction of the trachea . The supply of sevoflurane and 100% o2 was immediately stopped after the initiation of fire and manual ventilation was done at a fio2 of 0.2 . Normal saline was used to extinguish the fire and soon the condition was brought under control . The endotracheal tube (reinforced tube) was taken out, tracheostomy tube was intubated to maintain manual ventilation, and spo2 was again increased to 98% . Vitals before and after the tracheostomy were stable except for the temporary decrease in spo2 . The condition of the tube after extubation was as follows: the part directly above the cuff had holes due to melting from the heat; the coil inside the tube had melted, and there was overall charring (fig . The operation was completed without occurrence of any further incident, and since the patient was still in a semi - coma state, he was transferred to the icu while maintaining bag ventilation through the tracheostomy tube . In the abga conducted directly after being transferred to the icu, the ph was 7.406; the pco2 was 33.6 mmhg; the po2 was 121 mmhg; the hco3 was 20.7 mmhg, and oxygen saturation was 97.8% . There were no observable changes in the chest x - rays both, before and after the operation (fig . The patient showed no improvement in consciousness during continuous mechanical ventilation; therefore, 5 days after the surgery, the patient was transferred to another hospital as per the wishes of the guardian . There were no irregularities in the chest x - ray images and clinical symptoms after being monitored for 4 months post - surgery (fig . Intra - tracheal tube fire is rare and yet a critical emergency that can cause fatal complications . Despite numerous studies on the cause and prevention of fire, of course, when a fire occurs, the type of operation and the cause for the fire are different . It can occur during operations using lasers, in tracheostomies, and there exists reported incidents for double - lumen tubes . The three important factors that contribute to the occurrence of intra - tracheal fires are oxygen, fuel, and heat . The high concentration of oxygen is the main cause of fire, but there are reports of fires occurring at 50% oxygen concentrations and can even occur in 25% oxygen environments, which is similar to the atmosphere . Therefore, caution is needed especially in tracheostomy since 100% highly concentrated oxygen is typically used, which is characteristic of the operation . For fuel, the intra - tracheal tube itself is the problem since tubes generally consist of pvc material . In tracheostomy, the risk of fire is increased since fire - resistant tubes are not used, unlike in other laser operations . Our present case also employed a reinforced tube, since tracheostomy was done after the neurosurgery, which is believed to be one of the reasons for the fire . There are reports of heat occurring in all modes of cutting, coagulation, and blending . Therefore, when doing a tracheostomy, the use of electrocautery is minimized or a bipolar is used, but the bipolar can also cause sparks while coming into contact with tissue; so it cannot be considered as a completely safe alternative . Our case also considered these points and tried to minimize the use of electrocautery during the operation . However, it is believed that the reinforced wire was exposed due to damage to the tube cover during the process of cutting into the mesh . There was immediate occurrence of hemorrhage before inserting the tube, and while urgently trying to control the bleeding, the electrocautery and reinforced wire are believed to have reacted to initiate the fire . Although there are a number of reports on intra - tracheal tube fires and numerous reports on the review, prevention, and countermeasures of tube fires, currently there are no accurate protocols established regarding this situation . However, when similar cases and reports are put together, there are some common suggestions and advice, which can be organized as follows: 1) use a tube of sufficient length so the tip of the tube can reach directly above the carina to minimize the possibility of damaging the balloon during tracheostomy, 2) avoid using flammable gases for anesthesia, 3) fill the balloon with normal saline, 4) maintain the safest minimum level of fio2 when using nitrous oxide or helium, 5) remove the by - products of the electrocautery (smoke, burnt tissue) through a sufficient amount of suction before performing the tracheostomy, 6) insert the tube deeply before the tracheostomy, 7) the surrounding area needs to have sufficient hemostasis before proceeding and avoid using electrocautery for the tracheostomy, and 8) when there is hemorrhage after a tracheostomy, carry out ligature of the hemorrhage with the tube and cuff in place, or use bipolar electrocautery . There are also reports, which state that peep ventilation can decrease the risk of fire . Whereas, rhee et al . Reported that by filling the balloon with normal saline and mucous lidocaine, tube fires can be prevented that can occur in laser operations as well as maintain the shape of the balloon and ventilation when there are punctures in the air balloon due to fire and other incidents . Additionally, maintaining the aridness of the operating room to prevent fires and preparing containers and ambu bags with normal saline in case of fire emergencies are also considered as important factors . The above - mentioned methods may prevent fire emergencies, but necessary countermeasures to combat the occurrence of fire must also be devised . The anesthesiologist needs to first check the state of the patient, quickly separate the pipe streaming anesthetic gas from the tube, and attempt ventilation with atmospheric air . At the same time, there needs to be cooperation amongst the surgeons to extinguish the fire . Dealing with a tube that has been on fire is another part that should not be ignored . There is controversy regarding immediate extubation after the incidence of a tube fire . In the past, immediate extubation was recommended considering the chemical risks due to the evolution of toxic substances from the burnt tube and the damage to the trachea . However, chee and benumof argue that immediate extubation is not always the best option, considering that the damage from the fire is minimal in most of the cases of fire reported until now; most of the patients undergoing tracheostomies have difficulties in maintaining their airways due to edema, which is the leading cause of morbidity and the increase in the death rate in accidents involving anesthesia is hypoventilation and hypoxia . In our case, immediate extubation and intubation of the endotracheal tube were done, but in post - operative examinations, there were no problems with the trachea itself and there was no chemical damage . It is most important to consider the risk benefit on a case - by - case basis rather than setting a general rule regarding the timing of the extubation . In conclusion, it is important in tracheostomies to understand that though occurrence of fires are rare, they are still possible along with other risk factors and the surgeons must be attentive in terms of preventing the occurrence of fires . Caution needs to be taken, since tube fires can occur in unexpected areas such as the reinforced wire in our case . In addition, when a tube fire does occur, it is very important to minimize additional damage or burns in the respiratory tract through appropriate and fast responses, and to determine a suitable time for extubation according to the specific situation.
|
The sars outbreak in vietnam began with the admission of a traveler from hong kong on february 26, 2003, to hospital a, a 56-bed, three - story, privately owned and expatriate - operated facility located in hanoi . Within 2 weeks, extensive nosocomial transmission of sars occurred in workers, patients, and visitors in hospital a. on march 12, hospital a was closed to new admissions except for sick hospital a workers . On that date, the 120-bed, six - story public hospital b began admitting patients with suspected and probable sars . Hospital b treated 33 patients with laboratory - confirmed sars between march 12 and may 2, 2003, the discharge date of the last patient (figure). Of these, 23 were admitted directly to hospital b, and 10 were transferred from hospital a to hospital b on march 28 . Many of hospital b s 33 patients were exposed to sars as patients or visitors in hospital a. laboratory - confirmed cases of severe acute respiratory syndrome (sars) by date of admission, in hospital a and hospital b, vietnam, february the ten case - patients who were transferred from hospital a to hospital b on march 29, 2003, are noted by cross - hatching . No nosocomial sars - associated coronavirus (sars - cov) transmission was reported in hospital b, and none of its 117 healthcare workers (defined as all staff working in the hospital building during the sars outbreak) became ill with a sars - compatible illness . When hospital b began admitting patients, visitors were not tightly restricted, the main elevator was out of service, and families and workers often used the designated patient elevator . Researchers (k.c.l ., h.q.n .) And infection control advisors working daily on the hospital b wards reported variable infection control and patient isolation, particularly during the early weeks . On march 19, formal infection control training was organized and substantial technical support and supplies arrived from who, mdecins sans frontires belgium, and the japan international cooperation agency . Systems were established to restrict visitors, and entry guards and mdecins sans frontires advisors were tasked with distributing and monitoring personal protective equipment, such as n95 masks, gloves, gowns, and hand sanitizer . Two of the authors of this article (k.c.l ., h.q.n . ), who worked daily on the wards, observed that infection control practices improved considerably after these interventions . To help researchers determine whether sars - cov transmission occurred among hospital b healthcare workers, staff were offered serologic testing from may 12 to 14 and were asked to complete a short questionnaire in vietnamese . Participants provided written consent and answered questions about demographics, level of contact with sars case - patients, and personal protective equipment use during the busiest week of patient admissions (march 1219) and the remaining weeks of the outbreak . Serum specimens were analyzed at the national institute for hygiene and epidemiology, hanoi, and at the centers for disease control and prevention, atlanta, by indirect enzyme - linked immunosorbent assay (elisa) and indirect immunofluorescence (ifa) on vero e-6 cells infected with sars - cov (1). Data were double - entered into excel and analyzed with sas version 8.0 (sas, inc ., cary, nc). Of 117 hospital b healthcare workers, 108 participated (92.3% response rate). According to the hospital director, all 9 nonparticipants remained well, and none had a history of sars - like illness . Among participants, 62 (57.4%) respondents worked on the sars wards (table). Most (85.5%) were physicians and nurses . During the first week of sars patient care in hospital b, 39 (62.9%) of sars ward workers reported working in sars - patient rooms for> 6 hours on their single busiest day . Of the 62 workers, 58.1% and 64.5% reported being in sars patient rooms during medication nebulizer treatment, and 65% reported being in patient rooms during noninvasive positive pressure ventilation . All but one respondent wore a mask always or usually while in sars patients rooms . However, during the first week of sars patient care in hospital b, 43 ward workers (69.4%) reported wearing only a cloth or surgical mask, often in combination . All 62 sars ward workers reported using an n-95 mask after march 19, although only 56 (90.3%) reported always or usually using a mask while in sars patients rooms . Respondents reported using gloves 77.4% of the time before march 19 and 75.8% after march 19 . Reported symptoms and personal health behaviors of healthcare workers are also presented in the table . One sars ward respondent reported a fever, and less than 23% reported either a cough or sore throat . First, our survey is subject to recall and reporting bias, because not only was it difficult for respondents to recall behaviors during specific periods within the previous 2 months, but respondents may have been concerned that results could be used to evaluate their performance . Estimates of sars exposures and the frequency of personal protective equipment use among sars ward workers are therefore probably inflated . Second, we collected serum specimens approximately 10 to 12 days after the last sars patients were discharged; although these patients were discharged after their 5th to 6th week of illness, the minimal chance that a patient shed virus beyond the usual 2- to 3-week period (2) would theoretically mean that a few participants may have been tested before seroconversion . A third limitation is our lack of data on hand - washing or sanitizing practices, important means of preventing respiratory virus droplet spread . The finding of no infection with sars - cov among hospital b workers in the presence of 33 confirmed sars case - patients may support the hypothesis that, in the absence of a superspreading patient or event, most sars patients will not transmit the virus (36). For example, in singapore, 81% of the first 205 reported probable case - patients had no evidence of transmission of clinically identifiable sars to other persons (3). Over 35 healthcare workers in our study reported being exposed to a sars patient during events that can potentially generate aerosols (i.e., nebulizer treatment or noninvasive positive pressure ventilation), yet they did not acquire sars . Although likely many factors contributed, we demonstrated a lack of sars transmission both before and after the provision of formal infection control training and personal protective equipment . Contrasting the hospital b situation with that of neighboring hospital a may be helpful; in hospital a, extensive transmission clusters followed admission of the index case - patient . The 23 directly admitted hospital b patients were less severely ill than the 38 hospital a patients . In vietnam, the best available measure of relative disease severity is the death rate and the maximal level of respiratory assistance provided . Although no hospital b patients died or received invasive mechanical ventilation, four received biphasic intermittent positive airway pressure . Seven hospital a case - patients were intubated; an additional two received biphasic intermittent positive airway pressure . Five hospital a case - patients died in vietnam, and the index case - patient died in hong kong (7). Hospital a workers did not wear masks in the earliest days after the index case - patient was admitted, although shortly after the recognition of this nosocomial cluster, enhanced infection control measures were initiated . In contrast, by the time patients were going to hospital b for evaluation, both patients and healthcare workers were wearing masks (n.t . Van, pers . Comm .) Hospital a nursing staff likely also had longer and closer contact with sars patients . In nursing style, hospital b resembled those of other public hospitals in vietnam, where nursing is traditionally a shared function with family members . Families of sars patients in hospital b were observed by authors (k.c.l ., n.q.h .) To be feeding, bathing, and toileting the patients . Hospital a nurses, however, were required by hospital guidelines to assume most patient care functions traditionally shared with the patient s family (l.t . Comm . ), thereby increasing their direct contact with sars patients and their respiratory and other secretions . Furthermore, the more severely ill sars patients of hospital a likely required more intensive nursing care, perhaps increasing the duration and dose of sars - cov exposure . Environmental conditions at the two hospitals differed, but the impact of these differences on sars transmission is unclear . Hospital a was a more modern facility; however, hospital b had designated sars isolation wards and large spacious rooms with high ceilings and ceiling fans and large windows kept open for cross - ventilation . In contrast, hospital a s rooms were smaller, and individual air - conditioning units were in use early during the outbreak . In addition, hospital a had diverse patients (maternity, postoperative, pediatric, etc .) Housed on the same hospital floor when the sars outbreak began . The findings of lack of transmission among hospital b healthcare workers raises the question of whether family caregivers or visitors might have become infected with sars - cov, and about the relative infectiousness of hospital b patients in general . Although overt sars transmission to visitors occurred in hospital a, no such transmission to visitors was observed in hospital b. we lack adequate data to quantify the exposure of visitors to patients at either hospital, but the authors who were present (k.c.l ., h.q.n .) Noted that after the first week, most hospital b family members tended to always wear masks and to rarely use gloves . Studies assessing the serologic status of family and community contacts of case - patients are ongoing . Although community transmission did not seem to play a major role in the vietnam sars outbreak, at least two episodes are known in which sars transmission occurred outside the hospital setting . This visitor was severely ill and was later hospitalized at hospital b on day 10 after symptom onset; he is known to have transmitted infection to one contact in the 4 hours immediately before his admission . If sars viral shedding peaks on day 10 of illness and continues for 23 weeks (3), we can assume that some of the hospital b patients were still infectious during their hospitalization . Among the 23 directly admitted hospital b patients, the median days to admission was 7 (range 113) after illness onset . In conclusion, we found no evidence of sars - cov transmission among hospital b workers, despite contact with laboratory - confirmed sars case - patients and variable infection control practices and use of personal protective equipment . This finding may be explained by differences in infection control practices, use of personal protective equipment (including masks for patients as well as healthcare workers), nursing style, environmental features, and clinical factors such as severity of illness and the absence of a highly infectious sars - cov spreader . More study is needed to determine how each of these factors affects the risk of sars transmission if we are to adequately prepare for future sars epidemics.
|
Since the international subarachnoid aneurysm trial, endovascular coil embolization has been widely used for the treatment of intracranial aneurysms (1, 2). Moreover, improved devices and advanced coiling techniques have made it possible to treat an increased number of aneurysms, including those with difficult configurations . Among them, the stent protection technique has significantly widened the applicability of endovascular therapy (3). However, it is relatively well known that coiled aneurysms have a relatively high recanalization rate . Although digital subtraction angiography (dsa) is considered to be a standard test to assess recanalization, there are many reports that mr angiography (mra), which is noninvasive and non - irradiating in nature, is useful as a follow - up tool in coiled aneurysms (2, 4 - 6). In patients treated with stent - assisted coil embolizations, however, there have been concerns of a susceptibility artifact or radiofrequency shielding by a closed - cell stent, especially with the enterprise (codman, raynham, ma, usa). Therefore, we evaluated the interobserver and intermodality agreement in the interpretation of the time of flight (tof) mra for the follow - up of coiled intracranial aneurysms with the enterprise stent for the diagnosis of recanalization and in - stent stenosis . This study was conducted with the approval of the institutional review board of the seoul national university hospital . From june 2008 to april 2012, we performed endovascular treatment for 1254 patients with 1510 intracranial aneurysms . During this period, a total of 385 aneurysms underwent coil embolization using the enterprise stent . Among patients who had a follow - up evaluation interval of greater than 6 months, 40 patients (with 44 aneurysms) who underwent both tof mra and dsa follow - up with an interval gap of less than 2 months were included in this study . Our patients included 10 males and 30 females with a mean age of 58.8 9.6 years . The middle cerebral artery was the most common location, followed by the internal carotid artery and posterior circulation . The maximal aneurysm diameter ranged from 1.9 mm to 23.9 mm (mean, 7.7 4.5 mm). Initial occlusion immediately after coil embolization was classified using the 3-point raymond scale (7), and 16 residual aneurysms were included . The mean time gap between the tof mra and dsa was 41.0 25.2 days, and the interval between the follow - up dsa and coil embolization was 14.2 25.2 months (median 12 months). 1.5 tesla (t) (n = 28) or 3 t (n = 16) mr scanners were used for the acquisition of the 3d tof mra images . Intracranial 3d tof mra was performed in conjunction with the conventional mri, using a multiple overlapped and acquisition technique . In the imaging with the 3d tof mra, the following ranges of parameters were used: 3d fast imaging with steady procession; tr, 21 - 38 ms; te, 2.4 - 7.2 ms; flip angle, 18 - 25 degrees; effective section thickness, 0.5 - 1.2 mm; fov, 130 - 190 130 - 220 (maximum intensity projection [mip] images) and 175 - 240 190 - 270 (source images [si]); and 256 - 640 192 - 512 matrix covering an area from the clivus to the genu of the corpus callosum . Both rotational mip images and si (axial acquired partitions the dsa was performed using a biplane system (integris allura; philips medical systems, best, the netherlands) via transfemoral catheterization and selective injection of contrast media into the carotid or vertebral arteries . Imaging was performed to a standard and with adequate working projections as required . On both the follow - up tof mra and dsa, the degree of coiled aneurysmal stability was classified as follows: stable occlusion (no flow or filling of the contrast within the aneurysm); minor recanalization (slight residual flow or contrast filling at the neck of the aneurysm); or major recanalization (residual flow or contrast filling of the aneurysmal sac) (fig . Major recanalization required further treatment . In - stent stenosis was confirmed in the follow - up dsa . The degree of stenosis was represented as the ratio of the stented segment diameter to the diameter of the adjacent proximal non - stented segment . An in - stent stenosis of more than 33% on the dsa was considered significant (9), regardless of the presence of hemodynamic alterations or potential clinical implications . The set of follow - up tof mra images were randomly arranged and two experienced neurointerventionists (ydc, hsk) who were blinded to the pertinent clinical and radiologic information independently reviewed the follow - up mra mip images alone (' mip mode'), and both mip images and sis (' si mode') 4 weeks later to evaluate recanalization . In cases of disagreement, a consensus was established by a third interventional neuroradiologist (mhh). In addition, we compared the capability of the tof mra (mip images alone and si alone, respectively) to depict the residual flow within the coiled aneurysms and the stented parent arteries with that of the dsa (gold standard). The mr images were classified into three categories: " good " (when the images demonstrated similar features to the dsa), " poor " (when an evaluation could not be made), and " moderate " (when an evaluation could be made but information was lacking compared with the dsa) (5). The level of interobserver and intermodality agreement for the evaluation of the tof mra was analyzed by means of weighted kappa statistics . A comparison between the tof mra and the dsa for the detection of aneurysmal recanalization was made . The interpretation of was as follows: <0 indicated no agreement; = 0 to 0.19, poor agreement; = 0.20 to 0.39, fair agreement; = 0.40 to 0.59, moderate agreement; = 0.60 to 0.79, substantial agreement; and = 0.80 to 1.00, almost perfect agreement . All analyses were performed using medcalc software (version 12; mariakerke, belgium). This study was conducted with the approval of the institutional review board of the seoul national university hospital . From june 2008 to april 2012, we performed endovascular treatment for 1254 patients with 1510 intracranial aneurysms . During this period, a total of 385 aneurysms underwent coil embolization using the enterprise stent . Among patients who had a follow - up evaluation interval of greater than 6 months, 40 patients (with 44 aneurysms) who underwent both tof mra and dsa follow - up with an interval gap of less than 2 months were included in this study . Our patients included 10 males and 30 females with a mean age of 58.8 9.6 years . The middle cerebral artery was the most common location, followed by the internal carotid artery and posterior circulation . The maximal aneurysm diameter ranged from 1.9 mm to 23.9 mm (mean, 7.7 4.5 mm). Initial occlusion immediately after coil embolization was classified using the 3-point raymond scale (7), and 16 residual aneurysms were included . The mean time gap between the tof mra and dsa was 41.0 25.2 days, and the interval between the follow - up dsa and coil embolization was 14.2 25.2 months (median 12 months). 1.5 tesla (t) (n = 28) or 3 t (n = 16) mr scanners were used for the acquisition of the 3d tof mra images . Intracranial 3d tof mra was performed in conjunction with the conventional mri, using a multiple overlapped and acquisition technique . In the imaging with the 3d tof mra, the following ranges of parameters were used: 3d fast imaging with steady procession; tr, 21 - 38 ms; te, 2.4 - 7.2 ms; flip angle, 18 - 25 degrees; effective section thickness, 0.5 - 1.2 mm; fov, 130 - 190 130 - 220 (maximum intensity projection [mip] images) and 175 - 240 190 - 270 (source images [si]); and 256 - 640 192 - 512 matrix covering an area from the clivus to the genu of the corpus callosum . Both rotational mip images and si (axial acquired partitions) were used in the evaluation of the follow - up results . The dsa was performed using a biplane system (integris allura; philips medical systems, best, the netherlands) via transfemoral catheterization and selective injection of contrast media into the carotid or vertebral arteries . On both the follow - up tof mra and dsa, the degree of coiled aneurysmal stability was classified as follows: stable occlusion (no flow or filling of the contrast within the aneurysm); minor recanalization (slight residual flow or contrast filling at the neck of the aneurysm); or major recanalization (residual flow or contrast filling of the aneurysmal sac) (fig . The degree of stenosis was represented as the ratio of the stented segment diameter to the diameter of the adjacent proximal non - stented segment . An in - stent stenosis of more than 33% on the dsa was considered significant (9), regardless of the presence of hemodynamic alterations or potential clinical implications . The set of follow - up tof mra images were randomly arranged and two experienced neurointerventionists (ydc, hsk) who were blinded to the pertinent clinical and radiologic information independently reviewed the follow - up mra mip images alone (' mip mode'), and both mip images and sis (' si mode') 4 weeks later to evaluate recanalization . In cases of disagreement, a consensus was established by a third interventional neuroradiologist (mhh). In addition, we compared the capability of the tof mra (mip images alone and si alone, respectively) to depict the residual flow within the coiled aneurysms and the stented parent arteries with that of the dsa (gold standard). The mr images were classified into three categories: " good " (when the images demonstrated similar features to the dsa), " poor " (when an evaluation could not be made), and " moderate " (when an evaluation could be made but information was lacking compared with the dsa) (5). Two experienced neurointerventionists (ydc, mhh) reviewed the images . The level of interobserver and intermodality agreement for the evaluation of the tof mra was analyzed by means of weighted kappa statistics . A comparison between the tof mra and the dsa for the detection of aneurysmal recanalization was made . The interpretation of was as follows: <0 indicated no agreement; = 0 to 0.19, poor agreement; = 0.20 to 0.39, fair agreement; = 0.40 to 0.59, moderate agreement; = 0.60 to 0.79, substantial agreement; and = 0.80 to 1.00, almost perfect agreement . All analyses were performed using medcalc software (version 12; mariakerke, belgium). Among 44 aneurysms, stable occlusion was demonstrated in 25, minor recanalization in 8, and major recanalization in 11 . In - stent stenosis of more than 33% was observed in 5 patients . In mip and si modes, interobserver agreement was found to be good for tof mra (= 0.835, range 0.709 to 0.961; = 0.731, range 0.563 to 0.898, respectively). The discrepancy between observers was caused by the following: the confusion between the normal branch and the recanalized portions due to signal loss induced by the stent (n = 5), measurement differences in the degree of recurrence (n = 2), and the difference of interpretation in the cases of small recanalized portions that were parallel to the axial acquisition of the stented artery (n = 2). When we compared the tof mra with the dsa, the si mode demonstrated almost perfect agreement (= 0.892, range 0.767 to 1.000), which was better than the mip mode (= 0.598, range 0.370 to 0.826) (fig . 2). There was no significant difference between the 1.5 t (26/28, 92.8%) and 3 t (15/16, 93.8%) mr scanners . Two major recanalizations on the dsa were rated as a stable occlusion in one and as a minor recanalization in the other on the mra . The recanalized portions of both aneurysms were small and located at the paraclinoid internal carotid artery with an inferior direction . The small recanalized parts were parallel to the axial acquisition of the stented parent artery, and there were signal losses related to the enterprise stents in the mip images, and overlap of the recurred portion of the aneurysm with the stented parent arteries in the si (fig . The other case of stable occlusion on the dsa was interpreted as a minor recanalization on the mra . The discrepancy was due to suboptimal projection of the coiled aneurysm on the dsa, which hindered the revealing of a small recanalized portion covered with coils . In terms of the depiction of the internal and neck portions of the coiled aneurysms on the tof mra, the si produced better depictions than the mip image; the rate of good or moderate depiction was 93.1% and 63.6%, respectively . With regard to the in - stent stenosis, both images showed poor depiction in most cases (97.7% and 95.5%) (table 3). Among 44 aneurysms, stable occlusion was demonstrated in 25, minor recanalization in 8, and major recanalization in 11 . In - stent in mip and si modes, interobserver agreement was found to be good for tof mra (= 0.835, range 0.709 to 0.961; = 0.731, range 0.563 to 0.898, respectively). The discrepancy between observers was caused by the following: the confusion between the normal branch and the recanalized portions due to signal loss induced by the stent (n = 5), measurement differences in the degree of recurrence (n = 2), and the difference of interpretation in the cases of small recanalized portions that were parallel to the axial acquisition of the stented artery (n = 2). When we compared the tof mra with the dsa, the si mode demonstrated almost perfect agreement (= 0.892, range 0.767 to 1.000), which was better than the mip mode (= 0.598, range 0.370 to 0.826) (fig . 2). There was no significant difference between the 1.5 t (26/28, 92.8%) and 3 t (15/16, 93.8%) mr scanners . Two major recanalizations on the dsa were rated as a stable occlusion in one and as a minor recanalization in the other on the mra . The recanalized portions of both aneurysms were small and located at the paraclinoid internal carotid artery with an inferior direction . The small recanalized parts were parallel to the axial acquisition of the stented parent artery, and there were signal losses related to the enterprise stents in the mip images, and overlap of the recurred portion of the aneurysm with the stented parent arteries in the si (fig . The other case of stable occlusion on the dsa was interpreted as a minor recanalization on the mra . The discrepancy was due to suboptimal projection of the coiled aneurysm on the dsa, which hindered the revealing of a small recanalized portion covered with coils . In terms of the depiction of the internal and neck portions of the coiled aneurysms on the tof mra, the si produced better depictions than the mip image; the rate of good or moderate depiction was 93.1% and 63.6%, respectively . With regard to the in - stent stenosis, both images showed poor depiction in most cases (97.7% and 95.5%) (table 3). After coil embolization for an intracranial aneurysm, a follow - up evaluation is important due to the possibility of re - opening during the follow - up period . Dsa is considered the gold standard of follow - up imaging modalities (2, 6, 10). However, dsa is an invasive study and requires exposure to radiation and contrast media . There have been reports showing the good diagnostic performance of the tof mra in the follow - up of patients with coiled aneurysms (11, 12). Recently, the usage of stents has been increasing . In the follow - up evaluations, the stent - induced signal loss makes it difficult to evaluate the status of the aneurysm occlusion and stented parent artery (2, 4, 6, 13). Notably, our results demonstrate that the tof mra could be accurate and effective as a follow - up imaging modality to estimate the status of aneurysm occlusion when we pay attention to the source images . Although 3d reconstruction of mip images had more limitations due to signal loss, axial source imaging contributed to the improved accuracy by observation of the residual flow within the coiled aneurysms . This means that the abluminal signal loss related to the stent would be less than the luminal one, and signal masking outside of the stent would not be significant enough to hinder evaluation of the re - opening of the coiled aneurysms . Therefore, we suggest that close observation of the source images in addition to the mip images is mandatory to investigate the recanalization . (12) reported that a small residual lumen and suboptimal projection at the dsa were independently associated with a discrepancy between the dsa and tof mra . (14) insisted that the helmet - style remnants yielded a higher preference of the mra compared with the dsa in the assessment of recanalization of the coiled aneurysms . In our series, we also observed a similar case . In addition, we found that it was hard to discriminate the recanalized portion from the stented parent arterial lumen if the recanalized parts were placed in a superior or inferior direction (as opposed to a medial or lateral direction), even with the axial source image analysis . Signal loss at the stented parent artery in the mra is caused by a susceptibility artifact and radiofrequency shielding (4, 13). Stent - induced mra signal loss is known to be variable, depending on the thickness and cell design of the stent, raw materials used to make the stent, stented arterial tortuosity and the mr parameter (4 - 6). The significant artifact related to the enterprise stent may be induced by the closed cell design and tantalum markers on both ends of the stent (5). There have been many reports that enterprise stents have lower procedural complication rates than neuroform stents due to easy navigation and delivery (15, 16). Our study showed that the tof mra was sufficient to assess re - opening of the coiled aneurysms, but it was not sufficient to evaluate in - stent stenosis of the parent artery, which is problematic due to the significant chance of in - stent stenosis . (17) reported that significant in - stent stenosis (> 50% based on diameter) developed in 3% of the patients treated with the enterprise stent . According to our data, there was a 12.7% chance of in - stent stenosis (more than a 33% luminal loss), as demonstrated by dsa (9). Recently, there have been some reports that contrast - enhanced (ce) mra had better image quality of the stented parent arteries than the tof mra (2, 4, 5, 18, 19). They also insisted that, especially in large residual aneurysms, the sensitivity of the ce mra might be superior to the tof mra . Still, however, the ce mra does not seem to replace dsa in the investigation of stented artery status . The limited spatial resolution and the potential for venous enhancement are limiting factors of this imaging modality . In addition, ce mra carries a small but definite risk of nephrogenic systemic fibrosis (12). Because in - stent stenosis should be evaluated during the follow - up period in patients with intracranial stents and ce mra cannot exactly reflect in - stent stenosis of the stented parent artery, we suggest that the tof mra is sufficient and effective to evaluate the aneurysms treated using enterprise stents and that the dsa should be performed at least once during the follow - up period . Both tof mra and dsa were not performed on the same day in most cases . Therefore, mra might not reflect the exact condition of the aneurysms and stented parent arteries compared to the dsa . Another potential limitation is that the mra images had a variety of different image qualities . This was due to mra scanning using different machines in one institution and these different machines happened to be of different field strengths . These limitations also may have reflected the reality of the mra readings in a tertiary referral hospital . In the end, we could not compare the tof mra and dsa with the ce mra because the ce mra was not included in the follow - up mr protocol of the coiled aneurysms . This study on the interobserver and intermodality agreement demonstrated that the tof mra provided sufficient accuracy in the screening for aneurysm recurrence after enterprise stent - assisted coil embolization, especially with the evaluation of the si, in addition to mip images in the tof mra . This study on the interobserver and intermodality agreement demonstrated that the tof mra provided sufficient accuracy in the screening for aneurysm recurrence after enterprise stent - assisted coil embolization, especially with the evaluation of the si, in addition to mip images in the tof mra.
|
Osteonecrosis of the femoral head (onfh) is a debilitating disease that can often lead to mechanical failure, with collapse of the articular surface and structural joint deformity.1,2 however, some cases of onfh remain asymptomatic if the necrotic lesion undergoes no collapse . The prognosis of onfh largely depends on the location and width of the necrotic lesion . When this lesion involves over two - thirds of the weight - bearing area of the femoral head, the rate of collapse has been reported to be around 94%.3 on the other hand, necrotic lesions occupying less than the medial two - thirds of the weight - bearing area have low risk of collapse around 19%.3 we herein describe a case of medially located onfh with an associated collapsed medial lesion . The patient was fully informed that her data would be submitted for publication, and she consented . A 60-year - old female (height, 158 cm; weight, 58 kg; bmi, 22) presented with gradually worsening left hip pain . Hip range of motion was not restricted . A t - score for bone mineral density based on the lumber spine was 1.5 sd, indicating the normal bone mass . A radiograph obtained 12 months after the onset of pain showed vertical sclerosis in the center of the femoral head, and the lesion inside the boundary demonstrated diffuse bony sclerosis (fig . No collapse was observed at the weight - bearing surface of the femoral head, but joint space narrowing was recognized in the medial portion . T1-weighted magnetic resonance imaging (mri) showed a vertical low - intensity band corresponding to the sclerotic rim on the radiograph (fig . Computed tomography (ct) showed a subchondral collapse at the medial lesion (fig . 4) was obtained to confirm the diagnosis, using a 6-mm diameter biopsy needle that was advanced from the distal portion of the greater trochanter to the medial lesion of the femoral head . Histologically, osteonecrotic bone trabeculae covered by appositional bone formation were seen within the lesion (fig . 5), and the bone marrow tissue contained vascular - rich fibrous tissues . Based on these findings, the diagnosis of onfh was made . The patient was treated with celecoxib 200 mg / day for 4 months, and her hip pain gradually decreased . The latest radiograph 9 months after biopsy showed neither progression of collapse nor joint space narrowing . A high signal intensity on fat - saturated t2 images generally suggests a lesion with a rich vascularity or an edematous area including bone tumor . Chondroblastoma is a rare bone tumor, arising from the secondary centers of ossification of long bones . The proximal femur is reported to be a common site of developing the tumor . Since a lytic lesion surrounded by sclerotic border is considered to be diagnostic features, some cases may be confused with onfh.4 osteoid osteoma usually occurs near the metaphysis rather than the epiphysis, and appears as a radiolucent nidus showing high signal intensity on t2 images, accompanied by bone marrow edema.5 although the imaging findings of our cases seemed to be less similar to those of the tumors, we were unable to make a diagnosis of onfh due to the atypical imaging findings . Then, we decided to perform the bone biopsy to clarify a diagnosis of our case . Microscopically, the high - intensity area consisted of abundant vascularized fibrous tissue in combination with thickened trabeculae, indicating the reparative condition of the necrotic lesion . Osteonecrotic lesions involving the medially located non - weight - bearing area generally remain asymptomatic . It has been reported that necrotic lesions occupying less than the medial two - thirds of the weight - bearing area have low risk of collapse to be around 19%.3 in addition, such osteonecrotic lesions generally tend to be repaired over time if they do not undergo collapse,6 and repaired necrotic lesions show osteosclerotic changes.7 in our case, most of the necrotic lesion was repaired by prominent appositional bone formation . Motomura et al.8 reported that collapse consistently involved fracture at the lateral boundary of the necrotic lesion, at the junction between the thickened trabeculae of the reparative zone and the necrotic bone trabeculae . In the current case, on the other hand, an axial ct slice showed a fracture at the anteromedial junction between the thickened trabeculae and the necrotic bone trabeculae, against the anterior edge of the acetabulum . We speculated that collapse might have been caused by the repetitive mechanical stress between the anterior edge of acetabulum and the anteromedial necrotic lesion adjacent to the thickened trabeculae of the reparative zone . Regarding the mechanisms of collapse in onfh, kenzora and glimcher9 reported that a fracture may begin in the region of the resorbed necrotic subchondral plate at the lateral junction between necrotic and viable bone . In our case, ct showed some degree of bone resorption around the collapsed lesion, whereas diffuse bony sclerosis was seen in the necrotic area, indicating that osteonecrotic area has been repaired . Further studies are necessary to conclude whether subchondral bone resorption antedates the collapse in onfh.10,11 regarding the distribution of the necrotic area in onfh, several studies have suggested the importance of vessels feeding the femoral head.1215 the superior retinacular artery is known to be the principal source of blood to a large area of the femoral head, including the weight - bearing area of the superior portion.12,13 on the other hand, the inferior retinacular artery (ira) has also been reported to contribute to the vascularity of the femoral head.14,15 boraiah et al . Reported that the ira feeds 62% of the medial half of the femoral head.14 furthermore, liu et al.15 reported that necrotic lesions tended to occupy the medial two - thirds or less of the weight - bearing area when the ira was damaged . The medial location of the necrotic area in our case might have resulted from a disturbance of the ira.
|
Behet's disease (bd) is an immune - mediated, systemic vasculitis, in which blood vessels of all sizes (small, medium, and large) in both the venous and arterial circulation can be affected . Clinically it is characterised by recurrent aphthous ulcers of the mouth and/or genitals in combination with other systemic manifestations involving the skin, eyes, joints, vessels, gastrointestinal tract, or central nervous system . It lies at the crossroad between autoimmune and autoinflammatory disorders, may be triggered by infectious agents, and is characterised by a number of immunological aberrations, such as neutrophil hyperactivity (reviewed in [3, 4]). Bd is most frequently observed in populations around the mediterranean basin, the middle east, and the far east, and the clustering of bd in populations along the ancient silk route suggests that an inherited tendency to bd was spread by travellers along these trading routes . Multiple studies, in multiple populations, have confirmed a strong association between hla - b51 and bd, but other genes are also likely to be involved . Copy number variation (cnv) is departure from the normal diploid number of genes (n = 2) which may arise from gene duplication and deletion events and which may contribute substantially to quantitative variation in expression . An increasing number of cnvs have been characterised in the human genome with implications for both evolution and disease susceptibility . This cluster carries 5 highly homologous genes that encode for low affinity receptors for igg - complexed antigens, which are expressed widely throughout the haematopoietic system . These low affinity fc - gamma receptors are involved in the regulation of a multitude of innate and adaptive immune responses, with implications for both response to infection and susceptibility to autoimmunity . Fcgr3b is expressed almost exclusively on neutrophils, and there is a clear correlation between gene copy number and fcgr3b cell surface expression, neutrophil adherence to igg - coated surfaces, and immune complex uptake . Further, multiple studies have identified low fcgr3b cn (i.e., <2 copies) as a risk factor for systemic autoimmune diseases, such as systemic lupus erythematosus [810], rheumatoid arthritis [11, 12], and primary sjgren's syndrome [9, 10]. We therefore examined the association between fcgr3b cnv and bd, in a cohort of iranian patients . Ethics approval was obtained from the rheumatology research centre's ethics committee of tehran university of medical sciences . 187 iranian bd patients were recruited from the behet's clinic at shariati hospital, tehran, from early 2005 until late 2006 . 178 ethnically - matched, unrelated healthy volunteers were also recruited as normal controls between 2005 and 2007 . All the bd patients recruited for this study met the international study group (isg) criteria for bd . Information was obtained regarding their age, gender, ethnicity, clinical features, and family history . Serotyping for hla - b51 status was carried out in selected general immunologic laboratories within iran using routine commercial kits . Genomic fcgr3b cn was determined using a quantitative real - time pcr method, as previously described . Briefly, a duplex taqman copy number assay was performed, using fcgr3b specific primers (applied biosystems, hs04211858, fam - mgb dual labeled probe) and rnase p (applied biosystems, product 4403326, vic - tamra dual - labeled probe) as the reference assay . The assay was performed according to the manufacturer's instructions and pcr reactions were run on an applied biosystems 7300 real - time pcr machine . Copy number was determined using copy caller software (v.1.0, applied biosystems, usa), and results were accepted only when calling confidence was> 80%, and cq standard deviation between replicates was <0.20 . Analysis of fcgr3b cn in bd patients compared to controls, and with clinical manifestations within bd patients, was performed using logistic regression . 187 bd patients were included in the study (mean age 32.7 8.2, 48% female). Baseline characteristics are summarised in table 1 . Of those who were tested for hla status, 51% (89 of 175) were hla b5 positive and 51% (41 of 80) were hla b51 positive . The frequency of fcgr3b cn variants in both bd patients and controls is presented in table 2 . Copy numbers ranged from 1 to 4, and no null genotypes were observed in this cohort . The odds ratio for low copy number (<2 cn) was 0.6 (95% ci 0.30, 1.21, p = 0.16) and the odds ratio for high copy number (> 2 cn) was 0.75 (96% ci 0.33, 1.73, p = 0.50). Therefore there was no evidence that either low or high fcgr3b was associated with bd, and in fact, both low cn and high cn were slightly decreased in bd patients relative to controls . Further, there was no evidence of associations between fcgr3b cn variants and clinical manifestations within bd patients as shown in table 3 . This is the first study to examine the relationship between fcgr3b cn variants and behet's disease, and we report no evidence of an association in terms of either disease susceptibility or clinical manifestations in this cohort of patients from iran . However, a previous study of turkish bd patients has reported associations between fcgr2a, fcgr3a, and fcgr3b snps and bd, in terms of both disease susceptibility and clinical manifestations, but this remains unconfirmed . Other studies have reported intriguing but conflicting relationships between fcgr3b cn and vasculitis in the context of different diseases . For example, fcgr3b low cn (<2) is associated with granulomatosis with polyangiitis (wegener's granulomatosis) and microscopic polyangiitis (antineutrophil cytoplasmic antibody - associated systemic vasculitidies) in one study, and high fcgr3b cn (> 2) in another, and no association has been observed with vasculitis in conjunction with systemic lupus erythematosus . Further, similar to bd, susceptibility to other systemic vasculitidies including giant cell arteritis and kawasaki's disease has also been linked to snps within the fcgr gene cluster [16, 17]. The fcgr gene cluster is a complex genomic region, with both snp and cnv polymorphism . While we were unable to demonstrate an association between fcgr3b cn and bd in this study, there are undoubted links to polymorphism in this region with vasculitic conditions . In future, the challenge will be to integrate cnv and snp data into haplotypes in order to systematically evaluate and contrast associations with different vasculitidies.
|
Since 2000, over 160,000 children have come to the united states as international adoptees . More than 25% of these children have come from eastern european countries having received primarily institutional care . Children in these orphanages frequently endure significant social deprivation that may impact their physical growth due to suppression of hypothalamic function with consequent low levels of growth factors . We and others have previously documented significant physical growth delays in up to 34% of international adoptees from eastern europe, south america, and asia [35]. Of the many hereditary, environmental, and hormonal factors that may contribute, we have previously shown that age, prenatal factors (birth weight and risk of fetal alcohol syndrome), and growth factors (insulin - like growth factor binding protein-3, igfbp-3) are independently associated with the degree of growth delay in adoptees upon arrival into the us . A rapid period of catch - up growth (cug) is seen following a variety of growth delays when the causative conditions improve . The growth hormone-(gh-)insulin - like growth factor (igf) system is known to be involved in cug following many causes of growth delay, but limited data are available on the role of gh - igf system in cug following adoption . The goal of this prospective longitudinal study was to examine the determinants of cug in 148 postinstitutionalized international adoptees during the first 6 months after arrival into their adoptive families . We aimed to identify baseline factors that would help predict subsequent cug and therefore help counsel the families, the degree of cug, the usefulness of obtaining igf - i and igfbp-3 levels, and the impact of nutrition on cug and the physiologic roles of nutrition and the growth hormone system on cug . Participants were part of a longitudinal study of growth of institutionalized children adopted into the usa from eastern europe (russia, kazakhstan, and ukraine). The study was approved by the institutional review boards of the university of minnesota and inova fairfax hospital for children, and written informed consent was obtained from the adoptive parents . Participants who were between 6 and 59 months of age at adoption were recruited and enrolled through the international adoption clinics at the university of minnesota and inova fairfax hospital for children between march 2004 and march 2007 . Participants were examined within three weeks of arrival into the usa and then six months later . Auxological parameters included length or height (average of triplicate measurements), single determinations of weight, and occipitofrontal circumference (ofc). Midarm circumference, triceps, and subscapular skinfolds were also measured to assess the nutritional status of the adoptees in addition to liver function tests, total protein, and albumin, which are part of a routine pre - adoption evaluation . Preadoption historical data, including birth weight (bw) and time spent in institutions, such as hospitals and orphanages, were obtained via parent interview and translated pre - adoption medical records provided by the adoptive parents . Children were classified as being at high risk for fetal alcohol syndrome (fas) if a moderate or severe facial phenotype was identified using facial photographic analysis software as previously described [710]. Mothers recorded everything the child ate for three separate days in the two weeks prior to the clinic visit . The diet records were reviewed for completeness, and mothers were contacted afterward for additional clarification, if necessary . The diet records were entered into the nutrition data system for research software (university of minnesota) that generates intakes for 160 nutrients averaged over the three - day period of intake . Percentage of the us dietary reference intakes (dris) were calculated using recommendations of the institute of medicine . Serum (2.5 ml) was obtained through venipuncture and stored at 20c until shipping . (calabasas, ca) and reported as actual values and standard deviation scores (sdss). Tsh was defined as high if it was above the normal range of the assay (5.0 iu / ml). Age- and gender - specific z scores for anthropometric variables were calculated based on the cdc 2000 growth charts using epi info 3.3 (centers for disease control and prevention, atlanta, ga). For children older than 36 months age - specific percentiles for estimated annual height velocity were estimated from the figures and tables of roche and himes . Analyses were conducted on all subjects that had complete data for that analysis, and the numbers of available cases are reported, accordingly . Changes in mean growth variables within the same individuals were evaluated using paired t - tests, and tests among multiple means for independent groups were by analysis of variance . Linear regression models for growth status and change were developed by considering only the subset of potential independent variables whose spearman correlation coefficients with the dependent variables were statistically significant at p .10 . Adjusted odds ratios describing associations of tertiles of kcal / kg, igf-1, and igfbp-3 with subsequent cug were estimated from logistic regressions using cug (0.5 sd) as a dichotomous - dependent variable and adjusting for gender, age, and high risk for fas status . The mean age at the time of initial evaluation was 20 months (range 759 months), which was on average 20 10 days after arrival into the usa (table 1). The follow - up appointment was a mean of 6.05 0.86 months later . As we have previously reported, international adoptees had significant growth failure upon arrival, which was more severe in children with low birth weight (lbw, <2500 g; n = 34/104, 32.7%) and high risk for fas (n = 10/132, 7.6%). All three growth parameters were affected; 22% of children were <2 sds for height, 34% were <2 sds for weight, and 12% were <2 sds for ofc . Ten percent of children were wasted at baseline using weight - for - height <2 sds . Low igf-1 and/or igfbp-3 levels (<2 sds) were present in 32% (44 out of 136) at the initial visit . Liver function tests, total protein, and albumin were normal . At baseline, the mid - arm circumference was slightly below average when normalized for age (0.73 sds, 12.4% <2 sds) and height (0.56 sds, 10.8% <2 sds), and the weight for height was near normal (0.45 1.24 sds with 9.5% below 2 sds, table 1). At 6 months, there was significant improvement in means for height sds, weight sds, ofc sds, weight for height sds, and igfbp-3 sds (p cug, defined as a gain of> + 0.5 in height sds, was observed in 62% of children (82 out of 132), and 23% (30 out of 132) gained> + 1 height sds over the six month period . 84% of children had height velocity greater than the 50th percentile for age with 55% greater than the 95th percentile (figure 2). 90% of children had height velocity> 10 cm / yr and 12%> 20 cm / yr . The degree of cug was age dependent with mean growth velocities for children <18 months = 16.9 3.6 cm / yr, 1830 months = 12.8 3.0 cm / yr, and> 30 months = 10.6 2.5 cm / yr (p <.001) (figure 2). Although the proportion of stunted children significantly decreased by 6 months, 6.8% of children (n = 132) remained below 2 sds for height, 9.8% for weight, 8.5% for head circumference, and 4.5% for weight for height . Despite significant cug in the group as a whole, igf-1 and/or igfbp-3 remained low in a significant number of children (23% <2 sds) (29 out of 124). In order to identify potential factors associated with cug, we examined the relationships of the change in auxological parameters and growth factors with a number of environmental, historical, physical, medical, and hormonal variables . Young age, severity of short stature, and higher dietary intake at the initial visit were statistically significant independent predictors of improved growth (delta ht sds) (table 2). Neither igf - i nor igfbp-3 sds was an independent predictor of delta ht sds . Also, children in the lowest tertile of igf-1 sds were significantly more likely to show height cug than those in the highest tertile (p = .042, or = 4.9, 95%ci: 1.122.9). Although associated with baseline growth failure, lbw and being at high risk for fas were not significant predictors of cug in height . However, low risk for fas children was more likely to show height cug than the high risk for fas children (p = .007, or = 34.8, 95%ci: 2.7457.6). Excluding high risk for fas children from the regression analysis did not change the significant predictors . Mid - arm circumference and baseline weight for height were not independently predictive of baseline height sds or degree of height cug . Because of the important role of nutrition in growth, we analyzed caloric intake at baseline and six months using a three - day diet record . Mean caloric intake was higher than the dri at arrival (% dri = 135 42; kcal / kg = 108 33) and was increased further at six months (% dri = 157 42; kcal / kg = 125 34; p <.001) (table 1). At baseline, 76% of children were consuming greater than the dri (100%) increasing to 93% at six months . Although mean height velocity was higher in younger children (figure 2) and in those with higher caloric intake (table 2), the mean increases in caloric intake per kg did not significantly differ across different ages (p>.3 by anova) (figure 3). Those children who had cug (gain in height> + 0.5 sds) had statistically significantly higher caloric intake at both baseline and 6 months (table 3) compared with other children . Caloric intake at 6 months was significantly correlated with subsequent change in height sds (r = 0.318, p = .001). Children in the highest tertile of caloric intake / kg at the initial visit were also significantly more likely to show height cug than those in the lowest tertile of kcal / kg (p = .033, or = 4.2, 95%ci: 1.115.9). Relatively lower baseline weight sds, higher birth weights, higher caloric intake, and lower baseline igfbp-3 sds were significant positive independent predictors of change in weight sds (table 2). Caloric intake at 6 months was also significantly correlated with the change in weight sds (r = 0.441, p <ofc sds and ht sds were independent predictors of growth in ofc, so that children with relatively smaller heads and greater heights at baseline had the most improvement in subsequent head growth (table 2). If children who were high risk for fas were excluded from the analysis, ht sds was no longer a significant independent predictor of subsequent ofc growth . Children who remained stunted were significantly older (mean 32 months, range 14 to 59), shorter (mean 3.1 ht sds, range 2.1 to 4.1), lighter (mean 2.5 wt sds, range 1.4 to 4.0) and had smaller heads (mean 1.66 ofc sds, range 3.3 to 2) at the time of adoption than those who caught up (table 4). There were no significant differences in mean baseline growth factors in those who remained stunted compared to those who caught up . Three of the children who had high risk for fas remained stunted at 6 months . However, the degree of height cug (delta ht sds) in high risk for fas children was not statistically different from the larger cohort (data not shown). Due to persistent short stature, children who did not catch - up by 6 months (n = 6) were referred for pediatric endocrinology evaluation . At the time of endocrine evaluation, five of these children the four children who remained stunted, two were identified by provocative growth hormone stimulation testing as having growth hormone deficiency . One female child with growth hormone deficiency, who was adopted at 14 months old and had associated optic nerve hypoplasia and fas, has demonstrated an excellent response to growth hormone therapy with height at the 25th percentile at last evaluation five years after adoption . The pretreatment growth velocity was 6.8 cm / year (gv sd not established) compared to 12.3 cm / year (+ 2.96 sd) after 1 year of treatment with growth hormone . The other child a male who was 4 years old at the time of adoption with growth hormone deficiency was at low risk for fas and also demonstrated a good response to growth hormone treatment . The pre - treatment growth velocity was 4.9 cm / year (0.82 sd) compared to 6.9 cm / year (+ 2.12 sd) after 1 year of treatment with growth hormone . He is now growing along the 5th percentile at last evaluation on growth hormone therapy five years after adoption . Elevated tsh (> 5 iu / ml, range 5.0611.60) was seen in international adoptees (n = 18/110, 16.4%) at baseline with a normal free t4 level . Of the 18 children with elevated tsh at baseline, 6 had normal tsh at the 6-month follow - up, 7 had no follow - up tsh reported, and 5 had elevated tsh at the end of the study . Children with elevated tsh at the end of the study (n = 5/110, 4.5%) were referred to a pediatric endocrinologist . In this prospective study of cug in children following international adoption, we found that significant growth failure was present at baseline as published before by the authors . During the first 6 months after adoption, these children experienced substantial cug in length, weight, and ofc similar to previous cohorts [15, 16], and the degree of cug positively correlated with the young age and the time of adoption as observed by others . However, more than a third of children in this study did not show significant cug (> + 0.5 sds) during the 6-month follow - up period . 6.8% of children remained stunted (<2 ht sds) at the end of the study, and two of these children were identified as having growth hormone deficiency . Older children with more severe baseline growth failure were more likely to remain stunted at follow - up . Although our previous analyses showed that lbw, high risk for fas, and igfbp-3 were significantly and independently associated with height sds at the time of adoption, these variables were not significant independent predictors of subsequent height cug, which in the case of igfbp-3 was likely due to its correlation and colinearity with baseline ht sds . Changes in igf-1 and igfbp-3 were positively correlated with linear growth, but were not independent predictors of growth restoration of adoptees . Therefore, it is likely that the improved nutrition and other changes, such as a more nurturing environment, have an important effect on the growth hormone axis influencing catch - up growth . Among the variables analyzed, only age, caloric intake (per kg), and baseline height were found to be independent predictors of height cug . Previous studies of cug following growth failure caused by other mechanisms have shown improvement in serum levels of components of the gh - igf system [17, 18]. However, limited data are available on the role of gh - igf system in cug following adoption . We found that although baseline serum igfbp-3 values correlated with the degree of linear growth failure and igf-1 and igfbp-3 sds values improved in most children, neither igfbp-3 nor igf-1 was predictive of the degree of height cug in the first six months following adoption . The finding that neither baseline growth factor levels nor the change in their values independently predicted the degree of cug in height was unexpected . There are several potential explanations . It is possible that rapid changes in igf-1 levels could have occurred between the time that these children were united with their adoptive parents and when the igf-1 values were measured in the clinic . Alternatively, low levels of igfbp-3 may primarily reflect baseline growth hormone status in some patients . Improvement in igfbp-3 over time may improve the delivery of igf-1 to the target tissue . Finally, it is possible that other related factors, such as baseline height or caloric intake, are more important than these growth factors in this early, rapid cug phase . These relationships suggest that although growth factors improve during this period, recovery from growth failure related to international adoption is a complex phenomenon that is dependent upon a number of factors and not solely related to restoration of normal function of the gh - igf system per se . Growth failure at the time of international adoption could represent a combination of malnutrition, reduced growth hormone secretion, and/or growth hormone resistance as observed in other conditions . For example, children who suffer from intrauterine growth retardation have been shown to have growth hormone resistance, but normal growth hormone production . In psychosocial short stature, reversible suppression of growth hormone secretion may also occur in hyperphagic short stature, which is a condition associated with disordered eating behaviors (stealing food, hoarding food, foraging for discarded food) that are commonly seen in institutional settings [21, 22]. Access to sufficient macro- and micronutrients to support growth is critically important and, worldwide, the most common cause of growth failure during childhood . Nutritional demands vary depending on growth rates at different stages of development and any preexisting deficits due to pre- or postnatal malnutrition . During the most rapid growth phase between birth and 18 months the effects of even modest nutritional deficits may become magnified in children within institutional care settings . In this study, we found that 10% of the children were wasted (wt <2 sds) on arrival that relative caloric intake was unusually high at baseline and substantially increased in most children . The degree of cug for height and weight was related to calorie intake both at arrival and at six months . In addition, we have previously shown a high incidence of iron deficiency at adoption that persists at six months despite iron intake that is above the recommended daily allowance . These findings emphasize the role of adequate nutrition support for cug in international adoptees and highlight the need to monitor feeding issues that could impact nutritional intake . We found that the growth hormone axis, as measured by igf-1 and igfbp-3, may be suppressed at baseline following international adoption . Age and severity of growth failure at the time of adoption are independent predictors of the degree of subsequent cug . Lbw and high risk for fas, associated with baseline growth failure, are not significant predictors of the degree of subsequent cug, although a third of children who remained stunted after six months had facial features suggestive of fas . As nutritional intervention appears to be extremely important during the first 6 months after adoption, we recommend that adoptive parents be made aware of the need for increased calories beyond typical age requirements . If growth failure persists after 6 months of appropriate caloric intake, nutrition - independent causes should be considered, for example, growth hormone deficiency . The older, the more severely stunted at the time of adoption, and those who are high risk for fas should be monitored most closely.
|
Sixteen client - owned cats, presented to the irion animal hospital, seoul, korea, over a period of 7 months (november 2014 may 2015) were included in the study . All of these cats were undergoing minor dental treatment, and all of owners of these cats were voluntarily participated in this study . The mean age of cats was 3.8 years (range 17 years) with a mean body weight of 4.0 kg (range 2.86.0 kg). All cats were considered clinically healthy except for dental disease, by the owners at the time of the investigation, and this observation was supported by findings on physical examination, complete blood count, serum chemistry and thoracic radiography . After ct examination, microscopic examination via tracheal washing was performed, and animal with suspected infectious condition was excluded . Four asthmatic cats were selected from patients who have visited irion animal hospital from 2014 to 2015, and they showed clinical signs of wheezing and coughing, obvious bronchial and interstitial pattern in radiograph and therapeutic response to glucocorticoid . The mean age of cats was 7.8 years old (range 511 years old) with a mean body weight of 5.2 kg (range 2.77.0 kg). Four cats were 2 russian blue cats, 1 abyssinian cat and 1 domestic short hair cat . The animals of both healthy group and asthmatic group were fasted approximately 8 hr for general anesthesia ., seoul, korea) was injected rapidly (6 mg/ kg, iv) for induction . The tracheal tube was intubated, and anesthesia was maintained with isoflurane (ifran, hana pharm . Heart rate, respiratory rate, body temperature and end tidal carbon dioxide (etco2) were monitored continuously during anesthesia . Studies were performed with 4 channels ct scanner (lightspeed plus, general electric medical system, san francisco, ca, u.s.a . ). Ct power injector (liebel - flarsheim, mallinckrodt, cincinnati, oh, u.s.a .) Was used for control injection of iohexol (omnihexol, korea united pharm . Infused contrast media were 600 mg i / kg . Single breathe hold technique was performed that airway pressure was maintained at 15 cm of water to the airway during the ct scan . Computed tomography was performed using hrct: 1.25 mm thick transverse images spaced 5 mm apart . The gantry rotation time was 1 sec, tube potential was kv 120, and tube current was mas 200 . Analysis of dicom ct images was performed using a commercially viewing and analysis software (spectra, infinitt healthcare co., ltd ., all measurements were obtained on contrast enhanced transverse images, using moderately edge enhancing reconstruction algorithm at the lung window (window width=1,500 hounsfield unit (hu), window level= 600 hu). Bronchial lumen, entire bronchial diameter and adjacent arterial diameter were measured in four locations: the cranial part of left cranial, left caudal, right cranial and right caudal lung lobes . The right middle lung lobe was excluded, because the bronchus of the right middle lung lobe was visible longitudinally in transverse image . The caudal part of the left cranial lobe was also excluded due to lack of reproducibility and image quality . Pulmonary artery, bronchial lumen and whole bronchial diameter were measured for the entire hyper - dense region associated with wall and artery (fig . 1.high resolution computed tomography image of the caudal lung lobe . Whole transverse image (a) and magnified image (b). The whole diameter (thick white arrows) and internal diameter (thin white arrow) of caudal bronchus and the diameter of the adjacent pulmonary artery (black arrow) in transverse image were measured . All measurements were tried to caliper bronchi or arteries that were mostly circular . However, if circular bronchus and artery were not identified, oval bronchus and artery were measured for smallest diameters to avoid any effect of obliquity in determining the exact diameter . By measuring the overall bronchial diameter, bronchial lumen and adjacent artery, a total of three values (ba ratio, td ratio and ta ratio) were calculated (fig . The calculation of bronchial wall thickness was derived indirectly from overall and luminal diameter of bronchus (t=(d - l)/2).). Because the bronchial wall thickness had relatively small values than other values, directly measuring of bronchial wall thickness could be erroneous . Therefore, wall thickness (t) was derived indirectly from overall (d) and luminal (l) diameter of bronchus (t=(d - l)/2). High resolution computed tomography image of the caudal lung lobe . The whole diameter (thick white arrows) and internal diameter (thin white arrow) of caudal bronchus and the diameter of the adjacent pulmonary artery (black arrow) in transverse image were measured . The calculation of bronchial wall thickness was derived indirectly from overall and luminal diameter of bronchus (t=(d - l)/2). All calculations in statistical analyses were performed using non - commercial software (r, the r foundation) and commercial software (spss 19, spss inc . One way analysis of variation (anova) was performed to identify differences between each lobe (cranial part of left cranial, left caudal, right cranial and right caudal) in healthy group . A welch two sample t - test was used to compare difference between male and female . A welch two sample t - test was used to compare difference between healthy group and clinically asthmatic group . Sensitivity, specificity, positive predictive value and negative predictive value were calculated using the standard approaches at various cut - off ratios . For all statistical analyses, a p value of less than 0.05 was considered significant . Sixty four bronchi and arteries were obtained from heathy 16 cats, and 16 bronchi and arteries were obtained from 4 asthmatic cats . In obtained image, ba ratio, the calculated indices from healthy cats and asthmatic cats are described at table 1table 1.mean of each index measured in clinically healthy cats and clinically asthmatic catshealthy groupasthmatic groupp - value(n=16)(n=4)ba ratio0.86 0.120.93 0.21p=0.24td ratio0.18 0.020.22 0.02p<0.05ta ratio0.25 0.050.37 0.06p<0.05ba ratio, bronchial lumen to artery ratio; td ratio, bronchial wall to whole bronchial diameter ratio; ta ratio, bronchial wall to artery ratio .. td ratio and ta ratio in asthmatic cats were significantly greater than those in healthy cats (p<0.05). But, ba ratio showed no significant difference between asthmatic cats and healthy cats (p=0.24). There were no significant differences in td ratio and ta ratio between each lobe . And, there were no significant differences in td ratio and ta ratio in either ages or gender . Ba ratio, bronchial lumen to artery ratio; td ratio, bronchial wall to whole bronchial diameter ratio; ta ratio, bronchial wall to artery ratio . Given these findings, a receiver operating characteristic curve (roc) of td ratio and ta ratio was created using the data from healthy group and asthmatic group (fig . 3fig . 3.receiver operating characteristic curve of the td ratio and ta ratio in cats with asthma and healthy cats . The both td ratio and ta ratio were significantly different from 0.5 (p<0.05).). The area under curve (auc) of td ratio was 0.869, and auc of ta ratio was 0.945 . The both aucs of td ratio and ta ratio were significantly greater than 0.5 (p<0.05). Cut - off ratio of 0.203 was best balanced with sensitivity 81.3% and specificity 81.3% in td ratio . Cut - off ratio of 0.316 was best balanced with sensitivity 87.5% and specificity 92.2% in ta ratio (table 2table 2.result using various cut - off ratios to predict bronchial wall thickening in multiple indicescut - off ratiotptnfpfnsensspecppvnpvaccuracytd ratio0.19414432120.8750.67290.40000.9560.71250.20313521230.8120.81250.52000.9450.81250.20512531140.7500.82810.52170.9300.8125ta ratio0.3031555910.9380.8590.62500.98210.8750.3161459520.8750.9220.73640.96720.91250.3311160450.6880.9380.73330.92300.8875td ratio, bronchial wall to whole bronchial diameter ratio; ta ratio, bronchial wall to artery ratio tp, true positive; tn, true negative; fp, false positive; fn, false negative; sens, sensitivity; spec, specificity; ppv, positive predictive value; npv, negative predictive value . ). Receiver operating characteristic curve of the td ratio and ta ratio in cats with asthma and healthy cats . Solid line represents td ratio, and dotted line represents ta ratio . The both td ratio and ta ratio were significantly different from 0.5 (p<0.05). Td ratio, bronchial wall to whole bronchial diameter ratio; ta ratio, bronchial wall to artery ratio tp, true positive; tn, true negative; fp, false positive; fn, false negative; sens, sensitivity; spec, specificity; ppv, positive predictive value; npv, negative predictive value . As a result, the td ratio and ta ratio in cats with asthma were significantly greater than those in clinically healthy cats . However, the ba ratio was not significantly different between the healthy group and the asthmatic group . That is because, if the whole diameters of bronchi in feline asthma are the same, the luminal diameters will be smaller due to bronchial wall thickening . If the ba ratio is measured in lesions, such as bronchiectasis, it is considered that ba ratio may be different between asthmatic cats from healthy cats . The auc of td ratio had relatively high accuracy in predicting bronchial wall thickening in asthma patients, with a value of 0.869 . The auc of ta ratio was 0.945, which was greater than that of td ratio . Therefore, ta ratio is a more accurate index to detect bronchial wall thickening in asthmatic patients than td ratio . The td ratio cut off value of 0.203 had the best balance of sensitivity and specificity, while the ta ratio cut off value of 0.316 had the best . Therefore, to determine the bronchial wall thickening in cats with asthma, ta ratio and cut - off threshold of td ratio could be used . Several studies have evaluated the bronchial wall thickness in human medicine . Since bronchial wall thickness can be changed according to airway generation, we calculated the ratios of bronchial and arterial dimensions rather than their absolute values . One of the ratios was the td ratio which was dividing bronchial wall thickness by the whole diameter of bronchus . The percentage of wall area (wa%) has also been used in the quantification of bronchial wall thickness in human asthma patients . In the case of bronchiectasis, simple measurement of bronchial wall thickness divided by bronchial luminal diameter could cause spurious underestimation of intrinsic bronchial wall thickening . Thus, to obtain an estimation of bronchial wall thickness, we used ta ratio, which was the ratio of mean bronchial wall thickness divided by mean diameter of the accompanying pulmonary artery used previously . As a result, we found that the ta ratio was more accurate than td ratio . In human medicine, many studies have reported of correlation between the severity of asthma and images of bronchial changes in hrct . The forced expiratory volume in one second (fev1) has been reported to be correlated with wa% . Td ratio and wa% have been reported to be negatively correlated with carbon monoxide transfer coefficient . In veterinary medicine, bronchial wall thickness ratios will be helpful to assess the severity of feline asthma, because it is quantitative . However, indexing for the severity of asthma, such as fev1, in human medicine has not been established in veterinary medicine . Furthermore, the breed of cats used in this study was not diverse . Therefore, it was difficult to compare difference between breeds . Research studies are needed to determine the differences in normal ranges of bronchial wall for a variety of feline breeds . For example, in brachycephalic breed cat, such as persian cat, bronchial wall can be thicker than other breeds, even though there is no clinical sign . Dogs with brachycephalic airway syndrome may contribute to the loss of small airway wall rigidity . Based on this finding, the ba ratio in brachycephalic breed dogs is found to be different from that in non - brachycephalic dogs . In persian cat, brachycephalic syndrome including stenotic nares and elongated soft palate has been reported . For the first time, this study reported the evaluation of bronchial wall thickness of normal cats and clinically asthmatic cats using hrct . Our results suggest that quantification indices of bronchial wall thickness, such as td ratio and ta ratio, can be used to diagnose feline asthma syndrome and other diseases involving bronchial wall thickening . In conclusion, hrct is a useful modality to quantify bronchial wall thickness to diagnose diseases involving the thickening of bronchial wall, including feline asthma.
|
Familial adult myoclonic epilepsy (fame), or benign adult familial myoclonic epilepsy (bafme), is a neurological disease of an autosomal - dominant inheritance, which is characterized clinically by adult onset of finger tremulous movement mixed with myoclonic jerks . Linkage studies have mapped fame - associated loci to chromosome 8q23.3-q24.11 in japanese families [1, 2], to chromosome 2p11.1-q12.2 in italian [35] and spanish families, and chromosome 5p15.31-p15 in a french family . Although the identification of the causal gene(s) for fame is of great importance to the understanding of the molecular basis of the disease, gene(s) responsible for fame has not been identified . Here, we report that a mutation of the gene encoding ubr5 (ubiquitin protein ligase e3 component n - recognin 5) is associated with fame in a japanese family . All of the family members were born in a small town in yamagata prefecture, about 400 km north of tokyo, japan . The family consisted of 6 individuals with fame through four generations . Both men and women were affected with the disease, which is consistent with an autosomal - dominant inheritance . The proband (iii-1 in figure 1) was a 49-year - old woman who had noticed a shivering - like involuntary movement of the bilateral hands since the age of around 25 years . The shivering - like movement consisted of arrhythmic, fine twitches at the hands, which was exaggerated by posture, feeling of strain, and fatigue . The involuntary movement was limited only in her hands, although it became slightly worsened with age, as compared with the condition at the onset . No additional neurological symptoms, including cerebellar ataxia, dementia, muscle weakness, sensory disturbance, or other involuntary movements, were observed . The other affected members of the family showed virtually identical symptoms to the proband, although her cousin (44-year - old woman: iii-4 in figure 1) had an episode of generalized seizure at the age of 42 years, and her 74-year - old father (ii-4) and 72-year - old aunt (ii-5) showed a progression of myoclonic involuntary movements from the hands to all four extremities with aging, resulting in some difficulties in walking with assistance . The study was approved by the medical ethics committee of yamagata university faculty of medicine . For exosome analysis, genomic dna from the proband was extracted and purified from whole blood using qiaamp dna spin columns (qiagen n.v . Exome capture was performed using the sureselect human all exon system (agilent technologies, usa). The manufacturer's protocol for this system (illumina paired - end sequencing library prep, version 1.0.1) was used, with the following modifications: 5 g of dna sample was fragmented by the nebnext dsdna fragmentase (new england biolabs, usa). Sequencing reaction was performed on the illumina gaiix platform with version 4 chemistry and version 4 flow cells according to the manufacturer's instructions . The sequence reads to a reference human genome (ucsc ncbi37/hg19), we adopted the elandv2 software (illumina inc . Snvs and indels detection were performed with run.pl script from casava v1.6 (illumina inc . Snvs and indels were compared with ncbi dbsnp v131 to distinguish known snps (those that had been deposited to dbsnp) and novel snps (those that were not in dbsnp). All the snps were annotated by comparing their position to other genomic features including gene regions . Of 266,122 variants from ngs, 745 were expected to be functional (i.e., missense or nonsense). Of these functional variants, finally, of 467, we successfully designed 383 probes for goldengate assay (illumina inc ., usa) using the illumina assay design tool (illumina design scores> 0.4 and designable). Using this custom beadchip, we searched disease - specific mutation among ten members of the present family with fame including five affected, 85 unrelated individuals from the same community, which is an ancestral population of the proband, and 24 individuals from a diverse ethnic panel commercially provided by the coriell cell repositories (coriell institute for medical research, camden, nj, usa). Genomic dna from peripheral blood of the proband (iii-1) was subjected to an exome analysis on ngs using the sureselect human all exon system . All exons (37,354,942 bp) of the proband genome were sequenced and 36,768,760 bp (98.43%) were read . Among them, nucleotide variations were observed at 266,122 sites containing 467 functional variants (missense or nonsense). Of the 467 functional variants, the probes of 383 variants were successfully designed, and the goldengate assay was performed for 10 family members, consisting of 5 patients with fame (ii-4, ii-5, iii-1, iii-4, and iv-2) and 5 nonaffected members (ii-6, iii-2, iii-3, iii-5, and iv-1) (figure 1). Of the 383 functional variants examined, only c.5720g> a mutation (p.arg1907his) (nm_015902.5: exon 19) (chr8:103293724:grch37/hg19) in the ubr5 gene (gene i d: 51366) was found in all of the affected individuals in the family, but not in any of the non - affected family members (figure 2). Such mutation was not found in any of the unrelated 85 healthy japanese residents in the same community nor in any of the 24 individuals of various ethnicities . The arg-1907 residue and its surrounding regions in ubr5 were highly conserved across species from homo sapiens to danio rerio (figure 3). In the present study, an exome analysis of the proband and the subsequent goldengate assay for the family members identified the c.5720g> a mutation (p.arg1907his) in the ubr5 gene only in the affected members in the fame family, but not in the non - affected family members (figure 2). No such mutation was found in any of the 109 persons examined, including the unrelated 85 healthy residents in the same community and the 24 subjects of various ethnicities . The conservation of the arg-1907 residue in ubr5 across species suggests a functional importance of the residue (figure 3). The ubr5 gene was reported to be located in chromosome 8q22.3, which is close to the reported locus linked to japanese fame families . In european families with fame, chromosome 2p11.1-q12.2 [36] or chromosome 5p15.31-p15 has been mapped as the loci linked to fame . Therefore, three, or more, genes are assumed to be responsible for fame . This genetic heterogeneity in fame is not surprising because in many genetic diseases including familial alzheimer's disease and familial parkinsonism, a similar clinical phenotype can be produced by mutations in the different genes . It seems likely that the proteins encoded by the causal genes for fame may functionally be related with each other, and each may converge to the same biochemical pathway . The dysfunction of any of the fame - associated proteins may cause a dysfunction of the pathway, resulting in a similar clinical manifestation . Ubr5 is a human homolog of the drosophila melanogaster tumor suppressor gene hyperplastic discs (hyd) [8, 10]. Human ubr5 is a huge protein with 2799 aminoacid residues (figure 2(a)). The protein is localized mainly in the nucleus and has been shown to be ubiquitously expressed in various human tissues, including the brain . Ubr5 has the hect (homology to e6ap carboxy terminus) domain at the c - terminus, which functions as e3 ubiquitin - protein ligase (figure 2(a)) [811]. E3 ubiquitin - protein ligases are involved in protein degradation in the ubiquitin - proteasome system, which plays an important role in a variety of fundamental cell regulations, such as gene expression, stress response, dna repair, and cell cycle . Previous studies have shown that mutations in the genes encoding e3 ubiquitin - protein ligases can cause hereditary neurological diseases including angelman syndrome and autosomal recessive juvenile parkinsonism (arjp), both of which show tremor or tremulous involuntary movement as in fame . In conclusion, we identified an fame - associated mutation in the ubr5 gene in the candidate region linked to japanese fame families . Further study is needed to clarify the significance of the mutant protein in the pathogenesis of fame.
|
Ureteral injury is one of the most problematic complications with significant postoperative morbidity in pelvic and abdominal surgical procedures . Unrecognized ureteral injury can cause prolonged postoperative morbidity leading to fistula formation, sepsis, or renal functional loss . According to the literature, many studies assessing the incidence of ureteral injuries in gynecologic procedures detail ureteral injury rates ranging from 0.1 to 2.5% [4 - 7]. Although ureteral injury can be recognized intraoperatively and managed appropriately without any sequelae, it can also present during the postoperative period . Unfortunately, patients with undiagnosed injuries can have a highly variable course that causes diagnostic delay, resulting in additional hospitalization that is associated with substantial morbidity and commonly results in medicolegal litigations . The purpose of this study was to review the cases of ureteral injury during gynecologic surgeries in relation to possible predisposing factors and patient management according to the time of detection of the injury in our hospital from march 2006 to february 2011 . The records of 35 patients (1.2%) with 38 iatrogenic ureteral injuries sustained in a total of 2,927 gynecologic surgeries carried out from march 2006 to february 2011 in the department of obstetrics and gynecology in our hospital were retrospectively reviewed . Ureteral injuries were recognized intraoperatively in 20 patients and 1 to 28 days after the surgery in 15 patients . For the 35 patients with diagnosed iatrogenic ureteral injuries, gynecologic surgeries had been performed for malignant (n=27) or benign (n=8) pelvic disease . Laparoscopic surgery and laparotomy cases numbered 11 and 24 patients, respectively (table 1). Among the total 2,927 patients, 522 had predisposing factors for ureteral injuries, such as endometriosis, pelvic inflammatory disease, previous pelvic surgery, history of pelvic radiation, or congenital anomalies . In the presence of suspected ureteral injuries during the gynecologic operation, the urologist confirmed ureteral intactness the damaged suspicious lesion was confirmed by direct inspection or cystoscopic evaluation of urinary efflux . Twenty patients showed impaired urinary flow or ureteral patency, and defects were promptly repaired with proper procedures . The signs and symptoms in patients with postoperatively recognized ureteral ureteral intactness was evaluated by intravenous pyelography (ivp), retrograde pyelography (rgp), and contrast computerized tomography (ct). After repair of the ureteral injury was complete, success was defined on the basis of ivp or contrast ct . Statistical analysis was performed by chi - square and fisher's exact tests with p<0.05 considered as significant . The incidences of ureteral injury with laparoscopic surgery and laparotomy were 1.1% and 1.2%, respectively . The postoperative detection rate of ureteral injury was higher in laparoscopic surgery cases (73%) than in laparotomy cases (29%; p=0.027) (table 2). Of the patients with postoperatively diagnosed ureteral injuries, only two were managed with a secondary procedure, such as retrograde balloon dilatation or ureteroneocystostomy (table 3). All 20 cases of intraoperatively diagnosed ureteral injuries were unilateral injuries . In 6 of the 20 cases, the ureteral injury was a mucosa - sparing injury and was managed with primary closure . Another 5 patients with partial transected injury were managed through excision of the compromised segment followed by ureteroureterostomy . Among another eight cases presenting with complete transection of the ureter, two patients were managed by ureteroneocystostomy because of ureteral transection within 2 to 3 cm of the bladder . In the last case among the 20 cases, after the clip was removed, the ureter returned to its normal peristaltic activity and color . Serious complications requiring additional intervention were not observed during the follow - up visit and the urinary tract patency was not compromised at the follow - up ivp, contrast ct, or sonogram . Between postoperative day 1 and 28, patients in whom ureteral injury was suspected underwent rgp and ivp, showing non - visualized kidney, hydronephrosis, or contrast leakage into the pelvic cavity . Retrograde ureteral stenting with a double - j stent was attempted in all patients; if successful, the ureteral stent was preserved for 2 to 3 months . Of the 12 unilateral injuries, 5 patients presented with ureterovaginal fistula at postoperative days 6, 7, 14, 22, and 28, respectively . Flank pain was observed in two cases, and azotemia and fever were observed in one case . Rgp was used to confirm the diagnosis on day 5 or 6 after the operation . The methods of reconstruction were ureteroureterostomy, ureteroneocystostomy with psoas hitch, and ureteroneocystostomy with boari flap . Four patients were identified with ureteral injury with an associated urinary leak into the abdominal cavity by an increasing jackson - pratt drain amount between 3 days and 13 days after the operation . Cystoscopic ureteral stent insertion was achieved in only one patient, and the ureteral stent was preserved for 6 weeks . Satisfactory urinary drainage was confirmed on follow - up ivp after 1 month . In the second case, the ureteral stent was left in situ for a total of 6 months with a replacement interval of 3 months . The ureteral stent was removed after that period and ureteral distention was confirmed by ivp . This distention was resolved after ureteroneocystostomy with boari flap . In the one remaining case, three cases with bilateral injuries presented with anuria: azotemia in one case and ureterovaginal fistula and flank pain in two cases . The ivp showed bilateral silent kidney in one case and ureterovaginal fistula and hydronephrosis in two cases . The patient with bilateral ureterovaginal fistula also suffered from a rectal injury; thus, she was managed with primary rectal repair, ileostomy, and ureteral reconstruction . 522 had predisposing factors for ureter injuries including endometriosis, pelvic inflammatory disease, previous pelvic surgery, history of pelvic radiation, or congenital anomaly . The rate of ureteral injury was significantly higher in the group with risk factors (2.7%) than in the group without risk factors (0.9%; p=0.002). No predisposing factors were detected in 21 of the total 35 patients (60%) (table 4). Preoperative ureteral stenting was performed in 101 of 522 patients having risk factors according to the gynecologic surgeon's preference . The incidence of ureteral injury in the stenting group (1.0%) was lower than in the non - stenting group (3.1%); however, there was no statistically significant difference (p=0.324). All 20 cases of intraoperatively diagnosed ureteral injuries were unilateral injuries . In 6 of the 20 cases, the ureteral injury was a mucosa - sparing injury and was managed with primary closure . Another 5 patients with partial transected injury were managed through excision of the compromised segment followed by ureteroureterostomy . Among another eight cases presenting with complete transection of the ureter, two patients were managed by ureteroneocystostomy because of ureteral transection within 2 to 3 cm of the bladder . In the last case among the 20 cases, after the clip was removed, the ureter returned to its normal peristaltic activity and color . Serious complications requiring additional intervention were not observed during the follow - up visit and the urinary tract patency was not compromised at the follow - up ivp, contrast ct, or sonogram . Between postoperative day 1 and 28, patients in whom ureteral injury was suspected underwent rgp and ivp, showing non - visualized kidney, hydronephrosis, or contrast leakage into the pelvic cavity . Retrograde ureteral stenting with a double - j stent was attempted in all patients; if successful, the ureteral stent was preserved for 2 to 3 months . Of the 12 unilateral injuries, 5 patients presented with ureterovaginal fistula at postoperative days 6, 7, 14, 22, and 28, respectively . Flank pain was observed in two cases, and azotemia and fever were observed in one case . Rgp was used to confirm the diagnosis on day 5 or 6 after the operation . The methods of reconstruction were ureteroureterostomy, ureteroneocystostomy with psoas hitch, and ureteroneocystostomy with boari flap . Four patients were identified with ureteral injury with an associated urinary leak into the abdominal cavity by an increasing jackson - pratt drain amount between 3 days and 13 days after the operation . Cystoscopic ureteral stent insertion was achieved in only one patient, and the ureteral stent was preserved for 6 weeks . Satisfactory urinary drainage was confirmed on follow - up ivp after 1 month . In the second case, the ureteral stent was left in situ for a total of 6 months with a replacement interval of 3 months . The ureteral stent was removed after that period and ureteral distention was confirmed by ivp . This distention was resolved after ureteroneocystostomy with boari flap . In the one remaining case, three cases with bilateral injuries presented with anuria: azotemia in one case and ureterovaginal fistula and flank pain in two cases . The ivp showed bilateral silent kidney in one case and ureterovaginal fistula and hydronephrosis in two cases . The patient with bilateral ureterovaginal fistula also suffered from a rectal injury; thus, she was managed with primary rectal repair, ileostomy, and ureteral reconstruction . Among 2,927 patients, 522 had predisposing factors for ureter injuries including endometriosis, pelvic inflammatory disease, previous pelvic surgery, history of pelvic radiation, or congenital anomaly . The rate of ureteral injury was significantly higher in the group with risk factors (2.7%) than in the group without risk factors (0.9%; p=0.002). No predisposing factors were detected in 21 of the total 35 patients (60%) (table 4). Preoperative ureteral stenting was performed in 101 of 522 patients having risk factors according to the gynecologic surgeon's preference . The incidence of ureteral injury in the stenting group (1.0%) was lower than in the non - stenting group (3.1%); however, there was no statistically significant difference (p=0.324). Ureteral injuries are reported to occur in approximately 0.1 to 2.5% of gynecologic surgeries [4 - 7]. Recently, the increasing number of minimally invasive endoscopic procedures being conducted by urologists has led to many cases of ureteral injuries . However, the majority of ureteral injuries during non - urological surgery are recognized postoperatively, whereas injuries during urological surgery are usually identified during the operation . Also, postoperatively detected ureteral injuries are more complicated and require more procedures than do intraoperatively detected ureteral injuries . Ureteral injury is becoming more common as a result of the increased numbers of laparoscopic pelvic procedures . Endoscopic minimally invasive approaches are an option for the management of ureteral injuries and are associated with reduced morbidity and duration of hospitalization . On the other hand, ku et al . Concluded that minimally invasive strategies are not always successful in the management of postoperatively detected ureteral injuries . Also, two of three patients treated with percutaneous nephrostomy and antegrade ureteral stenting needed additional procedures in our series . Furthermore, the proximal drainage strategy is inconvenient for some patients and prolongs the recovery period, and surgical intervention is eventually required in patients who are not successfully managed . However, some patients may prefer the minimally invasive approach to avoid the operative repair . When the injury is detected postoperatively, the treatment plan should be discussed with a well - informed patient . Certain conditions increase the likelihood of ureteral injuries, particularly conditions that disrupt the normal anatomy and architecture of the ureters . These conditions include endometriosis, retroperitoneal fibrosis, and pelvic inflammatory disease with direct invasion by tumors . Other risk factors include previous pelvic surgery, broad ligament fibroids, history of pelvic radiation, and congenital abnormalities such as ureteral duplication, megaureter, or ectopic ureter or kidney [14 - 17]. In this study, 14 patients (40%) had predisposing factors such as those stated above . Also, 21 patients (60%) had no identifiable risk factors . The results of the present study correspond with data reported earlier showing that most ureteral injuries occur in patients who have no identifiable predisposing factors . This study showed that the incidence of ureteral injury in cases having risk factors was significantly higher than in cases without risk factors . Therefore, it is gratifying to find a process by which to prevent ureteral injury during gynecologic surgery, especially in patients with risk factors . Chou et al ., reported that prophylactic ureteral stenting did not prevent surgical damage to the ureter, but the ureteral stents might predispose to injury by reducing their pliability; furthermore, ureteral stenting itself is not free of complications . However, ureteral stents were helpful when standard attempts to identify the ureter had failed in an area of severe adhesions . The complications of ureteral stenting itself are nowhere near as catastrophic as a ureteral injury . In our study, only 1 of 101 patients who underwent gynecologic surgery with prophylactic ureteral stent insertion suffered from a ureteral injury . The injury rate in the prophylactic ureteral stenting group was lower than in the non - stenting group with risk factors . Although statistically insignificant, this study had a small number of patients and the injury rate of the non - stenting group with risk factors (3.1%) was higher than that in previously reported studies (0.1 to 2.5%). Therefore, it is worth verifying the injury rate of prophylactic catheterized patients having associated risk factors . In this review, it is obvious that the intraoperative diagnosis and repair of ureteral injuries can produce the best results [1,4 - 7,16]. Although the incidence of ureteral injury with laparoscopy was similar to the incidence of ureteral injury with laparotomy in this study, the postoperative detection rate of ureteral injuries was significantly higher for laparoscopic surgery than for laparotomy . In a report by ostrzenski et al ., intraoperative diagnoses of ureteral injury during laparoscopic gynecologic surgery were made in only 6 (8.6%) of the 70 total cases . Delayed diagnosis seems to be the single controllable factor adversely influencing outcome . In other words, laparotomy may be a better option for the detection of ureteral injury when the surgeon can predict the ureteral injury on the basis of associated risk factors . Careful surgical technique with surgical exploration of the pelvic side wall is probably the best method by which to prevent ureteral injury . The data presented in this study should be viewed with caution because of the retrospective nature and the lack of objective parameters for grading the difficulty of pelvic procedures . The incidence of ureteral injury was significantly higher in cases having risk factors than in cases without risk factors . Therefore, surgeons should be cautious to prevent ureteral injury during gynecologic surgery, especially in patients with risk factors . It is necessary to study the optimal method in order to avoid ureteral injury, such as proprophylactic ureteral stenting . Laparotomy might be a better option for early detection and intraoperative repair of ureteral injury during gynecologic surgery when the patient has risk factors associated with ureteral injury.
|
Since its inception, cell communication and signaling (ccs) has been published by biomed central as an open access journal . Biomed central is an independent publisher committed to ensuring high quality publications in the fields of biomedical research . Articles published in ccs are freely available to everyone online, and are archived in internationally recognized free repositories . Although it is still young, ccs has been moderately successful, as indicated by the several thousand accesses to the manuscripts published throughout 2004 . Of course, becoming established will require more years, but the quality of the publications that have been accepted by our editorial board is a sign of good health . Thanks to an open access policy, articles that are published become freely and instantly available to any person connecting to the world wide web . Because articles are intended to remain available at no cost forever, they can be read, downloaded and printed in perpetuity . Copies of the published manuscripts are also archived and searchable in pubmed central, the us national library of medicine's full - text repository of life science literature, and also in repositories at the university of potsdam in germany, at inist in france and in e - depot, the national library of the netherlands' digital archive of all electronic publications . Since the authors hold coyright for their published work, they can make their articles freely available on their institution's website . The copyright policy also stipulates that the authors grant anyone the permission to reproduce and disseminate the article, provided that no errors are introduced and that it is adequately cited . As a comparison, several journals now offer free access to their articles on line, but it is generally, either for a limited period of time or only after 6 to 12 month following publication . Thus, open access offers several benefits to authors and readers in the scientific community and the general public . First the authors are assured that their work is widely disseminated and that it is likely to be cited more often than when it is published in a journal whose access is limited to subscribers . At a time when politicians in many different countries are urging the scientific community to better communicate with the general public, this aspect is of prime importance . Another major consequence is that there is no financial barrier to the dissemination of knowledge . The impact of a country's economy on access to knowledge is considerable and is often under evaluated or ignored by those who live in wealthy environments . As long as a researcher has internet access, he or she can read open access articles (although enabling them to get internet access is, admittedly, a big issue). Contributing to the cost of publishing by paying apcs is comparable to paying a toll for driving safely and more rapidly on good quality highways . Multiple clean, fast and safe lanes kept in good condition, with same services provided to all customers . Any publishing of quality, traditional or electronic, involves processing that is generally paid by the scientific community (either as authors, readers or subscribers). It may seem to some authors that the requested fee of 525 us$is exceedingly high but, in truth, it is very low compared to the revenues made per article in the traditional publishing model, which some have suggested were as high as us$3000, if not higher . The apc pays for the article to be freely accessible, and for the processes required before inclusion in pubmed and archiving in pubmed central, e - depot, potsdam and inist . Authors can circumvent the charge by getting their institution to become a' member' of biomed central, whereby an annual membership fee covers the apcs for all authors at that institution submitting to any journal published by biomed central in that year . Current members include nhs england, the world health organization, the us national institutes of health, harvard, princeton and yale universities, and all uk universities . Many funding agencies have also realized the importance of open access publishing and have specified that their grants may be used directly to pay apcs . On behalf of the editorial board of ccs, i wish to reassure readers and authors that we are committed to evaluating manuscripts on the basis of their scientific quality, not on whether author's can pay article - processing charge . If an author is unable to afford the apc, the editor - in - chief will be able to waive payment, if deemed necessary ., we firmly believe that publishing open access can only help scientific communication and improve results, hence becoming an excellent service to society . We do hope that you will support our effort towards this end by submitting manuscripts to cell communication and signaling.
|
Enterovesical fistula is an abnormal communication between the bladder and the intestine (1). It may occur as a result of postoperative complication of radical cystectomy and bladder substitution from the ileum, also called neobladder . . Divided ileal loops are side - to - side or end - to - end anastomosed . Surgical incisions and the numerous anastomoses that are performed during these complex procedures can cause intestinal or vesical leakage postoperatively . Computed tomography (ct), cystoscopy, endoscopy, barium enema, and cystography are the techniques that are recently used for diagnosis of these fistulas (1). In some cases ct enterography (cte) is a new technique for evaluation of small bowels, surrounding structures, and the entire abdomen (2 - 4). Cte examination with multi - detector ct (mdct) enables us to get excellent quality reformatted images with high spatial resolution (3 - 5). We showed the exact location of the fistula and its association with the bowels and neobladder by cte . We demonstrated the location of the leakage with only one technique by cte with no need of an invasive procedure . The aim of this case report is to show that cte can be a new and effective modality in detecting enteroneovesical fistula and to discuss the efficacy of cte in the detection and evaluation of enterovesical fistula referring to the literature . To the best of our knowledge, cte usage in such cases has not been reported before in the literature so far . We think that this case report could be useful for early and correct diagnosis of similar cases . A 64-year - old man presented with feces coming from the transurethral catheter 5 days after radical cystectomy and neobladder operation . The fistula location could not be detected with abdominal ultrasonography (us), ct, cystoscopy, antegrade pyelography, barium enema and cystography (figure 1). 1250 ml of oral contrast - material solution, which was composed of 500 ml water, 200 ml lactulose (667 mg / ml, osmolac, biofarma, turkey), and 450 ml dilute - mixed barium sulfate suspension especially designed for ct (e - z - cat, opakim, turkey), was ingested orally over 60 minutes at a steady rate . After administration of oral contrast agent, cte with 2 mm slice thickness was performed with a 64-detector mdct machine (aquilion 64, toshiba, tokyo, japan). After cte examination, sagittal and coronal reformatted images (slice thickness: 1 mm) were obtained by routinely available workstation inside the mdct machine . Ileoneovesical fistula (from the anastomose side) was determined on cte images (figure 2). Therefore, follow - up with transurethral catheter was recommended . If necessary, operation was planned . Enteroneovesical fistula is a rare condition that can be difficult to diagnose (1). The most common causes of enterovesical fistulas are crohn disease, enteritis, ulcerative colitis, trauma, postoperative - postradiotheraphy complications, penetrating injuries, bladder carcinomas, pelvic inflammatory disease, foreign bodies, and abscesses (6, 7). In addition, they may occur as a postoperative complication of radical cystectomy and neobladder substitution procedure . The other common findings are pneumaturia and recurrent urinary infections (6, 7). However, classical symptoms are only evident in 50% of patients with confirmed fistulae (1). Ct, cystoscopy, endoscopy, barium enema, and cystography are mainly used for diagnosis of enterovesical fistulas (1). Neocystogram examination of the neobladder (after administration of a diluted contrast agent solution via transurethral catheter) is the most frequent method used for the diagnosis of enteroneovesical fistula (6, 7). Another disadvantage of neocystography is that the diluted contrast agent solution given into the bladder with high pressure and in large amounts can result in a new leakage site iatrogenically . Some ct criteria are used for diagnosis of enterovesical fistulas such as presence of air within the bladder, focal bladder - bowel wall thickening, and presence of an associated soft - tissue mass (6, 7). However, the percentages of success in demonstrating the fistulas are not as high as it is expected (6, 7). As a result, another new technique is necessary to demonstrate enterovesical fistulas, their causes, and the communication site . The fact that in our case, the fistula and its localization were not detected by other techniques and were only detected by cte, supports this idea . Cte has become a valuable technique in detecting small bowel diseases such as obscure gastrointestinal bleeding, suspected small - bowel tumor and especially inflammatory bowel diseases (3 - 5). Cte is a well - tolerated imaging technique that unlike ct enteroclysis, does not need nasoenteric intubation (8, 9). The images taken following the ingestion of large amounts of oral contrast material enables us to detect the small bowel lumen and wall more successfully (2 - 4). Small bowel distension also makes contrast agent leakage from the fistula more prominent . As a result, leakages that cannot be detected by routine ct can be detected by cte . Cte examination with 64 mdct enables us to get isotropic voxels and excellent quality reformatted images with high spatial resolution that is more easily diagnosed while evaluating the operation site and neobladder (2 - 5). Cte may be a useful, sensitive, effective, and non - invasive technique for the evaluation of enteroneovesical fistulas, leakage from the anastomose sides in postoperative cases, and other extraintestinal complications such as urinary tract obstruction or abscess formation.
|
Ghent university multidisciplinary research partnership bioinformatics: from nucleotides to networks; fund for scientific research (fwo)flanders (belgium) (postdoctoral research fellowship to f.i . ); institute for the promotion of innovation through science and technology in flanders (iwt - vlaanderen) (phd to k.p . ); proteomexchange project, funded by the european union 7th framework program under grant agreement number [260558 to n.h . ]; prime - xs project, funded by the european union 7th framework program under grant agreement number [262067 to k.g . And l.m . ].
|
Rheumatoid arthritis (ra) is a chronic immune - mediated condition that leads to significant disability if not sufficiently treated . Biologic drugs are recommended for treating ra1 if nonbiologic disease - modifying antirheumatic drugs (dmards) are not tolerated by the patient or do not induce low disease activity or remission . Approved and widely used biologics for treating ra include the tumor necrosis factor inhibitors etanercept,2 adalimumab,3 and infliximab,4 and the selective t - cell costimulation modulator abatacept.5 etanercept and adalimumab are administered subcutaneously; infliximab and abatacept are administered via intravenous (iv) infusion . The adult dose for ra is fixed in the etanercept label; adult ra dosing can be changed for weight or to address loss of efficacy in the adalimumab, infliximab, and abatacept labels.25 because of the high yearly cost of biologics and the prevalence of ra (approximately 1.3 million us adults6), the cost - effectiveness of biologics for treating ra is of interest to payers in general and pharmacy benefit managers (pbms) in particular . According to the pharmaceutical care management association (a pbm trade group), pbms administer drug plans for more than 210 million americans in both government - sponsored and private contexts.7 analyses of pbm data are likely to be highly generalizable within the population under study, because multiple health plans are represented . Pbms negotiate drug pricing and design formularies on behalf of the health plans they contract with.7 therefore, pbm analyses are particularly relevant in determining the cost - effectiveness of high - cost, frequently used medications such as biologics for treating ra . Formulary decisions by pbm stakeholders are guided primarily by clinical trial results, but they also consider data from other sources such as observational research and internal analyses.8 clinical trial,9 observational,10 and meta - analytic11 evidence indicates that biologics for treating ra are similar to one another in efficacy . The differences between drugs in dosing and administration, however, may lead to differences in cost - effectiveness . Pbms and the broader payer community will therefore benefit from cost - effectiveness analysis from other sources including claims from pbm plans to guide their formulary decisions regarding biologics for ra . Analyses of biologic claims in pbm databases have yielded insights on costs per treated patient12 and dose escalation,13 but these analyses have not included estimates of effectiveness . An analysis of pbm data that incorporates estimations of both cost and effectiveness of biologics for treating ra would, therefore, provide a fuller picture of what this type of payer can expect in different formulary scenarios . One method for achieving this sort of analysis is to measure the effectiveness of biologics according to a validated algorithm; one can then calculate the cost per effectively treated patient . A validated algorithm applied to medical claims data that classifies a biologic as effective based on six medication - related criteria has been developed to measure the effectiveness of biologics for ra.14 the algorithm determines a biologic to be not effective if any of the following occur: low medication adherence, biologic switch or addition, addition of a new nonbiologic dmard, increase in biologic dose or frequency, one or more glucocorticoid joint injections, and increase in dose of oral glucosteroid.14 the algorithm was developed to address a key limitation of claims data, which is that it does not contain direct measurement of patient response to treatment . The algorithm was validated against a standard, quantitative measure of ra remission or disease improvement (designated the gold standard) using linked claims and outcomes data from the veteran s administration ra registry.14 effectiveness according to the algorithm had high performance characteristics against the gold standard: positive predictive value, 76%; negative predictive value, 90%; sensitivity, 72%; and specificity, 91%.14 similar results were observed in a separate analysis using linked medical records and claims from a commercial health plan database (positive predictive value, 87%).15 application of the validated algorithm to commercial insurer databases (ims pharmetrics plus, marketscan, and optum research) has found effectiveness rates ranging from 27.7% to 33% with etanercept, adalimumab, and abatacept, and from 19.0% to 21.9% with infliximab.1618 the analysis of the optum database also found higher algorithm - defined effectiveness in biologics administered subcutaneously (30.6%) than those administered via iv infusion (22.1%).16 in these analyses, the cost per effectively treated patient according to the algorithm was also calculated . The analyses found that etanercept had the lowest year 1 cost per effectively treated patient according to the algorithm, followed by adalimumab, abatacept, and infliximab.1618 differences in cost per effectively treated patient were driven by similar algorithm - defined effectiveness with etanercept, adalimumab, and abatacept; lower total cost with etanercept; and fewer algorithm - defined effectively treated patients with infliximab . Therefore, in the present study we analyzed claims from the medco pbm database to estimate effectiveness according to the validated algorithm . We used algorithm - defined effectiveness to calculate the cost per effectively treated patient and conducted analyses by biologic and method of administration (subcutaneous and iv). The present study was an analysis of linked medical and pharmacy claims from the medco health solutions pbm database . Medco health solutions (franklin lakes, nj, usa), which was acquired by express scripts (st . Louis, mo, usa) in 2012, has pharmacy claims data for over 60 million covered lives and medical claims data for 12.7 million covered lives . Pharmacy claims data are available within weeks and medical claims data within 34 months of filing . All patient records were de - identified, and the study complied with the health insurance portability and accountability act of 1996 . For the present study, the data - cleaning algorithm checked and cleaned the biologic dose per dispensing field based on the plan paid amount, biologic dose, injection frequency, and wholesale acquisition cost (wac; analysource, first databank inc ., south san francisco, ca, usa). We identified patients included in the medco pbm database with one or more claims for a biologic of interest (abatacept, adalimumab, anakinra, certolizumab, etanercept, golimumab, infliximab, rituximab, or tocilizumab) from july 1, 2007, to july 31, 2012 . The first observed claim during the patient identification period defined the index date; the previous 180 days were defined as the pre - index period; and the follow - up period was the 365 days after the index date . Patients were included in the analysis if they had continuous health plan enrollment during the pre - index period, index date, and follow - up period; were aged 1863 years on the index date; and had a diagnosis of ra during the pre - index period or on the index date (international classification of diseases, ninth edition, clinical modification [icd-9-cm] diagnosis code 714.0x). Patients were excluded if they had claims for more than one biologic of interest on the index date or any biologics in the pre - index period; an index claim for a biologic that had not received us food and drug administration approval; and a diagnosis during the pre - index period for a non - ra condition for which any of the biologics of interest are approved (plaque psoriasis, icd-9-cm 696.1; psoriatic arthritis, 696.0; ankylosing spondylitis, 720.0; juvenile idiopathic arthritis, 714.3x; crohn s disease, 555.xx; ulcerative colitis, 556.xx; non - hodgkin s lymphoma, 200.xx or 202.xx; or chronic lymphocytic leukemia, 204.1x). Biologics of interest with <100 eligible patients were excluded from the final analysis because of small sample size . We collected key baseline characteristics and nonbiologic dmard use during the pre - index period . The validated algorithm14 for effectiveness evaluated each patient s treatment as effective or not effective (table 1). Briefly, a patient s treatment was determined by the algorithm to be effective if none of the following occurred: low adherence to drug (defined as medication possession ratio19 <80%, or <80% of the minimum recommended number of infusions); addition or switch of biologic; addition of a new nonbiologic dmard; increase in biologic dose or frequency; more than one glucocorticoid joint injection from 91 days to 1 year after the index date; and increase in dose of oral glucocorticoid (no pre - index prescription: received for 30 days from 91 days to 1 year after the index date; with pre - index prescription: cumulative dose> 120% of pre - index).14 annual biologic costs were calculated based on the total dose of biologics that patients received and the wac price as of january 1, 2013 . Annual cost per effectively treated patient was calculated by dividing the total cost of biologic treatment of the cohort by the number of effectively treated patients according to the validated algorithm . The formula for this calculation is as follows: total cost of biologic treatment / number of effectively treated patients = cost per effectively treated patient descriptive analysis was conducted for all patients in the analysis data set, by method of administration (subcutaneous or iv) and by index biologic . Method of administration and index biologic were compared in baseline characteristics, pre - index nonbiologic dmard use, and effectiveness according to the algorithm . Statistical comparisons were conducted using the student s t - test for continuous variables and chi - square or fisher s exact test for categorical variables . All analyses were conducted using sas version 9.21 (sas institute inc ., cary, nc, usa). The present study was an analysis of linked medical and pharmacy claims from the medco health solutions pbm database . Medco health solutions (franklin lakes, nj, usa), which was acquired by express scripts (st . Louis, mo, usa) in 2012, has pharmacy claims data for over 60 million covered lives and medical claims data for 12.7 million covered lives . Pharmacy claims data are available within weeks and medical claims data within 34 months of filing . All patient records were de - identified, and the study complied with the health insurance portability and accountability act of 1996 . For the present study, the data - cleaning algorithm checked and cleaned the biologic dose per dispensing field based on the plan paid amount, biologic dose, injection frequency, and wholesale acquisition cost (wac; analysource, first databank inc ., south san francisco, ca, usa). We identified patients included in the medco pbm database with one or more claims for a biologic of interest (abatacept, adalimumab, anakinra, certolizumab, etanercept, golimumab, infliximab, rituximab, or tocilizumab) from july 1, 2007, to july 31, 2012 . The first observed claim during the patient identification period defined the index date; the previous 180 days were defined as the pre - index period; and the follow - up period was the 365 days after the index date . Patients were included in the analysis if they had continuous health plan enrollment during the pre - index period, index date, and follow - up period; were aged 1863 years on the index date; and had a diagnosis of ra during the pre - index period or on the index date (international classification of diseases, ninth edition, clinical modification [icd-9-cm] diagnosis code 714.0x). Patients were excluded if they had claims for more than one biologic of interest on the index date or any biologics in the pre - index period; an index claim for a biologic that had not received us food and drug administration approval; and a diagnosis during the pre - index period for a non - ra condition for which any of the biologics of interest are approved (plaque psoriasis, icd-9-cm 696.1; psoriatic arthritis, 696.0; ankylosing spondylitis, 720.0; juvenile idiopathic arthritis, 714.3x; crohn s disease, 555.xx; ulcerative colitis, 556.xx; non - hodgkin s lymphoma, 200.xx or 202.xx; or chronic lymphocytic leukemia, 204.1x). Biologics of interest with <100 eligible patients were excluded from the final analysis because of small sample size . We collected key baseline characteristics and nonbiologic dmard use during the pre - index period . The validated algorithm14 for effectiveness evaluated each patient s treatment as effective or not effective (table 1). Briefly, a patient s treatment was determined by the algorithm to be effective if none of the following occurred: low adherence to drug (defined as medication possession ratio19 <80%, or <80% of the minimum recommended number of infusions); addition or switch of biologic; addition of a new nonbiologic dmard; increase in biologic dose or frequency; more than one glucocorticoid joint injection from 91 days to 1 year after the index date; and increase in dose of oral glucocorticoid (no pre - index prescription: received for 30 days from 91 days to 1 year after the index date; with pre - index prescription: cumulative dose> 120% of pre - index).14 annual biologic costs were calculated based on the total dose of biologics that patients received and the wac price as of january 1, 2013 . Annual cost per effectively treated patient was calculated by dividing the total cost of biologic treatment of the cohort by the number of effectively treated patients according to the validated algorithm . The formula for this calculation is as follows: total cost of biologic treatment / number of effectively treated patients = cost per effectively treated patient descriptive analysis was conducted for all patients in the analysis data set, by method of administration (subcutaneous or iv) and by index biologic . Method of administration and index biologic were compared in baseline characteristics, pre - index nonbiologic dmard use, and effectiveness according to the algorithm . Statistical comparisons were conducted using the student s t - test for continuous variables and chi - square or fisher s exact test for categorical variables . All analyses were conducted using sas version 9.21 (sas institute inc ., cary, nc, usa). Out of 97,816 patients with one or more ra diagnosis codes from january 1, 2007, to july 31, 2013, 11,693 (12%) had claims for biologics . Of these, 1,236 remained after applying inclusion and exclusion criteria (table 2). There were 146 patients who were subsequently excluded because their index biologic had a sample size <100 (anakinra, certolizumab, golimumab, rituximab, and tocilizumab). The analysis population was 1,090 patients, of whom 785 were taking subcutaneous biologics (etanercept, n=440; adalimumab, n=345) and 305 were taking iv biologics (infliximab, n=201; abatacept, n=104) (table 2). Etanercept was the most commonly used biologic, so it served as the comparator in index biologic analyses . The mean standard deviation age was 49.79.4 years, which was significantly higher in patients taking iv compared to subcutaneous biologics, and in abatacept compared to etanercept (table 3). The mean standard deviation charlson comorbidity index (cci) of the study sample was 0.81.2, and the most common comorbidities found were hypertension (27.4%), diabetes (11.7%), and chronic pulmonary disease (10.8%). The mean cci was similar between patients taking subcutaneous and iv biologics, etanercept and adalimumab, and etanercept and infliximab (table 3). Proportions of patients with individual comorbidities were similar between those taking subcutaneous and iv biologics, except for malignancy (1.3% versus 3.6%; p=0.02). The cci (1.11.3 versus 0.81.2; p=0.047) and proportion with hypertension (41% versus 27%; p=0.004) were higher in patients taking abatacept compared to etanercept . Most patients (72%) used dmards in the 180-day pre - index period, and the most commonly prescribed dmard was methotrexate (58%) (table 4). The proportion of patients taking dmards in the 180-day pre - index period was significantly higher among patients taking subcutaneous compared to iv biologics (p<0.001). This statistically significant difference was maintained in both iv biologics individually compared to etanercept (p<0.001 for infliximab and abatacept) (table 4). The overall rate of effectiveness according to the validated algorithm was 32% and was significantly higher among patients taking subcutaneous (36%) compared to iv biologics (23%; p<0.001) (table 5 and figure 1). Effectiveness according to the validated algorithm was higher in patients taking etanercept (36%) compared to infliximab (22%; p<0.001) and abatacept (24%; p=0.02) but similar compared to adalimumab (35%; p=0.77) (table 5 and figure 1). Low adherence was the most common reason for a biologic to be considered not effective by the algorithm; the rate for this criterion was highest among patients taking abatacept (versus etanercept, p=0.02). There was a significantly higher proportion of patients meeting the increased biologic dose criterion in iv compared to subcutaneous biologics (p<0.001), and in adalimumab, infliximab, and abatacept compared to etanercept (p<0.001 for all) (table 5). The proportion of patients meeting the multiple joint injections criterion was higher among patients taking iv compared to subcutaneous biologics (p=0.002) and for abatacept compared to etanercept (p<0.001) (table 5). The annual cost per effectively treated patient according to the algorithm was $67,819 overall, $64,738 for subcutaneous biologics, and $80,408 for iv biologics . By individual biologic, the cost per effectively treated patient according to the algorithm was $62,841 for etanercept, $67,226 for adalimumab, $90,696 for infliximab, and $62,303 for abatacept (figure 2). The cost per effectively treated patient according to the algorithm relative to etanercept (100%) was 107% with adalimumab, 99% with abatacept, and 144% with infliximab (figure 3). Out of 97,816 patients with one or more ra diagnosis codes from january 1, 2007, to july 31, 2013, 11,693 (12%) had claims for biologics . Of these, 1,236 remained after applying inclusion and exclusion criteria (table 2). There were 146 patients who were subsequently excluded because their index biologic had a sample size <100 (anakinra, certolizumab, golimumab, rituximab, and tocilizumab). The analysis population was 1,090 patients, of whom 785 were taking subcutaneous biologics (etanercept, n=440; adalimumab, n=345) and 305 were taking iv biologics (infliximab, n=201; abatacept, n=104) (table 2). Etanercept was the most commonly used biologic, so it served as the comparator in index biologic analyses . The mean standard deviation age was 49.79.4 years, which was significantly higher in patients taking iv compared to subcutaneous biologics, and in abatacept compared to etanercept (table 3). The mean standard deviation charlson comorbidity index (cci) of the study sample was 0.81.2, and the most common comorbidities found were hypertension (27.4%), diabetes (11.7%), and chronic pulmonary disease (10.8%). The mean cci was similar between patients taking subcutaneous and iv biologics, etanercept and adalimumab, and etanercept and infliximab (table 3). Proportions of patients with individual comorbidities were similar between those taking subcutaneous and iv biologics, except for malignancy (1.3% versus 3.6%; p=0.02). The cci (1.11.3 versus 0.81.2; p=0.047) and proportion with hypertension (41% versus 27%; p=0.004) were higher in patients taking abatacept compared to etanercept . Most patients (72%) used dmards in the 180-day pre - index period, and the most commonly prescribed dmard was methotrexate (58%) (table 4). The proportion of patients taking dmards in the 180-day pre - index period was significantly higher among patients taking subcutaneous compared to iv biologics (p<0.001). This statistically significant difference was maintained in both iv biologics individually compared to etanercept (p<0.001 for infliximab and abatacept) (table 4). The overall rate of effectiveness according to the validated algorithm was 32% and was significantly higher among patients taking subcutaneous (36%) compared to iv biologics (23%; p<0.001) (table 5 and figure 1). Effectiveness according to the validated algorithm was higher in patients taking etanercept (36%) compared to infliximab (22%; p<0.001) and abatacept (24%; p=0.02) but similar compared to adalimumab (35%; low adherence was the most common reason for a biologic to be considered not effective by the algorithm; the rate for this criterion was highest among patients taking abatacept (versus etanercept, p=0.02). There was a significantly higher proportion of patients meeting the increased biologic dose criterion in iv compared to subcutaneous biologics (p<0.001), and in adalimumab, infliximab, and abatacept compared to etanercept (p<0.001 for all) (table 5). The proportion of patients meeting the multiple joint injections criterion was higher among patients taking iv compared to subcutaneous biologics (p=0.002) and for abatacept compared to etanercept (p<0.001) (table 5). The annual cost per effectively treated patient according to the algorithm was $67,819 overall, $64,738 for subcutaneous biologics, and $80,408 for iv biologics . By individual biologic, the cost per effectively treated patient according to the algorithm was $62,841 for etanercept, $67,226 for adalimumab, $90,696 for infliximab, and $62,303 for abatacept (figure 2). The cost per effectively treated patient according to the algorithm relative to etanercept (100%) was 107% with adalimumab, 99% with abatacept, and 144% with infliximab (figure 3). In an analysis of pbm claims data, we found that patients with ra who took subcutaneous biologics experienced a higher rate of effectiveness according to a validated algorithm and lower cost per algorithm - defined effectively treated patient . Patients taking etanercept and adalimumab experienced similar algorithm - defined effectiveness rates, while the rates were higher with etanercept compared to infliximab and abatacept . The cost per effectively treated patient according to the algorithm was lowest with abatacept and etanercept followed by adalimumab and infliximab . Most of the results of our analysis are consistent with those observed in previous analyses of commercial claims databases . Some of the differences between our analysis and those previously reported may derive from the differences between pbm and commercial claims databases . It is important to note, however, that other commercial claims databases may include pbm data; in discussing the results of our analysis and those that have been previously reported, we are not making an exact pbm versus non - pbm comparison . Nevertheless, we have observed results that distinguish our study results from those already reported . Rates of algorithm - defined effectiveness in our study were significantly higher with subcutaneous compared to iv biologics, confirming a finding from an analysis of the optum research database (30.6% versus 22.1%, no p - value given).16 the present analysis found higher etanercept and adalimumab and lower iv biologic effectiveness than other analyses using the validated algorithm we applied to our analysis.1618 the difference may be due to better compliance with the subcutaneous biologics, which could have been identified because of pbm data use . Consistent with previous analyses,1618 we found adherence to be the primary reason for a treatment to be deemed not effective according to the validated algorithm . The pattern by biologic in those analyses, however, differed from what we observed in the current study . Previous analyses found infliximab to have the highest adherence rate followed by abatacept; adherence for subcutaneous biologics was approximately 45%.1618 in our study, etanercept, adalimumab, and infliximab all had an adherence of about 50%, while abatacept had the lowest rate (36.5%). The pbm data we analyzed may have captured more adherence data for subcutaneous biologics than other commercial claims databases . It is unclear, however, why both abatacept and infliximab had lower rates of adherence in our analysis than in previous analyses of other commercial claims databases . Also, the proportion of patients with an increased biologic dose as defined by the algorithm was higher among those taking iv compared to subcutaneous biologics, and for adalimumab, abatacept, and infliximab compared to etanercept . As noted above, the algorithm deemed treatment that met the increased dose criterion to be not effective . A similar pattern was seen in similar analyses of other commercial claims databases, with etanercept having the lowest and infliximab the highest proportions of patients whose biologic therapy met the algorithm s criterion for increased biologic dose.1618 dose escalation is permitted by the infliximab and adalimumab labels3,4 but not by the etanercept label.2 accordingly, higher rates of dose escalation with infliximab and adalimumab compared to etanercept have been observed in claims analyses.13,2027 biologic effectiveness, adherence, and dosing all have significant cost implications for formularies . Cost per effectively treated patient according to the algorithm incorporates these variables and provides a method to compare both biologic administration methods and individual drugs . In the current study, this outcome was lower in subcutaneous compared to iv biologics; by biologic, abatacept and etanercept were lowest, followed by adalimumab and infliximab (table 5). Previous studies of cost per effectively treated patient according to the algorithm, all in other commercial payer databases, have shown etanercept to be lowest, followed by adalimumab, abatacept, and infliximab . Notably, we derived these cost estimates from a pbm database and applied wac pricing . Pbm data show drug utilization across various plans and formulary types, possibly increasing the generalizability of our results . Similarly, applying wac pricing assigns costs as the highest possible amount and avoids the often - significant variability in paid amounts across different plan types . Of course, a key disadvantage would be the inability to conduct a plan - level analysis because no plan paid amounts were available . Overall, however, our analysis provides estimates of algorithm - defined effectiveness and cost per effectively treated patient that may allow plan managers to predict their formulary costs for biologics used to treat ra . Our study was retrospective, and bias may have been introduced by factors we did not identify or measure . Moreover, the choice of a biologic for ra could have been influenced by channeling bias owing to patient, disease, or labeling characteristics . For example, we observed that patients taking iv biologics as a group and abatacept in particular were older than those taking subcutaneous biologics and etanercept, respectively . We also observed a greater proportion of patients taking dmards in the pre - index period among iv compared to subcutaneous, and for both iv biologics the infliximab indication for ra requires that it be taken with methotrexate.4 therefore, patients who could not tolerate methotrexate therapy may have been directed to biologics that are labeled for biologic monotherapy in ra . The dose increase criterion of the effectiveness algorithm could have introduced bias in favor of etanercept, which does not include dose escalation or weight - based dosing in its label . The amount of dose escalation required to deem the biologic therapy ineffective, however, would most likely be employed in the event of clinically meaningful loss of efficacy . Finally, our use of pbm data to estimate algorithm - defined effectiveness has important limitations . The algorithm that we applied to the claims data in the study database, however, has been validated against the disease activity score in 28 joints (das28), a widely used and accepted assessment of ra disease activity.28 the validation study14 found that the algorithm s positive predictive value (ie, for finding a patient s treatment effective) was 75% (95% confidence interval, 62%86%) and negative predictive value was 90% (95% confidence interval, 84%94%). The gold standard was clinically meaningful (low disease activity defined as das28 3.2 or improvement by> 1.2 units by 122 months), suggesting that most patients whose treatment courses were deemed ineffective by the algorithm did not experience a significant clinical benefit from the index biologic during the follow - up period . A similar result was observed in an analysis using a commercial database15 (positive predictive value, 86.6%). We acknowledge that the algorithm has not been validated against a quality of life measure, and das28 focuses exclusively on joint counts and the global assessment of disease activity.28 in a us pbm setting, effectiveness according to a validated, claims - based algorithm was higher in subcutaneous versus iv biologics . Dose escalation and low adherence led to lower algorithm - defined effectiveness for infliximab and abatacept . Cost per effectively treated patient according to the algorithm was approximately $16,000 lower in subcutaneous versus iv biologics . The latter outcome was lowest with etanercept and abatacept among the subcutaneous and iv biologics, respectively . The results of our study suggest that patients and pbms may benefit from a formulary - driven strategy to encourage subcutaneous over iv biologic use in treating ra.
|
Pseudomembranous colitis (pmc) is a nosocomial infection mainly caused by the use of antibiotics and is commonly associated with abdominal pain and diarrhea . A gradual increase in pmc incidence has been observed, coincident with increasing antibiotic consumption.123 despite the use of antibiotics for the primary management of pmc, it has a recurrence rate of 15%30% and patients who had one recurrence can reach up to 40% of a second recurrence.4 this high rate of recurrent and refractory pmc not only lowers the quality of patients' lives, but also may predispose patients to severe megacolon, perforation, shock, and other complications . 567 fecal microbiota transplant (fmt) has emerged in recent years as a treatment option for patients with recurrent and antibiotic - refractory pmc, and many studies have achieved favorable results with this procedure.89101112131415 here we report a case of refractory pmc which was successfully resolved without recurrence after performing fmt using a colonoscope . A 69-year old woman was admitted to the inha university hospital with complaints of mucous diarrhea and low abdominal pain with repeated relapses and remission of symptoms over 5 months . She was taking medication for hypertension and had a history of adjuvant chemotherapy after undergoing a low anterior resection due to rectal cancer 12 years prior to admission to our hospital . Five months ago, the patient was admitted to a local hospital due to diarrhea that developed after eating pork . She then visited our hospital's outpatient unit because her symptoms remained the same . Even though antidiarrheals and probiotics were administered to the patient in the outpatient unit a colonoscopy performed two months prior to her visit revealed edema, hyperemia, and multiple whitish plaques from the transverse colon to the sigmoid colon (fig . 1a, b). Since pathologic findings included denuded epithelium covered with a mucoid exudate (fig . 1c) and stool test results were positive for clostridium difficile toxin, she was diagnosed with pmc . Her crp level was elevated to 7.99 mg / dl and no other bacteria were detected from blood or stool cultures . Administration of metronidazole (500 mg), orally 3 times per day for 10 days, temporarily improved her symptoms, with a decrease of crp to 1.58 mg / dl . However, diarrhea persisted and her symptoms were gradually worsened . Subsequently, vancomycin (250 mg) was given orally 4 times per day for 2 weeks, and symptoms were improved for a week, but diarrhea persisted . She underwent colonoscopy again after being admitted to our hospital 1 month prior to her final admission for fmt . Colonoscopy revealed pmc, and re - elevated crp levels (8.82 mg / dl). Hence, a daily dose of oral vancomycin was increased to 500 mg, 4 times per day for 2 weeks . However, mucous diarrhea persisted after discharge and the symptoms were not improved . Since her pmc was determined to be refractory to antibiotics, we decided to perform an fmt after obtaining consent from the patient and her guardian . At the time of admission for fmt, she had stable vital signs (blood pressure 146/78 mmhg, heart rate 80 beats / min, respiratory rate 18 breaths / min, and a temperature of 36.0) but was critically ill . She complained of systemic muscle weakness, abdominal pain and a feeling of incomplete defecation . Laboratory tests revealed wbc 8,860/mm, hemoglobin 13.3 gm / dl, platelet count 190,000/mm, total protein 6.9 gm / dl, albumin 3.8 gm / dl, total bilirubin 1.3 mg / dl, ast 19 iu / l, alt 15 iu / l, alp 161 iu / l, bun 9.4 mg / dl, creatinine 0.87 mg / dl, crp 0.21 mg / dl, na 138 meq / l, k 2.9 meq / l and cl 105 meq / l . Based on these results, she was suspected to have hypokalemia attributable to repeated diarrhea . The patient's daughter, who had no underlying diseases or gastrointestinal (gi) symptoms, volunteered to be the donor . In addition, the daughter had no history of medication over the previous 3 months . Donor screening tests were carried out, including a parasite exam, stool culture, and a susceptibility test for salmonella, shigella, and campylobacter species, a c. difficile toxin a / b test . In addition, several serum tests were done, including serum ameobic antibody, hav igg / m, hbsag / ab, hbcab, hcv ab, hiv ag / ab, vereneal disease research laboratory . The donor had no abnormal findings . Before the transplantation, the use of antibiotics was suspended and bowel cleansing was performed . Colonoscopy revealed edematous and hyperemic mucosal changes with multiple whitish patches from the transverse colon to the sigmoid colon (fig . 50 g of fresh feces were collected from the donor and then mixed and stirred with 500 ml of normal saline . Subsequently, the supernatant of the solution was filtered using a coffee filter or gauze (fig . Approximately 500 ml of the filtered fecal suspension was administered into the proximal ascending colon via a colonoscope (fig . After the fmt there were no complications and the patient was discharged 2 days after the procedure . At the first week follow - up visit, one month after being discharged, a follow - up colonoscopy was performed and found no relapsing symptoms . The patient is currently being monitored and had no recurrence of symptoms at the last follow - up, 9 months after the procedure . C. difficile infection is one of the common nosocomial infections and the leading cause of antibiotic - associated diarrhea . Intestinal dysbiosis caused by antibiotic use can eventually lead to proliferation of c. difficile, a gram - positive anaerobic bacteria, and toxin production and can result in symptoms such as abdominal pain and diarrhea . Pmc is diagnosed based on a positive result for c. difficile toxin or characteristic findings during colonoscopy.151617 for primary therapy of pmc, oral metronidazole (500 mg) is administered 3 times per day for 1014 days . Oral vancomycin (125250 mg) is recommended 4 times per day for 1014 days for severe cases.7818 despite favorable treatment outcomes, pmc has a 15%30% recurrence rate and repeated relapses in the course of the disease reduce the response to treatment.14 at first recurrence, the initial therapy can be implemented again, depending on a re - evaluating the severity of pmc . In cases of repeated recurrence, oral vancomycin (500 mg, 4 times per day) is considered and intravenous administration of metronidazole or a vancomycin enema is recommended, in combination with oral vancomycin or alone.1617 however, recurrent and refractory pmc is more difficult to treat,168 and is usually associated with megacolon, perforation, shock, and other severe complications related to the increasing incidence of pmc.7 although the use of metronidazole failed in the case reported here, the patient was diagnosed with mild pmc due to the absence of high fever or leukocytosis . Her symptoms persisted despite the use of vancomycin (250 mg, 4 times per day for 2 weeks). Since the initial dose of vancomycin was determined to be insufficient, it was increased to 500 mg, 4 times per day for another 2 weeks . However, an fmt was planned after the patient's pmc was diagnosed as refractory . New therapeutic approaches have been investigated for the treatment of recurrent and refractory pmc, and a large number of recent studies have explored the use of fmt.89101112131415 the concept of an fmt was first reported in 1958 by eiseman et al.9 for the treatment of fulminant pmc . Since then, a considerable number of case reports and studies on the treatment's effects and methodologies have been performed worldwide . In a recent randomized control trial, fmt had a better outcome than the use of vancomycin in patients with recurrent and refractory pmc.8 a domestic study also reported a successful case of treating recurrent and refractory pmc via enema11 and upper gi endoscopy.12 this case report was meaningful in that it compared clinical data and colonoscopic findings from follow - up colonoscopies in cases where pmc was managed with colonoscopy . An fmt can be performed via a nasogastric tube, upper endoscopy, enema, colonoscopy, and other methods.18 although some concerns have been raised with regard to the re - establishment of the normal intestinal flora from transplanted microbiota in the use of a nasogastric tube or upper endoscopy, studies have not shown significant differences in these methods . However, there may be problems such as vomiting, the risk of aspiration, and patient's rejection of the transplant . In our hospital, there was one case in which aspiration pneumonia developed in a patient with cerebrovascular disease after undergoing fecal transplantation with a nasogastric tube . The shortcomings of colonoscopy are that it is relatively more complicated than nasogastric tube insertion or upper gi endoscopy, and bowel cleansing is essential for proper examination . The advantages are that vomiting - related problems can be excluded, unnecessary fmt can be avoided, and transplantation can be done onto the lesion site by examining the mucosal state with colonoscopy . When the fecal solution can be retained in the colon for a sufficient time after transplantation, fecal transplant via colonoscopy is anticipated to be an effective method for treating pmc . Even though performing an enema would have been an easier procedure in this case, we chose transplantation via colonoscopy due to the short transit time . Furthermore, instead of injecting into the transverse or sigmoid colon, the fecal suspension was injected into the ascending colon for a longer colonic transit time . After transplantation, the patient was encouraged to rest in a supine position and to retain her stool, if possible . Although the side effects of fmt via colonoscopy are known to be minimal,19 cautions should be taken in using colonoscopy in patients with severe pmc associated with paralytic ileus or megacolon, due to the risk of complications such as perforations . Successful treatment of fmt cases has been reported and several multicenter randomized controlled studies and meta - analyses have demonstrated the favorable results of this procedure . However, fmt has not been widely implemented in korea because of patients being unwilling to undergo fecal transplantation and concerns about infections.20 in the future, patients will hopefully accept and understand the benefits of fecal transplantation, even though it may be aesthetically unappealing, through sufficient explanation during interviews by clinicians . Moreover, a donor screening test is warranted to prevent secondary infections caused by the transplantation . In this case report, the patient was compliant when the need for the procedure and the clinical outcomes of fmt were fully explained . Secondary infection was prevented as the patient's daughter was chosen as the donor and blood and fecal screening tests were thoroughly conducted before the procedure . Bowel cleansing was performed in preparation for the fmt, as described in previous studies.81013 on the day of procedure, 50 g of fresh feces were collected from the donor and then mixed and stirred with normal saline . Subsequently, the supernatant of the solution was filtered using a coffee filter or gauze (fig . Approximately 500 ml of fecal suspension were prepared and injected to the patient's colon via colonoscopy . During this process, the coffee filter takes longer to filter out fecal particles than gauze since the filter is blocked by those particles . Even though the effectiveness of fmt has been demonstrated, the transplantation procedure has not yet been standardized.1520 according to a systematic review by gough et al.15 in 2011, no differences were found in the rate of successful treatment in relation to the amount of used stool . However, a significantly lower recurrence rate was observed in the group transplanted with more than 50 g of stool (1%) compared to the group transplanted with less than 50 g (4%). Treatment rates showed a significant difference in cases transplanted with more than 500 ml of fecal solution compared with cases transplanted with less than 200 ml of fecal solution (97% and 80%, respectively). Based on the above results, we decided that preparing approximately 500 ml of fecal solution by mixing more than 50 g of feces with saline solution was appropriate for the transplantation . Van nood et al.8 selected donors through a questionnaire and screening tests among donor volunteers . Kelly et al.10 involved the patient's family members as donors . An insignificant difference was found in treatment success rates between the two groups (94% and 92%, respectively) and severe side effects were not seen . These outcomes provide a basis for expanding donor selection through adequate screening tests . In this case report transplantation from a family member is thought to alleviate the patients concerns towards fecal transplantation . However, the screening process took approximately one week before fecal transplantation was possible . In recent years, administration of freeze - dried fecal capsules from donors has lead to more timely and effective fmt, exhibiting successful results in over 90% of urgent - care patients with pmc.21 the patient in the current case report is currently being followed up and has been without recurrence for 9 months after the fmt . In a study on 94 patients followed up after fmt via enema, there were no cases of recurrence between 624 months.22 a previous study reported that eight relapsed cases out of 77 patients were attributable to antibiotic use, three months after fecal transplantation via colonoscopy . Recurrence was not detected in the remaining patients during a mean follow - up period of 17 months.23 based on these results, no relapse of pmc is expected over the long - term in the current case report . The above findings from several case reports and systematic reviews demonstrate the efficacy of fmt . The patient in the current case report showed a dramatic improvement after a single session of fmt . Although fmt has not been performed frequently in korean medical institutions due to patient aversion to fecal transplantation and concerns about infection, fmt is now officially recommend in european treatment guidelines.24 fmt is expected to be the standard therapy for the management of recurrent and refractory pmc domestically in the future.
|
Comparar o crescimento somtico, a funo pulmonar e o nvel de atividade fsica entre escolares nascidos prematuros com muito baixo peso e escolares nascidos a termo e com peso adequado . Foram recrutados escolares com idade de 8 a 11 anos residentes na mesma rea de abrangncia do estudo: prematuros e com peso <1.500 g e controles (nascidos a termo e com peso 2.500 g). Alm disso, foram coletadas informaes do perodo perinatal / neonatal dos recm - nascidos com muito baixo peso (rnmbp) de seus pronturios mdicos . Dos 93 escolares avaliados, 48 crianas no grupo rnmbp e 45 no grupo controle . No houve diferenas significativas entre os grupos em relao s caractersticas antropomtricas e nutricionais ou aos parmetros de funo pulmonar . No foram encontradas associaes entre as variveis perinatais / neonatais e parmetros da funo pulmonar dos escolares no grupo rnmbp . Embora sem diferena significativa em relao aos nveis de atividade fsica, o grupo rnmbp apresentou uma tendncia de ser mais ativo que o grupo controle . Nos escolares aqui estudados o crescimento e a funo pulmonar parecem no ser afetados por prematuridade, peso ao nascimento ou nvel de atividade fsica . Surfactant therapy and prenatal steroid use have been reported to result in a significant reduction in mortality among very - low - birth - weight (vlbw) infants . However, many preterm infants require prolonged oxygen supplementation or mechanical ventilation, which can lead to irreversible damage to the lung parenchyma . Controversy remains regarding the effects of prematurity, low birth weight, and certain neonatal factors on lung function in school - age children, despite the fact that several studies have examined this issue . Although some studies have shown a reduction in fev1, fvc, and lung volumes in preterm infants, others have shown preserved lung function during childhood . To date, there have been no studies conducted in brazil and evaluating lung function in school - age children who were vlbw infants . In preterm infants, the natural development of the lungs and airways is affected by the fact that part of the process of lung development occurs after birth . In an immature respiratory system, previous studies have shown that neonatal and perinatal factors can trigger a sequence of events that can affect lung structures and increase the incidence of respiratory disease . Among school - age children, the risk of health complications and delayed development is higher in those who were preterm infants and in those born at extremely low birth weight than in those who were full - term infants . In addition, studies suggest that, in preterm infants, catch - up growth is delayed and the risk of growth restriction in the first years of life is high, and that the subnormal weight and height observed in the first months of life can persist throughout childhood, adolescence, and adulthood . In the last two decades, there has been a significant reduction in the level of physical activity and an increase in sedentary behavior among pediatric patients . This can be attributed to changes in the types of activities in which young people engage, active activities involving increased energy expenditure having been replaced with long hours spent using the computer, playing video games, and watching television . However, there is currently little information regarding the level of physical activity among schoolchildren who were preterm infants, low - birth - weight infants, or both . The present study was motivated by the contradictory findings regarding lung function in school - age children who were low - birth - weight preterm infants, the possibility of retardation of growth (weight and height) in such children, and the significant changes in the types of activities in which they engage . The specific objectives of the study were to evaluate growth, lung function, and the level of physical activity in schoolchildren who were in the 8- to 11-year age bracket and who had been vlbw preterm infants and to compare their growth, lung function, and level of physical activity with those of schoolchildren who were in the same age bracket and who had been normal - birth - weight (nbw) full - term infants . The study included schoolchildren who were in the 8- to 11-year age bracket at the time of the study, who had been preterm infants whose birth weight was 1,500 g, and who had been admitted to the caxias do sul general hospital neonatal icu, in the city of caxias do sul, brazil, between january of 2001 and december of 2005 . For logistical reasons, only children residing in municipalities located within up to 100 km of caxias do sul were invited to participate in the study . The control group comprised children who had been full - term infants (37 weeks of gestational age) whose birth weight was 2,500 g, who had no respiratory symptoms, as determined by the international study of asthma and allergies in children questionnaire, and who were recruited from among those attending public schools in caxias do sul . Children with heart disease, those with neuromuscular disease, those with cognitive limitations, and those who were unable to perform spirometry were excluded from the study . Data were collected by two trained researchers at the university of caxias do sul in the period between july and december of 2013 . The study was approved by the research ethics committee of the pontifical catholic university of rio grande do sul (protocol no . 12323413.7.0000.5336), located in the city of porto alegre, brazil, and the parents or legal guardians of the children who agreed to participate in the study gave written informed consent . Data regarding the perinatal and neonatal periods for the children who had been vlbw preterm infants (the vlbwpi group) were collected from the neonatal icu database . We collected data on the following variables: use of antenatal corticosteroids; premature rupture of membranes; duration of oxygen therapy; length of hospital stay; birth weight; use of continuous positive airway pressure; hyaline membrane disease; and surfactant use . Weight was measured with a digital scale (glass 1 fw; g - tech, rio de janeiro, brazil), and height was measured with a portable stadiometer (alturaexata; tbw, so paulo, brazil). On the basis of height and weight, nutritional status was normalized to height - for - age, weight - for - age, and bmi - for - age z scores . Spirometry was performed with a portable spirometer (koko; ferraris respiratory, louisville, co, usa). All tests were performed in accordance with the american thoracic society standards and acceptability and reproducibility criteria . The children were verbally encouraged to perform a maximal expiratory maneuver at maximal effort following a maximal inspiratory maneuver . The following spirometric parameters were assessed: fvc; fev1; and fef25 - 75% . The level of physical activity was assessed by an adapted questionnaire consisting of items regarding the activities performed in the last seven days . The questionnaire gathered information on the type of activity, time spent commuting to school, work, or both, and frequency of / time spent in leisure - time physical activity . On the basis of their level of physical activity, the schoolchildren were classified as active (> 300 min / week) or inactive (300 min / week); those who were classified as having sedentary behaviors were subdivided into two groups, on the basis of their daily screen time (> 2 h / day or 2 h / day). A sample of 25 individuals per group was calculated to be sufficient to detect a 14% difference in percent predicted fev1, a standard deviation of 12% for the control group and of 17% for the vlbwpi group being assumed (on the basis of a previous study, with a power of 90% and a significance level of 5%). Given the possibility of losses, the number of individuals per group was increased to 30, totaling 60 participants . Variables with normal distribution were expressed as mean and standard deviation, whereas those with non - normal distribution were expressed as median and interquartile range . The study outcomes were compared between the two groups by the student's t - test for independent samples, the wilcoxon u test, and pearson's chi - square test . Univariate and multivariate linear regression models were used in order to evaluate the association between outcome variables (fev1, fvc, and fef25 - 75%) and predictor variables (birth weight, length of hospital stay, gestational age, premature rupture of membranes, use of surfactant, use of antenatal corticosteroids, duration of oxygen therapy, duration of mechanical ventilation, use of continuous positive airway pressure, and hyaline membrane disease). All analyses were performed with the statistical package for the social sciences, version 18.0 (spss inc ., chicago, il, usa), and differences were considered significant at p <0.05 . Of the 338 vlbw preterm infants admitted to the neonatal icu during the data collection period, 219 (64.79%) survived . Of those, 91 (41.55%) were located, and only 62 (28.31%) were selected for the study . Figure 1 shows the data regarding the selection of participants in the vlbwpi group . Figure 1flowchart of inclusion and exclusion of very - low - birth - weight preterm infants (vlbwpis). Of the 62 vlbw preterm infants selected, 7 were excluded because of technically inadequate spirometry tests and 7 were excluded because of cognitive deficits that prevented them from undergoing spirometry . Therefore, 48 (77.41%) participated in the study . Table 1 shows the information regarding the perinatal and neonatal periods for the vlbwpi group . There were no significant differences between the individuals who were included in the vlbwpi group and those who were not regarding neonatal and perinatal factors . In addition to the individuals who were selected for inclusion in the vlbwpi group, 52 controls were selected . Of those, 5 were excluded because they failed spirometry and 2 were excluded because they had cognitive deficits, a total of 45 controls (86.53%) being included in the study . Therefore, the final study sample consisted of 93 children: 48 in the vlbwpi group and 45 in the control group . There were no significant differences between the two groups regarding anthropometric characteristics or nutritional status (table 2). Table 1comparison of perinatal and neonatal variables between the very - low - birth - weight preterm infants who were included in the present study and those who were not . Variableincluded in the studynot included in the studyp (n = 48)(n = 171) antenatal corticosteroid use31 (64.6)100 (58.5)0.379surfactant use31 (64.6)100 (58.5)0.349hmd34 (70.8)112 (65.5)0.324mv31 (64.6)100 (58.5)0.349prom06 (12.5)25 (14.6)0.720oxygen therapy> 28 days09 (18.7)38 (22.2)0.623cpap27 (56.2)105 (61.4)0.317length of hospital stay, days 46.0 (35.5 - 60.0)43.0 (36.0 - 57.0)0.571birth weight, g 1.210.42 168.721.226.07 210.850.278gestational age, weeks 30.4 4.532.0 5.80.615hmd: hyaline membrane disease; mv: mechanical ventilation; prom: premature rupture of membranes; and cpap: continuous positive airway pressure . Values expressed as n (%), except where otherwise indicated . Hmd: hyaline membrane disease; mv: mechanical ventilation; prom: premature rupture of membranes; and cpap: continuous positive airway pressure . Table 2comparison of anthropometric characteristics and nutritional status between the schoolchildren who had been very - low - birth - weight preterm infants and those who had been normal - birth - weight full - term infants (controls). Variablecontrolsvlbwpisp(n = 45)(n = 48)age, years10.23 1.2710.18 1.390.860height, cm141.72 10.29138.53 11.290.159height - for - age, z score0.10 1.080.13 1.220.323weight, kg37.64 9.9534.66 10.360.161weight - for - age, z score0.03 0.890.27 1.020.123bmi, kg / m 18.49 3.4217.71 3.320.260bmi - for - age, z score0.38 1.150.30 1.270.740vlbwpis: very - low - birth - weight preterm infants ., there were no significant differences between the vlbwpi group and the control group regarding mean spirometric variables (table 3). Most of the study sample had normal spirometric values, i.e., z scores above 1.645 for the variables analyzed . In the vlbwpi group, mean gestational age (28.1 0.9 weeks; p = 0.006) and mean birth weight (1,015.0 122.7 g; p = 0.008) were significantly lower in those 6 than in the remaining 42 participants in the vlbwpi group . Although there were differences regarding the length of hospital stay [median number of days = 54.0 (42.0 - 66.0); p = 0.249] and the need for oxygen therapy for more than 28 days [n = 3 (60%); p = 0.083], they were not significant . The univariate and multivariate linear regression analyses revealed no significant associations of perinatal and neonatal factors with lung function data in the schoolchildren in the present study . Table 3comparison of lung function variables between the schoolchildren who had been very - low - birth - weight preterm infants and those who had been normal - birth - weight full - term infants (controls). 1.120.40 1.620.284fvc, l2.59 0.612.38 0.660.121fvc, z score0.83 1.030.66 1.440.525fev1/fvc, l0.86 0.580.85 0.890.498fev1/fvc, z score0.23 0.950.38 1.130.507fef25 - 75%, l2.60 0.742.36 0.770.139fef25 - 75%, z score0.69 1.040.14 1.370.392vlbwpis: very - low - birth - weight preterm infants . Table 4association of perinatal and neonatal variables with lung function in the schoolchildren who had been very - low - birth - weight preterm infants (univariate analysis). Variablefev1 fvcfef25 - 75% birth weight0.1390.5260.066length of hospital stay0.3360.9960.164gestational age0.0710.1360.274prom0.1380.0790.252surfactant use0.2140.4720.200duration of oxygen therapy, days0.1650.4560.279mechanical ventilation0.1550.1430.669cpap0.3240.3770.454hmd0.5480.7300.415corticosteroid use0.4060.4990.484prom: premature rupture of membranes; cpap: continuous positive airway pressure; and hmd: hyaline membrane disease . Prom: premature rupture of membranes; cpap: continuous positive airway pressure; and hmd: hyaline membrane disease . With regard to the level of physical activity, 34 (36.5%) of the participants although the level of physical activity was slightly higher in the vlbwpi group than in the control group, the difference was not significant (p = 0.055; figure 2a). In the vlbwpi and control groups, the most common leisure - time physical activities were soccer (37.5% vs. 22.2%; p = 0.108), running (27.9% vs. 22.2%; p = 0.936), and cycling (14.6% vs. 31.1%; p = 0.057). The mean time spent in active commuting was 20.55 5.89 min and 19.75 6.78 min (p = 0.737), respectively . Finally, although screen time was found to be> 2 h / day in 90 (96.7%) of the participants, there were no significant differences (p = 0.596) between the vlbwpi group and the control group regarding daily screen time (figure 2b). Figure 2comparison of physical activity level (in a) and daily screen time (sedentary behavior; in b) between the schoolchildren who had been normal - birth - weight full - term infants (controls) and those who had been very - low - birth - weight preterm infants (vlbwpis). In the present study, the schoolchildren who had been vlbw preterm infants and those who had been nbw full - term infants were found to be similar in terms of growth (weight and height) and lung function . In addition, the schoolchildren in the vlbwpi group were found to be slightly more active than those in the control group . Previous studies evaluating the growth of vlbw infants from discharge to early adulthood have shown that such monitoring plays an important role in identifying growth deficits and their consequences . Some of the aforementioned studies have shown that low birth weight is a risk factor for growth and bmi deficits . However, it has been reported that genetic factors and socioeconomic status have a greater influence on growth in schoolchildren than does low birth weight . These findings are consistent with those of the present study, in which schoolchildren who had been vlbw preterm infants and those who had been nbw full - term infants were found to have similar anthropometric characteristics and nutritional status . Although prematurity and the interventions that follow from it can affect respiratory system development, the present study showed no evidence of reduced lung function nearly a decade later in the schoolchildren in the vlbwpi group when compared with those in the control group . These results are consistent with those of previous studies showing preserved lung function in schoolchildren and adults who had been low - birth - weight preterm infants . One of the most compelling hypotheses to explain that is that pulmonary changes are more apparent in the first years of life and less so during childhood because parents provide respiratory health care, periodically monitoring lung function and being alert to any respiratory changes in their children . In addition, physical activity and adequate nutrition can contribute to the functional recovery of such individuals . Although some studies have suggested that socioeconomic and ethnic factors can influence lung function in such individuals, the present study did not evaluate that . Our finding of preserved lung function is inconsistent with previous studies showing impaired lung function in schoolchildren who had been vlbw preterm infants . In a recent study, schoolchildren who had been born at a gestational age of less than 32 weeks and who had not received surfactant therapy were shown to be at an increased risk of pulmonary involvement . These conflicting results can be attributed, at least in part, to differences in designs, lung evaluation methods, reference equations, prematurity definitions, and low birth weight classifications across studies . In the present study, only 6 of the schoolchildren in the vlbwpi group were found to have reduced lung function (as assessed by spirometry). This can be explained by the greater clinical severity of those 6 participants at birth; in comparison with the remaining vlbwpi group participants, they were born at a lower gestational age (<32 weeks), had lower birth weight (<1,200 g), had longer hospitalizations, and received supplemental oxygen for longer . In the present study this result is in agreement with those of a recent study, in which no perinatal factor was significantly associated with respiratory function variables . In addition, our result is similar to that of another study, in which low birth weight and gestational age were not associated with reduced lung function in schoolchildren . In contrast, other studies have shown that weight and gestational age have an influence on the duration of oxygen therapy and mechanical ventilation in vlbw preterm infants . In the present study, the schoolchildren in the vlbwpi group had undergone oxygen therapy, mechanical ventilation, or both in the first days of life . However, a previous study has shown that any lung function abnormality in schoolchildren who have previously undergone oxygen therapy, mechanical ventilation, or both is more closely related to prematurity than to neonatal lung injury itself . Previous studies conducted in our laboratory have shown that maximal expiratory flows are reduced in preterm infants and remain so until the second year of life . In the present study, our data suggest that lung function remains reduced until the second year of life and normalizes when the children reach school age, in parallel with a reduction in respiratory morbidity . Given the high cost of objective assessment devices such as pedometers and accelerometers, physical activity assessment by self - report questionnaires is a viable and practical alternative for quantifying sedentary behavior among young people . In the present study, a questionnaire proposed by hallal et al . Was used . The questionnaire quantifies the time spent commuting from home to school, work, or both, as well as the time spent in leisure - time activities . Although the questionnaire has been widely used in and appears to be well understood by the pediatric population, it does not quantify the time spent in activities of different intensities and therefore might limit the understanding and interpretation of physical activity in such individuals . In the present study, more than 60% of the sample was classified as inactive; according to previous studies conducted in brazil, this constitutes sedentary behavior, which is a major public health problem . No significant difference was found between the vlbwpi and control groups in the present study regarding the level of physical activity, a finding that is consistent with those of a study comparing children who had been preterm infants with those who had been full - term infants . Although there were no significant differences between the two groups of children, those in the vlbwpi group were found to be slightly more active than those in the control group . This can be attributed to family factors, such as parental preferences for certain physical activities serving as encouragement for the children to engage in those activities, or to parental overprotection . However, the influence of the aforementioned factors was not evaluated in the present study . More than 90% of the schoolchildren in the present study were found to spend more than 2 h per day watching television, playing video games, or using a computer . This finding appears to confirm those of national and international studies showing high levels of sedentary behavior in pediatric patients . Therefore, there is a need for strategic measures to combat sedentary behavior, given that sedentary behavior in pediatric patients is a risk factor for physical inactivity in adulthood . The main limitation of the present study is that our sample of vlbw preterm infants consisted of less than half of the total number of individuals available for recruitment . Most of those children were not located, resided in municipalities outside the catchment area, did not agree to participate, or died . However, we believe that the aforementioned limitation had no influence on the results obtained, given that perinatal and neonatal factors were similar between the vlbw preterm infants who were included in the present study and those who were not . In conclusion, the schoolchildren in the vlbwpi group and those in the control group were found to be similar in terms of growth (weight and height) and lung function . In addition, the schoolchildren in the vlbwpi group were found to be slightly more active than those in the control group . Furthermore, perinatal and neonatal variables were not associated with lung function in the schoolchildren studied.
|
The presence of a thick keratinized gingival covering serves as an effective barrier that is resistant to damage by various types of insults . As such a narrow zone of keratinized tissue favors gingival recession and inflammation in patients with subgingival restorations, impedes proper impression taking in prosthodontics, and results in an unstable attachment level after orthodontic treatment . A band of keratinized tissue around the neck of implants is desirable from a clinical standpoint because it facilitates surgery, prosthodontics, cosmetics, and maintenance . An adequate amount of attached gingiva makes plaque control more effective, decreases susceptibility to infection, and possibly prevents further recession . First used in burn surgery in 1992, freeze - dried acellular dermal matrix (alloderm) allografts were subsequently introduced in periodontal surgery in 1994 as an alternative to autogenous free gingival grafts (fggs) to achieve increased attachment of keratinized gingiva around natural teeth or implants, root coverage, and ridge preservation procedures . Allografts are freeze - dried, cell - free dermal matrices comprised of a structurally integrated basement membrane complex and an extracellular matrix in which collagen bundles and elastic fibers are the main components . In addition, the ultrastructural integrity of the extracellular matrix, if damaged, would induce an inflammatory response in the body . A major advantage of alloderm over skin preparations is the absence of the undesirable dead cells with their associated class i and ii hld antigens and potential transmission of cell - associated viruses . Furthermore, alloderm has essentially undamaged collagen and elastin matrices and does not initiate an inflammatory response by the host recipient tissues, making it completely biocompatible . The use of autografts has been considered the most predictable procedure for keratinized tissue augmentation and vestibular deepening . When compared to autografts, however, alloderm eliminates the need for a second surgical site, thus decreasing postoperative morbidity . It is easy and less time - consuming to use, and esthetically it blends well with the adjacent tissue; and multiple sites can be treated in a single visit . Therefore, the case study was undertaken to clinically evaluate the use of an acellular dermal matrix allograft (alloderm) to increase the width of attached gingiva and to evaluate stability of the gained attached gingival tissue . A total of 5 patients of which 3 were males and 2 were females in the age range of 2060 years were selected from out - patients of the department of periodontology, bapuji dental college and hospital, davangere . The study was carried out on subjects having sites with attached gingiva equal to or <1 mm on the facial aspect of the teeth [figure 1]. In addition to having a limited amount of attached gingiva, patients had to fulfill the following criteria: (1) good oral hygiene; (2) facial probing depths 2 mm; (3) no removable partial denture in the area to be treated; (4) not allergic to amoxicillin or clindamycin; (5) no dermal or autoimmune disease; (6) no systemic disease; and (7) were a nonsmoker . The procedure to be used and the potential risks and complications were discussed with the patient . Preoperative photograph showing less width of attached gingiva in relation to first premolar the junction of the attached and movable tissue was determined by rolling the alveolar mucosa coronally with the side of the probe (a roll - test). The width of the attached gingiva was measured at baseline and 3, 6, and 9-month postoperatively using the subtracting method . The apicocoronal dimension of the graft used was measured at the time of placement onto the recipient bed . The amount of graft shrinkage was calculated by subtracting the apicocoronal dimension of the graft from the amount of gained attached gingiva . Plaque index, gingival index, probing depth, and recession depth were also measured at baseline and 3, 6, and 9-month postoperatively . Measurements were made to the nearest 0.5 mm using a unc 15 periodontal probe (hu freidy, u.s.a .) And an occlusal stent (with guiding grooves). All patients underwent phase-1 periodontal therapy that included oral hygiene instructions, supragingival and subgingival scaling, and root planning . The case was selected for surgery only when patient compliance about oral hygiene was found to be satisfactory . After adequate anesthesia, a superficial horizontal incision was made just coronal to the mucogingival junction . 15) was held perpendicular to the gingival surface, and the lips were retracted firmly as the incision was made . Two vertical incisions were made at either end of the horizontal incision [figure 2]. Muscle and loose connective tissue fibers were thoroughly scraped with a scalpel to prevent subsequent graft mobility [figure 3]. Following preparation, the required dimension of alloderm allograft was procured and rehydrated in a petri dish with 50 ml of sterile saline solution for 5 min . After the protective backing paper had been floated, the alloderm allograft was transferred to another dish with 50 ml of sterile saline solution for 5 min . The allograft was placed with the connective tissue surface toward the recipient beds and the basement membrane surface facing externally [figures 4 and 5]. The allograft was stabilized on the recipient bed by resorbable sutures [figure 6]. Horizontal and vertical incision given at recipient site recipient site prepared rehydrated alloderm showing the connective tissue side of the graft alloderm placed at the site alloderm sutured and stabilized the patients were given postoperative instructions and medications . Amoxicillin (500 mg 3 times a day for 5 days) and ibuprofen (3 times a day for 3 days) were prescribed . The patient was advised to refrain from retracting the lips and cheeks and to avoid brushing or flossing in the grafted area for 6 weeks . The patient was seen at 6 weeks [figure 7], 12 weeks [figure 8], 24 weeks [figure 9], and 36 weeks [figure 10] to monitor wound healing and plaque control . Localized supragingival scaling was done if required and oral hygiene instructions were reinforced routinely at each visit . Postoperative photograph at 15 days after suture removal postoperative photograph at 3-month postoperative photograph at 6-month postoperative photograph at 9-month all patients underwent phase-1 periodontal therapy that included oral hygiene instructions, supragingival and subgingival scaling, and root planning . The case was selected for surgery only when patient compliance about oral hygiene was found to be satisfactory . After adequate anesthesia, a superficial horizontal incision was made just coronal to the mucogingival junction . 15) was held perpendicular to the gingival surface, and the lips were retracted firmly as the incision was made . Two vertical incisions were made at either end of the horizontal incision [figure 2]. Muscle and loose connective tissue fibers were thoroughly scraped with a scalpel to prevent subsequent graft mobility [figure 3]. Following preparation, the required dimension of alloderm allograft was procured and rehydrated in a petri dish with 50 ml of sterile saline solution for 5 min . After the protective backing paper had been floated, the alloderm allograft was transferred to another dish with 50 ml of sterile saline solution for 5 min . The allograft was placed with the connective tissue surface toward the recipient beds and the basement membrane surface facing externally [figures 4 and 5]. The allograft was stabilized on the recipient bed by resorbable sutures [figure 6]. Horizontal and vertical incision given at recipient site recipient site prepared rehydrated alloderm showing the connective tissue side of the graft alloderm placed at the site alloderm sutured and stabilized amoxicillin (500 mg 3 times a day for 5 days) and ibuprofen (3 times a day for 3 days) were prescribed . The patient was advised to refrain from retracting the lips and cheeks and to avoid brushing or flossing in the grafted area for 6 weeks . The patient was seen at 6 weeks [figure 7], 12 weeks [figure 8], 24 weeks [figure 9], and 36 weeks [figure 10] to monitor wound healing and plaque control . Localized supragingival scaling was done if required and oral hygiene instructions were reinforced routinely at each visit . Postoperative photograph at 15 days after suture removal postoperative photograph at 3-month postoperative photograph at 6-month postoperative photograph at 9-month all of the sites treated with alloderm demonstrated uneventful healing 15 days after surgery . Graft rejection and mobility of the newly created tissues were not found in any of the patients . However, at the 4 week postoperatively, a substantial amount of graft shrinkage could be seen . Tables 13 show changes in plaque index, gingival index, and probing depth, respectively . All of these three parameters show a consistent decrease in value in all patients, which indicates improved oral hygiene by the patients after the grafting procedure . Table 4 shows an increase in the width of the attached gingiva in all patients during the 9-month follow - up period . Complete keratinization of the newly formed attached tissue was observed at the end of 12 weeks [figure 8] and was maintained for 9-month [figure 10]. In all cases table 5 shows the percentage shrinkage of the graft, which on average was 75% at the end of the 3 month in all cases and was stabilized for 9-month . Data showing changes in plaque index data showing changes in gingival index data showing changes in probing depth data showing width of ag data showing amount of shrinkage of alloderm in this case study, an acellular dermal matrix (alloderm) was used to increase the width of attached gingiva at sites with <1 mm of attached gingiva . For years, free gingival autografts and connective tissue autografts have been used with great success . However, certain obvious limitations of the autografts forced clinical researchers to search for some alternative allografts that patients would find comfortable, compatible, and acceptable . Autografts require a second surgical site for the donor tissue . In the fgg technique, the donor site is healed by secondary intention and may result in postoperative pain and morbidity . The fggs result in a tyre patch appearance of the recipient site and are unaesthetic . Furthermore, autografts cannot be used to increase width of attached gingiva on multiple teeth at the same visit because of the limited supply of donor tissue . The use of alloderm has been shown to be effective in increasing the width of attached gingiva and can be used as a substitute for fggs and connective tissue grafts . The studies in which alloderm and connective tissue grafts have been used to increase the width of attached gingiva have shown similar results . The main aim of using this allograft was to minimize postsurgical complications and patient discomfort . Studies have shown that an acellular dermal matrix allograft provides a uniform thickness and is easily trimmed, well - adaptable material, and requires a short time (<10 min) to rehydrate before it can be used . On the other hand, harvesting of a connective tissue graft from the palate is time - consuming and the size of the graft that can be harvested limited . A second surgical site and the amount of time consumed adds to patient discomfort as compared to the lesser degree of patient discomfort with alloderm . Studies comparing fgg and alloderm to increase the width of attached gingiva have shown that alloderm is not as effective in increasing width of attached gingiva but more predictable in its esthetics and blending with the surrounding tissue as compared to fgg . The amount of attached gingiva gained with alloderm, however, is clinically sufficient to prevent persistent inflammation . The mechanism by which alloderm results in an increased width of keratinized attached gingiva is still controversial . Though most of the studies support the fact that the alloderm graft itself has little influence on epithelial differentiation, the type of epithelium that covers the allograft seems to be determined by the surrounding tissues . Alloderm acts as a scaffold to allow repopulation of fibroblasts, blood vessels, and epithelium from surrounding tissues, and it is eventually completely replaced by host tissues . Studies have also shown that this material (alloderm) exhibited more shrinkage than an autogenous fgg . The results of this study also showed considerable shrinkage (an average of 75%) in the allograft, which can be explained by the fact that alloderm has a nonvital matrix, and it lacks epithelial differentiation . The study further supports the use of an alloderm allograft for periodontal plastic surgical procedures . It can be concluded that a lesser but adequate amount of attached gingiva can be obtained using alloderm that is sufficient to maintain oral hygiene and resolve persistent gingival inflammation . Viewed subjectively, the sites showed better esthetics and blended with the surrounding tissue and caused less postoperative pain . These findings suggest that alloderm can be effectively used as an alternative to autogenous grafts for gingival augmentation procedures.
|
The treatment of intracranial aneurysms has been revolutionized by the introduction of detachable coils for endovascular therapy, and it has been demonstrated that it is a safe and effective method for treating aneurysms . It is not unusual, however, to encounter either transient or permanent ischemic events after embolization procedure of acoa aneurysms . Its prevalence of thromboembolic complications, including transient ischemic and stroke, has been reported to be 10.3% . At present, reliable early warning methods are lacking, so anterior circulation cerebral infarction (aci) is often diagnosed after clinical deterioration of neurological function, resulting in passive treatment . The risk factors relevant to aci after embolization are poorly understood, making preventative treatment difficult . The current study is the first to elucidate the risk factors which lead to aci after endovascular coiling of acoa aneurysms . During the past 2 decades, the emphasis on ischemic stroke pathogenesis has largely switched from hypoperfusion and hemodynamic - related explanations to thromboembolism as the predominant mechanism . Nevertheless, the close relationship between severity of extracranial arterial stenosis and brain infarction, the correlation between impaired functional blood flow reserve and subsequent brain infarction, and the correlation of reduced collateral blood flow with a poor prognosis indicate that ischemic stroke pathogenesis is a multifactorial process . The purpose of the present study was to investigate the inpatient database in acoa aneurysms using endovascular treatment . In particular, we wished to elucidate the risk factors relevant to aci after embolization using univariate and logistic regression analysis . Case files from patients that had undergone coil embolization of cerebral anterior communication artery aneurysms from october 2008 to april 2012 at tangshan gongren hospital were retrospectively reviewed . The patency of 54 patients aca and acoa during embolization was evaluated in the study . The stroke rate was 8.7% in ruptured patients for one time before embolization finished and 37.5% in ruptured patients for twice before embolization finished . The mean age of the study group was 53.6 years with a 1:1 female - to - male ratio . Hospital records including clinical charts, operative reports, and radiological studies were used to obtain patient characteristics including: age, coil type, rupture status, sex, aneurysm location, aneurysm size, embolization results, complication, and necessity of retreatment . The timing of the infarction following treatment occurred at 3 postoperative hours to 3 days . This study was conducted with approval from the ethics committee and intuitional review board of hebei medical university . The technique for endovascular coiling alone and stent - assisted coiling (boston scientific / target, california, america) has been previously described in the literature . All procedures were performed using a biplane angiographic system (philippe, amsterdam, holland) with three - dimensional rotational and digital subtraction capabilities and with the patients under general anesthesia and a systemic anticoagulant . Anticoagulation was aimed at keeping the activated clotting time at two to three times above the normal value (approximately 100 s) during catheterization, stent, and coil placement . Our protocol includes: 1) pretreatment with aspirin (300 mg) and clopidogrel bisulfate (300 mg) 30 min before coiling for stented patients and no pretreatment before coiling for non - stented patients, 2) systemic intravenous heparinization after placement of the femoral sheath for a goal activated clotting time of 250 - 300 s, 3) systemic intravenous heparinization 12 h after the procedure, 4) continuation of clopidogrel bisulfate (75 mg daily) for 6 months for stented patients and discontinuation of clopidogrel bisulfate for non - stented patients, and 5) aspirin (100 mg daily) for all patients indefinitely . The risk factors considered in the study were sex, age, smoking, alcohol consumption, hypertension, diabetes mellitus, hyperfibrinogenemia, hyperlipidemia, ischemic changes on electrocardiogram (ecg), fever, fluid volume balance, modified fisher grade, hunt - hess grade, intracerebral hematoma, ventricular hemorrhage, cerebral swelling, hydrocephalus, unilateral dysplasia of cerebral anterior circulation, direction of aneurysm body, aneurysm blood supply from left aca, aneurysm rupture times, time from aneurysm recent rupture before admission to embolization, stent use, packing degree, leukocyte count, platelet count, hematocrit, comorbidity score, aneurysm neck width, aneurysm parent artery width, aneurysm size, and embolization time . We defined the potential risk factors as follows: smoking (currently smoking more than one cigarette per day)alcohol consumption (drinking more than twice per week)hypertension (systolic blood pressure 140 mmhg, diastolic blood pressure 90 mmhg, and/or presence of antihypertensive drug treatment)diabetes mellitus was defined as a high - fasting plasma glucose level (126 mg / dl), or a current treatment with an oral hypoglycemic agent or insulinhyperfibrinogenemia was defined as a high plasma fibrinogen level (400 mg / dl)hyperlipidemia was defined as a fasting serum total cholesterol level of 240 mg / dl, or a current treatment with an antihyperlipidemic agentischemic changes on electrocardiogram (ecg; st - t change, flat t, and negative t)fever (normal body temperature range 36.0 - 37.4c, low grade fever range 37.5 - 38.0c, and high grade fever 38.1c)fluid volume balance was defined as intake and output balance from admission to the end of operationpacking degree was classified as defined by raymond et al . Class 1 complete occlusion, class 2 residual neck, and class 3 residual aneurysm sac . Smoking (currently smoking more than one cigarette per day) alcohol consumption (drinking more than twice per week) hypertension (systolic blood pressure 140 mmhg, diastolic blood pressure 90 mmhg, and/or presence of antihypertensive drug treatment) diabetes mellitus was defined as a high - fasting plasma glucose level (126 mg / dl), or a current treatment with an oral hypoglycemic agent or insulin hyperfibrinogenemia was defined as a high plasma fibrinogen level (400 mg / dl) hyperlipidemia was defined as a fasting serum total cholesterol level of 240 mg / dl, or a current treatment with an antihyperlipidemic agent ischemic changes on electrocardiogram (ecg; st - t change, flat t, and negative t) fever (normal body temperature range 36.0 - 37.4c, low grade fever range 37.5 - 38.0c, and high grade fever 38.1c) fluid volume balance was defined as intake and output balance from admission to the end of operation packing degree was classified as defined by raymond et al . Class 1 complete occlusion, class 2 residual neck, and class 3 residual aneurysm sac . For all 54 patients, cerebral angiography showed patency of the cerebral artery during the process of treatment . Non - contrast brain ct (siemens, munich, germany) was performed immediately after the procedure . For the 47 patients demonstrating no neurological deficit, repeat cts were requested at days 1 and 7 or sooner at the physician's discretion and no cerebral infarction occurred . With seven patients in the aci group and 47 patients in the no aci group, the study was designed to detect the risk factors of aci after embolization and a two - sided a level of 0.05 . Descriptive statistics, stratified by cerebral anterior circulation state, were calculated for baseline demographic and clinical characteristics . Student's t - test was used to compare continuous variables, the test to compare categorical variables, and the rank sum test to compare multicategorical variables according to cerebral infarction or no cerebral infarction of anterior circulation after embolization . Multiple logistic regression analysis was performed to identify independent risk factors for aci in the two groups . Odds ratios (ors) and 95% confidence intervals (cis) were calculated after adjusting for possible confounders (aneurysm size, modified fisher grade, and embolization time). All p - values are two - sided with statistical significance evaluated at the 0.05 a level . Ninety - five percent cis were calculated to assess the precision of the obtained adjusted odds ratio estimates . All analyses were performed using statistical package for social sciences (spss) 17.0 (spss, chicago, il). Case files from patients that had undergone coil embolization of cerebral anterior communication artery aneurysms from october 2008 to april 2012 at tangshan gongren hospital were retrospectively reviewed . The patency of 54 patients aca and acoa during embolization was evaluated in the study . The stroke rate was 8.7% in ruptured patients for one time before embolization finished and 37.5% in ruptured patients for twice before embolization finished . The mean age of the study group was 53.6 years with a 1:1 female - to - male ratio . Hospital records including clinical charts, operative reports, and radiological studies were used to obtain patient characteristics including: age, coil type, rupture status, sex, aneurysm location, aneurysm size, embolization results, complication, and necessity of retreatment . The timing of the infarction following treatment occurred at 3 postoperative hours to 3 days . This study was conducted with approval from the ethics committee and intuitional review board of hebei medical university . The technique for endovascular coiling alone and stent - assisted coiling (boston scientific / target, california, america) has been previously described in the literature . All procedures were performed using a biplane angiographic system (philippe, amsterdam, holland) with three - dimensional rotational and digital subtraction capabilities and with the patients under general anesthesia and a systemic anticoagulant . Anticoagulation was aimed at keeping the activated clotting time at two to three times above the normal value (approximately 100 s) during catheterization, stent, and coil placement . Our protocol includes: 1) pretreatment with aspirin (300 mg) and clopidogrel bisulfate (300 mg) 30 min before coiling for stented patients and no pretreatment before coiling for non - stented patients, 2) systemic intravenous heparinization after placement of the femoral sheath for a goal activated clotting time of 250 - 300 s, 3) systemic intravenous heparinization 12 h after the procedure, 4) continuation of clopidogrel bisulfate (75 mg daily) for 6 months for stented patients and discontinuation of clopidogrel bisulfate for non - stented patients, and 5) aspirin (100 mg daily) for all patients indefinitely . The risk factors considered in the study were sex, age, smoking, alcohol consumption, hypertension, diabetes mellitus, hyperfibrinogenemia, hyperlipidemia, ischemic changes on electrocardiogram (ecg), fever, fluid volume balance, modified fisher grade, hunt - hess grade, intracerebral hematoma, ventricular hemorrhage, cerebral swelling, hydrocephalus, unilateral dysplasia of cerebral anterior circulation, direction of aneurysm body, aneurysm blood supply from left aca, aneurysm rupture times, time from aneurysm recent rupture before admission to embolization, stent use, packing degree, leukocyte count, platelet count, hematocrit, comorbidity score, aneurysm neck width, aneurysm parent artery width, aneurysm size, and embolization time . We defined the potential risk factors as follows: smoking (currently smoking more than one cigarette per day)alcohol consumption (drinking more than twice per week)hypertension (systolic blood pressure 140 mmhg, diastolic blood pressure 90 mmhg, and/or presence of antihypertensive drug treatment)diabetes mellitus was defined as a high - fasting plasma glucose level (126 mg / dl), or a current treatment with an oral hypoglycemic agent or insulinhyperfibrinogenemia was defined as a high plasma fibrinogen level (400 mg / dl)hyperlipidemia was defined as a fasting serum total cholesterol level of 240 mg / dl, or a current treatment with an antihyperlipidemic agentischemic changes on electrocardiogram (ecg; st - t change, flat t, and negative t)fever (normal body temperature range 36.0 - 37.4c, low grade fever range 37.5 - 38.0c, and high grade fever 38.1c)fluid volume balance was defined as intake and output balance from admission to the end of operationpacking degree was classified as defined by raymond et al . Class 1 complete occlusion, class 2 residual neck, and class 3 residual aneurysm sac . Smoking (currently smoking more than one cigarette per day) alcohol consumption (drinking more than twice per week) hypertension (systolic blood pressure 140 mmhg, diastolic blood pressure 90 mmhg, and/or presence of antihypertensive drug treatment) diabetes mellitus was defined as a high - fasting plasma glucose level (126 mg / dl), or a current treatment with an oral hypoglycemic agent or insulin hyperfibrinogenemia was defined as a high plasma fibrinogen level (400 mg / dl) hyperlipidemia was defined as a fasting serum total cholesterol level of 240 mg / dl, or a current treatment with an antihyperlipidemic agent ischemic changes on electrocardiogram (ecg; st - t change, flat t, and negative t) fever (normal body temperature range 36.0 - 37.4c, low grade fever range 37.5 - 38.0c, and high grade fever 38.1c) fluid volume balance was defined as intake and output balance from admission to the end of operation packing degree was classified as defined by raymond et al . Class 1 complete occlusion, class 2 residual neck, and class 3 residual aneurysm sac . For all 54 patients, cerebral angiography showed patency of the cerebral artery during the process of treatment . Non - contrast brain ct (siemens, munich, germany) was performed immediately after the procedure . For the 47 patients demonstrating no neurological deficit, repeat cts were requested at days 1 and 7 or sooner at the physician's discretion and no cerebral infarction occurred . With seven patients in the aci group and 47 patients in the no aci group, the study was designed to detect the risk factors of aci after embolization and a two - sided a level of 0.05 . Descriptive statistics, stratified by cerebral anterior circulation state, were calculated for baseline demographic and clinical characteristics . Student's t - test was used to compare continuous variables, the test to compare categorical variables, and the rank sum test to compare multicategorical variables according to cerebral infarction or no cerebral infarction of anterior circulation after embolization . Multiple logistic regression analysis was performed to identify independent risk factors for aci in the two groups . Odds ratios (ors) and 95% confidence intervals (cis) were calculated after adjusting for possible confounders (aneurysm size, modified fisher grade, and embolization time). All p - values are two - sided with statistical significance evaluated at the 0.05 a level . Ninety - five percent cis were calculated to assess the precision of the obtained adjusted odds ratio estimates . All analyses were performed using statistical package for social sciences (spss) 17.0 (spss, chicago, il). After exclusion criteria were met, 54 acoa aneurysms from 54 patients were analyzed . Of these, seven (13.0%) were categorized into group i (aci after embolization) and 47 (87.0%) were categorized into group ii (no aci after embolization). The neurological outcomes of the ischemic stroke patients included brain swelling, motor dysfunction, abulia, aphasia, etc . Fifty - four acoa aneurysms (100%) were ruptured in patients presenting with subarachnoid hemorrhage . Univariate analysis of the clinical and laboratory data of the anterior circulation cerebral infarction and no anterior circulation cerebral infarction groups only two of the analyzed variables were significantly different between groups . Univariate analyses of clinical and laboratory data showed that negative fluid volume balance and modified fisher grade were more prevalent in the aci group than in the no aci group [table 1]. Other clinical and laboratory data, including age, sex, hypertension, diabetes mellitus, hunt - hess grade, and ventricular hemorrhage showed no differences between groups . Multiple logistic regression analyses adjusted for possible confounding factors . The adjusted or for modified fisher grade (or: 4.968, 95% ci: 1.013 - 24.360, p = 0.048) was significantly higher in the aci group [table 2]. Results of multiple logistic regression analysis applied to the anterior circulation cerebral infarction and no anterior circulation cerebral infarction groups although the risk factors of ischemic stroke in the anterior circulation have been extensively researched, there have been fewer studies focusing on the risk factors of aci after embolization; however, these studies do reveal risk factors comparable to those reported in the present study . Previously, it was demonstrated that modified fisher grade was the most influential risk factor for anterior circulation stroke . Given these findings, we evaluated the risk factors of aci after embolization and report the resulting effects on cerebral stroke here . In the present study, the prevalence of aci after embolization (13.0%) was found to be high in patients with the endovascular treatment of acoa aneurysms and modified fisher grade was found to be the major determinant for anterior circulation infarction after embolization . Seven of 55 patients undergoing coil embolization of acoa aneurysms developed aci after embolization, in which the patency of anterior circulation during embolization was observed . Thromboembolic events during endovascular treatment of intracranial aneurysms were reported to be between 2.9 and 6% . Fang et al ., showed morbidity or mortality caused by perioperative stroke occurred at a 3% rate in patients with acoa aneurysms . Why then, was the stroke rate (13%) so high in our study? The higher stroke rate is likely because the patients undergoing coil embolization of cerebral anterior communication artery aneurysms in this study had all ruptured once or twice prior to embolization . The possible mechanisms for aci after embolization were previously thought to be vasospasm, thrombosis, and emboli . No pulmonary embolism, cardiogenic embolism, deep venous thrombosis, cerebral vascular arteriosclerosis, nor cerebral vascular stenosis were found in the current study . Our study confirmed that vasospasm and thrombosis were the most common etiology for aci after embolization . In patients with subarachnoid hemorrhage due to acoa aneurysm, the significant risk factors determining outcomes were age, glasgow coma scale (gcs), hunt - hess grade, vasospasm, ventricular hemorrhage, and hydrocephalus . However, the associations between aci after embolization of acoa aneurysm and the risk factors, such as, age, sex, negative fluid volume balance, modified fisher grade, aneurysm size, embolization time, and so on are not being determined because of the limited number of studies undertaken . In the present study, multiple logistic regression analysis revealed that modified fisher grade is independently associated with aci after embolization; whereas, no association is found for other variables, which include negative fluid volume balance, aneurysm size, and embolization time . The previous studies reported that a closed relationship was observed between modified fisher grade and delayed ischemic neurological deficit . These findings suggest that modified fisher grade is a strong determinant for aci after embolization, and that a patient with a high modified fisher grade is at higher risk of aci after embolization . Aci after embolization is a potent predictor of a poor outcome in acoa aneurysm patients . Accordingly, modified fisher grade prior to stroke is required for prevention of aci after embolization . As much higher grade of modified fisher grade, we can enhance our prevention and treatment for vasospasm and thrombosis . First, this is a retrospective study, and inaccurate or insufficient assessment might have occurred . Second, this is a relatively small study, so the predictor of outcome could be significant by chance . Third, because the patients were recruited from a tertiary hospital, they may not represent the general stroke population after embolization . Fourth, aneurysm characteristics and assessment of embolization were assessed using aneurysm size, neck width, and raymond classification; but not using murayama classification, aneurysm volume in cubic millimeters, neck - to - volume ratio, or volumetric packing density . Fifth, ct was used in this study, which is not very sensitive in the evaluation of stroke . Thus, some of the stroke patients may not be ruled out . Finally, all our patients were chinese, and our data may not be generalizable to other ethnic groups . As such, we await the outcome of a prospective, randomized, controlled trial when treating cerebral aneurysms . Overall, the present study provides clues regarding the prevalence and causative risk factor of aci after embolization . Our results showed high prevalence of aci after embolization, and a modified fisher grade was identified as the most important risk factor therefore . Further studies on the mechanism, prevention, and treatment of aci after embolization are needed to provide specific guidance on its long - term management.
|
Receptacle consisting of superposed three cells, 103~113 20~30 m; the basal cell usually stouter or tapering to the foot, about 1.5 times longer than broad, 38~43 25~30 m; the subbasal cell slightly longer than the basal cell, about 2 times longer than broad, 43~45 20~23 m; the third cell slightly narrower than the others of receptacle, about as long as broad or somewhat narrower than long, 20~23 18~20 m . Perithecium composed of the stalk cell and the proper perithecium; the stalk cell somewhat longer than the third cell of receptacle, about 1.5 times longer than broad, 25~30 18~20 m; the proper perithecium usually straight, ellipsoidal inflated, somewhat darker brown, tapering gradually to the apex, where is usually slightly bent to one side, 90~110 20~35 m . Host genera: callicorixa, corixa, cymatia, hesperocorixa, micronecta and sigara (corixidae, hemiptera). Distribution: cosmopolitan . Specimens examined: cibubur lake, cibubur danau cibubur, jakarta, indonesia, 22 september, 2006 . The habits of this species were reported by thaxter (1908), picard (1913, c. italicus), spegazzini (1918, c. italicus), colla (1934, c. italicus), benjamin (1973), majewski (1973 and 1988, c. italicus, 1994), sugiyama & hayama (1981, c. italicus) and santamaria (1989, c. italicus). The present specimens are similar to the majority of the thalli described by benjamin and majewski . The specimens described here poses the additional appendiculate cells between the subbasal cell and the third cell, and immediately below the perithecium, as shown in the thalli drawn by majewski (fig . However, the necks of perithecia are considerably longer in the present materials than in those described by majewski . Thalli of this species have always been found on the inferior surface of the host's abdomen, however the present materials were always found on the inferior margin of the left elytra . Receptacle consisting of three superposed cells, 83~91 18~20 m; the basal cell about 1.5 times longer than broad, broader than the two cells above, 30 20 m; the sub - basal cell about 2.5 times longer than broad, longer than the others of receptacle, 33~38 13~15 m; the third cell about 2 times longer than broad, shorter and slender than the others of receptacle, 20~23 10~13 m . Appendiculate cells 2 in number, nearly symmetrical, producing appendages, usually branched on third cell of them, up to 175 m long . Perithecium composed of the stalk cell and the proper peritheium; the stalk cell about 2 times longer than broad, as long as third cell of receptacle; the proper perithecium long and slender, the margins hardly convex below, the tip portion long, slightly bent outward, tapering event1y to the blunt termination, 88~100 10~18 m . Host genus: micronecta (corixidae, hemiptera). Specimens examined: cibubur lake, cibubur dana cibubur, jakarta, indonesia, 22 september, 2006, l - y-2161 and 2189 . This species is nearly identical to c. minor; however, it has a nearly straight habit and a perithecium that is long and slender, hardly convex below, and a long portion of the tip that is bent slightly outward and tapers evenly to a blunt apex . In addition, the length of the stalk cell of perithecium in the present specimens is shorter than those of the specimens described by thaxter . According to the description by thaxter (1931), this species varies considerably in size and habit and the thalli always grow on the margin of the left elytra . Receptacle consisting of superposed three cells, 93~103 20~25 m; the basal cell above 1.5 times longer than broad, 35~40 20~25 m; the subbasal cell about 2 times longer than broad, longer than the other cells of receptacle, 38~43 18~20 m; the third cell about as long as broad, inflated, 20 20 m . Appendiculate cells flattened, two or three, somewhat broader than long, slight constriction; appendages bearing one to three secondary branchlets on the basal cell, 135~163 m long . Perithecium consisting of the stalk cell and the proper perithecium; the stalk cell somewhat longer than broad or about two times longer than broad, 20~25 13~20 m; the proper perithecium elliptical, nearly uniform or narrower below, inflated in the middle portion, tapering gradually to the apex, 95~100 20~25 m . Host genera: corixa and micronecta (corixidae, hemiptera). Specimens examined: cibubur lake, cibubur dana cibubur, jakarta, indonesia, 20 september, 2006, l - y-2170 and 2187 . This species is closely related to c. corixae; however, it differs in the following features: 1) the form of the thallus is strongly flexed throughout in the present species, while it is straight or somewhat flexed in the previously described species . 2) the distal portion of the perithecium has a tapered habit in the present species, while it is truncated in the previously described species . Thallus long and slender, hyaline or faintly tinged with brown, abruptly bent or irregularly strongly sigmoid habit . Receptacle consisting of superposed three cells, 143~161 20~28 m; the basal cell usually distinctly stouter, about 2~3 times longer than broad; the subbasal cell cylindrical, about 3~4 times longer than broad, longer than the others of receptacle, 68~83 20~25 m; the third cell somewhat narrower than the others, about 2 times longer than broad, 25~35 15~25 m . Appendiculate cells 4~6 or rarely 9 in number, slightly broader than long, nearly squarish; appendages longitudinal and stouter, usually producing the secondary branchlets on the third cell, 150 m long . Perithecium composed of the stalk cell and the proper perithecium; the stalk cell somewhat narrower below, somewhat longer than the third cell of receptacle, about 2~3 times longer than broad, 25~38 13~15 m; the proper perithecium slightly inflated, the margins subsymmetrically convex, becoming rather darker brown, abruptly recurved tip - portion, the apex blunt or truncate, 90~115 20~30 m . Specimens examined: raya bogor, jakarta, indonesia, 20 september, 2006, l - y-2100, 2101, 2102, 2103, 2104, 2105, 2106, 2107, 2108, 2109, 2110, 2111, 2112, 2113 and 2114; cibubur lake, cibubur dana, cibubur, jakarta, indonesia, 22 september, 2006, l - y-2148, 2152, 2154, 2155, 2156, 2157, 2160, 2165, 2167, 2171, 2172, 2173, 2184, 2185, 2186, 2195 and 2196 . This species is closely related to c. curvatus, but it is different from the latter due to its abruptly bent or strongly sigmoid habit and the recurved tip - portion of its perithecium . The present species was always collected near the basal portion of the legs and on the inferior surface of the abdomen and thorax of its hosts, but according to thaxter (1931), this species was always found on the inferior surface of the margin of the left elytra.
|
Neonatal sprague - dawley rats (seven days old) together with their maternal rats were obtained from a commercial breeder (orient co., seoul, korea). The experimental procedures were performed in accordance with the animal care guidelines of the national institutes of health (nih) and the korean academy of medical sciences . Each animal was housed under controlled temperature (232) and lighting (08:00 - 20:00) conditions with free feeding . The neonatal rats were randomly divided into five groups (n=15 in each group): a control group, and four cataract - induction groups, treated with either 0, 50, 100, or 200 mg / kg catechin . The rats in the catechin - treatment groups received catechin (sigma chemical co., st . Louis, mo, usa) orally once a day for ten consecutive days at the respective doses, starting five days after cataract - induction . The rats in the control group and in the cataract - induction groups received an equal amount of distilled water for the same duration . Cataracts were induced using a previously described procedure . In brief, at ten days of postnatal age, the neonatal rats received 100 mg / kg n - methyl - n - nitrosourea (mnu, sigma chemical co.) intraperitoneally . Just before use, mnu was dissolved in physiological saline containing 0.05% acetic acid . Slit - lamp biomicroscopic examination was performed on each eye to provide a morphological assessment of the degree of opacification at 15 days after cataract induction . Prior to the examination, mydriasis was achieved using a topical ophthalmic solution containing tropicamide with phenylephrine hydrochloride (santen pharmaceutical, osaka, japan). One drop of the solution was instilled in each eye every 30 minutes for 2 hours, while the animals were in a dark room . After 2 hours, the eyes were examined by slit - lamp biomicroscopy at 12magnification . The rats were sacrificed immediately after determination of cataract formation with slit - lamp biomicroscopy (15 days after cataract induction). The animals were anesthetized using zoletil 50 (10 mg / kg, i.p . ; vibac laboratories, carros, france). At necropsy, both lenses were quickly removed under a surgical microscope gl-99b - v7 (davis, california, ca, usa); a complete necropsy was performed on all animals . The lenses were fixed in 4% paraformaldehyde, dehydrated in graded ethanol, treated in xylene, and infiltrated and embedded in paraffin . Coronal sections of 5 m thickness were made using a paraffin microtome (leica, nussloch, germany) and were mounted on coated slides, then dried at 37 overnight on a hot plate . The lenses were collected and immediately frozen at -70. the tissues were homogenized with lysis buffer containing 50 mm tris - hcl (ph 8.0), 150 mm nacl, 10% glycerol, 1% triton x-100, 1.5 mm mgcl26h2o, 1 mm egta, 1 mm pmsf, 1 mm na2vo4, and 100 mm naf, and then ultracentrifuged at 50,000 rpm for 1 hours . Protein content were measured using a bio - rad colorimetric protein assay kit (bio - rad, hercules, ca, usa). Forty micrograms of protein was separated on sds - polyacrylamide gels and were transferred onto a nitrocellulose membrane . Mouse antibodies against actin (1:2000; santa cruz biotech, santa cruz, ca, usa), bax (1:1000; santa cruz biotech), and bcl-2 (1:1000; santa cruz biotech) were used as primary antibodies . Horseradish peroxidase - conjugated anti - mouse antibodies for bax and bcl-2 (1:2000; amersham pharmacia biothech gmbh, freiburg, germany) were used as secondary antibodies . The experiment was performed in normal lab conditions at room temperature, with the exception of membrane transfer . Membrane transfer was performed at 4 with a cold pack and a pre - chilled buffer . Band detection was performed using an enhanced chemiluminescence (ecl) detection kit (santa cruz biotech). Detected bands were calculated densitometrically using molecular analyst version 1.4.1 (bio - rad), in order to compare the relative expressions of proteins . Tunel staining was performed using an in situ cell death detection kit (roche, mannheim, germany) according to the manufacturer's protocol, in order to visualize dna fragmentation, a marker of apoptotic cell death . The epithelial cells were suspended in 10 mm tris - hcl buffer, ph 8.0, containing 1 mm edta, through incubation at 55 for 30 minutes . Sections were then incubated with proteinase k (100 g / ml), rinsed, incubated in 3% h2o2, permeabilized with 0.5% triton x-100, rinsed again, and incubated in tunel reaction mixture . The sections were rinsed and visualized using converter - pod with 0.03% 3,3'-diaminobenzidine (dab) and then mounted onto gelatin - coated slides . The slides were air dried overnight at room temperature, and coverslips were mounted using permount. To visualize caspase-3 expression, we performed caspase-3 immunohistochemistry using a previously described method . Sections were drawn from each lens and incubated overnight with mouse anti - caspase-3 antibody (1:500; santa cruz biotech) and then for another 1 h with biotinylated mouse secondary antibody (1:200; vector laboratories, burlingame, ca, usa). Bound secondary antibodies were then amplified with a vector elite abc kit (1:100; vector laboratories). The antibody - biotin - avidin - peroxidase complexes were visualized using 0.03% dab, and the sections were finally mounted onto gelatin - coated slides . The slides were air dried overnight at room temperature, and coverslips were mounted using permount. To compare relative expressions of proteins, we examined detected bands densitometrically using molecular analyst version 1.4.1 (bio - rad). The area of the lens epithelium region in each slice was measured using the image - pro plus computer - assisted image analysis system (media cybernetics inc ., silver spring, md, usa) attached to a light microscope (olympus, tokyo, japan). The tunel - positive and caspase-3-positive cells within each lens epithelium region were counted through the light microscope . Statistical analysis was performed using one - way anova followed by duncan's post - hoc test . Neonatal sprague - dawley rats (seven days old) together with their maternal rats were obtained from a commercial breeder (orient co., seoul, korea). The experimental procedures were performed in accordance with the animal care guidelines of the national institutes of health (nih) and the korean academy of medical sciences . Each animal was housed under controlled temperature (232) and lighting (08:00 - 20:00) conditions with free feeding . The neonatal rats were randomly divided into five groups (n=15 in each group): a control group, and four cataract - induction groups, treated with either 0, 50, 100, or 200 mg / kg catechin . The rats in the catechin - treatment groups received catechin (sigma chemical co., st . Louis, mo, usa) orally once a day for ten consecutive days at the respective doses, starting five days after cataract - induction . The rats in the control group and in the cataract - induction groups received an equal amount of distilled water for the same duration . Cataracts were induced using a previously described procedure . In brief, at ten days of postnatal age, the neonatal rats received 100 mg / kg n - methyl - n - nitrosourea (mnu, sigma chemical co.) intraperitoneally . Just before use, mnu was dissolved in physiological saline containing 0.05% acetic acid . Slit - lamp biomicroscopic examination was performed on each eye to provide a morphological assessment of the degree of opacification at 15 days after cataract induction . Prior to the examination, mydriasis was achieved using a topical ophthalmic solution containing tropicamide with phenylephrine hydrochloride (santen pharmaceutical, osaka, japan). One drop of the solution was instilled in each eye every 30 minutes for 2 hours, while the animals were in a dark room . After 2 hours, the eyes were examined by slit - lamp biomicroscopy at 12magnification . The rats were sacrificed immediately after determination of cataract formation with slit - lamp biomicroscopy (15 days after cataract induction). The animals were anesthetized using zoletil 50 (10 mg / kg, i.p . ; vibac laboratories, carros, france). At necropsy, both lenses were quickly removed under a surgical microscope gl-99b - v7 (davis, california, ca, usa); a complete necropsy was performed on all animals . The lenses were fixed in 4% paraformaldehyde, dehydrated in graded ethanol, treated in xylene, and infiltrated and embedded in paraffin . Coronal sections of 5 m thickness were made using a paraffin microtome (leica, nussloch, germany) and were mounted on coated slides, then dried at 37 overnight on a hot plate . The lenses were collected and immediately frozen at -70. the tissues were homogenized with lysis buffer containing 50 mm tris - hcl (ph 8.0), 150 mm nacl, 10% glycerol, 1% triton x-100, 1.5 mm mgcl26h2o, 1 mm egta, 1 mm pmsf, 1 mm na2vo4, and 100 mm naf, and then ultracentrifuged at 50,000 rpm for 1 hours . Protein content were measured using a bio - rad colorimetric protein assay kit (bio - rad, hercules, ca, usa). Forty micrograms of protein was separated on sds - polyacrylamide gels and were transferred onto a nitrocellulose membrane . Mouse antibodies against actin (1:2000; santa cruz biotech, santa cruz, ca, usa), bax (1:1000; santa cruz biotech), and bcl-2 (1:1000; santa cruz biotech) were used as primary antibodies . Horseradish peroxidase - conjugated anti - mouse antibodies for bax and bcl-2 (1:2000; amersham pharmacia biothech gmbh, freiburg, germany) were used as secondary antibodies . The experiment was performed in normal lab conditions at room temperature, with the exception of membrane transfer . Membrane transfer was performed at 4 with a cold pack and a pre - chilled buffer . Band detection was performed using an enhanced chemiluminescence (ecl) detection kit (santa cruz biotech). Detected bands were calculated densitometrically using molecular analyst version 1.4.1 (bio - rad), in order to compare the relative expressions of proteins . Tunel staining was performed using an in situ cell death detection kit (roche, mannheim, germany) according to the manufacturer's protocol, in order to visualize dna fragmentation, a marker of apoptotic cell death . The epithelial cells were suspended in 10 mm tris - hcl buffer, ph 8.0, containing 1 mm edta, through incubation at 55 for 30 minutes . Sections were then incubated with proteinase k (100 g / ml), rinsed, incubated in 3% h2o2, permeabilized with 0.5% triton x-100, rinsed again, and incubated in tunel reaction mixture . The sections were rinsed and visualized using converter - pod with 0.03% 3,3'-diaminobenzidine (dab) and then mounted onto gelatin - coated slides . The slides were air dried overnight at room temperature, and coverslips were mounted using permount. Sections were drawn from each lens and incubated overnight with mouse anti - caspase-3 antibody (1:500; santa cruz biotech) and then for another 1 h with biotinylated mouse secondary antibody (1:200; vector laboratories, burlingame, ca, usa). Bound secondary antibodies were then amplified with a vector elite abc kit (1:100; vector laboratories). The antibody - biotin - avidin - peroxidase complexes were visualized using 0.03% dab, and the sections were finally mounted onto gelatin - coated slides . The slides were air dried overnight at room temperature, and coverslips were mounted using permount. To compare relative expressions of proteins, we examined detected bands densitometrically using molecular analyst version 1.4.1 (bio - rad). The area of the lens epithelium region in each slice was measured using the image - pro plus computer - assisted image analysis system (media cybernetics inc ., silver spring, md, usa) attached to a light microscope (olympus, tokyo, japan). The tunel - positive and caspase-3-positive cells within each lens epithelium region were counted through the light microscope . Statistical analysis was performed using one - way anova followed by duncan's post - hoc test . The degree of lenticular opacification was enhanced in the cataract - induction rats and was reduced by catechin treatment . 2 . The number of tunel - positive cells was 8.302.78/section in the control group, 157.5010.26/section in the cataract - induction group, 143.308.94/mm in the cataract - induction and 50 mg / kg catechin group, 136.4011.36/section in the cataract - induction and 100 mg / kg catechin group, and 97.106.98/section in the cataract - induction and 200 mg / kg catechin group . These results show that mnu injection enhanced apoptotic cell death in the lens epithelium, and catechin treatment significantly suppressed cataract - induced apoptosis in a dose - dependent manner . 3 . The number of caspase-3-positive cells was 6.202.23/section in the control group, 103.206.78/section in the cataract - induction group, 101.203.67/mm in the cataract - induction and 50 mg / kg catechin group, 103.003.10/section in the cataract - induction and 100 mg / kg catechin group, and 84.202.73/section in the cataract - induction and 200 mg / kg catechin group . These results show that mnu injection enhanced caspase-3 expression in the lens epithelium, and that catechin (200 mg / kg) treatment significantly suppressed cataract - induced caspase-3 expression . To verify cataract - induced apoptosis, we ascertained the relative protein expressions of bax and bcl-2 related to apoptosis, and levels of bax and bcl-2 are presented in fig . The level of bax (24 kda, the pro - apoptotic factor) in the control group was set at 1.00 . In the cataract induction group, the levels of bax were 3.110.28 in the 0mg / kg catechin group, 2.790.28 in the 50 mg / kg catechin group, 1.980.18 in the 100 mg / kg catechin group, and 1.970.26 in the 200 mg / kg catechin group . In contrast, catechin administration reduced the expression of bax in a dose - dependent manner . Specifically, 100 mg / kg and 200 mg / kg catechin significantly suppressed the expression of bax protein . The level of bcl-2 (26~29 kda, the anti - apoptotic factor) in the control group was set at 1.00 . In the cataract induction groups, the levels of bcl-2 were 1.430.04 in the 0mg / kg catechin group, 1.550.03 in the 50 mg / kg catechin group, 1.430.05 in the 100 mg / kg catechin group, and 1.630.03 in the 200 mg / kg catechin group . Cataract formation increased bcl-2 expression, while catechin (200 mg / kg) administration slightly enhanced the expression of bcl-2 . We calculated the ratio of bax to bcl-2, one of the crucial factors determining if cells will undergo apoptosis . The ratio of bax to bcl-2 in the control group was set at 1.00 . In the cataract induction groups, the ratios of bax to bcl-2 were 2.170.20 in the 0mg / kg catechin group, 1.800.18 in the 50 mg / kg catechin group, 1.380.13 in the 100 mg / kg catechin group, and 1.210.16 in the 200 mg / kg catechin group . Cataract enhanced the expression of both bax and bcl-2, but bax expression increased much more than did increased bcl-2 expression . On the other hand, administration of catechin significantly suppressed the expression of bax protein . As a result, the ratio of bax to bcl-2 was increased by cataract formation, representing ongoing apoptotic cell death in the lens epithelium . Catechin treatment suppressed the ratio of bax to bcl-2, representing inhibition of apoptotic cell death in the lens epithelium . The degree of lenticular opacification was enhanced in the cataract - induction rats and was reduced by catechin treatment . 2 . The number of tunel - positive cells was 8.302.78/section in the control group, 157.5010.26/section in the cataract - induction group, 143.308.94/mm in the cataract - induction and 50 mg / kg catechin group, 136.4011.36/section in the cataract - induction and 100 mg / kg catechin group, and 97.106.98/section in the cataract - induction and 200 mg / kg catechin group . These results show that mnu injection enhanced apoptotic cell death in the lens epithelium, and catechin treatment significantly suppressed cataract - induced apoptosis in a dose - dependent manner . 3 . The number of caspase-3-positive cells was 6.202.23/section in the control group, 103.206.78/section in the cataract - induction group, 101.203.67/mm in the cataract - induction and 50 mg / kg catechin group, 103.003.10/section in the cataract - induction and 100 mg / kg catechin group, and 84.202.73/section in the cataract - induction and 200 mg / kg catechin group . These results show that mnu injection enhanced caspase-3 expression in the lens epithelium, and that catechin (200 mg / kg) treatment significantly suppressed cataract - induced caspase-3 expression . To verify cataract - induced apoptosis, we ascertained the relative protein expressions of bax and bcl-2 related to apoptosis, and levels of bax and bcl-2 are presented in fig . 4 . The level of bax (24 kda, the pro - apoptotic factor) in the control group was set at 1.00 . In the cataract induction group, the levels of bax were 3.110.28 in the 0mg / kg catechin group, 2.790.28 in the 50 mg / kg catechin group, 1.980.18 in the 100 mg / kg catechin group, and 1.970.26 in the 200 mg / kg catechin group . In contrast, catechin administration reduced the expression of bax in a dose - dependent manner . Specifically, 100 mg / kg and 200 mg / kg catechin significantly suppressed the expression of bax protein . The level of bcl-2 (26~29 kda, the anti - apoptotic factor) in the control group was set at 1.00 . In the cataract induction groups, the levels of bcl-2 were 1.430.04 in the 0mg / kg catechin group, 1.550.03 in the 50 mg / kg catechin group, 1.430.05 in the 100 mg / kg catechin group, and 1.630.03 in the 200 mg / kg catechin group . Cataract formation increased bcl-2 expression, while catechin (200 mg / kg) administration slightly enhanced the expression of bcl-2 . We calculated the ratio of bax to bcl-2, one of the crucial factors determining if cells will undergo apoptosis . The ratio of bax to bcl-2 in the control group was set at 1.00 . In the cataract induction groups, the ratios of bax to bcl-2 were 2.170.20 in the 0mg / kg catechin group, 1.800.18 in the 50 mg / kg catechin group, 1.380.13 in the 100 mg / kg catechin group, and 1.210.16 in the 200 mg / kg catechin group . Cataract enhanced the expression of both bax and bcl-2, but bax expression increased much more than did increased bcl-2 expression . On the other hand, administration of catechin significantly suppressed the expression of bax protein . As a result, the ratio of bax to bcl-2 was increased by cataract formation, representing ongoing apoptotic cell death in the lens epithelium . Catechin treatment suppressed the ratio of bax to bcl-2, representing inhibition of apoptotic cell death in the lens epithelium . Several animal species experience spontaneously occurring cataract of known inheritance and offer valuable model for studying human cataract . Various chemicals are known to contribute to the development of cataract in animals . Among these chemicals, mnu, a direct - acting alkylating agent that does not require metabolic activation, is known as a cataractogenic agent in rats . In addition, young animals are reported to be more susceptible to mnu than are adult animals . Therefore, in this study, a cataract model was constructed using a single intraperitoneal injection of nmu in rats at postnatal day 10 . Lens epithelial cells play a vital role in the metabolic homeostasis and maintenance of transparency in the lens, and damage to lens epithelial cells potently contributes to cataractogenesis . Moreover, apoptosis of lens epithelial cells has been reported to be the earliest event in the experimental formation of cataracts, such as those inducted by hydrogen peroxide and mnu . In human studies, the number of tunel - positive cells is above 50% in the lens epithelium after cataract surgery . In addition, caspase-3 is up - regulated and activated in the early stages of apoptosis following cataractogenesis . We found that the numbers of tunel - positive and caspase 3-positive cells in the lens epithelium were significantly higher following cataract induction . These findings indicate that mnu injection - induced cataracts increased apoptosis in the lens epithelium . The bcl-2 family of proteins - including bcl-2 and bcl - xl - plays an important role in the regulation of apoptosis in the nervous system . However, bcl-2 and bcl - xl form heterodimers with the main pro - apoptotic member bax, which can incapacitate their protective functions . The bcl-2/bax balance is one of the crucial factors determining if cells undergo apoptosis, and the balance can change during cataract formation . However, cataract formation increased bax expression much more than it increased bcl-2 expression . In the lens epithelium of the cataract, lens cell death occurs by apoptosis, and inhibition of apoptosis can delay cataract formation . It has been reported that catechins can modulate apoptosis by altering the expressions of anti - apoptotic and pro - apoptotic genes . Among the constituents of catechin, egcg is known to protect against oxidative stress - induced and chronic glutamate - induced apoptosis in several human cells . Yao et al . Reported that catechin protects against mitochondria - mediated apoptosis induced by h2o2 in human lens epithelial cells through the modulation of caspases and the mapk and akt pathways . We observed that catechin significantly suppressed both cataract - induced increases in dna fragmentation and caspase-3 expression in the lens epithelium in dose - dependent manners . Many studies have shown that egcg, the main component of catechin, inhibits the expression of pro - apoptotic genes such as bax, bad, and mdm2, and that egcg increases the expression of anti - apoptotic genes such as bcl-2, bcl - w, and bcl - xl . In the present study, however, cataracts induced apoptosis by increasing the bax expression much more than it did the bcl-2 expression . Administration of catechin suppressed the expression of bax protein in a dose - dependent manner, but only slightly enhanced bcl-2 expression . The ratio of bax to bcl-2 was increased by cataract formation . In contrast, catechin suppressed the ratio of bax to bcl-2, showing that apoptosis was inhibited by catechin treatment . Taken together, our results demonstrate that catechin alleviated cataract - induced apoptosis in lens epithelial cells . Catechin could potentially be used to delay cataractogenesis through the suppression of apoptotic cell death in the lens epithelium.
|
The cases reported involved metastasis from cutaneous or mucosal melanoma, gastric adenocarcinoma, hypernephroma, and various lung neoplasms . The less common metastatic tonsillar tumors originate from mesothelioma, hepatocellular carcinoma, ovarian androblastoma, seminoma, anaplastic thyroid carcinoma, pancreatic adenocarcinoma, prostatic adenocarcinoma, and gall bladder carcinoma . Breast carcinoma is one of the rarest primary tumors that can metastasize to the tonsil; only eight cases have been reported in the literature, and only one case of tonsillar metastasis of breast sarcoma has been reported . Tonsillar metastasis rarely becomes apparent before the diagnosis of the primary neoplasm, and only a few cases of tonsillar metastasis as a presenting feature have been reported in the literature . In most of these cases, the presenting symptoms were sore throat, an oral globus sensation, and different degrees of dysphagia and odynophagia . In other cases, patients were asymptomatic, and their tonsillar neoplasm was detected incidentally during a routine oral examination . Tonsillar metastasis can be bilateral or unilateral depending on the nature of the primary neoplasm . The prognosis for patients with tonsillar metastasis is rather poor . In this report, we present a case of a phyllodes tumor that metastasized to the tonsil; we have included the clinical features and pathological findings . A 54-year - old woman underwent right mastectomy for a breast tumor 3 years before she was referred to our department . Histopathological examination showed a tumor larger than 10 cm in diameter that had slightly invaded the surrounding tissues and was characterized by moderate nuclei pleomorphism, moderate cell density, and moderate mitosis (fig . The final pathology revealed that no tumor was identified on the margin of the resected specimen . Immunostaining showed that the tissue was negative for cytokeratin ae1/ae3, mnf116, and cam5.2 . Although she was informed of possible recurrence, she stopped ambulatory care 4 months after the operation . Two years and 10 months after the operation, she presented with cough and dyspnea . A biopsy of the lung tumor was performed with bronchoscopy, and the sample was diagnosed as metastasis of the phyllodes tumor . Pathology analysis of the lung specimen indicated metastasis of the malignant phyllodes tumor with incomplete resection . Three years and 1 month after the lung operation, the patient was referred to our department for throat pain and presented with left tonsil swelling . Physical examination revealed a left tonsillar tumor measuring 20 mm in diameter . Computed tomography images showed a left tonsillar tumor that did not spread outside the pharyngeal constrictor muscles . Pathology analysis of the biopsy of the left tonsil showed metastasis of the malignant phyllodes tumor of the breast . Histopathological analysis of the left tonsillar tumor showed growth of spindle cells, necrosis, and atypical nuclei (fig . Immunostaining showed that the tissue was negative for cytokeratin ae1/ae3, mnf116, and cam5.2 . Because the pathological features of the left tonsillar tumor were similar to those of the primary breast tumor, the left tonsillar tumor was diagnosed as a metastasis of the primary phyllodes tumor . Histopathology analysis of the right tonsillar tumor showed growth of spindle cells, necrosis, and atypical nuclei, which differed from the findings for the primary breast phyllodes tumor (fig . 3). Immunostaining showed that the tissue was positive for cytokeratin ae1/ae3, mnf116, and cam5.2 . In situ the pathological features of the resected right tonsil were similar to those of undifferentiated carcinoma of the oropharynx . No recurrence of the tonsillar tumors or deterioration of the lung lesion had been observed, but the breast tumor regrew . The central venous catheter became infected with methicillin - resistant staphylococcus aureus during chemotherapy, and the chemotherapy was stopped . Phyllodes tumor is an uncommon breast neoplasm that accounts for less than 1.0% of all breast tumors and has the ability to recur and metastasize . Phyllodes tumor is graded as benign, borderline, or malignant according to a set of histological data including stromal cellularity, stromal cell atypia, mitotic activity, stromal overgrowth, necrosis, and whether the margin is rounded or infiltrative and shows malignant heterologous elements . The overall incidence of metastasis of phyllodes tumor is 312%, most commonly to the lung . The treatment of choice is excision with a 10-mm margin, although malignant lesions require mastectomy . However, mastectomy is not effective in preventing metastatic disease, and the optimal treatment of metastatic disease has not been established . First, to our knowledge, this is the first reported case of a phyllodes tumor metastasizing to the tonsil . A review of the literature found several reports of phyllodes tumors metastasizing to the head and neck region, including the right ramus, posterior right maxilla, left mandibular posterior quadrant, and left angle and ramus of the mandible . Other cases involved gingival metastasis and metastasis of the temporomandibular region, parotid grand, thyroid adenoma . Second, this is the first reported case of secondary primary right tonsillar tumor which was developed in the patient with a metastatic left tonsillar tumor . The clinical course suggested that the right tonsillar tumor should be a metastasis of a phyllodes tumor . However, the right tonsillar tumor was diagnosed as undifferentiated carcinoma because the histopathology clearly differed from those of the left tonsillar tumor . Secondary neoplasms occurring in cases of phyllodes tumor were reported in one paper . In that report, eight tumors were diagnosed in 6/32 patients as secondary tumors of duodenal cancer, cervical cancer, laryngeal cancer, alveolar cell adenocarcinoma, metastatic colon cancer, astrocytoma, esophageal cancer, and lung adenocarcinoma . Another hypothesis is anaplastic transformation of phyllodes tumor (i.e., stromal elements may have changed to epithelial elements). Breast tumor metastasis to the tonsil is rare but it should be considered as a possible diagnosis . We report a case of phyllodes tumor metastasis to the left tonsil which developed undifferentiated carcinoma in the other side of tonsil later . Breast tumor metastasis to the tonsil is rare but it should be considered as a possible diagnosis . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request.
|
The term neuronal plasticity was already used by the father of neuroscience santiago ramn y cajal (1852 - 1934) who described nonpathological changes in the structure of adult brains . Old dogma that there is a fixed number of neurons in the adult brain that cannot be replaced when the cells die (for review see). In a wider sense, the ability to make adaptive changes related to the structure and function of the nervous system . Accordingly, neuronal plasticity can stand not only for morphological changes in brain areas, for alterations in neuronal networks including changes in neuronal connectivity as well as the generation of new neurons (neurogenesis), but also for neurobiochemical changes . We provide here a short overview of different forms of neuroplasticity with reference to the history of their discovery . In the late 1960s, the term neuroplasticity was introduced for morphological changes in neurons of adult brains . Using electron microcopy raisman demonstrated an anatomical reorganization of the neuropil in the septal nuclei of adult rats after a selective lesion to distinct axons which terminate on the neurons in those nuclei . Since then, many changes in the morphology of neurons in response to various internal and external stimuli have been described . A strong external stimulus that evokes numerous neuroplastic changes is stress . Repeated or chronic stress changes the morphology of neurons in various brain areas . Probably the most thoroughly investigated neuromorphological change is the stress - induced regression of the geometrical length of apical dendrites of pyramidal neurons that was first demonstrated in the hippocampus . The hippocampus is part of the limbic - hpa (hypothalamic - pituitary - adrenal) system and regulates the stress response . Retraction of dendrites of ca3 pyramidal neurons has been repeatedly documented after chronic stress as well as after chronic glucocorticoid administration [57]. Dendritic retraction does of course reduce the surface of the neurons which diminishes the number of synapses . Also neurons in the medial prefrontal cortex retract their dendrites in response to stress, but the effects depend on the hemisphere [8, 9]. Studies on the prefrontal cortex showed that neurons in this brain region are particularly plastic in that they change their dendritic morphology with the diurnal rhythm . The dendritic arborization of the pyramidal and stellate neurons in the basolateral complex was enhanced by a similar chronic stress paradigm that reduces branching of dendrites in hippocampal ca3 pyramidal neurons . The brain's pronounced neuroplastic capacities are also reflected by the fact that the synapses are replaced as soon as the stress is terminated . Furthermore, drugs that stimulate neuroplasticity can prevent the stress - induced retraction of dendrites in the hippocampal formation . A form of functional neuroplasticity is long - term potentiation (ltp), that is the long - lasting enhancement in signal transmission between two neurons after synchronous stimulation . The research on neuroplasticity in adult brains was strongly stimulated by observations that brain neurons may die, for example, because of trauma or degenerative illnesses such as parkinson's or alzheimer's disease . In the late 1990s, there were reports that even the stress that an individual experiences can kill neurons in the brain . This message was based on studies in wild vervet monkeys that had been housed in a primate center in kenya where they died suddenly . The finding that their brains revealed dead pyramidal neurons in the hippocampus attracted great public attention as the message was reduced to however, it later turned out that in this study on wild life animals the post mortem treatment of the brain tissue had been not optimal . The time between death of the animals and fixation of the brains for the neuropathological analysis was obviously too long so that morphology of the neurons was affected to an extent that had nothing to do with the previous stress exposure of the living animals . Since stress raises plasma glucocorticoids (gc), monkeys were chronically treated with gc in a subsequent study, and also the brains of these animals revealed changes in neuron morphology that were interpreted as dead or dying neurons . Instead, it was recognized that the morphological analysis of pyramidal neurons is technically delicate . It became apparent that, after a subject's death, neurons may dramatically change their morphology and turn into dark neurons when the brain tissue has not been fixed adequately for the histological analysis . When the chronic stress experiments were repeated under conditions that acknowledged those technical issues, it turned out that stress does not kill neurons, which is definitely a good message for stressed individuals . Further studies showed that apoptosis (programmed cell death) in the hippocampal formation is a relatively rare event and that chronic stress may even reduce cell death in certain hippocampal subfields while increasing apoptosis in others . Since chronic social stress in animals is regarded as preclinical model for depression the finding of a lack of neuron death in stressed animals also shed new light on a hypothesis saying that, in humans, major depression kills neurons in the brain . Indeed, it was later found that hippocampal neuron numbers in depressed subjects do not significantly differ from the numbers in healthy individuals . Also the hypothesis that chronic gc exposure leads to neuron death had to be revised . A summary of a range of studies on these issues concluded that it is unlikely that endogenous gc can cause structural damage to the hippocampal formation . Adverse influences such as stress, depression, and chronic gc treatments may cause shrinkage of the hippocampal formation . However, the underlying processes are obviously not neuron loss but other changes in the tissue such as reductions in neuronal dendrites and further presumptive alterations in the neuropil that have not been identified in detail yet ([6, 24]; for review see). The most appealing phenomenon of neuroplasticity appears to be adult neurogenesis, that is the generation of new neurons in adult brains . Neurogenesis takes of course place in the developing central nervous system, but in view of the fact that certain illnesses such as parkinson's disease and multiple sclerosis occur in adulthood the interesting question is whether also adult brains are able to replace lost neurons . In contrast to most cells of the body such as those in the gut, the skin, or the blood which are constantly renewed, the brain and in particular the mammalian brain has always been regarded as a nonrenewable organ . Although the adult brain can sometimes functionally compensate for damage by generating new connections among surviving neurons, it does not have a large capacity to repair itself because most brain regions are devoid of stem cells that are necessary for neuronal regeneration . This lack of neuroplasticity was first described by santiago ramn y cajal who stated that in adult centers the nerve paths are something fixed, ended, immutable . It is for science of the future to change, if possible, this harsh decree . The no new neurons dogma was already challenged almost five decades ago . Using autoradiography with the tritiated dna nucleoside h - thymidine, altman [27, 28] gained first evidence for the production of glia cells and possibly also of neurons in the brains of young adult rats and adult cats . In subsequent studies, 10-day - old rats received h - thymidine and the tritium radioactivity was visualized 2 months later in cells of the subgranular zone in the dentate gyrus . Unfortunately, autoradiography with h - thymidine is a very delicate method and it is not easy to pick up the low number of neurons that is generated daily in, for example, the dentate gyrus of adult mammals . Accordingly, h - thymidine autoradiographs produced at that time could not generally convince the scientific community that adult neurogenesis really exists . However, the neuronal character of newly generated cells in the rodent dentate gyrus was confirmed and further substantiated by demonstrating that these newborn cells receive synaptic input and extend axons into the mossy fiber pathway that projects to the ca3 subfield [3032]. Another landmark was in the early 1980s, when substantial neurogenesis was demonstrated in a vocal control nucleus of the adult canary brain, and a functional link between behavior, song learning, and the production of new neurons was established . The finding that, in songbirds (canaries, zebra finches), males have larger song control nuclei in their brains as compared to females indicated that the number of neurons in those adult birds may change with the season . Indeed, the neuron number in song control nuclei increases in spring time when male zebra finches begin to sing, and newborn neurons were also found in the hvc (hyperstriatum ventrale, pars caudalis) of adult canaries . Studies on the hvc in birds showed that steroid hormones play important roles in these processes of neuroplasticity, in particular the gonadal hormone testosterone [35, 37]. In line with these findings cajal's statement on the fixed number of neurons in adult brains was further challenged as it became clear that even in mammals, parts of the adult central nervous system are able to replace neurons . In the olfactory epithelium of the mammalian nose, sensory neurons are continuously generated throughout the lifespan, as first shown in adult squirrel monkeys . This electron microscopic study clearly showed large numbers of newborn sensory neurons that are produced every day in the olfactory epithelium of the adult animals . Later it was found that also neurons in the olfactory bulb (ob) of adult mammals can be replaced . The new ob neurons derive from the subventricular zone at the lateral ventricle where neuroblasts are generated that migrate through the rostral migratory stream to the ob (figure 1). The neuroblasts differentiate to functional neurons, in that case granule cells, which form synapses with mitral cells ([39, 40]; for review see). However, ob neurogenesis is easier to detect than hippocampal neurogenesis and it took several years until there was reliable evidence that hippocampal neurogenesis does exist in adult mammals . In particular, neurogenesis could long not be demonstrated in the brains of adult nonhuman primates such as rhesus monkeys thereby leading to the assumption that neuronal replication is not tolerated in primates . In an initial study, rakic investigated neurogenesis in adult rhesus monkeys using h - thymidine, examining major structures and subdivisions of the brain including the visual, motor, and the association neocortex, hippocampus and ob . Rakic found not a single heavily labeled cell with the morphological characteristics of a neuron in any brain in any adult animal and concluded that all neurons of the rhesus monkey brain are generated during prenatal and early postnatal life [42, 43]. Furthermore, rakic argued that a stable population of neurons may be a biological necessity in an organism whose survival relies on learned behavior acquired over a long period of time . These statements had a profound influence on the development of the research field in that they formed the basis for researchers of the time to show little interest to detect neurogenesis in the adult mammalian brain . A revolution in the field of neurogenesis research took place when the thymidine analog 5-bromo-2-deoxyuridine (brdu) and corresponding antibodies were introduced for labeling newborn neurons by immunohistochemistry . Using this new and in comparison to autoradiography simple and fast technique, it became clear that adult hippocampal neurogenesis in mammals is not restricted to rodents but has been conserved throughout mammalian evolution . The formation of new granule neurons was, for example, demonstrated in the dentate gyrus of adult rats and tree shrews [45, 46]; the later species is regarded as phylogenetically located between insectivores and primates . Evidence of neurogenesis in the adult primate brain derived from studies in marmoset monkeys, a small nonhuman primate from south america, and in macaques which are typical representatives of the nonhuman old - world primates [49, 50]. Finally, the existence of neurogenesis in the adult human brain was shown in cancer patients who were injected with brdu to monitor tumor cell proliferation . Some of these patients died from their illness and small samples of their hippocampi were evaluated for the presence of brdu - labeled neurons . Since brdu had been systemically administered, all dividing cells were supposed to be labeled . Indeed, newborn neurons were detected in the dentate gyrus granule cell layer of all individuals . It thus became generally accepted that adult neurogenesis not only does occur in the olfactory bulb and the gyrus dentatus of the hippocampal formation of mammals but can also be detected in higher brain regions such as the neocortex [52, 53]. However, there are still open questions regarding the extent of neurogenesis in homologous brain regions of different mammalian species (see below). To detect neurogenesis in brains of adult humans the group of j. frisn took advantage of the increased concentration of c in the atmosphere after nuclear bomb tests . After a nuclear explosion, this radioisotope is increasingly incorporated into dividing cells of living organisms, including humans . Through the determination of c, the authors found that about 700 new neurons are generated daily in the hippocampal formation of adult humans . Interestingly, the c analysis of human brains revealed adult neurogenesis in the striatum, adjacent to a site at the lateral ventricle where neuronal precursor cells are generated, and there are indications that the neuroblasts in the human striatum differentiate to interneurons . Surprisingly, no newborn neurons could be detected with the c technique in the adult human ob . These most recent findings clearly show that species and brain - region specific processes of neurogenesis await further elucidation . Adult neurogenesis does occur not only in mammals and birds but also in amphibians, reptiles, and bony fishes (for references see). Despite this omnipresence of adult neurogenesis within vertebrates, so far it appears that in most mammals, the generation of new neurons in adult brains takes place in two regions, the subventricular zone and the dentate gyrus, and the number of newly generated neurons is small compared to the total number of brain cells (figure 1). However, there are also reports from studies in mice that new neurons can be generated in the adult substantia nigra, although with a slow physiological turnover of neurons . In contrast, in fish a huge number of neurons are continuously produced in many areas of the adult brain . Also important to mention that in comparison with fishes, reptiles and birds, the rate of neurogenesis in adult mammals decreases with age . The existence of neurogenesis in adult brains gives hope that even damaged brain regions can be functionally repaired . Indeed, injury to the adult brain such as ischemic insults stimulates the proliferation of subventricular zone cells and thus the formation of neuronal precursor cells . These neuroblasts migrate along blood vessels to the damaged region (for review see). However, only a small percentage can survive, in part because inflammatory processes that occur in the ischemic brain region inhibit neurogenesis and the successful integration of new cells into a functional neuronal network . Anti - inflammatory drugs can restore neurogenesis, as shown in rodent models of peripheral inflammation and after irradiation . Knowledge about the regulation of adult neurogenesis is definitely a prerequisite for future therapeutic interventions that may take advantage of the generation of new neurons in adult brains . Kempermann emphasized that there is an immense spectrum of neurogenic regulators which reflect the sensitivity of adult neurogenesis to many different types of stimuli . Respective regulatory elements that are so far known include single molecules as well as environmental conditions that lead to changes in a large number of factors which themselves influence neurogenesis . Among the molecular factors that were first identified as regulators of adult neurogenesis are sex steroids such as estrogen which can at least transiently stimulate neurogenesis in the dentate gyrus . Steroid hormones have pleiotropic effects on the expression of many genes among which are also genes which themselves encode regulators of neurogenesis . Accordingly, in female mammals, effects of steroid hormones on adult neurogenesis depend on the estrous cycle and other stages related to reproductive biology . It is not surprising that growth factors such as bdnf (brain - derived neurotrophic factor) and vegf (peripheral vascular endothelial growth factor) regulate adult neurogenesis [6466]. Also the neurotransmitter glutamate and astroglia have an impact on adult neurogenesis, probably by generating a distinct microenvironment that may favor the generation / differentiation of neuroblasts [6769]. Effects of stress on neurogenesis in the dentate gyrus (the so - called hippocampal neurogenesis) have been studied by several groups . Chronic social stress in tree shrews and other adverse stress experiences in marmoset monkeys reduced hippocampal neurogenesis [23, 46, 48]. The effects of social and other forms of stress depend on the stressor's intensity and its duration, and they may be reversible . Prenatal stress in rhesus monkeys has persistent effects as a reduction in neurogenesis was observed in the adolescent individuals . In newborn marmoset monkeys which were intrauterinely exposed to the synthetic glucocorticoid dexamethasone, the proliferation of putative precursor cells but not the differentiation into mature cells was impaired . Interestingly, this decreased proliferation rate observed in newborn monkeys was no longer detectable in their 2-year - old siblings suggesting no long - lasting effect of prenatal hyperexposure to dexamethasone on neuronal proliferation and differentiation in the dentate gyrus of marmoset monkeys . Several authors attributed the effects of stress on neurogenesis to the actions of glucocorticoids which are elevated in the blood of stressed individuals . Corticosteroids do indeed regulate neurogenesis and the glucocorticoid receptor antagonist mifepristone prevented the stress - induced reduction in hippocampal neurogenesis . Also the mineralocorticoid receptor appears to play a particular role as indicated by the fact that a genetic disruption of the receptor impaired adult hippocampal neurogenesis in mice . Elements of the glucocorticoid system are not the only regulatory factors of adult neurogenesis in stress . Instead, as pointed out above, other components of the stress cascade such as enhanced excitatory neurotransmission (increased glutamate release) play also a role . In several preclinical models of depression using stress to induce depressive - like symptoms in animals, certain antidepressants restored the neurogenesis that had been impaired by the stress (see, e.g., [23, 77]). However, it remains an enigma whether endogenous or synthetic substances exist that can boost adult neurogenesis via this receptor system . The formation of new neurons is regulated by substances derived from blood vessels and is targeted by an enormous number of factors [61, 79]. Coinciding with this view are reports demonstrating that adult neurogenesis is enhanced by physical activity such as running, by learning, or by environmental enrichment [8284]. Soon after the discovery of adult neurogenesis it was hypothesized that hippocampal neurogenesis (i.e., the neurogenesis in the subgranular zone of the dentate gyrus, a region of the hippocampal formation) plays a crucial role in learning and memory . However, experimental results on the role of different forms of memory in adult rodents (e.g., spatial learning versus associative memory) were in part contradictory . In a comprehensive review, koehl and abrous came to the conclusion that adult neurogenesis in rodents is involved when the task requires the establishment of relationships among multiple environmental cues for the flexible use of acquired information . Whether this is true for all mammals remains to be determined as a low rate or even absence of neurogenesis was found in the hippocampal formation of adult bats and in whales, species with an excellent spatial working memory . In the ob, adult - born new neurons are integrated into the neuronal circuits that are responsible for olfaction and olfactory memory, respectively (for review see). The fact that in animal models of depression certain antidepressants restored normal neurogenesis that had been impaired by stress led to the hypothesis that the beneficial effects of antidepressants depend on the restoration of normal neurogenesis . The volume of the hippocampal formation is reduced in patients with major depression, and antidepressants can normalize hippocampal volume . However, the hippocampal shrinkage is probably not due to a decrease in neurogenesis but rather to more complex changes in the neural network which involve dendritic, axonal, and possibly also glial alterations . Failing adult hippocampal neurogenesis may not explain major depression, addiction or schizophrenia, but contributes to the hippocampal aspects of the diseases . A comparison of the neural stem - cell proliferation in post mortem brain samples from patients with major depression, bipolar affective disorder, schizophrenia, and control subjects revealed no evidence of reduced neurogenesis in the dentate gyrus of depressed individuals . Unexpectedly, significantly reduced numbers of newly formed cells were found only in schizophrenic patients . Concerning impaired neurogenesis as presumptive cause of depression a group of experts summarized that a lasting reduction in neurogenesis (is) unlikely to produce the full mood disorder . However, more recent reports based on post mortem studies showed decreased numbers of neuronal progenitor cells in the dentate gyrus of depressed patients and a selective enhancing effect of antidepressant treatment in the anterior and middle dentate gyrus of depressed individuals [9395]. To overcome the manifold limitations of post mortem studies, a future approach to address the question of adult neurogenesis in humans more precisely (possibly in longitudinal studies) could be the visualization of this process in live subjects using advanced in vivo imaging techniques . Moreover, this approach could help answer the open questions on the role of neurogenesis in cognitive functions and its functional impact and contribution to the etiology of depression . When searching for dead neurons in the hippocampal formation of male tree shrews, standard histology showed that chronic social stress does not lead to neuronal death but changes the appearance of the nuclei in the hippocampal neurons . Closer investigations revealed that chronic stress increases the formation of heterochromatin in the nuclei of the hippocampal neurons . In this study, the nuclear ultrastructure of hippocampal pyramidal neurons in male tree shrews that had been exposed to daily social stress during four weeks according to a standard stress paradigm was analyzed . Electron microscopic analysis revealed that in the stressed animals the nucleoplasma of ca3 pyramidal neurons displayed numerous heterochromatin clusters (figure 2). Heterochromatin is a form of condensed chromatin whose occurrence indicates that transcription of genes is reduced in those cells . Quantification of the clusters revealing areas larger than 1 m in the hippocampal region ca3 showed that there was more heterochromatin in stressed animals compared to controls . In contrast, in area ca1, the stress had no effect on the density of heterochromatin clusters (figure 3;). Although in those days it was totally unknown which genes in the hippocampal nuclei were silenced by the chronic stress, these morphological data indicated already what was later called epigenetics, the phenomenon that environmental factors change the structure of chromatin, influence transcription, and induce changes in the genome . Since glucocorticoid hormones are often regarded as important factors that convey many effects of chronic stress, it was tested whether a chronic cortisol treatment would have the same effects on the chromatin as the chronic social stress . Interestingly, chronic cortisol changed the number of heterochromatin clusters only in hippocampal region ca1, but not in ca3, the region that is targeted by stress (figure 3). These results indicate a site and treatment specific reaction to stress and glucocorticoid treatment in the hippocampal formation . The obvious differences between chronic stress and chronic glucocorticoid treatment must be kept in mind because they possibly reflect different cellular pathways activated by the two treatments.
|
Most eukaryotic cells express several thousand proteins, and multicellular organisms commonly express tens of thousands of proteins, exponentially increasing the probable total number of macromolecular interactions in these organisms, all passing information on pathways linking each other throughout the cell . For example, analyses suggest on the order of 50,000 different protein interaction pairs, and perhaps four times more in humans (hart et al ., 2006). This number is much higher if one considers the many possible combinations of interactions any protein may make at different times, or if one includes interactions between proteins and other macromolecules (e.g., dna and rna). A major challenge in cell biology is thus to elucidate dynamic interactomes of consequence and to understand how these interactomes lead to cellular phenotypes . The impacts of such understanding are potentially vast, allowing us to create new medical therapeutics and diagnostics as well as to harness cells as factories in the biotechnology industry for medicines, pesticides, biofuels, and new foods and materials . Another major impact area for cell biology is in our understanding of pathogens, which act by directly influencing or hijacking cellular processes in host cells; understanding how leads both to therapeutic insights as well as to a better understanding of cellular processes . The promise of cell biology for its impacts on downstream translational applications thus remains extremely high . But at a time when scientists are increasingly challenged to focus on translational aspects of their research, it is perhaps worth reflecting on what we know about the cellular interactome and the extent to which our current understanding can lead to rational strategies with predictable outcomes for controlling biological systems . For nucleic acids, recent advances have led to an explosion of the available genomic data . In contrast, proteins are incredibly diverse in their abundance and their properties, making them highly versatile for the dynamic tasks at hand, but at the same time exceptionally difficult to analyze . Unfortunately, although we may sequence the genome of an organism quickly, we have yet to completely define the interactome of any organism at all! Worse, current technologies do not reveal dynamic interactions between macromolecules at sufficient scale, with sufficient reliability, or with sufficient sensitivity to keep pace with the genomic revolution brought about by sequencing technologies . New imaging technologies can place the components of an interactome in the cellular context and even study their normal dynamic behavior, but of themselves cannot provide all the information needed to elucidate and understand interactomes . It is for these reasons that the interactomic revolution lags badly behind the genomic revolution . At the current pace, it would take us hundreds of years to fully annotate the human interactome with respect to function and dynamic interactions . Indeed, it is clear that most dynamic interactions relevant to both normal and disease - related cellular processes remain largely undescribed . The seriousness of this deficiency is further exacerbated by the fact that most data available in databases largely exclude dynamic interactions that change as cells progress through different states, such as those that occur through differentiation or accompany disease . Similarly, almost all interactions dependent on enzymes and their cognate substrates or on posttranslational modifications are most often ignored . As an example of the challenge, it is not uncommon to observe about half of a cell s transcriptome or protein abundance to change significantly during cellular transitions or infection . Moreover, proteins change partners and move; in one experiment in yeast,> 400 proteins were detected to shift their localization between the cytosol and cytoplasmic organelles in response to carbon source (jung et al ., 2013). These findings underscore the kinds of extensive changes in interactomes that are normal to living systems and that remain largely unexplored . There is therefore a desperate need for technologies that can quickly and reliably reveal the dynamic cellular interactome . The irony of the situation is that we are in the midst of a technological renaissance in biology, which has the potential to give the complete and accurate information necessary to go from bench to bedside . Omics and imaging approaches that have pushed the temporal and spatial resolution of cell biology studies to previously unimagined limits . As an example of how revolutions in approaches can transform our understanding of cell biology, let us consider the phenomenal improvements in cellular imaging during the past few decades . By the end of the 1970s, many considered electron and light microscopy to have reached their performance limitations . However, from the 1980s up to the present day, microscopic imaging has been in a constant state of revolution . This revolution is occurring mainly by building on existing platforms (the light and electron microscope), using established principles of physics and materials technology applied together in new ways . Similarly, we must build on the current developments in proteomic technologies, including affinity isolation of macromolecular complexes, mass spectrometry, and next generation dna sequencing . By judiciously adding new technologies to address bottlenecks and limitations to the current techniques (throughput, speed, signal to noise, and data integration), these technologies are bringing proteomic and interactomic studies to a whole new level i.e ., the ability to produce enlightening dynamic pictures of how macromolecular assemblies form and function in the living cell (russel et al . Any given macromolecule may make stable interactions with other macromolecules to form a tight complex, with which other macromolecules exchange rapidly in dynamic or transient interactions; and this whole network is surrounded by a macromolecular milieu of other complexes that jostle with it in vicinal interactions . Unfortunately, upon disruption of cells, macromolecular complexes tend to disintegrate and intermingle with components not normally exposed to one another, the resultant possibility of aberrant molecular interactions being a major source of nonspecific background . This problem is one of the most important facing biochemical approaches to the study of macromolecular interactions . Thus, ideally, we should aim to freeze a macromolecular complex in place within moments of visualizing its position in the cell and subsequently isolate the intact complex together with all its components and specific neighbors, including dynamic, transient, and vicinal interactors, no matter how fleeting . One approach our laboratories have had some success with in this regard is cell breakage by cryolysis . The rapid freezing of cells almost instantly preserves their complexes as they were at the moment of freezing, preserving even dynamic and state - specific associations . Then, as the processes of cell breakage and dispersal occur in the solid phase, there can be no change in the relative distribution or association of component molecules, limiting the period during which such changes can occur to only the extraction and isolation stages . Alternatively, high pressure or high shear fluid processors can also break cells rapidly and efficiently while minimizing heating damage associated with other approaches (e.g., sonication). However a cell is broken open, upon its breakage, the normal microenvironment and larger cellular context surrounding the macromolecular complex of interest is replaced by an artificial one consisting of buffers, salts, and stabilizing agents . Even so, we cannot hope to exactly replicate the conditions found inside the cell . In the absence of constant replenishment from a living cell, macromolecular complexes and their microenvironments moreover, during cell lysis extraction, there is usually a dilution step into the extraction buffer . Disruption of the cell and dissociation of the complexes also leads to time - dependent intermingling of components not normally exposed to one another and the resultant possibility of aberrant molecular interactions, a major source of nonspecific background . One obvious way to address this issue is to isolate complexes rapidly, thereby minimizing time - dependent decay . Fortunately, the need for such agents nanobodies, scfvs (single - chain variable fragments), monoclonal antibodies, aptamers, and the like is appreciated by many and has become a major push in many laboratories and corporations . Another way to address the problem is to optimize the affinity capture solvent so that it helps to preserve the complex, slowing or preventing the decay process . Unfortunately, such optimization remains empirical and time consuming, such that affinity capture practices often adopt a one - size - fits - all approach to protein isolation that cannot account for the diverse physicochemical properties of protein complexes and their constituents . Hence, there exists a pressing need to expedite the affinity capture optimization process through multiparameter searches of extraction solvents to identify those highly optimized for affinity capture of the protein of interest in order to enable the facile exploration of a broad extraction solvent space . Finally, chemical stabilizers or cross - linkers can be used to rivet a complex together; chemical cross - linking irreversibly captures binding partners so that even the most transient interactions can, in principle, be detected . Clearly, this approach is highly promising at two levels: as chemical stabilizers to preserve the structure and interactions surrounding a given tagged protein, and as chemical rulers to measure interatomic distances to determine the high resolution structure of a complex . Recently published studies have underscored the tremendous potential that this stabilizer and chemical ruler technology has to revolutionize the elucidation of endogenous protein complexes (rappsilber, 2011). It is the dynamic and regulated interactions of macromolecular interaction hierarchies that breathe life into a cell, and it is these kinds of dynamic data that we must gather and interpret to elucidate cellular and complex functions . As well as providing a highly detailed, albeit static, picture of macromolecular hierarchies, we must gather two kinds of data that inform on the dynamics of macromolecular complexes: snapshots of the dynamic process mediated by a complex, obtained by freezing that complex in sequences in space and time; and comparisons of ensembles of complexes in different states, where the states are defined by differences in the composition, connectivity, and morphology . The kinds of analyses that can be performed to gain data on the organization and dynamics of an interactome and its component machineries are multitudinous and highly varied, and so are beyond the scope of this essay . However, mass spectrometry is a mainstay of proteomics approaches to determine the protein composition of complexes, but quantitative mass spectrometry approaches, combined with clever biochemical mixing and enrichment analyses, have been designed to detect contaminants and to determine the purity and stoichiometry of complexes . If nucleic acids form a part of a complex, several microarray or high throughput sequencing approaches can be used . If the complex is homogenous enough, it can be morphologically mapped by the ever - improving techniques of electron microscopy . Nevertheless, each kind of analysis requires a macromolecular complex to be presented to it in a way that most efficiently optimizes the analysis, so as to maximize the amount and quality of information obtained (fig . First, each analytical technique requires an appropriate degree of purity; e.g., electron microscopy requires that virtually every complex that is visualized is identical, and although mass spectrometry is less demanding, high levels of contaminants can be limiting . Third, high concentration is currently an absolute requirement for some approaches (e.g., native mass spectrometry). Fourth, the appropriate buffer is key for some applications such as native mass spectrometry, where only volatile buffers can be used . Finally, morphological intactness (i.e., a low degree of damage) is important in, for example, electron microscopy studies . Diagram illustrating analyses of interactomes and complexes, showing the information gathered and the analytical readout . Blue, information gathered; purple, analytical readout (nmr, nuclear magnetic resonance; saxs, small - angle x - ray scattering). Below each readout are provided the key factors that must be addressed with the kind of technology and data . We will then need to be able to integrate these data into models that represent in unprecedented detail the changing interactions of the macromolecular players in almost any dynamic subcellular assembly . The first is how to extract the maximum amount of information from noisy data obtained from heterogeneous samples . The second is how to find static structural models that satisfy all the data points within their uncertainties . The third challenge is how to extend our techniques for building models of static structures to the modeling of individual snapshot states in the dynamic processes, followed by connecting these snapshots to capture the entire dynamic process . The fourth challenge is to reveal key dynamics of complex networks without exhaustive measurements of all biochemical parameters . These challenges are coupled, for example when the heterogeneous samples come from many stages of the process measured simultaneously . Moreover, our cellular maps need to map data at the right level of granularity to reveal sufficient detail of dynamic systems and to provide the necessary conceptual framework to navigate and understand the biology without including superfluous or misleading information . The ultimate goal is to use computational methods for building data - derived models of static and dynamic macromolecular structures as well as molecular networks representing cellular processes . Modeling approaches must be relevant to and tuned for the data types we seek to generate, ideally emphasizing data on molecular interactions that favor quality over quantity and mechanism over scale . It is of course important to construct and advance each model in parallel with experimental biology . This close juxtaposition between modeling and experiment generates a cycle in which experiments set the initial parameters for a model that is then refined based on further experiments inspired by the model, optimizing the completeness, precision, accuracy, and efficiency of the determination of the structural or network models despite noise, sparseness, and ambiguity of the data, even when collected from heterogeneous samples . The earlier a model can be generated, the more effective are the experiments and thus the overall process . The hope is to generate structural and network models resulting in nontrivial insights and hypotheses that can be tested experimentally . Such models are predictive, actionable, and prioritize experiments that are most critical for advancing our understanding, yielding insights into how the macromolecular assemblies and networks operate, how they evolved, how they can be controlled, and how similar functionality can be designed . In particular, they hold promise for rational target - based intervention and drug design strategies . We envision that current and emerging technologies can be assembled into a benchtop pipeline that can reveal part or all of an interactome under study . One might think of this approach as a multiscale molecular microscope; the first goal prepares the samples for observation, the second enables detailed observation and analysis of the sample, and the last enables integration of the data into a dynamic and interpretable picture of the sample that enables an understanding of the function and dynamic properties of the system . The majority of successful research today is based around individual, small to medium - sized laboratories investigating a particular area of research . Although it is clear that high throughput interactome studies have suffered from data quality issues, the high level of expertise, focus, and thoroughness of cell biologists ensures that these issues will be minimized . The molecular microscope, therefore, is of a scale and scope that can enormously empower any individual cell biology group . Furthermore, given that any area of research is just a segment of an interactome, it is possible to cover an entire interactome via the overlapping research of many such groups . We must continue to evolve the most quantitative and robust approaches that seek to preserve complexes in their native states . These approaches, when combined with interpretation through structural and dynamic modeling, will begin to reveal the dynamic molecular architecture of cells and their components . We will uncover novel interactions that contribute to pathophysiological states in the areas of infectious disease and cancer . Advancing methods to reveal high quality, high confidence protein interactions will enable the construction of accurate and comprehensive complex networks that form the basis of physiological and pathophysiological states . These networks are the basis of systems medicine, through which scientists are taking a network view of disease to enable drug repurposing and drug discovery . Finally, discovering macromolecular structures and interfaces between macromolecules at increasing structural resolution will open new opportunities for discovering new classes of druggable targets that disrupt or potentiate complexes and information flow.
|
Indeed, while their short - term effects for acute exposure are well known [1, 2] and some fatal cases [25] have been reported, chronicle exposures to these xenobiotics are not studied yet, even if toxic effects (abortion and liver damage) are suspected in people involved in these jobs . In addition, scientific research is leading to the development of protocols in which the use of anesthetic mixtures reduces their concentration; on the other hand, these require more sensitivity and selective analytical methods for their determination . Inhalation anesthesia is indeed a widely used method for inducing complete anesthesia in surgeries . Several collateral or secondary effects due to acute exposure to inhalatory anesthetics are reported in the literature [1, 2, 6], while little information has been collected on chronicle exposure to small amounts of these drugs . Nowadays, the most representative class of anesthetics used is perfluorinated molecules such as desflurane and sevoflurane . These drugs are very often employed in synergy with nitrogen dioxide and sometimes with other anesthetics in order to reduce doses and anesthetic induction times . The surgical operators exposure to the drugs is today drastically reduced due to the use of efficient air recirculation and refreshing systems in the surgical theatres and the development of anesthesia protocols . Nevertheless, symptoms such as drowsiness, reduction of concentration, and lack of clarity are sometimes still reported from operators, requiring a more effective control on working areas in order to reduce risks directly or indirectly connected to the inhalatory anesthetics use . In order to establish if an effective amount of anesthetic is inhaled from operators, a very sensitive technique is required to determine the concentration of anesthetic in surgical theatres since a relatively small xenobiotics concentration is required to improve the working conditions . While first approaches to determine anesthetics were based on hexane extraction [7, 8], more recently, gas chromatography (gc) equipped with different kinds of detectors has been used to identify these drugs [914]. The most recent method relies on rapid determination of sevoflurane and hexafluoroisopropanol (free, unconjugated form) based on direct injection of human plasma into gc / ms apparatus without any sample clean - up procedures . Indeed, gc / ms technique is nowadays a very common analysis tool and its field of application can be extended to moderately polar to very polar molecules by appropriate derivatization / modification procedures [16, 17]. In our work, a very sensitive method based on solid phase microextraction gas chromatography mass spectrometry for determination of anesthetics in urine has been developed . The analysis results were also evaluated in the light of independent environmental anesthetics determinations obtained through a complementary technique based on the photo - acoustic detection principle . In particular, sevoflurane, its metabolite hexafluoroisopropyl alcohol, and desflurane were taken into consideration (figure 1), using halothane as internal standard and matrix matched calibration curves . This approach took into consideration the matrix effect, which also, in our case, proved to be relevant especially when spme was used . Due to its high sensitivity, rapidity, and the simultaneous determination of different anesthetics in urine samples, the present method represents a further development in comparison with the literature [1921]. Water (hplc grade), methanol (hplc grade), -glucuronidase from bovine liver (1,000,000 units / g solid), and sodium chloride were purchased from sigma - aldrich (supelco, bellafonte). Spme experiments were carried out using three kinds of coated fibers: 100 m pdms, 65 m pdms / car, and 50/30 m dvb / car / pdms . Sevoflurane (99,9%) and desflurane (99,8%) were purchased from baxter (deerfield, il); halothane (99,5%) and hexafluoroisopropyl alcohol (99%) were purchased from sigma - aldrich (supelco, bellafonte). Standard solutions preparation was made according to this procedure: 20 l aliquots of sevoflurane, desflurane, and hexafluoroisopropanol (hfip) were weighed and dissolved in methanol in 100 ml flasks . Due to their high volatility, for all analytes (sevoflurane, boiling point: 331.75 k at 101.3 kpa and density 1.5 10 kg / m at 293 k; desflurane, boiling point: 296.65 k at 101.3 kpa and density 1.5 10 kg / m at 293 k; hfip, boiling point: 332 k at 101.3 kpa and density 1.6 10 kg / m at 293 k), pure standards volumes were picked through cold (255 k) tips and were rapidly weighed into volumetric flasks containing 10 ml of cold methanol . These solutions were then diluted with a further amount of cold methanol (255 k) up to the mark (100 ml) at ambient temperature (298 k). The solutions obtained had a final concentration of 302 g ml for desflurane and sevoflurane and 320 g ml for hfip . These stock solutions, stored in refrigerator at 277 k 2 k, were checked weekly and were found to be stable in these conditions up to three months . An aqueous mother solution containing all the analytes at a concentration of 250 g l has been prepared using these standard solutions and it has been found stable for no more than a month . Further diluted solutions, used to make the matrix matched calibration curves, were prepared weekly by simple dilution of the mother solution in hplc grade water . Internal standard solution was prepared picking 20 l of halothane standard (density 1,86 10 kg / m at 293 k) through cold (255 k) tips and rapidly weighing into volumetric flasks containing a small amount of cold methanol (about 10 ml at 293 k). The obtained solution was then further diluted up to the mark (100 ml) with methanol at ambient temperature (298 k). The solution obtained has a final concentration of 380 g ml and was stored in refrigerator at 277 k 2 k. this solution was checked weekly and it was found to be stable in these conditions up to three months . Analyses were carried out using focus gc thermo equipped with a capillary column supel q - plot (30 m 0.32 mm i.d . 15 m average thickness), coupled with a dsq ii mass spectrometer, working in selected ions monitoring (sim) mode . The analysis method was optimized in order to reach the maximum efficacy in terms of rapidity, selectivity, and sensitivity . The best trade - off obtained leads to a total analysis time of 13 minutes (see figure 2). Operating conditions were the following: injector temperature, 473 k; splitless (gas flow 1 ml min, splitless flow for 1 min with a gas flow 10 ml min); constant flow 1 ml min; and carrier gas, helium . The thermal program starts at 309 k and holds for 3 min and then the temperature increases at 40 k min up to 403 k and holds for 7 minutes at this temperature . According to the literature and the experimental data obtained from pure standards full scan ms spectra, the most representative mass peaks have been chosen (see table 1). These ions were used in sim mode in order to increase sensitivity, with respect to full scan ms . The rationale fragmentation processes that could explain these peaks are briefly reported in figure 2 . The following procedure was applied for the real samples preparation: 18 ml sealed vials were prepared with 1 ml of enzyme solution (-glucuronidase 999 ui / ml), 10 l of acetic acid, 40 l of internal standard solution, and 2.0 10 kg of nacl . 3950 l of surgery's operator urine was added by means of gastight syringe into the previously prepared vials . In order to avoid loss in is concentration, the urine volumes were placed into the vials, without unscrewing the cap and piercing the septum with the syringe's needle . After having placed the vials at 310 k for 16 h to obtain the enzymatic hydrolysis of the glucuronate - hfip, the samples were analyzed . Matrix matched calibration samples were prepared weekly according to the following procedure: 1 ml of enzyme solution (-glucuronidase 999 ui / ml), 10 l of acetic acid in order to generate the optimal conditions (ph 4 - 5) for the enzyme activation, 40 l of internal standard solution, 1 ml of standard solution containing the mix of anesthetics at increasing concentration, and an aliquot of urine (pooled 50% from female and 50% from male voluntary healthy subjects) up to final volume of 5 ml were added in a 18 ml vial, sealed with ptfe / silicon septum; finally, in order to get a salting - out effect, 2.0 10 kg of nacl was added . For the sake of strict repeatability, standards were subjected to 16 hours of incubation at 310 k (normally necessary for the enzymatic hydrolysis of the glucuronate - hfip) before analysis . The final optimal conditions were the following: fiber dvb / car / pdms; equilibration time (t1): 30 minutes (298 k 1 k); extraction time (t2): 10 minutes (298 k 1 k). The best fiber desorption conditions were the following: injector at 473 k, desorption time (t3) of 1 minute (splitless mode). Anesthetic concentrations in different selected operating rooms were measured by multi - gas monitor type 1302 (brel & kjr, denmark), whose design was based on the photo - acoustic detection principle . This instrument is capable of continuously recording the gaseous concentrations of fluorinated anesthetics within the surgery room . More than 25 real samples were collected from operators working in three different surgical rooms . Analyses were carried out in duplicate on pre- and post shift urine samples of both the operators coming in contact with the anesthetics during their shift (i.e., surgeons or anesthetists) and the ones that are not usually in contact with xenobiotics during shift (i.e., medical attendants). Solid phase microextraction is a sample preparation method, invented by pawliszyn in 1989, which does not require solvents . Since its first applications to environmental and food analysis, its use is becoming wider and frequent, due to its environmentally friendly features, effectiveness, and reduced costs . The principle of spme is based on a fused - silica fiber that is coated with an appropriate stationary phase . All analytes in the sample are directly extracted to the fibre coating, in a single step that involve both extraction and concentration from the headspace of the vial . Because of the high volatility of the compounds, optimizing the efficiency and sensitivity of the analysis method is necessary to identify the most suitable spme sampling conditions . Therefore, three different spme fibers (pdms; pdms / car; dvb / car / pdms) have been tested . The analyte peak areas, obtained from analyses of standard solutions at the same concentration of anesthetics, were compared and the higher efficiency of extraction of all the analytes was reached using the dvb / car / pdms fiber (according also to poli et al ., 1999). The second step was the determination of the optimal saturation time, needed for the analytes to reach equilibrium between the matrix, the headspace, and the fiber . The headspace sampling was performed at the same temperature (298 k 1 k) for all the analytes and optimal saturation time was determined; the analyte peak areas after 15, 30, and 60 minutes of equilibration were compared, showing that 30 minutes were enough to reach equilibrium in headspace . Finally, in order to improve the extraction efficiency, various extraction times were evaluated . The comparison between the responses obtained from extraction times of 5, 10, 20, and 30 minutes, at the same temperature (298 k 1 k), indicates that after 10 minutes the extraction efficiency reached a plateau . No further raise in analyte peak areas resulted from increase of the fiber exposition time in hs . A preliminary calibration curve was made in water in order to achieve the order of magnitude of both limit of detection (lod) and limit of quantification (loq) and to verify the linearity range of the whole method without any interference due to matrix . These provided a very strong linear correlation (r> 0.99) in a range from 0.32 g l to 40 g l. gc / ms chromatogram of 5 g l fortified (a) and blank (b) urine are reported in figure 5 to show analytes separation and method sensitivity in matrix . The effect of the matrix has been evaluated in order to verify its eventual impact on linearity, sensitivity, and slope of the calibration curves using matrix matched calibration curves to determine effects of the matrix at different levels of concentration . In addition, in our experience, the intrinsic low reproducibility of precise experimental conditions (i.e., intrinsic sample differences, fiber wearing, etc .) Often requires an internal standard to effectively reduce errors . When a matrix effect is observed, as in this case, both a matrix matched calibration curve and an internal standard should be used in order to reduce errors and improve the accuracy of the measures . As shown in figure 6, a marked matrix effect is observed when determining the same anesthetic concentration in water and urine . Indeed, very different (sample / internal standard) area ratios are observed looking at calibration curves obtained in distilled water (inserts) and calibration curves made using pooled urine as matrix . This matrix effect markedly lowers the calibration curve slopes (and consequently the sensitivity) with respect to calibration curves obtained in pure water . This defeats any attempt to use an external calibration and requires a matrix effect correction . However, matrix matched calibration curves repeated using different urine pools at distance of one to several weeks demonstrate good reproducibility, with similar slopes and intercepts . This demonstrates that matrix effect is not peculiar for each sample and does not require more complicated and time consuming multiple standard addition procedures in order to get reliable measures . The linearity of the method using matrix matched standards remains fair, even if it has been ascertained in a range of concentration that is smaller (from 0.30 g l to 22.5 g l for sevoflurane and desflurane and in the range 0.32 g l to 24 g l for hfip) than the corresponding linearity obtained in water solution (from 0.06 g l to 37.5 g l for sevoflurane and desflurane and in the range 0.6 g l to 40 g l for hfip; see figure 6) standards . The three curves obtained were weighed on 1/x in order to enhance the curve fitting at a lower concentration and show a very good coefficient of correlation r (see table 2). Also lod and loq have been calculated according to this procedure: average and standard deviation values of at least 20 blanks have been reckoned and lod and loq values are defined as blanks signal average plus 3 and 10 times the standard deviation of the blanks, respectively . The following performances studies were, moreover, carried out: within - laboratory repeatability (wlr) and within - laboratory reproducibility (wlr) expressed as% rsd on sample at 5.0 g l (see table 2). The extended performances reached through this method were useful to evaluate the anesthetic exposure effects on a small number of operators working in surgical theaters . In the selected theaters, a parallel evaluation of the environmental instantaneous levels of anesthetic was also conducted in order to evaluate eventual relationships between the environmental pollution and the anesthetics biological levels . The observed correlation was indeed scarce and no correlation was found between the exposition time and the anesthetics biological levels . Actually, it emerged that, during the surgical operations, the staff exposition time to anesthetics is largely variable and not linked to the working hours . Another exposition factor such as the distance between the vaporizer and each individual is variable as well . The samples collected from operators working in three different surgical theaters were used to determine desflurane levels, while those collected from the other two surgical theaters were employed to determine the sevoflurane levels and its metabolite hfip in urine . It is worth noting that, in all cases, the anesthetics levels determined after shift were higher than the corresponding levels in pre - shift samples . In particular, high levels of desflurane anesthetic were determined in people working in emergency b surgical theaters . From anamnesis, it was ascertained that several people mostly working in this theatre reported symptoms such as headache, drowsiness, asthenia, and concentration diseases, while the same diseases were rarely found in people working in the other theaters . Urine levels can be taken as a clue of the air condition system efficiency being mean levels of anesthetics well grouped for each surgical theatre; see figure 7 . It is also interesting to note that levels before and after shift were in the g l order, mostly corresponding to the lods of the previously reported methods [19, 20]. This implies that, in most cases, up to now, only few positive cases could be detected, of subject being exposed to anesthetics . From our determinations, instead, it seems that, even if in different extents, exposition to anesthetics involves all the personnel working in the theatres . Indeed, post - shift urine mean levels were always significantly higher than pre - shift ones . The developed analytical method proved to be very quick, sensitive, and robust (precision, calculated as rsd, was always below 13% for all intra- and interday determinations). It represents a further development in comparison with the literature being the first method for the quantification of desflurane in biological fluids . Indeed, this method exhibits lod and loq values at least 2 magnitude orders lower than those previously reported [1921] for similar volatile anaesthetics . This is probably due to the synergism of a well - optimized spme procedure and gc / sim - ms analysis . The preliminary data obtained by this pilot study on surgical theatres stressed the effectiveness of this method as a useful tool to monitor the exposition to anaesthetics in occupationally exposed people . Indeed, with this method, it has been possible to ascertain significant difference between the anesthetics levels in urine before and after the work shifts in 25 individuals . Further, significant differences in post - shift urine levels have been found in personnel working in different surgical theaters . This means that different working conditions and probably differences in efficiency of the environmental treatment effectively reflect on personnel exposition to these xenobiotics.
|
The risk factors for the development of prostate cancer include men of african ancestry with high incidence rate reported in some sub - saharan countries including ghana, 7% in men between 50 yrs and 74 yrs and nigeria with incidence rate of 127 per 100,000 population . In ghana, prostate cancer has been found to be the second commonest cause of cancer death in men . With the wide - spread use of serum prostate specific antigen (psa) screening for prostate cancer in urban areas, though radical prostatectomy could be cost effective, it has been noted that access of patients with localized prostate cancer to radical prostatectomy in the management of prostate cancer in sub - saharan africa is low mainly due to lack of expertise in the procedure of open radical prostatectomy . In ghana, the role of radical prostatectomy has been limited even though majority of the patients present with lower urinary tract obstructive symptoms or acute retention of urine . A program to train urologists in senegal in transperineal prostatectomy was commenced . However, its impact on the rest of sub - saharan africa including ghana has been limited . Other ways of training urologists in the west african subregion in the procedure of radical prostatectomy have become apparent . The societe internationale d'urologie (siu) fellowship is an alternate means of getting urologist in the subregion to get the needed training in other centers on the continent where radical prostatectomy for prostate cancer is routinely performed . This report looks at the early oncological and functional outcomes and morbidity of a single surgeon in the procedure of radical retropubic prostatectomy at the korle bu teaching hospital accra after a six month siu sponsored fellowship at university of stellenbosch, tygerberg hospital, south africa . Objective . To ascertain the patient characteristics, tumour characteristics, and the early outcomes of the initial twenty consecutive patients of an siu scholar after training in the procedure of anatomic radical retropubic prostatectomy for localized prostate cancer . A prospective study of consecutive patients with clinically localized prostate cancer (ct1-ct2) that underwent open anatomic radical retropubic prostatectomy from january 2010 to july 2012 at the korle bu teaching hospital, accra . Patients who had a systematic transrectal ultrasound guided biopsy (12 core biopsies) which confirmed prostate cancer were staged clinically . The staging investigations included radioactive bone scan to rule out bony metastasis and a pelvic ct scan to rule out extracapsular extension of the prostate cancer . Patients diagnosed with localized prostate cancer and consented to undergo open radical retropubic prostatectomy were included in the study . The preparation for the procedure involved admitting the patients two days before the procedure, light diet on preoperative day 2, and fluid only diet on preoperative day 1 . They had phosphate enema at 6 pm on preoperative day 1 and a rectal wash out on the morning of the operation . Two units of homologous blood were cross - matched and made available in the operative theatre . The patients underwent an open anatomic radical retropubic prostatectomy with obturator lymphadenectomy using a lower midline extra peritoneal incision under general anaesthesia and an epidural placed for postoperative analgesia . Antibiotic usage comprised 500 mg levofloxacin at induction and continued for 72 hours after the procedure . The prophylaxis against deep vein thrombosis involved the use of ted stockings and subcutaneous clexane 40 mg daily for 5 days . The parameters recorded included the patient age, clinical presentation, preoperative total prostate specific antigen (tpsa), the clinical stage, and gleason score . Also recorded were the operative time, the estimated blood loss, the prostate size, and any blood transfusions administered . Patients were discharged on postoperative day 8, and the urethral catheters removed between postoperative day 14 and 21 . The followup involved three monthly clinical examinations and serial psa determinations with tpsa greater than 0.4 ng / ml being viewed as biochemical progression . The data was analyzed using the statistical package for the social sciences (spss) for windows (version 19.0). The initial twenty consecutive cases of open radical retropubic prostatectomy performed were considered for this report . The mean age of the patients was 62.7 yrs 5.6 (range 51 yrs72 yrs). The commonest presentation was lower urinary tract obstructive symptoms (40%) (table 1). The mean preoperative tpsa was 16.12 ng / ml 13.68 ng / ml (range 2.4562.20 ng / ml) with 1 (5%) with tpsa less than 4.0 ng / ml, 7 (35%) tpsa 4.110.0 ng / ml, 8 (40%) with tpsa 10.120.0 ng / ml, and 4 (20%) with tpsa> 20.1 ng / ml . The mean gleason score was 6.5 0.8 (range 59). For the clinical stage, the mean prostate weight was 42.9 g 18.1 g (range 20 g100 g). Seven (35%) with prostate weight of 30 g or less, 12 (60%) prostate weight 30.1 g60 g, and 1 (5%) with prostate weight more than 60 g. the mean duration of surgery was 215.3 mins 18.7 mins (165 mins240 mins) with a mean estimated blood loss of 1140.0 mls 534.5 mls (range 500 mls2500 mls), a median of 1000.0 mls (table 2). The mean perioperative transfusion was 1.7 units 1.3 units (range 0.04.0 units) with a transfusion rate of 70% (14/20). No blood transfusion in 6 (30%), one unit of blood transfused in 2 (10%), two units in 7 (35%), three units in 3 (15%), and four units in 2 (10%). The wound drain was removed at a mean of 3.4 days 1.9 days (range 19 days) with the wound drain removed on postoperative day one in 1 (5%), postoperative day 2 in 2 (10%), and postoperative day 3 in 11 (55%). In 6 (30%) of the patients, the wound drain was removed after three days on the account of persistent drainage . The pathologic stage, but for two (10%) were higher than the clinical stage . Twelve (60%) of the patients were pt2, 5 (25%) pt3 and 1 (5%) pt4 . The mean pathological gleason score was 6.8 0.9 (range 69) (table 3). Five (25%) of the patients had the seminal vesicles infiltrated by the malignant tumour . For the three patients with positive margins, two of the patients had a course of external beam radiotherapy while one opted for 6 months of hormonal therapy using diethyl stilboestrol with soluble aspirin . No lymph node involvement was reported . However, in 5 (25%), lymph nodes were not retrieved from the submitted specimen . In terms of perioperative complications, there was one (5%) rectal injury recognized intraoperatively with successful primary repair and two cases (10%) of wound infection . For the functional outcome, seventeen (85%) of the patients had bilateral nerve sparing while 3 (15%) had unilateral nerve sparing . Fourteen (70.0%) of the patients were potent before the radical prostatectomy (iief> 16). Eleven (78.6%) of these patients who were potent preoperatively have maintained their potency while 3 (21.4%) have become impotent with no response to sildenafil citrate or tadalafil . All the patients are continent of urine with most of them being continent by 8 weeks after the procedure . Four (20%) of the patients did not experience any urine incontinence episodes after removal of the urethral catheter . By the end of the first week after removal of their urethral catheter, 11 (55%) were continent of urine, 13 (65%) by the end of the fourth week, 15 (75%) by the end of the eighth week, and 18 (90%) by the end of the twelfth week . Four (20%) of the patients developed anastomotic stricture that was managed successfully with dilatation / internal urethrotomy; one of these required endoscopic bladder neck resection . Three of these patients that developed anastomotic stricture did not experience any incontinence episodes after removal of their urethral catheters . Eighteen (90%) expressed satisfaction with the operation and outcome while 1 (5%) was not satisfied with the outcome at the time of this report . He is voiding well currently, continent but with erectile dysfunction . At a mean followup of 19.5 months, the tpsa of 19 (95%) patients had remained less than 0.4 ng / ml including the patients that had adjuvant radiotherapy and hormonal therapy . One patient with preoperative tpsa of 13.6 ng / ml and pt2a gleason 4 + 5 at one year followup had the tpsa rise to 45 ng / ml with no evidence of local recurrence or distant metastasis . There was no treatment or disease - related death; however, one of the patients died after 18 months of followup (psa 0.1) due to complications of diabetes mellitus . Reports indicate differences in the biology of prostate cancer in men of african descent resulting in presentation at an early age, more advanced clinical stage, higher gleason scores on initial presentation, a poorer five - year survival, and higher recurrence rate . There is also an observed shorter followup period for black africans diagnosed with prostate cancer . Therefore, access to radical prostatectomy for localized prostate cancer should be of interest including outcomes in those in the west african subregion which offered this potentially curative intervention . With increasing use of psa screening in some urban communities in west africa to detect early prostate cancer, strategies to increase the number of surgeons with expertise in this surgery this series explores the option of siu fellowship as a viable option in helping to acquire the skill of radical retropubic prostatectomy with a focus on the early outcomes . The mean age of the patients in this series of 62.7 yrs which is comparable to the 61 years reported from jamaica west indies with 91% of the population being of african ethnicity reflects the choice of the procedure in relatively young and fit patients as contrasts with the general population of black africans diagnosed with prostate cancer with a mean age of 68.9 yrs in a report from south africa . As observed in other studies [810], most of the patients with prostate cancer in this series presented symptomatically (75%); 40% presenting with lower urinary symptoms, and another 30% with acute retention of urine . Only 25% had their cancers detected through screening due to the absence of effective screening for prostate cancer among the majority of the ghanaian male population . The mean preoperative psa of 16.12 ng / ml was relatively high compared to 10.1 ng / ml reported from the west indies . But the commonest clinical stage of t1c (60%) noted in this series compares to the report from the west indies (68%). The mean operating time of 215.3 mins and estimated blood loss of 1140 mls compares to reports of established centers, with a mean operative time of 217 and estimated blood loss of 1395 mls in one study . However, comparing this finding to a contemporary series with mean estimated blood loss of 603 (range 1003500), the estimated blood loss was higher in this initial series . The transfusion rate of 70% in this series was rather high compared to a transfusion rate of 4.8% reported by chang et al . . This could be attributed to the surgical technique as these happen to be the early series in a learning curve as well as limited experience of the anaesthetic team in the procedure of radical retropubic prostatectomy . A defined transfusion trigger can help reduce this rate of transfusion as was observed in a reported retrospective study with transfusion rate being 88.9% in 1988 and dropping to 9.1% in 2002 . Radical prostatectomy offers a better assessment of the true pathological stage tending to be higher than the clinical stage as observed in this series . No malignant lesion was seen in two pathologic specimens though the specimens were subjected to multiple reviews . This calls into question the accuracy of the reports of the initial trus prostate core biopsies . The positive surgical margin of 15% compares to 15.5% reported by morrison et al . And 11.2 by eastham et al . However, seminal vesicle invasion was relatively high by 25% compared to 3.5% in the west indies study . A postoperative complication rate of 15% observed was high compared to 10% in the large series by catalona et al . . This may reflect the rather limited experience with the procedure as well as the limited number of cases considered in this early series as it had been observed that the incidence of postoperative complications declined significantly with increasing experience of the surgeon . The outcome of the procedure of radical prostatectomy has been judged by the functional results . The erectile function recovery rate in preoperatively potent men was 78.6% compared to 68% of men treated with bilateral nerve sparing surgery in the series by catalona et al . . Though this was also observed in other studies, 20% incidence was high compared to the 7% reported by morrison . At a mean followup of 19.5 months, the oncological outcomes assessed by biochemical progression with biochemical recurrence defined as any postoperatively tpsa> 0.4 ng / ml were satisfactory with 95% of the patients having tpsa of less than 0.4 ng / ml and no evidence of local recurrence or metastasis . Considering the patients' initial anxiety over the possible functional results, a satisfaction rate of 90% after the procedure is very encouraging . Open radical retropubic prostatectomy can be safely practiced in west africa with outcomes comparable to other well - established centers . The siu scholarship offers another avenue for training in radical prostatectomy for sub - saharan africa.
|
The common peroneal nerve (cpn) injuries are the most common among lower limb nerve injuries because of its fixed attachment in the region of the neck of the fibula . The involvement of cpn following varus displacement of the knee is commonly expected to be traction neuropraxia . The spontaneous recovery is usually expected and the not so favorable results of repair have led to a debatable consensus on its surgical management . Closed transaction / laceration of nerve following sports injury is highly uncommon . A 27-year - old male sustained closed avulsion fracture of the fibular head with complete foot drop following a hyperadduction injury to the knee . Early operative exploration revealed peroneal nerve laceration which was repaired primarily along with anatomical reduction of the fibular head which yields good results following early repair . This case review emphasizes that severe damage to cpn may occur in spite of closed injuries to the knee . Patients presenting with fibular head avulsion fractures at the knee and cpn injury should be subjected to early intervention with repair or reconstruction of the avulsion injuries and exploration of cpn to achieve good clinical outcome . The common peroneal nerve (cpn) is susceptible to injury because of its fixed attachment in the region of the neck of the fibula . The associated ligamentous injuries to the knee often guide treatment in this scenario with expectant management of the cpn . Laceration of the cpn is reported commonly following sharp injuries or with high - energy knee dislocations along with multiligamentous injury [2, 3]. We report an exceedingly uncommon association of cpn laceration along with a closed fibular head avulsion fracture in a 27-year - old male, sustained while playing cricket . Early exploration with repair of the cpn and stable fixation of the fibular head lead to good outcome in this case . A 27-year - old male presented to emergency with pain and swelling on posterolateral aspect of the right knee following a varus thrust while playing cricket . Clinical examination confirmed the findings along with foot drop and dense hypoesthesia in cpn distribution . Radiological examination revealed a displaced avulsion fracture of fibular head (fig . 1 and 2). Magnetic resonance imaging of the right knee showed avulsion fracture of the fibular head with attached lateral collateral ligament and midsubstance tear in the posterolateral capsule of the knee along with edematous soft tissue engulfing the cpn suggestive of its compression . The patient was advised to undergo open reduction and internal fixation of bony avulsion from the fibular head to restore the posterolateral stability of the knee joint along with simultaneous exploration of the cpn . The right knee was examined under anesthesia, and there was grade ii opening on varus stress testing at 30 and 60 flexion . Pre - operative x - ray shows avulsion fracture of the fibular head without dislocation of the knee joint . Magnetic resonance imaging section shows avulsion of the fibular head with soft - tissue edema around fibular neck . The bony avulsed fragment from the fibular head with attached lateral collateral ligament and popliteofibular ligament was identified . The cpn was found to be lacerated approximately by 50% of the total diameter (fig . 4). The fibular head avulsion was anatomically reduced and fixed with a single 4 mm partially threaded screw (fig . Neurolysis of cpn was done microscopically, and repair of nerve fascicles was done without tension . Post - operative bracing of the knee with intermittent range of motion was started on the 3 day . After 1 year, post - operative knee is stable with grade 3/5 power (mrc grading) at the right ankle, and sensations recovered up to 50% over the right foot . The strengthening exercises for quadricep and hamstring group of muscles were also started in the immediate post - operative period . Intraoperative photograph shows lacerated common peroneal nerve with retracted avulsed fibular head along with ligaments . A fibular head avulsion fracture is a rare entity . In a retrospective study of 2318 knee injuries the importance of recognition of this injury lies in the fact that it is an important indicator of posterolateral instability of the knee . The lateral collateral ligament and tendon of the long head of the biceps femoris muscle are attached to the lateral margin of the fibular head . The avulsion of this bony fragment with its attached insertion of the posterolateral corner ligamentous structures is referred to as arcuate sign . Although rare, it is highly indicative of underlying posterolateral corner injury . In our case, the patients was subjected to operative intervention due to the presence of this injury [6, 7]. Hyperadduction injury at the knee may lead to extensive damage to the lateral ligamentous structures of the knee and cpn . Platt was the first to report the association of posterolateral corner injuries with peroneal nerve injury . Watson - jones had noted extensive injury to the cpn in cases with injury to the lateral ligamentous complex of the knee . Occasionally, cpn injury can occurs with multiligament knee injuries associated with knee dislocations with incidence of 16 - 40% in patients . We are reporting a case of cpn laceration in a closed posterolateral corner complex injury with avulsion of fibular head which is a rare entity . In literature, there are few case reports showing such type of injuries . In a study of six cases having similar injuries due to varus or adduction strain, only one had complete cpn transaction . In another study of 54 cases of posterolateral corner injuries, only 9 patients had cpn palsy of which 7 cases were associated with avulsion of the fibular head; however, there is no mentioning of the common peroneal nerve laceration . In a series of six cases, only two patients had complete rupture and rest of the four cases had nerve in continuity; however, there is no evidence of involvement of avulsion of the fibular head . In another case report, there is cpn traction injury along with ligamentous injuries in the patient while playing rugby in which end - to - end repair was done after removing the damaged part, but there was no mentioning of fibular head avulsion . In general, laceration of the cpn occurred either due to sharp injuries or with knee dislocations along with multiligamentous injury due to high - energy trauma which is well supported by number of studies . In our case, we did primary nerve repair along with fixation of avulsion fracture of fibular head to restore the stability of knee joint, and the patient had an uneventful recovery . We conclude that the cpn laceration in closed hyperadduction injury associated with fibular head avulsion fracture is a rare complex . Patients presenting with fibular head avulsion fractures at the knee and cpn injury should be subjected to early intervention with repair or reconstruction of the avulsion injuries and exploration of the cpn to achieve a good clinical outcome . The case report emphasizes on deviating from the usual expectant diagnosis and management of closed cpn injury.
|
The cross - sectional study was undertaken in the schools located within the registered rural and urban field practice areas of the department of community medicine, jnmc, aligarh, uttar pradesh, india . The total population of male adolescents (10 - 19 yrs) in all the schools was 2347, out of which a sample of 410 students (205 from the rural schools and 205 from the urban schools) were selected using probability proportionate to size sampling (pps). The sample size was calculated using the formula, sample size = (1.96) pq / l where prevalence (p) = 20%, q = (1p) precision (l) = 4% the study tools consisted of a self - developed, pre - tested, semi - structured questionnaire arranged in two parts . The first part of the questionnaire dealing with the child's sociodemographic background was accomplished by the interviewer, and the second part had a section of aspirations and desires of adolescents including their role models and their future choice of career . All participants were reassured about their anonymity by instructing them to avoid writing their names and class section on the questionnaires . Socioeconomic class was calculated using a modified form of prasad's classification of per capita income . Simple percentages [table 1] and chi - square test of statistical significance was used for analysis [tables 2 and 3]. Sociodemographic characteristics role models of in - school adolescents occupational aspirations of in - school adolescents most of the study population was in their early (10 - 13 yrs) and mid - teens (14 - 15 yrs), hindu, lower to middle socioeconomic status, and living in unitary families with more than 5 family members [table 1]. Adolescents responded to the question regarding the presence of a role model in their lives with a near total majority (95.9%). Overall, the majority (62.7%) of adolescents revealed that their role models were film star (34.8%) and their teachers (27.9%), parents (14.3%), sportsman (12.0%). Politicians as the role models were opted by least proportion (1.2%). In urban and rural schools, there were significant differences between the choices of the role models (chi - square = 24.1, df = 06, p <0.05) [table 2]. When asked about the desires for the future occupation or job, many adolescents ardently responded that they wish to become businessmen (27.9%), doctor (18.6), and engineer (14.4%). Others opted to be a teacher, farmer, police officer, or government servant . The difference between urban and rural adolescents in the occupational desires was statistically significant (chi - square = 18.9, df = 08, p <0.05). Most of the study population was in their early (10 - 13 yrs) and mid - teens (14 - 15 yrs), hindu, lower to middle socioeconomic status, and living in unitary families with more than 5 family members [table 1]. Adolescents responded to the question regarding the presence of a role model in their lives with a near total majority (95.9%). Overall, the majority (62.7%) of adolescents revealed that their role models were film star (34.8%) and their teachers (27.9%), parents (14.3%), sportsman (12.0%). Politicians as the role models were opted by least proportion (1.2%). In urban and rural schools, there were significant differences between the choices of the role models (chi - square = 24.1, df = 06, p <0.05) [table 2]. When asked about the desires for the future occupation or job, many adolescents ardently responded that they wish to become businessmen (27.9%), doctor (18.6), and engineer (14.4%). Others opted to be a teacher, farmer, police officer, or government servant . The difference between urban and rural adolescents in the occupational desires was statistically significant (chi - square = 18.9, df = 08, p <0.05). This study highlighted that majority of adolescents have a personality in their minds, whose attributes they follow in their life . Though the stage of adolescence is a dynamic period of life with respect to changing attitudes and perceptions, change in their role models might be seen in due course with increasing age and maturity . At any given phase of adolescence, their choice of role models may indicate the likings and behavior form of the adolescent . An adolescent may choose a particular role model due to a bouquet of reasons . In this study, the reason given by the majority was related to the image of being ideal with a virtue of righteousness along with the glamour attached to them . This reason may be an indication of choosing film stars as the role model as this virtue is usually shown in the heroes of indian films . A good teacher also leaves a good impact on the students; thus, a good proportion chose them as role models . A small proportion chose parents as role models; the reasons for this observation need a detailed study . According to a researcher, in their study of adolescents from rural area it was found that film heroes were the role model for 31.3% students, cricketers for 12.61%, and political leaders for 7.83% students and for the rest of the students, parents / teachers were the role models . The pattern of choice was similar as compared to the present study . In another study, fifty - six percent of adolescents identified a role model . Parent / relative (42%), non - familial known individual (19%), and figure or individual available primarily through the media (39%). Among non - familial known individuals were friends (56.9%), professionals such as doctors or lawyers (22.8%), teachers (15%), and clergy (1.2%). Among figure were actors (18.5%), historical figures (5.7%), political leaders (1.9%), comic book characters (1.2%), and a community leader (0.6%). The desire of future occupation during adolescent plays an important role in the academic journey of an individual . Often, it has been observed that putting a foot in wrong shoe is detrimental to the practical life of an individual . The mindset of the society regarding various professions puts an enormous pressure on the adolescents . Further, the ever - increasing competition for some professions also augments the bulk of non - achievers of the competition and leaves them with disappointment and depression . Professionally guiding adolescents according to their likes and dislikes regarding their career could bring down the proportion of otherwise non - achievers . In a study, in response to the question, if you had to start work tomorrow and assuming you had the proper education or training, what kind of work would you most likely choose?, the following seven themes emerged from the responses of grade seven students: (a) professional occupations (e.g. Lawyer, computers, doctor, nurse, architect, counselor); (b) glamour occupations (e.g. Athlete, actress, fashion designer, chasing tornadoes); (c) trade occupations (e.g. Mechanic, carpenter); (d) occupations with children (e.g. Daycare worker, teacher); (e) occupations with animals (e.g. Zoologist, wildlife biologist, veterinarian); (f) volunteer occupations, and (g) service industry occupations (e.g. Chef, bed and breakfast, hairdresser). The finding of present study is in accordance with the above - mentioned study as the students revealed various choices for the future profession . In another study, the students who wanted to become doctor were 23.48%, engineer 16.5%, and teacher 24.54%, 14% students wanted to join defense / police services and the rest wanted to join the business / salaried jobs . The reason may be that the majority of study population belonged to the rural area where agriculture and small scale business was more practiced . It is observed in this study that although the role model in good proportion of adolescent were film stars, only 2 students desired to be an actor . This observation highlights that the students had rational thinking when it comes to future occupational choices . The above - mentioned studies show that the career choices during adolescent are varied, and all they need is proper guidance to progress with their choice of profession and they might give best results according to the developed capacity in them rather than being depressed . There is greater impact of cinema on the minds of adolescents, which resulted in choosing film actors as their role model . The choice of future occupation was not related to the type of role models but may be influenced by society and family admiration for certain occupations . Proper guidance in this phase of life in needed to develop rational thinking in adolescents . The permission of this thesis survey was obtained by the institutional board of studies held on 20.08.2002 . Verbal consent of the principals of the schools selected for the study was received prior to starting the study . The parents of the students were informed about this study in the parent teacher meeting and their consent was obtained by the principal of the school.
|
Obesity in humans has been established as a risk factor for a multitude of maladies including cardiovascular disease (cvd), type 2 diabetes mellitus (t2 dm), hypertension, renal disease, and neurologic dysfunction . Furthermore, obesity has been causally linked to a variety of cancers either as a risk factor or as a negative factor for prognosis [13]. Recent studies have suggested that the link to these disorders or diseases is due to a chronic low - grade inflammation that is associated with obesity [47]. Debate exists whether the inflammation is a product of obesity or rather inflammation results in an obese state . Nevertheless, once excess adipose tissue is established, the functions of the tissue appear to be comparable with a dynamic endocrine organ [8, 9]. In the obese individual, macrophages, adipocytes, and epithelial cells communicate via obesity - associated hormones, inflammatory cytokines, and other mediators . For example, adipose tissue is known to produce and secrete various adipokines, such as leptin and adiponectin, and pro - inflammatory factors, tnf, il-6, il-1, and c - reactive protein (crp) [4, 5]. All of these factors not only are important in adipogenesis but have been strongly linked to the onset of cvd, t2 dm [13], and metabolic syndrome [6, 7]. In addition, recent reports have associated this chronic inflammation seen in obesity with cancer promotion and development [1012]. A longitudinal community - based cardiovascular risk factors prevalence study (crisps) in human subjects from hong kong shows that il-6, soluble tumor necrosis factor receptor 2 (stnfr2; as a surrogate marker of tumor necrosis factor- activity), leptin, lipocalin 2, adiponectin, and adipocyte - fatty acid binding protein (a - fabp) are predictors for cancer development [1012]. In the last decade, several studies have shown elevated il-6, tnf, and il-1 levels in obese patients [1317]; however, data regarding the relevance of these cytokines are controversial [18, 19]. This could be partially attributable to the complex etiology of obesity, which consists of an interaction between genetics, diet, and physical activity levels, and is additionally influenced by environmental, socioeconomic, and behavioral factors . Chimpanzees have the closest homology to humans and also share a multitude of similar diseases related to obesity including cvd, t2 dm, hypertension, and renal disease . Although understood in humans, it is unknown if obese chimpanzees share a chronic inflammatory state . The study of obese chimpanzees could both help in the management of this species and also lend clues to the human obesity epidemic . In the present study, we examined cytokine, chemokine, and metabolic hormones levels in plasma of three chimpanzee weight categories; lean, overweight, and obese . We measured plasma concentrations of the following cytokines and chemokines: interferon gamma (ifn-), interleukin-6 (il-6), interleukin-12p40 (il-12p40), tumor necrosis factor (tnf), soluble cd40l (scd40l), interleukin-1 (il-1), interleukin-4 (il-4), interleukin - ra (il - ra), interleukin-10 (il-10), interleukin-13 (il-13), eotaxin, fractalkine, monocyte chemoattractant protein-1(mcp-1) and chemokine (cxc motif) ligand8 (cxcl8 or formally known as il-8)), and metabolic hormones such as connecting peptide (c - peptide), glucagon - like - peptide-1 (glp-1), glucagon, insulin, peptide tyrosine or pancreatic peptide yy336 (pyy), and leptin . The purpose of this study is to investigate the relationship between obesity and these cytokine / chemokine / metabolic hormones in chimpanzees . The hypothesis is that chimpanzees will be similar to humans and will demonstrate an inflammatory profile with increasing adiposity . The study population was grouped according to the body condition scoring and defined as lean, overweight, and obese . Chimpanzees in lean group were defined as muscular body, normal body condition, some abdominal tuck, and neither concave nor convex abdomen . Overweight chimpanzees were defined as round convex abdomen, big thighs, and the presence of fat around gluteal muscles . Obese chimpanzees were defined as having a very large abdomen that extends outside of body frame, pectoral fat, the presence of fat around gluteal muscles, and fatty deposits in axillary regions and/or below biceps . All subjects were considered healthy and in their normal social groups at the time they were sampled . The study population consisting of chimpanzees used in the study is shown in table 1 . All chimpanzees are group housed (multimale, multifemale) at the michale e. keeling center for comparative medicine and research at the university of texas md anderson cancer center and maintained in accordance with the guide for the care and use of laboratory animals of the institute of laboratory animal resources, national research council . The facility is fully accredited by the association for the assessment and accreditation of laboratory animal care international . The primary source of nutrition is harlan teklad chimpanzee diet (#7775), a high fiber, 20% protein - containing diet that is fed twice a day . Environmental enrichment is provided daily using various food puzzle devices, forage such as popcorn or sunflower seeds scattered in the grass of outdoor enclosures, manipulable items such cardboard boxes and through treats given as rewards for positive reinforcement training . Blood sample (10 ml) was collected in heparin coated collection tubes and immediately plasma was separated by centrifugation and stored at 80c until further use . Peripheral blood mononuclear cells (pbmcs) were separated from heparinized blood by centrifugation through a histopaque (density, 1.077 g / ml; sigma, st louis, mo). Peripheral blood mononuclear cells were removed from the interface and washed twice with complete rpmi 1640 (hyclone, logan, ut) supplemented with 100 000 u / l penicillin (sigma), 100 mg / l streptomycin (sigma), 2 mmol / l l - glutamine (sigma), and 25 mmol / l hepes (sigma). Cells were resuspended in appropriate concentrations in complete rpmi for cultures in various immune assays . Plasma concentration of cytokines / chemokines, ifn-, il-6, il-12p40, tnf, scd40l, il-1, il-4, il-10, il-13, il - ra, mcp-1, fractakine, eotaxin, il-15, il-17a, tgf-, macrophage inflammatory proteins-1, (mip-1 or ccl3), macrophage inflammatory proteins-1 (mip-1 or ccl4), and rantes and metabolic hormone panel containing leptin, c - peptide, glp-1 (active) glucagon, insulin, pancreatic peptide, and pyy (total) were measured using the multiplex map magnetic bead - based immunoassay kits (millipore corp . Blood was collected from lean (n #28), overweight (n #10), and obese (n #10) chimpanzees . Following centrifugation, plasma was aliquoted immediately and frozen at 80c until assayed . On the day of assay, frozen plasma was thawed, mixed by vortexing, and then centrifuged at 10,000 rpm for 5 min to isolate debris prior to use in the assay . All assays were conducted according to the manufacturer's instructions using handheld magnetic separator block for 96-well flat bottom plates (millipore, millipore corp .) And analyzed using the luminex 200 system (bio - rad corp . ). All samples were run in duplicate and cytokine standards supplied by the manufacturer were run on each plate . Acquisition gates were set at 8,00015,000, sample volume was 25 l, and 50 events per bead were acquired . Mean fluorescence intensity was analyzed using the bioplex manager software version 5.0 (bio - rad) and compared to a standard curve to generate concentration values . Values below the range of the standard curve were set to the lower limit of detection . The assay sensitivities (minimum detectable concentrations, pg / ml) were for ifn- and tnf (0.1 pg / ml), il-6 and il-10 (0.3 pg / ml), for il-1 and il-13 (0.4 pg / ml), for il-12p40 (10.5 pg / ml), for scd40l (4.9 pg / ml), for il-4 (0.6 pg / ml), for il - ra (2.9 pg / ml), for eotaxin (1.2 pg / ml), for fractakine (6.0 pg / ml), for mcp-1 (0.9 pg / ml), for cxcl8 (0.2 pg / ml), for c - peptide (24 pg / ml), for glp-1 (7.0 pg / ml), for glucagon (6.0 pg / ml), for insulin (58 pg / ml), for leptin (27.0 pg / ml), and for pyy (8.0 mg / ml). The proliferation of pbmcs samples from the chimpanzees was determined by the standard [h] thymidine incorporation as described previously [20, 21]. Briefly, aliquots of the pbmcs (10/well) were seeded in triplicate wells of 96-well plates and stimulated for 6 days individually with the mitogens concanavalin - a (con a), phytohemagglutinin (pha), and pokeweed mitogen (pwm) (each at 5 g / ml final concentration) (sigma, st louis . The culture medium without added mitogens served as negative control . After culturing for 5 day at 37c in 5% co2, each well was pulsed for 18 h with 0.1 ci of methyl - h - thymidine (icn, irvine, ca). These mitogen concentrations, pbmcs numbers, and incubation times were found to be optimal conditions for stimulation of pbmcs from healthy animals in our laboratory . The contents of the wells were then harvested onto glass fiber discs using a skatron cell harvester (skatron laboratories, va, and usa). The amount of radioactivity was determined in a wallac liquid scintillation counter (wallac1409, mustionkatu, tarku, finland). The results were reported as corrected counts per minute (cpm), which is the average count per minute (cpm) of mitogen - stimulated cultures minus the average cpm of cultures without mitogen . Freshly - isolated pbmcs, as described above, were stimulated with the mitogens pha, con a, and pwm (each at 5 g / ml final concentration) to determine the numbers of ifn--producing cells by the enzyme linked immuno spot (elispot) assay using the methodology reported earlier [20, 22]. Briefly, aliquots of pbmcs (10/well) were seeded in triplicate wells of 96-well plates (polyvinylidene difluoride backed plates, maip s 45, millipore, bedford, ma) precoated with the primary ifn- antibody and the lymphocytes were stimulated with the different mitogens . After incubation for 30 hr at 37c, the cells were removed and the wells were thoroughly washed with pbs and developed as per protocol provided by the manufacturer . Purple colored spots representing individual cells secreting ifn- were counted by an independent agency (zellnet consulting, new jersey, nj) using the ks - elispot automatic system (carl zeiss inc ., thornwood, ny) for the quantitative analysis of the number of ifn- spot forming cells (sfc) for 10 input pbmcs . Responses were considered positive when the numbers of sfc with the test antigen were at least five and also were five above the background control values from cells cultured in the medium alone . Aliquots of 1 10 cells resuspended in culture medium rpmi-1640 (hyclone laboratories) were dispensed in each well of a 96-well plate . The culture medium used was free of detectable endotoxin (<0.1 eu / ml) and all other solutions were prepared using pyrogen - free water and sterile polypropylene plastic ware . The cells were then incubated with or without tlr ligand peptidoglycan (pgn, tlr-2 ligand), ultrapurified lipopolysaccharide (lps, tlr-4 ligand), polyinosinic - polycytidylic acid (poly ic, tlr-3 ligand), and cytosine - phosphate - guanine (cpg) dna (tlr-9 ligand) all from invivogen (invivogen corp ., san diego, ca, usa) at 1 g / ml each for 24 hr at 37c in a 5% co2 atmosphere . The cell - free supernatant was harvested and stored at 70c for subsequent assays of cytokines and chemokines with the human inflammation cytometric bead array (cba) kit as described above . Natural killer cells activity was assessed using the standard 4 h radioactive chromium (cr-)release assay as described previously . Peripheral blood mononuclear cells were isolated from heparinized blood and incubated with chromium 51 (cr-) labeled k562 target cells to yield 100: 1, 50: 1, 25: 1, and 12.5: 1 effector - to - target ratios . The microtiter plates were then incubated for 4 hr at 37c in a 5% carbon dioxide incubator . At the end of the incubation, 100 l of supernatant was collected from each well and the amount of cr released was determined using the -counter . To account for the maximum release the% of specific lysis was calculated using the mean counts per minute (cpm) by the following formula:% specific lysis = (experimental release spontaneous release)/(maximum release spontaneous release) 100 . For statistical analysis, samples were grouped according to body condition of the animals from which samples were obtained . Comparison between groups of chimpanzees was done by one - way analysis of variance with the kruskal - wallis test and gaussian approximation with dunn's multiple comparison tests . Data are presented as group means sd . Only differences with a probability less than 0.05 all statistical analyses were conducted using graphpad prism 6.00 (graphpad software, san diego, california, usa). In the present study, we compared the circulating plasma concentration of proinflammatory cytokines, anti - inflammatory cytokines, growth factors, and metabolic hormones in lean, overweight, and obese chimpanzees . Plasma ifn-, il-6, il-12p40, tnf, scd40l, and il-1 levels were found to be significantly higher (p <0.0005) in overweight and obese chimpanzees than in lean controls (figure 1(a)). Anti - inflammatory cytokines il-4, il-10, il-13, and il - ra were also significantly higher in overweight and obese chimpanzees (figure 1(b)). Plasma mcp-1 and fractakine levels were significantly higher in the lean group relative to the obese group while eotaxin levels were higher in the overweight group compared to the obese group; however, no difference was found between obese and lean group (figure 1(c)). Cytokine cxcl8 was significantly higher in the obese group compared to lean and overweight group (figure 1(c)). Moreover, no significant differences were observed in il-12, il-15, il-17a, tgf-, mip-1a, mip-1, and rantes plasma concentrations between the 3 groups of chimpanzees (data not shown). Obesity was also associated with increased levels of leptin, insulin, glucagon, glp-1, pyy, and c - peptide in overweight and obese chimpanzees (figure 2). We also studied the immune responses of lean, overweight, and obese chimpanzees to test the hypothesis that obesity is associated with an impaired immune function and deregulated inflammatory response . In vitro proliferative responses of pbmcs and the production of ifn- we observed cona, pha, and pwm, 3 different mitogens inducing proliferative response of lymphocytes significantly lower in the overweight and obese groups compared to the lean group (figure 3). In ifn- producing t cells in ifn- elispot assay, pha, con a, and pwm stimulated pbmcs from the obese and overweight groups produced significantly higher levels of ifn- (p <0.005) than those from the lean group (figure 4). We also studied natural killer (nk) cells activity in lean, overweight, and obese chimpanzees using standard cr release assay . We observed significantly lower nk activity (47% compared to 51%) in obese chimpanzees compared to lean chimpanzees (figure 5). Tlrs play a crucial role in host defense against invading pathogens by mediating innate and adaptive immunities . Recent studies suggest that adipocytes may play an important role in the physiological regulation of immune responses in fat deposits via toll - like receptor (tlr) signaling cascades . Therefor we decided to study effect of various tlr ligands on pbmcs isolated from different groups of chimpanzees . Pbmcs isolated from lean and obese chimpanzee blood were stimulated with tlr ligands for 20 hr and supernatants were measured for cytokines . Obese chimpanzees showed increased capability to produce il-6 and cxcl8 after tlr-2, tlr-3, tlr-5, and tlr-9 stimulation (figure 6). In contrast, when pbmcs were stimulated with tlr-4, the obese chimpanzees had decreased il-6 and cxcl8 production compared to lean chimpanzees . However, no statistical difference was found between lean and obese chimpanzees for production of inflammatory cytokines by pbmcs stimulated with lipopolysaccharide (tlrs). Epidemiologic evidence suggests an important link between obesity and inflammation, although these findings were not appreciated in terms of the pathophysiologic conditions associated with obesity . For example, the levels of circulating fibrinogen and other acute phase reactants, including tnf, il-6, and c - reactive protein (crp) were found to be elevated in obesity [24, 25]. In the present study we investigated the relationship between cytokines and obesity by measuring plasma concentrations of different cytokines and metabolic hormones in lean, overweight, and obese chimpanzees . Furthermore, we also examined the influence of obesity on immune function . The important finding from the present study is that obesity is associated with simultaneous induction of several cytokines and metabolic hormones in plasma of overweight and obese chimpanzees compared to lean counterparts . We demonstrated that obesity is associated with increased levels of c - peptide, leptin, insulin, glp-1, pyy, and glucagon . Our findings are in agreement with the studies demonstrating positive relationships between levels of adipose tissue and circulating plasma c - peptide, insulin, leptin, il-6, and c - reactive protein levels and release of adipokines by adipose tissue matrix of obese humans [2628]. The plasma c - peptide has proved to be extremely valuable in the study of the natural history of type 1 diabetes to monitor insulin secretion in patients with insulin antibodies and as an adjunct in the investigation of patients with hypoglycemic disorders . Have shown in a human study that serum leptin concentrations rise in proportion to the body adiposity and therefore, obese individuals with metabolic syndrome generally have higher circulating leptin concentrations . In animal models, increased expressions of leptin are associated with release of proinflammatory cytokines such as tnf and il-6 in monocytes and macrophages . Leptin also has a significant effect on adaptive immunity, such as inducing a switch toward th1-cell mediated immune responses by increasing ifn-, tnf secretion, and the suppression of th2-cell responses in adipose tissue [30, 31]. Glucagon - like peptide 1 (glp-1), an insulinotropic hormone, also increased with obesity in our study . Glp-1 has been shown to inhibit food intake and induce weight loss in humans independent of type 2 diabetes status . The anorectic effect of glp-1 could be attributable to both its effect on gastric emptying and a direct effect on neurons in the central nervous system involved in appetite regulation . Overweight and obese chimps also had elevated levels of ifn-, tnf, il-6, cxcl8, il-12p40, scd40l, il-1, il-4, il - ra, il-10, il-13, and mcp-1 compared to the lean counterparts . These findings are consistent with the recent reports in a human study by jung et al ., demonstrating the effect of weight loss on serum cytokines in human obesity . Other studies have also revealed that proinflammatory cytokines il-6 and tnf were among the first to be implicated as a predictor or pathogenic mediator of insulin resistance, cvd, and in patients with type 2 diabetes [36, 37]. . Found that plasma levels of cxcl8 were higher in obese subjects compared with lean subjects . This finding could be related to the fact that obesity is known to be associated with a chronic state of low - grade inflammation . Our study showed il-, il-6, and il-10 were higher in obese chimpanzees . Il-1 together with il-6 concentrations reportedly predicts risk for type 2 diabetes in humans better than either cytokine alone . Il-10 is an anti - inflammatory cytokine produced by immune cells in adipose tissue that acts on adipocytes to improve insulin signaling, potentially decreasing further macrophage recruitment [41, 42]. In 2003, esposito et al . Showed that circulating levels of il-10 were elevated in obese women and speculated that the higher il-10 levels represented the body's attempt to inhibit continued proinflammatory cytokine production . In our study, we also found significantly increased levels of il-10 in overweight and obese chimpanzees . Esposito et al . Also reported that changes in life style aimed at reducing body weight and increasing physical activity over 1 year significantly reduced high il-10 levels in obese women, while manigrasso et al . Reported no significant change in il-10 levels after an observed reduction in body weight in another obesity study . In the present study owed experimental evidence from high - fat - diet - fed mice suggesting that il-12 could have an additional role in the systemic low - grade inflammation and the ensuing development of obesity - related insulin resistance . Schernthaner et al . Demonstrated circulating scd40l levels in obese patients were closely related to insulin levels, triglycerides, and to the inflammatory biomarkers (mcp-1). Two independent studies convincingly showed that the adipocyte - specific overexpression of mcp-1 in mice was sufficient to increase macrophage recruitment to adipose tissue and cause systemic insulin resistance, hepatic steatosis, and insulin resistance in liver and muscle . Data from this study indicate obesity is related to lower t- and b - cell proliferation function and activity of natural killer cells and higher ifn- secretion in obese compared to lean chimpanzees . Obesity has been linked to impaired t- and b - cell function, suggesting that metabolic alterations can be induced by or are a consequence of an altered self - immune tolerance and/or modulation of immune responses as reported in obese men and women who were compared with nonobese control subjects . Obese children and adolescents have been reported to have impaired cutaneous delayed - type hypersensitivity responses, mitogen - stimulated lymphocyte proliferation, and bactericidal capacity [49, 50]. Few reports exist, comparing activity of natural killer cells in obese and nonobese human beings . Moriguchi et al . Showed that obesity is related to reduced activity of natural killer cells in older men and women . Similar results were reported in obese zucker rats; activity of natural killer cells has been reported to be suppressed, an effect found to be reversible through exercise training via improved lymphocyte glucose uptake and enhanced glut-1 expression . We have observed decreased cytokines (il-6 and cxcl8) in obese chimpanzees when pbmcs were stimulated with specific ligands for tlr3, tlr4, and tlr9 but differences were not significant compared to lean chimpanzees . Recently, kopp et al . Demonstrated that il-6 release is stimulated in murine adipocytes by specific ligands for tlr1/2, tlr2/tlr6, tlr3, and tlr4, whereas monocyte chemoattractant protein-1 (mcp-1) release is increased upon stimulation with specific ligands for tlr1/2, tlr3, and tlr4 . An advantage of the chimpanzee model for obesity and inflammatory studies, besides a genomic similarity greater than 98% in comparison to humans, is that we can control obesity - related exogenous factors, such as nutrition and lifestyle, thus studying the molecular events leading to metabolic syndrome, inflammatory, and/or autoimmune conditions . One of these limitations is that we are reporting systemic circulating cytokines / chemokines and metabolic hormones concentrations . For example, leptin function may be modulated by local leptin concentration, the ratio between free and bound leptin, the expression of different forms of the receptors, the ratio between signaling and nonsignaling receptors, and/or the presence of specific inhibitors . A second limitation is that we have a limited number of overweight and obese animals in our chimpanzee colony from which to acquire samples . The most important finding of the present study is that plasma cytokines / chemokines and metabolic hormones concentrations are significantly increased in obese chimpanzees relative to normal - weight healthy chimpanzees . Also, in the present study, we observed an influence of obesity on immune function . In fact, the current study provides evidence that a proinflammatory state could be regarded as a significant prognostic indicator of the risk of obesity, cvd, and metabolic syndrome . Although obesity is a complex, multifactorial trait that cannot be explained by one factor, the findings of the present study represent important directions for the future planning of programs designed to prevent obesity - related diseases and in the identification of novel antiobesity targets.
|
Four separate searches were completed on ovid medline in - process and other non - indexed citations and ovid medline 1994 to present . The searches targeted literature on: (i) oesophageal cancer, chemoradiotherapy (crt) and functional imaging; (ii) pancreatic cancer, crt and functional imaging; (iii) oesophageal cancer, functional imaging and target volume definition; (iv) pancreatic cancer, functional imaging and target volume definition . Trials of neoadjuvant chemotherapy alone or mixed cohorts of chemotherapy and crt were excluded if separate analyses of these treatment modalities were not described . Studies were grouped into those that carried out functional imaging before crt, before and during crt, pre- and post - crt and post - crt only . The utility of functional imaging to predict chemoradiotherapy (crt) treatment response and prognosis or to define target volumes for radiotherapy for upper gastrointestinal tumours remains uncertain . Correlating functional imaging - derived parameters with treatment response and long - term treatment outcome may offer a means of risk - stratifying patients and ultimately guide treatment decisions . Physiological processes that can be assessed with imaging techniques include glucose metabolism, cell proliferation, hypoxia, perfusion and water diffusion . F - fluorodeoxyglucose (fdg) positron emission tomography (pet), which reflects glucose uptake and retention, is by far the most commonly used functional imaging test . Both neoadjuvant definitive crt has a 2 year local failure rate of around 50% [13] and most local failures occur within the gross tumour volume (gtv). A pathological complete response (pcr) is seen in 30% of cases after crt [57]. If rates of pcr could be improved by image - guided treatment intensification, crt followed by selective salvage oesophagectomy may become the preferred treatment . The early identification of non - responders would also define a group of patients who should proceed to early surgery . Locally advanced pancreatic cancer (lapc) has a poor prognosis, with a median survival ranging from 5 to 19 months . The lap07 trial has recently reported that crt after induction chemotherapy confers no survival advantage compared with continuing with chemotherapy alone (overall survival 15.2 and 16.4 months, respectively). The failure of crt to improve treatment outcome is, perhaps, a little surprising, given that for 2529% of patients with lapc, the first site of disease progression is at the site of the original tumour . Escalating the radiotherapy dose to the pancreas seems attractive, but is limited by normal tissue toxicity, particularly in the duodenum . If a method of identifying patients who have a high risk of local failure could be identified, a dose - escalation regimen that allows a higher rate of treatment - associated toxicity may be seen as worthwhile . After neoadjuvant crt, those with <10% of viable tumour cells have a median overall survival of 39 months compared with only 15 months in those who have> 10% of viable tumour cells remaining . Accurate gtv definition is essential in radiotherapy planning to reduce geographical misses and limit the involvement of normal tissues in the treatment volume . Incorporating functional imaging into gtv delineation is attractive for a number of reasons not least to reduce intra- and interobserver variability . It may allow an automation of the target delineation process and identify areas that may benefit from radiotherapy dose boosting . Computed tomography has its limitations most notably in defining mediastinal lymph node involvement in oesophageal cancer, which is improved with fdg - pet . The utility of functional imaging tests in providing predictive and prognostic information after crt for both oesophageal cancer and pancreatic cancer will be reviewed . A separate review of the benefit of incorporating functional imaging into radiotherapy treatment planning will be included . The limitations of the evidence will be discussed and recommendations as to how the integration of functional imaging into the risk stratification of patients with locally advanced oesophageal and pancreatic cancers will be made . Four separate searches were completed on ovid medline in - process and other non - indexed citations and ovid medline 1994 to present . The searches targeted literature on: (i) oesophageal cancer, crt and functional imaging; (ii) pancreatic cancer, crt and functional imaging; (iii) oesophageal cancer, functional imaging and target volume definition; (iv) pancreatic cancer, functional imaging and target volume definition . Trials of neoadjuvant chemotherapy alone or mixed cohorts of chemotherapy and crt were excluded if separate analyses of these treatment modalities were not described . Studies were grouped into those that carried out functional imaging before crt, before and during crt, pre- and post - crt and post - crt only . The database search to identify studies concerned with treatment response prediction in oesophageal cancer returned 181 results and three additional studies were identified from the references of these studies . Of these, eighty - one studies concerning target volume definition in oesophageal cancer were identified by the database search . The numbers in pancreatic cancer were lower the database search identified 66 studies concerning functional imaging as a means of predicting crt response, only six of which were eligible after full - text review . Only one study using functional imaging to guide target volume definition in pancreatic cancer apart from one series that used diffusion - weighted magnetic resonance imaging (mri) and another that used a putative hypoxia pet tracer (f - fluoroerythronitromidazole), all series used fdg - pet as the imaging modality of choice . Although other functional imaging modalities, such as dynamic contrast enhanced mri, have been shown to be feasible in cancers of the upper gastrointestinal tract, they have not been used in response prediction or target volume definition studies . Tables 14 summarise the data that showed a positive correlation with treatment outcome or prognosis . Many studies that carried out imaging at more than one time point commented upon the usefulness of the imaging at each time point . A clear trend immediately becomes apparent; imaging before crt, when analysed independently, offers little to no predictive or prognostic information . Recent studies that have gleaned as much information as is possible from pre - crt fdg - pet by carrying out a textural analysis have improved upon this to a degree: one series reported an area under the received operator characteristic (roc) curve of 0.85 when a technique that calculates the variability in the size and the intensity of homogenous uptake areas within the tumour was used . It can be seen that studies that have an area under the curve (auc) on roc analysis greater than 0.9 (and therefore offering relatively robust predictive power) have used a multi - parametric assessment . Combining functional parameters with anatomical - derived indices tests that applied parameter thresholds based upon roc curves seem to have done so to optimise the sensitivity of the test . The appropriateness of this approach needs external validation . A variety of ways of defining response have been used, with only five studies using pcr after crt as the end point to be predicted . The most commonly used fdg - pet - derived parameter used in response prediction is the maximum standardised uptake value (suvmax) - either as an absolute value at specific time points or as a relative change between two scan dates . A number of studies have shown the failure of suvmax to predict treatment outcome or survival . Parameters that try to include more information from across a region of interest, such as the suvmean, suvpeak (the average of suvs clustered around the suvmax) or fdg uptake heterogeneity or skewness, have been shown to offer more predictive information . Other methods include adding a volumetric measure to the suv, such as metabolic tumour volume and total lesion glycolysis . In oesophageal squamous cell carcinoma (scc), the roc curve auc improved from 0.71 to 0.93 when a response in functional tumour volume after crt was used rather than suv assessment alone . Suvmax measured on baseline imaging, when used as an independent factor, has failed to show any predictive utility . This is also true when baseline imaging parameters from studies that used dual time point assessments were analysed independently of the later imaging, particularly if suvmax was used . Of the 20 studies listed in table 1 that carried out fdg - pet at two time points, only one reported an association between baseline suvmax and treatment outcome the roc curve auc was 0.555 . Were able to predict the radiological response using only baseline fdg - pet with a sensitivity of 92% only when textural features such as local homogeneity, entropy and size zone were calculated . An initial suvmax greater than the median value of 12.8 was associated with a poorer overall survival (17.1 versus 33.4 months; p = 0.002) in a large retrospective analysis of baseline fdg - pet in patients treated with crt as definitive treatment . An apparent diffusion coefficient, a parameter derived from diffusion - weighted mri, less than the mean was associated with a radiological response in one series . When post - crt fdg - pet is used in patients managed by definitive crt, metabolic complete response (defined as a suvmax <3) is associated with improved overall survival and rates of local recurrence equal to that of patients receiving trimodality therapy . The relative reduction in suvmax may offer more predictive information than absolute values, although this is not always the case, particularly for those with adenocarcinoma . A variety of imaging response thresholds have been used, for example a reduction in suvmax ranging from 26.4 to 30% when fdg - pet was repeated during crt or from 32.3 to 75% when repeated post - crt (see table 1). However, tables 1 and 2 demonstrate that in most oesophageal carcinoma studies, a mixture of adenocarcinoma and scc has been included . When adenocarcinoma - only patients were included, the predictive power of a reduction in suvmax from baseline compared with the second week of crt no longer provided any prognostic information . This was also observed in a series where a relative reduction in suvmax from baseline to post - crt fdg - pets showed a significant correlation between a pathological response for oesophageal scc but not adenocarcinoma . Only one study offered different thresholds for adenocarcinoma and scc; 22 and 70% reduction in suvmax, respectively . This improved the specificity of the test to 90% for adenocarcinoma and 100% for scc . The suvmax and suvmean values on f - fluoroerythronitromidazole (fentim) pet (a putative hypoxia tracer) showed good test retest repeatability, but were not associated with a pathological response or survival . Although tumour hypoxia is not just the result of inadequate perfusion, a decrease in blood flow on perfusion computed tomography correlated with tumour size reduction after crt . Although a low tumour blood flow was also associated with a shorter median survival, this cohort had mixed treatment modalities and as only 12 patients had crt, it is difficult to extrapolate these data to the crt group . Incorporating fdg - pet into radiotherapy planning improves the accuracy of target volume definition and reduces geographical misses . The degree of agreement between tumour volumes delineated by different methods is assessed using a conformality index . A conformality index of 1.0 indicates total agreement, whereas 0 indicates that the two volumes are not spatially related at all . Computed tomography - defined gtvs excluded> 5% of the fdg - avid disease in 61% of patients in one series . In this series, the conformality index of the gtvs derived from computed tomography and computed tomography co - registered with fdg - pet was 0.68 . In another series of 16 patients, the mean conformality index of a computed tomography - derived and fdg - pet / computed tomography - derived gtv was 0.46 (range 0.130.80). The fdg - pet - derived gtvs tended to be smaller than those outlined on computed tomography alone in some series [5154] and significantly larger in others . When a visual assessment of fdg - pet images fused with the planning computed tomography was integrated into treatment planning, the gtv was decreased by> 25% in 12% of patients and increased by> 25% in 6% of patients . . Showed that 28% of patients had a> 2 cm craniocaudal, anteroposterior or lateral mismatch between gtvs derived from computed tomography and fdg - pet - derived gtv . Fdg - pet improves both intra- and interobserver variability in gtv definition for tumours of the gastro - oesophageal junction . The mean interobserver standard deviation of tumour length decreased from 10 mm to 8 mm (p = 0.02) with the addition of fdg - pet / computed tomography . This was also true for intraobserver agreement with the mean standard deviation in tumour length reducing from 5.3 mm to 1.8 mm (p = 0.001), with corresponding improvement in conformity index 0.73 for pet / computed tomography versus 0.69 for computed tomography (p = 0.05). This improvement in interobserver variability was not replicated in another study, despite the incidence of geographical miss of fdg - avid disease being reduced . The most obvious way a gtv can be altered by the inclusion of pet images is through the inclusion of previously unrecognised involved lymph nodes and a greater accuracy in defining tumour length . An absolute suv threshold of 2.36 has been shown to have a sensitivity and specificity of 76.2% and 96.0%, respectively, in predicting positive nodal involvement . Tumour length defined by an fdg suv of 2.5 had a better correlation with tumour length defined by endoscopic ultrasound (eus) than computed tomography - defined tumour length . Eus does, however, seem to be a more robust method of identifying pathological lymph nodes than fdg - pet and remains the gold standard . The timing of fdg - pet is important . In a series that repeated fdg - pet just before radiotherapy treatment planning, rather than relying on the diagnostic imaging, the best way of segmenting fdg - pet imaging to aid, or even semi - automate, gtv delineation remains unclear . Measurement of the tumour at surgical resection has allowed correlation of a variety of suv thresholds on fdg - pet with actual measured tumour length . An suv that was 40% of the maximum for the tumour grossly underestimated the tumour length seen after resection . Another series has suggested that the suv threshold for target volume definition to define tumour length needs to be decided on an individual patient basis . In this analysis, it was found that the optimal suv threshold used to define the tumour varied with tumour length and suvmax . For example, long tumours or those with a low suvmax required a higher percentage threshold to make the resultant tumour length correlate with that seen at pathology . This led the authors to conclude that an absolute suv of 2.5 might be the best compromise if fdg - pet alone was to be used to define the cranial and caudal limit of the tumour . This suggestion was supported by another series where an fdg suv of 2.5 correlated very well with tumour length measured on computed tomography . Using a personalised suv threshold based on suvmax led to a poorer correlation . Again, although an absolute suv correlated well with tumour length, the conformality index of the resultant volume remained poor (0.57). The only study to attempt to validate a pet tracer that is associated with hypoxia to derive target volumes was unsuccessful . In a study of 10 patients, the correlation coefficient of the hypoxic volumes derived on two separate fetnim - pet studies was only 0.21 . All studies to assess the predictive and prognostic utility of functional imaging in pancreatic cancer used fdg - pet . Only one study that showed a correlation with fdg - pet parameters with treatment response was found . Higher baseline suvmax was associated with a histopathological response the predictive function of fdg - pet in this series was increased by combining the baseline suvmax with the relative suv response after crt . It should be noted that this series defined histopathological response as <50% viable tumour cells seen in a resection specimen . An association with low baseline suvmax and larger suvmax reduction after crt was observed (see table 4). Only one series has looked at the effect of functional imaging on gtv definition in pancreatic cancer . In a cohort of patients with lapc, a computed tomography - defined gtv was used as the reference volume for comparison with a gtv that was delineated after fusion of the fdg - pet with the planning computed tomography . The pet - derived gtv was larger by 29.7%, due to extension of primary tumours and additional nodes . Figures 1 and 2 show the potential benefit of including fdg - pet in radiotherapy planning for lapc . Figure 3 illustrates one of the potential limitations of fdg - pet in lapc, namely the failure of fdg uptake to differentiate between tumour glucose metabolism and uptake in inflammatory cells . Although the aim of this review was to assess the predictive and prognostic utility and the additional benefit of functional imaging on target volume definition in oesophageal and pancreatic cancer, the lack of heterogeneity in the functional imaging modalities used and the large degree of variation in technique and reporting make comparison of the results challenging . There is a strong suggestion that a single parameter (e.g. Suvmax) derived from a pretreatment imaging study is unlikely to offer a predictor of pathological response that is robust enough to drive treatment decision - making . An obvious limitation of the studies that used fdg - pet is the heavy reliance on the suvmax within the tumour a single - pixel measure that is subject to considerable noise effect . This is in keeping with the observation that oesophageal tumours were more likely to respond to crt if the number of pixels with a high suv value was small, suggesting that noise effect could artificially elevate the suvmax . There is an emerging trend to utilise much more of the information that is included in the scan rather than a single point value . Approaches including total glycolytic volume, texture features (descriptive measures of tracer uptake heterogeneity) and even the simple method of combining tumour diameter with suvmax to produce a diameter - suv index may offer better predictive and prognostic utility . Using a support vector model that incorporated a number of features, the treatment outcome for all 20 patients treated with crt for oesophageal cancer could be accurately predicted when all features, including fdg - pet textural analysis, were taken into account . Failure of post - crt functional imaging to accurately predict the pathological response may be due to post - crt oesophagitis or because cell stunning effects, which have nothing to do with tumour cell viability, confound the picture . Some experts therefore advocate re - imaging earlier in the course of treatment as the onset of treatment - associated oesophagitis is around 2 weeks and as the reduction in fdg uptake at this time point may be more representative of cell death rather than stunning . Moreover, deferring reassessment until after crt has been completed does not give the opportunity of therapeutic intervention, such as radiotherapy dose escalation, in those who are failing to have an optimal response . It is clear that if fdg - pet is to be used for radiotherapy planning, it should be carried out as close to the planning computed tomography scan as possible . Disease progression from the time of diagnostic scanning to treatment planning could lead to the failure of inclusion of the positive lymph nodes in the treatment volume or progressing with a radical treatment plan in the presence of metastatic disease . The inclusion of hybrid pet / computed tomography scanning into routine planning computed tomography is worthy of consideration . Side by side/sequential viewing of images, whereas others have either relied upon image registration software or using hybrid pet / computed tomography scanners . The conformality index is often used to describe the reliability of a method of target volume definition compared with a current standard . This could be potentially problematic in upper gastrointestinal malignancies, particularly pancreatic cancer, where in the presence of a large, physiologically quiescent, stromal component to the tumour, the conformality index will always be low despite the functional imaging test identifying a region of interest that may contain all viable tumour cells . The investigation of pet tracers that give information on a variety of specific physiological processes, such as hypoxia, may be beneficial . The use of fdg - pet has a good scientific basis, in addition to being a pragmatic choice because of wide availability and relatively low costs . In a preclinical model, fdg - avid tumours required an increase in radiation dose to improved local control rates, whereas tumours with low fdg - avidity did not benefit from an increased radiation dose, suggesting that fdg - pet may be an appropriate means of defining an area that would benefit from dose boosting . Local treatment failure is an important consideration, both for oesophageal and pancreatic tumours, so dose - escalating a hypoxic subvolume is ideologically appealing . Other hypoxic tracers, such as f - misonidazole or cu - atsm (diacetyl - bis (n4-methylthiosemicarbazone)) should be investigated, as they may increase confidence in pet - derived hypoxic volumes . In preclinical oesophageal cancer models, flt uptake has been shown to be a rapidly responding marker of response to crt . Using flt as a pet tracer seems to be attractive, as cellular retention of flt relies upon phosphorylation by tyrosine kinase 1, which is only expressed in late g1 and s phase . Targeting only proliferating cells may be beneficial and may improve some of the poor predictive and prognostic utility associated with fdg uptake . There can be considerable movement of oesophageal tumours throughout the respiratory cycle, particularly in the craniocaudal direction in lower thoracic tumours . Data acquisition in a static pet scan is a slow process (over minutes). Uptake detection is therefore averaged throughout the time of acquisition and across the whole respiratory cycle . Four - dimensional pet imaging may allow a greater confidence in individual voxel suv values and in boundaries of transition between tracer uptake thresholds . Further studies are required to increase the confidence in the predictive and prognostic power of functional imaging in upper gastrointestinal malignancies . A multimodality, multiparametric assessment of the tumours at more than one time point to increase the likelihood of finding predictive indices should be systematically explored . Attempts should be made to reduce the time from imaging to the start of crt . The imaging modality used should give information about a physiological process that is associated with treatment resistance . With increased confidence in this imaging modality, the functional imaging could then be used for biological target volume definition . Delivering a higher radiotherapy dose to areas of the tumour that are less likely to respond, or integrating physiological modulating agents into the crt regimen, this approach would, however, requires a robust means of risk stratification that can be carried out early in the treatment schedule.
|
Bladder cancer is the second most common urological malignancy in humans, and it was estimated in 2012 in the united states that 73,510 new cases of cancer of the urinary bladder were diagnosed along with 14,680 deaths . In korea also, bladder cancer is the second most common genitourinary tumor and is about five times as common in men as in women . Bladder cancer is classified into two large groups of non - muscle - invasive bladder cancer (nmibc) and muscle - invasive bladder cancer (mibc) according to pathology and clinical features . Although only 20% of bladder cancer is confirmed as mibc at first diagnosis, mibc accounts for the majority of cancer - specific deaths . More than three - quarters of all bladder cancer cases are nmibc that can be treated by transurethral resection (tur). Unfortunately, about 70% of patients with nmibc who have undergone tur experience a tumor recurrence within 2 years . Furthermore, 20% to 30% of patients who have had a complete tur and intravesical therapy performed with bacillus calmette - gurin (bcg) have experienced progression to mibc . Thus, many diagnostic tools and biomarkers have been proposed and developed to predict the recurrence and progression of nmibc [8 - 10], but most of these have proven to be inadequate in terms of efficacy and accuracy because of the heterogeneous behavior of bladder cancer . Micrornas (mirnas) are small, noncoding rnas that are 18 to 22 nucleotides in length in their mature form . Micrornas act as posttranscriptional gene modulators and play an important role in cell proliferation, differentiation, survival, programmed cell death, and oncogenesis of cells and organisms, usually by inhibiting translation . Micrornas are aberrantly expressed in human cancer and may function as a novel class of oncogenes or tumor suppressor genes . Actually, numerous studies have detected mirna deregulation in human malignancies, including chronic lymphocytic leukemia, breast cancer, primary glioblastoma, lung cancer, thyroid cancer, colon cancer, and pancreatic cancer . Also, when histologically matched with normal urothelium, various types of mi - rnas are aberrantly expressed in bladder cancer . Accordingly, it has been suggested that mirnas play roles as oncogenes or tumor suppressors in the tumorigenesis and progression of bladder cancer . However, although many mirnas, their targets, and their mechanism of action as well as their clinical value have recently been described, few studies have focused on cell - free mirnas isolated from urine, particularly in bladder cancer . In the present study, we measured the expression levels of urinary cell - free mir-214 in nmimc patients and then investigated whether urinary cell - free mir-214 could be a prognostic biomarker for nmibc . A total of 138 patients with primary urothelial carcinoma of the urinary bladder and 144 healthy controls were enrolled in the study . Controls were selected to match the age and gender proportions of the bladder cancer patients, and subjects were screened to ensure that they were within the normal range of all laboratory results with no history of malignant tumors . Urine samples were collected in the morning and stored at 4, then centrifuged at 25,000 rpm for 15 minutes . Each supernatant and sediment was portioned into eppendorf tubes and stored at -20 until use . All primary tumor samples were obtained from patients who underwent tur and were histologically verified to have urothelial carcinoma . To reduce confounding factors affecting the analyses, and to delineate a more homogeneous study population, any patients diagnosed with a concomitant carcinoma in situ or for whom data collection was incomplete were excluded . The collection and analysis of all samples was approved by the institutional review board of our institute, and written informed consent was obtained from each subject (irb approval number 2006 - 01 - 001). Patients who had a t1 tumor, multiple tumors, large tumors (> 3 cm in diameter), or high - grade ta nmibc received one cycle of intravesical treatment (bcg or mitomycin - c). Patients who were free of disease within 3 months after treatment were assessed every 3 months for the first 2 years, and then every 6 months thereafter . Patients who refused or did not complete an imaging work - up such as a computed tomographic scan or an magnetic resonance imaging at least once every 3 months to evaluate their response tumors were staged and graded according to the 2002 tnm classification and the 1973 world health organization grading system, respectively . Recurrence was defined as a recurrence of primary nmibc at either a lower or the same pathological stage, and progression was defined as disease with a higher tnm stage upon relapse of nmibc . A genolution urine mirna purification kit (genolution pharmaceuticals inc ., seoul, korea) urine sample supernatant (500 l) was added to each tube containing genolution proprietary mirna separation solution, which was then vortexed for 20 seconds . Next, 200 l of chloroform was added and the samples were vortexed for 10 seconds, after which they were centrifuged at 13,000 rpm for 10 minutes at 4. a 600-l fraction from the top aqueous phase was taken and transferred into a new 1.5 ml tube, and 0.8 ml of isopropanol was added, followed by centrifugation for 5 minutes at 13,000 rpm and 4. after removing the aqueous solution, 1 ml of 70% ethanol was added and the sample was again centrifuged for 2 minutes at 13,000 rpm and 4. after removing the ethanol, the pellet was dissolved in 30 l rnase - free water and stored at -80 until use . A fixed concentration of microrna (5 ng/l) from a given volume of starting urine was used as the input into the reverse transcription reaction . The miscript reverse transcription kit (qiagen korea, seoul, south korea) was used for reverse transcription of the mirnas . After mixing with template rna, 5x miscript buffer, miscript reverse transcriptase mix, and rnase - free water in a final volume of 20 l, the mixture was centrifuged briefly and incubated for 60 minutes at 37. to inactivate the miscript reverse transcriptase mix, for quantification of the mirna expression, real - time amplification was performed with a rotor - gene 6000 . Real - time pcr assays were performed in microreaction tubes (corbett research, mortlake, australia) using the miscript pcr starter kit (qiagen korea, seoul, korea). To amplify target mirnas, forward primers were designed for the mir-214 (5'-aca gca ggc aca gac agg ca gt-3'). After thawing the reagents and template cdna, the pcr reaction was carried out in a final volume of 20 l containing 10 l 2x quantitect sybr green pcr master mix, 2 l 10x miscript universal primer, 2 l 10 pmol forward primer, 2 l template cdna, and rnase - free water . Real - time pcr conditions were as follows: one cycle of initial activation for 15 minutes at 95, followed by 50 cycles of 15 seconds at 94 for denaturation, annealing for 30 seconds at 55, and extension for 30 seconds at 70. the melting program was performed at 70 to 99 at a heating rate of 1 per 5 seconds . Spectral data were captured and analyzed by using rotor - gene real - time analysis software 6.0, build 14 . All samples were run in triplicate . For accurate and reproducible results by real - time pcr, it was necessary to normalize the amount of target mirna by using a suitable endogenous reference rna . Was used as a control for the normalization of real - time pcr results in mirna quantification studies using the miscript pcr system . U6 was analyzed in parallel as an endogenous rna reference gene and all data were normalized to u6 expression . A student t - test was applied to assess the association of the mirna expression level with the clinical variables . To compare the levels of mirna-214 in enrolled patients and controls, the prognostic value of the levels of mir-214 in nmibc was studied by using multivariate cox proportional hazards regression models . Statistical analysis was performed by using ibm spss ver . 19.0 (ibm co., armonk, ny, usa), and a p - value of <0.05 was considered statistically significant . A total of 138 patients with primary urothelial carcinoma of the urinary bladder and 144 healthy controls were enrolled in the study . Controls were selected to match the age and gender proportions of the bladder cancer patients, and subjects were screened to ensure that they were within the normal range of all laboratory results with no history of malignant tumors . Urine samples were collected in the morning and stored at 4, then centrifuged at 25,000 rpm for 15 minutes . Each supernatant and sediment was portioned into eppendorf tubes and stored at -20 until use . All primary tumor samples were obtained from patients who underwent tur and were histologically verified to have urothelial carcinoma . To reduce confounding factors affecting the analyses, and to delineate a more homogeneous study population, any patients diagnosed with a concomitant carcinoma in situ or for whom data collection was incomplete were excluded . The collection and analysis of all samples was approved by the institutional review board of our institute, and written informed consent was obtained from each subject (irb approval number 2006 - 01 - 001). Patients who had a t1 tumor, multiple tumors, large tumors (> 3 cm in diameter), or high - grade ta nmibc received one cycle of intravesical treatment (bcg or mitomycin - c). Patients who were free of disease within 3 months after treatment were assessed every 3 months for the first 2 years, and then every 6 months thereafter . Patients who refused or did not complete an imaging work - up such as a computed tomographic scan or an magnetic resonance imaging at least once every 3 months to evaluate their response tumors were staged and graded according to the 2002 tnm classification and the 1973 world health organization grading system, respectively . Recurrence was defined as a recurrence of primary nmibc at either a lower or the same pathological stage, and progression was defined as disease with a higher tnm stage upon relapse of nmibc . A genolution urine mirna purification kit (genolution pharmaceuticals inc ., seoul, korea) was used to purify the urine samples . Urine sample supernatant (500 l) was added to each tube containing genolution proprietary mirna separation solution, which was then vortexed for 20 seconds . Next, 200 l of chloroform was added and the samples were vortexed for 10 seconds, after which they were centrifuged at 13,000 rpm for 10 minutes at 4. a 600-l fraction from the top aqueous phase was taken and transferred into a new 1.5 ml tube, and 0.8 ml of isopropanol was added, followed by centrifugation for 5 minutes at 13,000 rpm and 4. after removing the aqueous solution, 1 ml of 70% ethanol was added and the sample was again centrifuged for 2 minutes at 13,000 rpm and 4. after removing the ethanol, the pellet was dissolved in 30 l rnase - free water and stored at -80 until use . A fixed concentration of microrna (5 ng/l) from a given volume of starting urine was used as the input into the reverse transcription reaction . The miscript reverse transcription kit (qiagen korea, seoul, south korea) was used for reverse transcription of the mirnas . After mixing with template rna, 5x miscript buffer, miscript reverse transcriptase mix, and rnase - free water in a final volume of 20 l, the mixture was centrifuged briefly and incubated for 60 minutes at 37. to inactivate the miscript reverse transcriptase mix, the samples were incubated for 5 minutes at 95 and placed on ice . For quantification of the mirna expression, real - time amplification was performed with a rotor - gene 6000 . Real - time pcr assays were performed in microreaction tubes (corbett research, mortlake, australia) using the miscript pcr starter kit (qiagen korea, seoul, korea). To amplify target mirnas, forward primers were designed for the mir-214 (5'-aca gca ggc aca gac agg ca gt-3'). After thawing the reagents and template cdna, the pcr reaction was carried out in a final volume of 20 l containing 10 l 2x quantitect sybr green pcr master mix, 2 l 10x miscript universal primer, 2 l 10 pmol forward primer, 2 l template cdna, and rnase - free water . Real - time pcr conditions were as follows: one cycle of initial activation for 15 minutes at 95, followed by 50 cycles of 15 seconds at 94 for denaturation, annealing for 30 seconds at 55, and extension for 30 seconds at 70. the melting program was performed at 70 to 99 at a heating rate of 1 per 5 seconds . Spectral data were captured and analyzed by using rotor - gene real - time analysis software 6.0, build 14 . All samples were run in triplicate . For accurate and reproducible results by real - time pcr, it was necessary to normalize the amount of target mirna by using a suitable endogenous reference rna . Was used as a control for the normalization of real - time pcr results in mirna quantification studies using the miscript pcr system . U6 was analyzed in parallel as an endogenous rna reference gene and all data were normalized to u6 expression . A student t - test was applied to assess the association of the mirna expression level with the clinical variables . To compare the levels of mirna-214 in enrolled patients and controls, the prognostic value of the levels of mir-214 in nmibc was studied by using multivariate cox proportional hazards regression models . Statistical analysis was performed by using ibm spss ver . 19.0 (ibm co., armonk, ny, usa), and a p - value of <0.05 was considered statistically significant . The mean age of the patients was 62.0813.38 years for 110 males and 28 females; the mean age of the controls was 63.7912.65 years for 114 males and 30 females . The number of patients in grades g1, g2, and g3 was 53, 64, and 21, respectively . The number of patients in stages ta and t1 was 64 and 74, respectively . Table 2 summarizes the association between urinary levels of mirna-214 and the clinicopathological parameters of bladder cancer patients . The levels of mir-214 were significantly higher in the nmibc patients than in the controls (20.083.21 vs. 18.962.68, p=0.002). However, the urinary levels of mir-214 were not significantly associated with either the grade or the stage of bladder cancer (p>0.05, each). When we compared the urinary levels of mir-214 according to clinical outcomes, we found that the urinary levels of mir-214 were significantly different between the recurrence and the nonrecurrence groups (table 3). Patients with recurrence of nmibc had lower levels of mir-214 than did those who had no recurrence (19.242.67 vs. 20.413.41, p=0.023). There was no significant difference in the levels of mir-214 between the progression and the nonprogression groups (p=0.919). In the univariate cox regression analysis, the number of tumors (especially 8) and the levels of mir-214 were influential factors in the recurrence of nmibc (hazard ratio [hr], 2.636; 95% confidence interval [ci], 1.220 to 5.699; p=0.014; hr, 2.231; 95% ci, 1.175 to 4.238; p=0.014, respectively). Multivariate cox regression analysis revealed that a low level of urinary mir-214 was the only independent predictor of nmibc recurrence (hr, 2.011; 95% ci, 1.027 to 3.937; p=0.041) (table 4). The patients with low levels of mir-214 had a significantly longer recurrence - free survival time than did the patients with high level of mir-214 (p=0.012) (fig . The mean age of the patients was 62.0813.38 years for 110 males and 28 females; the mean age of the controls was 63.7912.65 years for 114 males and 30 females . The number of patients in grades g1, g2, and g3 was 53, 64, and 21, respectively . The number of patients in stages ta and t1 was 64 and 74, respectively . Table 2 summarizes the association between urinary levels of mirna-214 and the clinicopathological parameters of bladder cancer patients . The levels of mir-214 were significantly higher in the nmibc patients than in the controls (20.083.21 vs. 18.962.68, p=0.002). However, the urinary levels of mir-214 were not significantly associated with either the grade or the stage of bladder cancer (p>0.05, each). When we compared the urinary levels of mir-214 according to clinical outcomes, we found that the urinary levels of mir-214 were significantly different between the recurrence and the nonrecurrence groups (table 3). Patients with recurrence of nmibc had lower levels of mir-214 than did those who had no recurrence (19.242.67 vs. 20.413.41, p=0.023). There was no significant difference in the levels of mir-214 between the progression and the nonprogression groups (p=0.919). In the univariate cox regression analysis, the number of tumors (especially 8) and the levels of mir-214 were influential factors in the recurrence of nmibc (hazard ratio [hr], 2.636; 95% confidence interval [ci], 1.220 to 5.699; p=0.014; hr, 2.231; 95% ci, 1.175 to 4.238; p=0.014, respectively). Multivariate cox regression analysis revealed that a low level of urinary mir-214 was the only independent predictor of nmibc recurrence (hr, 2.011; 95% ci, 1.027 to 3.937; p=0.041) (table 4). The patients with low levels of mir-214 had a significantly longer recurrence - free survival time than did the patients with high level of mir-214 (p=0.012) (fig . The current study showed that urinary cell - free mirnas can serve as noninvasive prognostic markers for the recurrence of nmibc . Micrornas have been identified in all types of bodily fluids, including cerebrospinal fluid, pleural fluid, peritoneal fluid, and even tears, saliva, and urine . Numerous studies have recently shown that mirnas are emerging as a new class of cancer biomarkers . In the case of urothelial carcinoma, urine is a particularly desirable source of such biomarkers . An ideal biomarker must be accessible by noninvasive protocols, be inexpensive to quantify, be specific to the disease of interest, and be a reliable indicator of disease before the appearance of clinical symptoms . Urine is more convenient and less invasive to collect than blood; in addition, mirnas exist in a stable form in urine even after seven cycles of freezing and thawing or 72 hours at room temperature . Cell - free mirnas in urine could be direct indicators of urological conditions including injury, malignancy, and so on . The exact mechanisms of release and the roles of cell free circulating mirnas are unclear . Recent studies have suggested, however, that the interaction between cells via mrna and mirna is accomplished by microvesicle transfer . Circulating mirnas might be released from cancer cells and communicate with recipient cells in the surrounding microenvironment by microvesicles . For this reason, it is certain that urine would have the highest exposure to microvesicles from urothelial cancer tissue . A number of studies have established either the over - expression or under - expression of mirnas in different types of human malignancy [21 - 27]. Accumulated evidence has shown that mirna expression signatures correlate well with the specific characteristics of each malignancy and can be used to classify normal and malignant tissues as well as the subtype of malignancy . These observations suggest that mirnas can function either as tumor suppressors or oncogenes, regulating different cellular processes by targeting hundreds of genes and conferring a predictive diagnostic value to mirna expression . In solid tumors, such as stomach, pancreatic, and prostate cancer, alteration of the levels of a small number of mirnas including mir-214 has been identified as a signature . In breast cancer, mir-214 expression is reduced, and in pancreatic and ovarian cancers, mir-214 has a relationship with chemoresistance . However, studies that have evaluated the relationship between the level of mir-214 and bladder cancer are rare, which, of course, includes urinary mir-214 . In the present study, we confirmed that urinary mir-214 can serve as a noninvasive prognostic biomarker of bladder cancer . The levels of mir-214 capably distinguished nmibc patients from the noncancerous controls, but could show no correlation with either the grade or the stage of nmibc . We suggest that the nmibc patients had relatively high levels of mir-214 compared with the control patients owing to the tumor - suppressive effects of mir-214 . In nmibc patients, low levels of urinary mir-214 could be associated with a recurrence of nmibc owing to relatively low tumor - suppressive effects . On the basis of these results, we inferred that mir-214 could be related to the inhibition of angiogenesis, to cell proliferation, and to tumor recurrence . As far as we could ascertain, only one study has evaluated urinary cell - free mirnas as diagnostic and prognostic biomarkers of bladder cancer . The current study is the first to link urinary mirna-214 with bladder cancer . The results of this study indicated that mir-214 in urine might serve as a noninvasive biomarker for predicting the prognosis of bladder cancer . Low levels of urinary mir-214 can be used as an independent prognostic parameter for the recurrence of nmibc . Thus, cell - free urinary microrna-214 might be a useful noninvasive biomarker for the recurrence of nmibc.
|
Numerical investigations of cosmological spacetimes can be categorized into two broad classes of calculations, distinguished by their computational goals: (1) geometrical and mathematical principles of cosmological models, and (ii) physical and astrophysical cosmology . In the former, the emphasis is on the geometric framework in which astrophysical processes occur, for example cosmological expansion, topological singularities, geometrodynamics in general, and classification characteristics or invariants of the many models allowed by the theory of general relativity . In the latter, the emphasis is on the cosmological and astrophysical processes in the real or observable universe, and the quest to determine the model which best describes our universe . The former is pure in the sense that it concerns the fundamental nonlinear behavior of the einstein equations and the gravitational field . The latter is more complex as it addresses the composition, organization, and dynamics of the universe from the small scales (fundamental particles and elements) to the large (galaxies and clusters of galaxies). However the distinction is not always so clear, and geometric effects in the spacetime curvature can have significant consequences for the evolution and observation of matter distributions . Any comprehensive model of cosmology must therefore include nonlinear interactions between different matter sources and spacetime curvature . A realistic model of the universe must also cover large dynamical spatial and temporal scales, extreme temperature and density distributions, and highly dynamic atomic and molecular matter compositions . In addition, due to all the varied physical processes of cosmological significance, one must draw from many disciplines of physics to model curvature anisotropies, gravitational waves, electromagnetic fields, nucleosynthesis, particle physics, hydrodynamic fluids, etc . These phenomena are described in terms of coupled nonlinear partial differential equations and must be solved numerically for general inhomogeneous spacetimes . The situation appears extremely complex, even with current technological and computational advances . As a result, the codes and numerical methods that have been developed to date are designed to investigate very specific problems with either idealized symmetries or simplifying assumptions regarding the metric behavior, the matter distribution / composition or the interactions among the matter types and spacetime curvature . It is the purpose of this article to review published numerical cosmological calculations addressing problems from the very early universe to the present; from the purely geometrical dynamics of the initial singularity to the large scale structure of the universe . There are three major sections: section 2 where a brief overview is presented of various defining events occurring throughout the history of our universe and in the context of the standard model, section 3 where reviews of early universe and relativistic cosmological calculations are presented, and section 4 which focuses on structure formation in the post - recombination epoch and on testing cosmological models against observations . Following the summary paragraphs in section 5, an appendix in section 6 presents the basic einstein equations, kinematic considerations, matter source equations with curvature, and the equations of perturbative physical cosmology on background isotropic models . With current observational constraints, the physical state of our universe, as understood in the context of the standard or friedman - lemaitre - robertson - walker (flrw) model, can be crudely extrapolated back to 10 seconds after the big bang, before which the classical description of general relativity is expected to give way to a quantum theory of gravity . As the time - line in figure 1 shows, the universe was a plasma of relativistic particles at the earliest times consisting of quarks, leptons, gauge bosons, and higgs bosons represented by scalar fields with interaction and symmetry regulating potentials . Figure 1a historical time - line showing the major evolutionary stages of our universe according to the standard model, from the earliest moments of the planck era to the present . The horizontal axis represents logarithmic time in seconds (or equivalently energy in electron - volts or temperature in kelvin, and the solid red line roughly models the radius of the universe, showing the different rates of expansion at different times: exponential during inflation, shallow power law during the radiation dominated era, and a somewhat steeper power law during the current matter dominated phase . A historical time - line showing the major evolutionary stages of our universe according to the standard model, from the earliest moments of the planck era to the present . The horizontal axis represents logarithmic time in seconds (or equivalently energy in electron - volts or temperature in kelvin, and the solid red line roughly models the radius of the universe, showing the different rates of expansion at different times: exponential during inflation, shallow power law during the radiation dominated era, and a somewhat steeper power law during the current matter dominated phase . It is believed that several spontaneous symmetry breaking (ssb) phase transitions occured in the early universe as it expanded and cooled, including the grand unification transition (gut) at 1034 s after the big bang in which the strong nuclear force split off from the weak and electromagnetic forces (this also marks an era of inflationary expansion and the origin of matter - antimatter asymmetry through baryon, charge conjugation, and charge + parity violating interactions and nonequilibrium effects); the electroweak (ew) ssb transition at 1011 s when the weak nuclear force split from the electromagnetic force; and the chiral or quantum chromodynamic (qcd) symmetry breaking transition at 10 s during which quarks condensed into hadrons . The most stable hadrons (baryons, or protons and neutrons comprised of three quarks) survived the subsequent period of baryon - antibaryon annihilations, which continued until the universe cooled to the point at which new baryon - antibaryon pairs could no longer be produced . Topological defects, defined as stable configurations of matter in the symmetric (high temperature) phase, may persist after any of the phase transitions described above to influence the subsequent evolution of matter structures . The nature of the defects is determined by the phase transition and the symmetry properties of the matter, and some examples include domain walls, cosmic strings, monopoles, and textures . A period of primordial nucleosynthesis followed from 10 to 10 during which light element abundances were synthesized to form 24% helium with trace amounts of deuterium, tritium, helium-3, and lithium . It is also during this stage that neutrinos (produced from proton - proton and proton - photon interactions, and from the collapse or quantum evaporation / annihilation of topological defects) stopped interacting with other matter, such as neutrons, protons, and photons . Neutrinos that existed at this time separated from these other forms of matter and traveled freely through the universe at very high velocities, near the speed of light . By 10 s, the matter density became equal to the radiation density as the universe continued to expand, identifying the start of the current matter - dominated era and the beginning of structure formation . Later, at 10 s (3 x 10 yr), the free ions and electrons combined to form atoms, effectively decoupling the matter from the radiation field as the universe cooled . This decoupling or post - recombination epoch marks the surface of last scattering and the boundary of the observable (via photons) universe, and plays an important role in the history of the cosmic microwave background radiation (cmbr). Assuming a hierarchical cold dark matter (cdm) structure formation scenario, the subsequent development of our universe is characterized by the growth of structures with increasing size . For example, the first stars are likely to have formed at t 10y from molecular gas clouds when the jeans mass of the background baryonic fluid was approximately 10 m, as indicated in figure 2 . This epoch of pop iii star generation is followed by the formation of galaxies at t 10 yr and subsequently galaxy clusters . Though somewhat controversial, estimates of the current age of our universe range from 10 to 20 gy, with a present - day linear structure scale radius of about 8 h mpc, where h is the hubble parameter (compared to 23 mpc typical for the virial radius of rich galaxy clusters). The solid and dotted lines potentially track the jeans mass of the average baryonic gas component from the recombination epoch at z 10 to the current time . A residual ionization fraction of nh+/nh 10 following recombination allows for compton interactions with photons to z 200, during which the jeans mass remains constant at 10m. The jeans mass then decreases as the universe expands adiabatically until the first collapsed structures form sufficient amounts of hydrogen molecules to trigger a cooling instability and produce pop iii stars at z 20 . Star formation activity can then reheat the universe and raise the mean jeans mass to above 10m. This reheating could affect the subsequent development of structures such as galaxies and the observed ly clouds . The solid and dotted lines potentially track the jeans mass of the average baryonic gas component from the recombination epoch at z 10 to the current time . A residual ionization fraction of nh+/nh 10 following recombination allows for compton interactions with photons to z 200, during which the jeans mass remains constant at 10m. The jeans mass then decreases as the universe expands adiabatically until the first collapsed structures form sufficient amounts of hydrogen molecules to trigger a cooling instability and produce pop iii stars at z 20 . Star formation activity can then reheat the universe and raise the mean jeans mass to above 10m. This reheating could affect the subsequent development of structures such as galaxies and the observed ly clouds . The isotropic and homogeneous flrw cosmological model has been so successful in describing the observable universe that it is commonly referred to as the standard model . Furthermore, and to its credit, the model is relatively simple so that it allows for calculations and predictions to be made of the very early universe, including primordial nucleosynthesis at 10 seconds after the big bang, and even particle interactions approaching the planck scale at 10 s. at present, observational support for the standard model includes: the expansion of the universe as verified by the redshifts in galaxy spectra and quantified by measurements of the hubble constant h0 = 100h km s mpc, where 0.5 h 1 is the hubble constant;the deceleration parameter observed in distant galaxy spectra (although uncertainties about galactic evolution, intrinsic luminosities, and standard candles prevent an accurate estimate);the large scale isotropy and homogeneity of the universe based on temperature anisotropy measurements of the microwave background radiation and peculiar velocity fields of galaxies (although the light distribution from bright galaxies is somewhat contradictory);the age of the universe which yields roughly consistent estimates between the look - back time to the big bang in the flrw model and observed data such as the oldest stars, radioactive elements, and cooling of white dwarf stars;the cosmic microwave background radiation suggests that the universe began from a hot big bang and the data is consistent with a mostly isotropic model and a black body at temperature 2.7 k;cmbr precision measurements suggest best fit cosmological parameters in accord with the critical density standard model;the abundance of light elements such as h, he, he, and li, as predicted from the flrw model, is consistent with observations, provides a bound on the baryon density and baryon - to - photon ratio, and is the earliest confirmation of the standard model;the present mass density, as determined from measurements of luminous matter and galactic rotation curves, can be accounted for by the flrw model with a single density parameter (0) to specify the metric topology;the distribution of galaxies and larger scale structures can be reproduced by numerical simulations in the context of inhomogeneous perturbations of the flrw models;the detection of dark energy from observations of supernovae is generally consistent with accepted flrw model parameters and cold dark matter + cosmological constant numerical structure formation models . The expansion of the universe as verified by the redshifts in galaxy spectra and quantified by measurements of the hubble constant h0 = 100h km s mpc, where 0.5 h 1 is the hubble constant; the deceleration parameter observed in distant galaxy spectra (although uncertainties about galactic evolution, intrinsic luminosities, and standard candles prevent an accurate estimate); the large scale isotropy and homogeneity of the universe based on temperature anisotropy measurements of the microwave background radiation and peculiar velocity fields of galaxies (although the light distribution from bright galaxies is somewhat contradictory); the age of the universe which yields roughly consistent estimates between the look - back time to the big bang in the flrw model and observed data such as the oldest stars, radioactive elements, and cooling of white dwarf stars; the cosmic microwave background radiation suggests that the universe began from a hot big bang and the data is consistent with a mostly isotropic model and a black body at temperature 2.7 k; cmbr precision measurements suggest best fit cosmological parameters in accord with the critical density standard model; the abundance of light elements such as h, he, he, and li, as predicted from the flrw model, is consistent with observations, provides a bound on the baryon density and baryon - to - photon ratio, and is the earliest confirmation of the standard model; the present mass density, as determined from measurements of luminous matter and galactic rotation curves, can be accounted for by the flrw model with a single density parameter (0) to specify the metric topology; the distribution of galaxies and larger scale structures can be reproduced by numerical simulations in the context of inhomogeneous perturbations of the flrw models; the detection of dark energy from observations of supernovae is generally consistent with accepted flrw model parameters and cold dark matter + cosmological constant numerical structure formation models . Because of these remarkable agreements between observation and theory, most work in the field of physical cosmology (see section 4) has utilized the standard model as the background spacetime in which the large scale structure evolves, with the ambition to further constrain parameters and structure formation scenarios through numerical simulations . The most widely accepted form of the model is described by a set of dimensionless density parameters which sum to (1)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\omega _ b} + {\omega _ d} + {\omega _ \gamma} + {\omega _ \lambda} = {\omega _ 0},$$\end{document} where the different components measure the present mean baryon density b, the dark matter density d, the radiation energy, and the dark energy . The relative contributions of each source and their sum 0 (which determines the topological curvature of the model) remains one of the most important issues in modern computational and observational cosmology . The reader is referred to for a more in - depth review of the standard model, and to [128, 154] for a summary of observed cosmological parameter constraints and best fit concordance models . Peebles and ratra provide a comprehensive literature survey and an excellent review of the standard model, cosmological tests, and the evidence for dark energy and the cosmological constant . However, some important unanswered questions about the standard model concern the nature of the special conditions that produced an essentially geometrically flat universe that is also homogeneous and isotropic to a high degree over large scales . In an affort to address these questions, it should be noted that many other cosmological models can be constructed with a late time behavior similar enough to the standard model that it is difficult to exclude them with absolute certainty . Consider, for example, the collection of homogeneous but arbitrarily anisotropic vacuum spacetimes known as the bianchi models [141, 69]. There are nine unique models in this family of cosmologies, ranging from simple bianchi i models representing the kasner class of spacetimes (the flat flrw model, sometimes referred to as type i - homogeneous, belongs to this group), to the more complex and chaotic bianchi ix or mixmaster model (which also includes the closed flrw model, type ix - homogeneous). Several of these models will be discussed in the first section on relativistic cosmology (section 3) dealing pre - dominately with the early universe, where the models differ the most . Anisotropic solutions, as well as more general (and in some cases exact) inhomogeneous cosmological models with initial singularities, can isotropize through anisotropic damping mechanisms and adiabatic cooling by the expansion of the universe to resemble the standard flrw model at late times . Furthermore, if matter is included in these spacetimes, the effective energy of anisotropy, which generally dominates matter energy at early times, tends to become less important over time as the universe expands . The geometry in these matter - filled anisotropic spacetimes thus evolves towards an isotropic state . Quantum mechanical effects have also been proposed as a possible anisotropy damping mechanism that takes place in the early universe to convert vacuum geometric energy to radiation energy and create particles . All of this suggests that the early time behavior and effects of local and global geometry are highly uncertain, despite the fact that the standard flrw model is generally accepted as accurate enough for the late time description of our universe . Further detailed information on homogeneous (including blanch!) Universes, as well as more general classes of inhomogeneous cosmological models can be found in [105, 158, 70]. This section is organized to track the chronological events in the history of the early or relativistic universe, focusing mainly on four defining moments: (1) the big bang singularity and the dynamics of the very early universe, (ii) inflation and its generic nature, (iii) qcd phase transitions, and (iv) primordial nucleosynthesis and the freeze - out of the light elements . Belinsky, lifshitz, and khalatnikov (blk) [32, 33] and misner discovered that the einstein equations in the vacuum homogeneous bianchi type ix (or mixmaster) cosmology exhibit complex behavior and are sensitive to initial conditions as the big bang singularity is approached . In particular, the solutions near the singularity are described qualitatively by a discrete map [30, 32] representing different sequences of kasner spacetimes (2)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$d{s^2} = d{t^2} + {t^{2{p_1}}}d{x^2} + {t^{2{p_2}}}d{y^2} + {t^{2{p_3}}}d{z^2},$$\end{document} with time changing exponents pi, but otherwise constrained by p1 + p2 + p3 = p12 + p22 + p32 - 1 . Because this discrete mapping of kasner epochs is chaotic mixmaster behavior can be studied in the context of hamiltonian dynamics, with a hamiltonian (3)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$2\mathcal{h} = - p_\omega ^2 + p _ + ^2 + p _ - ^2 + {e^{4\alpha}} (v - 1),$$\end{document} and a semi - bounded potential arising from the spatial scalar curvature (whose level curves are plotted in figure 3) (4)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$v = 1 + \frac{1}{3}{e^ {- 8{\beta _ +}}} + \frac{2}{3}{e^{4{\beta _ +}}} \left [{\cosh (4\sqrt 3 {\beta _ -}) - 1} \right] - \frac{4}{3}{e^ {- 2{\beta _ +}}} \cosh (2\sqrt 3 {\beta _ -}), $$\end{document} where e and are the scale factor and anisotropies, and p and p are the corresponding conjugate variables . A solution of this hamiltonian system is an infinite sequence of kasner epochs with parameters that change when the phase space trajectories bounce off the potential walls, which become exponentially steep as the system evolves towards the singularity . Figure 3contour plot of the bianchi type ix potential v, where are the anisotropy canonical coordinates . Seven level surfaces are shown at equally spaced decades ranging from 10 to 10 . For large isocontours (v> 1), the potential is open and exhibits a strong triangular symmetry with three narrow channels extending to spatial infinity . For v <1, the potential closes and is approximately circular for 1 . Contour plot of the bianchi type ix potential v, where are the anisotropy canonical coordinates . Seven level surfaces are shown at equally spaced decades ranging from 10 to 10 . For large isocontours (v> 1), the potential is open and exhibits a strong triangular symmetry with three narrow channels extending to spatial infinity . For v <1, the potential closes and is approximately circular for 1 . Some of the earliest numerical simulations of this dynamical system were performed by matzner, shepley, and warren, and moser, matzner and ryan who followed phase space trajectories and provided examples of solutions for various initial conditions and special cases . Several, more recent, numerical calculations of the equations arising from equations (3) and (4) have indicated that the liapunov exponents of the system vanish, in apparent contradiction with the discrete maps [53, 89], and putting into question the characterization of mixmaster dynamics as chaotic . However, it has since been shown that the usual definition of the liapunov exponents is ambiguous in this case as it is not invariant under time reparametrizations, and that with a different time variable one obtains positive exponents [35, 73]. Also, coordinate independent methods using fractal basin boundaries to map basins of attraction in the space of initial conditions indicates mixmaster spacetimes to be chaotic . Although blk conjectured that local mixmaster oscillations might be the generic behavior for singularities in more general classes of spacetimes, it is only recently that this conjecture has begun to be supported by numerical evidence (see section 3.1.2 and). As noted in section 3.1.1, an interesting and important issue in classical cosmology is whether or not the generic big bang singularity is locally of a mixmaster or blk type, with complex oscillatory behavior as the singularity is approached . Many of the bianchi models, including the kasner solutions (2), are characterized by either open or no potentials in the hamiltonian framework, and exhibit essentially monotonic or asymptotically velocity term dominated (avtd) behavior . Considering inhomogeneous spacetimes, isenberg and moncrief proved that the singularity in the polarized gowdy model is avtd type, as are more general polarized t symmetric cosmologies . Early numerical studies using symplectic methods confirmed avtd behavior and found no evidence of blk oscillations, even in t r spacetimes with u(1) symmetry (although there were concerns about the solutions due to difficulties in resolving steep spatial gradients near the singularity, which were addressed later by hern and stewart for the gowdy t models). However, weaver et al . Established the first evidence through numerical simulations that mixmaster dynamics can occur in a class of inhomogeneous spacetimes which generalize the bianchi type vi0 model with a magnetic field and two - torus symmetry . Berger and moncrief [41, 42] also demonstrated that u(1) symmetric vacuum cosmologies exhibit local mixmaster dynamics consistent with the blk conjecture, despite numerical difficulties in resolving steep gradients (which they managed by enforcing the hamiltonian constraint and spatially averaging the solutions). Another more recent example supporting the blk conjecture is provided by garfinkle, who finds local oscillating behavior approaching the singularity in closed vacuum (but otherwise generic) spacetimes with no assumed symmetry in the initial data . The inflation paradigm is frequently invoked to explain the flatness (0 1 in the context of the flrw model) and nearly isotropic nature of the universe at large scales, attributing them to an era of exponential expansion at about 10 s after the big bang . This expansion acts as a strong dampening mechanism to random curvature or density fluctuations, and may be a generic attractor in the space of initial conditions . An essential component needed to trigger this inflationary phase is a scalar or inflaton field representing spin zero particles . The vacuum energy of the field acts as an effective cosmological constant that regulates gut symmetry breaking, particle creation, and the reheating of the universe through an interaction potential v () derived from the form of symmetry breaking that occurs as the temperature of the universe decreases . Early analytic studies focused on simplified models, treating the interaction potential as flat near its local maximum where the field does not evolve significantly and where the formal analogy to an effective cosmological constant approximation is more precise . However, to properly account for the complexity of inflaton fields, the full dynamical equations (see section 6.2.2) must be considered together with consistent curvature, matter and other scalar field couplings . Also, many different theories of inflation and vacuum potentials have been proposed (see, for example, a recent review by lyth and motto and an introductory article by liddle), and it is not likely that simplified models can elucidate the full nonlinear complexity of scalar fields (see section 3.3) nor the generic nature of inflation . In order to study whether inflation can occur for arbitrary anisotropic and inhomogeneous data, many numerical simulations have been carried out with different symmetries, matter types and perturbations . Extended the planar cosmological code of centrella and wilson [59, 60] (see section 3.6.1) to include a scalar field and simulate the onset of inflation in the early universe with an inhomogeneous higgs field and a perfect fluid with a radiation equation of state p = /3, where p is the pressure and is the energy density . Their results suggest that whether inflation occurs or not can be sensitive to the shape of the potential . In particular, if the shape is flat enough and satisfies the slow - roll conditions (essentially upper bounds on v/ and v/ near the false vacuum 0), even large initial fluctuations of the higgs field do not prevent inflation . They considered two different forms of the potential: a coleman - weinberg type with interaction strength and distance between true and false vacua (5)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$v(\phi) = \lambda {\phi ^4}\left [{\ln \left ({\frac{{{\phi ^2}}}{{{\sigma ^2}}}} \right) - \frac{1}{2}} \right] + \frac{{\lambda {\sigma ^4}}}{2},$$\end{document} which is very flat near the false vacuum and does inflate; and a rounder type (6)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$v(\phi) = \lambda {({\phi ^2} - {\sigma ^2})^2},$$\end{document} which, for their parameter combinations, does not . Goldwirth and piran studied the onset of inflation with inhomogeneous initial conditions for closed, spherically symmetric spacetimes containing a massive scalar field and radiation field sources (described by a massless scalar field). In all the cases they considered, the radiation field damps quickly and only an inhomogeneous massive scalar field remains to inflate the universe . They find that small inhomogeneities tend to reduce the amount of inflation and large initial inhomogeneities can even suppress the onset of inflation . Suitable initial values (local conditions for which an equivalent homogeneous universe will inflate) over a domain of several horizon lengths in order to trigger inflation . Investigated the simplest bianchi model (type v) background that admits velocities or tilt in order to address the question of how the universe can choose a uniform reference frame at the exit from inflation, since the de sitter metric does not have a preferred frame . However, if inflation persists, the wave behavior eventually freezes in and all velocities go to zero at least as rapidly as tanh r, where is the relativistic tilt angle (a measure of velocity), and r is a typical scale associated with the radius of the universe . Their results indicate that the velocities eventually go to zero as inflation carries all spatial variations outside the horizon, and that the answer to the posed question is that memory is retained and the universe is never really de sitter . In addition to the inflaton field, one can consider other sources of inhomogeneity, such as gravitational waves . Although linear waves in de sitter space will decay exponentially and disappear, it is unclear what will happen if strong waves exist . Shinkai and maeda investigated the cosmic no - hair conjecture with gravitational waves and a cosmological constant () in 1d plane symmetric vacuum spacetimes, setting up gaussian pulse wave data with amplitudes \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$0.02\lambda \leqslant max (\sqrt i) \leqslant 80\lambda $$\end{document} and widths 0.08lh l 2.5lh, where i is the invariant constructed from the 3-riemann tensor and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${l_h} = \sqrt {3/\lambda} $$\end{document} is the horizon scale . They also considered colliding plane waves with amplitudes \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$40\lambda \leqslant \max they find that for any large amplitude or small width inhomogeneity in their parameter sets, the nonlinearity of gravity has little effect and the spacetime always evolves towards de sitter . The previous paragraphs discussed results from highly symmetric spacetimes, but the possibility of inflation remains to be established for more general inhomogeneous and nonperturbative data . In an effort to address this issue, kurki - suonio et al . Investigated fully three - dimensional inhomogeneous spacetimes with a chaotic inflationary potential v() = /4 . For the small scale runs, the grid dimensions were initially set equal to the hubble length so the inhomogeneities are well inside the horizon and the dynamical time scale is shorter than the expansion or hubble time . As a result, the perturbations oscillate and damp, while the field evolves and the spacetime inflates . For the large scale runs, the inhomogeneities are outside the horizon and they do not oscillate . They maintain their shape without damping and, because larger values of lead to faster expansion, the inhomogeneity in the expansion becomes steeper in time since the regions of large and high inflation stay correlated . Many studies of cosmological models generally reduce complex physical systems to simplified or even analytically integrable systems . In sufficiently simple models the dynamical behavior (or fate) of the universe however, the universe is composed of many different nonlinear interacting fields including the inflaton field which can exhibit complex chaotic behavior . For example, cornish and levin consider a homogenous isotropic closed flrw model with various conformal and minimally coupled scalar fields (see section 6.2.2). They find that even these relatively simple models exhibit chaotic transients in their early preinflationary evolution . This behavior in exiting the planck era is characterized by fractal basins of attraction, with attractor states being to (1) inflate forever, (ii) inflate over a short period of time then collapse, or (iii) collapse without inflating . Investigated the dynamics of the pre - inflationary phase of the universe and its exit to inflation in a closed flrw model with radiation and a minimally coupled scalar field . They observe complex behavior associated with saddle - type critical points in phase space that give rise to desitter attractors with multiple chaotic exits to inflation that depend on the structure of the scalar field potential . These results suggest that distinctions between exits to inflation may be manifested in the process of reheating and as a selected spectrum of inhomogeneous perturbations influenced by resonance mechanisms in curvature oscillations . This could possibly lead to fractal patterns in the density spectrum, gravitational waves, cosmic microwave background radiation (cmbr) field, or galaxy distribution that depend on specific details including the number of fields, the nature of the fields, and their interaction potentials . Investigated the nonlinear behavior of colliding kink - antikink solitons or domain walls described by a single real scalar field with self - interaction potential (-1). Domain walls can form as topological defects during the spontaneous symmetry breaking period associated with phase transitions, and can seed density fluctuations in the large scale structure . For collisional time scales much smaller than the cosmological expansion, they find that whether a kink - antikink collision results in a bound state or a two - soliton solution depends on a fractal structure observed in the impact velocity parameter space . The fractal structure arises from a resonance condition associated with energy exchanges between translational modes and internal shape - mode oscillations . The impact parameter space is a complex self - similar fractal composed of sequences of different n - bounce (the number of bounces or oscillations in the transient semi - coherent state) reflection windows separated by regions of oscillating bion states (see figure 4). They compute the lyapunov exponents for parameters in which a bound state forms to demonstrate the chaotic nature of the bion oscillations . Figure 4fractal structure of the transition between reflected and captured states for colliding kinkantikink solitons in the parameter space of impact velocity for a (-1) scalar field potential . The top image (a) shows the 2-bounce windows in dark with the rightmost region (v / c> 0.25) representing the single - bounce regime above which no captured state exists, and the leftmost white region (v / c <0.19) representing the captured state below which no reflection windows exist . Between these two marker velocities, there are 2-bounce reflection states of decreasing widths separated by regions of bion formation . Zooming in on the domain outlined by the dashed box, a self - similar structure is apparent in the middle image (b), where now the dark regions represent 3-bounce windows of decreasing widths . Zooming in once again on the boundaries of these 3-bounce windows, a similar structure is found as shown in the bottom image (c) but with 4-bounce reflection windows . This pattern of self - similarity characterized by n - bounce windows is observed at all scales investigated numerically . Fractal structure of the transition between reflected and captured states for colliding kinkantikink solitons in the parameter space of impact velocity for a (-1) scalar field potential . The top image (a) shows the 2-bounce windows in dark with the rightmost region (v / c> 0.25) representing the single - bounce regime above which no captured state exists, and the leftmost white region (v / c <0.19) representing the captured state below which no reflection windows exist . Between these two marker velocities, there are 2-bounce reflection states of decreasing widths separated by regions of bion formation . Zooming in on the domain outlined by the dashed box, a self - similar structure is apparent in the middle image (b), where now the dark regions represent 3-bounce windows of decreasing widths . Zooming in once again on the boundaries of these 3-bounce windows, a similar structure is found as shown in the bottom image (c) but with 4-bounce reflection windows . This pattern of self - similarity characterized by n - bounce windows is observed at all scales investigated numerically . The standard picture of cosmology assumes that a phase transition (associated with chiral symmetry breaking following the electroweak transition) occurred at approximately 10 s after the big bang to convert a plasma of free quarks and gluons into hadrons . Although this transition can be of significant cosmological importance, it is not known with certainty whether it is of first order or higher, and what the astrophysical consequences might be on the subsequent state of the universe . For example, the transition may play a potentially observable role in the generation of primordial magnetic fields . The qcd transition may also give rise to important baryon number inhomogeneities which can affect the distribution of light element abundances from primordial big bang nucleosynthesis . The distribution of baryons may be influenced hydrodynamically by the competing effects of phase mixing and phase separation, which arise from any inherent instability of the interface surfaces separating regions of different phase . Unstable modes, if they exist, will distort phase boundaries and induce mixing and diffusive homogenization through hydrodynamic turbulence [102, 112, 95, 4, 137]. In an effort to support and expand theoretical studies, a number of one - dimensional numerical simulations have been carried out to explore the behavior of growing hadron bubbles and decaying quark droplets in simplified and isolated geometries . Considered a first order phase transition and the nucleation of hadronic bubbles in a supercooled quarkgluon plasma, solving the relativistic lagrangian equations for disconnected and evaporating quark regions during the final stages of the phase transition . They investigated numerically a single isolated quark drop with an initial radius large enough so that surface effects can be neglected . The droplet evolves as a self - similar solution until it evaporates to a sufficiently small radius that surface effects break the similarity solution and increase the evaporation rate . Their simulations indicate that, in neglecting long - range energy and momentum transfer (by electromagnetically interacting particles) and assuming that baryon number is transported with the hydrodynamical flux, the baryon number concentration is similar to what is predicted by chemical equilibrium calculations . Kurki - suonio and laine studied the growth of bubbles and the decay of droplets using a one - dimensional spherically symmetric code that accounts for a phenomenological model of the microscopic entropy generated at the phase transition surface . Incorporating the small scale effects of finite wall width and surface tension, but neglecting entropy and baryon flow through the droplet wall, they simulate the process by which nucleating bubbles grow and evolve to a similarity solution . They also compute the evaporation of quark droplets as they deviate from similarity solutions at late times due to surface tension and wall effects . . Carried out parameter studies of bubble growth for both the qcd and electroweak transitions in planar symmetry, demonstrating that hadron bubbles reach a stationary similarity state after a short time when bubbles grow at constant velocity . They investigated the stationary state using numerical and analytic methods, accounting also for preheating caused by shock fronts . Fragile and anninos performed two - dimensional simulations of first order qcd transitions to explore the nature of interface boundaries beyond linear stability analysis, and determine if they are stable when the full nonlinearities of the relativistic scalar field and hydrodynamic system of equations are accounted for . They used results from linear perturbation theory to define initial fluctuations on either side of the phase fronts and evolved the data numerically in time for both deflagration and detonation configurations . No evidence of mixing instabilities or hydrodynamic turbulence was found in any of the cases they considered, despite the fact that they investigated the parameter space predicted to be potentially unstable according to linear analysis . They also investigated whether phase mixing can occur through a turbulence - type mechanism triggered by shock proximity or disruption of phase fronts . They considered three basic cases (see image sequences in figures 5, 6, and 7 below): interactions between planar and spherical deflagration bubbles, collisions between planar and spherical detonation bubbles, and a third case simulating the interaction between both deflagration and detonation systems initially at two different thermal states . Their results are consistent with the standard picture of cosmological phase transitions in which hadron bubbles expand as spherical condensation fronts, undergoing regular (non - turbulent) coalescence, and eventually leading to collapsing spherical quark droplets in a medium of hadrons . This is generally true even in the detonation cases which are complicated by greater entropy heating from shock interactions contributing to the irregular destruction of hadrons and the creation of quark nuggets . Figure 5image sequence of the scalar field from a 2d calculation showing the interaction of two deflagration systems (one planar wall propagating from the right side, and one spherical bubble nucleating from the center . The physical size of the grid is set to 1000 x 1000 fm and resolved by 512 x 512 zones . The run time of the simulation is about two sound crossing times, where the sound speed is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$c/\sqrt 3 $$\end{document}, so the shock fronts leading the condensing phase fronts travel across the grid twice . The hot quark (cold hadron) phases have smaller (larger) scalar field values and are represented by black (color) in the colormap . Figure 6image sequence of the scalar field from a 2d calculation showing the interaction of two detonation systems (one planar wall propagating from the right side, and one spherical bubble nucleating from the center . The physical size of the grid is set to 1000 x 1000 fm and resolved by 1024 x 1024 zones . Figure 7image sequence of the scalar field from a 2d calculation showing the interaction of shock and rarefaction waves with a deflagration wall (initiated at the left side and a detonation wall (starting from the right . A shock and rarefaction wave travel to the right and left, respectively, from the temperature discontinuity located initially at the grid center (the right half of the grid is at a higher temperature . The physical size of the domain is set to 1806.1 x 451.53 fm and resolved by 2048 x 512 zones . Image sequence of the scalar field from a 2d calculation showing the interaction of two deflagration systems (one planar wall propagating from the right side, and one spherical bubble nucleating from the center . The physical size of the grid is set to 1000 x 1000 fm and resolved by 512 x 512 zones . The run time of the simulation is about two sound crossing times, where the sound speed is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$c/\sqrt 3 $$\end{document}, so the shock fronts leading the condensing phase fronts travel across the grid twice . The hot quark (cold hadron) phases have smaller (larger) scalar field values and are represented by black (color) in the colormap . Image sequence of the scalar field from a 2d calculation showing the interaction of two detonation systems (one planar wall propagating from the right side, and one spherical bubble nucleating from the center . The physical size of the grid is set to 1000 x 1000 fm and resolved by 1024 x 1024 zones . Image sequence of the scalar field from a 2d calculation showing the interaction of shock and rarefaction waves with a deflagration wall (initiated at the left side and a detonation wall (starting from the right . A shock and rarefaction wave travel to the right and left, respectively, from the temperature discontinuity located initially at the grid center (the right half of the grid is at a higher temperature . The physical size of the domain is set to 1806.1 x 451.53 fm and resolved by 2048 x 512 zones . However, fragile and anninos also note a deflagration instability or acceleration mechanism evident in their third case for which they assume an initial thermal discontinuity in space separating different regions of nucleating hadron bubbles . The passage of a rarefaction wave (generated at the thermal discontinuity) through a slowly propagating deflagration can significantly accelerate the condensation process, suggesting that the dominant modes of condensation in an early universe which super - cools at different rates within causally connected domains may be through supersonic detonations or fast moving (nearly sonic) deflagrations . A similar speculation was made by kamionkowski and freese who suggested that deflagrations become unstable to perturbations and are converted to detonations by turbulent surface distortion effects . However, in the simulations, deflagrations are accelerated not from turbulent mixing and surface distortion, but from enhanced super - cooling by rarefaction waves . In multi - dimensions, the acceleration mechanism can be exaggerated further by upwind phase mergers due to transverse flow, surface distortion, and mode dissipation effects, a combination that may result in supersonic front propagation speeds, even if the nucleation process began as a slowly propagating deflagration . Observations of the light elements produced during big bang nucleosynthesis following the quark hadron phase transition (roughly 10 - 2 - 102 s after the big bang) are in good agreement with the standard model of our universe (see section 2.2). However, it is interesting to investigate other more general models to assert the role of shear and curvature on the nucleosynthesis process, and place limits on deviations from the standard model . Rothman and matzner considered primordial nucleosynthesis in anisotropic cosmologies, solving the strong reaction equations leading to he . They find that the concentration of he increases with increasing shear due to time scale effects and the competition between dissipation and enhanced reaction rates from photon heating and neutrino blue shifts . Their results have been used to place a limit on anisotropy at the epoch of nucleosynthesis . Kurki - suonio and matzner extended this work to include 30 strong 2-particle reactions involving nuclei with mass numbers a 7, and to demonstrate the effects of anisotropy on the cosmologically significant isotopes h, he, he and li as a function of the baryon to photon ratio . They conclude that the effect of anisotropy on h and he is not significant, and the abundances of he and li increase with anisotropy in accord with . Furthermore, it is possible that neutron diffusion, the process whereby neutrons diffuse out from regions of very high baryon density just before nucleosynthesis, can affect the neutron to proton ratio in such a way as to enhance deuterium and reduce he compared to a homogeneous model . However, plane symmetric, general relativistic simulations with neutron diffusion show that the neutrons diffuse back into the high density regions once nucleosynthesis begins there - thereby wiping out the effect . As a result, although inhomogeneities influence the element abundances, they do so at a much smaller degree then previously speculated . The numerical simulations also demonstrate that, because of the back diffusion, a cosmological model with a critical baryon density cannot be made consistent with helium and deuterium observations, even with substantial baryon inhomogeneities and the anticipated neutron diffusion effect . Gravitational waves are an inevitable product of the einstein equations, and one can expect a wide spectrum of wave signals propagating throughout our universe due to anisotropic and inhomogeneous metric and matter fluctuations, collapsing matter structures, ringing black holes, and colliding neutron stars, for example . The discussion here is restricted to the pure vacuum field dynamics and the fundamental nonlinear behavior of gravitational waves in numerically generated cosmological spacetimes . Centrella and matzner [57, 58] studied a class of plane symmetric cosmologies representing gravitational inhomogeneities in the form of shocks or discontinuities separating two vacuum expanding kasner cosmologies (2). By a suitable choice of parameters, the constraint equations can be satisfied at the initial time with a euclidean 3-surface and an algebraic matching of parameters across the different kasner regions that gives rise to a discontinuous extrinsic curvature tensor . They performed both numerical calculations and analytical estimates using a green s function analysis to establish and verify (despite the numerical difficulties in evolving discontinuous data) certain aspects of the solutions, including gravitational wave interactions, the formation of tails, and the singularity behavior of colliding waves in expanding vacuum cosmologies . Shortly thereafter, centrella and wilson [59, 60] developed a polarized plane symmetric code for cosmology, adding also hydrodynamic sources with artificial viscosity methods for shock capturing and barton s method for monotonic transport . The evolutions are fully constrained (solving both the momentum and hamiltonian constraints at each time step) and use the mean curvature slicing condition . [9, 11, 7], implementing more robust numerical methods, an improved parametric treatment of the initial value problem, and generic unpolarized metrics . In applications of these codes, centrella investigated nonlinear gravitational waves in minkowski space and compared the full numerical solutions against a first order perturbation solution to benchmark certain numerical issues such as numerical damping and dispersion . A second order perturbation analysis was used to model the transition into the nonlinear regime . Considered small and large perturbations in the two degenerate kasner models: p1 = p3 = 0 or 2/3, and p2 = 1 or 1/3, respectively, where p2 are parameters in the kasner metric (2). Carrying out a second order perturbation expansion and computing the newman - penrose (np) scalars, riemann invariants and bel - robinson vector, they demonstrated, for their particular class of spacetimes, that the nonlinear behavior is in the coulomb (or background) part represented by the leading order term in the np scalar 2, and not in the gravitational wave component . For standing - wave perturbations, the dominant second order effects in their variables are an enhanced monotonic increase in the background expansion rate, and the generation of oscillatory behavior in the background spacetime with frequencies equal to the harmonics of the first order standing - wave solution . Expanding these investigations of the coulomb nonlinearity, anninos and mckinney used a gauge invariant perturbation formalism to construct constrained initial data for general relativistic cosmological sheets formed from the gravitational collapse of an ideal gas in a critically closed flrw background they compared results to the newtonian zeldovich solution over a broad range of field strengths and flows, and showed that the enhanced growth rates of nonlinear modes (in both the gas density and riemann curvature invariants) accelerate the collapse process significantly compared to newtonian and perturbation theory . They also computed the back - reaction of these structures to the mean cosmological expansion rate and found only a small effect, even for cases with long wavelengths and large amplitudes . These structures were determined to produce time - dependent gravitational potential signatures in the cmbr (essentially fully relativistic rees - sciama effects) comparable to, but still dominated by, the large scale sachs - wolfe anisotropies . This confirmed, and is consistent with, the assumptions built into newtonian calculations of this effect . Two additional examples of general relativistic codes developed for the purpose of investigating dynamical behaviors in non - flat, vacuum, cosmological topologies are attributed to holcomb and ove . Holcomb considered vacuum axisymmetric models to study the structure of general relativity and the properties of gravitational waves in non - asymptotically flat spacetimes . The code was based on the adm 3 + 1 formalism and used kasner matching conditions at the outer edges of the mesh, mean curvature slicing, and a shift vector to enforce the isothermal gauge in order to simplify the metric and to put it in a form that resembles quasi - isotropic coordinates . However, a numerical instability was observed in cases where the mesh domain exceeded the horizon size . This was attributed to the particular gauge chosen, which does not appear well - suited to the kasner metric as it results in super - luminal coordinate velocities beyond the horizon scale . Ove developed an independent code based on the adm formalism to study cosmic censorship issues, including the nature of singular behavior allowed by the einstein equations, the role of symmetry in the creation of singularities, the stability of cauchy horizons, and whether black holes or a ring singularity can be formed by the collision of strong gravitational waves . Ove adopted periodic boundary conditions with 3-torus topology and a single killing field, and therefore generalizes to two dimensions the planar codes discussed in the previous section . This code also used a variant of constant mean curvature slicing, was fully constrained at each time cycle, and the shift vector was chosen to put the metric into a (time - dependent) conformally flat form at each spatial hypersurface . The phrase physical cosmology is generally associated with the large (galaxy and cluster) scale structure of the post - recombination epoch where gravitational effects are modeled approximately by newtonian physics on an uniformly expanding, matter dominated flrw background . A discussion of the large scale structure is included in this review since any viable model of our universe which allows a regime where strongly general relativistic effects are important must match onto the weakly relativistic (or newtonian) regime . Also, since certain aspects of this regime are directly observable, one can hope to constrain or rule out various cosmological models and/or parameters, including the density (0), hubble (h0 = 100 h km s mpc), and cosmological (a) constants . Due to the vast body of literature on numerical simulations dealing with the post - recombination epoch, only a very small fraction of published work can be reviewed in this paper . Hence, the following summary is limited to cover just a few aspects of computational physical cosmology, and in particular those that can potentially be used to discriminate between cosmological model parameters, even within the realm of the standard model . For a general overview of theoretical and observational issues associated with structure formation, the reader is referred to [132, 131], and to for a broad review of numerical simulations (and methods) of structure formation . The cosmic microwave background radiation (cmbr) is a direct relic of the early universe, and currently provides the deepest probe of evolving cosmological structures . Although the cmbr is primarily a uniform black body spectrum throughout all space, fluctuations or anisotropies in the spectrum can be observed at very small levels to correlate with the matter density distribution . Comparisons between observations and simulations generally support the mostly isotropic, standard big bang model, and can be used to constrain the various proposed matter evolution scenarios and cosmological parameters . For example, sky survey satellite observations [34, 149] suggest a flat a - dominated universe with scale - invariant gaussian fluctuations that is consistent with numerical simulations of large sale structure formation (e.g., galaxy clusters, lya forest). As shown in the timeline of figure 8, cmbr signatures can be generally classified into two main components: primary and secondary anisotropies, separated by a surface of last scattering (sols). Both of these components include contributions from two distinctive phases: a surface marking the threshold of decoupling of ions and electrons from hydrogen atoms in primary signals, and a surface of reionization marking the start of multiphase secondary contributions through nonlinear structure evolution, star formation, and radiative feedback from the small scales to the large . Figure 8historical time - line of the cosmic microwave background radiation showing the start of photon / nuclei combination, the surface of last scattering (sols), and the epoch of reionization due to early star formation . The times are represented in years (to the right and redshift (to the left . Primary anisotropies are collectively attributed to the early effects at the last scattering surface and the large scale sachs - wolfe effect . Secondary anisotropies arise from path integration effects, reionization smearing, and higher order interactions with the evolving nonlinear structures at relatively low redshifts . Historical time - line of the cosmic microwave background radiation showing the start of photon / nuclei combination, the surface of last scattering (sols), and the epoch of reionization due to early star formation . The times are represented in years (to the right and redshift (to the left . Primary anisotropies are collectively attributed to the early effects at the last scattering surface and the large scale sachs - wolfe effect . Secondary anisotropies arise from path integration effects, reionization smearing, and higher order interactions with the evolving nonlinear structures at relatively low redshifts . The black body spectrum of the isotropic background is essentially due to thermal equilibrium prior to the decoupling of ions and electrons, and few photon - matter interactions after that . At sufficiently high temperatures, prior to the decoupling epoch, matter was completely ionized into free protons, neutrons, and electrons . The cmb photons easily scatter off electrons, and frequent scattering produces a blackbody spectrum of photons through three main processes that occur faster than the universe expands: compton scattering in which photons transfer their momentum and energy to electrons if they have significant energy in the electron s rest frame . This is approximated by thomson scattering if the photon s energy is much less than the rest mass . Inverse compton scattering is also possible in which sufficiently energetic (relativistic) electrons can blueshift photons.double compton scattering can both produce and absorb photons, and thus is able to thermalize photons to a planck spectrum (unlike compton scattering which conserves photon number, and, although it preserves a planck spectrum, relaxes to a bose - einstein distribution).bremsstrahlung emission of electromagnetic radiation due to the acceleration of electrons in the vicinity of ions . This also occurs in reverse (free - free absorption) since charged particles can absorb photons . In contrast to coulomb scattering, which maintains thermal equilibrium among baryons without affecting photons, bremsstrahlung tends to relax photons to a planck distribution . Compton scattering in which photons transfer their momentum and energy to electrons if they have significant energy in the electron s rest frame . This is approximated by thomson scattering if the photon s energy is much less than the rest mass . Inverse compton scattering is also possible in which sufficiently energetic (relativistic) electrons can blueshift photons . Double compton scattering can both produce and absorb photons, and thus is able to thermalize photons to a planck spectrum (unlike compton scattering which conserves photon number, and, although it preserves a planck spectrum, relaxes to a bose - einstein distribution). Bremsstrahlung emission of electromagnetic radiation due to the acceleration of electrons in the vicinity of ions . This also occurs in reverse (free - free absorption) since charged particles can absorb photons . In contrast to coulomb scattering, which maintains thermal equilibrium among baryons without affecting photons, bremsstrahlung tends to relax photons to a planck distribution . Although the cmbr is a unique and deep probe of both the thermal history of the early universe and primordial perturbations in the matter distribution, the associated anisotropies are not exclusively primordial in nature . Important modifications to the cmbr spectrum, from both primary and secondary components, can arise from large scale coherent structures, even well after the photons decouple from the matter at redshift z 10, due to gravitational redshifting, lensing, and scattering effects . The most important contributions to primary anisotropies between the start of decoupling and the surface of last scattering include the following effects: sachs - wolfe (sw) effect: gravitational redshift of photons between potentials at the sols and the present . It is the dominant effect at large angular scales comparable to the horizon size at decoupling (2 /).doppler effect: dipolar patterns are imprinted in the energy distribution from the peculiar velocities of the matter structures acting as the last scatterers of the photons.acoustic peaks: anisotropies at intermediate angular scales (0.1 <0 <2) are atttributed to small scale processes occurring until decoupling, including acoustic oscillations of the baryon - photon fluid from primordial density inhomogeneities . This gives rise to acoustic peaks in the thermal spectrum representing the sound horizon scale at decoupling.sols damping: the electron capture rate is only slightly faster than photodissociation at the start of decoupling, causing the sols to have a finite thickness (z 100). Scattering over this interval damps fluctuations on scales smaller than the sols depth (<10).silk damping: photons can diffuse out of overdense regions, dragging baryons with them over small angular scales . Sachs - wolfe (sw) effect: gravitational redshift of photons between potentials at the sols and the present . It is the dominant effect at large angular scales comparable to the horizon size at decoupling (2 /). Doppler effect: dipolar patterns are imprinted in the energy distribution from the peculiar velocities of the matter structures acting as the last scatterers of the photons . Acoustic peaks: anisotropies at intermediate angular scales (0.1 <0 <2) are atttributed to small scale processes occurring until decoupling, including acoustic oscillations of the baryon - photon fluid from primordial density inhomogeneities . This gives rise to acoustic peaks in the thermal spectrum representing the sound horizon scale at decoupling . Sols damping: the electron capture rate is only slightly faster than photodissociation at the start of decoupling, causing the sols to have a finite thickness (z 100). Scattering over this interval damps fluctuations on scales smaller than the sols depth (<10). Silk damping: photons can diffuse out of overdense regions, dragging baryons with them over small angular scales . All of these mechanisms perturb the black body background radiation since thermalization processes are not efficient at redshifts smaller than 10 . Secondary anisotropies consist of two principal effects, gravitational and scattering . Some of the more important gravitational contributions to the cmb include: early isw effect: photon contributions to the energy density of the universe may be nonnegligible compared to ordinary matter (dark or baryonic) at the last scattering . The decreasing contribution of photons in time results in a decay of the potential, producing the early integrated sachs - wolfe (isw) effect.late isw effect: in open cosmological models or models with a cosmological constant, the gravitational potential decays at late times due to a greater rate of expansion compared to flat spacetimes, producing the late isw effect on large angular scales.rees-sciama effect: evolving nonlinear strucutures (e.g., galaxies and clusters) generate time - varying potentials which can seed asymmetric energy shifts in photons crossing potential wells from the sols to the present.lensing: in contrast to isw effects which change the energy but not directions of the photons, gravitational lensing deflects the paths without changing the energy . This effectively smears out the imaging of the sols.proper motion: compact objects such as galaxy clusters can imprint a dipolar pattern in the cmb as they move across the sky.gravitational waves: perturbations in the spacetime fabric affect photon paths, energies, and polarizations, predominantly at scales larger than the horizon at decoupling . Early isw effect: photon contributions to the energy density of the universe may be nonnegligible compared to ordinary matter (dark or baryonic) at the last scattering . The decreasing contribution of photons in time results in a decay of the potential, producing the early integrated sachs - wolfe (isw) effect . Late isw effect: in open cosmological models or models with a cosmological constant, the gravitational potential decays at late times due to a greater rate of expansion compared to flat spacetimes, producing the late isw effect on large angular scales . Rees - sciama effect: evolving nonlinear strucutures (e.g., galaxies and clusters) generate time - varying potentials which can seed asymmetric energy shifts in photons crossing potential wells from the sols to the present . Lensing: in contrast to isw effects which change the energy but not directions of the photons, gravitational lensing deflects the paths without changing the energy . Proper motion: compact objects such as galaxy clusters can imprint a dipolar pattern in the cmb as they move across the sky . Gravitational waves: perturbations in the spacetime fabric affect photon paths, energies, and polarizations, predominantly at scales larger than the horizon at decoupling . Secondary scattering effects are associated with reionization and their significance depends on when and over what scales it takes place . Early reionization leads to large optical depths and greater damping due to secondary scattering . Over large scales, reionization has little effect since these scales are not in causal contact . At small scales, some of the more important secondary scattering effects include: thomson scattering: photons are scattered by free electrons at sufficiently large optical depths achieved when the universe undergoes a global reionization at late times . This damps out fluctuations since energies are averaged over different directions in space.vishniac effect: in a reionized universe, high order coupling between the bulk flow of electrons and their density fluctuations generates new anisotropies at small angles.thermal sunyaev - zeldovich effect: inverse compton scattering of the cmb by hot electrons in the intracluster gas of a cluster of galaxies distorts the black body spectrum of the cmb . Low frequency photons will be shifted to high frequencies.kinetic sunyaev - zeldovich effect: the peculiar velocities of clusters produces anisotropies via a doppler effect to shift the temperature without distorting the spectral form . Its effect is proportional to the product of velocity and optical depth.polarization: scattering of anisotropic radiation affects polarization due to the angular dependence of scattering . Polarization in turn affects anisotropies through a similar dependency and tends to damp anisotropies . Thomson scattering: photons are scattered by free electrons at sufficiently large optical depths achieved when the universe undergoes a global reionization at late times . Vishniac effect: in a reionized universe, high order coupling between the bulk flow of electrons and their density fluctuations generates new anisotropies at small angles . Thermal sunyaev - zeldovich effect: inverse compton scattering of the cmb by hot electrons in the intracluster gas of a cluster of galaxies distorts the black body spectrum of the cmb . Kinetic sunyaev - zeldovich effect: the peculiar velocities of clusters produces anisotropies via a doppler effect to shift the temperature without distorting the spectral form . Polarization: scattering of anisotropic radiation affects polarization due to the angular dependence of scattering . Polarization in turn affects anisotropies through a similar dependency and tends to damp anisotropies . To make meaningful comparisons between numerical models and observed data, all of these (low and high order) effects from both the primary and secondary contributions (see for example section 4.1.4 and [94, 101]) must be incorporated self - consistently into any numerical model, and to high accuracy in order to resolve and distinguish amongst the various weak signals . The following sections describe some work focused on incorporating many of these effects into a variety of large - scale numerical cosmological models . Many efforts based on linear perturbation theory have been carried out to estimate temperature anisotropies in our universe (for example see and references cited in [131, 94]). Although such linearized approaches yield reasonable results, they are not well - suited to discussing the expected imaging of the developing nonlinear structures in the microwave background . Also, because photons are intrinsically coupled to the baryon and dark matter thermal and gravitational states at all spatial scales, a fully self - consistent treatment is needed to accurately resolve the more subtle features of the cmbr . This can be achieved with a ray - tracing approach based on monte - carlo methods to track individual photons and their interactions through the evolving matter distributions . A fairly complete simulation involves solving the geodesic equations of motion for the collisionless dark matter which dominate potential interactions, the hydrodynamic equations for baryonic matter with high mach number shock capturing capability, the transport equations for photon trajectories, a reionization model to reheat the universe at late times, the chemical kinetics equations for the ion and electron concentrations of the dominant hydrogen and helium gases, and the photon - matter interaction terms describing scattering, redshifting, depletion, lensing, and doppler effects . Such an approach has been developed by anninos et al ., and applied to a hot dark matter (hdm) model of structure formation . In order to match both the observed galaxy - galaxy correlation function and lobe measurements of the cmbr, they find, for that model and neglecting reionization, the cosmological parameters are severely constrained to 2h 1, where 0 and h are the density and hubble parameters respectively . In models where the igm does not reionize, the probability of scattering after the photonmatter decoupling epoch is low, and the sachs - wolfe effect dominates the anisotropies at angular scales larger than a few degrees . However, if reionization occurs, the scattering probability increases substantially and the matter structures, which develop large bulk motions relative to the comoving background, induce doppler shifts on the scattered cmbr photons and leave an imprint of the surface of last scattering . The induced fluctuations on subhorizon scales in reionization scenarios can be a significant fraction of the primordial anisotropies, as observed by tuluie et al . Also using ray - tracing methods . They considered two possible scenarios of reionization: a model that suffers early and gradual (eg) reionization of the igm as caused by the photoionizing uv radiation emitted by decaying neutrinos, and the late and sudden (ls) scenario as might be applicable to the case of an early generation of star formation activity at high redshifts . Considering the hdm model with 0 = 1 and h = 0.55, which produces cmbr anisotropies above current lobe limits when no reionization is included (see section 4.1.4), they find that the eg scenario effectively reduces the anisotropies to the levels observed by lobe and generates smaller doppler shift anisotropies than the ls model, as demonstrated in figure 9 . The ls scenario of reionization is not able to reduce the anisotropy levels below the lobe limits, and can even give rise to greater doppler shifts than expected at decoupling . Figure 9temperature fluctuations (t / t) in the cmbr due to the primary sachs - wolfe (sw) effect and secondary integrated sw, doppler, and thomson scattering effects in a critically closed model . The top two plates are results with no reionization and baryon fractions 0.02 (plate 1, 4 4, t / t |rms = 2.8 10), and 0.2 (plate 2, 8 x 8, t / t |rms = 3.4 x 10). The bottom two plates are results from an early and gradual reionization scenario of decaying neutrinos with baryon fraction 0.02 (plate 3, 4 4, t / t|rms = 1.3 10; and plate 4, 8 8, at / t |rms = 1.4 10). If reionization occurs, the scattering probability increases and anisotropies are damped with each scattering event . At the same time, matter structures develop large bulk motions relative to the comoving background and induce doppler shifts on the cmb . The imprint of this effect from last scattering can be a significant fraction of primary anisotropies . Temperature fluctuations (t / t) in the cmbr due to the primary sachs - wolfe (sw) effect and secondary integrated sw, doppler, and thomson scattering effects in a critically closed model . The top two plates are results with no reionization and baryon fractions 0.02 (plate 1, 4 4, t / t |rms = 2.8 10), and 0.2 (plate 2, 8 x 8, t / t |rms = 3.4 x 10). The bottom two plates are results from an early and gradual reionization scenario of decaying neutrinos with baryon fraction 0.02 (plate 3, 4 4, t / t|rms = 1.3 10; and plate 4, 8 8, at / t |rms = 1.4 10). If reionization occurs, the scattering probability increases and anisotropies are damped with each scattering event . At the same time, matter structures develop large bulk motions relative to the comoving background and induce doppler shifts on the cmb . The imprint of this effect from last scattering can be a significant fraction of primary anisotropies . Additional sources of cmbr anisotropy can arise from the interactions of photons with dynamically evolving matter structures and nonstatic gravitational potentials . Considered the impact of nonlinear matter condensations on the cmbr in 0 1 cold dark matter (cdm) models, focusing on the relative importance of secondary temperature anisotropies due to three different effects: (1) time - dependent variations in the gravitational potential of nonlinear structures as a result of collapse or expansion (the rees - sciama effect), (ii) proper motion of nonlinear structures such as clusters and superclusters across the sky, and (iii) the decaying gravitational potential effect from the evolution of perturbations in open models . They applied the ray - tracing procedure of to explore the relative importance of these secondary anisotropies as a function of the density parameter 0 and the scale of matter distributions . They find that secondary temperature anisotropies are dominated by the decaying potential effect at large scales, but that all three sources of anisotropy can produce signatures of order t / t|rms 10 as shown in figure 10 . Figure 10secondary anisotropies from the proper motion of galaxy clusters across the sky and rees - sciama effects are presented in the upper - left image over 8 8 in a critically closed cold dark matter model . The corresponding column density of matter over the same region (z = 0.43, z = 0.025) is displayed in the upper - right, clearly showing the dipolar nature of the proper motion effect . Anisotropies arising from decaying potentials in an open = 0.3 model over a scale of 8 8 are shown in the bottom left image, along with the gravitational potential over the same region (z = 0.33, z = 0.03) in the bottom right, demonstrating a clear anti - correlation . Maximum temperature fluctuations in each simulation are t / t = (5 10, 1.0 10) respectvely . Secondary anisotropies are dominated by decaying potentials at large scales, but all three sources (decaying potential, proper motion, and r - s) produce signatures of order 10 . Secondary anisotropies from the proper motion of galaxy clusters across the sky and rees - sciama effects are presented in the upper - left image over 8 8 in a critically closed cold dark matter model . The corresponding column density of matter over the same region (z = 0.43, z = 0.025) is displayed in the upper - right, clearly showing the dipolar nature of the proper motion effect . Anisotropies arising from decaying potentials in an open = 0.3 model over a scale of 8 8 are shown in the bottom left image, along with the gravitational potential over the same region (z = 0.33, z = 0.03) in the bottom right, demonstrating a clear anti - correlation . Maximum temperature fluctuations in each simulation are t / t = (5 10, 1.0 10) respectvely . Secondary anisotropies are dominated by decaying potentials at large scales, but all three sources (decaying potential, proper motion, and r - s) produce signatures of order 10 . In addition to the effects discussed in this section, many other sources of secondary anisotropies (as mentioned in section 4.1, including gravitational lensing, the vishniac effect accounting for matter velocities and flows into local potential wells, and the sunyaev - zeldovich (sz) (section 4.5.4) distortions from the compton scattering of cmb photons by electrons in the hot cluster medium) can also be fairly significant . See [94, 152, 28, 80, 93] for more thorough discussions of the different sources of cmbr anisotropies . Observations of gravitational lenses provide measures of the abundance and strength of nonlinear potential fluctuations along the lines of sight to distant objects . Since these calculations are sensitive to the gravitational potential, they may be more reliable than galaxy and velocity field measurements as they are not subject to the same ambiguities associated with biasing effects . Also, because different cosmological models predict different mass distributions, especially at the higher redshifts, lensing calculations can potentially be used to confirm or discard competing cosmological models . As an alternative to solving the computationally demanding lens equations, cen et al . Developed an efficient scheme to identify regions with surface densities capable of generating multiple images accurately for splittings larger than three arcseconds . They applied this technique to a standard cdm model with 0 = 1, and found that this model predicts more large angle splittings (> 8) than are known to exist in the observed universe . Their results suggest that the standard cdm model should be excluded as a viable model of our universe . A similar analysis for a flat low density cdm model with a cosmological constant (0 = 0.3, /3h02 = 0.7) suggests a lower and perhaps acceptable number of lensing events . However, an uncertainty in their studies is the nature of the lenses at and below the resolution of the numerical grid . They model the lensing structures as simplified singular isothermal spheres (sis) with no distinctive cores . Large angle splittings are generally attributed to larger structures such as clusters of galaxies, and there are indications that clusters have small but finite core radii more rcore 2030h kpc . Core radii of this size can have an important effect on the probability of multiple imaging . Flores and primack considered the effects of assuming two different kinds of splitting sources: isothermal spheres with small but finite core radii and radial density profiles (r + rcore2), and spheres with a hernquist density profile r (r + a), where rcore 2030 h kpc and a 300 h kpc . They find that the computed frequency of large - angle splittings, when using the nonsingular profiles, can potentially decrease by more than an order of magnitude relative to the sis case and can bring the standard cdm model into better agreement with observations . They stress that lensing events are sensitive to both the cosmological model (essentially the number density of lenses) and to the inner lens structure, making it difficult to probe the models until the structure of the lenses, both observationally and numerically, is better known . In cdm cosmogonies, the fluctuation spectrum at small wavelengths has a logarithmic dependence at mass scales smaller than 108 solar masses, which indicates that all small scale fluctuations in this model collapse nearly simultaneously in time . Furthermore, the cooling in these fluctuations is dominated by the rotational / vibrational modes of hydrogen molecules that were able to form using the free electrons left over from recombination and those produced by strong shock waves as catalysts . The first structures to collapse may be capable of producing pop iii stars and have a substantial influence on the subsequent thermal evolution of the intergalactic medium, as suggested by figure 2, due to the radiation emitted by the first generation stars as well as supernova driven winds . To know the subsequent fate of the universe and which structures will survive or be destroyed by the uv background, it is first necessary to know when and how the first stars formed . Ostriker and gnedin have carried out high resolution numerical simulations of the reheating and reionization of the universe due to star formation bursts triggered by molecular hydrogen cooling . Accounting for the chemistry of the primeval hydrogen / helium plasma, self - shielding of the gas, radiative cooling, and a phenomenological model of star formation, they find that two distinct star populations form: the first generation pop iii from h2 cooling prior to reheating at redshift z 14; and the second generation pop ii at z <10 when the virial temperature of the gas clumps reaches 10 k and hydrogen line cooling becomes efficient . Star formation slows in the intermittent epoch due to the depletion of h2 by photo - destruction and reheating . In addition, the objects which formed pop iii stars also initiate pop ii sequences when their virial temperatures reach 10 k through continued mass accretion . In resolving the details of a single star forming region in a cdm universe, abel et al . [2, 3] implemented a non - equilibrium radiative cooling and chemistry model [1, 21] together with the hydrodynamics and dark matter equations, evolving nine separate atomic and molecular species (h, h, he, he, he, h, h2-, h2, and e, according to the reactive network described in section 6.4.1) on nested and adaptively refined numerical grids . They follow the collapse and fragmentation of primordial clouds over many decades in mass and spatial dynamical range, finding a core of mass 200 m forms from a halo of about 10 m (where a significant number fraction of hydrogen molecules are created) after less than one percent of the halo gas cools by molecular line emission . Use a different smoothed particle hydrodynamics (sph) technique and a six species model (h, h, h, h2 +, h2, and e) to investigate the initial mass function of the first generation pop iii stars . They evolve an isolated 3 peak of mass 2 10m which collapses at redshift z 30 and forms clumps of mass 10 10 m which then grow by accretion and merging, suggesting that the very first stars were massive and in agreement with . The implications of an early era of massive star populations on the thermal and chemical state of the intergalactic medium was investigated by yoshida et al . . They considered the effects of feedback and radiation transfer in early structure formation simulations to show that a significant fraction of the igm can be ionized and polluted by metals from the first stars to form and become supernovae by z 15, thus affecting subsequent stellar populations . They also argue that observed elemental abundances in the intracluster medium are not affected by metals originating from the first stars . The ly forest represents the optically thin (at the lyman edge) component of quasar absorption systems (qas), a collection of absorption features in quasar spectra extending back to high redshifts . Qas are effective probes of the matter distribution and the physical state of the universe at early epochs when structures such as galaxies are still forming and evolving . The relative lack of constraining observational data at the intermediate to high redshifts (0 <z <5), where differences between competing cosmological models are more pronounced, suggests that qas can potentially yield valuable and discriminating observational data . Many complex multi - component numerical simulations have been performed of the lyman forest, which include the effects of dark matter (n - body), baryons (hydrodynamics), chemical composition (reactive networks), and microphysical response (radiative cooling and heating). See, for example, [67, 118, 166], which represent some of the earliest comprehensive simulations . For the most part, all these calculations have been able to fit the observations reasonably well, including the column density and doppler width distributions, the size of absorbers, and the line number evolution . Despite the fact that the cosmological models and parameters are different in each case, the simulations give roughly similar results provided that the proper ionization bias is used, bion (bh)/, where b is the baryonic density parameter, h is the hubble parameter and is the photoionization rate at the hydrogen lyman edge . (however, see for a discussion of the sensitivity of statistical properties on numerical resolution .) A theoretical paradigm has thus emerged from these calculations in which lya absorption lines originate from the relatively smaller scale structure in pregalactic or intergalactic gas through the bottom - up hierarchical formation picture in cdm - like universes . The absorption features originate in structures exhibiting a variety of morphologies commonly found in numerical simulations (see figure 11), including fluctuations in underdense regions, spheroidal minihalos, and filaments extending over scales of a few mpc . Expanded on earlier work to compare several lya statistical measures from five different background cosmological models, including standard critical density cold dark matter (cdm), open cdm, flat cdm with a cosmological constant, standard cdm with a tilted density spectrum, and a flat model with mixed hot and cold dark matter . All models were chosen to match local or low redshift observations, and most were also consistent with lobe measurements of the cmbr . The calculations were designed to establish which statistics are sensitive to different cosmological models . In particular, they find that the line number count above a given column density threshold is relatively insensitive to background models . On the other hand, the shape of the optical depth probability distribution function is strongly correlated to the amount of small scale power in density fluctuations, and is thus a good discriminator among models on scales of a few hundred kpc . Followed up with more detailed comparisons of ly systems in several cosmologies with observed high resolution qso spectra . Although all models are consistent with previous studies in that they give reasonably good statistical agreement with observed lya properties, under closer scrutiny none of the numerical models they considered passed all the tests, which included spectral flux, wavelet decomposed amplitude, and absorption line profile distributions . They suggest that comparisons might be improved, particularly in optically thin systems, by more energy injection into the igm from late he reionization or supernovae - driven winds, or by a larger baryon fraction . Clusters of galaxies are the largest gravitationally bound systems known to be in quasi - equilibrium . This allows for reliable estimates to be made of their mass as well as their dynamical and thermal attributes . The richest clusters, arising from 3 density fluctuations, can be as massive as 1010 m, and the environment in these structures is composed of shock heated gas with temperatures of order 10mbox 10 k which emits thermal bremsstrahlung and line radiation at x - ray energies . Also, because of their spatial size of 1 h mpc and separations of order 50 h mpc, they provide a measure of nonlinearity on scales close to the perturbation normalization scale 8 h mpc . Observations of the substructure, distribution, luminosity, and evolution of galaxy clusters are therefore likely to provide signatures of the underlying cosmology of our universe, and can be used as cosmological probes in the observable redshift range 0 z 1 . Thomas et al . Investigated the internal structure of galaxy clusters formed in high resolution n - body simulations of four different cosmological models, including standard, open, and flat but low density universes . They find that the structure of relaxed clusters is similar in the critical and low density universes, although the critical density models contain relatively more disordered clusters due to the freeze - out of fluctuations in open universes at late times . The profiles of relaxed clusters are very similar in the different simulations since most clusters are in a quasi - equilibrium state inside the virial radius and generally follow the universal density profile of navarro et al . . There does not appear to be a strong cosmological dependence in the profiles as suggested by previous studies of clusters formed from pure power law initial density fluctuations . However, because more young and dynamically evolving clusters are found in critical density universes, thomas et al . Suggest that it may be possible to discriminate among the density parameters by looking for multiple cores in the substructure of the dynamic cluster population . They note that a statistical population of 20 clusters could distinguish between open and critically closed universes . Figure 11distribution of the gas density at redshift z = 3 from a numerical hydrodynamics simulation of the lya forest with a cdm spectrum normalized to second year cobs observations, hubble parameter of h = 0.5, a comoving box size of 9.6 mpc, and baryonic density of b = 0.06 composed of 76% hydrogen and 24% helium . The isosurfaces represent baryons at ten times the mean density and are color coded to the gas temperature (dark blue = 3 10 k, light blue = 3 10 k). The higher density contours trace out isolated spherical structures typically found at the intersections of the filaments . A single random slice through the cube is also shown, with the baryonic overdensity represented by a rainbow - like color map changing from black (minimum) to red (maximum . The he mass fraction is shown with a wire mesh in this same slice . To emphasize fine structure in the minivoids, the mass fraction in the overdense regions has been rescaled by the gas overdensity wherever it exceeds unity . Distribution of the gas density at redshift z = 3 from a numerical hydrodynamics simulation of the lya forest with a cdm spectrum normalized to second year cobs observations, hubble parameter of h = 0.5, a comoving box size of 9.6 mpc, and baryonic density of b = 0.06 composed of 76% hydrogen and 24% helium . The isosurfaces represent baryons at ten times the mean density and are color coded to the gas temperature (dark blue = 3 10 k, light blue = 3 10 k). The higher density contours trace out isolated spherical structures typically found at the intersections of the filaments . A single random slice through the cube is also shown, with the baryonic overdensity represented by a rainbow - like color map changing from black (minimum) to red (maximum . The he mass fraction is shown with a wire mesh in this same slice . To emphasize fine structure in the minivoids, the mass fraction in the overdense regions has been rescaled by the gas overdensity wherever it exceeds unity . The evolution of the number density of rich clusters of galaxies can be used to compute 0 and 8 (the power spectrum normalization on scales of 8 h mpc) when numerical simulation results are combined with the constraint 800.5 0.5, derived from observed present - day abundances of rich clusters . Bahcall et al . Computed the evolution of the cluster mass function in five different cosmological model simulations and find that the number of high mass (coma - like) clusters in flat, low as models (i.e., the standard cdm model with 8 0.5) decreases dramatically by a factor of approximately 10 from z = 0 to z 0.5 . For low 0, high 8 models, the data result in a much slower decrease in the number density of clusters over the same redshift interval . Comparing these results to observations of rich clusters in the real universe, which indicate only a slight evolution of cluster abundances to redshifts z 0.51, they conclude that critically closed standard cdm and mixed dark matter (mdm) models are not consistent with the observed data . The models which best fit the data are the open models with low bias (0 = 0.3 0.1 and 8 = 0.85 0.5), and flat low density models with a cosmological constant (0 = 0.34 0.13 and 0 + = 1). The evolution of the x - ray luminosity function, as well as the number, size and temperature distribution of galaxy clusters are all potentially important discriminants of cosmological models and the underlying initial density power spectrum that gives rise to these structures . Because the x - ray luminosity (principally due to thermal bremsstrahlung emission from electron / ion interactions in the hot fully ionized cluster medium) is proportional to the square of the gas density, the contrast between cluster and background intensities is large enough to provide a window of observations that is especially sensitive to cluster structure . Comparisons of simulated and observed x - ray functions may be used to deduce the amplitude and shape of the fluctuation spectrum, the mean density of the universe, the mass fraction of baryons, the structure formation model, and the background cosmological model . Several groups [49, 56] have examined the properties of x - ray clusters in high resolution numerical simulations of a standard cdm model normalized to lobe . Although the results are very sensitive to grid resolution (see for a discussion of the effects from resolution constraints on the properties of rich clusters), their primary conclusion, that the standard cdm model predicts too many bright x - ray emitting clusters and too much integrated x - ray intensity, is robust since an increase in resolution will only exaggerate these problems . On the other hand, similar calculations with different cosmological models [56, 52] suggest reasonable agreement of observed data with cold dark matter + cosmological constant (acdm), cold + hot dark matter (chdm), and open or low density cdm (ocdm) evolutions due to different universal expansions and density power spectra . The sunyaev - zeldovich (sz) effect is the change in energy that cmb photons undergo when they scatter in hot gas typically found in cores of galaxy clusters . Thermal sz is the dominant mechanism which arises from thermal motion of gas in the temperature range 1010 k, and is described by the compton y parameter (7)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y = {\sigma _ t}\int {\frac{{{n_e}{k_b}{t_e}}}{{{m_e}{c^2}}}} dl,$$\end{document} where t = 6.65 10 cm is the thomson cross - section, me, ne and te are the electron rest mass, density and temperature, c is the speed of light, kb is boltzmann s constant, and the integration is performed over the photon path . Photon temperature anisotropies are related to the y parameter by t / t 2y in the rayleigh - jeans limit . The kinetic sz effect is a less influential doppler shift resulting from the bulk motion of ionized gas relative to the rest frame of the cmb . Springel et al . Used a tree / sph code to study the sz effects in a cdm cosmology with a cosmological constant . They find a mean amplitude for thermal sz (y = 3.8 10) just below current observed upper limits, and a kinetic sz about 30 times smaller in power . Da silva et al . Compared thermal sz maps in three different cosmologies (low density +, critical density, and low density open model). Their results are also below current limits: y 4 10 for low density models with contributions from over a broad redshift range z 5, and y 1 10 for the critical density model with contributions mostly from z <1 . However, further simulations are needed to explore the dependence of the sz effect on microphysics, i.e., cooling, star formation, supernovae feedback . Cosmological sheets, or pancakes, form as overdense regions collapse preferentially along one axis . Originally studied by zeldovich in the context of neutrino - dominated cosmologies, sheets are ubiquitous features in nonlinear structure formation simulations of cdm - like models with baryonic fluid, and manifest on a spectrum of length scales and formation epochs . Gas collapses gravitationally into flattened sheet structures, forming two plane parallel shock fronts that propagate in opposite directions, heating the infalling gas . Sheets are characterized by essentially five distinct components: the preshock inflow, the postshock heated gas, the strongly cooling / recombination front separating the hot gas from the cold, the cooled postshocked gas, and the unshocked adiabatically compressed gas at the center . Several numerical calculations [47, 145, 22] have been performed of these systems which include baryonic fluid with hydrodynamical shock heating, ionization, recombination, dark matter, thermal conductivity, and radiative cooling (compton, bremsstrahlung, and atomic line cooling), in both one and two spatial dimensions to assert the significance of each physical process and to compute the fragmentation scale . See also where fully general relativistic numerical calculations of cosmological sheets are presented in plane symmetry, including relativistic hydrodynamical shock heating and consistent coupling to spacetime curvature . In addition, it is well known that gas which cools to 1 ev through hydrogen line cooling will likely cool faster than it can recombine . This nonequilibrium cooling increases the number of electrons and ions (compared to the equilibrium case) which, in turn, increases the concentrations of h and h2 +, the intermediaries that produce hydrogen molecules h2 . If large concentrations of molecules form, excitations of the vibrational / rotational modes of the molecules can efficiently cool the gas to well below 1 ev, the minimum temperature expected from atomic hydrogen line cooling . Because the gas cools isobarically, the reduction in temperature results in an even greater reduction in the jeans mass, and the bound objects which form from the fragmentation of h2 cooled cosmological sheets may be associated with massive stars or star clusters . Anninos and norman have carried out 1d and 2d high resolution numerical calculations to investigate the role of hydrogen molecules in the cooling instability and fragmentation of cosmological sheets, considering the collapse of perturbation wavelengths from 1 mpc to 10 mpc . They find that for the more energetic (long wavelength) cases, the mass fraction of hydrogen molecules reaches nh2/nh 3 10, which cools the gas to 4 10 ev and results in a fragmentation scale of 9 10 m. this represents reductions of 50 and 10 in temperature and jeans mass respectively when compared, as in figure 12, to the equivalent case in which hydrogen molecules were neglected . Figure 12two different model simulations of cosmological sheets are presented: a six species model including only atomic line cooling (left, and a nine species model including also hydrogen molecules (right . The evolution sequences in the images show the baryonic overdensity and gas temperature at three redshifts following the initial collapse at z = 5 . In each figure, the vertical axis is 32 kpc long (parallel to the plane of collapse and the horizontal axis extends to 4 mpc on a logarithmic scale to emphasize the central structures . Differences in the two cases are observed in the cold pancake layer and the cooling flows between the shock front and the cold central layer . When the central layer fragments, the thickness of the cold gas layer in the six (nine) species case grows to 3 (0.3) kpc and the surface density evolves with a dominant transverse mode corresponding to a scale of approximately 8 (1) kpc . Assuming a symmetric distribution of matter along the second transverse direction, the fragment masses are approximately 10 (10) solar masses . Two different model simulations of cosmological sheets are presented: a six species model including only atomic line cooling (left, and a nine species model including also hydrogen molecules (right . The evolution sequences in the images show the baryonic overdensity and gas temperature at three redshifts following the initial collapse at z = 5 . In each figure, the vertical axis is 32 kpc long (parallel to the plane of collapse and the horizontal axis extends to 4 mpc on a logarithmic scale to emphasize the central structures . Differences in the two cases are observed in the cold pancake layer and the cooling flows between the shock front and the cold central layer . When the central layer fragments, the thickness of the cold gas layer in the six (nine) species case grows to 3 (0.3) kpc and the surface density evolves with a dominant transverse mode corresponding to a scale of approximately 8 (1) kpc . Assuming a symmetric distribution of matter along the second transverse direction, the fragment masses are approximately 10 (10) solar masses . However, the above calculations neglected important interactions arising from self - consistent treatments of radiation fields with ionizing and photo - dissociating photons and self - shielding effects . Susa and umemura studied the thermal history and hydrodynamical collapse of pancakes in a uv background radiation field . They solve the radiative transfer of photons together with the hydrodynamics and chemistry of atomic and molecular hydrogen species . Although their simulations were restricted to one - dimensional plane parallel symmetry, they suggest a classification scheme distinguishing different dynamical behavior and galaxy formation scenarios based on the uv background radiation level and a critical mass corresponding to 1 2 density fluctuations in a standard cdm cosmology . These level parameters distinguish galaxy formation scenarios as they determine the local thermodynamics, the rate of h2 line emissions and cooling, the amount of starburst activity, and the rate and mechanism of cloud collapse . This review is intended to provide a flavor of the variety of numerical cosmological calculations performed of different events occurring throughout the history of our universe . The topics discussed range from the strong field dynamical behavior of spacetime geometry at early times near the big bang singularity and the epoch of inflation, to the late time evolution of large scale matter fluctuations and the formation of clusters of galaxies . For the most part, the nature of the calculations dealing with the early or late universe can be distinguished by their basic motivations . For example, calculations of early universe phenomena are designed to explore alternative cosmological models or topologies, and in some cases, different theories of gravity . They also tend to study the nature of topological singularities, geometric effects, and the problem of initial conditions or the origin of matter distributions . Calculations of the late universe are generally focused to establish bounds on cosmological parameters in the context of the standard model, to resolve the correct structure formation scenario, to model the complex multi - physics interactions operating at vastly different scales, and to systematically compare invariant measures against observed data for both model validation and interpreting observations . Although a complete, self - consistent, and accurate description of our universe is impractical considering the complex multi - scale and multi - physics requirements, a number of enlightening results have been demonstrated through computations . For example, both monotonic avtd and chaotic oscillatory blk behavior have been found in the asymptotic approach to the initial singularity in a number of inhomogeneous cosmological models, though some issues remain concerning the generic nature of the singularity, including the effect of nonlinear mode coupling of spatial gradients to the oscillatory history, and the behavior in non - vacuum spacetimes with arbitrary global topology . Numerical calculations suggest that scalar fields play an important complicated role in the nonlinear or chaotic evolution of cosmological models with consequences for the triggering (or not) of inflation and the subsequent dynamics of structure formation . It is possible, for example, that these fields can influence the details of inflation and have observable ramifications as fractal patterns in the density spectrum, gravitational waves, galaxy distribution, and cosmic microwave background anisotropies . Numerical simulations have also been used to place limits on curvature anisotropies and cosmological parameters at early times by considering primordial nucleosynthesis reactions in anisotropic and inhomogeneous cosmologies . Finally, the large collection of calculations performed of the post - recombination epoch related to large scale structure formation (for example, cosmic microwave background, gravitational lensing, ly absorption, and galaxy cluster simulations) have placed strong constraints on the standard model parameters and structure formation scenarios when compared to observations . Considering the range of models consistent with inflation, the preponderance of observational, theoretical and computational data suggest a best fit model of the late structure - forming universe that is spatially flat with a cosmological constant and a small tilt in the power spectrum . These best fit model parameters, and in particular the introduction of a cosmological constant, are generally consistent with recent evidence of dark energy from supernovae and high precision cmbr observations . Obviously many fundamental issues remain unresolved, including even the overall shape or topology of the cosmological model which best describes our universe throughout its entire history . However, the field of numerical cosmology has matured in the development of computational techniques, the modeling of microphysics, and in taking advantage of current trends in computing technologies, to the point that it is now possible to perform high resolution multiphysics simulations and carry out reliable comparisons of numerical models with observational data . Some basic equations relevant for fully relativistic as well as perturbative cosmological calculations are summarized in this section, including the complete einstein equations, choices of kinematical conditions, initial data constraints, stress - energy - momentum tensors, dynamical equations for various matter sources, and the newtonian counterparts on background isotropic models . The most common is the adm or 3 + 1 form which decomposes spacetime into layers of three - dimensional space - like hypersurfaces, threaded by a time - like normal congruence n = (1, -)/, where we use greek (latin) indices to specify spacetime (spatial) quantities . The general spacetime metric is written as (8)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$d{s^2} = (- {\alpha ^2} + {\beta _ i}{\beta ^i})d{t^2} + 2{\beta _ i}d{x^i}dt + {\gamma _ {ij}}d{x^i}d{x^j},$$\end{document} where and are the lapse function and shift vector respectively, and ij is the spatial 3-metric . The lapse defines the proper time between consecutive layers of spatial hypersurfaces, the shift propagates the coordinate system from 3-surface to 3-surface, and the induced 3-metric is related to the 4-metric via v = gv + nnv . The einstein equations are written as four constraint equations, (9)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{(3)}r + {k^2} - {k_{ij}}{k^{ij}} = 16\pi g{\rho _ h},$$\end{document} (10)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\nabla _ i}({k^{ij}} - {\gamma ^{ij}}k) = 8\pi g{s^j},$$\end{document} twelve evolution equations, (11)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}{c}} {{\partial _ t}{\gamma _ {ij}} = {\mathcal{l}_\beta} {\gamma _ {ij}} - 2\alpha {k_{ij}},\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;} \\ {{\partial _ t}{k_{ij}} = {\mathcal{l}_\beta} {k_{ij}} - {\nabla _ i}{\nabla _ j}\alpha + \alpha \left [{{} ^{(3)}{r_{ij}} - 2{k_{ik}}k_j^k + k\;{k_{ij}} - 8\pi g\left ({{s_{ij}} - \frac{1}{2}s{\gamma _ {ij}} + \frac{1}{2}{\rho _ h}{\gamma _ {ij}}} \right)} \right]} \end{array},$$\end{document} and four kinematical or coordinate conditions for the lapse function and shift vector that can be specified arbitrarily (see section 6.1.2). Here kij is the extrinsic curvature describing how the 3-metric evolves along a time - like normal vector . It is formally defined as the lie derivative (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathcal{l}_n}$$\end{document}) of the spatial metric along the vector \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${n^\mu}, {k_{ij}} \equiv {\mathcal{l}_n}{\gamma _ {ij}}/2$$\end{document}. Also, (12)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}{c}} {{\mathcal{l}_\beta} {\gamma _ {ij}} = {\nabla _ i}{\beta _ j} + {\nabla _ j}{\beta _ i},\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;} \\ {{\mathcal{l}_\beta} {k_{ij}} = {\beta ^k}{\nabla _ k}{k_{ij}} + {k_{ik}}{\nabla _ j}{\beta ^k} + {k_{kj}}{\nabla _ i}{\beta ^k},} \end{array}$$\end{document} where i is the spatial covariant derivative with respect to ij, rij is the spatial ricci tensor, k is the trace of the extrinsic curvature kij, and g is the gravitational constant . The matter source terms h, s, sij and s = sii as seen by the observers at rest in the time slices are obtained from the appropriate projections (13)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\rho _ h} = {n^\mu} {n^\nu} {t_{\mu \nu}}, $$\end{document} (14)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s_i} = - \gamma _ i^\mu {n^\nu} {t_{\mu \nu}}, $$\end{document} (15)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s_{ij}} = - \gamma _ i^\mu \gamma _ j^\nu {t_{\mu \nu}}, $$\end{document} for the energy density, momentum density and spatial stresses, respectively . Here c = 1, and greek (latin) indices refer to 4(3)-dimensional quantities . It is worth noting that several alternative formulations of einstein s equations have been suggested, including hyperbolic systems which have nice mathematical properties, and conformal traceless systems [147, 31] which make use of a conformal decomposition of the 3-metric and trace free part of the extrinsic curvature aij = kij - ij k/3 . Introducing \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\tilde \gamma _ {ij}} = {e^ {- 4\psi}} {\gamma _ {ij}}$$\end{document} with e so that the determinant of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\tilde \gamma _ {ij}}$$\end{document} is unity, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\tilde a_{ij}} = {e^ {- 4\psi}} {a_{ij}}$$\end{document}, evolution equations can be written in the conformal traceless system for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\psi, {\tilde \gamma _ j},k,{\tilde a_{ij}}$$\end{document} and the conformal connection functions, though not all of these variables are independent . However, it is not yet entirely clear which of these methods is best suited for generic problems . For example, hyperbolic forms are easier to characterize mathematically than adm and may potentially be more stable, but can suffer from greater inaccuracies by introducing additional equations or higher order derivatives . Conformal treatments are considered to be generally more stable, but can be less accurate than traditional adm for short term evolutions . Many numerical methods have been used to solve the einstein equations, including variants of the leapfrog scheme, the method of mccormack, the two - step lax - wendroff method, and the iterative crank - nicholson scheme, among others . For a discussion and comparison of the different methods, the reader is referred to, where a systematic study was carried out on spherically symmetric black hole spacetimes using traditional adm, and to [31, 6, 13] (and references therein) which discuss the stability and accuracy of hyperbolic and conformal treatments . For cosmological simulations, one typically takes the shift vector to be zero, hence \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathcal{l}_\beta} {\gamma _ {ij}} = {\mathcal{l}_\beta} {k_{ij}} = 0$$\end{document}. However, the shift can be used advantageously in deriving conditions to maintain the 3-metric in a particular form, and to simplify the resulting differential equations [59, 60]. See also describing an approximate minimum distortion gauge condition used to help stabilize simulations of general relativistic binary clusters and neutron stars . Several options can be implemented for the lapse function, including geodesic (= 1), algebraic, and mean curvature slicing . The algebraic condition takes the form (16)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha = {f_1}({x^\mu}) {f_2}(\gamma), $$\end{document} where f1(x) is an arbitrary function of coordinates x, and f2() is a dynamic function of the determinant of the 3-metric . This choice is computationally cheap, simple to implement, and certain choices of f2 (i.e., 1 + ln) can mimic maximal slicing in its singularity avoidance properties . On the other hand, numerical solutions derived from harmonically - sliced foliations can exhibit pathological gauge behavior in the form of coordinate shocks or singularities which will affect the accuracy, convergence and stability of solutions [5, 86]. Also, evolutions in which the lapse function is fixed by some analytically prescribed method (either geodesic or near - geodesic) can be unstable, especially for sub - horizon scale perturbations . The mean curvature slicing equation is derived by taking the trace of the extrinsic curvature evolution equation (11), (17)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\nabla ^i}{\nabla _ i}\alpha = \alpha [{k_{ij}}{k^{ij}} + 4\pi g({\rho _ h} + s)] + {\beta ^i}{\nabla _ i}k - {\partial _ t}k,$$\end{document} and assuming k = k(t), which can either be specified arbitrarily or determined by imposing a boundary condition on the lapse function after solving equation (17) for the quantity /tk . It is also useful to consider replacing tk in equation (17) with an exponentially driven form as suggested by eppley, to reduce gauge drifting and numerical errors in maximal and mean curvature sliced spacetimes . The mean curvature slicing condition is the most natural one for cosmology as it foliates homogeneous cosmological spacetimes with surfaces of homogeneity . Also, since k represents the convergence of coordinate curves from one slice to the next and if it is constant, then localized caustics (crossing of coordinate curves) and true curvature singularities can be avoided . However, for gowdy spacetimes with two killing fields and topology t r, isenberg and moncrief proved that such foliations do exist and cover the entire spacetime . A different approach to conventional (i.e., 3 + 1 adm) techniques in numerical cosmology has been developed by berger and moncrief . For example, they consider gowdy cosmologies on t x r with the metric (18)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$d{s^2} = {e^ {- \lambda /2}}{e^{\tau /2}} (- {e^ {- 2\tau}} d{\tau ^2} + d{\theta ^2}) + {e^ {- \tau}} [{e^p}d{\sigma ^2} + 2{e^p}q\;d\sigma \;d\delta + ({e^p}{q^2} + {e^ {- p}})d{\delta ^2}],$$\end{document} where, p and q are functions of and, and the coordinates are bounded by 0 (,,) 27. the singularity corresponds to the limit . For small amplitudes, p and q may be identified with + and polarized gravitational wave components and with the background cosmology through which they propagate . An advantage of this formalism is that the initial value problem becomes trivial since p, q and their first derivatives may be specified arbitrarily (although it is not quite so trivial in more general spacetimes). Although the resulting einstein equations can be solved in the usual spacetime discretization fashion, an interesting alternative method of solution is the symplectic operator splitting formulation [40, 121] founded on recognizing that the second order equations can be obtained from the variation of a hamiltonian decomposed into kinetic and potential subhamiltonians, (19)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$h = {h_1} + {h_2} = \frac{1}{2}\int_0^{2\pi} {d\theta (\pi _ p^2 + {e^ {- 2p}}\pi _ q^2) + \frac{1}{2}\int_0^{2\pi} {d\theta \;{e^ {- 2\tau}} (p_{,\theta} ^2 + {e^{2p}}q_{,\theta} ^2)}.} $$\end{document} the symplectic method approximates the evolution operator by (20)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${e^{h\delta \tau}} = {e^{{h_2}\delta \tau /2}}{e^{{h_1}\delta \tau}} {e^{{h_2}\delta \tau /2}} + \mathcal{o}{(\delta \tau) ^3},$$\end{document} although higher order representations are possible . If the two hamiltonian components h1 and h2 are each integrable, their solutions can be substituted directly into the numerical evolution to provide potentially more accurate solutions with fewer time steps . This approach is well - suited for studies of singularities if the asymptotic behavior is determined primarily by the kinetic subhamiltonian, a behavior referred to as asymptotically velocity term dominated (see section 3.1.2 and). Symplectic integration methods are applicable to other spacetimes . For example, berger et al . Developed a variation of this approach to explicitly take advantage of exact solutions for scattering between kasner epochs in mixmaster models . A unique approach to numerical cosmology (and numerical relativity in general) is the method of regge calculus in which spacetime is represented as a complex of 4-dimensional, geometrically flat simplices . The principles of einstein s theory are applied directly to the simplicial geometry to form the curvature, action, and field equations, in contrast to the finite difference approach where the continuum field equations are differenced on a discrete mesh . A 3-dimensional code implementing regge calculus techniques was developed recently by gentle and miller and applied to the kasner cosmological model . They also describe a procedure to solve the constraint equations for time asymmetric initial data on two spacelike hypersurfaces constructed from tetrahedra, since full 4-dimensional regions or lattices are used . The new method is analogous to york s procedure (see and section 6.3) where the conformal metric, trace of the extrinsic curvature, and momentum variables are all freely specifiable . These early results are promising in that they have reproduced the continuum kasner solution, achieved second order convergence, and sustained numerical stability . Discuss an implicit evolution scheme that allows local (vertex) calculations for efficient parallelism . However, the regge calculus approach remains to be developed and applied to more general spacetimes with complex topologies, extended degrees of freedom, and general source terms . A cosmological constant is implemented in the 3 + 1 framework simply by introducing the quantity - /(8g) as an effective isotropic pressure in the stress - energy tensor (21)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${t_{\mu \nu}} = - \frac{\lambda} {{8\pi g}}{g_{\mu \nu}}.$$\end{document} the matter source terms can then be written as (22)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\rho _ h} = \frac{\lambda} {{8\pi g}},$$\end{document} (23)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s_{ij}} = - \frac{\lambda} {{8\pi g}}{\gamma _ {ij}},$$\end{document} with s - 0 . The dynamics of scalar fields is governed by the lagrangian density (24)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathcal{l} = - \frac{1}{2}\sqrt {- g} [{g^{\mu \nu}} {\nabla _ \mu} \phi {\nabla_v} \phi + \xi rf(\phi) + 2v(\phi)], $$\end{document} where r is the scalar riemann curvature, v () is the interaction potential, f() is typically assumed to be f() =, and is the field - curvature coupling constant (= 0 for minimally coupled fields and = 1/6 for conformally coupled fields). Varying the action yields the klein - gordon equation (25)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${g^{\mu \nu}} {\nabla _ \mu} {\nabla _ \nu} \phi - \xi r\phi - {\partial _ \phi} v(\phi) = 0,$$\end{document} for the scalar field and (26)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}{c}} {{t_{\mu \nu}} = (1 - 2\xi) {\nabla _ \mu} \phi {\nabla _ \nu} \phi + \left ({2\xi - \frac{1}{2}} \right){g_{\mu \nu}} {g^{\sigma \lambda}} {\nabla _ \sigma} \phi {\nabla _ \lambda} \phi \;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;\;} \\ {- 2\xi \phi {\nabla _ \mu} {\nabla _ \nu} \phi + 2\xi \phi {g_{\mu \nu}} {g^{\sigma \lambda}} {\nabla _ \sigma} {\nabla _ \lambda} \phi + \xi {g_{\mu \nu}} {\phi ^2} - {g_{\mu \nu}} v(\phi),} \end{array}$$\end{document} for the stress - energy tensor, where gv - rgmv - gvr/2 . For a massive, minimally coupled scalar field, (27)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${t_{\mu \nu}} = {\partial _ \mu} \phi \;{\partial _ \nu} \phi - \frac{1}{2}{g_{\mu \nu}} {g^{\rho \sigma}} {\partial _ \rho} \phi \;{\partial _ \sigma} \phi - {g_{\mu \nu}} v(\phi), $$\end{document} and (28)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\rho _ h} = \frac{1}{2}{\gamma ^{ij}}{\partial _ i}\phi {\partial _ j}\phi + \frac{1}{2}{\eta ^2} + v(\phi), $$\end{document} (29)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s_i} = - \eta {\partial _ i}\phi, $$\end{document} (30)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s_{ij}} = {\gamma _ {ij}}\left ({- \frac{1}{2}{\gamma ^{kl}}{\partial _ k}\phi {\partial _ l}\phi + \frac{1}{2}{\eta ^2} - v(\phi)} \right) + {\partial _ i}\phi {\partial _ j}\phi, $$\end{document} where (31)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\eta = {n^\mu} {\partial _ \mu} \phi = \frac{1}{\alpha} ({\partial _ t} - {\beta ^k}{\partial _ k})\phi, $$\end{document} n = (1, -)/, and v () is a general potential which, for example, can be set to v = in the chaotic inflation model . The covariant form of the scalar field equation (25) can be expanded as in to yield (32)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{1}{\alpha} ({\partial _ t} - {\beta ^k}{\partial _ k})\eta = \frac{1}{{\sqrt \gamma}} {\partial _ i}(\sqrt \gamma {\gamma ^{ij}}{\partial _ j}\phi) + \frac{1}{\alpha} {\gamma ^{ij}}{\partial _ i}\alpha {\partial _ j}\phi + k\eta - {\partial _ \phi} v(\phi), $$\end{document} which, when coupled to equation (31), determines the evolution of the scalar field . The stress - energy tensor for a fluid composed of collisionless particles (or dark matter) can be written simply as the sum of the stress - energy tensors for each particle, (33)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${t_{\mu \nu}} = \sum {mn{u_\mu} {u_\nu},} $$\end{document} where m is the rest mass of the particles, n is the number density in the comoving frame, and u is the 4-velocity of each particle . The matter source terms are (34)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\rho _ h} = \sum {mn{{(\alpha {u^0})}^2},} $$\end{document} (35)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s_i} = \sum {mn{u_i}(\alpha {u^0}),} $$\end{document} (36)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s_{ij}} = \sum {mn{u_i}{u_j}.} $$\end{document} there are two conservation laws: the conservation of particles (nu) = 0, and the conservation of energy - momentum t = 0, where is the covariant derivative in the full 4-dimensional spacetime . Together these conservation laws lead to uu = 0, the geodesic equations of motion for the particles, which can be written out more explicitly in the computationally convenient form (37)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{d{x^i}}}{{dt}} = \frac{{{g^{i\alpha}} {u_\alpha}}} {{{u^0}}},$$\end{document} (38)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{d{u_i}}}{{dt}} = - \frac{{{u_\alpha} {u_\beta} {\partial _ i}{g^{\alpha \beta}}}} {{2{u^0}}},$$\end{document} where x is the coordinate position of each particle, u is determined by the normalization uu = - 1, (39)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{d}{{dt}} = {v^\mu} {\partial _ \mu} = {\partial _ t} + {v^i}{\partial _ i}$$\end{document} is the lagrangian derivative, and v = u / u is the transport velocity of the particles as measured by observers at rest with respect to the coordinate grid . The stress - energy tensor for a perfect fluid is (40)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${t_{\mu \nu}} = \rho h{u_\mu} {u_\nu} + p{g_{\mu \nu}}, $$\end{document} where gv is the 4-metric, h - 1 + + p/ is the relativistic enthalpy, and, p, and u, are the specific internal energy (per unit mass), pressure, rest mass density and four - velocity of the fluid . Defining v - u / u and (41)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$u = - {n_\mu} {u^\mu} = \alpha {u^0} = {(1 + {u^i}{u_i})^{1/2}} = {\left ({1 - \frac{{{v_i}{v^i}}}{{{\alpha ^2}}}} \right)^ {- 1/2}},$$\end{document} as the generalization of the special relativistic boost factor, the matter source terms become (42)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\rho _ h} = \rho h{u^2} - p,$$\end{document} (43)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s_i} = \rho hu{u_i},$$\end{document} (44)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s_{ij}} = p{\gamma _ {ij}} + \rho h{u_i}{u_j}.$$\end{document} the hydrodynamics equations are derived from the normalization of the 4-velocity, uu = 1, the conservation of baryon number, (u) - 0, and the conservation of energy - momentum, t - 0 . The resulting equations can be written in flux conservative form as (45)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial d}}{{\partial t}} + \frac{{\partial (d{v^i})}}{{\partial {x^i}}} = 0,$$\end{document} (46)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial e}}{{\partial t}} + \frac{{\partial (e{v^i})}}{{\partial {x^i}}} + p\frac{{\partial w}}{{\partial t}} + p\frac{{\partial (w{v^i})}}{{\partial {x^i}}} = 0,$$\end{document} (47)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial {s_i}}}{{\partial t}} + \frac{{\partial ({s_i}{v^j})}}{{\partial {x^j}}} - \frac{{{s^\mu} {s^\nu}}} {{2{s^0}}}\frac{{\partial {g_{\mu \nu}}}} {{\partial {x^i}}} + \sqrt {- g} \frac{{\partial p}}{{\partial {x^i}}} = 0,$$\end{document} where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$w = \sqrt {- g} {u^0},d = w\rho, e = w\rho\epsilon, \;{s_i} = w\rho h{u_i}$$\end{document}, and g is the determinant of the 4-metric satisfying \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\sqrt {- g} = \alpha \sqrt \gamma $$\end{document}. A prescription for specifying an equation of state (e.g., p - (-1)e / w = (- 1) for an ideal gas) completes the above equations . When solving equations (45, 46, 47), an artificial viscosity method is needed to handle the formation and propagation of shock fronts [162, 85, 84]. These methods are computationally cheap, easy to implement, and easily adaptable to multi - physics applications . However, it has been demonstrated that problems involving very high lorentz factors are somewhat sensitive to different implementations of the viscosity terms, and can result in substantial numerical errors if solved using time explicit methods . On the other hand, a number of different formulations of these equations have been developed to take advantage of the hyperbolic and conservative nature of the equations in using high resolution and non - oscillatory shock capturing schemes (although strict conservation is only possible in flat spacetimes curved spacetimes exhibit source terms due to geometry). A particular formulation used together with high resolution godunov techniques and approximate riemann solvers is the following [139, 26]: (48)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial \sqrt \gamma u(\vec w)}}{{\partial t}} + \frac{{\partial \sqrt {- g} {f^i}(\vec w)}}{{\partial {x^i}}} = \sqrt {- g} s(\vec w),$$\end{document} where (49)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$s(\vec w) = \left [{0,{t^{\mu \nu}} \left ({\frac{{\partial {g_{vj}}}}{{\partial {x^\mu}}} - \gamma _ {\nu \mu} ^\delta {g_{\delta j}}} \right),\alpha \left ({{t^{\mu 0}}\frac{{\partial \ln \alpha}} {{\partial {x^\mu}}} - {t^{\mu \nu}} \gamma _ {\nu \mu} ^0} \right)} \right],$$\end{document} (50)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${f^i}(\vec w) = \left [{d\left ({{v^i} - \frac{{{\beta ^i}}}{\alpha}} \right),{s_j}\left ({{v^i} - \frac{{{\beta ^i}}}{\alpha}} \right) + p\delta _ j^i,(e - d)\left ({{v^i} - \frac{{{\beta ^i}}}{\alpha}} \right) + p{v^i}} \right],$$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\vec w = (\rho, {\nu _ i},\epsilon), u (\vec w) = (d, {s_i}, e - d), e = \rho h{\tilde w^2} - p,{s_j} = \rho h{\tilde w^2}{v_j},d = \rho \tilde w,{v^i} = {\gamma ^{ij}}{v_j} = {u^i}/(\alpha {u^0}) + {\beta ^i}/\alpha $$\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\tilde w = \alpha {u^0} = {(1 - {\gamma _ {ij}}{\nu ^i}{\nu ^j})^ {- 1/2}}$$\end{document}. Although godunov - type schemes are accepted as more accurate alternatives to av methods, especially in the limit of high lorentz factors, they are not immune to problems and should generally be used with caution . They may produce unexpected results in certain cases that can be overcome only with problem - specific fixes or by adding additional dissipation . A few known examples include the admittance of expansion shocks, negative internal energies in kinematically dominated flows, the carbuncle effect in high mach number bow shocks, kinked mach stems, and odd / even decoupling in mesh - aligned shocks . Godunov methods, whether they solve the riemann problem exactly or approximately, are also computationally much more expensive than their simpler av counterparts, and it is more difficult to incorporate additional physics . A third class of computational fluid dynamics methods reviewed here is also based on a conservative hyperbolic formulation of the hydrodynamics equations . However, in this case the equations are derived directly from the conservation of stress - energy, (51)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\nabla _ \mu} {t^{\mu \nu}} = \frac{1}{{\sqrt {- g}}} {\partial _ \mu} \left ({\sqrt {- g} {t^{\mu \nu}}} \right) + \gamma _ {\alpha \mu} ^\nu {t^{\mu \alpha}} = 0,$$\end{document} to give (52)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial d}}{{\partial t}} + \frac{{\partial (d{v^i})}}{{\partial {x^i}}} = 0,$$\end{document} (53)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial \varepsilon}} {{\partial t}} + \frac{{\partial (\varepsilon {v^i})}}{{\partial {x^i}}} + \frac{{\partial [\sqrt {- g} ({g^{0i}} - {g^{00}}{v^i})p]}}{{\partial {x^i}}} = {\sigma ^0},$$\end{document} (54)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial {{\mathcal s}^j}}}{{\partial t}} + \frac{{\partial ({{\mathcal s}^j}{v^i})}}{{\partial {x^i}}} + \frac{{\partial [\sqrt {- g} ({g^{ij}} - {g^{0j}}{v^i})p]}}{{\partial {x^i}}} = {\sigma ^j},$$\end{document} with curvature source terms \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\sigma ^\nu} = - \sqrt {- g} {t^{\beta \gamma}} \;\gamma _ {\beta \gamma} ^\nu $$\end{document}. The variables d and v are the same as those defined in the internal energy formulation, but now (55)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\varepsilon = w\rho h{u^0} + \sqrt {- g} {g^{00}}p,$$\end{document} (56)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathcal{s}^i} = w\rho h{u^i} + \sqrt {- g} {g^{0i}}p$$\end{document} are different expressions for energy and momenta . An alternative approach of using high resolution, non - oscillatory, central difference (nocd) methods [99, 100] has been applied by anninos and fragile to solve the relativistic hydrodynamics equations in the above form . These schemes combine the speed, efficiency, and flexibility of av methods with the advantages of the potentially more accurate conservative formulation approach of godunov methods, but without the cost and complication of riemann solvers and flux splitting . Nocd and artificial viscosity methods have been discussed at length in and compared also with other published godunov methods on their abilities to model shock tube, wall shock and black hole accretion problems . They find that for shock tube problems at moderate to high boost factors, with velocities up to v 0.99, internal energy formulations using artificial viscosity methods compare quite favorably with total energy schemes, including nocd methods and godunov methods using either approximate or exact riemann solvers . However, av methods can be somewhat sensitive to parameters (e.g., viscosity coefficients, courant factor, etc .) And generally suspect in wall shock problems at high boost factors (v> 0.95). On the other hand, nocd methods can easily be extended to ultra - relativistic velocities (1-v <1011) for the same wall shock tests, and are comparable in accuracy to the more standard but complicated riemann solver codes . Nocd schemes thus provide a reasonable alternative for relativistic hydrodynamics, though it should be noted that low order versions of these methods can be significantly more diffusive than either the av or godunov methods . The perfect fluid equations discussed in section 6.2.4 can be generalized to include viscous stress in the stress - energy tensor, (57)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${t^{\mu \nu}} = \left [{t_{ideal}^{\mu \nu}} \right] + \left [{t_{viscous}^{\mu \nu}} \right]$$\end{document} (58)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$= \left [{\rho h{u^\mu} {u^\nu} + p{g^{\mu \nu}}} \right] - \left [{2\eta {\sigma ^{\mu \nu}} + \xi \theta ({g^{\mu \nu}} + {u^\mu} {u^\nu})} \right],$$\end{document} where 0 and 0 are the dynamic shear and bulk viscosity coefficients, respectively . Also, = u is the expansion of fluid world lines, is the trace - free spatial shear tensor with (59)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\sigma ^{\mu \nu}} = \frac{1}{2}\left ({{h^{\lambda \nu}} {\nabla _ \lambda} {u^\mu} + {h^{\lambda \mu}} {\nabla _ \lambda} {u^\nu}} \right) - \frac{1}{3}\theta {h^{\mu \nu}}, $$\end{document} and h = g + uu is the projection tensor . The corresponding energy and momentum conservation equations for the internal energy formulation of section 6.2.4 become (60)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial e}}{{\partial t}} + p\frac{{\partial w}}{{\partial t}} + \frac{{\partial (e{v^i})}}{{\partial {x^i}}} + p\frac{{\partial (w{v^i})}}{{\partial {x^i}}} = \sqrt {- g} {u_\nu} {\nabla _ \mu} t_{viscous}^{\mu \nu}, $$\end{document} (61)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial {s_j}}}{{\partial t}} + \frac{{\partial ({s_j}{v^i})}}{{\partial {x^i}}} + \sqrt {- g} \frac{{\partial p}}{{\partial {x^j}}} - \frac{{{s^\mu} {s^\nu}}} {{2{s^0}}} - \frac{{\partial {g_{\mu \nu}}}} {{\partial {x^j}}} = - \sqrt {- g} {g_{jv}}{\nabla _ \mu} t_{viscous}^{\mu \nu}.$$\end{document} for the nocd formulation discussed in section 6.2.4 it is sufficient to replace the source terms in the energy and momentum equations (53, 53, 54) by (62)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\sigma ^\alpha} = - \sqrt {- g} {t^{\beta \gamma}} \gamma _ {\beta \gamma} ^\alpha - \frac{\partial} {{\partial t}}(\sqrt {- g} t_{viscous}^{0\alpha}) - \frac{\partial} {{\partial {x^j}}}(\sqrt {- g} t_{viscous}^{j\alpha}).$$\end{document} one cannot take arbitrary data to initiate an evolution of the einstein equations . The data must satisfy the constraint equations (9) and (10). York developed a procedure to generate proper initial data by introducing conformal transformations of the 3-metric \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\gamma _ {ij}} = {\psi ^4}{\tilde \gamma _ {ij}}$$\end{document}, the trace - free momentum components \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${a^{ij}} = {k^{ij}} - {\gamma ^{ij}}k/3 = {\psi ^ {- 10}}{\tilde a^{ij}}$$\end{document}, and matter source terms \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s^i} = {\psi ^ {- 10}}{\hat s^i}$$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\rho _ h} = {\psi ^ {- n}}{\hat \rho _ h}$$\end{document}, where n> 5 for uniqueness of solutions to the elliptic equation (63) below . In this procedure, the conformal (or hatted) variables are freely specifiable . Further decomposing the free momentum variables into transverse and longitudinal components \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\hat a^{ij}} = \hat a_*^{ij} + {(\hat lw)^{ij}}$$\end{document}, the hamiltonian and momentum constraints are written as (63)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\hat \nabla _ i}{\hat \nabla ^i}\psi - \frac{{\hat r}}{8}\psi + \frac{1}{8}{\hat a_{ij}}{\hat a^{ij}}{\psi ^ {- 7}} - \frac{1}{{12}}{k^2}{\psi ^5} + 2\pi g\hat \rho {\psi ^{5 - n}} = 0,$$\end{document} (64)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${({\hat \nabla _ j}{\hat \nabla ^j}w)^i} + \frac{1}{3}{\hat \nabla^i} \left ({{{\hat \nabla} _ j}{w^j}} \right) + \hat r_j^i{w^j} - \frac{2}{3}{\psi ^6}{\hat \nabla ^i}k - 8\pi g{\hat s^i} = 0,$$\end{document} where the longitudinal part of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\hat a^{ij}}$$\end{document} is reconstructed from the solutions by (65)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\left ({\hat lw} \right)^{ij}} = {\hat \nabla ^i}{w^j} + {\hat \nabla ^j}{w^i} - \frac{2}{3}{\hat \gamma ^{ij}}{\hat \nabla _ k}{w^k}.$$\end{document} the transverse part of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\hat a^{ij}}$$\end{document} is constrained to satisfy \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\hat \nabla _ j}\hat a_*^{ij} = \hat a_{*j}^j = 0$$\end{document}. Equations (63) and (64) form a coupled nonlinear set of elliptic equations which must be solved iteratively, in general . The two equations can, however, be decoupled if a mean curvature slicing (k = k(t)) is assumed . Given the free data \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$k,{\hat \gamma _ {ij}},{\hat s^i} and \hat \rho $$\end{document}, the constraints are solved for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\hat a_*^{ij},{(\hat lw)^{ij}}$$\end{document} and . The actual metric ij and curvature kij are then reconstructed by the corresponding conformal transformations to provide the complete initial data . Anninos describes a procedure using york s formalism to construct parametrized inhomogeneous initial data in freely specifiable background spacetimes with matter sources . The procedure is general enough to allow gravitational wave and coulomb nonlinearities in the metric, longitudinal momentum fluctuations, isotropic and anisotropic background spacetimes, and can accommodate the conformal - newtonian gauge to set up gauge invariant cosmological perturbation solutions as free data . The newtonian limit is defined by spatial scales much smaller than the horizon radius, peculiar velocities small compared to the speed of light, and a gravitational potential that is both much smaller than unity (in geometric units) and slowly varying in time . The appropriate perturbation equations in this limit are easily derived for a background flrw expanding model, assuming a metric of the form (66)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$d{s^2} = - (1 + 2\phi) d{t^2} + a{(t)^2}(1 - 2\phi) {\gamma _ {ij}}d{x^i}d{x^j},$$\end{document} where (67)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\gamma _ {ij}} = \delta _ j^i{\left ({1 + \frac{{k{r^2}}}{4}} \right)^ {- 2}},$$\end{document} and k = - 1, 0, + 1 for open, flat and closed universes . Also, a 1/(1 + z) is the cosmological scale factor, z is the redshift, and is the comoving inhomogeneous gravitational potential . The governing equations in the newtonian limit are the hydrodynamic conservation equations, (68)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial {{\tilde \rho} _ b}}}{{\partial t}} + \frac{\partial} {{\partial {x^i}}}({\tilde \rho _ b}v_b^i) + 3\frac{{\dot a}}{a}{\tilde \rho _ b} = 0,$$\end{document} (69)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial ({{\tilde \rho} _ b}v_b^j)}}{{\partial t}} + \frac{\partial} {{\partial {x^i}}}({\tilde \rho _ b}v_b^iv_b^j) + 5\frac{{\dot a}}{a}{\tilde \rho _ b}v_b^j + \frac{1}{{{a^2}}}\frac{{\partial \tilde \rho}} {{\partial {x^j}}} + \frac{{{{\tilde \rho} _ b}}}{{{a^2}}}\frac{{\partial \phi}} {{\partial {x^j}}} = 0,$$\end{document} (70)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial \tilde e}}{{\partial t}} + \frac{\partial} {{\partial {x^i}}}(\tilde ev_b^i) + \tilde p\frac{{\partial v_b^i}}{{\partial {x^i}}} + 3\frac{{\dot a}}{a}(\tilde e + \tilde p) = {\tilde s_{cool}},$$\end{document} the geodesic equations for collisionless dust or dark matter (in comoving coordinates), (71)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{dx_d^i}}{{dt}} = v_d^i,$$\end{document} (72)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{dv_d^i}}{{dt}} = - 2\frac{{\dot a}}{a}v_d^i - \frac{1}{{{a^2}}}\frac{{\partial \tilde \phi}} {{\partial {x^i}}},$$\end{document} poisson s equation for the gravitational potential, (73)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\nabla ^2}\tilde \phi = 4\pi g{a^2}({\tilde \rho _ b} + {\tilde \rho _ d} - {\tilde \rho _ 0}),$$\end{document} and the friedman equation for the cosmological scale factor, (74)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{da}}{{dt}} = {h_0}{\left [{{\omega _ m}(\frac{1}{a} - 1) + {\omega _ \lambda} ({a^2} - 1) + 1} \right]^{1/2}}.$$\end{document} here \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\tilde \rho _ d},{\tilde \rho _ b},\tilde p and \tilde e$$\end{document} are the dark matter density, baryonic density, pressure and internal energy density in the proper reference frame, x and vbi are the baryonic comoving coordinates and peculiar velocities, xdi and vdi are the dark matter comoving coordinates and peculiar velocities, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\tilde \rho _ 0} = 3h_0 ^ 2{\omega _ 0}/(8\pi g{a^3})$$\end{document} is the proper background density of the universe, 0 is the total density parameter, m = b + d is the density parameter including both baryonic and dark matter contributions, = /(3h02) is the density parameter attributed to the cosmological constant, h0 = 100 h km s mpc is the present hubble constant with 0.5 <h <1, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\tilde s_{cool}}$$\end{document} represents microphysical radiative cooling and heating rates which can include compton cooling (or heating) due to interactions of free electrons with the cmbr, bremsstrahlung, and atomic and molecular line cooling . Tilded (non - tilded) variables refer to proper (comoving) reference frame attributes . An alternative total energy conservative form of the hydrodynamics equations that allows high resolution godunov - type shock capturing techniques is (75)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial {\rho _ b}}}{{\partial t}} + \frac{1}{a}\frac{\partial} {{\partial {x^i}}}({\rho _ b}\tilde v_b^i) = 0,$$\end{document} (76)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial ({\rho _ b}\tilde v_b^j)}}{{\partial t}} + \frac{1}{a}\frac{\partial} {{\partial {x^i}}}({\rho _ b}\tilde v_b^i\tilde v_b^j + p{\delta _ {ij}}) + \frac{{\dot a}}{a}{\rho _ b}\tilde v_b^j + \frac{{{\rho _ b}}}{a}\frac{{\partial \tilde \phi}} {{\partial {x^j}}} = 0,$$\end{document} (77)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial e}}{{\partial t}} + \frac{1}{a}\frac{\partial} {{\partial {x^i}}}(e\tilde v_b^i + p\tilde v_b^i) + \frac{{2\dot a}}{a}e + \frac{{{\rho _ b}\tilde v_b^i}}{a}\frac{{\partial \tilde \phi}} {{\partial {x^j}}} = {s_{cool}},$$\end{document} with the corresponding particle and gravity equations (78)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{dx_d^i}}{{dt}} = \frac{{\tilde v_d^i}}{a},$$\end{document} (79)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{d\tilde v_d^i}}{{dt}} = - \frac{{\dot a}}{a}\tilde v_d^i - \frac{1}{a}\frac{{\partial \tilde \phi}} {{\partial {x^i}}},$$\end{document} (80)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\nabla ^2}\tilde \phi = \frac{{4\pi g}}{a}({\rho _ b} + {\rho _ d} - {\rho _ 0}),$$\end{document} where b is the comoving density, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\rho _ 0} = {a^3}{\tilde \rho _ 0},\tilde v_b^i$$\end{document} is the proper frame peculiar velocity, p is the comoving pressure, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e = {\rho _ b}\tilde v_b^2/2 + p/(\gamma - 1)$$\end{document} is the total peculiar energy per comoving volume, and the gravitational potential . The baryonic equations from the previous section are easily extended to include reactive chemistry of both atomic and molecular species (e.g., h, h, he, he, he, h, h2 +, h2, and e) by assuming a common flow field, supplementing the total mass conservation equation (68) with (81)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{{\partial {{\tilde \rho} _ j}}}{{\partial t}} + \frac{\partial} {{\partial {x^i}}}({\tilde \rho _ j}v_b^i) + 3\frac{{\dot a}}{a}{\tilde \rho _ j} = \sum\limits_i {\sum\limits_l {{k_{il}}(t)} {{\tilde \rho} _ i}{{\tilde \rho} _ l}} + \sum\limits_i {{i_i}{{\tilde \rho} _ i}} $$\end{document} for each of the species, and including the effects of non - equilibrium radiative cooling and consistent coupling to the hydrodynamics equations . The kil (t) are rate coefficients for the two body reactions and are generally incorporated in numerical codes as tabulated functions of the gas temperature t. the ii are integrals evaluating the photoionization and photodissociation of the different species . A fairly complete chemical network system useful for primordial gas phase compositions, including hydrogen molecules, consists of the following collisional, photoionization, and photodissociation chains collisional reactions (primordial chain): h+e h + 2eh+e h + 2eh+e h + 2eh + e h + 2 ehe + e he + 2ehe + e he + collisional reactions (hz molecular chain): (7)h + e h + (8)h + e h + (9)h + e h + (10)h + e h + (11)h + e h + (12)h + e h + (13)h + e h + (14)h + e h + (15)h + e h + (16)h + e h + (17)h + e h + (18)h2 + + h h2 + h(19)h2 + + h h2 + h photoionization reactions (primordial chain): (20)h + h + e(21)he + he + e(22)he + he + e photodissociation / ionization reactions (molecular chain): (23)h + h + e(24)h + h + e(25)h + h + e(26)h + h + e(27)h2 + 2h collisional reactions (primordial chain): h+e h + 2eh+e h + 2eh+e h + 2eh + e h + 2 ehe + e he + 2ehe + e he + collisional reactions (hz molecular chain): (7)h + e h + (8)h + e h + (9)h + e h + (10)h + e h + (11)h + e h + (12)h + e h + (13)h + e h + (14)h + e h + (15)h + e h + (16)h + e h + (17)h + e h + (18)h2 + + h h2 + h(19)h2 + + h h2 + h photoionization reactions (primordial chain): (20)h + h + e(21)he + he + e(22)he + he + e photodissociation / ionization reactions (molecular chain): (23)h + h + e(24)h + h + e(25)h + h + e(26)h + h + e(27)h2 + 2h for a comprehensive description of the chemistry and explicit formulas modeling the kinetic and cooling rates relevant for cosmological calculations, the reader is referred to [92, 144, 54, 1, 21]. This reactive network is by no means complete, and in fact, ignores important coolants and contaminants (e.g., hd, lih, and their intermediary products [151, 78, 48]) expected to form through non - equilibrium reactions at low temperatures and high densities . Although it is certainly possible to include even in three dimensional simulations, the inclusion of more complex reactants demands either more computational resources (to resolve both the chemistry and cooling scales) or an increasing reliance on equilibrium assumptions which can be very inaccurate . For the hydrodynamic equations, the methods range from lagrangian sph algorithms with artificial viscosity [72, 88], to high resolution shock capturing eulerian techniques on single static meshes [142, 134], nested grids, moving meshes, and adaptive mesh refinement . For the dark matter equations, the canonical choices are treecodes or pm and p3 m methods [90, 68], although many variants have been developed to optimize computational performance and accuracy, including adaptive mesh, particle, and smoothing kernel refinement methods [45, 77, 130]. An efficient method for solving non - equilibrium, multi - species chemical reactive flows together with the hydrodynamic equations in a background flrw model is described in [1, 21]. It is beyond the scope of this review to discuss algorithmic details of the different methods and their strengths and weaknesses . Instead, the reader is referred to [103, 77] for thorough comparisons of various numerical methods applied to problems of structure formation . Compare (by binning data at different resolutions) the statistical performance of five codes (three eulerian and two sph) on the problem of an evolving cdm universe on large scales using the same initial data . The results indicate that global averages of physical attributes converge in rebinned data, but that some uncertainties remain at small levels . Compare twelve lagrangian and eulerian hydrodynamics codes to resolve the formation of a single x - ray cluster in a cdm universe . The study finds generally good agreement for both dynamical and thermodynamical quantities, but also shows significant differences in the x - ray luminosity, a quantity that is especially sensitive to resolution . The standard zeldovich solution [165, 68] is commonly used to generate initial conditions satisfying observed or theoretical power spectra of matter density fluctuations . Comoving physical displacements and velocities of the collisionless dark matter particles are set according to the power spectrum realization (82)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\left| {\frac{{\delta \rho}} {\rho} (k)} \right|^2} \propto {k^n}{t^2}(k),$$\end{document} where the complex phases are chosen from a gaussian random field, t(k) is a transfer function appropriate to a particular structure formation scenario (e.g., cdm), and n = 1 corresponds to the harrison - zeldovich power spectrum . The fluctuations are normalized with top hat smoothing using (83)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\sigma _ 8 ^ 2 = \frac{1}{{{b^2}}} = \int_0^\infty {4\pi {k^2}p(k){w^2}(k)dk,} $$\end{document} where b is the bias factor chosen to match present observations of rms density fluctuations in a spherical window of radius rh = 8 . Mpc . Also, p(k) is the fourier transform of the square of the density fluctuations in equation (82), and (84)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$w(k) = \frac{3}{{{{(k{r_h})}^3}}}(\sin (k{r_h}) - (k{r_h})\cos (k{r_h}))$$\end{document} is the fourier transform of a spherical window of radius rh . Overdensity peaks can be filtered on specified spatial or mass scales by gaussian smoothing the random density field (85)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\sigma ({r_o}) = \frac{1}{{{{(2\pi r_f^2)}^{3/2}}}}\int {\frac{{\delta \rho}} {\rho} (r')} \exp \left ({- \frac{{|{r_o} - r'{|^2}}}{{2r_f^2}}} \right){d^3}r'$$\end{document} on a comoving scale rf centered at r = ro (for example, rf = 5 mpc with a filtered mass of mf 10mbd over cluster scales). N peaks are generated by sampling different random field realizations to satisfy the condition v = (r0)/-(rf) = n, where (rf) is the rms of gaussian filtered density fluctuations over a spherical volume of radius rf . Bertschinger has provided a useful and publicly available package of programs called cos - mics for computing transfer functions, cmb anisotropies, and gaussian random initial conditions for numerical structure formation calculations . The package solves the coupled linearized einstein, boltzman, and fluid equations for scalar metric perturbations, photons, neutrinos, baryons, and collisionless dark matter in a background isotropic universe . It also generates constrained or unconstrained matter distributions over arbitrarily specifiable spatial or mass scales . Bertschinger has provided a useful and publicly available package of programs called cosmics for computing transfer functions, cmb anisotropies, and gaussian random initial conditions for numerical structure formation calculations . The package solves the coupled linearized einstein, boltzman, and fluid equations for scalar metric perturbations, photons, neutrinos, baryons, and collisionless dark matter in a background isotropic universe . It also generates constrained or unconstrained matter distributions over arbitrarily specifiable spatial or mass scales.
|
In most industrialized countries, including germany, the prevalence of overweight and obesity in children and adolescents has increased over the last decades [13]. This has also led to the occurrence of various metabolic or cardiovascular disease risks, previously only observed in adults [4, 5]. In addition to higher risks for cardiovascular disease and type ii diabetes, increased body weight has been associated with psychosocial problems such as depression or low self - esteem and decreased overall quality of life . As excessive body weight tracks into adulthood and increases the risk for cvd, diabetes, or cancer [8, 9], childhood overweight has also been associated with premature mortality [1012]. Overweight or obesity is a complex phenotype but various risk factors such as low levels of physical activity (pa) and increased sedentary behavior, parental obesity and activity levels [14, 15], or socioeconomic status have been identified . Along with the change in body composition a secular decline in physical fitness and motor ability in children has been observed [1719]. The decline was most pronounced for aerobic fitness, which is associated with reduced cvd risk [21, 22]. A commonly discussed reason for the decline in physical fitness is low levels of moderate - to - vigorous physical activity [23, 24]. Specifically a decline in habitual physical activity including active transport has been observed [25, 26]. On the other hand participation in organized sports in germany, 70.2% of 7- to 10-year - old children are involved in sports clubs . This number also reflects the importance of sports clubs concerning social integration and development of the personality [30, 31] in addition to physical fitness and health . Due to its popularity, sports participation should be considered as an effective strategy to reduce fatness and increase fitness in children [3234]. The world health organisation (who) also promotes the use of existing settings based on the national situation and cultural habits for the prevention of overweight and obesity . While an inverse relationship between body composition and extracurricular sports participation was shown in adolescents, no such relationship was shown in primary school children . Quinto romani concludes that the literature examining the effects of organized sports on children's weight status or physical fitness is inconclusive . In addition to problems of accurate assessment, sports participation in organized youth sports does not necessarily guarantee sufficient physical activity to achieve health benefits or increase fitness . Further, various environmental factors need to be considered when examining the effect of sports participation on body composition and fitness . The purpose of the study, therefore, was to examine the association between participation in organized sports and physical fitness as well as overweight in 8-year - old children while considering various environmental constraints . Baseline data from 1119 (53% male, 47% female) second - grade children (7.6 0.4 years) from 32 schools (64 classes) participating in a health and lifestyle intervention project (urmel - ice) in southwest germany was used . The study protocol was approved by the institutional ethics review board, and parental consent as well as child assent was obtained prior to data collection . Height and weight were measured in 1064 children (95% of the total sample) according to standard procedures during a physical examination performed by the outpatient clinic of the children's hospital . Height was measured to the nearest 0.1 cm (ulm stadiometer, busse, ulm, germany) and weight to the nearest 0.1 kg using a calibrated balance beam scale (seca, hamburg, germany) with participants wearing only underwear . Body mass index (bmi) was calculated (kg / m) and converted to bmi percentiles (bmipct) using kromeyer - hauschild et al . (general motor abilities test for children), a commonly used fitness test for 6- to 11-year - old children, was administered in the schools by trained personnel . In addition to the 6 items of the ast (6 min run, 20 m sprint, medicine ball throw, throw - on - target, throw - and - turn, and obstacle run) sit - and - reach test and one - leg - balancing from the eurofit test were incorporated to cover a wider range of fitness - related parameters . A total of 995 children (89% of all participating children) participated in these physical fitness tests . A parental questionnaire was used to determine participation in organized sports outside the school setting . As there is currently no validated instrument for the assessment of health behaviour available in german, questions were based on the kiggs survey, which assessed health behaviour in 18,000 german children and adolescents . Children's sports participation was classified as less than once a week, once or twice a week, and more than twice a week . In addition, the questionnaire assessed confounding variables such as migration background, parental education, parental overweight and parental participation in organized sports . Confounding variables were dichotomized . Migration background was present when either the child's father or mother was born outside germany or when a foreign language was spoken during the child's first years . Level of parents' education was differentiated by 10 years of schooling of either father or mother . A bmi cutpoint of 25 was used to determine between overweight and nonoverweight, and parental sports participation was separated by participation in organized sports or visiting a fitness centre more than one hour per week . Descriptive statistics for the three sports participation groups were calculated and checked for normal distribution . The odds ratio for children being overweight as well as sports participation was calculated via multiple stepwise logistic regression entering sex, overweight, migration background, level of parents' education, parental overweight, and parental participation in sports as confounding variables . In addition, the child's weight status was considered for the sports participation model, while sports participation was considered when calculating the odds ratio for being overweight . Differences in individual fitness parameters by sports participation were calculated via multivariate analysis of covariance (mancova), again adjusting for the previously mentioned confounding variables . Missing values were excluded per case, and level of significance was defined as p <0.05 . Table 1 shows age and anthropometric data of the total sample by sports participation . The majority of children (60%) participated in sports once or twice per week beyond the recommended 3 classes of pe . Bmipct differed significantly between sports participation groups (f (2, 1004) = 6.81, p <0.01). Specifically, those reporting sports participation 1 - 2 times per week had significantly lower bmipct than those reporting less than once a week . Table 2 displays the prevalence of potential confounding variables on child's sports participation . After entering all of these variables as well as sex in a multiple stepwise logistic regression, comparing children who participate less than once with those participating regularly in organized sports, only migration background as well as parental weight status remained in the final model, which explained between 11.2% (cox and snell r) and 16.4% (nagelkerke r) of the variance in sports participation . Having a migration background or overweight parents reduced the odds for regular sports participation . It was further shown that the odds of children being overweight were significantly lower with increased sports participation (table 3). Using mancova, controlling for sex, overweight, migration background, parental overweight, and parental participation in organized sport, a significant main effect of participation in organized sports on most physical fitness parameters was shown (table 4). Post hoc analysis using bonferroni adjustment revealed that children who participate less than once a week in organized sports performed significantly worse than those who participate regularly . There were no differences between children participating once or twice per week in organized sports compared to those participating more often . No significant differences occurred for the 20 m sprint and obstacle run, even though there was a tendency of a better performance with higher sports participation . In the present study 12.4% of children were overweight or obese, which is comparable to previously reported percentages in germany and other european countries [4345]. Similarly, participation rates in organized sports are comparable to those reported previously in german children . The inverse relationship between fitness and overweight as well as physical activity and overweight has generally been accepted . This study, however, further shows that this association remains even after controlling for various family - related confounding variables . These results suggest that sports participation is an important aspect when examining overweight and physical fitness, even at a relatively young age . Regular participation in organized sports, even only once or twice per week, already reduced the odds for being overweight by almost 50% . Similar results have been reported in adolescents [37, 47], 10- to 11-year - old children, and in preschoolers . Interestingly, no association between sports participation and body fatness was observed in studies examining similar age groups [36, 49]. One explanation for these results may be that bmi does not necessarily differentiate between body fat and lean tissue . A lower amount of body fat in children with higher sports participation could be masked by a higher lean body mass, which would result in no differences in bmi ., however, relied on skinfold measurements rather than bmi but could not show any association between bmi and sports participation either . Further, only limited information on the type of sports children are engaging in is available, and different sports may affect body composition differently . In addition, sports participation is only one component of children's physical activity, and especially younger children probably obtain the majority of their physical activity via free play, which may also differ significantly in intensity . Nevertheless, engagement in organized sports has been associated with long - term engagement in physical activity . The present study also indicates that migration status as well as parental weight status needs to be considered when examining the association between sports participation and body weight in children . Parental overweight as well as lower socio - economic status has been shown to be associated with a higher body weight in children . Migration status is also commonly associated with lower socioeconomic status but a recent study in a german sample showed an inverse relationship between migration status and sports participation independent of household income or parental education . This could be due to different cultural values and attitudes towards sports . Even though migration status is associated with educational level, no significant association between parental education and overweight in children van der horst et al . Also argued that parental support, such as transportation to training and competition, is a crucial component concerning children's sports participation . This kind of support seems to be more important than parents serving as role models, but more active parents are probably more likely to provide transportation or other forms of support for their children . In addition, a significant relationship between sports participation and various components of physical fitness has been shown, independent of migration background, parental education, and parental sports participation . Particularly the role of regular sports participation in aerobic fitness should be emphasized as the inverse association between aerobic fitness and cardiovascular disease risk has already been reported in children . Regular sports participation also increases power, flexibility, and balance [36, 57]. The better performance in these components may be crucial for continued engagement in sports and physical activity, as a better overall fitness allows for better performance and thus increases long - term motivation . Interestingly, saar and jrime showed such an association between sports participation and fitness only in adolescents, but not in children . In this study it should also be considered that younger children generally display lower engagement in organized sports and obtain most of their exercise via unstructured play . . Argue that especially participation in vigorous activity increases physical fitness, but such activities can occur in unstructured play or general physical activity as well . Further, it could be argued that a prolonged engagement in sports is necessary to cause changes in physical fitness, and particularly in younger children, some may have just started participating in organised sports and, therefore, might not display any adjustments . It should also be considered that the directionality of the relationship between regular sports participation and physical fitness cannot be determined via a cross - sectional study . It may be possible that children with a higher physical fitness are more likely to participate in organized sports due to their better abilities . Similarly, it remains to be determined whether increased body weight is a result of a lack of sports participation or whether selection bias leads to a lower participation of overweight children in organized sports . Most likely the association between sports participation and physical fitness as well as body composition is bidirectional, which will make it difficult to establish a causal pathway even in longitudinal studies . Nevertheless, it has been argued that participation in sports is one way to increase fitness and reduce body fat [33, 59] even though biological and genetic aspects need to be considered . In addition to the cross - sectional design other limitations of the present study should be addressed . Relying on parent questionnaires for children's participation in organized sports may have introduced potential bias, particularly as parents were informed about the intention of the study due to the following intervention . There is also no information on the intensity children experienced during training sessions or the duration of their training . In general, however, training in organized sports at this age lasts between 60 and 90 minutes per day . Further, only participation in organized sports was considered rather than total physical activity, which may be problematic, especially in younger children ., however, did show a direct relationship between sports participation and habitual pa in preschoolers . The large sample size, on the other hand, is a strength of the present study, and an analysis of missing value did not show any systematic bias . In addition, anthropometric as well as physical fitness measurements were performed by trained staff and followed standard procedures, which adds to the credibility of the study . Overall, the present study shows that increased participation in organized sports is associated with increased physical fitness and lower risk for overweight in elementary school children . Even though directionality of these relationships cannot be established, these results emphasize the necessity for an early establishment of an active lifestyle, including sports participation, to allow for the development of various components associated with physical fitness as this may facilitate long - term engagement in sports and physical activity . Considering the low levels of physical education in school with the continued risk of further reduction, the promotion and facilitation of engagement in organized sports would be an important aspect concerning public health . In germany, roughly 70% of boys and 65% of girls engage in organized sports, which could significantly contribute to children's overall physical activity levels as long as sufficient activity time and engagement are assured . In addition, participation in organized sports has been positively associated with the development of psychosocial components such as increased self - esteem, better stress tolerance, and reduced social isolation . These benefits along with the association between sports participation and body weight underline the importance of organized sports in a child's development . Therefore, the facilitation of access to various sports that allow children with different abilities to engage in a variety of activities is a crucial aspect in today's efforts concerning public health.
|
These adverse outcomes are common, for example lenke and levy reported that in women with phe levels> 20 mg per decilitre, 73% had microcephaly and 92% of children had intellectual disabilities . To prevent such outcomes and allow normal development of the foetus, pregnancies must be planned and a strict low - phenylalanine diet must be maintained prior to and throughout pregnancy, . Phe levels of under 240 mol / l are considered to be safe in pregnancy and at the time the women in the current study were pregnant, clinical practice in south australia was to aim for phe levels prior to and during pregnancy of 75 to 150 this compares with safe phe levels of 120 to 360 mol / l for women with pku who are not pregnant, and phe levels of between 20 and 70 the strict low phe diet required during pregnancy is a vegetarian diet, with large quantities of low protein foods developed specifically for people with pku, and large quantities of a medical formula supplementing the vitamins and minerals that the body cannot synthesise . As this formula has a strong, bile - like odour, a taste that many find unpleasant, and a viscous consistency, women often find this difficult to consume during pregnancy, particularly when affected by pregnancy - related illness, such as morning sickness, . During pregnancy, extensive monitoring is required throughout pregnancy, with weekly medical appointments and twice weekly blood tests to ensure that phe levels are in the safe range for pregnancy . As the required phe levels during pregnancy to prevent negative birth outcomes are significantly lower than usual acceptable levels, significant diet and lifestyle changes are necessary to achieve and maintain the restricted phe levels . As such it would be expected that pregnancy would be a particularly stressful period for women with pku . There has been some consideration of the experiences and needs of women with pku prior to and during pregnancy . For example, waisbren et al . Reported a study of young women who were neither pregnant nor planning a pregnancy, finding social support for birth control and positive attitudes towards birth control to best predict birth control use . They also noted that most women in the study saw having children as a natural sequel to finding a husband (p. 303) with few acknowledging that an unplanned pregnancy may occur . These findings raised questions regarding the best way to support women with pku as the first generation of women with treated pku were reaching child bearing age . An evaluation of a programme designed to provide support to women with pku during their pregnancy found some promising effects for a peer support programme . Women with a child with pku were trained to provide social support and enhance positive attitudes in women with pku who were pregnant or planning pregnancy . However, there were no differences in metabolic control or pregnancy outcomes between the women who participated in the programme and those who did not, suggesting that further work is needed to understand the issues faced, and the best way to provide support . To date, research has not yet focussed on the experience of women with pku during pregnancy or the factors that impact on this, such as stresses, coping strategies, and available supports . The concerns of women with pku when they are considering a pregnancy and the strategies and supports that they believe will assist them to cope during pregnancy will also be considered in the current study; information which will provide valuable information to guide clinical practice . The participants in this study were eight women (mean age 29.9 years, sd 7.9 years, range 2142 years) with pku living in south australia . N = 7) were currently maintaining the pku diet (on diet) and were taking a supplement (medical formula). Six of these women were having regular blood tests with the frequency of tests ranging from weekly to once every four to six weeks . These women were all early - treated (treated for pku from soon after birth), and all had tested iqs in the normal range (not intellectually impaired). Five of the participants had never had a pregnancy but were planning to in the future, two participants had children and were not planning any further pregnancies, and one participant was pregnant (third trimester). The women with children had 3 and 5 children respectively, all of whom had normal intellectual and health outcomes . Two participants had experienced pregnancy complications, including miscarriages, which were unrelated to the management of pku . Two participants had a history of major depressive disorder, with one of these participants also experiencing recurrent bulimia nervosa . Another participant had a history of bipolar affective disorder, with a current depressive episode . As such, 37.5% of the participants in this study reported experiencing significant psychological disorders in their lifetime . For a summary of further participant characteristics (relationship status, education background, current study, and employment status) see table 1 . The study was approved by the human research ethics committee of the children, youth, and women's health service . Participants were recruited through the women's and children's hospital with all women with pku living in south australia invited to participate (n = 20). Interviews took place in a location convenient to the participant and were conducted by tm . The m.i.n.i . Is a brief, verbally administered questionnaire assessing lifetime experience of psychological disorders . The m.i.n.i . Follows the diagnostic criteria for the diagnostic and statistical manual of mental disorders (dsm - iv - tr) and the international classification of diseases (icd-10) for 15 major categories of axis 1 psychiatric disorders, suicidality and anti - social personality disorder (this section was not utilised within this study). Administration time ranges from 15 min to approximately 30 min depending upon the quantity of symptoms endorsed by the participant . This diagnostic tool has received extensive reliability and validity testing and is widely utilised in both research and clinical settings, . This structured measure was utilised to gain insight into participants' experience of both diagnosed and undiagnosed psychological disorders . The interview was designed based on the relevant literature by the research team to ensure the study aims were achieved . This interview schedule was utilised as a base to generate discussion with probing to gain further detail occurring throughout . The initial questions of the interviews regarded the impact of pku on the participant's life from childhood . The following areas were then explored, dependent on the participant's circumstances:for women with children: their experiences during pregnancy, including difficulties they encountered, positive aspects of their pregnancies, coping strategies and supports utilised, and other factors, such as supports, that they would have liked to have received during pregnancy.for women who had not yet had a pregnancy: their perception of pregnancy, including concerns, factors and supports that they believe would assist them to cope during pregnancy . For women with children: their experiences during pregnancy, including difficulties they encountered, positive aspects of their pregnancies, coping strategies and supports utilised, and other factors, such as supports, that they would have liked to have received during pregnancy . For women who had not yet had a pregnancy: their perception of pregnancy, including concerns, factors and supports that they believe would assist them to cope during pregnancy . Transcriptions were analysed qualitatively utilising the guidelines for thematic analysis as described by braun and clarke . The participants in this study were eight women (mean age 29.9 years, sd 7.9 years, range 2142 years) with pku living in south australia . N = 7) were currently maintaining the pku diet (on diet) and were taking a supplement (medical formula). Six of these women were having regular blood tests with the frequency of tests ranging from weekly to once every four to six weeks . These women were all early - treated (treated for pku from soon after birth), and all had tested iqs in the normal range (not intellectually impaired). Five of the participants had never had a pregnancy but were planning to in the future, two participants had children and were not planning any further pregnancies, and one participant was pregnant (third trimester). The women with children had 3 and 5 children respectively, all of whom had normal intellectual and health outcomes . Two participants had experienced pregnancy complications, including miscarriages, which were unrelated to the management of pku . Two participants had a history of major depressive disorder, with one of these participants also experiencing recurrent bulimia nervosa . Another participant had a history of bipolar affective disorder, with a current depressive episode . As such, 37.5% of the participants in this study reported experiencing significant psychological disorders in their lifetime . For a summary of further participant characteristics (relationship status, education background, current study, and employment status) see table 1 . The study was approved by the human research ethics committee of the children, youth, and women's health service . Participants were recruited through the women's and children's hospital with all women with pku living in south australia invited to participate (n = 20). Interviews took place in a location convenient to the participant and were conducted by tm . The m.i.n.i . Is a brief, verbally administered questionnaire assessing lifetime experience of psychological disorders . The m.i.n.i . Follows the diagnostic criteria for the diagnostic and statistical manual of mental disorders (dsm - iv - tr) and the international classification of diseases (icd-10) for 15 major categories of axis 1 psychiatric disorders, suicidality and anti - social personality disorder (this section was not utilised within this study). Administration time ranges from 15 min to approximately 30 min depending upon the quantity of symptoms endorsed by the participant . This diagnostic tool has received extensive reliability and validity testing and is widely utilised in both research and clinical settings, . This structured measure was utilised to gain insight into participants' experience of both diagnosed and undiagnosed psychological disorders . The interview was designed based on the relevant literature by the research team to ensure the study aims were achieved . This interview schedule was utilised as a base to generate discussion with probing to gain further detail occurring throughout . The initial questions of the interviews regarded the impact of pku on the participant's life from childhood . The following areas were then explored, dependent on the participant's circumstances:for women with children: their experiences during pregnancy, including difficulties they encountered, positive aspects of their pregnancies, coping strategies and supports utilised, and other factors, such as supports, that they would have liked to have received during pregnancy.for women who had not yet had a pregnancy: their perception of pregnancy, including concerns, factors and supports that they believe would assist them to cope during pregnancy . For women with children: their experiences during pregnancy, including difficulties they encountered, positive aspects of their pregnancies, coping strategies and supports utilised, and other factors, such as supports, that they would have liked to have received during pregnancy . For women who had not yet had a pregnancy: their perception of pregnancy, including concerns, factors and supports that they believe would assist them to cope during pregnancy . The length of the complete interviews ranged from 30 to 90 min . Transcriptions were analysed qualitatively utilising the guidelines for thematic analysis as described by braun and clarke . The issues reported by women with and without children generally matched closely so are presented and discussed together . Comment is made on areas where there were differences between the women who had experienced pregnancy, and those who were planning a pregnancy in the future . Illustrative quotes for each theme are presented in table 2, table 3 . Women reported anticipating and experiencing a number of key pregnancy - related stresses, related to the unique experience of managing pku during pregnancy . These were 1) achieving and maintaining the low phe levels required prior to, and throughout, pregnancy, 2) the time consuming nature of managing pku throughout pregnancy, and 3) the impact on their social interaction . The core concern for the women was achieving and maintaining the low phe levels required prior to, and throughout, pregnancy . Women who had not yet had a pregnancy tended to express this concern through discussion about their ability to maintain the strict diet to, in turn, maintain levels . These concerns were supported by the mothers, with all describing this as the core worry and source of stress throughout their pregnancies . A number of women reported that they were so concerned about this that they had once believed that they would never have children for this reason . For most women, their concerns about maintaining levels were described in the context of their concerns about the impact of elevated phe levels on their baby's development . The mothers emphasised that there are many factors during pregnancy that lead to an increase in phe levels separate from diet management, and that the experience of these factors lead to increased stress during pregnancy . Such factors include pregnancy - related illness (such as morning sickness), being unwell (such as a cold), and weight loss . Two of the mothers had struggled with weight loss and were hospitalised due to this during one pregnancy each . One of these mothers reported that, whilst experiencing the weight loss was very stressful, admission to hospital was a positive experience as it allowed her the time, space, and support to focus on her pregnancy . These two mothers also reported experiencing pregnancy - related illness and that this had also lead to difficulties in their ability to consume and keep down the supplement and maintain levels . Only one woman who had not had a pregnancy commented that she was concerned about the impact of pregnancy - related illness on managing pku during pregnancy . This indicates that this issue is one that is not generally of concern in the consideration of pregnancy; however it is of great concern during pregnancy . Issues regarding the time consuming nature of managing pku throughout pregnancy were raised mainly by mothers, with only one woman who hadn't had a pregnancy raising concerns about this . As such, this does not appear to be of central concern in the consideration of pregnancy; however an issue that becomes apparent during preparation for a pregnancy . The combination of weekly dietician or medical visits, twice weekly blood tests, and constant measuring and recording of food appeared to be stressful for all mothers . Other specific areas of concern differed depending on the women's life circumstances at the time . Women with other children found issues such as cooking for themselves and the family, and getting blood tests in on time, difficult . Women working full - time found weekly appointments to be difficult, whilst women living in rural areas were concerned about how their pregnancy might be managed from afar . The impact of managing pku during pregnancy on the women's social life was only raised by mothers . This again appears to be an issue which is not of central concern in the consideration of pregnancy, but has a significant impact during the pregnancy . Mothers reported that they found it difficult to go out to social gatherings which involved food as they generally could not eat the food served . The mothers reported that they had to take their scales to weigh their food anywhere that they may eat and have their supplement with them . A number of different ways were identified through which the anticipated and experienced stress and worry associated with managing pku during pregnancy could be managed, including 1) access to supports, 2) problem - focussed coping skills including developing relevant skills and seeking knowledge, and 3) emotion focussed coping skills including positive reappraisal and reassurance seeking . The importance of a number of different supports during pregnancy was emphasised by both mothers and those who had not had a pregnancy . The general support from the hospital, through aspects such as regular appointments, frequent blood tests, and advice over the phone, was key for the majority of the women . A number of women, both mothers and women who had not had a pregnancy, identified the importance of the support of the dietician specifically . The majority of the women who had not had a pregnancy and one mother reported that they would like the support of other mothers with pku during their pregnancy . A mother identified that such support is not currently offered as an option through the hospital and the majority of women reported that they knew few other women with pku to seek such support from . The women emphasised the significance of gaining support and advice from someone who had coped through similar experiences as theirs . The women made suggestions such as having support sessions with another mother with pku, being able to contact another mother over the phone when required, or having a support line that they could utilise . A number of women who had not yet had a pregnancy commented that they felt that access to psychological services would assist in supporting them through their pregnancy . Whilst no mothers reported having received psychological assistance during their pregnancy, one mother identified that she felt that the stress and worry were overwhelming during one of her pregnancies . One woman who had not yet had a pregnancy suggested that a brief psychological intervention early in the pregnancy as a preventative measure may be beneficial, followed by access to psychology on an as needs basis throughout the remainder of the pregnancy . Problem - focussed coping refers to action taken either within the environment (for example, preparing financially) or within oneself (for example, learning new skills) to alter the stressful situation, . Several problem - focussed coping strategies were perceived as either helpful or potentially helpful for coping during pregnancy . The majority of women who had not had children emphasised the importance of the preparation time prior to pregnancy to cope with the pregnancy . They reported that, within this period, they would acquire the necessary skills (such as measuring food and counting protein), knowledge (such as appropriate foods), and confidence to be able to manage and cope with the pregnancy . Many women also reported that obtaining knowledge would be helpful in coping with a pregnancy . Some women, including a mother, reported that they would like, or would have liked, knowledge and an understanding about pku and pregnancy (including the process, diet, and necessary skills) in their late teenage years or early twenties even though they were not yet considering pregnancy at that time . These same women and others reported that obtaining a comprehensive understanding of the management of pku during pregnancy shortly prior to the beginning of the preparation period would be beneficial to coping . Mothers described adjustments that they made to their lives to cope with changes during pregnancy, such as eating before going out, and taking scales, snacks and supplement when going out . Adapting to the circumstances meant that these mothers were still able to attend and be involved in social functions . Emotion - focussed coping strategies are utilised to alter the emotion attached to a situation rather than changing any aspect of the situation itself . This is achieved by either reappraising the problem to change the relational meaning of the situation (for example, emphasising the positive of the situation) or altering the way in which the situation is attended to (for example, avoidance), . Whilst mothers reported utilising emotion - focussed strategies such as positive re - appraisal and reassurance seeking during their pregnancies, these were not discussed by women who had not had a pregnancy . Mothers described coping with stresses by reminding themselves that this was a short - term difficulty with the aim of supporting the birth of a healthy baby . They described obtaining this reassurance through the regular appointments and regular blood test results, me hearing my guthrie results was a way of letting me know my baby's ok and through phone calls to the hospital when stressed or unsure about something . Women reported anticipating and experiencing a number of key pregnancy - related stresses, related to the unique experience of managing pku during pregnancy . These were 1) achieving and maintaining the low phe levels required prior to, and throughout, pregnancy, 2) the time consuming nature of managing pku throughout pregnancy, and 3) the impact on their social interaction . The core concern for the women was achieving and maintaining the low phe levels required prior to, and throughout, pregnancy . Women who had not yet had a pregnancy tended to express this concern through discussion about their ability to maintain the strict diet to, in turn, maintain levels . These concerns were supported by the mothers, with all describing this as the core worry and source of stress throughout their pregnancies . A number of women reported that they were so concerned about this that they had once believed that they would never have children for this reason . For most women, their concerns about maintaining levels were described in the context of their concerns about the impact of elevated phe levels on their baby's development . The mothers emphasised that there are many factors during pregnancy that lead to an increase in phe levels separate from diet management, and that the experience of these factors lead to increased stress during pregnancy . Such factors include pregnancy - related illness (such as morning sickness), being unwell (such as a cold), and weight loss . Two of the mothers had struggled with weight loss and were hospitalised due to this during one pregnancy each . One of these mothers reported that, whilst experiencing the weight loss was very stressful, admission to hospital was a positive experience as it allowed her the time, space, and support to focus on her pregnancy . These two mothers also reported experiencing pregnancy - related illness and that this had also lead to difficulties in their ability to consume and keep down the supplement and maintain levels . Only one woman who had not had a pregnancy commented that she was concerned about the impact of pregnancy - related illness on managing pku during pregnancy . This indicates that this issue is one that is not generally of concern in the consideration of pregnancy; however it is of great concern during pregnancy . Issues regarding the time consuming nature of managing pku throughout pregnancy were raised mainly by mothers, with only one woman who hadn't had a pregnancy raising concerns about this . As such, this does not appear to be of central concern in the consideration of pregnancy; however an issue that becomes apparent during preparation for a pregnancy . The combination of weekly dietician or medical visits, twice weekly blood tests, and constant measuring and recording of food appeared to be stressful for all mothers . Other specific areas of concern differed depending on the women's life circumstances at the time . Women with other children found issues such as cooking for themselves and the family, and getting blood tests in on time, difficult . Women working full - time found weekly appointments to be difficult, whilst women living in rural areas were concerned about how their pregnancy might be managed from afar . The impact of managing pku during pregnancy on the women's social life was only raised by mothers . This again appears to be an issue which is not of central concern in the consideration of pregnancy, but has a significant impact during the pregnancy . Mothers reported that they found it difficult to go out to social gatherings which involved food as they generally could not eat the food served . The mothers reported that they had to take their scales to weigh their food anywhere that they may eat and have their supplement with them . The core concern for the women was achieving and maintaining the low phe levels required prior to, and throughout, pregnancy . Women who had not yet had a pregnancy tended to express this concern through discussion about their ability to maintain the strict diet to, in turn, maintain levels . These concerns were supported by the mothers, with all describing this as the core worry and source of stress throughout their pregnancies . A number of women reported that they were so concerned about this that they had once believed that they would never have children for this reason . For most women, their concerns about maintaining levels were described in the context of their concerns about the impact of elevated phe levels on their baby's development . The mothers emphasised that there are many factors during pregnancy that lead to an increase in phe levels separate from diet management, and that the experience of these factors lead to increased stress during pregnancy . Such factors include pregnancy - related illness (such as morning sickness), being unwell (such as a cold), and weight loss . Two of the mothers had struggled with weight loss and were hospitalised due to this during one pregnancy each . One of these mothers reported that, whilst experiencing the weight loss was very stressful, admission to hospital was a positive experience as it allowed her the time, space, and support to focus on her pregnancy . These two mothers also reported experiencing pregnancy - related illness and that this had also lead to difficulties in their ability to consume and keep down the supplement and maintain levels . Only one woman who had not had a pregnancy commented that she was concerned about the impact of pregnancy - related illness on managing pku during pregnancy . This indicates that this issue is one that is not generally of concern in the consideration of pregnancy; however it is of great concern during pregnancy . Issues regarding the time consuming nature of managing pku throughout pregnancy were raised mainly by mothers, with only one woman who hadn't had a pregnancy raising concerns about this . As such, this does not appear to be of central concern in the consideration of pregnancy; however an issue that becomes apparent during preparation for a pregnancy . The combination of weekly dietician or medical visits, twice weekly blood tests, and constant measuring and recording of food appeared to be stressful for all mothers . Other specific areas of concern differed depending on the women's life circumstances at the time . Women with other children found issues such as cooking for themselves and the family, and getting blood tests in on time, difficult . Women working full - time found weekly appointments to be difficult, whilst women living in rural areas were concerned about how their pregnancy might be managed from afar . The impact of managing pku during pregnancy on the women's social life was only raised by mothers . This again appears to be an issue which is not of central concern in the consideration of pregnancy, but has a significant impact during the pregnancy . Mothers reported that they found it difficult to go out to social gatherings which involved food as they generally could not eat the food served . The mothers reported that they had to take their scales to weigh their food anywhere that they may eat and have their supplement with them . A number of different ways were identified through which the anticipated and experienced stress and worry associated with managing pku during pregnancy could be managed, including 1) access to supports, 2) problem - focussed coping skills including developing relevant skills and seeking knowledge, and 3) emotion focussed coping skills including positive reappraisal and reassurance seeking . The importance of a number of different supports during pregnancy was emphasised by both mothers and those who had not had a pregnancy . The general support from the hospital, through aspects such as regular appointments, frequent blood tests, and advice over the phone, was key for the majority of the women . A number of women, both mothers and women who had not had a pregnancy, identified the importance of the support of the dietician specifically . The majority of the women who had not had a pregnancy and one mother reported that they would like the support of other mothers with pku during their pregnancy . A mother identified that such support is not currently offered as an option through the hospital and the majority of women reported that they knew few other women with pku to seek such support from . The women emphasised the significance of gaining support and advice from someone who had coped through similar experiences as theirs . The women made suggestions such as having support sessions with another mother with pku, being able to contact another mother over the phone when required, or having a support line that they could utilise . A number of women who had not yet had a pregnancy commented that they felt that access to psychological services would assist in supporting them through their pregnancy . Whilst no mothers reported having received psychological assistance during their pregnancy, one mother identified that she felt that the stress and worry were overwhelming during one of her pregnancies . One woman who had not yet had a pregnancy suggested that a brief psychological intervention early in the pregnancy as a preventative measure may be beneficial, followed by access to psychology on an as needs basis throughout the remainder of the pregnancy . Problem - focussed coping refers to action taken either within the environment (for example, preparing financially) or within oneself (for example, learning new skills) to alter the stressful situation, . Several problem - focussed coping strategies were perceived as either helpful or potentially helpful for coping during pregnancy . The majority of women who had not had children emphasised the importance of the preparation time prior to pregnancy to cope with the pregnancy . They reported that, within this period, they would acquire the necessary skills (such as measuring food and counting protein), knowledge (such as appropriate foods), and confidence to be able to manage and cope with the pregnancy . Many women also reported that obtaining knowledge would be helpful in coping with a pregnancy . Some women, including a mother, reported that they would like, or would have liked, knowledge and an understanding about pku and pregnancy (including the process, diet, and necessary skills) in their late teenage years or early twenties even though they were not yet considering pregnancy at that time . These same women and others reported that obtaining a comprehensive understanding of the management of pku during pregnancy shortly prior to the beginning of the preparation period would be beneficial to coping . Mothers described adjustments that they made to their lives to cope with changes during pregnancy, such as eating before going out, and taking scales, snacks and supplement when going out . Adapting to the circumstances meant that these mothers were still able to attend and be involved in social functions . Emotion - focussed coping strategies are utilised to alter the emotion attached to a situation rather than changing any aspect of the situation itself . This is achieved by either reappraising the problem to change the relational meaning of the situation (for example, emphasising the positive of the situation) or altering the way in which the situation is attended to (for example, avoidance), . Whilst mothers reported utilising emotion - focussed strategies such as positive re - appraisal and reassurance seeking during their pregnancies, these were not discussed by women who had not had a pregnancy . Mothers described coping with stresses by reminding themselves that this was a short - term difficulty with the aim of supporting the birth of a healthy baby . They described obtaining this reassurance through the regular appointments and regular blood test results, me hearing my guthrie results was a way of letting me know my baby's ok and through phone calls to the hospital when stressed or unsure about something . The importance of a number of different supports during pregnancy was emphasised by both mothers and those who had not had a pregnancy . The general support from the hospital, through aspects such as regular appointments, frequent blood tests, and advice over the phone, was key for the majority of the women . A number of women, both mothers and women who had not had a pregnancy, identified the importance of the support of the dietician specifically . The majority of the women who had not had a pregnancy and one mother reported that they would like the support of other mothers with pku during their pregnancy . A mother identified that such support is not currently offered as an option through the hospital and the majority of women reported that they knew few other women with pku to seek such support from . The women emphasised the significance of gaining support and advice from someone who had coped through similar experiences as theirs . The women made suggestions such as having support sessions with another mother with pku, being able to contact another mother over the phone when required, or having a support line that they could utilise . A number of women who had not yet had a pregnancy commented that they felt that access to psychological services would assist in supporting them through their pregnancy . Whilst no mothers reported having received psychological assistance during their pregnancy, one mother identified that she felt that the stress and worry were overwhelming during one of her pregnancies . One woman who had not yet had a pregnancy suggested that a brief psychological intervention early in the pregnancy as a preventative measure may be beneficial, followed by access to psychology on an as needs basis throughout the remainder of the pregnancy . Problem - focussed coping refers to action taken either within the environment (for example, preparing financially) or within oneself (for example, learning new skills) to alter the stressful situation, . Several problem - focussed coping strategies were perceived as either helpful or potentially helpful for coping during pregnancy . The majority of women who had not had children emphasised the importance of the preparation time prior to pregnancy to cope with the pregnancy . They reported that, within this period, they would acquire the necessary skills (such as measuring food and counting protein), knowledge (such as appropriate foods), and confidence to be able to manage and cope with the pregnancy . Many women also reported that obtaining knowledge would be helpful in coping with a pregnancy . Some women, including a mother, reported that they would like, or would have liked, knowledge and an understanding about pku and pregnancy (including the process, diet, and necessary skills) in their late teenage years or early twenties even though they were not yet considering pregnancy at that time . These same women and others reported that obtaining a comprehensive understanding of the management of pku during pregnancy shortly prior to the beginning of the preparation period would be beneficial to coping . Mothers described adjustments that they made to their lives to cope with changes during pregnancy, such as eating before going out, and taking scales, snacks and supplement when going out . Adapting to the circumstances meant that these mothers were still able to attend and be involved in social functions . Emotion - focussed coping strategies are utilised to alter the emotion attached to a situation rather than changing any aspect of the situation itself . This is achieved by either reappraising the problem to change the relational meaning of the situation (for example, emphasising the positive of the situation) or altering the way in which the situation is attended to (for example, avoidance), . Whilst mothers reported utilising emotion - focussed strategies such as positive re - appraisal and reassurance seeking during their pregnancies, these were not discussed by women who had not had a pregnancy . Mothers described coping with stresses by reminding themselves that this was a short - term difficulty with the aim of supporting the birth of a healthy baby . They described obtaining this reassurance through the regular appointments and regular blood test results, me hearing my guthrie results was a way of letting me know my baby's ok and through phone calls to the hospital when stressed or unsure about something . This qualitative study explored the key pregnancy - related stresses anticipated or experienced by women with pku, and the strategies and supports they either utilised or anticipated to be beneficial to coping during pregnancy . Whilst much of the literature in this area does not have a consistent theoretical focus, a number of studies focussing on women with high - risk pregnancy have utilised the theoretical model, the transactional model of stress and coping (see,). This model provides a viable framework through which the relationship between high - risk pregnancy and maternal psychological distress, and factors that influence this relationship, can be understood . This model suggests that coping with a high - risk pregnancy is a complex interaction of cognitive appraisals, coping strategies and coping resources, . Particular patterns of thinking and responding, plus access to resources such as social support, can reduce the impact of high - risk pregnancy on psychological well - being, . Appraisal of the situation as within their control is associated with increased psychological well - being for women with a high - risk pregnancy, whilst appraisal of threat and uncertainty is associated with increased psychological distress (,,,). Positive reappraisal is an effective emotion - focussed coping strategy for women with a high - risk pregnancy, whilst avoidance is associated with increased psychological distress (,,). The efficacy of problem - focussed coping strategies, such as preparing for motherhood, is unclear, potentially due to the uncertain nature of high - risk pregnancy,, . Whilst general social support is beneficial for women with high - risk pregnancy, support from medical professionals is of particular importance for women with a high - risk pregnancy due to a chronic condition, . The transactional model of stress and coping was be used to guide understanding of the factors utilised or anticipated to be utilised by the women in the current study during pregnancy to cope, or anticipated to be beneficial to coping, during pregnancy . As expected, key stresses were specific to the experience of pregnancy for women with pku . Coping strategies and supports utilised or anticipated as beneficial were generally similar to that within the literature in the area of high - risk pregnancy and coping . However, some supports not yet considered within the high - risk pregnancy literature were identified . As literature in the area of pku has not yet considered the issues explored here, this study makes a novel contribution to understanding pregnancy - related stresses and coping for women with pku . This study revealed that the core concern for both mothers and women who had not yet had a pregnancy is achieving and maintaining the low phe levels required prior to and during pregnancy . This finding is consistent with research identifying that women with pku find attaining and maintaining metabolic control during pregnancy to be challenging, . Considering the significant negative impact of elevated phe levels on the developing foetus, it is unsurprising that this is the core stress regarding pregnancy for these women . The issues of the time consuming nature of managing pku during pregnancy and the social impact were raised almost exclusively by the mothers in the sample . This indicates that these are issues that are not pertinent when women are considering pregnancy; however have a significant impact during pregnancy . These findings are consistent with research which indicates that practical issues, such as the significant diet and lifestyle changes required, are barriers to dietary control for women with pku during pregnancy . Awareness and understanding of the pregnancy - related stresses anticipated and experienced by women with pku are of importance for clinicians involved in the care of these women . Awareness allows clinicians to be sensitive to such stresses, educate women regarding potential stresses, and to normalise such worries and stresses . Women who had not yet had a pregnancy tended to focus upon supports and problem - focussed coping strategies, such as knowledge seeking and skill building . Whilst mothers also discussed such strategies and supports, they also expressed utilising emotion - focussed strategies, such as positive reappraisal and reassurance seeking . This is consistent with lazarus who argues that, as coping is a process, problem - focussed strategies are often utilised early in the stressful situation, with an increase in the use of emotion - focussed strategies over time . Emotion - focussed coping strategies may be utilised in the midst of a stressful period, but may not be considered as a potential coping strategy in the preparation for such a time . The importance of knowledge about pregnancy, including factors such as the process, diet, and expectations, as a young woman was emphasised, in addition to having a full, comprehensive understanding prior to preparation for pregnancy . An optional information session prior to preparation for pregnancy was suggested, within which comprehensive information about pregnancy and expectations is provided . Research has shown that education regarding the effects of pku on pregnancy is important in preventing unplanned pregnancies and improving metabolic control prior to and during pregnancy, . However, the findings of this study suggest that comprehensive information regarding pregnancy, including the process and skills required may assist women in coping prior to and during pregnancy . The development and implementation of pregnancy - specific information sessions, and potentially take - home information packs, for young women and potential new mothers is one way in which clinicians could further assist women with pku in coping prior to, and during, pregnancy . The importance of the support of health professionals prior to and during pregnancy was emphasised by all women . Frequent appointments, advice and blood tests were key to coping with a pregnancy for many of the women, with an emphasis on the support of the dietician . Found that support from medical professionals was particularly important for women with a high - risk pregnancy due to a chronic condition, as is pku . Mothers described utilising the emotion - focussed strategy of seeking reassurance from medical professionals when they were feeling stressed and anxious . This finding is consistent with o'brien et al . Who emphasised the importance of seeking reassurance from medical professionals for women with high - risk pregnancy in managing stress and anxiety . Awareness of the importance of their support and reassurance can allow medical professionals to ensure that sensitive and responsive care is provided throughout the pregnancy . The women in this study emphasised the importance of receiving support from another mother with pku to assist them in coping during pregnancy, yet indicated that they did not know other women to seek such support from informally . . Found that the support of another mother with pku assisted women to attain metabolic control for pregnancy much earlier . Such support could be provided informally by willing mothers with pku, either through meeting or over the phone, or through a more formal means, such as the development of a national support line . Telephone support is currently utilised for patients with other medical conditions and services facilitating this support indicate that the provision of support in this manner has proved invaluable for patients . Additionally, given the accessibility of online social media in recent times, development of formal points of contact through social networking outlets may also be one way in which contact between women with pku could be facilitated . Research has indicated that such use of social networking has led to an increase in social support for patients and increased quality of life, whilst the inclusion of medical professionals in the facilitation of such groups may also increase the positive benefits achieved . As such, it is suggested that the development of support communities, including medical professionals, through online social networking be explored for women with pku, in addition to the provision of telephone support . Services should consider how best to include and support the women's partners in care during pregnancy . It is likely that some of the stressors experienced by women during pregnancy may differ depending on whether it is a first pregnancy, or whether women already have children . Women may learn from their previous experiences, and may cope better in subsequent pregnancies . On the other hand, there may be additional stressors when women need to also care for children during pregnancy . Increased exposure to stressors during pregnancy increases the risk of the development of psychological disorders during high - risk pregnancies, . In the current study, women expressed concerns about psychological well - being and coping during pregnancy . In addition, a significant proportion of the women in this sample had experienced significant psychological disorders within their lifetime, consistent with research indicating that this population is at higher risk of developing psychiatric symptoms, . As such, psychological support may assist in alleviating stress and anxiety during pregnancy and reduce the risk of the development of psychological disorders . The provision of a brief psychological intervention in the preparation for the pregnancy and in the early stages, focussing on strengthening coping skills and psycho - education regarding common psychological disorders such as depression and anxiety, may be beneficial as a preventative measure and assist in the promotion of psychological well - being . It is recommended that this then be followed by access to psychological support as required for the remainder of the pregnancy . The women who participated were open to discussing their condition, pregnancy and psychological well - being and, likely, those who were not as willing to discuss such matters were underrepresented . Research suggests that, whilst it is now recommended that the diet is maintained throughout the lifespan, many women cease the diet in adulthood, . Extensive research evidences the emotional and cognitive effects of cessation of the diet in adulthood, with increased rates of internalising symptoms such as depressive and anxious symptoms, . As such, the experiences of this sample may not be reflective of the population . The retrospective, self - report nature of the study is a further limitation . Due to the small number of women with pku in south australia, only one woman was pregnant at the time of the study and as stress and coping changes across the pregnancy, assessment at multiple periods during pregnancy would also provide a deeper understanding of women with pku's experiences . In addition, five women were discussing their perceptions of what a pregnancy would be like for them, but had never been pregnant . It is likely that their perceptions would be different once they had experienced a pregnancy . A further limitation of this study is that women with pku treated within one centre alone are considered . The findings of this study provide some critical insight into the pregnancy - related stresses anticipated and experienced by women with pku and the coping strategies and supports they utilise or believe are beneficial during pregnancy . Promotion of maternal well - being is key to achieving positive outcomes for both the mother and child . Awareness of the unique pregnancy - related stresses for women with pku assists health professionals to provide sensitive and responsive care . Provision of comprehensive information is essential in supporting women in their decision to have a child . Developing pathways for contact between pregnant women and mothers with pku may assist the promotion of psychological well - being during pregnancy, as may provision of psychological support.
|
A 30-years old woman visited at our hospital, complaining of pain in her lower back, left inguinal area, and left leg . Two months before this visit, she was found to have a mass growing in her left thigh, which was causing her pain (fig . Her excisional biopsy revealed fibromatosis of the rectus femoris muscle . Following the procedure, she continued to experience pain at the operated site, as well as pain in her left inguinal region . Starting from day 3 after the surgery, the previously mentioned pains were accompanied by pain in her lower back and in the medial side of her left knee . She was asked to rate her pain using a visual analogue scale (vas) and her rating, on average, was 100/100 . Physical examination found hyperesthesia and static allodynia in the left medial side of her affected leg . Both her left hip flexion (g 4/5) and left knee flexion (g 4/5) were diminished . Her blood test results revealed an elevated erythrocyte sedimentation rate and c - reactive protein concentration of 56 and 4.49, respectively . On her first day at the hospital the results showed that the compound motor action potential amplitudes in her left femoral nerve were within the normal range but were reduced as compared with her right femoral nerve . Sensory nerve conduction tests revealed that sensory nerve action potentials were not obtained in her left saphenous nerve or in her medial femoral cutaneous nerve . Electromyography (emg) results showed increased insertional activity in the left vastus lateralis, fibrillation, positive sharp waves (2 +), and diminished recruitment . Based on the results, femoral neuropathy was suspected and pregabalin 150 mg and duloxetine 60 mg were, accordingly, administered . Twenty - one days into her hospitalization, the pain in her left lower leg diminished slightly, to 30/100 on her vas rating . However, the pain in her left inguinal area and in the medial side of her left knee continued . Thus, a femoral nerve block was performed and the dosage of pregabalin was increased to 300 mg and administered along with duloxetine 60 mg . On the patient's thirty - five days of hospitalization, the pain in her left inguinal area improved . In contrast, the pain in the medial side of her left knee worsened to 100/100 on her vas rating . Significantly reduced sensory reflex responses to cold (2/10), touch (0/10), and pinprick (0/1) were found in the medial side of her left knee . No allodynia was found . After a left l3 transforaminal epidural steroid injection, the pain in the medial side of her left knee showed an improvement based on her vas rating of 40/100 . On the thirty - six days after her first visit to the hospital, her leg pain diminished . Nevertheless, she experienced abdominal pain, nausea, and vomiting and came to the er at the hospital to have those symptoms treated . Her abdominal x - rays revealed an ileus and abdominal computer tomography tests showed a huge retroperitoneal mass . These findings led to performing lumbar spine magnetic resonance imaging (mri) (fig . 2), which found disc degeneration accompanied by an annular tear in l5-s1 as well as a mass in her left iliopsoas muscle . In addition, her torso pet scans (fig . 3) revealed a suprarenal mass in her right side, as well as tumors seeded in her left psoas muscle, in both lungs, and in her pleura and peritoneum . The patient was transferred to the department of internal medicine at the hospital to receive treatment for her metastatic retroperitoneal liposarcoma . Isolated femoral neuropathy is rarely reported as the cause of ppp . In most cases, the causes are iatrogenic factors associated with either direct trauma to the nerves, nerve stretching, or nerve compression . With the increasing diversity in the type and extent of surgical procedures, in fact, postoperative femoral neuropathy has been reported in a number of cases in gynecology, in vascular surgery, and in renal transplantation [3 - 5]. Since the first study in chronic post - surgical pain was published by crombie et al . In 1998, a growing interest in ppp has developed among clinicians . Ppp is defined as a post - surgical pain that continues for more than two months with no particular reason . Its prevalence rate varies with the types of surgery and each study reports it differently ., ppp results from persistent nociception or inflammation, or from neuropathic pain due to surgical trauma to the major peripheral nerves . Ppp risk factors include: (a) preoperative factors, such as psychosocial factors; (b) intraoperative factors, such as anesthesia, surgical approaches, and nerve injuries; and (c) postoperative factors such as analgesia use, and early - stage neurophysiological assessment . Using a minimally invasive surgical approach is important in the prevention of ppp . Anatomically speaking, the lumbar plexus is situated anterior to the transverse process of the lumbar vertebrae (l2 - 5) or in the posterior one third of the psoas major, which is found anterior to the transverse processes of the lumbar vertebrae . Numerous terminal branches arise from the lumbar plexus, some of which originate from the lateral border of the psoas major . The femoral nerve, which is the largest branch of the lumbar plexus and which is situated in the posterior area of the psoas major, lies between the psoas and the iliacus . It exits the pelvis, passes deep to the inguinal ligament; and bifurcates into anterior and posterior divisions . The femoral nerve provides motor innervations to the iliacus and to the pectineus, sartorius, and quadriceps femoris muscles . The nerve also provides sensory innervations to the distal two thirds of the anteromedial aspect of the thigh and to the medial aspect of the leg . An injury to the femoral nerve will lead to numbness and paresthesia in the anterior thigh, the medial calf, medial foot, or the great toe, as well as to pain sensations in the iliac fossa, inguinal region, anterior thigh, or the medial region of the calf . If a case of femoral neuropathy is suspected, the possibility of misdiagnosis must be verified with l4 radiculopathy or lumbar plexopathy to ensure the accuracy of the diagnosis . In l4 radiculopathy, dermatomes from the regions of the patient's major complaints are different from those of femoral neuropathy . Symptoms of l4 radiculopathy include pain in the anterior thigh and medial knee, paresthesia in the anteromedial side of the tibia, weakness in the tibialis anterior, deterioration in the quadriceps femoris muscles and hip adductor, and reduction or loss of patellar tendon reflexes . Lumbar plexopathy symptoms include weakness in the hip flexors and adductor, weakness in the knee extensor, sensory loss in the areas innervated by the femoral, obturator, and lateral femoral cutaneous nerves, and deterioration in the iliopsoas muscle . In patients diagnosed with femoral neuropathy, a clinical diagnosis of iatrogenic femoral neuropathy lesions can be assisted by imaging techniques and electrodiagnostic studies . Mri tests also help with the examination of intraspinal pathology and can help eliminate the possibility of retroperitoneal hematoma . A diagnosis can be confirmed by emg tests of the denervation and recruitment changes in the iliopsoas, quadriceps and sartorius muscles . Moreover, henry c. tong reported using appropriate diagnostic criteria which helped ensure good specificity while examining for lumbosacral radiculopathy . It is a neoplasm arising from the mesenchymal cells and includes adipose, muscle, and connective tissues . Soft tissue sarcoma can be found inside all parts of the body, but they are most frequently found in the proximal area of the lower extremities . With this type of sarcoma, the wide excision of the primary tumor is the key to successful treatments and radiation therapy is required even after complete resection . In patients with soft tissue sarcoma, early diagnosis is often delayed and an aggressive invasion of muscles, bones, and nerves is common ., fibromatosis is defined as an infiltrating fibroblastic proliferation, which shows no histological sign of inflammation or clearly distinguished neoplasms . Fibromatosis is difficult to distinguish from low - grade fibrosarcoma, although fibromatosis does not develop into a malignant tumor and is not metastatic to the distal area . Local recurrence is common in fibromatosis, and, thus, a wide excision of the lesion extending from 2 cm to 3 cm from the tumor is the recommended mode of treatment . In our patient, her preoperative pain, limited to the mass in her thigh, persisted after the operation . The pain, sensed only in the mass before the surgery, after surgery started to infiltrate into the areas that are innervated by the femoral nerve . Based on these findings, we assumed that a peripheral nerve injury resulting from the procedure might have affected the progression of her pain . Furthermore, we suspected, based on our examination of emg results, postoperative femoral neuropathy that resulted from surgery - induced direct damage to the femoral nerve . Treatments were provided accordingly but were found to have only a limited effect on the pain that continued to affect the patient . Based on her report of feeling localized pain in her left quadratus lumborum and on our observation of limited flexion in her hip, we assumed the likely origin of her pain was the liposarcoma that was found earlier in her lumbar plexus . In this case study, we ignored the possibility of more serious nerve damage, such as damages to the plexus, and settled on a more fundamental diagnosis of peripheral nerve injury as the cause of the patient's ppp . The recent surge in interest in ppp in the medical community may play a part in clinicians delivering a misdiagnosis due to the lack of a thorough evaluation of the patient's symptoms, while there can be many causes of the pain after the surgery . Our patient experienced what was considered a persistent neuropathic pain after undergoing an excision of a benign tumor in her thigh . Our initial diagnosis was that her pain was caused by postoperative femoral neuropathy, and we provided treatments, accordingly . However, an imaging test revealed a metastatic tumor in her iliopsoas muscle, and our diagnosis eventually changed to tumor induced lumbar plexopathy . We report this case, along with our review of the literature, to emphasize the importance of performing a more thorough and accurate diagnosis when treating ppp.
|
Agrochemicals are widely used for decades, in an attempt to protect crops against insect pests . Nevertheless, in the light of the increasing resistance, every year a vast array of new compounds is introduced into the market, with consequential negative side effects and increased costs in food production . More specifically, pesticides are poisons intentionally dispersed in the environment to control pests, and which subsequently persist in the soil, water and food, with toxicity related outcomes to both humans and animals (schulz, 2004; carvalho, 2006; moraes et al ., 2009). Notwithstanding, the use of agrochemicals remains a common practice, especially in tropical regions (carvalho, 2006). Brazil is the the third main consumer of pesticides worldwide (agriculture and agri - food, canada, 2005). Numbers from the brazilian pesticide industry show that pesticide sales in brazil have risen from us$0.98 billion in 1992 to us$4.5 billion in 2004, this representing an increase of 360% over the period (brazil, 2008). Furthermore, discrepancies between brazilian regulation of the pesticide market, and those enforced in developed countries, have paved the way to the importation of vast amounts of pesticides that are highly toxic, severely restricted, or even banned in other nations (carvalho, 2006; smith, 2001). According to peres and moreira (2007), the widespread and growing use of pesticides for raising crops and cattle in brazil has given rise to a number of environmental changes and problems, both by the contamination of human communities, as part of the environment, and by accumulation in biotic and abiotic segments of ecosystems . With year - round harvests, the low level of mechanization in the various phases of production, and the consequential exposure to multiple environmental contaminants (pesticides), the vulnerability of brazilian workers and the environment itself to these genotoxic agents becomes evident . Environmental quality control requires the monitoring of various indicators, including the assessment of pesticide residues . This is due to these animals living in direct contact with aquatic sediments adjacent to areas where pesticides are commonly used . In these water bodies, many poorly water - soluble compounds eventually settle, with the consequential increase in the degree of local contamination, when compared to the water column as a whole (grisolia, 2005; umbuziero et al ., 2006). . Nevertheless, in recent studies, potentially genotoxic substances have been recognized and quantified, when using fish as experimental organisms (andrade et al ., 2004). Nowadays, several tests have been well developed and standardized for assessing the genotoxic profile of a wide spectrum of substances . In comparison to other methods, the advantage of the simplicity of the micronucleus test facilitates counting the micronuclei in erythrocytes therefore, the test has been widely used to evaluate the mutagenic potential of new drugs and chemicals, being also indicated in routine screening and environmental monitoring (al - sabti et al ., 1994; bcker et al ., 2006). Micronuclei are formed during the telophase of mitosis or meiosis, when the nuclear envelope is reconstituted around the chromosomes of daughter cells (udroiu, 2006). Micronuclei are the result of chromosome acentric fragments (clastogenic effect) or whole chromosomes that, through incomplete migration, have been excluded from the main core (aneugenic effect). Thus, micronuclei represent a loss in chromatin as a result of damage to either chromosome structure (fragmentation) or the mitotic apparatus . There may also be the formation of bilobed nuclei, thereby indicating an early change in cellular metabolism (fenech, 2000; grisolia and cordeiro, 2000; bombail et al . The aim was to survey the use of pesticides in guatambu, santa catarina state, brazil, and, through micronucleus testing, determine the risk and toxicological impact of pesticides contaminating regional dams . The study was undertaken in a farming community which included members of the lambedor river watershed association of guatambu, in the west santa catarina state, southern brazil, during april, 2009 . Fish were collected in all the dams existing in agricultural rural properties (10 sampling areas), as shown in figure 1 . Three fishes of similar size and weight (between 700 g and 900 g) were collected with cast nets in each dam . Blood samples of approximately 40 l were taken from each by cardiac puncturing with sterile heparinized syringes and needles . Samples were transferred to labeled eppendorf tubes containing edta, and then taken to the toxicology laboratory of the community university of the region of chapec for micronucleus testing . Two blood smears per individual were prepared on clean microscope slides, to then be air - dried at room temperature . Subsequently, they were first fixed with absolute methanol for 10 min and then air - dried for at least 24 h. after fixation, the slides were treated with 1n hcl for 11 min in a water - bath at 60 c . After washing with distilled water, they were then stained with a schiff solution in the dark . In sequence, the slides were removed and left to dry at room temperature, for subsequent microscopic examination . According to criteria already described by ayllon and garcia - varquez (2000), only rounded non - refractive structures that had separated from the main nucleus were taken into account for micronuclei scoring . 3000 erythrocytes from each fish were counted (1000 erythrocytes on each slide) at 1000 magnification under an oil - immersion objective, end examined for micronucleated cells . The study was undertaken in a farming community which included members of the lambedor river watershed association of guatambu, in the west santa catarina state, southern brazil, during april, 2009 . Fish were collected in all the dams existing in agricultural rural properties (10 sampling areas), as shown in figure 1 . Three fishes of similar size and weight (between 700 g and 900 g) were collected with cast nets in each dam . Blood samples of approximately 40 l were taken from each by cardiac puncturing with sterile heparinized syringes and needles . Samples were transferred to labeled eppendorf tubes containing edta, and then taken to the toxicology laboratory of the community university of the region of chapec for micronucleus testing . Two blood smears per individual were prepared on clean microscope slides, to then be air - dried at room temperature . Subsequently, they were first fixed with absolute methanol for 10 min and then air - dried for at least 24 h. after fixation, the slides were treated with 1n hcl for 11 min in a water - bath at 60 c . After washing with distilled water, they were then stained with a schiff solution in the dark . In sequence, the slides were removed and left to dry at room temperature, for subsequent microscopic examination . According to criteria already described by ayllon and garcia - varquez (2000), only rounded non - refractive structures that had separated from the main nucleus were taken into account for micronuclei scoring . 3000 erythrocytes from each fish were counted (1000 erythrocytes on each slide) at 1000 magnification under an oil - immersion objective, end examined for micronucleated cells . The responses from the questionnaires showed regular use of pesticides in 100% of sampling areas . As regards equipment washing, it was evident that 70%, of the water is normally returned to the farm itself, the remainder being discarded onto the soil . The responses also revealed that farmers were uncertain as to the correct destination of empty containers . The most widely used pesticides were roundup (glyphosate), karate (lambda cyhalothrin), herbimix (atrasine and simazine) and priori xtra (azoxystrobin). Cyprinus carpio, hypostomus punctatus, rhamdia quelen and oreochromis niloticus figured among the animals collected in this study . Micronucleate erythrocytes (figure 2) were found mat different frequencies among the captured fish species, as shown in figure 3, the highest mean values being observed in cyprinus carpio (15.33 in weir 4, 15.00 and 14.00 in weir 8 . Figure 4 shows the means of micronuclei per dam, being especially perceptible in the larger sized sampling areas of dams 4 (12.44) and dam 8 (13.78). However, they were close to the overall average in dam 5 (12.33), where the species collected were rhamdia quelen and oreochromis niloticus . The significant contribution to the environmental impact in the region, through the paramount, current use and handling of pesticides in small and middle - sized farms in the community, was amply proven . Induction of micronuclei was previously reported for fish collected in dams or rivers (udroiu, 2006) and in situ quantification of micronuclei in piscine erythrocytes has been demonstrated to be an adequate biomarker in the evaluation of aquatic ecosystems quality (aylln and garcia - vazquez, 2000; avas and ergene - gzkara, 2003; ergene et al ., 2007). The water used both in the preparation of the pesticide solutions and in the washing of utensils, is a relevant factor and possible source of poisoning . As reported by respondents, in the past the whole washing procedure was carried out near water sources or streams . It is known that, depending on the characteristics of the soil where disposal occurs, the contamination of both surface and ground water is a possibility, thereby constituting a contributing factor to environmental contamination (peres and moreira, 2007). Of late, the effects of pesticides on aquatic organisms, especially when using non - lethal doses, have been amply demonstrated (crestani et al ., 2006; veiga et al ., 2006; glusczak et al ., 2007; marques et al . 2007; the processes of transport and impact on non - target organisms are governed by the rates of degradation and bioavailability of pesticides in soil or water, bioavailability itself depending on local physico - chemical and climatic conditions . Several factors influence the effects of pesticides on fishes, among others, the fish - species studied, the class, dose and concentration of the pesticide, and exposure time (glusczak et al ., 2007; fonseca et al . ; 2008, cattaneo et al ., 2008). (2005), on examining differences in response between species by in situ analysis, noted the appropriateness of the species tilapia rendalli as a bioindicator of genotoxicity in a lake environment . According to grisolia (2002), on exposure to different concentrations of glyphosate in the commercial formulation roundup, there was an increase in the frequency of micronuclei in erythrocytes . According to grisolia (2005) and udroiu (2006), the prevailing, extensive farming procedures, on inducing considerable impacts on the environment, the subsequent increase in mutation rate would lead to an increase in genetic load and a reduction in adaptive potential, with the consequential elimination of susceptible genotypes . Apparently the action of any chemical genotoxic agent may give rise to an increase in micronucleus frequency . Consequently, based on the fact that spontaneous formation of micronuclei is normally low and nearly uniform among species (siu et al ., 2004), in environmental monitoring, micronucleus assaying has emerged as a simple, inexpensive and rapid method for detecting genotoxic effects . Spontaneous formation of micronuclei in fish is normally very rare . In our study, however, significant frequencies were observed in the captured specimens from each dam, with micronucleus testing revealing the rate of micronucleated erythrocytes to be high, with a minimum of 6.21 and a maximum of 13.78 per 1,000 erythrocytes evaluated . When compared with the results obtained by rodriguez - cea et al . (2003), with an average 3 micronuclei per 1000 erythrocytes examined, the above indices can be considered high . The data also further corroborated other studies in brazil which showed a high incidence of micronuclei and nuclear abnormalities in organisms exposed to various chemicals (matsumoto et al ., it was proven through in vivo piscine micronucleus testing, that water from the lambedor water - shed can be considered genotoxic, with emphasis on the degree of genotoxicity from pollution in the area . This implies the possibility of pesticide effluents discharged into the river constituting a disease - hazard to local populations . It is recommended that the river water be analyzed chemically, with a mind to identifying additional classes of toxicants that may also be contributing to genotoxicity in this specific water - shed.
|
Virgifera leconte (coleoptera: chrysomelidae) is a widespread and serious pest of maize, zea mays (l.). Believed to have originated in mexico, it spread throughout parts of the united states and canada during the twentieth century as maize production increased (krysan and smith 1986; levine and oloumi 1991). Then, over the last two decades, there were repeated accidental introductions of d. v. virgifera from north america into europe (miller et al . 2005). The pest is now an economic threat to maize production in many european countries, namely austria, hungary, italy, romania, slovakia, ukraine and serbia (sivcev and tomasev 2002; kiss et al . Diabrotica v. virgifera is a univoltine species whose three larval instars feed almost exclusively on maize roots (moeser and vidal 2005). The feeding damage can cause plant lodging and significant yield losses . To control this pest, european farmers typically apply granular soil insecticides or insecticide - coated seeds against the larvae and foliar insecticides against the adults (ward et al . 2004). The use of chemical pesticides in maize, however, can interfere with effective integrated pest management and biological control programmes that have been established for other european maize pests (babendreier et al . . Moreover, soil insecticides and insecticide - coated seeds can, when improperly applied, endanger honeybees (heimbach et al . Thus, kuhlmann and burgt (1998) and babendreier et al . (2006) stressed the importance of biological control options . For a pest like d. v. virgifera, whose most damaging stages are below - ground, soil - dwelling entomopathogenic nematodes are considered strong candidates for use in a biological control programme . Several field studies (e.g., creighton and fassuliotis 1985; poinar et al . 1983; kaya et al . 1989; thurston and yule 1990; ellsbury et al . 1996; jackson 1997) have shown variable efficacy of nematodes in controlling diabrotica pests and have revealed a number of factors that may reduce their impact . Failed control attempts using nematodes have been attributed to (i) the use of nematode species or strains that were not adapted to the host or to local conditions (jackson 1995; georgis et al . 2006), (ii) a lack of alternative hosts in the soil (brust 1991; susurluk 2005), (iii) losses during application (smits et al . 1994; cabanillas et al . 2005) or, of particular interest in the current study, (iv) unfavourable soil characteristics (kaya 1990; koppenhfer and fuzy 2006a, b). The activity, infectivity and survival of entomopathogenic nematodes can be profoundly influenced by soil composition, through its effects on moisture retention (ellsbury et al . 1996), oxygen supply (kaya 1990; koppenhoefer and fuzy 2006b) and texture (kaya 1990). For example, survival of steinernema glaseri steiner and s. carpocapsae (weiser) (both rhabditida: steinernematidae) was found to be lowest in clay soils followed by silty clay and sand or sandy silt (kung et al . Heterorhabditis bacteriophora poinar (rhabditida: heterorhabditidae) was reported to move least in clay soil and most in fine sand or sandy silt soils (barbercheck and wang 1997). 2008) showed in laboratory bioassays that h. bacteriophora, h. megidis poinar, jackson and klein (rh ., heterorhabditidae) and steinernema feltiae filipjev (rh . : steinernematidae) were more effective in killing third instar d. v. virgifera larvae in sand than in non - sandy garden soil . Therefore, one could assume that d. v. virgifera larvae would be better controlled by nematodes in maize fields with sandy soils than in fields with heavy clay or silty soils . This, in turn, would largely reduce the potential market areas for a nematode - based biological control product . In contrast to the high performance of nematodes observed in sandy soil, d. v. virgifera larval survival is reported to be lowest in such soils with high sand content (turpin and peters 1971; macdonald and ellis 1990) and economic root damage or plant lodging is more frequently reported from regions with heavy clay soils than from those with light sandy soils (i. zseller, 2005, personal communication). Consequently, we might hypothesize nematodes to be unsuitable for the biological control of d. v. virgifera larvae in dense soils . In this study, we examined the impact of soil characteristics on the efficacy of entomopathogenic nematode species that had (a) proved virulent to d. v. virgifera larvae in laboratory screenings (toepfer et al . 2005) and (b) had been successfully applied as a fluid during sowing of maize or during mechanical weed control in field experiments (toepfer et al . The nematodes were applied to d. v. virgifera - infested maize pots with soils of three different compositions of clay, silt and sand . The efficacy of each nematode in controlling d. v. virgifera in these soils was assessed by counting the emerging d. v. virgifera adults in sleeve cages placed around the plants . The results of this study are a prerequisite to assess the potential market areas for a nematode - based biological control product against this invasive maize pest, prior to starting the development and implementation of such a product . Three entomopathogenic nematode species were applied against d. v. virgifera larvae in a field experiment using artificially infested maize plants potted into three different soils, referred to as soils a, b, c (table 1). Those soils were prepared by adding different amounts of river sand (nearby river tisza) to three batches of air dried natural gleyic csernozem soil (iuss 2007) of silty clay texture taken from the experimental field (table 1). Soil and sand had been sieved through a 5-cm mesh in order to remove large pieces, prior mixing with a shovel . Five 1-l soil samples were randomly taken from each of the three prepared soil groups in order to analyse soil texture (atterberg 1905) and ph (h2o) (table 1). Soil moisture was measured as w%(=grav.%) at 50100-mm depth in two pots per soil type every 10 min (hotdog dt1, elpro, switzerland). Soil temperature was measured at 100150-mm depth in two pots per soil type every hour (hobo data loggers, onset computer, bourne, ma, usa). Soil texture, ph, moisture and temperature were compared between soil types using the non - parametric m. whitney u test (table 1).table 1characteristics of the three soils of different sand content used for growing maize in pots for four plant - scale field experiments in csongrad county, southern hungary in 2005 and 2006 (n 46 25 59.54; e 20 20 22.12; 83 m elevation)soil characteristicssoil asoil bsoil csand content (%) 144763silt content (%) 441716clay content (%) 423621ph (h2o)8.38.28.7humus (%) 242313soil moisture at 50100-mm depth (w% = grav.%)242319mean soil temperature (c) at 100150-mm depth19.419.118.7min soil temperature (c) at 100150-mm depth13.313.814.1max soil temperature (c) at 100150-mm depth29.429.529.8soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field . The average soil moisture from may to june 2006 is shown as well as the average soil temperature from august to september 2006; letters beside values indicate significant differences between soils according to the non - parametric m whitney u test at p <0.05 characteristics of the three soils of different sand content used for growing maize in pots for four plant - scale field experiments in csongrad county, southern hungary in 2005 and 2006 (n 46 25 59.54; e 20 20 22.12; 83 m elevation) soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field . The average soil moisture from may to june 2006 is shown as well as the average soil temperature from august to september 2006; letters beside values indicate significant differences between soils according to the non - parametric m whitney u test at p <0.05 maize plants of the hybrid magister (ufa semences, bussigny, switzerland) were grown in plastic pots (d = 200 mm, h = 220 mm). Two fungicide - treated maize grains (fungicide fludioxonil and metalaxyl - m, maxim xl 035fs, syngenta) were sowed into each pot and, if both germinated, one plant was removed . Pots were placed into the rows of a maize field with the top of the pots at the level of the soil surface always leaving at least one maize plant as a buffer between pots (systematic block design). At the 46 leaf stage of maize, potted plants were infested with eight second instar d. v. virgifera larvae (see below). One week later, nematodes were applied (see below and table 2). The roots of the hybrid magister emit the nematode attracting volatile -caryophyllene in response to d. v. virgifera larval feeding (rasmann et al . 2005). Eleven to twenty - two replicates were organised for each treatment group (soil type and nematode species) and for the controls (table 2). At the 68 leaf stage of maize (see dates in table 2), gauze sleeve cages (approximately 1.5-m height) were placed over the potted and d. v. virgifera - infested plants in order to capture emerging adults . The experiment was repeated four times.table 2experimental time table for applying three nematode species against d. v. virgifera larvae into three different soils of potted maize plants in csongrad county, southern hungary in 2005 and 2006experimentdatesninfestation with 8 d. v. virgifera larvaenematode applicationd . V. virgifera adult emergence1early sept 2005mid sept 2005early oct late oct 2005192224 may 0615 may 2006late may early july 20061113330 may 068 june 2006mid june mid july 20061719415 mid aug 200622 aug 2006early sept mid oct 20061113n = number of plants (= pots) assessed per treatment group (soil type and nematode species) and control experimental time table for applying three nematode species against d. v. virgifera larvae into three different soils of potted maize plants in csongrad county, southern hungary in 2005 and 2006 n = number of plants (= pots) assessed per treatment group (soil type and nematode species) and control diabrotica v.virgifera eggs were obtained from a laboratory culture of field - collected beetles in southern hungary (25c day, 1520c night, 14l:10d, 4060% r.h . ; for procedures see singh and moore 1985). The eggs were overwintered at 68c in moist sand, and diapause was broken in early april by transferring them to 25c for 14 days . Approximately 200300 maize grains of the hybrid magister were washed with soap to remove fungicides and planted in a plastic tray (300 450 mm) with moist potting soil (garri plusz, garri company, budapest, hungary). Five days after planting, ready - to - hatch eggs were placed into these plastic trays, which were then stored in the dark at 25c (approximately 5,000 eggs per tray). One week after larval hatching (when most larvae were in late first instar stage), the soil containing the larvae was put onto a new tray with new maize plants to provide more food for further larval development . After another week, late second instars were obtained by manually crumbling the soil and maize roots . Using a moist paintbrush, larvae were transferred into several petri dishes (45-mm diameter) containing a small amount of soil and then taken to the field . The potted maize plants were infested with eight d. v. virgifera larvae by emptying the contents of the petri dishes (larvae and soil) into two 100140-mm deep holes in the soil at a distance of 5080 mm from both sides of the maize plant . About 810 third - instar larvae per plant root are often estimated to cause economic damage to a plant, depending on local conditions and maize prices (c. r. edwards, personal communication, 2004); occasionally already two larvae per plant are considered sufficient (reed et al . 1991). Infective juveniles of three nematode species were used in this study: (1) a hybrid of european and us strains of h. bacteriophora poinar provided from liquid culture by e - nema gmbh, schwentinental, germany, (2) the dutch nl - hw79 strain of h. megidis poinar, jackson and klein re - isolated from swiss soils and provided from a liquid culture by andermatt biocontrol, grossdietwil, switzerland, and (3) a hybrid of european strains of s. feltiae (filipjev) provided from liquid culture by e - nema gmbh . These nematodes were known to be effective against second and third instars from previous laboratory bioassays (70100% mortality; rasmann et al . Heterorhabditis bacteriophora and s. feltiae were shipped in clay in a cool box from the producer to the experimental site, and h. megidis was shipped in vermiculite . Approximately 23 h before application, the infective juveniles were diluted with the carrier material in tap water to the required concentration . Using a pipette, 2,000 infective juveniles in 1.22-ml tap water were injected twice (in the late evening and following morning) 100 mm into the soil at distances of 150 mm from the plant, totalling 4,000 juveniles per pot (= 13 juveniles per cm or 1.3 10 juveniles per hectare). These injections simulated the commonly practised application of nematodes as a fluid into soil during sowing of maize or during mechanical weed control (toepfer et al . 2008, 2010). To evaluate the quality of each of the nematode shipments prior to application (kaya and stock 1997), 100 infective juveniles were added to three plastic cups (d = 40 mm, h = 60 mm) containing 200 g of moist, sterilised sand and five larvae of galleria mellonella l. (lepidoptera: pyralidae). Mortality of g. mellonella larvae was assessed after 1 week in darkness and at 22c . Mortality of 70100% of g. mellonella was found for all nematode batches, indicating that the test material was of sufficient quality for subsequent applications and analyses . Emerged adults were removed weekly from the sleeve cages during their period of emergence (table 2) and counted . Emergence of adults was compared among soils, nematode species and controls in each experiment (fig . 1) using the non - parametric m. whitney u test . In order to pool data from the four experimental repetitions, the mean weighted efficacy of each nematode species in each of the three soils was then calculated as the reduction of d. v. virgifera relative to the untreated controls (corrected efficacy% = (100 (beetles in treated pots 100/beetles in the control)) (fig . 2). A comparison among efficacies of nematode species in the three different soils was conducted using the bonferroni post hoc test following an anova (kinnear and gray 2000).fig . 1adult emergence from eight second instar d. v. virgifera larvae per maize plant from three different soils either treated with entomopathogenic nematodes or left untreated (potted maize plants in a maize field in southern hungary; soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field; 1122 potted maize plants were allocated to every treatment and control group in each of four experiment repetitions; error bars = sem; letters above bars indicate significant differences according to m whitney u test at p <0.05)fig . 2mean percent reduction of diabrotica v. virgifera emergence due to applications of entomopathogenic nematodes into three different soils . Mean weighted reduction of adult emergence shown in comparison to the controls (= corrected efficacy); potted maize plants in a maize field in southern hungary; soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field; 1122 potted maize plants were allocated to every treatment and control group for each of four experiment repetitions; error bars = sem; letters above bars indicate significant differences of efficacies between soils and between nematode species according to the bonferroni post hoc test at p <0.05 following an anova adult emergence from eight second instar d. v. virgifera larvae per maize plant from three different soils either treated with entomopathogenic nematodes or left untreated (potted maize plants in a maize field in southern hungary; soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field; 1122 potted maize plants were allocated to every treatment and control group in each of four experiment repetitions; error bars = sem; letters above bars indicate significant differences according to m whitney u test at p <0.05) mean percent reduction of diabrotica v. virgifera emergence due to applications of entomopathogenic nematodes into three different soils . Mean weighted reduction of adult emergence shown in comparison to the controls (= corrected efficacy); potted maize plants in a maize field in southern hungary; soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field; 1122 potted maize plants were allocated to every treatment and control group for each of four experiment repetitions; error bars = sem; letters above bars indicate significant differences of efficacies between soils and between nematode species according to the bonferroni post hoc test at p <0.05 following an anova the influence of soil characteristics on nematode efficacy in reducing d. v. virgifera was tested with between - subjects anova (glm procedure) in cases where a certain soil characteristic was proven significantly different between the soil types according the m whitney u test (see table 1). Linear associations between soil characteristics and nematode efficacy were determined by the pearson correlation coefficient after visually consulting scatter plots for linearity (kinnear and gray 2000). Three entomopathogenic nematode species were applied against d. v. virgifera larvae in a field experiment using artificially infested maize plants potted into three different soils, referred to as soils a, b, c (table 1). Those soils were prepared by adding different amounts of river sand (nearby river tisza) to three batches of air dried natural gleyic csernozem soil (iuss 2007) of silty clay texture taken from the experimental field (table 1). Soil and sand had been sieved through a 5-cm mesh in order to remove large pieces, prior mixing with a shovel . Five 1-l soil samples were randomly taken from each of the three prepared soil groups in order to analyse soil texture (atterberg 1905) and ph (h2o) (table 1). Soil moisture was measured as w%(=grav.%) at 50100-mm depth in two pots per soil type every 10 min (hotdog dt1, elpro, switzerland). Soil temperature was measured at 100150-mm depth in two pots per soil type every hour (hobo data loggers, onset computer, bourne, ma, usa). Soil texture, ph, moisture and temperature were compared between soil types using the non - parametric m. whitney u test (table 1).table 1characteristics of the three soils of different sand content used for growing maize in pots for four plant - scale field experiments in csongrad county, southern hungary in 2005 and 2006 (n 46 25 59.54; e 20 20 22.12; 83 m elevation)soil characteristicssoil asoil bsoil csand content (%) 144763silt content (%) 441716clay content (%) 423621ph (h2o)8.38.28.7humus (%) 242313soil moisture at 50100-mm depth (w% = grav.%)242319mean soil temperature (c) at 100150-mm depth19.419.118.7min soil temperature (c) at 100150-mm depth13.313.814.1max soil temperature (c) at 100150-mm depth29.429.529.8soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field . The average soil moisture from may to june 2006 is shown as well as the average soil temperature from august to september 2006; letters beside values indicate significant differences between soils according to the non - parametric m whitney u test at p <0.05 characteristics of the three soils of different sand content used for growing maize in pots for four plant - scale field experiments in csongrad county, southern hungary in 2005 and 2006 (n 46 25 59.54; e 20 20 22.12; 83 m elevation) soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field . The average soil moisture from may to june 2006 is shown as well as the average soil temperature from august to september 2006; letters beside values indicate significant differences between soils according to the non - parametric m whitney u test at p <0.05 maize plants of the hybrid magister (ufa semences, bussigny, switzerland) were grown in plastic pots (d = 200 mm, h = 220 mm). Two fungicide - treated maize grains (fungicide fludioxonil and metalaxyl - m, maxim xl 035fs, syngenta) were sowed into each pot and, if both germinated, one plant was removed . Pots were placed into the rows of a maize field with the top of the pots at the level of the soil surface always leaving at least one maize plant as a buffer between pots (systematic block design). At the 46 leaf stage of maize, potted plants were infested with eight second instar d. v. virgifera larvae (see below). One week later, nematodes were applied (see below and table 2). The roots of the hybrid magister emit the nematode attracting volatile -caryophyllene in response to d. v. virgifera larval feeding (rasmann et al . 2005). Eleven to twenty - two replicates were organised for each treatment group (soil type and nematode species) and for the controls (table 2). At the 68 leaf stage of maize (see dates in table 2), gauze sleeve cages (approximately 1.5-m height) were placed over the potted and d. v. virgifera - infested plants in order to capture emerging adults . The experiment was repeated four times.table 2experimental time table for applying three nematode species against d. v. virgifera larvae into three different soils of potted maize plants in csongrad county, southern hungary in 2005 and 2006experimentdatesninfestation with 8 d. v. virgifera larvaenematode applicationd . V. virgifera adult emergence1early sept 2005mid sept 2005early oct late oct 2005192224 may 0615 may 2006late may early july 20061113330 may 068 june 2006mid june mid july 20061719415 mid aug 200622 aug 2006early sept mid oct 20061113n = number of plants (= pots) assessed per treatment group (soil type and nematode species) and control experimental time table for applying three nematode species against d. v. virgifera larvae into three different soils of potted maize plants in csongrad county, southern hungary in 2005 and 2006 n = number of plants (= pots) assessed per treatment group (soil type and nematode species) and control diabrotica v.virgifera eggs were obtained from a laboratory culture of field - collected beetles in southern hungary (25c day, 1520c night, 14l:10d, 4060% r.h . ; for procedures see singh and moore 1985). The eggs were overwintered at 68c in moist sand, and diapause was broken in early april by transferring them to 25c for 14 days . Approximately 200300 maize grains of the hybrid magister were washed with soap to remove fungicides and planted in a plastic tray (300 450 mm) with moist potting soil (garri plusz, garri company, budapest, hungary). Five days after planting, ready - to - hatch eggs were placed into these plastic trays, which were then stored in the dark at 25c (approximately 5,000 eggs per tray). One week after larval hatching (when most larvae were in late first instar stage), the soil containing the larvae was put onto a new tray with new maize plants to provide more food for further larval development . After another week, late second instars were obtained by manually crumbling the soil and maize roots . Using a moist paintbrush, larvae were transferred into several petri dishes (45-mm diameter) containing a small amount of soil and then taken to the field . The potted maize plants were infested with eight d. v. virgifera larvae by emptying the contents of the petri dishes (larvae and soil) into two 100140-mm deep holes in the soil at a distance of 5080 mm from both sides of the maize plant . About 810 third - instar larvae per plant root are often estimated to cause economic damage to a plant, depending on local conditions and maize prices (c. r. edwards, personal communication, 2004); occasionally already two larvae per plant are considered sufficient (reed et al . 1991). Infective juveniles of three nematode species were used in this study: (1) a hybrid of european and us strains of h. bacteriophora poinar provided from liquid culture by e - nema gmbh, schwentinental, germany, (2) the dutch nl - hw79 strain of h. megidis poinar, jackson and klein re - isolated from swiss soils and provided from a liquid culture by andermatt biocontrol, grossdietwil, switzerland, and (3) a hybrid of european strains of s. feltiae (filipjev) provided from liquid culture by e - nema gmbh . These nematodes were known to be effective against second and third instars from previous laboratory bioassays (70100% mortality; rasmann et al . Heterorhabditis bacteriophora and s. feltiae were shipped in clay in a cool box from the producer to the experimental site, and h. megidis was shipped in vermiculite . Approximately 23 h before application, the infective juveniles were diluted with the carrier material in tap water to the required concentration . Using a pipette, 2,000 infective juveniles in 1.22-ml tap water were injected twice (in the late evening and following morning) 100 mm into the soil at distances of 150 mm from the plant, totalling 4,000 juveniles per pot (= 13 juveniles per cm or 1.3 10 juveniles per hectare). These injections simulated the commonly practised application of nematodes as a fluid into soil during sowing of maize or during mechanical weed control (toepfer et al . 2008, 2010). To evaluate the quality of each of the nematode shipments prior to application (kaya and stock 1997), 100 infective juveniles were added to three plastic cups (d = 40 mm, h = 60 mm) containing 200 g of moist, sterilised sand and five larvae of galleria mellonella l. (lepidoptera: pyralidae). Mortality of g. mellonella larvae was assessed after 1 week in darkness and at 22c . Mortality of 70100% of g. mellonella was found for all nematode batches, indicating that the test material was of sufficient quality for subsequent applications and analyses . Emerged adults were removed weekly from the sleeve cages during their period of emergence (table 2) and counted . Emergence of adults was compared among soils, nematode species and controls in each experiment (fig . 1) using the non - parametric m. whitney u test . In order to pool data from the four experimental repetitions, the mean weighted efficacy of each nematode species in each of the three soils was then calculated as the reduction of d. v. virgifera relative to the untreated controls (corrected efficacy% = (100 (beetles in treated pots 100/beetles in the control)) (fig . 2). A comparison among efficacies of nematode species in the three different soils was conducted using the bonferroni post hoc test following an anova (kinnear and gray 2000).fig . 1adult emergence from eight second instar d. v. virgifera larvae per maize plant from three different soils either treated with entomopathogenic nematodes or left untreated (potted maize plants in a maize field in southern hungary; soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field; 1122 potted maize plants were allocated to every treatment and control group in each of four experiment repetitions; error bars = sem; letters above bars indicate significant differences according to m whitney u test at p <0.05)fig . 2mean percent reduction of diabrotica v. virgifera emergence due to applications of entomopathogenic nematodes into three different soils . Mean weighted reduction of adult emergence shown in comparison to the controls (= corrected efficacy); potted maize plants in a maize field in southern hungary; soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field; 1122 potted maize plants were allocated to every treatment and control group for each of four experiment repetitions; error bars = sem; letters above bars indicate significant differences of efficacies between soils and between nematode species according to the bonferroni post hoc test at p <0.05 following an anova adult emergence from eight second instar d. v. virgifera larvae per maize plant from three different soils either treated with entomopathogenic nematodes or left untreated (potted maize plants in a maize field in southern hungary; soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field; 1122 potted maize plants were allocated to every treatment and control group in each of four experiment repetitions; error bars = sem; letters above bars indicate significant differences according to m whitney u test at p <0.05) mean percent reduction of diabrotica v. virgifera emergence due to applications of entomopathogenic nematodes into three different soils . Mean weighted reduction of adult emergence shown in comparison to the controls (= corrected efficacy); potted maize plants in a maize field in southern hungary; soils were prepared by adding different amounts of river sand to natural gleyic csernozem soil of silty clay texture (soil a) taken from the experimental field; 1122 potted maize plants were allocated to every treatment and control group for each of four experiment repetitions; error bars = sem; letters above bars indicate significant differences of efficacies between soils and between nematode species according to the bonferroni post hoc test at p <0.05 following an anova the influence of soil characteristics on nematode efficacy in reducing d. v. virgifera was tested with between - subjects anova (glm procedure) in cases where a certain soil characteristic was proven significantly different between the soil types according the m whitney u test (see table 1). Linear associations between soil characteristics and nematode efficacy were determined by the pearson correlation coefficient after visually consulting scatter plots for linearity (kinnear and gray 2000). In most experiments nematodes reduced d. v. virgifera larvae, regardless of the soil they were applied to (fig . 1). None of the three nematode species consistently reduced d. v. virgifera, i.e. H. bacteriophora reduced d. v. virgifera in eight out of eleven cases, and h. megidis and s. feltiae, each reduced d. v. virgifera in five out of 11 cases . Soil type generally influenced the efficacy of nematodes in the reduction of d. v. virgifera (one - way anova: f(2,717) = 13.4, p <0.001). Heterorhabditis bacteriophora and h. megidis were nearly double as effective in soil a as in soil b or c (soil a being the soil with the lowest sand and highest silt and clay content) (fig . 2). In soil a, h. bacteriophora reduced d. v. virgifera by 58 33% sd, and h. megidis reduced d. v. virgifera by 33 37% . No difference in the efficacy of both nematodes was found in soils b and c. among the soil factors shown in table 1, low sand content and high silt content were the factors best correlated with the efficacy of h. bacteriophora (r = 0.311 and 0.309, both p <0.001; both had higher r values than other factors). High silt content was the factor best correlated with the efficacy of h. megidis (r = 0.23, p = 0.001). 2), i.e. In soils with low or medium sand content . In those soils, s. feltiae reduced d. v. virgifera by 20 46% and 30 6%, respectively . However, it rarely reduced d. v. virgifera in soil c with high sand content (fig . 1). Among the soil factors shown in table 1, high clay content was the factor best correlated with the efficacy of s. feltiae (r = 0.246, p = 0.01). The choice of a nematode species influenced the reduction of d. v. virgifera adult emergence (between - subject anova: f(11,717) = 23.8, p <0.001). Heterorhabditis bacteriophora reduced d. v. virgifera by 3358% on average across soils, which was significantly more than h. megidis (1633%) and s. feltiae (020%) (fig . 2). Adult emergence of d. v. virgifera from untreated control pots varied among experiments and soils, i.e. Between 0.08 and 1.8 emerging adults from the eight larvae used to infest each maize plant (fig . 1). On average, 0.99 0.35 adults emerged from soil a, 0.58 0.45 from soil b and 0.88 0.47 from soil c. overall, high sand content influenced d. v. virgifera emergence negatively (r = 1.5, p = 0.037), whereas high silt content influenced d. v. virgifera emergence positively (r = 0.21, p = 0.005). This study showed that nematodes can reduce d. v. virgifera emergence in all three of the soil types tested . However, the higher efficacy in soils with high clay and silt content was surprising because several previous studies suggested that sandy soils provide good conditions for nematode survival, movement, host finding behaviour and infectivity (e.g., kung et al . Our results suggest the opposite is true for d. v. virgifera control in maize fields . Only barbercheck and wang (1997) also found that h. bacteriophora killed more larvae of diabrotica undecimpunctata barber in loam than in sand . Our study does not provide much insight into which factors might have prevented the nematodes from being more effective in the sandy soils . One explanation for the apparently high efficacy of nematodes in non - sandy soils might be that the nematodes were applied too close to maize roots and d. v. virgifera (here 150 mm) to detect a reduction in nematode movement in heavy soils with low sand content . It is known that movement of nematodes can be restricted in dense soils such as clay or silty clay; whereas, strong movement can usually be observed in loamy sand or sandy soil (barbercheck and kaya 1991; barbercheck 1992; portillo aguilar et al . (2006) reported that the mobility of s. carpocapsae was greater in marine sand than in sandy loam soil, and koppenhoefer and fuzy (2006a) showed that the infectivity of s. scarabaei slightly declined from sandy soils to fine clay soils, whereas no such effects were reported for h. bacteriophora and h. zealandica . Despite the advantages of sandy soils, nematodes may still find their hosts easier in clay soils than in sandy soils when moving along cracks formed by plant roots or the host larvae . In sand, however, they will disperse more equally and the net - movement towards the host larvae may therefore be less directed . Another possible explanation for our results is that the survival of d. v. virgifera larvae is usually high in heavy soils (turpin and peters 1971; beckler et al . 2004), such as clay, and would therefore provide most host larvae for nematode attack and propagation . Gaugler (2002) reported that nematodes usually have an advantage over insecticides in that they propagate within the pests and thus can react to high pest densities . This was also suggested for h. megidis when applied against d. v. virgifera in maize fields in the usa (i. hiltpold 2008, personal communication). However, in our study, the time period required for nematode propagation (12-week period) would hardly be enough to infest more larvae because the applied larvae already started to pupate and emerge as adults (toepfer and kuhlmann 2006). Moreover, our results suggest that high sand content, in contrast to above mentioned papers, only slightly reduced d. v. virgifera survival, measured in the untreated controls . We found approximately 12% survival from late second instar to the adult stage in the silty clay with low sand content and 8% in the sandiest soil . However, the negative influences of sand to first instar larvae, such as through coarse texture or fast desiccation of sandy soils (gustin and schumacher 1989; macdonald and ellis 1990) were excluded in this study through the infestation of plants with later less sensitive instars . Such mortality factors of first instars might be the reason that greater damage from d. v. virgifera, particularly plant lodging, are more often reported from regions with heavy and dense soils than from regions with light sandy soils (i. zseller, 2008, personal communication). Another reason might be that population pressure of d. v. virgifera is usually higher in regions with heavy and dense soils due to higher intensity of maize growing when compared to regions with sandy soils considered suboptimal for maize production due to soil aridity (i. zseller, 2008, personal communication). In conclusion, the efficacy data presented here suggest that nematodes might be suitable biological control agents for managing d. v. virgifera in most soils, including heavy non - sandy soils, such as those found in the intensive maize production areas of central europe . On average across soils, h. bacteriophora was more effective at controlling d. v. virgifera larvae (43%) than h. megidis (23%) and s. feltiae (11%). This should encourage and support the development of a biological control product against this invasive alien maize pest in europe.
|
Computer - aided detection (cad) was introduced in breast cancer screening as a technology to avoid perceptual oversights and its effectiveness has been demonstrated in many studies [13]. Nevertheless, there is a continuing debate regarding the usefulness of cad [4, 5]. While most radiologists agree that cad systems have value because of their high performance in detecting microcalcifications, many believe that current cad algorithms for masses and architectural distortions have too many false positives to allow effective use [68]. Evidently, more research is needed to improve cad algorithms . However, the lack of confidence some radiologists have in cad may also be another reason . In previous research strong evidence was found that the performance of cad algorithms may not be a problem, but that the concept of cad may need to be revised . The assumption on which cad is currently based is that significant lesions initially missed by radiologists will be acted upon when cad marks them . In practice, however, many lesions are not missed by perceptual oversight but due to incorrect interpretation [1012]. Therefore, it is not surprising that studies reveal that many significant lesions are still missed even when cad marks them [1316]. To prevent such interpretation errors cad needs to be designed to help radiologists with decision making . The purpose of this study was to investigate a novel way of using cad algorithms . In the traditional prompting approach [17, 18], cad results are displayed after the reading is completed, offering the reader a possibility to check if no perceptual failures occurred related to search . In current practice, readers are strongly discouraged to downgrade their findings on the basis of cad . Compared with the traditional approach, we investigated a method in which cad marks are only displayed on request during the reading . This novel approach means that when the reader is inspecting a certain region in a mammogram, that particular region can be probed for the presence of any cad information using a pointer and, if present, only the cad information about this location is shown . In addition to the cad mark also the level of suspicion computed by the cad system is displayed . However image regions deemed normal by the reader are not probed for cad and thus no other cad marks elsewhere on the image would be shown . However, this method has the potential to aid readers in making decisions when they inspect potential lesions, without being distracted by false positives of cad . Our study was motivated by previous research, which demonstrated a significant improvement in detection performance when cad mass marks were independently combined with reader scores . In that study, cad marks on regions not reported by the reader were not used, which is similar to the approach investigated here . As independent combination of reader results with cad would not be easily accepted in clinical practice, we designed a screening workstation in which readers themselves can combine their interpretation with cad in an interactive way . To investigate the proposed cad concept the institutional review board approved this retrospective study and waived the need for informed consent . For the purpose of this study, a dedicated mammographic workstation was developed that has the basic functionality that screening radiologists expect when they read digital mammograms on electronic displays, including dedicated hanging protocols, zooming, image manipulation, and local contrast enhancement tools . The workstation was equipped with a 30-inch color lcd panel (model flexscan sx3031w; eizo nanao technologies inc ., hakui, ishikawa, japan) with a native resolution of 2,560 1,600 . Cad processing was performed on a separate server and results were submitted to the workstation with the image data before a reading session started . Cad results were obtained from the r2 imagechecker v8.0 (hologic, bedford, ma, usa). On the workstation (fig . 1) the presence of cad marks can be queried interactively by clicking on suspect regions in the mammogram using a pointing device by the readers . It is not possible to display all available cad marks at once as in traditional cad prompting devices . For each queried location, the workstation checks if a cad mark is available at that location . If a cad mark is available, it is presented to the reader by displaying the contour of the region detected by cad along with a computer - estimated malignancy score . The contour of the region is colored based on the malignancy score using a continuous color scale ranging from red to yellow, for respectively high to low malignancy ratings . Previous studies show that giving readers additional information on the likelihood of cad marks might be helpful in decision making [1922]. The upper row shows prior mammograms and the lower row displays the current screening mammograms that have to be reported . In the case shown here, a reader reported a localized finding in both projections and is asked to assign a malignancy score between 0 and 100 to that finding . In the craniocaudal (cc) view, a cad region was present at the reported location the graphical user interface of the cad workstation used in the observer experiments . The upper row shows prior mammograms and the lower row displays the current screening mammograms that have to be reported . In the case shown here, a reader reported a localized finding in both projections and is asked to assign a malignancy score between 0 and 100 to that finding . In the craniocaudal (cc) view, a cad region was present at the reported location the average number of cad regions that could be activated was adjustable . Only cad regions with malignancy ratings exceeding some threshold were included . In the observer study, we adjusted this threshold such that in normal cases the average number of false - positive regions was two per image . A total of 120 screening mammograms were selected from the dutch breast cancer screening program and were digitized by using a laser digitizer suitable for medical applications (lumiscan 85, lumisys, sunnyvale, ca, usa) at a pixel resolution of 50 m . The mammograms were averaged down to a resolution of 100 m, maintaining a gray - level resolution of 12 bits . From these cases, 40 had a biopsy - proven malignant mass, and 80 were cancer - free . As a result of the dutch screening protocol, all cancer cases selected were subtle cancers that were missed at the original screening and were retrospectively identified as visible . We chose to use cases with missed cancers to maximize the power of our observer experiment . Each mammogram was presented with the corresponding prior screening mammogram, as is common in screening practice to allow detection of temporal changes . Table 1study overviewtotal cases120 normal cases80 cancer cases40 cancer cases detected by cad33available cad regions587 available true - positive cad regions41 available false - positive cad regions546cancers hit in at least one view by the cad system at an operating level of 2.0 false - positive markings per imageregions that could be queried at the operating level of 2.0 false - positives markings per image cancers hit in at least one view by the cad system at an operating level of 2.0 false - positive markings per image regions that could be queried at the operating level of 2.0 false - positives markings per image nine readers, of which four were certified screening radiologists and five were non - radiologists with mammogram reading skills, participated in the study . Before the actual observer study, the expert radiologists were presented with fewer training cases due to time constraints . The number of training cases presented to the radiologists ranged from 10 to 30 . The training cases served to familiarize the observers with the system, including the reporting functionalities, the interactive cad functionality, and the controls for adjusting the brightness and contrast ., cad was made available for the cases initially read without cad and vice versa . The order of the cases within each subset was randomized in the two sessions to minimize reading order effects . The observers were instructed to search for malignant masses and architectural distortions only, and were informed that the study set did not contain microcalcification cases . They were also informed what the approximate proportion of the abnormal cases was . To report abnormalities, readers were asked to mark the finding in the mlo and cc view, and assign a malignancy score on a continuous scale ranging from 0 to 100 . Readers were also instructed to mark at least one finding per case, unless a case was so obviously normal that no reasonable finding could be marked . In the with - cad session, the readers could query the cad system by clicking on regions in the mammogram that they were inspecting . Otherwise the reading and reporting was the same as in the non - cad sessions . They were free to report any finding, regardless if it was marked by cad or not . In a previous study the potential contribution of cad in improvement of mammographic interpretation was investigated by independently combining findings of the readers with detection results of the cad software . We applied the same method to the experimental data obtained in this study . In that way we could compare the effect of interactive use of cad during reading with the effect of combining reader reports with cad independently after the reading is completed . In summary, independent combination was implemented as follows: only locations in the mammogram that the observers reported were considered . For every finding it was checked whether the location of the finding was marked by cad and its level of malignancy was determined . If two views were available and the finding was marked in both views, the highest level of malignancy assigned to either of the cad regions was taken . If the finding was not marked at all by cad a zero level was assigned . The combined malignancy score of a finding was computed by taking a weighted average of the reader score with the cad - estimated malignancy score . We used localization receiver operating characteristic (lroc) to analyze the data for differences in reader performance between reading with and without using interactive cad, for individual readers, as well as for the average reader . To determine a lroc, the decision threshold is varied and the correct localization fraction is plotted as a function of the false - positive fraction . The false - positive fraction is defined as the fraction of normal cases recalled as a function of the decision threshold . For every reader, we determined the cutoff point at which the false - positive recall rate was 10%, by thresholding the scores the observer had given to the findings . The primary metric of detection performance was the mean correct localization fraction in the false - positive fraction interval ranging from 0 to 0.1 . This interval is chosen because in screening programs radiologists usually have recall rates below 10% . A finding was considered a true positive (tp), if it had a correct location in at least one of the views . We defined a location to be correct if the distance between the observers marked location and the true cancer location was less than 2 cm . The false - positive fraction was estimated from the observers marked locations in the normal cases . We computed significance of differences between sessions with and without cad for the average reader by using the wilcoxon signed rank test . The statistical analysis was performed by using r data analysis software (version 2.9.0; r foundation for statistical computing, vienna, austria). The number of times reported and unreported tp and false - positive (fp) cad regions were queried was computed for every reader . A cad region was considered queried if the distance between the observers query location and the center point of the cad region was less than 0.5 cm, or if the query location was within the cad region . Reading times per case mean reading time per case and its standard deviation was computed for every reader in both reading modes . Reading times exceeding 5 min were excluded from the analyses on the basis of the assumption that these excessively long reading times were the result of interruptions during the session . As a result, approximately 3% of all cases were excluded from the time analysis . A p value of less than 0.05 was considered to indicate a statistically significant difference . A total of 120 screening mammograms were selected from the dutch breast cancer screening program and were digitized by using a laser digitizer suitable for medical applications (lumiscan 85, lumisys, sunnyvale, ca, usa) at a pixel resolution of 50 m . The mammograms were averaged down to a resolution of 100 m, maintaining a gray - level resolution of 12 bits . From these cases, 40 had a biopsy - proven malignant mass, and 80 were cancer - free . As a result of the dutch screening protocol, the majority of the cases had only mediolateral oblique (mlo) views available . All cancer cases selected were subtle cancers that were missed at the original screening and were retrospectively identified as visible . We chose to use cases with missed cancers to maximize the power of our observer experiment . Each mammogram was presented with the corresponding prior screening mammogram, as is common in screening practice to allow detection of temporal changes . Table 1study overviewtotal cases120 normal cases80 cancer cases40 cancer cases detected by cad33available cad regions587 available true - positive cad regions41 available false - positive cad regions546cancers hit in at least one view by the cad system at an operating level of 2.0 false - positive markings per imageregions that could be queried at the operating level of 2.0 false - positives markings per image cancers hit in at least one view by the cad system at an operating level of 2.0 false - positive markings per image regions that could be queried at the operating level of 2.0 false - positives markings per image nine readers, of which four were certified screening radiologists and five were non - radiologists with mammogram reading skills, participated in the study . Before the actual observer study, 60 training cases were presented to the non - radiologists . The expert radiologists were presented with fewer training cases due to time constraints . The number of training cases presented to the radiologists ranged from 10 to 30 . The training cases served to familiarize the observers with the system, including the reporting functionalities, the interactive cad functionality, and the controls for adjusting the brightness and contrast ., 30 mammograms were read with cad and 30 without . In the second session, the order of the cases within each subset was randomized in the two sessions to minimize reading order effects . The observers were instructed to search for malignant masses and architectural distortions only, and were informed that the study set did not contain microcalcification cases . They were also informed what the approximate proportion of the abnormal cases was . To report abnormalities, readers were asked to mark the finding in the mlo and cc view, and assign a malignancy score on a continuous scale ranging from 0 to 100 . Readers were also instructed to mark at least one finding per case, unless a case was so obviously normal that no reasonable finding could be marked . In the with - cad session, the readers could query the cad system by clicking on regions in the mammogram that they were inspecting . Otherwise the reading and reporting was the same as in the non - cad sessions . They were free to report any finding, regardless if it was marked by cad or not . In a previous study the potential contribution of cad in improvement of mammographic interpretation was investigated by independently combining findings of the readers with detection results of the cad software . We applied the same method to the experimental data obtained in this study . In that way we could compare the effect of interactive use of cad during reading with the effect of combining reader reports with cad independently after the reading is completed . In summary, independent combination was implemented as follows: only locations in the mammogram that the observers reported were considered . For every finding it was checked whether the location of the finding was marked by cad and its level of malignancy was determined . If two views were available and the finding was marked in both views, the highest level of malignancy assigned to either of the cad regions was taken . If the finding was not marked at all by cad a zero level was assigned . The combined malignancy score of a finding was computed by taking a weighted average of the reader score with the cad - estimated malignancy score . We used localization receiver operating characteristic (lroc) to analyze the data for differences in reader performance between reading with and without using interactive cad, for individual readers, as well as for the average reader . To determine a lroc, the decision threshold is varied and the correct localization fraction is plotted as a function of the false - positive fraction . The false - positive fraction is defined as the fraction of normal cases recalled as a function of the decision threshold . For every reader, we determined the cutoff point at which the false - positive recall rate was 10%, by thresholding the scores the observer had given to the findings . The primary metric of detection performance was the mean correct localization fraction in the false - positive fraction interval ranging from 0 to 0.1 . This interval is chosen because in screening programs radiologists usually have recall rates below 10% . A finding was considered a true positive (tp), if it had a correct location in at least one of the views . We defined a location to be correct if the distance between the observers marked location and the true cancer location was less than 2 cm . The false - positive fraction was estimated from the observers marked locations in the normal cases . We computed significance of differences between sessions with and without cad for the average reader by using the wilcoxon signed rank test . The statistical analysis was performed by using r data analysis software (version 2.9.0; r foundation for statistical computing, vienna, austria). The number of times reported and unreported tp and false - positive (fp) cad regions were queried was computed for every reader . A cad region was considered queried if the distance between the observers query location and the center point of the cad region was less than 0.5 cm, or if the query location was within the cad region . Mean reading time per case and its standard deviation was computed for every reader in both reading modes . Reading times exceeding 5 min were excluded from the analyses on the basis of the assumption that these excessively long reading times were the result of interruptions during the session . As a result, approximately 3% of all cases were excluded from the time analysis . A p value of less than 0.05 was considered to indicate a statistically significant difference . The mean correct localization fraction of a reader in the false - positive fraction interval ranging from 0 to 0.1 (tfp10) is used as the performance measure . Results show that radiologists did not perform better in this study than the non - radiologists . We computed average lroc curves from all the readers, the non - radiologists, and the radiologists . These are shown in figs . 2, 3, and 4, respectively . Table 2reader detection performance in the false - positive fraction interval ranging from 0 to 0.1without cad tpf10 (%) with cad tpf10 (%) independent combination tpf10 (%) non - radiologists 141.151.343.3 235.351.541.7 316.025.926.3 415.425.227.4 2average lroc curves obtained from the nine readers for the detection of cancers with and without using cad . The false - positive fraction interval ranging from 0 to 0.1, where the mean correct localization fraction is computed, is highlighted in light yellowfig . 4average lroc curves obtained from the four radiologists reader detection performance in the false - positive fraction interval ranging from 0 to 0.1 average lroc curves obtained from the nine readers for the detection of cancers with and without using cad . The false - positive fraction interval ranging from 0 to 0.1, where the mean correct localization fraction is computed, is highlighted in light yellow average lroc curves obtained from the five non - radiologists average lroc curves obtained from the four radiologists the performance of the average reader increased with cad at low false - positive rates from 25.1% to 34.8% . The difference between reading with and without cad for the average reader, measured by the performance metric defined above, was statistically significant (p = 0.012). Results confirm that performance may also be increased by independent combination with cad scores, with a smaller increase, however, than obtained with interactive use of cad . The difference we found between interactive use of cad and independent combination is not statistically significant . As an example, a mammogram of a woman with an invasive ductal carcinoma is shown in fig . Seven of the nine readers correctly localized the cancer in both sessions, but rated their finding substantially more suspicious in the session with interactive cad enabled, one reader only located the cancer correctly in the session where cad was enabled, and one reader did assign a slightly lower rating to the cancer in the session with cad . In fig . 6, the average time to read a case without cad was 84.7 61.5 s. the radiologists read the cases much faster than the non - radiologists . Average reading time in the session with cad was 85.9 57.8 s / case (table 3). There were no significant differences in reading times for the session with cad and the session without cad (p = 0.13) (table 3). 5mediolateral oblique mammographic views of a woman with an invasive ductal carcinoma indicated by the arrow . Seven of the nine readers correctly localized the cancer in both sessions, but rated their finding substantially more suspicious in the session with interactive cad enabled, one reader only located the cancer correctly in the session where cad was enabled, and one reader did assign a slightly lower rating to the cancer in the session with cadfig . 6the same case as in fig . 5 with the activated cad region . The red contour and a cad score close to zero indicate a high probability that this is a cancertable 3mammogram reading timesaverage reading time per case (s)without cadwith cadp valuenon - radiologists 183.6 47.0111.5 70.30.001 284.3 59.267.7 42.10.03 3131.1 65.1129.5 56.90.51 4158.8 68.1146.0 62.30.23 533.4 29.635.2 29.00.45 average97.0 70.096.7 67.40.97radiologists 663.1 45.658.9 37.80.57 757.8 31.770.8 44.60.002 873.1 44.173.1 31.40.42 986.7 52.188.6 39.10.12 average70.0 45.172.8 39.80.02 reader average84.7 61.585.9 57.80.13 mediolateral oblique mammographic views of a woman with an invasive ductal carcinoma indicated by the arrow . Seven of the nine readers correctly localized the cancer in both sessions, but rated their finding substantially more suspicious in the session with interactive cad enabled, one reader only located the cancer correctly in the session where cad was enabled, and one reader did assign a slightly lower rating to the cancer in the session with cad the same case as in fig . 5 with the activated cad region . The red contour and a cad score close to zero indicate a high probability that this is a cancer mammogram reading times the cad system had a lesion - based sensitivity of 80.4% (41/51) at the operating level of 2.0 false - positive markings per image used in the study . Table 4 shows that on average 274.2 of the 546 false - positive cad regions (50.2%) were not queried . It also shows that on average 5 of the 41 true - positive cad regions (12.2%) were not queried . The radiologists queried far fewer false - positive cad regions than the non - radiologists . Table 4number of cad regions queriedqueried cad regionsnon - queried fp cad regionsnon - queried, unreported tp cad regionsnon - queried cad regions but reported tp findingnon - radiologists 129029322 233824432 333025142 45008331 519637777 average330.8249.63.82.8radiologists 617639687 726231960 820936594 944414030 average272.753056.52.75 reader average305274.2252.78 there were 587 cad regions in total; 546 false - positive cad regions and 41 true - positive cad regions number of cad regions queried there were 587 cad regions in total; 546 false - positive cad regions and 41 true - positive cad regions results of this study show that readers are able to improve detection performance when they use cad for interpretation of mass lesions in an interactive way . The beneficial effect of cad can be attributed fully to improvement of interpretation, because traditional cad prompts to avoid perceptual oversights were not shown . The effectiveness was remarkable given that the readers in this study used the interactive system for the first time and had limited training . It is noted that in a previous experiment using a similar observer study design and dataset no significant improvement with traditional cad prompting was found when readers had limited training . This suggest that for mass detection interactive cad may be more effective than traditional cad . This is in accordance with studies suggesting that interpretation errors are more common than perception errors [10, 11]. Results obtained in this study show that readers are able to exploit the predictive power of cad to improve their decisions . This may come as a surprise, because due to the large number of false positives it is often believed that the performance of cad for masses is much less than that of an experienced reader . It is noted, however, that in a previous study it was shown that the performance of the cad system was comparable to that of experienced readers when analysis was restricted to locations identified by the radiologists . This is what counts in this study, because cad results were only shown on regions probed by the readers . Interestingly, malignancy ratings of cad were also used previously in the large cadet ii trial conducted in the uk, where the size of the cad marks was used to represent the computed likelihood of cancer . Positive results of this trial could also be related to using cad as a decision support . The potential gain of using cad for decision making was also demonstrated in a previous study, in which cad information was independently combined with reader scores . Results in this study confirm that by independent combination of reader scores with cad, performance can be improved (table 2). On average, we found that the improvement in performance was larger when readers used cad themselves than when cad was independently combined with their scores . Interestingly, for one of the radiologists (number 8) detection performance decreased when using interactive cad, whereas performance increased with independent combination . This may well be due to insufficient training . Table 3 shows the average reading times per reader for the sessions with and without cad . We found that for the non - radiologists the average reading time was slightly reduced when they used cad . For the radiologists the reading time increased less than 3 s on average with cad . It seems that interactive use of cad does not cost much extra time, because the information is presented at the moment the reader asks for it . In the experiments we used a threshold to adjust the average number of cad regions per image that could be activated . On average, there were two false positives per normal image . In clinical practice the operating point of prompting systems for masses in mammography are often set to a level near 0.5 false positives per image . We used more regions, because it was thought that in the interactive system more false positives would be tolerable . Many of them are never activated, and if they are activated they are perceived very differently than traditional prompts . The radiologists queried far fewer false - positive cad regions than the non - radiologists which may indicate they are more confident in their reading . Interactive cad is intended to aid the reader in decision making and will not help to avoid perceptual oversights . The success of the interactive approach may be explained by assuming that perceptual oversights do not occur frequently . In our study this appeared to be the case . On average only 5 (12.2%) of the true - positive cad regions thus, in the reader study at most 12.2% of the cancers were overlooked, while none of them were reported in the original screening . Results also show that on average 274.2 (50.2%) false - positive cad regions were not activated, limiting the number of false positives to which the readers are exposed . It is noted that the system can easily be extended by displaying the most suspicious, non - queried cad regions as traditional prompts after the reading is completed . In general, the response of the radiologists to the interactive cad system was very positive and they preferred it to conventional cad prompting systems . An advantage of the proposed system is that obvious false positives of the cad system are rarely shown, as the readers do not probe these regions . The reading conditions were less optimal than in screening practice, because a 4-megapixel color display was, instead of two 5-megapixel grayscale monitors commonly used in mammography . This might have a negative effect on the detection performance, especially for detecting microcalcifications . As microcalcification cases were not included in our study we do not believe that image quality influenced our study outcome . In which no significant differences were found between the observer performances for detecting breast cancer masses when performing soft - copy reading on 3- or 5-megapixel lcd monitors . Another limitation of our study is the absence of cc views in most cases . In the dutch screening program, we would like to note that both limitations did not affect the difference in detection performance described in this paper, because the conditions were similar in the sessions with cad and the sessions without cad . It may be that their alertness, concentration, and decision thresholds were affected by the knowledge that this study was a controlled laboratory experiment in which their decisions would be recorded and used in a study, and that the balance between cancer and normal cases was artificial . Because their assessments of the mammographic cases in this retrospective observer study would not affect patient care, their decisions could be different from those in an actual clinical setting . However, the reading conditions in the with - cad and without - cad sessions were similar, and therefore the observed effect on detection performance can be attributed solely to the use of the interactive cad system . Because we performed lroc analysis, decision thresholds did not affect study results . As in many other studies, the sample was heavily weighted towards cancer cases . Not doing so would make this form of research extremely expensive . The effect on sensitivity and recall rates of radiologists using this interactive cad system for real - life screening can only be determined by a large randomized controlled trial in which radiologists use this system during routine use and for a substantial period . Nevertheless, a laboratory study is generally a first step to demonstrate the usefulness of a cad concept before a large trial is performed . The readers participating in this study had different backgrounds and experience . We expect that when readers gain more experience with the system they will learn how optimize use of it . In addition, readers need to find out how to weight cad information in their decisions, and we expect them to improve this when they gain more understanding of the strengths and weaknesses of the cad software . We found that in addition to using cad in the traditional way to avoid perception errors, there is a large potential for using cad as a decision aid to reduce interpretation failures . Results suggest that interactive cad may be more effective than traditional cad for improving mass detection without affecting reading time.
|
Atherosclerosis is the leading cause of peripheral artery disease (pad) and coronary artery disease (cad). Some previous studies have reported that pad is a coronary heart disease risk equivalent.1)2) another study, however, reported that risk factors for pad are different to those for cad.3) risk factors for atherosclerosis are hypertension (ht), diabetes mellitus (dm), hypercholesterolemia {high total cholesterol (tc) levels, high low density lipoprotein - cholesterol (ldl - c) levels, and/or low high density lipoprotein - cholesterol (hdl - c) levels}, smoking, older age, obesity, metabolic syndrome (mets)4) and chronic kidney disease (ckd).5) risk factors for pad may vary depending on the affected arteries.6) although the prevalence of pad and cad is known to increase with the ageing population,7) few studies have compared risk factors for pad to cad solely in the korean population . Therefore, our objective in the present study was to analyze and compare risk factors for pad, cad, and for normal controls under the hypothesis that risk factors for pad and cad are different from those for normal controls . We reviewed the records of patients diagnosed with pad and cad at the cardiac and vascular center from november 1994 to november 2004 as well as those of healthy subjects (normal control group; control) who underwent health examinations of digestive organs during the same period at the health promotion center of samsung medical center . We excluded patients with cardiovascular disease (cvd), cerebrovascular accident, or lung cancer from the normal control group . The enrolled subjects consisted of 1) patients with pad (n=415) who had over 50% peripheral artery occlusion confirmed by lower extremity computed tomography angiography, 2) patients with cad (n=3686) including those with stable angina, unstable angina, and acute myocardial infarction confirmed by cardiac catheterization, and 3) control (n=3835). In addition, self reported information on the absence of cad and pad was used in control . This study was approved by the samsung medical center institutional review board; informed consent was waived for this retrospective study . Subjects were defined as having ht if they were taking an anti - ht drug, had been clinically diagnosed with ht, or had either a systolic blood pressure (sbp) 40 mm hg or a diastolic blood pressure (dbp) 90 mm hg . Subjects who met one of the following requirements were defined as having dm: on an oral hyperglycemic agent, using insulin, clinical diagnosis of diabetes, or a fasting glucose level> 126 mg / dl . Subjects were defined to have hypercholesterolemia if they met one of the following requirements: diagnosis of hypercholesterolemia or a medication history of hypercholesterolemia or tc> 200 mg / dl or ldl - c> 130 mg / dl . The following body mass index (bmi) categories were recognized: normal (18.5bmi<23), overweight (23bmi<25) and obese (bmi25). There was no statistical meaning of adding an underweight category because the number of underweight patients was two in the pad group, thus we included them into the bmi normal group in pad . A patient who had smoked within a year prior to the study was defined as a smoker . The estimated glomerular filtration rate (egfr), which was used as an indicator of kidney function, was calculated using the modification of diet renal disease study formula: egfr (ml / min/1.73 m)=186.3{serum creatinine (cr)}(age)(0.742 if women)(1.21 if african - americans). The national kidney foundation kidney disease outcome quality initiative defined ckd as an egfr <60 ml / min/1.73 m. patients with mets were classified into two groups based on the modifications suggested by the national cholesterol education program adult treatment panel iii.1) diagnosis of mets in this study was based on the presence of three or more of the following symptoms: 1) bmi 25 (bmi categories for asia of international obesity taskforce), 2) triglyceride (tg) levels 150 mg / dl, 3) hdl - c levels <40 mg / dl for men and <50 mg / dl for women, 4) ht with sbp 130 mm hg, dbp 85 mm hg, or undergoing active antihypertensive drug therapy, and 5) fasting blood sugar (fbs) 100 mg / dl or active use of oral hypoglycemic agents or insulin . A number of pad patients had had cad, however, cad patients were not diagnosed with pad in our data . Patients with pad were divided into two groups based on the absence or presence of coexisting cad . Pad subjects were also classified into two groups based on the modified recommendations of haltmayer et al.8) according to the affected arteries of the lower limb: 1) aortoiliac (ai) disease including occlusion or> 50% stenosis in the abdominal aorta and common and external iliac arteries, 2) femoropopliteal (fp) disease including occlusion or> 50% stenosis in the common, superficial and deep femoral, popliteal, and infrapopliteal arteries . The fp and ai groups were compared with the cad group, because the coronary arteries are similar to the fp arteries in size . General characteristics of pad, cad, and control subjects were analyzed by one - way analysis of variance with the bonferroni method in multiple comparisons testing for continuous variables . The -test was used to compare categorical variables . To analyze and compare risk factors between pad subjects with coexisting cad and those with no coexisting cad and between pad subjects with ai and fp, we employed student's t - test for continuous variables and the -test for categorical variables . Simple logistic regression analysis and multinomial logistic regression analysis were carried out to determine the association among cardiovascular risk factors in pad, cad, and control subjects . I, age, gender, ht, dm, hypercholesterolemia, obesity grade (obese), smoking status and ckd were adjusted . Model ii considered age, gender, smoking status, ckd, and mets . We reviewed the records of patients diagnosed with pad and cad at the cardiac and vascular center from november 1994 to november 2004 as well as those of healthy subjects (normal control group; control) who underwent health examinations of digestive organs during the same period at the health promotion center of samsung medical center . We excluded patients with cardiovascular disease (cvd), cerebrovascular accident, or lung cancer from the normal control group . The enrolled subjects consisted of 1) patients with pad (n=415) who had over 50% peripheral artery occlusion confirmed by lower extremity computed tomography angiography, 2) patients with cad (n=3686) including those with stable angina, unstable angina, and acute myocardial infarction confirmed by cardiac catheterization, and 3) control (n=3835). In addition, self reported information on the absence of cad and pad was used in control . This study was approved by the samsung medical center institutional review board; informed consent was waived for this retrospective study . Subjects were defined as having ht if they were taking an anti - ht drug, had been clinically diagnosed with ht, or had either a systolic blood pressure (sbp) 40 mm hg or a diastolic blood pressure (dbp) 90 mm hg . Subjects who met one of the following requirements were defined as having dm: on an oral hyperglycemic agent, using insulin, clinical diagnosis of diabetes, or a fasting glucose level> 126 mg / dl . Subjects were defined to have hypercholesterolemia if they met one of the following requirements: diagnosis of hypercholesterolemia or a medication history of hypercholesterolemia or tc> 200 mg / dl or ldl - c> 130 mg / dl . The following body mass index (bmi) categories were recognized: normal (18.5bmi<23), overweight (23bmi<25) and obese (bmi25). There was no statistical meaning of adding an underweight category because the number of underweight patients was two in the pad group, thus we included them into the bmi normal group in pad . A patient who had smoked within a year prior to the study was defined as a smoker . The estimated glomerular filtration rate (egfr), which was used as an indicator of kidney function, was calculated using the modification of diet renal disease study formula: egfr (ml / min/1.73 m)=186.3{serum creatinine (cr)}(age)(0.742 if women)(1.21 if african - americans). The national kidney foundation kidney disease outcome quality initiative defined ckd as an egfr <60 ml / min/1.73 m. patients with mets were classified into two groups based on the modifications suggested by the national cholesterol education program adult treatment panel iii.1) diagnosis of mets in this study was based on the presence of three or more of the following symptoms: 1) bmi 25 (bmi categories for asia of international obesity taskforce), 2) triglyceride (tg) levels 150 mg / dl, 3) hdl - c levels <40 mg / dl for men and <50 mg / dl for women, 4) ht with sbp 130 mm hg, dbp 85 mm hg, or undergoing active antihypertensive drug therapy, and 5) fasting blood sugar (fbs) 100 mg / dl or active use of oral hypoglycemic agents or insulin . A number of pad patients had had cad, however, cad patients were not diagnosed with pad in our data . Patients with pad were divided into two groups based on the absence or presence of coexisting cad . Pad subjects were also classified into two groups based on the modified recommendations of haltmayer et al.8) according to the affected arteries of the lower limb: 1) aortoiliac (ai) disease including occlusion or> 50% stenosis in the abdominal aorta and common and external iliac arteries, 2) femoropopliteal (fp) disease including occlusion or> 50% stenosis in the common, superficial and deep femoral, popliteal, and infrapopliteal arteries . The fp and ai groups were compared with the cad group, because the coronary arteries are similar to the fp arteries in size . Subjects were defined as having ht if they were taking an anti - ht drug, had been clinically diagnosed with ht, or had either a systolic blood pressure (sbp) 40 mm hg or a diastolic blood pressure (dbp) 90 mm hg . Subjects who met one of the following requirements were defined as having dm: on an oral hyperglycemic agent, using insulin, clinical diagnosis of diabetes, or a fasting glucose level> 126 mg / dl . Subjects were defined to have hypercholesterolemia if they met one of the following requirements: diagnosis of hypercholesterolemia or a medication history of hypercholesterolemia or tc> 200 mg / dl or ldl - c> 130 mg / dl . The following body mass index (bmi) categories were recognized: normal (18.5bmi<23), overweight (23bmi<25) and obese (bmi25). There was no statistical meaning of adding an underweight category because the number of underweight patients was two in the pad group, thus we included them into the bmi normal group in pad . A patient who had smoked within a year prior to the study was defined as a smoker . The estimated glomerular filtration rate (egfr), which was used as an indicator of kidney function, was calculated using the modification of diet renal disease study formula: egfr (ml / min/1.73 m)=186.3{serum creatinine (cr)}(age)(0.742 if women)(1.21 if african - americans). The national kidney foundation kidney disease outcome quality initiative defined ckd as an egfr <60 ml / min/1.73 m. patients with mets were classified into two groups based on the modifications suggested by the national cholesterol education program adult treatment panel iii.1) diagnosis of mets in this study was based on the presence of three or more of the following symptoms: 1) bmi 25 (bmi categories for asia of international obesity taskforce), 2) triglyceride (tg) levels 150 mg / dl, 3) hdl - c levels <40 mg / dl for men and <50 mg / dl for women, 4) ht with sbp 130 mm hg, dbp 85 mm hg, or undergoing active antihypertensive drug therapy, and 5) fasting blood sugar (fbs) 100 mg / dl or active use of oral hypoglycemic agents or insulin . A number of pad patients had had cad, however, cad patients were not diagnosed with pad in our data . Patients with pad were divided into two groups based on the absence or presence of coexisting cad . Pad subjects were also classified into two groups based on the modified recommendations of haltmayer et al.8) according to the affected arteries of the lower limb: 1) aortoiliac (ai) disease including occlusion or> 50% stenosis in the abdominal aorta and common and external iliac arteries, 2) femoropopliteal (fp) disease including occlusion or> 50% stenosis in the common, superficial and deep femoral, popliteal, and infrapopliteal arteries . The fp and ai groups were compared with the cad group, because the coronary arteries are similar to the fp arteries in size . General characteristics of pad, cad, and control subjects were analyzed by one - way analysis of variance with the bonferroni method in multiple comparisons testing for continuous variables . The -test was used to compare categorical variables . To analyze and compare risk factors between pad subjects with coexisting cad and those with no coexisting cad and between pad subjects with ai and fp, we employed student's t - test for continuous variables and the -test for categorical variables . Simple logistic regression analysis and multinomial logistic regression analysis were carried out to determine the association among cardiovascular risk factors in pad, cad, and control subjects . I, age, gender, ht, dm, hypercholesterolemia, obesity grade (obese), smoking status and ckd were adjusted . Model ii considered age, gender, smoking status, ckd, and mets . The mean age of pad subjects was 64.4 (9.3) years, while the mean age of cad subjects was 61.2 (9.9) years, and that of control subjects was 59.9 (9.1) years (p<0.001). The proportion of males in the subject groups was as follows: 90.6% for pad, 71.4% for cad, and 75.5% for control (p<0.001). More pad subjects than cad and control subjects had ht, dm, and ckd (p<0.001), while more cad subjects were smokers, had hypercholesterolemia, and were obese than pad and control subjects (p<0.001). Among the components of mets, more pad subjects had high blood pressure and high fbs (p<0.01) than patients in the other two groups, while more cad subjects had low hdl - c levels and were obese than pad and control subjects (p<0.01). Tc, tg, ldl - c, hdl - c, fbs, and cr were significantly different among the three groups (p<0.001). The results after bonferroni correction for multiple comparisons are shown in table 1 . Among pad subjects, the proportion of ai subjects with coexisting cad was 58.4%, while the proportion of pad patients with no coexisting cad was 56.8% {p = nonsignificant (ns)}. The proportion of coexisting cad was 33.6% in pad patients with ai and 32.2% in pad patients with fp (p = ns) (table 2). In model i, the adjusted odds ratios (ors) for ht {or 6.43, 95% confidence interval (ci) 4.92 - 8.39}, dm (or 7.71, 95% ci 6.05 - 9.84), hypercholesterolemia (or 1.50, 95% ci 1.18 - 1.90), smoking (or 10.3, 95% ci 7.89 - 13.4), and ckd (or 1.54, 95% ci 1.14 - 2.04) were significantly higher in subjects with pad compared to those in normal controls . However, the ors for hdl - c (or 0.92, 95% ci 0.91 - 0.93), being overweight (or 0.51, 95% ci 0.38 - 0.67), and being obese (or 0.32, 95% ci 0.24 - 0.43) were significantly lower in pad subjects compared to those in normal controls . The ors for ht (or 2.89, 95% ci 2.57 - 3.25), dm (or 4.90, 95% ci 4.28 - 5.61), smoking (or 3.76, 95% ci 3.28 - 4.30), being overweight (or 1.21, 95% ci 1.04 - 1.41), being obese (or 1.74, 95% ci 1.51 - 2.01) and ckd (or 1.46, 95% ci 1.24 - 1.72) were significantly higher in cad subjects than those in normal controls . However, the ors for hypercholesterolemia (or 0.67, 95% ci 0.60 - 0.76) and hdl - c (or 0.93, 95% ci 0.92 - 0.94) were significantly lower in the cad group than those in the control group . In model ii, the ors for smoking (or 9.38, 95% ci 7.35 - 11.9), ckd (or 2.14, 95% ci 1.63 - 2.82), and mets (or 3.61, 95% ci 2.89 - 4.51) were higher in pad subjects than those in normal controls . Comparing cad subjects with normal control group subjects, the ors for smoking (or 3.36, 95% ci 2.99 - 3.79), ckd (or 1.80, 95% ci 1.56 - 2.09), and mets (or 3.66, 95% ci 3.31 - 4.05) were significantly higher in cad subjects (table 3). We analyzed the association between cardiovascular risk factors in 1) pad patients with or without coexisting cad, and in the normal control group and 2) the pad affected site; ai or fp, and normal control group . The ors in pad patients with or without coexisting cad group and ai or fp group for ht, dm, smoking, hdl - c, and obese grade (model i) and smoking, mets, and ckd (model ii) were similar to pad subjects (table 4 and 5). The overall findings of this study revealed that ht, dm, hypercholesterolemia, obesity, smoking, ckd and mets are risk factors for pad and cad . However, these findings are consistent with those of previous studies that reported that risk factors for pad are similar to those for cad . For instance, ht,9) dm,10) hypercholesterolemia,11) smoking,12) ckd,13) and mets4) are known risk factors for cad . Ht,14) dm,15) hypercholesterolemia,16) smoking,17) ckd,5) and mets4) are risk factors for pad . In our study, the mean tc, ldl - c, hdl - c values were higher in the normal control group than those in the pad or cad group . The results from a japanese male worker adult study based on the national health and nutrition examination surveys20) are consistent with the high tc, ldl - c, hdl - c values that we found in our normal control group . Obesity is one of the major risk factor for cvd, including pad.21) obesity is also associated with high mortality related to chronic disease.22) however, patients with cad or pad have an inverse correlation between bmi and cardiovascular mortality after adjustment for confounding variables in the factores de riesgo y enfermedad arterial registry.23) the obesity paradox24) is that obese patients receive better treatment and care, because they are perceived to be at high risk . However, our pad obesity results cannot be explained by the obesity paradox, because pad subjects had occlusion or> 50% stenosis in the peripheral artery confirmed by lower extremity computed tomography angiography . This corresponds to an ankle - brachial index <0.9 and the consequent development of intermittent claudication, gangrene, and pain . Our pad subjects who visited tertiary medical services already had progressed pad with a limited radius of action, immobilization, muscle atrophy, and depression requiring surgery or intervention . The factors outlined above may explain why the obesity results were inconsistent between pad and cad subjects in our analysis . The ors for the risk factors for the absence or presence of coexisting cad in pad and cad, with the exception of obesity, were similar among the groups . A study on the association of cardiovascular risk factors with patterns of lower limb atherosclerosis in 2659 patients who underwent angioplasty revealed that dm predicted pad compared to no dm or current smoking status.25) an italian study also showed that preexisting cad with pad was associated with risk factors for pad.26) in our study, 33% of subjects with pad had coexisting cad . This result is consistent with previous studies that reported 21% of pad subjects showed myocardial infarction and 26% of pad subjects had angina.27) a comparison of the ors for ai and fp according to the affected site in pad and cad revealed similar risks as those reported in a turkish study (ankara),28) and two u.s.a - based studies (san diego29) and southern california30)). First, the study was conducted retrospectively at a single center, which may have caused selection bias . We were also not able to eliminate the possibility of information bias when collecting medical records from the medical charts of the subjects and laboratory results . Second, the mean age of the subjects in the normal control group was younger than that of the subjects in the pad and cad groups . To minimize the effect of age, we conducted age - adjusted analysis . A further limitation of our study is that we could not consider symptoms of patients with pad, physical activity, nutrition, socioeconomic position, waist circumference, or health behavior variables due to limited data . Further cardiovascular cohort studies considering these variables are therefore required to verify the risk factors for atherosclerosis . We found significantly different ors for risk factors, namely age, gender, ht, dm, hypercholesterolemia, hdl - c, obesity, smoking, ckd, and mets, in the pad and cad groups compared to those in the control group . Interestingly, the ors for obesity were inconsistent between pad and cad subjects . In other words, obesity grade was showed opposite trends . However, in both diseases, cardiovascular risk factors were found to be risk factors . In conclusion, there appears to be no differences in risk factors for pad and cad in the korean population . We found significantly different ors for risk factors, namely age, gender, ht, dm, hypercholesterolemia, hdl - c, obesity, smoking, ckd, and mets, in the pad and cad groups compared to those in the control group . Interestingly, the ors for obesity were inconsistent between pad and cad subjects . In other words, obesity grade was showed opposite trends . However, in both diseases, cardiovascular risk factors were found to be risk factors . In conclusion, there appears to be no differences in risk factors for pad and cad in the korean population.
|
Mortality rates due to accidental drowning are higher in japan than in western countries, largely resulting from a higher incidence of sudden unexpected death (sud) of japanese people in hot baths . Although the precise mortality rates are unknown, approximately 10% of suds confirmed by the tokyo medical examiner s office occur at home, involving individuals who took deep hot baths . A few studies have examined the autopsies of victims of sud associated with taking hot baths . Satoh et al summarized the findings of 268 autopsy cases of sud in hot baths . Pathological and serological examination of the 173 subjects who did not show decomposition revealed a high incidence of structural cardiac disorders, such as coronary artery disease and cardiomegaly . Only 7 of the subjects were below 50 years of age, but all 7 had a history of epilepsy . Here, we present a rare autopsy case of sud of a young subject found dead in a hot bath . We attempted genetic screening using next - generation dna sequencing (ngs), which allows large numbers of samples to be sequenced simultaneously . It can be used for the comprehensive analysis of panels of 20 to 80 genes associated with inherited arrhythmia or cardiomyopathy to detect arrhythmogenic potential in the victims whose hearts have no significant structural disorders . A 28-year - old female beauty therapist was found dead in a bathtub with her face submerged . There was no clinical history of significant organ or functional disease, such as epilepsy, that could have caused sud or syncope in any of the cases . There was no family history of heart disease, and no electrocardiography had been performed within the past 10 years . During medicolegal autopsy, no traumatic injury was found, but signs of drowning, specifically froth in the upper airway and pulmonary edema, were evident . Low levels of ethanol (1.1 mg / ml) were detected in the blood, but the full toxicological examination was negative . We concluded that all possible causes of sudden loss of consciousness, other than those of cardiac origin, were excluded by the full autopsy examination as well as the investigation of the scene of death . The heart weighed 200 g and was examined as described in a previous report, but it did not show any significant pathological changes . Under microscopic examination, ischemic necrosis of myocytes, substantial coronary artery atherosclerosis with luminal narrowing greater than 50%, and myocardial disarray were not evident . Diffuse but very mild interstitial fibrosis of the left ventricle was found (figure 1). Gross and microscopic appearance of the deceased victim s heart (after fixation with formalin): (a) horizontal section of both ventricles (scale bar = 1 cm) and (b) mild interstitial fibrosis of the left ventricle, visualized using elastica - masson staining (scale bar = 100 m). The ethical committee of toyama university approved this study, which was performed in accordance with the ethical standards established in the 1964 declaration of helsinki . The genetic analysis using ngs genomic dna samples of the case were extracted directly from whole blood using the qiaamp dna mini kit (qiagen sciences inc ., we designed a custom ampliseq panel using ion ampliseq designer software (http://www.ampliseq.com) to target all exons of 73 cardiac disorder this custom panel, which consisted of 2 separate polymerase chain reaction (pcr) primer pools and produced a total of 1870 amplicons, was used to generate the target amplicon libraries . Genomic dna samples were pcr - amplified using the designed custom panel and the ion ampliseq library kit v2.0 (life technologies, carlsbad, ca, usa). Emulsion pcr and ion sphere particle enrichment were conducted with the ion pgm template ot2 200 kit (life technologies). Ion sphere particles were loaded on an ion 314 chip kit v2 and sequenced using an ion pgm sequencing 200 kit (life technologies). The torrent suite and ion reporter software 5.0 (life technologies) were used to perform primary to tertiary analyses, including optimized signal processing, base calling, sequence alignment with the hg19 human genome reference (http://genome.ucsc.edu/), and variant analysis . For all variants detected, we consulted the east asian (eas) population database of 4327 individuals from the exome aggregation consortium (http://exac.broadinstitute.org) to filter out those variants for which the minor allele frequency (maf) was 1.0% or undetermined in the eas population . For each genetic variation identified, we applied the single nucleotide polymorphism database (dbsnp) as a population database and the human gene mutation database (hgmd) and clinvar as reported disease - causing mutation databases . We also included 8 types of in silico predictive algorithms to evaluate the pathogenicity of identified variants . The url for each database, in silico algorithms, and conditions used to evaluate pathogenicity are listed in table 2 . From the ngs analysis, scn5a_p.gly289ser, cacnb2_p.ser502leu, and myh11_p.lys1573glu were detected as rare variants in eas, and the mafs were 0%, 0.95%, and 0.035%, respectively . The sequences of scn5a_p.gly289ser and cacnb2_p.ser502leu found in this case study are depicted in figure 2 . Sequences for possible channelopathy - related pathogenic variants from the deceased: (a) scn5a, (b) cacnb2, and (c) myh11 . Scn5a_p.gly289ser was previously reported as possibly pathogenic in an earlier study and was evaluated as the other 2 variants were evaluated as having uncertain significance in clinvar and are not noted in hgmd . After using our in silico predictive algorithm analyses, scn5a_p.gly289ser was evaluated as possibly pathogenic twice, cacnb2_p.ser502leu was evaluated as possibly pathogenic 5 times, and myh11_p.lys1573glu was evaluated as possibly pathogenic 6 times (table 3). Detected variants and results of in silico analysis . Abbreviations: cadd, combined annotation dependent depletion; fathmm, functional analysis through hidden markov models; maf, minor allele frequency; provean, protein variation effect analyzer; sift, sift sequence . Previous reports indicate a number of heart conditions that may cause sud in young adults, including structural heart disease such as coronary anomaly, hypertrophic cardiomyopathy, and arrhythmogenic right ventricular cardiomyopathy . No evidence of these conditions were found in this particular case . Our study supports the findings of others with evidence that concealed cardiomyopathy and channelopathy may also result in sud of young adults . Arrhythmogenic events and related sud usually require both an abnormal myocardial substrate and an inciting trigger, such as exercise, being asleep, or emotional stress as seen in many cases . Nagasawa et al found that in the elderly, blood pressure and heart rate begin to rise immediately on immersion in a hot bath . These changes were associated with a temporary decrease in sympathetic activity without the compensatory parasympathetic suppression, resulting in hypotension and bradycardia . Chiba et al showed that increased peripheral blood pressure and cardiac output occurred after bathing in both young and elderly subjects . In addition, asymptomatic ventricular tachycardia occurred in elderly individuals while sitting in hot water, and this arrhythmia developed within 5 minutes of immersion . Many japanese people love to take bath in water that reaches shoulder depth and soak in a sitting position, and a higher water temperature than in western countries is generally used (approximately 40 - 42c). These studies, along with the case described here, show that immersion in deep hot water can trigger an arrhythmogenic event which could lead to drowning in the bath water in individuals with an inherited or acquired heart disease . We recently reported the significance of postmortem genetic analysis using ngs for both sud syndrome and sud with epilepsy cases in young people to explore the cause of such death if pathological change of the heart is not evident . The present case is notable in that detection of rare gene variants suggested that the deceased might have had undiagnosed arrhythmogenic potential which could cause sudden loss of consciousness during bathing . However, we should note the limitations involved in interpretation of the detected variants found by ngs analysis . We frequently depend on population databases and in silico analyses to evaluate the pathogenicity of detected variants because functional or genetic analysis of family members, the criterion standard method for evaluating the pathogenicity of genetic variants, can be difficult in some cases . However, the evaluations obtained from different in silico analyses do not always correspond, as shown in our case . Guidelines for interpreting sequence variants recommend that several in silico analyses should be used to evaluate the pathogenicity of arrhythmia - related gene variants because most algorithms used for missense variant prediction are only 65% to 80% accurate when examining known disease variants . In addition, le scouarnec et al and kapplinger et al indicated that identification of a variant does not confirm the presence of the disease because many of the variants found in brugada syndrome patients were also identified in the control population . Genetic analysis using ngs may provide significantly useful information about the mechanism of sud in some conditions, but careful and comprehensive evaluation of the detected variants is needed when the evaluation for pathogenicity differs across a range of predictive procedures . Scn5a_p.gln289ser is a very rare variant, not only in eas but across the world . However, 1 patient with long qt syndrome has been reported to have this variant . In addition, although the relevance of drinking alcohol to sud occurring in hot baths is not fully understood, some researchers consider that ethanol intake may increase the chance of developing atrial fibrillation, a prolonged qt interval, and sud as the combination of pathogenic genetic variants and alcohol intake might increase the risk of sudden arrhythmogenic events occurring in hot baths . The cacnb2_p.ser502leu variant is rare but has a relatively high incidence in eas, yet 5 of 8 in silico tools evaluated this variant as pathogenic . The l - type calcium channel is composed of 4 subunits, and cacnb2 codes one of 3 ancillary subunits . Cacnb2 is the dominant isoform known to play an essential role in the voltage dependence of the l - type calcium channel . Accelerated inactivation of the calcium current was found in 1 person who had a mutation in cacnb2, and the variant is also associated with brugada syndrome, short qt, long qt 8 (timothy syndrome), j wave syndrome, and sudden death . Our results show that the variants of cacnb2 may also have the potential to cause arrhythmogenic sud in hot baths . We should note that we cannot evaluate the pathogenic significance of the combined effect of the variants seen in present case . Currently available in silico tools can only indicate the pathogenicity of single genes; thus, the pathogenic significance of interactions between different gene variants cannot be fully evaluated . This victim s heart might have concealed an arrhythmogenic potential from the combination of 2 channelopathy - related pathogenic variants, even if structural abnormality was not evident . The role of the variant of myh11 (which encodes a smooth muscle myosin heavy chain) is not well established . This gene belongs to the myosin heavy chain family and is a major contractile protein in smooth muscle cells . Whereas mutations in myh11 have been identified in families with inherited patent ductus arteriosus and thoracic aortic aneurysms and dissections, cases of arrhythmia or sudden death associated with this myh11 variant examination of further cases involving this variant will be useful to determine how significant this variant is . Given the high cost of genetic analysis, it is not feasible to conduct this analysis routinely for every case . In many circumstances, careful toxicological screening and histological examination of the heart and other organs should provide enough evidence to specify cause of death or might at least contribute to narrowing the list of target genes to explore . In particular, detection of minimal cardiac pathology, including necrosis, inflammation, and fatty infiltration into the ventricle, during an examination might be indicative of cardiomyopathy - related genetic variants . Such findings may prompt further genetic analysis, even if the observed pathological changes do not fulfill the commonly used diagnostic criteria of structural heart diseases . We report here a rare autopsy case of a young female adult who died suddenly and unexpectedly in her bathtub . Genetic analysis using ngs showed 2 previously unpredicted channelopathy - related variants with possible arrhythmogenic potential . A combination of the possible pathogenic channelopathy - related gene variants might have contributed to this unusual death in the bathtub, and the event may also have been triggered by bathing under the influence of alcohol . Although the evaluation of these detected variants is still complicated by our inability to completely assess pathogenicity, future molecular analysis by ngs may help to predict which young people could be at risk of sud in hot baths.
|
Most treatment studies are done with a very specific purpose in mind: to gain approval or acceptance of a particular therapeutic modality . Research following the regulatory model is specifically geared to the legal requirements of drug approval and registration . Although there is no equivalent to the food and drug administration (fda) for psychotherapy, the methodology of the regulatory model has been adopted in that field as well . In order to establish efficacy, this has led to the practice of eliminating from clinical trials all patients with comorbid illnesses, coexisting conditions, and even potentially compromising psychosocial or environmental characteristics . Observation periods are, typically, very short . In order to prevent administrative or delivery problems from masking the effect of the treatment intrusions such as the administrative requirements of a health care plan or third party payer are minimized, and the treatment is provided in optimal form, often in an academic health center . Specific measures are taken to ensure compliance of the clinician with the protocol and adherence of the patient with the procedures and treatments . Formally, efficacy studies define optimal treatment outcomes for narrowly selected patients treated under rigidly controlled and ideal conditions . With a primary focus on symptoms, the assessment of efficacy is based upon the degree to which the level of symptomatology is reduced or eliminated . In an efficacy trial, treatment is provided by specially selected and trained clinicians who provide optimal treatment and expend substantial resources to ensure compliance and minimize drop out . Research supported for commercial purposes, particularly that supported by the drug companies themselves, has, of necessity, conformed to the regulatory model . This is the case regardless of whether the site of the study is an academic health center or a community- treatment facility, and regardless of whether the coordination of the study is done directly by the sponsor or by an intermediary (contract research organization, or cro). It is worth noting that those doing clinical psychotherapeutic or behavioral research have not (yet) adopted this cro type of arrangement . The regulator)- model has also been carried over into research that has no industrial sponsorship, even to research on mental disorders that has been directed to government agencies or foundations . In a treatment study driven by a regulatory model of investigation, there is no minimum effect size or minimum pro portion of rcsponders necessary . In addition, there is no requirement that the subject population be representative of the kind of patient seen in actual practice . As such, a trial done in accordance with the regulatory model represents only the beginning of a process of clinical development . Efficacy studies define optimal treatment outcomes for narrowly selected patients treated under rigidly controlled and ideal conditions . The classic efficacy trial is used to define the gold standard of the best outcome under ideal circumstances . Because of the tight standard of control required in efficacy studies, the policy and practice relevance of these trials will always be limited . The clinical trials of cognitive enhancers provide a useful example of the differences between regulatory and public health research . The trials of cognitive enhancers seek to show slowing or reversal of the progression of alzheimer's disease or to demonstrate improved management of the symptoms of the disease . These trials typically attempt to show that the course of a progressive disease has been modified . The design of such trials involves great complexities even under optimal conditions . In an effort to demonstrate efficacy within the regulatory model, current clinical trials involving antidementia compounds typically exclude any patient with psychiatric or neurologic symptoms or substance abuse, and require the patient to be generally physically healthy and living with a caregiver . Schneider et al applied these criteria to a large, state -wide database in california and excluded all but 10% of patients . The resulting sample was younger, less severely ill, more highly educated, and more likely to be white and with higher incomes than the population as a whole . These sorts of data provide little guidance to the patient, family, or clinician in the selection of treatment approaches . In fact, there is a small but growing literature on issues relating to subject selection in clinical trials . In schizophrenia, for example, subjects tend to be younger than the general clinical population and are more likely to be male and part of an ethnic minority . In the treatment strategies in schizophrenia (tss) study, fewer than 10% of those screened were actually enrolled in the study the story is much the same in bipolar illness . In general, subjects enrolled in studies tend to have been ill for a very long time - 15 years in bipolar trials - and are unstable or unsatisfied with their current treatment . Even in studies attempting to recruit first - episode patients, the period of undetected or untreated illness exceeds 3 years . Age itself is a common concern, with many studies having an arbitrary age cutoff of 55 or 60 years . Even geriatric studies have been restricted, for all intents and purposes, to the young - old population of patients in their sixties . Few older patients have ever been studied, despite the clear impact of advanced age on pharmacokinetics, dynamics, and drug metabolism and on treatment response . In general, the rigid exclusions of most regulatory - oriented clinical trials have significantly distorted the conclusions of these studies . Studies that are informed by a public health model are often, called effectiveness studies . We avoid use of that term, since it seems to convey multiple and conflicting meanings in different audiences . Public health studies bring us into the world of actual practice with time - pressured clinicians taking care of large numbers of patients with uncertain clinical presentations, complex comorbidities, and varying degrees of interference with ideal levels of compliance . The exclusive focus on symptomatology is expanded to include outcomes related to issues of function, disability, morbidity, mortality, resource use, and quality of life . The classic public health trial is used to assess the expected outcome under usual circumstances of practice . In contrast to the elegantly crafted efficacy trial, a public health trial must be bigger in size, simpler in design, broader in terms of inclusions and narrower in terms of exclusions, and more representative with respect to settings of care . These settings will not be limited to academic health centers or tertiary care institutions, but will include primary care, community settings, and long - term care institutions . Unlike efficacy trials, where specially trained clinicians carry out state - of - the - art assessment and treatment, public health trials are carried out in settings of usual practice where there is a broad and variable range of clinician expertise and experience with the disorder under study . Outcome measures will necessarily extend beyond symptomatology to include function, disability, morbidity, mortality, health care and other resource use, family burden, institutionalization, and quality of life . Public health studies are not simply secondary analyses of administrative data collected in large and naturalistic databases, but are treatment trials that are broadly representative of clinical, family, and organizational factors . We begin with the assumption that the mental disorders of late life are chronic, recurring conditions . Within this broad perspective, three types of studies would seem to be appropriate . First arc treatment trials including both short - term and long - term studies directed toward management of symptoms, optimization of function, and minimization of disability . The methodology of these trials is well established and accepted by all those involved in clinical care . However, the conceptualization of the nature of treatment response is broader in public health trials than in regulatory trials . Rather than focusing exclusively on response as a dichotomous variable, ie, responder or nonresponder, a public health approach requires in addition that attention be paid to speed of response, completeness of response, and durability of response . An intervention directed at the speed of response fits within an overall conceptualization of treatment . The question is how can we accelerate the response to treatment and how early in the treatment process can we know when an approach to treatment is likely to fail? A related question concerns the management of treatment - resistant cases . Regardless of how treatment response is defined, we know that invariably a subset of patients show incomplete responses or nonresponse to any given treatment intervention . Under the regulatory model, the management of nonresponders and partial responders receives relatively little attention . Yet treatment - resistant patients make up a significant portion of actual clinical practice and they account for a major share of the mortality, morbidity, and cost of mental illness . Therefore, a public health orientation requires that the management of treatment resistance be a priority for investigation . An intervention directed at the completeness of response is considered rehabilitative . The question is how well is well and can we improve the nature of response by targeting interventions to reduce residual symptomatology posttreatment? A rehabilitative strategy might entail augmentation with a new pharmacologic or psychotherapeutic agent or some significant alteration in lifestyles and circumstance . The question is once well, how can we stay well and can we reduce the risk of relapse (of the same episode) or recurrence (of a new episode) through some longer term approaches to treatment? Interventions are also preventive if they target the excessive levels of disability that often characterize the mental disorders of older people . As we learn more about the risk factors, etiology, and pathophysiology of mental disorders in late life, it is conceivable that preventive interventions could be directed toward delaying the onset of disease or even preventing the onset entirely . In order to carry out such studies, whether they are treatment studies, preventive interventions, or rehabilitative interventions, we need to identify the structural barriers in the ways in which research is organized and to innovate approaches to address these barriers . The role of the academic health center is being redefined in the context of health care system reorganization, and access to patients has become problematic . Patient - oriented research is seen as a particularly fragile enterprise at this point in time . Many academic health centers are part of clinical systems that include community hospitals, primary care and specialty care office practices, and capitated contracts . The nonacademic settings of these large networks are where the majority of patients are located . The new challenge for the field is how to turn these clinical and administrative networks into research networks for the development and management of intervention trials . At the same time, the parallel challenge is how to identify the critical elements of academically based protocols and paradigms, and adapt them for use in the broader community . Advancement for academic investigators is based on research productivity, usually measured by significant publications and success in developing extramural funding . Large - scale, longitudinal, public - health - oriented studies typically have a very long period of time before important publications are developed, and they usually involve the participation of a large number of investigators . If there is a commitment to developing this type of research, the challenge for the field is how to adapt promotion and tenure policies to this situation so as to properly recognize individual contributions . Similarly, much of the training of new investigators is based upon a model of individual scientific activity: the independent investigator directing a small group of junior colleagues, fellows, students, and technicians . Training typically does not prepare investigators for participation in large - scale endeavors . Nor are there established training pathways into some of the newer roles in large - scale studies, database management, clinical coordination, site management, etc . Determination of priorities within this broad panorama of intervention research is always the result of the complex interaction between public health need and scientific opportunity . Death, disability, and societal and family burden have each been proposed as the sole criterion for policy determination . For example, in the influential text the global burden of disease, major depression, bipolar disorder, schizophrenia, and obsessive compulsive disorder are all included on the list of the 10 leading causes of disability worldwide . In fact, major depression is identified as the leading cause of disability . On the other hand, in that same study, no mental disorder the identification of significant areas of scientific opportunity is equally problematic, with investigators from different fields advocating on behalf of substantial increases in the investment in their particular areas of interest . The national advisory mental health council, with the legislative mandate to guide policy development and program support, has become a valuable sounding board for the identification of promising scientific opportunities . This council has produced recent reports on genetics research, prevention research, and the interface of clinical trials and mental health services research . Priority setting must be part of a continuing process of programmatic adjustment, readjustment, and redirection in the field . New treatments must be developed as our knowledge base of basic and clinical neuroscience and behavioral science expands . Established treatment approaches must be fine - tuned in accordance with the needs of patient populations and the settings in which they receive care . Research must catch up with practice and evaluate the many common approaches to treatment that have developed without a firm base of research . Here we include such approaches as continuation and maintenance electroconvulsive therapy-, reduction or taper strategies, treatment algorithms or decision trees for patients with treatment refractory illness, and unusual treatments such as mcthylphenidatc for minor depression . A wealth of potentially promising treatment approaches currently exists in the form of case reports, uncontrolled studies, letters to the editor, and internet postings . A major goal for the public health enterprise will be to organize and systematically study these interventions and identify those which are clinically valuable and those which are not . As part of a public health mission, we must also attend to issues of safety and consumer protection . For example, the widespread use of over - the - counter, unregulated treatments needs to be carefully examined for possible benefit and for potential harm . Use of complementary and alternative approaches is very high . Even in patients volunteering for participation in clinical drug trials, use of herbal medications is substantial; in a series of 150 such subjects, emmanuel and colleagues report that 56% have used herbs in the last month . It is therefore incumbent upon us to evaluate these treatments, including natural products such as st john's wort or kava, psychophysiologic approaches such as eye movement desensitization and reprocessing (emdr), and somatic approaches such as acupuncture, if for no other reason than that our patients are using these in large, uncontrolled, natural experiments our patients are not helped by treatments that are available in only in scientific journals . Lehman and steinwachs report that fewer than half the patients with schizophrenia in the united states received a level of care that was consistent with the current state of the art . This is an important finding that cannot be ignored . As a field we must take on the challenge of translating our research into practice and placing the most powerful clinical tools in the hands of patients, their families, and the clinicians that care of them the mental health field is significantly altering the culture of treatment research by moving from a narrowly defined regulatory model to a more inclusive public health model . This new approach to intervention promises to improve patient care by addressing the types of practical questions and functional outcomes that are typically brought to the attention of clinicians . This new generation of research is directed toward defining standards of appropriate and cost - effective treatment for the diverse population of patients seen in all health care settings . This should not be taken to indicate that there is no place for the highly controlled efficacy research needed to establish that a treatment has merit . But rather it is now the case that efficacy is the beginning of a process of inquiry and not the end . The interdependence of challenge and opportunity, often used as a clich, should be considered real and entirely appropriate in this instance . The challenge to all of us as patients, clinicians, scientists, or educators is great ., there is a wonderful opportunity to have a significant impact on improving patient care.
|
Wandering spleen, also known as ectopic spleen, is an uncommon clinical entity characterized by hypermobility of the spleen due to laxity or absence of the normal ligaments that attach the spleen to the left upper quadrant . This allows the spleen to essentially drop to the lower abdomen by the force of gravity attached only to its abnormally elongated vascular pedicle . Common complications of a wandering spleen include torsion of its pedicle, compression of another organ by the spleen or the pedicle, and susceptibility of the spleen to trauma . Symptoms are most commonly attributed to complications related to irreducible torsion which produces venous congestion, arterial infraction, strangulation and rupture of the spleen . Treatment of choice is splenopexy for an uncomplicated or complicated but viable wandering spleen and splenectomy for a non - viable spleen . Herein, we present a case of a patient with progressive torsion of a pelvic spleen causing recurrent abdominal pain and eventually spleen strangulation and rupture . A 46-year - old male was admitted to the emergency department complaining of constant left lower quadrant abdominal pain of increasing severity for the last 6 days . Direct questioning revealed a history of mild, intermittent lower abdominal pain for the past 65 days . The patient was febrile (38.8 c), had tachycardia (118 beats / min) and blood pressure of 90/50 mmhg . Physical examination revealed abdominal distention, predominantly in the hypogastric region due to a tender mass causing dullness on percussion suprapubicly . Pelvic mass or pelvic peritonitis arised from a variety of causes were included in the differential diagnosis . Abdominal x - rays revealed increased pelvic radio - opaqueness, few dilated loops of small intestine, and displacement of the splenic flexure in the normal spleen position . Emergency ct revealed absence of the spleen in its normal position, a homogeneous pelvic mass with no contrast enhancement pushing aside the sigmoid colon, free blood in the peritoneal cavity around the mass, and a normal urinary tract . The absence of the spleen in its normal position and the non - enhancement of the pelvic mass made the diagnosis of an ectopic strangulated spleen undeniable . The spleen was enlarged (23 cm 18 cm 12 cm), located inside the pelvis, attached to an abnormally elongated torted pedicle (19 cm), and adhered to the greater omentum and intestine (none of splenic ligaments were present) (fig . The spleen was strangulated due to the 760 clockwise twists of its pedicle (fig . 2), and ruptured at its lower pole (2 cm in depth, not evolving a trabecular vessel grade ii laceration). 3); however, the organ continued to appear non - viable and total splenectomy was performed . Thorough investigation revealed no evidence of accessory spleens in the left upper quadrant, the bowel mesentery, the greater omentum and the pelvis . During exploration histology revealed acute thrombotic changes in arteries and veins of the splenic hilum, with diffuse hemorrhagic and ischemic infarcts of the spleen . The postoperative course was uneventful and the patient was discharged on the fifth postoperative day without any complication . Wandering spleen is a rarely diagnosed clinical entity . According to our knowledge less than 500 cases of patients with recurrent abdominal pain or abdominal emergency caused by a wandering spleen moreover, splenectomy for treatment of a wandering spleen account for less than 0.25% of splenectomies in reported series . Wandering spleen is 7 times more common in females than males after age 10 and 2.5 times more common in males than females under the age of 1 year . The most common age of presentation is childhood especially under 1 year of age followed by the third decade of life, and is more frequently seen in females of reproductive age . Wandering spleen occurs because of either extreme laxity or absence of the normal ligaments that attach the spleen to its fixed position in the left upper quadrant . Three of these ligaments are virtually always present (except in the condition of the wandering spleen), and two may be present to variable extents . The three ligaments, that are constantly present, are the splenogastric ligament, the splenorenal ligament and the splenocolic ligament . The two ligaments, that are variably present, are the splenoomental and the splenophrenic ligament . Absence or laxity of the above mentioned ligaments allows the spleen to essentially drop to the lower abdomen in either the right or the left lower quadrant by the force of gravity attached by its elongated vascular pedicle . It occurs most probably as a result of congenital anomalies in the development of the dorsal mesogastrium and the absence or malformation of the normal splenic suspensory ligaments . Conditions associated with wandering spleen include enlargement or absence of a kidney, splenomegaly and previous pregnancy . Splenomegaly and pregnancy are thought to contribute to the laxity of the supporting structure by direct effect of gravity and estrogen respectively . Symptoms may remain limited or absent for long periods of time, but complications related to torsion, compression of another organ by the spleen or its pedicle and susceptibility of the spleen to trauma are quite common . Initially, irreducible torsion produces venous congestion as a result of which the spleen becomes edematous and enlarged . Eventually, progressive torsion results in infraction of the arterial supply, acute ischemia, strangulation, necrosis and rupture of the congested and gangrenous spleen . More frequently, patients are admitted due to a non specific chronic pelvic pain related to splenomegaly or pressure on adjacent organs . The most common physical finding is a palpable lower abdominal mass representing the abnormally enlarged torted spleen . Laboratory tests are usually nonspecific, but may occasionally reveal evidence of hypersplenism or functional asplenia . Ultrasonography, nuclear scintigraphy, ct and mri can prove useful in revealing the nature of a pelvic mass of unknown entity and confirm the diagnosis of an ectopic spleen . Operative management is the treatment of choice in uncomplicated and complicated cases because conservative treatment of an asymptomatic wandering spleen is associated with a complication rate of 65% . The wandering spleen is ideally for laparoscopic splenectomy because it is generally free from attachments and other organs . The treatment for a wandering spleen as an incidental finding at laparotomy or if the torsion can be corrected and the spleen appears to be viable is splenopexy . Splenopexy has been successful in preventing complications of wandering spleen while preserving the splenic function . They applied open or laparoscopic techniques with or without using a mesh and peritoneal flaps . As the torsion involves the vascular pedicle, partial splenectomy or splenic implantation of the totally strangulated spleen is usually unattainable . However, partial infraction of a wandering spleen necessitating partial splenectomy and splenopexy or splenectomy and splenic implantation has been reported in the literature . The present report was referred to a patient with progressive torsion of a pelvic spleen causing recurrent abdominal pain and eventually spleen strangulation and rupture . The patient exhibited a period of vague intermittent lower abdominal pain lasted 65 days followed by a period of constant left lower quadrant pain of increasing severity lasted 6 days . On the first 65 days, vague pain was attributed to progressive torsion which resulted in venous congestion and enlargement of the spleen . On the last 6 days, exacerbation of pain was attributed to irreducible torsion, infraction of the arterial supply, acute ischemia, strangulation, necrosis and rupture of the congested and gangrenous spleen . Although the presence of the ectopic spleen could be easily identifiable on serial physical examinations since childhood, it was diagnosed in adulthood due to manifestation of complications . Written informed consent was obtained from the patient for publication of this case report and accompanying images . Konstantinos boulas, salpigktidis i and barettas n equally contributed to the writing of this paper . Konstantinos blouhos, anestis hatzigeorgiadis and konstantinos boulas performed the operation.key learning pointsthe presence of an ectopic spleen can be easily identified on serial physical examinations since childhood.however it is commonly misdiagnosed until the manifestation of complications in adulthood . The presence of an ectopic spleen can be easily identified on serial physical examinations since childhood.however it is commonly misdiagnosed until the manifestation of complications in adulthood . The presence of an ectopic spleen can be easily identified on serial physical examinations since childhood.
|
In the library at bailieborough, county cavan, ireland, there is a small ring - bound folder in the local studies section which contains a list of folk healers with a specific listing of which it lists a number of informal local healers but also some from a considerable distance away with either a phone number or a brief address . The specific conditions (45 in total) for which the cure can be accessed range from arthritis to warts and includes illnesses such as bell s palsy, skin cancer and tuberculosis . Entries note that a lady with the cure for hiatus hernia for example, lives in the townland of crookswood and to find her:go on to filling station, take left turn, and then left again past school, into narrow lane, half mile, lane on right . Through gate house in wood (niece lives at end of lane). Generally works sat - mon - thurs (bailieborough library folder, undated). Go on to filling station, take left turn, and then left again past school, into narrow lane, half mile, lane on right . Through gate house in wood (niece lives at end of lane). The survival of such a listing, well - thumbed i might add, is testimony to a deep connection in ireland with the concept of the folk cure, something which resides in individual practitioners and in specific places; that is publicly known but privately practiced . While the clinical qualifications and ability of those with the cure may not withstand deeper biomedical scrutiny, what matters more is the sense of a long narrative connection between folk medicine, health cure and their co - presence within what health geographers refer to as therapeutic landscapes (wilson 2003; williams 2007). This relationship among folk medicine narratives, curative practices and place form the basis of its potential interest for medical humanities research and this paper will discuss these in relation to historical health practices on the island of ireland (foley 2010). Drawing from earlier research on healing waters, the different practices, practitioners and settings of hydrotherapy are extended in this paper to consider folk medicine more widely (foley 2010). A brief review of the literature considers where folk medicine sits within therapeutic landscapes research . The particular use of narrative sources and imaginative accounts which underpin this research also provide an explicit link to medical humanities . As a final literature component, histories of medicine are discussed in terms of how they are often framed by the relative positionalities of formal and informal medicine though other dualistic terms such as orthodox / unorthodox or conventional / unconventional were equally applied (price 1981; porter 1997). Quackery and the potentially harmful practices of the unqualified, unscrupulous and profiteering quack are central themes in these literatures (porter 1989). In considering a set of themes in depth, particular concerns emerged around the linked themes of power / regulation and authenticity of both practices and practitioners within ireland from the 18th to 20th centuries . These were never as black and white in reality and remain contested to the present day . A third theme explicitly links medical / health geography and medical humanities in looking at the reputational narratives of folk medicine . These were explicitly related to practices in place and in turn informed the reputations of places, practices and practitioners in driving and sustaining both local and national economies of folk medicine, still visible today in the thriving markets for complementary and alternative medicine (cam) (moore and mcclean 2010). A mix of secondary and primary irish empirical material is used to illustrate these themes, drawn from a range of therapeutic landscapes and practices . Finally, the paper takes a position that sees the medical humanities as a challenge to medicine to become interdisciplinary, and be disciplined by arts and humanities as well as science (bolton 2008, 132). In looking at a range of narratives and themes that sees the practices of folk medicine as having an interdisciplinary intent, in recent therapeutic landscapes literature, both historic and contemporary discussions on spiritual health, nature cures and general indigenous medical practices have been prominent themes (wilson 2003; williams 2007). Therapeutic landscapes are broadly described as places that have achieved lasting reputations for providing physical, mental and spiritual healing and typically include settings such as spa towns, pilgrimage sites and wilderness as well as smaller scale baths and retreat settings (gesler 2003). Andrews and kearns (2005) layered examination of health histories in place in their study of teignmouth in the uk, though focused on more formal services, provides a useful template . Providing a potentially valuable parallel link between developments in cultural geography and a wider medical humanities, research by foley (2011) considers a deep mapping of place and the associated practices and inhabitations that form the basis of embedded healing assemblages (bailey and biggs 2012). In considering those more profound histories, it may be valuable to recast folk - medicine as representative of a set of traditional public health practices to be set alongside the necessary development of formal health care services (buckley 1980). Central to this were informal practitioners and practices placed somewhere between professional and lay health / medical knowledges . In addition, there were long histories in a number of celtic countries around the complex relationships between charms, nature cures and the power of hereditary healing families, members of which had a control over the practice of medicine in locations like ireland and the highlands of scotland (donoho 2012). Medical historians like porter (1997) and kelly (2009) note the writing on informal medical practices as often contradictory, simultaneously appalled and fascinated . In a contemporary setting, (2005) on contested definitions and professional power divisions between cam and conventional biomedicine . In addition, medical / health geographers have studied contemporary examples of cam practice around yoga and wellness practices (hoyez 2007; lea 2008), in which the spatial networks and narrated meanings of cam are considered in terms of the reproduction of a set of globalised therapeutic settings / practices . Many of these contemporary cam themes can be specifically applied to folk medicine, yet there appears to be a reluctance to connect them together explicitly in the literature . It is also important to note the contested nature of such forms of practice especially by formal medicine and a positioning of all forms of non - allopathic medicine as not so much cam as scam (in its literal sense). This too reflects historical work on quackery and in particular the present role of the internet as a source of inauthentic medical knowledge (doel and segrott 2003). Yet a counter narrative in the literature in ireland is evident in work by moore and mcclean (2010) and patrick logan (1981), a medical doctor with a deep affinity for folk - medicine and country cures and a coherent advocate of the expertise of its prominent practitioners . Finally in the medical humanities literature, david hufford s (2003) work on belief, spirituality and health also makes for provocative reading . His arguments focus on the invocation of rationality by the scientific medical community as a means to discredit any form of unapproved medical practice . Yet, he argues, the act of discrediting is itself an irrational act in that science cannot effectively predict human behaviours, responses and choices . In addition he argues that there are a range of parallel narratives defined by patient beliefs, experimental practices and local traditions of bodily care to be found in all multi - cultural societies (hufford 2003). In this collective research on cam and folk medicine, one can identify a number of overlapping themes founded on power / regulation, authenticity and reputational narrative, and these will act as points of discussion across the remainder of the paper . Drawing from a hybrid collection of primarily secondary qualitative sources narrative, reputation and inhabited practice as much as medical evidence play a key part in methodological approaches appropriate to medical humanities research . Sources including travellers accounts, archival records, national collections and oral histories are all utilised to identify discourses around folk medicine . In addition, some contemporary ethnographic fieldwork including site visits and participant observation in extant practices, such as at holy wells, were also undertaken . In considering representative material on folk medicine in ireland, this narrative is reflective of a pragmatic and applied set of healing texts and practices which provide a parallel evidence - base to that used in scientific medicine . That evidence is not only drawn from sources which discuss the position of folk - medicine in relation to its own practices and settings but also frames that discussion against scientific medical structures . A key source in ireland is the national folklore commission s surveys of 19348 which included a particular interest in the term leighis (cure), and how these were recorded within specific locations (national folklore collection 1934). These collective narratives act as a timely recording of indigenous health knowledges and practices, and the types of cures identified included listings of herbal folk cures, charms and spells as well as accounts of individual healers and their expertise . Seventh sons of seventh sons, for example, were regularly mentioned in archival material as were hereditary skills in bone - setting or the cure of warts, handed down, usually though not always, from father to son (nfc 1938). Health outcomes were recorded for both humans and animals, and these repeated stories drawn from multiple locations ranged from the para - medical to the magical . A second parallel survey undertaken by the ulster folk museum in the 1960s focused specifically on folk - medicine in northern ireland . A common historical medical humanities source, external travellers accounts, described practices and cures from the perspectives of a range of correspondents, some positive, some hostile (de latocnaye 1984; hardy 1836). Often shamrockist in their gaze, the travellers were objective and occasionally bewildered recorders of the practices they observed . Other essentially oral sources, especially relevant given that many cures were enacted through speech, included old songs, poems and charms passed down by seancha, recognised local storytellers . Examples included interviews from 197980 with older residents about folk cures in the dublin and wicklow areas (nfc 1980). Finally, material from local historical journals, often overlooked in academic research, provide much of the depth in a deep mapping of place - based health practices . In terms of local narratives of folk medical practice, these accounts via oral testimonial sources are valuable in themselves but also record contestation from more official forms of medical practice . Overall, the sources for folk medicine are often partial and ephemeral in contrast to the records of a more professionalized and centralized medical profession . This was in part shaped by the location (often, but not exclusively rural) and nature of the practice of folk - medicine as a collective and at times lay practice, in which familial knowledge, oral traditions and a communal attachment all played a part (bourke 2001). When considering folk medicine in ireland across the 18th to 20th centuries, power was a central theme, especially in terms of its position within the wider practice of formal medicine and healing . Linked to power, regulation played a significant role, in different forms, in the management of that power . Foucault noted that there was a quite blurred history within what he termed, noso - politics, in how formal medical structures took hold and older folk practices were subsumed or incorporated to a wider public health from the 18th century on (foucault 1980). Hierarchies were evident in the expression of power between both informal and formal practitioners in place and also around patient / practitioner interactions . From the 18th to well into the 20th century, there was a contrast between local, often free healers, and the slowly developing professional for - profit medicine . In rural ulster, the hierarchies were subverted somewhat in rural areas because of a preference for local folk healers and a deep distrust of the collar and tie men of the medical profession (buckley 1980). At the other end of the scale, the professional bodies responsible for scientific medicine created an identifiable group of trained professionals for whom the practices of folk medicine seemed anathema . Yet such a positionality of inclusion and exclusion was never clear - cut in terms of the experience of health care provision and utilization across the country, evident in the different spaces of practice and the overlapping bodies of practitioners . In considering the relationship between power and sites of medical practice, it was expressed in a geography that was hierarchical and relatively rigid . Spatially, power needs to be concentrated to be visible, hence the symbolic importance of the hospital or workhouse in irish research . Yet the more fluid practices of folk - medicine were expressed in mobile sites and settings, certainly in terms of some of the belief - based practices; conditional, relational, even sometimes invisible in that knowledge of their existence or location only existed via word - of - mouth . Such settings included country fairs, people s homes, the healers own homes as well as other communal settings, but all were places associated with a reputational form of healing power and energy . Empirically the sweat house was a good local example (evans 1957). As small constructions dotted across the landscape, sweat houses were an essential folk - medical site in rural upland areas (foley 2010). Looking a little like stone igloos covered by grass and earth, the interiors were heated with turf, and patients entered and spent time in the closed settings and sweated out their fevers (fig . 1). Legeelan, county cavan (source: author) that previous to the bath, a fire was kindled inside, and when it was sufficiently heated, the ashes were swept out . The people came to be cured of the pianta fuar, as she called the rheumatism, the irish name meaning literally cold pains . Legeelan, county cavan (source: author) that previous to the bath, a fire was kindled inside, and when it was sufficiently heated, the ashes were swept out . The people came to be cured of the pianta fuar, as she called the rheumatism, the irish name meaning literally cold pains . (mulcahy 1903, 589). While one of the concerns of formal medicine was the lack of regulation they associated with folk medicine, there was evidence of some good regulatory practice at sweat houses (hufford 1998). Used to cure flu, arthritis and rheumatism, they were sometimes regulated by itinerant bath masters who would check potential users as to their ability to withstand the rigours of the sweating cure (richardson 1939). More importantly, sweat houses were privately or communally owned, providing a service to extended families and small communities in remote locations especially in the northern half of the country (foley 2010). This was especially important in locations where any form of conventional primary health care service did not meaningfully emerge until the end of the 19th century when a network of dispensaries, (noted by foucault (1980) as part of a new medico - administrative apparatus of power), introduced a more regulated set of public health spaces into the irish countryside . But up to this time, sweat houses, similar in form to scandinavian sauna or mexican temazcalli, developed epigenetically and provided a form of local empowerment and ownership over a set of necessary healing practices (groark 2005). As a second example, there were a range of sites associated with water which formed an important component of the folk - medical geographies of ireland . Holy wells were one classic form, a mix of spiritual and physical healing site mentioned in the introduction and discussed in more depth elsewhere (foley 2011). Another example, lough leighis, was a famous healing lake in east cavan, visited up to the 20th century by users who came from long distances to take away its curiously curative and energizing mud . It is now buried under bog and forest (fig . 2) but encapsulates a setting associated with a perceived natural curative substance, akin to herbal medicines found in most cultures . The mud from the lake had a particular reputation for curing skin diseases including scurvy and leprosy and indeed was distributed around the country as a curative product (coote 1802; kelly 2009). This local nature - based collection of therapeutic materials echoes what kathi wilson refers to as the 24-hour pharmacy in relation to the canadian first nations term for the land as a source of curative berries and herbs (wilson 2003).fig . 2site of lough leighis (loughanleagh), county cavan (source: author) site of lough leighis (loughanleagh), county cavan (source: author) a persistent associated theme in discussions of medical regulation and power was that of training and healing expertise . In the development of a hierarchical structure of formal medical power, metaphors exist of the folk practitioner as representing the ignorant / untrained / low / unapproved and the medic as representing the knowledgeable / trained / high / approved (logan 1981; moore and mcclean 2010). Such words recur over and over in discussions, evidence of a notional drawbridging of ownership and status . The relationship between training and regulation can even be seen in contemporary attempts by cam practitioners to be accepted by formal medicine through strict training requirements (clarke et al . Critical questions do need to be asked about the regulation of informal folk medicine as accusations of quackery were often apposite (porter 1989). Quackery did result in some genuinely dangerous historic practices, the response to which in turn became a central plank in medical regulation and the creation of professional bodies . There were some very dubious practitioners in the towns and countrysides of the british isles from the mid 19th century on . One example, a form of hereditary quackery franchise, was to be seen in the presence of travelling healers called sequahs (schupbach 1985). These sequahs--there were twenty - seven of them over time and they operated across the british isles--built an identity for their practices and products based on american indian healing and commodified through their exotic medicines, which though folk were not exactly local (schupbach 1985). Most were english born, unqualified and sold a patent medicine, prairie flower oil, which was proven to have no medical benefit at all (fig . While their business was eventually declared illegal, they still attracted audiences despite a patent lack of training or medical regulation . What was perhaps most interesting about the sequahs was their exotic nature, which while folk was certainly neither local nor indigenous . Yet at the same time as they practiced their trade in irish towns such as dublin and kilkenny, there were other rural practitioners trading in patented rubs and potions who were less visible, but importantly less commercially motivated (maloney 1972; fleetwood 1990).fig . 3sequah poster (source: wellcome images) sequah poster (source: wellcome images) despite strong relationships between regulation and professional training, authenticity and ownership of practice have always been slippery themes in medical history . In theoretical terms, debates on meta - narratives lie at the heart of cultural health geographies and emphasise the need to consider a more heterogeneous story . Hufford (1998) for example, suggests the need to consider a methodological populism (302), which assumes an equal value for all forms of health narrative and practice . Here the practices of formal and informal medicine were arguably much more connected than they might seem . There was an overlapping use of knowledge bases, and trite though it might seem in any notional performance of health, there was a sense that practice made perfect. In folk medicine terms, this meant that many traditional healers had access to and used existing medical texts, photocopied, passed on through generations of families with as logan (1980) observes, extensive liner notes . The practice makes perfect notion was as much a feature of the work of the traditional bone - setter as the contemporary surgical rotation . Indeed as an empirical example of authentic practice, the bone - setter was and remains an important folk practitioner across cultures and has strong links to contemporary authenticated forms of cam like osteopathy and chiropractic (heller et al . The bone - setter was a valued folk medical practitioner across the province of ulster . While they often carried out an itinerant practice, in that they moved from place to place as they were needed, they also operated from known locations to which they drew in turn an itinerant clientele (buckley 1980). Almost always male, they drew on a wealth of often hereditary experience, learnt from their fathers and grand - fathers which as far as their patients were concerned, gave them as much authenticity and ownership of practice as allowed them to continue to heal . A second feature of the authenticity of folk medicine practices, associated also with contemporary biomedical practice in secondary care settings, was the enhancement of practitioner expertise to ensure what one might term clinical mass. Logan (1981) describes the unacknowledged expertise of the informal practitioner though an extensive case - load and genuine physician training as being in itself an authenticating practice . Here the experientially - developed knowledge underpinned a subsequent therapeutic reputation, which in turn was drawn from that repeated practice . Logan, himself a medical doctor, also commented on the regard of formal doctors for the informal doctor s skills and suggested within his own country practice that even in the 1980s a form of cross - referral was taking place . Indeed a bone - setter in county carlow with forty years experience was invited to speak to physicians in formal training sessions in the early 2000s while similar evidence of referral from general practitioners to informal healers was found in mid - ulster in 1985/6 (naughton 2004; moore 2010). In considering a demand for folk medicine, cox s (2010) description of the medical marketplace in ireland from 1750 to 1950 demonstrated the existence of a hybrid setting where folk and scientific cures were equally used, a forerunner perhaps of the online medical marketplaces of the early 21st century . Herbal medicines were central to folk - medicine and drew from pharmacopeias of considerable range . The violet was used in ulster as a cure for cancer by dint of stewing and drinking of the liquid and the same applied to coltsfoot (fig . This simple form of extracting concentrated therapeutic materials from original herbal form would not be unfamiliar to a modern pharmacist . Poultices, evident in forms such as eel - skin bandages from lough neagh, have parallels in many cultures (ballard 2008). In such rural settings, the relationships between the authenticity of a folk medical practice / cure was cemented by their perceived efficacy as well as a place - specific sourcing of materials considered to be curative.fig . 4coltsfoot (source: andreas trepte, www.photo-natur.de) coltsfoot (source: andreas trepte, www.photo-natur.de) extending that utilisation perspective, the question also emerged as to who authenticated the practice--the medic or the patient? This applied particularly to gendered bodies of knowledge and in particular narratives of birthing and midwifery practices, engaged in by a range of unregulated but far from in addition, the waters of holy wells and their associated rituals were used in a range of reproductive practices ranging from assistance in conception to delivery and post - natal care (foley 2010). Two wells visited by the author in 2008 and 2009 showed how these narratives sustain into the present day . Patrick s well in clonmel--shaped like a womb--was and is visited by couples planning to have children as recounted by a local guardian, while fr . Well in kildare has long been used for post - natal blessings, particularly among members of ireland s travelling community, a practice observed during those visits . This gendered perspective, especially as it relates to an embodied knowledge is certainly one which persists in a range of indigenous settings, where local cultural traditions associated with women s health have long and authentic histories (cross and macgregor 2010). Hufford also notes this as an especially good example of inappropriate notions about the boundaries of expert knowledge and authority, contrasting biomedical constructions of childbirth as a medical emergency against a reassertion by women of the authority of experience and traditional knowledge (1998, 302). In considering a wider medical humanities, reputational narratives were central to the perceived value of folk medicine, especially as it was to be found in therapeutic landscapes . Just as the therapeutic landscape of the spa or holy well relied on its sustained healing reputation, so the reputation of the folk practitioner also depended on word - of - mouth and indeed, stories of effective cures associated with that practice . If a neighbour or friend came back cured or in less pain for a particular condition, that was physical evidence of an effective practitioner . Ineffective or harmful practitioners might have their performance perceived as losing their touch, as a loss of healing energy . One might suggest that this concern with consistently measurable health outcomes has some interesting parallels with contemporary hospital league tables . In empirical terms, a whole history of spa medicine, considered scientific in its time but subsequently relegated to the margins of practice, was visibly focused on the reputations and narratives of the water . The quality of the water and the quality of the cure were an essential aspect of their popularity, and a material spectral trace of the water source at castleconnell in county limerick, considered effective for liver complaints, jaundice and ulcers, is pictured in fig . 5 (rutty, james 1757). This hybrid space, where informal and then - formal medical practices overlapped, was one in which both orthodox and non - orthodox narratives took root.fig . (source: author) the narrative as text was also embedded directly into practice . The idea of an oral pharmacon, words that could both kill or cure, was an important concept in ireland . Charms, healing words to soothe the patient and invoke a form of external healing potential (ballard 2008). Old irish texts used a term also used in mainland europe, the le, to represent an oral cure that could be curative and also maledictive . Curative texts can also be found in the various folklore collections, and one example is a written cure from the 1870s for toothache, written on the back of an envelope in longford (fig . 6toohtache cure written on the back of an envelope (source: nfc) toohtache cure written on the back of an envelope (source: nfc) this relationship between the written and spoken word was an important component within irish folk medicine narratives . In the 18th and through much of the 19th century, the irish population were not especially literate, so an oral culture was central to the recording and communication of folk medical knowledges (buckley 1980). Cure was often an incantation or spoken treatment, echoing the idea that a talking cure in ireland was part of a wider global culture of indigenous healing power wherein an oral medicine was managed by a wide range of shamans, priests, healers and wise elders . Moore (2010) recounts an ongoing practice in mid - ulster from the mid 1980s of cures or charms as they were referred to locally, which he identified as in part oral but which operated with the tacit approval of local general practitioners and which formed part of a wider social transaction . While assumptions have been made as to the place of folk - medicine being essentially rural as opposed to the rational and advanced city, evidence shows a more complex network of health beliefs and practices . Many examples of folk cures in the nfc came from cork, galway and dublin with detailed written descriptions for how visitors in search of a cure should behave at a holy well . In many cases this consisted of a list of prayers, walking circuits and physical actions which were a necessary part of a cure negotiation in place (foley 2010). To receive the full benefits, one had to obey the rules, whereas a transgression would result in no cure or even a worsening of one s condition . People who used holy wells incorrectly or who interfered with well tradition generally got a shock or unpleasant surprise . At st . Kieran s well in county meath, the entry in the nfc collection noted the effect of an interference with the legends associated with the well: the pattern day of st . There is usually a crowd around the well waiting for the three trouts which are supposed to appear at 12 o clock . People say they are hundreds of years old . Once a man happened to catch them, brought them home and put them in the pan . There is usually a crowd around the well waiting for the three trouts which are supposed to appear at 12 o clock . People say they are hundreds of years old . Once a man happened to catch them, brought them home and put them in the pan . (nfc 1934) in 2012, in conjunction with a colleague from trinity college dublin, a testing programme of three historic spas and twelve holy wells across ireland was carried out . The programme (part of a postgraduate research project in hydrogeology) was partially an investigation of chemical concentrations in water; it was equally motivated by testing whether folk narratives of specific cures at holy wells and spas had any basis in scientific medicine . The results were mixed, as much from the lack of local cure narratives as the presence of high levels of curative minerals . However, a number of interesting results emerged, especially at a famous holy well in county kerry, tober na ngealt (located in gleann na ngealt, the valley of the insane). The chemical testing identified forty times the normal concentrations of lithium, an established contemporary chemical used in the treatment of mental ill - health . In aligning this with the folk medical narratives, people had been coming (and often left here) for centuries, as both well and valley had established reputations for curing madness (logan 1980). The survival of folk medical practices were also arguably linked to migration, a form of cura in urbis, where rural traditions and practices were relocated and survived within urban settings . This too can be extended to contemporary work on cam practice amongst migrant communities (cross and macgregor 2010). This final thematic concern for narrative - based medicine brings us back full circle to the contested relationships between scientific and talking cures and the increased attention and acceptance within medical humanities of narrative and belief - based medicine . Indeed in the discussions on folk medicine in ireland, classic imaginative texts such as carleton s gothic novel, the evil eye, provide a rare account of behaviours at an irish spa town, ballyspellan . In thinking about deep mappings of healing, folk medicine geographies emerge as mobile, relational, complex and persistent . The narratives of informal practice and folk - medicine drawn from irish evidence suggest fluid and hybrid relations with formal medicine, and the complementary nature of the two models reflects wider cultural models of curative belief that are important to the wider field of medical humanities . (2004), commenting on indigenous health in thailand, notes that health acts as a marker of contested social relations enacted through place and sees it as a struggle between local knowledge and global change . In ireland, this was evidenced by the decline of holy well and sweat house use for example, by the introduction of a network of dispensaries and country doctors in the later nineteenth century . Contemporary globalising therapeutic landscapes and practices such as yoga, ayurveda and spa retreat spaces seem to favour the exotic, an arguably orientalist cam that differs a little from a more local and genuinely complementary cah (complementary and alternative health). In addition, folk medicine has always been seasonal / temporal / relational / local with regard to its curative potential . In utilizing wilson s (2003) notion of the 24-hour pharmacy, it might be suggested that in nature the folk medical pharmacy may never close but its shelves are stocked differently depending on the season . The position of folk medicine, both as form and practice, suggest the co - presence of a set of emplaced and embodied energies of health . Many of the cures were place and object specific, from which energy was drawn and reoriented towards the place and the body in the place . For example, many of the rural cures at sweat houses and others sites aimed to provide new energies for work . Reinvigoration was a common narrative in spa settings and was employed in producing in such places the revitalized and re - energised body, visibly getting the flow going within vascular and reproductive systems . In any discussion of health the notion of an oscillation of health would be a component part (bergdolt 2008; foley 2010). These flowing energies were embodied, yet traditional healers were well - placed in their peripatetic wanderings to tap in to those oscillating health energies . There was also a sense of practitioner energies ebbing and flowing through their practice but simultaneously the sources of folk - medicine doing the same across the year . There were seasonal cures for seasonal illnesses, suggesting a sense of renewable, even sustainable medical energies and products . This contrasts with contemporary high - tech medicine and its considerable energy demands in terms of technology / expertise / speed / power, the direct opposite of folk - medicine as a form of slow health. There are good reasons why folk - medicine functioned in both historic and contemporary societies, linked to core concepts of accessibility and service gaps, and what emerged organically to fill natural and socially constructed gaps . It was also instructive to note that many irish practitioners who had the cure did not charge for services or left it open for the patient to offer a token payment, a choice not available at the paid general practitioner s surgery . Again contrasts may be made with the highly commodified contemporary cam marketplace, but as moore (2010) noted, there was also a sense of cultural exchange and social support in a set of healing practices that were public beliefs yet private acts . Finally, in considering resilience and resistance, folk medicine in ireland and elsewhere is partially framed by an instinctive resistance to the conduct of conducts of individual health . The slightly dubious contemporary democratization of personal health knowledge via the internet is not dissimilar in nature if entirely different in form to the traditional folk healer who also drew on then extant medical knowledges to build up his or her own expertise and user communities . In considering how folk medicine has sustained in the face of a range of hostile gazes, to be displaced is not necessarily to be erased, and resilience remains a feature of both the human body and the social practices of healing and well - being.
|
Mitchel 1892 first reported presence of an anomalous structure and described as a process of horn like shape, curving from the base downward to cutting edge . Mellor and ripa in 1970 coined the term talon cusp because of its resemblance to an eagle's talon . Its prevalence has an ethnic variation ranging from 0.06 in mexican children to 7.7% in north indian children . It originates as a result of outward folding of inner enamel epithelial cells (precursor of ameloblasts) and transient focal hyperplasia of peripheral cells of mesenchymal dental papilla (precursor of odontoblasts) during the morpho - differentiation stage of tooth development . It shows a predilection for permanent dentition (77%) with a higher incidence in maxillary teeth (94%). Maxillary lateral incisors are the most commonly affected (55%) followed by central incisors (33%) and canines (4%). Maxillary lateral incisors susceptibility could be related to compression of tooth germ by external pressure from adjacent central incisor and canine, which develops about 7 months earlier . Hattab et al ., classified the anomalous cusp based on the degree of their formation and extension as: type 1 talon: a morphologically well - delineated additional cusp that prominently projects from the palatal or labial surface of primary or permanent anterior tooth and extends at least half the distance from cementoenamel junction to the incisal edge . Type 2 semi talon: an additional cusp of a millimeter or more but extending less than half the distance from cementoenamel junction to the incisal edge . Type 3 trace talon: enlarged or prominent cingula and their variations, i.e., conical, bifid, or tubercle - like . Radio graphically, it is visible as v - shaped radiopaque structure superimposed over the normal image of the crown, in which enamel, dentin, and occasionally pulp space extension can be seen . Early diagnosis and management of talon cusp is essential as it results in compromised esthetics, occlusal and tongue interferences, accidental fractures, increased caries susceptibility leading to pulpal and periodontal involvement . A 12-year - old boy reported to out patient department with a chief complaint of irregular teeth . Clinical examination showed mal - aligned teeth with diastema between maxillary central incisors [figure 1]. An anomalous pyramidal shaped structure was detected on the palatal surface of the left maxillary central incisor extending from the cervical margin of the tooth toward the incisal edge [figure 2]. An intraoral periapical radiograph of tooth revealed a typical v - shaped radiopaque structure arising from cingulam of central incisor with its pulpal extension superimposed over the image of an affected crown without any signs of periapical pathology [figure 3]. A 5-mm deep pulpotomy was performed at the exposure site with a sterile #2 round bur . Mineral trioxide aggregate (mta) (dentsply maillefer, ballaigues, switzerland) was mixed as per manufactures instructions and placed directly onto exposed pulp [figures 4 and 5]. Cavity was restored with glass ionomer cement at the same appointment . At 4-year follow - up, mineral trioxide aggregate pulpotomy clinical photograph immediate post - operative x - ray 4-year follow - up x - ray talon cusp usually occurs on the lingual surface of incisors, although there are case reports of their occurrence on the supernumerary, geminated and fused teeth . Jowhari et al ., documented a case of facial talon and suggested altering definition of talon cusp to indicate possible projection from either lingual or facial surface of a tooth . A case of labial and palatal talon cusp on same tooth was reported by abbott in 1998 . The extent of pulp horn is difficult to distinguish on a radiograph because of its superimposition over the main pulp chamber . Siraci et al ., suggested the use of cone beam computed tomography cbct in determining pulpal extensions into talon cusp . Treatment requires careful clinical judgment and depends on the size and shape of talon cusp . Prophylactic sealing of deep developmental groove has been advocated to prevent the development of caries . In cases of teeth with immature apices, gradual reduction of talon cusp followed by application of desensitizing agent and sealing has been advocated to preserve pulp vitality . Grinding on side of the cusp is recommended to initiate reparative dentin deposition because of the location of most of the odontoblasts along the length of cusp . Formation of secondary dentin at lateral walls led to constriction of pulp and total obliteration of pulp horn cannot be achieved . However, this cannot be applied predictably in all situations because of chances of sensitivity development, multiple visits, longer duration of treatment and requires patient compliance . When occlusal interference is severe, a complete reduction of cusp followed by vital pulp therapy or endodontic therapy can be completed in a single visit . Vital pulp therapy has a higher success rate compared to endodontic treatment, irrespective of the size of exposure . Success rates of 91% for pulpotomy was seen in comparison to 80% in direct pulp capping when performed under aseptic conditions and has been attributed to removal of inflamed pulp and reduction in bacterial load . Mta has replaced calcium hydroxide because of its biocompatibility, excellent sealing ability, antibacterial properties and property to induce hard tissue formation in pulpal tissue . Histological examination of mta pulpotomies showed a rapid, continuous, thicker dentin bridge with no tunnel defects or imperfections and more frequent presence of odontoblastic layer when compared with calcium hydroxide based materials . Koh et al ., suggested use of mta as an alternative to existing materials in prophylactic treatment of dense evaginatus . This paper presents a case of type 1 talon cusp with a 4-year follow - up, successfully managed by mta pulpotomy . Use of mta pulpotomy can be a possible single - sitting treatment option for management of talon cusp.
|
The blood brain barrier (bbb) is composed of a tightly sealed monolayer of brain capillary endothelial cells which, together with astrocytes and pericytes, separates the brain from its external environment . The bbb plays an important role in both protecting the brain and maintaining homeostasis in the central nervous system (cns) [1, 2]. A key component of the system for regulating the cns internal milieu is the presence of several transporter systems, which are located at the bbb and are able to transport substances across the bbb . One of the most important transporters at the bbb is the multidrug resistance protein p - glycoprotein (pgp), encoded by mdr1/abcb1 and belonging to the family of atp - binding cassette transporters . Pgp is located throughout the human body in organs or tissues with an excretory and/or barrier function, such as liver, kidney, testes and the bbb . At the bbb, pgp is highly expressed at the vessel walls of the brain capillaries, where it functions as an efflux pump . Pgp has the remarkable capacity to extrude a large range of structurally and functionally unrelated compounds from the brain . Together with its high expression, this is the main reason that pgp is considered to be of great importance for protecting the brain from accumulation of potentially toxic substances [5, 6]. Age is a risk factor for many neurodegenerative disorders, such as alzheimer s disease (ad) and parkinsons s disease (pd) [7, 8]. Progressive dysfunction of pgp at the bbb with increasing age could be a contributing factor in the increasing risk of developing neurodegenerative disorders with advancing age . For neurodegenerative disorders such as ad several studies have described a higher incidence of ad in women, which might partly be explained by survival differences favouring women, although hormonal differences could also play a role [911]. Pgp expression is known to differ between men and women; for example, hepatic pgp expression is 2.4-fold lower in females, although there are large interindividual differences in pgp levels . Little is known about gender differences in pgp function at the bbb, which again may be under gender specific hormonal influences . Positron emission tomography (pet) with the radiolabelled pgp substrate (r)-[c]verapamil is a validated technique to measure bbb pgp function in vivo [14, 15]. It has been shown that the volume of distribution (vt) of (r)-[c]verapamil inversely reflects cerebral pgp function . Previous data suggest decreased cerebral pgp function in healthy aging [1719] and ad, whilst conflicting results have been obtained in pd [21, 22]. The purpose of the present study was to further investigate global and regional effects of age and gender on bbb pgp function in a large group of healthy controls, as measured using (r)-[c]verapamil and pet . Thirty - five healthy male and female subjects in three different age groups (young subjects between 20 and 30 years, middle aged subjects between 40 and 50 years and elderly subjects between 55 and 70 years of age) were recruited through advertisements in newspapers and by means of flyers . Of the 35 subjects, ten males (five young and five elderly) had also been included in a previously published pilot study of toornvliet et al . Assessing bbb pgp function . Subjects underwent a standardized clinical assessment, including medical history, family history, use of medication and drugs of abuse, and physical and neurological examinations . All subjects had normal scores on screening laboratory tests and urine screening for use of drugs of abuse was negative . All subjects had a normal magnetic resonance imaging (mri) scan, as evaluated by a neuroradiologist . Mini - mental state examination (mmse) scores were within the normal range (mmse> 26). Medication at the time of scanning was not allowed, except for medication known not to interfere with pgp function [24, 25]. Written informed consent was obtained from all participants after a complete written and verbal description of the study . The study was approved by the medical ethics review committee of the vu university medical center . All subjects underwent structural mri scans using a 1.0-t magnetom impact scanner (siemens medical solutions, erlangen, germany) or a 1.5-t sonata scanner (siemens medical solutions, erlangen, germany). Scan protocols on both scanners included an identical coronal t1-weighted 3-d magnetization prepared rapid acquisition gradient echo . Voxel size of the images was 0.98 0.98 1.49 mm . These mri scans were used for co - registration and region - of - interest (roi) definition . Pet scans were acquired using an ecat exact hr+ scanner (siemens / cti, knoxville, tn, usa). All subjects received an indwelling radial artery cannula for arterial sampling and a venous cannula for tracer injection . First, a 10-min transmission scan in 2d acquisition mode was performed using three retractable rotating line sources . Next, a 3d dynamic emission scan was started simultaneously with the injection of 369 19 mbq (r)-[c]verapamil, performed using an infusion pump (med - rad, beek, the netherlands). This emission scan consisted of 20 frames with progressive increase in frame duration (1 15, 3 5, 3 10, 2 30, 3 60, 2 150, 2 300, 4 600 s; total acquisition time 60 min). During the scan, arterial blood was withdrawn continuously using an online sampling device (veenstra instruments, joure, the netherlands). At set times, continuous sampling was interrupted and manual samples were taken . Subject motion was restricted by the use of a head immobilisation device, and position of the head was checked visually at regular intervals during scanning (using laser beams) and corrected immediately when necessary . All pet sinograms were corrected for dead time, tissue attenuation, decay, scatter and randoms . Pet scans were reconstructed using a standard filtered back projection (fbp) algorithm and a hanning filter with a cutoff at 0.5 times the nyquist frequency . A zoom factor of 2 and a matrix size of 256 256 63 were used, resulting in a voxel size of 1.2 1.2 2.4 mm and a spatial resolution of approximately 6.5 mm full width at half maximum at the centre of the field of view . Images were also reconstructed using a partial volume corrected ordered subset expectation maximization (pvc osem) reconstruction algorithm, a previously described and validated method that results in improved image resolution, thereby reducing partial volume effects (pve) [2830]. Co - registration of structural t1 mr images to corresponding pet images (using summed fbp or pvc osem reconstructed images of frames 312) and segmentation of the co - registered mri into grey matter, white matter and cerebrospinal fluid was performed using statistical parametrical mapping (spm; version spm2, www.fil.ion.ucl.ac.uk/spm, institute of neurology, london, uk). Rois were defined on the basis of the segmented mri and a probabilistic template as implemented in pvelab . Frontal, parietal, temporal, occipital, posterior and anterior cingulate, medial temporal and cerebellar rois were used for further analysis . In addition, a global cortical region was defined consisting of the volume weighted average of frontal, parietal, temporal and occipital cortices and posterior and anterior cingulate regions . The original on - line blood curve was calibrated using whole blood radioactivity concentrations derived from the seven manual samples . The calibrated whole blood curve was multiplied with a single - exponential fit to the plasma - to - whole blood ratios of these samples, thereby generating a total plasma curve . Finally, the metabolite corrected plasma input function was obtained by multiplying this total plasma curve with a sigmoid fit to one minus the polar metabolite fraction [16, 32]. This method of obtaining the plasma input function for (r)-[c]verapamil, corrected for polar metabolites, has been described in more detail previously . Kinetic analyses were performed using software developed within matlab 7.04 (the mathworks, natick, ma, usa). (r)-[c]verapamil data were analysed using a standard two tissue compartment model with the regional k1/k2 ratio fixed to the value obtained for the whole brain grey matter roi . Statistical analyses were performed using spss 15.0 (spss institute, chicago, il, usa). Potential differences in injected tracer dose, specific activity and tracer metabolism (parent and polar metabolite fraction) were verified using students t tests . Comparison of global and regional differences in vt between age and gender groups was assessed using both students t tests and analysis of variance (anova) with post hoc least significance difference (lsd) testing . Linear regression analyses were performed using vt as dependent variable and age (continuous) as independent variable . The threshold for significance was set at p <0.05 . Thirty - five healthy male and female subjects in three different age groups (young subjects between 20 and 30 years, middle aged subjects between 40 and 50 years and elderly subjects between 55 and 70 years of age) were recruited through advertisements in newspapers and by means of flyers . Of the 35 subjects, ten males (five young and five elderly) had also been included in a previously published pilot study of toornvliet et al . Assessing bbb pgp function . Subjects underwent a standardized clinical assessment, including medical history, family history, use of medication and drugs of abuse, and physical and neurological examinations . All subjects had normal scores on screening laboratory tests and urine screening for use of drugs of abuse was negative . All subjects had a normal magnetic resonance imaging (mri) scan, as evaluated by a neuroradiologist . Mini - mental state examination (mmse) scores were within the normal range (mmse> 26). Medication at the time of scanning was not allowed, except for medication known not to interfere with pgp function [24, 25]. Written informed consent was obtained from all participants after a complete written and verbal description of the study . The study was approved by the medical ethics review committee of the vu university medical center . All subjects underwent structural mri scans using a 1.0-t magnetom impact scanner (siemens medical solutions, erlangen, germany) or a 1.5-t sonata scanner (siemens medical solutions, erlangen, germany). Scan protocols on both scanners included an identical coronal t1-weighted 3-d magnetization prepared rapid acquisition gradient echo . Voxel size of the images was 0.98 0.98 1.49 mm . These mri scans were used for co - registration and region - of - interest (roi) definition . Pet scans were acquired using an ecat exact hr+ scanner (siemens / cti, knoxville, tn, usa). All subjects received an indwelling radial artery cannula for arterial sampling and a venous cannula for tracer injection . First, a 10-min transmission scan in 2d acquisition mode was performed using three retractable rotating line sources . Next, a 3d dynamic emission scan was started simultaneously with the injection of 369 19 mbq (r)-[c]verapamil, performed using an infusion pump (med - rad, beek, the netherlands). This emission scan consisted of 20 frames with progressive increase in frame duration (1 15, 3 5, 3 10, 2 30, 3 60, 2 150, 2 300, 4 600 s; total acquisition time 60 min). During the scan, arterial blood was withdrawn continuously using an online sampling device (veenstra instruments, joure, the netherlands). At set times, continuous sampling was interrupted and manual samples were taken . Subject motion was restricted by the use of a head immobilisation device, and position of the head was checked visually at regular intervals during scanning (using laser beams) and corrected immediately when necessary . All pet sinograms were corrected for dead time, tissue attenuation, decay, scatter and randoms . Pet scans were reconstructed using a standard filtered back projection (fbp) algorithm and a hanning filter with a cutoff at 0.5 times the nyquist frequency . A zoom factor of 2 and a matrix size of 256 256 63 were used, resulting in a voxel size of 1.2 1.2 2.4 mm and a spatial resolution of approximately 6.5 mm full width at half maximum at the centre of the field of view . Images were also reconstructed using a partial volume corrected ordered subset expectation maximization (pvc osem) reconstruction algorithm, a previously described and validated method that results in improved image resolution, thereby reducing partial volume effects (pve) [2830]. Co - registration of structural t1 mr images to corresponding pet images (using summed fbp or pvc osem reconstructed images of frames 312) and segmentation of the co - registered mri into grey matter, white matter and cerebrospinal fluid was performed using statistical parametrical mapping (spm; version spm2, www.fil.ion.ucl.ac.uk/spm, institute of neurology, london, uk). Rois were defined on the basis of the segmented mri and a probabilistic template as implemented in pvelab . Frontal, parietal, temporal, occipital, posterior and anterior cingulate, medial temporal and cerebellar rois were used for further analysis . In addition, a global cortical region was defined consisting of the volume weighted average of frontal, parietal, temporal and occipital cortices and posterior and anterior cingulate regions . The original on - line blood curve was calibrated using whole blood radioactivity concentrations derived from the seven manual samples . The calibrated whole blood curve was multiplied with a single - exponential fit to the plasma - to - whole blood ratios of these samples, thereby generating a total plasma curve . Finally, the metabolite corrected plasma input function was obtained by multiplying this total plasma curve with a sigmoid fit to one minus the polar metabolite fraction [16, 32]. This method of obtaining the plasma input function for (r)-[c]verapamil, corrected for polar metabolites, has been described in more detail previously . Kinetic analyses were performed using software developed within matlab 7.04 (the mathworks, natick, ma, usa). (r)-[c]verapamil data were analysed using a standard two tissue compartment model with the regional k1/k2 ratio fixed to the value obtained for the whole brain grey matter roi . Statistical analyses were performed using spss 15.0 (spss institute, chicago, il, usa). Potential differences in injected tracer dose, specific activity and tracer metabolism (parent and polar metabolite fraction) were verified using students t tests . Comparison of global and regional differences in vt between age and gender groups was assessed using both students t tests and analysis of variance (anova) with post hoc least significance difference (lsd) testing . Linear regression analyses were performed using vt as dependent variable and age (continuous) as independent variable . The threshold for significance was set at p <0.05 . Thirty - five subjects were included in the study, 16 women and 19 men, divided into three different age groups: young (age 24 2, range 2127 years), middle aged (age 46 3, range 4250 years) and elderly (age 63 4, range 5769 years) (table 1). Four of the female subjects (two young, two middle aged) were on oral contraceptives, which were all stopped in the week of pet scanning . The middle - aged women included in analyses were aged 43, 43, 44 and 48, respectively, and were not in the menopause or had reached postmenopausal status yet . There was no use of hormonal replacement therapy in female subjects and no use of other medication in both male and female participants . There were no differences in injected tracer dose and specific activity between the age groups, gender groups or gender groups within the age groups . One subject (female, middle aged group, 43 years) was excluded from further analysis because of technical problems during arterial sampling.table 1characteristics of age groupsnfemale (%) age (years)id (mbq)sa (gbq mol)young94424 2369 1451 16middle105046 3368 1551 22old164463 4371 3539 13n number of subjects, i d injected dose of (r)-[c]verapamil, sa specific activity of the injected (r)-[c]verapamil characteristics of age groups n number of subjects, i d injected dose of (r)-[c]verapamil, sa specific activity of the injected (r)-[c]verapamil areas under the curve (aucs) for both parent and polar metabolite fractions of (r)-[c]verapamil were calculated . Parent fraction aucs were 38.0 4.1, 35.9 5.1 and 39.5 4.6 min for young, middle aged and elderly subjects, respectively . Polar metabolite fraction aucs were 10.0 3.2, 8.9 2.5 and 9.3 2.2 min for young, middle aged and elderly subjects, respectively . In summary, there were no significant differences in tracer metabolism between the age groups . Similarly, within each age group, there were no significant differences in metabolism between males and females . For fbp reconstructed data, significant (p <0.05) increases in (r)-[c]verapamil vt were found in the elderly group compared with the young group for frontal, temporal, posterior and anterior cingulate, medial temporal lobe and cerebellar regions (table 2). For pvc osem reconstructed data, similar results were obtained, except that in this case, also a significant increase in vt of the global cortical region was seen (table 3). No significant differences were seen between young and middle aged groups and between middle aged and elderly groups . As effects of pve correction on (r)-[c]verapamil data were minimal (tables 2 and 3), all further analyses were performed for fbp reconstructed data.table 2volume of distribution of (r)-[c]verapamil in several brain regions for different age groups in case of fbp reconstructed datayoungmiddleoldglobal0.71 0.20.75 0.10.84 0.2frontal0.71 0.20.74 0.10.85 0.2*parietal0.70 0.20.75 0.10.83 0.2temporal0.71 0.20.76 0.10.86 0.2*occipital0.73 0.20.76 0.10.85 0.2posterior cingulate0.65 0.10.74 0.10.82 0.2*anterior cingulate0.66 0.20.72 0.10.80 0.1*medial temporal0.77 0.20.88 0.21.07 0.3*cerebellum0.67 0.20.74 0.10.88 0.2**p <0.05 for young versus elderly aged grouptable 3volume of distribution of (r)-[c]verapamil in several brain regions for different age groups in case of pvc osem reconstructed datayoungmiddleoldglobal0.68 0.20.73 0.10.82 0.2*frontal0.68 0.20.72 0.10.84 0.2*parietal0.67 0.20.72 0.10.81 0.2temporal0.68 0.20.75 0.10.83 0.2*occipital0.69 0.20.73 0.10.81 0.1posterior cingulate0.64 0.10.73 0.10.82 0.2*anterior cingulate0.65 0.20.72 0.10.79 0.1*medial temporal0.76 0.10.91 0.21.09 0.4*cerebellum0.65 0.20.72 0.10.80 0.1**p <0.05 for young versus elderly aged group volume of distribution of (r)-[c]verapamil in several brain regions for different age groups in case of fbp reconstructed data * p <0.05 for young versus elderly aged group volume of distribution of (r)-[c]verapamil in several brain regions for different age groups in case of pvc osem reconstructed data * p <0.05 for young versus elderly aged group within each age group, the effect of gender was assessed . Results for the global cortical region are shown in fig . 1, illustrating a significantly higher mean vt in young women than in young men, but no differences in the other age groups . Therefore, anova was performed to assess age effects for each gender separately . For men, a main effect of age post hoc lsd analyses revealed significant differences in vt between young and middle aged groups for all regions, except frontal and cerebellar roi . In addition, significant differences between young and elderly groups were observed for all brain regions . In contrast, in women, no main effect of age was seen in any of the regions . Finally, for men and women separately, the relationship between (r)-[c]verapamil vt and age was assessed using linear regression analysis . Again, there was a main effect of age in men for all regions, but none in women.fig . 1boxplot of volume of distribution (vt) of (r)-[c]verapamil for the global cortical brain region for the young, middle aged and elderly groups . Open circles outliers, vt = vt.table 4regional regression coefficients (and corresponding p values) for linear regression of the volume of distribution of (r)-[c]verapamil against age in men and women separatelymenwomenglobal0.64 (0.003)0.12 (0.672)frontal0.63 (0.004)0.10 (0.732)parietal0.63 (0.004)0.10 (0.734)temporal0.65 (0.003)0.24 (0.465)occipital0.62 (0.005)0.04 (0.891)posterior cingulate0.58 (0.009)0.21 (0.443)anterior cingulate0.66 (0.002)0.14 (0.620)medial temporal0.68 (0.001)0.42 (0.123)cerebellum0.60 (0.006)0.30 (0.273) boxplot of volume of distribution (vt) of (r)-[c]verapamil for the global cortical brain region for the young, middle aged and elderly groups . Open circles outliers, vt = vt . Regional regression coefficients (and corresponding p values) for linear regression of the volume of distribution of (r)-[c]verapamil against age in men and women separately this is the first study to assess in vivo effects of gender and aging on human bbb pgp function in a large sample size with pet and (r)-[c]verapamil . This study shows an 18 to 38% increase in the volume of distribution of (r)-[c]verapamil with normal aging in several brain regions, such as frontal, temporal, medial temporal and anterior and posterior cingulate regions . These data are consistent with an age - related decline in bbb pgp function and are in line with previous studies assessing bbb pgp function in vivo during healthy aging [1719]. Importantly, the present results indicate that the effects of age on bbb pgp function are driven by men . In women, no main effect of age on pgp function three previous studies have assessed bbb pgp function in healthy aging . In a pilot study in ten subjects, five young and five elderly males, toornvliet and colleagues observed an ~18% decrease in pgp function in the elderly for a whole brain grey matter region of interest . Bartels and colleagues were the first to study regional differences in pgp function with aging and found clusters with higher uptake in white matter regions in ten elderly compared with seven younger subjects (14 males) using a voxel - based approach . Bauer and colleagues extended these findings in thirteen subjects (11 males), in which six older subjects had increased tracer uptake in several brain regions, although some of these findings disappeared after correcting for pve . These previous studies used relatively small subject groups and did not take into account effects of gender on pgp function . Furthermore, not all of these studies used the pure enantiomer (r)-[c]verapamil, which is the preferred tracer for quantifying pgp function [16, 33, 34]. In addition, some of these studies have used single - tissue compartment models [17, 19] whilst recent studies have shown that two components can be identified in (r)-[c]verapamil data [20, 35, 36]. As such, a two - tissue compartment model provides better fits to (r)-[c]verapamil data [16, 37]. This difference in age effects on bbb pgp function seems to be mainly due to the relatively high distribution volumes in young female subjects . The reason for this remains unknown, but it could be due to interindividual differences in pgp function itself, or interindividual differences in (fluctuating) hormone levels in women that, in turn, could affect pgp function . It is known that (both endogenous and synthetic) progesterone / progestins and estrogens can have an effect on pgp function . In an attempt to limit these individual differences in (fluctuating) hormone levels, all female subjects in both young and middle aged groups were scanned at comparable time points in their menstrual cycle (during menstruation). Of course, this does not guarantee comparable hormone levels or comparable effects of hormone levels on pgp function . In the present study further studies are needed to investigate the relationship between (r)-[c]verapamil measurements and actual hormone levels . Interestingly, a preclinical study has found differences in brain uptake of verapamil comparing female mice to male mice, which suggested a modest increase in pgp expression and/or function in female animals . This is in contrast to the findings of the present clinical study in humans, in which a higher vt was found in young women than in young men, suggesting reduced pgp function in young women . Further studies are needed to assess whether this discrepancy is due to differences in hormonal status or species differences in transporter expression and/or activity at the bbb . Using pet and (r)-[c]verapamil, it is not possible to differentiate between decreased pgp function due to a decrease in bbb pgp expression or due to decreased functionality of the transporters with intact pgp expression . Decreased pgp function with increasing age could account for increased drug toxicity and increased cns side effects of drugs that are able to pass the bbb in the elderly . Additionally, older people more often suffer from health problems, and it is not uncommon that this results in polypharmacy which often includes the use of pgp inhibiting drugs, which may lead to further impairment of the protective function of pgp . Furthermore, a decrease in pgp function with increasing age could make the elderly more vulnerable to both exogenous as well as endogenous neurotoxins that are transported by pgp (such as amyloid - beta, the protein that accumulates in the brain in ad), and this may contribute to the increasing risk of neurodegenerative diseases with age . Results of this study suggest decreased pgp function in young women compared with young men, which could implicate that women are exposed to higher concentrations of neurotoxins earlier in life and therefore during a longer time period, which in turn could possibly account for the increased risk of ad in women . Recently, using pet and (r)-[c]verapamil, it has been shown that ad patients have diminished bbb pgp function compared with healthy elderly aged subjects, further supporting a possible role of pgp in the aetiology of ad . Data in this study were assessed with and without a pve correction method, showing comparable results in distribution volumes . It should be noted that, although the age range varied from 21 to 69 years, there was no significant brain atrophy present on mri scans, and as (r)-[c]verapamil is a tracer which has low uptake throughout the brain and therefore shows little contrast, no major effects from pve correction methods should be expected . Strengths of the present study are the relatively large sample size of the three different age groups and the wide age range of subjects included, in addition to the quantitative nature of the study . Nevertheless, a limitation of the study is that the different age groups still become relatively small when separated according to gender . In addition, despite extensive screening, inclusion of subjects with preclinical neurodegenerative disorders, which by themselves are associated with decreased pgp function, cannot be excluded . The volume of distribution of (r)-[c]verapamil increases with age in several cortical brain regions, strongly suggesting a progressive decrease in bbb pgp function with age . However, this effect is only seen in males, suggesting different aging patterns between men and women . This article is distributed under the terms of the creative commons attribution license which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.
|
Accordingly, the number of reports of laparoscopic pancreaticoduodenectomy (lap pd) has gradually increased . Although the feasibility and safety of lap pd have been established in institutes particularly experienced in the skilled performance of this technique (hereafter referred to as experienced institutes), the benefit of lap pd beyond conventional surgery has not yet been shown . The management of concomitant abdominal aortic aneurysm (aaa) and intra - abdominal malignancy is controversial . Three issues must be considered in the development of a treatment technique in such cases . The first is mutual interference because of operative fields that are in close vicinity to one another, resulting in adhesions or collateral injuries . The last is postoperative complications, especially intra - abdominal abscessation with graft infection . In particular, the pancreas is the organ that is most resistant to resolution of these issues because of its anatomical proximity to the aorta and severity of pancreatic fistulae as a postoperative complication . The feasibility and safety of endovascular repair (evar) for aaa have been established . In addition, laparoscopic colectomy and evar for aaa were successfully performed in a patient . Similarly, lap pd and evar for aaa could have some benefits for patients . However, to the best of our knowledge, concomitant treatment by lap pd and evar has never been reported . A 70-year - old japanese man was referred from vascular surgery for investigation of a pancreatic tumor, which was identified as a cystic tumor of the pancreas head by computed tomography (ct). Within 1.5 years he had a previous history of percutaneous coronary intervention for acute myocardial infarction when he was 66 years old and aortic stent grafting for an aaa when he was 68 years old . The aaa was located on the infrarenal aorta with a thrombus of 52 mm (fig . The height, weight, and body mass index of the patient were 163 cm, 67.3 kg, and 25.3, respectively . A ct scan showed a cystic tumor of 31-mm diameter in the pancreas head without dilatation of the main pancreatic duct (fig . 2), but contrast - enhanced endoscopic sonography revealed a nodule among the cyst mucus (fig . Thus, we diagnosed the enlarging tumor as a branched - type ipmn with a nodule and planned to perform a resection . To avoid disturbing the aaa or stimulating a residual aaa, we intended to perform lap pd . Open laparoscopy was performed at the umbilicus, and an additional five ports were placed (fig . The patient had severe visceral steatosis, and the abdominal cavity was filled with omental fat . For mobilization around the ligament of treitz and the fourth portion of the duodenum, an additional port was placed at the middle of the inferior abdomen (fig . 3). During this procedure, neither duodenal adhesion to the aorta nor other inflammatory changes due to the previously placed stent graft were observed . After mobilization, an upper - middle incision of 15 cm was made, and the pancreas head was excised and removed . A pancreato - jejunal anastomosis was created by hand - suturing between the pancreatic duct and the jejunal mucosa . Although the patient required medical therapy for pancreatic fistulae (grade b according to the international study group on pancreatic fistula [isgpf]), his postoperative recovery was uneventful . The pathological diagnosis was intraductal papillary mucinous adenoma with small foci of carcinoma in situ (fig . Lap pd after evar for aaa was safely performed with both rigorous preoperative planning and a meticulous operation . Although lap pd is one of the most complicated procedures in laparoscopic surgery, its safety and feasibility have been reported in experienced institutions . Pancreatic cancer, as a representation of pancreas head tumors, has a poor prognosis . Thus, the indications for lap pd in patients with pancreatic cancer are very limited . This case involved an ipmn, and the patient was thus a good candidate for lap pd . There are few operative indications for this type of neoplasia, and reported cases have shown a poor prognosis . When pancreatic cancer and aaa are simultaneously present, pancreatectomy is first recommended, including determination of the stage of the cancer . Second, mutual interference between the two conditions is undeniable because of the proximity of the pancreas to the aorta . Deiparine advocated division of the retroperitoneal dissection procedure: right - sided dissection for pd and left - sided dissection for abdominal aortic bypass . The last is the severity of the postoperative complications after pancreatectomy . In the present case, laparoscopic dissection of the pancreas head was safely performed without interference of the residual aaa because the axis of the laparoscopic procedure was located apart from the aaa (fig . Moreover, laparoscopic procedures require smaller operative fields using magnified visualization . These are benefits of the laparoscopic approach for patients with aaa . After the resection, an upper abdominal incision was made and reconstruction of the pancreas stump was performed through the incision . This reconstruction involved wirsung anastomosis, which represents the usual manner of standard pd in our institute . Total lap pd has been reported in experienced institutes; however, other reconstruction methods and no reconstruction have also been reported . Thus, we performed reconstruction by hand as usual because laparoscopic reconstruction had not replaced hand sewing at that time in our institute . The additional upper incision is adequately located apart from the aaa; therefore, the reconstruction procedure is safely performed without interference by the aaa . The isgpf grade b pancreatic fistulae healed with medical therapy and without graft infection . The pancreatic tumor was detected during follow - up of the aaa after evar . Increased performance of evar for written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request . Norihiko ishikawa, mari shimada, and hideki moriyama performed the lap pd with the corresponding author.
|
Baseline flt imaging in this patient with metastatic malignant melanoma demonstrated splenic (s), peritoneal (p) and bm metastases . After 14 days of treatment with a novel antiangiogenesis agent the upper abdominal peritoneal deposit (vertical arrow) had substantially decreased activity while the lower abdominal focus could no longer be visualised . Uptake at sites of baseline abnormality in the spleen (horizontal arrow) and right femoral bm (oblique arrow) were relatively photopaenic compared to adjacent normal tissues . Fdg pet scanning (not shown) demonstrated no change over the same period . Most clinical studies of hypoxia imaging have utilized the nitroimadozole, [f]fluoromisonidazole (fmiso). Slow blood pool clearance and high lipophilicity contribute to significant background activity and relatively low contrast between hypoxic and normal tissues . A new agent [f]fluoro - azomyacinarabinofuranoside (faza) has lower lipophilicity as demonstrated by low brain uptake in the left panel . More rapid blood clearance with similar absolute uptake in hypoxic tissue leads to higher contrast as demonstrated in this comparative study of faza (left) and fmiso (right) scans in a patient with locally advanced retropharyngeal cancer.
|
Many moral psychologists today accept that there are two types of moral reasoning focusing on lawrence kohlberg s justice and carol gilligan s care.1 kohlberg elaborated the cognitive approach to moral development and formulated his moral stage theory,2,3 which came to be very influential in the field for many years.4 gilligan s criticism5 of kohlberg s theory was not only a critique of the absence of a gender - related focus but also of the scientific approach and methods . The cognitive view of moral development denotes that the logic of a person s reason influences moral behavior in accordance with his or her judgement.4 a more relational approach to morality is proposed in the care oriented view by gilligan,5 who also argues that this is more representative of the moral experience of women.4,5 however, the two views of moral reasoning may be considered as complementary to each other with gilligan s work more regarded as an expansion of kohlberg s theory than merely a critique.1,6 choosing a cognitive approach in line with kohlberg s theory means that moral function is considered to contain not only thinking about issues of right or wrong in social relationships, but also emotions . Furthermore, it implies that the way people conceptualize these issues are grounded in their understanding of justice, rights, fairness, and the welfare of other individuals . Moral awareness and knowledge are formed in childhood and undergo developmental transformations during life.7 although it has been much criticized over the years, kohlberg s theory is still important in research on moral development . Rest et al8 have launched a fruitful neo - kohlbergian approach that has guided a number of empirical studies, which have given strong support to kohlberg s theory . The core ideas in this research are the emphasis on cognition, the individual s construction of moral epistemology, the moral judgment development evolving from simpler ideas to more complex ones, and the individual s growing awareness of the importance of society and of how people interrelate through laws, rules, institutions, and roles . Despite much strength in contemporary critical work, arnold4 argues that the fundamental place of reason in morality cannot be dismissed, and should be investigated further and clarified in future empirical studies . To be able to investigate moral development among individuals according to kohlberg s theory within a quantitative research paradigm, reliable and valid instruments are essential . In order to study moral development according to this theory in a culturally coherent way in scandinavia, an instrument, the moral development scale for professionals (mdsp)9 has been developed and initially tested for reliability and validity in norway, where a number of items following the conventional and postconventional levels in the theory2,3 were developed . Although sufficient and fairly sound psychometric properties were shown for the new instrument,9 further testing is needed, especially the issue of construct validity tested with structural equation modeling (sem), because the instrument is grounded in a theory . The aim of this study was to investigate construct validity of the mdsp with sem . The mdsp is based on lawrence kohlberg s theory of moral development,2,3 which proposes that individuals pass through moral stages from the concrete to the abstract . The scale has been developed with the aim of measuring moral development among adults, who can be expected to have reached the upper levels of kohlberg s stages of moral development, ie, the conventional and postconventional levels.9 kohlberg s theory suggests that moral development can be conceptualized along a continuum ranging from low and concrete to high and abstract levels: 1) the preconventional level, 2) the conventional level, and 3) the postconventional level . Most children under 9 years of age are on the preconventional level . At the first stage on this moral level (stage 1), the individual cannot recognize the interests of other people fully and does not consider them . The individual may be viewed as a selfish actor, and moral judgement is linked to physical consequences . To avoid punishment is the reason for doing right as well as the superior power of authorities . At the second stage (stage 2), the perspective is more individualistic, and one s own interests and needs guide the right actions in a world where other individuals also have their interests and needs.2,3 most adolescents and adults in western society have reached the conventional level of moral development . The first stage (stage 3) individual interests are not as important anymore, and shared feelings, expectations of other people, and agreements between individuals have become increasingly important . There is a wish to please and help others and to be approved by other people, ie, to be a good girl or boy . At stage 4, the individual is guided by the system that defines rules and laws and by the earned expectations of others . Law and order are central to this stage.2,3 the postconventional level is typified by moral values that are in conformity with the self and with sharable and shared rights, duties, and standards . This level is reached only by a minority of adults after the age of 20 years2,3 or even after 30 years.10 at the first stage on this level (stage 5), the rational individual is well aware of rights and values prior to social attachments and contracts . That legal and moral points sometimes may diverge and be in conflict with each other provision of the greatest good to the greatest number of people is also central to this stage . Right and wrong are constituted by the norms of the majority in society . At the last stage (stage 6), conscience and universal ethical principles are in focus . Human beings are ends in themselves, self - chosen ethical principles are followed, and the nature of morality is recognized by the rational individual.2,3 in order to measure moral development among adults, mdsp has been constructed . Since the preconventional level in kohlberg s theory reflects early stages in the development it was not incorporated in the instrument . The conventional level, with its 2 stages focusing on moral thinking in the individual s family, among friends, and in society in general, the perspective of the postconventional level, with the 2 stages, 5 and 6, reflecting universal ethical principles and basic democratic rights and values, was also incorporated in the items.9 the summated self - report instrument was developed in the norwegian language in norway . Thirty - two items reflecting the 4 stages of moral development at the conventional and postconventional levels, 8 items for each stage, were formulated in a likert - type format . After different actions to test the appropriateness of the items, an instrument with 12 items was finally chosen to be suitable to have in the instrument.9 these actions were implemented with data from different study groups . A group of 183 students answered the scale and item - to - item correlations were computed . Data from a study group of 326 students were used for further reduction of the items by means of a factor analysis (principal component analysis with varimax rotation and kaiser normalization) and item - to - item correlations . Item reduction followed the recommendations formulated by streiner and norman.11 validity of the final instrument was supported by the fact that there was a significant difference between student groups with an expected higher score and students with an expected lower score, respectively . Validity was also partly supported by a factor analysis that explained 51% of the variances with a logical 4-factor solution.9 reliability assessed as internal consistency with the cronbach s alpha coefficient reached a value of 0.67 in the study group of 326 students.9 since a value of 0.70 is considered to be sufficient for group level comparisons, the reliability of mdsp should be considered as acceptable in the initial testing and development procedures . The instrument is built up of items that to some degree are causal indicators and, therefore, high internal consistency is not as critical.11 causal indicators are in this particular context items that lead to behavior that reflect a particular stage or level in kohlberg s theory . The final instrument has 12 likert - type items ranging from 1 (not agree at all) to 5 (agree completely), which yields a total sum between 12 and 60 . The intention of mdsp has been to provide a scale that can be used to evaluate moral development among, for example, students and professionals for whom it is essential to have a well developed ability for moral behavior, ethical thinking, and decision making . Although indications of validity have been shown in the initial development and testing procedures,9 a convenience sample of a total of 339 nursing students at a university college in norway was recruited for the study during 2 different years . The request to participate in the study mean age in the study group was 25.3 years, ranging from 18 to 53 years . Eighteen males (5.3%) were present in the study group, and there was no difference in age between males and females when t tested for independent samples (2-tailed probability). Validity of the scale was assessed as construct validity and first tested through sem by the use of simple structure models.12 the program mplus version 3.13 was used for the sem analyses13 within the streams modeling environment for specifying, estimating, and evaluating the models.14 model fit was measured with the root mean square error of approximation (rmsea) and chi - square tests . A value of rmsea of about 0.05 represents a close fit of the model, although values up to 0.08 may be acceptable.15 when chi - square tests are used in this context, model fit is ideal when there is no difference between data and the model . A 1-factor model was first tested with all items of mdsp influencing 1 single latent variable . A hypothesized simplex structure model, with 4 latent variables, was tested in a second step . In this model, items representing the intended kohlberg stages 3, 4, 5, and 6, respectively, influenced the 4 latent variables . Based on results from the 4-factor model, it was hypothesized that the final model consisted of 3 latent variables, where 2 of them were representing the 2 stages (3 and 4, respectively) on the conventional level and 1 the whole postconventional moral level (stages 5 and 6). Internal consistency of the latent variables in the final model, as well as the internal consistency of the whole scale, was assessed with the cronbach s alpha coefficient.16 according to kohlberg s theory of moral development, only a minority of individuals reach the postconventional level after the age of 20 years.2,3 construct validity was tested through investigation of how large a proportion of the respondents older than 20 years achieved a high score, ie, a total sum score 24, on the items at stage 5 and stage 6 . Written permission for doing the research with students as respondents was obtained from the current leaders at the university college . Oral information and the option to withdraw from the data collection were given to the respondents when the questionnaires were handed out to them . Data were treated with confidentiality, and the same ethical principles that guide clinical research were applied,17 as well as the intentions of the declaration of helsinki.18 since no health information was requested from the respondents, no formal approval from the regional committee for research ethics needed to be obtained . A convenience sample of a total of 339 nursing students at a university college in norway was recruited for the study during 2 different years . The request to participate in the study mean age in the study group was 25.3 years, ranging from 18 to 53 years . Eighteen males (5.3%) were present in the study group, and there was no difference in age between males and females when t tested for independent samples (2-tailed probability). Validity of the scale was assessed as construct validity and first tested through sem by the use of simple structure models.12 the program mplus version 3.13 was used for the sem analyses13 within the streams modeling environment for specifying, estimating, and evaluating the models.14 model fit was measured with the root mean square error of approximation (rmsea) and chi - square tests . A value of rmsea of about 0.05 represents a close fit of the model, although values up to 0.08 may be acceptable.15 when chi - square tests are used in this context, model fit is ideal when there is no difference between data and the model . A 1-factor model was first tested with all items of mdsp influencing 1 single latent variable . A hypothesized simplex structure model, with 4 latent variables, items representing the intended kohlberg stages 3, 4, 5, and 6, respectively, influenced the 4 latent variables . Based on results from the 4-factor model, it was hypothesized that the final model consisted of 3 latent variables, where 2 of them were representing the 2 stages (3 and 4, respectively) on the conventional level and 1 the whole postconventional moral level (stages 5 and 6). Internal consistency of the latent variables in the final model, as well as the internal consistency of the whole scale, was assessed with the cronbach s alpha coefficient.16 according to kohlberg s theory of moral development, only a minority of individuals reach the postconventional level after the age of 20 years.2,3 construct validity was tested through investigation of how large a proportion of the respondents older than 20 years achieved a high score, ie, a total sum score 24, on the items at stage 5 and stage 6 . Written permission for doing the research with students as respondents was obtained from the current leaders at the university college . Oral information and the option to withdraw from the data collection were given to the respondents when the questionnaires were handed out to them . Data were treated with confidentiality, and the same ethical principles that guide clinical research were applied,17 as well as the intentions of the declaration of helsinki.18 since no health information was requested from the respondents, no formal approval from the regional committee for research ethics needed to be obtained . A 1-factor model of moral development showed a close goodness - of - fit with rmsea = 0.039, indicating that 1 single concept is reflected in the model . Chi - square was 81.71 (df = 54), p <0.01 . In the second step of the investigation, this model also showed a close goodness - of - fit with rmsea = 0.042 and chi - square 81.03 (df = 51), p <0.00 . Here, however, stage 5 explained 100% of the variances in 6, which presumably means that information is lacking at the postconventional level, where only 2 items represent the final stage . This result means that the 2 stages on the postconventional level cannot be separated from each other in the study group . The final 3-factor model showed a close goodness - of - fit with rmsea = 0.041 and chi - square 81.12 (df = 52), p <0.01 . No respondent reached the maximum score total, ie, 30, on the postconventional level . A total number of 27 individuals (13.5%) above 20 years of age reached a value 24 (80% of maximum score) on this moral level . Valid instruments that are grounded in theory can be used not only to measure phenomena within the theory in question . The aim of this study was to investigate construct validity of the mdsp with sem . Many instruments are built on kohlberg s theory of moral development,2,3 which have primarily been used in studies in the english speaking world.6,19 this article focuses validity testing of mdsp, developed in the scandinavian cultural context, with the aim of measuring moral development among adults, who are presumed to have reached the higher levels of moral development.9 mdsp differs a lot from many other similar instruments . One such well known instrument is the defining issues test,20 also grounded in kohlberg s theory of moral development,2,3 although it assumes some changes in the original thinking.21 that instrument is time consuming to use because of its format, with cases yet to be discussed . Mdsp is designed to be quite easy to use and not very time consuming for the respondents to answer . Because the stages as well as the moral levels are conceptualized along a continuum from low to high in the theory that underlies the instrument, a simplex structure model tested through structural equation modelling was suitable for testing the relationship between the stages and levels . A convenience sample of nursing students participated in the study . It was not possible to separate the two stages at the post - conventional level (stage 5 and 6) in the simplex structure model that was tested, probably because only 2 items reflected the highest stage . This is a limitation of the instrument, but in the construction phase only 2 items at this stage had sufficient psychometric properties to be retained . It may also be logical that the two highest stages are difficult to separate, since the dialectical joining of judgement experience processes with reflective claims of others at stage 5 may continuously develop into a personal judgement at stage 6, informed by the experiences of all previous stages . It is also possible not enough students had reached stage 6, which seldom occurs before 40 years of age.10 however, a structure with both levels of the postconventional stage merged into 1 single latent variable gave a model with a close goodness - of - fit . Although the chi - square tests had significant values, which often is the case, there is a close goodness - of - fit for all 3 models . It also corroborates kohlberg s moral stage theory.2,3 however, cronbach s alpha coefficients of the factors are too low to be used as separate subscales . The alpha value for the whole scale was not very high either, but close to the value reported before,9 and 0.70 is considered adequate for group level comparisons . The reason for this borderline value is probably that some of the items are causal factors.11 another possible reason is that the items of mdsp both reflect what rest et al8 call macromorality and micromorality, respectively . Kohlberg s theory2,3 primarily addresses issues concerning macromorality, ie, issues related to formal structures in society such as laws, institutions, and general practices . Micromorality, on the other hand, concerns developing relationships with particular others and the creation of personal, individual virtues throughout life.8 micromorality is reflected in gilligan s care - oriented view of moral development,5 and some of the items in mdsp do reflect caring values like community, consideration, kindness, and communication . Construct validity of the instrument was further supported by the fact that only a small proportion (13.5%) of the respondents older than 20 years of age reached a high total score (24) on the items that represent the postconventional moral level, which is in line with the underlying theory of mdsp.2,3 mdsp has been developed in the scandinavian cultural context . But if mdsp is translated into other languages, it has to be tested again with respect to reliability and validity.11 this is an interesting issue for further research . Further development of the instrument could also include construction of new items on the postconventional level in order to try to enhance construct validity . In order to make mdsp possible to use among, for example, pupils and younger students, including new items on the preconventional level would be valuable . The instrument will be researched further, in order to measure and describe moral development in different groups of professionals and students and, also, to relate the measures to behavior and aspects of personality . In conclusion, the results of this study show that the mdsp is an instrument that shows a high degree of construct validity with close correspondence to its theoretical base.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.