Split (1)

train · 133k rows

text stringlengths 0 868k
The revolution in hiv treatment brought about by combination antiretroviral therapy in 1996 had altered the course of the disease among those living with hiv in high - income countries but had only reached a fraction of people in low- and middle - income countries . In resource - poor countries, access to antiretroviral therapy (art) has improved during the last years and mortality rates among treated patients have declined substantially . Ethiopia is one of the seriously affected countries in sub - saharan africa, with more than 1.3 million people living with hiv . In 2003, the government of ethiopia introduced its art program with the goal of reducing hiv - related morbidity and mortality, improving the quality of life of people living with hiv, and mitigating some of the impact of the epidemic . The country has scaled up its art program and is planning to decentralize the service further to existing health facilities providing art reaching 517 in december 2009 . In ethiopia although some studies demonstrate that the incidence of hiv - related wasting syndrome has also declined in the haart era, data from the nutrition for healthy living (nfhl) cohort showed that weight loss and wasting are still common in hiv - infected people and that even a 5% weight loss in 6 months markedly increases the risk of death . Nevertheless, mortality has been high compared to high - income countries and factors contributing to this high mortality are poorly understood in resource - limited countries like ethiopia . Few studies have evaluated the usefulness of such simple markers as predictors of clinical events in patients receiving highly active antiretroviral therapy (haart). In ethiopia, we treated and followed patients using the who clinical stage, hemoglobin level, and the tlc as criteria for beginning treatment . But there is no proper understanding of these factors of paramount importance in tackling the factors of mortality after initiating art . The aim of this study was to assess predictors of survival rate in hiv patients treated with haart . A retrospective cohort study design was carried out from january 2008 to february 2012 at zewditu memorial hospital in addis ababa, the capital of ethiopia . The study population consists of all hiv - infected patients aged 14 and above who were seen at zewditu memorial hospital hiv clinic, addis ababa . The study participants were plwh who had been on art in the hospital from january 2008 to february 2012, who have complete registration, intake, and follow - up forms . Patients who transferred out, lost to follow - up (drop, lost), women who were pregnant at the time of art initiation, lactating mothers in who stage i or ii who started art exclusively to prevent vertical transmission, and patients with competing causes of death other than hiv were excluded . Profiles of all patients on art between january 2008 and february 2012 were evaluated, and exposure status was first identified as stages i - ii (unexposed) versus stages iii - iv (exposed). Finally those who fulfill inclusion criteria were given unique i d number in increasing order for both exposed and unexposed art groups separately . Then, simple random sampling technique was employed separately to select 416 samples using computer - generated random number table . Data collection format was developed from art entry and follow - up form being used in the art clinic of the zewditu memorial hospital . Data quality was ensured by designing proper data collection materials, by checking the collected data daily for completeness, and thorough continuous supervision . All the completed data collection forms were examined again for completeness and consistency during data management, storage, and analysis by principal investigator . The main outcome measure was survival rates from the initiation of art to the end of follow - up date . The independent variables were sociodemographic characteristics, baseline clinical, laboratory, and art information . Spss version 20 was used for survival analysis to measure the association of patient's characteristics with time from art initiation to death . Cox proportional hazard model was used to identify independent predictors of mortality using hazard ratios with 95% ci . Significant predicator in a bivariate analysis with p <0.05 was included in a multivariable cox regression analysis . Ethical clearance for the conduct of this study was obtained from the research and ethical committee of school of public health of the college of health sciences at addis ababa university . Names or identification numbers of hiv / aids patients were not included in the data sheet . A total of 416 patients aged 14 years and above, who started art, were included in this study . From the study participants, 231 (55.5%) of them were males and the mean age was 36.4 (sd = 8.93). Fifty - four percent (54.3%) of the cohort started art on the late stage of the disease (stages 3 - 4). The mean hemoglobin level was 12.9 gm / dl (iqr = 1114). The median bmi of patients at the initiation of art was 22 kg / m . Three hundred ninety - five (97.5%) of the patients had adherence rate of more than 95% . Two hundred twenty three (53.6%) of patients were placed on 3tc - tdf - efv regimen, 11% of patients had been treated for tb in the past prior to this study, and 96.9% of the patients were not given opportunistic infection prophylaxis . Regarding substance use, 29% (119), 21.4% (88), 8.3% (34), and 33% (137) had been using alcohol, tobacco, hard drug, and soft drug, respectively (table 1). The minimum follow - up time was 0.25 months and the maximum was 43 months . The majority 59.5% of deaths occurred within the first 3 months of starting art . In univariable cox regression analysis who clinical stage, anemia and having past tb coinfection were all associated with progression to death . In a multivariable cox regression analysis, significant predictors of mortality were who clinical stage (hr = 2.99 at 95% ci (1.26, 5.31)), anemia (hr = 5.54 at 95% ci (2.58, 11.86)), and having past tb coinfection (hr = 4.13 at 95% ci (1.79, 9.51)) (table 2). The majority of deaths occurred the first three months of the treatment (log rank test, p <0.001) (figures 1, 2, and 3). This 5-year retrospective cohort study of aids patients on art gives an insight into survival and its determinants in a hospital setting in zewditu . The spectrum of patients enrolled in this center was similar for many other start - up art programs in resource - poor settings . In this cohort, mortality was highest during the first three months of treatment of art initiation . The who clinical stages 3 - 4, hemoglobin level <10 gm / dl, and past tb coinfection treatment the findings have practical implications for managing hiv - infected patients in resource - limited settings . The high early mortality in patients with advanced disease implies the need for starting treatment earlier . The majority of deaths occurring during the first three months might be due to the fact that large proportion (54.3%) of the cohort in our study was found to start art with who stages 3 and 4 . The pattern of mortality observed in our cohort is consistent with findings from other resource - poor settings . In arba minch hospital patients, mortality in the first year of follow - up was 15.4/100 person - years and most of deaths occurred within first three months . The incidence mortality rate of 3.8/100 person - years in our cohort is comparable to arbaminch hospital cohort in the first year . In tanzan, a regular decline in mortality from 35.7 during pretreatment follow - up to 17.5 per 100 person - years during the first month of treatment is reported . Another similar study conducted by johannessen et al . Estimated mortality was 19.2, 24.5, and 29.0% with respect to at 3, 6, and 12 months, respectively, with the majority of deaths occurring within three months of starting art . These findings are similar to what has been reported elsewhere [11, 12]. Patients with severe anemia had nearly 6 times higher risk of dying during the first year on art compared to those with a normal hemoglobin level (ahr = 5.54, 95% ci (2.58, 11.86)). Several studies from africa and ethiopia have shown that anemia is an independent predictor of mortality in patients on art, even after controlling for cd4 cell count . Recently, studies from developing countries have found the same association [10, 12, 13]. Indeed, study conducted in tanzania shows anemia as a strong predictor of mortality; patients with severe anemia had nearly 15 times higher risk of dying during the first year on art as compared to those with a normal hemoglobin level . Another study conducted in cameroon indicated that patients with hemoglobin 8.5 g / dl had two times more risk of death than those with hemoglobin level 8.5 g / dl . As shown by others, we found that the who clinical stage was an independent marker of mortality in patients treated with haart [12, 14]. Compared to anemia, the who stage was a stronger predictor of death in the first month of treatment . While the ultimate goal should be to treat patients before they progress to such advanced stages, doctors in new settings will continue to treat such patients because of poor testing practices in africa . Therefore, careful documentation of the patient's disease stage will be helpful in identifying patients who need more intense follow - up . Improving the counseling and testing practices should be viewed as a more sustainable strategy . A study conducted in arba minch and malawi who clinical stage 4 was important predictor of death [8, 12, 16, 17]. Koenig et al . Found that patients with aids who receive a diagnosis of tb during the first months after art initiation had a mortality rate of 27%, which was 3 times higher than that among other patients ., patients who delayed art greater than 6 months after tb diagnosis had higher mortality rate than those who initiated art less than 6 months after tb diagnosis . Study conducted in durame hospital, ethiopia, showed that patient with positive tb test had 3.9 times more risk than others . Our study also showed similar result; patients having past tb coinfection had 6.5 times more risk than the referent group . We believe that the delay in diagnosis and treatment and not giving tb prophylaxis contributed to the higher mortality . Bmi is described as important prognostic markers either independently or in combination with the tlc both in untreated and in treated patients [8, 16, 17, 19]. <16 kg / m) had six times higher risk of dying than relatively nourished patients . Another study conducted in cameroon showed that bmi <15 kg / m had three times higher risk of death than bmi> 18.5 the rate was two times higher for patients who began art with a severe immune - depression cd4 <50 cells/ . This was comparable to what was reported in study done in tanzania by johannessen et al . . Study conducted in durban, south africa, indicates that cd4 cell count <50 cell/l was the most predictor of mortality in hiv patients after they started art . Our study findings didn't show any association difference which could be due to smaller sample we had in this study but majority of the study participants started art with cd4> 50 cell/l . This study showed that the incidence of death was 3.8/100 person - years with the majority of deaths occurring within 3 months of art initiation . We found a very high mortality rate in this cohort especially during the three months of treatment . The factors associated with survival were who stage, basic haemoglobin, tb coinfection, and anemia . Our study, while confirming the clinical benefit of art, raises the challenge of earlier and timely access to art and that of maintaining this clinical benefit over time . This highlights the need for identifying and treating patients early through improved counseling and testing strategies.
Nonalcoholic fatty liver disease (nafld) is one of the most common chronic liver diseases in the worldwide and it is associated with chronic diseases such as diabetes and heart disease . Nafld is associated with insulin resistance and is defined as fat accumulation in liver, exceeding 5% of liver weight, in the absence of ethanol intake> 10 g / day . The first one is about the development of insulin resistance that explains the effect of insulin resistance in nafld . The second theory is increased inflammation which can lead to nafld . In a study conducted in japan, a significant relationship was observed between the level of serum c - reactive protein (crp) and risk of nafld . However, in another study, no significant correlation was seen between serum crp and nafld . Vitamin d is a fat - soluble vitamin that exists in a number of food products such as oils and dairy products . Vitamin d is traditionally known as a regulator of calcium and phosphorus metabolism, but in recent years a significant relationship has been observed between serum levels of vitamin d and risk of chronic diseases such as diabetes and cardiovascular diseases . Vitamin d receptors are present in more than 38 tissues and its receptors affect genes controlling oxidative stress and inflammation . There are several lines of evidence demonstrate an association between vitamin d and liver disease . However, in several studies, there were no association between vitamin d concentration and severity of fatty liver . The effect of vitamin d on its receptor in these cells regulates and balances the inflammation and oxidative stress . Moreover, several studies have confirmed the relationship between serum vitamin d levels and inflammation . Due to the role of inflammation in nafld, hence, the purpose of this study was to investigate the effect of vitamin d supplementation on inflammation in patients with nafld . A randomized double - blind placebo - controlled clinical trial was conducted on 60 patients (30 - 70 years) with nafld . Samples were calculated with a confidence interval of 95% and 80% power of the test by below formula (s = 1.7, d = 0.7). This study was conducted in metabolic liver disease research center in isfahan university of medical sciences, isfahan, iran . The study was performed with the approval of isfahan university of medical sciences local ethics committee . Exclusion criteria in our study were defined as acute illnesses, chronic kidney disease, hyperparathyroidism, hypoparathyroidism, chronic heart failure, hepatitis c or hepatitis b, wilson syndrome, history of chronic liver diseases, or disorders that affect gallbladder and bile ducts, pregnancy or history of taking any drugs affecting levels of alt including (valproic acid, tamoxifen, 3-hydroxy-3-methylglutaryl - coenzyme a reductase inhibitors, metformin, angiotensin - converting enzyme 1 and angiotensin - converting enzyme - related 1). Subjects should not intake oral vitamin d / calcium / multivitamin supplementation in the previous study . Participants were divided into two groups using permuted block randomization: (a) 30 patients in vitamin d group (capsules containing 50,000 iu vitamin d), (b) 30 patient in the placebo group . Intervention period followed for 10 weeks and patients received vitamin supplements or placebo capsules every week . To evaluate the acceptability of vitamin d supplementation, serum 25-hydroxy vitamin d level was measured at the beginning and end of the study . Dietary records were collected every 2 weeks, and intakes were determined based on estimated values in household measurements . To obtain nutrient intakes of participants on the basis of these 5-d food diaries, nutritionist iv software (version 7.0; n - squared computing, salam, or, usa), which was modified for iranian food items were used . Physical activity levels estimated as metabolic equivalent of task hours per week (met - hr / wk). Met - hr / wk for each exercise program calculated (days per week hours of exercise each time met equivalent of exercise) and summed of all met - min / wk values for each patient evaluated . Height and body weight were measured while the subjects were in a standing position at baseline and 10 week . 25-hydroxy vitamin d was assessed by using a commercial elisa kit (immuno diagnostic systems). At the beginning and the end of the study . Ast and alt serum levels were measured through enzymatic photometric method (ifcc) with a sensitivity of 2 u / l and a coefficient of variation of 14% (alt, ast, and alkaline phosphatase (alp) were measured by commercially available enzymatic reagents (pars azmoon) on a bt-3000 (biotechinica) autoanalyzer . Crp serum was measured by high - sensitivity enzyme (test pars tehran, tehran, iran). Level of liver esteatosis was assessed by using ultrasonography with esaote medical ultrasound machine (convex 3.5 mhz) at the beginning and the end of the study . Us performed by the same expert radiologist with the same instrument in the begging and the end study . Hepatic ultrasonography was conducted by someone who is unaware of the objectives of the study . Patients for ultrasound should be fasting for 8 h. ultrasonography is performed in the supine position . Echogenicity the liver, the presence or absence of bulky tumors cystic or solid and calcification was assessed . Independent - samples student's t - test was used to detect differences in general characteristics and dietary intakes between two groups . In this analysis chi - square test for comparison the grades of fatty liver between two groups of placebo and intervention used and paired t - test used to assess the within group comparison of quantitative variables . All statistical analyses conducted using statistical package for the social sciences (spss), version 16 (spss inc ., chicago, usa). A randomized double - blind placebo - controlled clinical trial was conducted on 60 patients (30 - 70 years) with nafld . Samples were calculated with a confidence interval of 95% and 80% power of the test by below formula (s = 1.7, d = 0.7). This study was conducted in metabolic liver disease research center in isfahan university of medical sciences, isfahan, iran . The study was performed with the approval of isfahan university of medical sciences local ethics committee . Exclusion criteria in our study were defined as acute illnesses, chronic kidney disease, hyperparathyroidism, hypoparathyroidism, chronic heart failure, hepatitis c or hepatitis b, wilson syndrome, history of chronic liver diseases, or disorders that affect gallbladder and bile ducts, pregnancy or history of taking any drugs affecting levels of alt including (valproic acid, tamoxifen, 3-hydroxy-3-methylglutaryl - coenzyme a reductase inhibitors, metformin, angiotensin - converting enzyme 1 and angiotensin - converting enzyme - related 1). Subjects should not intake oral vitamin d / calcium / multivitamin supplementation in the previous study . Participants were divided into two groups using permuted block randomization: (a) 30 patients in vitamin d group (capsules containing 50,000 iu vitamin d), (b) 30 patient in the placebo group . Intervention period followed for 10 weeks and patients received vitamin supplements or placebo capsules every week . To evaluate the acceptability of vitamin d supplementation, serum 25-hydroxy vitamin d level was measured at the beginning and end of the study . Dietary records were collected every 2 weeks, and intakes were determined based on estimated values in household measurements . To obtain nutrient intakes of participants on the basis of these 5-d food diaries, nutritionist iv software (version 7.0; n - squared computing, salam, or, usa), which was modified for iranian food items were used . Physical activity levels estimated as metabolic equivalent of task hours per week (met - hr / wk). Met - hr / wk for each exercise program calculated (days per week hours of exercise each time met equivalent of exercise) and summed of all met - min / wk values for each patient evaluated . Height and body weight were measured while the subjects were in a standing position at baseline and 10 week . 25-hydroxy vitamin d was assessed by using a commercial elisa kit (immuno diagnostic systems). At the beginning and the end of the study . Ast and alt serum levels were measured through enzymatic photometric method (ifcc) with a sensitivity of 2 u / l and a coefficient of variation of 14% (alt, ast, and alkaline phosphatase (alp) were measured by commercially available enzymatic reagents (pars azmoon) on a bt-3000 (biotechinica) autoanalyzer . Crp serum was measured by high - sensitivity enzyme (test pars tehran, tehran, iran). Level of liver esteatosis was assessed by using ultrasonography with esaote medical ultrasound machine (convex 3.5 mhz) at the beginning and the end of the study . Us performed by the same expert radiologist with the same instrument in the begging and the end study . Hepatic ultrasonography was conducted by someone who is unaware of the objectives of the study . Patients for ultrasound should be fasting for 8 h. ultrasonography is performed in the supine position . Echogenicity the liver, the presence or absence of bulky tumors cystic or solid and calcification was assessed . Normality of studied variables was evaluated using kolmogorov smirnovtest or probability - probability plot . For nonnormal variables, independent - samples student's t - test was used to detect differences in general characteristics and dietary intakes between two groups . In this analysis chi - square test for comparison the grades of fatty liver between two groups of placebo and intervention used and paired t - test used to assess the within group comparison of quantitative variables . All statistical analyses conducted using statistical package for the social sciences (spss), version 16 (spss inc ., chicago, usa). The study flow chart shows the screening, randomization and follow - up of the participants [figure 1]. In this study, 29 men and 31 women participated . Data shows that 23.6% and 10.9% of our subjects have abnormal alt and ast levels at baseline, respectively . Compliance with the treatments was good in both groups and no side - effects were presented . On the basis of 5-d dietary intake and physical activity records, no significant differences were seen between the two groups [table 3]. The comparison of subclinical characteristics at baseline and after intervention of study adjusted changes in metabolic variables in nafld who received either vitamin d supplements or placebo fatty liver grades in nafld who received either vitamin d supplements or placebo dietary intakes and physical activity of nafld who received either vitamin d supplements or placebo throughout the study vitamin d supplementation resulted in an increase of serum 25(oh) d concentrations in inter group (p <0.05) and intra - group (p <0.05). At the end of study, in the intervention group, tg and crp reduced significantly compare with baseline (p <0.05). A significant increase was seen in calcium serum in the intervention group in comparison with baseline (p <0.05) and compared with the placebo group (p <0.05). After adjusting for baseline values, levels of alt, ast, tg and crp were reduced in the intervention group in comparison with the placebo group, but these changes were not significant between two groups after intervention . This study was the first one that investigated the effect of vitamin d supplementation on inflammation in patients with nafld . In this study, vitamin d supplementation did not reduce inflammation in patients with nafld in the intervention group compared with the control group . In addition, vitamin d supplementation did not significant effect on serum tg levels and liver enzymes . Several studies have shown significant relationship between low serum vitamin d and increase inflammatory markers . In a study conducted by grossmann et al ., 12 weeks of vitamin d supplementation caused a significant decrease in the levels of inflammatory factors in patients with cystic fibrosis . In another study on 328 african - american patients, vitamin d supplementation significantly decreased systemic inflammation in these patients . In another study, the effect of vitamin d supplementation was investigated on inflammatory markers in patients with type 2 diabetes . In this study, vitamin d supplementation significantly decreases systemic inflammation and crp concentration in patients with type 2 diabetes . However, in several studies, vitamin d supplementation had no effect on systemic inflammation and crp . Vitamin d affects through receptors on these organs and regulates pro - inflammatory and systemic inflammation in the body . In addition, vitamin d with binding to its receptors in monocytes can reduce pro - inflammatory cytokines . The first one was use of ultrasound method for diagnosis of fatty liver disease, while for accurate diagnosis of fatty liver, liver biopsy should be used . The second limitation was a small sample size of participants, especially in grades one and three . Vitamin d supplementation had no effect on crp and other variables in the intervention group compared with the placebo group . Further studies with strong design and more sample must conduct to demonstrate the effect of vitamin d supplementation on inflammation in patients with nafld.
Various studies have investigated the role of human papillomavirus (hpv) in oral squamous cells carcinoma (oscc) but the results are highly controversial . Most reports have shown that hpv 16 is the most prevalent type in both oral and genital tumors1 . Abnormalities in several components of the cell - cycle regulatory machinery have been observed in oral cancers as well as in other types of cancer . Protein p21 is a universal inhibitor of cyclin - dependent kinases (cdks) that mediates cell cycle arrest in the g1 and g2/m phase to prevent dna replication in cells in which this molecule is damaged . When cells are stimulated by growth factors, this protein is inactivated by phosphorylation and cells progress from the g1 to the s phase . The hyperphosphorylated form of prb releases e2f transcription factors which, in turn, activate the transcription of various target genes17 . In view of the importance of hpv in carcinogenesis, the objective of this study was to investigate the presence of hpv dna and the most frequent viral types in patients with oscc, and to compare the immunohistochemical expression of the cell - cycle proteins p21 and prb between hpv - positive and hpv - negative cases in order to establish a possible correlation between the expression of these proteins and hpv infection in oscc . Thirty - three cases of oscc were retrieved from the 1996 - 2004 pathology service archives of the department of dentistry of the federal university of rio grande do norte and hospital dr . Eligible cases were males or females aged 30 years or older (mean age= 65.45 years; range= 30 - 93 years) with newly diagnosed, histologically confirmed oscc and not submitted to any kind of therapy (chemotherapy, radiotherapy or surgery). Topographic locations included malignancies of the tongue, gingiva, floor of mouth, palate, buccal mucosa, retromolar area and lip . The presence of hpv dna and immunohistochemical expression of proteins p21 and prb were studied in specimens fixed in formalin and embedded in paraffin . Ten 10-m histological sections were used for the study of hpv, two 3-m sections were stained with hematoxylin and eosin for histopathological analysis, and two 3-m sections were submitted to immunohistochemistry . This method was developed by the research team of the laboratory of molecular biology of the dental school of the university of so paulo (usp)10 and consisted of the initial removal of paraffin by baths in xylene heated to 65c followed by hydration of the tissues in a decreasing ethanol series (absolute, 95%, 70% and 50%). Then, 400 l sterile lysis buffer (50 mm nacl, 5 mm tris - hcl, ph 8, 12.5 mm edta, ph 8, and 0.25% sds) and proteinase k at a final concentration of 500 g / ml were added to the tissue pellet of each sample and the samples were incubated at 55c for 3 to 5 days until complete dissolution of the material . Next, 200 l of a 4 m ammonium acetate solution were added to each sample for protein precipitation, followed by 600 l 100% isopropanol for dna precipitation . Finally, the dna pellets obtained were washed with 70% ethanol, dissolved in 50 l te buffer and stored at -20c . The samples were submitted to polymerase chain reaction (pcr) to evaluate the efficacy of dna extraction . For this, a pair of primers designated pco3 + (5'cttctgacacaactgtgttcactagc3') and pco4 + (5'tcaccgcaac ttcatccacgttcacc3') was used which flank a 110-bp sequence of the human b - globin gene present in all human cells12 . The reaction was carried out in an eppendorf thermocycler (eppendorf, netherler, hamburg, germany). Samples positive for the -globin gene were analyzed by pcr regarding the presence of hpv dna using a pair of generic primers called gp5 + (5'tttgttactgtggtagatactac3') and gp6 + (5'gaaaaata aactgtaaatcat attc3')11, which flank a fragment of about 140 bp of the l1 gene, a highly conserved sequence in the genome of mucosal (genital and oral) hpvs . The use of this primer pair permits the detection and amplification of this dna segment from at least 23 individual mucosal (genital and oral) hpv types, including high risk hpv types . The reaction mixture contained 1.0 m gp5+/gp6 + (invitrogen, life technologies, carlsbad, california), 1.0 u taq dna polymerase (biosystems, new jersey, usa), 20 mm tris - hcl, ph 8.4, 50 mm kcl, 1.5 mm mgcl2, 200 m dntp (amersham bioscience, bucknghamshire, uk), and 0.7 to 7.0 l dna, in a final volume of 50 l . The pcr conditions for detection of hpv were: initial denaturation at 95c for 5 min, followed by 40 cycles of amplification at 95c for 1 min, 45c for 2 min and 72c for 1.5 min, and a final extension step at 72c for 10 min . Each dot blot membrane included several negative and positive controls for hpv types, as well as pcr products from patients and controls . The membrane was hybridized overnight as 56c in 2x standard saline citrate (ssc), 0.5% sodium dodecylsulfatte (sds) and 200 g / ml dna with 19 hpv types probes (6,11, 16, 18, 31, 33, 34, 35, 39, 40, 42, 43, 44, 45, 51, 52, 54, 56, 58), most common in mucosal (genital and oral), and label [p]datp . After hybridization, the unbound probe was of 2x ssc and 0.5% sds at room temperature and two 10-min washes of the same solution at 56 c. the membrane was exposed to x - ray film at -20 c for 24 h. for immunohistochemical analysis, the sections were dewaxed in xylene, rehydrated in decreasing ethanol series, and rinsed in water . In order to inhibit endogenous peroxidade activity, the sections were treated by immersion in 5 changes of 0.3% h2o2 in absolute methanol (5 min each change) and rinsing in water . Immunohistochemical analysis was performed using the streptavidin - biotin technique (streptavidin - biotin complex, sabc; dako, carpinteria, usa). The reaction was incubated with monoclonal antibodies: rb-1 (dako) at a dilution 1:50 for 60 min, antigen retrieval by microwaves, 0.1 m ph 10 tris - edta for 10 min; waf1 (dako) at a dilution 1:50 for 20 min, antigen retrieval by steamer, ph 8 edta . Careful rinses were performed with several changes of pbs between each stage of the procedure . Louis, mo, usa), then counterstained lightly with mayer's hematoxylin, dehydrated in a graded ethanol series, allowed to dry in air and mounted with permount mounting medium (fisher scientific company, pittsburgh, pa, usa). For counting of labeled cells, representative areas of the tumor where staining was constant were selected . P21- and prb - positive cells were counted under a light microscope using a counting grid in an area of 0.25 mm at a final magnification of 1,000 to avoid recounting of the same histological fields . Each nucleus was counted as one unit and the number of positive cells for each case was obtained by the sum of labeled nuclei . A sample was considered to be positive for prb and p21 when at least 10% of the cells were stained . The results were analyzed statistically by the student's t - test, mann - whitney u - test and chi - square test, with the level of significance set at 95% (= 0.05). The research project was approved by the research ethics committee of the federal university of rio grande do norte (process #68/03). Of the 33 samples that were positive for the human -globin gene (figure 1a), hpv 16 and/or hpv 18 were detected in 11 (33.33%) (figure 1b). Hpv 18 was identified in 9 (81.81%) cases and hpv 16 and 18 were simultaneously present in 2 (18.19%) cases . Prb was expressed in 9/11 (81.82%) hpv - positive tumors and in 15/22 (68.19%) hpv - negative cases (figure 2a). Expression of p21 was observed in 5/11 (45.45%) hpv - positive tumors and in 7/22 (31.82%) hpv - negative tumors (figure 2b). Statistical analysis revealed a significant association between the presence of hpv and immunohistochemical expression of prb (p=0.044). With respect to the expression of protein p21, no significant association was observed between the expression of this protein and the presence of the virus (p=0.416). This study investigated paraffin - embedded oscc specimens for the presence of hpv by pcr . Hpv dna was detected in 11 (33.33%) of the 33 oscc cases evaluated . However, it is extremely difficult to compare the results of different reports on hpv in the oral mucosa because of variations in parameters, such as type of sample (tissue extracted by biopsy, scraping), preparation method (fresh, frozen or fixed), ethnic difference between patients, geographic differences, and sensitivity of the methods used . Iftner, et al.7 have also reported that differences in dna extraction procedures and in transport and storage of the clinical samples, and especially the use of different dna polymerases for pcr, may affect the performance of the assays . The most widely used primers are the generic primer pairs gp5+/gp6 + and my09/my11, which are able to amplify various virus types . In the present study, we used the gp5+/gp6 + primer pair because, in addition to detecting a variety of virus types, it amplifies a small fragment (140 bp). This fact is important when evaluating archived paraffin - embedded tissue, as done in the present study, which may show marked dna fragmentation in some cases . In the present study, only hpv 16 and hpv 18 were detected, which is in agreement with the findings of previous studies3,5,8,10,20 . Hpv 18 was present alone in most cases (9/11, 81.81%) and was detected together with hpv 16 in 2 (18.19%) of the 11 cases . These results agree with those reported by other investigators who detected hpv 18 in most of their samples3,20 . However, hpv 16 was the most frequent type in other studies2,57 . In view of the complexity of the biological behavior of malignant tumors, knowledge of the abnormalities that compromise the study of regulatory proteins, such as p21 and prb, may help identifying malignant tumors in amore accurate manner . In the present study, expression of p21 was detected in 5 (45%) of the 11 hpv - positive tumors and in 7 (31.8%) of the 22 hpv - negative tumors, with no significant difference between groups . These findings suggest that the presence of hpv is not sufficient to evaluate the relationship between viral proteins and cell - cycle regulatory proteins such as p21 . Another important cell - cycle regulatory protein is prb, which also shows an important relationship with hpv . Viral oncoprotein e7 plays a relevant role in tumor progression by binding to protein prb, thus releasing transcription factor e2f which, in turn, activates the transcription of genes that promote cell - cycle progression and cell proliferation as cited earlier4 . In the present study, a significant difference in the immunohistochemical expression of prb was observed between hpv - positive (9/11, 81.8%) and hpv - negative tumors (15/22, 68.2%). Lim, et al.7 examined the alterations of molecules within the prb pathway by looking at the presence of homozygous deletions in p16(ink4a) and the expression patterns of prb, cyclin d1 and cdk4, as well as the presence of hpv . Prb overexpression was found in 20/20 samples, the expression was mainly observed in all layers of the epithelia, particularly in the basal layer where cells are actively dividing, and aberrant prb expression was found in 12/20 samples . Strikingly, hpv was present in all samples, suggesting that it plays a significant role in driving oral carcinogenesis . Notably, 17/20 of the samples showed more than one alteration in the prb pathway . However, lim, et al.7 did not find any significant relationship between the presence of hpv, homozygous deletion of p16(ink4a) and overexpression of prb, cyclin d1 and cdk4 . Taken together, these data demonstrate that alterations in the prb pathway are a common event and involve the aberration of more than one molecule within the pathway . Furthermore, the presence of hpv in all samples suggests that hpv infection may play an important role in oral carcinogenesis . Nevertheless, nemes, et al.9 found no significant difference in the immunohistochemical expression of prb when comparing carcinoma groups with and without hpv . 19, evaluating cases of colorectal cancer, observed that the increase in prb levels was associated with the hyperphosphorylated form of the protein (inactive form). However, xu, et al.18 stated that antibodies against prb label both the phosphorylated and non - phosphorylated form of the protein . The present results regarding the immunohistochemical expression of prb suggest a higher possibility of hpv infection in oscc cases presenting higher prb expression, and that binding of hpv protein e7 to prb is likely to induce the accumulation of the latter, thus leading to its inactive form . In the present study, hpv dna was detected in a low percentage of oscc cases (33.33%), suggesting that hpv plays a key role in the development and progression of only a small subgroup of these carcinomas . Hpv 18 was the most prevalent type, suggesting that this viral type was specifically related to the development of oscc in the studied sample . The immunohistochemical expression of protein prb was significantly higher in hpv - positive oscc than in hpv - negative tumors, this finding indicating an important relationship between the virus and prb in these tumors . No difference in the immunohistochemical expression of p21 was observed between hpv - positive and hpv - negative oscc cases . It is likely that hpv infection and immunohistochemical expression of p21 represent independent factors in these tumors.
To analyze nvt penicillin - nonsusceptible pneumococcus (pnsp) detected in patients with invasive pneumococcal disease, we used data from the active bacterial core surveillance (abcs) system, a population- and laboratory - based collaborative system between the centers for disease control and prevention and state health departments and academic institutions in 10 states (california, colorado, connecticut, georgia, maryland, minnesota, new mexico, new york, oregon, and tennessee). We considered pnsp non - pcv13 serotypes detected in patients in all age groups from 2009 (pre - pcv13, n = 285 patients) through 2012 (post - pcv13, 339 patients). Nonsusceptibility was based on the meningitis breakpoint (mic> 0.12 g / ml), as recommended by the clinical and laboratory standards institute (10). / c were grouped together as 15bc because of the reported reversible switching between the 2 serotypes, which makes the precise differentiation of these serotypes difficult (11). To determine whether geographic differences in the proportions of pnsp were consistent across serotypes, we calculated the proportions of pnsp for each of the 7 most common nvt serotypes (15a, 15bc, 16f, 23a, 23b, 33f, and 35b) across the 10 sites for 2009 and 2012 . We found that serotypes with the highest proportions of pnsp in 2012 already had high resistance in 2009 (figure 1). We calculated the spearman correlation coefficient between the proportion of pnsp for each pair of serotypes across states in 2009 (range 0.09 to 0.66) and 2012 (range 0.300.79) (technical appendix). We found significant overall correlation in 2009 and 2012 (p<0.001 for both years), indicating that sites with high proportions of pnsp in 1 serotype typically will also have high proportions of pnsp in other serotypes . This finding suggests that differences in selection pressure account for the geographic variation in the proportions of pnsp . Comparison of proportion of nonvaccine type serotypes with penicillin resistance, by serotype, united states, 2009 and 2012 . Based on active bacterial core surveillance system data from 10 us states . We next implemented a standardized regression approach, used previously to analyze the pneumococcal - resistance patterns pre - pcv7 (7) and post - pcv7 (8) (technical appendix). To investigate the source of geographic variation in the proportion of pnsp, we tested the hypotheses that either geographic heterogeneity in serotype distribution (std1), or serotype - specific differences in penicillin resistance (std2) were responsible for the observed variation . These effects were quantified by regressing crude versus standardized prevalence of penicillin resistance (figure 2; technical appendix), by which a regression slope of 1 would indicate that the factor considered had zero effect . By using 2009 data, we found that regression slopes for std1 (0.445, 95% ci 0.083 to 0.972) and std2 (0.463, 95% ci 0.013 to 0.939) indicate that both factors played a similar intermediate role in generating this geographic variation in penicillin resistance, with neither 95% ci containing 1 . In 2012, the regression coefficient for std2 was higher (0.634, 95% ci 0.141.128), whereas the coefficient for std1 decreased (0.367, 95% ci 0.025 to 0.758). Although these changes are not statistically significant relative to 2009, they might suggest shifting contributions to the observed variation in proportions of pnsp after the introduction of the pcv13 vaccine in 2010, with geographic differences in serotype distribution having an increased role and differences in serotype - specific pnsp becoming less important . Crude versus standardized proportions of nonvaccine type serotypes with penicillin nonsusceptibility, by state, united states, 2009 and 2012, based on active bacterial core surveillance system data from 10 us states . Regression slopes with 95% cis are indicated in the upper left corner of each panel . Dashed lines represent the inverse - variance weighted (red) and unweighted (gray) regression slopes . Finally, we sought to quantify the rate of change in penicillin resistance during 20092012 in each state . We documented the proportion of pnsp by state for the pre- and post - pcv13 periods (technical appendix table 4). New mexico, maryland, and georgia saw the highest increases in the proportion of pnsp during 20092012, whereas a slight decline was observed for colorado, new york, and connecticut . Although the distribution of serotypes might greatly fluctuate among geographic regions immediately after vaccine introduction, the overall proportions of nvt serotypes with penicillin resistance across the country might not vary significantly between the pre- and post - vaccine periods . Of potential importance are the small increases in the proportions of pnsp serotypes not included in either vaccine that were observed between the implementation of pcv7 and pcv13 (12), which might lay the foundation for changes post - pcv13 . The marked variation in the proportion of penicillin resistance among states highlights the potential of local selective pressures to favor certain serotypes and resistant strains within each serotype to increase in frequency as the population returns to equilibrium (13). Previous studies have already shown significant regional differences in antibiotic use and vaccination coverage across the united states (14,15). A combination of these factors, which will likely vary between and within regions, would greatly affect proportions of resistance across the country . In our study, we observed that the dynamics of penicillin resistance continue to shift in the wake of vaccine introduction . Our postvaccine observations were recorded shortly after the introduction of the vaccine; additional observations would be valuable to determine the stability of the postvaccine dynamics and any potential importance of the temporal changes we observed to factors contributing to variation in resistance levels . Further long - term nationwide surveillance of serotype dynamics is required to assess the multiple ecologic factors that influence antibiotic resistance in the pneumococcus in the conjugate vaccine era . Methods and additional results for a study assessing penicillin resistance of nonvaccine type pneumococcus before and after pcv13 introduction, united states.
Overweight and obesity are pandemic conditions associated to increased risk for type 2 diabetes, cardiovascular disease, cancer and all cause - mortality [2, 3], and a dramatic increase in public health expense to their management [4, 5]. Mediterranean diet seems to be a model to preserve a good health, especially when followed for the life - span . However, the large amount of carbohydrate included in the modern mediterranean diet could be not adequately metabolized in strongly sedentary people and favor body weight increase . Several randomized clinical trials carried out in specialized medical setting have clearly shown that a short - term ketogenic diet could be useful to obtain a quick and relatively safe weight loss in selected patients [7, 8]. Moreover, the efficacy on body weight loss seems to be associated to a large number of positive metabolic changes, potentially useful to mitigate the features of the metabolic syndrome and contrasting the development of type 2 diabetes [9, 10]. In particular, a recent meta - analysis of randomized clinical trials, showed that ketogenic diets induce a long - term more significant improvement in body weight, diastolic blood pressure, triglycerides and hdl - cholesterol, when compared to low fat diets . However, there are no many studies testing if this approach could be useful, feasible and safe also in a setting of general medicine . This scientific question is of primary relevance, given the large prevalence of obesity in general population, that could not be managed in a hospital setting . In this context, the aim of our study was to evaluate the efficacy and tolerability of a ketogenic diet suggested and monitored in the setting of general practice, in term of long and mid - term weight loss and modification of the main cardiovascular (cv) disease risk factors . General practitioners, well acquainted with vlck diets methods selected by a senior physician already expert in the tested method, after a further specific training, have carried out this observational study . The selected patients met the following inclusion requirements: they are aged between 3069 years, have a bmi between 2737 kg / m and an abdominal circumference of 98 cm or more for men and 87 cm or more for women . The exclusion from this study occurred in case of renal impairment (i.e. Creatinine greater or equal to than 1.5 mg / dl), major depressive with eating disorders, serious hepatic impairment, insulin - dependent type 1 diabetes, oral anticoagulant treatment . Furthermore, patients with an ongoing anti - cancer treatment as well as pregnant or breast - feeding women were not taken into account . The 21.1% of the subjects was affected by arterial hypertension, the 10% by impaired fasting glucose; the 6.4% by type 2 diabetes, the 3.2% was in secondary prevention for cardiovascular diseases . The 12.2% had pharmacologically compensated hypothyroidism . After to have signed a specific informed consent form, eligible patients, at time zero, were subjected to a general medical examination and an evaluation of anthropometric and bio - humoral parameters . Thirty - seven general practitioners identified, in three months time, 377 eligible patients (m 21.2%, w 78.8%). Among them, 311 were selected, as they were the only participants to the first monitoring visit at 30 days . Sixty - six patients dropped - out for different reasons, but none of which of a clinical matter . The next monitoring visits were planned first after 3 months and then after 12 months . The enrolled patients have been subjected to vlck diet (as implemented by lignaform), a nutritional regimen is a vlck diet, based on the use of high biological level protein formulation of milk / egg / legumes origin (peas and no ogm soybeans), with a content of 1518 g in proteins, 26 g in carbohydrates, 3 g in fats for a caloric intake of 100 kcal . Our method is articulated in different stages: in the first step we provide a protein intake of 1.21.5 g / kg of ideal body weight, in association with low - glycemic index vegetables . Thus, it is a normal - protein regime compared to the ideal weight, but hyper - protein diet in relation to the others nutrients consumed . Afterwards, the formulations are replaced by natural protein foods and the diet is gradually completed with other aliments on the base of glycemic index following a multiphasic scheme . Then, only one formulation was replaced by a protein aliment (meat, fish, eggs) and vegetables (stage 2). Immediately after, another formulation was substituted with another protein food (conclusion of stage 2). Eventually, patients inserted, in sequential, fruit, dairy products, cereals and legumes (stages 3456). The last stage (stage 7) consisted in a re - education to the mediterranean diet based on patient s expenditure of energy . However, from the very beginning an integration of calcium, magnesium, potassium, omega 3 fatty acids (500 mg) and olive oil is necessary . The following variables have been measured with standardized methods or calculated at the baseline, at the monitoring visit at 30 days, then after 3 and 12 months: height, weight, body mass index (bmi), waist circumference (wc), index of central obesity (ico = ratio of waist circumference and height), impedentiometrically estimated fat mass, systolic (sbp), diastolic (dbp) and pulse pressure (pp), thyroid stimulating hormone (tsh), fasting plasma glucose (fpg), glycated haemoglobin (hba1c), total cholesterol (tc), ldl cholesterol (ldl - c), hdl cholesterol (hdl - c), triglycerides, liver transaminases, gamma - glutamyl transferase (ggt), creatinine, estimated glomerular filtration rate (egfr, ckd - epi formula), microalbuminuria, uric acid (sua), serum potassium, sodium, magnesium and calcium . Categorical parameters were compared by the chi - square test followed by the fisher exact test . Normally distributed parameters were compared with anova for paired and unpaired samples, followed by the student t - test, while not - normally distributed parameters with kruskal wallys analysis of variance followed by mann the predictor of a more significant weight loss were identified by the application of a logistic regression test . All the analyses were carried out with the help of spss 21.0, version for windows . The main characteristics of the enrolled patients are resumed in table 1 . Throughout the study, 82.5% of the patients involved in the study, completed the first 4 week period, 71.1% the first 12-week period, 52% continued the protocol until 12 months.table 1main anthropometric, haemodynamic and laboratory characteristics of the enrolled subjects at the baseline (value compared between genders)variablemenwomenage (years)48.3 10.9 * 45.6 9.9body weight (kg)97.5 10.8 * 81.9 10.4body mass index (kg / m)32.1 2.8 * 31.2 3.1waist circumference (cm)108.3 9.6 * 99.6 10.0index of central obesity0.62 0.050.61 0.06fat mass (%) 41.4 16.3 * 37.3 15.9systolic blood pressure (mmhg)132.5 14.2 * 128.0 15.1dyastolic blood pressure (mmhg)78.9 7.7 * 75.9 11.3pulse pressure (mmhg)53.5 12.852.1 14.6tsh (uui / ml)2.1 1.32.6 2.5fasting plasma glucose (mg / dl)104.6 21.8 * 95.7 27.0glycated haemoglobin (%) 5.5 0.95.5 0.8total cholesterol (mg / dl)215.6 35.4211.8 39.3hdl cholesterol (mg / dl)45.2 10.5 * 56.3 14.9ldl cholesterol (mg / dl)138.7 31.7132.9 36.1triglycerides (mg / dl)158.9 75.3 * 117.0 67.9ast (u / l)25.0 10.9 * 21.2 7.5alt (u / l)33.3 19.5 * 23.4 10.8gamma glutamyl transferase (u / l)32.6 16.9 * 23.2 17.4creatinine (mg / dl)0.93 0.15 * 0.80 0.15serum uric acid (mg / dl)5.6 1.2 * 4.5 1.2microalbuminuria (mg / l)10.3 7.2 * 8.9 9.3serum potassium (meq / l)4.9 1.84.3 1.3serum sodium (meq / l)139.4 3.8139.2 3.1serum magnesium (mg / dl)2.0 0.61.9 0.5serum calcium (mg / dl)8.9 1.28.9 1.2 * p <0,05, men vs. women main anthropometric, haemodynamic and laboratory characteristics of the enrolled subjects at the baseline (value compared between genders) * p <0,05, men vs. women all the measured anthropometric variables exhibited a similar trend . Body weight significantly improved from baseline to 4 weeks (7 5 kg, p <0.001), from 4 to 12 weeks (5 3 kg, p <0.001), while no changes were observed from 12 weeks to 12 months (1 2 kg, p = 0.06). Therefore, after 1 year the subjects experienced a mean total body weight loss of 14 10 kg . The bmi significantly improved from baseline to 4 weeks (3 2 kg / m, p <0.001), from 4 to 12 weeks (2 2 kg / m, p <0.001), while no changes were observed from 12 weeks to 12 months (0.2 0.9 therefore, after 1 year the subjects experienced a mean total body weight loss of 5 3 kg / m . The wc significantly improved from baseline to 4 weeks (7 4 cm, p <0.001), from 4 to 12 weeks (5 7 cm, p <0.001), while no significant changes were observed from 12 weeks to 12 months (0.2 1.1 cm, p = 0.68), so after 1 year the subjects experienced a mean total body weight loss of 13 7 cm . The ico improved from baseline to 4 weeks (0.04 0.02, p <0.001), from 4 to 12 weeks (0.03 0.04, p <0.001), while no significant changes were observed from 12 weeks to 12 months (0.01 0.04, p = 0.64). Therefore after 1 year the subjects experienced a mean total body weight loss of 0.8 0.4 . The estimated percentage of body fat significantly improved from baseline to 4 weeks (3.8 3.8%, p <0.001), from 4 to 12 weeks (3.4 3.5%, p <0.001), while no significant changes were observed from 12 weeks to 12 months (0.2 1.1 cm, p = 0.89), therefore after 1 year the subjects experienced a mean total body weight loss of 8.1 5.9% (fig . 1body weight, bmi, waist circumference, and estimated body fat mass changes during the different study phases body weight, bmi, waist circumference, and estimated body fat mass changes during the different study phases regarding the haemodynamic parameters, sbp significantly improved from baseline to 3 months (10.5 6.4 mmhg, p <0.001) but no changes were observed after 1 year of observation . A similar trend, has been noticed for dbp (2.2 3.1 mmhg, p <0.001) and pp (8.3 6.2 mmhg, p <0.001). Fpg significantly improved from baseline to 4 weeks (8.7 15.3 mg / dl, p <0.001) and no change were observed after 1 year of monitor . Similarly, hba1c improved from baseline to 3 months (0.3 0.7 mg / dl, p <0.001) and held steady after 1 year of observation . About lipid parameters, ldl - c significantly improved from baseline to 3 months (19.5 16.9 mg / dl, p <0.001) and we noticed no change after 1 year of observation . A similar trend has been observed for tg (23.4 30.2 mg / dl, p <0.001), while hdl - c improved from baseline to 4 weeks (+ 1.8 5.6 mg / dl, p = 0.038), and even more after 12 months (+ 3.5 3.3 mg / dl, p as regards the liver parameters, ast significantly improved from 1 to 3 months (2.2 3.2 u / l, p <0.001), and no other changes were marked after 1 year of observation . A similar trend has been observed for alt (3.1 5.3 u / l, p <0.001), while gamma - gt improved from baseline to 4 weeks (4.1 5.2 mg / dl, p <0.001), with no other significant changes after 1 year of observation . With reference to renal parameters, estimated glomerular filtration rate (egfr), creatinine level and microalbuminuria were not significantly modified during the observation period, while uricemia mildly but significantly improved from the 3rd month to the end of the study (0.4 1.5 mg / dl, p = 0.048). No significant change has been observed as regards serum level of potassium, sodium and magnesium . However calcemia mildly but significantly decreased from baseline to 30 days (0.35 0.82 mg / dl, p = 0.001), while it improved in the following period from 30 to 90 days (+ 0.21 0.71 mg / dl, p = 0.017). The short - term body weight loss was quicker in men than in women (p <0.05), greater in those subjects experiencing a ketonuria in the first period of diet (p <0.001), and was directly related to the baseline body weight (rr 1.10, 95% ci 1.041.16, p <0.001), and inversely to patient age (rr 0.20, 95% ci 0.27 to 0.15, p <0.001), while the long term body weight loss was greater in those subjects experiencing a ketonuria in the first period of diet (p <0.05), and was directly related to the baseline body weight (rr 1.26, 95% ci 1.271.18, p <0.001) and body fat mass (rr 1.17, 95% ci 1.011.33, p = 0.033). The international guidelines for cardiovascular disease prevention suggest, as a first step, the optimization of dietary habits in order to improve the cardiovascular disease risk [14, 15]. In our study, carried out in the setting of general practice, we observed that a short - term ketogenic diet is able to improve both on the short and long - term a large number of anthropometric, haemodynamic and metabolic parameters related to the cardiovascular disease risk . In particular we examined a significant improvement in body weight, bmi, wc, ico, estimated body fat, sbp, dbp, pp, fpg, hba1c, ldl - c, tg and hdl - c levels, that tend to remain stable after 1 year from the end of the short ketogenic period . The mild improvement of uricemia observed in the trial could also have some relevant prognostic implication . Our results, in terms of body weight and lipid control improvement, are in good agreement with previous short - term randomized clinical trials comparing the effect of high protein diets to standard protein nutritional regimes . A more recent meta - analysis of 17 randomized clinical trials involving 1141 obese patients confirmed our observation, showing that low - carb / high protein diets are also associated to a significant improvement of systolic and diastolic bp, basal glycaemia and hba1c . Beyond the low intake of carbohydrate, low - fat diets induce improvement in basal insulinemia depending on protein content in the diet itself, as high protein diets are associated to improved insulinemia, and consequently improved glucose metabolism . The long - term positive effects on body weight and other metabolic parameters observed in our study could be explained by the maintenance of a low - glycaemic index diet after the ketogenic hyperproteic period of the tested method . Thus, one can say that observed effects are related to the reduction of energy intake per se rather than the tested dietary method . Moreover, one can argue that the baseline characteristics of the enrolled patients were not homogenous as well as different physician ability to discuss the methods could have influenced the efficacy of the method itself . This can be understood looking at the goal we wanted to reach, that was to mimic real patients that a general practitioner usually cope with . However, at the best of our knowledge, this is the first report one can find in the literature of the efficacy and tolerability of a short - term ketogenic intervention on overweight and obese patients outside highly specialized centres, with a relatively long follow - up after intervention end . With the limitation of an observational study, in our experience a short - term ketogenic diet managed in the setting of general practice seemed to be able to improve a large number of anthropometric, haemodynamic and metabolic parameters related to the cardiovascular disease risk, with improvements maintained also on the long - term [23, 24].
Seizure is one of the most common problems in pediatric neurology which occurs in 4 - 10 percent of children in the first 16 years of life . A detailed and reliable account of the event by an eyewitness is the most important part of the diagnostic evaluation, but it may not often be available . Electroencephalography (eeg) is recommended in evaluation of a child with first seizure presentation and it is a useful diagnostic tool in diagnosis of seizure and differentiating it from seizure - like attacks . Eeg needs cooperation and immobility of the patient and in all children, apart from the age, recording in natural sleep is preferred to drug- induced one . But, in children who do not naturally sleep, pharmacological agents and procedural sedation should be used to induce it . Chloral hydrate is a non - opiate, non - benzodiazepines sedative - hypnotic drug which has been used for pediatric sedation induction in dosage of 40 - 100 mg / kg for years[36]. But, there are concerns about its long action duration, obstruction of airway and depression in respiration, desaturation of oxygen, sedative effects consistency and its potential for carcinogenicity . Promethazine is a cheap and easily available antiemetic agent which can be used for sedation induction as an old sedative agent[8, 9]. There has been no randomized trial to compare these two agents in drug - induced sleep eeg . So, the purpose of this study was to compare efficacy and safety of oral chloralhydrate (ch) and promethazine (pz) in sedation induction for sleep eeg of children in yazd, a central city in ir iran . We followed a randomized single - blind study on sixty referred children to eeg unit of shahid sadoughi hospital from january 2010 to february 2011 . Thirty children were required in clinical, open - label, parallel group study conducted on each group to detect a 20% difference in efficacy between the two drugs with type one error (alpha) of 0.05 and 80% power . Eligible participants included children aged 1 - 10 years, referred to eeg unit by a pediatric neurologist based on standard indications after a clinical assessment which was indicative of seizure or unclear spells or seizure - like events, didn't sleep naturally, and were classified as american society of anesthesiology (asa) class 1 (a normally healthy patient) or 2 (a patient with mild systemic disease: mild asthma, controlled diabetes mellitus). Exclusion criteria consisted of presence of gastritis or any other serious systemic diseases, severe systemic reaction and receiving a sedative or hypnotic agent within the past 48 hours . The trial used computer generated equal randomization and allocation ratio was 1:1 for the two groups . Randomisation was done by a computer generated random number list and blinding was done by employing an investigator with no clinical involvement in the trial . Data collectors, outcome assessors and data analysts were all kept blinded to the allocation but the interventionists (eeg staff). The trial adhered to established procedures to maintain separation between person who took outcome assessment and staff that delivered the intervention . The drug was delivered by eeg staff and primary and secondary outcomes were assessed by the resident of research who was not informed of the drug group assignment . Investigators, staff and participants were all kept masked to outcome measurements and trial results . The children were randomized to receive either single dose of 70 mg / kg chloral hydrate which was diluted in water (group i) or 1 mg / kg of promethazine dissolved in water (group ii). In both groups, the drugs were administered orally and before entering electroencephalography room . The sedation level was observed and recorded every 10 min . Ramsay sedation scale was used for assessment of sedation level . If the child was not sedated after 30 minutes of drug ingestion, the second dose of the drug, in half of the first one, was administered . Heart rate, blood pressure and respiratory rate were measured before and every 15 minutes after two hours of drug taking . Pulse oximetry was also done before and within two hours after the drug was taken . Secondary outcome included clinical side effects, serious adverse events (respiratory depression requiring assisted ventilation, cyanosis, hypoxia (oxygen saturation of less than 90%), hypotension or 25% or greater decrease in pre sedation mean arterial blood pressure, severe vomiting, intractable irritability and agitation, apnea, laryngospasm, bradycardia, time from administration of the drug to adequate sedation, caregiver's satisfaction on a likert scale (5 for completely satisfied, 4 for satisfied, 3 for partially satisfied, 2 for partially unsatisfied and 1 for completely unsatisfied), and total stay time in eeg unit . Any kind of clinical side effects were evaluated either by parents report or by physical examination within two hours after taking the drugs . Failure to achieve adequate sedation (patient awakened or moved, interfered with completion of eeg, inadequate sedation and need to administration of other sedative drug) and procedure abortion due to serious adverse events, were considered as failure of sedation regimen . The developmental status of the patient was assessed by a pediatric neurologist based on denver ii developmental screening test . Chi - square test or fisher exact test was used for data analysis of qualitative variables and mean values were compared using independent t - test . The study has been approved by the ethic committee of shahid sadoughi university of medical sciences, yazd, iran . The design and conduct of this trial was straightforward, and we did not have any exclusions or losses during follow - up . Twenty four girls (40%) and 36 boys (60%) with mean age of 2.91.9 years were evaluated . Comparison of demographic characteristics of the children is shown in table 1 which indicates that no statistically significant differences were seen from view point of sex distribution, developmental status, mean age and mean weight of children in both groups . Comparison of demographic characteristics of children in both groups with the first dose of the drugs, adequate sedation (ramsay sedation score of four) was obtained in 13 (43.3%) children in promethazine and in all of 30 (100%) children in ch group . Statistical analysis showed that chloral hydrate was a more effective drug in obtaining ramsay sedation score of four (p<0.001). In promethazine group, second dose of drug was used in 17 children, in eight of whom a ramsay sedation score of four was achieved . Eeg after adequate sedation was successfully recorded in 70% of pz group (95% confidence interval of 0.53 - 0.86) and in 96.7% of ch group (95% confidence interval of 0.91 - 1.18) and statistical analysis showed that ch was a more effective drug in induction of sleep for recording of electroencephalography (p=0.006). Table 2 shows comparison of mean values of some variables and indicates that in ch group higher ramsay score was obtained following the first dose of the drug, the ramsay sedation score four was obtained sooner, eeg was performed in shorter time after taking the drug and the parents waited less in the eeg unit and were more satisfied . Comparison of mean of some variables in two groups sd: standard deviation mild side effects such as vomiting in 20% (n = 6) of ch and agitation in 6.6% (n = 2) of promethazine group were seen . No statistically significant differences were seen from viewpoint of safety between the two drugs (p=0.1). No serious adverse events (apnea and respiratory depression that needed ventilator support, hypotension, etc) were seen in these two groups . Various drugs have been used for procedural sedation in children . In present study, efficacy and safety of oral chloral hydrate and promethazine in sedation induction for sleep eeg of children results of present study indicated that chloral hydrate was an effective drug for providing sedation in uncooperative children which is in agreement with other studies[4, 12, 13]. In this study, ramsay score of four was achieved with 70 mg / kg chloral hydrate, in all of 30 children in 96.7% of whom electroencephalography recording was done successfully and success rate in doing the procedure was similar to other studies[4, 14, 15]. However, the lowest success rate of chloral hydrate in sedation induction was 56% in fvero et al study and in other studies this rate varied between 62.5% and 100%[3, 15, 1719]. Possible explanation for these discrepancies is differences in dosage of the drug, race, sample size, type of procedure, medical condition of patients, etc . In present study, but, in fvero et al study, respiratory complications occurred in two of 41 children who got 50 mg / kg of chloral hydrate and in heistein et al study in texas, serious side effects occurred as apnea in 0.3%, airway obstruction in 1.4%, hypoxia in 5.9%, hypercarbia in 6.6% and hypotension in 0.4% of 1095 children who were sedated with chloral hydrate for echocardiography . In this study, the only adverse effect of chloral hydrate was vomiting that occurred in 20% of children . In ronchera - oms et al study in spain, 9.9% of 596 children who were sedated with chloral hydrate to undergo magnetic resonance imaging, faced side effects; the most common (1%) adverse effects were nausea, vomiting (6.9%), nervousness and unusual excitement . In heistein et al study, 10.8% showed adverse events most common of which were hypercarbia (6.6%) and hypoxia (5.9%) and minor complications occurred in 7.4% of pre - school children in roach et al study . In the present study, vomiting occurred in 20% of children who were sedated by chloral hydrate, while 0.4 percent of children in texas study and 30% in turkish study, had vomiting . In our study, electroencephalography recording was done successfully in 43.3% of children who were sedated by 1 mg / kg oral promethazine . Padmanabhan et al in india, found that combination of promethazine plus tramadol was more effective than promethazine plus ketamine in sedation of uncooperative children for dental treatment (69% vs 42%, p<0.001). In present study, agitation as the only side effect of promethazine occurred in 6.6% of children . Adenipekun et al compared complications of parenteral and/or oral promethazine, diazepam, chlorpromazine and paraldehyde in children sedation induction during radiotherapy, and found that complications occurred in 48% of children and the most common side effect was injection cellulitis in 85.3% . In a randomized double - blind crossover study in michigan, children who received 0.2 mg / kg intranasal midazolam had less decrease in systolic and diastolic blood pressure and slept less and recovered faster as compared to those who got 62.5 mg / kg ch with 12.5 mg promethazine . However, promethazine may be increased in eeg power spectra of the delta and theta bands at the frontal cortex in rats, but, eeg characteristic of children was not evaluated in present study . The limitations of this study were its small sample size and short duration of follow up . Therefore, it is suggested that further studies be conducted with larger sample size, longer follow up periods and different dosages of chloral hydrate . The results of present study showed that chloral hydrate was more effective and less time consuming in eeg unit . Therefore, chloral hydrate can be considered as a safe, cheap and effective drug in sedation induction for electroencephalo - graphy and may be used in other procedures (echocardiography, ct scan, mri, bone marrow aspiration, lumbar puncture) in children.
Hyperpigmentation of the gingiva has always been a concern to certain patients, especially young females . Although melanin pigmentation of the gingiva is completely benign and does not present a medical problem, its unaesthetic appearance as black gums is more pronounced in patients having a high smile line (gummy smile). Gummy smile can be due to incomplete passive eruption, maxillary protrusion, hyperactive muscle of lips, short lip, gingival enlargement, etc . Gingival depigmentation can also be performed by surgical blade, coarse diamond bur, electrosurgery, cryosurgery or lasers . Considering the advantages of lasers over other modalities of treatment, this article will focus on the management of such a case using gaalas diode lasers of 810 nm . A 22-year - old female patient was referred with a complaint of gummy smile and hyperpigmented gingiva [figure 1]. On examination, pseudopockets (approximately 23 mm) were detected in the maxillary and mandibular anteriors along with generalized excessive amount of melanin pigmentation on the gingiva [figure 2]. The patient was explained about the treatment options and informed that, after depigmentation, melanin pigmentation tends to recur and, as gingivectomy is also performed simultaneously, the overall appearance would be worth doing it . Profile view of gummy smile with hyper melanin pigmentation of the gingiva intraoral view of gummy smile with hyper melanin pigmentation of the gingiva gingivectomy and depigmentation were planned in the 1525 region and the 3444 region using a 810 nm diode laser . Although procedures like this can be performed under topical anesthesia, infiltration was planned as the patient was anxious and sensitive . Under infiltration anesthesia with 2% lignocaine (with 1:100,000 adrenaline), an 810 nm gaalas diode laser (picasso)(picasso, by amd lasers) was used in contact mode with the gingival tissues . E gel was prescribed for local application -three to four times a day for 2 days . Because a large area of the raw wound was kept exposed, antibiotic cap . Immediate postoperative view of gingivectomy and depigmentation using an 810 nm diode laser the patient reported no adverse effects or discomfort during the postoperative healing phase . She was happy and satisfied with 6-month postoperative results [figures 4 and 5]. Gingivectomy and depigmentation were planned in the 1525 region and the 3444 region using a 810 nm diode laser . Although procedures like this can be performed under topical anesthesia, infiltration was planned as the patient was anxious and sensitive . Under infiltration anesthesia with 2% lignocaine (with 1:100,000 adrenaline), an 810 nm gaalas diode laser (picasso)(picasso, by amd lasers) was used in contact mode with the gingival tissues . E gel was prescribed for local application -three to four times a day for 2 days . Because a large area of the raw wound was kept exposed, antibiotic cap . Immediate postoperative view of gingivectomy and depigmentation using an 810 nm diode laser the patient reported no adverse effects or discomfort during the postoperative healing phase . She was happy and satisfied with 6-month postoperative results [figures 4 and 5]. Diode laser is a versatile laser and has been successfully used at three wavelengths: 980 nm, 810 nm and, more recently, 940 nm . It has numerous soft tissue applications, viz frenectomy, crown lengthening, gingival depigmentation, troughing, etc . In a diode laser, the substance stimulated to produce a coherent light beam is a semiconductor . This technology has produced a laser that is compact and economic . A diode laser has become an important tool in the dental armamentarium due to its exceptional ease of use and affordability . The diode laser is well absorbed by melanin, hemoglobin and other chromophores that are present in periodontal disease . This provides the diode laser with broad clinical utility: it cuts precisely, coagulates, ablates and vaporizes the target tissue with much less trauma, improved postoperative healing and faster recovery time . Melanin pigmentation in gingiva is present only when melanin granules synthesized by melanocytes are transferred to the keratinocytes . Therefore, recurrence of the pigmentation is inevitable and has been reported from 24 h to 8 years following surgery . Conventional procedures for corrections of pigmented gingiva consist of surgical stripping with scalpel, use of electrosurgery, cryosurgery or a coarse diamond bur . However, the laser is the least - invasive and predictable method of performing this procedure . It has a high level of precision, requires minimal anesthesia and causes very low collateral tissue damage . Cases where only gingivectomy is required can be performed without anesthesia or under topical anesthesia, but because both gingivectomy and depigmentation were planned together in this patient and a significantly larger area needs to be operated upon, infiltration anesthesia was given . Given the incredible ease of use and its versatility in treating soft tissue, the diode laser becomes the patients with complaints of hyperpigmented gingiva should also be assessed for the presence of gummy smile . Once the amount of gingiva displayed is reduced by gingivectomy, the patient's concern for hyperpigmented gingiva will also reduce . As a result, in most of the cases, a repeat surgery for depigmentation
Charging of grains of identical insulating materials during collisions has been of considerable interest recently, both for its intrinsic physics and for its applications to situations ranging from volcanic dust plumes and desert sandstorms to industrial powder processing . However, work up to now has not explained why in some instances charging grows, rather than diminishes as one might naively expect, and can run away extremely rapidly, leading to electrical discharges: lightning . Outstanding examples of runaway collisional charging involve ice, in thunderstorms both on earth and on other planets, and, it is speculated, in the solar nebula; these instances concern granular media whose particles also undergo nucleation, growth, and fission, so that they, in effect, reproduce . In this work, we demonstrate with a minimal dynamical model that secondary nucleation, production of a new particle from an existing particle, is a key process in producing runaway electrical charging in self - replicating granular matter . We concomitantly present the results of experiments on growing ice in situ from the vapor phase within an environmental scanning electron microscope . We show that an effect of the electric field is to induce the formation of fast - growing ice palms intermediate in morphology between whiskers and dendrites; the ease of breakage of these palmlike formations will clearly favor secondary nucleation and hence runaway electrification . In a thousand seconds, more or less, its volume increases a thousandfold, the intensity of its electric fields increases a thousandfold, and its electric energy increases a billionfold; thus described vonnegut the tremendous metamorphosis a cumulus cloud undergoes to become a cumulonimbus or thundercloud . Thundercloud electrification is a consequence of ice particles colliding within a cloud and exchanging electrical charge . Charge dipole development in a thunderstorm is due to the physical separation of particles with opposite charges inside the cloud: larger, heavier particles will fall, while smaller, lighter particles will rise in the updraft, owing to their different dynamics, and these particles carry different charges . Usually, in thunderstorms, the smaller ice particle is an ice crystal and carries positive charge aloft in the updraft; the larger graupel ice particle falls with an opposite negative charge, leading to a typical thunderstorm . We may contrast the foregoing with charging in other granular media, where it has been argued that simple geometry, without growth and fission processes, leads to a net transfer of electrons from larger to smaller particles, so that smaller particles tend to charge negatively and larger ones positively . Whether this differential charging tendency operates one way or the other depends on the microphysics, which differs for different materials, so this polarity differs . For our present purposes, however, what is relevant is that there should exist such a triboelectric charging tendency in one sense or the other . Here we build a minimal model (figure 1) incorporating solely the collisional dynamics of charge transfer plus nucleation, growth, and fission processes, which we aim to have general relevance to self - replicating granular media . Anatomy of our minimal model of charging of friable self - replicating granular matter through secondary nucleation, incorporating the processes of particle growth (ri ri + 1), advection (with speed ui), collision, charge transfer, and fission (with probability s). We consider (figure 1) a one - dimensional system of length l, within which we place randomly n neutrally charged particles, qi = 0 for i = 1,..., n, of size ri extracted from a gaussian distribution of sizes with mean r = 1 and standard deviation . These particles grow at a constant rate, independent of particle size, that sets the time scale of the problem . At the same time, they sediment in an upward flow of constant magnitude at their terminal velocity, ui, determined by the instantaneous balance of fluid drag and gravitational forces . The sedimentation speed is normalized by the updraft speed (i.e., ui = 1 for passive tracers) and is approximated by a linear function of the particle size ri, ui = 1 (ri / rc). This function is positive (negative) for ri below (above) a critical value rc . The sedimentation speed of all particles in the simulation is updated every integration time step; in this way, small particles that are initially advected upward by the updraft slow their upward motion as they grow and begin moving downward after reaching the threshold rc . When the trajectories of two particles i and j cross, they collide . To overcome the 1d limitation of the model, we allow particles to get past one another after the collision, so that after each time step particles end up in whatever final position their velocities prescribe . Both mass and charge are conserved during a collision but, while charge is transferred in every collision (the smaller particle leaving the collision positively charged: qi qi + 1 and qj qj 1 with ri <rj), we assign a certain probability s for fission to occur for each of the two particles involved in a collision . If fission does occur for particle i, a new, neutrally charged particle with radius 1 splits from it, reducing its size to ri = ri 1 . Although fracture of particles has been shown to lead to additional charging, we left this effect out of the model for the sake of simplicity as it does not change qualitatively the presented results . Boundary conditions are absorbing: particles leaving the system through the upper or lower boundary are absorbed there, and do not participate further in the dynamics, but their charge accumulates to the total charge at the boundaries: qu(l) = qi for i leaving the system through the upper (lower) boundary, respectively . The total large - scale charge separation is calculated as q = qu ql . For given initial conditions (set completely by the concentration of particles, = n / l, and the initial spread of the size distribution,), the behavior of our minimal model then depends on just two parameters, the critical radius rc and the secondary nucleation rate s. in what follows, we set rc = 8, = 2 and = 0.1 and explore the behavior of the model with respect to the secondary nucleation rate s. we note that electric forces are not considered in the model but implicitly (through the secondary nucleation rate responsible for the process of fission). Figure 2 displays the typical transient dynamics of the charge distribution in the model . The figure shows an initial stage in the transient dynamics chosen to exemplify how the charge separation process operates in the model . As time passes, as indicated by black arrows, light positively charged particles move toward the upper boundary while heavy negatively charged ones move in the opposite direction, contributing to a non - negligible dipolar large scale charge separation q . Regions where localized collisions are produced generate large charges that are then separated by differential advection . Even at those early stages in the process, the global dipolar structure of the system, quantified by the large - scale charge difference between the boundaries q, is the dominant field . Figure 3 shows particle size and charge distributions for the upper and lower boundaries . As time passes, light positively charged particles move toward the upper boundary while heavy negatively charged ones move in the opposite direction, as indicated by arrows, contributing to a non - negligible large - scale dipolar charge distribution q . Particle size (rj) and charge (qj) distributions for the system upper boundary (left panels) and lower boundary (right panels). The total charge separation q at a finite time step (which is a measure of the speed of the charge - separation process) displays nonmonotonic discontinuous behavior as a function of the secondary nucleation rate s. below a critical value sc, the long - term dynamics reaches an emptying state with no particles left in the domain and a finite (and small) final charge separation; as there are few secondary nuclei, the initial particles grow and collide very little before leaving the system . Occasionally some charge is produced, but not much . Above sc, the number of collisions grows, and with it the charge transfer . As the charge acquired by the particles is correlated with their size, charge separation occurs too . The system approaches a steady state with an average nonzero number of particles in the domain and an exponentially divergent charge separation, as shown in the inset of figure 4 . This exponential charge growth is limited in nature by electrical discharges, lightning . The total charge separation q displays nonmonotonic behavior as a function of the secondary nucleation rate s. inset: time evolution of q for s = 0.1 shows the exponential growth characteristic of all values of s> sc . However, for secondary - nucleation rates much greater than sc, there are more and more collisions . The particles undergo more fission into secondary nuclei, and although much charge is produced, it does not separate as well; charge separation is still exponentially divergent, but the growth rate decreases beyond sc . There is thus an intermediate optimal value of the secondary nucleation rate to produce the greatest charge separation . This critical value sc 1/(rc) is 0.0625 in the simulations (dashed line in figure 4). A smaller value of rc (which means a weaker updraft) requires secondary nucleation to occur more often (larger sc) in order to ensure some particles are advected upward (leading to charge separation), while the initial density of particles,, controls the collision probability . It is worth mentioning that even in the limit of very high particle density, in which many collisions occur at early stages, charge separation is minimal in the absence of secondary nucleation . Earlier work of ours made us suspect that secondary nucleation ought to be important in runaway collisional charging . Previously we have shown that the nonlinear feedback effects of secondary nucleation are responsible for chiral symmetry breaking in experiments involving crystallizing a chiral chemical compound from solution . We showed that secondary nuclei in such stirred crystallization experiments are often easily detached whisker or needle crystallites growing from a mother crystal, and a runaway process involving the formation of secondary nuclei leads to complete chiral symmetry breaking . Water molecules possess a high electric polarizability; they are electrical dipoles and can be highly affected by the presence of an external field . During dendrite growth, an electric field can produce an ordering of the molecular dipoles and increase the molecular flow toward the dendrite tip . This increases the growth velocity, decreases the tip radius and disables the generation of side - branches, producing long whiskers . These effects have long been noted and were studied quantitatively by libbrecht and tanusheva, who measured the tip velocity and found that high voltages could multiply the growth rate more than 10-fold . We hypothesized that this dendrite growth mechanism should be involved in promoting secondary nucleation . Thus, we undertook laboratory experiments to see whether similarly easily detached forms as in solution crystallization experiments are produced in ice under the influence of an electric field . We employed a fei quanta 200 environmental scanning electron microscope (esem) equipped with a liquid nitrogen cold stage to grow ice in situ at low pressures and at temperatures of 90200 k. the microscope was set up so that the cold finger, together with a thermostat, was directly beneath the substrate (a silicon wafer attached with silver glue). We began by evacuating the chamber in the high - vacuum mode of the microscope (6 10 pa) and lowering the substrate to the working temperature . We first scanned the uncovered sample substrate, on which we grew an ice film by switching to low - vacuum mode and opening the water input microvalve at a pressure of 40 pa for some seconds . We found this was the highest pressure at which we could obtain clear images . We closed the microvalve at or before the point when the substrate temperature increases and cannot be maintained at the working temperature, following which we switched back to high - vacuum mode and observed the ice growth in situ . In the electron - microscope chamber, a high - voltage electron beam is used for imaging, and as we display in figure 5, we find that the electric field produces rapid dendrite growth wherever we charge with electrons by imaging . A typical ice morphology seen under these circumstances is of a form intermediate between whiskers and dendrites, which often takes on the aspect of a palm tree; see figure 5a . As we zoom out (figure 5b, c), we note that the palm forest is found only where we had been imaging; outside the area of the electron beam, we find a relatively flat film of ice, while within the imaged zones, three in figure 5c, we find faster ice growth and the ice forest . Growth in an esem: (a, b) at t = 170 k, p = 40 pa, v = 30 kv, an ice the forest displays the morphology intermediate between whiskers and dendrites typically formed with charged ice . (c) in an overview, the three zones where we imaged and charged with electrons stand out, showing the increased growth on the background ice film . We had noted such palmlike forms in previous experiments involving growing ice inside an electron microscope, but had not then realized that the electric field was involved in their production . These experiments are necessarily qualititative, being performed within the chamber of an unmodified esem, but we find the results suggestive: owing to their geometry, the breakage of these structures on collision is likely and will lead to the formation of new nucleation centers . Such friable morphologies do not only form in ice under electric fields; snowflakes too have such delicate structures, but an electric field promotes this form of growth . Our minimal physical model of a self - replicating granular material shows how secondary nuclei from such growth can lead to runaway charging . These effects may be present in ice on earth, in terrestrial thunderstorms, and in astrophysical ices, in the solar nebula, and in thunderstorms on other planets, some of which, for example, on venus, may involve self - replicating granular materials other than water ice . It is conceivable that this dynamics is involved in the formation of the martian geological structures called razorbacks . While ice is clearly the most quotidian example of a friable self - replicating granular material, one that breaks easily and continues to grow, other such materials can be both sought in different astrophysical environments, and also produced in technological contexts.
Cervical cancer is the third most commonly diagnosed cancer and the fourth leading cause of cancer death in females worldwide, despite improvements in screening programs, which have allowed the diagnosis of preinvasive lesions and reduced the incidence of advanced stage cervical cancer . Several features of cervical cancer are prognostically important, including the extent of tumor, lymph node involvement, tumor size, lymph vascular space invasion, and depth of stromal invasion by tumor cells . Optimal management consists of precise staging and implementation of appropriate treatment followed by deliberate post - treatment surveillance, early detection of recurrence, and appropriate salvage therapy . Early detection of recurrence has been found to improve survival [4 - 6]. Several methods are available for detection of relapse, which serve as a significant prognostic factor for patients with cervical cancer . However, the disease is usually far advanced when the accompanying symptoms are observed . Screening pap smear is insufficient for detection of early disease, diagnosis of relapse by physical examination is difficult because of anatomical changes after the initial treatment, and frequent performance of computed tomography (ct) or magnetic resonance imaging (mri) is too expensive . To overcome these drawbacks, several tumor markers have been investigated in the search for prognostic parameters that could be used in monitoring of treatment response and in detection of recurrence in patients with cervical cancer . The squamous cell carcinoma antigen (scc - ag) is the most commonly used tumor marker for cervical cancer . Serum scc - ag level has shown correlation with the extent of the disease [7 - 9] and response to treatment and provides a valid tool for early detection of disease recurrence [10 - 13]. A very large proportion of patients (74 - 88%) present with an elevated scc - ag serum level in association with, or preceding, the disease [10 - 13], and 70 - 86% of cervical cancer patients with recurrent disease were found to have elevated scc - ag levels during follow - up . However, in some unusual cases, elevation of scc - ag was not observed at diagnosis but was observed at diagnosis but not at recurrence . . Reported on two patients with a normal initial scc - ag level but an elevated level at recurrence, and rose et al . Reported on two patients whose pretreatment scc - ag level was abnormally high but a normal level was observed at recurrence . With regard to this phenomenon, choi et al . Explained that the reason for an unusual level of scc - ag from normal to overexpression is that the number of tumor cells with antigen expression at diagnosis is insufficient . However, invasiveness and tumor size increase upon recurrence, resulting in an elevated level of scc - ag . For the opposite case, which is more difficult to explain, they proposed that most tumor cells with high antigen expression are removed after treatment, and the subsequent recurrence involves tumor cells with low levels of antigen expression . The first objective of this study was to identify patient-, disease-, and treatment - related factors associated with an unusual scc - ag response, and the second objective was to determine whether scc - ag is a useful tumor marker in patients with unusual scc - ag patterns or whether an alternative approach is needed . We conducted a retrospective review of clinical information from 1,610 patients with cervical cancer between january 1994 and december 2010 . Among these patients, 895 were excluded due to the absence of pretreatment or post - treatment scc - ag value, incomplete treatment, or missing some clinical information . We therefore analyzed 715 patients with histologically proven cervical cancer who were treated with radiotherapy and/or chemotherapy or surgery with adjuvant radiotherapy and/or chemotherapy at samsung medical center (smc) in seoul, korea . We analyzed information regarding age, menopausal status, international federation of gynecology and obstetrics (figo) stage, pathology, tumor size, lymph node involvement, pretreatment and post - treatment scc - ag levels, treatment modality, response to treatment, and recurrence . Inclusion criteria were as follows: 1) biopsy - confirmed cervical cancer of clinical stage i - iv according to the figo staging system; 2) definitive or postoperative radiotherapy combined with chemotherapy in any sequence; and 3) measurement of serum scc - ag levels before and after treatment . We collected serum samples from all patients in order to determine serum scc - ag levels before and after treatment and performed a retrospective review of the patients' records . Serum scc - ag was measured using a scc immunoradiometric assay kit (imx, abbott diagnostics, abbott park, il) with a lower level of sensitivity of 0.1 ng / ml . The cut - off level of serum scc used at smc was 1.5 ng / ml . For assessment of biochemical response, scc - ag levels measured before and 1 - 2 months after the treatment were compared . When scc - ag showed a decrease after treatment, it was defined as a " positive biochemical response, " while, in the reverse case, defined as a " negative biochemical response . " Biochemical failure was defined as two consecutive increases in the scc - ag value of more than 1 ng / ml or elevation of greater than 1.5 ng / ml . The median length of follow - up for all patients was 38.3 months (range, 1.1 to 161.4 months). Clinical examination, pap smear, serum scc - ag measurement, and imaging work - up, including ct or mri, were performed before and after treatment, followed by further work - up, depending on the clinical finding or serum scc - ag level . If a patient showed biochemical failure without evidence of local recurrence during the clinical follow - up examinations, all possible sites of recurrence were checked systemically . The initial site of recurrence was categorized as locoregional recurrence (lrr) or distant metastasis (dm) based on the location of the true pelvis . Among 129 patients with recurrence, 14 patients who showed a normal scc - ag level at diagnosis but an elevated level at recurrence were classified as group i; 22 patients with an elevated scc - ag level at diagnosis but not at recurrence were classified as group ii; and 76 patients with an elevated scc - ag level at both diagnosis and recurrence were classified as group iii . Patients with a normal scc - ag level at both diagnosis and recurrence were excluded in this study . We decided on an adequate treatment option for salvage therapy for recurred patients depending on their recurrence patterns . For patients with lrr, if operable, we performed salvage surgery; otherwise, reirradiation was performed . For patients showing distant metastasis, we chose chemotherapy prior to other treatment options for salvage treatment . It is notable that no significant difference in selection of the treatment option for recurred patients was observed among the three patient groups . Statistical analyses were performed using chi - square test or fisher's exact test, and one - way anova was used to examine the relationships between unusual scc - ag levels and other clinicopathologic factors . Disease - free survival (dfs) and overall survival (os) were calculated at the start of treatment using the kaplan - meier method . Log - rank test was used to determine the p - value, and p<0.05 was considered significant . 18 (spss inc ., chicago, il) was used in performance of all statistical analyses . The median ages of patients in groups i, ii, and iii were 45.5 years (range, 30 to 74 years), 56.0 years (range, 29 to 82 years), and 54.0 years (range, 30 to 79 years), respectively . Eight (57.1%), eight (36.4%), and 33 (43.4%) patients had a premenopausal status . With respect to clinical staging, five (35.7%), eight (36.4%), and 14 (18.4%) patients were stage i; eight (57.1%), 11 (50.0%), and 43 (56.6%) patients were stage ii; 0 (0%), two (9.1%), and 13 (17.1%) patients were stage iii; and one (7.1%), one (4.5%), and six (7.9%) patients were stage iv for groups i, ii, and iii, respectively . Regarding pathological characteristics, eight (57.10%), 19 (86.4%), and 72 (94.7%) patients in groups i, ii, and iii, respectively, had squamous cell carcinoma; five (35.7%), one (4.5%), and two (2.6%) patients had adenocarcinoma; and one (7.1%), one (4.5%), and two (2.6%) patients had adenosquamous cell carcinoma . Tumor size ranged between 1.6 - 8.0 cm (median, 4.2 cm) in group i, 2.1 - 14.0 cm (median, 4.4 cm) in group ii, and 1.3 - 8.4 cm (median, 4.6 cm) in group iii, and the patients were classified based on a size of 4 cm, which is the basis of size - based classification of figo stage . Five (35.7%), 12 (54.5%), and 50 (65.8%) patients in groups i, ii, and iii, respectively, had lymph node involvement . The initial levels of scc - ag in groups i, ii, and iii showed respective ranges of 0.2 - 1.4 ng / ml (median, 1.0 ng / ml), 1.5 - 21.0 ng / ml (median, 2.8 ng / ml), and 1.5 - 362.0 ng / ml (median, 8.4 ng / ml), and patients were classified based on a cut - off of 1.5 ng / ml, the value used in our hospital . Regarding response to treatment, nine (64.3%) patients in group i, 15 (68.2%) patients in group ii, and 51 (67.1%) patients in group iii showed complete response; two (14.3%), three (13.6%), and 19 patients (25.0%) showed partial response; two (14.3%), two (9.1%), and one (1.3%) patients showed progression of the disease; the result of treatment could not be assessed due to lack of records for one (7.1%), two (9.1%), and five patients (6.6%), respectively . Seven (50.0%), 16 (72.7%), and 62 (81.6%) patients in groups i, ii, and iii, respectively, showed a positive biochemical response . The site of recurrence was lrr in seven (50.0%), 12 (54.5%), and 37 patients (48.7%); dm in five (35.7%), nine (40.9%), and 33 patients (43.4%); and simultaneous lrr and dm in two (14.3%), one (4.5%), and six patients (7.9%) for groups i, ii, and iii, respectively . A summary of the results of univariate and multivariate analyses for unusual scc - ag levels at initial diagnosis and recurrence is shown in table 2 . In univariate analysis, unusual scc - ag levels showed a statistically significant correlation with pathology and biochemical response . However, in the multivariate analysis, none of the clinicopathologic factors showed a statistically significant relationship with unusual scc - ag levels . The 5-year dfs rates of groups i, ii, and iii were 7.1%, 9.1%, and 0% (p=0.418), and the 5-year os rates were 34.3%, 58.4%, and 33.3% (p=0.142), respectively . Consistent with previous reports, scc - ag functioned as a tumor marker for most of the patients in our study . In classification of patients based on the standard cut - off level of 1.5 ng / ml scc - ag used at smc, 66.3% of patients with cervical cancer showed an elevated scc - ag level on diagnosis, and 75.3% of patients showed an elevated scc - ag level at recurrence . In the current study, we assume that lower scc - ag levels at diagnosis, compared with previous studies, was due to a high proportion of patients with low stage and similar to that reported in other previously published studies; we have shown that post - treatment scc - ag levels are helpful in detection of cervical cancer recurrence . In addition, the percentage of patients whose scc - ag level exceeded 1.5 ng / ml at diagnosis increased with increasing stage: 54.1%, 78.2%, 87.5%, and 95.5% for stages i, ii, iii and iv, respectively . Thus, the value of scc - ag as a tumor marker for the initial and relapse diagnoses of cervical cancer and its role as a prognostic factor have been confirmed by many previous studies, including the current study . However, a number of studies have reported unusual cases in which elevation of scc - ag level was observed at diagnosis but not at recurrence, or, conversely, was not observed at diagnosis but was observed at recurrence . We also observed 14 patients with the former pattern and 22 with the latter pattern among the patients in our recent study on the function of scc - ag . Based on these findings, we became interested in the common characteristics of such patients and the role of scc - ag as a marker in these patients . As shown in tables 1 and 2, differences in stage, pathologic type, lymph node involvement, median value of initial scc - ag, and biochemical response were observed between the normal (group iii) and unusual (groups i and ii) scc - ag groups . Although only pathologic type showed statistical significance in multivariate analysis, pathology and biochemical response were statistically significant in univariate analysis . Regarding pathologic type, the proportion of squamous cell carcinoma, which was expected to show an association with higher scc - ag, compared with other pathologic types, was lower in groups i and ii than in group iii . The initial median scc - ag levels in groups i, ii, and iii increased by 1.0 ng / ml, 2.8 ng / ml, and 8.4 ng / ml, respectively . From these results, we conclude that the lack of elevation of scc - ag at diagnosis or relapse was due to low production of scc - ag . In group i, where absence of scc - ag elevation was observed at diagnosis, but elevation was observed at relapse, the initial production of scc - ag was low because there were few cells producing scc - ag . In contrast, the relapsed lesion contained many scc - ag - producing cells; therefore, elevated scc - ag was detected at recurrence . For group ii, where elevation of scc - ag was observed at diagnosis, but normal levels of scc - ag were observed at relapse, we conclude that the primary lesion consisted of many cells producing scc - ag, however, these cells were no longer present after treatment . Thus, relapse involved cells that were not capable of producing scc - ag, indicating no elevation of scc - ag at recurrence . Serum scc - ag has already been known to be a prognostic factor with respect to the aggressiveness of cervical cancer [7 - 9]. Dfs and os among the three groups are shown in fig . 1 and table 3 . Although the current result lacked statistical significance, systematic relationship of scc - ag level with clinical outcome can be found . The 5-year dfs and os of group iii were lowest at 0% and 33.3%, and those of group ii were highest at 9.1% and 58.4%, respectively . The lower dfs and os of group iii can be easily understood by the fact that it showed the highest level of scc - ag at initial diagnosis among the groups, which adversely affects the prognosis, as reported in the literature . However, this simple explanation based only on the initial scc - ag level did not fully elucidate the differences in survival rates among the current patient groups . For example, group ii showed a better survival rate than group i, even though the initial scc - ag level was higher in group ii than in group i, implying that something other than the initial scc - ag level was necessary to explain the survival pattern . By cross checking the survival patterns in the three groups, we suggested that not only the initial scc - ag level but also the biochemical response according to scc - ag level may be related to the prognosis of cervical cancer . The better survival observed in group ii, compared with that in groups i and iii, can be explained by the fact that a larger portion of patients in group ii showed a positive biochemical response after treatments and reduction of the productive capacity for scc - ag; hence, the expression of scc - ag can decline to the point that it cannot be detected at relapse . The major finding in the current study is that the treatment response of patients with unusual change in scc - ag was not significantly different from that of the usual patient case with a typical scc - ag level . This implies that continuous check of scc - ag levels might be necessary for early detection of relapse, even in the case of an unusual patient . In particular, paying extra attention to group ii patients with an elevated scc - ag level at initial diagnosis but with a normal scc - ag level at recurrence, including careful physical examination and imaging work - up, is strongly recommended . This result is consistent with those of previous studies [10 - 13], however, compared with previous studies, the reliability of the result may be further improved with the current analysis because a larger number of patients were enrolled in this study . Nevertheless, this study has a number of limitations . Although this study included the largest number of patients with unusual scc - ag patterns analyzed to date, the sample size was not sufficient to validate statistical significance . In addition, although we identified some common characteristics of patients with unusual scc - ag patterns and found a similar response to treatment and a higher survival rate in these groups, we explained these findings only in terms of clinicopathologic factors without study of the underlying molecular biology . In order to overcome these limitations, further research involving biochemical analysis of a larger number of patients with unusual scc - ag patterns the effectiveness of scc - ag level as a tumor marker and its role as a prognostic factor have been validated in the present study as consistent with previous studies . Biochemical response as well as scc - ag could be considered as prognostic factor in both patients with usual and unusual scc - ag level . This result strongly suggest that continuous follow - up of scc - ag levels is helpful for early detection or prediction of relapse in patient with cervical cancer.
Studies have demonstrated that different ethnic groups may have different predisposing risk factors, epidemiologic patterns, and outcomes of stroke . This has been shown in african americans, caucasians, hispanics, arabs, and asians [16]. These differences could be due to differences in demographic or socioeconomic factors or in lifestyle . Although epidemiologic studies on stroke were carried out in different parts of the world, including some arab countries [711], there are no published data about palestine . Furthermore, knowledge of the prevalence of stroke - related risk factors can help health decision makers to direct efforts toward reducing stroke - related morbidity and mortality . In palestine the private sector plays a minor role due to its high cost compared to the average income in palestine . Currently, the palestinian national authority is in charge of west - bank and gaza strip, with a total population of 4,151,668 inhabitants . Nablus district is the second largest district with a population of 362,159 native palestinian inhabitants . This study was conducted to identify the risk factors, in - hospital mortality, and discharge medications for patients with ischemic stroke admitted to al - watani government hospital, nablus, palestine . This one - year, retrospective, hospital - based study was conducted between september 01, 2006 and august 31, 2007 . All patients admitted to the hospital with acute ischemic stroke were included in the study . Each diagnosed patient had been followed up until either death at the hospital or discharge . The data were collected by retrospective review of medical charts included age, gender, medications, serum creatinine (scr) level, risk factors, and post - stroke medical complications . Then following were considered risk factors: age, hypertension (htn), diabetes mellitus (dm), congestive heart failure (chf), atrial fibrillation (af), ischemic heart disease (ihd), smoking, previous stroke, and obesity [1215]. Hyperlipidemia is a risk factor for stroke, but we did not include it because it had not been done routinely at the hospital . Obesity was defined as a body mass index (bmi)> 30 for both genders . Creatinine clearance (crcl) was calculated by using cokcroft - gault equations, and values for females were obtained by multiplying the result by 0.85 . The post - stroke complications considered were the presence of one or more of the following: constipation, seizure, depression, infection, limb pain, and gastrointestinal upset . Analysis of data was carried out using the " statistical package for social sciences " (spss) program for windows version 15.0 (spss inc ., univariate analysis was carried out using pearson chi - square for categorical variables and student's t test for continuous variables . Multiple logistic regression analysis was used to find independent predictors of in - hospital mortality . Variables included in the regression model were those that had a significant p value (p <0.05) in the univariate analysis . Analysis of data was carried out using the " statistical package for social sciences " (spss) program for windows version 15.0 (spss inc ., univariate analysis was carried out using pearson chi - square for categorical variables and student's t test for continuous variables . Multiple logistic regression analysis was used to find independent predictors of in - hospital mortality . Variables included in the regression model were those that had a significant p value (p <0.05) in the univariate analysis . We found that 186 stroke patients were admitted to the hospital during the study period; of these, we studied 153 who were diagnosed with ischemic stroke . 45.8% were males and 54.2% were females, giving a male: female ratio of 0.84:1 . There was no significant difference between females and males in age . Among the patients, 39.9% had previous attack, and 60.1% had a first ever stroke (fes). Patients with fes were younger than those with recurrent stroke (67.94 11.66 versus 70.80 10.19 years, respectively); the difference in age between the two groups was not significant (p = 0.11). The prevalence of risk factors in the study sample was investigated (figure 1). Patients had an average of 3.4 1.2 risk factors (range 1 7) before the attack . Htn was the most prevalent risk factor (66%) of the patients, followed by dm (45.8%). Renal dysfunction was also common: 33.9% of the patients had an estimated crcl <60 ml / min . Smoking was practiced by 19.6% of the patients, most of whom (99%) were males . No significant difference was found in the prevalence of risk factors between males and females, with the exception of smoking which was significantly associated with males . However, chf and dm were more common in females, while htn was more common in males . Prevalence of various risk factors in the stroke patients admitted to the hospital during the study period . Htn: hypertension, dm: diabetes mellitus, bmi: body mass index, af: atrial fibrillation, chf: congestive heart failure, ihd: ischemic heart disease twenty - six (17%) of the patients died during hospitalization . Of the 127 survivors, four variables were significantly associated with in - hospital mortality: history of previous stroke (p= 0.004), crcl at admission (p = 0.004), number of post - stroke complications (p = 0.001), and age (p = 0.043). Multiple logistic regression analysis indicated that the number of post - stroke complications (p= 0.001) and previous stroke (p = 0.03) were significant independent predictors of in - hospital mortality . Table 1 summarizes the demographic and clinical characteristics of patients who survived versus those who died . Table 2 shows multiple logistic regression model using the enter method for predicting mortality after stroke . Results of univariate analysis of 153 ischemic stroke patients according to vital status at discharge . Htn: hypertension, dm: diabetes mellitus, af: atrial fibrillation, ihd: ischemic heart disease, chf: congestive heart failure . Continuous variables were expressed as mean sd, while categorical variables were expressed as frequency and percentage . P value was calculated using independent t test for continuous variables and chi - square test for categorical variables . Multiple logistic regression by the enter method for identifying predictors of mortality after ischemic stroke . An average of 4.33 medications (sd = 1.5, range: 19) were prescribed per stroke survivor . Seventy - four (92.5%) stroke survivors with a diagnosis of hypertension were discharged on antihypertensive medications . Ace - i were the most (n = 62, 50%) was the class of antihypertensive agents most frequently prescribed for stroke survivors . The main exceptions were anti - coagulants, antibiotics, and anti - inflammatory agents, all of which were used at admission but were discontinued at discharge . There was no difference in the average number of medications prescribed for males and females at discharge (p= 0.36). We studied the characteristics of patients with ischemic stroke attacks at al - watani hospital, palestine . The mean age was higher than that reported in hospital - based studies from some other arab countries but lower than that reported from developed countries [16, 17]. An important observation is the very low percentage (1.6%) of stroke patients who were less than 45 years old . The prevalence of stroke in young patients seems to vary between different ethnic groups of various geographical areas . For instance, only 35% of all strokes occurred in individuals under 45 years old in some countries, while in others they constituted as much as 1930% [1820]. The male: female (m: f) ratio of 0.84:1 in this study was not in agreement with previous studies on stroke from other countries . One study in a province of saudi arabia found a m: f ratio of 1.8:1 . A second study among the national guard community in saudi arabia found a m: f ratio of 2.2:1 . A third study in saudi arabia found a ratio of 3.4:1 [2123]. However, a hospital - based study in saudi arabia found a 1:1 male: female ratio in stroke patients in general . The unexpected gender ratio in our study might indicate the presence of undiagnosed or uncontrolled stroke - related risk factors in women in palestine . The high prevalence of risk factors among the stroke victims indicates that control of these factors is important for the prevention of stroke . Thus, screening, modification, and better control of existing risk factors, such as htn, dm, and cardiac diseases, should be the primary strategy for prevention of stroke . Prospective observational studies have established that the risk of primary stroke is strongly related to blood pressure (bp). Lowering diastolic bp by 5 mmhg or systolic bp by 10 mmhg reduces the risk of stroke by an estimated 38% . In our study, most patients with htn were given anti - hypertensive agents, particularly ace - i, at discharge . About one - third of the patients had an estimated crcl <60 ml / min . A recent study indicated that mild degrees of renal dysfunction are associated with increased risk of incident ischemic stroke or transient ischemic attack . Recent studies have also established that patients with end stage renal disease (esrd) have 510fold higher risk of stroke compared to patients with non - esrd [28, 29]. Results of in - hospital mortality among stroke patients in this study were also close to those reported in most arab countries . Four variables were significant risk factors of in - hospital mortality in stroke patients, namely, history of previous stroke, number of post - stroke complications, creatinine clearance, and age . The influence of age on stroke outcome is still a matter of debate . While several studies showed a negative influence, other studies showed no influence [3038]; our results resemble those that showed a negative influence of age on stroke outcome . It is difficult to establish whether age influences stroke outcome itself, or through other factors associated with age . Our finding regarding crcl as an independent predictor of early mortality in stroke patients is endorsed by some studies . For example, a study by friedman in 1991 indicated that serum creatinine was an independent predictor of mortality among 492 stroke survivors followed up for a mean period of 18 months . Indicated that patients with creatinine clearance calculated at admission of <51 ml / min had a higher mortality rate . Finally, a recent study by fabjan et al . Indicated that in patients with ischemic stroke, decreased crcl was associated with higher in - hospital mortality . Interestingly, we found that prior use of anti - platelets was not associated with decreased risk of mortality . A hospital - based study carried out in kuwait found that non - se of anti - platelets is significantly associated with deleterious 30-day outcome . One way to reduce early mortality in stroke patients is to develop a stroke unit supervised by a specialized neurologist . Admission of acute stroke patients into specialized hospitals seems to reduce the risk of in - hospital mortality . Moreover, academic medical centers with vascular neurologists had lower rates of in - hospital mortality for patients with ischemic stroke . It seems that mortality in patients with stroke does not depend only on patient - related factors but also on hospital characteristics . Most of the patients in the study had risk factors commonly present in stroke patients . Better control of these risk factors might decrease the future incidence rate of stroke in palestine . The number of post - stroke complications and previous stroke were significant independent predictors of in - hospital mortality . Medications prescribed at discharge for stroke survivors are consistent with the type of risk factors, especially htn, present in patient's medical files.
Parry - romberg syndrome (prs), or progressive facial hemiatrophy, is a rare disorder presenting as a slowly progressive but self - limited atrophy of facial structures, sometimes followed by wasting of adjacent skin, connective or ocular tissue, muscle, cartilage, and bone1). Symptoms usually appear in the first or second decades of life23), but a few cases with a late onset have been described4). Prs is more common in females, and is believed to be sporadic, although some rare familial cases have been reported4). Although some prs patients are neurologically normal, diverse neurologic symptoms have been reported, most commonly seizures and headache5). Common magnetic resonance imaging (mri) findings include ipsilateral high signal intensity in the white matter or gray matter78), leptomeningeal enhancement7), calcification7), cerebral atrophy378), and intracranial vascular malformation9). We present a unique case, a 10-year - old girl in whom prs presented on the right face, who later had recurrent episodes of monoplegic ataxia . Brain mri revealed very few findings with an increased signal at the ipsilateral hemipons and hemicerebellar peduncle . The patient, a 10-year - old korean girl, is the younger daughter of two children . She was born healthy and her family history was unremarkable . At the age of 4 years, her parents discovered mild hair loss over the right parietal region of her scalp, over an area of about 1 cm in diameter that slowly increased in size, centered around a small white papule (fig . Diagnosis of localized scleroderma was made based on clinical features, and topical steroids were administered . The lesions slowly evolved over one year and became perpendicularly elongated with consequent atrophy, but without hyperpigmentation, and remained static after a year . Beginning from the age of 6 years, her face gradually became asymmetric atrophy on her right cheek, and worsened over the following two years . Unfortunately, the comprehensive evaluation was not performed by local orthopedic care despite her asymmetric facial atrophy . At the age of 10 years, she visited for sudden - onset ataxic gait on the left side two months prior . She had recurrent episodes of numbness, paresthesia, and limpness in her left leg, followed by falling down to the left side . There was no history of headaches, visual dysfunction, or seizures and no history of recent viral infection or trauma . There was no family history of scleroderma, neurologic, rheumatologic, or autoimmune disease . Physical examination revealed subcutaneous atrophy of the whole right hemiface, and a 30.5-cm linear scleroderma " en coup de sabre " (lscs) in the right paramedian frontal area without skin discoloration (fig . Motor examination revealed 2 to 3 degrees of left leg weakness, but deep tendon reflexes were present in both legs without ankle clonus or babinski responses . She showed deficits of the cerebellar function tests such as romberg test, tandem gait, finger - to - nose test, and rapid alternating movements . General examination revealed no atrophy of the trunk on the same side or the ipsilateral limb . An autoantibody profile showed the presence of antinuclear antibodies at low titers (1:40, homogeneous). Rheumatoid factor was present at 19.2 iu / ml (range, 0 - 20 iu / ml). Antidouble stranded dna, anti - scl-70, lupus anticoagulant, anticardiolipin antibody, anticentromere, and test for syphilis (venereal disease research laboratory) were all negative . The cerebrospinal fluid was acellular, with normal protein and glucose . X - rays of the skull and face revealed no evidence of fracture, and abdominal sonography did not yield abnormalities . Mri of the brain showed a hemiatrophy of right side facial structure and skull base underlying skin lesion . The diagnosis that best accounts for our patient's symptoms, disease course, and laboratory and mri findings is prs with recurrent monoplegic ataxia due to ipsilateral hemipons involvement . She was treated with oral prednisolone of 30 mg daily (1.2 mg / kg / day administered 3 times) for 2 months including a tapering period . Recurrent episodes of her ataxic gaits diminished within two months of follow - up period . Additionally, there was no progression of facial hemiatrophy or other neurological deficits for more than 3 years of observing the patient . First described by parry (1825), the prevalence is unknown, but stone4) suggested 1/500,000 births are positive for prs . The progression of atrophy usually lasts from two to 10 years and then the process seems to enter a stable phase . The final condition of facial deformity may depend on the duration of the disease10). Prs has been linked with many systemic manifestations including dermatologic, neurologic, ophthalmologic, cardiac, rheumatologic, infectious, endocrine, and maxillofacial fields . Other symptoms associated with prs were as follows: headaches412), movement disorders secondary to brain lesions1), trigeminal neuralgia12), hemiplegic migraines13), behavioral changes11), sympathetic hyperactivity12), progressive intellectual deterioration due to cerebral hemiatrophy (rasmussen encephalitis)3), oculomotor nerve palsy11), facial nerve palsy11) and even death due to brainstem involvement13). The most common findings on mri are usually ipsilateral t2 hyperintensity, mostly in white - matter, gray matter and corpus callosum78). Other findings are as follows378910); leptomeningeal enhancement7), calcification7), cerebral atrophy378), intracranial vascular malformation9), focal corpus callosum infarctions7), ipsilateral infarcts in amygdaloid body7), and ipsilateral meningeal and basal ganglia lesions8). Neuroimaging findings in patients with prs were frequently ipsilateral, although, contralateral findings have been reported7). To the best of our knowledge, only two cases of prs with the t2 hyperintensity in the ipsilateral hemipons, including our patient, have been reported13). A two - year - old boy with prs had many severe neurologic dysfunctions including seizures, dysarthria, oculomotor nerve palsy, and dysphagia . Mri revealed progressive atrophy of right cerebral hemisphere, and right midbrain and pons lesions . At the age of five years, he died in his sleep despite treatment with intravenous immunoglobulin and cyclophosphamide13). Our patient with prs presented with recurrent episodes of monoplegic ataxia, and increased signal at ipsilateral hemipons and hemicerebellar peduncle on brain mri . A follow - up mri was planned after the treatment of steroid, but was not performed, because her parents were very concerned about recurrent use of sedative drug . We could not absolutely demonstrate, just might speculate, the correlation between a decline of ataxic gait and any improvement of neuroimaging . The pathogenesis of prs is not well understood and numerous etiologies have been suggested101415), including trauma, infection, autoimmune processes, and cervical sympathetic dysfunction . Autoimmune reaction appears to be the favored hypothesis in some patients, based upon coexisting autoantibodies15) such as antinuclear antibodies, antidouble strand dna, anticardiolipin antibodies, rheumatoid factors, and oligoclonal bands in the cerebrospinal fluid, and good response to immunosuppressive therapy1). Brain biopsies have been performed in some children, revealing perivascular lymphocytic infiltrate, and gliosis and sclerosis of the leptomeninges13), suggesting an inflammatory process . Hyperactivity of the brain stem center has also been suggested as a cause of prs14). In our patient, mri discovered t2 hyperintensities at the ipsilateral hemipons, and her recurrent episodes of ataxic gaits gradually improved after the oral steroid trial, although all laboratory findings for autoimmune profiles and hypercoagulable screens were negative . Therefore, we speculated that abnormal autoimmune reaction and hyperactivity of the brain stem might be involved in her disease . Chiu et al.6) reported a high rate of neurologic symptoms (28% to 65%) and neuroimaging abnormalities (19% to 73%) in children with prs by institutional and literature review . However, neurologic symptoms were not correlated with neuroimaging abnormalities, and there was poor correlation between the severity of the cutaneous lesions and mri findings . They recommended that all children with prs or lscs have a brain mri performed at initial diagnosis, and that systemic immunosuppressive medication should be strongly considered for children found to have intracranial abnormalities . Our patient was treated with oral prednisolone and the episodes of ataxic gaits gradually improved within two months without relapse or progression or other neurological deficits for more than three years of observing the patient . We present a very curious patient with prs who had recurrent monoplegic ataxia due to ipsilateral hemipons involvement without fatal neurological deterioration . Because clinical predictors of intracranial abnormalities are poor, neuroimaging should be strongly considered before starting treatment as a baseline examination to identify intracranial lesions and to determine therapeutic plans, although the children may be asymptomatic.
Operando uv / vis spectroscopy measurements were performed to study the hydrocarbon species trapped inside hsapo34 cages, together with mass spectrometry to follow product formation during the mto reaction . Timeresolved operando uv / vis spectra were recorded to monitor the reaction and regeneration under different reaction conditions and with different feedstocks . The operando uv / vis spectroscopy measurements were performed by using an avantes avalightdhsbal probe connected to an avantes avaspec 2048l spectrometer . Online analysis of the reaction products during the mto reaction was obtained by a pfeiffer vacuum omnistar mass spectrometer with a mass range of 555 . The evolution of methanol, propylene, and dimethyl ether was tracked by monitoring the mass signals 31, 41, and 45, respectively . Operando uv / vis spectroscopy experiments were performed in a custombuilt reaction cell, which is outlined in figure s5 in the supporting information . The reaction cell was built with a very low dead volume to directly link the spectroscopic data with the catalytic performance of the material . The average residence time () for a molecule in the gas phase in just the pipelines of the setup was 102 s and in the custombuilt cell 125 s. the design of this cell is essential to this work as the it is the heart of the setup . A comparison between the custombuilt cell, and a commercial operando cell as well as more detailed information about the cell design and properties can be found in the supporting information (s.4). The hsapo34 catalyst powders were pressed into pellets of approximately 16 mm diameter and around 0.1 mm thickness, weighing between 57 mg, by using a laboratory pellet press and around 4 ton of pressure under vacuum . Before every reaction, the catalyst pellet was activated in oxygen (linde 5.0). In this twostep activation, a 30 ml min o2 flow was introduced . In the first step, the temperature was ramped to 423 k at a rate of 5 k min, and held there for 5 min, aiming to eliminate water . Then, the temperature was ramped to 723 k at a rate of 10 k min to eliminate any other impurities in the zeolite material . After these two steps, the temperature was brought to the specific reaction temperature for that experiment and allowed to adjust to that temperature at a rate of 15 k min . Then, methanol was fed through a saturator using a 10 ml min flow of n2 as a carrier gas, effectively containing approximately 13% methanol . The catalyst used in the experiments described in this work is a commercial hsapo34 material . The crystal size of this material was 4.3 m (with standard deviation =0.9) and the sio2:al2o3 ratio used in the synthesis of the sample was 0.4, which can be translated theoretically into four acid sites per cage . Lower acidity and longer lifetimes are reported for lower silicon contents.45a, 50 the tplot micropore volume of the sample under study is 0.25 cm g, whereas the mesopore volume is 0.2 cm g, calculated by using the barrett halenda (bjh) method of the material, argon physisorption isotherms, and the cumulative desorption pore volume in a range of 1300 nm . Furthermore, the (relative) proton affinity measured by co adsorption is 1179 kj mol, a characteristic value for an average of weak to medium strength acid sites.45b the supporting information shows an overview of these calculations for catalyst acidity characterization . Nh3 temperatureprogrammed desorption (tpd) measurements displayed in figure s7 (in the supporting information) revealed that, theoretically, the hsapo34 sample has approximately 0.9 acid sites per cage and suggests that about 25% of the si forms a brnsted acid site . The co adsorption ftir spectra and nh3tpd profile can be found in the supporting information (s.5). It is important to mention that even highpurity methanol may contain enough organic impurities to create a hydrocarbon pool on a microporous solid acid catalyst . Acetone and ethanol are known precursors for the formation of cyclic (hydrocarbon pool) species . To investigate the effect of the extrinsic impurities in the feedstock, two methanol feedstocks with a different degree of impurities an ultrapure feedstock was prepared by following the procedure of marcus et al.53 acros analysis grade methanol was fractionally distilled and kept in a glovebox to ensure no water or other impurities were adsorbed from the atmosphere . This methanol was then passed over a 10 cm column filled with dry molecular sieves (linde type 4) to remove any additional water . The methanol was subsequently passed over columns with pretreated amberlyst 15 and amberlyst 37, successively . This ultrapure methanol contained 49 ppm of impurities (gc, fid detector) primarily consisting of 2,2dimethoxyacetone . In addition, ultrapure carrier gasses (linde, 5.0) contain 110 ppm impurities, which might be a potential source of contamination . For this reason, a homebuilt gas trap with molecular sieves (sigma aldrich, 5) was installed to filter the o2 and n2 flows . The third methanol feedstock was created by adding 5 wt% of ethanol to ultrapurified methanol produced by the method described above, to observe the influence of this common impurity on the methanol feedstocks.36 the addition of ethanol to the feedstock may influence the reaction in a twofold manner; the kinetic diameter of an ethanol molecule is closer to that of the micropores of hsapo34, which makes diffusion slower, but recent work has also shown that the ethanoltoolefins (eto) process leads to the faster formation of polyalkylated benzene carbocations and coke deposits.49, 50, 54 the type of impurities, concentrations, and gas methanol feedstock abbreviations are summarized in table 1 . All main impurities in the methanol feedstock fit inside the hsapo34 micropores of around 0.38 nm in size assuming that the respective calculated diameters are the maximum size, and pore entry will proceed in a poreparallel rather than poreperpendicular manner . Operando uv / vis spectroscopy measurements were performed to study the hydrocarbon species trapped inside hsapo34 cages, together with mass spectrometry to follow product formation during the mto reaction . Timeresolved operando uv / vis spectra were recorded to monitor the reaction and regeneration under different reaction conditions and with different feedstocks . The operando uv / vis spectroscopy measurements were performed by using an avantes avalightdhsbal probe connected to an avantes avaspec 2048l spectrometer . Online analysis of the reaction products during the mto reaction was obtained by a pfeiffer vacuum omnistar mass spectrometer with a mass range of 555 . The evolution of methanol, propylene, and dimethyl ether was tracked by monitoring the mass signals 31, 41, and 45, respectively . Operando uv / vis spectroscopy experiments were performed in a custombuilt reaction cell, which is outlined in figure s5 in the supporting information . The reaction cell was built with a very low dead volume to directly link the spectroscopic data with the catalytic performance of the material . The average residence time () for a molecule in the gas phase in just the pipelines of the setup was 102 s and in the custombuilt cell 125 s. the design of this cell is essential to this work as the it is the heart of the setup . A comparison between the custombuilt cell, and a commercial operando cell as well as more detailed information about the cell design and properties can be found in the supporting information (s.4). The hsapo34 catalyst powders were pressed into pellets of approximately 16 mm diameter and around 0.1 mm thickness, weighing between 57 mg, by using a laboratory pellet press and around 4 ton of pressure under vacuum . Before every reaction, the catalyst pellet was activated in oxygen (linde 5.0). In this twostep activation, a 30 ml min o2 flow was introduced . In the first step, the temperature was ramped to 423 k at a rate of 5 k min, and held there for 5 min, aiming to eliminate water . Then, the temperature was ramped to 723 k at a rate of 10 k min to eliminate any other impurities in the zeolite material . After these two steps, the temperature was brought to the specific reaction temperature for that experiment and allowed to adjust to that temperature at a rate of 15 k min . Then, methanol was fed through a saturator using a 10 ml min flow of n2 as a carrier gas, effectively containing approximately 13% methanol . The catalyst used in the experiments described in this work is a commercial hsapo34 material . The crystal size of this material was 4.3 m (with standard deviation =0.9) and the sio2:al2o3 ratio used in the synthesis of the sample was 0.4, which can be translated theoretically into four acid sites per cage . Lower acidity and longer lifetimes are reported for lower silicon contents.45a, 50 the tplot micropore volume of the sample under study is 0.25 cm g, whereas the mesopore volume is 0.2 cm g, calculated by using the barrett halenda (bjh) method of the material, argon physisorption isotherms, and the cumulative desorption pore volume in a range of 1300 nm . Furthermore, the (relative) proton affinity measured by co adsorption is 1179 kj mol, a characteristic value for an average of weak to medium strength acid sites.45b the supporting information shows an overview of these calculations for catalyst acidity characterization . Nh3 temperatureprogrammed desorption (tpd) measurements displayed in figure s7 (in the supporting information) revealed that, theoretically, the hsapo34 sample has approximately 0.9 acid sites per cage and suggests that about 25% of the si forms a brnsted acid site . The co adsorption ftir spectra and nh3tpd profile can be found in the supporting information (s.5). It is important to mention that even highpurity methanol may contain enough organic impurities to create a hydrocarbon pool on a microporous solid acid catalyst . For example, acros analysis grade acetone and ethanol are known precursors for the formation of cyclic (hydrocarbon pool) species . To investigate the effect of the extrinsic impurities in the feedstock, two methanol feedstocks with a different degree of impurities an ultrapure feedstock was prepared by following the procedure of marcus et al.53 acros analysis grade methanol was fractionally distilled and kept in a glovebox to ensure no water or other impurities were adsorbed from the atmosphere . This methanol was then passed over a 10 cm column filled with dry molecular sieves (linde type 4) to remove any additional water . The methanol was subsequently passed over columns with pretreated amberlyst 15 and amberlyst 37, successively . This ultrapure methanol contained 49 ppm of impurities (gc, fid detector) primarily consisting of 2,2dimethoxyacetone . In addition, ultrapure carrier gasses (linde, 5.0) contain 110 ppm impurities, which might be a potential source of contamination . For this reason, a homebuilt gas trap with molecular sieves (sigma aldrich, 5) was installed to filter the o2 and n2 flows . The third methanol feedstock was created by adding 5 wt% of ethanol to ultrapurified methanol produced by the method described above, to observe the influence of this common impurity on the methanol feedstocks.36 the addition of ethanol to the feedstock may influence the reaction in a twofold manner; the kinetic diameter of an ethanol molecule is closer to that of the micropores of hsapo34, which makes diffusion slower, but recent work has also shown that the ethanoltoolefins (eto) process leads to the faster formation of polyalkylated benzene carbocations and coke deposits.49, 50, 54 the type of impurities, concentrations, and gas methanol feedstock abbreviations are summarized in table 1 . All main impurities in the methanol feedstock fit inside the hsapo34 micropores of around 0.38 nm in size assuming that the respective calculated diameters are the maximum size, and pore entry will proceed in a poreparallel rather than poreperpendicular manner . As a service to our authors and readers, this journal provides supporting information supplied by the authors . Such materials are peer reviewed and may be reorganized for online delivery, but are not copyedited or typeset . Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.
Carcinosarcoma (also known as pseudosarcoma, pseudosarcomatous squamous cell carcinoma, pleomorphic carcinoma, and spindle cell carcinoma) is a highly malignant tumor characterized by dual malignant histologic differentiation of the epithelial component consisting of a focally squamous cell carcinoma and a mesenchymal component having a sarcomatoid stroma . Carcinosarcoma may arise in any squamous epithelium of the body, however its occurrence is extremely rare in the sinonasal cavity [3 - 13]. We present a case of a carcinosarcoma located in the maxillary sinus that was is aggressive and displayed a high recurrence rate even when a multimodality therapeutic approach was adopted . A 62-year - old male was admitted to the emergency room due to uncontrolled epistaxis and complaining of swelling and tenderness in the right cheek . The patient was receiving warfarin as an anticoagulative measure, having previously suffered a stroke . An examination of the nasal cavity was not possible at the emergency room due to the severity of bleeding . Two days later, when the nasal packing was removed and endoscopic examination performed, a mass in the middle meatus and bulging of the medial wall of the maxillary sinus were observed (fig . Computed tomography (ct) and magnetic resonance imaging (mri) scans revealed a large mass comprised of soft tissue with an ill - defined outline and an irregular peripheral enhancement on the right maxillary sinus . The mass had pushed against the right inferior wall of the maxillary sinus; destroyed the infraorbital foramen; completely destroyed the medial wall of the maxillary sinus; partially damaged the superior, middle and inferior turbinate; and obstructed the entire right nasal cavity . The lateral, anterior, and inferior walls of the right maxillary sinus were focally destroyed and a focal tumor extension was exposed . The mass extended superiorly to some part of the ethmoid sinus but did not involve the sphenoid sinus and frontal sinus (fig . An endoscopic biopsy revealed a carcinosarcoma with an osteosarcomatous element by hematoxylin - eosin staining and immunohistochemical stain (fig . 2). Fluorodeoxyglucose positron emission tomography (fdg pet)-ct was used to evaluate metastasis to adjacent organs . Fdg pet - ct revealed the presence of large mass of soft tissues with increased fdg uptake accompanied by bony erosion in the right maxillary sinus . Also, nodular lung lesions with increased fdg uptake in lateral basal and posterior basal segment of right lower lung were observed . Hence, the clinical tnm staging of this patient was t3n0m0 (stage iii). A surgical resection with postoperative chemoradiation therapy was planned and the patient underwent a total maxillectomy on the right side . Examination in the operating room revealed a large tumor filling the nasal cavity, maxillary sinus, and ethmoid sinus . The tumor had eroded through the inferior and medial orbital walls, however, periorbital invasion was not evident . The patient's postoperative course was uncomplicated, and he received postoperative radiation therapy with a total dose of 5,580 cgy . However, during the radiation therapy, a mass lesion in the periorbital area was found in an endoscopic examination . As a consequence, wide local excision was performed on the mass and the patient received a full course of irradiation, followed by chemotherapy (cisplatin+5 fluorouracil+taxotere). Two months later, the patient developed a massive recurrence infiltrating the orbit, cheek, and the masseter muscle . The patient decided not to receive further surgical treatment or chemotherapy, and was lost to follow - up . Carcinosarcoma is a biphasic tumor composed of dual components: an epithelial portion with squamous cell carcinoma and sarcomatoid lesion . This tumor can arise in any squamous epithelium of the body, such as the respiratory tract, upper aerodigestive tract, and reproductive organs . In the head and neck region, this tumor is extremely rare in the sinonasal cavity, as indicated by the few case reports available (table 1) [3,5 - 13]. Because of this rarity, tumor histogenesis, clinical course and resulting prognosis, and management are contentious issues . Concerning histogenesis, whether the cellular composition of carcinosarcoma is that of a true heterologeous tumor or whether it originates from a single malignant component having both epithelial and mesenchymal differentiation is debatable . Recent electron microscopic and immunohistochemical investigations revealed epithelial differentiation in some of the spindle cells in the sarcomatous element, suggesting that the sarcomatous element is derived from mesenchymal transformation of the carcinoma cells . From the known cases (table 1), carcinosarcoma of the maxillary sinus seems to preferentially appear in older patients . Clinically, the symptoms are often nonspecific, but unilateral nasal obstruction and bleeding are initial symptoms . Because of the high stage presentation at the time of diagnosis, this tumor presents significant therapeutic challenges and a fateful prognosis for the patient . Carcinosarcoma in the maxillary sinus was treated by surgery in eight of the 11 cases (table 1). Except for one case, but, clinical effectiveness of chemotherapy is impossible to determine with statistical significance due to the small number of cases to date . Although an accurate estimation of survival outcome is not conclusive, carcinosarcoma at the maxillary sinus confers a poor survival rate and a high local recurrence rate . In the known cases, tumors in the maxillary sinus recurred after management in seven of 11 cases (table 1). Local recurrences and metastases typically were lethal . An overall mortality rate of 42% at 30 months was reported in carcinosarcoma at other sites . Survival periods were from 2 - 40 months and local recurrences eventually occurred in most cases (table 1). When a carcinosarcoma tumor is located within the maxillary sinus, multimodal therapy (i.e., surgery, radiotherapy, and/or chemotherapy) should be considered . Also, before aggressive multimodal therapy is initiated, patients should be counseled concerning the tendency for aggressive patient behavior, poor prognosis, and likelihood of recurrence.
Midgut malrotation (mmr) is a congenital nonrotation or incomplete rotation of the primitive intestinal loop around the axis of superior mesenteric artery (sma) during fetal development . Mmr is more known by pediatrics than adult surgeons because it occurs at a rate of about 1 in 500 live births . Up to now, surgical treatment has been guided by the experience from pediatric surgery and ladd's procedure has been the treatment of choice in adults . However, a dilemma arises when patients are asymptomatic and incidentally diagnosed with mmr during another abdominal affection such as appendicitis . Volvulus is the main complication of mmr, but the occurrence of acute midgut volvulus of clinical significance in the absence of surgical treatment is unknown . Therefore, practicing ladd's procedure on asymptomatic patients may put them at risk of complications . Here, we report the case of a 37-year - old patient with acute left side appendicitis and asymptomatic mmr . A 37-year - old man was admitted at the emergency unit of our hospital with acute abdominal pain, which started the previous night . Pain was diffused, with tenderness mainly in upper left quadrant, and the temperature was 37.5c . Laboratory tests showed an elevated blood cell count (15,000) with normal c - reactive protein . Contrast - enhanced abdominal computed tomography showed acute left side appendicitis with midgut malrotation [figure 1a - c]. Appendix was enlarged, with a transverse diameter measured to 13 mm, associated with four stercoliths visualized in the plane of the left renal vein . The entire small bowel was found in the left half of the abdomen and the entire colon was found in the right half . The superior mesenteric vein (smv) was to the left of the sma rather than in the normal right ventral position . Surgical findings confirmed the severe inflammation of the appendix and the ileocecal region(s) located in the left quadrant . A ladd's procedure was performed, including derotation of the bowel, appendectomy, division of the mesenteric bands lying across the duodenum from cecum to right upper quadrant, widening of the base of the mesentery, taking down the ligament of treitz, moving the duodenum to the right, and finally returning the bowel to a position of nonrotation with the cecum placed into the left upper quadrant [figure 1d]. Superior mesenteric vein (arrow) is on the left side of the superior mesenteric artery (arrowhead); (b) coronal multiplanar reformation (mpr) from portal - venous phase ct demonstrates a midgut malrotation . Superior mesenteric vein (black arrowhead) is on the left side of the superior mesenteric artery (white arrowhead). The entire small bowel (thin arrows) is in the left half of the abdomen and colon (thick arrows) is in the right half; (c) coronal mpr from portal - venous phase ct demonstrates a acute upper left side appendicitis (arrows) with two stercoliths (arrowheads) and (d) operative view with the entire small bowel in the right half of the abdomen and colon in the left half left side acute appendicitis is extremely rare but can occur with congenital abnormalities with true left - sided appendix such as situs inversus totalis and mmr or as an atypical presentation of a long right - sided appendix, which is thus projected into the left lower quadrant . Mmr is a congenital anomaly referring to either nonrotation or incomplete rotation of the primitive intestinal loop around the axis of the sma during fetal development . Adult mmr is rare because the diagnosis is usually made before the age of 1 year . The most dreaded complication of mmr is volvulus, which occurs in 60 - 70% of neonates diagnosed with mmr and delay in diagnosis may lead to extended intestinal necrosis . Diagnosis is made in the adult in the presence of chronic abdominal symptoms, during surgery for acute abdomen, or incidentally during an imaging exam for no specific symptoms . In the case of our patient, this exam should show the whirlpool sign, which is wrapping of smv and bowel around the sma . Adult mmr is rare with an incidence ranging from 0.0001 to 0.19% in asymptomatic adults . The problem is to know whether it is necessary or not to treat asymptomatic mmr . Some authors have advocated operative management only in patients with mmr symptoms because they found that patients had a low risk of complication and elective surgery was not necessary with close follow - upb)second, performing appendectomy and ladd's procedure in the same time, to treat mmr and avoid complications . For some authors the risk of volvulus, even if low, warrants operative intervention especially since the risk for volvulus is lifelong and do not diminish with age . Actually, the current literature supports surgical correction of mmr for patients with minor symptoms or incidentally found mmr because very few of these patients are truly asymptomatic if careful history is obtained . In our case, this attitude is supported because of a difficult follow - up . Some authors have advocated operative management only in patients with mmr symptoms because they found that patients had a low risk of complication and elective surgery was not necessary with close follow - up second, performing appendectomy and ladd's procedure in the same time, to treat mmr and avoid complications . For some authors the risk of volvulus, even if low, warrants operative intervention especially since the risk for volvulus is lifelong and do not diminish with age . Actually, the current literature supports surgical correction of mmr for patients with minor symptoms or incidentally found mmr because very few of these patients are truly asymptomatic if careful history is obtained . In our case, this attitude is supported because of a difficult follow - up . The complication of surgical management of mmr is bowel obstruction secondary to adhesion after ladd's procedure . In a pediatric series, several studies of retrospective series have shown that laparoscopic treatment of mmr is feasible in most cases, with good perioperative outcome, but there is still a lack of long - term follow - up with this method . Benefits of laparoscopic surgery were: less pain, early return of bowel function, and shorter hospital stay with a decrease in the incidence of postoperative adhesion possibly translating into a lower incidence of postoperative bowel obstruction . According to literature, most patients are operated by laparotomy and only a few by a laparoscopic approach . Management of incidentally mmr diagnosis during another abdominal affection can be either conservative or not . The watch and wait attitude could be proposed if the patient could be followed, otherwise the surgical attitude should definitively be proposed.
To present a unique case of a 58-year - old female with toxic anterior segment syndrome (tass), following a triple procedure: descemet's stripping automated endothelial keratoplasty (dsaek), phacoemulsification and posterior chamber intraocular lens implantation . The patient was treated with topical dexamethasone sodium phosphate 0.1% and topical atropine sulfate 1% . Due to a slow improvement in her clinical status, oral prednisone 1 mg / kg / day was added . The anterior chamber reaction improved gradually, with tapering down of topical and oral treatment, until a complete resolution of the anterior chamber reaction was observed . Taking into account the estimated volume of dsaek triple procedures performed worldwide, we would expect an annual incidence of several tass cases, following triple dsaek procedures . However, we were unable to find any such previous reports in the literature . This fact raises questions regarding the cause of reduced tass incidence following triple dsaek procedures . Toxic anterior segment syndrome (tass) is an acute, sterile anterior chamber inflammation, which may develop following anterior segment surgery . Most cases are reported after uneventful cataract surgery . In patients requiring both cataract extraction and endothelial keratoplasty, a descemet's stripping automated endothelial keratoplasty (dsaek) triple procedure, consisting of phacoemulsification and intraocular lens (iol) implantation, followed by dsaek, up to the present, only two reports of keratoplasty - related tass have been published, both following penetrating keratoplasty . The first was a case series of 8 patients with tass - like, noninfectious, severe, early inflammation . The second, reported a large outbreak of tass (24 cases out of 94 procedures performed), presenting as postoperative keratitis with inflammatory anterior chamber reaction mainly hypopion and cells . This outbreak was found to be caused by faulty sterilization of the guided trephine system . To our knowledge herein is presented a case of tass following a triple procedure: dsaek, phacoemulsification and posterior chamber iol implantation . A 58-year - old female, suffering from bilateral fuchs endothelial dystrophy, bilateral cataract and corneal subepithelial scarring in her left cornea, following an adenovirus infection, underwent an uneventful dsaek triple procedure in her left eye: phacoemulsification, implantation of a posterior chamber iol and dsaek . Intraocular pressure was 13 mm hg, best - corrected visual acuity was 20/200, and the graft was attached to the recipient cornea, with a deep anterior chamber . Treatment with topical dexamethasone sodium phosphate 0.1% and ofloxacin 0.3% administered four times daily was initiated . Five days following the surgery, the patient presented with decreased vision in her left eye, which had begun 24 h postoperatively . On examination of her left eye, 1) revealed conjunctival hyperemia, a completely attached and centrally located endothelial corneal graft, deep anterior chamber with a cellular reaction of 3 + and prominent flare measuring 3 + . Visualization of the posterior segment was poor due to the clinical status of the anterior segment no details could be observed, but for a red light reflex . The patient was started on hourly topical dexamethasone sodium phosphate 0.1% . Due to the extensive posterior synechiae, the patient received a short and intensive course of topical tropicamide 0.5% and phenylephrine hydrochloride 10%, followed by topical atropine sulfate 1% . Follow - up examination, one day after the initiation of treatment, revealed significant improvement in the anterior chamber cellular reaction with no evident cells or flare, and residual posterior synechiae spanning 60 degrees . The posterior segment could be well visualized, showing no inflammatory involvement of the retina and vitreous . Fibrin fiber accumulation was only mildly improved and therefore, the patient was started on oral prednisone 1 mg / kg / day . Due to the early onset of visual deterioration (24 h postoperatively), the normal appearing posterior segment (visualized shortly after initiation of treatment) and the rapid clinical response to the above treatment, a clinical diagnosis of infectious endophthalmitis was ruled out . Follow - up examinations on days 3, 8 and 10 following initiation of treatment, revealed gradual absorption of fibrin and no evident posterior synechiae . 8 weeks following the tass diagnosis, the patient's best - corrected visual acuity was 20/50, with a spherical correction of + 1.25 diopter and a cylindrical correction of 1.75 diopter (170 axis). Intraocular pressure was 14 mm hg, with a clear, attached, thin endothelial corneal graft . No evidence of an anterior chamber reaction, fibrin formation or posterior synechiae was observed . According to the eye bank of america association, 42,606 corneal transplants were performed in the usa in 2009, out of which 18,221 were endothelial keratoplasty procedures (2009 eye banking statistical report, washington, dc, eye bank association of america). The world health organization (who) estimates that about 120,000 corneal transplants are performed worldwide each year (human organ and tissue transplantation report by the secretariat, submitted at the 112th session of the world health organization executive board, may 2003). There is no sufficient data in the literature regarding the volume of triple dsaek procedure surgeries performed worldwide . The frequency of tass reported in the literature is about 0.250.8% [5, 6]. Therefore, we would expect an annual incidence of several tass cases, following triple dsaek procedures . It is probable that the cataract extraction constituent of the triple dsaek procedure is responsible for the occurrence of tass in our patient . Nevertheless, the fact that there is no previous report of tass following such a procedure raises questions regarding the cause of the reduced incidence of tass following triple dsaek procedures . Due to the fact that the inflammatory reaction may jeopardize the integrity of the endothelial graft and reduce the chances of a successful transplant, we intend to closely monitor this patient and apply a more gradual tapering down of her current treatment.
Inflammatory -cell inhibition and apoptosis are increasingly accepted as key contributors to failing insulin secretion leading to type 1 and type 2 diabetes [1, 2]. Interleukin-1, a 17 kda proinflammatory cytokine and mediator of inflammation, fever, and acute - phase responses [1, 3], inhibits -cell function in vitro and in vivo by signaling via nfb and mitogen activated protein kinases (mapk) to activate endoplasmic reticulum and mitochondrial death pathways [47]. The mapk family encompasses the extracellular signal - regulated kinase (erk), c - jun n - terminal kinase (jnk), and p38 cascades . The precise contribution of the jnk pathway to stress - induced -cell failure is not fully understood, especially with regard to the differential roles of the jnk subtypes, jnk1, jnk2, and jnk3 . The jnk proteins control the expression of immediate early genes such as ap-1 transcription factor family members and are important regulators of both apoptosis and survival, depending on the biological context [8, 9]. Three mammalian genes encoding for jnk have been identified: jnk1, jnk2, and jnk3, located on different chromosomes [10, 11]. Jnk1 and jnk2 are expressed in a large variety of tissues regulating cell proliferation, differentiation, inflammation, autoimmunity, obesity, and tumorigenesis . Jnk3 expression was thought to be restricted to the brain, heart, and testes [13, 14]; however, more recently, jnk3 was found to be expressed also in human and mouse pancreatic -cells . Mice deficient in a single jnk allele survive, as do jnk1 jnk3 and jnk2 jnk3 mice, whereas combined genetic disruption of jnk1 and jnk2 alleles causes early embryonic death due to severe dysregulation of apoptosis in the brain . Additionally, jnk1 /jnk2 mouse embryonic fibroblasts (mefs) are protected against uv - induced apoptosis, indicating that jnk1 and jnk2 are required for a normal apoptotic response to uv exposure . Furthermore, jnk3 mice are protected from stroke, neuronal death, and oxidative stress . Supporting these direct observations of the importance of jnk in proapoptotic signalling, cell - permeable jnk inhibitory protein-1 (jip-1) derived jnk inhibitory peptides or the jnk inhibitory small molecule sp600125 decrease intracellular jnk signalling and improve cell survival in vitro and in vivo [1822]. Splicing of the jnk genes gives rise to more than twelve different transcript variants [13, 23] translating into proteins with and without a cooh - terminal extension to generate both 46 kda and 54 kda isoform proteins with a high level of homology . Initially, the different jnk subtypes were thought to have largely redundant functions, but different tissue distribution, substrate preferences, and expression patterns support that the jnk subtypes also have nonredundant functions and are involved in distinct cellular processes [10, 12, 13, 23, 25]. However, little is known about how the individual jnk isoforms and subtypes mediate apoptosis . Apart from phosphorylating and activating members of the activating protein-1 (ap-1) transcription factor family, jnk proteins regulate other proteins involved in cell proliferation and apoptosis, including p53, myc, and members of the bcl-2 family of proteins [6, 26, 27]. The precise contribution of the individual jnk subtypes in mediating il-1-induced -cell apoptosis is largely unknown, although a protective role of jnk3 in il-1, tnf-, and ifn--induced -cell apoptosis via akt2 signaling has been suggested [15, 28]. In these studies, no differentiation was made between the roles of the jnk subtypes in the signaling pathways of the three individual proinflammatory cytokines . Since jnk subtype activation is stimulus dependent and as il-1 is indispensable in the proapoptotic combination of inflammatory cytokines, the action of tnf- and inf- being mainly to synergize with il-1, it is important to investigate the differential role of the jnk subtypes in stimulus - specific pancreatic -cell signalling . Here, we investigated the individual roles of jnk1, jnk2, and jnk3 in il-1-induced apoptosis in insulin - producing ins-1 cells and provide evidence for a critical role of jnk1 in mediating il-1-induced -cell apoptosis, whereas jnk2 but not jnk3 conferred protection . The clonal rat -cell line ins-1 (gift from wollheim, geneva, switzerland) and ins-1 cell lines stably expressing shrna were grown in rpmi-1640 medium with 11 mmol / l glucose (invitrogen, naerum, denmark) supplemented with 50 mol / l -mercaptoethanol, 100 u / ml penicillin, 100 g / ml streptomycin, and 10% heat - inactivated fetal bovine serum (fbs) (invitrogen). Recombinant mouse il-1 was from bd bioscience pharmingen (san diego, ca, usa). Jnk1(f-3) mouse monoclonal antibody raised against amino acid 1 - 384 of full length jnk1 p46 human origin was purchased from santa cruz technologies (santa cruz, ca, usa, catalog number: sc-1648, used at 1: 1000 dilution). Jnk2 rabbit polyclonal antibody raised against a synthetic peptide for human jnk2 (catalog number: #4672, used at 1: 1000 dilution), jnk3 rabbit monoclonal antibody raised against a synthetic peptide for human jnk3 (catalog number: #55a8, used at 1: 1000 dilution), p - jnk (thr183/tyr185) polyclonal rabbit antibody raised against a synthetic phosphopeptide corresponding to residues surrounding thr183/tyr185 of human sapk / jnk (catalog number: #9251, used at 1: 1000 dilution), t - jnk polyclonal rabbit antibody raised against a recombinant human jnk2 fusion protein (catalog number: #9252, used at 1: 1000 dilution), cleaved caspase 3 (asp175) rabbit polyclonal antibody raised against amino terminal residues adjacent to asp175 in human caspase 3 (catalog number: #9661, used at 1: 500 dilution), myc (d84c12) rabbit monoclonal antibody raised against synthetic peptide corresponding to amino - terminal residues of c - myc (catalog number: #5605, used at 1: 1000 dilution), and -tubulin (9f3) rabbit monoclonal antibody raised against human -tubulin (catalog number: #2128, used at 1: 1000 dilution) were all from cell signalling (beverly, ma, usa). The mouse monoclonal -actin antibody raised against -cytoplasmic actin n - terminal peptide, ac - asp - asp - asp - ile - ala - ala - leu - val - ile - asp - asn - gly - ser - gly - lys, conjugated to keyhole limpet haemocyanin (klh) was obtained from abcam (cambridge, uk, catalog number: ab6276, used at 1: 10000 dilution). The specificity of the jnk antibodies was previously verified against recombinant jnk1, jnk2, and jnk3 protein using western blot analysis . Ft cells, used to produce lentivirus, were cultured in d - mem medium (invitrogen) supplemented with 100 u / ml penicillin, 10 nm mem nonessential amino acids, 1 mm sodium pyruvate, and 10% fbs (invitrogen) (complete d - mem). Ht1080 cells, used for virus titration, were cultured in d - mem medium (invitrogen) supplemented with 100 u / ml penicillin, 100 g / ml streptomycin, and 10% fbs (invitrogen). Ins-1 cell lines, stably expressing jnk1, jnk2, or jnk3 shrnas, nonsense shrna, or empty vector, were created as described in . In brief, ins-1 cells were transduced with an moi of 5 with virus generated by transfection of hek293 ft cells with the lentiviral vectors plko.1 jnk1 (trcn0000055115), plko.1 jnk2 (trcn0000012590), plko.1 jnk3 (trcn0000012634), or empty vector (all from open biosystems, thermo scientific, st . Leon - rot, germany) or plko.1 nonsense (shc002) (sigma, brondby, denmark). All constructs contained a puromycin - resistance gene as mammalian selection marker, and stably transduced ins-1 cells were selected using 1 g / ml puromycin (sigma). Ins-1 cell lines were passaged a minimum of three times and tested for knockdown efficiency and specificity compared to empty vector and nonsense shrna expressing ins-1 cell lines . Total rna was isolated using trizol (sigma) followed by rneasy mini elute kit (qiagen, hilden, germany) purification . 1 g of total rna was used to prepare targets by one - cycle target labeling kit (affymetrix, santa clara, ca, usa) following the instructions of the manufacturer . Hybridization cocktails were hybridized onto rat genome 230 2.0 genechips, containing 31,099 rat gene probes, at 45c for 17 h (60 rpm) in a hybridization oven 640 (affymetrix). Genechips were rinsed and stained in a genechip fluidics station 450 using the fluidics protocol eukge - ws2v5_450 (affymetrix). For all conditions, three separate experiments were analyzed on separate arrays; that is, a total of 36 arrays were used . Array data is available at arrayexpress (https://www.ebi.ac.uk/arrayexpress), accession number e - mtab-3146 . To adjust for nonspecific hybridization, optical effects, and comparability, significant differential expression was assessed using the moderated t - statistics for pairwise comparison between conditions implemented in the limma package . The comparisons performed were 45 min il-1 exposed jnk1 knockdown (kd) ins-1 cells adjusted for nonexposed jnk1 kd versus 45 min il-1 exposed ns control ins-1 cells adjusted for nonexposed ns control ins-1 cells; 45 min il-1 exposed jnk2 kd ins-1 cells adjusted for nonexposed jnk2 kd versus 45 min il-1 exposed ns control ins-1 cells adjusted for nonexposed ns control ins-1 cells; and 45 min il-1 exposed jnk3 kd ins-1 cells adjusted for nonexposed jnk3 kd versus 45 min il-1 exposed ns control ins-1 cells adjusted for nonexposed ns control ins-1 cells . Genes were considered to be significantly regulated if the log2 fold change was> 1 or <1 and the p value was <0.05 . Only probes that could be mapped to gene identifiers using the rat2302.db probe annotation package were considered for further analysis . For clustering analysis, we used hierarchical clustering as implemented in the heatmap.2 function in the gplots r package . Briefly, the mean log2 expression value for three replicates of the 12 conditions was calculated for each probe . Overrepresented biological processes among groups of regulated genes were identified by hypergeometric testing of gene ontology (go) terms using david [32, 33]. Only go terms reaching a benjamini corrected p value <0.05 were considered significantly overrepresented . Ins-1 cells were exposed to 150 pg / ml il-1 or vehicle over either a 12 h (stable shrna cell line experiments) or 24 h (ins-1 cell line experiments) time course and total rna was isolated using the rneasy kit (qiagen) and quantified on a nanodrop 1000 microvolume spectrophotometer . The rna was treated with recombinant shrimp dnase (affymetrix), and first strand cdna was synthesized from 2 g of rna using the high capacity cdna reverse transcription kit (applied biosystems, carlsbad, ca, usa) following the manufacturer's protocol . Quantitative rt - pcr was performed in a 10 l volume using 0.5 l of premixed taqman primer / probes (applied biosystems), 5 l 2x taqman universal master mix (applied biosystems), and 4.5 l template (20 ng) and run on a 384-well plate in triplicate on the applied biosystems prism 7900ht real - time pcr machine for 40 cycles . The following primer / probes were purchased from applied biosystems: hprt1 (rn01527840_m1), rn18s1 (hs03928990_g1), jnk1 (rn01453358_m1), jnk2 (rn00569058_m1), jnk3 (rn00563035_m1), jun (rn00572991_s1), trp53 (rn00755717_m1), junb (rn00572994_s1), jund (rn00824678_s1), and myc (rn00561507_m1). The primer / probe sequences for the jnk isoforms are listed in table 1 and synthesized by integrated dna technologies (idt, berchem, belgium). We utilized the human isoform - specific primer and probe sequences determined by dreskin et al . And modifying them based upon a cross species homology comparison between human and mouse, as the rat jnk isoform sequences were not published . Relative transcript quantities were calculated by the standard curve method and normalized to the average of the housekeeping genes 18s and hprt1 . The appropriate housekeeping genes were selected by analyzing the mrna expression of four common housekeeping genes, gapdh, ppia, 18s, and hprt1, in ins-1 cells after 12 and 24 h exposures to il-1. The two genes used were the least variable following il-1 treatment . Ins-1 cells (0.8 10 cells / well for western blotting and 0.075 10 cells / well for cell death detection assay) were transfected with sirna directed against rat myc (sigma), negative control sirna (mission sirna universal negative control, sigma), or vehicle . The cells were transfected using dharmafect4 (thermo scientific, denmark) according to the manufacturer's protocol, with a final concentration of sirna of 50 nmol / l . The cells were incubated for 22 h with sirna or vehicle and then exposed to il-1 (150 pg / ml) or left nonexposed for 24 h. protein was isolated and analyzed by western blotting and apoptotic cell death was measured by the cell death detection elisa (roche, hvidovre, denmark). Ins-1 cells or ins-1 cell lines stably expressing shrna were grown to 8090% confluence, exposed to il-1 (150 pg / ml) or vehicle for up to 24 h, washed in ice - cold pbs, and lysed for 15 min on ice using 1x lysis buffer (cell signaling). The protein concentration was measured by the bradford method (bio - rad, copenhagen, denmark). 3040 micrograms of total protein were mixed with 4x lds sample buffer (invitrogen), heated for 5 min at 70c, and loaded on 10% nupagebis - tris gel (invitrogen). The blots were blocked for 1 h in 1x tris - buffered saline (ph 7.6) containing 0.1% tween 20 and 5% bsa and afterwards incubated overnight at 4c with primary antibody . Blots were rinsed and incubated with a rabbit secondary horseradish peroxidase - conjugated antibody for 1 h. immune complexes were detected by chemiluminescence using super signal west dura extended duration substrate (thermo scientific), and images were captured digitally by use of the fuji las3000 platform (fujifilm, tokyo, japan) or the alpha innotech flourchem q imaging platform (kem - en - tec, taastrup, denmark). Apoptotic cell death was measured by the detection of dna - histone complexes released from the nucleus to the cytosol of cells by using cell death detection elisa (roche) as described by the manufacturer . In brief, 0.075 10 ins-1 cells stably expressing jnk1, jnk2, jnk3, nonsense shrna, or empty vector were cultured 24 h prior to exposure to il-1 (150 pg / ml) or vehicle . After an additional 24 h, the culture medium was removed and cells lysed in 200 l 1x lysis buffer for 30 min at room temperature . The lysate was then centrifuged for 10 min at 200 g, incubated with anti - dna peroxidase and anti - histone - biotin, and added to streptavidin - coated wells for 2 h at room temperature . Absorbance was measured after addition of peroxidase substrate abts (2.2-azino - bis-3-ethylbenzthiazoline-6-sulfonate) at 405 and 490 nm . All statistical analyses were performed at raw data using graphpad prism (graphpad software inc ., san diego, ca, usa). Where the figures show normalized data, the mean of the controls of the individual experiment was set to 1 and the error bars show the standard error calculated from the raw data . Statistical significance was determined using one- or two - way anova with post hoc tests, or student's t - test as appropriate . To determine which isoforms are expressed in the ins-1 cell model, we created rat - specific primers and probes (table 1), utilizing the human isoform - specific primer and probe sequences determined by dreskin et al . And modifying them based upon a cross species homology comparison between human and mouse, as the rat jnk isoform sequences have not been published . Utilizing quantitative rt - pcr, we found that the ins-1 cells expressed jnk11, jnk11, jnk21, jnk22, jnk31, and jnk32 . Jnk12 and jnk12 were expressed at very low levels and jnk21 and jnk22 were not expressed in ins-1 cells (data not shown). We chose to examine il-1-induced regulation of the six isoforms with the higher level of expression in the ins-1 cell line . We exposed ins-1 cells to 150 pg / ml of il-1 or vehicle for 2 to 24 h. we used 150 pg / ml il-1 to induce apoptosis in the ins-1 cells as titration experiments showed that this was the lowest concentration sufficient to induce maximal apoptosis (data not shown). Utilizing rt - pcr, we found that jnk11, jnk11, jnk21, and jnk22 were not regulated by il-1, whereas jnk31 was significantly upregulated at 8 h and jnk32 was upregulated from 8 to 24 h (figures 1(a)1(f)). Comparison of the data obtained with jnk isoform - specific primers with data obtained with nonisoform - specific taqman primers confirmed that jnk1 and jnk2 were not regulated by il-1, whereas jnk3 was upregulated from 6 to 12 h (supplementary figures 1a1c, in supplementary material available online at http://dx.doi.org/10.1155/2016/1312705). As there are no available commercial jnk isoform - specific antibodies, we used jnk1, jnk2, or jnk3 subtype specific antibodies . We exposed ins-1 cells to 150 pg / ml il-1 for 4 to 24 h to measure the expression and regulation of the jnk subtype proteins by western blot analysis . The jnk1 subtype encompasses jnk11 and jnk11 isoforms translating into 46 kda and jnk12 and jnk12 isoforms translating into 54 kda isoform proteins, respectively . We found that only jnk1 46 and 54 kda isoform proteins expressions were significantly regulated in that they were decreased by il-1 in a time - dependent manner (figure 2(a)). The jnk2 subtype includes jnk21 and jnk22 translating into 46 kda and 54 kda isoform proteins, respectively . The jnk2 antibody reacts only with the 54 kda isoform protein, compatible with jnk22 being the predominating jnk2 isoform expressed in ins-1 cells (unpublished data). The jnk3 subtype specific antibody reacts only with the 54 kda protein isoform corresponding to jnk32; however, jnk31 that translates into a 46 kda protein isoform and jnk32 are expressed at equally high levels in ins-1 cells (unpublished data). However, the observed il-1-induced jnk3 mrna expression did not translate into increased jnk3 54 kda isoform protein expression (figure 2(a)). Of note, detection of il-1-regulated jnk31 isoform protein expression was not possible with this jnk3 subtype antibody . Finally, we exposed ins-1 cells to 150 pg / ml il-1 or vehicle for 0.5 to 24 h to measure jnk phosphorylation as a measure of jnk activity . Jnk 46 and 54 kda isoforms were both significantly phosphorylated after 0.5 to 6 h of il-1 exposure, with maximum peak phosphorylation of the isoforms after 0.5 to 1 h of il-1 exposure (figure 2(b)). In summary, il-1 increased jnk31 and jnk32 mrna expression and decreased jnk1 subtype protein expression in ins-1 cells . Furthermore, il-1-induced jnk phosphorylation peaks after 0.5 to 6 h of stimulation . To investigate the differential roles of the jnk subtypes in il-1-induced cell death, we produced stable ins-1 knockdown cell lines expressing shrnas directed against jnk1, jnk2, or jnk3, as well as nontarget (nonsense, ns) shrna and empty vector (ev) controls . The jnk knockdown cell lines were tested for knockdown specificity and efficiency by western blot analysis using jnk subtype specific antibodies (figure 3(a)). We achieved specific knockdown of the intended jnk subtypes by approximately ~80% jnk1, ~75% jnk2, and ~45% jnk3 knockdown compared to control ns (ns shrna) ins-1 cells (figure 3(a)). We next wished to measure early response jnk activity in the stable jnk knockdown ins-1 cell lines to investigate how knockdown of the individual jnk subtype affected total phosphorylation status of the different jnk isoforms (46 or 54 kda). We exposed the stable jnk knockdown ins-1 cells to 150 pg / ml il-1 or vehicle for 0.5 h (figure 3(b)) as we detected peak jnk phosphorylation at this time point in nontransduced ins-1 cells (figure 2(b)). Though the jnk knockdown ins-1 cell lines showed specific jnk1, jnk2, or jnk3 knockdown (figure 3(b)), this did not affect the total level of jnk (all jnk subtypes) (figure 3(b)). Interestingly, jnk1 knockdown (jnk1 shrna) ins-1 cells showed significantly reduced il-1-induced phosphorylation of the 46 kda isoforms compared to control ns expressing ins-1 cells . Phosphorylations of the 46 kda isoforms in jnk2 knockdown (jnk2 shrna) and jnk3 knockdown (jnk3 shrna) ins-1 cells were not different compared to the control ns ins-1 cells (figure 3(b)). There were no differences in phosphorylation of the 54 kda jnk isoforms between 0.5 h il-1 exposed ns and jnk1, jnk2, or jnk3 knockdown ins-1 cell lines (figure 3(b)). To summarize, only jnk1 knockdown reduced early il-1-mediated activity of the 46 kda jnk isoforms as determined by phosphorylation in ins-1 cells . Next, to investigate the functional impact of knockdown of the individual jnk subtypes, we exposed the stable jnk knockdown and control cell lines to 150 pg / ml of il-1 or vehicle for 24 h, after which apoptosis markers were measured by elisa and western blotting . In contrast, knockdown of jnk1 prevented il-1-induced apoptosis, measured as decreased levels of cytoplasmic nucleosomes (figure 4(a)). Jnk1 interestingly, knockdown of jnk2 significantly potentiated il-1-induced apoptosis and caspase 3 activation, while jnk3 knockdown did not significantly affect il-1-induced apoptosis or cleavage of caspase 3 compared to ns cells . Since the jnk members had differential effects on il-1-induced apoptosis, we next determined if there were unique early response gene clusters regulated by each jnk member . Ins-1 cells stably expressing shrnas directed against jnk1, jnk2, jnk3, or ns were exposed to 150 pg / ml of il-1 or vehicle for 45 min . Mrna expression was analyzed by microarray analysis . When we compared the normalized gene expression profile of the 45 min il-1 exposed jnk1, jnk2, or jnk3 knockdown ins-1 cells with the gene expression profile of 45 min il-1 exposed ns ins-1 cells, adjusted for their il-1 nonexposed control conditions, 74, 144, and 134 genes, respectively, were found to be differentially regulated (supplementary tables 13). The jnk1 knockdown ins-1 cell line gene expression pattern was significantly different from that of jnk2 or jnk3 knockdown and ns ins-1 cells (supplementary figure 2). However, overall, there were no significant clusters or pathway associations to cast light on the potential pathways or early il-1-induced mechanisms underlying the unique actions of the jnk subtypes, and we therefore decided to proceed with a candidate gene approach to understand the mechanisms of action of the jnk subtypes . We therefore next analyzed in the jnk knockdown cells specific jnk - related signalling molecules known to be regulated by the jnk proteins to determine if the regulation of these genes by il-1 is mediated specifically by jnk1 . Ins-1 cells stably expressing shrna directed against jnk1, jnk2, or jnk3, or the ns or ev controls, were exposed to 150 pg / ml of il-1 for 2, 6, and 12 h. il-1 upregulated jun mrna from 2 to 12 h, trp53 mrna at 6 and 12 h, junb mrna from 2 to 12 h, jund mrna at 2 h, and myc mrna at 12 h (figures 5(a)5(e)). These findings indicate that many of the common jnk - related signalling proteins are regulated by il-1. Interestingly, there was a temporal difference in the regulation of the mrna transcripts, as jun and junb were upregulated at all time points, whereas myc was upregulated only at 12 h and jund was upregulated significantly only at 2 h. knockdown of jnk1, jnk2, or jnk3 did not affect the regulation of trp53 or junb mrna expression by il-1. This indicates that these mrna transcripts are not regulated by jnk1, jnk2, or jnk3 specifically, either due to redundancy in the actions of the jnk members or due to the fact that they are not regulated by the jnk proteins in ins-1 cells . Jnk1 knockdown increased basal jun mrna expression at 2 h (figure 5(a)) and attenuated the upregulation of myc by il-1 at 12 h (figure 5(e)), indicating that jnk1 may be involved in the basal regulation of jun and that it specifically mediates the regulation of myc mrna expression by il-1. Next, we wished to determine if il-1 regulates the levels of myc protein and if jnk1 mediates this regulation in response to il-1. Ins-1 cells were exposed to 150 pg / ml of il-1 or vehicle for 4 to 24 h, and protein was analyzed by western blot analysis . Il-1 increased the total amount of myc protein from 12 to 24 h (figure 6(a)). The increase in total myc protein by il-1 corresponded to the timing of the upregulation of myc mrna by il-1, which we noted at 12 h (figure 5(e)). Next, we exposed the ins-1 cells stably expressing shrna directed against jnk1, jnk2, or jnk3, or the ns or ev controls to 150 pg / ml of il-1 or vehicle for 16 h. knockdown of jnk1 prevented il-1 induction of total myc protein expression (figure 6(b)). These results, taken together with the data in figure 5(e), indicate that jnk1 mediates inflammatory regulation of myc transcription and translation in ins-1 cells . The myc protein has been shown previously to be involved in jnk - mediated apoptosis triggered by uv irradiation or antineoplastic drugs [26, 35]. We therefore wished to determine if myc mediates il-1-induced apoptosis in the ins-1 -cell model . Ins-1 cells were transiently transfected with either sirna directed against myc or a control ns oligonucleotide sequence and then exposed to 150 pg / ml of il-1 or vehicle for 24 h (figure 7). Transfection with sirna directed against myc decreased the total level of myc by ~2.8-fold detected by western blot analysis (figure 7(a)) and, interestingly, attenuated the il-1-induced caspase 3 activation by ~3.2-fold (figure 7(b)). In addition, transfection of ins-1 cells with myc sirna attenuated il-1-induced apoptosis by ~1.6-fold (figure 7(c)). This indicates that myc may mediate il-1-induced apoptosis in the ins-1-cell line and, taken together with the previous results, that the jnk1-myc pathway is an important mediator of il-1-induced apoptosis . Few studies have investigated the differential roles of the jnk subtypes in cellular apoptosis, or if there are specific downstream signaling proteins utilized by a specific jnk subtype to mediate its actions . It is known that il-1 does not induce apoptosis in most cells but the pancreatic -cells belong to the exceptions . Many studies have shown that jnk plays an important role in cellular apoptosis and specifically in cytokine and il-1-induced -cell apoptosis most using the nonspecific jnk inhibitor sp600125 . We show here that jnk11, jnk11, jnk21, jnk22, jnk31, and jnk32 isoforms are expressed in ins-1 cells whereas only the jnk3 isoforms mrna is regulated by il-1. When we analyzed jnk1, jnk2, and jnk3 subtype protein expression, only jnk1 subtype was significantly downregulated by il-1 after 24 h of exposure . We believe that this downregulation of jnk1 subtype is not mediated by proteases after cell lysis since we use a broad protease inhibitor cocktail in our lysis buffer . The reduced jnk1 subtype expression may though be a side effect of apoptosis due to caspase 3-mediated cleavage; however, in other stress - induced apoptotic cell lines, jnk protein expression is shown to be caspase - independent [37, 38]. Gene expression profiling studies followed by functional characterization of candidate genes have demonstrated that the exposure of insulin - producing cell lines, fluorescence - activated cell - sorted primary rodent -cells, intact rodent islets, and human islets to proinflammatory cytokines induces not only upregulation of proapoptotic / downregulation of antiapoptotic genes, but also a protective response including downregulation of proapoptotic / upregulation of antiapoptotic genes, with a high degree of concordance between the different model systems [39, 40]. These findings suggest that inflammatory attack on the pancreatic -cell induces a race between deleterious and protective responses, of which the deleterious pathways eventually prevail . We believe that the observed decrease in jnk1 content following 16 h of exposure to il-1 is a late compensatory negative feedback mechanism serving to suppress signaling via jnk1; however, this late suppression in jnk1 content is insufficient to prevent apoptosis . Knockdown of jnk1 completely prevented il-1-induced ins-1 cell apoptosis, while jnk2 knockdown potentiated cytokine - induced ins-1 cell apoptosis . This is an interesting observation as jnk2 has been shown to inhibit jnk1 signaling, and thus knockdown of jnk2 may act to increase jnk1 activity . Knockdown of jnk3 did not significantly affect il-1-induced apoptosis compared to ns cells but an increase could be observed, but not in levels of cleaved caspase 3 . Both jnk1 and jnk2 knockdown protected ins-1e cells against apoptosis by 40 and 60%, respectively, in that study . We found complete protection of apoptosis by jnk1 knockdown and found that jnk2 knockdown potentiated the effect of il-1. Our study and differed in the following respects: we utilized ins-1 cells stably expressing shrna, whereas abdelli et al . Used a cytokine combination, containing 10 ng / ml il-1, 25 ng / ml tnf-, and 150 ng / ml ifn-, while we exposed ins-1 cells to only il-1 at 150 pg / ml . Thus, using a cytokine combination, confounding pathways and downstream signaling molecules are activated compared to testing il-1 alone . However, as we only achieved ~50% knockdown of jnk3 in this study, new studies with more efficient jnk3 knockdown might acknowledge jnk3 as a protective protein . We also investigated early il-1-induced jnk phosphorylation as a surrogate for jnk activity in the jnk knockdown ins-1 cells . Here, we only observed significant reduction of phosphorylation of the 46 kda isoform in 0.5 h il-1 exposed jnk1 knockdown ins-1 cells when compared to ns ins-1 cells . This was not surprising to us as the major jnk1 isoforms expressed in ins-1 cells translate into 46 kda proteins and as we achieved a high jnk1 knockdown efficiency in the jnk1 knockdown ins-1 cell line . Despite high specific knockdown of the individual jnk subtypes in the shrna expressing ins-1 cell lines, we did not see any changes in total levels of jnk . The total jnk antibody recognizes all three jnk subtypes and therefore a reduction in only one subtype is unlikely to affect the total amount of jnk . The reduced 46 kda phosphorylation might explain the decreased il-1-induced apoptosis in jnk1 knockdown ins-1 cells as inhibition of total jnk activity decreases intracellular jnk signalling and improves rodent -cell survival in vitro in response to cytokines [5, 18, 19, 43]. We did not observe altered 54 kda isoform phosphorylation between 0.5 h il-1 exposed ns and jnk1, jnk2, or jnk3 perhaps indicating that il-1-induced phosphorylation in the individual jnk knockdown subtype ins-1 cells is covered by the remaining jnk isoforms . There are many potential downstream targets of jnk1 that activate apoptosis, such as the mitochondrial stress pathway and caspase activation, but there are few studies analyzing if there are specific signaling proteins or transcription factors that are uniquely regulated by each jnk subtype . We performed microarray mrna expression profiling to investigate the genes regulated by the jnk subtypes . There were no differences in basal gene expression levels in jnk1, jnk2, or jnk3 shrna expressing ins-1 cells when compared to ns shrna expressing ins-1 cells, indicating that individual jnk subtype knockdown does not initiate differential basal gene regulation . Exposure of the cells to il-1 for 45 min initiated differential gene regulation; however, no significant clusters were identified . This indicates that the jnk subtypes might mediate their major differential effect by modulating activity of proteins rather than affecting early il-1-induced gene transcription in -cells . Using a transcription factor candidate gene expression analysis, we found that myc was specifically regulated by jnk1 after 12 h of il-1 exposure . We found that myc mrna and total protein levels were specifically downregulated in jnk1 knockdown ins-1 cells and that knockdown of myc decreased il-1-induced apoptosis and cleaved caspase 3 . In addition to activating myc expression, jnk proteins are known to increase the stability of the myc protein that normally has a short half - life of approximately 30 minutes . Our data also suggests that jnk1 increases the stability of total myc, as myc protein levels were increased in wild - type ins-1 cells by il-1 from 16 h to 24 h; additionally, we found that myc mrna expression was increased at 12 h. this increase could be due to an increased stability of the mrna transcript, as opposed to transcriptional activation, given that there is a delayed increase in myc mrna expression relative to other jnk - regulated genes, such as jun, junb, and jund, which were all increased at 2 h. myc is involved in mediating numerous cellular functions, including cell proliferation, growth, differentiation, and apoptosis . There is much debate as to how myc regulates these opposing cellular processes, but it seems to be through a complex and intricate balance between myc and its protein interaction partner max, as well as other signaling pathways . Myc induces the expression of the tumor suppressor protein cyclin - dependent kinase inhibitor 2a, which stabilizes p53, an important regulator of apoptosis, by sequestering the e3 ubiquitin - protein ligase, mouse double minute 2 homolog, in turn degrading p53 . Myc also induces the proapoptotic bh3-only protein, bim, and blocks the expression of the antiapoptotic proteins bcl-2 and bcl - xl . Myc has been shown to promote intrinsic cell death by destabilizing via the bax protein . Thus, myc knockdown in cisplatin - induced apoptosis in a549 human lung carcinoma cells blocked cytochrome c release and prevented bax oligomerization . P53 induction of p21cip1 drives the cell into senescence, and blocking p21 upregulation redirects the actions of p53 to activate apoptotic pathways . P53 was significantly upregulated in ins-1 cells following il-1 treatment; however, when we analyzed p21cip1 mrna expression in the ins-1 cells stably expressing jnk1 shrna, we did not observe a decrease in expression, and thus we do not favor this mechanism of action . In nonstressed islets, myc expression is low and -cell specific myc overexpression markedly increases -cell apoptosis . Here, we suggest that myc is a key mediator of il-1-induced apoptosis in the ins-1 cell model . We additionally propose that jnk1 specifically regulates myc, implicating myc as a potential downstream relay of the apoptotic effect of jnk1 . Further experiments are likewise required to verify the direct involvement of myc in mediating the apoptotic actions of jnk1, such as overexpression of jnk1 combined with myc knockdown . In summary, this study suggests that jnk1 is a key mediator of il-1-induced ins-1 cell apoptosis, that the transcription factor myc is regulated specifically by jnk1, and that myc may mediate the apoptotic actions of jnk1 . Future studies are required to investigate if the jnk1-myc pathway is involved in cytokine - induced apoptosis in other cell types to determine if this is a pancreatic -cell specific effect or a more general cellular effect . We propose that the jnk1-myc pathway may be a target for protecting pancreatic -cells from inflammatory stress, and thus a potential treatment target in diabetes.
Dental implantation is an effective therapeutic option to replace missing teeth in modern dentistry . In order for an implant to successfully sustain functional loads, there must be sufficient alveolar bone around the implant . Implants must be at least 5 mm wide and 7 - 10 mm in length1 . After implantation, dehiscence or fenestration defects frequently occur because of insufficient residual bone volume . Bone augmentation should be performed prior to and/or simultaneously with implant placement when the preoperative examination shows a lack of alveolar bone volume at the implant placement site . Alveolar bone defects may be treated with various bone regeneration techniques including block bone graft, guided bone regeneration (gbr), ridge splitting, and distraction osteogenesis2,3,4,5 . Gbr is one of the most predictable methods, which mostly uses a barrier membrane to separate the grafted defect and the surrounding connective tissue for successful bone regeneration3 . Two major types of non - resorbable barrier membranes are expanded polytetra - fluoroethylene (e - ptfe) and titanium mesh6 . Despite many advantages of gbr, it is difficult to maintain suitable space for ideal bone regeneration because unless there is a hard structure to support the space, soft tissue collapses into it . It has been applied to various defects indicated for gbr, including sinus augmentation sites8,9 . Several studies have used gbr procedures with titanium mesh and various bone graft materials including autologous bone, bovine bone mineral, alloplastic materials, and their combinations8,10,11,12,13,14 . However, studies that have used titanium mesh and allogeneic graft, especially freeze - dried bone allograft (fdba), are rare . Few of these studies present histologic evidence of bone maturation on the grafted site with titanium mesh and fdba . One complication related to titanium mesh is the high risk of exposure following repeated mucosal irritation . Although titanium mesh exposure does not always lead to bone augmentation failure in a clinical setting8,13, the bone quality of gbr would be adversely affected15 . Before its application, titanium mesh should be cut, bent, and trimmed . Any prominent, sharp edges resulting from these manipulations may cause membrane exposure . Recently, preformed titanium mesh with round and blunt edges were developed to prevent mucosal irritation . We used a customized, three - dimensional, preformed titaniumn mesh (smartbuilder; osstem, busan, korea) to reconstruct the peri - implant defects occurring immediately after implant placement . Clinical and histologic investigations were used to evaluate the preformed titanium mesh's efficacy as a barrier membrane against a mixture of autologous and fdba in localized alveolar bone regeneration . A total of 10 patients (5 male and 5 female, aged 17 - 87 years) who were partially edentulous participated in this study between august 2012 and june 2014 at hanyang university hospital . Preoperative clinical and radiologic evaluations indicated that the gbr procedure should be performed simultaneously with the implant placement in all patients . This study was approved by the institutional review board of hanyang university hospital (hyh irb 2012 - 06 - 014). Implant were placed under local anesthesia using a trapezoidal full - thickness flap with two vertical releasing incisions . A total of 12 implants (ts iii ca; osstem) in 10 patients were inserted by the standard procedure . In all cases, the implant threads were partially exposed and the gbr procedure was performed for these peri - implant defects . Then, the preformed titanium mesh was located on that height and immobilized by cover cap for a staged approach or by healing abutment for transmucosal gbr . The height, cover cap, and healing abutment were specifically designed for the preformed titanium mesh. (fig . 2) an autobone collector (osstem) was used to harvest autologous bone chips were either from the mandibular ramus or from an area adjacent to the surgical site . The bone chips were mixed with fdba (sure - oss; hansbiomed, seoul, korea) in 1: 1 volume ratio . A mixture of the graft materials was placed on the dehiscence or fenestration defect (fig . Antibiotics and analgesics were administered three times daily for ten days in addition to 0.12% chlorhexidine mouth rinse . The sutures were removed two weeks after surgery, and the patients were followed every four weeks after surgery for wound assessment . After approximately four months of the healing period, re - entry surgery was performed to uncover the implant under the minimum flap reflection . 5) a trephine drill with a 2.2 mm internal diameter was used to obtain the core biopsy from the regenerated site. (fig . Two months after the re - entry surgery, both the osseointegration and the integrity of the peri - implant tissue were evaluated . The complications and implant success rate were investigated for twelve months after the definite prosthesis was placed . The specimen obtained at re - entry was immediately fixed in 10% buffered formalin, dehydrated in a series of ethanol baths, and embedded in methyl methacrylate for histologic evaluation . The polymerized blocks were sectioned with a diamond saw microtome, micro - grinded and polished using sandpaper . The areas of vital bone, residual graft materials, and soft tissue were grossly measured and analyzed . A total of 10 patients (5 male and 5 female, aged 17 - 87 years) who were partially edentulous participated in this study between august 2012 and june 2014 at hanyang university hospital . Preoperative clinical and radiologic evaluations indicated that the gbr procedure should be performed simultaneously with the implant placement in all patients . This study was approved by the institutional review board of hanyang university hospital (hyh irb 2012 - 06 - 014). Implant were placed under local anesthesia using a trapezoidal full - thickness flap with two vertical releasing incisions . A total of 12 implants (ts iii ca; osstem) in 10 patients were inserted by the standard procedure . In all cases, the implant threads were partially exposed and the gbr procedure was performed for these peri - implant defects . Then, the preformed titanium mesh was located on that height and immobilized by cover cap for a staged approach or by healing abutment for transmucosal gbr . The height, cover cap, and healing abutment were specifically designed for the preformed titanium mesh. (fig . 2) an autobone collector (osstem) was used to harvest autologous bone chips were either from the mandibular ramus or from an area adjacent to the surgical site . The bone chips were mixed with fdba (sure - oss; hansbiomed, seoul, korea) in 1: 1 volume ratio . A mixture of the graft materials was placed on the dehiscence or fenestration defect (fig . Antibiotics and analgesics were administered three times daily for ten days in addition to 0.12% chlorhexidine mouth rinse . The sutures were removed two weeks after surgery, and the patients were followed every four weeks after surgery for wound assessment . After approximately four months of the healing period, re - entry surgery was performed to uncover the implant under the minimum flap reflection . 5) a trephine drill with a 2.2 mm internal diameter was used to obtain the core biopsy from the regenerated site. (fig . Two months after the re - entry surgery, both the osseointegration and the integrity of the peri - implant tissue were evaluated . The complications and implant success rate were investigated for twelve months after the definite prosthesis was placed . The specimen obtained at re - entry was immediately fixed in 10% buffered formalin, dehydrated in a series of ethanol baths, and embedded in methyl methacrylate for histologic evaluation . The polymerized blocks were sectioned with a diamond saw microtome, micro - grinded and polished using sandpaper . The areas of vital bone, residual graft materials, and soft tissue were grossly measured and analyzed . Newly regenerated bone at the augmented sites was confirmed by re - entry at four months after the initial surgery . After removing the preformed titanium mesh, a thin connective tissue layer called " pseudoperiosteum " postsurgical complications were observed in three of the 10 patients (30%). In two of these patients, the titanium mesh became exposed and there was small flap dehiscence on the cover cap in one patient . During the healing period, the exposed titanium meshes and cover caps were frequently irrigated with 0.12% chlorhexidine until fibrous tissue formed beneath the titanium mesh and graft materials were no long lost into the oral cavity . No signs of infection or suppuration were identified in the soft tissue around the exposed area . In all cases, the quality and quantity of the regenerated bone was clinically acceptable; however, at the exposed site, there was some resorption of graft materials . Radiologic evaluation at mesh insertion, removal and 12 months after definitive prostheses were placed showed stable marginal bone in all implants. (fig . 7) histologic findings of the core specimen from patient #2 revealed that the allograft particles are well - incorporated and surrounded by newly formed vital bone and connective tissue. (fig . 8) vital bone surrounded ~80% of the allograft, while fibrous marrow tissue surrounded 5% of the graft, and inflammatory cell infiltrates made up the remaining 15% . Adequate bone volume is a prerequisite for the long - term success of endosseous implants . Insufficient bone must be reconstructed with various hard tissue augmentation procedures2,3,4 . In order for augmentation procedures to be successful, it is imperative to stabilize the graft during healing, support the osteogenic potential of the graft materials, and close the primary soft tissue . Gbr is often performed during implant placement to correct the peri - implant alveolar defects, and is considered a favorable procedure . The gbr technique uses a barrier membrane to prevent soft tissue cells from entering the grafted space, maintaining the space for successful bone regeneration . Actually, the most important ability of gbr is its ability to maintain space under the membrane . This preliminary study focused on a titanium mesh, which is one of the most reliable barrier membranes in ridge augmentation . Based on these qualities, titanium mesh has been useful in the reconstruction and augmentation of oral and maxillofacial defects . Another advantage of the titanium mesh is its inherent rigidity that maintains the space needed to allow new bone growth . Several studies have demonstrated that titanium mesh supports the grafted space and prevents soft tissue collapse better than does e - ptfe6,14 . In contrast, although some cross - linked collagen membranes are also rigid resorbable barrier membranes, they only protect the grafted space at the beginning of regeneration and gradually lose their rigidity6 . One of the prerequisites of successful gbr is a barrier mem brane that restricts epithelial cell migration . Unlike other barrier membranes the macro - pores allow sufficient blood flow and diffusion of nutrients and oxygen that consequently enhance the regeneration of the bone and soft tissue . As the membrane pore size of increases, so does the regenerative capacity . Despite concern that epithelial cells and bacteria could infiltrate through large pores, space maintenance was found to actually play a greater role in bone regeneration than does cell occlusiveness18 . When blood clot stabilization is achieved with the titanium mesh in addition, the titanium mesh with large pores demonstrates more osseous formation and less soft tissue attachment than does a titanium mesh with small pores12 . We found that easily removable titanium meshes tend to have less adhesive fibrous tissue formation . The titanium meshes used in this study have two different pore sizes that permit the migration of bone - forming cells, but block the grafted materials from leaking . A major limitation of the titanium mesh is the fairly high rate of mesh exposure through the tissue . Corinaldesi et al.8 reported a exposure rate of 14.8% after particulated bone augmentation in the mandible . Louis et al.14 reported 52% exposure of the maxilla and mandible with a range of 43%-55% . Three of the 10 patients (30%) in this study experienced titanium mesh exposure during the healing period (with one in the maxilla and two in the mandible). However, even in cases of membrane exposure, there was satisfactory bone regeneration and successful implant survival . The most common cause of mesh exposure is continuous mucosal irritation by the titanium mesh . Sharp edges produced by improper mesh adjustment may increase the risk of exposure . Using a preformed titanium mesh having a preformed mesh not only shortens the duration of surgery, but also reduces the risk of mesh exposure . In our study, there were no titanium mesh edge exposures because the preformed titanium meshes had optimal round and blunt edges . Ciocca et al.10 also prepared a customized titanium mesh using computer - aided design and computer - aided manufacturing (cad / cam) technology to augment the atrophic alveolar ridge and demonstrated satisfactory bone regeneration . Few studies have reported the histological results of new bone formation with titanium mesh use in humans . Proussaefs and lozada19 demonstrated ~36% new bone formation after 8 months in a histologic study of cases augmented by mixed grafts of autologous and inorganic bovine bone (in a 1: 1 volume ratio). Using the mesh with either a combination graft (of 70% autologous bone and 30% bovine bone matrix) or a graft of autologous bone alone produces similar amounts of total bone volume 8 - 9 months after grafting11 . In accordance with previous studies using allogeneic grafts20,21, preliminary histologic analysis in our study demonstrated a satisfactory amount of new bone formation with limited allograft particle embedding . It is thought that fdba scaffolding connects with marrow trabeculae, providing favorable osteoconductivity for new bone formation . Moreover, marginal bone levels around the implant remained stable for 12 months after the final prostheses were placed . The customized, three - dimensional, and preformed titanium mesh used in combination with autologous bone and fdba induced successful bone regeneration in peri - implant defects occurring after implant placement . Even in the cases of titanium mesh exposure, this preliminary study shows histologic evidence of satisfactory vital bone formation in the augmented area . Preformed titanium mesh supports the grafted space for new bone formation, makes application and removal convenient, and minimizes the risk of mesh exposure in the reconstruction of peri - implant alveolar bone defects.
Prescription drugs are becoming the drugs of choice for adolescents and young adults with a reported increase in misuse of 212% from 1992 to 2003 . The substance abuse and mental health services administration and johnston et al . Have reported that the misuse or nonmedical use of prescription drugs has a greater prevalence rate than illicit drugs use with the exception of marijuana use, with the highest prevalence rates being reported among adolescents and young adults . The increased incidence and prevalence of nonprescription and prescription drug misuse among young people led to the office of national drug control policy's prescription drug abuse prevention campaign to target parents of adolescents in 2008 . Friedman and manchikanti argued that continued prescription drug misuse among adolescents may be attributed to adolescents' perception that this type of drug use is safer than illicit drugs, the ease of access to these drugs, and lower societal stigma about misuse compared to illicit drugs use . These three variables are directly related to peer influence and are consistent with kandel's adolescent socialization theory, particularly imitation and social reinforcement . Kandel described peer influence, rather than parent influence, as being the most important influence to adolescents' immediate lifestyle, hence peers being more relevant in understanding adolescents' health risk behaviors . Regarding kandel's theory, imitation involves adolescents modeling their behaviors and attitudes based on others' behaviors and social reinforcement involves adolescents internalizing and displaying behaviors and attitudes approved by others . Both are applicable to adolescents' perception of prescription drug use being safer than illicit drugs and lower stigma about misuse, since these perceptions are based on attitudes displayed by others in conjunction with adolescents' own beliefs . The theory also applies to ease of access to drugs, such that if parents and peers are engaging in prescription drug use, drugs may be more easily accessible to adolescents . Also noteworthy is the developmental level of adolescents / young adults, and according to e. h. erikson and j. m. erikson peers are key counterplayers during this stage of life . Adolescents / young adults are forming their identity which may be based on in - group or out - group values . If adolescents'/young adults' group values involve prescription drug use, then there will be norms for use and ease of access to drugs . Understanding the roles of adolescents' perception that this type of drug use is safer than illicit drugs, the ease of access to these drugs, and lower societal stigma about misuse compared to illicit drugs use may provide additional targetable areas for intervention . Hence, the purpose of this study is to explore the extent to which these variables are predictive of adolescents'/young adults' prescription drug misuse . In the health risk behaviors and substance abuse literature, abuse has been shown to be related to perceived risk (pr) such that as pr of substance use increases, use decreases [912]. Pr of nonprescription and prescription drugs have not been extensively explored with most studies addressing pr of nonprescription and prescription drug misuse in relation to illicit drugs . Arria et al . Conducted a longitudinal study on perceived harmfulness of stimulants and analgesics in college students and found that 25.2% and 27.8% of students attributed a descriptor of great risk to the occasional nonmedical use of stimulant and analgesics misuse, respectively . Additionally, prescription stimulants and analgesics were viewed as less risky than cocaine but more risky than marijuana and binge drinking . The partnership for a drug free america (pdfa) reported that 40% of adolescents viewed prescription medication to be safer than illegal drugs . Additionally, adolescents did not believe that prescription pain relievers were addictive and believed that it was okay to use prescription drugs without a prescription once in a while . Prescription drugs may be perceived as being safer than illicit drugs because they can be legitimately prescribed by doctors and are food and drug administration approved [5, 6]. Manchikanti also reported that the increase in social acceptability of medicating ailments may also be responsible for misperceptions of prescription drug misuse safety . Based on these findings, we hypothesize that pr of prescription drugs will be significantly lower than illicit drugs and that the belief that prescription drugs misuse is safer than illicit drug use will be positively related to nonprescription and prescription drug misuse . Another variable mentioned by friedman as being responsible for the increased prevalence in prescription drug misuse is lower societal stigma about misuse . Like pr, the role of parent and peer approval has been extensively studied in the substance abuse literature but few studies have focused on its relations with nonprescription and prescription drug misuse . Ford found that adolescents who had parents and peers with pro - substance abuse attitudes were more likely to report engaging in prescription drug misuse . Additionally, the pdfa highlighted that 21% of adolescents reported that their parents won't care if they caught them engaging in prescription pain reliever misuse . Researchers also found that adolescents whose friends engage in substance use were more likely to engage in prescription drugs misuse [1518]. According to the pdfa, 33% of adolescents reported that there was less shame attached to using prescription pain relievers than illicit drugs . These findings reiterate imitation and social reinforcement as described in kandel's adolescent socialization theory and the influence of in - groups and out - groups . We hypothesize that perceived societal stigma (pss) in the form of peer and parent disapproval and perceived peer misuse would be related to nonprescription and prescription drug misuse . We also hypothesize that, similar to pr, participants will perceive peers to be more approving of prescription drug misuse than illicit drug use . Ease of access to nonprescription and prescription drugs has been suggested as responsible for the increased prevalence of misuse; however, similar to pr and pss, few researchers have studied the extent to which this is true . . Found that half the sample they examined reported that prescription stimulants were easily accessible on campus with 21.2% and 9.8% reporting being offered stimulants or purchasing stimulants from other students, respectively . However, they did not explore the extent to which easy accessibility was predictive of misuse . Poulin found that students who reported medical use of stimulants reported giving, selling, and being forced to give their medication to others . Giving and selling prescribed medication to others were positively related to increase in nonmedical stimulant use, thus providing evidence for the role of ease of access in stimulant misuse . Manchikanti identified several modes of access to prescription drugs including internet pharmacies, drug theft, sharing among family and friends, doctor shopping, and improper prescribing . The pdfa also provided evidence for the role of easy access to drugs in the increase in misuse prevalence . According to the pdfa, adolescents reported having easy access to prescription drugs via parents' medicine cabinets (62%), others' prescriptions (50%), and from the internet (32%). This provides further evidence for the role of imitation and social reinforcement in prescription drug misuse . Therefore, we hypothesize that ease of access to nonprescription and prescription drugs will be predictive of nonprescription and prescription drug misuse . Based on kandel's adolescent socialization theory and the proposals by friedman and manchikanti about the role of pr, pss, and ease of access in the increased prevalence of nonprescription and prescription drug misuse, we hypothesize that these variables will be predictive of misuse . Specifically, pr and pss will be negatively related to misuse and ease of access will be positively related to misuse . The sample consisted of 465 college students between the ages of 18 and 24 years (m = 18.57, sd = 0.86). Participants were predominantly caucasian (74%), female (60%), and freshmen (73%). Sixteen percent of participants (n = 73) reported some prescription drug misuse and 15% (n = 71) reported some nonprescription drug misuse . Note that cough and cold syrup and pills misuse (9%, n = 42) were not included in the frequency calculations because the question about cough and cold syrup and pills did not distinguish between prescription and nonprescription drugs . Twenty - six percent of participants (n = 119) reported some nonprescription and/or prescription drug misuse . Misuses of nonprescription and prescription drugs were defined as use of medications to get high . Pr was measured by perceived personal risk, which is the extent to which the participant felt they would be at risk of getting sick or hurt if they engaged in nonprescription, prescription, and illicit drug use . Pr was measured on a 7-point evaluation scale ranging from no risk at all (1) to very much at risk (7). Pss was participants' self - report on their perceptions about how friends and parents felt about them engaging in nonprescription, prescription, and illicit drug use (i.e., parent and peer disapproval). Parent and peer approval was measured on a 5-point likert scale ranging from strongly approve (1) to strongly disapprove (5). Pss variables also included participants' perceptions of friends' nonprescription and prescription drug misuse . Friends misuse was participants' assessment of the percentage of friends who engaged in misuse in 10% increments (e.g., 0%, 1%10%, 11%20%). To measure accessibility of nonprescription and prescription drugs, participants answered questions on whether their friends brought medications to school for recreational use (access in school) and what nonprescription and prescription drugs were kept in the home . Participants were also asked about their perceptions about the safety of nonprescription and prescription drug misuse in relation to illicit drugs use . Nonprescription and prescription drugs misuse and illicit drug use were measures of lifetime use on a 5-point frequency scale ranging from never (1) to more than 40 times (5). For nonprescription and prescription drugs, the question stem was have you ever used the following medications recreationally? And for illicit drugs the question stem was have you ever engaged in the following activity? Prescription drug misuse was measured for the following classifications of medications; prescription pain (e.g., vicodin, codeine, oxycontin, percocet), prescription stimulants (adderall, dexedrine, ritalin), and prescription sedatives and tranquilizers (mebaral, quaaludes, xanax, valium (benzodiazepines), nembutal, fluoxetine). Nonprescription drug misuse was measured for nonprescription pain relievers (e.g., tylenol, motrin, advil, aleve, ibuprofen, aspirin) and nonprescription sleeping pills . Misuse was also measured for cough and cold syrup and pills; however, no distinction was made between prescription and nonprescription . Data were collected as part of the media influences on health risk behaviors and prescription drug use in young adults project . Data were collected using a survey developed by the authors specifically for this project; however, portions of the survey (e.g., pr and pss) were modified from omori and ingersoll . College students were recruited from the introduction to psychology course to participate in the study . Participants completed an online survey at a computer lab where workstations were separated by desk partitions . Participants received two research credits upon completion of the survey . To ensure participant privacy, descriptive statistics were computed (see table 1). To test for differences in pr and perception of societal stigma for nonprescription and prescription drug misuse versus illicit drug use, paired sample t - tests were computed . Pearson correlations were computed to explore the relationship between participants pr and pss for nonprescription and prescription drug misuse and that of illicit drug use . Nonprescription and prescription drug misuse was dichotomized into nonusers (participants who responded never to the questions) and users (participants who reported any misuse). Binary logistic regressions were calculated to differentiate pr, pss, and access to nonprescription and prescription drugs on self - reported nonusers and misusers . Demographic variables including age, gender, and ethnicity were controlled for in the first step of the regression analyses . Results of correlations and paired sample t - tests are presented in table 2 . Pr of nonprescription and prescription drugs misuse was positively correlated with pr of marijuana and crack or cocaine at the p 0.001 . Similarly, peer approval for nonprescription and prescription drug misuse was positively correlated with peer approval for marijuana and crack or cocaine use at the p 0.001 . Parent approval for prescription pain, prescription sedatives and tranquilizers, prescription stimulants, and nonprescription sleeping pills was positively correlated with marijuana and crack or cocaine use at the p <0.05 to p 0.001 range . Parent approval for nonprescription pain was significantly positively correlated with approval for marijuana use and uncorrelated with approval for crack or cocaine use . Parent approval for cough / cold syrup was uncorrelated with approval for marijuana use and crack or cocaine use . Pr of all nonprescription and prescription drugs examined were lower than the pr of crack or cocaine confirming the hypothesis that pr of prescription drugs is lower than that of illicit drugs . Participants also perceived risk from marijuana use to be higher than that from nonprescription pain, cough / cold syrup, and nonprescription sleeping pills misuse . Participants perceived risk from the misuse of prescription pain and prescription sedatives and tranquilizers to be higher than that of marijuana use . Regarding pss, participants reported parent disapproval of all nonprescription and prescription drugs misuse as significantly lower than parent disapproval of marijuana and crack or cocaine use . Participants reported that their peer disapproval of nonprescription and prescription drugs misuse was significantly lower than that of crack or cocaine . These results confirm that participants perceived peers and parents to be more approving of nonprescription and prescription drug misuse . Participants' pss of all the nonprescription and prescription drugs measured with the exception of cough / cold syrups and pills and nonprescription pain medication was higher than that of marijuana use . Participants' perceived peers to be less disapproving of nonprescription pain misuse than marijuana use . Results of binary logistic regression analyses predicting nonprescription and prescription drug misuse are presented in table 3 . Regarding prescription pain drugs misuse, caucasians were more likely to be misusers than african - americans / black and hispanics, while pr and peer disapproval were negatively associated with use . Access to prescription medications at home was positively associated with misuse . For prescription sedatives and tranquilizers, african - americans / blacks were less likely to be misuses than caucasians, and parent disapproval and peer use were positively associated with misuse . Age was positively related to misuse of stimulants while peer disapproval and perceived risk were negatively related to misuse . No other predictor variables were related to nonprescription sleep drugs misuse . For cough / cold syrup and pills, peer disapproval and note that the odds ratio and confidence intervals could not be calculated for asians for any of the prescription drugs, for hispanics for nonprescription sleep, and for ethnicity and access in home for cold / cough syrup and pills due to extremely large standard errors . As discussed in friedman and manchikanti, we proposed that pr, perception of illicit drugs being safer than street drugs, pss, and access to nonprescription and prescription drug misuse would be significantly related to misuse . Our results provide some evidence that these variables provide a plausible explanation for increased prescription drug misuse among adolescents / young adults . Both pr and pss of nonprescription and prescription drugs misuse and illicit drug use were positively correlated, suggesting that adolescents / young adults recognize that nonprescription and prescription drugs misuse are risky . These findings also provide evidence for the high correlation of illicit drug use and nonprescription and prescription medication misuse [16, 18, 22]. Specifically, pr for one substance may influence pr for the other substance and subsequent decisions to engage in use of both substances . Additionally, adolescents / young adults may belong to in - groups and out - groups that are consistent in how they perceive substance abuse, for example, a group that disapproves of illicit drug use may also disapprove of prescription drug misuse . These results also provide evidence for social reinforcement and imitation of attitudes proposed in the adolescent socialization theory . Pr and pss of nonprescription and prescription drugs being lower than crack or cocaine but not marijuana highlight an important trend that is somewhat consistent with arria et al . And specifically, the potential of a substitution effect whereby adolescents / young adults perceive misuse of nonprescription and prescription drugs as a middle ground between too little and too much risk, as well as the formation of a new sub - culture should be explored . These findings also suggest a need to reevaluate and reconfigure programs targeting marijuana prevention with programs emphasizing pr and stigma (possibly via harsher penalties for use). In addition to reevaluating marijuana programs, more should also be done to increase awareness of the risks associated with nonprescription and prescription drug misuse . The office of national drug control policy's media campaign targeted parents; however, the findings of this study suggest that adolescents / young adults may benefit from additional campaigns targeting them (adolescents / young adults) and their peers that highlight the risks associated with nonprescription and prescription drug misuse . Addressing misuse in this way may be very effective since it will reduce the amount of unhealthy or inappropriate social reinforcement and imitation of undesirable attitudes regarding prescription drug misuse currently displayed by adolescents / young adults . The inconsistency in pr and pss of nonprescription and prescription drugs when compared to marijuana may also explain why pain medication misuse is second only to marijuana use . The only drugs perceived as being less risky than marijuana were nonprescription pain, nonprescription sleep, and cough and cold medications suggesting that adolescents'/young adults' perception of nonprescription and prescription drugs differ probably due to access or level of control imposed by the food and drug administration . Also noteworthy is the nonsignificant relationship between parent disapproval for cough / cold syrup and pills and marijuana and crack or cocaine . Possible explanations for these nonsignificant relationships include parents not viewing these drugs as risky and worthy of discussion with adolescents, parents not recognizing that these drugs are subject to misuse, adolescents mistaking access for approval, or both parents and adolescent not connecting the relationship between misuse of cough / cold medications and illicit drugs . Though nonprescription drugs are less risky than prescription drugs, it is imperative that programs and campaigns incorporate the dangers associated with the improper use of nonprescription drugs, particularly among adolescents and young adults, instead of focusing solely on prescription drugs . To predict misuse, demographic variables were first controlled for . Given the restricted age range of our sample, it was interesting that there was a significant age difference for prescription stimulant misusers . We propose that since stimulants are known study drugs, older participants may be engaging in more stimulant misuse due to demands of classes . Surprisingly, particularly for pain medication, gender was not a significant predictor of misuse . Several researchers have found that women tend to misuse pain medications more often than men [24, 25]. One possible reason for our nonsignificant results is our definition of misuse . In most studies, misuse is broadly defined as non - prescribed use, but because our definition was limited to recreational use we may have screened out the young women who misuse these medications for pain relief rather than getting high . Consistent with friedman, manchikanti, and ford, pss was the strongest predictor of all nonprescription and prescription drug misuse with the exception of nonprescription sleeping pills . This reiterates the need for prevention programs to target adolescents / young adults; adolescents / young adults influence each other's decision to engage in use therefore increasing the pr and reducing acceptance of nonprescription and prescription drug misuse in some adolescents and young adults may have a ripple effect . Of particular note is the significantly positive relationship between parent disapproval, peer use, and sedatives and tranquilizers misuse . These findings highlight that though parents may be important and instrumental in limiting access and exposure to medications, their disapproval may have the reverse effect on adolescents / young adults . It also further explains the role of peer groups and peer norms in misuse and further confirms kandel findings about the role of peers in immediate lifestyle choices adolescents / young adults make . Pr was only a significant predictor of prescription pain, prescription sedatives and tranquilizers, and prescription stimulants, suggesting that other variables may also be contributing to adolescents and young adults' decision to engage in misuse . Pr may still be important but may be interacting with other variables in the decision - making process . Future studies should explore other correlates of misuse and how they interact with pr to influence misuse . Noteworthy is the failure of the variable, prescription drug not being safer than illicit drug, to predict misuse . This suggests that pr in general may be more important than risk in relation to other substances for predicting misuse . Regarding access to medication, medicine kept in the home was only significantly related with misuse of nonprescription sleeping pills . Separate regression analyses were conducted including access to medicine cabinets in the home and this was not significantly correlated to misuse for any classification of drug . We hypothesize therefore that medicine kept in the home being a significant predictor of misuse may be due to a combination of access and acceptability of use for medical reasons as suggested by manchikanti and consistent with social reinforcement and imitation . Access in school was only predictive of prescription pain, and the authors suspect that these medications were probably the most accessible medications taken to school . As mentioned before, this study was restricted to recreational users of nonprescription and prescription medication, these misusers do not encompass all non - medical use therefore generalizations about misuse are limited . Additionally, the findings of this study should be viewed as exploratory due to the restrictedness and non - representativeness of the sample . Because of the higher misuser to nonuser ratio, statistical power to detect significant correlates of misuse may have been insufficient; therefore, future studies should replicate these analyses with lower misuse to nonuser ratios . Other future directions include using the results from this study as a basis for developing a peer - focused prevention intervention and a prescription drug misuse awareness intervention . To conclude, adolescents'/young adults' pr and pss of nonprescription and prescription drugs misuse differ from their perception of illicit drug use, particularly for crack or cocaine . Their perceptions are important because they are correlated with misuse and program planners should work towards targeting these perceptions to prevent and decrease misuse . Additionally, access to medications also influences misuse and this suggests that to prevent and decrease use, stronger measures should be taken to restrict access to otc and prescription drugs.
Cosmetotextiles are garments designed to contact the skin with the aim of transferring active substances useful for cosmetic purposes, particularly to combat ageing effects [14]. In fact, there are already several textile products on the market that claim to have certain properties that are usually found in pharmaceuticals or cosmetics, such as moisturising, slimming, energising, refreshing, relaxing, vitalizing, or uv - protecting properties, or are simply perfume . There is a real need to develop test methods to demonstrate and verify the effectiveness and durability of these claimed properties . Liposomes are biocompatible, biodegradable, and nontoxic artificial vesicles formed by lipids that can encapsulate many compounds (hydrophilic, hydrophobic, and amphiphilic) for application to textiles . Moreover, liposomes have been the subject of numerous studies because of their importance as microencapsulation devices for drug delivery and their applications in cosmetics [710]. In fact, one way of enhancing drugs' skin penetration is the use of vesicular systems or liposomes [9, 10]. In this study, a new strategy to enhance the delivery of an active agent from a textile to the skin using mixed micelles (mms) was investigated . The micelles are composed of a lipid and a surfactant and are capable of transforming into liposomes when the surfactant is eliminated by simple dilution with water . The potential ability of the mm to be structured as liposomes in textile fabrics by dilution in water was investigated [11, 12]. Antioxidants are substances used as natural resources to regulate processes considered external threats to the body, preventing oxidative stress . It has been demonstrated that when topically applied, these exogenous antioxidants can diminish the effects of free radicals using defence mechanisms similar to those of endogenous antioxidants [13, 14]. The encapsulation of antioxidants in liposomes improves their therapeutic potential against oxidant - induced tissue injuries, because liposomes facilitate intracellular delivery . In this regard, textiles containing antioxidants might have diffusion characteristics similar to those of transdermal relize patches used in the field of pharmaceuticals . In this study, the phenolic acid ga was used as an active principle for its anti - inflammatory, antifungal, and antiviral properties and the antioxidant protection it provides to our cells against free radicals . The ability of ga to serve as a reliable chemical tracer and its beneficial effects lend support to its incorporation into a textile designed to be used in contact with the skin . In the present work, the antioxidant ga has been incorporated into co and pa through two different vehicles, lip and mm, and their respective absorption / desorption behaviours have been studied . The aim of this work was to determine ga penetration from different biofunctional textiles within the layers of the skin using a specific in vitro percutaneous absorption method . The standard fabrics used were plain cotton fabric (co) (bleached desized cotton print cloth, style 400 iso 105-f02) and spun polyamide fabric (pa) (style 361, iso 105-f03). Liposomes were prepared using commercial lipids (phospholipids) emulmetik 900 (lucas meyer gmbh, france), and mixed micelles were prepared using the same lipids and the surfactant oramix cg 110 (caprylyl / capryl glucoside) (seppic italia srl, italy). The antioxidant active agent gallic acid (ga) (sigma - aldrich) was employed . Methanol (hplc - grade) and distilled water were used for high - performance liquid chromatography analysis with uv detection (hplc - uv). Methanol (carlo erba, france) was used to extract ga from the textiles . Emulmetik 900 is a waxlike soybean lecithin emulsifier with an enriched content of phosphatidylcholine for use in the cosmetic industry and was employed for lip and mm formation . Lips containing 4% emulmetik 900 (pc) and 2% gallic acid (ga) were prepared using the thin - film hydration method reported elsewhere . The lipid film was dispersed in 100 ml of a 2% ga aqueous solution, and multilamellar vesicles (mlv) were obtained . Mms (30% surfactant, 4% pc, and 2% ga) were prepared by solubilising all compounds in distilled water; solubilisation was performed by gently shaking until clear solutions were obtained . Dynamic light scattering (dls) (zetasizer nano zs zen3600; malvern instruments ltd ., malvern, worcestershire, uk) was used to determine the size distribution and polydispersity index of the lip and mm . A noninvasive backscattering technique was used to minimise multiple scattering effects without the need to dilute the samples . The measurement was performed at room temperature with polystyrene cells (ref 67.754 sarstedt). The detection of the light scattered was performed at an angle of 173. each sample was measured in triplicate . The data were interpreted by correlating the particle size distribution with the intensity of light scattered . All data were collected and analysed using the software programme dispersion technology software (dts) provided by malvern instruments ltd . To quantify the ga entrapped in the vesicles, a lip formulation was precipitated and separated from the supernatant by centrifugation at 14000 rpm for 15 minutes using a centrifuge 5415-eppendorf (germany). The initial liposome dispersion and the supernatant were diluted in isopropanol / water 1/1 and read spectrophotometrically at 269 nm (ga maximum absorption) using a cary bio300 spectrophotometer . The efficacy entrapment percentage of ga in the lip was determined by taking into account the amount of the active principle present in the entire liposome dispersion (ga lip), as well as in the supernatant (ga supernatant) (see (1)), using a ga calibration curve: (1)%e = ga lip ga supernatant ga lip 100 . Lips and mms containing ga were applied onto co and pa fabrics in triplicate by bath exhaustion in a liquor ratio of 1/5 at 60c for 60 min with manual stirring every 10 minutes . To quantify the amount of lip or mm absorbed into the fabrics, the samples were weighed before and after application under 24 h standard ambient conditions (23 2c and 50 5% relative humidity, iso 554 - 1976). To study the desorption process, the treated fabrics were washed in three different water baths at room temperature; the samples were weighed before and after each washing with deionised water (1/5 bath ratio, 1/10 bath ratio, and 1/25 bath ratio, resp .) For 5 min with magnetic stirring under 24 h standard ambient conditions (23 2c and 50 5% relative humidity, iso 554 - 1976). Particle sizes were measured in the baths after the exhaustion treatment and in the baths after the first and third washings as described for the initial formulations . For these studies, pig skin was used from the unboiled backs of large white / landrace pigs weighing 3040 kg . The pig skin was provided by the clnic hospital of barcelona, spain . After excision, the skin was dermatomed to a thickness of approximately 500 50 m with a dermatome ga630 (aesculap, germany). Skin discs with a 2.5 cm inner diameter were prepared and fitted into static franz - type diffusion cells . Skin absorption studies were initiated by applying 10 l of lip or mm (approximately 70 g / cm ga) or by applying the fabrics treated with the same lip or mm (containing approximately 150250 g / cm ga) onto the skin surface . Between the textile and the skin, 20 l of distilled water was added to ensure close contact . A control skin disc (without product application on the skin surface) was used to rule out possible interferences in the analysis of ga by hplc - uv . According to the oecd methodology, the skin penetration studies were performed for 24 h of close contact between the textile and the skin . To increase the contact pressure between the textile fabric and skin, permeation experiments were also carried out by placing a steel cylinder on the textile - skin substrate at a constant pressure in accordance with standard conditions (125 g / cm) (iso 105-e04, 1996) (see figure 1). After the exposure time, the receptor fluid was collected and brought to a volume of 5 ml in a volumetric flask . In the case of the formulations, the skin surface was washed with a specific solution (500 l sles (sodium lauryl ether sulphate) (0.5%) and twice with 500 l distilled water) and dried with cotton swabs . In the case of the textiles, the fabrics were removed from the skin surface and collected together with the top of the cell . In both cases, after eliminating the excess ga from the skin surface, the stratum corneum of the skin was removed using adhesive tape (d - squame, cuderm corporation, dallas, tx, usa) applied under controlled pressure (80 g / cm for 5 sec). The epidermis was separated from the dermis after heating the skin to 80c for five seconds . Ga was extracted from the different samples (surface excess, co / pa or skin layers) using a methanol: water (50: 50) solution agitated in an ultrasonic bath for 30 min at room temperature . After filtration on a millex filter (0.22 m, millipore, bedford, ma, usa), the solutions containing ga were assessed by hplc - uv . The ga extracted from the different samples was determined by hplc equipped with a uv - vis detector as previously described . The column used was a lichrocart 125 - 4/lichrosorb rp-18 (5 m) (darmstadt, germany). The mobile phase was 80% water/20% methanol flowed at a rate of 1 ml / min . The area under curve was used to calculate the concentration of ga using external standards that showed linearity over a concentration range from 0.25 to 100 g / ml . This experimental methodology prevented any compound from possibly interfering with the analysis of the target substance . Analysis of variance (anova) was used to determine significant differences between percutaneous absorption values obtained from different samples (significant level accepted * p <0.01) using the statgraphics program . Two textiles, co and pa, were chosen to compare the roles of two vehicles, two phospholipid structures (lip and mm) composed of the same phospholipids but with a surfactant in the case of mm . Both vehicles were applied by bath exhaustion, as it was explained in section 2 to study the absorption and desorption of ga . The lip formulation was prepared by thin - film hydration method, as described in section 2, with 4% phospholipids (pc) and 2% ga in water . Polydisperse vesicle suspensions (0.7 pdi) with especially large multilamellar vesicles (mlv 700 nm) were formed . The multilamellar structure allows for high encapsulation efficiency for both hydrophilic and hydrophobic substances, which can be localised not only in the central core of the vesicle but also in the aqueous interlamellar spaces or in the multiple lamellar spaces . To quantify the ga entrapped in the vesicles, the amount of ga in the initial lip solution and in the supernatant and the difference between them were evaluated as described in section 2, yielding a fairly high entrapment efficacy of 31.9 9.6% . In mm, the two constituent pc and the surfactant agent however, the dilution of mm promotes the separation of the surfactant and the pc with the formation of liposomes . This results in a large increase in size, giving rise to a turbid solution . The absorption of micelles by textiles could be maintained after washing because of the expected increase in the size of the vehicles inside the textile fibres, which could enhance the fixation of the micelles in textiles with less desorption, as occurs in the skin [25, 26]. The variation in the vehicle sizes with dilution for the two formulations is presented in table 1 . The lip size decreases from approximately 700 to 400 nm with dilution, whereas the mms have an initial size of 8 nm and increase to 55 nm for a dilution to 2.5% mm in water, as expected, due to liposome formation with dilution . The lip pdi (> 0.600) was much higher than mm pdi (0.1), indicating a higher dispersion for the big structures . The active agents vehiculised in lip (4% pc, and 2% ga = 6% dry product) and mm (30% surfactant, 4% pc and 2% ga = 36% dry product) were applied to the textile substrates, co and pa, by bath exhaustion as described in section 2 . The initial and final percentages of dry product calculated by the weight difference between the dry initial fabric and dry fabric after bath exhaustion are shown in table 2 . When the mms were applied to the fabrics by an exhaustion process, higher absorption than that in the lip - treated fabrics was observed . Nevertheless, extremely high desorption was observed due to the lip treatment of both textiles . It is important to note that pa absorbed much more mms and lips than co. the interaction of lecithin with co has been reported to occur mainly at the surface through a coating layer, whereas the interaction with pa occurs in the interior of the fibres . The higher absorption of mm in co and especially in pa could be due to the presence of 30% oramix . The increase in particle size with dilution in the washing baths, which reached up to 50100 nm, did not prevent desorption . The separation of lip composed of phospholipids and micelles featuring oramix could increase their affinity for water in the two textiles, favouring desorption . The desorption of lip from the pa- and co - treated fibres was approximately 50%, whereas the desorption of mm from the pa- and co - treated fibres was 90% . The particle size of the lipid structures of lip and mm was evaluated in the initial, after treatment, and after washing baths (table 3) to determine the possible influence on product desorption . A comparison of the results in table 3 with those obtained for lip and mm elution in table 1 shows that in all the baths of co and pa, the lip exhibited a similar size of approximately 500 nm . In the initial baths however, a size increase of up to 100200 nm was already observed in the initial bath after the treatment as well as in the washing baths . The concentration of mm in the bath after textile treatment or after washing treatments is much lower than the one assayed in table 1; the surfactant could have been removed in a high extent, and lipids could have been organised as vesicles higher in size . The extremely high absorption of mm could be due to the easy penetration of the small structures into fabrics . However, the increase in the size of these structures (see table 3) did not prevent their exit from the fibres, and desorption was notable . This finding could be due to the higher permeability of textiles compared with human skin, which may explain why this effect was not observed [25, 26]. To study the penetration of active principles through the skin, an in vitro methodology based on percutaneous absorption is performed to demonstrate the delivery of an encapsulated principle from a textile to the different layers of the skin (stratum corneum, epidermis, or dermis). The percutaneous absorption of the two formulations, lip (2% ga, 4% pc) and mm (2% ga, 4% pc, and 30% oramix cg 110), was evaluated, as were the co and pa textiles impregnated with the same lip or mm . The two formulations and the co and pa textiles previously treated with the formulations were placed in contact with the skin discs as described in section 2 . The aim of this assay was to demonstrate tracer delivery into the different layers of the skin . Gas encapsulated in mms and lips, which were either embedded or not embedded in cosmetotextiles, were applied to the skin to study the percutaneous absorption profiles of the agents . The ga extracted from a washing sample, the fabric, the stratum corneum, the rest of the epidermis, the dermis, and the receptor fluid was analysed . Comparison of percutaneous absorption in percentage indicates that it is higher when ga was applied as a formulation (lip or mm) than when it is applied through cosmetotextile . Besides, co delivers to the skin ga in a greater extent than pa . As shown in figure 2, the penetration of ga formulated in lip was much higher than that of ga formulated in mm . All skin compartments showed a higher amount of ga when vehiculised with lip than when vehiculised with mm . This result could be due to the bilayer structure of the lip, which is similar to the lipid bilayer structures present in the sc and in the cellular membranes of the skin . Evidence that lips do not penetrate deeper than the stratum corneum layer has been published . However, lips enhance the penetration of both hydrophilic and lipophilic drugs [30, 31]. However, both formulations promote the incorporation of a significant amount of ga in all skin layers, as indicated by the outstanding amount detected in the receptor fluid, which accounts for the amount that would be present at a systemic level . Significant differences at a high level of * p <0.01 can be visualized in figure 2 . Therefore, besides all previous comments, it is important to remark the significant difference between the amount of ga in the sc when applied lip related to its corresponding pa textile and between the two formulations and their corresponding textiles in the deep layers of the skin (dermis and receptor fluid). When ga was embedded into the cosmetotextiles, a marked reservoir effect was always induced . A lower degree of ga skin penetration was obtained in most skin layers compared with the results obtained for the formulation application alone . A similar penetration profile was obtained for the textiles treated with ga in mm or lip in the skin compartments, sc, epidermis, and even in the dermis . In the dry textiles, the different lipid structures of lip and mm, which may induce different enhancement behaviours, were lost . Therefore, textiles embedded with different vehicles may be expected to play a similar reservoir role . It is important to note that ga was absent in the receptor fluid of both the lip - treated textiles and mm - treated pa . Ga was only detected in the mm - treated co fabric and in a smaller percentage than that detected with the free formulations . A comparison between the two textiles shows that much higher global percutaneous absorption was observed in the co than in the pa fabric . Ga was present in greater amounts in all skin layers when co cosmetotextiles were topically applied and even reached the receptor fluid when applied through mm . As in the washing desorption process, it seems that pa has greater substantivity for ga than co vehiculised either in mm or lip, because lecithin has been reported to incorporate mainly on the surface of co fibres, whereas interaction with pa occurs to a greater extent in the interior . Therefore, it seems reasonable to predict a higher reservoir effect for pa textiles, promoting a lower percutaneous absorption of ga . The precise amount of active agents present in cosmetotextiles was determined before being used in a textile drug delivery system . Much greater absorption of the formulations was found for the mm treatments relative to that observed for the lip treatments . However, the mm - treated fabrics showed much higher desorption, leading to a lower amount of absorbed material in the textile after washing . A large increase in particle size from 7 to 200 nm however, this increment in size does not help the formulation remain in the textile; on the contrary, it favours the desorption of the formulation . The percutaneous absorption of two formulations, lip and mm, was evaluated, as was that of co and pa textiles impregnated with the same lip or mm . The results indicate that the penetration of ga formulated as lip is much higher than that when formulated as mm . The bilayer structure of the vesicles, which is similar to the lipid bilayer structures present in the stratum corneum and in the rest of the skin, may account for their affinity . When ga was embedded in the cosmetotextiles, it always promoted a reservoir effect, especially in the case of the pa fabrics . A similar penetration profile was obtained for the textiles treated with ga in mm or lip in the different skin compartments . Ga was absent in the receptor fluid of both lip - treated textiles and in the mm - treated pa; it was only detected in the mm - treated co fabric and in a smaller amount than that in the free formulations . This methodology may be useful to verify the penetration through human skin of encapsulated substances applied to textile materials, which can be considered as strategic delivery systems for the release of a given active principle at specific doses in the skin.
The gene expression pathway initiates at nuclear transcription generating a pre - mrna, which very often undergoes splicing, post - transcriptional regulation, and then translation into a protein . During the pre - mrna splicing process, introns are removed and exons are joined in order to generate the mature mrna [13]. The formation of this functional megacomplex is an orchestrated assembly of proteins and rna that requires identification of exon - intron boundaries . Exons are regularly alternatively spliced, meaning that they are either included or excluded from the final mature mrna transcript . A recent comprehensive sequencing study observed that more than 90% of the genes undergo alternative splicing . This vastly increases the transcriptome repertoire, and emphasizes both the significance of splicing and the requirement for its accurate execution . In addition to protein coding genes, noncoding genes are transcribed . Micrornas (mirna), the most comprehensive noncoding group, are a class of ~22 nt noncoding rnas that inhibit gene expression through binding to the 3 untranslated region (utr) of target mrna transcripts [6, 7]. There are hundreds of unique mirnas in a given species, each predicted to regulate a plethora of target genes [913]. In fact, computational predictions indicate that mirnas may regulate 60% of all human protein coding genes . Therefore, it came as no surprise that mirnas were linked to many cellular processes such as differentiation, growth, and apoptosis, while mirna perturbations were associated with numerous diseases, including cancer [16, 17]. In the past few years, the pivotal role played by mirnas in gene regulation has been recognized [1820]. Mirnas are processed through a series of post - transcriptional biogenesis steps . The canonical maturation pathway, similar to protein - coding genes, initiates at transcription (mostly by rna polymerase ii) generating a primary (pri-) mirna . The pri - mirna is characterized by a hairpin rna structure recognized by the nuclear rnase - iii enzyme drosha, and its cofactor dgcr8 . The microprocessor cleaves the pri - mirna to generate a shorter hairpin of about 70 nt length the pre - mirna . This intermediate mirna is exported from the nucleus to the cytoplasm via exportin-5 where the rnase iii endonuclease dicer generates the final mature mirna . This short rna loses one of its strands (the complementary mirna * strand) while the other is loaded onto an argonaute - containing rna - induced silencing complex (risc) which mediates gene silencing . Once the mirna binds to its target gene, regulation takes place mainly through mrna degradation or translation inhibition [22, 23] (see figure 1). For simplicity, the widely used term mirnas can be located inter- or intragenically . When intergenic, their expression is coordinated with other mirnas as a cluster [25, 26]. When intragenic, namely, positioned within a protein - coding gene (almost exclusively in introns), they are often expressed from the same strand as their host - gene [2730] and at correlated levels . Given that both coding mrnas and mirnas are generated from the same transcriptional unit, and that they cooccur in close cellular proximity, it would be puzzling if these events exhibited total independence . Recent studies, from transcription, mirna - processing, and splicing oriented perspectives, have investigated these fascinating interactions and yielded interesting, yet somewhat controversial findings . Relationships between intronic mirnas and the processing events of their host mrna, namely, transcription and splicing have been addressed . Here we outline the major studies in the field . Expressed sequence tag (est) libraries of expressed mrnas the ests represent a snapshot of cellular transcripts at a particular time point and thus display the given mrna plethora and its variety at a particular cellular state . Analysis of this data revealed several chimeric transcripts containing mirna and part of the adjacent mrna sequences . At an early stage of mirna research notably, at a later stage, some of these est fragments were shown to be partially spliced, with either 5 or 3 ends matching putative drosha cleavage sites . These results strengthened the possibility that mirnas and mrnas are processed from the same rna substrate . In addition, the correlated expression pattern of host - gene transcripts and their mirnas suggested that mirnas have coevolved to use the same promoter for transcription . Along with this work, by comparing mirna processing in a construct containing only the intronic sequence versus one that also includes the flanking exons, pawlicki and steitz found that the levels of pri - mirna transcribed from introns are increased in the presence of flanking exons, due to prolonged retention at the site of transcription . This supported the notion that flanking exons may facilitate mirna processing by increasing the time pri - mirnas spend tethered to the dna template [33, 34]. Altogether, the data indicates that intronic mirna processing is enhanced by physical proximity to the site of transcription, and possibly also by splicing of the host gene . Several groups have isolated and identified various proteins associated with the human microprocessor complex [3537]. In these studies, numerous microprocessor - associated proteins were identified as splicing factors (e.g., hnrnph1;) or involved in pre - mrna processing (e.g., dhx15;). Taken together, based on mirna - mrna transcriptional (est) evidence; shared promoters; facilitated biogenesis when flanked by exons; and overlapping proteins between the functional complexes, the data suggests that the microprocessor is potentially enhanced and present during transcription and most likely also during splicing . If the same rna substrate is subjected to both host - gene and intronic mirna maturation, the intriguing question raised is how do all these processes transcription, pre - mrna splicing, and mirna processing the complexity of the mirna - host - gene interaction model has increased recently when studies from the proudfoot laboratory demonstrated that pre - mirnas are generated through cotranscriptional cleavage by drosha . Suggested that efficient clearance of intronic sequences following microprocessor (drosha) cleavage may act to enhance the splicing efficiency . These researchers showed that the microprocessor complex, as well as 5-3 and 3-5 rna exonucleases, are recruited to chromatin associated with intronic mirnas during transcription of the host primary transcript, and that drosha cleavage occurs before host intron splicing . They found that mirna - harboring transcripts preferentially associated with chromatin fractions, from which they concluded that both pre - mirna cleavage and intronic splicing must occur on the same nascent transcripts . The rapid exonucleolytic removal of intronic sequences may clear the proximal vicinity of rna processing for the purpose of efficiently completing the pre - mrna splicing task . The enhancement of splicing by the microprocessor does not agree with other studies [30, 40] (discussed below) and does not concur with experiments in yeast that showed enhanced processing for sirna flanked exons in splicing mutants . Dependencies are seen, for example, during the biogenesis process of small nucleolar rna (snorna) [4244]. In the process of snorna maturation, functional links between intronic snornp assembly, an antithesis to this dependency is the alternative mirna biogenesis pathway that bypasses the microprocessor via generation of mirtrons [48, 49]. This mechanistically distinct class of intronic mirnas stem from very short introns where splicing substitutes the first step of mirna biogenesis . In this case, splicing activities replace the requirements for a microprocessor . However, not all roads lead to the observed dependency between microprocessing and splicing . Ying and lin have designed an artificial intron containing a pre - mirna secondary structure . They used this construct to show that the mature mirna was released only from the spliced intron . This suggested that spliced introns are subsequently used by drosha and argued against any physical link between the microprocessor and the transcriptional unit or between the microprocessor and the spliceosome . . Showed that exons of pre - mrna are tethered to the elongating rna polymerase ii either directly or indirectly without affecting processing, indicating that cotranscriptional cleavage of nascent intronic mirna transcripts does not affect splicing efficiency [40, 51]. Supporting the same view, kim and kim addressed mirna biogenesis in light of the splicing mechanism . They demonstrated that cleavage of an intronic mirna did not significantly affect the production of mature mrna and, conversely, the production of mature mirna was not significantly affected by splicing . In their experiments, knockdown of drosha, or mutations in the mirna hairpin, eliminated mirna generation without dramatically affecting mrna splicing . This suggested that mirna biogenesis and splicing are coordinated but not functionally linked or interdependent . Taking a closer look, however, they also mention that drosha knockdown led to a modest increase in spliced mrna production and so did mutations in the mirna hairpin . Their work showed that the adjacent introns were spliced more rapidly than mirna - encoding introns, suggesting that binding of the microprocessor may eventually interfere with the splicing to some extent . Taken together, kim and kim's data imply mostly independent activities but cannot exclude the possibility that the microprocessor interferes, to some level, with splicing . Attempting to explain how both mirna and mrna are generated from the same dna locus, reconciling with the studies described here, we come up with two distinct models . The second predicts generation of an mirna and mrna products arising from two independent rna transcripts (see figure 2). If the latter scenario was true, microprocessing and splicing would be independent of each other . The outcome would be either no functional hindrance between the microprocessor and spliceosome activities or a competition for available pre - mrna substrates . In the event that both rna products originate from the same precursor, it is conceivable that the two processes happen consecutively . This would imply that execution of one process would be a prerequisite for the other to occur . Alternatively, mirna processing and mrna splicing may be coordinated so that the microprocessor and spliceosome interact with each other . This interaction may be minimal, without affecting the amounts of mirna and mrna produced as was suggested recently, or it may constitute a level of regulation . We note that these events should always be looked at in the spatial - temporal context meaning that the microprocessor might act at an independent rate prior to the spliceosome assembly, and thus their direct interaction would be prevented . Due to accumulating evidence, both in favor and against dependencies between splicing and microprocessing, the potential coordinated activity between the microprocessor and the spliceosome can be stratified into four possible relationships . The microprocessor can inhibit or activate the spliceosome, and the spliceosome can inhibit or activate the microprocessor (figure 3)., the microprocessor could activate the spliceosome by recruiting splicing factors to intronic mirnas, while at the same time the spliceosome could inhibit microprocessing . We cannot rule out, however, that these relationships occur in one large complex depending on the presence of particular rna processing proteins within the microprocessor . Many complex regulatory loops, both positive and negative, were seen in other cellular systems (e.g., see [52, 53]). The microprocessor, on the other hand, is composed of a handful of proteins [21, 36], minimally described as a two - protein complex [24, 35] (alternatively, see). It is hard to visualize these two very differently - sized complexes aligned at the same position, competing for the same substrate . Thus, a coordinated processing and crosstalk seems necessary for these complexes the microprocessor and the spliceosome to be able to process the same transcript with intricate accuracy . During the mrna splicing process, the rate at which transcription takes place may affect the transcripts' pattern of splicing . Thus, kinetics of intron removal and exon ligation may play a role in selecting particular spliced isoforms . Given that some introns undergo mirna excision, unless the removal is extremely rapid, one can imagine a possible effect on splicing outcome . Thus, from an evolutionary perspective, an intronic mirna might evolve to participate in determining splicing kinetics . Consequently, an evolutionary driving force may direct mirna positioning within the intron to prevent disruption of relevant splice signals (also see). In summary how widespread is the mechanism and does it govern all intronic mirnas? To date, not all microprocessor and spliceosome crosstalk scenarios (as described in figure 3) have been identified . Yet, given the complexity of cellular pathways, it is probably only a matter of time before their elucidation.
Animal welfare standards are becoming increasingly important even if there are different opinions in the definition of acceptable animal welfare conditions due to cultural, ethical or religious differences between individuals . The treaty of lisbon (european commission, 2007) recognizes animals as sentient beings, capable of feeling pain and pleasure, so that the european commission has adopted specific programmes to improve the animal welfare conditions and to protect them from maltreatment, abuse, pain or suffering during transport, restraint, stunning, slaughter, or killing . The world organization for animal health (oie) in its terrestrial animal health code states that the use of animals carries with it an ethical responsibility to ensure the welfare of such animals to the greatest extent practicable (oie, 2008). Animal killing for food production and the related operations are among the events that may induce pain, stress, fear and other forms of suffering to the animals even under the best available technical conditions . On the other hand, as widely described in literature, a better protection of animals during slaughter contributes to improving the quality of the meat . The directive 93/119/ec (european commission, 1993) on the protection of animals at the time of slaughter or killing had already established common minimum rules for the protection of animals at the time of slaughter or killing in the community . In 2009, the eu adopted the regulation (ec) n. 1099/2009 on the protection of animals at the time of killing, which lays down rules for the killing of animals bred or kept for the production of food, wool, skin, or other products (european commission, 2009). This regulation establishes the killing of animals (except some derogation, e.g. The religious slaughter) only after stunning, which is necessary to induce a lack of consciousness and sensibility . In order to maintain the loss of consciousness and sensibility until the death of the animal, the stunning procedure has to be performed in accordance with specific methods and parameters . In particular, the duration of unconsciousness induced by a stunning method must be longer than lapse between the end of stun and the time to onset of death . In this sense, given the high number of broiler chickens slaughtered for human consumption [about 60 billion of birds per year (fao, 2012)], the welfare of these animals during slaughter is of significant concern . To protect the poultry welfare, electrical water bath after shackling, the birds are immersed (generally up to their shoulders) into an electrified water bath, inducing unconsciousness due to the run of electric current through the head and body; the necks of the birds are then cut mechanically . Depending on the dimensions of the water bath, conventionally, a metal strip in the base of the water bath forms the positive electrode and the shackles earthed form the negative electrode, so that the electric current passes through the bird in the direction from head to legs . In particular, when the animals touch the water, the circuit closes causing the current to run through the head and body . The presence of several birds at the same time in the water creates a parallel pathway of resistance . Different combinations of electrical parameters can be chosen in order to optimize the current flow and achieve an effective, rapid, and long lasting stunning . In particular, the current intensity, the voltage, the frequency and the current type (alternating current or direct current) are the most common electrical parameters that can be changed to improve the stunning effectiveness and maintain a good meat quality . Often alternating current (ac) is used, even if in some slaughterhouses a pulsed direct current (dc) is applied . Values of frequency of 50/60 hz up to more than 2000 hz may be used . In general on the other hand, low frequencies cause high muscle contractions and consequent rupture of small blood vessels in the skin and/or flesh point . These aspects produce carcass defects with downgrading of meat quality (wilkins et al ., 1999). Therefore, to ensure both carcass and meat quality, higher stunning frequencies (> 300 hz) have become more common in poultry slaughterhouses (bilgili, 1999; gazdziak, 2007)., 1999; raj at al ., 2001) have reported the adverse effect of high stunning currents (especially at low frequencies) on meat quality . For instance in broilers stunned with currents higher than 130 ma an increase of breast muscle hemorrhages has been found . Red wing tips were also observed with a 50 hz sine wave ac above 110 ma . (2001), for example, found a significantly lower occurrence of broken bones and breast meat hemorrhages in broilers stunned with a sine wave ac of 1500 hz compared to 50 hz . A significant reduction of ventricular fibrillation and cardiac arrest was also observed with higher frequencies (bilgili, 1999; gazdziak, 2007). The annex i of the regulation (ec) n.1099/2009 establishes the minimum currents at which the animals shall be exposed in the water bath to guarantee an effective stunning . In particular, it defines three different current levels in correspondence of three different frequency ranges . A minimum exposure time for each bird of four seconds is also suggested . An efsa scientific opinion (efsa, 2012) specifies that the duration of unconsciousness induced by electrical stunning should be at least 45 seconds from the start of stunning to death by bleeding out . According to the regulation (ec) n.1099/2009, meat producers shall ensure that operators responsible for stunning carry out regular checks to ensure that the animals do not present any signs of consciousness or sensibility in the period between the end of the stunning process and death . Measuring the lack of consciousness and sensibility (i.e. Ability to feel pain) of an animal is complex and it needs to be performed under scientifically approved methodology . The occurrence of a flat, isoelectric, electroencephalogram (eeg) with a profound reduction of electrical brainpower to less than 10% of the pre - stun level has been used to indicate unconsciousness in broilers (raj et al . However, due to physical (line speed, difficulties to observation, high number of birds slaughtered, etc .) And economic (time, costs) constraints, use of eeg to verify the animal unconsciousness is not applicable in practice in the modern commercial poultry slaughterhouses . Changes in the behavior of poultry (e.g. Spontaneous blinking, wing flapping, spontaneous swallowing, head shaking), physical signs (e.g. Onset of seizures, cessation of breathing, fixed eye) and physiological reflexes (e.g. Response to external stimulus such as corneal reflex, response to pain stimulus such as comb or toe pinching) represent the common parameters used by the operators (erasmus et al ., the corneal reflex seems to be the most reliable parameter to evaluate unconsciousness (prinz et al ., 2010; erasmus et al ., 2010; efsa, 2013). In particular, the absence of corneal reflex in broiler chickens is considered as an effective indicator of deep unconsciousness (gregory and wilkins, 1989). A positive response itself, however, does not necessarily indicate sensitivity in broilers and ability to perceive pain; for this reason, it can be expected that a limited number of animals might still show a positive response for a short period post - stun . Under practical field conditions a maximum of 30% of corneal reflexes can be used as an indicator to identify an acceptable stunning . Studies based on the comparison between eeg results and occurrence of corneal reflex confirm this assumption (prinz et al . The aim of the present work is to identify the optimal setting of electrical parameters to obtain an effective water bath stunning in a commercial poultry slaughterhouse . In particular, different combinations of voltage and frequency values were tested in order to achieve a satisfying unconsciousness of the animals until their death . Moreover, a local commercial poultry slaughterhouse equipped with electrical water bath for bird stunning has been selected . A commercial stunner (linco water stunner ba4) was used to modify the voltage and frequency levels of the electric current provided to the water bath . The slaughter line speed was set up to ensure for each bird a minimum stunning time of 4 s, with four birds simultaneously submerged in the water . A digital ammeter placed on the water bath equipment allowed the monitoring of the actual total current in the water bath . As the birds present at the same time in the water creates a parallel pathway of resistance, calculations for the average current passing through the individual birds were made based on the measured amount at the water bath divided by the number of birds (four) simultaneously submerged in the water . Three different frequency levels (200 hz, 600 hz and 750 hz) combined with different voltages were tested . The selected electrical parameters allowed average currents passing through each chicken compliant with those required in the annex i of the regulation (ec) n.1099/2009 (european commission, 2009). The state of consciousness, as result of an ineffective or poor stun of the birds, was evaluated at three key stages: i) immediately after stunning, ii) at the time of neck cutting, and iii) during bleeding until death occurred . The parameter used as consciousness indicator was a positive corneal reflex (blinking response elicited by touching or tapping the cornea) and the stunning process was considered as inadequate if it induced a positive corneal reflex in more than 30% of birds . The effects of each tested combination of stunning electrical parameters were evaluated on 100 consecutive broiler chickens (genetic line ross 708) having weights ranging from 3 to 4.5 kg . Moreover, the carcasses and meat quality parameters in relation to the above stunning conditions parameters were evaluated . To this aim, in table 1 the results obtained with different stunning procedures (different combinations between frequency and voltage of electrical current) on broilers slaughtered at different live weight are summarized . A frequency of 200 hz and a voltage of 40 v were initially set for broilers with an average live weight of 3.95 kg . These values generated a total current of 120 ma, as displayed on the ammeter at the water bath . So, the estimated average current flowing through each bird was 30 ma (120 ma divided by the number of birds simultaneously submerged in the water). These stunning parameters induced in 92% of the tested broiler chickens, with a standard error (se) of 2.71%, a positive response to the corneal reflex in order to improve the stunning effectiveness and to reduce the number of animals with a positive corneal reflex, the applied voltage was increased . In particular, two different voltages (80 v and 100 v) were tested for broilers with an average live weight of 3.750 kg . These combinations generated total average electric currents in the water bath of 210 ma and 260 ma, respectively corresponding to estimated average currents per individual bird of 53 ma (at 80 v) and 66 ma (at 100 v). Stunning with an estimated current of 53 ma showed a positive response to the corneal reflex in 25% of the animals (with a se of 4.33%). A significant reduction of birds with corneal reflex (only 5%) was observed when an estimated current of 66 ma per animal was applied . About one third (29%) of the birds stunned with a current of 53 ma showed lesions mainly in breast but also in leg muscles . Petechiae and wide blood effusions (figures 1, 2 and 3) represented the most frequent lesions . A higher percentage of animals (67%) with similar lesions was found in the birds stunned with a current of 66 ma . As a consequence of the above results, the effects of higher frequency currents, in particular frequencies of 600 and 750 hz, were investigated . An average estimated current for each bird of 150 ma at 600 hz and 200 ma at 750 hz were applied to 100 birds having an average live weigh of 4.2 kg . The corneal reflex was still used as consciousness indicator but, in order to have additional information on stunning effectiveness, the response to comb pinch was also evaluated . The obtained results showed that when birds were stunned with an estimated current of 150 ma and a frequency of 600 hz, 46% of animals was positive to the corneal reflex (with a se of 4.98%) and no one of them was positive to comb pinching test . Stunning with an average electric current for individual bird of 200 ma at a frequency of 750 hz produced a lower percentage (12%) of animals with a positive response to corneal reflex and no positive birds to comb pinching test . No negative effect has been found on carcasses and meats as well as no macroscopic lesions in both experiments . The above reported results indicated that a frequency of 750 hz and a total current of 800 ma (200 ma per bird) could guarantee an effective stunning for the majority of the broilers without compromising the carcass and meat quality . Our experiments confirmed that high stunning frequencies induce a lower occurrence of lesions on carcasses, but are less effective at stunning and require greater electrical current intensities to be effective . The results also suggested that electrical water bath stunning, complying with the parameters indicated in the regulation (ec) n. 1099/2009, rarely produces unconsciousness in all the animals without any consequence on meat quality . A reason for this result is that both in the annex i to regulation (ec) no 1099/2009 and in the stunning equipment at the slaughterhouses, the optimal electrical parameters are defined as an average value per animal . The electrical current measured (and that can be read on the ammeter at the abattoir) in a multiple - bird stunning water bath indicates the total current that flows through all the birds in the water bath, and can be used to calculate only the average current for each bird (sparrey et al ., 1993). As variations in impedance (resistance) between the birds are significant, it is not possible to ensure constant electric current for each stunned chicken . Therefore, by using an average value, the risk is that some animals are not stunned effectively because they receive insufficient electric current to ensure unconsciousness and insensibility (bilgili, 1999; kettlewell and hallworth, 1990; shields and raj, 2010). The problem could be resolved by increasing the average stunning currents in the recommendations of the regulation (ce) n.1099/2009 (european commission, 2009), but this can produce in some animals a poor meat quality with lesions on carcasses and meats . It can be due to a higher weight and/or size of these birds, to the fat content of their muscles, to a peculiar skull bone structure and thickness, but also to shackle conditions (degree of fouling, contact area with bird) (bilgili, 1992; boyd, 1994; kettlewell and hallworth, 1990). This is also the reason because most studies on electrical parameters for water - bath stunning (especially laboratory - scale studies) are difficult to extrapolate directly to large - scale field conditions (bilgili, 1999; raj, 2004). Further research would be needed to ensure that also birds with an higher impedance are stunned effectively avoiding, at the same time, lesions on carcasses of broiler chickens with lower resistance to the electrical current flowing . For this reason, the influence of some peculiar features of broilers on their electrical resistivity is currently investigated . The present work aimed to find an optimal setting of electrical parameters for the water bath stunning in a commercial poultry slaughterhouse without any negative influence on carcass and meat . The results obtained, using several combinations of voltages and frequencies, showed that low frequencies (200 hz) were not able to guarantee adequate welfare conditions with low electric current intensity (30 ma / bird). An increase in electric current intensity (53 and 66 ma / bird), maintaining a frequency of 200 hz, produced macroscopic lesions on carcasses with an adverse effect on meat . On the contrary, a frequency of 750 hz and an intensity of 200 ma for each bird resulted as the best combination of electrical parameters to obtain an effective stunning for the majority of animals without negative impact on the carcass and meat quality.
Neurocognitive dysfunctions have received considerable attention as potential endophenotypic markers for bipolar disorder (bd) as these are seen in patients (during the euthymic phase) and in the first degree relatives . The various neurocognitive deficits in patients with bd include deficits in attention, processing speed, set shifting, verbal learning, and memory . Data arising out of various studies and meta - analysis have also shown that unaffected siblings of patients with bd also have neurocognitive deficits . Unaffected siblings of bd patients have been shown to have deficits in set shifting, attention, processing speed, and memory functions, a profile similar to that of patients with bds . However, the deficits may not be as marked in the unaffected siblings as in patients . In terms of the strength of the findings, meta - analysis suggest that compared with the healthy controls, the neurocognitive deficits in the first degree relatives have a small effect size for executive functions, verbal memory and sustained attention . However, data on neurocognitive deficits in unaffected siblings of bd is limited and there is a need to expand this data . For a trait to be recognized as an endophenotype, there is a need for establishing the same across different ethnic groups . Occasional studies involving healthy siblings of patients with bd have been conducted in india; however, these studies have compared the relatives of patients with bd with healthy controls only . In this background, this study aimed to compare the cognitive function of unaffected siblings of patients of bd with that of patients of bd and a group of healthy controls . This study was conducted at the outpatient clinic of department of psychiatry of postgraduate institute of medical education and research, chandigarh, a tertiary care hospital in north india . The study was approved by the institutional ethics committee and all the participants were enrolled about obtaining written informed consent . The study included three groups: the unaffected siblings of patients with bd, patients of bd and a healthy control group . The inclusion criteria for the participants in all the three groups were age between 18 and 60 years, being able to read and write hindi and english, and being free from any significant medical comorbidity (involving the brain, raised blood pressure etc .) And auditory / visual impairment . The unaffected siblings group included subjects with a diagnosis of bd type i in their first degree relative but themselves were never diagnosed to have a psychiatric disorder . The psychiatric disorders (except for nicotine dependence) in the siblings were ruled out on the basis of the history provided by the participants, patients and other family members were ever available . The patient group included those with a diagnosis of bd type i according to dsm - iv criteria, and currently in euthymic phase (hamilton depression rating scale [hdrs] score <8 and young mania rating scale [ymrs] score <6), were not taking benzodiazepines during the day time and free from any other comorbid psychiatric disorder apart from nicotine dependence . The healthy controls comprised of those who did not have any first or second degree relative suffering from any psychiatric disorder and they were not suffering from any psychiatric disorder apart from nicotine dependence . This was established on the basis of the history provided by the participants and their relatives . This observer rated scale, consists of 17 items and scores can range from 0 to 50 . The scores can range from 0 to 60 and a total score <6 is considered to be indicative of euthymic range . This test is a measure of executive function that requires planning, use of feedback and cognitive set shifting ., subjects are required to match a card that appears on the bottom part of the computer screen to one of four stimulus cards that are present on the upper part of the computer screen . The stimulus cards have four different designs, that is, the first has a red circle, the second has two green stars, the third has three yellow crosses, the forth has four blue circles . The cards that subject are required to match to one of four stimulus cards vary in color, geometric form and number . A subject is presented with 8 inches by 11 inches card with six simple design in a 2 by 3 matrix . The stimulus is shown for 10 s after which the subject is asked to reproduce as many designs in an accurate and correct location in a blank sheet of paper . The subjects are asked to reproduce the design on three trials and after a 25 min delay . This is followed by a recognition trial in which 12 designs are shown again, one at a time (6 from the original design) and the subject is asked whether the design was present in the original matrix . The test measures immediate recall, learning rate, delayed recall as well as recognition for visuospatial information . The test includes three learning trials for a set of words each followed by a recall and then followed by a delayed recall after 20 min delay . This is followed by a yes or no recognition trial, in which the subject is asked to identify the words from a list of words which also include the initially read out words . The list in this recognition trial is also read out to the subject . This test requires the subject to match symbols to numbers as quickly as possible using a visual reference . The siblings of patients with bd - i were recruited among the caregivers who were attending the psychiatry outpatient clinic of the hospital and came along with patients of bd - i . Similarly, the patients with bd - i were recruited from the patients attending the psychiatry outpatients . The control group was recruited from the nongenetically related caregivers of the patients with bd and hospital staffs . Initially the participants were evaluated on the selection criteria and those who fulfilled the selection criteria were enrolled . The neurocognitive battery was administered by a clinical psychologists (rn, ss, as), who have sufficient experience of using the tests . The neurocognitive testing was done between 10 am and 2 pm over 1 - 2 sitting, not more than 1 h apart . For the patients receiving benzodiazepines, it was ensured that they did not receive the same during the 12 h prior to the assessment on neurocognitive testing . Statistical analysis was carried out using spss software version 14 (spss, chicago [il], us). Descriptive statistics in the form of frequencies, percentages, means, and standard deviations were used for studying the demographic, clinical and neurocognitive variables . The three groups were compared by using the chi - square test for the categorical variables and analysis of variance for continuous variables . When the frequency of the number of cases for a particular variable was <5 in a cell, weighted cases was used to calculate the chi - square value . To account for the confounders, analysis of covariance this study was conducted at the outpatient clinic of department of psychiatry of postgraduate institute of medical education and research, chandigarh, a tertiary care hospital in north india . The study was approved by the institutional ethics committee and all the participants were enrolled about obtaining written informed consent . The study included three groups: the unaffected siblings of patients with bd, patients of bd and a healthy control group . The inclusion criteria for the participants in all the three groups were age between 18 and 60 years, being able to read and write hindi and english, and being free from any significant medical comorbidity (involving the brain, raised blood pressure etc .) And auditory / visual impairment . The unaffected siblings group included subjects with a diagnosis of bd type i in their first degree relative but themselves were never diagnosed to have a psychiatric disorder . The psychiatric disorders (except for nicotine dependence) in the siblings were ruled out on the basis of the history provided by the participants, patients and other family members were ever available . The patient group included those with a diagnosis of bd type i according to dsm - iv criteria, and currently in euthymic phase (hamilton depression rating scale [hdrs] score <8 and young mania rating scale [ymrs] score <6), were not taking benzodiazepines during the day time and free from any other comorbid psychiatric disorder apart from nicotine dependence . The healthy controls comprised of those who did not have any first or second degree relative suffering from any psychiatric disorder and they were not suffering from any psychiatric disorder apart from nicotine dependence . This was established on the basis of the history provided by the participants and their relatives . This observer rated scale, consists of 17 items and scores can range from 0 to 50 . The scores can range from 0 to 60 and a total score <6 is considered to be indicative of euthymic range . This test is a measure of executive function that requires planning, use of feedback and cognitive set shifting ., subjects are required to match a card that appears on the bottom part of the computer screen to one of four stimulus cards that are present on the upper part of the computer screen . The stimulus cards have four different designs, that is, the first has a red circle, the second has two green stars, the third has three yellow crosses, the forth has four blue circles . The cards that subject are required to match to one of four stimulus cards vary in color, geometric form and number . A subject is presented with 8 inches by 11 inches card with six simple design in a 2 by 3 matrix . The stimulus is shown for 10 s after which the subject is asked to reproduce as many designs in an accurate and correct location in a blank sheet of paper . The subjects are asked to reproduce the design on three trials and after a 25 min delay . This is followed by a recognition trial in which 12 designs are shown again, one at a time (6 from the original design) and the subject is asked whether the design was present in the original matrix . The test measures immediate recall, learning rate, delayed recall as well as recognition for visuospatial information . The test includes three learning trials for a set of words each followed by a recall and then followed by a delayed recall after 20 min delay . This is followed by a yes or no recognition trial, in which the subject is asked to identify the words from a list of words which also include the initially read out words . The list in this recognition trial is also read out to the subject . This test requires the subject to match symbols to numbers as quickly as possible using a visual reference . In this test, a subject is presented with 8 inches by 11 inches card with six simple design in a 2 by 3 matrix . The stimulus is shown for 10 s after which the subject is asked to reproduce as many designs in an accurate and correct location in a blank sheet of paper . The subjects are asked to reproduce the design on three trials and after a 25 min delay . This is followed by a recognition trial in which 12 designs are shown again, one at a time (6 from the original design) and the subject is asked whether the design was present in the original matrix . The test measures immediate recall, learning rate, delayed recall as well as recognition for visuospatial information . The test includes three learning trials for a set of words each followed by a recall and then followed by a delayed recall after 20 min delay . This is followed by a yes or no recognition trial, in which the subject is asked to identify the words from a list of words which also include the initially read out words . The list in this recognition trial is also read out to the subject . This test requires the subject to match symbols to numbers as quickly as possible using a visual reference . The siblings of patients with bd - i were recruited among the caregivers who were attending the psychiatry outpatient clinic of the hospital and came along with patients of bd - i . Similarly, the patients with bd - i were recruited from the patients attending the psychiatry outpatients . The control group was recruited from the nongenetically related caregivers of the patients with bd and hospital staffs . All the three groups were recruited by purposive sampling . Initially the participants were evaluated on the selection criteria and those who fulfilled the selection criteria were enrolled . The neurocognitive battery was administered by a clinical psychologists (rn, ss, as), who have sufficient experience of using the tests . The neurocognitive testing was done between 10 am and 2 pm over 1 - 2 sitting, not more than 1 h apart . For the patients receiving benzodiazepines, it was ensured that they did not receive the same during the 12 h prior to the assessment on neurocognitive testing . Statistical analysis was carried out using spss software version 14 (spss, chicago [il], us). Descriptive statistics in the form of frequencies, percentages, means, and standard deviations were used for studying the demographic, clinical and neurocognitive variables . The three groups were compared by using the chi - square test for the categorical variables and analysis of variance for continuous variables . When the frequency of the number of cases for a particular variable was <5 in a cell, weighted cases was used to calculate the chi - square value . To account for the confounders, analysis of covariance was used for computation of corrected f scores . As the number of cases in some of the cells was <5, for the variables of gender, marital status, education, occupation and religion, weighted cases were taken to carry out the chi - square test . As shown in table 1, there was no significant difference among the three study groups with respect to various sociodemographic variables such as age, marital status, employment status, education level, religion and locality of living . Demographic profile of participants the mean duration of illness in patients with bd was 102 (standard deviation [sd]-70.8) months and the mean duration of treatment was 89.4 (sd-67.3) months . The mean hdrs score of the patient group was 2.4 (sd-1.90) with a median of 2 . Similarly, the mean ymrs score was 1.00 (sd-1.12) with a median of 0.5 . All patients of the bd were on medications, of them 35% were receiving valproate, 55% were receiving lithium carbonate and 10% were not on any mood stabilizers . Ten patients (50%) were receiving antipsychotics, 2 (10%) patients were on antidepressants and 4 (20%) patients were receiving benzodiazepines . Prior to neuropsychological assessment for the current study, the mean duration of euthymia prior to assessment was 16.5 (sd-19.25) months, the mean number of lifetime manic episodes were 2.85 (sd-1.38), mean number of lifetime depressive episodes were 1.50 (sd 1.23) and the mean number of mixed episodes were 0.50 (sd-0.22). Total number of lifetime episodes prior to assessment for the current study was 4.40 (sd-2.8). As shown in table 2, on wisconsin card sorting test (wcst), relatives of patients with bd performed significantly better than the patients in terms of wcst total score, wcst total number of errors, wcst nonperseverative errors and wcst conceptual level responses . Comparison of findings of cognitive functioning as is evident from table 2, the performance of patients with bd was significantly poorer than the unaffected siblings and healthy controls in terms of wcst total scores, wcst total errors, wcst nonperseveratory errors and wcst concept responses . However, the siblings of patients with bd did not differ significantly from the healthy controls on any of the wcst measures . On brief visuospatial memory test (bvmt) and wechsler adult intelligence scale digit symbol test (wais dst), patients with bd performed poorly than the unaffected siblings and healthy controls on all the measures . However, no significant differences were seen between the unaffected siblings and the healthy controls on bvmt and wais dst . On hopkins verbal learning test too, there was significant difference between the patients with bd and the unaffected siblings on all the measures . In addition, the performance of unaffected siblings was significantly poorer compared to healthy controls . As the number of cases in some of the cells was <5, for the variables of gender, marital status, education, occupation and religion, weighted cases were taken to carry out the chi - square test . As shown in table 1, there was no significant difference among the three study groups with respect to various sociodemographic variables such as age, marital status, employment status, education level, religion and locality of living . Demographic profile of participants the mean duration of illness in patients with bd was 102 (standard deviation [sd]-70.8) months and the mean duration of treatment was 89.4 (sd-67.3) months . The mean hdrs score of the patient group was 2.4 (sd-1.90) with a median of 2 . Similarly, the mean ymrs score was 1.00 (sd-1.12) with a median of 0.5 . All patients of the bd were on medications, of them 35% were receiving valproate, 55% were receiving lithium carbonate and 10% were not on any mood stabilizers . Ten patients (50%) were receiving antipsychotics, 2 (10%) patients were on antidepressants and 4 (20%) patients were receiving benzodiazepines . Prior to neuropsychological assessment for the current study, the mean duration of euthymia prior to assessment was 16.5 (sd-19.25) months, the mean number of lifetime manic episodes were 2.85 (sd-1.38), mean number of lifetime depressive episodes were 1.50 (sd 1.23) and the mean number of mixed episodes were 0.50 (sd-0.22). Total number of lifetime episodes prior to assessment for the current study was 4.40 (sd-2.8). As shown in table 2, on wisconsin card sorting test (wcst), relatives of patients with bd performed significantly better than the patients in terms of wcst total score, wcst total number of errors, wcst nonperseverative errors and wcst conceptual level responses . Comparison of findings of cognitive functioning as is evident from table 2, the performance of patients with bd was significantly poorer than the unaffected siblings and healthy controls in terms of wcst total scores, wcst total errors, wcst nonperseveratory errors and wcst concept responses . However, the siblings of patients with bd did not differ significantly from the healthy controls on any of the wcst measures . On brief visuospatial memory test (bvmt) and wechsler adult intelligence scale digit symbol test (wais dst), patients with bd performed poorly than the unaffected siblings and healthy controls on all the measures . However, no significant differences were seen between the unaffected siblings and the healthy controls on bvmt and wais dst . On hopkins verbal learning test too, there was significant difference between the patients with bd and the unaffected siblings on all the measures . In addition, the performance of unaffected siblings was significantly poorer compared to healthy controls . Most of the previous studies which have evaluated patients with bd have compared them with healthy controls . Studies which have evaluated the first degree relatives or siblings have compared them with a control group . This design can be considered to provide better information about the existent of endophenotypes associated with a disorder . Healthy first degree relatives of patients with bd are considered to be an important group to study the endophenotypes . This study attempted to compare the neurocognitive functioning of unaffected siblings of patients with bd, patients with bd and the healthy controls . All the three groups were matched on the sociodemographic variables, suggesting that the differences in the neuropsychological domains seen in the present study cannot be attributed to these variables . For this study, we selected the tests for the cognitive domains of executive functioning, visual memory, verbal memory and learning, psychomotor speed, concentration and graphomotor abilities because these are among the most important cognitive domains for daily functioning and have been reported to be commonly involved in the siblings of patients with bd . The finding of present study, that is, compared with the healthy controls, euthymic patients of bd have cognitive deficits in all the neurocognitive domains studied is in accordance to the existing literature . Meta - analytic studies suggest that patient with bd have neuropsychological impairments in the domains of attention and processing speed, verbal learning, memory and executive functioning etc . Endophenotypes are considered to be intermediate phenotypes which arise due to genetic vulnerability associated with a particular disorder . Considering this fact finding any neurocognitive endophenotype associated with bd can help in understanding this disorder better . Three meta - analysis have evaluated the level of neurocognitive dysfunction in relatives / siblings of patients with bd and have reported consistently that the relatives of bd have deficit in the domain of verbal memory, although there are some differences with regards to the subdomains of verbal memory . One meta - analysis included 17 studies comprising of 443 relatives of patients with bd and 797 healthy controls and suggested that relatives of patients with bd have impairments in the trail making test - b, wcst perseveration, continuous performance test omission, verbal learning and immediate recall . The second meta - analysis which included 532 relatives and 854 healthy controls suggested that 6 out of the 11 studies included reported impairment in the broad domain of verbal memory and learning in relatives compared to the healthy controls . When the effect size was specifically evaluated for the twin studies, unaffected co - twins had impairment in the domain of verbal declarative memory, but the effect size was not as compelling as seen with mixed group of relatives . Among the various domains of verbal memory, long delayed recall was reported to be more specifically impaired in the list learning task, but not in the story recall task . Further, the meta - analysis concluded that in relatives of patients with bd visualspatial learning and memory, alternating attention, psychomotor speed, abstraction / cognitive flexibility, sustained attention and selective attention are mostly preserved . The third meta - analysis reported large effect sizes for impairment of verbal memory and executive function (working memory, executive control, fluency) in relatives of patients with bd compared with healthy controls . The same meta - analysis also reported that compared with healthy controls relatives of bd also have impairments in the domain of executive function (concept shifting, executive control), mental speed, visual memory, and sustained attention, but the effect sizes are of medium sizes (0.5 - 0.8). When we compare the findings of our study with these meta - analysis, our results concur with regards to the impairment in the domain of verbal memory with all the meta - analyses and preserved functioning in the domains of executive functioning, visual memory, psychomotor speed, concentration and graphomotor abilities, with 2 of the 3 meta - analyses . Our findings also concur with that reported in a previous study from india which reported impairment in the verbal memory . However, our findings differ from some of the studies done from india, which have reported impairment in some of the domains of executive functions . However, it must be remembered that one of these study included only 10 siblings of bd patients and other included unaffected first degree relatives rather than siblings only . It is quite possible that the differences in the findings may be influenced by the sample size and genetic loading for bipolarity . Lack of difference on most of the neuropsychological tests between healthy controls and siblings of patients with bd suggests that these may not be endophenotypes associated with bd . The consistent finding from the existing literature and our study suggest that verbal memory is an important endophenotype of bd . Some limitations of the present study should be considered, while interpreting the findings . All the study groups were recruited through purposive sampling and the study included only 20 participants in each group . The study was limited to a clinic population and generalization to community sample should be done with caution . Our sample did not include twin - pairs and the sociodemographic data was group matched rather than case to case matched . To conclude, the findings of the present study suggest that some cognitive markers can distinguish unaffected siblings of bd from healthy controls . This can be useful in clinical practice to ascertain the genetic liability in an index case for bd . Furthermore, it may provide quantitative deficits of neurocognitive functioning which can help in implementing remedial measures . The present evidence base for such neurocognitive markers has not consolidated to the point of promulgation of specific tests or domains as specific replicable discriminating endophenotypes.
The mucopolysaccharidoses (mps) are a family of genetic disorders characterized by changes in an individual s ability to metabolize mucopolysaccharides, which are complex sugar molecules found in the connective tissue, mucosal fluids, synovial fluid, and other cells throughout the body . There are six types of mps, with some types having several subtypes . According to brown (1999), epidemiological data are problematic to report, but range from 1 in 100 000 live births to 1 in 600 000 live births . This dysfunction in metabolism may result in a variety of distinct physical features, such as short stature, contracture of joints, claw - like hands, abnormal spine curvature, and hydrocephalus (neufeld and muenzer 1995). Treatment options vary, but hematopoietic cell transplantation seems to offer the best long - term quality of life improvement and decreased mortality and morbidity options for children with some of the more severe forms of mps (grewal et al 2002). One subtype of mps is mps i, which includes hurler, scheie, and hurler - scheie syndromes . Each of these disorders within mps i is caused by a deficiency of alpha - l - iduronidase . Within mps i, hurler syndrome is generally associated with more severe features and poorer prognosis than either scheie or hurler - scheie syndromes (brown 1999). In most cases of hurler syndrome, motor skills are limited by age 18 months, and developmental regression occurs, including progressive loss of neurocognitive functioning, resulting in mental retardation . With hurler - scheie syndrome, these declines usually appear between 3 and 8 years of age, with milder neurocognitive losses and a low risk for early mortality . These neurocognitive losses typically include progressive dementia resulting from hydrocephalus and increasing deposits of nonmetabolized mucopolysaccharides (shapiro et al 1995). Language and memory deficits after a period of initial developmental slowing have been associated with the more severe forms of mps i (guffon et al 1998). While neurocognitive deficits have been associated with mps, to date there are few neurocognitive reports of children with this disorder and no longitudinal studies, resulting in scant knowledge regarding appropriate assessment and intervention (brown 1999). Many studies report cross - sectional assessments of these children at different stages . In this case report, we have the opportunity to follow a young lady with hurler - scheie syndrome over the course of 10 years, documenting the quantity and quality of neurocognitive effects associated with this disease . This represents a rare chance to longitudinally track the effects of hurler - scheie in a young person and allows recommendations to be made to health care professionals regarding potential neurocognitive and psychological care for children with this disorder . Researchers are currently engaging in novel therapies designed to reduce and perhaps reverse the effects of hurler - scheie . However, while these therapies may have a beneficial effect on orthopedic, skeletal, or ophthalamic problems, their effect on neurocognitive functioning is not clearly understood . Thus, we are in a position to begin documenting both the physiological and neurocognitive effects of these new treatments . The focus of this case report is to describe long - term neurocognitive changes in a young female with hurler - scheie syndrome that was treated using enzyme replacement therapy . To our knowledge, this is the first longitudinal case report of a patient receiving enzyme replacement therapy for hurler - scheie syndrome . The following information was collected with the approval of the institutional review board at the university of mississippi medical center . We report the case of a now 15-year - old female diagnosed with mps - i, specifically hurler - scheie syndrome, alpha (not her real name). Alpha s mother gave consent for her child to serve as a subject in this investigation, and alpha gave assent . Her mother reported alpha grew well at first, but then seemed to slow down . Her mother also noted alpha could not raise her arms over her head, even as an infant . At age 3.5 years, alpha complained of wrist pain, and was seen by her primary care physician . Alpha began taking gymnastics class as part of her 4-year - old preschool; her instructor noted that alpha could not touch her toes or raise her arms . Alpha was then referred to a local orthopedic clinic and x - rays were obtained . According to alpha s mother, the clinic noted something wrong on the x - ray films, and referred alpha to a pediatric orthopedic surgeon for further evaluation . Alpha could not actively abduct her shoulders beyond 90 degrees and passive abduction was limited to 130 degrees . She was noted to have good finger function and grip, and a full range of motion in her neck, hips, knees, ankles, and elbows, with no appreciable organomegaly . However, after reviewing the x - rays and noting atypical features such as broad ribs with some notching at the medial metaphyseal ends, and smaller than usual femoral heads bilaterally, the orthopedic surgeon suspected alpha had scheie syndrome, one of the mps i syndromes . Alpha was referred to a geneticist to conduct urine and blood tests and was diagnosed with hurler - scheie syndrome . By age 8, alpha remained a very happy, bright young lady who was active in theatre camp and swimming (she used her own, special technique according to her mother). She could actively abduct her shoulders 80 degrees and had about 50% range of motion in her neck . She was wearing glasses, was an avid reader, and was doing very well in school . By age 10 in 1999, alpha was 50 inches (124 cm) tall and weighed 71 pounds (32 kg). She had restricted range of motion in her hips and knees, and was beginning to complain of neck pain . In 2000, at the age of 12, alpha was admitted for the placement of a vp shunt secondary to increasing hydrocephalus . She also began enzyme replacement therapy in 2000 on a pharmaceutical study at the age of 12, as well as outpatient physical therapy to encourage range of motion in her extremities . Tanner staging was noted as appropriate for her age; in general, hurler - scheie and scheie patients have normal puberty and reproductive abilities . Her neurocognitive functioning was assessed three times, in june 1994 when she was 5 years 11 months old, in june 2002 when she was 13 years 11 months old, and in july 2003, when she was 15 years old . The initial assessment at age 511 was not conducted by the authors, but took place at another location . However, this assessment was done by a licensed clinical psychologist who used age - appropriate, valid measures . Copies of the report from that assessment were reviewed from the patient s medical chart . Given her young age (511) at her initial assessment, the patient was administered the stanford - binet intelligence scale, fourth edition, and the wide range achievement test, third edition (see table 1). These measures assess for intelligence (iq) and achievement, respectively . At the time, the patient had just completed kindergarten, had no behavior problems, and was considered by her teachers to be ready for the first grade . Her mother likewise thought the patient was doing well academically, but was concerned that the patient could perhaps have been showing signs of mild forgetfulness . Overall, the scores on these measures range from the average to the highly superior range, as she scored at or above the 90th percentile in most areas . At that time, it was clear that alpha was functioning in the average to superior range intellectually and academically, and had no significant behavioral or emotional problems . Alpha s parents were aware of the impressive nature of these findings, but were also aware of the usual course of this disease, including gradual neurocognitive decline . They began both systematic and non - specific interventions designed to challenge alpha intellectually and stimulate her already significant cognitive abilities . Alpha was enrolled in a school that stressed academic excellence, and her mother reported that alpha did well through the seventh grade . Alpha was home - schooled for the second half of the seventh grade, as she was travelling frequently to receive treatment for her condition . When she began eighth grade back at her same school, her grades began to fall from consistent as up through the seventh grade to bs and cs in the eighth grade . This prompted alpha s parents to seek another neurocognitive evaluation . At the time of the second assessment, the patient was 13 years and 11 months, and this second battery consisted of parts of the wechsler intelligence scale for children third edition (wisc - iii), woodcock - johnson tests of cognitive ability third edition (wj - iii), the wide range assessment of memory and learning (wraml), the california verbal learning test children s version (cvlt - c), the stroop color and word test, the rey - osterrieth complex figure test (rocf), the child behavior checklist (cbcl - parent report), the youth self report (ysr), the children s depression inventory (cdi), and the revised children s anxiety and depression scale (rcads). This battery is designed to be a comprehensive measure of intelligence, neurocognitive functioning, and behavioral and emotional adjustment . It should be noted that though different batteries of measures were used between neurocognitive assessments, the results from both assessments are comparable . Specifically, overall intelligence quotient (iq) scores between the stanford - binet and the woodcock - johnson show good correlation (sattler 1992). Results from this second assessment indicate a significant decline in overall abilities from alpha s initial level of functioning . Her abilities were now within the average range of functioning; however, she again demonstrated no significant behavioral or emotional problems . Alpha s parents began implementing suggested interventions, including after school tutoring and structuring alpha s study time so that she studied for short blocks of time with frequent breaks . At the time of this report, alpha s mother described alpha as doing better in school (generally bs and cs, a few as), and continuing to be emotionally and socially well - adjusted . She completed the same battery as the one she completed at age 1311 (see table 3). While declines in neurocognitive functioning are generally expected in children with mps, this case report of a young lady with hurler - scheie demonstrates that declines may proceed at different rates and are likely influenced by premorbid neurocognitive functioning and environmental behavioral vectors . In other words, alpha s current level of average neurocognitive functioning is probably the result of impressive capabilities prior to the onset of hurler s syndrome as well as the degree of intervention and cognitive expectations that characterize her family system . The idea of cognitive reserve as a protective factor in individuals who have some sort of neurological insult has been assumed in children with traumatic brain injury and brain tumors . Thus, it could be that since alpha had such a high premorbid level of functioning, she had more to spare during the course of her illness and treatment (taylor 2004). It should be noted that many children with hurler - scheie show some degree of cognitive sparing, in comparison with other types of mps . It should be noted that alpha has been diagnosed with a milder form of mps, hurler - scheie, and that this subtype of mps has been shown to involve relative neurocognitive sparing (brown 1999). However, this report is the first of its kind to our knowledge to document longitudinal changes in a youngster . The issue of alpha s current level of neurocognitive functioning cannot be fully addressed in this report . Her initial decline is undoubtedly related to her diagnosis of hurler - scheie syndrome . However, the amount of decline and conversely the degree of neurocognitive sparing attributable to her premorbid functioning and behavioral interventions by her parents is indeterminable . The differences in her test performance may be attributable to regression to the mean, a common result of multiple assessments conducted on a single individual . Consequently, we cannot estimate the amount of variance accounted for by alpha s premorbid intellectual capabilities, hurler - scheie syndrome, and her parents level of cognitive and intellectual interventions . It should also be noted that the measured decline in iq might be related to progressive motor dysfunction, as this might affect some of the subtests on the neurocognitive measures . There are no reports of the possible neurocognitive - sparing or improving effects of enzyme replacement therapy, which alpha received . Weaknesses of this case report include the use of different measures of intelligence and neurocognitive functioning . However, all measures used to assess this patient are well - established, well - validated measures, and hence should be interpreted as adequately reflecting her level of neurocognitive functioning at the time they were administered . This case represents a unique opportunity to study a genetic disorder with neurocognitive effects, in the light of apparently strong biological and environmental protective factors . Children with hurler - scheie syndrome should be followed regularly with neurocognitive assessments in order both to document expected intellectual declines and to target areas for cognitive and behavioral interventions that might slow the decline associated with this disease . The strong behavioral and environmental support that alpha received from her parents cannot be discounted . Alpha s parents proactively began working with her in light of her diagnosis, and then followed through with a neurocognitive rehabilitation plan suggested by the first author (tde). This neurocognitive rehabilitation plan was tailored to address the specific levels of functioning that alpha evidenced from her assessments . We strongly recommend neurocognitive assessment and intervention for these patients, alongside newer medical interventions . The lack of continued neurocognitive decline from age 1311 to age 150 may be attributable to (1) the milder form of mps with which alpha was diagnosed, (2) the newer treatments initiated by the team of physicians (jm), (3) the fact that alpha probably began life with a higher - than - average neurocognitive capacity, or (4) the supportive and appropriately challenging environment of social support that alpha enjoyed . However, neurocognitive assessment adds a low burden to an overall treatment plan, and can help with behavioral interventions designed to improve long - term neurocognitive functioning.
Access to adequate and safe blood transfusion facilities is integral to any basic health care delivery infrastructure . Blood transfusions are also inherently embedded with risks ranging in severity from minor to life threatening . Judicious patient selection with pragmatic pretransfusion assessments of risk versus benefit to the potential recipient combined with stringent quality control is an effective mode of reducing transfusion related adverse events . In addition, continuous monitoring of transfusion related complications can promote patient care and safety . The goal of hemovigilance was to observe, identify, and prevent the occurrence or recurrence of transfusion related unwanted events so as to increase the safety, efficacy, and efficiency of the blood transfusion process, covering the entire blood transfusion chain of donors to recipients . On the basis of this core principle, the haemovigilance programme of india (hvpi) was launched by the indian pharmacopoeia commission in collaboration with the national institute of biologicals on december 10, 2012 . The hvpi that comes under the pharmacovigilance programme of india (pvpi), tracks adverse reactions related to blood transfusions and blood product administration in affiliated blood banks across india . Our institute obtained approval for a component in the year 2011 and affiliation to the hvpi, in 2013 . This study was carried out with the objective of observing and analyzing the acute transfusion reactions (atrs) encountered in the blood bank of this remote north eastern teaching hospital . This workup would enable us to develop insight into atr patterns not yet documented from remote centers like ours and compare them with that of larger national and international transfusion centers . The study was conducted in the department of transfusion medicine, (hvpi centre), and the department of pharmacology, (pvpi centre) of this north east indian medical institute and attached teaching hospital . Approval for conducting the study was obtained from the research protocol evaluation committee and the institutional ethical committee . This was a retrospective observational study in which all atrs reported to the blood bank over a period of 20 months (may 2013 to january 2015) were reviewed and analyzed . The hospital is following the standard operating procedures adapted from the cdsco technical manual for transfusion, starting with donor selection, phlebotomy, component processing, testing for infectious diseases, storage, cross matching, issue of component, and follow - up of the recipient . The paramedical staff involved in blood transfusion has been trained in transfusion practices, enabling them to identify and manage any encountered transfusion reaction at the earliest . Prior to the transfusion, they are required to cross - check for any clerical errors, abo - rh group of the patient and the blood bag, types of blood products and blood unit number, inspect the blood bag for hemolysis, clot and leakage, and expiry date . In the event of a transfusion reaction, the transfusion reaction form is being filled with information pertaining to: the date and time of initiation and cessation of the transfusion, time of the reaction, patients pre- and post - transfusion vital signs, approximate volume of blood transfused, as well as clinical signs and symptoms . The reaction form along with the posttransfusion blood sample (2 ml in citrate vial and 2 ml in plain vial), urine sample, and the leftover blood product bag, and transfusion set are immediately sent to the blood bank . The blood bank performs a thorough evaluation of the suspected transfusion reaction and rechecks the blood requisition form, returned blood / component unit number, abo - rh grouping and screening for irregular antibodies . Blood grouping of the patient is repeated and compared with the pretransfusion sample . The blood bag and posttransfusion blood sample is checked for hemolysis and compared with the pretransfusion sample . In case of a suspected hemolytic reaction, further investigations done include: qualitative and quantitative estimation of plasma hemoglobin% direct antiglobulin testhemoglobinuria: gross visual examination and urine hemoglobin by dipstickshematuria: microscopic examinationserum total and unconjugated bilirubinperipheral blood smears examination for the presence of schistocytes and spherocytes . Qualitative and quantitative estimation of plasma hemoglobin% direct antiglobulin test hemoglobinuria: gross visual examination and urine hemoglobin by dipsticks hematuria: microscopic examination serum total and unconjugated bilirubin peripheral blood smears examination for the presence of schistocytes and spherocytes . Compatibility testing is repeated on pre- and post - transfusion sample: diamed - id microtyping system . In case of a reaction such as transfusion - related acute lung injury (trali) and pulmonary embolism, chest x - ray report is cross checked . Based on the clinical features mentioned in the transfusion reaction form, and the laboratory reports, the reactions are classified according to the standard criteria defined by the american association of blood banks . After completion of transfusion reaction workup and categorization of the transfusion reaction, data are submitted to the hvpi . The data collected for this study were analyzed for frequency, percentage, mean, and standard deviation . Statistical software used was microsoft office excel 2007 and ibm spss statistics version 20 (statistical package for the social sciences ibm corporation). The chi - square test was used where applicable, and p <0.05 was considered significant . Nc is the number of component / whole blood units transfused and nt is the total number of transfusion units [table 1; column 3]risk of transfusion reactions with a particular component / whole blood: ntrc / nc 100 where ntrc is the total number of reactions encountered with a particular component / whole blood, and nc is the total units of component / whole blood transfused [table 1; column 5]risk of a particular reaction with a particular component / whole blood: nptr / nc 100 where nc is the total number of components / whole blood units transfused [table 2; column 2, 3, and 4]frequency of a particular reaction in relation to total number of transfusions: nptr / nt 100 where nptr is the total number of the particular transfusion reaction and nt is the total number of transfusion units [table 2; column 5]frequency of particular reaction in relation to total number of transfusion reactions: nptr / ntr 100 where nptr is the total number of the particular transfusion reaction and ntr is the total number of transfusion reactions [figure 1]. Nc is the number of component / whole blood units transfused and nt is the total number of transfusion units [table 1; column 3] risk of transfusion reactions with a particular component / whole blood: ntrc / nc 100 where ntrc is the total number of reactions encountered with a particular component / whole blood, and nc is the total units of component / whole blood transfused [table 1; column 5] risk of a particular reaction with a particular component / whole blood: nptr / nc 100 where nptr is the total number of a particular transfusion reaction, and nc is the total number of components / whole blood units transfused [table 2; column 2, 3, and 4] frequency of a particular reaction in relation to total number of transfusions: nptr / nt 100 where nptr is the total number of the particular transfusion reaction and nt is the total number of transfusion units [table 2; column 5] frequency of particular reaction in relation to total number of transfusion reactions: nptr / ntr 100 where nptr is the total number of the particular transfusion reaction and ntr is the total number of transfusion reactions [figure 1]. Frequency of wb / component transfusions and associated atrs type of transfusion reaction with respect to associated wb / component transfusions relative frequency of acute transfusion reactions the study was conducted in the department of transfusion medicine, (hvpi centre), and the department of pharmacology, (pvpi centre) of this north east indian medical institute and attached teaching hospital . Approval for conducting the study was obtained from the research protocol evaluation committee and the institutional ethical committee . This was a retrospective observational study in which all atrs reported to the blood bank over a period of 20 months (may 2013 to january 2015) were reviewed and analyzed . The hospital is following the standard operating procedures adapted from the cdsco technical manual for transfusion, starting with donor selection, phlebotomy, component processing, testing for infectious diseases, storage, cross matching, issue of component, and follow - up of the recipient . The paramedical staff involved in blood transfusion has been trained in transfusion practices, enabling them to identify and manage any encountered transfusion reaction at the earliest . Prior to the transfusion, they are required to cross - check for any clerical errors, abo - rh group of the patient and the blood bag, types of blood products and blood unit number, inspect the blood bag for hemolysis, clot and leakage, and expiry date . In the event of a transfusion reaction, the transfusion reaction form is being filled with information pertaining to: the date and time of initiation and cessation of the transfusion, time of the reaction, patients pre- and post - transfusion vital signs, approximate volume of blood transfused, as well as clinical signs and symptoms . The reaction form along with the posttransfusion blood sample (2 ml in citrate vial and 2 ml in plain vial), urine sample, and the leftover blood product bag, and transfusion set are immediately sent to the blood bank . The blood bank performs a thorough evaluation of the suspected transfusion reaction and rechecks the blood requisition form, returned blood / component unit number, abo - rh grouping and screening for irregular antibodies . Blood grouping of the patient is repeated and compared with the pretransfusion sample . The blood bag and posttransfusion blood sample is checked for hemolysis and compared with the pretransfusion sample . In case of a suspected hemolytic reaction, further investigations done include: qualitative and quantitative estimation of plasma hemoglobin% direct antiglobulin testhemoglobinuria: gross visual examination and urine hemoglobin by dipstickshematuria: microscopic examinationserum total and unconjugated bilirubinperipheral blood smears examination for the presence of schistocytes and spherocytes . Qualitative and quantitative estimation of plasma hemoglobin% direct antiglobulin test hemoglobinuria: gross visual examination and urine hemoglobin by dipsticks hematuria: microscopic examination serum total and unconjugated bilirubin peripheral blood smears examination for the presence of schistocytes and spherocytes . Compatibility testing is repeated on pre- and post - transfusion sample: diamed - id microtyping system . In case of a reaction such as transfusion - related acute lung injury (trali) and pulmonary embolism, chest x - ray report is cross checked . Based on the clinical features mentioned in the transfusion reaction form, and the laboratory reports, the reactions are classified according to the standard criteria defined by the american association of blood banks . After completion of transfusion reaction workup and categorization of the transfusion reaction, data are submitted to the hvpi . The data collected for this study were analyzed for frequency, percentage, mean, and standard deviation . Statistical software used was microsoft office excel 2007 and ibm spss statistics version 20 (statistical package for the social sciences ibm corporation). The chi - square test was used where applicable, and p <0.05 was considered significant . Nc is the number of component / whole blood units transfused and nt is the total number of transfusion units [table 1; column 3]risk of transfusion reactions with a particular component / whole blood: ntrc / nc 100 where ntrc is the total number of reactions encountered with a particular component / whole blood, and nc is the total units of component / whole blood transfused [table 1; column 5]risk of a particular reaction with a particular component / whole blood: nptr / nc 100 where nc is the total number of components / whole blood units transfused [table 2; column 2, 3, and 4]frequency of a particular reaction in relation to total number of transfusions: nptr / nt 100 where nptr is the total number of the particular transfusion reaction and nt is the total number of transfusion units [table 2; column 5]frequency of particular reaction in relation to total number of transfusion reactions: nptr / ntr 100 where nptr is the total number of the particular transfusion reaction and ntr is the total number of transfusion reactions [figure 1]. Nc is the number of component / whole blood units transfused and nt is the total number of transfusion units [table 1; column 3] risk of transfusion reactions with a particular component / whole blood: ntrc / nc 100 where ntrc is the total number of reactions encountered with a particular component / whole blood, and nc is the total units of component / whole blood transfused [table 1; column 5] risk of a particular reaction with a particular component / whole blood: nptr / nc 100 where nptr is the total number of a particular transfusion reaction, and nc is the total number of components / whole blood units transfused [table 2; column 2, 3, and 4] frequency of a particular reaction in relation to total number of transfusions: nptr / nt 100 where nptr is the total number of the particular transfusion reaction and nt is the total number of transfusion units [table 2; column 5] frequency of particular reaction in relation to total number of transfusion reactions: nptr / ntr 100 where nptr is the total number of the particular transfusion reaction and ntr is the total number of transfusion reactions [figure 1]. Frequency of wb / component transfusions and associated atrs type of transfusion reaction with respect to associated wb / component transfusions relative frequency of acute transfusion reactions the study was conducted in the department of transfusion medicine, (hvpi centre), and the department of pharmacology, (pvpi centre) of this north east indian medical institute and attached teaching hospital . Approval for conducting the study was obtained from the research protocol evaluation committee and the institutional ethical committee . This was a retrospective observational study in which all atrs reported to the blood bank over a period of 20 months (may 2013 to january 2015) were reviewed and analyzed . The hospital is following the standard operating procedures adapted from the cdsco technical manual for transfusion, starting with donor selection, phlebotomy, component processing, testing for infectious diseases, storage, cross matching, issue of component, and follow - up of the recipient . The paramedical staff involved in blood transfusion has been trained in transfusion practices, enabling them to identify and manage any encountered transfusion reaction at the earliest . Prior to the transfusion, they are required to cross - check for any clerical errors, abo - rh group of the patient and the blood bag, types of blood products and blood unit number, inspect the blood bag for hemolysis, clot and leakage, and expiry date . In the event of a transfusion reaction, the transfusion reaction form is being filled with information pertaining to: the date and time of initiation and cessation of the transfusion, time of the reaction, patients pre- and post - transfusion vital signs, approximate volume of blood transfused, as well as clinical signs and symptoms . The reaction form along with the posttransfusion blood sample (2 ml in citrate vial and 2 ml in plain vial), urine sample, and the leftover blood product bag, and transfusion set the blood bank performs a thorough evaluation of the suspected transfusion reaction and rechecks the blood requisition form, returned blood / component unit number, abo - rh grouping and screening for irregular antibodies . Blood grouping of the patient is repeated and compared with the pretransfusion sample . The blood bag and posttransfusion blood sample is checked for hemolysis and compared with the pretransfusion sample . In case of a suspected hemolytic reaction, further investigations done include: qualitative and quantitative estimation of plasma hemoglobin% direct antiglobulin testhemoglobinuria: gross visual examination and urine hemoglobin by dipstickshematuria: microscopic examinationserum total and unconjugated bilirubinperipheral blood smears examination for the presence of schistocytes and spherocytes . Qualitative and quantitative estimation of plasma hemoglobin% direct antiglobulin test hemoglobinuria: gross visual examination and urine hemoglobin by dipsticks hematuria: microscopic examination serum total and unconjugated bilirubin peripheral blood smears examination for the presence of schistocytes and spherocytes . Compatibility testing is repeated on pre- and post - transfusion sample: diamed - id microtyping system . In case of a reaction such as transfusion - related acute lung injury (trali) and pulmonary embolism, chest x - ray report is cross checked . Based on the clinical features mentioned in the transfusion reaction form, and the laboratory reports, the reactions are classified according to the standard criteria defined by the american association of blood banks . After completion of transfusion reaction workup and categorization of the transfusion reaction, data are submitted to the hvpi . The data collected for this study were analyzed for frequency, percentage, mean, and standard deviation . Statistical software used was microsoft office excel 2007 and ibm spss statistics version 20 (statistical package for the social sciences ibm corporation). The chi - square test was used where applicable, and p <0.05 was considered significant . Nc is the number of component / whole blood units transfused and nt is the total number of transfusion units [table 1; column 3]risk of transfusion reactions with a particular component / whole blood: ntrc / nc 100 where ntrc is the total number of reactions encountered with a particular component / whole blood, and nc is the total units of component / whole blood transfused [table 1; column 5]risk of a particular reaction with a particular component / whole blood: nptr / nc 100 where nptr is the total number of a particular transfusion reaction, and nc is the total number of components / whole blood units transfused [table 2; column 2, 3, and 4]frequency of a particular reaction in relation to total number of transfusions: nptr / nt 100 where nptr is the total number of the particular transfusion reaction and nt is the total number of transfusion units [table 2; column 5]frequency of particular reaction in relation to total number of transfusion reactions: nptr / ntr 100 where nptr is the total number of the particular transfusion reaction and ntr is the total number of transfusion reactions [figure 1]. Nc is the number of component / whole blood units transfused and nt is the total number of transfusion units [table 1; column 3] risk of transfusion reactions with a particular component / whole blood: ntrc / nc 100 where ntrc is the total number of reactions encountered with a particular component / whole blood, and nc is the total units of component / whole blood transfused [table 1; column 5] risk of a particular reaction with a particular component / whole blood: nptr / nc 100 where nc is the total number of components / whole blood units transfused [table 2; column 2, 3, and 4] frequency of a particular reaction in relation to total number of transfusions: nptr / nt 100 where nptr is the total number of the particular transfusion reaction and nt is the total number of transfusion units [table 2; column 5] frequency of particular reaction in relation to total number of transfusion reactions: nptr / ntr 100 where nptr is the total number of the particular transfusion reaction and ntr is the total number of transfusion reactions [figure 1]. Frequency of wb / component transfusions and associated atrs type of transfusion reaction with respect to associated wb / component transfusions relative frequency of acute transfusion reactions a total of 3455 units of whole blood and component transfusions were carried out in the study duration, out of which a total of 32 (0.92%) atrs were encountered . The age of the recipients ranged from 14 to 88 years, with the mean age of females (43.7 years) slightly lower than that of males (44.3 years). There was a female preponderance (59.4%) in the frequency of transfusion reactions, over males (40.6%). However, this difference was not significant (p = 0.13, = 2.25). Transfusion with packed red blood cell (prbc) was most commonly associated with adverse reactions (15 reactions out of a total of 1042 transfusions; p = 0.06, = 3.52), followed by whole blood (wb) transfusions (13 reactions out of a total of 1467 transfusions; p = 0.83, = 0.045) [table 1]. A total of 650 units of fresh frozen plasma (ffp) transfusions were carried out that finally resulted in four reactions (p = 0.36, = 0.84). Allergic reaction was the most frequently encountered transfusion reaction (65.6%) [figure 1], which was most commonly seen with prbcs (risk of 0.76%; p = 0.42, = 0.63) and wb (risk of 0.68%; p = 0.63, = 0.23) [table 2]. This was followed by febrile nonhemolytic transfusion reactions (fnhtrs) (28.1%), which was seen more commonly with prbcs (risk of 0.57%; p = 0.016, = 5.7). There was one reaction each of anaphylaxis and pulmonary embolism, following wb and prbc transfusions, respectively . No hemolytic reactions were encountered in the study period . The mean volume of blood at which transfusion reaction had occurred was 192.5 95.7 ml [table 4]. Figure 2 shows the relative frequency of transfusion reactions according to the department in which the recipients were being treated, and the adverse event reported . Most common manifestations included urticaria and itching (n = 14 each), followed by fever (n = 9), dyspnea (n = 7), and increased pulse rate (n = 6) [figure 3]. Demographic characteristics of the transfusion recipients reporting with atrs (n=32) volume of blood at which atr initiated relative frequency of departments reporting acute transfusion reactions frequency of clinical manifestations related to the acute transfusion reactions the french blood agency had initially developed it as a national system of surveillance and alert, from blood collection to the follow - up of recipients . Hemovigilance is currently recognized as an indispensable component of quality management in blood programs globally . An ideal hemovigilance system is designed to detect, gather, and analyze unexpected or undesirable effects associated with transfusion . The information obtained is intended to bring about required changes in transfusion policies, improve transfusion standards, assist in the formulation of transfusion guidelines, and thus improve safety and quality of the transfusion process . It is thus not only an avenue to analyze blood transfusion incidents, but also a tool to measure the effects of new processes or corrective actions implemented to remedy their causes and prevent their recurrence . Noninfectious adverse transfusion reaction (niatrs) such as acute hemolytic transfusion reactions, fnhtrs, anaphylactic reactions, trali, and allergic reactions are recognized as predominant contributing factors of transfusion - related morbidity and mortality . Atrs are those immune or nonimmune adverse reactions that occur within 24 h of the transfusion . The estimated frequency of atrs varies from 0.2% to 10%, and mortality is approximately, 1 in 250,000 . In this study, the frequency of atrs was observed to be 0.92%, which was comparable to that of a study carried out in punjab, where the incidence of atrs was 1.09% . Two larger studies done in new delhi and chandigarh, however, showed a relatively lower frequency of transfusion reactions (0.05% and 0.18%, respectively). A study in switzerland and the incidence of transfusion reactions at our center was thus higher than that observed at some national and international centers . The frequency of atrs was more in females (59.4%) than in males (40.6%). A similarly skewed incidence of transfusion reactions toward females was seen in studies done in saudi arabia (54.3%) and zimbabwe (61.6%). However, studies were done in india by kumar et al . And bhattacharya et al . Show a lower incidence of transfusion reactions in females (45.7% and 34.2%, respectively). The most common atr observed was an allergic reaction (65.6% of all atrs), which presented most commonly with urticaria and/or itching . There was no significant difference observed between the number of allergic reactions and type of transfusion (p> 0.05 for wb, prbc, and ffp transfusions). Allergic reactions can occur in up to 2% of transfusions as a result of recipient ige and donor antigen interactions triggering the release of histamine and de novo synthesis of leukotrienes and platelet activating factor . Clinically, allergic reactions have been discerned from the more severe anaphylactoid reactions by the absence of clinical manifestations such as bronchospasm and/or hypotension . Similar to the findings of this study, allergic reactions were also found to be the most common transfusion reaction in studies done in delhi (55.1%) and iran (49.2%). However, the overall incidence of allergic reactions in the study done in delhi was only 0.02%, which was lower than the incidence of allergic reactions in our study (0.6%). Fnhtr, which is defined as an otherwise unexplained rise in temperature of at least 1c during or shortly after transfusion, comprised of 28% of the total atrs, in this study (0.26% of total transfusions). Fnhtrs are reported to be more common with platelet transfusions than prbcs because platelets require storage at 2024c, which results in donor leukocyte activation and pro - inflammatory cytokine accumulation . However, fnhtrs were found to be more with prbcs (0.57% of all prbc transfusions) and wb (0.13% of all wb transfusions) than platelets, with which no reactions were seen . The association of fnhtr's with prbc transfusions was found to be significant (p <0.05). A greater incidence of fnhtrs with prbcs was also observed in a study done by kumar et al . The relatively fewer number of platelet transfusions (n = 246) as compared to whole blood (n = 1467) and prbcs (n = 1042) could be a reason for nondetection of any reactions with platelets . In a study done at aiims, the frequency of fnhtrs with prbcs was found to be 0.04%, which was lower than that observed in this study . The overall incidence of fnhtrs in the same study was 0.01%, which again was much lower than seen in our hospital . The higher incidence of both allergic reactions, as well as fnhtrs as compared to the premier institute in delhi could be a consequence of the lack of leukoreduction facilities at our hospital . The risk of fnhtr with transfusion of nonleukoreduced whole blood and prbcs was estimated to be 0.114% in a study done in chandigarh, which is closer to the incidence of fnhtrs seen in this study . Though universal leukoreduction has reduced the incidence of febrile reactions, it has not been found to have a similar impact on that of allergic reactions because acellular plasma components rather than leukocytes in blood components contribute to allergic atrs . The introduction of leukoreduction at our institution could possibly enable us to reduce the incidence of atrs in general and febrile reactions in particular . There was one fatal transfusion event, in which a recipient suffering from deep vein thrombosis, developed severe respiratory distress, frothing from the mouth, collapsed, and eventually died . Postmortem findings ascertained pulmonary embolism, which was, however, confirmed as not being due to air emboli . The overall incidence of transfusion reactions in this hospital is slightly higher than those having more advanced transfusion facilities in india . There was no significant difference among the overall incidence of atrs based on the type of component transfused . However, a significant association was observed between the number of prbc transfusions and febrile reactions . The use of leukoreduced wb and prbcs could possibly reduce the incidence of atrs in general and fnhtrs in particular.
Surgical pathologic evaluation of axilla is a standard part of the management of breast - conserving therapy for breast cancer; this has both prognostic and therapeutic implications . While the presence of axillary lymph metastasis is the single most critical predictor of survival in breast cancer, the absolute number of lymph nodes involved appears to be equally as important . To reflect the importance of this fact, the 6th edition of the ajcc / tnm cancer staging manual incorporated major changes in the pathologic nodal staging for breast cancer to include the number of lymph nodes involved (13 +, 49 +, 10 +) so that an increasing number of positive nodes results in higher n - stage and overall stage . Potentially confounding the value of number of lymph nodes involved is the variability of total number of lymph nodes excised or examined during axillary staging . As a result, there has been increasing interest in the use of the nodal ratio as a possible prognostic factor . The nodal ratio (nr) is defined as the absolute number of positive nodes identified divided by the total number of nodes removed and has been used to potentially eliminate the confounding of involved versus examined nodes . The nodal ratio has significant prognostic value for locoregional recurrence and survival, with some authors suggesting that it may be even more important than the absolute number of positive nodes . Although rare, supraclavicular recurrences are difficult to salvage and are often associated with a poor prognosis . The nodal ratio has not previously, to our knowledge, been used to predict the risk of in - field regional recurrence after bct the purpose of our study was to determine if, in the high - risk patient population who have undergone adequate axillary dissection, nodal ratios can help identify a subgroup of patients that are at highest risk for nodal in - field recurrences so that radiation treatment modifications can potentially be made to improve regional relapse rates in this high - risk population . After obtaining irb approval, the medical records of patients with breast cancer undergoing breast - conserving surgery and whole breast radiation therapy at yale university school of medicine treated from 1975 to 2003 were reviewed . The present study cohort consisted of a group of high - risk, early - stage, invasive breast cancer patients who had a minimum of 8 lymph nodes excised with breast - conserving surgery followed by adjuvant radiation therapy (n = 1060). Of this group, 273 patients were lymph - node positive, and of these, 56 patients (20.5%) had 4 positive nodes . After conservative surgery, all patients were treated with radiation therapy using standard isocentric techniques using 6 mv photons with appropriate wedges delivering a median dose of 48 gy to the entire breast . An electron cone down was utilized in all patients to bring the total median dose to the tumor bed to 64 gy . Regional nodal radiation was delivered at the discretion of the treating physician, in accordance to the standard practices of our institution during the time period in which the patients were treated . The institutional policy has generally been not include the axilla after alnd unless there is an inadequate number of lymph nodes excised, or significant residual tumor burden in the axilla (as estimated by pathology or surgical / operative report), due to the increased risk of lymphedema . Typically, the supraclavicular fossa was treated to a median dose of 46 gy for 1 involved axillary node . The technique for regional nodal radiation has been previously described and is only briefly discussed here . External beam radiation was administered to the supraclavicular fossa using a separate anterior beam half - blocked at the central axis . The field was angled 1015 degrees off of the spinal cord and extended from midline medially (at the skin surface) to the medial border of the humeral head laterally . If the residual burden of disease in the axillary region was thought to be high, the lateral border was extended laterally to beyond the humeral head to encompass the axilla . Because these patients were treated in an era in which ct - simulation was not routinely performed, the majority of the patients underwent traditional, fluoroscopic simulation, and the supraclavicular field dose was specified to a standard depth of 3 cm in all patients . Nodal ratios (nrs) were calculated for each patient as follows: absolute number of lymph nodes involved divided by the number of lymph nodes excised, multiplied by 100 (expressed as a percentage). Patients were grouped into three categories: low (nr <40%), intermediate (nr <70% and 40%), and high (nr 70%). Breast relapse - free survival was defined by time to local failure in the treated breast . Nodal relapse - free survival was time to regional failure (axilla, supraclavicular fossa, infraclavicular fossa, or internal mammary nodes). Disease free survival was defined by time to disease failure outside of the local / regional area . All events were calculated from the time of initial diagnosis to the time of the event . The outcomes were calculated using standard life - table methods . The nodal ratio for each patient and relevant covariables were assembled in a database and analyzed using prodas, version 9.1 (sas institute, cary, nc). Of the 56 patients in our cohort, 29% (n = 16) were in the low, 39% (n = 22) in the intermediate, and 32% (n = 18) in the high nr groups, respectively . The clinical characteristics of the entire cohort, as a function of nodal ratio distribution, are given in table 1 . Table 2 describes the radiation field delivery as a function of nodal ratio . Of note, 4 patients of the 56 in our cohort had only tangential breast radiation fields without any regional nodal radiation . These patients were classified in the low nodal ratio group (n = 3) and the intermediate nodal ratio group (n = 1). Thus, the remainder of the 52 patients in the cohort received supraclavicular radiation (axillary radiation); specifically, all patients in the high nodal ratio group received supraclavicular radiation to a median dose of 46 gy . As shown in table 3, none of the patients in the low nr group had more than 9 positive nodes identified on axillary dissection, whereas 67% of patients in the high nr group had 10 or more positive nodes identified . For the entire cohort, the overall survival was 62%, disease - free survival was 61%, breast relapse - free survival was 83%, and nodal relapse - free survival was 93% at 10 years . The nodal ratio was predictive of nodal relapse free survival (77% in the hnr group versus 100% in the lnr and inr groups (p <.05). The os, dmfs, and nrfs correlated with n2 (49 nodes+) versus n3 (10 +) status but did not correlate with brfs, as expected . While there was a trend toward poorer overall survival and disease - free survival in the hnr group, the differences were not statistically significant . Three of the 56 patients had regional nodal relapses; all 3 nodal recurrences were in the supraclavicular fossa in patients with high nodal ratios (table 4). Therefore, the 7% nodal relapse rate was due solely to supraclavicular relapses, with no axillary or internal mammary relapses . All 3 regional recurrences had been treated with a single ap field prescribed to a dose of 46 gy at 3 cm, as described above . In this group of patients with high nodal ratios, the absolute number of positive lymph nodes dissected from the axilla is currently recognized as the most significant predictor of survival in breast cancer [58]. It is intuitive that the fewer the number of lymph nodes removed in dissection of the axilla, the less reliable this predictor will be, with significant potential for understaging and under treating . Exactly what constitutes an adequate axillary dissection, however, in terms of providing sufficient prognostic and therapeutic benefits, remains a topic of considerable debate . In contemporary series of patients with early breast cancer, when 710 lymph nodes are identified in the axillary specimen, fewer than 3% of patients will experience axillary failure [3, 9, 10]. Most studies assessing the extent of dissection required to accurately assess nodal status suggest that> 10 nodes should be examined . To a certain extent, the variation in the total numbers of axillary nodes removed between series of patients reflects not only differences in surgical technique, but also in the pathologists' examination of the specimens . The concept of the nodal ratio was developed in order to reduce the confounding of the number of involved lymph nodes by the extent of surgical clearance and thoroughness of pathologic examination . By combining the involved and examined nodes into a single value, the prognostic implications of axillary dissection may be more reliable and may potentially lead to better selection of patients requiring adjuvant regional nodal therapy . In addition, for comparison of different series of patients, the nodal ratio can serve as a uniform standard value . Nodal ratio has been particularly useful when looking at patients with 13 positive nodes and/or inadequate dissections, as these have historically been groups for whom the decision to use adjuvant radiation therapy is considered controversial . Outcomes are worse with higher numbers of positive nodes and with higher nodal ratios, with a number of studies suggesting that the latter is the stronger of the two prognostic factors . The nodal ratio has been shown to be predictive for breast cancer outcomes in a variety of clinical scenarios (e.g., early - stage and locally advanced, mastectomy and bct, chemotherapy, and/or radiation) [8, 1117]. These studies have found nodal ratios to be predictive of a variety of outcome parameters including locoregional relapse, disease - free survival (dfs), progression - free survival (pfs), cause - specific survival (css), overall survival (os), and metastasis - free survival . Furthermore, nodal ratios have also been used to rectify interinstitutional differences in outcomes that exist due to variations in axillary dissection practice . These findings are reviewed in a recent comprehensive publication of the prognostic value of nodal ratios . Among the studies that have used nodal ratio as a prognostic indicator our definition of high nodal ratio was similar to the publications by tai et al ., the international nodal ratios working group, and others, that used ratios of> 50%75% for their high nodal ratio group [2, 11]. In the above - mentioned review of nodal ratios that included> 20 clinical studies, the percentage cutoffs for nodal ratios varied depending upon the outcomes being investigated and the level of statistical significance being sought . Hence, there has yet to be established a clear benefit to the use of any one method of grouping patients by nodal ratio over any other . Our study suggests that high nodal ratios of> 70% are predictive of supraclavicular relapse in women with early - stage breast cancer who have had at least 8 nodes excised on alnd . It is important to note that while the vast majority of these patients received supraclavicular radiation, the fields were determined clinically in the era in which these patients were treated, with the dose prescribed routinely at a depth of 3 cm, without ct guidance, as was the convention at our institution . More recent investigations in the ct treatment planning era suggest that the depth of the supraclavicular nodes varies significantly, ranging from 2.49.5 cm (median = 4.3 cm). Given this variability in depth and the substantial risk of supraclavicular recurrence in the high nodal ratios risk group, meticulous attention should be paid by the treating radiation oncologist to contouring the location of the supraclavicular lymph nodes with careful selection of the radiation beam energy, with consideration given to a supraclavicular boost in high - risk patients to ensure optimal delivery of dose to these lymph nodes at potential risk for recurrence . While supraclavicular fossa recurrences are rare after breast conservation therapy, our data suggest that in patients with 4 or more positive axillary nodes treated with traditional tangential / supraclavicular techniques, high nodal ratios (> 70%) predict for in - field regional recurrences . While these findings need to be reproduced in larger datasets, more meticulous treatment planning of regional nodes, radiation dose escalation, and/or more intensive systemic therapies in high nodal ratio patients should be considered.
Aura is defined as attacks of reversible focal neurological symptoms (visual, sensory and/or speech symptoms) that last more than 5 min and no longer than 1 h. migraine - like headache usually occurs at the onset, during or follows aura symptoms . Patients with motor weakness, according to the present classification, are classified separately as hemiplegic migraine . It is well known that physical activity can lead to an aggravation of the intensity of the headache and a primary exertional headache is described in the current ihs classification under other primary headaches as a migraine - like headache unleashed by physical exertion . We describe the cases of three patients with recurrent episodes of migraine with aura induced by physical activity . The relationship between exertion and aura is unknown and still debated; moreover, the international classification of headache does not, at present, include this subtype of headache . Three young men (case a 19 year - old, case b 21 year - old, case c 25 year - old) came to our observation for recurrent attacks of migraine - like headache of a pulsating quality and severe intensity, with nausea, photo- and phonophobia, that resolved spontaneously within 12 h if untreated . The attacks were preceded by reversible visual symptoms presenting as fortification spectrum and ipsilateral cheiro - oral paresthesia (cases b and c only), that lasted for 1540 min . Onset of the symptoms occurred a few years earlier: 4 years for cases a and c, 2 years for case b. in all cases the symptoms occurred when they were in the locker room: in cases b and c shortly after a football match, but never after training; whilst in case a the symptoms occurred occasionally after swimming pool and gym training or after participating in physical education activities at school . The father of case a and the mothers of cases b and c suffered from episodic attacks of migraine without aura . The patients medical history, physical and neurological examination did not suggest any other secondary disorder (cases a and b are smokers). Case a also suffers from episodic migraine without aura according to the current international classification of headache disorders (ichd - ii) criteria . The patients, however, underwent extensive diagnostic investigation: brain magnetic resonance with angiographic sequences, electroencephalography, vertebral and carotid echo - doppler, complete ocular examination, electrocardiography, transthoracic echocardiography and complete blood cell count, general chemistry profile, coagulation studies, protein c, protein s, antithrombin iii, anticardiolipin antibody, erythrocyte sedimentation rate, c - reactive protein, antinuclear antibody and thyroid function test . The prevalence of sport- and exercise - related headaches is estimated to be about 3035% (15% of which are migrainous headaches) [2, 3]. In the study of williams and nukada, the reported subtypes of headache were: effort migraine, trauma - induced migraine, effort / exertion headache and post - traumatic headache; all effort and trauma - triggered migraine patients (11 and 8, respectively, of 129 patients) reported aura symptoms before the headache (visual and/or sensory disturbances). However, the precise epidemiology of this phenomenon is unknown . According to ichd - ii criteria, the headache subtype presented by the patients fulfilled criteria for typical aura with migraine headache (ichd - ii code: 1.2.1) and for primary exertional headache (pulsating headache, lasting from 5 min to 48 h, brought on by and occurring only during or after physical exertion; ichd - ii code: 4.3). Since these symptoms could mimic, in approximately 10% of these headaches, important pathologies, such as carotid dissection, artero - venous malformation, cerebral venus sinus thrombosis, seizures, subarachnoid or intraparenchymal haemorrhage, it was therefore mandatory to exclude a secondary form of headache in these patients . There are anecdotal reports of episodes of migraine preceded by head trauma and visual symptoms (with a past history of non - sports - related migraine), migraine prodrome symptoms after unusually strenuous running with no subsequent head pain or recurrent attacks of hemiplegic migraine induced only by exertion . To date, the pathogenesis of primary exertional headache is unidentified and it is still under debate; several theories regarding the cause have been proposed, such as, migraine triggered by physical effort particularly evident in aerobic exercise, altitude and hot weather, suggesting that low oxygen tension may trigger migraine by an as yet unknown mechanism . Moreover, it has been postulated that a dilatation of pain - sensitive venous sinuses, at the base of the brain, as a result of increased cerebral arterial pressure, is induced by the exertion . In contrast to the hypothesized pathophysiology of the cough headache (ichd - ii code: 4.2), a similar vascular and hemodynamic pathogenesis is supposed to be shared by both primary exertional headache and primary headache associated with sexual activity (ichd - ii code: 4.4), due to the similar age at onset, male predominance, pain characteristics and response to treatment . The pathophysiological correlate of migraine aura is cortical spreading depression (csd). In our patients it has been suggested that the combination of exertion - induced hyperventilation and the subsequent hypocapnia with respiratory alkalosis and hypomagnesemia predisposes these patients to cerebral vasoconstriction during exertion lowering the threshold for the development of csd or aura in migraineurs . The present ichd - ii classification does not mention sport / exercise - induced migraine with aura episodes as primary headache, although there are many reports of attacks of migraine with aura shortly after practicing . Therefore, in case of patients suffering from this particular type of headache, there is currently the need to make a double diagnosis (typical aura with migraine headache and primary exertional headache; ichd - ii codes: 1.2.1 and 4.3), or to add a specifier (e.g. Migraine with aura triggered by exercise). Since there are many cases described in the literature of migraine with aura triggered only by exercise, to faciliate the diagnosis it may be helpful to specify, in the typical aura with migraine headache comments, that in some cases it can be exclusively triggered by sport / exercise.
The investigation of the structural - functional organization of chromatin in situ using conventional transmission electron microscopy has been hindered by a number of technical limitations . The major handicap derives from the fact that in most electron microscopy preparations, the agents employed for thin - section contrasting render electron - opaque, together with the deoxyribonucleoprotein, many other different intermingled substances, which masks the morphology of the chromatin structures . Therefore, very little in situ data have been produced on chromatin structural organization and its functionally related changes . However, valuable information has been obtained from studies applying a highly selective and specific staining method for dna, the feulgen - like osmium ammine technique . This staining procedure, introduced by cogliati and gautier, contributed to electron microscopy by exclusively visualizing the dna - containing structures, thus allowing a study of the chromatin organization down to the molecular level in thin sections of samples fixed in situ . For this reason, it is of interest to review these in situ studies, even though obtained some years ago, and to discuss them in the light of recent results on the chromatin structural - functional organization, coming from investigations conducted using different technical approaches . In fact, comparisons of these data may help to shed light on topics which are still debated, such as: the relationship between chromosome territories and the interchromatin space within the interphase cell nucleus; the structure of chromatin fibres (i.e., whether with a diameter of 10 or 30 nm); the structure of transcriptionally - active and inactive chromatin . A brief description of the characteristics of the feulgen - like technique for the visualization of dna - containing structures at the electron microscope level and its potential for studying both gross and fine chromatin structure in situ will be discussed first . In 1973 cogliati and gautier proposed a staining procedure for the visualization of the dna - containing structures at the electron microscope level . This method was based on a feulgen - like reaction which utilizes an electron - opaque osmium - ammine complex as a schiff - like reagent . The classic schiff reagent is a solution of pararosaniline chloride (red - purple coloured) rendered colourless by so2 exposure, which after reacting with aldehyde groups, restored to the red - purple colour of pararosaniline . This reagent is used for cytochemical detection of substances in which aldehyde groups are generated either by mild hydrochloric acid hydrolysis (e.g., dna in the feulgen reaction) or by periodic acid treatment (e.g., glycoconjugates in the pas reaction). The osmium - ammine complex prepared by cogliati and gautier, and in a more reproducible protocol established by olins et al ., behaves as a schiff reagent in the presence of so2 by reacting with aldehyde groups produced in the feulgen and in the periodic acid schiff (pas) reaction, rendering electron opaque with high selectivity and specificity the dna- and the glycoconjugate - containing structures in thin sections . For the selective staining of the dna or the glycoconjugate - containing structures, the staining reaction works on thin sections derived from routinely dehydrated and resin - embedded samples . The high selectivity for dna and glyconjugates of the osmium - ammine - so2 staining in the feulgen and in the pas reaction, respectively, has been demonstrated . In thin section of mammalian cells, only the dna - containing structures are rendered electron - opaque in the feulgen - like reaction whereas the cytoplasmic organelles exhibit very low electron opacity . In the nucleus, all the ribonu - cleoprotein components remain unstained (supplementary figure 1a). After periodic acid pre - treatment the staining reaction allows selective visualization of substances containing a high proportion of carbohydrate macromolecules such as glycogen, glycoprotein and proteoglycans; whereas dna - containing structures are not rendered electron - opaque (supplementary figure 1b). For more complete information on the osmium - ammine complex as a schiff - like reagent in electron microscopy the first studies conducted using osmium - ammine staining in the feulgen - like reaction allowed easy distinguishing of condensed heterochromatin from dispersed euchromatin of mammalian cell nuclei in situ and clearly established the gross ultrastructural morphology of transcriptionally - active chromatin . It has been shown that chromatin organization depends on the metabolic state on the cell, more precisely on rna polymerase ii transcriptional activity . In cells with a moderate rna polymerase ii - mediated transcriptional activity, such as resting rat hepatocytes, a significant portion of chromatin is condensed in electron - dense masses, well separated from the completely electron - translucent nucleoplasmic space, the interchromatin compartment (figure 1a). Thinner chromatin threads appear to branch out for a short length from the periphery of the chromatin masses . On the contrary, in highly transcriptionally - active cells, such as regenerating rat hepatocytes, chromatin appears mainly in a very dispersed form, constituting a network of interwoven threads uniformly distributed through the nucleoplasmic space . Very small clumps of condensed chromatin are associated with the inner nuclear membrane and sparsely distributed in the nucleoplasm (figure 1b). Selective inhibition of rna polymerase ii activity by -amanitin causes highly dispersed chromatin to compact into electron dense masses, thus increasing the interchromatin space completely devoid of chromatin structures (figure 2). The dispersion of the chromatin clumps, with the increased occupancy of the interchromatin space that accompanies the progressive increase in rna polymerase ii - mediated transcriptional activity, is particularly striking in human circulating lymphocytes stimulated to proliferate by phytohemagglutinin (figure 3a - c). These observations indicate that chromosomes during interphase are highly plastic structures and that the relationship between chromatin and the interchromatin space is highly variable depending upon rna transcription and cell cycle phases . The chromatin and the inter - chromatin compartment appear to be clearly segregated only in the case of low nuclear transcriptional activity, whereas in cells with up - regulated synthesis of mrnas a clear compartmentalization is not detected . These findings may ameliorate the differences between models proposed for the relationship between the chromatin and interchromatin compartment in interphase cell nucleus . Evidence supports that after mitosis the compact chromosomes, even though they undergo marked decondensation, still occupy distinct regions, the chromosomes territories, within the interphase nucleus . The inter - chromatin domain contains proteins and ribonucleoproteins which constitute the nuclear machinery necessary for nucleic acid synthesis and processing . From an ultrastructural point of view one model, proposed by cremer and cremer, suggests that the chromosomes territories are separated by the interchromatin domain, which are almost devoid of dna, and that transcriptionally - active genes are located at the periphery of a given chromosome territory, where they constitute a thin layer, the perichromatin region, in which extended chromatin fibers and rna transcripts intermingle . The other model, proposed by branco and pombo, argues that chromatin from different chromosomes is not separated by the interchromatin domain . Rather, the chromatin structures form a lattice - like network of fibers which intermingle in an uniform way within individual chromosome territory and between different chromosome territories . A defined perichromatin region is excluded, rna transcription taking place everywhere within the chromatin domains . Thus, this model does not support the compartmentalization in chromosomes territories, interchromatin domain and perichromatin region . Indeed, the data obtained using the osmium - ammine feulgen - like reaction suggest that the model of the chromosome territories, interchromatin domain and perichromatin region compartmentalization may be more valid for nuclei characterized by a low rna transcription rate in which a clear compartmentalization in chromatin domains and the interchromatin space is present . This appears not to be the case for cells characterized by an enhanced transcription rate . In such cells, chromatin constitutes a diffuse network uniformly distributed throughout the nucleoplasm, with all the nucleoplasmic components intermingled together and the consequent loss of any obvious compartmentalization . Also, ultrastructural data coming from the preferential visualization of the ribonucleoprotein components using the uranyl - edta - lead staining procedure were consistent with the apparent presence of three different compartments in the nuclei of resting cells and with the loss of this compartmentalization in cells with an enhanced pol ii transcriptional activity . This is clearly visible in supplementary figure 2 a, b showing a resting and a regenerating rat hepatocyte, respectively . It appears that, depending on the transcriptional activity of the cells, the organization of the nuclear compartments can be consistent with one or the other model . However it is worth noting that, whereas the cremer and cremer model can be consistent also with a modulation of chromatin architecture from resting cells (characterized by a low rna transcription rate) to proliferating cells (characterized by a high rna transcription rate), just by expanding the perichromatin region, the branco and pombo model cannot justify the chromatin compartmentalization in cells with a low rna transcription rate, being in fact applicable only to highly transcriptionally active cells . In the late 20 century there were major achievements in the study of chromatin structure and function derived from investigations conducted using isolated chromatin that was subjected to treatment with detergents, different ionic strength solutions and metal cation concentrations, and to nuclease digestion . Many years ago these studies led to the discovery that chromatin was constituted by repeating units, the nucleosomes, made up of histones and dna, thus opening new scenarios for the understanding of the structural organization of dna in chromatin and of the mechanisms controlling gene expression . Visualization of nucleosomes in situ was obtained using the osmium - ammine staining in the feulgen - like reaction . In fact, this staining procedure was found to possess high resolution of the stained structures in thin sections, thus allowing a clear visualization of dna filaments (as thin as the 2 - 3 nm dna double helix molecule) and visualization of nucleosomes in thin sections of mammalian cells routinely processed for electron microscopy . The nucleosome is composed by a histone octamer, two each of histones h2a, h2b, h3 and h4, which constitute a protein core around which 147 base pairs of dna are wrapped in 1.7 left - handed super - helical turns; histone h1 is attached to the complex . Ultrastructurally, nucleosomes are flat cylinders with a diameter of 11 nm and with a height of 5.5 nm . Therefore, after the feulgen - like osmium - ammine reaction, since only dna is stained, the particles appear as small rings, with a diameter of about 11 nm, constituted by electron - opaque thin filament, about 3 nm thick (corresponding to the thickness of double helix dna filament), delineating an unstained inner core . The observation of these ring - shaped structures is obviously limited to those portions of chromatin where the electron beam is perpendicular to the diameter of the nucleosomes . Moreover, nucleosomes in thin sections of chromatin fixed in situ do not lie in the same plane, but in fact (given the thickness of sections that range from 50 - 80 nm) they may be distributed on overlapping planes . Thus, section thickness and varying orientations of the chromatin reduces a generalized visualization of the ring - shaped particles . Nevertheless, they can be frequently recognized both in the extended fibres of the dispersed chromatin (compare figure 4a, in which nucleosomes are shown in a spread chromatin preparation, with figure 4b, showing a dispersed in situ chromatin fibre) and within the small clumps and the masses of highly condensed chromatin (figure 4c, d). Measurements of the diameter of clearly recognizable ring - shaped particles (performed on micrographs with an original magnification of 50,000 and photographically enlarged to 175,000) resulted in a mean value of 110.8 nm (s.d .) With a range from 9.5 to 13.0 nm, strongly suggesting their identification with nucleosomes . After the discovery of the nucleosomal organization of chromatin in 1974, a series of investigations were conducted using different methological approaches in order to determine whether the nucleosomal filament (in the remainder of this article the nucleosomal filament will be described as an 11-nm fiber) gives rise to higher order structures for dna compaction within interphase and metaphase chromosomes . These studies, conducted in vitro, lead to the conviction that the nucleosome filament, the first level of dna compaction, was further folded into a 30 nm chromatin fiber, that was considered to represent the basic unit of interphase chromatin . Furthermore, 30 nm chromatin fibres were visualised in isolated mitotic chromosomes swollen in low salt solution, in starfish sperm intact nuclei and in polytene chromosome puffs after inhibition of transcription . This firm belief of the existence of 30 nm chromatin fibers was questioned by a series of studies conducted in recent years using different approaches to visualize chromatin in situ . Using cryo - electron microscopy and image processing of vitreous sections of human mitotic chromosomes, it was possible to demonstrate that mitotic chromatin exhibited a homogeneous grainy texture, in which there were no visible 30-nm fibers, but the bulk of compact chromatin existed in a highly disordered and interdigitated state, comparable with a polymer melt . Furthermore, the application of the electron spectroscopic imaging (esi) technique to the study of chromatin structure allowed the visualization in situ of 10 nm thick chromatin fibres even in compact chromatin domains known as condensed heterochromatin . These esi data indicated that a large portion of chromatin in mammalian cell nuclei was organized in 10 nm thick fibers . Indeed, very recently using cryo - electron microscopy and synchrotron x - ray scattering, it was shown that human mitotic hela chromosomes were composed mainly of irregularly folded nucleosome fibers no thicker than 11 nm, thus indicating the near absence of regular 30-nm chromatin fibers within chromosomes . In this context, has the study of the structural organization of chromatin in situ using the feulgen - like osmium - ammine technique added to our knowledge? The major questions explored were the following: i) are the 11-nm and the 30-nm chromatin fibers present in situ? Ii) which of these two kinds of fibers represents the basic unit of chromatin in situ? The studies conducted in situ were mainly carried out using mammalian cells characterized by a physiological dispersion of chromatin, such as regenerating hepatocytes, which greatly facilitated the observations of chromatin structural organization . Furthermore, these cells have very large nucleolar bodies characterized by a greater electron - translucency than the nucleoplasmic space, a consequence of rrna extraction due to the hcl hydrolysis . In the nucleolar bodies most of the intranucleolar chromatin structures consist of very small clumps and of thin fibers which are well separated from each other and can be followed for a very long tract, unlike the fibers in the extra - nucleolar compartment (figure 5a). These characteristics rendered the regenerating rat hepatocyte nuclei, and especially the intranucleolar chromatin, particularly suitable for the high resolution study of the chromatin structure in situ . The studies conducted on this type of cells revealed the presence of both 11 and 20 - 25 nm chromatin fibers . Regarding the 11-nm fibers, they were easily recognized within the nucleolar body and frequently appear to be loosely interwoven to each other (figure 5b). Visualization of the 11-nm fibers was improved by the use of stereo - pair micrographs, which demonstrated that many of the chromatin structures were composed of these kind of fibers (figure 6a). The analysis of stereopair micrographs allowed these fibers to be detected giving rise to rings of different diameter, frequently intermingled together (figure 6b). Regarding the thicker chromatin fibers, the analysis of chromatin structure in situ did not reveal the presence of fibers with an actual thickness of 30 nm, but, in fact showed fibers with a thickness ranging from 20 to 25 nm . This kind of fibers were mainly observed within the nucleolar body (supplementary figure 3), always as solitary fibers, and never being clearly observed to constitute more complex chromatin structures, in contrast to the 11 nm thick fibers . The 20 - 25 nm thick fibers did not show either a solenoid or a beaded organization . Other than the 11 and the 20 - 25 nm fibers, fibers with intermediate thickness were also observed . Analysis of these fibers using high magnification stereopair micrographs indicated that these fibers appeared to be frequently composed of two 11 nm thick nucleofilaments wound around one - another (figure 7a), thus suggesting that the 20 - 25 nm thick fibers might result from the association of two 11 nm fibers . Regarding the structure of the chromatin in metaphase chromosomes, in situ analysis after the feulgen - like osmium ammine reaction, also carried out using stereo - pair micrographs, did not allow detection of a clear structural organization in basic units, constituted by either 11 or 25 - 30 nm thick chromatin fibers (figure 7b). Altogether these observations are consistent with the available data obtained from different methodological approaches indicating that, in situ, interphase chromatin is mainly organized in fibers with a thickness of about 11 nm; while the image data are not consistent with a structural organization of chromatin based upon units composed of 30 nm thick chromatin fibers . The first studies conducted using osmium - ammine staining in the feulgen - like reaction allowed easy distinguishing of condensed heterochromatin from dispersed euchromatin of mammalian cell nuclei in situ and clearly established the gross ultrastructural morphology of transcriptionally - active chromatin . It has been shown that chromatin organization depends on the metabolic state on the cell, more precisely on rna polymerase ii transcriptional activity . In cells with a moderate rna polymerase ii - mediated transcriptional activity, such as resting rat hepatocytes, a significant portion of chromatin is condensed in electron - dense masses, well separated from the completely electron - translucent nucleoplasmic space, the interchromatin compartment (figure 1a). Thinner chromatin threads appear to branch out for a short length from the periphery of the chromatin masses . On the contrary, in highly transcriptionally - active cells, such as regenerating rat hepatocytes, chromatin appears mainly in a very dispersed form, constituting a network of interwoven threads uniformly distributed through the nucleoplasmic space . Very small clumps of condensed chromatin are associated with the inner nuclear membrane and sparsely distributed in the nucleoplasm (figure 1b). Selective inhibition of rna polymerase ii activity by -amanitin causes highly dispersed chromatin to compact into electron dense masses, thus increasing the interchromatin space completely devoid of chromatin structures (figure 2). The dispersion of the chromatin clumps, with the increased occupancy of the interchromatin space that accompanies the progressive increase in rna polymerase ii - mediated transcriptional activity, is particularly striking in human circulating lymphocytes stimulated to proliferate by phytohemagglutinin (figure 3a - c). These observations indicate that chromosomes during interphase are highly plastic structures and that the relationship between chromatin and the interchromatin space is highly variable depending upon rna transcription and cell cycle phases . The chromatin and the inter - chromatin compartment appear to be clearly segregated only in the case of low nuclear transcriptional activity, whereas in cells with up - regulated synthesis of mrnas a clear compartmentalization is not detected . These findings may ameliorate the differences between models proposed for the relationship between the chromatin and interchromatin compartment in interphase cell nucleus . Evidence supports that after mitosis the compact chromosomes, even though they undergo marked decondensation, still occupy distinct regions, the chromosomes territories, within the interphase nucleus . The inter - chromatin domain contains proteins and ribonucleoproteins which constitute the nuclear machinery necessary for nucleic acid synthesis and processing . From an ultrastructural point of view one model, proposed by cremer and cremer, suggests that the chromosomes territories are separated by the interchromatin domain, which are almost devoid of dna, and that transcriptionally - active genes are located at the periphery of a given chromosome territory, where they constitute a thin layer, the perichromatin region, in which extended chromatin fibers and rna transcripts intermingle . The other model, proposed by branco and pombo, argues that chromatin from different chromosomes is not separated by the interchromatin domain . Rather, the chromatin structures form a lattice - like network of fibers which intermingle in an uniform way within individual chromosome territory and between different chromosome territories . A defined perichromatin region is excluded, rna transcription taking place everywhere within the chromatin domains . Thus, this model does not support the compartmentalization in chromosomes territories, interchromatin domain and perichromatin region . Indeed, the data obtained using the osmium - ammine feulgen - like reaction suggest that the model of the chromosome territories, interchromatin domain and perichromatin region compartmentalization may be more valid for nuclei characterized by a low rna transcription rate in which a clear compartmentalization in chromatin domains and the interchromatin space is present . This appears not to be the case for cells characterized by an enhanced transcription rate . In such cells, chromatin constitutes a diffuse network uniformly distributed throughout the nucleoplasm, with all the nucleoplasmic components intermingled together and the consequent loss of any obvious compartmentalization . Also, ultrastructural data coming from the preferential visualization of the ribonucleoprotein components using the uranyl - edta - lead staining procedure were consistent with the apparent presence of three different compartments in the nuclei of resting cells and with the loss of this compartmentalization in cells with an enhanced pol ii transcriptional activity . This is clearly visible in supplementary figure 2 a, b showing a resting and a regenerating rat hepatocyte, respectively . It appears that, depending on the transcriptional activity of the cells, the organization of the nuclear compartments can be consistent with one or the other model . However it is worth noting that, whereas the cremer and cremer model can be consistent also with a modulation of chromatin architecture from resting cells (characterized by a low rna transcription rate) to proliferating cells (characterized by a high rna transcription rate), just by expanding the perichromatin region, the branco and pombo model cannot justify the chromatin compartmentalization in cells with a low rna transcription rate, being in fact applicable only to highly transcriptionally active cells . In the late 20 century there were major achievements in the study of chromatin structure and function derived from investigations conducted using isolated chromatin that was subjected to treatment with detergents, different ionic strength solutions and metal cation concentrations, and to nuclease digestion . Many years ago these studies led to the discovery that chromatin was constituted by repeating units, the nucleosomes, made up of histones and dna, thus opening new scenarios for the understanding of the structural organization of dna in chromatin and of the mechanisms controlling gene expression . Visualization of nucleosomes in situ was obtained using the osmium - ammine staining in the feulgen - like reaction . In fact, this staining procedure was found to possess high resolution of the stained structures in thin sections, thus allowing a clear visualization of dna filaments (as thin as the 2 - 3 nm dna double helix molecule) and visualization of nucleosomes in thin sections of mammalian cells routinely processed for electron microscopy . The nucleosome is composed by a histone octamer, two each of histones h2a, h2b, h3 and h4, which constitute a protein core around which 147 base pairs of dna are wrapped in 1.7 left - handed super - helical turns; histone h1 is attached to the complex . Ultrastructurally, nucleosomes are flat cylinders with a diameter of 11 nm and with a height of 5.5 nm . Therefore, after the feulgen - like osmium - ammine reaction, since only dna is stained, the particles appear as small rings, with a diameter of about 11 nm, constituted by electron - opaque thin filament, about 3 nm thick (corresponding to the thickness of double helix dna filament), delineating an unstained inner core . The observation of these ring - shaped structures is obviously limited to those portions of chromatin where the electron beam is perpendicular to the diameter of the nucleosomes . Moreover, nucleosomes in thin sections of chromatin fixed in situ do not lie in the same plane, but in fact (given the thickness of sections that range from 50 - 80 nm) they may be distributed on overlapping planes . Thus, section thickness and varying orientations of the chromatin reduces a generalized visualization of the ring - shaped particles . Nevertheless, they can be frequently recognized both in the extended fibres of the dispersed chromatin (compare figure 4a, in which nucleosomes are shown in a spread chromatin preparation, with figure 4b, showing a dispersed in situ chromatin fibre) and within the small clumps and the masses of highly condensed chromatin (figure 4c, d). Measurements of the diameter of clearly recognizable ring - shaped particles (performed on micrographs with an original magnification of 50,000 and photographically enlarged to 175,000) resulted in a mean value of 110.8 nm (s.d .) With a range from 9.5 to 13.0 nm, strongly suggesting their identification with nucleosomes . After the discovery of the nucleosomal organization of chromatin in 1974, a series of investigations were conducted using different methological approaches in order to determine whether the nucleosomal filament (in the remainder of this article the nucleosomal filament will be described as an 11-nm fiber) gives rise to higher order structures for dna compaction within interphase and metaphase chromosomes . These studies, conducted in vitro, lead to the conviction that the nucleosome filament, the first level of dna compaction, was further folded into a 30 nm chromatin fiber, that was considered to represent the basic unit of interphase chromatin . Furthermore, 30 nm chromatin fibres were visualised in isolated mitotic chromosomes swollen in low salt solution, in starfish sperm intact nuclei and in polytene chromosome puffs after inhibition of transcription . This firm belief of the existence of 30 nm chromatin fibers was questioned by a series of studies conducted in recent years using different approaches to visualize chromatin in situ . Using cryo - electron microscopy and image processing of vitreous sections of human mitotic chromosomes, it was possible to demonstrate that mitotic chromatin exhibited a homogeneous grainy texture, in which there were no visible 30-nm fibers, but the bulk of compact chromatin existed in a highly disordered and interdigitated state, comparable with a polymer melt . Furthermore, the application of the electron spectroscopic imaging (esi) technique to the study of chromatin structure allowed the visualization in situ of 10 nm thick chromatin fibres even in compact chromatin domains known as condensed heterochromatin . These esi data indicated that a large portion of chromatin in mammalian cell nuclei was organized in 10 nm thick fibers . Indeed, very recently using cryo - electron microscopy and synchrotron x - ray scattering, it was shown that human mitotic hela chromosomes were composed mainly of irregularly folded nucleosome fibers no thicker than 11 nm, thus indicating the near absence of regular 30-nm chromatin fibers within chromosomes . In this context, has the study of the structural organization of chromatin in situ using the feulgen - like osmium - ammine technique added to our knowledge? The major questions explored were the following: i) are the 11-nm and the 30-nm chromatin fibers present in situ? Ii) which of these two kinds of fibers represents the basic unit of chromatin in situ? The studies conducted in situ were mainly carried out using mammalian cells characterized by a physiological dispersion of chromatin, such as regenerating hepatocytes, which greatly facilitated the observations of chromatin structural organization . Furthermore, these cells have very large nucleolar bodies characterized by a greater electron - translucency than the nucleoplasmic space, a consequence of rrna extraction due to the hcl hydrolysis . In the nucleolar bodies most of the intranucleolar chromatin structures consist of very small clumps and of thin fibers which are well separated from each other and can be followed for a very long tract, unlike the fibers in the extra - nucleolar compartment (figure 5a). These characteristics rendered the regenerating rat hepatocyte nuclei, and especially the intranucleolar chromatin, particularly suitable for the high resolution study of the chromatin structure in situ . The studies conducted on this type of cells revealed the presence of both 11 and 20 - 25 nm chromatin fibers . Regarding the 11-nm fibers, they were easily recognized within the nucleolar body and frequently appear to be loosely interwoven to each other (figure 5b). Visualization of the 11-nm fibers was improved by the use of stereo - pair micrographs, which demonstrated that many of the chromatin structures were composed of these kind of fibers (figure 6a). The analysis of stereopair micrographs allowed these fibers to be detected giving rise to rings of different diameter, frequently intermingled together (figure 6b). Regarding the thicker chromatin fibers, the analysis of chromatin structure in situ did not reveal the presence of fibers with an actual thickness of 30 nm, but, in fact showed fibers with a thickness ranging from 20 to 25 nm . This kind of fibers were mainly observed within the nucleolar body (supplementary figure 3), always as solitary fibers, and never being clearly observed to constitute more complex chromatin structures, in contrast to the 11 nm thick fibers . The 20 - 25 nm thick fibers did not show either a solenoid or a beaded organization . Other than the 11 and the 20 - 25 nm fibers, fibers with intermediate thickness were also observed . Analysis of these fibers using high magnification stereopair micrographs indicated that these fibers appeared to be frequently composed of two 11 nm thick nucleofilaments wound around one - another (figure 7a), thus suggesting that the 20 - 25 nm thick fibers might result from the association of two 11 nm fibers . Regarding the structure of the chromatin in metaphase chromosomes, in situ analysis after the feulgen - like osmium ammine reaction, also carried out using stereo - pair micrographs, did not allow detection of a clear structural organization in basic units, constituted by either 11 or 25 - 30 nm thick chromatin fibers (figure 7b). Altogether these observations are consistent with the available data obtained from different methodological approaches indicating that, in situ, interphase chromatin is mainly organized in fibers with a thickness of about 11 nm; while the image data are not consistent with a structural organization of chromatin based upon units composed of 30 nm thick chromatin fibers . Another question that has been posed after the demonstration that dna is organized into nucleosomes was to ascertain the relationship between the nucleosomal organization of dna and gene transcription . In other words, whether dna uncoils from the histone octamer as a pre - requisite for transcription and whether it must resume the nucleosome configuration for gene silencing . In this context, special attention has been paid to the structural - functional relationship of ribosomal genes . This is due to the fact that, in higher eukaryotes, the rrna genes are present in multiple copies and, therefore, easily studied by different methodological approaches . Data obtained from spread chromatin preparations indicated that the transcribing ribosomal genes are constituted by a central dna axis connected with nascent growing rna transcripts whose length progressively increases from the transcription initiation site to the termination site, the well - known christmas tree structure . A series of in vitro studies showed that the dna of the transcribing ribosomal genes is in a nonnucleosomal configuration, whereas that of the repressed transcriptionallyinactive ribosomal genes exhibits a nucleosome organization, suggesting that the activity of ribosomal genes could be regulated by dna unravelling versus compaction into nucleosome . By contrast, in vivo psoralen cross - linking assays have demonstrated that the ratio between the non - nucleosomal and the nucleosomal structured chromatin did not change, even with a marked variation of transcriptional activity, questioning the assumption that ribosome gene transcription can be controlled by dna unravelling and compaction . The study of chromatin in situ using the feulgen - like osmium - ammine staining has greatly contributed to elucidation of the structural - functional organization of ribosomal chromatin . In mammalian cells, during interphase the ribosomal genes associated with transcription factors are located in the nucleolus, within the so - called fibrillar centers (figure 8a). This precise localization has been established by the fact that some factors associated with ribosomal genes (i.e., nucleolin, upstream binding factor, and the largest rna polymerase i subunit) are selectively stained by silver, which is located in the fibrillar centers (figure 8b). It has been repeatedly demonstrated, using the feulgen - like staining, that the ribosomal chromatin is present within the fibrillar centres (figure 8c) and it is organized into very thin filaments with a thickness of 2 - 3 nm (the same thickness as that of the dna filament) and are loosely interwoven (figure 8d). Of note, the greater portion of the ribosomal chromatin within the fibrillar centres is transcriptionally inactive, despite being associated with a number of transcription factors, rrna transcription taking place only at the periphery of the fibrillar centers . In addition, the dna present in metaphase nucleolar organizer regions, which consist of transcriptionally - inactive ribosomal genes are also in an extended non - nucleosomal configuration . This was demonstrated by combining the silver staining procedure for the agnor proteins with the feulgen - like osmium - ammine reaction (figure 8e, f). Therefore, these in situ studies support the conclusion that, at least for ribosome genes, the extended, non - nucleosomal structure is a necessary, but not sufficient condition for transcription and that gene inactivation during interphase and metaphase does not always occur by dna compaction into nucleosomes . Unfortunately there are no available data on the structure - function relation of other genes in situ that might lead to similar or divergent conclusions . Indeed, extended dna filaments similar to those observed in the nucleolus have never been clearly found in the nucleoplasmic space, even in high transcriptionally - active nuclei such as those of regenerating hepatocytes . However, the possibility cannot be ruled out that the lack of visualization of extended dna filaments in the extra - nucleolar compartment may be due to the low number of copies of the transcriptionally active non - ribosomal genes . The ultrastructural studies conducted in situ at the electron microscope level using the feulgen - like osmium - ammine reaction for the selective staining of dna have helped to define the structural - functional organization of interphase and metaphase chromatin in mammalian cells . The major contributions are the following: i) the gross chromatin morphology appears to depend upon rna polymerase ii transcriptional activity; a clear compartmentalization into chromatin territories, peri - chromatin region and inter - chromatin space is present only within nuclei with a low transcriptional activity; compartmentalization is lost during enhanced rna synthesis . This demonstrated high plasticity of chromatin is consistent both with the chromosome territory - interchromatin model and with the interchromatin network model: the nuclear architecture model depending upon the transcriptional activity of the cell . Ii) the structural organization of interphase chromatin appears to be mainly based on the about 11 nm thick fiber . Thicker chromatin fibers (20 - 25 nm thick) were also visualized, but only in special nuclear districts (i.e., the nucleolar body), where these fibers sometimes appeared to be composed of two interwoven 11 nm thick fibers . No evidence was obtained that the 20 - 25 nm thick chromatin fiber represents a basic unit of condensed interphase chromatin or of metaphase chromosomes . Therefore, these data are consistent with a model of structural organization of chromatin based on the 11 thick fibers, but not upon on higher - order (20 - 30 nm thick) fibers . Iii) not all transcriptionallyinactive chromatin is organized into nucleosomes, as observed for a portion of chromatin containing the ribosomal genes . This conclusion is consistent with the data obtained from the psoralen photocrosslinking assay of ribosomal chromatin structure, suggesting a model for control of ribosome gene activity that is not mediated simply by dna unraveling from, or compaction into the nucleosome structure.
An hiv - negative male, in his sixties, originally presented with a 6-month history of an isolated large nodule on the right malleolar region which was confirmed as kaposi's sarcoma (ks) on excision . Subsequently he continued to develop more papules and plaques on the feet and over the following 7 years underwent excision of around 20 skin lesions under local anaesthesia . More recently he developed, simultaneously, a crop of 5 nodules and a large plaque of ks 5.5 cm in diameter on the dorsum of the right foot with extension to the interdigital spaces and toes (fig . 1a, fig . Chemotherapy with intravenous liposome - encapsulated doxorubicin was not considered because of the significant comorbidities including mild to moderate heart failure . Therefore, in the following order, we tried two courses of photodynamic therapy, imiquimod 5% cream applied once daily for 8 weeks and a cycle of anti - herpes therapy based on valganciclovir . It was decided to administer intralesional vinblastine 1 mg / ml diluted 1:5 with saline solution . However, the patient developed side effects such as general malaise, swelling and erythema of the perioral and periocular areas and tingly tongue after the first injection, in keeping with a possible allergic reaction . At that point, at a bit of a loss for options, we switched to doxorubicin . Following a serial dilution test from 1:20 to undiluted, this medication was used intradermally at the dose of 2 mg / ml diluted 1:1 with saline solution . The large ks plaque on the dorsum of the right foot was treated by spacing the intradermal injections every 5 mm, using a similar technique to that used in the treatment of axillary hyperhidrosis with botulinum a toxin . The treatment led to complete resolution of the ks lesions after 4 treatments spaced 6 weeks apart . We observed skin necrosis in some well - delimited areas following each injection (fig . 1b), associated with mild to moderate pain which was well controlled with paracetamol 1,000 mg twice daily . The patient has not developed any new lesions for almost 18 months and continues to remain clear (fig . Ks is an angioproliferative disease associated with human herpesvirus 8 . The classic variant of ks is characterised by a low mortality and significant morbidity, and treatment needs to be finely balanced between these two aspects . To date, a curative treatment has yet to be found and therapeutic management includes surgery, radiotherapy, chemotherapy or a combination of all of the above . Although in recent years numerous agents such as thalidomide, imatinib, sirolimus as well as matrix metalloproteinase inhibitors (col-3), anti - angiogenic factors (bevacizumab) and nf-b inhibitors (bortezomib) have been tried, the outcome of these treatments remains unsatisfactory . Liposomal anthracyclines (pegylated or liposomal daunorubicin or doxorubicin) and taxanes such as paclitaxel therefore remain the cornerstones of systemic therapy against ks . Doxorubicin acts through intercalation of double - stranded dna bases and by inhibiting dna topoisomerase ii whose activity is markedly increased in proliferating cells . It represents a particularly effective treatment for widespread ks as it accumulates in highly vascularised lesions . Common agents for intralesional use in ks include interferon alpha, and more recently vincristine and vinblastine . Although intralesional doxorubicin is a standard treatment for ks in some centres, there are no publications showing the effectiveness of this treatment in ks . Intralesional doxorubicin was very successful in this case and the persistent remission induced would suggest that doxorubicin might be equally or even more effective than other standard intralesional treatments for ks cutaneous lesions in selected cases . Further studies with a large cohort of patients could be helpful to clarify the impact of intralesional doxorubicin in ks.
The question of why nature chose phosphate for life on earth has been around for many years . Phosphate diesters are especially adapted to link two nucleotides and still ionize, helping to stabilize the dna and rna for carrying and processing genetic information . Arsenic acid, which is the most closely related to phosphoric acid, was thought to be unsuitable because of the fast hydrolysis of arsenic esters . Diphoshate arsenate (adp arsenate) can be synthesized by beef heart submitochondrial particles . Furthermore, a recent finding of a bacterial strain (gfaj-1) that can rely on arsenic instead of phosphorus raised the questions of if and how arsenate can replace phosphate in biomolecules that are essential to sustain cell life . The possibility of arsenate - based cellular life has been questioned, mostly in the form of comments and a literature review . While the gfaj-1 strain observations await further experimental validation, computational approaches can be effective tools to address scientific questions related to the arsenate assuming that arsenate can replace phosphate in vital nucleotides, we computationally probe if arsenate nucleotides can retain the structural and functional features of phosphate nucleotides . In order to have a broad representation of the molecular systems in the cell and to ensure biological relevance rather than particular protein / dna / rna sequences of the gfaj-1 cell, we combine quantum mechanical, molecular mechanical and molecular dynamics simulations to investigate arsenate phosphate replacement in three selected types of molecules (atp / adp as energy source and replication regulation; dna protein complexes for dna replication and transcription initiation; a trna the hydrolysis of atp / adp as the energy source is coupled to most enzymatic reactions in life, and is involved in processes such as regulation of dna replication . We investigated three bacterial dna protein complexes which are essential for dna replication and transcription . Fis selects targets mainly through indirect recognition involving dna bending, using the minor groove shape and the sequence - dependent conformational change over adjacent major groove surfaces . Dna complex provides a test whether the combination of geometry and sequence specificity still allow an arsenate backbone . The second factor is the integration host factor (ihf), which functions in nucleoid structuring, chromosome replication and dna rearrangements, and transcription regulation in many prokaryotic processes . Ihf contacts the dna exclusively via the phosphodiester backbone in the minor groove, introducing a u - turn into the dna . Thus, the ihf dna complex provides a comparison of phosphodiester versus arsenatediester backbones in dna recognition . The third complex is the f plasmid rep protein (repe) dimer in complex with the repe operator dna . Repe is essential for stringent regulation of the plasmid copy number in esherichia coli . In the repe dna complex, the two dna binding sites are separated by 100). Thus, repe dna provides a test for cumulative structural changes due to as p replacement in dna . To investigate a possible phosphate - arsenate substitution in trna, we selected the bacterial trna lysidine synthetase complex (tils), which ensures translational fidelity . We used the crystal structure of the thermus thermophilius 70s ribosome bound to rf2 as the starting conformation . In this translation termination state, a step just before ribosome recycling, the interactions between 30s and 50s could be sensitive to energy perturbation . Finally, we compared the experimentally observed exafs spectra with the theoretical exafs spectra for the arsenate dna and rna . Pure dna and rna with phosphate and arsenate backbones could have similar conformations and the ability to retain the watson crick base pairs . (b) trajectory of the number of hydrogen bonds between watson crick base pairs in the dna . (d) trajectory of the number of hydrogen bonds between watson crick base pairs in the trna (pdb 3a2k, chain c). Dnaa is a large component of the initiation complex at the oric region in bacterial replication initiation . Md simulations indicated that adenosine diarsenate (adas) may still regulate dnaa conformation change . Dnaa complex is represented by red ribbons (pdb code: 1l8q); the snapshot from simulations of adp dnaa is depicted by blue ribbons, and the snapshot from simulations of the adas (b) superimposition of the snapshot from the simulations of adp dnaa (blue ribbon) and the apo form dnaa (green ribbon). (c) rmsds along the trajectories with respect to the crystal structure of adp (d) adas interacts with dnaa less strongly than adp with dnaa . In this study, the density functional theory was used to calculate the free energy change of the hydrolysis of adenosine phosphates and adenosine arsenates . Molecular mechanical force fields for the arsenates systems were parametrized using intensive density functional calculations, and then molecular dynamics simulations were employed to investigate the structural and energy changes due to phosphate - arsenate replacement in the selected molecular complexes . Earlier quantum mechanical calculations indicated that arsenate dna and phosphate dna may have similar conformational properties . Consistently, our work confirms that partial replacement of phosphate by arsenate in dna can retain certain structural and functional properties; however, this is unlikely to hold for the ribosome . Our study also indicates a perfect match between proteins and phosphate in terms of structure and interaction energy, which are superior to those between proteins and arsenate . The theoretical free energy changes of hydrolysis of adenosine triarsenate (atas) and adenosine diarsenate (adas) were based on qm calculations with large basis set (6 - 311++g * ) and include solvation effects . The full geometry optimizations and harmonic vibrational frequency calculations were performed at the b3lyp/6 - 311++g * level of theory . Vibrational energy corrections and entropies were used to calculate the free energy change of the hydrolysis reactions . Implicit solvent effects with water as the solvent were also considered by the polarizable continuum model (pcm) using the continuous surface charge formalism . Gaussian09, density functional theory at the b3lyp/6 - 311++g * * level was used to calculate the energy change of atas hydrolysis . B3lyp/6 - 31+g * level of theory was used to add arsenate nucleotides into charmm27 force field, due to the arsenate phosphate replacement . The parametrization of all - atom empirical force field for arsenate nucleic acids were based on modification of the current charmm27 force field for phosphate nucleic acids . Phosphate replacement were recalibrated to quantum mechanical calculations of the model compounds listed in supporting information, sup - figure 1 . The corresponding phosphate compounds in the supporting information, sup - figure 1, were used in the original charmm27 force field parametrization . The full geometry optimizations, harmonic vibrational frequency calculations, and potential energy surface for torsion angles were performed at the b3lyp/6 - 31+g * level of theory using the gaussian09 program . Bond lengths and angles related to as atom were fitted to average values obtained from the model compounds . The force constants were fitted to the harmonic vibrational frequency of dimethyl arsenate (supporting information, sup - figure 1a). Atomic charges were based on nbo calculations at the b3lyp/6 - 31+g * level, adjusted by fitting the potential energy curve of h2o---(ch3)2aso4 interactions (supporting information, sup - figure 2). It can be seen that the potential energy curves for the arsenate and phosphate are almost identical, with arsenate shifted to a slightly longer r0 distance, due to the large vdw radius of the arsenic atom . The partial charges of as, o = as, and o as were 1.58, 0.59, and 0.8, very closed to that of the related phosphate charges (1.50, 0.57, 0.78). Similarly, the force fields for adenosine triarsenate (atas) and adenosine diarsenate (adas) were also parametrized . Sup - figure 3, supporting information, compares the vibrational frequencies obtained by density functional theory calculations and our optimized arsenate force field calculations for the atas . Supporting information table 1 compares selected force field parameters for arsenate and phosphate compounds . Besides the longer as o bond, the optimized arsenate parameters are very similar to phosphate nucleotides used in the charmm force field . Md simulations were performed using the namd package and the charmm 27 force field, with constant pressure ensembles (npt) at 1 atm and the temperature at 300 k. the time step was 2 fs with a shake constraint on all bonds with hydrogen atoms . Productive md runs were performed after 5000 steps of minimizations and three 150 ps heating and equilibration runs . The starting conformations of the pure dna / rna and protein nucleic acid complexes were based on x - ray crystal structures of the phosphate system . The pdb codes for fis dna, ihf dna, and repe dna complexes are 3iv5, 1ihf, and 2z9o, respectively . The trna protein complex is the bacillus subtilis trna in complex with geobacillus kaustophilus lysidine synthetase (pdb 3a2k). Ribosome crystal structures are taken from the thermus thermophilus 70s ribosome bound to release factor 2 (pdb codes, 2x9r and 2x9s). The simulated molecules were solvated in a tip3p water box with a margin of at least 15 from any edge of the water box . Magnesium, potassium and chloride ions were also added to the simulated system to obtain different ionic conditions . Pure dna system (7bna) was neutralized with 22 sodium ions . In the simulation of the trna tils complex, three ionic concentrations were tested . For low ionic conditions, 33 sodium, 20 magnesium, and 5 chloride ions for the high ionic concentration, the effective ion concentration is around 0.2 m (with 167 sodium, 20 magnesium, 20 potassium, and 160 chloride ions). The system with protonated histidines is similar to the low ionic concentration setup, with 17 sodium, 20 magnesium, and 6 chloride ions . The high ionic concentration (0.25 m) was used for pure trna simulations . For the ribosomal systems, in addition to the existing magnesium ions in the crystal structure, we also added 400 magnesium ions, 2397 sodium ions, and 400 chloride ions to neutralize the overall charges in ribosome . 497327 water molecules are added to solvate the ribosome complex . Before the production run, we have pre - equilibrated the systems with mg and other ions in the solution . The ribosomes were fixed and only water and ions were allowed to move in the md simulations for the first 4 ns, which were not included in the productive simulations ., we used the program ionize (theoretical and computational biophysics group, university of illinois at urbana champaign, http://www.ks.uiuc.edu/development/mdtools/ionize/license.html) to place magnesium and sodium ions around the negatively charge regions in the rna . Following the md simulations, first, we calculate the buried surface areas for two interacting partners, with a surface tension coefficient of 0.015 kcal/(mola), as recommended by haberthuer and caflish . Second, we include the ions within the first solvation shell (5) of solute in the interaction energy calculation, to consider the ionic shielding effect in the electrostatic interactions . The inclusion of ions in the interaction energy may provide better interaction energies for highly charged nucleotides, especially for the trna and ribosome systems . The normalized correlation matrix was obtained by computing the covariances of the spatial atom displacements of 60 ns md trajectories for selected pairs of atoms:12we use p or as atom in the dna (or rna) backbone to represent the motions in dna (or rna). The c carbons were used to represent protein structure . After we obtain the normalized correlation matrix, we compare phosphate and arsenate complexes to obtain the linear correlation between each correlation matrix element . The rmsd analysis of dynamic trajectories was obtained using starting crystal structures as reference . Theoretical as k - edge (11867 ev) exafs spectra for the arsenate dna and rna were simulated with ifeffit algorithms in feff8, using the graphical utility artemis . All non - hydrogen atoms within an 8 distance from as atoms were extracted from the dna or rna complexes . The average spectra were obtained by averaging all simulations with as atoms in the dna system (linear 7bna dodecamer, fis dna, ihf the spectra for the ribosome were averaged from 60 arsenic positions in the 30s and 60 arsenic positions in the 50s subunits . Separate averages using only 60 arsenic positions in 30s or only 60 arsenic positions in 50s subunits converged, indicating that the sampling is representative of the ribosome structures . Our quantum mechanical calculations reveal the as = o bond length is 1.653 and as o is 1.823; thus, the average bond lengths of as = o and as o is 1.74, which is very close to 1.73, obtained from fitting of exahs spectra . As can be seen in sup - figure 4, supporting information, the vibrational frequencies obtained by density functional theory calculations and our optimized arsenate force field calculations agree very well, indicating a good fit of the force constants . In molecular mechanics calculations, molecular vibrational frequencies are mostly dominated by force constants of bond stretch and bending, and the low frequency vibrational modes are usually mixed with bending and torsional motions of chemical bonds . The fitting of the potential energy surfaces for the torsion angles of compounds a, b, c, and d (see sup - figure 1,supporting information) are reported in sup - figure 5, supporting information . In the model compound torsion scans, only the specific torsion angle is fixed, and all other coordinates have no constraints . In the force field parametrization, it is essential to fit the intrinsic molecular mechanics surface to the quantum mechanical surface, and keep the location of the molecular mechanics global minimum for a particular dihedral at the same point as the molecular mechanics global minimum . As can be seen in sup - figure 5, supporting information, the majority of the molecular mechanics curves overlap the quantum mechanical surface, including the and which are important for rna structures . The deviations of two torsional angles, o c3, are also by less than 0.5 kcal / mol, which is within the range of the accuracy of quantum mechanical calculations . Often, different levels of quantum mechanical calculations and optimized torsion profiles for nucleic acids force field could deviate by more than 0.5 kcal / mol . Recently, the charmm 27 force field has been improved leading to the charmm36 force field which has a better treatment of nucleic acids . In this study, we only modified the force field parameters related to phosphate - arsenate substitution; all other parameters are still charmm 27 . First, we compare pure dna and rna with phosphate and arsenate backbones . For dna, we selected a linear b dna dodecamer (the 7bna dodecamer), which wolfe - simon et al . Used as the representative dna structure to compare with the observed exafs spectra . For rna, we simulated a pure trna, which forms the trna lysidine synthetase complex (tils). As can be seen in figure 1, both phosphate and arsenate dna are very stable during the 60 ns simulations, with the arsenate dna being slightly more flexible than the phosphate dna (figure 1a). Both phosphate and arsenate dna are able to keep all watson crick base pairs (figure 1b). In the trna simulations, both phosphate and arsenate trnas have larger rmsd fluctuations than dna (figure 1c), which is a typical behavior for trna molecule in solution . Crick base pairs are also very stable for both phosphate and arsenate trna, and only a few opened during simulation (figure 1d). Overall, our simulations of two dna and rna systems indicated that the arsenate dna and rna could have similar conformations and the ability to keep the watson crick base pairs, consistent with recent quantum mechanical studies . Can atas or adenosine diphoshate arsenate (adp as) in the gfaj1 cell provide energy comparable to that of atp? To compare the hydrolysis energies of atp and its arsenate analogues, we calculated the theoretical free energy changes for five reactions (table 1). Hydrolysis of atas releases less energy than atp . The free energy change obtained for hydrolysis of adp as to adp and as (reaction 2) was calculated to be 3.0 kcal / mol, while hydrolysis of atas into adenosine diarsenate (adas) gives 2.2 kcal / mol . Hydrolysis of atas into adenosine monoarsenate (amas) can yield a larger free energy change (8.1 kcal / mol). The calculated free energy changes for the hydrolysis of atp are 4.9 kcal / mol (reaction 1) and 11.5 kcal / mol (reaction 4). The product of atp hydrolysis can be used to regulate the initiation of dna replication, which is a key event in the cell cycle of all organisms . In bacteria, replication initiation occurs at the oric region which is recognized by the atp dnaa and adp dnaa complexes . Following replication initiation, atp dnaa reforms to reinitiate a dna replication cycle . Dnaa interaction should be sufficiently strong for dnaa oligomerization; yet, it should also be sufficiently weak to allow adp replacement by atp . We used molecular dynamics (md) simulations to test if adas in complex with dnaa can regulate dna replication similar to adp . Adp binds dnaa in a pocket between domains iiia and iiib (figure 2a). Without adp, the domains separate, resulting in misorientation of domains iiib and iv with respect to iiia (figure 2b). When we replaced adp by adas, the interaction between domains iiia and iiib in the adas dnaa complex still appeared relatively stable; however, domain iv became more flexible than in the adp dnaa (figure 2d), indicating that it is easier to replace adas than adp during the reinitiation of dna replication . Dna complexes in both phosphate / arsenate forms are stable during the simulations (figure 3, parts a and e), deviating little from the initial structure . The rmsds of the md relaxed snapshots at 50 ns of the arsenate and phosphate dna - fis complexes are 2.9 from the crystal structure (figures 3a and 3e, table 2). If we only focus on dna dynamics, the covariance matrices for phosphate and arsenate dna are correlated with r = 0.74 (sup - figure 6a, supporting information). Dna complex presents a large difference between phosphate and arsenate dna (figure 3b). While both ihf and subunits maintain their interaction with the u - shaped phosphate dna, the subunit interacts more weakly with arsenate dna (green structures, figure 3b). However, the overall rmsds for both phosphate and arsenate ihf dna complexes are similar (sup - figure 7a, supporting information, table 2). The structural deviations of repe dna (figure 3c) are also larger than those of fis dna, with rmsd of 3 for phosphate dna and 4 for arsenate dna (sup - figure 7b, supporting information, table 2). Arsenic dna (dna(as))-protein complexes are more stable than arsenic rna (rna(as))protein complexes . In the figure, the crystal structures of phosphate dna protein complexes are represented by red lines (dna) and ribbons (proteins); snapshots from simulations of phosphate dna (dna(p))protein complexes are correspondingly in blue; snapshots from simulations of the arsenate dna / rna protein complexes are in green . (a) the dna(as)fis protein (green) complex does not deviate significantly from the dna(p)protein complexes . (b) weaker arsenate dna(as)ihf protein (green) interaction leads to larger dna structural fluctuations . (c) the repe protein is able to accommodate the cumulative dna structural changes introduced by arsenate phosphate replacement in a 37 bp dna fragment, with the two ends separated by 100 . (d) the trna(as)-tils complex deviates extensively from the phosphate crystal structure . Tils crystallized with trna(p) is represented by red ribbon; green ribbon represents tils complexed with trna(as). Trna(p) is represented by sticks, while trna(as) is shown as yellow surface to highlight the large differences between phosphate and arsenate trna (e) two independent simulations for fis dna complex indicate that arsenate dna protein complex is slightly more flexible than phosphate dna protein complex . (f) arsenate dna interacts less strongly with protein than phosphate dna protein complex in two simulations of fis dna complex . Three ionic conditions are listed for trna tils complex: hsp, protonated histidines in tils; high, high ionic concentration; low, low ionic concentration . Average rmsd from crystal structure for whole complex, and rmsd for nucleotides are in parentheses . Interaction energies are averaged over the last 30 ns in the md simulation trajectories; values in parentheses are the interaction energies averaged over the last 15 ns . The agreement between the interaction energies averaged over different time periods indicates convergence in the simulations . The interaction energies between the protein and arsenate dna are slightly smaller than those with phosphate dna (table 2). The differences are about 2, 0.5, and 5 kcal / mol, for the fis dna, ihf dna, repe dna complexes, respectively . The average interactions from the two simulations are within 0.6 kcal / mol for fis dna (phosphate) and 1.0 kcal / mol for fis dna (arsenate). For the ihf dna complex, dna wraps around the ihf proteins (figure 3b). Therefore, the phosphate - arsenate substitution may not induce geometrical strain in the dna, leading to almost identical protein dna interaction energies for the phosphate and arsenate dna (sup - figure 7b, supporting information). The binding distance between two repe monomers in the repe dna complexes separates to almost 100 (figure 3c); thus, here phosphate - arsenate substitution could have larger effects leading to much weaker protein dna interactions in the case of the arsenate dna (sup - figure 7d, supporting information). The smaller protein dna interaction energy for arsenate dna is correlated with its higher exposure to water and cations (table 2). Overall, even though the arsenate dna protein interaction energy is lower than that of the phosphate dna counterpart, their dynamics are similar, with correlation coefficients ranging from r = 0.56 to 0.42 (sup - figures 6 and 8, supporting information). In summary, we found that the structural and dynamical properties of arsenate dna and phosphate dna do not present marked differences . However, the interaction of the arsenate dna with the protein is weaker than that of phosphate dna . We simulated three ionic conditions (low and high salt concentrations, and protonated histidines in the tils protein). Trna interaction energies are similar at high ionic concentration and with protonated tils histidines (table 2 and sup - figure 7, supporting information), and both are stronger than the tils arsenate substitution weakens the tils trna interaction, making the gap slightly larger than that observed for protein the arsenate substitution in the trna system leads to larger structural changes and the dynamics of the trna and the tils protein also change (sup - figures 7 and 8, supporting information). Tils interaction is only r = 0.3 (sup - figure 6, supporting information). Similar to the dna systems, the arsenate trna has higher solvent exposure and contact with cations (table 2). The difference in the dynamics of phosphate and arsenate trnas raises a pivotal question: can an arsenate ribosome exist and be functional? The interaction energy difference between the small - sized trna protein complexes could be magnified in the largest cellular rna to address the question of the differences in the energy landscape and dynamics of the assembly between ribosomes made of phosphates and arsenates, we conducted massive md simulations of phosphate and arsenate ribosomes . Both phosphate and arsenate ribosomes underwent large conformational changes (figure 4) after 40 ns simulation at 300 k. during the first 10 ns, the rmsds of both phosphate and arsenate ribosomes are small, with the structures similar to the crystal structure (figure 4c). Because arsenate is heavier, one would expect that the arsenate ribosome would have slower conformational dynamics . However, after 10 ns, the structural change of the arsenate ribosome becomes larger than that of the phosphate, mainly because of the change in the arsenate 30s . Both phosphate and arsenate 50s present large rmsds, mostly because of the portion extruding from the main 50s body, like the l1 stalk where the l1 ribosomal protein binds (figure 4, parts a and b), which is known to be very flexible . Apart from this region, the main body of 50s has smaller rmsd than the 30s subunit (figure 4c). The rna backbone follows the same trend as the entire unit, but with a slightly lower magnitude . These conformational changes of both the phosphate and arsenate ribosomes may be mixed with structural relaxation and intrinsic motion since the ribosome is a large molecular machine with large global motions . As can be seen in figure 4d, converged motions can be observed at the p - site trna already after 20 ns, with arsenate trna having smaller rmsd than phosphate trna . The e - site trna is more flexible, consistent with the anisotropic network model analysis that the e - site trna has different dynamics than the p - site trna . Subunits of arsenate ribosome (ribosome(as)) are more repulsive than those of phosphate ribosome (ribosome(p)), making it more difficult to assemble arsenate rrna into the functional 70s ribosome than its phosphate counterpart . (a and b) snapshots from simulations of the ribosome(p) and ribosome(as), respectively . The two trnas are shown in surface presentation, with the p - site trna sitting between the e - site trna and rf2 . (c) rmsds (root mean squared deviations) of ribosome(p) and ribosome(as) from the starting crystal structures during the simulations . (d) e - site trna is more flexible than p - site trna . The trnas, rf2, and mrna are not included in the calculation . Including these four molecules makes 30s and 50s more repulsive for the arsenate system . The rmsd differences between the phosphate and arsenate ribosomes coincide with the interaction energy change of the s16 ribosomal protein with its surrounding rrna, with the s16-arsenate rna interaction weakening after 10 ns (sup - figure 9a, supporting information). Several other ribosomal proteins, s4, s17, and s20 are also important for global stabilization of rrna structure, and the interaction of arsenate rrna with all these proteins is weaker than for phosphate rrna (sup - figure 9, supporting information). The consistent weaker interaction of arsenate rrna with ribosomal proteins may hamper the 30s assembly . If however arsenate rrna could successfully fold into 30s and 50s subunits, could arsenate 30s and 50s associate as phosphate 30s and 50s do? As can be seen in figure 4d, while the phosphate 30s and 50s spend most of their time in an attractive energy landscape, the arsenate 30s and 50s could be repulsive to each other . Assuming that arsenate 30s and 50s can associate into 70s, we examine the energy and dynamics of the p - site and e - site trnas, mrna, and the rf2 protein (sup - figure 9, supporting information). In the p - site, arsenate trna has similar dynamic and interaction energies with rf2 and other molecules; however, in the e - site, the arsenate trna is more repulsive to other molecules than its phosphate counterpart . Overall, it appears that it is more difficult to assemble arsenate rrna into the 30s/50s subunits and into the full 70s ribosome than its phosphate counterpart . This raises the question of whether an arsenate ribosome has been observed in the arsenate cell . To answer this question, we compare the experimentally observed exafs spectra with the theoretical exafs spectra for the arsenate dna and rna . Wolfe - simon et al . Recorded and fitted as k - edge (11867 ev) exafs spectra . There are three characteristic peaks with decreasing magnitude, with the first peak reflecting the as o bond geometry, and second and third peaks reflecting nonbonded atoms around as (figure 5a). Our theoretical spectra of the 70s ribosome(as) do not match the experimental exafs, implying that the arsenate 70s does not contribute to the main arsenate source of experimental exafs . (a) theoretical curves of two as atoms in the 7bna dodecamer dna(as) (blue and green lines) compared to the observed exafs curve (black line) and the wolfe - simon s fitting (red line). (b) the theoretical curves averaged from the 7bna dodecamer dna (green line) and the 70s (blue line) versus the observed exafs curve (black line) and the wolfe - simon s fitting (red line). (c) two typical theoretical curves from linear 7bna dodecamer dna (green line) and 70s ribosome (red line). (d) theoretical curve from bent dna (red line) is between that of linear dna (green line) and 70s ribosome (blue line). The experimental exafs and wolfe - simon s fitting are taken from ref (3). On the basis of the structures of arsenate dna and rna simulated in this study, we calculated the phase and amplitude of arsenate with the ifeffit algorithms in feff8, using the program artemis . Dna dodecamer (the 7bna dodecamer) as the representative dna structure to compare with the observed exafs spectra . We also used the same refined 7bna dodecamer structure as a benchmark (with the appropriate as = o and as o distances). We found that two as atoms may generate theoretical curves that coincide with the observed exafs curve and the wolfe - simon s fitting (figure 5a). The fitting curves averaged from all as atoms in the 7bna dodecamer also have three distinct peaks (figure 5b). Bacterial dna is mostly bent due to packing, binding with proteins, and high salt concentration . Therefore, the linear 7bna dodecamer may not be a good candidate to represent cellular dna structures . More importantly, for normal bacterial cells, the ribosome constitutes about 25% of the total mass . Thus, ribosome structures should be included in a comparison between cellular polynucleotide structures and experimental observations . We then tested the nonlinear dna structures described above and the 70s ribosome . We found that the spectra of bent dna and rna around the regions of peaks 2 and 3 are totally different from those of linear dna . For example, most as atoms in the ribosome have a typical peak around 2.3, whereas there is a valley between peaks 2 and 3 for linear dna (figure 5c). The simulated exafs spectra for nonlinear dna progressively change from a linear dna pattern to that of rna . For a bent dna (repe, figure 3c), the position and shape of peak 1 overlap with those of rrna, and the spectra around the 23 region lie between those of linear dna and rrna (figure 5d). Overall, the theoretical exafs spectra of the as 70s ribosome (blue line, figure 5b) do not match the experimental exafs curve . Thus, our results demonstrate that arsenate 70s ribosome does not contribute to the main arsenate source in wolfe - simon s bacterial cell . Another indication of a negligible concentration of arsenate 70s ribosome comes from comparison of nonbonding as c nonbonding distances have been characterized to be 2.35 and 2.92 . However, in our simulated arsenate ribosome, the radial distribution for as c distances is 2.8 and there is no density around 2.35 (sup - figure 10, supporting information). The possible existence of arsenate dna and rna in the gfaj-1 cell has attracted considerable scientific debate as to whether and how arsenate analogues of phosphate can exist . Because of problems associated with chemical stability, current experimental approaches encounter difficulties in fully assessing the characteristics of arsenate dna and rna . Instead, we test computationally possible arsenate phosphate replacement by examining key molecular systems; however, because of the large size of the molecules our theoretical protocols are also limited . For the atp and adenosine triarsenate (atas) hydrolysis, we used the highest level of quantum mechanical calculations feasible given current computational power (density functional theory at b3lyp/6 - 311++g * * level). The solvation treatment with state of - the - art current quantum mechanical methods also involves approximations . As can be seen in table 1, while the calculated free energy change for reaction 4 is lower than the experimental value by only 0.6 kcal / mol, the free energy change for reaction 1 deviates significantly from the experimental measurement . However, we successfully reproduced the trend of the hydrolysis reactions, i.e., hydrolysis to amp (reaction 4) provides more energy than hydrolysis to adp (reaction 1). Therefore, we expect that the relative energies of hydrolysis of atp and atas would reflect a trend: hydrolysis of adenosine triarsenate (atas) provides 23 kcal / mol less energy than atp . It is still computationally challenging to calculate the absolute protein interaction energy using molecular mechanics simulations . Nevertheless, our current study revealed that arsenate nucleotides would interact with proteins less strongly than phosphate nucleotides . As can be seen in table 2, our two independent simulations of the fis dna complex agree quite well: the interaction energies which are estimated from different time periods deviated from each other by less than 1.0 kcal / mol . Overall, the interaction energy differences between phosphate and arsenate dna are about one to two times the standard deviations, indicating that the differences between the phosphate and arsenate cases are significant . The smaller protein nucleotide interaction energy for arsenate dna / rna could be explained by the larger volume of the arsenate nucleotide, which weakens electrostatic interactions . Our observation of the higher exposure of arsenate dna / rna to water and cations also reflects the effects of the larger volume of arsenate . In principle, because the arsenate nucleotides possess larger volumes, the solvation energy changes due to the buried surface area can compensate for the weak arsenate nucleotide - protein interaction; however, our study indicates that the solvation effect cannot offset the weaker electrostatic interaction . Large scale molecular dynamics simulations can provide insights into biological systems; including dna flexibility, dna protein interactions, trna and trna protein complexes, and the mechanism of ribosomal function . The computational methods used are sufficiently accurate to reproduce experimental structures and conformational dynamics of a variety of molecules . Our evaluation of the structural consequences of phosphate - arsenate substitutions in selected crucial processes in the cell may help in understanding the biological consequences . At the level of small nucleotide hydrolysis as energy source, we found that hydrolysis of adenosine triarsenate (atas) provides 23 kcal / mol less energy than atp . Thus, while atas hydrolysis may provide the gfaj-1 cell sufficient energy for some reactions, because ribosome assembly requires many energy - consuming atp dependent enzymatic reactions, the lower free energy obtained in atas hydrolysis may lead to an energetic strain that hampers ribosome assembly . On the other hand, at the level of gene replication and transcription, we found that the small adenosine diarsenate molecule may be able to similarly regulate the dnaa protein conformational dynamics . While arsenate dna interacts with proteins less strongly than phosphate dna, complexes of proteins with arsenate or phosphate dna may share similar dynamics . At the level of translation we found major problems . Arsenate - substituted rna not only interacts with proteins less strongly than phosphate rna, but also presents changes in conformational dynamics . The most detrimental arsenate substitution outcome that we observe is that the 30s and 50s may become too repulsive to assemble into a functional 70s ribosome . In principle, mutations in the proteins and in the rna could make up for some of the structural and energetic changes caused by arsenate replacement . However, while such mutations may be possible in arsenate dna protein interactions, this is not the case for the ribosome . To further confirm our doubts regarding the existence of an arsenate ribosome our comparison of the experimental exafs spectra of the arsenic bacteria with theoretical exafs spectra for arsenate dna and rrna only finds evidence for a possible existence of linear arsenate dna fragments in the dried gfaj-1 cell, and the characteristic ribosomal structure has not been observed . We hypothesize that the main reason for the slow growth of the gfaj-1 cell could be the small number of phosphate ribosomes that survived during cellular divisions . Nature has chosen phosphate not only for its energetic function and its stability; our study points to a perfect match between proteins and phosphate in terms of structure and interaction energy, which are superior to those between proteins and arsenate . Apparently, evolution has optimized the inter - relationship between proteins and dna / rna, which requires overall changes at the molecular and systems biology levels when replacing phosphate by arsenate.
Cribriform - morular variant of papillary thyroid carcinoma (cmv - ptc) is a distinct ptc with a better prognosis . The affected patients have shown both germline and somatic mutations of adenomatous polyposis coli (apc) genes . Unlike classic ptc, we report a case of cmv - ptc in a patient with apc, comparing with its documented cytomorphology and discuss its useful cytomorphological features in discriminating from other thyroid neoplasms . A 24-year - old female presented with altered bowel habits and bleeding per rectum was diagnosed with apc . At the same visit, she was diagnosed to have a multinodular goiter on imaging . Hypercellular smears showed cells arranged in monolayer sheets, discohesive papillae, cribriform clusters, cell morules with scattered single cells in a clean background [figure 1]. Cribriform clusters showed slit - like and oval - to - round empty spaces surrounded by broad anastomosing bars of cells . The papillae had well - formed branching fibrovascular cores [figure 2a], however, lacked sharp anatomical borders or nuclear palisading, unlike those seen in conventional ptc . The cells of papillae showed discohesion and spindling at the borders instead . The cellular composition varied with columnar cells at the edges of cell clusters, spindle cells attached to fibrovascular cores of papillae, and polygonal cells with small indistinct nucleoli in monolayer sheets . Hypercellular smears showing monolayer sheets (arrow) with cribriform spaces (star), discohesive clusters of cells (arrow head) and morules (circle) (h&e stain, 100) (a). Papillae with well - formed branching fibro - vascular cores (arrow) and discohesive cells (arrow head) (h&e stain, 100). Histology sections showing cribriform pattern (h&e stain, 200) these cytomorphological features were unusual for conventional ptc . They were suspicious; however, were not the classic features of cmv - ptc documented in the literature . Therefore, it was placed in bethesda thyroid cytology diagnostic category 5, suspecting a ptc variant . The thyroid contained multiple, circumscribed whitish nodules, distributed in both lobes and isthmus . Immunocytochemical staining with beta - catenin and biotin as well have shown a value in cytological diagnosis . A series of 18 cases describe varying cellular arrangements with papillary pattern, which had been the predominant pattern in three - fourths of described cases . In contrast, papillae were rare in this case and those present showed cell discohesion with spindling at the edges instead of palisading . Tall cells and spindle cells described as individual cells in the case series were present at the edges of flat monolayer sheets and papillary structures respectively in this case . The peculiar form of nuclear clearing, foamy / hemosiderin - laden histiocytes and background hyaline material additionally described in the case series were absent in this case . Lack of colloid has been a constant feature both in the case series and this case . Fascicular and solid patterns are described as additional architectural patterns in another series of five cmv - ptc cases . Even though some degree of nuclear clearing and occasional nuclear inclusions were present, classical ptc nuclear features were absent in this case and the nuclei in general appeared to be of a higher grade than those seen in conventional ptc . The most salient features described in a series of another eight cases was the hypercellularity and papillary architectures in which the papillae have shown three - dimensional branching and prominent fibrovascular cores covered by single layers of cells with classical ptc nuclear features, unlike the papillae of this case . Five other cmv - ptc cases additionally describe classical ptc nuclear features and cohesive papillary structures . Additionally, they describe cells with abundant cytoplasm and distinct cell borders, which was additionally appreciated in some columnar and polygonal cells in this case . Therefore, the cytomorphology of the present case is somewhat dissimilar to the features already described and those include papillae with cell discohesion and spindling at the periphery, presence of columnar cells only at the edges of flat monolayer sheets, absence of classic ptc nuclear features with the nuclei appearing to be of a higher grade than in ptc and discernible mitotic activity . Varied cytomorphological appearance of cmv - ptc may raise the possibility of a range of differential diagnosis of ptc variants and other thyroid neoplasms . The tall cell variant of ptc (tv - ptc) may resemble cmv - ptc when abundant columnar cells are seen on smears . However, the varying cytological features and smaller number of tall cells in proportion in cmv - ptc will differentiate it from tv - ptc . Tumor necrosis that may be present in tv - ptc is not described in cmv - ptc . The presence of architectural atypia and squamous morules raise the possibility of a diffuse sclerosing variant of ptc . However, the absence of significant nuclear pleomorphism, psammoma bodies, and sclerosing stromal fragments will be helpful to differentiate cmv - ptc from this variant . . However, nuclear stratification resembling metastatic endometrial / colonic carcinoma and the absence of classical ptc nuclear features will be helpful in differentiating it . However, the constellation of cytomorphological features of cmv - ptc in the absence of characteristic dispersed / powdery chromatin pattern of mc will make this diagnosis unlikely . Sheets of cells with eosinophilic granular cytoplasm, distinct cell borders, nuclear clearing, grooves, and inclusions are common to both cmv - ptc and hurthle cell tumors hence, making their differentiation difficult . Diagnosing cmv - ptc on smears would be challenging especially in view of its varied cytomorphological appearance . However, the full cytomorphological spectrum of cmv - ptc, when appreciated, may be characteristic enough to allow its accurate diagnosis . Awareness of the varied cytomorphology of cmv - ptc avoids misdiagnosis, especially when it occurs sporadically, unassociated with fap . Diagnosed apc patients, especially those with concurrent thyroid enlargement require exclusion of cmv - ptc, which has a recognizable cytomorphology and a favorable outcome.
Women have among the highest rates of new hiv infections globally and the rate of new infections has not lessened in recent years [14]. African americans account for 66% of new hiv infections among all us women over 5 times their proportion representation (12%) in the population . One in 30 african - american women can expect to acquire hiv infection during their lifetime; the vast majority of these are through heterosexual intercourse . Crack - using african - american women are a distinct, hard - to - reach population for whom empowerment to reduce hiv / sti risk takes on additional complexities due to the entangled dependencies of drugs, partnerships with men (who are often drug involved) for material support for women and their children, and constant threat of violent reprisal [4, 79]. Concurrent infection with sti is considered to be endemic among african - american, drug - using, hiv+ women . Women's biological inequality in vulnerability to sexually transmitted infection (sti) can be addressed with greater availability and use of male and female condoms (fc). In addition to challenges in the diffusion of available protection technologies, however, gender inequity in sexual relationships, limited bargaining power of women complicated by threats of violence, and insufficient resource commitment to health issues among minorities and the poor all contribute to women's continuing entrenchment of hiv / aids in the united states . The fc is the only female - initiated protection method that protects against hiv / sti and unwanted pregnancy at a level equivalent to a male condom (mc;). Full integration of the fc has lagged far behind in hiv prevention efforts [1214]. Interventions for us populations at high risk infrequently (4 of 14 studies) included information and counseling on the fc, although most studies were targeted to heterosexual risk groups . Formal cdc documents on voluntary counseling and testing (vct) do not specifically refer to fc as integral to the counseling approach . Effective interventions targeted to drug - using women to reduce sexual risk are few in number and, as pointed out by wechsberg et al ., have rarely involved follow - up intervals of longer than 6 months . Studies with short - term followup evaluating effective intervention approaches have included two woman - focused interventions: the co - op model as well as the nida standard model tested by sterk and colleagues, as against two enhanced models . The womens' co - op intervention is a brief 4-session intervention with mixed individual and group sessions, based on empowerment and feminist theory, encouraging women to understand their hiv risks in the context of substance abuse and effects on personal power and vulnerability to victimization . Numerous adaptations have been conducted since the first trial of the intervention, which resulted in its recognition as a best evidence intervention, based on results from 6-month followup . Long - term followup (4 years) of 60% of the original study population, however, found evidence of differential attrition favoring the retention of the high - risk participants and lack of long - term sustained salutary effects observed at 6 months . Sterk and colleagues followed 333 mainly crack - using women who were randomly assigned to three different conditions . With 96% retention at 6 months, positive change was demonstrated in drug use behavior and sexual risk behavior, as well as drug - related sexual risk behavior such as sex trade . However, no differences among the nida standard and woman - focused interventions were found . The enhanced interventions were based on five behavioral theories with a gender- and culture - specific focus . All conditions involved access to prevention methods and included practice of negotiation and protection techniques and technologies . The behavioral intervention tested here (bestbet) integrated elements from three existing theories the theory of gender and power, community empowerment theory, and risk reduction / harm reduction theory as well as an original theory of body empowerment . The latter draws heavily from feminist health principles espoused widely in the 1970s in such works as our bodies, ourselves . The bestbet intervention was initially developed as a multiple session, clinic - based intervention among hiv+ women, and has evolved through a series of studies on diverse populations of high - risk women [2325]. Increased body knowledge appeared to facilitate use of women's barrier methods in these studies because risk behavior declined . We believed that active crack / polydrug users would attend a relatively long, multisession intervention with women - focused content despite the inherent physical and mental challenges involved . We posited that the woman - specific intervention themes would have cross - cutting relevance and produce positive behavioral change among this population at very high sexual risk for hiv / sti . In this paper, we describe a randomized controlled trial of an intervention (bestbet) from a sample of 198 drug - using women with high - risk sexual behavior who were followed for 12 months . The feminist health model as applied to hiv underscores the need for holistic education about reproductive organs and genitals, rather than a narrow focus on hiv . Our intervention included session content on normal female anatomy, the menstrual cycle, pregnancy, menopause, sti signs and symptoms, female cancers, benefits of screening (mammography and pap smear), and common surgeries . The body empowerment approach posits that increased knowledge, sense of ownership, and pride in the body (body knowledge) are an independent pathway to self - esteem and to self - efficacy for protection behavior use of female - initiated barriers, mc negotiation with partners, and refusal of unsafe sex . Thus, we introduced to intervention women the entire range of female methods thought possibly to reduce risk of sti / hiv female condom, diaphragm, cervical cap, and spermicides (the study was initiated prior to the findings concerning vaginal irritation with nonoxynol-9; we counseled women to abandon use of spermicides for disease protection following publication of the findings)arranged hierarchically according to what was known about protection level in a harm reduction approach to increasing protection behavior (i.e., something is better than nothing). We also focused on the need for female solidarity and mutual support . These four pillars body knowledge, access to female initiated methods, emphasis on harm reduction, and a setting promoting female solidarity provided the intervention core components . We integrated content on female and male barriers in each intervention session, focusing on practical applications of the fc with diverse partners, including paid sexual transactions (e.g., cheeking or oral application of mc without partner initiation) concomitant with drug use (e.g., inserting an fc before getting high), and situations of potentially violent partners (inserting cervical barrier with spermicide for discreet risk reduction). Women tried the female barriers at home and shared their experiences at the following group session, where troubleshooting for problems encountered in the initial adoption period was facilitated by a trained counselor . The impact of basic body education coupled with access to a full range of female barrier options on decreasing sexual risk behavior has not, to our knowledge, been evaluated in active substance users . For this trial, we enhanced certain elements and adapted the study to target out - of - treatment drug users . We added a session dedicated to intimate partner violence (for paying, nonprimary, and primary partners) including a module on basic self - defense techniques and exit strategies and use of protection methods in the context of forced sex . The intervention was held at a university - operated, community storefront site with a long history of provision of hiv counseling and testing in a poor, inner city neighborhood . The elements of the intervention were (1) small groups with interactive counseling; (2) trained and certified near - peer community counselors with a history of substance abuse and in recovery for at least 2 years; (3) role play and rehearsal, (4) multimedia educational approaches, such as videos, audio tapes, brochures, posters, and anatomical models; (5) active referrals to local service organizations; (6) access to hiv testing; and (7) training of cbo staff for community capacity building . Audio tapes of diverse risk vignettes based on interviews with the target population and accompanying illustrated handouts were prepared by an outside nonprofit health organization . We collaborated with a nearby branch of a national family planning organization to facilitate diaphragm and cervical cap fittings and offered patient advocate support to accompany study participants to clinic appointments . To be eligible for the bestbet study, we required women to (1) be 18 years of age or older, (2) be hiv seronegative, (3) report 30% or more unprotected vaginal or anal sex acts over the preceding three months (averaged over all partners), (4) report not currently being in drug user treatment other than with methadone, and (5) report that heroin or cocaine were either injected, snorted, or smoked at least 12 times during the same three - month interval . Women were excluded for psychiatric problems or if they had been in drug treatment for more than 6 months . Because changing drug use behavior was not an explicit study objective, we did not exclude women from attending sessions if they were high except if such use disrupted group dynamics . Eligible women were recruited in philadelphia between november 2001 and august 2003, with the use of a mobile outreach van staffed with trained interviewers and harm reduction counselors . The van was parked in designated, high - risk areas known for crack - selling and smoking activity . Interested women gave the first written consent to be administered a 20-minute, confidential prescreening assessment interview that included demographic and behavioral risk items as well as to provide locator information . The second screening assessment was conducted at a community storefront site that served as an information and referral center for drug users . Recruitment and study methods have, in part, been presented in a prior publication . This study was approved by and conducted in compliance with the institutional review board of the university of pennsylvania . Participants completed a baseline risk assessment instrument delivered via audio, computer - assisted self - interview (a - casi) targeting sexual and drug user behavior over prior 6 months . Additional baseline data were collected in a face - to - face interview including the following: demographic and reproductive health history, history of sti, health care insurance, and types and location of health care services used in past 6 months . Following baseline data collection, all women received enhanced hiv and sti harm - reduction counseling that exceeds standard guidelines for hiv voluntary counseling and testing (vct); both the mc and fc were taught . We counseled women with sti on treatment locations and required these women to bring written confirmation of treatment for formal enrollment . We provided hiv - positive women with referrals for further counseling and care but they were excluded from this study . Women randomized to the intervention arm were invited back for five, 3-hour, weekly group sessions within 2 months of enrollment and were contacted for 6- and 12-month reunion sessions at community sites . Control participants received limited case management and the offer of free mcs and fcs, but no other proactive study intervention . At 6- and 12-month following enrollment, all assessments were repeated at the community sites or other locations when necessary . Masters' level interviewers were trained and certified in vct and in standardized interviewing techniques . Intensive retention efforts (phone, mailed correspondence, and in person) were used to follow participants considering their mobility, including community outreach, visits to known crack houses and other hang - outs, and hospital and prison outreach . Retention challenges were discussed weekly in study meetings . Using multiple methods and extensive efforts to locate hard - to - reach participants, the retention rate was 95% at 12 months . To test for differences between the control and intervention groups at baseline, chi - square for dichotomous variables and independent sample t - test for continuous variables were conducted for demographic variables and background characteristics . Univariate analyses including frequencies and percentages were completed to describe the total sample and its subsets at baseline and 12-month follow - up . Our main outcome variable, frequency of unprotected vaginal intercourse (monthly), is the focus of this paper . Data for this analysis were derived from a series of questions delivered via a - casi, asking first, the total frequency of acts during the interval (vaginal, anal, and oral) followed by the frequency of acts protected by mc or fc, diaphragm, cervical cap, or spermicide (these latter three related only to vaginal sex). The remainder was defined as unprotected vaginal sex acts . Protected and unprotected vaginal sexual acts were calculated at baseline and at 12-month followup for two types of partners: primary partners and hiv - negative nonprimary partners . The number of hiv - positive nonprimary partners was prohibitively small to include for analysis . A primary (male) partner was described as someone you have lived with or have seen a lot, and to whom you have felt a special emotional commitment . If a woman answered that she did not have vaginal sex in the prior interval (this was only possible at followup) or did not have that type of partner, she was considered as having zero frequency of unprotected acts . For this study we used an intent - to - treat analysis with the inclusion of women who may not have been sexually active during followup and/or may not have had a primary or nonprimary sexual partner . Pairwise analysis was performed on the outcome variable separately for primary and nonprimary partners from baseline to followup, for each intervention arm, which included generating a paired sampled t - test (p <0.05 was considered significant). For comparison of intervention versus control arms, first a change either parametric (student's t - test) or nonparametric tests (mann - whitney u test) were used to assess statistical significance, depending on the normality of distribution . All analyses were conducted using spss version 19.0 (spss, inc ., chicago, illinois). A total of 1134 women were prescreened at the van . Of the 616 eligible women, 304 (49%) successfully completed the baseline interviews and specimen collection and were invited to participate in the bestbet study . Among eligible women completing baseline interviews (n = 304), of these women, 227 (75%) returned for enrollment procedures and were randomized (113 as intervention subjects and 114 as controls). Twenty - nine women were later excluded based on contradictory information related to eligibility criteria (see figure 1). A slightly greater percentage of eligible women who completed baseline interviews, as compared to the final study group, reported drug injection (49% versus 42%) and somewhat fewer had health insurance (65% versus 70%). The majority of the study participants were african - american (see table 1). A majority of participants were unemployed with nearly two - thirds reporting use of food stamps . Most women had a history of drug treatment, with crack / rock cocaine and marijuana as the drugs of choice . Most participants (c 79.8%, i 85.9%) had a primary male sex partner, and more than half (c 56.6%, i 60.6%) had both a recent nonprimary male sex partner(s) and a primary partner . Women with primary partners reported substantial levels of recent (past 6 months) intimate partner violence: 21% had partners who had made threats on their life, 34% had been forced to have vaginal or anal sex without a condom, 25% had been punched or hit with something that hurt, and 11% had consulted medical care because of a fight (data not shown). No significant differences across arms were found . At baseline, the overall mean frequency of unprotected vaginal sex acts (all enrolled women) with primary partners in the past 6 months was 34.3 (median = 12), and with nonprimary, hiv - negative partners was 22.7 acts (median 0). At 12-month followup, the overall mean frequency of unprotected vaginal sex acts (all enrolled women) with primary partners was 15 . 6 (median 0); with nonprimary hiv - negative partners the follow - up mean frequency was 2.9 acts (median 0). A total of 189 women completed assessments at 12-month followup (retention rate: 95.4%). For the paired baseline - to - followup comparisons, among controls, for primary partner, baseline frequency was 32.7 acts; at 12 months this was reduced to 19.3 acts (paired t - test, p = 0.008; see table 2). Among intervention women, mean of unprotected vaginal acts at baseline for primary partner was 35.9 and at follow - up was 12.3 (paired t - test, p = 0.000). For control women with nonprimary hiv partners, mean baseline frequency of unprotected vaginal acts was 21.6 acts; at 12-month followup frequency was 2.5 (paired t - test, p = 0.000). Among intervention women, frequency of unprotected vaginal acts with non- primary hiv - partners at baseline was 23.8, and at 12-month followup was 3.5 (paired t - test, p = 0.002). A statistical test of the change over time (i.e., reduction in unprotected acts), per partner type, compared across arms, indicated borderline significance for primary partners (p = 0.075), favoring the intervention arm . For nonprimary partners, no statistical difference could be detected between the change observed across the two arms from baseline to followup (p = 0.80). Proportions of women reporting mc use were greater in both arms in cross - sectional analyses comparing baseline to followup . Mc use with primary partners was lower than with nonprimary partners across both arms, at both baseline and followup (table 3). Intervention women reported mc use with primary partners more frequently at followup but the difference across arms was not statistically significant for either primary or nonprimary partners . Mc use with nonprimary partner was reported by two - thirds (i) and three - quarters (c) of women; the higher rates in i women at follow - up were achieved despite lower usage at baseline with nonprimary partners (i versus c). Use of the fc was also substantially higher at followup than at baseline in both arms . The lowest proportions of women reporting fc use at followup were c women with nonprimary partners (7%). Use of spermicide and cervical barriers was also greater at followup compared with baseline for all women except c women with their nonprimary partners . Very few protected acts involved spermicide use alone and only 1 woman reported use of a cervical barrier unaccompanied by either mc or fc use . Thus, followup method use as compared with baseline method use appeared to increase the least when considering the subgroup control women - nonprimary partners . For i women, by contrast, there were consistent and substantial differences when comparing baseline to followup, with both partner types and across all methods . The sample of active, drug - using women in this study demonstrated large changes in risk behavior over 12-month follow - up . Frequency of unprotected sex acts dropped significantly for both study arms, across both partner types . The difference in frequency of unprotected sex for both study arms was modified by partner type . For primary partners, statistical significance would likely have been realized with greater numbers due to the large variability in the outcome measure . For nonprimary partners, there was no observed difference across the study arms; women in both arms reported substantial increases in protection . Our findings agree with those of others indicating that use of mc is less frequent with a primary partner than with nonprimary partners; nevertheless, the results with primary partner for intervention women are encouraging as these partners are often considered to pose a greater risk of sti / hiv transmission to drug - using women . Although both types of counseling reduced unprotected acts, the value - added impact of the group - based intervention appeared to reside mainly with primary partners . In our study, fc use also increased in both arms, with greater and more uniform increases among i women . In particular, at followup, fewer c women used fc with nonprimary partners, with proportions that were significantly different from i women . We have previously shown that introduction to the fc and other female protection methods promoted mc negotiation and possibly a greater rejection of unprotected sex . These findings taken together suggest that our group - based intervention treatment was superior in encouraging behavior change . Prior studies among drug - using women have often suffered from short follow - up periods . Study participants who used fc found the method sufficiently practical to use with primary and nonprimary partners . There has been a tendency to discount female barrier methods as impractical and unacceptable though no wide - scale evidence supports this contention and indeed there is evidence to the contrary [13, 14]. Women have potentially more control over fc (versus mc) use but its impact will only be realized with strong promotional programs and quality counseling including outreach activities to men wherever possible and easy access to continuing supplies, to ensure adoption and maintenance of the behavior . The fc should be a regular component of vct, formalized into easily accessible counseling guidelines and promoted widely . A separate analysis of knowledge changes with this intervention suggests that a key component of fc adoption is empowerment of women through better knowledge of their bodies . Such education should be incorporated routinely into future interventions and programs for drug - using women including, importantly, woman - focused drug treatment programs, still few in number and often lacking a reproductive health approach . Our body empowerment approach and counselor training supplied women with key elements to boost the use of female - initiated methods, including cervical barriers and devices that are important and relevant to drug - using women but poorly promoted and underresearched as a dual protection method . Study participants were selected on the basis of specific criteria drawn up to concentrate a high level of drug - related and sexual risk . They agreed and were expected to attend five, relatively long, intervention sessions and return for follow - up assessments . Other drug - using populations with a lower risk profile or less availability for study procedures might have demonstrated different results . Nevertheless, we used a - casi, an established technique to increase the validity of reporting of sensitive behavior in numerous populations . Additionally, there was high variability in frequency of reported unprotected acts at both time points . These considerations tend to mitigate concerns about reporting bias, though there is no way of eliminating this possibility . Comparisons of fc and mc use proportions were cross - sectional due to high levels of changes in partner and sexual activity . Drug - using women continue to be at extremely high risk for hiv / sti, with large demonstrated racial disparities, despite successful inroads made for other at - risk populations in the interim, such as non - injection - using men who have sex with men; additional approaches are still urgently needed . Arm, as we designed two alternative counseling approaches that could be used in the field; thus changes over time cannot be attributed to the intervention procedures with complete confidence and may be due in part to the additional time duration spent with counselors . Of concern, we may well have underestimated the impact of our intervention as compared to mc counseling only, which is practiced widely . Also, our analysis was based on an intention - to - treat approach; women assigned to the intervention arm did not necessarily complete all five sessions . The sample size may have been too small to detect some changes that were statistically significant for example, the differences within main partner across intervention and control arms . Finally, contamination of the message across study arms was certainly possible, given the relatively small geographic recruitment area and overlapping social networks; this too would have acted to minimize observed differences across the study arms . The hiv primary prevention landscape is changing, with oral preexposure prophylaxis (prep) as well as postexposure prophylaxis (pep) now documented to be valuable tools in the prevention mix and potentially applicable to drug - using populations . The potential for reducing sexual risk with vaginal prep for women is still unclear, with conflicting and recently disappointing results regarding the efficacy of vaginal tenofovir [37, 38]. A daily, voluntary application of an antiviral vaginal compound may suffer from poor adherence; long - term intact options may be considerably more effective . As additional topical microbicidal compounds complete testing, including microbicidally impregnated vaginal devices, the counseling on the use of such methods, especially among women at high risk such as idu and nidu women, will become more routine . Our results suggest that active drug - using women at high risk of sexually transmitted hiv / sti will partake of such counseling and capitalize on expanded access to these technologies.
Taking advantage of the widespread symbiotic interactions pre - existing between yeast and drosophila, we have recently developed an oral delivery method to induce rna interference (rnai) in a pest insect by knocking down essential genes expressed in its digestive tract (fig . 1). By feeding d. suzukii with saccharomyces cerevisae transformed with a plasmid vector expressing double - stranded rna (dsrna) targeting y - tubulin23c (y - tub23c), which is known to be lethal when mutated in the closely related d. melanogaster, we observed a significant decrease of y - tub23c mrna level in larvae and adult midgut of d. suzukii . More importantly, we observed that the reduced expression of y - tub23c mrna correlated with a significant reduction in both larval survivorship and adult reproductive fitness in a species - specific manner . Our results are exciting because it showed that oral delivery of dsrna expressed in yeast can induce sufficient rnai knock down of a target gene to reduce fitness of an insect pest . The fact that the target insect for our study, d. suzukii, is a species without systemic rnai mechanism suggests that our approach may even be more effective in species with systemic rnai, in which the silencing signal can be more efficiently disseminated beyond the intial target cells, i.e. Cells in the digestive tract . In addition, it remains to be tested in future experiments whether the delivery of dsrna by microbes, rather than naked dsrnas, could enhance the propagation of the rnai silencing signal . Figure 1.schematic summarizing the protocol for production and oral delivery of genetically modified yeast expressing dsrna to insect targets . Inverted repeats of target sequence are cloned into expression vector p406tef1 and transformed into s. cerevisae . Previously expanded yeast culture is then pelleted and could be use for further applications . For more details, schematic summarizing the protocol for production and oral delivery of genetically modified yeast expressing dsrna to insect targets . Inverted repeats of target sequence are cloned into expression vector p406tef1 and transformed into s. cerevisae . Previously expanded yeast culture is then pelleted and could be use for further applications . For more details, 2 . Since the first report of gene silencing using antisense single - stranded rna (ssrna) in plants at the end of the 1980s and a few years later in c. elegans, rnai efficiency have been notably improved with the discovery made by fire and mello highlighting the role of dsrna in this phenomenon . The use of dsrna molecules as a tool mediating sequence specific suppression of gene of interest (goi) was then extensively developed and utilized in many other organisms . Despite the fact that rnai pathways are well conserved among eukaryotes, knockdown efficiency often varies depending on target species, target genes, and delivery methods . One of the major issue limiting the success of rnai strategies remains to be our incomplete understanding of mechanisms leading to the transport and amplification of dsrna molecules from one cell to another . The improvement of delivery methods also constitutes a critical step to effectively mediate knockdown phenotype . In a large number of insect taxa, oral administration has been reported to show similar efficiency on target gene expression when compared to injection methods . The obvious advantages of oral delivery include reduced stress for organisms and ease of use for small insects . Nonetheless oral delivery of dsrna is still restricted to a few number of administration mode and to date, most rnai experiments using oral delivery are based on feeding dsrna either synthesized in vitro or produced in bacteria . Among emerging applications, our use of genetically modified yeast as biopesticide presents a novel approach to extend the toolbox of integrated pest management (ipm). Studies on symbiotic interactions have indicated that yeast are not only restricted to drosophila but broadly spread across different insect taxa . In the mosquito aedes aegypti, recent finding has shown that live yeast cells are efficiently ingested and hydrolyzed by larvae . With the recent advances in sequencing technology, the characterization of insect gut microbiota will lead to the identification of novel symbiotic microorganisms amenable to be genetically modified and used as dsrna delivering vector . In the context of pest management, the finding of new species - specific interactions between insect and microbe will considerably increase the specificity of the treatment against targeted insect . Beyond pest control strategies, the expansion of this technique constitutes a promising strategy to address the limits of rnai treatment, specifically in organisms where other delivery methods such as injection and classical oral dsrna administration remain unsuccessful or too expensive . Recent advances in genetic and molecular biology offer a broad range of powerful technologies to manipulate expression and function of specific genes . With the development of genome engineering methods like znfs, talens and more recently crispr / cas9 system, our ability to generate genomic changes is bringing about a revolution in scientific discoveries . In model organisms such as drosophila, uas / gal4 system and this tool is particularly efficient to drive tissue specific and ectopic gene or dsrna expression, using promoter restricted to certain cell populations or developmental stage . Although the development of these tools constitutes incontestable advances in terms of specificity and efficiency, there is still some exception where the use of exogenously delivered dsrna constitutes valuable alternative . Indeed, genome engineering relies on the establishment of transgenic lines by injection of genetic constructs into embryonic germline cells, which could remain challenging in non - model insect systems . In addition, functional studies of genes playing distinct roles during development and adult life could be challenging since the loss of function of these goi generally leads to lethal phenotype . As shown in studies addressing the characterization of hormonal pathways for example, the same set of genes could be involved in both developmental processes and regulation of physiological state in an age - dependent manner . In such scenario, the temperature dependent uas / gal80 or other inducible systems can be used in model species . Alternatively, the use of transient suppression of gene expression using rnai should also be considered . In fact, in experiments that require temperature manipulation in the experimental design, orally administrated or injected dsrna represent a helpful substitute to the gal80 temperature - dependent system . As high - throughput sequencing for genome and transcriptome acquisition is becoming more and more accessible, the opportunities to explore beyond the sphere of model organisms are now unlimited . As a consequence, the number of genes with unknown function continues to rise inexorably . In this context, the improvement of dsrna delivery has great potential in helping researchers tackle the genome to phenome challenge . We propose that microbial delivery of dsrna for gene silencing may be less time - consuming and labor - intensive than genome engineering and could be potentially applied to a broad range of organisms for reverse genetics study as well as integrated pest management.
As mentioned by triantafillidou and tsoumakas review (2006), in greece, alcohol use and abuse by adolescents is an important problem, mainly in suburban and rural areas . In risk factors for starting drinking alcohol family, relations with peers, risky behaviors, genetic reasons and advertisements moreover, adolescents drink because of their attitudes that drinking is pleasant and makes them forget their problems . As far as alcohol use in adolescence concerns, research efforts have been directed toward the testing of models that hypothesize effects involving causal paths that connect risk and protective factors to alcohol use, but also efforts to modifying adolescents health behaviors and risky habits . In the same way, research efforts to validation of susceptibility of which adolescents initiate to smoke, such as experimentation, related beliefs and social norms, depression and aggression as causal related factors in the purpose of prediction, prevention and cessation . The negative consequences of tobacco smoking are well documented and widely accepted . Although alcohol can be beneficial to psychological health when used in small quantities, the quantity required to help prevent heart disease appears to be higher and the use of large quantities of alcohol causes cirrhosis of the liver . But is adulthood legalizes smoking and alcohol use and the risky factors disappear because of the age? Are there longitudinal studies concerning the heavy drinkers and smokers in adolescence and then the same in their adulthood or the interest stops in the end of adolescence? It is true that fewer research studies have taken place comparing alcohol and tobacco use in adolescence than in postadolescence . The purpose is the research of advertisements methods that best influence youth for tobacco use prevention . Furthermore, cognitive factors such as attitudes, norms and self - efficacy about smoking among students have a main role in research practice, so as for alcohol . In the same way, social smoking, this is one of the main purposes of this study: to investigate research tools for alcohol and tobacco use in early adulthood and propose evaluated programs for intervention and prevention . The theory of planned behavior of ajzen (1991, 1988, 1980) argues that behavior can be predicted by the intention of the people for adoption of that . Furthermore, to the formation of intention contribute three fundamental dimensions: attitudes toward the specific behavior, subjective rules of the environment and the perceived behavioral control of the person to carry out the behavior . Attitudes are the evaluations of the individual toward a behavior, subjective norms, embodying the dimensions of normative beliefs on the beliefs of significant others for such behavior, while perceived behavioral control includes the dimensions of perceived controllability and ease adopting an attitude and self - efficacy is associated with a person s beliefs about the extent of the capabilities to express this behavior . A series of studies have taken place on the base of this model in risky health behaviors and substance use of young adults . In greek literature there is a lack of researches according to alcohol and tobacco use in students using the theory of planned behavior . The theory of planned behavior of ajzen (1991, 1988, 1980) argues that behavior can be predicted by the intention of the people for adoption of that . Furthermore, to the formation of intention contribute three fundamental dimensions: attitudes toward the specific behavior, subjective rules of the environment and the perceived behavioral control of the person to carry out the behavior . Attitudes are the evaluations of the individual toward a behavior, subjective norms, embodying the dimensions of normative beliefs on the beliefs of significant others for such behavior, while perceived behavioral control includes the dimensions of perceived controllability and ease adopting an attitude and self - efficacy is associated with a person s beliefs about the extent of the capabilities to express this behavior . A series of studies have taken place on the base of this model in risky health behaviors and substance use of young adults . In greek literature there is a lack of researches according to alcohol and tobacco use in students using the theory of planned behavior . For the purposes of the research process two questionnaires were constructed, one for alcohol use and one for smoking, conducted in greek student population aged 18 - 25, according to the theory of planned behavior (figure 1) and study of international literature . Research tools - questionnaires taken into consideration, after permission, for the construction of ours were that of cooke, sniehotta & schuz, jamison & myers, mcmillan & conner, norman, bennetti & lewis . Firstly, two pilot studies took places as follows: the first included five students of various departments, who have raised issues about tobacco and alcohol use that recorded . Then we constructed the questions, according to the first pilot study and the guide of constructing a tool based on the theory and behavior and the study of other investigations . Followed by a second pilot study involving twenty students from different departments of the university of peloponnese and the technological educational institute of kalamata, where two questionnaires were included . All the comments and questions of the participants were recorded and a first statistical analysis of data and corrections took place . Thereafter, a third pilot study followed evaluating the research tool as follows: the survey involved 138 people, of 18 - 25 years old, the period between june and september 2012 from various faculties of the university of peloponnese and of the technological educational institute of kalamata (table 1). The 72.6% were women and 27.4% men: 17.9% of the sample in the first year, 19.6% in the second year, 23.2% in the third year and the remaining 39.3% in the fourth or higher year . The 81.5% are students of the university of peloponnese, while 18.5% studying at tei of kalamata . The 95.4% consumed up to 5 times whiskey, vodka, brandy or similar drink . What observed in all cases is that the father consumed greater amounts of alcohol than the mother except packaged alcoholic beverages and cocktails with alcohol . In all cases, students feel that men are allowed to consume more alcohol . In relation to the number of times drunk alcoholic beverages, to an extent they cannot keep their balance by walking, cannot speak well, vomit or could not remember what had happened, the following were found: the 75.8% of students has drunk so much up to 5 times throughout his life . The 88.0% of the students have drunk so much up to 5 times in the last year . The results on the number of times within the last year (12 last month so far) happened to students some negative events because of alcohol use, show the following: the vast majority of students said that never happened any of these events . Important of course is the percentage of students (16.2%) due to the alcohol they neglected their studies 1 to 2 times . It then observed that 81.2% of students in an exit, consume 1 to 3 alcoholic beverages, 13.0% from 4 to 6 drinks, no drink 5.1% and only 0.7% consumed 7 or more alcoholic drinks . The 90.6% of friends drinking alcohol from 1 to 4 times in a typical week while 97.1% of friends consume from 1 to 6 drinks in a typical exit . The 82.6% of students said that visiting a bar from 1 to 4 times a week . 52.1% spend from 3 to 4 hours at a bar with friends, 22.2% spend more than 5 hours, 21.4% spend 1 to 2 hours while the remaining 4.3% spend less than an hour . Of the students who drink alcohol, 4.4% always drink alone, the 41.5% drink with a friend, the 72.6% drink with 2 or 3 friends, 61.5% drink with a group of four or more friends and drink at 26.7% home with the family . In relation to the degree of agreement between students and some proposals concerning alcohol consumption the records are as follows: 52.2% of students agree more or less completely that his / her friends would have endorsed the drink . The 57.8% agree to some of his friends that absolutely would expect to drink when they go out . In relation to the family, however, 56.3% disagree a little bit to absolutely that his / her family would approve drinking . Few students are split on whether the family would expect to drink when they go out . The scales related to self - efficacy beliefs and control showed: the 94.8% of students agree a little bit to strongly that if they drink alcohol is mostly under control . Nonetheless, 58.2% agree completely that is easy to drink more than usual when drinking with friends, although a number of students (56.7%) disagree more or less entirely to have control over the amount of drinking when drinking with friends . The 76.5% disagree more to absolutely that would be drinking the same number of drinks as his / her friends in an outlet, if they would believe that is what they should be doing . The 79.4% disagree enough to completely that usually tries to drink the same number of drinks that his / her friends drink . The 76.3% disagree a little bit to completely that his friends would encourage him / her to drink the same number of drinks in an exit as they drink . The 83.7% disagree a little bit to completely that sometimes feel pressured to drink when going out with friends . Related to self - efficacy, the 68.9% disagree a little bit to completely that when he / she confronts a problem drinking will make him / her to forget . In contrast with the records of the previous paragraph, the 53.75% agree a little bit to completely that when he / she is bought a drink, it is hard to say no . The 59.8% disagree a little bit to absolutely that the shop serves non - adulterated drinks makes him / her drinking more . The 59.1% agree a little bit to completely that during celebrations they usually drink more; 11.8% are neutral . The 64.7% disagree a little bit to absolutely that the size of the group can affect the amount of drinking . In relation to the socio - economic circumstances and self - efficacy, 84.5% disagree a little bit to absolutely that at this time the crisis makes him / her drinking more than usual . The 85.8% disagree more to absolutely that the fear of unemployment makes him / her drinking or drinking more than usual . By studying the intention in relation to social influence, students are split on whether they intend to drink alcohol in the next week, if a friend requests, 53% disagree a little bit to absolutely that intend to drink alcohol when his / her friends drink alcohol . On a scale of attitudes towards alcohol consumption, 39.3% of those who drink combining drink with food, with snacks 47.4%, 74.1% with the music, 34.3% with smoking . As regards to smoking behavior, table 2 shows the following: the 65.9% of students said that they smoke . The 34.8% smokes in average 11 to 20 cigarettes a day, 30.4% smokes 6 to 10 cigarettes, 28.3% smokes 1 to 5 cigarettes while the remaining 6.5% smokes more than 21 cigarettes a day . During the past month, 36.2% of students smoked on average 11 to 20 cigarettes, 29.8% smoked 1 to 5 cigarettes, 23.4% smoked 6 to 10 cigarettes, while the remaining 10.6% smoked more than 21 cigarettes . The average number of cigarettes they intend to smoke in the next month is 257.80 (279.17) cigarettes . 10.6% started smoking because their friends smoked, 17.0% because they thought it would be loosen, 48.9% for no apparent reason and 12.8% for another reason . The average number of siblings who smoke has been found equal to 1.19 (0.45). Further, in relation to normative beliefs, 58.8% of students disagree enough to completely that his best friend believes that it is negative in smoke . The 91.1% disagree enough to completely that his / her father believes it is not negative in smoke . The 88.8% disagree enough to completely that his / her mother believes that it is negative to smoke . The 80.0% disagree a little bit to completely that his / her partner believes that it is negative in smoke . The 60.9% disagree a little bit to absolutely that people who smoke believe that it is negative to smoke . 87.2% disagree a little bit to absolutely that his / her siblings think it is negative to smoke . The 62.7% disagree a little bit to absolutely that people around him / her indoors (e.g. Cafes, bars) believe that it is bad to smoke . What concerns the intention of the students, 75.8% of the students who do not smoke said there was no possibility to smoke in the future . 19.8% said that they might smoke in the future while 4.4% said they d smoked in the future . Of those who said they would or might smoke to smoke in the future, a percentage of 9.1% will do it because their friends smoke, a rate of 27.3% believing that they will loose a percentage of 45.5% for no apparent reason and a percentage of 22.7% for another reason . The 41.4% agree a little bit to completely that the cost of cigarettes / tobacco permits to buy them . Students are divided as to whether they smoke more than usual when they have much work to do . The 57.9% agree totally that more or smoke more than usual when they are in a bad mood . The 46.4% disagree quite a bit to that when it s in a good mood smoke more than usual . The 82.9% agree a little bit to completely that just to go out makes him / her smoking more than usual . The 80.5% agree a little bit to completely that just to have anxiety makes him / her smoking more than usual . The 87.5% agree a little bit to absolutely that when he / she drinks his / her coffee smokes more than usual . The 90.2% agree a little bit to absolutely that he / she smokes when he drinks alcohol more than usual . The 56.1% agree a little bit to absolutely that if he / she quits smoking you will eat more . The 75.0% agree a little bit to absolutely that they are going to smoke after eating . The 63.4% agree a little bit to completely that just to feel lonely makes him / her smoking more than usual . The 56.2% disagree a little bit to absolutely that to stop eating a cigarette while 24.4% agreed more to absolutely . The 53.7% agree a little bit to absolutely that just listening to the music that he / she likes, makes him / her smoking more than usual . The 75.0% agree a little bit to absolutely that during stressful periods such as examination periods, makes him / her smoking more than usual . The 65.0% agree enough to completely that if there was a heartbreak in his / her life would make him / her to smoke more than usual . The 46.3% disagree enough to completely that the fear of unemployment would make him / her starting smoking or smoking more than he / she used while a percentage of 34.2% agrees a little bit to enough . The 61.0% disagree a little bit to absolutely that economic crisis made him / her to start smoking or smoke more than usual . The 22.0% is neutral . In relation to the view of students and those who already smoke may smoke in the future about their attitudes to smoke for the next month, we observe: the 42.5% of students consider that it would be little to absolutely pleasant, 20.0% being neutral and approximately 20.0% felt that it would be a little embarrassing . The reliability of the scales of the questionnaires used by a reliability coefficient of cronbach and factor analysis (factor analysis), as listed in tables 3 and 4 . The reliability coefficient for the scale to the degree of agreement between students and some proposals concerning alcohol consumption (table 3) is 0.895 . This means that the items of the scale have high internal consistency as to what count . The audit of the bartlett sphericity have a proof that the variables are correlated with each other (x2=1212.577, p<0.001) while the modulus of the kaiser - meyer - olkin equals 0.835, which is considered high . These two elements suggest that our data is properly analyzed with multivariate technique of factor analysis . Factor analysis resulted in a statistically significant 5 factors explain 64.0% of the original variance . The reliability coefficient for the scale on the characterization of drinking alcohol equals cronbach a=0.834 . This means that the data in the original scale have good internal consistency as to what count . The audit of the bartlett sphericity have a proof that the variables are correlated with each other (x2=517.372, p<0.001) while the modulus of the kaiser - meyer - olkin equals 0.783, which is considered high . These two elements suggest that our data is properly analyzed with multivariate technique of factor analysis . Factor analysis resulted in two statistically significant factors that explain 69.0% of the original variance . The reliability coefficient for the scale on whether other people believe that it is negative in smoking students equals cronbach a=0.813 . This means that the data in the original scale has high internal consistency as to what count . The audit of the bartlett sphericity have a proof that the variables are correlated with each other (x2=447.293, p<0.001) while the modulus of the kaiser - meyer - olkin equals 0.777, which is considered high . These two elements suggest that our data is properly analyzed with multivariate technique of factor analysis . Factor analysis resulted in 3 statistically significant factors that explain 69.0% of the original variation . The reliability coefficient for the scale to the way in which students work on smoking equals cronbach a=0.850 . The audit of the bartlett sphericity have a proof that the variables are correlated with each other (x2=379.017, p<0.001) while the modulus of the kaiser - meyer - olkin equals 0.510, which is considered moderate . These two elements suggest that our data is properly analyzed with multivariate technique of factor analysis . Factor analysis resulted in a statistically significant 6 factors explain 72.0% of the original variance . The reliability coefficient for the scale on the view of students who already smoke to smoke and those who may in the future about what was to smoke next month equals cronbach a=0.785 . This means that the data in the original scale has high internal consistency as to what count . The audit of the bartlett sphericity have a proof that the variables are correlated with each other (x2=161.974, p<0.001) while the modulus of the kaiser - meyer - olkin equals 0.709, which is considered high . These two elements suggest that our data is properly analyzed with multivariate technique of factor analysis . Factor analysis resulted in two statistically significant factors that explain 77.0% of the original variance . The values of cronbach a reliability coefficient of central scales for the two questionnaires are listed in table 3, while values of analysis and scales of variability explained by these listed in table 4 . The results demonstrate the significance and application in universities and technological educational institutes appropriate primary preventive interventions for students nonusers of tobacco and alcohol and appropriate programs of secondary and tertiary prevention in heavy users of tobacco and alcohol use and high - risk individual . The results demonstrate the significance and application in universities and technological educational institutes appropriate primary preventive interventions for students nonusers of tobacco and alcohol and appropriate programs of secondary and tertiary prevention in heavy users of tobacco and alcohol use and high - risk individual.
Bone marrow is the major hematopoietic organ . Bone marrow hematopoietic tissues are highly sensitive to toxins, including radiation and chemotherapeutics, which may induce myelosuppression . The cytoactivities of primitive hematopoietic cells may, therefore, be depressed, and the number of peripheral blood cells may decrease substantially . In addition, severe myelosuppression may cause infections, inflammation, and bleeding [1, 2]. It is generally accepted that maintenance of normal hematopoiesis relies on the stabilization of the hematopoietic microenvironment . As the major component of this microenvironment, hematopoietic cytokines play a key role in the regulation of hematopoiesis, controlling the proliferation, differentiation, and maturation of primitive hematopoietic cells [3, 4]. Il-6 is a kind of cytokine with a wide range of biological activities, produced mainly by t and b lymphocytes, monocytes, fibroblasts, and so forth [5, 6]. Recent studies showed that il-6 involved not only in the progress of the stress reaction, autoimmune, and neoplastic diseases of the body but also in regulation of the proliferation and differentiation of primitive hematopoietic cells, and it is considered as a permissive factor of primitive hematopoiesis . Of all the cytokines, il-6 is the first one found to be associated with the pathogenesis of the disease, due to its close relation with a variety of diseases under overexpression . In the present study, a mouse model of aplastic anemia was established by using cyclophosphamide in combination with chloramphenicol and co radiation . After modeling, the in vitro proliferation of bmsc was tested by mtt assay, and the il-6 secretion levels of bmsc were analyzed . This study gives new insights into the hematopoiesis regulating properties of il-6 in mice with aplastic anemia . The procedures of our experiment are in compliance with the principles of laboratory animal care . Imdm tissue culture media and il-6 elisa kits were purchased from the jingmei company (chengdu, china). The tunel kit was purchased from the boster company (wuhan, china). The fully automatic blood cell analyzer (hs-18) was made in italy; the inverted phase contrast microscope by the chong qing optical instrument factory (china); the co2 incubator (mcd-15a) in japan; and the fully - automatic elisa meter by the thermo company (usa). Healthy balb / c male mice, weighing 1822 g, aged 68 weeks, were provided by the experimental animal center of chengdu university of traditional chinese medicine . Animals were housed in a warm, quiet environment with free access to food and water . The radiation source (co) was provided by sichuan academy of agricultural sciences . Briefly, the mice were irradiated with 2.0 gy co and then treated with daily intraperitoneal injections of cyclophosphamide at 40 mg / kg / day and chloramphenicol at 50 mg / kg / day for the next three days . On day 7 after modeling, 20 l blood was taken from the orbital vein of the mouse and diluted with the manufacturer recommended diluent before analysis with the hs-18 fully automatic blood cell analyzer . Eight mice from each group were sacrificed, and the femurs of each mouse were removed . The bmc suspension was prepared according to zhang's method, and the number of bmc was counted . On day 7, two mice from each group were randomly chosen, the femurs and spleens were removed, fixed in 4% neutral formalin, decalcified, and desiccated, and embedded in paraffin, and then semithin sections were cut . After hematoxylin - eosin staining, the pathomorphological changes of bone marrow and spleen were observed with a light microscope . On day 7, bmc smears were prepared, and bmc apoptosis was analyzed by tunel, according to the specifications of the tunel kit . 5 microscopic fields of each slide were randomly chosen and observed under microscope, and the apoptosis ratio was calculated . On the 4th, 7th, and 10th days after modeling, bmc suspensions were prepared as described above then adjusted to a concentration of 1 10 cells / ml . Bmc were cultured in imdm supplemented with 15% fetal calf serum at 37c in 5% co2 and saturated humidity . After 48 h of cultivation, culture supernatants were harvested and stored at 20c for il-6 analysis . Mtt was added to every well, and the culture medium was put back to the incubator . 4 h later, the mtt was removed and the cells were washed by pbs twice . 100 l of isopropyl alcohol was added to split the cells . Then, the enzyme - linked immunosorbent assay was used at the 570 nm to detect the a value of every well . All data were expressed as mean standard deviation (x-s), and the t - test was used to evaluate the difference between groups, with p <0.05 considered to be statistically significant . As measured by the fully automatic blood cell analyzer, the number of peripheral blood cells in the aplastic anemia mouse model was notably decreased (p <0.05). Besides, the number of bmc was markedly decreased (p <0.05). These data indicated that the aplastic anemia model had been successfully established (figure 1). The morphology of the bone marrow tissue had changed obviously after modeling . In our model, the amount of hematopoietic tissue, as well as the number of hematogenous cells in bone marrow, was obviously reduced . The number of lymphocytes, fat cells, and other nonhematogenous cells, however, increased markedly . These changes were accompanied by interstitial edema and blood sinus expansion (figure 2). The spleen atrophied, the splenic corpuscle shrank or disappeared, and its structure was clearly compromised . Spleen blood sinuses dilated, hematopoietic focus disappeared, and megakaryocytes decreased or were absent (figure 3). The apoptosis rate of bmc from the aplastic anemia group (9.75 2.43%) was significantly higher than that of normal controls (3.63 1.06%; figure 4) (p <0.05). Nuclei of the apoptotic bmc were stained red with fast red while nuclei of nonapoptotic bmc were stained blue with hematoxylin (figure 5). Figure 6 showed that at the three time points (4th day, 7th day, and 10th day), the level of il-6 in cultured supernatants of bmsc from the anemia group was significantly higher than that of the normal group (p <0.05). Bmsc displayed long fusiform shape under invert phase contrast microscope cultured more that 2 days (figure 7). The a value of model group at the three time points (4th day, 7th day, and 10th day) was significantly lower than that of normal group (p <0.05) (figure 8). It has many target cells including macrophages, liver cells, stationary t cells, activated b cells, and plasma cells . It can play important roles in the acute phase of the immune response, hematopoietic regulation, and other processes . Recent studies also found that il-6 can stimulate the formation of myeloid, erythroid, megakaryocyte, and macrophage cloning, in combination with epo, il-3, and other hematopoietic cytokines . As il-6 has important functions in proliferation, differentiation, and maturation of early hsc, it is considered as a permissive factor of primitive hematopoiesis . Defective bone marrow stroma, or microenvironment, has been proposed as one of several mechanisms to account for bone marrow failure . This could involve defects in positive- or negative - acting hemopoietic regulator expression by stroma or alteration of normal stroma - stem cell interactions . As the permissive factor of primitive hematopoiesis, the role of il-6 in the bone marrow hematopoiesis disorder has been subject of intense attention in recent years . So far, the precise mechanism of il-6 in hematopoiesis regulation still remains largely unclear . In the present study, a mouse model of aplastic anemia was established by using cyclophosphamide in combination with chloramphenicol and co radiation . After modeling, the peripheral blood cells and bmc were significantly reduced and the apoptosis of bmc was obviously increased . Decreased hematogenous cells and increased fat cells in the bone marrow of the mouse model were easily observable with a microscope . Furthermore, the spleen shrank, the splenic sinus was enlarged, and the hemopoietic focus were evidently reduced . These results demonstrated that the bone marrow hematopoietic function was severely injured, and the mice model was successfully constructed . To investigate the level of il-6 secreted by bone marrow stromal cells from the mouse model of aplastic anemia, in the present study, in vitro cultivation of bone marrow stromal cells was employed, and the il-6 level was measured with elisa . The result showed that at the three time points (4th day, 7th day, and 10th day), the level of il-6 in cultured supernatants of bmsc from the anemia group was significantly higher than that of the normal group, which indicated that the il-6 secretion level may be enhanced to some extent by the induction of aplastic anemia caused by irradiation and chemotherapeutic drugs . As a cytokine with a wide range of biological activities, il-6 has very complex functions . It is a key component of the inflammatory mediator network, with an important role in the inflammatory response . As an anti - inflammatory cytokine however, il-6 is also a proinflammatory factor and, when overexpressed, can lead to a variety of diseases . Significantly elevated il-6 levels were detected in the serum of rheumatoid arthritis, diabetes, acute pancreatitis, hiv, and cancer patients [1316]. Herodin et al . Reported that in radiation - induced bone marrow depressed baboons, a substantial precocious and transient il-6 blood release was detected within hours after irradiation . The origin of the precocious transient il-6 peak observed just after irradiation was not clear . It was supposed that the increase of il-6 may be caused by a more precocious il-1 and/or tnf release . In a clinical experiment, fu et al . Found that the pretreatment level of il-6 in serum and bone marrow of 37 aplastic anemia patients were slightly higher than that of normal control, but there was no significant difference between the aplastic anemia group and the normal control group . Supposed that the change of il-6 level in aplastic anemia patients may be due to an association with inflammatory response, and il-6 may have an effect of immunoregulation and mediate induction in the destruction pathology of bone marrow cells, but the concrete mechanism still needs to be elucidated . In our study, we noticed that in the anemia group, with the increase of il-6 level, the proliferation of the bmsc was obviously impeded . This result indicated that high level of il-6 might be harmful to the proliferation of bone marrow stromal cells and might interfere with the stability of the bone marrow hematopoietic microenvironment . As the main component of the bone marrow hematopoietic microenvironment, bmsc adhere to hematopoietic stem cells, support and regulate the internal environment for the settling, differentiation, proliferation, and maturation of the primitive hematopoietic cells, and secrete a variety of cytokines to regulate hematopoiesis; therefore, defects of the bone marrow stromal cells can cause hematopoietic disorders of the bone marrow [19, 20]. The results of our study suggested that the il-6 secretion level may be enhanced to some extent by the induction of aplastic anemia caused by irradiation and chemotherapeutic drugs and that the abnormal level of il-6 might probably interfere with the stability of the bone marrow hematopoietic microenvironment . Currently, the role of il-6 in the regulation of hematopoiesis process and the specific mechanism remain unclear, so further investigations are needed.
Modern western society is obsessed with achievement, youth, and beauty . Since the latter half of the 20th century there has been an increasing focus on the body as a vehicle for identity and self expression, with a greater recognition of the role of appearance and the desire for self improvement . This contrasts with cultures where age is revered and elders are deferred to with respect . Well documented beauty practices date back as far as cleopatra s milk baths, the use of kohl to darken and enhance the eyes, vegetable dyes on cheeks and lips, and hair adornments . Historically, people have often undergone extreme discomfort and risk to conform to culturally prescribed modes of beauty including binding of the feet, ritual tattooing, and body scarification . A contributing factor to the 21st century obsession with beauty and perfection has been the significant development over the past two decades of the ways in which the body (particularly female) has been presented by the mass media and portrayed in advertising . The media is a significant force in convincing women, especially, that they are inadequate unless they package and present themselves in certain culturally sanctioned ways (ring 2000). This has promoted increasingly impossible standards of beauty, which have progressively become more unrealistic and unattainable . Although beauty practices have mainly been the domain of women, both sexes historically went to great lengths to beautify themselves . For example, in pre - revolution 18th century france, the parisian lady and her male counterpart both wore heavily powdered faces, painted lips, false hair and wigs, and high heeled shoes . Haiken (1997) has suggested that north american society became increasingly visual with heightened values attached to women s looks over the period since the second world war . The emergence of hollywood movie stars and the presence of fashion models in film, television, and the print media served to make ideal images accessible to greater numbers of people and to have a greater impact on the public consciousness . Appearance became a focal point for women and the pursuit of beauty was worth the time, money, and in some instances, the pain . Throughout the latter part of the 20th century, advances in medicine and nutrition, combined with an increasing awareness of individual healthcare, have enabled people to live longer, healthier, and more productive and active lives . As the population ages, more people are seeking ways of enhancing their appearance for personal and professional reasons . Beauty and youth are becoming significant determinants of economic security, and to appear well groomed and confident, and remain viable in the workplace, middle aged women, especially, began seeing the growing speciality of cosmetic surgery as a solution to the tyranny of middle age . A 1958 study (edgerton et al), found the typical facelift patient to be a married, upper - middle class, socially active woman who was grateful for and enthusiastic about their enhanced appearance . The preoccupation with appearance extends across the life span with each stage creating distinct psychological reactions to the body (goin and goin 1981). However, the loss of youth and the onset of middle age (between 40 and 60 years) are significant because of negative stereotypes and myths associated with aging, and the critical psychosocial realities of this growing group . Life roles alter with age through events such as the death of parents or partners, disruption of relationships due to ill - health, children leaving the family home, and loss of vocational status . For women, the physiological signs of aging have been further perceived as being symptomatic of the loss of femininity, sexual identity, social power, and social visibility (featherstone 1995). All these factors serve to enhance dissatisfaction with looking old, and increase a desire to try to look younger . As people age, their concerns about their appearance increasingly focuses on the face . For example, goodman (1994) interviewed 24 women, 12 of whom had undergone cosmetic surgery, and 12 of whom had not . The younger women were mostly concerned about the shape and appearance of their bodies, whilst the older women were preoccupied with their faces . In particular, the older women disliked wrinkles and drooping skin, and had undergone facelifts, chemical peels, and chin tucks . Intrinsic aging processes include loss of skin elasticity and collagen, along with fat atrophy . Extrinsic factors, notably solar radiation, damage the dermis, with affects on collagen and elastic fibres (demas and braun 2001). Other factors that can contribute to an aged appearance to the face include general poor health, an unhealthy diet, cigarette smoking, and alcohol . Demas and braun (2001) outline the signs of the aging face: a lined forehead;drooping brows, with a hooded appearance to the lateral upper lid;loss of check roundedness and deep nasolabial folds secondary to loss of subcutaneous fat;sagging neck lines consequent upon loss of platysma muscle tone;loss of chin definition, from submental fat deposition;drooping of the nasal tissues; andwrinkling of the skin around the mouth, with thinning of the lips . Drooping brows, with a hooded appearance to the lateral upper lid; loss of check roundedness and deep nasolabial folds secondary to loss of subcutaneous fat; sagging neck lines consequent upon loss of platysma muscle tone; loss of chin definition, from submental fat deposition; drooping of the nasal tissues; and wrinkling of the skin around the mouth, with thinning of the lips . The aged appearance can be emphasized by other skin damage, such as melanocytic pigmentation, as well as hair loss . These physical signs of facial aging are perceived by some people as a threat to self - continuity and are reacted to like a disease to be deplored and eradicated (poole and feldman 1999). Rather than being regarded as a completely natural time - ordered and predictable part of life, aging is increasingly represented as a pathological condition in need of correction or repair; a disease, which modern medicine must combat . Increased demand for aesthetic or cosmetic surgery (over the past 20 years) has been reflected in the changing attitudes to youth and beauty . According to the american society of plastic surgeons, more than 8.7 million people underwent cosmetic surgery in 2003, an increase of 33% from the year before, and a massive increase of 1698% since 1992 (asps 2004). In australia, accurate statistics for cosmetic / aesthetic procedures are not available as there is no centralized statistical authority or statutory data collection requirements . However, based on estimates of 350 surgeons, the new south wales (nsw) cosmetic surgery inquiry into cosmetic surgery (hccc 1999) established that the local industry had doubled over the 5 years preceding 1998 with approximately 52 000 surgical procedures and 250 000 cosmetic medical procedures performed in 1998 alone . This rate of growth is regarded comparable per capita with that of the us, with aesthetic surgery now one of the most popular strategies available in australia to achieve and maintain a socially acceptable appearance (ring 2000). The motivations for individuals undergoing surgery to try to reinstate a youthful appearance are complex . Figueroa (2003) emphasizes the role of self - esteem, and how a poor body image impacts upon self esteem . In particular, she points to one of the motivations for cosmetic surgery being a perceived inability to carry out a public role as a driving force for cosmetic procedures . This motivation is obvious in people such as actors, but is also impacting on competitiveness for other jobs . In particular, males, often executives, are increasingly likely to opt for cosmetic procedures to make them look younger, in the belief that this will enhance their job prospects . According to the british association of aesthetic plastic surgeons, males now account for some 10% of cosmetic surgery clientele, compared with 5% five years ago . The most popular procedure for men, who typically present in their 50s, is eyelid surgery or a brow lift . Allen (2003) considers that aesthetic surgery is one component of the evolving field of antiaging medicine that has been designed as the application of knowledge that delays the physical and mental deterioration associated with senescence to the end of life . In this antiaging context, aesthetic surgery has been referred to as rejuvenative and is performed mostly on the face to modify the signs of aging for those who wish to have their appearance restored to what it was previously . Such surgery may be carried out to try to avoid the negative stereotyping of aging . This contrasts with transformative surgery designed to change features, such as refining a large nose, and is more commonly done in the younger years . Some specific procedures are age - related such as liposuction, eyelid rejuvenation, facelifts, browlifts, chemical peels, dermabrasion, and laser resurfacing, which were selected by patients between the ages of 40 and 60 years (demas and braun 2001). According to mendelson (1992), significant improvements in facial rejuvenative surgery based on the correction of anatomical layers supporting facial features instead of a nip and tuck, have had a major impact on outcome quality and have contributed to the increasing numbers of patients seeking surgery . In australia, the nsw inquiry into cosmetic surgery (hccc 1999) has estimated that women aged between 45 and 59 years, who underwent mostly rejuvenative surgery, comprised 32.1% (the largest proportion) of all cosmetic surgery procedures surveyed for the study . Advanced techniques that promise less invasive procedures and a swifter recovery make surgery seem less frightening, especially for first time patients . It has been mooted by some researchers in the field that the preoccupation with appearance and the human body is partly due to these rapid technological advances (jefferson 1976). According to ringel (1998), biotechnological advances in such areas as laser surgery (which has shed its science fiction image and become a significant tool against aging skin [greely 2000]), chemical peels, and liposuction have made it possible to erase signs of aging that previously were considered indelible . According to the american academy of cosmetic surgery, nearly 170 000 men and women underwent laser resurfacing of the face in 1998, up from 138 800 in 1996 (a 64% increase) (aacs 2005). Laser resurfacing is considered effective because superficial layers of facial skin are vaporized, removing wrinkles and lines, and leaving new skin to grow . Other forms of facial rejuvenation include injectibles such as collagen (to remove lines around the mouth), and restalayne and hyalaform (to help plump out wrinkles and give lips a fuller look). Botox is an increasingly common therapy, which is the injection of a muscle paralysing toxin that blocks impulses from nerves to muscles related to expression lines and effectively flattens out frown lines around the mouth and eyes . Estimated expenditure in the us in 2004 on botox was $1125 220 232 . Also popular is fat transfer, where fat harvested from the abdomen or thighs is injected into the face to augment subcutaneous tissue of the face . The ostensible objective of aesthetic surgery is to improve the patient s psychological well - being by modifying their body image . Body image is the mental picture individuals have in their mind s eye of how they appear to others . This perception is influenced by each individual s beliefs and attitudes and is shaped by developmental, perceptual, and socio - cultural influences (sarwer et al 1998). An understanding of body image and its perturbations is of profound importance to plastic and aesthetic surgeons, because without a clear understanding of the patient s body image and physical concerns, it may prove impossible to understand the motivations, fears, and expectations of the patient undergoing aesthetic surgery . It changes in response to lifestyle events and situational factors including puberty, pregnancy, disability, illness, surgery, menopause, and aging (whq 2000). Body image has become a significant factor in the request for aesthetic surgery and this is reinforced by several review articles that have investigated psychological issues in aesthetic and plastic surgery (pruzinsky 1993; sarwer et al 1998; hasan 2000; honigman et al 2004). Researchers in this field have recently deviated from the historical framework of looking for psychopathology in aesthetic surgery patients as a basis for understanding their motivation for cosmetic interventions, and have acknowledged the relevance of the individual s body image as a more appropriate starting point for understanding the motivations for requests for aesthetic surgery . The literature on body image in the elderly suggests that appearance is a motivating factor for surgery, and body image as a determinant of psychological well - being . Fooken (1994) found that body image was a greater significance in the development and maintenance of sexual interest in the elderly than was physical health . This study validates the observations of goin and goin (1981), pruzinsky (1993) and sarwer et al (1998), who concur in the view that it is body image which is ultimately linked to appearance and is a significant motivator throughout one s life . The anticipated outcome of cosmetic procedures for the aging face is to improve the patient s emotional and psychological well - being through attempting to negate the physical effects of aging by enhancing appearance . The psychological aspects of cosmetic surgical procedures for the aging face such as facelifts have been explored by various researchers over the past 30 years (webb et al 1965; goin et al 1976, 1980; goin and goin 1981). An early study by edgerton et al (1964) specifically addressed facelift procedures for the aging face and found a mean sample age of women aged 48 years reported high rates of satisfaction and improved well - being (86%). In their study of 50 female facelift patients, goin et al (1980) found that postoperative depression was common following surgery, but only in patients with pre - existing clinically diagnosed depression . However, goin and colleagues did not follow patients beyond 6 months postsurgery, so long - term outcomes are unknown . Interestingly, the same study found that patients who desired an improved self - image pre - operatively had a greater possibility of experiencing postoperative psychological improvement . In a review of 37 studies honigman et al (2004) looked at psychological and psychosocial outcomes following varying cosmetic procedures, concluding that most people appeared satisfied with the outcomes (see below). Patients seeking surgery for the aging face do so for many reasons and researchers have suggested there are two major categories of motivation for surgery: internal and external (grossbart and sarwer 1999). Internally motivated patients are generally more committed to physical change and are therefore better patients, who were usually more satisfied with the outcome . Externally motivated patients are hoping to change not only their bodies, but also their lives, often to please others, and are often dissatisfied with the outcome if their lives do not change as imagined following surgery . Other factors which risk unsatisfactory outcomes include: postoperative infection; the procedure going wrong with a need for further surgery; psychosocial risks such as the timing of the surgery (a recent concern with appearance may suggest a crisis situation rather than a considered approach to surgery); realistic expectations of postoperative physical and psychosocial appearance; adequate physical and emotional family support during the postoperative period; a good relationship with the medical and nursing team; and relatively good physical health . When considering the aging person s request for cosmetic enhancement, it is as well to bear in mind the factors that seem to predict a good or poor psychosocial outcome from such procedures in general . In a review of the world literature, honigman et al (2004) found that predictors across all ages of a poor outcome in psychosocial terms (ie, psychological parameters such as self - esteem, social confidence, and social outcomes such as relationships and work) included: being male: perhaps males have a higher threshold for seeking cosmetic interventions, and are thus more severely affected by the time they actually undergo the procedure;being young: older people had a better outcome, in general, but this might have been confounded by the fact that a number of the larger studies included in the review were of older individuals specifically seeking antiaging procedures for the face;being motivated by the desire to please someone else: for example, to try to save a relationship, or because your partner wants you to have the procedure;underlying psychiatric problems such as depression or personality disorder;unrealistic expectations of surgery, both in terms of what could actually be achieved physically, and in terms of what impact the cosmetic change would have on life in general: for example, those seeing it as a panacea for all their life problems;having a minimal deformity, such that to the objective viewer there is nothing or very little physically wrong: some people with an excessive concern with a slight or objectively absent physical deformity have a psychiatric disorder called body dysmorphic disorder (bdd), which requires specific psychiatric and psychological treatment . Bdd is not particularly a late life disorder, usually having an onset in youth, but it can persist into old age . A full review of bdd is beyond the scope of this article, but the interested reader is referred to phillips and castle (2002);people who have had multiple previous cosmetic procedures with which they are unhappy . Being male: perhaps males have a higher threshold for seeking cosmetic interventions, and are thus more severely affected by the time they actually undergo the procedure; being young: older people had a better outcome, in general, but this might have been confounded by the fact that a number of the larger studies included in the review were of older individuals specifically seeking antiaging procedures for the face; being motivated by the desire to please someone else: for example, to try to save a relationship, or because your partner wants you to have the procedure; underlying psychiatric problems such as depression or personality disorder; unrealistic expectations of surgery, both in terms of what could actually be achieved physically, and in terms of what impact the cosmetic change would have on life in general: for example, those seeing it as a panacea for all their life problems; having a minimal deformity, such that to the objective viewer there is nothing or very little physically wrong: some people with an excessive concern with a slight or objectively absent physical deformity have a psychiatric disorder called body dysmorphic disorder (bdd), which requires specific psychiatric and psychological treatment . Bdd is not particularly a late life disorder, usually having an onset in youth, but it can persist into old age . A full review of bdd is beyond the scope of this article, but the interested reader is referred to phillips and castle (2002); people who have had multiple previous cosmetic procedures with which they are unhappy . It is difficult to extrapolate from these findings specifically to an aging population of people seeking cosmetic enhancement, but there is no reason to suspect that these factors are any less important in that group . Indeed, some risk factors may be particularly associated with older age, eg, relationship issues and depression . Such parameters need to be screened for in people seeking cosmetic enhancement . In the elderly, particular attention should be paid to why they are seeking the procedure at that time, and what their expectations are for the procedure (eg, have they recently been bereaved, and believe that the cosmetic procedure will help them find another partner?). The massive growth of the looks industry in recent years has not passed by the aging population . Indeed, much advertising and social pressure is specifically aimed at trying to get people to pay money to stop themselves from looking old . We need to try to ensure that the pressures on the elderly to look young do not create unrealistic expectations and lead to older people spending significant proportions of their savings on procedures that cannot turn back time.
Cataract is considered as a major cause of visual impairment in diabetic patients, as the incidence and progression of cataract is increasingly elevated in patients with diabetes mellitus . Recently, cataract surgery is an effective and the most common surgical ophthalmic procedure worldwide . However, the elucidation of pathomechanisms to delay or prevent the development of cataract in diabetic patients remains a challenge . Both diabetes and cataract pose an enormous health and economic burden, particularly in developing countries, where diabetes treatment is insufficient and cataract surgery often inaccessible . The transparency and stability of the eye lens the crystallins comprise 80%-90% of the soluble lens protein mass and are divided into three basic types termed,, and . Crystallin proteins located in the central and equatorial regions of the lens are normally stable and do not turnover, since these cells lose their nuclei during the developmental transition from epithelial to fiber cells . It was previously reported that the development of diabetes cataract should be associated with polyol pathway, osmotic stress caused by sorbitol accumulation, and free radical . However, few researches reported differential proteomic analysis of proteins from diabetic cataractous human lenses . In this study, crystallin proteins in the diabetic and age - related cataractous lenses were extracted and compared with those of normal subjects, using two - dimensional electrophoresis (2-de), maldi - tof - mass spectrometry (ms), and enzyme - linked immunosorbent assay (elisa) analysis . This was carried out to gain further insight into the significant observation of differences of age - related and diabetic cataract . The lenses were obtained from 20 age - related cataract patients (n = 20, 65.5 6.7 years), 20 type i diabetic cataract patients (n = 20, 35.5 7.5 years) and five normal controls (donated for corneal transplant in accordance with the standardized rules for development and applications of organ transplants and obtained from the eye bank of shanghai, china . ). The cataractous lenses were carefully examined by ophthalmologists prior to surgical removal and were all detected with nuclear cataract . Lenses of age - related and diabetic cataract were detected with grade iii and grade ii of nuclear cataract, respectively . The prestained and unstained molecular weight protein markers were from invitrogen (carlsbad, ca, usa) and amersham biosciences (piscataway, nj, usa), respectively . All chemicals for two - dimensional (2d) gel electrophoresis were from either amersham biosciences or bio rad (hercules, ca, usa). Louis, mo, usa) or fisher (atlanta, ga, usa). Monoclonal antibodies against beta - crystallin a3, alpha - crystallin b chain, and beta - crystallin b1 were purchased from sigma . Phacoemulsification was used to remove cortical region and was followed by irrigation and aspiration to remove the nuclear region . The recovered lenses should contain 10% of the original cortex and 90% of the nucleus . All samples were collected and stored at -80c before use . Each lens sample (20 mg) was mixed with 1 ml phosphate buffered saline (20 mm, ph 7.2), disrupted by sonication, and then centrifuged at 10,000 g for 30 min at 4c . To deplete high content of hyaluronic, which could severely interfere the 2-de process, the supernatant was collected and incubated with 25% prechilled trifluoroacetic acid at 4c for 2 h. the result solution was then centrifuged at 10,000 g for 10 min at 4c . The pellet was washed with prechilled acetone for three times and centrifuged at 10,000 g for 10 min at 4c and then dried in vacuum . Then the resulting pellets were dissolved in resolubilization buffer (5 m urea, 2 m thiourea, 2% 3-[(3-cholamidoproyl)-dimethyl - ammonio-1-propane sulfonate] (chaps), 2% caprylyl sulfobetaine 3 - 10,2 mm tri - butyl phosphine, 40 mm tris, ph 8.0) and incubated with immobiline dry strips (ph range of 3 - 10, amersham biosciences) overnight at 25c . Each preparation was subjected to 2d gel electrophoresis (ief in the first dimension followed by sds - page in the second dimension) by exactly following the manufacturer's handbook (amersham biosciences). Following the ief separation, the second dimension sds - page was performed with the laemmli method using a 15% polyacrylamide gel of 16 14 cm (width height). After the first dimensional ief separation, the strips were consecutively treated for 15 min each, first with 100 mm dithiothreitol (in equilibration buffer: 0.1 m tris, ph 6.8, containing 6 m urea, 30% glycerol, and 1% sds), and next with 300 mm iodoacetamide (also dissolved in the equilibration buffer). 25 g trypsin was dissolved in 2.5 ml tosylphenylalanylchloromethane mixed with 250 l of 0.1% redistilled acetonitrile . A 15 l sample of this trypsin solution was activated in 100 l 50 mm nh4hco3 . After washed with dh2o for two times, the gel spots were then washed with 200 l of 25 mm ammonium bicarbonate for three times, followed by dehydrated with acn . After dried down in a vacuum centrifuge, the gel - pieces were incubated in the activated trypsin solution for 16 h at 37c . The resulting peptides were extracted three times by 20 ml aliquots of 5% tfa in 50% acn . Maldi - tof - ms analysis was performed using autoflex maldi - tof - ms (bruker, germany). The resulting peptides were dissolved in 0.5% tfa and 5% acn and mixed with matrix (saturated sinapinic acid in acetoritrile / h2o, containing 0.1% tfa, 1:1, v / v) to promote desorption and ionisation . An n2 laser at 337 nm was used to desorb the solute molecules from the sample disc and a voltage of 20 kv were established in the source region . The results were subsequently investigated with the matrix science web site (http://www.matrixscience.com/) using mascot searchpeptide mass fingerprint to search for homologous proteins in the ncbinr (national center for biotechnology information nonredundant) database with the taxonomy set to to detect the concentrations of beta - crystallin a3, alpha - crystallin b chain, and beta - crystallin b1 in the soluble protein samples from lenses of normal control, diabetic, and age - related cataract patients, the extracted proteins were applied to elisa analysis according to the method previously reported . Monoclonal antibodies were first fixed into the plates and reacted with extracted lens proteins and then hrp - antibodies . Finally, the mixtures were reacted with tetramethylbenzidine substrate, after termination with 2 m h2so4, od450 nm was detected for each well using a microtiter plate reader within 30 min . The lenses were obtained from 20 age - related cataract patients (n = 20, 65.5 6.7 years), 20 type i diabetic cataract patients (n = 20, 35.5 7.5 years) and five normal controls (donated for corneal transplant in accordance with the standardized rules for development and applications of organ transplants and obtained from the eye bank of shanghai, china . ). The cataractous lenses were carefully examined by ophthalmologists prior to surgical removal and were all detected with nuclear cataract . Lenses of age - related and diabetic cataract were detected with grade iii and grade ii of nuclear cataract, respectively . The prestained and unstained molecular weight protein markers were from invitrogen (carlsbad, ca, usa) and amersham biosciences (piscataway, nj, usa), respectively . All chemicals for two - dimensional (2d) gel electrophoresis were from either amersham biosciences or bio rad (hercules, ca, usa). Louis, mo, usa) or fisher (atlanta, ga, usa). Monoclonal antibodies against beta - crystallin a3, alpha - crystallin b chain, and beta - crystallin b1 were purchased from sigma . Phacoemulsification was used to remove cortical region and was followed by irrigation and aspiration to remove the nuclear region . The recovered lenses should contain 10% of the original cortex and 90% of the nucleus . All samples were collected and stored at -80c before use . Each lens sample (20 mg) was mixed with 1 ml phosphate buffered saline (20 mm, ph 7.2), disrupted by sonication, and then centrifuged at 10,000 g for 30 min at 4c . To deplete high content of hyaluronic, which could severely interfere the 2-de process, the supernatant was collected and incubated with 25% prechilled trifluoroacetic acid at 4c for 2 h. the result solution was then centrifuged at 10,000 g for 10 min at 4c . The pellet was washed with prechilled acetone for three times and centrifuged at 10,000 g for 10 min at 4c and then dried in vacuum . Then the resulting pellets were dissolved in resolubilization buffer (5 m urea, 2 m thiourea, 2% 3-[(3-cholamidoproyl)-dimethyl - ammonio-1-propane sulfonate] (chaps), 2% caprylyl sulfobetaine 3 - 10,2 mm tri - butyl phosphine, 40 mm tris, ph 8.0) and incubated with immobiline dry strips (ph range of 3 - 10, amersham biosciences) overnight at 25c . Each preparation was subjected to 2d gel electrophoresis (ief in the first dimension followed by sds - page in the second dimension) by exactly following the manufacturer's handbook (amersham biosciences). Following the ief separation, the second dimension sds - page was performed with the laemmli method using a 15% polyacrylamide gel of 16 14 cm (width height). After the first dimensional ief separation, the strips were consecutively treated for 15 min each, first with 100 mm dithiothreitol (in equilibration buffer: 0.1 m tris, ph 6.8, containing 6 m urea, 30% glycerol, and 1% sds), and next with 300 mm iodoacetamide (also dissolved in the equilibration buffer). 25 g trypsin was dissolved in 2.5 ml tosylphenylalanylchloromethane mixed with 250 l of 0.1% redistilled acetonitrile . A 15 l sample of this trypsin solution was activated in 100 l 50 mm nh4hco3 . After washed with dh2o for two times, the gel spots were then washed with 200 l of 25 mm ammonium bicarbonate for three times, followed by dehydrated with acn . After dried down in a vacuum centrifuge, the gel - pieces were incubated in the activated trypsin solution for 16 h at 37c . The resulting peptides were extracted three times by 20 ml aliquots of 5% tfa in 50% acn . Maldi - tof - ms analysis was performed using autoflex maldi - tof - ms (bruker, germany). The resulting peptides were dissolved in 0.5% tfa and 5% acn and mixed with matrix (saturated sinapinic acid in acetoritrile / h2o, containing 0.1% tfa, 1:1, v / v) to promote desorption and ionisation . An n2 laser at 337 nm was used to desorb the solute molecules from the sample disc and a voltage of 20 kv were established in the source region . The results were subsequently investigated with the matrix science web site (http://www.matrixscience.com/) using mascot searchpeptide mass fingerprint to search for homologous proteins in the ncbinr (national center for biotechnology information nonredundant) database with the taxonomy set to to detect the concentrations of beta - crystallin a3, alpha - crystallin b chain, and beta - crystallin b1 in the soluble protein samples from lenses of normal control, diabetic, and age - related cataract patients, the extracted proteins were applied to elisa analysis according to the method previously reported . Monoclonal antibodies were first fixed into the plates and reacted with extracted lens proteins and then hrp - antibodies . Finally, the mixtures were reacted with tetramethylbenzidine substrate, after termination with 2 m h2so4, od450 nm was detected for each well using a microtiter plate reader within 30 min . The soluble proteins extracted from the lenses of age - related cataract patients, type i diabetic cataract patients, and normal controls were subjected to 2-de analysis . The 2-de gels [figure 1] showed that most of the soluble proteins of control, diabetic cataract, and age - related cataract lenses were located in the section of ph 5 - 9 with the relative molecular weight at 14,000 - 97,000 da, while relative molecular weights of more abundant crystallines were localized at 20,000 - 31,000 da . Two - dimensional electrophoresis analysis of soluble proteins extracted from normal control, age - related cataractous, and diabetic cataractous lens . Five protein spots with significantly differential concentrations were pointed with arrows and then recovered and subjected to mass spectrometry analysis in control, diabetic cataract and age - related cataract groups, 73, 76, and 68 protein spots were detected, respectively . A total of five significant differential protein spots were selected by the pdquest software [figure 1]. The 2-de analysis revealed that the type i diabetic cataract lenses contained the highest concentrations of proteins in spot 1, 2, 3, and 4, while control lenses contained the lowest contents of these proteins . Additionally, age - related cataract lenses were detected with the highest concentration of the protein in spot 5 . A total of five selected protein spots were extracted from the gels, hydrolyzed with trypsin, and applied to ms analysis . The resulting ms data were investigated with the matrix science online service to search for homologous proteins . Peptides of five crystallin and related proteins were detected: the protein in spot 1 was hydrolyzed into 16 peptides and 7 peptides were identical with segments of beta - crystallin a3, with the matched sequence coverage at 40% [figure 2]; the protein in spot 2 was hydrolyzed into 26 peptides, and 6 ones were identical with segments of alpha - crystallin b chain, with the matched sequence coverage at 45% [figure 3]; the protein in spot 3 was hydrolyzed into 10 peptides, and 7 ones were identical with segments of chain a, crystal structure of truncated human beta - b1-crystallin, with the matched sequence coverage at 49% [figure 4]; the protein in spot 4 was hydrolyzed into 25 peptides, and 6 ones were identical with segments of beta - crystallin b1, with the matched sequence coverage at 34% [figure 5]; and the protein in spot 5 was hydrolyzed into 11 peptides, and 5 ones were identical with segments of an interesting unnamed protein product, which is highly similar to alpha - crystallin b chain, containing an alpha - crystallin a chain region at n terminal, and an alpha - crystallin - hsps_p23-like domain, the matched sequence coverage was 49% [figure 6]. Mass spectrometry analysis of spot 1 the protein extracted from spot 1 was digested with trypsin and 16 peptides were detected . The protein was then identified as gi\|12056461, beta - crystallin a3 with seven matched peptides mass spectrometry analysis of spot 2 the protein extracted from spot 2 was digested with trypsin and 26 peptides were detected . The protein was then identified as gi\|4503057, alpha - crystallin b chain with six matched peptides mass spectrometry analysis of spot 3 the protein extracted from spot 3 was digested with trypsin and 10 peptides were detected . The protein was then identified as gi\|42543230, crystal structure of truncated human beta - b1-crystallin with seven matched peptides mass spectrometry analysis of spot 4 the protein extracted from spot 4 was digested with trypsin and 25 peptides were detected . The protein was then identified as gi\|4503061 beta - crystallin b1 with six matched peptides mass spectrometry analysis of spot 5 the protein extracted from spot 5 was digested with trypsin and 11 peptides were detected . The protein was then identified as gi\|194380530, unnamed protein product with five matched peptides in elisa analysis, the concentrations of beta - crystallin a3, alpha - crystallin b chain, and alpha - crystallin chain a in the three protein samples from lenses of control, diabetic, and age - related cataract patients were determined . The results revealed that type i diabetic cataract lenses contained much more beta - crystallin a3, alpha - crystallin b chain, and beta - crystallin b1 than the other two groups; additionally, the concentrations of the three proteins in age - related cataract lenses were detected as a little higher than those of control subjects [figure 7]. Enzyme - linked immunosorbent assay analysis the protein concentrations of beta - crystallin a3, alpha - crystallin b chain, and beta - crystallin b1 were determined in lenses of normal control, type i diabetic cataract and age - related cataract patients the soluble proteins extracted from the lenses of age - related cataract patients, type i diabetic cataract patients, and normal controls were subjected to 2-de analysis . The 2-de gels [figure 1] showed that most of the soluble proteins of control, diabetic cataract, and age - related cataract lenses were located in the section of ph 5 - 9 with the relative molecular weight at 14,000 - 97,000 da, while relative molecular weights of more abundant crystallines were localized at 20,000 - 31,000 da . Two - dimensional electrophoresis analysis of soluble proteins extracted from normal control, age - related cataractous, and diabetic cataractous lens . Five protein spots with significantly differential concentrations were pointed with arrows and then recovered and subjected to mass spectrometry analysis in control, diabetic cataract and age - related cataract groups, 73, 76, and 68 protein spots were detected, respectively . A total of five significant differential protein spots were selected by the pdquest software [figure 1]. The 2-de analysis revealed that the type i diabetic cataract lenses contained the highest concentrations of proteins in spot 1, 2, 3, and 4, while control lenses contained the lowest contents of these proteins . Additionally, age - related cataract lenses were detected with the highest concentration of the protein in spot 5 . A total of five selected protein spots were extracted from the gels, hydrolyzed with trypsin, and applied to ms analysis . The resulting ms data were investigated with the matrix science online service to search for homologous proteins . Peptides of five crystallin and related proteins were detected: the protein in spot 1 was hydrolyzed into 16 peptides and 7 peptides were identical with segments of beta - crystallin a3, with the matched sequence coverage at 40% [figure 2]; the protein in spot 2 was hydrolyzed into 26 peptides, and 6 ones were identical with segments of alpha - crystallin b chain, with the matched sequence coverage at 45% [figure 3]; the protein in spot 3 was hydrolyzed into 10 peptides, and 7 ones were identical with segments of chain a, crystal structure of truncated human beta - b1-crystallin, with the matched sequence coverage at 49% [figure 4]; the protein in spot 4 was hydrolyzed into 25 peptides, and 6 ones were identical with segments of beta - crystallin b1, with the matched sequence coverage at 34% [figure 5]; and the protein in spot 5 was hydrolyzed into 11 peptides, and 5 ones were identical with segments of an interesting unnamed protein product, which is highly similar to alpha - crystallin b chain, containing an alpha - crystallin a chain region at n terminal, and an alpha - crystallin - hsps_p23-like domain, the matched sequence coverage was 49% [figure 6]. Mass spectrometry analysis of spot 1 the protein extracted from spot 1 was digested with trypsin and 16 peptides were detected . The protein was then identified as gi\|12056461, beta - crystallin a3 with seven matched peptides mass spectrometry analysis of spot 2 the protein extracted from spot 2 was digested with trypsin and 26 peptides were detected . The protein was then identified as gi\|4503057, alpha - crystallin b chain with six matched peptides mass spectrometry analysis of spot 3 the protein extracted from spot 3 was digested with trypsin and 10 peptides were detected . The protein was then identified as gi\|42543230, crystal structure of truncated human beta - b1-crystallin with seven matched peptides mass spectrometry analysis of spot 4 the protein extracted from spot 4 was digested with trypsin and 25 peptides were detected . The protein was then identified as gi\|4503061 beta - crystallin b1 with six matched peptides mass spectrometry analysis of spot 5 the protein extracted from spot 5 was digested with trypsin and 11 peptides were detected . In elisa analysis, the concentrations of beta - crystallin a3, alpha - crystallin b chain, and alpha - crystallin chain a in the three protein samples from lenses of control, diabetic, and age - related cataract patients were determined . The results revealed that type i diabetic cataract lenses contained much more beta - crystallin a3, alpha - crystallin b chain, and beta - crystallin b1 than the other two groups; additionally, the concentrations of the three proteins in age - related cataract lenses were detected as a little higher than those of control subjects [figure 7]. Enzyme - linked immunosorbent assay analysis the protein concentrations of beta - crystallin a3, alpha - crystallin b chain, and beta - crystallin b1 were determined in lenses of normal control, type i diabetic cataract and age - related cataract patients diabetes is a known risk factor for cataract formation . In view of the prevailing and predicted outbreak of diabetes in developing countries like india, diabetic cataract may become a leading cause of blindness, along with age - related cataract . In the present study, we comparatively analyzed the separated protein spots on 2-de gels of normal control, age - related, and diabetic cataract lenses . No distinction was made in this study regarding changes between the cortical and nuclear regions of these lenses . In 2-de and ms analysis, five significantly differential protein spots were detected, including beta - crystallin a3, alpha - crystallin b chain, chain a of crystal structure of truncated human beta - b1-crystallin, beta - crystallin b1, and an unnamed protein product . The gels revealed that type i diabetic cataract lenses should contain much more beta - crystallin a3, alpha - crystallin b chain, chain a, crystal structure of truncated human beta - b1-crystallin and beta - crystallin b1 than the other two groups . And in elisa analysis, type i diabetic cataract lenses were also proved to contain more contents of beta - crystallin a3, alpha - crystallin b chain, and beta - crystallin b1 than age - related cataract and control lenses [figure 7]. It was interesting that a significant protein spot was detected in age - related cataract lenses; it was not entitled and could only be identified from a cdna sequence cloned from human hippocampus . It was highly similar to alpha - crystallin b chain, containing an alpha crystallin a chain region at n terminal, and an alpha - crystallin - hsps_p23-like domain, seldom mentioned in cataract, and its role and principle in cataract were still unclear . However, this protein might be helpful in the further research on the mechanism of age - related cataract . As previously reported, beta - crystallin oligomers were suggested to play a critical role in maintenance of lens transparency; and the truncation of beta - b1-crystallin was associated with its structure and stability . And diabetic may enhance nh2 - and cooh - terminal extensions of beta - b1-crystalline, which could accelerate lens opacity and oligomer formation . In our study, higher contents of beta - b1-crystalline and truncated human beta - b1-crystallin were determined in diabetic cataract lenses, and it was consistent with early reports . Alpha - crystallin was reported to constitute the major portion of eye lens cytoplasm and its concentration in the lens could reach up to 50% of the total proteins; it displayed chaperone - like activity in suppressing the aggregation of various proteins and in preventing inactivation of enzymes due to heat and other stress conditions . Alpha - crystallin, especially alpha - crystallin b, was also known to undergo extensive posttranslational modifications including oxidation, mixed disulfide formation, truncation, and glycation during aging, and was believed to be the key structural and functional element for maintaining the transparency of the lens . Furthermore, it was known that the chaperone activity of -crystallin is compromised in various types of cataract, including diabetic cataract . It was reported that alpha - crystallin from diabetic rat and human lenses had shown a substantial loss in their chaperone function, in addition, -crystallin chaperone activity was also found to be impaired in galactosemic rat lenses . Owing to the loss of its chaperone function, more alpha - crystallin should be expressed by the surround cells and tissues; therefore, in this research, significantly higher alpha - crystallin b chain concentration could be detected in type i diabetic lenses . Additionally, the contents of beta - crystallin a3 and was also studied in age - related cataracts lenses . In this study, proteins extracted from control, type i diabetic, and age - related cataracts lenses were applied to 2-de, ms, and elisa analysis . Type i diabetic cataract lenses should contain the highest contents of beta - crystallin a3, alpha - crystallin b chain, beta - crystallin b1, and chain a of crystal structure of truncated human beta - b1-crystallin . Compared with control subjects, age - related cataracts lenses revealed slightly higher concentrations of the four proteins above; additionally, gi\|194380530, an unnamed crystalline - like protein was also detected in this group with significantly higher content . Furthermore, the identification of these differential proteins could help to diagnose the certain types and grades of nuclear cataract in clinical research and treatment, and could also bring benefits in the further research on the principle of cataract . The lens samples could only be extracted and studied through surgery after cataract was formed and detected; therefore, to reveal the pathogenesis in the early stage of cataract, more attention could be devoted to gene research . To monitor the expression levels of the genes for these differential proteins
A total of 1,217 dead birds were shipped at 4c to the tropical medicine institute " pedro kouri " and identified by ornithology experts . Brain, heart, and kidneys were removed and tested for wnv by using reverse transcription polymerase chain reaction (rt - pcr) (12). Briefly, rna was extracted by using the qiamp viral rna kit (qiagen, inc ., valencia, ca, usa). Primers wn212 (5-ttgtgttggctctcttggcgttctt-3) and wn619c (5-cagccgacagcactggacattcata-3) were used to detect viral rna . A second rt - pcr with primers wn9483 (5-cacctacgccctaaacactttcacc-3) and wn9794 (5-ggaacctgctgccaatcataccatc-3) was performed on the same rna preparation . Serum specimens from horses in havana and havana province were tested for antibodies to wnv by using a competitive enzyme - linked immunosorbent assay (elisa) with monoclonal antibodies 3.1112 g and 6b6c-1 as described by blitvich et al . We tested 210 serum specimens from horses collected as part of an infectious anemia study . The immunoglobulin m (igm) test was not performed because horses were never suspected of having wnv and did not have any history of suspected viral encephalitis or other illness or symptoms . An inhibition value> 30% was used as the diagnostic criterion to identify flavivirus antibody (table 1). * wnv, west nile virus; elisa, enzyme - linked immunosorbent assay; prnt, plaque reduction neutralization test; slev, saint louis encephalitis virus . The cuban health ministry and medical services division conducted surveillance for encephalitis of unknown origin in patients> 30 years of age . Serum and cerebrospinal fluid specimens were shipped at 4c to the tropical medicine institute " pedro kouri . " Human sera were screened for wnv igm and igg by using commercial igm and igg elisa kits (focus technologies, cypress, ca, usa) according to manufacturer's instructions . Hemagglutination - inhibition (hi) tests were also undertaken with wnv and saint louis encephalitis virus (slev) antigen (14). Reactive serum samples were further tested by a plaque reduction neutralization test (prnt) with wnv (ny99, ontario, canada, 2001 isolate), slev (parton strain, american type culture collection catalog no . Vr-1265), and dengue virus (dengue 2, ng - c strain). Prnt was performed to confirm wnv - specific antibody and was carried out as described previously (15) by using a neutral red double - overlay procedure . Horses or human patients were considered seropositive for a particular flavivirus if the 90% prnt titer for that virus was> 4-fold greater than the neutralization titers determined for other viruses used in the assay . Endpoint titrations were defined as the highest dilution of serum that reduced plaque formation by> 90% . Most (58%) of the 1,217 birds tested were resident species of cuba, primarily chestnut manakins (lonchura malaccas), blue jays (cyanocitta cristata), herring gulls (larus argentatus), yellow - faced grassquits / olive finches (tiaris olivacea), and northern parulas (parula americana). Nineteen (9.0%) of the 210 horses had serum specimens with antibodies to flaviviruses (table 1). Four and 8 animals had wnv- and slev - specific antibodies, respectively, in the prnt . Two horses seropositive for wnv came from havana city, and 2 others came from havana province . Seven serum samples had antibodies to undetermined flaviviruses on the basis of results of neutralization assays, and further virus characterization was not performed . None of the horses, including those that were positive for flavivirus antibodies, showed any signs of illness at the time of serum collection . Both acute - phase and convalescent - phase serum specimens from these patients were positive for flavivirus antibody by igm and igg elisas (table 2). Convalescent - phase serum samples were tested for wnv - specific antibody by prnt, and the neutralization titers were 320 and 160, respectively . Neutralizing antibodies against slev or dengue virus these persons are the first to have confirmed cases of wnv - associated illness in cuba . Both patients had histories of febrile illness, muscle weakness, and encephalitis, and both were hospitalized . These persons had jobs that required them to spend large amounts of time outdoors, and they lived in communities in santi spiritus and villa clara in central cuba ., table 2), who also resided in santi spiritus, had a low wnv titer by hi assay but had neutralizing antibodies to wnv, which suggests a past wnv infection . This patient was identified during surveillance in 2004 but may have been exposed to wnv in 2003 . * wnv, west nile virus; elisa, enzyme - linked immunosorbent assay; prnt, plaque reduction neutralization test; ig, immunoglobulin; hi, hemagglutination inhibition; slev, saint louis encephalitis virus; denv, dengue virus; nd, not done . Acute - phase / convalescent - phase serum samples . Serum specimens from the 10 remaining patients were negative for wnv igm but were positive for flavivirus igg by elisa; most of these were also positive by hi assay (table 2). One person appeared to have been exposed to dengue virus, and 4 had antibodies to unidentified flaviviruses . Seroconversions were not demonstrated in any of these persons, so we cannot say whether their illnesses were associated with slev or dengue virus infections . We report the first evidence of antibodies to wnv in horses and humans in cuba . The fact that human and horse infections have been detected strongly suggests that a local amplification cycle has been established in cuba . The mode of entry of the virus into cuba is unknown . In north america, avian death from wnv infection has been well documented (35). However, none of the dead birds collected during this study showed evidence of viral infection . Although 1,217 animals were tested, a more intensive dead bird surveillance program may be needed to identify animals that die from wnv infection . Resident bird species in cuba may be less susceptible to wnv infection, and death rates among birds in the caribbean may be lower than those observed in canada and the united states . This study also provides evidence that suggests wnv and slev may co - circulate in cuba . Further studies are required to confirm these observations and to characterize the transmission cycles involved . Finally, expansion of existing mosquito control programs in cuba, which currently focus on aedes aegypti and dengue prevention, may be required to respond to this new public health threat.
There are three distinct components of reduction in airway caliber: secretions, smooth muscle contraction and airway wall thickening . While pathogenetic changes that bring about airway narrowing may be heterogeneous, it is generally accepted that inflammatory cell infiltration with secretion of pro - inflammatory cytokines plays a major role in pathogenesis of asthma . The major inflammatory cells that are involved in this process are type 2 helper t (th2) cells, eosinophils and mast cells . Upon stimulation, th2 cells elaborate various cytokines (il-4, il-5, il-13 and gm - csf in particular) that stimulate the plasma cells to switch to specific ige production and induce myeloid differentiation . Ige bind to mast cells that result in secretion of preformed mediators of bronchoconstriction and glandular secretion (histamine, leukotrienes and kallikrein) as well as secretion of cytokines (il-4 and il-5), which increase eosinophil chemotaxis and th2 and mast cell proliferation (positive feedback). When stimulated by ige, eosinophils release a number of compounds cytotoxic to airway epithelium such as eosinophil cationic protein (ecp) as well as il-8, a chemotactic factor for eosinophils and neutrophils . Neutrophilic inflammation becomes more pronounced and is related to airflow obstruction particularly in the airways of chronic asthmatics . The airway epithelium may also play an important role in initiation and maintenance of the inflammatory response through secretion of chemokines such as regulated on activation, normal t - cell expressed and secreted (rantes) that attracts eosinophils, basophils and lymphocytes to the airway . Airway epithelium also elaborates nitric oxide (no), which is thought to suppress th1 cells thereby augmenting th2 cell induced inflammation . Through a process termed airway remodeling, these acute inflammatory events may lead to cellular proliferation, smooth muscle hypertrophy and hyperplasia, and collagen deposition below the basement membrane . The precise relationship of acute inflammatory cascade to airway remodeling and its modification by host and environmental factors are under investigation . The 14- and 15-membered ring macrolide antibiotics may interfere with cytokine production and inflammatory cell metabolism relevant to asthma pathogenesis outlined above at various levels . The hydrophobic nature of the 14- or 15-membered lactone ring and hydrophilic nature of both sugar moieties may lead to formation of drug micelles and promote the interaction of macrolide antibiotics with phospholipids in the plasma and intracellular organellar membranes . This, in turn, may alter the biophysical properties of the effector inflammatory cell membrane thereby interfering with the regulation of intracellular metabolic and transcriptional pathways involved in the inflammatory cascade, such as elaboration of reactive oxygen species by nadph oxidase and release of myeloperoxidase and elastase in neutrophils . This so - called membrane stabilizing effect may in part account for anti - inflammatory actions of macrolide antibiotics . Administration of erythromycin to rats for 3 months reduced production of cytokine induced neutrophil chemoattractant (cinc)-1, rat counterpart for human interleukin-8, from rat alveolar macrophages . Kohayama et al showed a reduction in interleukin-8 release from eosinophils from atopic individuals who were treated with 14-membered ring macrolide antibiotics . In an elegant study probing mechanism of action of this effect, abe et al investigated the effects of clarithromycin on interleukin-8 gene expression and protein levels in human bronchial epithelial cell line bet-1a . Clarithromycin inhibited il-8 gene expression in a dose and time dependent manner and the action was mediated by suppression of activated protein-1 binding and nuclear factor (nf)-b sites . Shimizu et al showed reduction in expression of messenger rna for the gene responsible for mucin production (muc5ac) in nasal epithelium of rats administered clarithromycin, inferring a direct inhibitory effect on mucus secretion . Roxithromycin inhibits mast cell inflammatory cytokine production (tnf - alpha) in a dose dependent fashion . In a study of 15 patients with mild to moderate asthma, chu et al demonstrated reduction of airway edema on endobronchial biopsies, as inferred by relative increase in vascularity, following a 6-week treatment with clarithromycin . Although mechanism of such an effect was unclear, the reduction of edema was significantly more in asthmatic patients who tested positive for mycoplasma pneumoniae, suggesting an antimicrobial mechanism of action . Finally, no generation in mice in response to lipopolysaccharide stimulation is suppressed significantly after 4 weeks of oral macrolide antibiotic administration, suggesting that anti - inflammatory effects may, in part be mediated by the no pathway . Macrolide antibiotics, particularly troleandomycin and erythromycin, decrease corticosteroid requirements in patients with prednisolone - dependent asthma . Spector and his colleagues conducted a double - blind crossover trial comparing troleandomycin to placebo in 74 corticosteroid - dependent patients with severe asthma and chronic bronchitis . Two - thirds of patients showed marked improvement in sputum production, pulmonary function measurements, need for bronchodilators, and subjective evaluation . Much of this effect, however, was attributed to troleandomycin - induced inhibition of methylprednisolone and theophylline metabolism by the hepatic cytochrome p-450 complex . Troleandomycin was later discontinued because of its intolerable adverse effects, particularly osteoporosis, associated with prolongation of methylprednisolone half - life and long - term elaboration of prednisone in vivo . Low - dose, long - term macrolide antibiotics therapy may have effects beyond their corticosteroid - sparing action in asthma . To this end, macrolide antibiotics inhibit lymphocyte proliferation in response to phytohemagglutinin, decrease neutrophil accumulation via decrease in chemotactic activity, decrease mucus secretion and decrease contraction of isolated bronchial tissue . Open label studies with troleandomycin in methylprednisolone - dependent patients with asthma have demonstrated greater reduction in methylprednisolone doses than would have been predicted by inhibition of methylprednisolone metabolism in the liver . Gotfried and his colleagues showed a significant improvement in pulmonary function test results and in quality of life measures in prednisone dependent patients with asthma following a six - week course of clarithromycin without any change of prednisone requirements . In a small case series of patients administered clarithromycin for one year, two of three prednisone dependent patients were able to discontinue prednisone altogether . Macrolide antibiotics are efficacious in patients with asthma not treated with corticosteroids by reducing airway hyperreactivity and eosinophilic inflammation . A 10-week course of low - dose erythromycin was associated with significant decrease in bronchial hyperresponsiveness to histamine challenge, expressed as pc20, in patients with asthma . In a double blind, placebo - controlled crossover trial, amayasu et al treated 17 adults with mild to moderate asthma who were clinically stable with low - dose clarithromycin for 8 weeks . Determination of blood and sputum eosinophil counts, sputum eosinophil cationic protein (ecp) levels, and methacholine challenge testing were carried out before and after treatment . At the conclusion of the study, all inflammatory indices and values of pc20 for methacholine improved . In a study of 11 patients with mild asthma, 250 mg azithromycin orally given twice weekly for 8 weeks increased pc20 of methacholine significantly while fev1 and fvc did not change . Tamaoki and his colleagues showed that erythromycin, roxithromycin, and erythromycin attenuated the contractile response of human isolated bronchial strips to electrical field stimulation . Rubin and his colleagues showed that treatment with clarithromycin for two weeks improved nasal secretion rheology, hydration, cohesion and transportability in patients with purulent rhinitis . One possible explanation for the efficacy of low - dose, long - term macrolide antibiotics therapy in patients with asthma is the putative role played by persistent airway infections in its pathogenesis, particularly chlamydia pneumoniae and mycoplasma pneumoniae infections . These infectious agents may underlie acute asthma exacerbations and the initiation and maintenance of asthma in previously asymptomatic patients . Infection with mycoplasma pneumoniae induces rantes expression in cultured human airway epithelial cell, an effect that is mitigated with erythromycin . In a randomized double - blind placebo - controlled trial, kraft and her colleagues studied the effects of low - dose clarithromycin on 52 patients with stable asthma . Patients had baseline spirometry, bronchoscopy with lavage and biopsy for pcr testing for infection with chlamydia pneumoniae and mycoplasma pneumoniae and measurement of various inflammatory mediators obtained from the lower respiratory tract . After 6 weeks of treatment with clarithromycin, lung function (fev1) significantly improved but only in the group of patients with evidence of infection . There were also significant reductions in levels of il-5, il-12, tnf- in bronchoalveolar lavage fluid and level of tnf- in airway tissue in patients with infection . Notably, there was a decrease in tnf- level in lavage fluid and airway tissue in patients without evidence of infection as well . These findings were also supported by black and his colleagues who found that patients with asthma and serological evidence of infection with chlamydia pneumoniae showed improvement in peak expiratory flow rates after a 3-month course of roxithromycin . Intriguingly, the authors also noted that the benefits seemed to diminish at subsequent 3 month and 6 month time points following therapy . They postulated that this was related, in part, to lack of power of the study to detect a difference or failure to eradicate the organisms . Alternatively, the immunomodulatory effects of roxithromycin may have been lost once the drug was stopped . Low - dose, long - term 14- and 15-membered ring macrolide antibiotic therapy represents a promising addition to our anti - asthma drug armamentarium . The salutary effects of these drugs are related, most likely, to their distinct immunomodulatory properties although eradication of persistent airway infection with chlamydia pneumoniae and mycoplasma pneumoniae in patients with asthma may also play a role . Clearly, additional, multi - center, randomized, double - blind, placebo - controlled trials are indicated to address these issues.
The combination of a sulfonylurea and a thiazolidinedione may be a particularly effective treatment option in the early stages of type 2 diabetes when -cell function is at its highest . This allows maximal benefit to be obtained from the insulin secretion - promoting abilities of the sulphonylureas and the -cell - protective effects of the thiazolidinediones . Evidence was identified through a search of medline and embase from january 1996 to october 2006, using the search terms patients with type 2 diabetes characteristically experience a gradual decline in glycaemic control and progression from oral glucose - lowering monotherapy to combination therapy and ultimately to exogenous insulin therapy (1,2). A decrease in the number of functional insulin - producing -cells contributes to the pathological decline in glycaemic control typically seen in type 2 diabetes (3) and preserving -cell function has emerged as a vital component of long - term management strategies . Already at diagnosis of type 2 diabetes about 50% of insulin secretion capacity there is now increasing evidence available that near to normal glucose control prevents progressive deterioration of insulin secretion . Therefore, a move towards introducing combination therapy earlier in the course of type 2 diabetes with the aim of preserving glycaemic control and -cell function and thereby improving long - term outcomes is considered as a better approach to meet the dual defect in pathophysiology of type 2 diabetes . Such an approach poses the challenge of defining optimal combination regimens and the point at which to introduce them . Recent studies suggest that early, aggressive dual or even triple combination therapy in newly diagnosed patients slows the decline in glycaemic control compared with standard monotherapies (5,6). Intervening before the onset of frank type 2 diabetes in high - risk groups, such as those with gestational onset diabetes (7,8) or individuals with impaired glucose tolerance (9,10), is also emerging as a relevant approach to reducing the long - term morbidity and mortality of this chronic disease . Although not all individuals with insulin resistance will go on to develop type 2 diabetes, in those that do, overt type 2 diabetes develops when -cells are no longer able to compensate for insulin resistance . Insulin resistance in itself may contribute to the decline in -cell function by inducing endoplasmic reticulum stress as a consequence of an increased demand for insulin (11). This is in addition to the toxic effects of elevated glucose and lipid levels because of their impaired metabolic processing in the presence of insulin resistance (12). Today, a variety of agents of differing modes of action are available to improve glycaemic control . The sulfonylureas (e.g. Glipizide, glyburide, glimepiride and gliclazide) are insulin secretagogues that act to increase insulin secretion . Biguanides (principally metformin), reduce hepatic glucose output and increase the uptake of glucose by peripheral tissues . More recently, the thiazolidinediones (pioglitazone and rosiglitazone) have emerged as novel, effective glucose - lowering agents (13). The thiazolidinediones are peroxisome proliferator - activated receptor gamma (ppar)-stimulating insulin sensitisers that also act without increasing insulin secretion . Other, less widely used agents include the -glucosidase inhibitor, acarbose, the incretin mimetic, exenatide, and the new short - acting insulin secretagogues, repaglinide and nateglinide . A variety of agents with novel mechanisms of action are currently in development and their role in future management regimens has yet to be defined . Recent research effort has focused on defining the effect of oral glucose - lowering agents in this respect to guide decisions on appropriate combination therapies to achieve long - term outcomes beyond glycaemic control . This review examines the mechanistic distinctions in terms of glycaemic control and -cell functional preservation and the latest clinical data that support the rationale for thiazolidinedione sulfonylurea combination therapy in patients with type 2 diabetes . The sulfonylureas and biguanides formed the mainstay of oral glucose - lowering therapy from their introduction in the early 1940s until the 1990s when thiazolidinediones became available . Sulfonylureas stimulate endogenous insulin secretion via their action at the katp channel in the plasma membrane of pancreatic -cells (14) and effectively decrease hba1c levels by between 0.8% and 2.0% (15). As sulfonylureas act by enhancing insulin secretion, they are most effective in the early stages of type 2 diabetes when -cell function is at its greatest . Despite their initial efficacy, glycaemic control is inevitably lost over time with the sulfonylureas, necessitating the introduction of combination therapy to regain control and prolong the time before progression to exogenous insulin therapy . In the united kingdom prospective diabetes study (ukpds), 53% of newly diagnosed type 2 diabetics initially treated with sulfonylureas subsequently required additional treatment within 6 years to maintain glycaemic control (16). In the recently published adopt study, the proportion of the patients with type 2 diabetes exceeded the target fasting blood glucose level of 180 mg / dl after follow - up (17). Given the direct effects of the sulfonylureas on the -cell and the potential for -cell exhaustion, combination regimens with agents that improve glycaemia by different modes of action, such as the thiazolidinediones, are recommended . This combination may be particularly effective given the known positive effects of the thiazolidinediones on -cell function discussed below . The thiazolidinediones act as insulin - sensitising agents and increase the peripheral action of insulin . They act as ligands of ppar, which is involved with the regulation of genes that control glucose homeostasis and lipid metabolism and is found in high concentrations in adipose tissue, hepatocytes and skeletal muscle . These agents have also proved effective in reducing hba1c levels and maintaining glycaemic control, with average reductions in hba1c levels of between 0.5% and 1.5% (15,18). Recent evidence suggests that the thiazolidinediones may be more effective than sulfonylureas in maintaining glycaemic control over the long term (17,19). In a direct comparison of pioglitazone vs. gliclazide as monotherapy, significantly more pioglitazone - treated patients maintained their glycaemic control at 2 years than did patients treated with gliclazide (19). Short- and long - term studies with thiazolidinediones and sulfonylurea in combination have shown that this combination offers sustained glycaemic control (2027). (20) found that, compared with the addition of bedtime insulin to maximal doses of sulfonylurea or metformin, the addition of pioglitazone resulted in comparable improvements in glycaemic control and less hypoglycaemia after 16 weeks of treatment . Although this study did not report separate results for the sulfonylurea and metformin groups, there was an overall reduction in hba1c of 1.9% compared with 2.3% for insulin (20). In another short - term study, sulfonylurea combination exclusively and reported decreases of 0.9% and 1.3% for pioglitazone doses of 15 and 30 mg, respectively, over 16 weeks . Long - term studies also support the sustained beneficial effects of this combination on glycaemic control (table 1). In a 6-month study, comaschi et al . (23) reported significant and sustained reductions in hba1c when pioglitazone was added to either sulfonylurea or metformin . Four further studies of increasing duration have also confirmed the maintenance of glycaemic control following the addition of pioglitazone to sulfonylurea therapy . In the quartet study, the addition of pioglitazone to existing sulfonylurea therapy resulted in a 1.2% reduction in hba1c after 1 year in 319 patients with inadequately controlled type 2 diabetes (25). (28) also reported significant (1.3%; p <0.01 from baseline) and sustained reductions in hba1c levels when either rosiglitazone or pioglitazone were added to failing glimepiride in 91 patients with type 2 diabetes and the metabolic syndrome after 1 year . In the 2-year end point of the quartet study described above, comparing the addition of pioglitazone or metformin to failing sulfonylurea therapy, found that after a rapid decrease in hba1c levels over the first 20 weeks of the study plateaued with overall reductions of 1.03% and 1.16% for the pioglitazone plus sulfonylurea and metformin plus sulfonylurea add - on groups, respectively, after 104 weeks of treatment (21). The recently presented glycaemic results of the prospective pioglitazone clinical trial in macrovascular events (proactive) study (22) of 5238 patients with type 2 diabetes and evidence of macrovascular disease further support the maintenance of glycaemic control following the addition of pioglitazone to existing sulfonylurea therapy . A subgroup analysis of the proactive study looked at the 1001 patients who were managed with sulfonylurea therapy at baseline . Patients treated with pioglitazone experienced significant decreases from baseline in hba1c levels that were sustained up to the 34.5-month assessment and fewer patients switched to or required addition of metformin or insulin compared with those who received placebo [figure 1; (22)]. Maintenance of long - term glycaemic control with combination sulfonylurea and pioglitazone therapy [charbonnel and scheen, 2006 (22)]. 55, 2006; a478 . Reprinted with permission from the american diabetes association long - term glycaemic and lipidaemic effects of combined sulfonylurea and thiazolidinedione therapy in patients with type 2 diabetes -cell stress is reduced with thiazolidinedione therapy, but enhanced with sulfonylurea therapy (29). Studies have shown that chronic exposure to glibenclamide can lead to an acceleration of -cell apoptosis and -cell exhaustion or desensitisation (3034). The precise mechanism by which glibenclamide initiates -cell apoptosis remains unclear, but may involve closure of the inwardly rectifying k sulfonylurea receptor subtype of the atp - sensitive potassium channel (32,34), the sustained enhancement of ca influx mediated by glibenclamide leading to elevated and toxic cytosolic ca levels (33) and nitric oxide production (30). In addition, prolonged exposure to sulfonylurea renders -cells less responsive to subsequent sulfonylurea stimulation . (31) found that prolonged in vitro exposure of human pancreatic islets to various insulin secretagogues, including sulfonylureas, resulted in a reduced capacity to respond to further secretory stimulation . Interestingly, certain sulfonylureas may offer a protective effect from hydrogen peroxide - induced -cell damage (35). Several lines of evidence support the beneficial effects of thiazolidinediones in terms of improving insulin secretion, preserving -cell mass and islet structure and also protecting -cells from oxidative stress (3642). How the thiazolidinediones exert these protective effects remains unclear . In the presence of chronically elevated glucose levels (glucotoxicity), elevated free fatty acid (ffa) levels (lipotoxicity) appear to play an important role in -cell damage during the early stages of type 2 diabetes, impairing their functionality and inducing cell death (43,44). In the presence of both chronic hyperglycaemia and elevated ffa levels, -cells synthesise less insulin and lose the glucose - stimulated insulin secretion response (45,46). Thiazolidinediones may protect against the toxic effects of chronically elevated lipid levels by limiting the exposure of -cells to circulating ffas (47) and by their effects on triglyceride partitioning in tissues . They may also protect against -cell apoptosis and facilitate -cell proliferation more directly by preventing nuclear factor (nf)kb activation in -cells (37,48). Amyloid deposition has also been associated with increased -cell apoptosis (49) and a reduction in amyloid deposition with thiazolidinediones has been demonstrated in vivo (50). The protective effects of the thiazolidinediones in this respect may be exerted via activation of a phosphatidylinositol 3-kinase (pi3k) akt cascade, which acts to inhibit the human islet amyloid polypeptide (h - iapp) induction of apoptosis (51). Recently a strong effect of pioglitazone on low - grade - inflammation in patients with cardiovascular disease (cvd) without diabetes has been described, which may be another way to protect the -cells (52). Clinical studies have also provided indirect support for the preservation of -cell function with thiazolidinedione therapy . Homeostasis model assessment (homa) is a mathematical tool that models the glucose insulin feedback loop in the homeostatic state . It permits estimations of insulin sensitivity (% s) and -cell function (% b) from pairs of fasting glucose and insulin (or c - peptide) measurements . A 23-week study of pioglitazone monotherapy showed that there was an increase in homa-%b (53). In a separate study in drug - nave patients with type 2 diabetes, wallace et al . (54) reported an increase in homa-%b during 3 months of pioglitazone therapy compared with a small decrease among patients receiving placebo . In addition, they reported a significant decrease in the pro - insulin / insulin ratio suggesting that the -cells were under less stress . Other studies have also reported improvements in the insulinogenic index (provides a measure of -cell function during an oral glucose tolerance test) and the disposition index (in which the value is corrected for underlying insulin resistance) (5658). For example, in studies comparing pioglitazone and gliclazide either as monotherapies (19) or as add - on treatments to existing therapy (59), both agents were associated with an initial improvement in the homa-%b . However, only patients treated with pioglitazone were able to maintain this improvement during 2 years of treatment, while those treated with gliclazide experienced a continued gradual decline, despite a greater initial improvement [figure 2; (19,59)]. Improvement in -cell function over 2 years of treatment with either pioglitazone or gliclazide [tan et al the pioglitazone group is shown by the dashed line and diamonds; * p <0.0001, p <0.01, p <0.05 . Reprinted with permission from the american diabetes association studies support an effect for both thiazolidinediones and sulfonylureas in improving insulin resistance in the short term in type 2 diabetes using techniques such as the hyperinsulinaemic / euglycaemic clamp (which allows the determination of the amount of glucose necessary to compensate for an increased insulin level without causing hypoglycaemia) and homa-%s (54,6064). However, direct comparisons during long - term treatment suggest that the thiazolidinediones may be better able to improve and maintain improvements in insulin sensitivity (19,65). During 1 year of treatment, pioglitazone therapy was associated with significant reductions in homa-%s (p = 0.002 from baseline), whereas no significant decrease was recorded for gliclazide in patients with type 2 diabetes (65). (19) found that pioglitazone was associated with an improvement in homa-%s, while gliclazide was associated with a worsening in this measure of insulin resistance . Combining sulfonylurea therapy with thiazolidinediones may ensure long - term benefits in terms of insulin resistance (66). In the adopt study, comparing rosiglitazone with glibenclamide and with metformin in early type 2 diabetes, rosiglitazone improved insulin resistance and -cell function to a significantly greater extent than both competitors did (17). In addition to the toxic effects of elevated ffas on -cells, the abnormal lipid profile including elevated small dense ldl, lowered hdl - cholesterol and elevated triglycerides associated with type 2 diabetes poses a further burden in terms of increasing the risk of cvd . Thus, most studies of glucose - lowering therapy now also include an assessment of lipid effects . Older sulfonylureas appear to be associated with adverse cardiovascular risks, possibly due to their binding to atp - sensitive potassium channels in cardiomyocytes and vascular smooth muscle cells (67,68). However, how these effects might translate into clinical implications is poorly defined and the newer sulfonylureas appear to be associated with a lower risk of adverse cardiovascular events, such as myocardial infarction and may in fact inhibit atheromatous plaque formation (69,70). Patients with pre - existing cvd may be particularly sensitive to the effects of sulfonylureas in this respect (71,72), as studies in which such patients were excluded showed no increased risk of cardiovascular mortality (73). Pioglitazone has been shown to improve the lipid profile in patients with type 2 diabetes by increasing hdl - cholesterol levels, decreasing triglyceride levels and increasing the lipoprotein particle size of ldl in combination regimens with sulfonylurea (20,27,74). Evidence is emerging of a differential effect between the thiazolidinediones in this respect (75,76). (76) described above, the addition of pioglitazone to metformin and/or sulfonylurea therapy was associated with a decrease in triglyceride levels and an increase in hdl - cholesterol levels . The addition of rosiglitazone also resulted in an increase in hdl - cholesterol, but with no significant improvement in triglyceride levels and an overall increase in total cholesterol levels (76). (75) reported on the improvement in lipid parameters in patients switched from rosiglitazone sulfonylurea combination therapy to pioglitazone sulfonylurea therapy in addition to continued stable statin therapy . After 17 weeks of treatment, replacement of rosiglitazone with pioglitazone was associated with significant improvements in triglyceride and total cholesterol levels and more modest improvements in ldl - cholesterol (75). Long - term studies have shown that the beneficial effects associated with pioglitazone therapy are maintained over months and years [table1; (21,24,74,7779)]. Thiazolidinediones have other advantages over traditionally employed oral agents, including additional potential cardioprotective effects, such as improving the pro - thrombotic state and blood pressure . When given in combination with the sulfonylurea, glimepiride, both rosiglitazone and pioglitazone have been shown to improve key components of the prothrombotic state associated with type 2 diabetes [including plasminogen activator inhibitor 1 levels] (28). In a study of patients with type 2 diabetes and the metabolic syndrome failing on initial therapy with a sulfonylurea or metformin, combination therapy with glimepiride and either pioglitazone or rosiglitazone was associated with significant improvements in both systolic and diastolic blood pressure over 12 months (80). In addition, thiazolidinediones have been shown to lower the levels of a number of inflammatory parameters, including high sensitivity c - reactive protein and matrix metalloproteinase (52,8184). In a recently published study comparing the efficacy of simvastatin, pioglitazone and the combination of both in patients with cvd, but without diabetes, the combination of pioglitazone and statin had additive and complimentary effects on a broad spectrum of inflammatory parameters and the lipoprotein profile independent of hba1c level (52). Type 2 diabetes manifests in an insulin - resistant individual when pancreatic -cells are unable to produce sufficient insulin to overcome insulin resistance in the muscles and liver . Intervening early to attain glycaemic control and protect -cell function is now regarded as central to improving long - term outcomes for patients with type 2 diabetes . The insulin secretagogue sulfonylureas and biguanides represented the mainstay of oral glucose - lowering therapy from their development in the 1940s to the 1990s . Today, these agents are still used and are proving especially useful in early combination therapy regimens with agents that improve glycaemic control by different molecular mechanisms . In patients treated with a sulfonylurea, there is a strong rationale to support the early combination with thiazolidinediones in type 2 diabetes . In addition to improving and maintaining glycaemic control, the thiazolidinediones reduce -cell stress, improve insulin resistance and modify a variety of cardiovascular risk factors, including the abnormal lipid profile and increased low - grade inflammation activity associated with type 2 diabetes . The combined benefits of thiazolidinediones and sulfonylureas may delay the progression of type 2 diabetes and the need for exogenous insulin therapy, and may also offer benefits in terms of reduced risk of cvd.
Cavernous hemangioma is a benign vascular malformation and belongs to a wide and continuous overlapping spectrum of hamartomas . Most cavernous haemangiomas occur in the vertebral body and may extend into the epidural space . Purely extradural cavernous hemangiomas without any vertebral body involvement is extremely rare and accounts for only 4% of all extradural spinal tumors and 12% of haemangiomas occurring extradurally . We herein present a rare case of extradural dumbbell lumbar (l3) cavernous hemangioma with paraspinal extension . A 52-year - old female presented with insidious onset progressive low backache with pain radiating to whole of left lower limb associated with paraesthesias for two months . Left lower limb power was 4/5 in hip flexion, extension, abduction and adduction, 4/5 in knee flexion and extension, subtle weakness in ankle flexion and extension and great toe extension with hypotonia . The reflexes of left lower limb were sluggish whereas on right side they were brisk (normal). Sensory examination revealed impairment of all the modalities of sensations (pin prick, touch, temperature, vibration- impaired upto anterior superior iliac spine) from l2 to s4 dermatomes on left side . Magnetic resonance imaging of lumbar spine revealed an irregularly shaped, well defined extradural lesion at l3 vertebral level indenting the body, displacing the thecal sac posterolaterally and extending into left paraspinal region through l3- 4 neural foramen . Lesion was isointense on t1w, hyperintense on t2w images with strong homogenous enhancement on gadolinium contrast study [figure 1]. Provisional preoperative diagnosis of schwannoma was considered . Though the clinical findings and radiology were not concordant, the patient was suggested surgical intervention for the presence of enhancing mass lesion noted on the imaging with guarded prognosis . Shows irregularly shaped well defined extradural lesion (arrows), hypointense on t1w (a), hyperintense on t2w (b) images with homogenous contrast enhancement (c, d, e) and paraspinal transforaminal extension (d, e) the patient underwent left hemilaminectomy from l2 to l4 . There was an extradural, brownish red, highly vascular mass located anterolateral to thecal sac at l3 vertebral body with well defined capsule around it . Left l3 nerve root was pushed superiorly by the tumor and it was not arising from any neural tissue . It was dissected clear from the l3 nerve and the dura keeping the dissection over the coagulated capsule . The spinal component of the lesion was excised in toto until the neural foramen, where it was coagulated and was cut sharply leaving behind the extra - foraminal portion . Microscopic examination revealed numerous dilated vascular channels of variable sizes lined by a single layer of flattened epithelial cells and filled with blood elements . Interspersed thick hyalinised blood vessels and mature adipose tissues were noted [figure 2]. Radiotherapy was administered to the residual paraspinal portion of tumor [figure 3]. For radiotherapy, the patient was immobilised in a vacuum locking device and ct simulation was done in the treatment position . Margin of 1 cm was added to the post contrast t1w mri to obtain the clinical target volume; planning target volume was obtained by adding a margin of 0.5 cm to the clinical target volume . Three dimensional conformal radiotherapy was planned on eclipse planning system (varian medical systems, palo alto, ca) on linear accelerator (clinac ix- 3665) using 6 mv x rays . The dose prescription was 40 gy, 2 gy per fraction, 20 fractions given five days a week over five weeks . (a, b) the proliferating and anatomizing capillary channels lined by endothelial cells (h and e, 100) shows postoperative changes (arrow) in spinal canal and residual tumor in paraspinal region cavernous hemangioma is a benign vascular malformation, also known as cavernous malformation, cavernous angioma or cavernoma . The cavernous hemangiomas occur throughout the neuroaxis including both intracranial and spinal compartments . According to location, its incidence in supratentorial, infratentorial and spinal compartments is 80%, 15% and 5% respectively . Purely extradural spinal cavernous hemangiomas are rare and the extension through intervertebral foramen into extraspinal region (dumbbell) is still rarer . In that case, it can be confused with commonly diagnosed nerve sheath tumors . The onset of symptoms in these spinal cavernomas may be acute, progressive or remittent, depending on the biological behavior of the tumor . Lumbar extradural hemangiomas behave differently, not only from intramedullary cavernous hemangiomas but also from extradural cavernomas of other spinal locations . Purely extradural hemangiomas should be included in the differential diagnosis of lumbar extradural soft - tissue lesions . In contrast to intracerebral cavernous hemangiomas, the patterns of density on ct scans and signal intensity on mr images are more homogenous in extradural hemangiomas . Another point of differentiation is the absence of low signal rim (hemosiderin) which is usually seen in intraaxial spinal cord cavernomas . As seen in present case, extradural cavernous hemangiomas are usually isointense on t1w and hyperintense on t2w images and show homogenous contrast enhancement because of the presence of sinusoidal channels . The lesion should be differentiated from other epidural neoplastic or inflammatory conditions, such as meningioma, neurofibroma, lymphoma, hemorrhagic vascular mass, granuloma and angiolipoma . Complete and in toto excision of the lesion should be attempted for clinical improvement; however, in case of subtotal excision, adjuvant radiotherapy is advised . Radiosurgery as primary or adjuvant therapy is increasingly becoming an option as advances in radiosurgical equipment are enabling safe and accurate targeting of lesions . Though purely extradural cavernomas are rare in occurrence, they should be considered as possible differential diagnosis of dumbbell lesions of spine in view of operative nuances (especially massive haemorrhage) and management thereof.
Periodontitis is a chronic immunoinflammatory infectious disease leading to the destruction of periodontal ligament and adjacent supportive alveolar bone induced by pathogenic biofilms containing numerous periodontal pathogens . Among the periodontal pathogens, porphyromonas gingivalis, treponema denticola and tannerella forsythia are commonly co - isolated in subgingival biofilm samples from adult periodontitis lesions [15]. This consistent coexistence suggests that a strong ecological relationship may exist among these microbial species . Furthermore, several studies report the co - existence of p. gingivalis and t. denticola in close association with chronic periodontitis lesions [1, 68], detection in carotid and aortic atheromatous plaques, exhibit nutritional interactions, demonstrate bimodal co - aggregation [1113], binding of p. gingivalis fimbriae to t. denticola dentilisin, as well as synergistic biofilm formation [15, 16]. Moreover, both species express high trypsin - like proteolytic enzyme activities [1720] in addition to synergistic virulence as mixed infections in mouse abscess [21, 22] and pneumonia animal models . We have shown previously that p. gingivalis and fusobacterium nucleatum exhibit synergistic soft tissue destruction . The mechanisms of interaction between p. gingivalis and t. denticola as a consortium in the subgingival sulcus and whether they express a synergistic pathogenic potential in progressing periodontitis remain enigmatic at present . Recently, we have demonstrated that p. gingivalis, t. denticola, and t. forsythia with and without f. nucleatum not only exist as a consortium that is associated with chronic periodontitis in humans but also exhibit virulence resulting in the colonization of the rat oral cavity, induction of enhanced igg immune responses, and significant alveolar bone resorption characteristic of polymicrobial (three pathogens or more) periodontitis . Monomicrobial (single pathogen) periodontal infections using p. gingivalis, t. denticola, t. forsythia, or f. nucleatum have been studied in rats and mice [2530]. Increasing evidence supports the concept that bacterial interactions among members of the subgingival pathogens at any time during periodontal disease progression are important . However, there are no published reports establishing a mixed microbial (two species) periodontal infection for examining the virulence between p. gingivalis and t. denticola . This study examined mixed microbial periodontal disease using p. gingivalis and t. denticola as a consortium and examined their colonization / infection characteristics, periodontal inflammation parameters, immune response patterns, induction of alveolar bone resorption, and virulence interactions . The bacteria used in this study were p. gingivalis 381 and t. denticola atcc 35404 and these strains were grown under anaerobic conditions (85% n2, 10% h2, and 5% co2) at 37c in a coy anaerobic chamber as described previously [25, 31]. The p. gingivalis strain 381 was chosen due to its known role in alveolar bone resorption in adult periodontitis and its proven ability to colonize the oral cavity of rodents [25, 27, 28, 32]. For oral monobacterial infection, p. gingivalis (2 10 cells per ml: grown for 3 days on cdc anaerobic 5% sheep blood agar plates) or t. denticola (2 10 cells per ml: grown in gm-1 broth for 4872 hours as a log phase culture) was mixed with equal volumes of sterile 2% (w / v) low viscosity carboxymethylcellulose with pbs (cmc: sigma), [25, 26, 28, 33] and one ml was used for infection (10 cells per ml) by oral gavage [25, 26, 28, 33]. For oral mixed microbial infection, p. gingivalis (2 10 cells per ml) was gently mixed with an equal volume of t. denticola (2 10 cells per ml), mixed gently for 1 - 2 min, and allowed to interact for additional 5 minutes for any interactions among these species . An equal volume of sterile 2% (w / v) cmc was added, mixed thoroughly, and one ml (5 10 cells of p. gingivalis ml, 5 10 cells of t. denticola) was administered by oral gavage and anal topical application . Rats are coprophagic in nature, and the rationale behind the anal application is that bacteria will be in the feces and will then return to the oral cavity, thereby establishing a cycle of oral reinfection [28, 34]. Female sprague - dawley rats (8 weeks old, charles river laboratories, ma, usa) were maintained in groups and housed in microisolator cages in an aalac facility at the university of florida . The protocol (#e900) and all rat infection procedures used in this study were approved by the institutional animal care and use committee of the university of florida . Animals were fed standard powdered chow (teklad global 18% protein rodent diet 2918, harlan) and water ad libitum . All rats were administered kanamycin (20 mg) and ampicillin (20 mg) daily for 4 days in the drinking water [25, 35] and the oral cavity was swabbed with 0.12% (v / v) chlorhexidine gluconate (proctor and gamble, oh, usa) mouth rinse [25, 31] to inhibit the endogenous organisms and to promote subsequent colonization of p. gingivalis and t. denticola . Rats were randomized into groups (n = 18) and monobacterial and mixed microbial inocula were administered by oral gavage and anal topical application [28, 34] for 4 consecutive days per week on 46 alternate weeks (1624 inoculations). Sham - infected control rats received vehicle and sterile 2% low viscosity cmc only . Oral microbial samples from rats were collected using sterile cotton swabs at pre- and post - infections . A total of 46 postinfection microbial samples were collected the following week from all the infected rats . To determine the kinetics of virulence of mono- and mixed infection - induced periodontal disease and immune responses, rats were euthanized at the beginning of the 8th (7 weeks of 16 inoculations) and 13th weeks (12 weeks of 24 inoculations). The rats were killed, skulls were removed, autoclaved, and mechanically defleshed with a periodontal scaler . The randomly selected rat jaws (n = 3) were also suspended in 10% (v / v) buffered formalin, decalcified, tissues trimmed, and used for histomorphometry and histology . Dna was isolated from rat oral microbial samples using a wizard genomic dna purification kit (promega, wi, usa). The standard genomic dna for p. gingivalis, and t. denticola were also extracted following the same procedure from their respective 2472 hours pure cultures as described previously in . Subsequently, pcr was performed using 16s rrna gene species - specific pcr oligonucleotide primers with a bio - rad thermal cycler as described previously in [25, 31, 35]. After amplification; pcr products were separated by 1.5% agarose gel electrophoresis and the bands were visualized using the uvp biodoc - it imaging system . The genomic dna extracted from p. gingivalis and t. denticola served as positive control and pcr performed with no template dna making up the negative control . Each pcr assay with the standard dna was sensitive enough to detect 0.05 pg of dna (p. gingivalis 30 cells; t. denticola 18 cells). Different pcr cycles from 35 to 40 were standardized to produce detectable amplicons with the least amount (0.05 pg) of template dna . Serum from monobacterial (n = 9) or mixed microbial infected rats (n = 9) at 7 weeks (4 infections) and 12 weeks (6 infections) was used to determine igg, igm, iga, and igg subclass (igg1, igg2a, igg2b, igg2c) antibody concentrations, using a standard elisa protocol [25, 3436]. Briefly, diluted infected rat serum (1: 100 for igg and 1: 20 for igm, iga and igg subclass) was incubated in wells of either p. gingivalis or t. denticola coated microtiter polystyrene plates (costar, corning, ny, usa) for 2 hours at room temperature . After washing, alkaline phosphatase - conjugated goat anti - rat igg (1: 2000), igm and iga (bethyl laboratories, tx, usa) were added (1: 500) and incubated for additional 2 h at room temperature on a rotator . The substrate (p - nitrophenylphosphate; sigma, 1 mg / ml) was added to the washed plates, and the reaction was terminated by using 3 m naoh . For igg subclass elisa analysis, alkaline phosphatase - conjugated goat anti - rat igg1, igg2a, igg2b, and igg2c (bethyl laboratories, tx, usa) were used (1: 500). The optical density (od) louis, usa), which were coated onto wells of the microtiter polystyrene plates, detected, and developed as described above . The pattern of alveolar bone resorption (horizontal or vertical) induced by p. gingivalis and t. denticola were measured by both morphometric and radiograph methods, respectively . The 7 and 12 weeks mono- and mixed microbial infected jaws (n = 6) were immersed in 3% (vol / vol) hydrogen peroxide overnight, and stained with 0.1% (wt / vol) methylene blue to delineate the cemento - enamel junction (cej) using the modified morphometric method [33, 34]. The digital images of both buccal and lingual root surfaces of all molar teeth were captured under a 10 stereo dissecting microscope (stereo discovery v8; carl zeiss), after superimposition of buccal and lingual cusps to ensure reproducibility and consistency . The line tool was used to make horizontal bone resorption measurements on all molars in each quadrant from the cej to the alveolar bone crest (abc). The surface perimeters of cej and abc were traced using the calibrated line tool . As the axiovision software program was calibrated using a precise ruler, the area of the horizontal bone loss reading in mm two blinded investigators were used and all measurements were done two times by the same examiner at separate times and the means of the measurements were obtained for each of the four quadrants . The maxillae and mandibles were placed and stabilized with dental wax on a digital kodak 6000 sensor (carestream health, usa) oriented with the axis of the teeth parallel to the sensor surface . Digital radiographs of distal and mesial surfaces of the molars were acquired with orthogonal projection geometry using an exposure time of 0.08 s at 60 kvp and 15 ma . All radiographic images were exported into the tuned aperture computed tomography workbench, calibrated for magnification using known anatomic measurements, and histograms equalized . The line tool was used to make vertical bone resorption measurements on the distal and mesial sides of each interproximal surface (2 sites per tooth) for each of the molars in each quadrant from the cej to the abc (i.e., resorption) as the primary outcome parameter of the study . The summation of alveolar bone resorption in mm was tabulated and analyzed for intra and intergroup comparison [25, 31, 35]. Monomicrobial and mixed microbial infected rat jaws (n = 3) were removed randomly and fixed in 10% buffered formalin . The decalcified tissue was embedded in paraffin blocks, 4 sections prepared, stained with hematoxylin and eosin and the wholeslides were digitally scanned with a scanscope cs system (aperio technologies, vista, ca). The scanned slides were viewed with imagescope viewing software (aperio technologies, vista, ca). The inflammation at the supracrestal gingival connective tissue between the molars in each specimen at consecutive sections or levels 10 and 20 was examined based on multiple parameters including polymorphonuclear leukocytes (pmn), lymphocytes, blood vessel density, apical migration of junctional epithelium (je), rete ridge elongation (r) and alveolar bone resorption (abr). The number of inflammatory cells (pmns and lymphocytes) per unit area (0.05 mm 0.05 mm) was counted in the area of the junctional epithelium and adjacent connective tissue . The migration of je, elongation of rete ridges and resorption of alveolar bone was measured using the imagescope software with a microgrid at a magnification of 200 . The distances from the cej to the coronal portion of the connective tissue attachment (apical migration), from the cej to the apical portion of the rete ridge; and from the cej to the level of the alveolar bone crest were measured . The alveolar bone resorption and igg antibody data were presented as means standard deviations (prism 4, graphpad software). P values were calculated using the kruskal walis anova with dunn's correction for multiple comparisons and mann - whitney student t - test . Prior to mono- or mixed infection; we examined all rats for p. gingivalis and t. denticola using appropriate bacterium - specific primers by pcr, and observed all rats were consistently negative for these oral pathogens . The pcr results demonstrate an appropriately sized amplicon for p. gingivalis (600 bp) present in dna isolated from rat oral microbial samples following infection with the single - microbe inocula (data not shown). Among two monobacterial infections, p. gingivalis was found positive by pcr in all individual rats (n = 18) and was positive 14 times during the four to six sampling times . In addition, 5083.3% of infected rats were positive for p. gingivalis during four (2, 3, 4, and 6) out of six sampling times . In contrast, t. denticola (860 bp) amplicons were negative for dna isolated from rat oral microbial samples following infection with the single - microbe inocula . The rats that had been given p. gingivalis + t. denticola mixed infection showed 72% (13/18) positive amplicons for p. gingivalis and only 2 out of 18 rats were positive for amplicons of t. denticola . To provide additional documentation of oral infection and to demonstrate an immunological response to p. gingivalis and t. denticola infection, we evaluated the levels of pathogen specific igg, igm, iga, and igg subclass (igg1, igg2a, igg2b, iggc) antibodies in rat sera 7 weeks and 12 weeks post - initial infection (figure 1). The induction of igg antibody response patterns was identical in both 7 and 12 weeks infected rats using either mono- or mixed infection protocols . All rats in the p. gingivalis infected group at both 7 (figure 1(a)) and 12 weeks (figure 1(c)) demonstrated significantly elevated igg antibody (p <.05) compared to the levels in shaminfected control rats . Similarly, all rats infected with t. denticola produced igg antibody that was significantly higher (p <.05) than levels of sham - infected control rats at both 7 (figure 1(b)) and 12 weeks (figure 1(e)) postinfection . However, p. gingivalis infection induced significantly higher igg levels (> 100-fold) than t. denticola infection in the monoinfected rats . The levels of igg antibody in the rat serum paralleled the frequency of detection of p. gingivalis in the oral microbial samples . Interestingly, all rats in the t. denticola monobacterial infection group at 12 weeks (figure 1(e)) induced significantly strong igg immune response in spite of our inability to detect t. denticola dna in the oral microbial samples . All rats in the mixed infection groups showed elevated serum igg antibodies to p. gingivalis and t. denticola compared to the levels in shaminfected control rats (figure 1). Interestingly, p. gingivalis + t. denticola infection at 7 (figures 1(a) and 1(b)) and 12 week (figures 1(d) and 1(f)) post - initial infection induced> 100-fold stronger p. gingivalis specific igg immune response as compared to t. denticola igg responses . Approximately, 90% of the rats infected with mixed bacteria (16/18) presented elevated serum igg to p. gingivalis when compared to sham - infected control rats (figure 1(a)). Similarly, 100% of the mixed microbial infected rats (18/18) demonstrated significantly elevated serum igg to t. denticola compared to that in sham - infected control rats (figure 1(b)). None of the p. gingivalis and t. denticola infected rats induced iga and igm antibodies during 7 and 12 weeks of infection (data not shown). Thus, we had observed that p. gingivalis and t. denticola are antigenic in the rats, which resulted in significant levels of serum igg antibodies . In order to more fully assess the characteristics of the antibody, we determined the igg subclass distribution of the humoral immune response following oral infection . Following 12 weeks of p. gingivalis mono- and mixed microbial infection, the igg2b subclass levels (p <.05) were higher than the igg1 and igg2a antibody levels and significantly (p <.05) greater than in sham - infected control rats (figures 1(c) and 1(d)). Similarly, in t. denticola mono- and mixed microbial infection, the igg2b subclass levels (p <.05) were higher than the igg1 and igg2c antibody levels and significantly greater than in sham - infected control rats (p <.05) (figures 1(e) and 1(f)). Additionally, p. gingivalis induced higher levels of igg subclass antibody than that induced by t. denticola . In order to address the potential virulence between the p. gingivalis and t. denticola in periodontal disease progression in the rats, we examined the effect of infection on the maxilla and mandible alveolar bone resorption . Both mono- and mixed infection induced buccal and palatal areas of alveolar bone resorption (table 1; figure 2). Here, the maxillary and mandibular bone loss in the rats infected with p. gingivalis, t. denticola, and p. gingivalis + t. denticola were significantly greater (p <.05) than that of the sham - infected control group at 7 and 12 weeks (table 1). The maxillary and mandibular bone loss in all infected groups during 12 weeks of periodontal disease was generally greater than 7 weeks of periodontal disease . In addition, mandibular bone loss was generally higher than maxillary bone loss in both buccal and palatal surfaces (table 1). Gingivalis monoinfection induced more palatal mandibular horizontal bone loss area than maxilla at 7 and 12 weeks post - initial infection . In contrast, t. denticola monoinfection generally induced greater palatal and buccal area bone loss than p. gingivalis as well as more mandibular bone loss than maxilla at 7 and 12 weeks post - initial infection . Similarly, mixed infection induced more significant bone loss in both maxilla and mandibles, palatal and buccal surfaces than monoinfection at 7 and 12 weeks post initial infection (table 1). Furthermore, mixed infection induced more mandibular palatal surface horizontal area bone loss than maxillae . In order to confirm our observations of alveolar bone resorption, radiographic analysis of the maxilla and mandible mono- and mixed infection resulted in significantly increased maxillary, mandibular, and total interproximal alveolar bone resorption at 7 weeks (data not shown) and 12 weeks of periodontal disease compared with sham - infected control rats (p <.05) (figure 3). In addition, there was an overall loss in vertical bone height, with associated circumferential angular defects . Furthermore, mixed infection demonstrated a significant increase in maxillary, mandibular, and total vertical bone loss compared to any of the monobacterial and sham - infected control infections (p <.05) (figure 3). In order to determine if the infection protocols induced differing levels of inflammation which could be responsible for the increased alveolar bone resorption observed, sections of the maxilla and mandible of rats infected with p. gingivalis and/or t. denticola during 7 and 12 weeks of periodontal disease were examined at consecutive levels 1, 10, and 20 for inflammation . Mixed microbial infection rats showed more significant histological changes, particularly apical migration of je, rete ridge elongation, pmn density, lymphocytes infiltration, blood vessel density and alveolar bone loss than sham - infected control animals (table 2; figure 4). The sham - infected control rats showed mild inflammation with fewer pmn and lymphocytes, no apical migration, and small rete ridge elongation . Similarly, mixed microbial infection induced significant apical migration of je (p <.01) and dense inflammation in the periodontium compared to p. gingivalis monoinfected rats . In addition, mixed microbial infection rats showed no significant differences in rete ridge elongation, pmn density, lymphocytes infiltration, and blood vessel density compared to p. gingivalis and t. denticola mono - infected rats . P. gingivalis and t. denticola infected rats showed significant histological changes, specifically apical migration of je, alveolar bone loss, pmn density, lymphocytes infiltration, and blood vessel density more than sham - infected control animals (table 2; figure 4). Moreover, p. gingivalis infected rats showed significant infiltration of lymphocytes (p <.05) and blood vessel density in the periodontium (p <.001) compared to mixed microbial infected rats (table 2). This paper explicitly demonstrates an experimental model for mixed microbial infections in periodontal disease, documenting colonization / infection with the p. gingivalis / t . Denticola consortium of oral microorganisms, with (kinetics) induction of periodontal inflammation at 7 and 12 weeks, generation of specific systemic igg immune responses to the infecting pathogens, and stimulation of enhanced alveolar bone resorption in rats . These results also documented, for the first time, the virulence of mixed infections with p. gingivalis + t. denticola in a periodontal disease model . Bacterial synergism in progression from periodontal health to disease has been proposed but few studies have documented bacterial synergism due to the inherent complexity of the subgingival microflora [8, 38]. In the previous study, we had not examined the early induction of periodontal inflammation and assessment of both palatal and buccal horizontal bone loss . Here we demonstrate this early kinetics in a model of periodontal disease at 7 and 12 weeks of disease . The monobacterial infection in rats indicated that p. gingivalis exhibited the ability to colonize / infect the oral cavity with 46 alternate weekly infection schedules (1624 inoculations) during the 712 weeks study establishing a chronic infection . We have shown previously that infecting rats 15 - 16 times with p. gingivalis, over a similar interval of the experiment, resulted in consistent detection of genomic dna in oral microbial samples [25, 31, 35]. Moreover, induction of significant igg immune responses and enhanced alveolar bone loss observed in all rats clearly documents that these rats were infected, even though the rats showed negative pcr reactions for t. denticola . We recognize the limitations in sample collection procedures, as existing with all the current techniques of microbial sampling from the oral cavity . The serum igg antibody levels to monoinfection during 7 and 12 weeks of periodontal disease clearly indicated that p. gingivalis is highly effective in colonization and/or is highly antigenic in the rats when compared to t. denticola . However, we observed an increase in serum igg antibody to t. denticola in p. gingivalis mono - infected rats . While this igg antibody was more than sham - infected controls, it was approximately 1000-fold lower than the homologous igg antibody response to p. gingivalis infection . This could indicate that these bacteria share some common epitopes . The mixed oral infection with p. gingivalis / t . These altered responses could be due to a lowered colonization capacity of the t. denticola within the mixed consortium challenge and/or a decreased ability to multiply in the oral cavity during the infection, thus resulting in a lower magnitude of antigenic challenge, reduced periodontal inflammation, and no robust alveolar bone loss nor virulence synergism . The predominant response following p. gingivalis infection was the igg2b (t helper type 1) and igg1 subclass (t helper type 2), followed by igg2a (th1) and undetectable level of igg2c antibody indicating a stimulation of both th1 and th2 activities in development of the humoral immune response to bacterial infection . Similarly, the predominant response following t. denticola monoinfection was the igg2b subclass, followed by igg1, igg2c and undetectable level of igg2a antibody in rats suggesting a mixed th1- and th2-responses to oral infection . In contrast, igg1 antibody titer was much higher in mice to t. denticola infection . Despite the high bacterial specific igg antibody levels during 7 and 12 weeks of infection, there was no significant immune protection from alveolar bone loss in rats as well as in several previous studies [39, 40] suggesting complex mechanisms of antibody protection . Furthermore, p. gingivalis recombinant hemagglutinin b immunization or immunized and infected rats induced igg subclass responses (igg1 = igg2a> igg2b> igg2c) suggesting a mixed th1 and th2 responses and immunized rats had less alveolar bone loss indicating a protective immune response [41, 42]. Similarly, immunization with p. gingivalis whole cells induced high - titer serum igg2a (th2), moderate - titer igg2b (th1) and low - titer igg1 (th2) responses and immunization with rgpa - kgp cysteine proteases of p. gingivalis induced high - titer serum igg2a (th2) responses which restricted colonization and decreased periodontal bone loss indicating a protective immune response in the rat . While differences in horizontal (palatal and buccal surface) and interproximal alveolar bone resorption levels were observed following monoinfection with p. gingivalis and t. denticola dependent upon both the differences in the sites of the samples as well as the techniques for measurements, we could not easily compare the magnitude of alveolar bone resorption between these individual bacteria . Denticola significantly increased interproximal as well as horizontal alveolar bone loss compared to mono - infections . This increased bone loss may be related to enhancement of expression of the virulence of individual bacteria by cooperative abilities of their extracellular potent proteinases (p. gingivalis rgpa, rgpb, kgp gingipains cysteine proteinase) (t. denticola chymotrypsin - like protease, phospholipase c, oligopeptidase, endopeptidase and cystalysin) to affect host systems through specific cleavage of cell surface receptors and the inactivation of host - defense proteins [18, 20]. In addition, mixed infection with p. gingivalis + t. denticola exhibits significant virulence synergism in abscess formation and mortality in mouse pneumonia model and mouse abscess model [21, 22]. The analysis of the data have clearly shown the following: (i) mono- and mixed microbial colonization / infection of human oral pathogens in rat oral cavity during 7 weeks of periodontal disease (gained access to the oral epithelium), (ii) generation of a specific serum igg antibody responses (as early as 7 weeks) reflecting the oral infection (engagement of systemic host response mechanisms), (iii) induction of enhanced horizontal and interproximal alveolar bone resorption in rats with mixed infection as expected (direct result of local infection), (iv) induction of inflammatory response (apical migration of je, rete ridge elongation, crestal alveolar bone loss, pmns) consistent with established characteristics of periodontal disease, and (v) no synergistic virulence observed with p. gingivalis / t . This mixed infection model will provide an opportunity for further studies to clarify the characteristics and alterations of the host response profiles such as proinflammatory cytokines and matrix metalloproteinases in periodontal tissues that relate to osteoclastic alveolar bone loss in response to mixed infections.
Sleep disturbance is associated with many complications and decreased efficiency during the day, increased somnolence and reaction time, and reduced power of making correct and timely decisions (1). Sleep and poor quality sleep can result from physical discomfort and be a side effect of drugs and mental disorders, such as depression, anxiety, and schizophrenia (1). Ohayon & reynolds (2), in their 2009 study, showed that half of the patients with sleep disorders also had some symptoms of a mental disorder, such as anxiety, and mood disorders, but depression was the most frequent one . The distorted night sleep symptoms in depressed patients have been described extensively in clinical trials . Major depressive disorder (mdd) is a mental state characterized by depressed mood, loss of energy, loss of interest in usual activities, anhedonia, and unrealistic negative thoughts about oneself, the future, and social isolation (3). The median 12-month prevalence of mdd in 42 studies in various countries was reported to be 5.3% by a recent review (4). In addition, depressive disorders cause a significant negative impact on daily functioning (5). It is usually a matter of several common scales for mdd associated with sleep problems (6). The prevalence of sleep disturbances in patients with mdd has been reported to range from 10 to 60% . It varies because of various definitions of sleep disturbances and data - collection methodologies (7). The association between sleep disturbances and mdd was reported that 41% of depressed patients had sufficient insomnia for an additional dsm - iv diagnosis of insomnia (8). Ford et al . In their study showed that 14% of patients with persistent insomnia suffered from depression at the same time (9), and another study reported that 11% of the patients in a sleep clinic had major depression (10). In addition, lundt showed that there was a relationship between severity of sleepiness and severity of depression (11). Therefore, it was suggested that sleep disturbances could be a potential marker for mdd . Sleep disorders can be used to explain many cognitive damages associated with depression, including negative or threatening interpretations regarding ambiguous stimuli (12). Chronic sleep deprivation can increase the stress response as well (13), which is one of the strongest and most reliable findings in depression . All of this evidence indicates that damage from sleep should be considered as a risk factor in the development of depression . Despite the importance of sleep disorders in depression diagnosis and being in fact one of the most important symptoms of depression, because of our lack of understanding, it has always been ignored in treatment . As a result, one reason for this is the fact that few tools exist to accurately measure the quality of sleep that can be used to better detect disorders found in this field (14). One of the widely used scales for sleep quality is the pittsburgh sleep quality index (psqi). Pittsburgh sleep quality questionnaire, which is used to evaluate sleep latency, sleep duration, and habits leading to good quality sleep, includes some components that deal with sleep disorders, medications, reduction in efficiency of daily performance, where total scores resulting from the study of these seven components provide a picture of quality and quantity of one s sleep (15). The epworth sleepiness scale (ess) sleep test questionnaire also is used to measure daytime sleepiness and a guide to sleep problems and sleep disorders . Unlike the present study, that is evaluating psychometric properties of the persian translation of the pittsburgh sleep quality index in depressed patients, morteza nazifi and his colleagues studied staff working at the healthcare for this feature in a wider range (16). Since the pittsburgh sleep quality questionnaire is capable of covering different stages of sleep, it is regarded as one of the best ones available, and checking for its validity and reliability amongst depressed patients is a step in this direction . In view of limitations of sample size or studied population in previous psychometric studies (16, 19, 2527), the need for a psqi study with a larger sample of depressed patients was needed . So, the current study is concentrated on the reliability and validity of a special instrument to measure sleep quality (psqi). The aim of this study was to determine the reliability and validity of the persian version of the pittsburgh sleep quality index (psqi) and the epworth sleepiness scale (ess) questionnaire in patients with depression . In this case - control study that was carried out in 2014, 93 patients referred to outpatient clinics of rasoul akram and iran hospital, and tehran psychiatric institute who were diagnosed with unipolar depression (mdd), bipolar type one (bid) or two (biid) and dysthymia based on the structured clinical interview for dsm disorders (scid), were enrolled in the study after obtaining their informed consent . Also, 100 healthy participants enrolled in the study as the control group . The pittsburgh sleep quality index includes seven components of subjective sleep quality, sleep latency, sleep duration, sleep efficiency, sleep disturbances, the use of sleep medications and day time dysfunctions provide a total score of these seven components that allows us to better understand the quality and quantity of one s sleep . The pittsburgh sleep quality index is a self - reporting instrument consisting of nine questions designed to measure the quality of sleep disorders in a period of one month . The scale scores range from 0 to 21, with higher scores indicating poor quality of sleep and scores less than 5 considered as high quality of sleep (15). The index is a summarized, accessible, and reliable tool for measuring sleep quality that has high internal consistency (cronbach alpha = 0.83) and test - retest reliability (0.850.87). It also means people with poor and high sleep quality with diagnostic sensitivity of 0.89 (coefficient of kapa = 0.75, p <0.001), respectively (15). In addition, epworth sleep scale (ess), which is a subjective rating scale, was used to measure levels of daily sleep . Respondents are required to score the possibility of falling asleep in eight situations in their daily lives on a scale from 0 (never) to 3 (high risk of sleep). The scale scores range from 0 to 24, and a higher score means more irregular sleep . Epworth sleep scale (ess) has been used widely to measure daytime sleepiness in older populations . In addition, patients with sleep disorders had significantly higher scores on this scale than the control group (17). Beck depression inventory-2, is suitable for people who are more than 13 years old and have at least a sixth - grade education . The questionnaire contains 21 indicators, all of which are related to the symptoms of major depression, and it is designed to check the status of emotion, cognition, obvious behavior, physical signs and symptoms of internal scale from lowest to highest marks allocated . At this scale, zero to nine levels indicate normal depression, scores of 10 to 16 indicate symptoms of mild depression, 17 to 29 indicate moderate depression, and scores of 30 or greater are indicative of severe depression (18). The persian versions of two sleep questionnaires that used pittsburg sleep quality index (psqi) and epworth sleepiness scale (ess) were used in previous studies (19). First, the patients with a diagnosis of unipolar, bipolar, major depression, or dysthymia based on structured clinical interview (scid) were selected, and they responded to the brief symptom inventory of depression scale and beck depression inventory-2, then the persian version of the pittsburgh sleep quality index questionnaire was distributed to them, and results were compared with the pittsburgh sleep quality index questionnaire, completed by a control group of 190 people selected from the staff of the tehran institute of psychiatry to assess the reliability and validity in this population . At the same time, patients were also assessed for daytime sleepiness with ess questionnaire . Since results of this questionnaire can be effective in this study and, in particular, because daytime sleepiness and cognitive impairment caused by it could produce anxiety and depression and also intensify anxiety and depression in these people . Therefore, it was necessary to translate the english version into farsi and then translate it back into english, and, at the same time, the reliability and validity of the questionnaire in this population could be examined . Inclusion criteria of study were diagnosis of unipolar depression, bi - polar, or dysthymia through a structured clinical interview and lack of co - morbidity with other diagnoses, both male and female genders, having knowledge of at least reading and writing . Exclusion criteria of the study were having other disorders associated with medical and chronic psychiatric and physical disorders, pregnancy, having two jobs with a night shift or a night shift job, medical drugs, or substance abuse . We used the pearson coefficient to determine test - retest reliability, and cronbach s alpha was used to determine the reliability of the test . Confirmatory factor analysis was used to determine the actual structure of the scale and to determine the validity of the instrument . We also used the t - test to compare the difference between the two means of all quantitative variables in both the healthy and depressed groups . In this case - control study that was carried out in 2014, 93 patients referred to outpatient clinics of rasoul akram and iran hospital, and tehran psychiatric institute who were diagnosed with unipolar depression (mdd), bipolar type one (bid) or two (biid) and dysthymia based on the structured clinical interview for dsm disorders (scid), were enrolled in the study after obtaining their informed consent . Also, 100 healthy participants enrolled in the study as the control group . The pittsburgh sleep quality index includes seven components of subjective sleep quality, sleep latency, sleep duration, sleep efficiency, sleep disturbances, the use of sleep medications and day time dysfunctions provide a total score of these seven components that allows us to better understand the quality and quantity of one s sleep . The pittsburgh sleep quality index is a self - reporting instrument consisting of nine questions designed to measure the quality of sleep disorders in a period of one month . The scale scores range from 0 to 21, with higher scores indicating poor quality of sleep and scores less than 5 considered as high quality of sleep (15). The index is a summarized, accessible, and reliable tool for measuring sleep quality that has high internal consistency (cronbach alpha = 0.83) and test - retest reliability (0.850.87). It also means people with poor and high sleep quality with diagnostic sensitivity of 0.89 (coefficient of kapa = 0.75, p <0.001), respectively (15). In addition, epworth sleep scale (ess), which is a subjective rating scale, was used to measure levels of daily sleep . Respondents are required to score the possibility of falling asleep in eight situations in their daily lives on a scale from 0 (never) to 3 (high risk of sleep). The scale scores range from 0 to 24, and a higher score means more irregular sleep . Epworth sleep scale (ess) has been used widely to measure daytime sleepiness in older populations . In addition, patients with sleep disorders had significantly higher scores on this scale than the control group (17). Beck depression inventory-2, is suitable for people who are more than 13 years old and have at least a sixth - grade education . The questionnaire contains 21 indicators, all of which are related to the symptoms of major depression, and it is designed to check the status of emotion, cognition, obvious behavior, physical signs and symptoms of internal scale from lowest to highest marks allocated . At this scale, zero to nine levels indicate normal depression, scores of 10 to 16 indicate symptoms of mild depression, 17 to 29 indicate moderate depression, and scores of 30 or greater are indicative of severe depression (18). The persian versions of two sleep questionnaires that used pittsburg sleep quality index (psqi) and epworth sleepiness scale (ess) were used in previous studies (19). First, the patients with a diagnosis of unipolar, bipolar, major depression, or dysthymia based on structured clinical interview (scid) were selected, and they responded to the brief symptom inventory of depression scale and beck depression inventory-2, then the persian version of the pittsburgh sleep quality index questionnaire was distributed to them, and results were compared with the pittsburgh sleep quality index questionnaire, completed by a control group of 190 people selected from the staff of the tehran institute of psychiatry to assess the reliability and validity in this population . At the same time, patients were also assessed for daytime sleepiness with ess questionnaire . Since results of this questionnaire can be effective in this study and, in particular, because daytime sleepiness and cognitive impairment caused by it could produce anxiety and depression and also intensify anxiety and depression in these people . Therefore, it was necessary to translate the english version into farsi and then translate it back into english, and, at the same time, the reliability and validity of the questionnaire in this population could be examined . Inclusion criteria of study were diagnosis of unipolar depression, bi - polar, or dysthymia through a structured clinical interview and lack of co - morbidity with other diagnoses, both male and female genders, having knowledge of at least reading and writing . Exclusion criteria of the study were having other disorders associated with medical and chronic psychiatric and physical disorders, pregnancy, having two jobs with a night shift or a night shift job, medical drugs, or substance abuse . We used the pearson coefficient to determine test - retest reliability, and cronbach s alpha was used to determine the reliability of the test . Confirmatory factor analysis was used to determine the actual structure of the scale and to determine the validity of the instrument . We also used the t - test to compare the difference between the two means of all quantitative variables in both the healthy and depressed groups . In this study, 93 depressed patients and 100 patients in the control group were examined . The mean age of depressed patients was 32.3 (sd = 7.1), and their ages ranged from 21 to 61 (median: 30), and the average age in the control group was 34.2 (sd = 9.8), with people s ages in the range of 18 to 62 (median: 32). In depressed patients group, 34 women (36.6%) and 59 men (63.4%) and 66 women in the control group (66.0%) and 34 males (34.0%) were enrolled . 1: time to bed twenty (21.5%) of those went to bed between 20 and 22 as their bed time . Forty - seven people (50.4%) went to bed between 23 and 24, and 26 of them (28.0%) said that they go to bed between the hours of 1 and 4:00 a.m. question no . 2: time between going to bed and falling into sleep an average of 40 minutes (sd = 35) passed before the subjects went to sleep after getting into bed . The average time took 30 minutes and in a range of 0 to 180 minutes . Based on the psqi encoding, 16 patients (17.2%) received code 0 (under 15 minutes), 43 (46.2%) coded 1 (between 16 and 30 minutes), 24 (25.8%) coded 2 (31 to 60 minutes) and 10 (10.8%) coded 3 (over 60 minutes). 3: wake - up time as shown in table 2, most people woke up between 6:00 and 8:00a.m . 4: amount of night sleep average hours of night sleep amongst those surveyed was 7.6 hours (sd = 2.3) and in the range of 3 to 12 hours (median 6 hours) (table 3). 5: sleep problems table 4 describes sleep problems based on the fifth question in the pittsburgh sleep quality index (psqi) in depressed patients surveyed . These questions examined the medications used to help patients sleep and daily functioning disorders based on the pittsburgh sleep quality index (psqi) in depressed patients (table 5). 9: sleep quality in this question, respondents were asked to rank the quality of their sleep in the past month . Six patients (6.5%) indicated the quality of their sleep as very good, 37 (39.8%) recognized it as relatively good, 37 (39.8%) knew it as relatively poor, and 13 (14.0%) described it as very bad . Parts 1, 2, 3, and 6 of psqi questionnaire are described under questions 9, 2, 4, and 6, respectively . The average percentage of sleep efficiency, as defined by the fourth component of psqi was 90.0% (sd = 8.2) and in the range of 60 to 100% (median 92.3%). Seventy - seven patients (28.4%) had a sleep efficiency higher than 85% (coded 0). Sleep efficiency of 11 (11.8%) was between 75 and 84% (code 1). Three patients (3.2%) had it between 65 and 74% of sleep efficiency (code 2) and in 2 patients (2.2%), sleep efficiency was less than 65% (code 3). Five patients (5.4%) received code 0 (score of 0), while 69 patients (74.2%) were coded 1 (grades 1 to 9), 13 people (14.0%) coded 2 (grades 10 to 18), and 6 people (6.5%) coded 3 (grades 19 to 27), respectively . Eight patients (8.6%) received code 0 (score of 0), 46 people (49.5%) coded 1 (grades 1 or 2), 30 (32.3%) coded 2 (grades 3 or 4) and 9 people (9.7%) coded 3 (grades 5 or 6), respectively . The mean of psqi total score of surveyed people was 8.1 (sd = 3.5), which was in the range of 1 to 18, and thus, only 12 (12.9%) did not receive a score of less than 5 . Percentiles 25, 50 (middle), and 75 consisted of 6, 8 and 10, respectively . The mean psqi score in the control group was 5.6 (sd = 3.1), and in the range of 0 to 15, which was significantly lower than that of depressed patients (t = 5.142, p <0.001). In this group, 37 patients (37.0%) had a score below 5 and percentiles 25, 50, and 75 consisted of 3, 5, and 7, respectively . Cronbach s alpha coefficient of the questionnaire for 16 titles (regardless of questions 1 and 3) and with regard to coding of questions 2 and 4 was 0.811 . With the elimination of the fourth question, average scores of people on the beck depression inventory (bdi - ii) was 27.1 (sd = 10.2) and 18.0 (sd = 3.8) for epworth sleep scale (ess). The pearson correlation coefficient was 0.299 (p= 0.004) between scores of psqi and 0.264 (p = 0.011) between ess and psqi . In order to do the exploratory factor - analysis of the questionnaire, principal component and oblimin rotation the kmo index of 0.598 and bartlett test of sphericity were statistically significant (p <0.001), which showed the relative sufficiency of the sample . First, three factors were extracted that explained a total variance of 75.1%, but only two items were put into the second factor, and one item was put into the third one . In the next stage, the analysis was done to find a single factor . This single factor with an eigen value of 2.652 would explain only 37.9% of variance and the lowest load factor was 0.306, while the minimum load factor was higher than 0.5 . The first factor, with an eigen value of 2.652, 37.9% of the variance and the second factor with an eigen value of 1.426, would explain only 20.4% of variance (in general, 58.3% of variance explained). Load factors are shown in table 6 . As it can be seen in the table, based on the load factor, at least 0.5 of third factor this item is placed into the second factor . On the other hand, in both factors thus, the first factor can be considered as the general agent, and the second one is the quantitative (yield) sleep factor . In this study, 93 depressed patients and 100 patients in the control group were examined . The mean age of depressed patients was 32.3 (sd = 7.1), and their ages ranged from 21 to 61 (median: 30), and the average age in the control group was 34.2 (sd = 9.8), with people s ages in the range of 18 to 62 (median: 32). In depressed patients group, 34 women (36.6%) and 59 men (63.4%) and 66 women in the control group (66.0%) and 34 males (34.0%) were enrolled . Question no . 1: time to bed twenty (21.5%) of those went to bed between 20 and 22 as their bed time . Forty - seven people (50.4%) went to bed between 23 and 24, and 26 of them (28.0%) said that they go to bed between the hours of 1 and 4:00 a.m. question no . 2: time between going to bed and falling into sleep an average of 40 minutes (sd = 35) passed before the subjects went to sleep after getting into bed . The average time took 30 minutes and in a range of 0 to 180 minutes . Based on the psqi encoding, 16 patients (17.2%) received code 0 (under 15 minutes), 43 (46.2%) coded 1 (between 16 and 30 minutes), 24 (25.8%) coded 2 (31 to 60 minutes) and 10 (10.8%) coded 3 (over 60 minutes). 3: wake - up time as shown in table 2, most people woke up between 6:00 and 8:00a.m . 4: amount of night sleep average hours of night sleep amongst those surveyed was 7.6 hours (sd = 2.3) and in the range of 3 to 12 hours (median 6 hours) (table 3). 5: sleep problems table 4 describes sleep problems based on the fifth question in the pittsburgh sleep quality index (psqi) in depressed patients surveyed . These questions examined the medications used to help patients sleep and daily functioning disorders based on the pittsburgh sleep quality index (psqi) in depressed patients (table 5). 9: sleep quality in this question, respondents were asked to rank the quality of their sleep in the past month . Six patients (6.5%) indicated the quality of their sleep as very good, 37 (39.8%) recognized it as relatively good, 37 (39.8%) knew it as relatively poor, and 13 (14.0%) described it as very bad . Parts 1, 2, 3, and 6 of psqi questionnaire are described under questions 9, 2, 4, and 6, respectively . The average percentage of sleep efficiency, as defined by the fourth component of psqi was 90.0% (sd = 8.2) and in the range of 60 to 100% (median 92.3%). Seventy - seven patients (28.4%) had a sleep efficiency higher than 85% (coded 0). Sleep efficiency of 11 (11.8%) was between 75 and 84% (code 1). Three patients (3.2%) had it between 65 and 74% of sleep efficiency (code 2) and in 2 patients (2.2%), sleep efficiency was less than 65% (code 3). Five patients (5.4%) received code 0 (score of 0), while 69 patients (74.2%) were coded 1 (grades 1 to 9), 13 people (14.0%) coded 2 (grades 10 to 18), and 6 people (6.5%) coded 3 (grades 19 to 27), respectively . Eight patients (8.6%) received code 0 (score of 0), 46 people (49.5%) coded 1 (grades 1 or 2), 30 (32.3%) coded 2 (grades 3 or 4) and 9 people (9.7%) coded 3 (grades 5 or 6), respectively . The mean of psqi total score of surveyed people was 8.1 (sd = 3.5), which was in the range of 1 to 18, and thus, only 12 (12.9%) did not receive a score of less than 5 . Percentiles 25, 50 (middle), and 75 consisted of 6, 8 and 10, respectively . The mean psqi score in the control group was 5.6 (sd = 3.1), and in the range of 0 to 15, which was significantly lower than that of depressed patients (t = 5.142, p <0.001). In this group, 37 patients (37.0%) had a score below 5 and percentiles 25, 50, and 75 consisted of 3, 5, and 7, respectively . Cronbach s alpha coefficient of the questionnaire for 16 titles (regardless of questions 1 and 3) and with regard to coding of questions 2 and 4 was 0.811 . With the elimination of the fourth question, average scores of people on the beck depression inventory (bdi - ii) was 27.1 (sd = 10.2) and 18.0 (sd = 3.8) for epworth sleep scale (ess). The pearson correlation coefficient was 0.299 (p= 0.004) between scores of psqi and 0.264 (p = 0.011) between ess and psqi . In order to do the exploratory factor - analysis of the questionnaire, principal component and oblimin rotation were used . The kmo index of 0.598 and bartlett test of sphericity were statistically significant (p <0.001), which showed the relative sufficiency of the sample . First, three factors were extracted that explained a total variance of 75.1%, but only two items were put into the second factor, and one item was put into the third one . In the next stage, the analysis was done to find a single factor . This single factor with an eigen value of 2.652 would explain only 37.9% of variance and the lowest load factor was 0.306, while the minimum load factor was higher than 0.5 . The first factor, with an eigen value of 2.652, 37.9% of the variance and the second factor with an eigen value of 1.426, would explain only 20.4% of variance (in general, 58.3% of variance explained). Load factors are shown in table 6 . As it can be seen in the table, based on the load factor, at least 0.5 of third factor, this item is placed into the second factor . On the other hand, in both factors, the second and fourth components are loaded . Thus, the first factor can be considered as the general agent, and the second one is the quantitative (yield) sleep factor . The aim of this study is to validate the persian version of the pittsburgh sleep quality index (psqi), comparing two different groups of individuals (healthy and depressed patients) by both questionnaire scores of psqi and ess measures . Whereas one prospective study showed that people with sleep disturbances are at risk for depression (20), another study has reported that both sleep problems and depression either were connected to each other or two separated diseases with the same etiology (21). Most depressed patients have sleep problems, specially having trouble falling or staying asleep and early morning awakenings (22). Also, there are many depressed patients who frequently complain about increased daytime sleepiness or daytime fatigue (23). Nyer et al.s study showed that depressed students with sleep disturbance may have more anxiety symptoms, daytime hyperarousal, and functional impairments than depressed students without sleep disturbances (24). The results of our study showed the internal consistency checks psqi, in our study, cronbach s alpha coefficient of the questionnaire to 16 (regardless of questions 1 and 3) and with regard to coding, questions 2 and 4, was 0.811 . With the elimination of the fourth question, this index increased up to 0.821 the fourth question of psqi your actual sleep during the night? May be answered differently in different situations, especially which of responding to this question are very widespread in the individuals studied . Therefore, the question must be asked in another way .. also, the majority of patients, in response to this question, expressed a numerical range such as 5 to 6 hours, and it shows the response of some patients . Asking this question means that the average hours of sleep at night people were surveyed . For questions 1 and 3 as well as the situation was similar in the two questions about the time of arrival to bed and waking up the patients were studied . In this study, the validity and reliability of the questionnaire were reported as being acceptable . The results of our study showed that the average score of psqi people surveyed was 8.1 (sd = 3.5), which was in the range of 1 to 18, and thus, only 12 (12.9%) received less a score of 5 . The results of our study also showed that average scores on the beck depression inventory (bdi - ii) were 27.1 (sd = 10.2) epworth sleepiness scale (ess) 18.0 (sd = 3.8), respectively . Pearson correlation coefficient between the scores of psqi and bdi - ii was 0.299 (0.004 = p), and the scores of psqi and ess were 0.264 (0.011 = p), so there was agreement between the questionnaires . In a study for evaluation the validity of italian version of psqi on 50 individuals in five different groups (healthy young and elderly, sleep apnea syndrome patients, depressed patients, individuals with dementia), the results showed an overall reliability coefficient (cronbach s alpha) of 0.835, indicating a high degree of internal consistency . The mean psqi global score showed significant differences between groups, with an impaired overall quality of sleep in patients groups with respect to both the healthy groups and italian version of psqi had an overall efficiency comparable to the mother language version and differentiate et al.s study, the japanese version of the pittsburgh sleep quality index (psqi - j) was used, and the psqi - j global and component mean scores were significantly higher in psychiatrically disordered subjects than control subjects, except for the component of sleep duration (26). Results of our study showed that the correlation coefficients between the psqi global and component scores were statistically significant . The psqi global and component mean scores were significantly higher in psychiatrically disordered subjects than control subjects . In study conducted by yazdi et al . The results obtained from the questionnaire showed ess, psqi, and bdi - ii double together and have a positive linear correlation . In our study, patients evaluated sleep quality in terms of severity of depression, and, according to the beck questionnaire, there was a positive linear relationship . The results also showed that the severity of daytime sleepiness and impaired quality of sleep also were correlated strongly . Pearson coefficient showed average scores of people on the beck depression inventory (bdi - ii) was 27.1 (sd = 10.2) and 18.0 (sd = 3.8) for epworth sleep scale (ess). Results of our study showed pearson correlation coefficient to be 0.299 (p = 0.004) between psqi and bdi - ii scores and 0.264 (p = 0.011) between psqi and ess . To study the factorial structural of psqi, the results showed that in the psqi questionnaire, it is possible to regard the first factor as a general one and the second factor as the quantitative agent (yield) of sleep . Studies performed by using the pittsburgh sleep quality index have some limitations including small sample or heterogeneity in terms of demography, which decrease the researcher s ability in terms of finding research support for all of the sub - scales and generalizing their findings to a larger population . In addition, a review of the literature showed that only a few studies have specifically examined the psychometric properties of this measure (28). However, given the modest sample size of our study, the validity of the results for the psqi was comparable to or better than that of previous studies . In our study, cronbach s alpha coefficient psqi questionnaire was up to 0.821 . According to the psqi and bdi - ii scores, results of our study showed psqi is a useful, valid, and reliable tool for the assessment of sleep quality, and the persian version of the questionnaire provides a good and reliable differentiation between normal and pathological groups, with higher scores reported by people characterized by impaired objectively - evaluated sleep quality . The present study supports the utility of the persian version of psqi as a reliable and valid measure for subjective sleep quality in clinical practice and research.
The intestinal epithelium is the largest surface area of the human body in direct contact with the external environment and exposed to a multitude of foreign microorganisms, macromolecules, and xenobiotics . As such, a fine regulation of gut mucosal immune functions is needed to develop a prompt and self - limiting inflammatory response against harmful pathogens but also to maintain normal gut homeostasis when no potential threat is sensed . Complex interactions between different cell types, effectors of both innate and adaptive immunity, regulate the inflammatory status within the intestinal mucosa . Pro- and anti - inflammatory cytokines represent key players in shaping this network and maintaining the communication among various cell types; balance among these mediators appears to be critical for gut immune homeostasis . In fact, a broad wealth of evidence demonstrates the importance of cytokine dysregulation in the onset of inflammatory conditions of the gastrointestinal tract . In particular, ibd, namely, crohn's disease (cd) and ulcerative colitis (uc), is characterized by a significant dysregulation of cytokine production, with, in general, an overabundance of proinflammatory mediators . For example, it has been shown that in the inflamed mucosa of ibd patients and colitis models, there is a perturbation of the balance between the proinflammatory cytokine, il-1, and its naturally occurring antagonist, the il-1 receptor antagonist (il-1ra), and that restoring this balance by exogenous administration of il-1ra ameliorates intestinal inflammation [2, 3]. As in the case of il-1, other members of the il-1 family, such as il-18, have also been implicated in the initiation and perpetuation of chronic intestinal inflammation [46]. The il-1 family of cytokines is constantly expanding, and, very recently, new members have been identified and studied, such as il-1f11, il-1f6/8/9, il-1f7, and il1f10, respectively known as il-33, il-36, il-37, and il-38 . To date, of these novel members, il-33 is the best characterized in terms of function and biological effects since its initial description in 2005 . However, controversy still exists as to its precise role in intestinal disorders, particularly in the development of ibd . Thus, the aim of this review is to summarize what is already established regarding the role of il-33 in the gi tract, while providing insight into the potential role of this novel il-1 family member in the pathogenesis of chronic intestinal inflammation . In 2003, a novel 30 kd protein, localized the nuclei of endothelial cells, was identified and shown to be highly expressed in high endothelial venules of tonsils, peyer's patches, and lymph nodes . The authors recognized, within the amino - terminal part of this molecule (aa 1160), a novel homeodomain - like helix - turn - helix (hth) dna - binding domain . As such, this protein was hypothesized to possess nuclear factor function, critical for the induction of a lymphatic endothelium phenotype, and was therefore coined nuclear factor - high endothelial venules two years later, nf - hev was identified as a novel member of the il-1 family, shown to be the ligand for the former orphaned receptor, st2, and renamed il-1f11 or il-33 . In this first report, il-33 was described as a potent enhancer of th2 responses, inducing the production of il-5 and il-13 . Il-33 was reported to be widely expressed in different cell types and within most organs throughout the body . In fact, il-33 has been detected in cells of both hematopoietic origin, particularly in restricted populations of professional antigen presenting cells such as macrophages and dendritic cells, and in several different cell types of nonhematopoietic origin such as fibroblasts, adipocytes, smooth muscle cells, endothelial cells, bronchial and intestinal epithelial cells . Initially, it was thought that il-33 was synthesized as a full - length 30 kd protein (full - length il-33, f - il-33) and processed by caspase-1 upon inflammasome activation, resulting in an alleged 18 kd bioactive peptide in a similar fashion to the other major il-1 family members, such as il-1 and il-18 . However, further investigation by three independent research groups revealed that the inflammasome paradigm for il-33 did not occur in the in vivo setting and, instead, demonstrated that f - il-33 possessed full bioactivity, while proapoptotic caspase-3 and -7 processed f - il-33 into less bioactive forms of 2022 kd (cleaved il-33, c - il-33) [1012]. More recently, f - il-33 has been shown to serve as a substrate for neutrophil elastase and cathepsin g, resulting in 1822 kd peptides with an increased bioactivity of tenfold, suggesting a possible extracellular mechanism to amplify the effects of il-33 during inflammatory conditions . To add further complexity to this scenario, an alternative splice variant of il-33 (spil-33) has been described that is 5 kd smaller than f - il-33 and lacks the exons cleavable by caspases, but possesses similar bioactivity to f - il-33 . Figure 1 summarizes the current knowledge regarding the different il-33 isoforms / splice variants and their bioactivity . As previously mentioned, il-33 exerts its biological effects through the binding of its receptor, st2, also known as il-1 receptor - like 1 (il1rl1), belonging to the toll - il-1 receptor (tir) superfamily . St2 exists in two different splice variants, leading to the synthesis of proteins with opposite biological functions: st2l, a transmembrane receptor that activates downstream signaling upon il-33 recognition, and sst2, a soluble molecule that likely serves as a decoy receptor by binding il-33 and decreasing its availability to st2l, the il-33 signaling receptor . Similar to other tir receptors, st2l requires pairing to a coreceptor in order to initiate the downstream cell signaling cascade . As such, the il-33 receptor complex consists of st2l and the il-1 receptor accessory protein (il1racp), a tir member also involved in il-18 signaling . St2 and il1racp interact through their tir domain with myd88, traf6, and irak1/4, eventually leading to the activation of transcription factors, such as nf-b and ap-1, which promote the production of several proinflammatory mediators . (sigirr) or tir8, can also dimerize with st2 and likely acts as a negative regulator of the il-33/st2 signaling pathway, ultimately reducing il-33's biological effects . To date, a very limited amount of information is available regarding the biologic and pathophysiologic relevance of il-33 isoforms / splice variants, st2 splice variants, and alternative st2/sigirr signaling . Since its first description, il-33 has been reported to be localized in barrier epithelia within organs / tissues in direct contact with the external environment, including the skin, airway, and gut epithelia, suggesting a possible role of this cytokine in early immune responses against invasive pathogens . Moreover, several studies consistently show that normal mice injected with recombinant il-33 develop a marked epithelial cell hyperplasia in the pulmonary and gi tracts, together with an eosinophilic and mononuclear infiltration into the lamina propria, specifically localized in these barrier organs / tissues [18, 19]. Interestingly, the production of a thick mucus layer is one effective mechanism aimed to enhance epithelial barrier function and infers protection of these mucosal organs . It is commonly thought that these specific effects on intestinal epithelial cells are mediated by the th2 cytokine il-13 [20, 21], which is abundantly overexpressed after il-33 stimulation / administration; however, the possibility that il-33 per se promotes epithelial differentiation towards a secretory type it may not be ruled out . In fact, il-33 is also a potent inducer of th2 cytokines that are pivotal in mounting potent immune responses against helminthes and fungi; in fact, early papers exploring il-33 function have pointed out its fundamental role in eliminating intestinal parasites . For example, trichuris muris, a nematode capable of infesting the gi tract, induces the production of high levels of il-33 from the infected ceca of experimental animals . In this experimental setting even though a significant increase of nk cells was detected in mesenteric lymph nodes (mlns) from scid and wild - type animals treated with il-33, parasite clearance appeared to be mediated through t- and b - cell activation, as scid mice failed to eliminate t. muris upon il-33 administration . Il-33 appeared to have similar protective functions, enhancing host responses against other parasitic and bacterial threats, such as toxoplasma gondii, pseudomonas aeruginosa, and leptospira infections, in different organ systems . More recently, a growing body of evidence has shown that il-33's protective effects against parasites are also mediated by a newly identified innate immune cell population, uniquely coined nuocytes, named after the 13th letter of the greek alphabet, making reference to their ability to produce high levels of il-13 . In fact, these innate effector leukocytes display unique phenotypic characteristics and are not aligned with any other known mature leukocyte population . They express icos, cd45, st2, and il-17br and respond to il-33 and/or il-25 stimulation with a significant increase in il-13 expression . In addition, the transcription factor, ror, has been described to be necessary for their development . Nuocytes appear to be early initiators of th2 responses, and their activation is pivotal in eliciting worm clearance after nippostrongylus brasiliensis infection, but a th2 response is not required for nuocyte activity, as their development occurs in th2 cytokine deficient mice and in rag2 knockout mice [19, 26]. At the same time, similar il-33/il-25-responsive innate effector cell populations have been described by others . Characterized a population, namely, natural helper cells (nhc), identified by the presence of cell surface st2, c - kit, sca-1, and il-7r, that reside in mesenteric adipose tissue and are organized in fat - associated lymphoid clusters . Identified similar cells, but not expressing either sca-1 or c - kit, which were coined innate helper 2 (ih2) cells and that are widely distributed in mouse mln, spleen, liver, and bone marrow . Together, these novel cell populations and others (e.g., multipotent progenitor type 2 (mpp) cells) are termed innate lymphoid cells (ilcs) and share significant biologic similarities . As such, it may be hypothesized that ilcs represent different maturation steps or different differentiation phenotypes from the same hematopoietic lineage . Nonetheless, nuocytes, nhc, and ih2 cells are induced by il-33 and are pivotal in mounting effective immune responses against helminthes characterized by the overproduction of il-5 and il-13 and the induction of histopathologic changes in the gut mucosa, including epithelial / goblet cell hyperplasia and eosinophilic infiltration . Whether or not these novel innate cell populations are the only responsible for the induction of these pathologic features is still debatable, as it has been clearly shown that il-33 induces the production of chemokines for eosinophils and may also directly affect epithelial cell biology . It seems reasonable that during parasitic infestation, in order to induce a prompt innate response, cells constituting intestinal barrier, such as epithelial cells and macrophages / dendritic cells, act as a major source of il-33/il-25; however, at present, no experimental data are available to confirm this hypothesis; novel experimental tools may provide important insights to this topic; in fact, mice genetically engineered to have the -galactosidase - neomycin resistance fusion gene inserted in il-33 intron 1, the il-33-lacz gene trap reporter mice, were recently described and used to specifically measure and localize il-33 promoter activity within mouse body; indeed, these animals may be a valuable tool to identify the cellular sources of il-33 during health and disease conditions, such as parasitic infestations . As a growing body of evidence confirms the importance of il-33-induced ilcs in the protection against parasites, to date, the potential role of these novel cells in spontaneous inflammatory conditions has not been fully characterized in models of intestinal inflammation . Il-1 family members, coordinating early innate responses and later adaptive immune responses, have been shown to play an important role in the pathogenesis of chronic intestinal inflammation, characterizing ibd [31, 32]. As such, il-33 appeared to be a promising candidate to be studied in the setting of human ibd . In fact, in 2010, four independent groups described the dysregulation of il-33 expression in patients with uc and to a lesser extent, cd [3336]. Consistently, all groups showed increased protein levels of il-33 within the inflamed mucosa of ibd patients compared to healthy controls, particularly in uc [3336]. Immunohistochemistry experiments revealed intense il-33 staining in lamina propria inflammatory infiltrates, primarily localizing in cells that morphologically resemble macrophages and b cells / plasma cells . Importantly, nonhematopoietic cell types also contribute to the augmented production of il-33 during intestinal inflammation; in particular, intestinal epithelial cells [33, 35, 36] and myofibroblasts display the highest levels of il-33 during active ibd . Il-33 was also detected in other cell types within gut mucosa, confirming previous reports in other organ systems, with expression in fibroblasts, smooth muscle cells, endothelial cells [8, 37], and adipocytes . Il-33 was also detectable in the sera of ibd patients, with concentrations significantly increased compared to healthy controls [33, 35]. Circulating il-33 levels were also found to be markedly reduced upon anti - tnf administration (infliximab / remicade) and may have the potential to be used as a marker of disease activity and/or response to anti - tnf treatment . In fact, f - il-33 was the only form found to be present in both the cytoplasm and nuclei of il-33-producing cells, such as intestinal epithelial cells, whereas evaluation of mucosal biopsies revealed the presence of both f - il-33 and 2022 kd cleaved forms; conversely, sera displayed exclusively the presence of the cleaved 2022 kd forms . Taken together, these data suggest the presence of extracellular proteases that have the ability to cleave il-33, possibly modulating its bioactivity . As mentioned earlier, neutrophil elastase and cathepsin g are capable of cleaving f - il-33, generating more potent forms . As such, the inflammatory milieu characterizing ibd may have the potential to amplify il-33's biological effects . On the other hand, similar to proapoptotic caspases, extracellular proteases may instead have the ability to inactivate f - il-33, perhaps in an attempt to prevent possible harmful effects that may be triggered by high circulating levels of this cytokine . Indeed, further data are needed in order to clarify the significance of the circulating forms of il-33 and the mechanism(s) leading to their generation . Data regarding the analysis of il-33 expression in human ibd were closely recapitulated in samp1/yitfc (samp) mice, a spontaneous model of chronic intestinal inflammation immunologically characterized by an early th1 response and a later mixed th1/th2 phenotype, both significantly contributing to the extent of disease severity in these mice [40, 41]. In this study, samp mice were shown to display high il-33 levels in the serum as well as the gut mucosa, consistently localized to intestinal epithelial cells and macrophages within the lamina propria . Interestingly, mucosal expression of il-33 was found to positively correlate with the severity of samp enteritis . A substantial alteration of st2 expression as well was detected in the intestinal mucosa and sera from ibd patients . St2 was abundantly expressed in the inflamed mucosa of ibd patients compared to healthy controls, and similarly, elevated circulating levels of sst2 were shown in uc and cd patients [33, 35], correlating with mucosal st2 expression and both clinical and endoscopic disease activities . Indeed, this interesting piece of data may suggest that serum il-33/sst2 is produced within intestinal mucosa and directly reflects the severity of mucosal inflammation; as such, it would be worthwhile to investigate the role of circulating il-33 and sst2 as markers of disease . Besides quantitative differences of st2 expression, striking qualitative alterations were detected in the inflamed ibd mucosa versus healthy tissues . St2 was constitutively expressed by intestinal epithelial cells during normal conditions; however, in chronically inflamed ibd mucosa, intestinal epithelial cells lose st2 expression, which is redistributed to other inflammatory cell types . Specifically, intestinal epithelial cells of uc patients did not present st2, whereas st2 localized to lamina propria professional antigen presenting cells and t helper lymphocytes . If a robust increase of st2-positive cells within the lamina propria infiltrate is a common feature of different inflammatory conditions of the gut, the epithelial reduction / disappearance of st2 appears to be specific for ibd . In fact, in nonspecific colitides, such as infectious colitis and diverticulitis, st2 appears to be upregulated in both the epithelial and immune compartments of gut mucosa . Of note, epithelial dysregulation of st2 refers to a marked decrease of st2l, the il-33 transmembrane receptor, but not of the sst2 protein [33, 35]. As such, this particular pattern of expression may suggest that during ibd, a severe impairment of il-33 signaling within the epithelial layer occurs, whereas il-33/st2 engagement may be enhanced in intestinal immune cells . However, whether this alteration of epithelial st2l is a feedback response to the chronic exposure of elevated il-33 concentrations or an intrinsic epithelial defect characterizing ibd has yet to be determined . Of note, during active ibd, an intense st2 signal is detectable in perivisceral adipose tissue, where a rich infiltrate of st2-positive immune cells is evident . Consistent with recent data in the literature, this particular st2-expressing cell population, dispersed within mesenteric fat, may represent the nhc population, recently described by moro et al ., that are pivotal for the onset of immune responses against parasites, but whose possible role in idiopathic intestinal inflammation has not yet been explored . Remarkably, as a further confirmation of the dysregulation of il-33 and st2 in human ibd, recent data, obtained in an italian cohort of adult and pediatric uc and cd patients, demonstrate that specific il-33 and st2 gene polymorphisms confer an increased risk of developing ibd (both uc and cd), suggesting the involvement of the il-33/st2 axis in the onset of chronic intestinal inflammation . Despite robust data describing the changes in patterns of the expression of il-33 and st2, current data regarding the role of this novel cytokine / receptor pair in the onset of ibd is conflicting and scarce . In fact, while some studies suggest a proinflammatory function, others indicate a protective, anti - inflammatory role . Since its first description as a cytokine, il-33 has been shown to possess potent proinflammatory activity, inducing th2 cytokine production and promoting th2 immunity . Thus, il-33 was initially identified as a possible target for dampening inflammation in several animal models of inflammatory diseases, such as airway inflammation and arthritis (i.e., ovalbumin challenge - induced airways inflammation and collagen - induced arthritis) [4446] since it was well established that il-33 had the ability to promote inflammation through both the recruitment and activation of immune cells to the site of inflammation, as demonstrated by data obtained in a th2 cell adoptive transfer model and in vitro . Consequently, mice overexpressing il-33 were reported to display spontaneous airway and lung inflammation, whereas blocking the il-33/st2 axis decreased inflammation in an experimental murine model of asthma . Similarly, antagonizing il-33's biological effects, using anti - st2 blocking antibodies, was effective in ameliorating joint inflammation in a murine model of rheumatoid arthritis; in fact, the administration of il-33 to cultures of immune cells isolated from murine inflamed joints led to a dramatic increase in il-5, il-6, and il-17 production [45, 46]. Unfractionated mln cells, collected from inflamed samp mice, secrete high levels of the aforementioned cytokines when cultured in the presence of il-33 . Of note, both il-5 and il-6 have been shown to play a pathogenic role in samp ileitis, as demonstrated by the amelioration of intestinal disease following either anti - il-5 or anti - il-6 treatment [50, 51], whereas il-17 has been extensively characterized as a key cytokine in many immune - mediated diseases, including ibd [5254]. Along these same lines, unpublished data generated in our laboratory showed that blockade of the il-33/st2 axis significantly reduces intestinal inflammation in samp mice [5557]. Mechanistically, this effect appeared to be associated with a decrease of lamina propria eosinophil infiltration, by downregulating il-5 and eotaxin-1 and eotaxin-2, and by reducing the percentages of il-17 producing macrophages, a population that has previously been described in intestinal and airway inflammatory conditions [58, 59]. However, a full phenotypic and functional characterization of this nonclassical cell population has not yet been performed . In addition, il-33-induced inflammation may play a role in the development of intestinal fibrosis, as samp mice treated with anti - st2 blocking antibodies show decreased collagen deposition within the intestinal wall, together with a reduced production of pro - fibrotic molecules, such as transforming growth factor (tgf)-, connective tissue growth factor (ctgf), collagen-1, insulin growth factor (igf)-1, and matrix metalloproteinase (mmp)-9 . Consistently, healthy akr mice treated for one week with intraperitoneal injections of recombinant il-33 developed a marked thickening of muscularis layer of the intestinal wall, which was accompanied by increased expression of collagen-1, collagen-3, igf-1, and ctgf . These data, along with the observation that in vitro il-33 stimulation of human subepithelial myofibroblasts (semf) induces the expression of profibrogenic genes such as col1a1, col3a1, ctgf, and tgfb1, suggest that il-33 may also play an important role in promoting inflammation - associated gut fibrosis, as reviewed by lopetuso et al . . Additional data, primarily obtained from chemically induced models of intestinal inflammation, provide further insight into the role of il-33 and st2 in gut inflammatory conditions . Induced colitis in il-33 knockout (ko) mice and wild - type littermates using dextran sodium sulfate (dss) administration . The colonic inflammation caused by dss is primarily initiated by disruption of the epithelial barrier, which results in bacterial translocation into the underlying lamina propria . In this model, the resulting inflammation is mediated by the activation of innate immune responses and occurs in a t - cell - independent manner . During the acute phase of this experimental model, il-33 ko mice presented with reduced histologic inflammatory scores, with a significant reduction of granulocyte infiltration when compared to wild - type mice . Other independent groups replicated similar results, using the same acute animal model [6365]; in addition, sedhom et al . Confirmed the pathogenic role of il-33 also in a different model of intestinal inflammation, the trinitrobenzene - sulfonic - acid- (tnbs-) induced colitis, which is obtained throughout the chemical haptenization of protein expressed within the gut wall . Interestingly, sedhom et al . Demonstrated on both dss- and tnbs - induced colitis that, during the onset of intestinal inflammation, the il-33/st2 axis activation was able to affect the non - haematopoietic component of the inflammatory response, resulting in a significant impairment of the epithelial barrier function . Conversely, results obtained by oboki et al ., during the recovery phase of the dss - induced colitis in il-33 ko mice, suggest that il-33 might have different roles during different phases of the inflammatory process; in fact, weight recovery was markedly delayed in il-33 ko mice, with a slight increase in mortality rate . These results suggest that il-33 is a critical amplifier of innate immune responses within the gut mucosa, whereas its role in the maintenance of chronic inflammation is less clear . Alternatively, il-33 may possess an important functional role in enhancing innate immune responses related to bacterial clearance or in promoting mucosal wound healing . Despite its well - known proinflammatory properties, il-33 has also shown protective functions in different diseases; in fact, early reports demonstrated that il-33 exerts a cardioprotective effect, reducing overload - induced cardiomyocyte hypertrophy; on the same line, miller et al . Showed that il-33 reduced the development of atherosclerosis and the inflammation within the adipose tissue of obese mice, confirming the beneficial effect of il-33 on the cardiovascular system . In addition, il-33 appeared to have some protective role on various inflammatory conditions as well . For example, il-33 appears to reduce inflammation in con - a hepatitis, in central nervous system demyelinating disorders, and in pancreatitis . Moreover, the ability of il-33 to recruit neutrophils to the site of inflammation has been shown to reduce the consequences of severe septic events, whereas the il-33-mediated expansion of il-4-producing basophils, upon high - dose immunoglobulin administration, has been shown to induce profound immunoregulatory effects . The dichotomous nature of il-33 has also led to the generation of conflicting data in the setting of intestinal inflammation . In fact, data generated on the spontaneous enteritis characterizing samp mice suggests a frank pathogenic role, while il-33 ko mice undergoing dss colitis develop a mixed response . In addition, chronic dss colitis appears to be less severe after il-33 administration . In these studies, gro et al . Induced both acute and chronic dss colitis in balb / c mice and administered il-33 to experimental animals using different protocols . When il-33 was injected during the first cycle of dss, colonic inflammation was more severe, with a dramatic increase in neutrophil infiltration; conversely, treating animals during the recovery phases of both acute and chronic dss colitis decreased inflammatory scores and improved epithelial regeneration . A different group reported partially overlapping results using a similar acute dss protocol . Utilizing the acute dss colitis model, imaeda et al . In these studies, the authors reported increased inflammatory scores in il-33-treated balb / c mice; however, when evaluating the epithelial layer, complete reversion of the goblet cell depletion characteristic of dss colitis was observed . This effect appeared to be mediated by the suppression of notch ligand expression by semfs . In fact, the notch pathway is a key regulator of epithelial cell differentiation, leading towards an absorptive phenotype . As such, il-33-mediated inhibition of the notch pathway resulted in the maturation of epithelial cells towards a goblet cell phenotype, likely representing a protective response against harmful conditions . Interestingly and along similar lines, il-33 expression has been reported in semfs underlying ulcerated epithelia in uc and gastric ulcers [34, 75]. In addition, recent data suggest that il-33 stimulation may increase gastric epithelial proliferation, whereas dramatic changes in the pattern of il-33 expression in endothelial cells have been described during angiogenesis . Overall, these data together strongly suggest that the il-33/st2 axis may be implicated in the maintenance of intestinal barrier function, wherein perturbations may likely play an important role in the development of chronic inflammatory conditions of the gut . As such, we can speculate that il-33 may enhance bacterial clearance by inducing early granulocyte infiltration, promoting epithelial differentiation towards a mucus - secreting phenotype, and by facilitating wound healing . The redistribution / loss of st2l within the epithelial compartment described during uc [33, 35] is consistent with the goblet cell depletion characterizing this particular disease and can also account for a defective wound healing process that can contribute to the chronicity of the inflammatory process . Data generated by duan et al . Using the th1-driven tnbs - induced colitis, opposing to what was shown by sedhom et al ., mice developed less severe colitis following intraperitoneal injections of il-33, whereas anti - il-33 antibody administration did not significantly affect intestinal inflammation . The anti - inflammatory effects of il-33 appeared to be mediated by a decreased production of the prototypic th1 cytokine, ifn, while the th2 cytokines, il-5 and il-13, were found to be increased . In addition, the authors also infer that il-33 has the ability to promote tolerogenic dendritic cell development, which ultimately results in the expansion of the t regulatory cell population . Thus, during th1-driven inflammation, il-33 may have the capability to modulate gut mucosal immune responses to a more th2-driven phenotype and promote the expansion of regulatory cell types . The different functions of the il-33/st2 axis during intestinal inflammation in samp spontaneous enteritis and in the chemically induced dss- and tnbs - induced colitis models are recapitulated in figure 2 . Indeed, the il-33/st2 axis appears to be widely represented throughout the whole body, having different, and sometimes opposing, functions . The resulting balance between the differential effects appears to be straightforward in certain tissue / organ systems, such as the airways / lungs or the joints, where inflammation, in itself, is the major detrimental agent to cause pathology . In more complex systems, wherein mucosal immune responses interact with a large bacterial load and epithelial barrier integrity and function is essential to consider, such as that found in chronic intestinal inflammation, the final outcome of this intricate interplay is difficult to predict and may vary according to slightly modifications of the initial conditions . In fact, il-33 appears to enhance intestinal inflammation in disease models, which are driven by th2 and innate immune responses, such that observed in samp mice and the acute phase of dss colitis, and possibly in uc patients . Conversely, il-33's effects during a th1-driven model, such as in tnbs colitis, may result in decreased intestinal inflammation mediated by cytokine and cell - mediated modulation of immune responses . On the other hand, emerging evidence suggests that il-33 may have positive effects on epithelial repair and barrier function . High levels of il-33 during acute inflammation are likely to worsen tissue damage, whereas they may enhance tissue repair during recovery, promoting wound healing and the restoration of the epithelial barrier, as shown in the dss model . Thus, the initial features of the specific immune response and the timing of il-33 administration / blockade may dictate the overall outcome of disease pathogenesis . The nuclear localization sequence in il-33's primary structure suggested a possible role and function for this cytokine as an alarmin, that is, a protein released from dying / suffering cells as an extracellular sign of danger . Consistent with this hypothesis is the fact that il-33 is released by cells undergoing mechanical stress and is cleaved by pro - apoptotic caspases into less active forms [1012]. Moreover, data obtained on mononuclear cells confirm that il-33 is overexpressed after tlr-2 and -4 stimulation, but it is released only when necrosis of these cells is induced . On the same line, it has been shown that other danger signals, such as extracellular atp, different pathogen - associated molecular patterns (pamps), and inflammasome activation, lead to the increased production of il-33 in different cell types (i.e., glial cells, airway epithelial cells) [8284]. Indeed, the alarmin paradigm may have the potential to reconcile how il-33 possesses such a wide spectrum of effects in the gastrointestinal tract . That is, upon harmful stimuli, il-33 is released by suffering epithelial barrier cells in order to recruit and activate immune cells and clear potential pathogens . At the same time, the presence of a defective and damaged epithelial barrier must be quickly repaired, and the need for prompt epithelial restitution and wound healing is promoted . Interestingly, ibd genetic studies have identified a few candidate susceptibility genes, encoding proteins that are pivotal for the maintenance of epithelial cell integrity, such as the endoplasmic reticulum stress protein, proteins related to the autophagy process, and structural proteins . It is tempting to speculate that when epithelial function is severely impaired as a consequence of mutations of the aforementioned genes, suffering intestinal epithelial cells may release high levels of il-33, activating a potentially detrimental immune response . At the same time, the loss / dysregulation of st2l on intestinal epithelial cells in ibd may alter epithelial restoration . As such, further, more mechanistic investigation is warranted to dissect this complicated scenario, aiming to clarify the specific effects of the il-33/st2 axis, at different times as well as the contribution of different cellular sources, in order to elucidate the predominant role of this complex cytokine system in the pathogenesis of intestinal inflammation.
From the first reported infected patient in may 2009 through january 2010, a total of 740,835 patients in south korea were reported as having pandemic (h1n1) 2009 virus infection . A total of 225 patients (0.03%) died of disease related to pandemic (h1n1) 2009 . During this period, physicians in local clinics and tertiary hospitals sent specimens from 67 patients who were suspected of having drug - resistant pandemic (h1n1) 2009 to the korea centers for disease control; 11 patients (16%) had drug - resistant virus (figure). After confirmation of drug resistance, epidemic intelligence service officers obtained clinical and epidemiologic data by medical record review and interviews with household contacts and attending physicians for all patients . Clinical course and outcome of 11 patients with oseltamivir - resistant pandemic (h1n1) 2009, south korea . Symptom aggravation was defined as influenza - related symptoms that worsened regardless of new infiltrations seen by chest radiography . Symptom improvement was defined as influenza - related symptoms (nasal stiffness, sore throat, cough, myalgia, fatigue, headache, and fever) that were absent or mild . Ed, emergency department . To investigate whether virus contained genetic markers associated with resistance to antiviral drugs, a conventional genotyping assay (sequencing) was performed, and neuraminidase (na) and matrix 2 genes were sequenced . All 11 patients had virus with a histidine - to - tyrosine mutation at residue 275 of the na protein (h275y); 1 patient also had virus with an i117 m mutation (figure). Detailed molecular epidemiologic data and genetic characteristics of the isolates are described elsewhere (2). Of the 11 patients, 6 were <59 months of age and 5 had underlying immunosuppressive conditions; only 1 patient was immunocompetent and> 59 months of age (table). Three patients from whom samples before and after treatment with oseltamivir were available showed evidence of having acquired the h275y mutation during oseltamivir therapy . None of the 11 patients received oseltamivir chemoprophylaxis . * specimens were obtained from oropharyngeal (n = 7) and nasopharyngeal (n = 2) swabs, nasopharyngeal washings (n = 1), and brochoalveolar lavage fluid (n = 1). Patients who had underlying diseases such as hiv infection, malignancy, liver cirrhosis, or chronic renal failure, or patients receiving immunosuppressive treatment . Carbapenem - resistant pseudomonas aeruginosa (patient 3), carbapenem - resistant acinetobacter baumanii (patient 4), and penicillin - susceptible streptococcus pneumonia (patient 10). Of the 3 patients, 1 was infected with carbapenem - resistant p. aeruginosa (patient 3) and 1 was infected with carbapenem - resistant a. baumanii (patient 4). We also tested 100 persons who had contact with the 11 patients for possible transmission of drug resistance . Eight of 100 were confirmed as having been infected with pandemic (h1n1) 2009 virus before the 11 patients were infected . Influenza - like illnesses developed in the 11 patients a median of 2 days (range 17 days) after the 8 contact persons were confirmed as having pandemic (h1n1) 2009 . Five of the 8 contact patients were children; none had an immunosuppressive condition or were given oseltamivir chemoprophylaxis before illness; and 7 of 8 were <59 months of age . Oseltamivir - resistance tests were not performed for these 8 patients because they all received oseltamivir therapy and their clinical symptoms resolved . Therefore, the possibility of transmitted resistance from contact patients was not demonstrated in this study . All 11 patients were initially given the usual dose of oseltamivir (75 mg 2/day in adults). After detection of oseltamivir resistance, treatment regimens were as follows: 3 patients were given high - dose oseltamivir (150 mg 2/day in adults), 3 patients were given combination therapy (oseltamivir and amantadine; oseltamivir and peramivir; and oseltamivir, amantadine, and ribavirin, respectively); 3 patients were given zanamivir nasally; and 2 patients continued to receive oseltamivir . Seven of the 11 patients had complications during treatment: 6 had viral or secondary bacterial pneumonia and 1 had acute respiratory distress syndrome (table). Patient 3 died 15 days after confirmation of infection with pandemic (h1n1) 2009 virus and 10 days after the emergence of oseltamivir - resistant virus . Patient 4 died 15 days after confirmation of infection and 4 days after emergence of oseltamivir - resistant virus . Patient 8, who was infected with virus that had h275y and i117 m mutations, died 18 days after confirmation of infection and 4 days after the emergence of oseltamivir - resistant virus . Our nationwide surveillance of drug - resistant pandemic (h1n1) 2009 in south korea indicated that most patients were children (<59 months of age) or immunocompromised . All isolates had the h275y mutation in the na protein, and 1 isolate also had the i117 m mutation in the same protein . Our finding that oseltamivir resistance developed in immunocompromised patients is consistent with those of recent case reports that described development of oseltamivir resistance in immunosuppressed patients receiving this drug (3,4). A recent study in australia reported that 4 of 32 adult oncology and hematology patients were infected with oseltamivir - resistant virus with the h275y mutation (5). In 3 of our patients (patients 3, 5, and 11) drug - resistant thus, we suggest that physicians be alert to emergence of oseltamivir - resistant pandemic (h1n1) 2009, particularly if there is treatment failure with oseltamivir or prolonged viral shedding is evident . More than half of our patients were <59 months of age, indicating that a younger age may be a risk factor for infection with drug - resistant pandemic (h1n1) 2009 . Clinical trials have reported oseltamivir resistance in <5.5% of children with seasonal influenza (6). Explanations for the higher rate of drug resistance in children than in adults are that children have a more protracted course of influenza, longer viral shedding times, and higher viral titers (7). Another explanation might be that we cannot rule out suboptimal dosing of oseltmaivir in children, although world health organization dose standards were used (8) and all pharmacies were given instructions on emergency compounding of oseltmaivir . Availability of pretreatment and posttreatment samples indicated that resistance to oseltamivir developed during treatment in> 3 patients . One case report (9), 1 report of a cluster of cases in vietnam (10), and 1 outbreak in a hematologic ward (11) documented patient - to - patient transmission of oseltamivir - resistant virus . One of our patients was infected with virus that had a novel na mutation (i117 m). A previous study indicated that the i117v mutation in avian influenza virus (h5n1) was associated with low - level oseltamivir resistance (12). The i117 m mutation of na may contribute to oseltamivir resistance, but it is not clear whether isolates with these 2 na mutations have higher levels of resistance or virulence than the h275y na mutant . We found few patients with drug - resistant pandemic (h1n1) 2009 in south korea . However, our study was based on the nationwide surveillance system for drug resistance among patients with suspected oseltamivir treatment failures, which is different from other surveillance systems, in which all isolated viruses are tested . Thus, we cannot report the prevalence of drug - resistant pandemic (h1n1) 2009 and risk factors for drug - resistant virus infection in south korea . Further studies are needed to monitor oseltamivir resistance, especially in immunosuppressed or pediatric patients when treatment failure with oseltamivir or prolonged viral shedding occur.
Prostate cancer is the most commonly diagnosed solid cancer in men, with 220,800 estimated new cases and 27,540 estimated deaths in the united states recorded in 2015 . Globocan 2012 sources estimate prostate cancer incidence in the european union at 345,195 new cases, with a crude rate of 139, making it the most commonly diagnosed cancer in european men, with 71,789 estimated cancer deaths (the third cause of cancer death behind lung and colorectal cancer). Patient factors associated with the development of prostate cancer include age [3, 4], race and family history, all of which are nonmodifiable factors, with age as the most important nonmodifiable factor . The most important environmental risk factors of prostate cancer are lifestyle - associated, with nutrition and dietary habits being among the most important . Obesity is an excess of accumulation of adipose tissue in the body; genetics and lifestyle - related factors are thought to be the primary obesity determinants . A recent meta - analysis has demonstrated that a high body mass index (bmi) correlated positively with prostate cancer detection particularly high - grade prostate cancer detection; another recent meta - analysis provides preliminary evidence to demonstrate that obesity is a significant risk factor for aggressive prostate cancer and prostate cancer - specific mortality . Prostate - specific antigen (psa), despite its controversies, remains the mainstay of early prostate cancer detection, and several population- and nonpopulation - based studies have shown a negative association between bmi and psa . These results could lead to a delayed diagnosis of prostate cancer with an unfavourable prognosis in the obese population [9, 10, 11]. One of the mechanisms proposed to lower psa in the obese population is the increased plasma volume in obese men and the resulting haemodilution . To address this concern, we have investigated whether the predictive accuracy of psa and the digital rectal examination (dre) is modified by obesity in a cohort of 1,319 patients undergoing the first prostate biopsy . A total of 1,319 men who underwent the first transrectal ultrasound - guided prostate needle biopsy from 20072011 at a university hospital in spain were included in this study, and data concerning these patients were retrospectively collected . There was no age limit in the study; however, the range in the age of patients ran from 48 to 84 years - old . Patients with inhibitors of 5-alpha reductase (5 ari) intake were included (118 patients). Indications for prostate biopsy were a psa higher than 4.0 ng / ml, an abnormal dre or both . All the patients had between 1012 cores taken during the biopsy, and the prostate was biopsied bilaterally near the base, mid - gland and apex regions . No patients showed missing psa or bmi data; thus, all 1,319 patients were included in the analysis . Patient bmi was categorised as follows: <25 kg / m (normal weight); 2529.9 kg / m (overweight); and 30 kg / m (obese), as defined by the world health organisation . When the dre suggested prostate cancer, the case was classified as abnormal . Baseline variables were compared across bmi categories using the chi - squared test (categorical) and the kruskal - wallis test (continuous). A linear regression model controlling for age, digital rectal findings and transrectal ultrasound (trus) volume was used to calculate mean - adjusted psa concentrations with 95% confidence intervals (ci) for each bmi category . Receiver operator characteristic (roc) curves plotted as false - positive rate (1 minus specificity) versus sensitivity, were used to assess psa accuracy for predicting prostate cancer overall, then stratified according to the dre findings using the area under the roc curve (auc) to measure the accuracy of psa as a predictor of prostate biopsy results . Aucs were compared across the bmi groups overall and stratified according to dre findings using the chi - squared test . Roc curves were also used to assess the psa accuracy in predicting a biopsy gleason score 7 and in calculating the predictive value of dre according to bmi . Multivariate logistic regression analysis was used to examine the association between bmi and prostate cancer and between bmi and gleason score as determined by the trus biopsy, after adjusting for age, prostate volume, psa level and dre findings . A two - tailed p <0.05 was considered to indicate statistical significance in all the analyses . A total of 1,319 men who underwent the first transrectal ultrasound - guided prostate needle biopsy from 20072011 at a university hospital in spain were included in this study, and data concerning these patients were retrospectively collected . There was no age limit in the study; however, the range in the age of patients ran from 48 to 84 years - old . Patients with inhibitors of 5-alpha reductase (5 ari) intake were included (118 patients). Indications for prostate biopsy were a psa higher than 4.0 ng / ml, an abnormal dre or both . All the patients had between 1012 cores taken during the biopsy, and the prostate was biopsied bilaterally near the base, mid - gland and apex regions . No patients showed missing psa or bmi data; thus, all 1,319 patients were included in the analysis . Kg / m (normal weight); 2529.9 kg / m (overweight); and 30 kg / m (obese), as defined by the world health organisation . When the dre suggested prostate cancer, the case was classified as abnormal . Baseline variables were compared across bmi categories using the chi - squared test (categorical) and the kruskal - wallis test (continuous). A linear regression model controlling for age, digital rectal findings and transrectal ultrasound (trus) volume was used to calculate mean - adjusted psa concentrations with 95% confidence intervals (ci) for each bmi category . Receiver operator characteristic (roc) curves plotted as false - positive rate (1 minus specificity) versus sensitivity, were used to assess psa accuracy for predicting prostate cancer overall, then stratified according to the dre findings using the area under the roc curve (auc) to measure the accuracy of psa as a predictor of prostate biopsy results . Aucs were compared across the bmi groups overall and stratified according to dre findings using the chi - squared test . Roc curves were also used to assess the psa accuracy in predicting a biopsy gleason score 7 and in calculating the predictive value of dre according to bmi . Multivariate logistic regression analysis was used to examine the association between bmi and prostate cancer and between bmi and gleason score as determined by the trus biopsy, after adjusting for age, prostate volume, psa level and dre findings . A two - tailed p <0.05 was considered to indicate statistical significance in all the analyses . Overall characteristics of the study cohort at baseline and stratified by bmi are listed in table 1 . Fourteen percent of the patients (n = 182) in the study were in the obese group . The median prebiopsy psa was 6.5 ng / ml and no differences were observed in the psa levels across the groups (p = 0.7). The number of patients with an abnormal dre (24%) was higher in the obese group . A diagnosis of cancer was more common among the overweight (45%) and the obese group (48%) (p <0.001). A total of 32 patients, who were taking 5 ari, were diagnosed of prostate cancer . The percentage of patients with a biopsy gleason score 7 was higher in the obese group (29%); however, the difference was not statistically significant (p = 0.2). Baseline characteristics of the study population (overall and stratified by bmi groups) psa prostate - specific antigen; dre digital rectal examination; trus transrectal ultrasound; p * kruskal - wallis test after controlling for age, dre findings and trus volume, the mean psa levels were found to be lower in the obese than the overweight group, but the trend was not statistically significant (p = 0.6). The mean - adjusted psa concentrations (95% confidence interval [ci]) for normal, overweight and obese men were 7.7 (7.38.0), 8.1 (7.78.7) and 7.9 (7.18.8), respectively . In the overall study sample, the best auc of serum psa for predicting prostate cancer on biopsy corresponded to the obese group (auc = 0.62 [0.540.71]) (table 2). Accuracy of pre - biopsy psa for predicting cancer on prostate biopsy across bmi categories bmi body mass index; dre digital rectal examination; auc area under the curve; se standard error with delong test; 95% ci 95% confidence interval; p chi - square test when stratified according to dre findings, the best auc of psa for predicting prostate cancer corresponded to the men with nonsuspicious pca on dre in the obese group (auc = 0.63 [0.540.73]), whereas there were no significant differences among those with a dre suspicious for prostate cancer (p = 0.90) (table 2). The impact of dre findings on cancer detection as a function of obesity was evaluated by a multivariable analysis adjusted for bmi as a continuous variable, psa and age at diagnosis . An abnormal dre portended twice the odds of any prostate cancer diagnosis compared with normal dre in each bmi group: 1.52 (1.171.98) in the normal weight group; 1.61 (1.142.20) in the overweight group; and 2.09 (1.193.67) in the obese group; p = 0.002, p = 0.007 and p = 0.01, respectively . The percentage of men in each bmi category in whom prostate cancer was detected varied, and was much higher in the obese group (p <0.001). As shown in table 3, bmi was one of the significant factors predicting prostate cancer after adjustments for age, psa level, prostate volume and dre abnormality in a multivariate analysis (or 1.4; 95% ci 1.21.7; p <0.001). Multivariate analysis of factors predicting prostate cancer and a biopsy gleason sum 7 psa prostate - specific antigen; dre digital rectal examination; bmi body mass index; 95% ci odds ratio; p value by multivariate logistic regression as shown in table 3, bmi was not a significant factor predicting a biopsy gleason score 7 after adjustments for age, psa level, prostate volume and dre abnormality in the multivariate analysis (or 1.03; 95% ci 0.971.1; p = 0.3); however, an abnormal dre was able to independently predict it . The auc of combined psa and dre for diagnosing prostate cancer improved from 0.60 to 0.63 with the addition of bmi to the model, as shown in figure 1 and table 4 . Accuracy of incorporating bmi to classical predictor models of prostate cancer and a biopsy gleason sum 7 bmi body mass index; psa prostate - specific antigen; dre digital rectal examination; auc area under the curve; se standard error under the nonparametric assumption; 95% ci 95% confidence interval; p chi - square test roc curves showing the accuracy of incorporating bmi to classical models in the prediction of prostate cancer detection . Receiver operator characteristics; psa prostate - specific antigen; dre digital rectal examination; bmi body mass index the auc of combined psa and dre for diagnosing prostate cancer improved from 0.62 to 0.65 with the addition of bmi to the model, as shown in figure 2 and table 4 . Roc curves showing the accuracy of incorporating bmi to classical models in the prediction of a biopsy gleason 7 . Receiver operator characteristics; psa prostate - specific antigen; dre digital rectal examination; bmi body mass index overall characteristics of the study cohort at baseline and stratified by bmi are listed in table 1 . Fourteen percent of the patients (n = 182) in the study were in the obese group . The median prebiopsy psa was 6.5 ng / ml and no differences were observed in the psa levels across the groups (p = 0.7). The number of patients with an abnormal dre (24%) was higher in the obese group . A diagnosis of cancer was more common among the overweight (45%) and the obese group (48%) (p <0.001). A total of 32 patients, who were taking 5 ari, were diagnosed of prostate cancer . The percentage of patients with a biopsy gleason score 7 was higher in the obese group (29%); however, the difference was not statistically significant (p = 0.2). Baseline characteristics of the study population (overall and stratified by bmi groups) psa prostate - specific antigen; dre digital rectal examination; trus transrectal ultrasound; p * kruskal - wallis test after controlling for age, dre findings and trus volume, the mean psa levels were found to be lower in the obese than the overweight group, but the trend was not statistically significant (p = 0.6). The mean - adjusted psa concentrations (95% confidence interval [ci]) for normal, overweight and obese men were 7.7 (7.38.0), 8.1 (7.78.7) and 7.9 (7.18.8), respectively . In the overall study sample, the best auc of serum psa for predicting prostate cancer on biopsy corresponded to the obese group (auc = 0.62 [0.540.71]) (table 2). Accuracy of pre - biopsy psa for predicting cancer on prostate biopsy across bmi categories bmi body mass index; dre digital rectal examination; auc area under the curve; se standard error with delong test; 95% ci 95% confidence interval; p chi - square test when stratified according to dre findings, the best auc of psa for predicting prostate cancer corresponded to the men with nonsuspicious pca on dre in the obese group (auc = 0.63 [0.540.73]), whereas there were no significant differences among those with a dre suspicious for prostate cancer (p = 0.90) (table 2). The impact of dre findings on cancer detection as a function of obesity was evaluated by a multivariable analysis adjusted for bmi as a continuous variable, psa and age at diagnosis . An abnormal dre portended twice the odds of any prostate cancer diagnosis compared with normal dre in each bmi group: 1.52 (1.171.98) in the normal weight group; 1.61 (1.142.20) in the overweight group; and 2.09 (1.193.67) in the obese group; p = 0.002, p = 0.007 and p = 0.01, respectively . The percentage of men in each bmi category in whom prostate cancer was detected varied, and was much higher in the obese group (p <0.001). As shown in table 3, bmi was one of the significant factors predicting prostate cancer after adjustments for age, psa level, prostate volume and dre abnormality in a multivariate analysis (or 1.4; 95% ci 1.21.7; p <0.001). Multivariate analysis of factors predicting prostate cancer and a biopsy gleason sum 7 psa prostate - specific antigen; dre digital rectal examination; bmi body mass index; 95% ci as shown in table 3, bmi was not a significant factor predicting a biopsy gleason score 7 after adjustments for age, psa level, prostate volume and dre abnormality in the multivariate analysis (or 1.03; 95% ci 0.971.1; p = 0.3); however, an abnormal dre was able to independently predict it . The auc of combined psa and dre for diagnosing prostate cancer improved from 0.60 to 0.63 with the addition of bmi to the model, as shown in figure 1 and table 4 . Accuracy of incorporating bmi to classical predictor models of prostate cancer and a biopsy gleason sum 7 bmi body mass index; psa prostate - specific antigen; dre digital rectal examination; auc area under the curve; se standard error under the nonparametric assumption; 95% ci 95% confidence interval; p chi - square test roc curves showing the accuracy of incorporating bmi to classical models in the prediction of prostate cancer detection . Receiver operator characteristics; psa prostate - specific antigen; dre digital rectal examination; bmi body mass index the auc of combined psa and dre for diagnosing prostate cancer improved from 0.62 to 0.65 with the addition of bmi to the model, as shown in figure 2 and table 4 . Roc curves showing the accuracy of incorporating bmi to classical models in the prediction of a biopsy gleason 7 . Receiver operator characteristics; psa prostate - specific antigen; dre digital rectal examination; bmi body mass index in this study, we investigated whether the diagnostic accuracy of psa is altered by obesity and dre; thus, whether psa is still a valid diagnostic tool in obese men . We have tested this concern by calculating the auc and strengthening the model by logistic regression . A higher bmi was significantly associated with an increased risk of prostate cancer detection when adjusted for age, psa level, dre findings and prostate volume; however, no association was found between the bmi and gleason score 7 in biopsy specimens . Although some researchers have established an inverse relationship between psa level and bmi [9, 10, 11], we have not been able to do so; psa levels in our study did not differ among bmi groups . Our results could reflect the fact that our study is not a population - based study; thus, our patients are at higher risk for prostate cancer because of the high psa levels or abnormal dre . One study which focused on european mediterranean men, found results similar to ours with no differences in the levels of psa across bmi groups . One is the anti - androgen theory; it is known that obese men have lower testosterone, leading to lower psa production under androgen control . Another possibility is based on the haemodilution theory, which means that obese men have greater plasma volume . Psa is normally released in the seminal fluid and leaks at low levels into the serum; therefore, greater plasma volume could result in haemodilution, lowering serum psa concentrations [13, 14]. Regardless of the reason, lower psa concentrations mean that obese men are less likely to have an elevated psa and are, subsequently, less likely to undergo biopsy, resulting in fewer cancers detected . To resolve this problem, a correction of the psa value for the degree of obesity has been proposed in the united states: for overweight men, the multiplication of psa by a factor of 1.05; and for obese men, multiplication by a factor between 1.1 and 1.5 . A chinese study has demonstrated that although psa concentration decreases with increasing bmi, psa mass remains consistent; this study recommends a cut - off point between 3.32 and 3.68 ng / ml for psa to screen for prostate cancer in the obese population . For the purpose of the study, the operating characteristics of psa as a function of increasing bmi were analysed and the auc differed in obese and in nonobese men in predicting prostate cancer status; the best auc occured in the obese population, and the difference was statistically significant . In this sense, not only does obesity not negatively affect the accuracy of psa to detect cancer, but the accuracy is in fact better . It is not possible to explain this finding just with the haemodilution theory especially in men with a psa 4, even though multiple cut - off points have been tested in the obese and nonobese populations . We do not know the role of hemodilution in patients with psa <4 ng / ml because we have not analyzed these patients separately because only patients with an abnormal dre and psa which was lower than 4 ng / ml were tested . We do not have data concerning testosterone levels; therefore, the antiandrogen theory cannot be asserted . Other theories related to endocrine factors such as the levels of leptin a hormonal peptide involved in the regulation of body weight could be involved . Leptin levels are higher in patients with prostate cancer than in patients with benign prostatic hyperplasia . There is in vitro evidence that leptin stimulates the proliferation and expression of growth factors and also the growth of androgen - independent cells [1720]. The inverse relationship between hormones such as leptin and adiponectin has also been implicated . When levels of adiponectin have been compared in the prostate cancer population with healthy men or men with benign prostatic hyperplasia, it has been observed that levels of adiponectin are significantly lower in the men with prostate cancer, and even lower in men with aggressive prostate cancer [21, 22]. After stratification by dre, no difference was found in the performance accuracy of psa in predicting the presence of cancer among bmi groups in patients with an abnormal dre, and so psa accuracy was better in predicting prostate cancer in the obese population with normal dre . This latter finding could also reflect the difficulty in performing dre in obese patients, and in this sense creates a higher rate of false negatives . Although the use of dre for screening has been criticised due to a low sensitivity [23, 24, 25], dre is part of the screening algorithms in the guidelines of the european association of urology . The auc for dre in the present study is at least the same as for psa (0.56). The obese men with abnormal dre in this study were more likely to be diagnosed with prostate cancer, but psa diagnostic accuracy is not modified in obese patients with abnormal dre; the accuracy is comparable with normal weight men . Dre adds a significant benefit to psa accuracy in overweight and obese patients with normal dre . A multicentre study that examined the predictive values of dre for prostate cancer detection also found a higher risk of prostate cancer in the obese population with an abnormal dre . Greater bmi and dre together with psa were significant predictors for prostate cancer in the multivariate analysis (a higher bmi was significantly associated with an increased risk of prostate cancer when adjusted for age, psa level, digital rectal examination findings and prostate volume), and these results are consistent with studies by oh and freedland [27, 28]. However, no association has been found between bmi and the risk of a biopsy gleason score 7 . Many studies have found that obese men undergoing radical prostatectomy have higher - grade and larger tumors, providing further evidence that obese men undergoing radical prostatectomy have more aggressive prostate cancers [29, 30]. The reason we did not find a correlation between obesity and a higher biopsy gleason score might lie in the low correlation between the gleason biopsy score and that of the radical prostatectomy specimen as is described in the literature [31, 32, 33]. Another point of interest in this study is the improvement of the psa auc in the predictive models of prostate cancer that include bmi compared with the models that do not include it (0.63 to detect prostate cancer and 0.61 to detect a gleason 7 in prostate biopsy). These results would indicate that bmi could be part of the routine items involved in prostate cancer diagnosis . Attending to our results psa is still a useful diagnostic tool in our obese population, however, there is some evidence in the literature that the psa cut - off for biopsy should be lowered in the obese population; so we are taking this recommendation into account . Mri - imaging in the obese population could be a tool to take into consideration, since dre may be difficult in the obese patients; some nodules that are not well palpated may emerge in the mri - image . The present study has clear limitations that could explain the absence of the inverse association between serum total psa level and bmi in our population . First, this is not a population study, so the men in the study represent a population with a higher risk of prostate cancer because of their psa or their abnormal dre . Dre was not performed by the same urologist, therefore, it could be biased . The retrospective nature of the study is another limitation because we only could collect data regarding bmi; no data was available concerning waist circumference, which might be a better indicator for obesity in adults . Our population is a white european cohort; thus, we cannot generalize our results to other populations (e.g., asian or african - american men). In conclusion, we found that the predictive value of psa in predicting prostate cancer is something better in the obese population than in the other groups . The best auc occurs in the obese population with a normal dre; we might thus conclude that psa is still a valid tool in evaluating patients for a suspicious prostate cancer . Dre findings when suspicious, are an independent predictor of prostate cancer detection in each bmi group.
Hepatitis b virus is a potentially life - threatening cause of liver disease in the world . It both causes chronic infection and puts people at high risk of death from cirrhosis and liver cancer . Globally, it is estimated that more than 2 billion people are still living with hbv infection . Over 350 million are believed to be chronically infected with the virus and are thought to be at a high risk of developing chronic hepatitis, cirrhosis, and primary hepatocellular carcinoma . About 1.2 million die annually from chronic hepatitis, cirrhosis, and hepatocellular carcinoma [2, 3]. Viral hepatitis during pregnancy is associated with high risk of maternal complications and high rate of vertical transmission . Fetal and neonatal hepatitis acquired from mother during pregnancy lead to impaired cognitive and physical development in latter life of the children . The risk of vertical transmission depends on the time at which pregnant woman acquired hbv infection and on her statuses of hbsag and hepatitis b early antigen (hbeag). In the absence of immunoprophylaxis 1020% of women seropositive for hbsag transmit the virus to their neonates . Vertical transmission rate reaches approximately 90% when women are seropositive for both hbsag and hbeag . The prevalence of chronic hbv infection is categorized as high (8%), intermediate (27%), and low (<2%). In developed countries, the incidence of hepatitis is around 0.1% whereas in developing countries it ranges from 3 to 20% and even higher in some areas . In africa and asia, the prevalence of hbv is> 8% and 2 billion people have markers of current or past infection with hbv . About half of new infections result from vertical transmission during pregnancy, a statistic that is linked to the fact that hbv screening is not part of routine antenatal care in the area . Immunization is estimated to avert between 2 and 3 million deaths globally each year . In ethiopia, ethiopia has successfully introduced hepatitis b vaccine in the form of pentavalent combination vaccine into the routine schedule in 2007 . There is no widely available treatment for chronic hepatitis b and the other sequelae of hbv infection in the country, and if they are available, this treatment cost falls on the individual patient [12, 13]. In ethiopia, the prevalence of liver disease is high and accounts for 12% of the hospital admissions and 31% of mortality rate . The prevalence of hbv infection among pregnant mothers in addis ababa was 7% and 50% had evidence of infection at the age of 20 years . In similar studies conducted among pregnant women in jimma, the prevalence of hbv infection was 3.7% while it was 4.9% and 8.1% among pregnant women in dessie and mekelle, respectively [17, 18]. Several studies around the world recommended that pregnant women should be screened for hepatitis b before delivery, as this offers an opportunity to prevent another generation from being chronically infected by the virus . However, in ethiopia laboratory diagnosis of hbv infection is not part of routine care in anc of all health facilities . Moreover, there is little information concerning seroprevalence of hbv infection among pregnant women and the existing data indicate that it differ from region to region as indicated above . Therefore, the present study is aimed to estimate seroprevalence of hbv infection and to identify associated risk factors among pregnant women attending anc in arba minch hospital, south ethiopia . The study was conducted from february to april 2015 in antenatal clinic of arba minch hospital, which is found in arba minch town . The town is located in an altitude of 12001300 meters above sea level, with average annual temperature of 29c . Arba minch hospital serves more than 2 million people in south nations nationalities and peoples regional state in ethiopia . A facility based cross - sectional study design was used to enroll 232 pregnant women attending anc in arba minch general hospital . The sample size was determined using single population proportion formula to estimate the prevalence of hbv infection and toxoplasma gondii infection among pregnant mothers attending anc in arba minch general hospital (larger project). The sample size is calculated based on the following assumptions: prevalence of hbv and t. gondii infections as 8.1% and 83.6%, respectively; 95% level of confidence; 5% margin of error . The minimum calculated sample size for hbv and t. gondii infections was 126 and 232 . The present study was conducted among pregnant women attending anc in arba minch hospital and mentally fit to respond the questions . A total of 696 pregnant women attended the anc clinic during the past three months before study was initiated . This number was divided for the sample size to get the sample interval (k value) which is 3 . Therefore, every 3rd mother attending the clinic was enrolled in the study until the calculated sample size was achieved within three months of data collection . A pretested and structured questionnaire was used to collect information on sociodemographic, risky sexual behavior, history of hospital admission, history of abortion, and contact with hbv infected individuals . The data was collected through face - to - face interview by using nurses working in the anc clinic of the hospital . Following the interview, approximately 2 ml of venous blood was collected from each consenting study participant by experienced phlebotomist . Briefly, serum was separated from red blood cells and stored at 20c prior to assay . Finally, the serum was tested for hbsag using elisa test kit (dialab) at arba minch national blood bank center laboratory, strictly following the manufacturer's instruction . After checking for completeness and consistency of the collected information, the data was entered into computer, cleaned, and analyzed using spss version 20.0 software package . Bivariate and multivariate logistic regressions were used to assess the association between potential risk factors considered and hbv infection . Variables with p value <0.25 by the bivariate analysis were entered into multivariate model . At multivariate logistic regression, p value <0.05 was set as statistically significant for all variables . Ethical clearance was approved and obtained from arba minch university college of medicine and health science research ethical review committee . Official permission was sought from arba minch zonal health bureau and arba minch hospital administration . Moreover, written informed consent was obtained from all study participants prior to interview and blood collection . Individual test results were communicated with the attending physician for further management of the cases . A total of 232 pregnant women who had been attending arba minch hospital anc clinic from february 2015 to april 2015 were included in the study . The mean age of the participants was 25.98 years dominantly within the age range of 2529 years and standard deviation (sd) was 4.49 . Majority of the participants were housewives and had studied up to primary level education (table 1). Of 232 pregnant women tested for hbsag, 10 (4.3%) were found to be seropositive, giving the overall prevalence of 4.3% (95% ci: 2.26.9%). Pregnant women of age group of 2529 years comprised 101 (43.5%) of the total study participants, of which 4 (4%) were seropositive . Hbsag seropositivity was observed to be higher in first trimester (5.1%) and the least in the second trimester (4.0%) but this difference was not statistically significant (p> 0.05). Moreover, none of the sociodemographic factors was significantly associated with hbsag seropositivity (table 2). Sixteen (6.9%) of pregnant women attending anc clinic had were reported to have history of blood transfusion and 2 (12.5%) of them were seropositive . However, blood transfusion was not significantly associated (p = 0.605) with prevalence of hbv infection among pregnant women attending anc clinic in arba minch general hospital . About 219 (94.4%) and 54 (23.3%) pregnant women had the practice of ear piercing and abortion, respectively . The respective prevalence of hbv infection among pregnant women who pierced their ear and aborted previously was 3.7% (n = 8) and 13% (n = 7). The significant association was observed between hbv infection and women who aborted previously (p = 0.013). Fifty - seven (24.6%) of the study participants had also a history of hospital admission and only 2 (3.5%) of them were seropositive . Concerning respondents of previous history of contracting sexually transmitted disease (std), of 10 pregnant women who had the disease, 2 (22.2%) were seropositive . The prevalence of hbsag among women who suffered from std was significantly higher than those who did not suffer from std in univariate logistic regression (p = 0.020) but this association was not maintained after controlling the effect of confounding variables in multivariate logistic regression (p = 0.450). In this study, 12 (5.2%) pregnant women had previous history of multiple sexual partners and 2 (16.7%) of them were seropositive . Sexual practice with more than one individual significantly (p = 0.046) increases the transmission of hbv among pregnant women attending anc clinic (table 2). The seroprevalence of hbsag among pregnant women attending anc clinic in arba minch general hospital was 4.3% . According to who classification, the prevalence of hbsag was intermediate among pregnant mothers . Unless preventive measures through vaccination are taken to tackle the risk of transmission, the unborn babies are at a higher risk of contracting hbv infection . The infection was significantly higher among pregnant mothers who had aborted previously and had history of sex with multiple sexual partners . Health facilities or organizations working on abortion of pregnancies play great role in the transmission of the virus which might be associated with using unsterile equipment during the abortion process . Moreover, unsafe sexual practice with multiple sexual partners is the major way of transmission of hbv among women of the childbearing age . The prevalence of hbsag among pregnant women attending anc clinic in arba minch general hospital was comparable with studies conducted in bahir dar (3.8%), jimma (3.7%) and dessie (4.9%), dares salaam in tanzania (3.9%), and lagos nigeria (4.2%). In contrast to our study, the highest prevalence was reported from benin (12.5%), cameron (10.2%), and mali (8%). On the other hand, the lowest prevalence was reported from two studies from india [27, 28]. The difference between the present studies and the above studies might be due to difference in socioeconomy and behavioral and cultural practices of age between 15 and 45 years . In agreement with other studies [29, 30] there was no difference in seropositivity of hbsag between urban and rural pregnant mothers in the present study and it is in agreement with a study reported from sana'a, yemen . In contrast to our study, study from eastern sudan has shown significantly higher prevalence of hbsag among pregnant mothers from urban area than the rural counterparts . This difference might be due to the varied numbers of urban and rural study participants as compared to our study . According to this study, the prevalence of hbsag was significantly higher among pregnant women who had history of abortion . Unplanned pregnancy is related to unprotected sexual intercourse which results in abortion and also increases the risk of hbv infection if such partners are infected . Also, instrumentation during abortion and related activities may serve as sources of exposure; all these circumstances may increase the likelihood of acquiring the infection . This is in agreement with a study reported from lagos nigeria but in contrast with similar study carried out in north west of iran . In the current study, the rate of hbv infection was significantly higher and about seven times more likely to occur in those who had history of multiple sexual partners as compared to those who did not have multiple sexual partners . The significant association of having multiple sexual partners with hbv infection was also documented by other investigators [18, 33]. In contrast, some studies have shown that there was no significant association between abortion and seropositivity of hbsag among pregnant mothers [22, 34]. Hepatitis b virus infection is sexually transmitted and the transmission increases with the duration of sexual activity and number of sexual partners [35, 36]. Blood transfusion is one of the means of transmission of bloodborne pathogen like hbv but it was not significantly associated with hbsag seropositivity in the present study . However, blood transfusion was significantly associated with transmission of hbv in a number of studies [21, 23, 28]. Improving the quality of laboratory screening of blood for hbv is one of the components in reducing the risk for transfusion - transmitted hbv . The possible explanation for absence of significant association between hbv infection and blood transfusion might be improved screening of hbv infection from blood donors before transfusion in ethiopia . The rate of vertical transmission of hbv infection is influenced by the time of pregnancy at which acute hbv infection occurs in the mothers . In our study, the highest seroprevalence of hbv infection was found in those pregnant women at the first trimester as compared to second and third trimesters . However, there was no statistically significant difference in the prevalence of hbsag seropositivity in different gestational age of pregnant mothers and it was in agreement with other studies [29, 38]. In conclusion, the prevalence of hbsag among pregnant mothers attending anc clinic in arba minch general hospital was intermediate . Abortion and unsafe sexual practice with more than one sexual partner play significant role in the transmission of the virus from infected person to healthy women of childbearing age . Therefore, screening pregnant women for hbv infection should be part of the routine care in anc clinic in arba minch general hospital and in other similar settings . Health information on safe sex to women of childbearing age should be given to interrupt the transmission . In addition, health facilities working on abortion should strictly follow the aseptic techniques in order to save the life of both aborting mother and subsequent children of that mother.
Adenoviruses are viral pathogens that target a variety of organs in the human body [1, 2]. They are highly contagious and can be deadly against patients with a compromised immune system [1, 37]. There are over 50 serotypes of adenovirus (ad), divided among 7 species (a g) [1, 35, 715]. Species b viruses are distinguishable from their ability to severely infect the respiratory tract, urinary tract, and kidney . Some subspecies like the b2 adenovirus 11 are primarily responsible for urinary tract infections, while others like the b1 adenovirus 21 are more associated with ocular and respiratory diseases [5, 79, 11, 16]. Since no specialized treatments against these b adenoviruses are currently available, it is of particular interest to study how they interact with the immune system at the molecular level . Species b adenoviruses have broad infectivity tropism by using the ubiquitous cd46 receptor to infiltrate cells [2, 4, 9, 13, 14]. Cd46 is a membrane cofactor protein (also known as mcp) that is found as a glycoprotein on all human nucleated cells, including those in the immune system like monocytes and lymphocytes [3, 8, 15, 1719]. Cd46 is a regulator of complement activation (rca) and belongs to a family of proteins whose structures consist of short consensus repeat (scr) modules . Cd46 works as a cofactor with factor i, a serine protease that cleaves and inactivates complement proteins c3b and c4b . By binding to c3b and c4b that is, it works as a suppressing agent of the immune system by preventing attack on autologous cells . Studies have shown that binding of adenovirus, like ad11, can lead to cd46 downregulation, which sensitizes cells to complement - mediated lysis by mac [14, 19]. After species b adenoviruses attach to cd46 on a cell, viral invasion of the cell occurs with endocytosis and macropinocytosis, supported by integrins [2, 6]. Due to the ubiquitous nature of cd46, type b adenoviruses have become useful as gene delivery vectors for being able to transduce hematopoietic stem cells, dendritic cells, and malignant tumor cells [2, 3, 7, 8]. Compared with other species, type b adenoviruses are less susceptible to inactivation by host immune molecules due to lower levels of neutralizing antibodies in human sera against the virus . Many recombinant type b or fiber - swapped adenovirus vectors have been developed for gene transfer and vaccination approaches . Thus, the comparison of receptor binding mechanisms to cd46 for different adenoviruses will be useful for improving selection of gene delivery vectors [5, 13]. Each of the many capsid vertices on adenoviruses 11 and 21 has a trimeric fiber protein consisting of an n - terminus, an elongated shaft, and a globular knob domain that binds with cd46 [1, 2, 6, 7, 11, 19]; the knob domains of ad11 and ad21 are called ad11k and ad21k, respectively, hereafter . Crystal structures show that the viral knob domain is a trimeric ligand with three identical protomers, and each protomer binds to a specific part of a cd46 molecule (figure 1(a)). Cd46 is made of four scr domains, with the 4th scr domain (scr4) linked by an stp (rich in serine, threonine, and proline) segment, a transmembrane region, and a cytoplasmic tail [1, 5, 6, 810, 12, 1618]. Scr domains are connected to each other by a flexible interdomain linker, and the cytoplasmic tail is attached to the cell surface . Binding of an adenovirus protomer only occurs at the scr1 and scr2 domains of cd46(scr1 - 2), as shown schematically in figure 1(b) [2, 5, 7, 8, 1719]. Crystallization studies show that three protomers (p1, p2, and p3) of ad11k or ad21k bind to three molecules of cd46(scr1 - 2) [1, 2, 6, 7, 17, 19] (figure 1(a)). According to the topology of figures 1(c) and 1(d), each cd46(scr1 - 2) molecule binds two protomers of ad11k or ad21k . However, one protomer in each complex contacts a larger surface area on cd46(scr1 - 2) and is responsible for a larger number of intermolecular interactions . Both conformation and electrostatics are thought to drive the interaction of the adenovirus ligands to their receptor . The free structure of cd46(scr14) shows a bend between scr1 and scr2, but cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k show a more linear orientation of these domains, suggesting a conformational change upon virus binding [1, 2, 17]. Also, the loop regions of ad11k and ad21k change conformation before binding to cd46(scr1 - 2) [1, 2]. Both viral proteins in either complex bind to cd46(scr1 - 2) through coulombic interactions and hydrogen bonds [1, 6]. Previous studies have shown that critical salt bridges exist between glu63 of cd46(scr1 - 2) and specific arg residues on ad11k or ad21k [1, 6, 1315, 17]. Alanine - scanning mutagenesis has often been used to determine the individual contributions of different residues to a protein of interest . In cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k, certain residues can play critical roles in facilitating binding stability . In these residues, the role of the side chain functional groups can be inferred from alanine mutations . However, generating libraries of mutant proteins experimentally can be tedious and time - consuming . Recently, computational alanine scanning has allowed the calculation of alanine mutation effects on the binding free energy of a protein complex [2125]. The systematic mutation of residues by computational analysis allows the prediction of mutations that can dramatically affect protein binding affinity . Although the methodology is limited by factors such as conformational changes and nonadditive effects, it is an efficient way to yield an energy map of mutational perturbations that reveal important interactions in cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k . This energy map can serve as a predictive tool in the selection of cd46(scr1 - 2) or adenovirus protein mutants with desired binding affinity in experimental mutagenesis studies . In this paper, we compare the electrostatic interactions of ad11k and ad21k with their cd46(scr1 - 2) receptor to delineate similarities and differences in their binding mechanisms . We use computational tools to perturb the electrostatic network of cd46(scr1 - 2) and the two adenovirus proteins in order to identify and quantify the role of specific charged amino acids in association and binding . Since cd46(scr1 - 2), ad11k, and ad21k all have an overall negative charge, long - range recognition of cd46(scr1 - 2) with ad11k / ad21k is not initially favored . However, if there are localized charged patches on both proteins in a complex, these patches may facilitate long - range recognition as well as specific binding at the interface of the complex . We propose a generalized electrostatic hypothesis that contributes to the formation of the two complexes and suggest specific amino acids that are contributing to binding . Our analysis contributes to a molecular understanding of the mechanisms of adenovirus infection as well as provides a foundation for the design of molecular inhibitors against ad11k or ad21k binding . Three - dimensional coordinates of the complexes cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k were obtained from the protein data bank, with pdb ids 3o8e and 3l89, respectively . For cd46(scr1 - 2)-ad11k, chain a for ad11k and chain b for cd46(scr1 - 2) were selected because they had the least number of missing residues . The missing residues on chain a, 113128, were terminal residues and were sufficiently away from the binding site to be of concern; therefore, they were not reconstructed . A full heterohexameric cd46(scr1 - 2)-ad11k model was generated by applying a rotation / translation matrix transformation on chains a and b as specified in the pdb file header, using an r (https://www.r-project.org/) script . The resulting assembly consisted of a total of three cd46(scr1 - 2)-ad11k complexes, according to the topology of figure 1(c), and a complex containing two protomers bound to a single cd46(scr1 - 2) molecule was extracted for our analysis . In this complex, cd46(scr1 - 2) contained only modules scr1 and scr2, which participate in ad11k binding, whereas modules scr3 and scr4 were deleted . The program chimera was used to prepare the final cd46(scr1 - 2)-ad11k complex . For cd46(scr1 - 2)-ad21k, the pdb file had the truncated version of cd46(scr1 - 2) with only modules scr1 and scr2 present . Pdb chains b and c for ad21k and chain n for cd46(scr1 - 2) were chosen for the analysis (figure 1(d)). Chains b and c were chosen because they had the least missing residues compared to other complexes . The chimera model / refine loops interface of modeller was used to construct nonterminal missing residues for ad21k . The missing residues are not located near the complex interface and therefore may not directly affect association . The modified pdb files for both complexes were used to generate pqr files, containing atomic coordinates, partial charges, and atomic radii using pdb2pqr [30, 31] server with the parse force field selection . To determine the ionization state of each ionizable amino acid, apparent pka values this information was used in setting up the poisson - boltzmann electrostatic calculations, described below . The integrated analysis of electrostatic similarities of proteins (aesop) computational framework [23, 24, 35] was used to generate alanine scan mutants of the adenovirus protein, ad11k or ad21k, and cd46(scr1 - 2) for each of the two complexes . Aesop operates in the r environment using custom - made r scripts to systematically mutate the side chains of charged ionizable residues (arg, asp, his, glu, and lys) into alanine, one at a time, thus generating a family of mutant proteins . Alanine is typically chosen as a charge - removal perturbation with the least local structural perturbation, in analogy to experimental alanine scan studies . Chimera was used to rename the two adenovirus chains into one chain, enabling the separation of the complex into two components for the electrostatic calculations . For each member of the mutant family, separate pqr files were prepared for the complex and the two individual components of the complex . The adaptive poisson - boltzmann solver (apbs) was used to calculate spatial distributions of electrostatic potentials for the alanine scan mutant family and parent protein, using the linearized poisson - boltzmann equation [23, 24] and parameters from the pqr files . The protein molecular surface was calculated using a probe sphere with radius 1.4 and the ion accessibility surface was defined using a probe sphere with radius 2.0 . Grid dimensions and lengths were determined within aesop in order to achieve <1.0 grid resolution . For cd46(scr1 - 2)-ad11k, grid dimensions were 161 129 97 and grid lengths were 135 96 116 . For cd46(scr1 - 2)-ad21k, grid dimensions were 161 129 97 and grid lengths were 138 119 96 . The dielectric coefficient was set to p = 20 for the protein interior and s = 78.54 for the solvent, unless noted otherwise below . The use of an internal dielectric coefficient of p = 20 is justified in a study of the parameterization of the aesop framework using alanine scan experimental data on protein complexes with available crystal structures and is in agreement with earlier poisson - boltzmann parameterization data and numerous studies thereafter . Electrostatic potential calculations were performed with ionic strength corresponding to 150 mm of monovalent counterion concentrations, at a temperature of 298.15 k, to model experimental conditions . Apbs electrostatic potentials were calculated for each of the protein complexes and individual protein components, and electrostatic maps were generated with chimera . Chimera and custom r scripts were also used for calculation of distances in pairwise electrostatic interactions, such as coulombic and hydrogen bonding . A cutoff distance of 8 was used for coulombic interactions, with those below 5 referred to as salt bridges, hereafter . Chimera was used to calculate hydrogen bonds, according to standard geometric criteria . For each complex, the surface areas of individual proteins and the complex were measured with chimera, after adding hydrogen atoms to the crystal structures . Sasa was then calculated by taking the difference between the sum of individual protein surface areas and the complex surface area . Van der waals interactions were calculated using distance criteria with custom r scripts, which made use of the cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k pdb files . Six calculations of electrostatic potentials and electrostatic free energies were performed using apbs, as described in [23, 24, 35, 39], with each calculation corresponding to the reactants and products of the thermodynamic cycle shown in supplementary figure s1 of the supplementary material available online at http://dx.doi.org/10.1155/2015/967465 . In preparation for the calculations, all structures of the mutant complexes were centered on the coordinates of the parent protein complex to eliminate grid artifacts and allow for accurate comparison of electrostatic potentials and electrostatic free energies of binding within each family of mutants . After introduction of mutations using aesop, as described above, the components of each complex were separated to generate the reactants of the thermodynamic cycle of supplementary figure s1 . The thermodynamic cycle contains a reference binding state (top horizontal process) and a solution binding state (bottom horizontal process). Electrostatic potentials for the solution state were calculated with parameters described above (and shown in supplementary figure s1), while those of the reference state were calculated using the same dielectric coefficient of 20 for both the protein interior and solvent, in the absence of ionic strength . Electrostatic free energies of binding were calculated for cd46(scr1 - 2) and its corresponding adenovirus protein to show mutant effects on thermodynamic stability in each complex . The reported electrostatic free energies of binding for the mutants are relative to the parent protein (also called wild type, wt) and are given as(1)gbinding=gmutantsolutiongparentsolution, where gmutant and gparent correspond to(2)gsolution=gsolvation+gcoulombicas previously described [23, 40] (see supplementary figure s1 for description of the electrostatic free energy components). Electrostatic similarities for the families of cd46(scr1 - 2) and adenovirus protein mutants were calculated using the electrostatic similarity distance (esd) equation [23, 24, 39]:(3)esd=1ni, j, kbi, j, kai, j, kmaxai, j, k,bi, j, k, where a and b are the electrostatic potentials of proteins a and b, respectively, at grid point (i, j, k), and n is the total number of grid points . An n n pairwise comparison of distance matrix was generated, where n is the number of mutants plus the parent protein . An esd value of 0 represents identical electrostatic potentials, with an increasing value denoting increasing dissimilarity . Mutants were clustered in dendrograms based on their esd values, using a hierarchical clustering with an average linkage algorithm, implemented in r [23, 24, 39]. Clustering was performed for proteins in each of the two complexes, cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k . Our goal is to elucidate the role of charge in the interaction of cd46(scr1 - 2) with ad11k and ad21k . Although cd46(scr1 - 2), ad11k, and ad21k have negative net charges of 6, 8, and 6, respectively, they are able to form the complexes cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k . We used electrostatic potentials, electrostatic free energies of binding, hierarchical clustering, and local physicochemical analysis at the protein - protein interfaces to propose a mechanism of association . The surface at the interface of cd46(scr1 - 2) with ad11k / ad21k is composed of localized regions of positive and negative electrostatic potential projections (figure 2), which contribute to the makeup of the charged macrodipoles of the proteins, and therefore to nonspecific, long - range recognition step of association . These regions are organized into distinct patches, reflecting the types of residues that dominate the patches, and also contribute to the binding step of association through specific short - range electrostatic interactions . For example, positive patches contain an excess of arg and lys residues, while negative patches contain an excess of asp and glu residues . Visual inspection of figure 2 reveals a positive center around arg280(a) in ad11k and around arg247(b)/arg279(b) in ad21k with a negative patch on top of it . Complementary patches are in the cd46(scr1 - 2) contacts, with a negative center around glu63 and a positive patch above it . Table 1 summarizes all coulombic interactions at the interface using an 8 cutoff distance . Although both complexes distribute their charged residues at the interface for complementary binding, their charge distributions are distinct . The surface maps of figure 3 show the location of residues that are involved in any coulombic interactions . Cd46(scr1 - 2)-ad11k has two medium - strong favorable coulombic interactions at 5 or less (called salt bridges herein) and five weaker coulombic interactions in the range of 58 (called weak coulombic interactions herein), whereas cd46(scr1 - 2)-ad21k has three salt bridges and four weak coulombic interactions (table 1). Both complexes have unfavorable coulombic interactions, one strong and one weak for ad11k and one strong and four weak for ad21k . Overall, both complexes appear to have similar coulombic interactions contributing to the binding free energies of the two complexes . Based on the data of table 1, a central residue for binding is glu63 of cd46(scr1 - 2), located in the intermodular linker of scr1-scr2, because it makes salt bridge contacts with positively charged residues in ad11k / ad21k . Therefore glu63 is a key residue for the stability of cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k . Previous studies have also pointed out that glu63 is an important binding residue for ad11k [2, 6, 13] or ad21k . Table 2 shows intermolecular hydrogen bonds for all residues in cd46(scr1 - 2) and the adenovirus proteins . Cd46(scr1 - 2)-ad11k has 11 hydrogen bonds (involving 8 distinct residues in cd46(scr1 - 2) and 7 distinct residues in ad11k), while cd46(scr1 - 2)-ad21k has 8 hydrogen bonds (involving 8 distinct residues in both cd46(scr1 - 2) and ad21k). Most of the additional hydrogen bonds in cd46(scr1 - 2)-ad11k come from the interactions of the ad11k protomer 1 with cd46(scr1 - 2). Overall, the larger hydrogen bond count contributes to a more favorable enthalpic component of the binding free energy for ad11k . At the interface, cd46(scr1 - 2)-ad11k has a buried solvent accessible surface area (sasa) of 1841 while the cd46(scr1 - 2)-ad21k has a buried sasa of 2286, meaning that cd46(scr1 - 2)-ad11k has ~19.5% smaller area of interaction than cd46(scr1 - 2)-ad21k . The larger buried sasa of cd46(scr1 - 2)-ad21k also suggests a larger number of water molecules excluded from the binding interface and released in the bulk solvent, therefore contributing to more favorable entropic effects in the binding free energy . At the same time, this larger sasa implies a larger number of side chains with constrained conformational freedom, contributing to compensatory, less favorable entropic effects . We also calculated van der waals interactions (atom - atom contacts within 4) for each complex and found that cd46(scr1 - 2)-ad11k has 131 (28 from nonpolar atom pairs) interactions, whereas cd46(scr1 - 2)-ad21k has 184 interactions (79 from nonpolar atom pairs), corresponding to 51 more nonpolar contacts for ad21k compared to ad11k . Overall, the larger number of nonpolar interactions contributes to a more favorable enthalpic component of the binding free energy for ad21k . Our hydrogen bonding, salt bridge, and sasa data are overall in agreement with data from the pdbepisa server (http://www.ebi.ac.uk/pdbe/prot_int/pistart.html), with the exception of some potentially very weak hydrogen bonds suggested by pdbepisa, corresponding to donor - acceptor distances> 3.5 . It should be noted that our analysis includes both favorable and unfavorable coulombic interactions up to 8 . The pdbepisa analysis showed very small but similar gain in the solvation free energy upon formation of both complexes (without including interfacial hydrogen bond and salt bridge contributions). Through a systematic alanine scan of charged residues, we determined the contribution of each charged amino acid to the electrostatic component of the binding free energy in both complexes . We calculated electrostatic free energies of binding for the two families of mutants and parent proteins, as described in section 2.4 . Figure 4 shows graphs of differences between electrostatic free energies of binding (1) for cd46(scr1 - 2) from its complexes with the ad11k (figure 4(a)) and ad21k (figure 4(b)), respectively . Positive g values indicate that the complex is thermodynamically less stable than the parent protein complex, whereas negative g values indicate a more stable complex than the parent complex . Thus, a positive g sign indicates a loss of binding, whereas a negative g sign indicates a gain of binding upon mutation . The free energy maps of figures 5 and 6 show the location of individual residues that have experienced significant loss or gain of binding (see supplementary tables 13 for g values). In both complexes, mutated residues that contribute to more than 2.5 kj / mol in the free energy differences are considered to be more influential for binding, and they are marked in figure 4 (the chosen 2.5 kj / mol value corresponds to the thermal energy at room temperature). The data of figure 4 quantify that glu63 of cd46(scr1 - 2) has the strongest contribution to binding, followed by lys119 in both complexes, and also arg25 in the case of ad11k . This is in agreement with the assessment of intermolecular interactions discussed above on the basis of visualization and charge - charge distances in coulombic interactions (figures 2 and 3). The electrostatic potential of the glu63ala mutant appears to be unique, as it clusters on its own in the electrostatic clustering dendrograms (supplementary figures s4 and s5), and it shows the largest loss of binding effect in the free energy plots (figure 4 and supplementary table s1), compared to other acidic mutants . It appears that glu63 is a key residue for the interaction of cd46(scr1 - 2) with the adenovirus proteins, perhaps because of its unique position in the intermodule scr1-scr2 linker . In the case of the complex of cd46(scr1 - 2) with ad11k, removal of the unfavorable asp27-glu285(a) interaction, by replacing asp27 with ala, resulted in the strongest predicted gain of binding (figure 4). In general, the electrostatic free energy data (figure 4) are in agreement with the distance - based evaluation of coulombic interactions (table 1). Similar arguments can be made for the g of ad11k and ad21k, shown in supplementary figures s2 and s3 . However, the electrostatic free energy data reveal less obvious weak binding contributions from residues that are beyond the 8 distance that was used to define the binding interface . For completion, electrostatic clustering dendrograms for ad11k and ad21k are shown in supplementary figures s6 and s7 . Although the presence of surface patches with like charges produce unfavorable coulombic interactions, this effect can be compensated by the introduction of favorable intermolecular coulombic interactions at the binding interface and by solvation effects, depending on number, magnitude, and location of intermolecular interactions . To delineate the relative coulombic and solvation contributions in each mutant and parent protein, we examined the raw electrostatic free energies of association, g, for each mutant and parent protein and their decomposition into coulombic and solvation contributions, according to the thermodynamic cycle of supplementary figure s1 . Supplementary figures s8s11 show the electrostatic free energy decomposition for each of the four proteins in the cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k complexes . As expected g and g show opposite trends, and their combined magnitudes determine if the much smaller magnitude g will be overall favorable (negative) or unfavorable (positive). Based on the values and sign of the calculated g, cd46(scr1 - 2)-ad11k appears to be electrostatically more stable than cd46(scr1 - 2)-ad21k; however, g (coulombic and solvation effects) may not be the dominant contribution to the overall stability of the complexes, and one should consider additional energetic contributions (hydrogen bonds and nonpolar interactions), as well as entropic contributions . The effects of mutations of residues at the complementary charged surface patches discussed above are depicted in the free energy graphs of figure 4 and are summarized in supplementary tables s1s3 . For example, in the case of the cd46(scr1 - 2) free energy graph, the glu63 mutant has a significantly higher (loss of binding) g (> 6 kj / mol) than other mutants (figure 4). The higher g for glu63 comes from its primary contribution to the central negative patch of cd46(scr1 - 2), which aligns with the central positive patch of ad11k and ad21 upon complex formation (figure 2). Specifically, glu63 forms a salt bridge with arg280(a) in ad11k and a bifurcated salt bridge with arg247(b) and arg279(b) in ad21k, as shown in figure 7 . Therefore, removing glu63 would significantly reduce patch complementation and loss of pairwise interactions with the aforementioned arg residues in ad11k / ad21k, with the effect being more prominent in ad21k because of the bifurcated salt bridge (table 1, figure 7). Unlike the arg residues of ad11k / ad21k, glu63 does not have nearby negative residues that can compensate for its mutation, so its g is considerably higher than other mutations . Thus, there are specific charged residues in the center of ad11k or ad21k and cd46(scr1 - 2) that destabilize the complex when mutated . Since these residues exist in oppositely charged surface patches, patch complementation and specific pairwise interactions play a significant role in stabilizing both complexes . Similarly, in the case of the ad11k free energy graph, the arg266(e)ala, arg279(a)ala, and arg280(a)ala mutants all have relatively higher positive g (> 3 kj / mol) than that of the wild type (supplementary figure s2). The three residues belong to the same ad11k central positive patch, which aligns with a central negative patch containing glu63 on cd46(scr1 - 2) (figure 2). For the ad21k free energy graph, the arg247(b)ala and arg279(b)ala mutants also show positive g (supplementary figure s3) and reside in a positive patch that aligns with glu63 of cd46(scr1 - 2) (figure 2). Because mutating any of these arg residues diminishes the corresponding patch size, the higher g likely comes from a weakening of patch complementation . With the distribution of positive and negative charge on both proteins, . For ad11k, the large negative patch near asp300(e) complements with the protruded positive patch containing lys119 on cd46(scr1 - 2) (figure 2). For ad21k, glu299(c) also resides in a large negative patch that aligns with lys119 . The asp300(e)ala mutant has a g of 1.46 kj / mol and the glu299(c)ala mutant has a g of 1.22 kj / mol . These mutations diminish the corresponding negative patch, which would then be less amenable to align with positive patch of lys119 . Granted, there are nearby negative residues that can compensate for the loss of asp300(e) or glu299(c), but their absence still results in a less stable complex . For the lys119ala mutant of cd46(scr1 - 2), the free energy graph of cd46(scr1 - 2) shows a more pronounced g of approximately 5 kj / mol in both complexes (figure 4). Unlike asp300(e) of ad11k or glu299(c) of ad21k hence, the mutation of lys119 would strongly diminish the corresponding positive patch on cd46(scr1 - 2). Without lys119, the large opposing negative patch containing asp300(e) on ad11k or glu299(c) on ad21k would be heavily compromised in electrostatic alignment . In other words, the high g values of lys119 show how effectively this mutation destabilizes both complexes . For both cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k, the role of additional complementary mutations involved in stabilizing or destabilizing pairwise interactions, but not located in the charged surface patches discussed above, can be depicted by examining figure 4, supplementary figures s2 and s3, and supplementary tables s1s3 . The specific intermolecular coulombic and hydrogen bonding interactions can be seen in tables 1 and 2, respectively . Point out that both protein complexes have similar association rate constants (ka) and likely form complexes using similar recognition processes . As figure 2 shows, this recognition occurs from patch complementation between cd46(scr1 - 2) and the adenovirus proteins . However, cd46(scr1 - 2)-ad21k has a much greater dissociation rate constant (kd), resulting in lower binding affinity (higher dissociation constant, kd = kd / ka). According to table 2, cd46(scr1 - 2)-ad11k has 43% more intermolecular hydrogen bonds but 19.5% less sasa than cd46(scr1 - 2)-ad21k . We speculate that the additional hydrogen bonds play a dominant role in stabilizing the cd46(scr1 - 2)-ad11k . Nonetheless, the larger binding area of ad21k would contribute to the stability of the interface because of additional nonpolar interactions . The 22-fold higher affinity of ad11k compared to ad21k, expressed as ratio of kd values, corresponds to ~8 kj / mol binding free energy difference . Considering that a typical hydrogen bond energy can be up to 6 kj / mol, the 11 hydrogen bonds of cd46(scr1 - 2)-ad11k would contribute up to 66 kj / mol to the binding affinity, and the 8 hydrogen bonds of cd46(scr1 - 2)-ad21k would contribute up to 48 kj / mol . The difference of 18 kj / mol in hydrogen bonding is in favor of cd46(scr1 - 2)-ad11k stabilization compared to cd46(scr1 - 2)-ad21k (note that these contributions are estimates because we do not use variable distance and angle criteria and are used simply to denote which complex may be generally more favorable based on counting hydrogen bonds). Based on qualitative distance arguments, and although we have not taken into account effects owed to position - dependent variable dielectric coefficients, a coarse estimate of coulombic interactions suggests that ad11k and ad21k should have similar electrostatic contributions to binding (vide supra). On the other hand, the increased interfacial sasa of cd46(scr1 - 2)-ad21k provides a 9.3 kj / mol advantage for this complex (using a nonpolar energy approximation as in mm - gbsa calculations, with surface tension parameter equal to 0.0209 kj / mol /). In combination, these estimates suggest that cd46(scr1 - 2)-ad11k may be favored energetically over cd46(scr1 - 2)-ad21k, by ~9 kj / mol . It should be noted that these calculations provide a very approximate estimate of intermolecular energies and neglect the fact that intermolecular contacts may be dynamically forming and deforming . Also, the calculations neglect the frequency of contacts given that we use static crystallographic structures, as well as any entropic effects upon binding and desolvation . The hypothesis underlying our study assumes a two - step electrostatics - based model of association [2325, 35, 40, 43] between cd46(scr1 - 2) and the adenovirus proteins . According to this model, the first step, which is the recognition step, involves nonspecific long - range electrostatic interactions between the two proteins through the interaction of protein macrodipoles . In the second step, which is the binding step, the two proteins undergo conformational and entropic changes to form specific pairwise physicochemical interactions, including hydrophobic and electrostatic (hydrogen bonding and coulombic / solvation) contacts, as well as solvent exclusion . Although both components of the complexes, cd46(scr1 - 2) and ad11k / ad21k, have a negative net charge, the presence of complementary surface patches of opposite charges (and electrostatic potentials generated by these charges) is sufficient to accelerate their encounter through long - range electrostatic interactions and to lead to complex formation through short - range pairwise interactions and entropic effects . The presence of patches with like charges can be viewed as a stressed coulombic environment in the individual proteins, which drives complex formation in order to at least partially alleviate the stress by the formation of intermolecular electrostatic contacts . Therefore, the two - step association model, consisting of weak and nonspecific electrostatic recognition (step 1) and strong and specific binding (step 2), is expected to be operative in the case of cd46(scr1 - 2)-ad11k / ad21k association . However, in the case of step 2, compensatory enthalpic and entropic contributions may make qualitative arguments less intuitive . Experimental alanine scans (and point mutations in general) are perturbation methods that alter the physicochemical composition of the local environment and are typically used to elucidate the role of the mutated amino acids in binding . Computational alanine scans (or other mutations) and electrostatic calculations are useful to predict the role of ionizable amino acids in binding for highly charged proteins . Such data are faster to generate than experimental data and can guide subsequent experimental studies . Figures 46, supplementary figures s2 and s3, and supplementary tables s1s3 provide databases of computationally predicted loss of binding and gain of binding mutations for cd46(scr1 - 2), ad11k, and ad21k . We have compared our computational results with an experimental alanine scan that examined the interaction of cd46(scr1 - 2) mutants with ad11k . This study suggests that mutating arg25, lys110, and lys119 on cd46(scr1 - 2) results in ~20% drop in binding efficiency compared to wild type cd46, which is in agreement with our study . However, the experimental study does not present data for the most significant mutation according to our computational data, that of glu63ala . It is likely that glu63ala was excluded in the experimental study because it is located in the linker between the two scr domains; however, our experience with other scr - containing viral inhibitors of the complement system suggests that charged linker residues play an important role in recognition of complement protein targets [4346]. The experimental data shows no change in binding efficiency for the asp27ala mutant, even though our computational analysis predicts that the mutant should experience a noticeable gain in binding . This may be either due to the experimental design or due to a nonphysiological conformation of asp27 in the crystal structure of cd46(scr1 - 2)-ad11k, but not in cd46(scr1 - 2)-ad21k, we used in our calculations . To the best of our knowledge, there are no mutagenesis data on cd46(scr1 - 2)-ad21k in the literature . Thus, we hope that our computational results can act as a guide for future mutagenesis experiments in order to target more relevant residues that impact binding on cd46(scr1 - 2) and ad11k / ad21k . / ad21k have negative net charge, they are still able to associate with stable complexes . This is because of the presence of oppositely charged patches on the surfaces of cd46(scr1 - 2) and ad11k / ad21k, which allow the adenovirus proteins to recognize cd46(scr1 - 2) and promote binding, in addition to nonelectrostatic effects and entropic contributions . Such patches originate from the clustering of specific charged groups on the protein surfaces . At the interface, residues that contribute to binding participate in important pairwise intermolecular interactions (hydrophobic and electrostatic). Our electrostatic free energy graphs show that mutations of ionizable residues at the complex interface cause a more distinguishable change in the electrostatic energy of binding for the complex . A critical residue for the formation of cd46(scr1 - 2)-ad11k / ad21k is glu63 of cd46(scr1 - 2), which is involved in stabilizing coulombic interactions in both complexes . Overall, this study has shown that electrostatics contributes to the formation of cd46(scr1 - 2)-ad11k and cd46(scr1 - 2)-ad21k . We propose specific mutations that are predicted to be stabilizing or destabilizing of the complexes . Upon experimental verification, this type of analysis may be useful in designing cd46(scr1 - 2)-like molecules or cd46(scr1 - 2)-derived peptide fragments that may be potential ad11k / ad21k viral inhibitors . / ad21k - derived peptide fragments to serve as inhibitors of cd46(scr1 - 2) and complement activation, which would be useful in cases of autoimmune diseases . Finally, site - specific mutations could be used for developing adenoviruses into better gene delivery vehicles, and combinatorial mutagenesis may lead to tailored protein variants, as previously shown [4346].
Propofol is a short - acting intravenous hypnotic agent, which is widely used for sedation and general anesthesia . However, pain during injection of propofol can occur in up to 80% of patients, which can be very stressful to patients . Many methods including cooling or diluting the propofol solution or the concomitant use of drugs such as methylene blue, pregabalin, or magnesium sulfate have been used to reduce this pain . However therefore, propofol long - chain triglycerides (lcts)/medium - chain triglycerides (mcts) were introduced to minimize injection pain, which has less concentration of aqueous free propofol than propofol - lct . However, pain on injection still occurs despite use of propofol - lct / mct . Pretreatment with small dose of remifentanil has been demonstrated to be effective in reducing pain from propofol injection without side effects . Esmolol, a short - acting 1 adrenergic receptor antagonist, is widely used to reduce cardiovascular stress response to layngoscopy and tracheal intubation . It was shown that perioperative infusion of esmolol reduced anesthetic requirement for surgery and postoperative analgesic consumption . Recently, it was reported that pretreatment with esmolol 0.5 mg / kg has analgesic effect on rocuronium injection pain without side effects . The present study was designed to compare the analgesic effect of pretreatment with remifentanil 0.35 g / kg, and esmolol 0.5 mg / kg and 1 mg / kg in minimizing pain during injection of propofol - lct, compared with placebo . In all, 120 patients aged 18 to 70 years, american society of anesthesiologists physical status i and ii, scheduled for elective dental surgery requiring general anesthesia were included . We excluded patients who have cardiac, neurologic or psychiatric problem, patients who had analgesic or sedative agents within 24 hours before surgery, and patients requiring a rapid sequence induction . The present study was approved by the ethics committee of kyungpook national university hospital (knuh 201305003001) and informed written consent was obtained from all patients . On arrival in the operating room, electrocardiogram, noninvasive blood pressure, and pulse oximetry were measured, and a 22-gauge catheter was inserted into a dorsal vein of the patient's nondominant hand . Using a computer - generated table, patients were randomized to 1 of the 4 treatment arms (n = 30 each) receiving normal saline, remifentanil 0.35 g / kg, esmolol 0.5 mg / kg and 1 mg / kg as pretreatment . A study - blinded nurse prepared pretreatment substance using identically coded syringes at room temperature . Thirty seconds after injection of pretreatment drug, patients received propofol - lct 0.5 mg / kg at rate of 0.5 ml / sec using syringe pump . A study - blinded anesthesiologist measured score of injection pain of propofol using a 4-point scale (0 = none [negative response to questioning], 1 = mild pain [pain reported in response to questioning only, without any behavioral sign], 2 = moderate pain [pain reported in response to questioning and accompanied by a behavioral sign, or pain reported simultaneously without questioning], 3 = severe pain [strong vocal response or response accompanied by facial grimacing, arm withdrawal or tears]). Thereafter, propofol - lct1.5 mg / kg and rocuronium 0.8 mg / kg were administered for tracheal intubation, and anesthesia was maintained with desflurane 4% to 7% in 50% n2o / o2 . Emergence reactions associated with pretreatment substances such as hypotension and bradycardia were recorded . In the present study, the incidence and severity of pain after propofol injection was the primary outcome, and all other variables were secondary outcomes . On the basis of previously published data, we estimated the incidence of pain during propofol injection in the placebo group to be around 80% . A 40% difference (80%40%) between placebo group and treatment groups would be considered of clinical significance . Using a 2-tailed test of the proportions with error of 0.05 and error of 0.8, data were analyzed using statistical software (spss, version 23.0 for windows; spss, chicago, il). Fisher exact test or the chi - square test was used for sex, incidence of pain, and incidence of side effects . In all, 120 patients aged 18 to 70 years, american society of anesthesiologists physical status i and ii, scheduled for elective dental surgery requiring general anesthesia were included . We excluded patients who have cardiac, neurologic or psychiatric problem, patients who had analgesic or sedative agents within 24 hours before surgery, and patients requiring a rapid sequence induction . The present study was approved by the ethics committee of kyungpook national university hospital (knuh 201305003001) and informed written consent was obtained from all patients . On arrival in the operating room, electrocardiogram, noninvasive blood pressure, and pulse oximetry were measured, and a 22-gauge catheter was inserted into a dorsal vein of the patient's nondominant hand . Using a computer - generated table, patients were randomized to 1 of the 4 treatment arms (n = 30 each) receiving normal saline, remifentanil 0.35 g / kg, esmolol 0.5 mg / kg and 1 mg / kg as pretreatment . A study - blinded nurse prepared pretreatment substance using identically coded syringes at room temperature . Thirty seconds after injection of pretreatment drug, patients received propofol - lct 0.5 mg / kg at rate of 0.5 ml / sec using syringe pump . A study - blinded anesthesiologist measured score of injection pain of propofol using a 4-point scale (0 = none [negative response to questioning], 1 = mild pain [pain reported in response to questioning only, without any behavioral sign], 2 = moderate pain [pain reported in response to questioning and accompanied by a behavioral sign, or pain reported simultaneously without questioning], 3 = severe pain [strong vocal response or response accompanied by facial grimacing, arm withdrawal or tears]). Thereafter, propofol - lct1.5 mg / kg and rocuronium 0.8 mg / kg were administered for tracheal intubation, and anesthesia was maintained with desflurane 4% to 7% in 50% n2o / o2 . Emergence reactions associated with pretreatment substances such as hypotension and bradycardia were recorded . In the present study, the incidence and severity of pain after propofol injection was the primary outcome, and all other variables were secondary outcomes . On the basis of previously published data, we estimated the incidence of pain during propofol injection in the placebo group to be around 80% . A 40% difference (80%40%) between placebo group and treatment groups would be considered of clinical significance . Using a 2-tailed test of the proportions with error of 0.05 and error of 0.8, data were analyzed using statistical software (spss, version 23.0 for windows; spss, chicago, il). Fisher exact test or the chi - square test was used for sex, incidence of pain, and incidence of side effects . 1). There was no difference in demographic data between groups (table 1). The incidence of pain during propofol injection was significantly reduced with remifentanil 0.35 g / kg (36.7%), esmolol 0.5 mg / kg (40%) and 1 mg / kg (36.7%), compared with placebo group (83.3%) (respectively, p <0.05). In addition, pretreatment with remifentanil (3.3%), and esmolol 0.5 mg / kg (3.3%) and 1 mg / kg (3.3%) significantly decreased the incidence of severe injection pain, compared with placebo (26.7%) (respectively, p <0.05). There were no emergence reactions associated with pretreatment substances such as hypotension and bradycardia in all groups . . Demographic characteristics of the study population (n = 120). Incidence and pain severity during injection of propofol . This study showed that pretreatment with remifentanil 0.35 g / kg, and esmolol 0.5 mg / kg and 1 mg / kg, was equally effective to reduce pain during propofol injection, compared with placebo . But propofol is associated with high incidence of pain at injection site, which is often very stressful to patients . The direct exposure of nociceptive receptors or free nerve ending in the vein by free propofol can increase the pain on injection . Varghese et al reported that when added with lidocaine, both propofol - lct / mct and propofol - lct had similar incidence of injection pain . By a systemic review and meta - analysis in 2011, pretreatment with a small dose of opioids halved the incidence of pain after propofol injection, which can generally be recommended . The previous study demonstrated that pretreatment with remifentanil 0.35 g / kg reduced injection pain of propofol by 38.8% without any side effects . In the present study, the incidence of pain from propofol injection was 33.3% in the patients who received remifentanil 0.35 g / kg, which is consistent with the previous study . Esmolol, antagonist of 1 adrenergic receptor, is often used to blunt adrenergic response to perioperative stimuli . It was demonstrated that a single injection of esmolol 1 to 2 mg / kg is effective to attenuate the increase of heart rate after intubation without adverse effects . In the previous studies, intraoperative infusion of esmolol decreased the requirement of opioid and inhalation anesthetic without causing hemodynamic change, and reduced postoperative analgesic consumption . Up to date, the exact analgesic mechanism of adrenergic receptor antagonist remains unclear . Adrenal hormone, commonly known as stress hormone, increases during emotional distress and anxiety, which are associated with activation of hypocampal neurons . Adrenergic receptors are involved in learning - facilitated plasticity in the mammalian hippocampus, which requires activation of n - methyl - d - aspartate (nmda) receptor . The activation of nmda receptor in the hippocampus is involved in nociceptive processing, at least, in part . In addition, it was found that esmolol can facilitate inhibitory transmitter release in spinal trigeminal nucleus, which produces analgesic effects . In the present study, pretreatment with esmolol 0.5 mg / kg and 1 mg / kg and remifentanil 0.35 g / kg equally decreased pain during propofol injection . The incidence of pain when propofol was injected into vein of the dorsum of hand can reach as high as 80% . Pretreatment substances such as remifentanil and esmolol can cause dose - dependent decrease in blood pressure and heart rate . Therefore, a placebo group was included to investigate the adverse effect of the pretreatment substances . In the present study, there were no emergence reactions associated with pretreatment with remifentanil 0.35 g / kg, and esmolol 0.5 mg / kg and 1 mg / kg . These results were compatible with the previous studies . The present study had some limitations . In the present study, premedication, such as sedatives, the previous study showed that 87% of patients who did not receive anxiolytic premedication reported the recall about injection pain after propofol injection . Therefore, another study is needed to examine the patient's satisfaction about anesthetic care and the incidence of recall for pain during propofol injection . In conclusion, pretreatment with esmolol 0.5 mg / kg and 1 mg / kg, and remifentanil 0.35 g / kg were equally effective in reducing pain during injection of propofol without adverse effects.
Over - the - counter cold medicines, which contain amantadine, are widely used in the people s republic of china . Clinicians are familiar with the psychosis caused by long - term treatment with amantadine, especially in elderly patients; however, early - onset psychotic complications among healthy young individuals have rarely been reported . This article reports the case of a 28-year - old patient who presented with hallucination delusion syndrome soon after treatment with cold medicine containing amantadine hydrochloride and acetaminophen . Clinicians should be sensitive to the acute psychotic complications induced by an interaction between amantadine and acetaminophen . Over - the - counter cold medicine, which contains amantadine, is widely used in the people s republic of china . Typically, it takes several months of amantadine administration to bring about these side effects.1 in this article, we report on the case of a 28-year - old patient suffering from a cold who presented with hallucination delusion syndrome immediately after the use of a cold medicine containing amantadine hydrochloride and acetaminophen . A 28-year - old man was admitted to the first affiliated hospital of zhejiang university school of medicine because of hallucinations and persecutory delusions, which lasted for ~48 hours . When he was alone at home, he had an auditory hallucination that his parents described of inviting a taoist, and he heard that his birthday horoscope did not match with that prepared by his parents . The auditory hallucinations lasted for almost an entire day and severely affected the patient s sleep . Prior to admission, he had been in excellent health and did not have a history of medical problems, psychiatric disorders, or substance abuse . He was born in zhejiang province of the people s republic of china and had not traveled elsewhere . Five days prior to admission, he reported symptoms of a cold, including a runny nose, and had therefore started taking an over - the - counter cold medicine (brand name: kuaike), which contained 250 mg of acetaminophen and 100 mg of amantadine hydrochloride . Three days later, he began to experience hallucinations and delusions . During the mental status examination administered upon admission, however, he frequently looked down and did not maintain eye contact with the examiner . His speech was a bit slow, but with normal tone, rhythm, and prosody . Although the patient acknowledged his own abnormal mental state, his insight was still partially impaired . Laboratory studies revealed complete blood count, electrolytes, glucose, urea, creatinine, hepatic function, and thyroid hormone levels within normal limits, and the rapid plasma reagin test, serum human immunodeficiency virus (hiv) antibody test, and urinalysis for narcotic drugs were negative . The patient was immediately treated with haloperidol (5 mg daily) and paliperidone extended release (3 mg daily), while kuaike administration was ceased . Haloperidol was used for 3 days, and the use of paliperidone extended release was maintained for 2 weeks to prevent relapse . Six months later, we conducted a telephonic follow - up, wherein the patient reported of no subsequent psychotic experiences . Written informed consent was obtained from the patient for the publication of this case report . The report was approved by the first affiliated hospital of zhejiang university school of medicine ethics committee . Written informed consent was obtained from the patient for the publication of this case report . The report was approved by the first affiliated hospital of zhejiang university school of medicine ethics committee . Existing literature reports about several drugs that could induce acute psychosis, such as psychostimulants,2,3 antibiotics,4 antivirals,5 and antiparkinsonism.6 amantadine is indicated for the treatment of influenza a, parkinsonism, and drug - induced extrapyramidal reactions . Increasing evidence shows that amantadine enhances dopamine release indirectly via antagonism of the n - methyl - d - aspartate receptor, and this mechanism may be responsible for this rarely exhibited psychotic side effect.7 n - methyl - d - aspartate antagonists, such as ketamine, can induce the positive, negative, and cognitive symptoms of schizophrenia.8 there are numerous reports of amantadine being prescribed for long - term antiparkinsonian effect.9,10 however, to our knowledge, there were only three previous reports of rapid psychiatric complications among otherwise healthy and young individuals . The first report described an acute psychosis secondary to an amantadine overdose,11 the second noted the emergence of psychosis following 100 mg of amantadine twice daily in combination with venlafaxine and quetiapine,12 and the third study presented two cases of psychosis among 295 subjects in an antiviral trial of amantadine.13 the current case demonstrates the potential adverse effects of amantadine on the central nervous system among young healthy adults at the standard dose . Although the incidence of this induced psychosis is low, it may increase with the daily administration of amantadine, and clinicians should be aware of the rapid onset of these psychotic complications . Recently, the use of amantadine in the treatment of influenza a has been discouraged.14 because of its limited effectiveness, amantadine is only recommended for use during a serious epidemic or pandemic alongside other public health measures.15 although we believe that amantadine was the primary cause of this patient s psychosis, we cannot exclude the effects acetaminophen might have had in this adverse reaction . There have been only two reported cases of acetaminophen use associated with psychosis: acetaminophen in combination with codeine and acetaminophen overdose.16,17 acetaminophen has been reported to have an inhibitory effect on prostaglandin synthase in the brain,18 and prostaglandin itself has been linked to the etiology of schizophrenia.19 over - the - counter cold medicines containing amantadine are widely used in the people s republic of china . Clinicians should be aware of the severe side effects of these medicines on the central nervous system.
Anteromedial, anterolateral, and superomedial portals were created and a diagnostic arthroscopy was performed . The presence of a concomitant injury to the ligament or cartilage was assessed and meniscal tear was identified . Unstable fragments and fibrous tissues were removed with a motorized shaver, rasp, or basket forceps and the surface of the meniscus was exposed . The meniscal surface and adjacent synovium were abraded to stimulate vascularization . For the repair of the medial meniscal tears, an arthroscope was inserted via the anteromedial portal and a zone specific cannula was inserted via the anterolateral portal . Vertical mattress sutures using a double arm needle were placed every 4 mm along the length of the tear in an inside out fashion . An additional suture strand was used when the sutures were not considered strong enough . For the lateral meniscal repairs, an arthrosocpe was inserted through the anterolateral portal and sutures were inserted using a zone specific cannula through the anteromedial portal . An accessory incision was made on the medial side for medial tears and lateral side for lateral tears for knot tying and the suture passed through the cartilage was retrieved through it . Peripheral blood (50 - 60 ml) was collected from the arm using a sterile syringe and transferred into a 200 ml beaker (fig . The blood was gently stirred with a glass rod (10 ml glass syringe plunger) for 5 to 10 minutes until 3 - 5 ml fibrin clot precipitated around the rod . Then, the clot was placed on damp gauze to remove excess fluid and trimmed to proper size (fig . A transparent shoulder cannula with its polyethylene diaphragm (used to prevent reflux of irrigating fluid) removed to facilitate passage of the fibrin clot was inserted through the anterolateral portal for medial tears and anteromedial portal for lateral tears . A 20 cm - long 18-gauge needle was inserted through the cannula, penetrated the target area where the prepared fibrin clot would be added and the skin . A wire loop attached to a needle was inserted through the 18-gauge needle and was withdrawn from the skin, and the outer 18-gauge needle was removed (fig ., the suture was passed through the wire loop and pulled out of the skin . Irrigation inflow was turned off to proceed the procedure under a " dry scope . " The clot was inserted through the cannula and delivered into the desired intraarticular site by using a plastic pusher and gently pulling the connected suture strand (fig . After confirming the location of the clot, the sutures that had been pulled through the meniscus out of the joint were ligated . Partial weight bearing was performed for 6 postoperative weeks in most of the cases . In cases of radial tears, cast immobilization was applied for 3 postoperative weeks, mobilization exercises were started at 0-30 after the 3rd postoperative week and advanced gradually until the 6th postoperative week, and partial weight bearing was allowed afterwards . Between june 2007 and march 2010, 41 meniscal tears (19 radial tears, 12 longitudinal tears in the red - white zone, 7 transverse tears, and 3 oblique tears) were repaired using a fibrin clot at our institution . Second - look arthroscopy or follow - up mri was performed at an average of 8.3 months after surgery . Once a meniscus is torn or treated with menisectomy, the load - bearing function of the meniscus changes and the knee joint becomes less stable, which leads to a higher risk of osteoarthritis . An in vitro study showed that 16% to 34% removal of the meniscus led to a 350% increase in the load on the articular surface5). The meniscus should be preserved whenever feasible especially in young or active patients because they become more vulnerable to osteoarthritis after menisectomy6). However, meniscal tear repairs are not always successful and healing can be delayed or fail . Accordingly, various methods designed to promote healing have been suggested including meniscal rasping, fibrin clot insertion, vascular access channel creation, and synovial flap transfer . The indications for meniscal repair surgery have been extended with use of those procedures that facilitate healing of lesions in the avascular zones2). Webber et al.7) reported that delayed healing was attributable to the absence of a hematoma, not a blood supply per se . A hematoma in a torn meniscus acts as a scaffold that contains growth factors and repair cells for fibrocartilage regeneration through chemotactic activity . The frequency of hematoma formation is lower in the white - white zone or white - red zone compare to the red - red zone . Arnoczky et al.4) reported that an exogenous fibrin clot acted as a hematoma that promotes healing of the meniscus in dogs . In other words, lesions that had been filled with a fibrin clot healed through a proliferation of fibrous connective tissue that modulated into fibrocartilaginous tissue . Afterwards, many authors have reported on the efficacy of the use of a fibrin clot in clinical settings . In the study of henning et al.8), the failure rate of meniscal repair using a fibrin clot was 8% . Van trommel et al.2) reported that all of the 5 lateral meniscus tears involving the popliteal hiatus healed with repair using fibrin clot which were confirmed by second - look arthroscopy . For now, the best clinical results of the fibrin clot use can be expected in isolated meniscal tears . The recent increase in the use of prp has led to a high interest in fibrin clots which has similar healing properties that can be obtained without particular equipment at low costs3). However, due to its fragility, delivering the fibrin clot to the exact desired intraarticular site has been considered challenging . However, studies that document a delivery method that can be standardized are rare . Although some studies showed that a fibrin clot could be delivered into the joint using a suture or an injection syringe, they are not described in detail and too difficult to reproduce2,8). In the study of sethi et al.9), the synovium near the meniscus was abraded to induce bleeding and the blood ran down and pooled in the torn site to form an in situ fibrin clot . This method is advantageous in that an exogenous fibrin clot delivery method is not needed . However, there is a possibility that the clot may be irrigated away and it is difficult to create a clot in the exact site . Van trommel et al.2) reported successful results of meniscal repair using a fibrin clot, but they did not describe the delivery method that they used . Arthroscopy forceps cannot be helpful in planting fibrin clots in the exact spot10). A fibrin clot tied with a suture can be delivered from the anterior portal to a desired site, but it is highly likely to be destroyed during the procedure . With our method that has high reproducibility, a fibrin clot can be delivered to a desired site with ease without risk of being damaged by soft tissue during insertion . Our method can be applied to meniscal tears, especially longitudinal tears in the white - white zone or white - red zone where the likelihood of repair failure is high . In addition, the method is expected to extend the indications for meniscal repair to radial tears where menisectomy is expected to result in functional loss, large - sized transverse tears in young patients, areas between bundles after double - bundle anterior cruciate ligament reconstruction3), and rotator cuff repair . However, we believe a long - term follow - up study should be conducted and biomechanical changes and systemized indications for the use a fibrin clot in meniscal repair should be investigated in future studies.
Durable left ventricular assist devices (lvads) improve the quality and length of life by restoring normal circulation in the majority of recipients1 . Since the introduction of smaller and more durable continuousflow lvads, there has been a steady decline in adverse event rates and, consequently, better survival rates2, 3, 4 . Recent studies have shown that the 1year survival for bridge to transplant (btt) is 85%, and the 2year survival for destination therapy (dt) is 76% . Measures for quality of life and functional status have also demonstrated substantial benefit from lvad support in patients with severe debilitation secondary to heart failure5 . While several clinical studies have confirmed that lvad support provides considerable benefits for the majority of recipients, this therapy remains seriously underutilized6 . In 1958 the discipline developed slowly, with approximately 200 surgeries performed each year . Since gaining independence in 1991, 26 cardiac surgery centres were established across the country, and in 2014, there were more than 8000 cardiac surgeries performed in kazakhstan . Prior to 2011, there was no vad programme and most patients could not afford to travel outside the country for treatment; patients with severe heart failure received medical treatment that helped palliate the disease with limited impact on longterm outcomes . In this context, the national research center for cardiac surgery (nrccs), located in astana, kazakhstan, established a mechanical circulatory support programme in 2011.with the help of experienced european centres, the nrccs established the sole vad programme in kazakhstan providing vad support to all regions of this, the world's ninth largest country . This report describes the logistics and clinical results for the first three years of the programme . This was a retrospective, observational study of patients who received lvad implantation from the start of the programme in november 2011 to november 2014 and the last date of follow up was 28 february 2015 . The nrccsvad team uses four devices the heartmate ii and centrimag vad (thoratec corporation, pleasanton, ca, usa), heartware hvad (heartware international, framingham ma, usa) and the heartmateiii (thoratec), the latter of which was approved for use in btt and dt in kazakhstan in 2014 . Our analysis included all patients with endstage heart failure who received a vad and excluded the small number of patients who received heartmateiii devices . We used the adverse event definitions as described by the intermacs group.7 the investigation conforms with the principles outlined in the declaration of helsinki . Local ethics committee approval was obtained, and all patients gave written consent agreeing that their clinical data could be used for research purposes . Descriptive analysis was performed by presenting the mean sd for continuous data . Kazakhstan is a country with 17 million residents dispersed over 2.7 million km (6.4 persons / km). In 2010, initial resources available at the time included a stateoftheart cardiac surgery hospital that opened in october 2011, an experienced surgical team and financial support from the kazakhstan ministry of health . Nrccs staff also received training at centres in the czech republic, lithuania, united states and germany . A multidisciplinary team was established to cover all the responsibilities related to selection of patients and continued care, both within the city of astana and in remote regions across the country (figure 1). The team developed mechanical circulatory support operating procedures and provided training to staff from 15 regional hospitals and clinics across the country . Kazakhtan: number of vad patients of region of residence and driving distances from nrccs . Distances from the nrccs to the regional centres are up to 2000 km . Because patients are discharged home to regions distant from the nrccs, identification of a cardiologist knowledgeable in vad is essential . Cardiologists (n = 31), surgeons (n = 8) and nurses (n = 12) participated in educational meetings at the nrccs that were designed to provide sufficient knowledge of the vad systems to enable firstlineofcare in cases of emergency and routine followup assessment cardiologists who work far from a tertiary care centre are given 2 days of training . Patients and their family are also trained on the vad system prior to patient discharge . Training consists of heart failure medical management, including anticoagulation therapy, monitoring for complications (e.g. Driveline infections and stroke) and directions related to device troubleshooting . The programme provides air ambulance transport when necessary to return the patient to astana via chartered plane or helicopter for advanced evaluation and care . Reasons for this can include device troubleshooting, pump thrombosis, stroke, major bleeding and generalized infections . If patients are not sufficiently stable for transport, we provide advice to local physicians on patient management . Patients with advanced heart failure are referred to nrccs for consideration of an implantable vad; referrals come from within the institution and from cardiologists around kazakhstan (figure 1). The team includes vad surgeons, cardiologists, a vad coordinator, anaesthesiologists, neurologists, nephrologists, nurses, a dietician, psychologists, a pharmacist and physiotherapists . Preimplant psychological assessment and evaluation of social support, including obtaining information about the patient's home environment to ensure essential vad operating and management conditions, are conducted before implant . The indication for lvad support according to usual international criteria for btt or dt is determined during the workup phase . The heart transplant programme in kazakhstan is in a nascent stage, and therefore, patients that are determined to be btt are expected to have an extended duration of lvad support . In the three years prior to february 2015, 14 heart transplant surgeries have been performed in kazakhstan13 at the nrccs in astana and 1 in the city of almaty . After the assessment, lvad candidates are educated about the surgery, followup care, and selfcare requirements; then, signed informed consent is obtained . There are no specific criteria for device selection (e.g. Heartmate ii vs. heartware hvad) except that the hvad device is often preferred in the case of smaller patients (body surface area 1.21.5 m). Implantation techniques and postoperative management followed established guidelines.8, 9 anticoagulation therapy for heartmate ii patients included an early, postoperative intravenous infusion of heparin and then, when possible, daily oral aspirin (100 mg) and warfarin regimen, with a target international normalized ratio (inr) of 2.02.5 . There are some differences in anticoagulation strategy for hvad patients compared with lvad patients hvad patients are given a higher aspirin dose (300 mg daily) and higher warfarin dose to reach an inr range of 2.53.5 . After patients are stabilized, they are transferred from the intensive care unit to the cardiac surgery ward and then to the lvad department for rehabilitation and preparation for hospital discharge . Detailed selfcare instruction is provided to patients and their family members; for patients who will return to their home outside of astana, any necessary instruction is provided to medical professionals in that community for continued care . Several patients who previously received implants have subsequently joined nrccs staff in various roles and at times provide emotional support to new patients during their hospital stay . Patients and family members provide all vadrelated care and maintenance . In each community with two or more patients, a support group has been formed to assist other patients with social adaptation . Each patient carries an identification card that has their name, a description of the device, serial number and contact information for the vad coordinator in astana . Patient and caregivers are trained on proper driveline care, which is performed daily in summertime and 3 times per week in the winter . After discharge, local physicians see patients monthly for 3 months, then every 3 months or more often as needed . All patients return to the nrccs in astana at months 1, 3 for laboratory analysis and echocardiography and at month 6 for catheterization, laboratory analysis and spiroergometry . While at home, patients maintain contact with the nrccs vad coordinator and nurses . Patients communicate health status, driveline status, weekly inr results directly to the vad coordinator and nurses using whatsapp, a software application for mobile phone devices . Patients take photos of their driveline exit site and send these once weekly to the vad coordinator and nurses . If necessary, the nrccs surgeons are asked to assess the patient . Descriptive analysis was performed by presenting the mean sd for continuous data . Kazakhstan is a country with 17 million residents dispersed over 2.7 million km (6.4 persons / km). In 2010, initial resources available at the time included a stateoftheart cardiac surgery hospital that opened in october 2011, an experienced surgical team and financial support from the kazakhstan ministry of health . Nrccs staff also received training at centres in the czech republic, lithuania, united states and germany . A multidisciplinary team was established to cover all the responsibilities related to selection of patients and continued care, both within the city of astana and in remote regions across the country (figure 1). The team developed mechanical circulatory support operating procedures and provided training to staff from 15 regional hospitals and clinics across the country . Kazakhtan: number of vad patients of region of residence and driving distances from nrccs . Distances from the nrccs to the regional centres are up to 2000 km . Because patients are discharged home to regions distant from the nrccs, identification of a cardiologist knowledgeable in vad is essential . Cardiologists (n = 31), surgeons (n = 8) and nurses (n = 12) participated in educational meetings at the nrccs that were designed to provide sufficient knowledge of the vad systems to enable firstlineofcare in cases of emergency and routine followup assessment cardiologists who work far from a tertiary care centre are given 2 days of training . Patients and their family are also trained on the vad system prior to patient discharge . Training consists of heart failure medical management, including anticoagulation therapy, monitoring for complications (e.g. Driveline infections and stroke) and directions related to device troubleshooting . The programme provides air ambulance transport when necessary to return the patient to astana via chartered plane or helicopter for advanced evaluation and care . Reasons for this can include device troubleshooting, pump thrombosis, stroke, major bleeding and generalized infections . If patients are not sufficiently stable for transport, we provide advice to local physicians on patient management . Patients with advanced heart failure are referred to nrccs for consideration of an implantable vad; referrals come from within the institution and from cardiologists around kazakhstan (figure 1). The team includes vad surgeons, cardiologists, a vad coordinator, anaesthesiologists, neurologists, nephrologists, nurses, a dietician, psychologists, a pharmacist and physiotherapists . Preimplant psychological assessment and evaluation of social support, including obtaining information about the patient's home environment to ensure essential vad operating and management conditions, are conducted before implant . The indication for lvad support according to usual international criteria for btt or dt is determined during the workup phase . The heart transplant programme in kazakhstan is in a nascent stage, and therefore, patients that are determined to be btt are expected to have an extended duration of lvad support . In the three years prior to february 2015, 14 heart transplant surgeries have been performed in kazakhstan13 at the nrccs in astana and 1 in the city of almaty . After the assessment, lvad candidates are educated about the surgery, followup care, and selfcare requirements; then, signed informed consent is obtained . There are no specific criteria for device selection (e.g. Heartmate ii vs. heartware hvad) except that the hvad device is often preferred in the case of smaller patients (body surface area 1.21.5 m). Implantation techniques and postoperative management followed established guidelines.8, 9 anticoagulation therapy for heartmate ii patients included an early, postoperative intravenous infusion of heparin and then, when possible, daily oral aspirin (100 mg) and warfarin regimen, with a target international normalized ratio (inr) of 2.02.5 . There are some differences in anticoagulation strategy for hvad patients compared with lvad patients hvad patients are given a higher aspirin dose (300 mg daily) and higher warfarin dose to reach an inr range of 2.53.5 . After patients are stabilized, they are transferred from the intensive care unit to the cardiac surgery ward and then to the lvad department for rehabilitation and preparation for hospital discharge . Detailed selfcare instruction is provided to patients and their family members; for patients who will return to their home outside of astana, any necessary instruction is provided to medical professionals in that community for continued care . Several patients who previously received implants have subsequently joined nrccs staff in various roles and at times provide emotional support to new patients during their hospital stay . Patients and family members provide all vadrelated care and maintenance . In each community with two or more patients, a support group has been formed to assist other patients with social adaptation . Each patient carries an identification card that has their name, a description of the device, serial number and contact information for the vad coordinator in astana . Patient and caregivers are trained on proper driveline care, which is performed daily in summertime and 3 times per week in the winter . After discharge, local physicians see patients monthly for 3 months, then every 3 months or more often as needed . All patients return to the nrccs in astana at months 1, 3 for laboratory analysis and echocardiography and at month 6 for catheterization, laboratory analysis and spiroergometry . Patients communicate health status, driveline status, weekly inr results directly to the vad coordinator and nurses using whatsapp, a software application for mobile phone devices . Patients take photos of their driveline exit site and send these once weekly to the vad coordinator and nurses . If necessary, the nrccs surgeons are asked to assess the patient . From november 2011 to november 2014, 146 patients underwent implantation of 152 vads at nrccs (approximately 50 devices implanted per year). Excluding heartmate iii devices, a total of 135 patients received a device for left ventricular assist, and of these, 95 patients (65%) received a heartmate ii device and 40 patients (26%) received a heartware device for left ventricular assist . The patients were 83% male and had an average age of 50 years (table 1). Three children aged 11, 16 and 16 years received lvads, and all other patients were over 18 years of age . Children are not eligible to be heart donors in kazakhstan under current laws; therefore, we rarely perform vad implantation in children because of the low possibility of appropriate adult heart donors that are available . Severely ill patients with intermacs profiles 1 or 2 comprised 23% of our study population . Baseline characteristics and concomitant procedures for patients implanted with a vad (n = 138) abbreviations: aortic valve; av, body surface area; bridge to transplant; bsa, btt, cabg, cardiac resynchronization therapy device with defibrillator function; coronary artery bypass grafting; crtd, destination therapy; dt, icd, implantable cardioverterdefibrillator; interagency registry for mechanically assisted circulatory support; intermacs, la, left atrium; left ventricle; lv, mitral valve; mv, new york heart association; nyha, tapse, tricuspid annular plane systolic excursion; tricuspid valve; tv, radiofrequency ablation rfa . By the end of the followup period, 43/135(32%) the other 92 patients either received a transplant (n = 3), had the device turned off without explantation (n = 2) or remained alive with ongoing lvad support at the end of the follow up period (n = 87). The median time from the lvad implantation to heart transplantation was 329 137 days (range 202475 days). The two patients, whose pumps were turned off because of thrombosis, were in stable condition and waiting for heart transplant at the time this manuscript was written . Following implant surgery the mean time in the intensive care unit was 6.8 8.7 days and the mean duration of hospital stay from the lvad implant day to the day of discharge was 32.3 14.0 days . The mean time on the device for left ventricular assist was 466 330 days (range 51200 days). Meier survival estimates for all patients who continued on lvad support were 93% after 1 month, 86% after 6 months and 77% after 12 months (figure 2).survival rates by baseline intermacs profile showed that patients with more severe illness had lower survival rates after 12 months, compared with patients with less severe illness (figure 3).when we compared survival rates by year of the programme after 12 months of vad support, patients implanted in year one had a survival of 70%, whereas patients implanted in year two or year three had 12month survival rates of 81 and 83% respectively (figure 4). The mean (sd) 6min walk distance before lvad implantation was 166 96 m, and after 3 months was 395 73 m (p <0.001). Meier analysis: survival for lvad patients by year of program, in which the patient received implant . The most common complication during the first 30 days was bleeding requiring reoperation [n = 10 (7%)] or rbc transfusion [n = 23 (17%)] (table 2). Right ventricular failure was observed in 20 (15%) patients during the first 30 days . In one case, a patient (male, 48 years) after implantation of lvad heartmate ii was required the setting of the rvad levitronix centrimag to support the right ventricle . He was on rvad for 147 days, followed by heartware implantation for the right ventricle longterm support . Six months after the first surgery, the patient was discharged home . During the first 30 days renal failure requiring hemodialysis occurred in 19 (14%) patients who did not require this procedure prior to implant . Ventricular arrhythmias occurred in 10 (7%) patients, and 6 (4.4%) of them developed during the first 30 days after implantation . Two patients required implantation of a cardioverter defibrillator (icd) 10 and 32 months after lvad implantation . One patient experienced a psychotic episode during the first 30 days during which he purposely damaged the driveline but it did not affect the pump function . Adverse events listed by the percent of patients with events and the events per patientyear (eppy) of support; n = 135 (lvad) abbreviations: ecmo, extracorporeal membrane oxygenation; gastrointestinal; gi, heart transplantation; htx, lvad, left ventricular assist device; rbc, red blood cells; right ventricle; right ventricular assist device; rv, rvad, vad, ventricular assist device . Transfusion of rbc during the first 7 days post implant: 50 kg: 4 u packed rbc within any 24 h period during first 7 days post implant; 50 kg: 20 cc / kg packed rpc within any 24 h period during first 7 days post implant . After the first 30 days, the most common adverse event was driveline infection occurring in 46 (34%) patients and of these, 13 (10%) underwent surgical debridement . Stroke occurred in 33 (24%) patients including 18 (13%) patients with ischemic stroke and 15 (11%) patients with hemorrhagic stroke . Fourteen patients (10%) had device thrombosis, and three of these patients required lvad reimplantation during the first 30 days after initial implant . As depicted in figure 1, the majority of patients (n = 115, 76%) came from regions outside of astana . One hundred twenty (89%) patients were discharged home, and the remainder died in hospital . The most common reason for readmission was driveline infection, and most of these occurred after month six . During the study period these 8 patients were readmitted with stroke (n = 2), lvad thrombosis (n = 2), multiorgan failure (n = 2), gastrointestinal bleeding (n = 1) and epistaxis (n = 1). The most common complication during the first 30 days was bleeding requiring reoperation [n = 10 (7%)] or rbc transfusion [n = 23 (17%)] (table 2). Right ventricular failure was observed in 20 (15%) patients during the first 30 days . In one case, a patient (male, 48 years) after implantation of lvad heartmate ii was required the setting of the rvad levitronix centrimag to support the right ventricle . He was on rvad for 147 days, followed by heartware implantation for the right ventricle longterm support . Six months after the first surgery, the patient was discharged home . During the first 30 days renal failure requiring hemodialysis occurred in 19 (14%) patients who did not require this procedure prior to implant . Ventricular arrhythmias occurred in 10 (7%) patients, and 6 (4.4%) of them developed during the first 30 days after implantation . Two patients required implantation of a cardioverter defibrillator (icd) 10 and 32 months after lvad implantation . One patient experienced a psychotic episode during the first 30 days during which he purposely damaged the driveline but it did not affect the pump function . Adverse events listed by the percent of patients with events and the events per patientyear (eppy) of support; n = 135 (lvad) abbreviations: ecmo, extracorporeal membrane oxygenation; gastrointestinal; gi, heart transplantation; htx, lvad, left ventricular assist device; rbc, red blood cells; right ventricle; right ventricular assist device; rv, rvad, vad, ventricular assist device . Transfusion of rbc during the first 7 days post implant: 50 kg: 4 u packed rbc within any 24 h period during first 7 days post implant; 50 kg: 20 cc / kg packed rpc within any 24 h period during first 7 days post implant . After the first 30 days, the most common adverse event was driveline infection occurring in 46 (34%) patients and of these, 13 (10%) underwent surgical debridement . Stroke occurred in 33 (24%) patients including 18 (13%) patients with ischemic stroke and 15 (11%) patients with hemorrhagic stroke . Fourteen patients (10%) had device thrombosis, and three of these patients required lvad reimplantation during the first 30 days after initial implant . As depicted in figure 1, the majority of patients (n = 115, 76%) came from regions outside of astana . One hundred twenty (89%) patients were discharged home, and the remainder died in hospital . The most common reason for readmission was driveline infection, and most of these occurred after month six . During the study period these 8 patients were readmitted with stroke (n = 2), lvad thrombosis (n = 2), multiorgan failure (n = 2), gastrointestinal bleeding (n = 1) and epistaxis (n = 1). The initiation of the vad programme at nrccs has provided an important therapeutic option to patients with heart failure in kazakhstan . Strong governmental support has been a key factor in the initiation and development of our programme . By adopting new technologies and applying the results of our data we aim to reduce adverse events and improve outcomes in our patients . Some clinical characteristics of our patients were similar to the patients in the intermacs database, with a few notable exceptions10 . The majority of our patients (54%) had intermacs profile 4 at baseline, whereas only 14% of patients in the intermacs database were intermacs profile 4 . We implant earlier in patients because of the low likelihood of heart transplant, the large distances between our centre and many of our patients, and to prevent right ventricular failure . The percentage of patients with icd/ cardiac resynchronization therapy in our population is lower than in some centres outside kazakhstan, perhaps because of the fact that cardiac electrophysiology programmes in kazakhstan began to develop recently . The mean age of our patients was similar to other recently published lvad experience11, 12 . The proportion of our patients with a dt indication was similar to the intermacs database . Fifty six percent of our patients received a vad for the btt indication; however, because of the lack of heart donors, transplantation is not common . Also, contributing to the low transplant rate is that patients are cautious about undergoing another surgical procedure after they have been stabilized on the vad . For patients with the btt indication, we sometimes perform coronary artery bypass graft during the vad implantation procedure to revascularize the walls of the right ventricle because there is a low likelihood of a heart donor that is becoming available . We always perform valve repair if moderate to severe tricuspid valve or mitral valve insufficiency is present during implantation to prevent worsening of pulmonary hypertension and right ventricular failure . Radiofrequency ablation is performed according to recent guidelines.13 approximately half of our patients receiving lvad had right ventricular heart failure prior to lvad implantation . If we cannot optimize right ventricular function preoperatively, the patient may still undergo lvad implantation, and we generally set a lower threshold for rv implant . Our approach to longterm therapy of biventricular heart failure includes inotropic support and nitric oxide . If optimal pharmacologic therapy does not fully control the right ventricular heart failure, then we begin treatment with rvad levitronics centrimag . Survival rates were lower after 12 months on lvad support in patients implanted during the first year of our programme . Patients implanted during the first year (2012) tended to have more severe intermacs profiles, and this may explain our observation . After the first year, we selected our patients differently such that patients with intermacs profiles 1 and 2 received shortterm support devices and longterm support assist devices were given to patients with intermacs profiles 3 and 4 . We believe that factors contributing to the better outcomes observed in years 2 and 3 are related to improvements in preoperative treatment of patients, increase in experience and skill of team members . The strength of our study is that we performed a high volume of vad implants relative to other existing world cardiac surgery centres of excellence . However, our study is not without limitations, including that the analysis was retrospective . Our patient cohort was not large enough to develop models to identify predictors of adverse events; however, this is a relevant topic for future research . Other limitations are that the number of patients who continued on vad support beyond 12 months was low, limiting the inferences that can be made from survival estimations beyond 12 months . Our study population has some differences with vad populations reported in the clinical literature, therefore making it challenging to compare results of vad populations from other centres . Notwithstanding, the differences in our study population compared with other centres, observed survival and adverse event rates are not dissimilar to those reported by other centres.11, 12, 13 our vad programme was developed before any heart transplantation programme existed in our country . The existence of the vad programme is now stimulating the growth of heart transplantation in kazakhstan . However, one of the main challenges we currently face is the low probability that our patients will receive heart transplantation . In addition, remote monitoring of lvad patients is a unique challenge we face because of the large distances between our centre and our patients.
A rare condition in newborns called congenital chylothorax (cc) occurs when lymphatic fluid accumulates within the pleural cavity . Here is a presentation of a birth traumatic case with bilateral pleural effusion successfully treated by octreotide . A 3100-g - term male newborn delivered vaginally from a 33-year - old mother was admitted to the neonatal intensive care unit with respiratory distress signs . Early chest x - ray (cxr) showed bilateral pleural effusion . The thoracentesis pleural fluid had been drained with these characteristics: glucose: 1.9425 mmol / l, protein: 11 g / l, cholesterol: 1.295 mmol / l, and triglycerides: 3.39 mmol / l . Counts of red blood cells and white blood cells were 10,000 and 2500 per cu / mm, respectively; so, congenital chylothorax was diagnosed and total parenteral nutrition (tpn) were initiated . Therefore, we started feeding with a medium chain triglyceride (mct), but plural effusion was seen once again and we had to restart tpn . Finally, the cxr and ultrasound did not show any pleural effusion in both sides and the ultrasound done in the third month showed no pleural effusion either . Octreotide therapy as one of the conservative managements for cc can be considered before surgical methods . This treatment method also had some effects on the feeding initiation time and helped us to start feeding sooner . However, more studies like clinical trials are still necessary to investigate all aspects of octreotide treatment to determine the amount of its dose, initiation time, treatment duration, etc . A rare condition in newborns called congenital chylothorax (cc) occurs when lymphatic fluid accumulates within the pleural cavity (1). Diagnosis of cc is confirmed when analysis of pleural fluid shows a triglyceride content equal to or more than 1.13 mmol / l with a cell count equal to or more than 1000 cells/l (80% or more lymphocytes) (2). In the post natal period, supportive methods like ventilator care, immediate drainage of effusion, and total parenteral nutrition (tpn) must be considered as first line treatment . Recently, using different doses of octreotide with different treatment responses was reported in some case reports (2, 3). Surgical methods can be useful as a final option when using those managements could not help (4). Here is a presentation of a birth traumatic case with bilateral (right prominent) pleural effusion successfully treated by supportive care and low dose of octreotide . This newborn male, weighing 3100 g, was delivered at 38th week of gestation from a 33-year - old mother through normal vaginal delivery .the score of apgar was 6 in 5 minutes . There were acrocyanosis, subcostal, and intercostal retractions, and the acceleratory muscles were used for breathing that showed respiratory distress . Therefore, the infant was ventilated with ambo bag (o2 sat was about 75% - 80%) admitted to the neonatal intensive care unit (nicu) and finally connected to a ventilator at baqiyatallah hospital in tehran, iran . An early chest x - ray (cxr) showed bilateral (right more than left) pleural effusion with left - sided heart shift (figure 1). Kidney, urinary tract, and bladder also were reported normal in ultrasound but the report confirmed bilateral pleural effusion (right prominent). Insertion of intercostal tubes (icd) was performed and about 60 cc of pleural fluid was drained (first its color was light red and then gradually changed to white). Biochemistry analysis of pleural fluid showed following characteristics: glucose: 1.9425 mmol / l, protein: 11g / l, cholesterol: 1.295 mmol / l and triglycerides: 3.39 mmol / l . Counts of rbc and wbc were 10,000 and 2500 per cu / mm . After two weeks of begging tpn, accumulation of plural fluid was approximately stopped; therefore, we started feeding with a medium chain triglyceride (mct). Here we decided to start octreotide subcutaneously (1 g / kg / day). With initiation of octreotide, bilateral pleural effusion was decreased, and respiratory status improved . Ultrasound was performed daily and showed a decrease of pleural effusion in the right side . Moreover, there was no evidence of pleural fluid in the left side (figure 2). After 20 days of using octreotide, the cxr and ultrasound did not show any pleural effusion accumulation in the both sides, and the patient was discharged . Follow - up physical examination and ultrasound done during 3 months showed no pleural effusion . As mentioned above chylothorax means accumulation of chyle within the pleural cavity, and it is based on the etiology . It is usually categorized in several forms like traumatic, spontaneous, and congenital (1). Here we presented a case of cc in a newborn male with trauma birth that was successfully treated by continuous administration of low dose of octreotide . The patient had a low apgar score and was in respiratory distress status; so, he was shifted to the nicu and connected to a ventilator . (triglyceride content 1.13 mmol / l with a cell count 1000 cells/l (80% or more lymphocytes)) (2) all options of therapeutic approaches for management of cc usually begin with supportive and conservative methods . Ligation of thoracic duct, pleural absorption, and pleurodesis as the surgery methods can be useful when all medical and conservative methods fail to reduce the pleural effusion and treatment of cc (4), conservative methods include long hospitalization, thoracentesis and insertion of chest tube, total parenteral nutrition, and introduction of a mct diet (1, 4). Also, octreotide is another option of conservative management that has been used in some cases for treatment of chylothorax . It is a peptide that mimics the effect of somatostatin pharmacological and results in the reduction of gastrointestinal secretions, intrahepatic venous flow, amount of triglyceride, and chyle output of pleural effusion (1, 5, 6). Intravenous infusion is necessary for somatostatin while octreotide can be used subcutaneously or intravenously (1). Table 1 shows the studies that have previously used octreotide for the treatment of cc (2 - 4, 7 - 16). Based on this table, octreotide has been successfully used for the treatment of cc in some studies; however, it should be taken into account that this treatment method cannot be applied in all cases of cc . In the majority of these studies, octreotide usually starts initially 0.5 to 1 g / kg / h then gradually increases to 10 g / kg / h (for 5 to 28 days). Mildly distended abdomen in two cases and pulmonary hypertension in 4 patients were side effects of the octreotide therapy reported in these studies . In our case, low dose of octreotide (1 g / kg / day) was given subcutaneously and after 20 days there was no pleural effusion . One of the advantages of using octreotide in our case was related to the feeding initiation time . After one week of using octreotide, we could start feeding with mct without re - accumulation of fluid in the plural cavity . Adverse effects are rare but diarrhea or constipation, nausea, vomiting and hyperglycemia, or hypoglycemia have been reported in some cases (1, 5). In our case, we did not see any side effects of octreotide even with 20 days of the octreotide therapy . Ongenital chylothorax even as a rare etiology of pleural effusion should be considered in neonate with plural effusion and in respiratory distress . Also, based con the table 1, it can be concluded that octreotide can be considered as a good option for conservative management of cc . More studies like clinical trials are still necessary to investigate all aspects of octreotide treatment to determine the amount of its dose, time of initiation and duration of treatment, its treatment effect together with other conservative treatment and etc.
Russell body duodenitis (rbd) is a rare inflammatory disease characterized by an abundance of polyclonal plasma cells present in the duodenal mucosa . These plasma cells contain intracytoplasmic eosinophilic globules of condensed immunoglobulin, the so - called russell body . We describe the case of a patient with rbd in whom endoscopic and histopathologic findings were observed chronologically, along with a review of the relevant literature . He was found to have a nodule in the right middle lung field on a plain chest radiograph at a local clinic, and was referred to our hospital for detailed examination . A nodule measuring 2 cm was detected in segment 8 of the right lung on chest plain computed tomography (ct). The morphology of the nodule was lobulated, and cavitation was observed in the interior . Results of smear, culture, and polymerase chain reaction assay from sputum specimens were all negative for tuberculosis . Bronchoscopy was performed on hospital day 9, during which bronchial lavage fluid was collected, and a biopsy of the nodule was performed . Double capsule - like circular objects were positive for periodic acid - schiff stain and grocott stain, yielding a diagnosis of pulmonary cryptococcosis . Moreover, the level of the cluster of differentiation (cd) 4 was 570/l, the cd8 level was 655/l, and the cd4/cd8 ratio was 0.87, suggesting no evidence of aids . On hospital esophagogastroduodenoscopy (egd; day 14) revealed a significant amount of residue and an irregular ulceration with surrounding elevation of the duodenal bulb (fig . 1a), which had brought about severe stenosis . With the suspicion of duodenal cancer, biopsy samples were obtained from ulcer edges . Although admixed with various inflammatory cells, necrotic tissues were observed, but no definition of adenocarcinoma cells was found (fig . However, since some large atypical cells were admixed with infiltrating inflammatory cells, reexamination was required to rule out undifferentiated carcinoma and malignant lymphoma . The second egd (day 21) and the third egd (day 30) revealed no signs of ulcer healing . Contrast - enhanced upper gastrointestinal radiography (day 37) revealed severe stenosis from the duodenal bulb to the superior duodenal angle (fig . 2). Positron emission tomography - ct was performed to screen the whole body for malignant tumors . No significant accumulation of fluorodeoxyglucose was observed in any site except the lesion of pulmonary cryptococcosis in the right lung, and no accumulation was detected in the duodenal bulb . Considering this benign stenosis, we performed a gastrojejunostomy (day 43), and thereafter, oral intake became possible . The fourth egd (day 56) revealed that the peripheral redness and edema of the ulcers had become more severe than in the previous findings (fig . Biopsy samples revealed dissemination of large cells with eosinophilic cytoplasms and eccentric nuclei in the necrotic / granulation tissue of the duodenal lamina propria (fig . 3b). The large cells were cd20(), cd68(), cd79a(+), and s100(), and they were chain(+) or chain(+), suggesting russell bodies derived from polyclonal plasma cells (fig . The fifth egd (day 91) revealed that the ulcers in the duodenal bulb had reduced in size, and some scarring was present (fig . Although a biopsy at this time confirmed the presence of a few russell bodies, the majority had disappeared (fig . The patient is being followed up while continuing the oral administration of a proton pump inhibitor (ppi). Hsu et al . Showed that russell bodies originate from distended rough endoplasmic reticulum in which immunoglobulin is inhibited from being secreted and condensed . Tazawa and tsutsumi first reported russell body gastritis (rbg) in 1998, in which russell bodies were found in many plasma cells infiltrating the gastric mucosa . First reported in a patient positive for hiv; only five cases have since been reported [5 - 8]. The differential diagnoses include plasmacytoma, mucosa - associated lymphoid tissue lymphoma, and signet ring cell carcinoma . In the present case, because the russell bodies were derived from plasma cells positive for cd79a and were suggested to be polyclonal by the mixture of and chain - positive cells, rbd was diagnosed . Many patients with rbg are positive for h. pylori, which is believed to be associated with the development of rbg . However, only one of the five previously reported cases of rbd was positive for h. pylori . The other background diseases were hiv infection in one, crohn disease in one, retroperitoneal metastasis of ureteral cancer in one, and adenocarcinoma of the ascending colon in one case . Although the development of russell bodies is assumed to be associated with chronic inflammation, microorganisms, and immunodeficiency, the causes of their development remain unknown . Although russell bodies are frequently found in benign tissue adjacent to a malignant tumor, there are also reports suggesting that the production of chemokines in tumor cells is associated with the development of russell bodies . In the present case, the patient was negative for h. pylori and hiv, and there was no evidence of malignancy or immunodeficiency . We could chronologically observe the endoscopic appearance and histopathological findings of rbd in our patient . When the ulcers were first detected, although severe infiltration of inflammatory cells was observed, rbd was not manifested . Through the aggravation of the ulcers furthermore, the fifth egd revealed a tendency for the ulcers to heal, and the majority of the russell bodies had disappeared . From these processes, it was assumed that the russell bodies were not a cause of the ulcerations, but byproducts secondarily induced by a severe inflammatory state after the development of the ulcers . In the present case, because food residues were always retained in the duodenal bulb, mechanical stimulation might also have been associated with the development of the russell bodies . Regarding therapeutic responses of russell bodies, there is a report of patients with rbg who were positive for h. pylori, in whom the endoscopic findings improved after h. pylori eradication and the russell bodies disappeared . The present patient was negative for h. pylori and had not undergone h. pylori eradication . His treatment consisted of administration of a ppi and gastrojejunostomy, which are assumed to have contributed to the resolution of the local inflammation . As for the correlation with the degrees of inflammation at the ulcer site, the russell bodies would be expected to appear and disappear as the degree of inflammation changed . The prognosis was favorable with the internal use of a ppi in cases of rbg negative for h. pylori . There have been no published reports of recurrence or malignant transformation during follow - up . However, it is often difficult to distinguish russell bodies from plasmacytoma, mucosa - associated lymphoid tissue lymphoma, and signet ring cell carcinoma . Multiple endoscopic observations and biopsies, like that used in the present case, are required to diagnose malignant disease . This was a valuable case in which the clinical and pathological features of rbd, an extremely rare disease, could be compared in the present patient from onset to healing.
Polycyclic aromatic hydrocarbons (pahs) are ubiquitous semi - volatile environmental contaminants (1, 2) and have been often monitored in water, air, soil and food matrices (3). They are principally by - product of incomplete combustion of organic substances and also generated by fossil fuels or plants burning . Due to their ubiquitous presence and potential to cause adverse human health effects environmental waters can be contaminated with pahs from diverse sources such as industrial and municipal wastewaters, runoff, atmospheric deposition via wet and dry particle deposition and gross gas absorption, oil spills, rain water and from asphalt abrasion (2, 4 - 6). Long - range atmospheric transport of pahs has been well documented in different countries (5). After the arrival of pahs to the atmosphere, they are transferred into water by direct surface contact or as a result of precipitation (5). Occurrence of pahs in water resources, including drinking water have been reported indifferent parts of the world (5). Who reported that water is a very significant source of pahs, and in drinking water, fluoranthene, phenanthrene, pyrene and anthracene were usually detected in it (7, 8). Among the routes of exposure of the general public such as inhalation of ambient and indoor air, dermal absorption, and/or dietary intake, drinking water is also important (9, 10). The typical concentration range for sum of selected pahs in drinking water vary between 1 ngl and 11 gl (7, 8). The incidence of these compounds in the environment is of reasonable concern, as these are known to be mutagenic and carcinogenic (3). Pahs need metabolic activation to exert their carcinogenic effects, and through a three - step sequence resulting in the formation of diol epoxides, which react with dna to create adducts that can cause mutations and begin the carcinogenic process (11, 12). Various pahs vary in carcinogenic capability, but even those that are considered as not being carcinogenic, may act in organisms as synergists, increasing the carcinogenicity of other pahs (13). According to the international agency for research on cancer classification system, benzo [a] pyrene as one of the most known is classified in group 1 and some of them are also categorized as group 2a or 2b carcinogens (14, 15). It was not conceivable to set up a threshold level for pahs below which danger would be unimportant and so a tolerable daily intake could not be set (16). Therefore, it suggested that exposures to pahs must be as low as reasonably achievable (17). Pahs are contaminants which undergo the legislative control or are integrated in the monitoring programs of the eu scientific committee on food (scf), world health organization (who), environmental protection agency (epa), and food and drug administration (fda) (18). For example, who has recommended maximum permissible concentrations of 0.7 gl for benzo [a] pyrene (bap) in drinking water (19, 20). The international organizations, i.e. Who, epa and european community (ec), have recommended the continual detection and quantification of these compounds in drinking waters (21) and established the maximum residue levels for bap (20). The permissible level for bap in drinking water that was proposed by who is the same as that of iranian national drinking water standard (22) (23) have reported the measurement of 16 priority polycyclic aromatic hydrocarbons (pahs) in six stations in karaj river, which is the main resource of drinking water in tehran . The single pahs concentrations ranged from not detected to 2,327.8 ng l-1, with a mean value of 31.5 ng l-1 . The total pahs concentrations ranged from 25.6, in the spring, to 4,040.3 ng l-1, in the summer . The sample preparation step in an analytical process typically consists of an extraction procedure that results in the separation and enrichment of analytes of interest from a sample matrix . Extraction can differ in degree of selectivity, speed and convenience and depends on the approach, conditions and the type of the extraction phase (24, 26, 35 - 36). Liquid extraction (lle) is among the oldest of the preconcentration and matrix separation techniques in analytical chemistry (24, 26). Solid - phase extraction (spe) uses much less solvent than lle, but can be rather expensive (24, 26). Dispersive liquid - liquid microextraction (dllme) offers several important advantages over trivial solvent extraction methods: faster operation, no need of large amounts of organic extraction solvent, low cost and time and easy application (20, 24). Thus, since its introduction, dllme has been frequently used for determination of organic contaminants in liquid samples, including of pahs in water samples (20, 24). The aim of this study was to determine the level of 13 priority pahs in different brands of water for injection as well as tap water samples collected from tehran, iran, in march, 2014 using dllme procedure and gc / ms . Standards and reagents naphthalene (naph . ), acenaphthene (ace . ), fluorene (fl . ), phenanthrene (phen . ), anthracene (ant . ), anthracene - d10 (ant.d10), pyrene (pyr . ), benzo [a] anthracene (b[a]a), chrysene (chy . ), benzo [b] fluoranthene (b[b]f), benzo [k] fluoranthene (b[k]f), benzo [a] pyrene (b[a]p), dibenz [a, h] anthracene (d[ah]a) and benzo [ghi] perylene (b[ghi]p) with purity higher than 98% were purchased from sigma - aldrich / fluka / supelco (germany). Hplc grade isooctane, toluene, acetonitrile, dichloromethane, tetrachloroethylene, n - hexane, ethanol, 2-propanol, methanol, acetone and chloroform were obtained from chem - lab belgium . Ultrapure water was obtained from a milli - q plus ultra - pure water system (millipore, molsheim, france). Tap water and water for injection sampling according to drinking water supply, tehran was divided into six regions . In 2014, six tap water samples (each 500 ml) were collected from each region during two weeks, totally 36 samples and stored in amber glass bottles . The water samples were stored in a cold box while being carried to the laboratory and stored at 4c . Water for injection samples commercially available in tehran were purchased from drugstores (five different brands, six batches each, totally 30 samples). Calibration standards individual stock standard solutions (1 mgml) of the pahs were prepared in toluene . A mixed intermediate standard solution at a concentration of 100 ngml was prepared via appropriate dilution of the stock solutions in methanol . Spiked calibration standards at concentration levels of 0.35, 0.7, 1.4, 2.8, and 5.6 ngmlwere prepared by addition of 35 l, 70 l, 140 l, 280 l and 560 l of mixed standard stock solution to 10 ml of blank water samples in each case . A stock solution of anthracene - d10 in toluene at concentration of 1 mgml was used as internal standard . An aliquot of 70 l of anthracene - d10 in methanol (100 ngml) was added to the spiked water sample as internal standard . Extraction and clean - up by using dllme technique we have already developed a method using dllme technique (that is environmentally friendly, a very simple and rapid method for extraction and preconcentration of organic compounds from water samples and reduce the cost of analysis by reduction of organic solvents) and gc / ms analysis for determination of 13 priority pahs in the mineral water samples (27). This method was applied for analysis of 13 pahs in tap water as well as water for injection samples as follows: 10 ml ultrapure water was placed in a 10 ml screwed glass tube and 70l of anthracene - d10 (as internal standard) at concentration 100ngml was added to the sample . A mixture of 500 l chloroform and 1000 l acetone (as extraction and disperser solvent, respectively) was quickly injected into the sample solution with a 500 l hamilton syringe . A cloudy solution was formed after adding the mixture extraction and disperser solvent in the glass tube . The glass tube containing ultrapure water, extraction and disperser solvent was placed in a centrifuge (hettich zentrifugen universas 320r) and centrifuged for 3 min at 2500 rpm . The upper layer was discarded and 500 l of the lower phase (extraction solvent) was removed by a hamilton syringe and transferred to 1.5 ml amber glass vial . The contents of the vial were dried using a gentle stream of nitrogen at room temperature and re - dissolved with 70 l chloroform . Gc ms instrumentation and conditions the analysis was carried out using gc model agilent 7890a, washington, usa, equipped with a split / splitless injection port, an autosampler model agilent 7693, electronic ionization and a triple quadrupole mass analyzer model agilent 7000 series . A hp-5ms 5% phenyl methyl silox, agilent 19091s-433 capillary column was used with 30 m 0.25 mm i.d . And 0.25 m film thickness . Helium with a purity of 99.99% and a flow rate of 1 mlminwas used as carrier gas . The initial oven temperature was maintained at 60c for 0.5 min, increased to 230c at a ramp rate of 3cmin and kept for 0.5 min, then increased to 290c at 5c min and hold for 10 min at the final temperature . The ion source and triple quadrupole mass analyser temperature were kept at 230c and 280c, respectively . The vial was placed in autosampler and 2 l of the contents was injected into the gas chromatograph for analysis . Pahs concentrations were calculated by intrapolating the peak ratio for pah to internal standard on the calibration curve . In order to compensate for losses during sample processing and instrumental analysis, spiked water samples at concentration levels of 0.35, 0.7, 1.4, 2.8, and 5.6 ngmlwere prepared in triplicates and then treated according to the procedure described previously . Method performance characteristics in the present study, the spike calibration curves (five points) for all the analytes were constructed by plotting the peak area ratio of each compound to internal standard against the concentration of that pah . The graphs were constructed from triplicate analysis of the ultrapure water spiked at each concentration level (0.35 - 5.6 ngml). All 12 spiking calibration curves of pahs were linear and the coefficients of determination (r) ranged 0.993 - 0.999 . The repeatability and recovery of method for each 12 analytes ranged 4.0 - 16.0% and 71 - 90% respectively . Limits of detection (lod) and limits of quantification (loq) were calculated based on the signal - to - noise ratio of equal to 3 and 10, respectively . The recoveries and rsds of 12 pahs in quality control samples (qc) are summarized in table1 . The recoveries and rsds of 12 pahs in quality control samples (spiking level: 1.0 ngml) analyzed using dllme method and gc - ms determination of 13 pahs in tap water and water for injection samples . The optimized and validated method was utilized for extraction and determination of studied pahs in 36 tap water samples and 30 water for injection samples . The results showed that the concentration of 12 pahs in all samples (tap water and water for injection) were lower than the loq (0.1 - 0.35 ngml) of the method . Regarding naphthalene, the results showed that it was present in all analyzed samples including tap water and water for injection samples, and no analyte - free sample as blank matrix for determining the blank sample baseline and constructing the calibration line was available . Therefore, it was not possible to construct the calibration curve for naphthalene, and its concentration in samples was not determined . It is recommended that for accurate determination of naphthalene, an isotope - labeled naphthalene such naphthalene - d8 (surrogate analyte) instead of naphthalene is used as calibration standard . By this approach, the true blank matrix, which is not accessible by other methods and is a prerequisite for accurate quantification specially at trace level is provided (28). Water treatment plants are the hearts and brains of the practice to develop the water quality through chemical mixing, coagulation, flocculation, sedimentation, filtration, post - filtration treatment, including disinfection, ph control, and final storage at the plant (30). Removal effectiveness of pahs by the mentioned treatment processes are reported to be in the range of 20 - 100% (30). In another study, it was shown that the concentration of pahs in mineral water samples collected from tehran were also lower than loq (27). There are only few published papers for determination of pah in tap water . In one of these studies, hou et al . The results for tap water showed that it was free of contamination . In another study, maa et al . (32) evaluated sixteen pahs in three real water samples including tap water, sea water and river water . No pahs were found in the tap water samples . Also, zanjani et al . (33) determined the level of twelve pahs in well water, sea water and tap water, and reported that tap water was free from pahs . (30) evaluated sixteen pahs standard in the 24 drinking water samples and found contamination including chrysene, benzo[k]fluoranthene and indeno[1, 2, 3-cd] pyrene at concentration levels higher than the european union s drinking water maximum limit . In another study, huixu et al . (34) found naphthalene and acenaphthene in the tap water samples at 0.059 ngml and 0.399 ngml, respectively . Pena et al . (20) determined eighteen pahs in drinking water samples (tap, bottled, fountain, well). Sum of pahs concentration were between 127.8 ng land 413.2 ng l. to the best of our knowledge, this is the first study regarding evaluation of the contamination of water for injection samples with pahs . Our results showed that the concentration of pahs in all samples were lower than the loq (0.1 - 0.35 ngml) of the method . Considering the few studies regarding pahs contamination in drinking water in iran, to get a clear picture of contamination of drinking water, comprehensive monitoring of pahs in tap water in different provinces and seasons is suggested . In the present study, no contamination of tap water samples and water for injection samples with pahs were found . However, a comprehensive survey for analysis pahs in water is recommended.
Mycobacterium avium complex (mac) contains clinically important nontuberculous mycobacteria and is the second largest medical complex in the mycobacterium genus after the mycobacterium tuberculosis (mtb) complex . Mac affects patients with chronic obstructive pulmonary disease and cystic fibrosis, as well as immunosuppressed individuals with hiv / aids . Mac is currently composed of 12 species which are very close phylogenetically related, but they are diverse regarding to their host preference, course of disease, virulence and immune response, such as m. avium, m. intracellulare and m. colombiense . M. colombiense (mcol) infections were initially described in hiv patients in bogot, colombia . In this initial study, mcol was confirmed to be the causative agent of pulmonary disease and bacteraemia in this group of people who died of hiv / mcol coinfection . After this study mcol has been isolated in other scenarios such as lymphadenopathy, subcutaneous infections and disseminated disease in hiv - negative patients in countries like spain, france, china, canada and russia . In this study we attempted to find the mcol virulence factors from the genome sequence to decipher its possible skills as a mac opportunistic pathogen . The mcol cect 3035 genome was sequenced using pacbio technology (institute for genomes sciences, university of maryland, college park, md, usa), then automatically annotated using the gendb 2.4 platform . To study the mcol pathogenome, we used different bioinformatics tools to search for prophages sequences (phast tool), genomic islands (islandviewer and gipsy / pips tools), protein families (pathogenfinder) and mycobacterial virulence factors (vfdatabase (vfdb)). The islands detected with islandviewer were classified using the national center for biotechnology information functional annotation and the conserved domain database, and for the gipsy / pips analysis we used the m. indicus pranii genome as the closest related nonpathogenic species . To search for the mcol singletons paratuberculosis map4 (refseq nc_021200), m. intracellulare atcc 13950 (refseq nc_016946), m. intracellulare mott-36y (refseq nc_017904), m. intracellulare mott-02 (refseq nc_016947), m. intracellulare mott-64 (refseq nc_016948), m. indicus pranii mtcc 9506 (refseq nc_018612), m. yongonense 051390 (refseq nc_021715), mtb h37rv (refseq nc_000962) and mcol cect 3035 with the edgar tool . Then we detected the secretory singletons using pred - tat and pred - lipo tools . For the detection of transmembrane singletons we used tmhmm server 2.0, and for the detection of the cell wall singletons we used cw - pred . Using the tools phast, islandviewer and gipsy / pips, we did not detect prophage sequences in the mcol genome . In addition, we did not find structures compatible with crispr / cas systems by applying the crispr finder tool . However, we detected a total of 45 genomic islands (nine of these are classified as pathogenicity island), which contain a total of 320 predicted genes . Interestingly, 92.8% of these genes code for hypothetical proteins with unknown functions (fig . 1). In addition, the mcol pathogenicity islands contain genes that code for the drra - c transporter, which is involved in the transportation of phthiocerol dimycocerosates (pdims) and also contains the rmt2 and mmpl4 genes, which are involved in the synthesis and transmembrane transportation of glycopeptidolipids (gpls). Using the edgar tool for comparative genomics analysis of a selected set of mycobacterial genomes we detected a total of 452 singletons, which represent 8.4% of the mcol genome . According to a classification of these singletons into functional clusters of orthologous groups (cogs) categories 87 genes are involved in cellular processing and signaling, 75 are involved in information storage and processes, 163 are involved in metabolism of mcol and 122 are grouped as poorly characterized (fig . 2). The majority of singletons (85%) contain typical sec signal peptides for recognition of the preprotein by the general secretory pathway, and 22% contain varying numbers of transmembrane helical segments for a putative integration into the cytoplasmic membrane . We also detected one singleton with an lpxtg motif that is an indication of cell wall localization of the respective protein . Among these mcol singletons encoding gene sufs2 is inducible in response to oxidative stress and is important for the survival of agrobacterium tumefaciens . The presence of urease in pathogenic bacteria strongly correlates with pathogenesis in some human diseases and is an important virulence factor . Additionally, cryptococcus gattii knockout mutants for genes encoding the urease accessory proteins ure4 and ure6 showed reduced multiplication within macrophages . The vfdb analysis allowed us to detect a total of 204 mcol genes that are homologous with previously described mycobacterial virulence factors . The largest groups of genes comprise deduced virulence factors assigned to the class's cell surface components and secretion system . Analysis of protein families with the pathogenfinder 1.1 tool allowed us to predict 32 virulence factors in the mcol genome sequence . Of these genes 65.6% (n = 21) encoded hypothetical proteins and 5.5% (n = 2) encoded potentially secreted proteins with characteristic sec signal peptides . Among these ten were also found in the vfdb, and 23 are new potential virulence factors . Among these new potential mcol virulence factors we found several genes homologous to the m. avium subsp . K10 genome: map_0847, map_1945c, map_0092, map_3697c, map_1909, map_3223c, map_0908c, map_2811c and map_2636 . According to basic local alignment search tool (blast) searches, these genes (except map_1909) are likely not to be present in the mtb h37rv genome . Interestingly, the map_1909 gene encodes the lppm lipoprotein, which in mtb is an important virulence factor involved in the manipulation of the phagosomal maturation in macrophages . Hominissuis 104 genome: mav_4325 (codes for abc transporter, atp - binding protein), mav_1611 (codes for transcriptional regulator, tetr family protein), mav_4258 (codes for the rsbw protein) and mav_2193 (codes for acyl carrier protein), mav_2835 (codes for enoyl - coa hydratase / isomerase family protein), as well as the mav_3699, mav_0045, mav_1178, mav_1177, mav_4234, mav_0139, and mav_3009 genes (code for hypothetical proteins). According to blast search, all these genes (except mav_4258) are likely to not be present in the mtb h37rv genome . In addition, the rsbw protein in mtb is involved in the response to heat, cold, oxidative, starvation and anaerobic stresses . Finally, we found a homologue to the mmar_4989 gene from the m. marinum m genome . This gene encodes the yrbe4a conserved membrane protein, which has an unknown role in virulence but is predicted to be involved in lipid catabolism in mtb . Experimental studies are necessary to decipher the role of these new potential virulence factors in opportunistic pathogens such as mcol . One of the hostile environments to which mycobacteria have to adapt during infection in the host is the macrophage . Therefore, among all of the probable mcol virulence factors these have special importance because they are involved or are possibly implicated in macrophage modulation mechanisms (fig . 4). Trehalose is an important compound for several mycobacterial cell wall glycolipids, including sulfolipid-1 (sl-1), trehalose monomycolate and trehalose dimycolate (tdm). On the other hand, mcol has the gene that encodes the whib3 protein, which is an important virulence factor that is involved in several processes, including up - regulation of the synthesis of sl-1 and tdm, probably through the sensing of the reactive oxygen species (ros) and nitric oxide . This complex constitutes a group of extracellular mycolyl transferases (ag85a, ag85b and ag85c), which play important roles in the biosynthesis of major components of the mycobacterial cell envelope, such as tdm and mycolylarabinogalactan . Mcol has the genes that code for the sec export systems, seca1 and seca2 . The housekeeping seca1 protein of mtb is involved in the secretion of the virulence factors lprg and lpqh . In addition, the seca2 export system secretes important virulence factors such as superoxide dismutase (soda) involved in the survival inside macrophages and catalase peroxidase protein (katg) involved in isoniazid resistance . Mcol has the gene encode protein kinase g (pkng), which prevents phagosome lysosome fusion by blocking lysosomal delivery . This process blocks the intracellular degradation of mycobacteria in lysosomes and mediates intracellular survival of mycobacteria within macrophages . Mcol has genes that code for proteins that in mtb are associated with protection against ros; these are ndk, nuog, sod and katg . In mtb ndk damages the phagocyte nicotinamide adenine dinucleotide phosphate (nadph) oxidase complex in macrophages . Nadph oxidase is responsible for the production of ros, which are radical molecules that are crucial for the control of mycobacterial infections . In addition ndk also prevents phagosome lysosome fusion through a mechanism that involves the inactivation of macrophages rab proteins . It has been suggested that the ndk protein could be exported through esx-1, which is lacking in mac members, including mcol . Therefore, experimental research is necessary to investigate ndk secretion in mcol . In mtb nuog is an important virulence factor that can neutralize ros produced by nadph oxidase and with this inhibits macrophage apoptosis . In addition, soda and katg proteins are secreted by the seca2 export system; they protect against ros by forming h2o2, which is further detoxified by katg . Two - component systems (tcss) are major regulatory systems for bacterial adaptation to environmental changes . The prra / b, mpra / b, phop / r and dosr / s tcss are the most studied and are involved in important virulence mechanisms in mtb . The prra / b system has been implicated in macrophage phagocytosis and is transiently required for the early stages of macrophage infection . The mpra / b is a stress - responsive tcs that directly regulates expression of several sigma factors, and it also regulates the espa operon in mtb and modulates esx-1 function . In mtb phop / r controls 30 genes directly, whereas regulatory cascades are responsible for signal amplification and downstream effects through proteins like espr, which controls esx1 function . Phop also controls the noncoding rna (ncrna) mcr7, which controls the secretion of the twin arginine translocation (tat) substrates, such as antigen ag85 complex proteins (ag85a and ag85c). In mtb the dosr / s tcs regulates the expression of around 48 genes under hypoxic and nitric oxide stress and is required for full virulence and pathogenicity in different animal models . Mcol has genes that code for proteins that are involved in the transportation and regulation of iron, such as irta, irtb, viub, esx-3 and ider . To obtain iron mtb synthesizes a cell - associated siderophore named mycobactin and a secreted one, carboxymycobactin, which sequesters iron and delivers it to the bacterium via specialized fe siderophore transporters . In mtb fe - carboxymycobactin can be secreted through irta transporters and is translocated by the irtb - viub abc transporter . The secretion and translocation of mycobactin is not entirely understood, but in m. smegmatis the esx-3 secretion system plays an important role for the mycobactin - mediated iron uptake . Sulfolipid-1 (sl-1) is a cell wall glycolipid and important virulence factor that restricts mtb growth in macrophages . Sl-1 has been also proposed to alter superoxide (o) production and blocks phagosome several enzymatic steps are necessary for the sl-1 biosynthesis; mmpl8 and sap proteins then transport sl1 across the membrane . Mcol possesses the genes involved in the sl-1 biosynthesis and transport, except the pks2 . Therefore, it is highly probable that mcol does not produce sl-1 . Additionally, the production of this glycolipid is suggested to be restricted to pathogenic mycobacteria, especially to members of the mtb complex . Mtb produces phospholipase c (plc), which is an important virulence factor that induces the inhibition of cyclooxygenase-2 expression (cox-2), and this blocks prostaglandin e2 (pge2) synthesis by macrophages . (pge2 is an essential factor involved in the activation of the membrane repair mechanism, and therefore its inhibition is associated with necrosis of macrophages .) Analysis of the mcol genome suggests that the genes involved in the phospholipase c production (plca, plcb, plcc and plcd) are missing . Therefore, it is a feasible that this species does not utilize this virulence mechanism during macrophage infection . Members of mtb complex also produce p - hydroxybenzoic acid derivatives (p - hbads), which are precursors of pgl biosynthesis . According to vfdb, several genes participating in pdim / pgl / p - hbad synthesis and transportation are lacking in mcol . The esx secretion system is a specialized secretion system for the transport of extracellular proteins across the mycobacterial cell wall . In mycobacteria there are five esx systems (esx-1, esx-2, esx-3, esx-4, esx-5), and all of them are present in the mtb genome . The esx-1 secretion system exports important mtb virulence factors such as esat-6 and cfp-10, and it also induces apoptosis in macrophages and generates a semiporous phagosome, . Mcol possesses all of the esx systems except esx-1, and mcol also lacks the esat-6 and cfp-10 genes . The heat shock protein hspx is under the control of the dosr / s tcs during hypoxic conditions, and is suggested to be involved in the long - term survival of mtb inside macrophages . However, the mmps and mmpl proteins assemble into a complex that contribute to gpls biosynthesis and export . Mcol possesses a gpl locus; it is highly possible that this species is able to produce gpl . However, experimental studies are necessary to establish the mcol gpl serovar structure . In conclusion, mcol possesses many of the mtb virulence mechanisms that have been involved in apoptosis, necrosis and inhibition of phagosome lysosome fusion . However, mcol has deletions in the genes involved in the p - hba / pdim / pgl, plc, sl-1 and hspx production, and loss of the esx-1 . The inability to produce these compounds may be related to its lower virulence in mice infected with mcol compared to mice infected with mtb . Thus, the opportunistic nature of mcol could be associated with its inability to produce significant virulence mechanisms used by mtb during its adaptation to the host . In addition, the singletons and the virulence - associated genes conserved in the mcol genome could be used to design molecular diagnostic tools.
Efforts to improve the outcomes of surgical coronary revascularization have taken many forms, but among the most successful have been bilateral internal mammary artery (i m a) and radial artery (ra) grafts . It has been clear for some time that saphenous vein conduits have limited life span, and that multiple i m a s improve graft patency and clinical results . Recent refinements in ra preparation and management have taken ra patencies close to i m a s, now providing surgeons with up to four excellent arterial conduits . With four arteries and liberal sequential grafting methods, most patients can benefit from all - arterial grafts . This article will review the current status of all - arterial coronary bypass in current clinical practice . While a right i m a to left anterior descending (lad) coronary bypass was among the first coronary revascularizations performed and reported in 1967, the subject was controversial until loop and associates demonstrated clear clinical benefits in the early 1980 s . With adoption of routine ima - coronary bypass, efforts at using more i m a conduits expanded, and evolved into the techniques of sequential and bilateral i m a grafting (also termed internal thoracic artery [ita] bypass). Objective documentation of clinical benefits subsequently emerged, and all - arterial coronary bypass became an attractive surgical option for multivessel disease patients . While all - arterial bypass has become the most common coronary artery bypass graft (cabg) procedure in much of the world, recent assessment of us practice showed only about 4% of cabg cases involved both i m a s . With so much information showing clear clinical benefits, an expansion in i m a use in the us should be encouraged . In the authors practice, certain principles have been useful in the transition to all - arterial coronary grafting, and subsequent sections document concepts involved with the evolution of this approach . All - arterial coronary bypass should start with multiple i m a grafts, which are the well - validated long - term conduits for coronary revascularization . Single lima bypass with ra s constructed as t - grafts probably do not substitute prognostically for multiple i m a s . For some time, the authors have been performing multiple i m a bypasses in 75 - 80% of multivessel patients, including valve / cabg cases . Performing bilateral i m a grafts is more time - consuming and technically demanding than saphenous vein procedures . One optimization factor for bilateral i m a s has been liberal use of right i m a (rima) to lad grafts (figure 1a). See text for details . In the authors series, rima to lad procedures (figure 1a) historic concerns regarding sternal re - entry with intact rima s traversing the midline have been dispelled by covering the graft with the thymic fat pad at the conclusion of the procedure, along with knowledge that only 4 - 5% of these patients required re - operation after 20-years . After placing the rima to the lad, the left i m a (lima) usually was used for single or sequential grafting of the circumflex coronary artery (ccx) system . The 1a approach optimized patency advantages of multiple i m a grafting, since both grafts have early patency rates of close to 100% in this configuration [1, 13]. Alternative configuration b, used in 1/3rd of the multivessel disease patients, involved placing the lima as a simple or sequential graft to the lad system, and anastomosing the rima to the right coronary artery (rca) (figure 1b). This technique was applied more commonly in patients with proximal rca stenoses, in which the rima could reach the mid - rca easily . Patencies and outcomes with this configuration have demonstrated equivalency to alternative a, understanding that in both approaches, i m a grafts should be placed to the largest, most important coronary vessels . Although free i m a patencies have been good, free i m a grafts have been used infrequently in the authors practice, in order to simplify the procedure and to mitigate the necessity for extra anastomoses . However, if a free i m a offers solutions to address complex anatomic problems, there is no hesitation to use free grafts, usually connected proximally to the ascending aorta . One such example is anatomy warranting a sequential lima to important lad - diagonal vessels, in the setting of a large obstructed ccx system . The grafting strategy in this situation utilizes the lima for sequential lad grafting, and a free rima is placed to one or more ccx vessels (configuration c). Outcomes with radial artery (ra) grafting have been variable and controversial, possibly due to differences in preparation techniques . The brompton randomized trial was a breakthrough in ra bypass, and for the first time, validated ra techniques with excellent late graft patency data . Proper preparation of the ra was important in the brompton trial in order to optimize graft patency, which exceeded 95% at 5-years in randomly selected patients . Important graft preparation methods include: vigorous distension of the entire graft (including the area of the distal anastomosis) with autologous heparinized whole blood to break the arterial spasm (after all, this vessel is an artery and is subject normally to high arterial pressures); use of calcium channel blocking agents both in the distending blood and postoperatively for 6 weeks; and grafting only to coronary vessels with 75% stenosis, in order to prevent a string sign from competitive flow . In the a and c configurations (rima / lad - lima / ccx and seqlima / lad - freerima / ccx), the extra length of the ra facilitates revascularizing the distal rca with either simple or sequential anastomoses (figure 1a). In the b configuration, the ra is anastomosed to the ccxs system as a simple or sequential graft (figure 1b). Proximal ra anastomoses usually are performed to the aorta, and the conduit is used frequently for sequential coronary grafting . Because of lower patencies in our early studies, rima grafts to ccx vessels through the transverse sinus are avoided, although better data have been published recently . While imaging of arterial grafts in our early series was performed with r - wave gated digital subtraction or conventional angiography, the recent development of high - resolution, gated, computed tomographic angiography (cta) has facilitated on - going validation of evolving surgical techniques . The ability to achieve> 95% patency for most i m a and ra configurations [1, 4] has produced almost uniform early postoperative graft patency in current practice . In figure 2 are representative cta images of postoperative all - arterial bypass grafts in configuration a. computed tomographic angiography imaging of the most common type of all - arterial grafting configuration (a) in the author's practice . The right internal mammary artery connects to the left anterior descending, the left internal mammary artery is a sequential graft to 2 circumflex marginal arteries, and the radial artery is used for the distal right coronary artery . The rima graft to the lad and a sequential lima graft to 2 ccx marginal arteries are evident . In this configuration, the ra is used for the distal rca, and because the ra is longer, it will reach to distal - most rca branches . Likewise, figure 3 illustrates configuration b, in which lima - lad and rima - rca grafts are constructed . The second most common configuration with left internal mammary artery -left anterior descending, right internal mammary artery - right coronary artery, and radial artery - circumflex coronary artery grafts . In this configuration, the ra is used for simple or sequential grafting of the ccx system, and again because of conduit length, the ra is capable of reaching the distal branches of the ccx, if necessary . Finally, in special cases, free i m a grafts are performed (configuration c). Figure 4 depicts coronary anatomy that mandated revascularization of 3 anterior wall vessels with a triple sequential lima graft, in the setting of a compromised important ccx system . In special cases, this patient needed a triple sequential left internal mammary artery graft to the left anterior descending system, so a free right internal mammary artery graft was placed to an important circumflex coronary artery marginal artery . The radial artery was placed to the distal right coronary artery, which was a previously stented infarct vessel and of tertiary importance . Thus, the internal mammary artery grafts are usually reserved for the 2 most important coronary systems . Therefore, the rima was constructed as a free graft to the large ccx vessel . Thus, the relative size and importance of the coronary vessels and size of the viable myocardial regions are considered in configuration decisions, as well as the capabilities of individual arterial grafts in terms of length, coronary size - match, etc . However in over 75% of multivessel patients, at least 2 i m a s are used, and the lad is almost always revascularized with an i m a graft . Many studies have demonstrated improved outcomes with multiple arterial grafts . In our series, a multiple i m a approach to a mean follow up of 20-years was associated with significant long - term reductions in death rates, non - fatal myocardial infarction, percutaneous coronary intervention (pci), and redo coronary bypass (figure 5). Fatal and non - fatal events over 20-years after single versus multiple internal mammary artery grafts (modified from ref . The composite of all 4 events was reduced by an average of 19% over the first 15 years (modified from reference 17). Data were adjusted with a cox model to compensate for minor differences in baseline characteristics . Mi: myocardial infarction, pci: percutaneous coronary intervention, i m a: internal mammary artery, cabg: coronary artery bypass graft . At an interval of 15 years after surgery, 19% of patients having multiple i m a grafts benefited clinically, as compared to single i m a s and vein grafts . In the author s view, this number justifies performing all - arterial grafts in 75 - 80% of multi - vessel disease patients, including those having valve surgery with concomitant coronary obstruction . More recent studies in the duke databank involving larger sample sizes and longer follow up are on - going and are confirming these findings . Out to over 25 years of follow up, composite outcomes seem to improve as arterial grafts increase (figure 6), although this analysis is in preliminary stages and needs more scrutiny . In the larger duke university series (n=19,483) followed over 25 years, single internal mammary artery and adjunctive saphenous vein grafts were performed in 87% of coronary artery bypass surgery patients, multiple internal mammary artery grafts in 4%, and no internal mammary artery in 9% . The composite of all - cause death, non - fatal myocardial infarction, subsequent percutaneous coronary intervention, and redo coronary artery bypass surgery was the outcome variable . A small gradient in patient age existed between groups, with age in no internal mammary artery> single internal mammary artery> multiple internal mammary artery, so that further analysis, including multivariable risk adjustment, will be required . However, initial assessment reveals continually improving outcomes as arterial grafts are increased (modified from ref . Mima: multiple internal mammary artery, sima: single internal mammary artery, nima: no internal mammary artery . Multiple i m a grafts seem to achieve the best results, although the magnitude of difference suggested in figure 6 may diminish after multivariable analysis is applied . Lastly, ample data exist to confirm improved outcomes with ra conduits as adjunctive grafts to i m a s (as compared to saphenous veins). So in summary, most studies confirm the benefits of performing more arterial grafts, and support the current trend toward all - arterial coronary bypass . Meticulous surgical technique should be applied in harvesting fragile i m a and ra vessels to prevent spasm or intimal tears causing dissection . Adequate flow should be confirmed before graft deployment to prevent the disastrous consequences of inserting a bad i m a or ra . With experience and gentle technique, sometimes, an i m a graft can be small, and it is often helpful to cut the vessel back to an adequate diameter for better flow . Occasionally, this requires shortening the i m a considerably and then converting it to a free graft . Finally, ra grafts require very precise harvesting and proper preparation (as described above) to prevent local dissection or graft spasm, also termed a string sign . First, many studies have shown higher rates of sternal infection with mima grafting in diabetics . The subject of sternal infection involves a number of complex multivariable issues, including operating room technique and others . Graft skeletonization can be helpful, but another important factor is effective topical antibiotic irrigation at the end of the procedure which, in several randomized trials, reduced sternal infection rates from 2 - 3% in control groups to around 0.5% . With such methods (vancomycin - 1 gm and gentamicin - 80 mg in one liter of warm saline for irrigation at the conclusion of the procedure), it has been possible to liberally apply bilateral i m a procedures, so that diabetics can undergo routine all - arterial grafting with negligible sternal complications . Bilateral i m a harvesting does increase early postoperative discomfort, and with longer cardiopulmonary bypass times, minor morbidities (such as postoperative bleeding) are slightly increased . In the opinion of the authors, the trade - off of improved long - term results warrants this early morbidity, and most analyses lastly, all - arterial coronary bypass may be most appropriate for elective management of severe multi - vessel or left main coronary disease, whereas patients with acute myocardial infarction or less serious coronary obstruction probably fare better with pci . In this way, surgery and pci are becoming complementary rather than competitive, and in coming years, all - arterial coronary bypass should play an increasingly important role in the treatment of coronary artery disease.
Protection of human health and the environment is one of the major challenges facing developing as well as developed countries of the world [15]. The original aim of regulating waste disposal is to reduce the introduction of polluting substances into the atmosphere since protection of the environment is a major challenge facing developing countries such as zimbabwe . The activities in solid waste management in the informal enterprises of gweru involve risk either to the worker directly involved or to the informal enterprise operators . Risks occur at every stage in the process, from the point where enterprise operators handle waste in their enterprises for collection or recycling to the point of ultimate disposal [611]. The informal sector enterprise activities generate large quantities of waste which could be detrimental not only to the environment but to the waste workers as well . Many concerns have been raised about the potential harm from waste to the environment and general public, but the risks and consequent costs of occupational hazards in waste management have received little attention in the rush to adopt or adapt technologies such as composting . Environmental policies and legislation are, in the main, aimed at regulating the disposal of waste rather than addressing and preventing its generation . In some countries of the developed world attention seems to have shifted towards policies and legislation designed to minimise the generation of waste and to secure its beneficial reutilisation . It is therefore vital in this study to examine the occupational safety and health hazards associated with solid waste generated and disposed of in the informal enterprises of the city of gweru the third largest urban settlement in zimbabwe . The city of gweru covers an area of about 16 700 square kilometres and lies in agro - ecological region three . The main types of soils that characterise the landscape of gweru include black basalt soils, red loams, sands, and gravel . It lies in a watershed which stretches from rusape to bulawayo and is at an altitude of 1422 meters . The municipal area is dissected by numerous streams most of which drain into the gweru river, a tributary of gwayi river . The normal rainy season starts in october right through to april . In the past few years, however, the rainfall patterns have been increasingly becoming poor, with seasons, in some cases, ending in march . Temperatures are high in summer (september to april) when they may average 30c and low in winter (may to july) averaging 14c . Mkoba high density suburb located in the western section of the city of gweru is the largest low income residential area and is divided into 20 sections which are referred to as villages . Other low income high density suburbs include ascot, monomotapa, senga - nehosho, and mambo and the middle density suburbs include ivene, woodlands, nashville, and shamrock park . High income low density areas are located mainly in the northern and eastern sectors of the city and include lundi park, southdowns, kopje, gweru east, windsor park, daylesford, harben park, brackenhurst, ridgemond, athlone, and riverside . The settlements in gweru are divided into 18 wards and these are located in different directions from the cbd . According to the 2012 national census of zimbabwe undertaken by zimstat, the total population of gweru was 158 233 comprising 73 768 males and 84 465 females and the households make a total of 41 149 out of the city's 18 wards . The suburbs or residential areas are divided into wards for ease of administration and service provision by the local council . The city of gweru has always had great potential for growth due to its endowment with a wide variety of industries and as a result it has the highest per capita income in zimbabwe . This has resulted in it being the city with the highest employment rate per capita in the country . It is centrally located and hence it is a very accessible place and the hub of traffic traversing the country . The major industries include zimbabwe alloys, a chrome smelting plant, and bata shoe company (established in 1939), and both are leading employers in gweru . The city is situated in one of zimbabwe's finest cattle rearing areas: the surrounding agricultural activity revolves around the cattle industry (both beef and dairy). Flowers are also grown in the area for the export market, and zimbabwe's largest distiller, afdis, has extensive vineyards in gweru for the production of wine . Mining is also prevalent, mainly chromite ore from rich deposits along the great dyke to the east of gweru . The objective of any informal enterprise should be to minimise the amounts of unwanted products or by - products so as to reduce impact on human health and the environment [1319]. It is vital to examine the potential environmental and health impacts of waste generated in the informal enterprises since this gives an indication of the effectiveness of the waste management practices such as waste collection and disposal . According to tchobanoglous et al . Hazardous wastes are wastes or combinations of waste that pose a substantial present or potential hazard to humans or other living organisms because such wastes are nonbiodegradable or persistent in nature; they can be biologically magnified, can be lethal, or may otherwise cause or tend to cause detrimental cumulative effects . The environmental management act of zimbabwe defines a hazardous substance as any substance whether solid, liquid, or gas or any organism which is injurious to human health or the environment . It further defines hazardous waste as any waste which is poisonous, corrosive, noxious, explosive, inflammable, radioactive, toxic, or harmful to the environment . The properties of solid waste that have been used to assess whether the waste is hazardous or not are related to questions of safety (corrosivity, explosivity, flammability, ignitability, and reactivity) and health (carcinogenicity, infectivity, irritability, mutagenicity, toxicity, radioactivity, and teratogenicity). There has been growing concern over the disposal of solid waste, which may contain small amounts of hazardous waste . Hazardous products generated in the informal enterprises, just like those generated in the domestic and industrial sectors, pose a threat to human health and the environment in their use and disposal . In this study, the amounts of hazardous waste in the informal sector solid waste stream were determined by measuring components separated mechanically (by hand) from the commingled waste . Wastes become a problem when they are harmful to the environment or human health and in this regard the wastes become hazardous . The shrinking of the formal sector industries in zimbabwe has resulted in the growth of home industries in the city of gweru . These home industries generate solid waste and sound management of the waste is the greatest challenge currently facing these industries . These activities produce high quantities of waste which could be detrimental to the health of the waste worker and environment by contributing to air, water, and land pollution as well as pollution of the visual environment and hence a number of safety and health risks if the waste is not properly managed through an efficient waste management system . The informal enterprises are recognised as part of a waste management system in an urban environment in terms of waste recycling . Studies in zimbabwe have made preliminary assessments on the impact of domestic and formal waste on the environment [2024], but no comprehensive study has been made to determine the characteristics of waste generated in the informal enterprises as well as the occupational safety and health hazards associated with the collection and disposal of the waste . Studies have not clearly articulated the issue of the occupational safety and health risks of waste generation, collection, and disposal in the informal enterprises of zimbabwe as deserving investigation because some say it is difficult to study and probably the government does not directly generate any revenue from this sector . This is an area in which our ignorance exceeds our knowledge and hence deserves special attention in this study . The research design employed in the study was closely related to the ontological and epistemological assumptions held about reality by the various stakeholders associated with the informal enterprises of gweru . A multimethods approach triangulating quantitative (for generating hard data) and qualitative (for generating soft data) approaches was thus employed in the study area comprising a sample of 601 informal enterprises . In this study working procedures, conditions, and occupational safety and health risks were assessed in the informal enterprises of gweru . The study population for questionnaire surveys comprised all the 589 organised informal enterprises in monomotapa high density suburb, shamrock park medium density suburb, mkoba high density suburb, ascot high density suburb, kudzanai market, and kombayi market . Focus was on these areas because of the large concentrations of informal enterprises characterised by a diverse range of enterprises that include retail, service, repair, manufacturing, and construction activities . In monomotapa 47 out of 51 enterprises agreed to participate in the survey . At shamrock park there was a combination of informal enterprises and small - scale and medium - scale enterprises . All the 57 informal sector enterprises were selected to participate in the survey and they were those with less than 10 employees and the small - scale and medium - scale enterprises were left out since they did not meet the criteria for defining informal enterprises . All the 182 enterprises at kudzanai that were allocated with stalls from which they operated were involved in this study and participated with keen interest and the majority are retailers of food and clothing . The other market area near the city centre is at kombayi and all the 29 informal enterprises that were allocated stalls participated in the study and at kudzanai these are mainly food and clothing retailers . In mkoba and ascot high density suburbs the majority of enterprise operators participated in the survey and the very few that declined to participate were either suspicious or simply uncooperative . Out of a total of 229 enterprises in mkoba, 224 participated from the sections of mkoba 6, mkoba 14, and mkoba 16 and in ascot a total of 50 out of 53 enterprises participated in the study . Questionnaire surveys were used to realise the immediate objectives of the research as well as to gather data on the informal enterprises of gweru . To gather data on critical areas of solid waste management in the informal sector, the design as recommended by oppenheim, de vaus, and baker was used so as to reduce ambiguity or bias . The questionnaire was developed to cover aspects of the objectives to investigate issues concerning informal enterprise waste generation and disposal practices, availability and type of waste disposal services, and perceptions on the waste management situation in the informal enterprises and how the system can be improved . The questionnaire administered to the home industry operators aimed at collecting information on the quantity and type of waste produced, waste collection and disposal practices, and the occupational safety and health hazards associated with these activities . The instrument was divided into appropriate sections to allow for the systematic collection of data from the enterprises in the different spatial locations of monomotapa, shamrock park, mkoba, kudzanai, kombayi market, and ascot . The survey questionnaire was semistructured, containing both open - ended and closed - ended questions . Interviews were for the purpose of gathering information on waste management system in gweru's home industries, occupational safety and health problems associated with solid waste management, planning for waste management in informal enterprises and environmental impact of waste produced in the home industries . Personal observations were undertaken to assess the typical tasks performed during waste collection and disposal and the associated hazards . In addition to the field assessments a focus group discussion was held in each of the spatial areas was held . This was meant to assess the perceptions of the workers as well as enterprise operators on risk perception, injuries and diseases linked to waste occupation and their own ideas for improvement options . Data collection for the waste compositional study followed the traditional material based classification adopted by burnley . The samples from the informal enterprises were collected in plastic bags and labelled with unique identity marks . The segregated components were weighed to determine weights as percentages of total weight of a sample . It is generally assumed that solid waste generated in the informal enterprises contributes an insignificant proportion to the total waste stream generated in any urban environment and hence it does not deserve special attention . However, the study reveals that significant quantities of solid waste are generated in the informal sector of gweru especially in market areas that focus on retailing of vegetable and food products and the industrial sectors involved in manufacturing and construction . The major components of the waste stream include food and vegetable wastes at monomotapa, ascot, and mkoba (51%, 29%, and 18% of total weight, resp . ), metals at shamrock park, monomotapa, and mkoba (36%, 31%, and 19% of total weight, resp . ), and paper at mkoba, ascot, and kudzanai (11%, 11%, and 9% of total weight, resp . ). Solid waste generated in the retail sector is dominated by biodegradable waste in the form of food and vegetable waste as well as long - term biodegradable (incinerable) wastes such as paper, textiles, rubber, and leather products . The biodegradable waste stream dominates in the market areas of kudzanai and kombayi where it constitutes an average of 57.1% of waste generated in these areas . In the market areas located in ascot and mkoba, the biodegradable fraction comprises 31.6% and 20%, respectively, of the waste generated in those areas . It is important to note that biodegradability is a vital biological characteristic of the organic component of solid waste . Therefore, wastes with low lignin content such as food wastes and vegetable wastes are more biodegradable than those with high lignin content such as paper and plastic that are dominant in some enterprises . Establishing biodegradability of solid waste is essential because the majority of environmental and health problems associated with waste generated in the enterprises are caused by the biodegradable components . This assertion confirms findings in the literature regarding the impacts of biodegradability of solid waste on human health and the environment (see [2935] and tchobanoglous, 2003). The nonbiodegradable waste fraction includes metals, plastics, and inerts arising out of builder's rubble . Metals dominate in the manufacturing and construction enterprises at monomotapa and shamrock park and constitute on average 30.6% and 39.6%, respectively, of the total waste generated in those areas . This can be attributed to the nature of activities associated with these enterprises that include welding, steel fabrication, panel beating, mechanical and electrical engineering, and tinsmithing . The dry recyclables such as paper, plastics, and glass are lower in most cases due to the informal practices of waste reduction, reuse, and recycling with the involvement of rag pickers, itinerant buyers, and dealers of recyclables . The composition of hazardous waste generated in the informal enterprises of gweru is shown in table 1 . Hazardous waste contributes on average 2.6% of total waste by weight in the informal enterprises . Although occurring in small quantities, the hazardous solid waste can have significant negative impacts on human health and environment when improperly disposed of . The hazardous wastes pose substantial present or potential hazards to humans or other living organisms because they are nondegradable, are persistent in nature, or are lethal . The typical problems associated with hazardous enterprise wastes identified above are summarised in table 2 . In the informal enterprises of gweru, the hazardous waste stream comprises mainly cleaning products, personal care products, automotive products, pesticides, insecticides, and herbicides, and miscellany which incorporates batteries and sharps such as broken glassware . There is risk caused by the myriad of toxic chemicals present in some the hazardous waste shown in table 2, especially the e - waste because of its association with heavy metals such as arsenic, cadmium, chromium, lead, and mercury . These heavy metals have no beneficial effects in humans and there is no known homeostasis mechanism for them . These elements are regarded as most toxic to humans and animals and the adverse human health effects associated with exposure to them, even at low concentrations, are adverse and include, but are not limited to, neurotoxic and carcinogenic actions [3638]. Arsenic is a metalloid that would be associated with insecticide containers discarded in the informal enterprises . In organic arsenic is considered carcinogenic and is related mainly to lung, kidney, bladder, and skin disorders . The toxicity of arsenic in its organic form has been known for decades under the following forms: acute toxicity, subchronic toxicity, genetic toxicity, developmental and reproductive toxicity, immunotoxicity, and biochemical and cellular toxicity [18, 32]. The solid wastes generated in the enterprises such as lead and zinc batteries, detergent containers, and pvc contain cadmium which derives its toxicological properties from its chemical similarity to zinc . Cadmium accumulates in the human body affecting several organs that include the liver, kidneys, lungs, bones (osteomalacia; osteoporosis), the placenta, brain, and the central nervous system . Other types of damage that have been observed include reproductive and development toxicity and hepatic, haematological, and immunological effects . Discarded batteries, alloys, and petroleum additives associated with the informal enterprises are linked with the heavy metal lead which has no essential function in the human body.toxic waste is capable of causing injury or death through injection, inhalation, or skin absorption; some can cause cancer, genetic mutation, and foetal harm.flammable/combustible wastes can be easily set on fire.corrosive waste can burn and destroy living tissue or other materials when brought into contact with them.once in the bloodstream, lead is primarily distributed among blood, soft tissue, and mineralising tissue and children are particularly sensitive to this metal because of their more rapid growth rate and metabolism, with critical effects in the developing nervous system . Mercury would be associated with containers of seed preservatives, fungicides, pharmaceuticals, and batteries discarded in the informal enterprises and it is one of the most toxic heavy metals in the environment . Thus far the disposal of e - waste with the rest of the municipal solid waste may result in negative impacts on the environment such as groundwater contamination by lead leaching and high concentrations of lead in lead leachate . When e - waste is burnt in incinerators, heavy metals become concentrated in the ash, limiting its disposal and reuse options . Since most of the plastic materials in e - waste contain flame retardants that are mainly halogenated organic chemicals, toxic organic contaminants such as dioxins and furans may be formed during incineration and exit through the stack to the surrounding areas in the form of gaseous pollutants . Toxic waste is capable of causing injury or death through injection, inhalation, or skin absorption; some can cause cancer, genetic mutation, and foetal harm . Flammable / combustible wastes can be easily set on fire . Corrosive waste can burn and destroy living tissue or other materials when brought into contact with them . The actual fate of the small quantities of hazardous waste generated in municipal solid waste is generally unknown and hence the environmental persistence of these hazardous compounds is one of the critical issues in their long - term management and this is true with regard to the hazardous waste generated in the informal sector of gweru identified in table 2 . In the informal enterprises the hazards associated with nonpersistent organic waste emanating from containers of oil, some solvents, biodegradable pesticides, waste oils, and most detergents cause toxicity problems to the environment and biota . Persistent organic wastes such as some pesticides are associated with immediate toxic effects (acute and subacute) resulting in long - term chronic toxicity and the transportation of organic waste from the source can result in widespread contamination and bioconcentration in the food chain . Occupational health concerns emanating from solid waste in the informal enterprises relate to the infestation of areas used for storage and disposal of solid wastes with vermin and insects that serve as potential disease vectors (figure 2). During focus group discussions and questionnaire interviews with enterprise operators a number of waste related problems the problems identified included disease transmitting insects such as flies and cockroaches and increasing populations of rodents and odours . The provincial environmental health technician in the ministry of health and child welfare and the senior environmental health officer in the gweru city health department confirmed that the problems of disease transmitting insects were attributable to the indiscriminate dumping of refuse . Enterprise operators reported that the waste related problems were attributed to noncollection or erratic collection of waste and the lack of adequate temporary storage facilities . Open space dumping in the backyards of enterprises as well as improvised pit dumping has provided fertile grounds for breeding of disease transmitting insects such as the two - winged fly (diptera) and cockroaches (dictyoptera). The most important fly species from the point of view of pathogen transmission observed in the enterprise dumping areas were the housefly (musca domestica) and a species of the tropical green blowfly (chrysomya). Musca domestica breed on solid, moist, and fermenting organic matter and can develop in less than two weeks after the eggs are laid over a temperature range of 20c30c . Cockroaches are usually attracted by the moisture in waste streams and are potential carriers of faecal pathogens . In confirming these problems the senior environmental health officer in the city of gweru revealed thatflies and cockroaches breeding and feeding on the indiscriminately dumped solid waste carry particles of waste from place to place . Flies spread enteric infections such as diarrhoea, typhoid, dysentery, eye infections and skin infections such as cutaneous ephthera [sic] and yaws and incidents of such diseases as diarrhoea have occurred in the informal enterprises . These incidents are common during rainy seasons when fly populations increase and when collections are erratic due to logistic problems . The conditions at kudzanai market as well as at kombayi market are particularly worrying during the rainy season when uncontrolled dumping can result in unsightly heaps of waste and this is detrimental to human health . Flies and cockroaches breeding and feeding on the indiscriminately dumped solid waste carry particles of waste from place to place . Flies spread enteric infections such as diarrhoea, typhoid, dysentery, eye infections and skin infections such as cutaneous ephthera [sic] and yaws and incidents of such diseases as diarrhoea have occurred in the informal enterprises . These incidents are common during rainy seasons when fly populations increase and when collections are erratic due to logistic problems . The conditions at kudzanai market as well as at kombayi market are particularly worrying during the rainy season when uncontrolled dumping can result in unsightly heaps of waste and this is detrimental to human health . Increasing rat populations were reported by 69% of the enterprise operators especially in those enterprises where waste is disposed of in open pits . The rats are such a menace and have the potential of spreading flea - borne disease and plague . Though such diseases have not yet occurred in the enterprises, they need to be guarded against as the rat populations continue to increase . In those enterprises with an unreliable collection system, burning of combustible solid waste such as paper, plastic rubber, and textiles waste hot ashes which are added to combustible refuse pose a great danger to the inhabitants adjacent to the enterprises since this results in uncontrolled fires . In most cases the fires start with the objectionable practice of open burning of waste and the smoke from the burning refuse is an environmental nuisance to surrounding residents . It has also been observed that waste management procedures in developing countries are characterised by a dominance of manual handling tasks . The waste generated in the informal enterprises exposes those involved in the collection and recycling to a diversity of occupational health hazards that might not be easily treated due to limited access to healthcare facilities . Exposure to occupational hazards in terms of waste management is defined by the properties of the waste, the management task (collection, transport, and recycling), and the applied procedures and technologies . Waste collection from the informal sector also involves carrying heavy loads and rotting organic waste or waste contaminated with pathogens and/or hazardous substances is handled . The waste handlers in the enterprises have shown a high risk of muscular - skeletal disorders such as low back pain and elbow / wrist pain twice as often as the control group due to handling heavy loads . Furthermore, the repetition of similar movements of hands and arms when grabbing and disposing waste containers causes joint problems as also observed by yang et al ., 2001; the risks associated with solid waste management in the informal enterprises can thus be divided into the following categories: occupational accidents, physical risks, chemical risks, ergonomic risks, psychological risks, and biological risks . The health risks either to the worker directly involved or to the enterprise operators and nearby residents are caused by many factors that include the following: the nature of raw waste, its composition (e.g., toxic, allergic, and infectious substances), and its components (e.g., gases, dusts, leachates, and sharps).the nature of waste as it decomposes (e.g., gases, dusts, leachates, and particle sizes) and their change in ability to cause a toxic, allergic, or infectious health response.the handling of waste (e.g., shovelling, lifting, equipment vibrations, and accidents).the processing of wastes (e.g., odour, noise, vibration, accidents, air and water emissions, residuals, explosions, and fires).the disposal of wastes (e.g., odour, noise, vibration, stability of waste piles, air and water emissions, explosions, and fires).the health hazards associated with waste management in gweru according to records from the gweru city council's health department are summarised in table 4 . The nature of raw waste, its composition (e.g., toxic, allergic, and infectious substances), and its components (e.g., gases, dusts, leachates, and sharps). The nature of waste as it decomposes (e.g., gases, dusts, leachates, and particle sizes) and their change in ability to cause a toxic, allergic, or infectious health response . The handling of waste (e.g., shovelling, lifting, equipment vibrations, and accidents). The processing of wastes (e.g., odour, noise, vibration, accidents, air and water emissions, residuals, explosions, and fires). The disposal of wastes (e.g., odour, noise, vibration, stability of waste piles, air and water emissions, explosions, and fires). An interview with a health authority in the gweru city council confirmed the statistics shown in table 7 which revealed that 40% of waste collectors who were referred to gweru provincial hospital suffered cuts and punchers while 16% suffered from sprains . Eye injuries were mainly due to dust and smoke from the fires at the dumpsite . The official also indicated that there were no active vaccination programs for workers due to low financial allocation to the health sector by the national fiscus, although she quickly pointed out that injections were administered at the time of occurrence . She indicated that a single rabies injection / vile can cost up to us$100 . Back and truck injuries have the lowest incidences at 2% but when they occur they are highly life - threatening . Table 5 shows the number and percentage of occupational injuries among workers in the cleansing section of the gweru city council health services department, by injury type and cause from 2011 to 2012 according to statistics from the human resources department . The common mechanical hazards affecting waste workers in the informal enterprises include cuts from sharp items (razor blades, glass cutlets, and metal pieces) and needle pricks from dressmaking enterprises . Observations revealed that workers are also at risk of being electrocuted from naked wires, wrong wiring connections, traumatic injuries from sharp objects, burns from electric sparks during electrical fixing, dust from carpenters and grind mills, noise from welders and milers, and exposure to heat and ultraviolet radiation from welding . Health hazards also emanate from infections caused by biological agents, especially virus infections such as hepatitis b / c . Tetanus infection is also a serious concern since some of the workers are not vaccinated and the wounds are not treated adequately due to a lack of hygiene and the necessity to resume work immediately in order not to lose income . Other mechanical risks include bruises from hitting equipment, fractures, and contusions evoked by falling from unsecured platforms of trucks . However, closely connected with waste collection are cuts from sharp items from waste generated in the informal enterprises as well as falling accidents from small platforms of waste collection trucks . The mechanical safety and health problems associated with solid waste management in the informal enterprises were succinctly explained by a municipal waste worker who was busy collecting waste at monomotapa:mechanical hazards associated with solid waste generated and disposed in the informal sector include piercing, scraping and bruising by scrap metals, old wires and vehicle shells resulting in wounds from contact with sharp waste . Hazards like broken bottles, liquid fires at fuelling depots, residual fires at landfills, bins with jagged edges and compactors pose safety hazards to us employees . Broken bottles, glasses and other sharp objects impale our already worn out gloves thus exposing us to cuts and bruises which may lead to diseases like tetanus, dermatitis and may eventually fester into septic wounds . We also do not have adequate protective clothing to protect ourselves especially face masks, gloves and overalls . Mechanical hazards associated with solid waste generated and disposed in the informal sector include piercing, scraping and bruising by scrap metals, old wires and vehicle shells resulting in wounds from contact with sharp waste . Hazards like broken bottles, liquid fires at fuelling depots, residual fires at landfills, bins with jagged edges and compactors pose safety hazards to us employees . Broken bottles, glasses and other sharp objects impale our already worn out gloves thus exposing us to cuts and bruises which may lead to diseases like tetanus, dermatitis and may eventually fester into septic wounds . We also do not have adequate protective clothing to protect ourselves especially face masks, gloves and overalls . There are various methods used by the gweru city council to prevent injuries and these include the use of personal protective equipment (ppe), personal protective clothing (ppc), and safety warnings ppc such as dust masks and respirators are used to deal with problems of high levels of dust and smoke . However, landfill workers and bin loaders complained that the material used to make the masks is not very effective since they are facing respiratory difficulties during the time of waste burning . Some of the masks do not fit to faces since they do not have room for adjustment; hence some workers would rather operate without masks, a move that may be detrimental to their health and most of the time most workers do not have the masks since they are usually in short supply (figure 3). Work - suits and safety shoes are also used as a way of protecting the body from harmful objects . Furthermore, ear plugs are used in areas with high levels of noise . Working in areas with high levels of noise ergonomic hazards in the informal enterprises result from carrying or lifting heavy loads, repetitive movement and work, that is, shovelling, muscular - skeletal disorders resulting from handling heavy containers, heat stress resulting from exposure to excessive temperatures, and hearing loss due to too much exposure to excessive noise . Collection and sorting operations require repeated lifting and twisting motions which are common sources of musculoskeletal injuries including repetitive strain injuries . Collection workers must lift, twist, and dump heavy bins and bags and during curbside sorting the lifting can exceed guidelines recommended and hence is likely to cause harm (figure 4). Manual sorting tasks often require reaching, lifting, and twisting and this can cause workers pain, soreness, general fatigue, tendonitis, and musculoskeletal injuries of the feet, arms, shoulders, hands, wrists, and lower and upper back . Observations showed that garbage workers experienced a high incidence of repetitive strain injuries because of repeated flexing and twisting motions, further noting that waste collection workers are usually inadequately trained and prepared for the fine motor activities required for curb side sorting hence exposure to ergonomic hazards (table 6). It is the awkward postures, forceful exertions, static loading, extended reaches, deviated wrist hand and arm postures, and contact stress which present major ergonomic hazards . A total of 32 waste collectors were interviewed on healthy ergonomics behaviour; 29 of them are male and aged between 18 and 50 years . It became clear that most men had some insight into the occupational hazards of their workplaces but generally lacked thorough factual occupational health and safety knowledge . The respondents were able to mention certain safety related occupational health risks but did not consider these hazards to be dangerous to their health or capable of causing disease . For example, the waste collection crews in mkoba and ascot considered their trade to be dangerous but could not explain the health effects that were related to the job . The level of awareness regarding the major areas of ergonomics was found to be low among the collection crew members who operated in the informal enterprises when compared to the office workers as shown in table 7 . In identifying the health impacts of chemical and biological agents in the informal sector, the possible obstructing factors include the following: the long period before the effect becomes manifested, the multiplicity of causes of diseases (which makes it difficult to distinguish occupational diseases from diseases caused by, e.g., unhygienic living conditions); the lack of knowledge mechanisms involved in the pathogenesis of human chronic diseases; and a wrong classification of diseases . There is high danger of skin and blood infections resulting from direct contact with these liquids and from infected wounds intoxication and skin irritation resulting from contact with small amounts of hazardous chemical waste . Residues of hazardous chemicals in recyclable containers and their gaseous emissions pose hazards to workers involved in the collection, sorting, and washing processes . Chemicals that pose risks include chlorine, fluorine, paper beaching, deinking, pulping agents, plastic additives and equipment cleaning solvents, and insecticides and herbicides . Contact with skin or inhalation or even ingestion of these chemicals can cause dermatitis, disorder to the central nervous system, and possible liver and kidney damage . Exposure to fumes from heated metals can produce metal fume fever which is a flu - like condition . Exposure to chemicals can also cause irritation to the skin and respiratory tract and potential damage to the liver and central nervous system . Inhalation of metal, glass, paper, or plastic dust from shredding, demagging, and detinning can cause or aggravate chest discomfort, bronchitis, or asthma . Acute exposure to metal dust may cause irritation of the upper respiratory system and eventually severe pulmonary irritation . Chronic exposure to some heavy metals may cause cancer and adverse effects to the central nervous gastrointestinal system . Disposal of old batteries and electronic and electrical appliances such as cell phones, radios, computers, televisions, digital satellite decoders, and fluorescent tubes may pose danger as these contain toxic substances such as mercury, lead, and cadmium . Motor mechanics and welders at shamrock park, monomotapa, ascot, and mkoba use paraffin, paint, and solvents such as benzene and methylated spirit and there is high danger of skin and blood infections resulting from direct contact with these liquids . Scrap batteries removed from vehicles have the potential of corroding clothes, causing blisters, and fire outbreaks due to the acid containers . Scrap metal from welding shops and garages is hazardous since people experience cuts when collecting and disposing waste materials . Empty bottles of toxic chemicals are dangerous to children who play with these and poisoning may occur through ingestion, absorption, and inhalation of gases in empty containers . Biological hazards associated with waste generated and disposed of in the informal sector enterprises include water borne diseases resulting from flies and mosquitoes breeding in dumping sites around the enterprises . Rabid dogs scrambling in bins may result in bites that cause rabies and rodents may also spread disease . Dermal and blood infections may result from direct contact with waste and from infected wounds, zoonosis due to bites by wild or stray animals feeding on waste, and enteric infections transmitted by insects . Leaching of toxic matter in areas close to the dumps leads to contamination of water sources resulting in diarrheal diseases . Workers may be infected by biological agents such as bacteria and viruses that contaminate waste, which are usually formed from the decomposition of matter and result in infections . Cuts or puncture wounds from broken glass, metal edges, or needles become the site of infection following exposure to bacteria and viruses and the infections include hepatitis b, fungi, or parasites . Common health problems associated with exposure to certain bacteria, fungi, and viruses include contact dermatitis infections, diarrhoea, and skin diseases . Long - term occupational exposure to contaminated air in composting operations can include allergic responses such as asthma, chronic bronchitis, and hay fever . Other symptoms in waste workers include chills, irritation of eyes, nose, and upper respiratory tract, nausea, headache, chest tightness, and feeling of influenza . Workers in paper sorting operations have the highest incidence or chances of lung infections compared to all other waste workers and this is a result of high levels of organic dust and endotoxins (poisonous substances produced by bacteria in the air). Water - borne diseases are also biological hazards emanating from flies and mosquitoes breeding in dumpsites and causing malaria . Dermal and blood infections from direct contact with waste and from infected wounds, zoonosis resulting from bites by stray animals feeding on waste, and enteric infections transmitted by insects are the other biological hazards . It has been documented that waste workers experience higher incidents of diarrhoea, viral hepatitis, and higher incidents of obstructive and restrictive respiratory disorders than control groups and suffer from dog and rat bites, skin diseases, and jaundice [34, 43]. Some of the problems that were reported by the authorities in the city of gweru as emanating from waste generated in the enterprises are like common cold, cough, bronchitis, bronchial asthma, tuberculosis, and other respiratory problems . However, other authors such as van eerd and porta et al . Have noted that it is difficult to prove a direct link between these diseases and the waste occupation . Occupational exposure in the case of solid waste management activities in the informal enterprises of gweru is influenced especially by the properties of the waste and secondly by the management task which involves collection and disposal as well as the applied procedures and technologies . Solid waste management procedures in the informal sector of gweru are characterised by a dominance of manual handling tasks . Collection involves carrying heavy loads and rotting organic waste or waste contaminated with pathogens and/or hazardous substances . The working conditions and properties of the waste expose workers involved in collection and disposal of waste to a diversity of occupational safety and health hazards that might not be treated adequately due to limited resources . A holistic view of waste management implies integrating the waste management system into the informal enterprises activities and the gweru municipality as an organisation since this incorporates occupational safety and health aspects (see figure 5). For the manufacturing and construction enterprises in monomotapa, shamrock park, mkoba, and ascot there would be need to take into account the waste management issues as an integral part of the design activity . T would represent the process such as construction and manufacturing, while e would represent an aggregate of the base level process design activity b1 and another base level activity e2 which both refine t by specifying cycle by cycle its attributes with an aim to end up with an acceptable performance of t assessed against a predefined set of performance criteria . E2 refers to the she system taking into account safety, health, and environmental issues of the activities . Waste workers in the informal enterprises of gweru experience a number of adverse health and safety effects and these include higher incidents of diarrhoea, viral hepatitis, higher incidents of obstructive and restrictive respiratory disorders, and dog and rat bites, skin diseases, and jaundice . There are also higher incidents of muscular - skeletal disorders affecting the waste collectors such as low back pain and elbow / wrist pain and joint problems which arise from the repetitive movements of hands and arms when grabbing and disposing waste containers . The common mechanical hazards in the informal enterprises of gweru include cuts from sharp items such as razor blades, glass cutlets, and metal pieces . Workers are thus exposed to the risk of infections caused by biological agents, especially virus infections . Infections such as hepatitis b / c and tetanus are a major concern since workers are rarely vaccinated and wounds are not treated adequately due to a lack of hygiene and the desire to resume work immediately so as not to lose income . Mechanical risks experienced by waste workers in gweru include bruises from hitting equipment, fractures, and contusions evoked by falling from unsecured platforms of trucks . Since safety, health, and environmental management systems are a vital component of the waste management model shown in figure 5, risk assessment therefore becomes imperative in determining and evaluating the risks posed by the working conditions of the waste workers . Risk assessment is a systematic examination of all aspects of work and it considers what could cause injury or harm, whether the hazards could be eliminated, and what preventive or protective measures should be put in place to control the risks . Undertaking risk assessment would enable the municipality of gweru and the enterprise operators to understand the action necessary to improve workplace occupational health and safety . The ultimate objective is to decide on an action plan designed to establish the control of risk and to ensure that risk control remains effective . Risk assessment directly relates to the actual techniques and procedures in detecting what hazards could cause injury or long - term health impacts . The focus group discussions with waste workers and interviews with waste authorities in gweru showed indeed that transfer mechanisms of waste from temporary waste disposal receptacles into municipal receptacles needed urgent attention . The risk assessment survey also showed that the waste management conditions in the informal sector enterprises were hazardous . Waste collection involved manual handling of plastic and metal bins and this was associated with a number of ergonomic hazards as discussed in the previous sections . Some of the roads, especially in mkoba, ascot, and monomotapa high density suburbs, were rough and unpaved and hence posed risks in the form of road accidents . Waste was also sometimes strewn down the streets from the collection vehicles . In all the enterprises including those in monomotapa and shamrock park, sharp items such as razor blades, glass cutlets, and syringes as well as hazardous substances such as broken where plastic bags were used for collecting solid waste, the thin permeable material posed dermal exposure because hazardous substances, microorganisms, and sharp items also injure workers when handling the waste bags with bare hands . There is inadequate and improper personal protective clothing (ppe) as evidenced by the torn or makeshift protective clothing such as the gloves worn as protection by the workers . It was also revealed through risk assessment that most of the waste workers as well as enterprise operators had been affected by cuts and skin rashes that were caused by substances and insects associated with the disposed - of solid waste . The open wounds were also at risk of being infected by tuberculosis in such unhygienic working conditions . It has been observed by bleck and wettberg that hepatitis b infections can occur when the cuts are caused by razor blades or syringes which are disposed of in the ordinary waste stream . Dust is generated in quite visible amounts in informal sector enterprises especially at monomotapa, kombayi market, ascot, and mkoba . This was during the pouring of waste into collection bags and also during the transfer of waste into containers . Dust constitutes a major hazard because of its contribution to inhalation; exposure to biological agents and bronchial asthma, cough, and other respiratory problems may result . The ergonomic hazards are exacerbated by the carrying and emptying of heavy unstable waste bags and this is a major health hazard among the female workers . The safety interventions in gweru are complicated by the fact that solid waste collection is undertaken through labour intensive systems and hence workers experience high physical loads and inadequately stored waste . In the low - tech waste management sector of the city of gweru, occupational safety and health intervention is often equalled with the supply of personal protective clothing . This has been proven to be one of the least effective measures due to the demand for correct application, infrequency of supply, and inadequate materials as also in studies undertaken elsewhere by kenao . Officials from the health department of the city of gweru indicated that their safety interventions included mainly the provision of ppe . The environmental health officer in the city of gweru indicated that we provide our waste collection crew with ppe to protect themselves against occupational hazards associated with the collection and disposal of solid waste and this has proven to be effective through the years . Van eerd, however, notes that health officials may not be aware that protective devises are among the least effective safety interventions and that the long distribution intervals, especially for masks, rendered the supply itself absurdum . Usually even when workers are supplied with the protective equipment, they normally do not use it as a result of lack of awareness as well as their low social status . A sustainable solution to increase occupation safety and health among the workers would be the adaptation of workplace and process design . Improving the occupational safety of waste workers is thus a crucial step to increase their social welfare . This can only be done in an efficient manner by firstly identifying the actual occupational risks associated with solid waste management activities . This is vital in the quest to apply a hierarchy for exposure control measures as initiated by the council directive 89/391/eec of june 1989 . This entails eliminating the hazard at its source, for example, substituting hazardous chemicals or omitting burdensome work steps and hence rendering additional work steps unnecessary and it is the most efficient precaution . Technical measures are also vital and these involve safer equipment and are more preferable to individual measures such as personal protective equipment and training in proper behaviour . These do not eliminate the hazard per se but only provide a barrier between the hazard and the worker at the ultimate point . This is the stopp principle: s: substitution of hazardous process or material.t: technical measures.o: organisational measures.p: personal protective equipment.p: personal behaviour.the lack of a comprehensive waste policy that is packaged to deal with safety, health, and environmental management issues in zimbabwe has compromised effective solid waste management in the informal sector . There is lack of consensus on what constitutes solid waste, its characteristics, and how the waste should be managed and this has resulted in the municipalities having no proper guidelines over the organisation of sustainable solid waste management in the informal enterprises.
Laser - assisted in situ keratomileusis (lasik) is the most common surgical technique for correcting refractive defects and although its efficacy and safety have already been proven, it is not free of potential complications . One of the most feared is postoperative ectasia which induces astigmatism and myopia and reduces the quality of vision due to the induced high - order aberrations and in severe cases it reduces visual acuity . In order to detect ectatic change early, many authors have studied posterior corneal surface stability after laser refractive surgery [1, 2]. Although postoperative ectasia was described in several papers [1, 3], its cause remains unclear . Onset seems to be favored by conditions such as a low residual corneal thickness, an abnormal preoperative corneal topography, a high refractive defect, or the patient's young age [35]. Today femtosecond laser (fsl) is widely used in lasik surgery to create the corneal flap . Compared with the microkeratome (mk), it has increased the safety of the operation and improved the predictability and homogeneity of the corneal flap thickness . The latter has been shown to limit loss of corneal tensile strength especially for thin - flap lasik (90120 m). To our knowledge, no studies have as yet focused on posterior corneal surface changes after femtosecond laser - assisted keratomileusis (fsl - lasik) using a corneal tomography unit . The purpose of the present study is to evaluate the posterior corneal surface in eyes which underwent fsl - lasik for myopia and myopic astigmatism over a twelve - month follow - up period in order to highlight any eventual postoperative forward shift . After the local ethics committee had approved the study protocol, patients were enrolled in a prospective noncomparative case series between january 2012 and june 2012 . Inclusion criteria were age of 21 years and older with stable myopia and a myopic astigmatism for at least two years . Exclusion criteria were systemic or ocular pathologies interfering with the healing process of the cornea, keratoconus, corneal dystrophy, glaucoma, previous eye trauma, or surgery . The study was conducted on patients undergoing fsl - lasik at the department of surgery and biomedical science of university of perugia . All patients underwent a complete preoperative assessment, including corneal tomography using a scheimpflug camera (sirius, c.s.o . Four tomographic images were obtained for each eye, and the best image was chosen . Anterior corneal surface data are derived from the integration of both types of images, while data on the posterior corneal surface and the lens are derived only from scheimpflug images . A corneal flap of 9.0 mm in diameter was made at a depth of 110 microns with the femtosecond laser (visumax, carl zeiss meditec ag, jena, germany). Once the corneal flap was lifted, photoablative excimer laser treatment was applied (mel 80, carl zeiss meditec ag, jena, germany). Check - ups were scheduled for 1, 6, and 12 months after surgery . At each check - up changes in the posterior corneal curvature (pcc), posterior corneal elevation (pce), with respect to the best - fit sphere, and the anterior chamber depth as evaluated from the endothelium (acd) were studied by comparing the results of the preoperative evaluation with postoperative data . The postoperative forward shift was expressed as the difference between preoperative and postoperative pcc values in the central 4 mm areas of the elevation maps, assigning a positive value to anterior shift . Differences in posterior corneal curvature, ablation, residual thickness, and the ablation percentage of the total preoperative corneal thickness were analyzed by spearman's coefficient of rank correlation (). The analysis of variance (anova) for repeated measures and student's t - test for paired data with the bonferroni correction were used for data analysis . Statistical significance was set at p 0.05 . Forty - two eyes of 42 patients underwent bilateral and simultaneous fsl - lasik surgery, and one eye of each subject was randomly chosen (coin toss) and included in this study . The mean age of patients was 36.05 8.3 years (range: 2453 years). The mean preoperative spherical equivalent was 5.05 2.07 d (range: 1.25 d/7.50 d) and the programmed ablation depth was 117.2 32.2 m (36160). Table 1 reports mean values of the posterior corneal curvature, posterior corneal elevation, and anterior chamber depth . Data analysis detected no significant changes in the posterior corneal curvature at 1, 6, and 12 months after surgery compared with preoperative values (f = 1.47; p = 0.226). There was no significant change in posterior corneal elevation during the 12-month follow - up period (f = 1.89; p = 0.135). Anterior chamber depth was stable 1 month and 6 months after fsl - lasik surgery but a significant reduction was observed 12 months after surgery (0.03 0.07 mm) (f = 4.25; p = 0.007) (bonferroni test: t = 2.94; p = 0.005). Our data did not show any linear correlation between corneal ablation depth and posterior corneal curvature throughout the follow - up period (figures 1(a), 1(b), and 1(c)). No relationships emerged between posterior corneal curvature, residual corneal thickness (figures 2(a), 2(b), and 2(c)), and the percentage of ablated corneal tissue (figures 3(a), 3(b), and 3(c)). Our study on patients undergoing fsl - lasik for myopia and myopic astigmatism shows the posterior corneal surface was stable over time . Since refractive surgery reduces corneal thickness, weakening of this layer might possibly have a modification of the posterior corneal surface . In fact, one potential complication of this type of surgery is posterior corneal ectasia which ranges in frequency from 0.04 to 0.9% depending on several factors such as the accuracy of the preoperative evaluation, the surgical technique, and the surgeon's skill [3, 5, 8, 9]. Using orbscan (orbscan, bausch & lomb, tampa, fl, usa) a forward shift of the posterior corneal surface was observed after photokeratectomy (prk) and lasik [1, 4, 10]. Orbscan sensitivity in studying the posterior corneal surface after refractive surgery was, however, questioned because a change in optical features does not allow the instrument to provide accurate corneal mapping [11, 12]. Orbscan uses mathematical calculations to recreate the posterior corneal surface and this strategy, in patients undergoing refractive surgery, can cause false positive readings of the posterior corneal elevation . Corneal morphology is assessed better by rotating scheimpflug cameras that analyze the posterior corneal elevation without mathematical calculations . Evaluations by pentacam (oculus gmbh, wetzlar, germany), which is the first instrument to be based on this technology, appear more reliable as they seem less influenced by the effects of refractive surgery . The different sensitivities of the scheimpflug camera and orbscan in studying the corneal morphology were demonstrated in 2007 by nishimura et al . And later confirmed by others . Studies conducted with pentacam showed that the risk of presenting a forward displacement of the posterior corneal surface after refractive surgery was lower than that which had been suggested using orbscan . In using pentacam to monitor myopic eyes undergoing prk or mk - lasik, ciolino and belin did not observe any case of forward shift at 2 months after surgery . This observation was confirmed by nishimura et al . And by sun et al . Although reduced, the forward shift complication did not completely disappear . In 2010, using pentacam, zhang and wang observed a forward shift of posterior corneal elevation in patients 1 month and 6 months after epi - lasik surgery . Nowadays, cases of iatrogenic corneal ectasia after lasik are still reported even in absence of detectable preoperative risk factors in eyes studied with orbscan or with the scheimpflug camera [16, 17]. In our opinion, some limitations emerge from these reports . Most studies on posterior corneal surface stability after lasik have short follow - ups [2, 11, 12], even though it is well known that a change in the corneal morphology may be observed even a long time after refractive surgery has been performed . Moreover, many studies were conducted on patients who underwent lasik using a microkeratome which does not ensure a high repeatability and regularity of the corneal cut to the detriment of flap thickness homogeneity . On the contrary, the femtosecond laser allows the cut to be made at a lower depth, with greater predictability of and homogeneity in thickness . This probably reduces the loss of corneal tensile strength [6, 10] and should minimize the risk of postoperative ectasia . In a retrospective study with a long follow - up period, moshirfar et al . Used orbscan to study eyes undergoing fsl - lasik and observed 0.05% incidence of iatrogenic ectasia and 0.25% total incidence of postoperative ectasia . In our study, we used a recently introduced rotating scheimpflug camera that was proven to be accurate and reliable in studies on healthy eyes and on eyes affected by pathological ectasia with high repeatability and reproducibility . Moreover, sirius system demonstrated high repeatability and reproducibility for anterior chamber depth measurements [22, 23]. In our patients who underwent fsl - lask, we did not observe any change in the posterior corneal surface even one year after surgery . Our findings concur with other authors who reported that a scheimpflug camera after mk - lasik demonstrated posterior corneal surface stability after a long follow - up period [2, 24]. Furthermore, in agreement with other authors [2, 11, 12], the difference in posterior corneal curvature in our study did not correlate with residual corneal thickness, corneal ablation depth, or the percentage of ablated corneal tissue . Lasik surgery induces a change in the corneal morphology with an increase in peripheral corneal curvature and posterior central curvature without a forward shift . Observed soon after surgery, these effects tend to decrease over time but can be confused with a bulge of the posterior corneal surface . In our work, we did not observe any changes in the posterior corneal surface probably because our postoperative examinations began one month after surgery . Moreover, use of the femtosecond laser to create the corneal flap may have lessened these effects on corneal morphology . Unexpectedly, we observed a reduction in the anterior chamber depth 1 year after surgery, without any clinical consequences, as was reported by nishimura et al . In 2007 and by sun et al . In 2009 this paradoxical observation may be one result of the magnification effect that the cornea has on the lens front surface after lasik, or it may be caused by the change in lens morphology due to the increased accommodative effort that patients must make once the myopic refractive error is corrected . In fact, its early appearance is a consequence of peripheral stromal thickening which recovers the normal morphology within three months, but we cannot account for its onset one year after surgery . Using a rotating scheimpflug camera, our study demonstrated posterior corneal surface stability 12 months after surgery in patients who underwent fsl - lasik for myopia and myopic astigmatism . Although these data should be confirmed by further studies, with more patients, our work seems to confirm that the femtosecond laser plays a role in making this surgery safer and more predictable, probably by reducing the onset of forward shift of the posterior corneal surface.
Interest in erosion has increased as there has been a rise in its incidence in the younger population . Previously erosive challenges in the cervical area were reported mostly in elderly people, whose teeth had become non - functional . However, it has been shown that dietary changes and inadequate oral hygiene have led to erosion becoming more frequent among young people . Several studies have examined a possible association between dental erosion and the consumption of soft drinks, i.e., carbonated cola beverages and citrus - based fruit drinks . There has also been increased interest in the dental effects of soft drink beverages due to the escalating (an increase of 56%, rising approximately 2 - 3%/year) consumption by children and adolescents over the last decade . In a country like india with extreme climatic conditions of summer and winter, canadian estimates that consumption in india shows an estimated 13% jump during the summer or heat months . India food and drink report estimated that soft drinks sales in india increase by an impressive 38.6% over the 2008 - 2013 forecast in value terms . It has been suggested that casein phosphopeptides have the ability to stabilize calcium phosphate in solution by binding amorphous calcium phosphate with their multiple phosphoserine residues, thereby allowing the formation of small casein phosphopeptide - amorphous calcium phosphate (cpp - acp) clusters . The current study was undertaken to evaluate the effect of cpp - acp paste on the remineralization potential of enamel after its surface was exposed to cola drinks . A quantitative measure of mineral loss (calcium and phosphorus loss) using a spectrophotometric autoanalyzer was carried out along with scanning electron microscope (sem) study of the surface profile before and after exposure to cola drinks and cpp - acp application . An in - situ clinical trial study was carried out after random screening of 1200 school going children and selecting 30 subjects further divided into two groups of 15 subjects each as shown in the flowchart . Ethical approval for the study was obtained from the ethical committee affiliated to the baba farid university of health sciences, faridkot through letter no: bfuhs/2008/p - th/8610 . A written consent from the parent / guardian of the wards was taken on an informed consent form . Upper and lower arch impressions of the subjects were taken and a working cast prepared from the same . Enamel slabs were prepared by cutting thin sections of enamel (5 mm 5 mm 1 mm) using a slow speed hand piece under continuous water spray [figure 1] from the permanent premolar teeth procured from tooth bank being maintained at the department of pedodontics and preventive dentistry at punjab government dental college and hospital, amritsar since 2004 . Sound, relatively planar buccal, lingual surfaces free from cracks, stains and hypomineralized areas were selected and were thrice rinsed in deionized water . Preparation of enamel slabs using slow speed hand piece under continuous water spray measuring 5 mm 5 mm 1 mm three such enamel slabs were prepared from each tooth, out of which two slabs were embedded in the premolar region on each side of the palatal removable plate fabricated on each subject's working cast . The remaining third enamel slab was used as a control to obtain the baseline values in both groups, i.e., group a for sem analysis and group b for calcium and phosphorus analyses . Every subject was blinded by a given code and the remaining third slab (control enamel slab) was stored in artificial saliva in culture tubes tagged with the respective codes until they were subjected to their respective analyses for baseline values [figure 2]. The arrows are pointing to the code the oral hygiene practices of each subject were noted on a prepared questionnaire and were not found to be significantly different from one another . On day 1, each of the selected subject underwent thorough oral prophylaxis to obtain a baseline plaque score of zero disclosed by a disclosing solution (two tone dye solution fluorescein dye and c red no . The two tone disclosing agent was procured from a local dental dealer manufactured by the burmah chemical company bombay . This was repeated on days 1, 4, 8, 12 and 15 so as to obtain a baseline plaque score of zero each time before starting the cola exposure . Every subject was asked to wear their respective appliance and drink 30 ml of aerated cola drink (procured from the same lot) swishing it around the mouth for 1 min before spitting it out . The subjects were then asked to rinse their mouth with water for 2 min immediately . This was carried out 4 times a day every 40 min on 1, 4, 8, 12 and 15 day of the study . When the appliance was removed from the mouth it was washed under running tap - water for 10 s and was placed in artificial saliva in vacuum sealed coded plastic boxes . The fluoride concentration of the tap water was predetermined by analyzing the school water sample at the chemistry department of guru nanak dev university amritsar using american pharmacists association (spectrophotometrically) before starting the study . After removing the appliance from the subjects mouth, the paste containing cpp - acp was applied to the enamel slab on the right side of the appliance and the left side enamel slab (control) was completely coated with acid resistant nail paint [figure 3] before storing the removable plates in artificial saliva [figure 4] and retained until the next cycle . The nail paint was removed from the left enamel slab using the nail paint remover before the slabs were repeatedly exposed to cola drinks (in - situ) every 4, 8, 12 and 15 day of the study . Application of casein phosphopeptide - amorphous calcium phosphate on the right side enamel slab and acid resistant nail paint on the left side enamel slab appliance placed in artificial saliva in vacuum sealed plastic boxes on the 15 day, both enamel slabs from each group (15-post - cola exposure slabs and 15 post - cola + cpp - acp slabs) were removed and subjected to sem study and quantitative calcium and phosphorus analyses to study the effect of cpp - acp on erosion of enamel caused by cola drinks and the subsequent remineralization of enamel . Group a (sem analysis) to evaluate the surface profile of the enamel the samples were subjected to sem analysis . The enamel slabs were first dried and then subjected to sputter coating in joel sputter coater and then subjected to sem analysis in joel scanning microscope model no 1600, which was operated at 30 kv . Group b (calcium and phosphorus solubility) to evaluate the calcium and phosphorus solubility of the intact enamel surface teeth samples were covered completely by molten sticky wax so that the sides were covered and only the 5 mm 5 mm of the top surface layer was exposed . Decalcification cycle in 10 ml of 0.2 n acetic acid adjusted at ph 4 by 1 n - naoh . The amount of soluble calcium and phosphorus in the acid solution indicated the enamel solubility and was determined quantitatively by roche automated clinical chemistry analyzer . The autoanalyzer was pre - calibrated using the normal serum provided by the manufacturer to avoid any error . A total of 30 subjects selected for the study were divided into two groups a and b wherein 15 subjects were taken for sem study - group a and 15 for calcium and phosphorus analyses - group b. the above mentioned parameters were measured on the control slab of each subject of each group coded at the beginning of the study so as to obtain the baseline values for respective study groups . The remaining two enamel slabs of the same code were exposed to cola drink in - situ at repeated intervals until 15 days, using one slab without cpp - acp application and the other after subjecting to cpp - acp application post - cola drink exposure . After 15 day, the two enamel slabs were subjected to analyses of their respective groups to evaluate the remineralization potential of cpp - acp on all the 30 in - situ models . The observations of various parameters were tabulated as given in [tables 1 and 2] and were subjected to one - way anova analysis in order to draw valid conclusion from the experimental data . The software used for these analyses was spss 11.5 (statistical package for social sciences). Level of significance of calcium solubility of enamel using anova level of significance of phosphorus solubility of enamel using anova using anova, a comparison was made of the baseline values of soluble calcium levels with the values of post - cola drink exposure and post - cpp - acp application group . The p value of baseline and cpp - acp application group was 0.641 showing no statistical difference in the calcium solubility of enamel of baseline and cpp - acp application group . The p value of baseline and post - cola drink exposure group was 0.001 showing statistical significance at 5% in the calcium solubility of enamel . The p value of post - cola drink and cpp - acp was 0.011 showing statistical significance at 5% level of significance in the calcium solubility of enamel [table 1]. There was no significant difference in phosphorus solubility of enamel in any of the three comparison groups [table 2]. Sem analysis- a total of 45 photomicrograph's of the enamel slabs of (group a) were taken at varying magnification's, i.e., 3000, 10,000 and 15,000 (15 3 = 45) [figure 5]. Sem pictures of enamel slabs of various groups at various magnification the topographic changes were observed by two different observers . Whenever, there was a difference of opinion, a third observer's result was noted and compared with the previous results . In baseline group, the photomicrograph at the three magnifications showed no evident loss of interprismatic enamel and a typical honeycombed appearance of normal enamel surface [figure 5]. The enamel surface topography of post - cola drink exposure group showed significant demineralization with evident loss of interprismatic mineral content and rough diffused margins of the outlines . The sem picture at 15,000 magnification showed that the features wherein enlarged depressions were visible in the diffused honeycomb pattern corresponding to an eroded surface layer [figure 5]. The photomicrograph was clearly different with the baseline as well as post - cpp - acp application group [figure 5]. Post - cpp - acp application group - sem pictures [figure 5] revealed considerable clogging of interprismatic areas indicating significant amount of remineralization when compared to the post - cola drink exposure group . At various magnifications distinct crystallite deposition as shown with the red arrow [figure 5] were found . Comparing the photomicrograph with the baseline sem pictures however, there was nt a significant difference in the comparative analysis of all the samples with the baseline pictures . These mineralized areas are highly relevant in explaining cpp - acp promoted remineralization of the surface of the enamel . Lussi stated that in no case may early diagnosis of erosive tooth wear be an excuse for a restoration . Instead, preventive measures must be initiated to reduce erosive challenge and to increase the protective and defensive factors thus bringing this equilibrium back to the oral environment . Recent studies on mi paste or tooth mousse containing cpp - acp have shown to remineralize eroded enamel . However, all these studies were in - vitro studies . The aim of the present research study was to create a clinical in - situ model with human enamel to evaluate the remineralization potential of cpp - acp on eroded enamel as compared to a control group using sem and to obtain a quantitative aspect of how much mineralization does occur with calcium and phosphorus ions using an autoanalyzer . The enamel substrate selected for the present study was human enamel sections taken from premolar teeth stored in the human tooth bank (htb) in the department of pedodontics and preventive dentistry, amritsar developed in the year 2004 . Htb is a non - profit institution where teeth from healthy donors are stored for research purpose with completed protocol forms and records . Artificial saliva was selected as a storage medium so as to simulate the oral environment . This study made use of a composition that was developed by featherstone et al . And the present study made use of the spectrophotometric method for chemical analysis of calcium and phosphorous appearing in acetic acid buffer solution (ph-4) as it is able to detect early changes in the enamel . These chemical methods are also the methods of reference (gold standard) to determine the mineral dissolved from samples in - vitro . Autoanalyser was used to determine calcium and phosphorus from the buffer solution as automation has led to reduction in the variability of results and human errors with improvement in reproducibility . A significant decrease in calcium solubility of enamel after application of cpp - acp was found when compared with post - cola drink exposure group, which showed an increase in solubility of enamel . This is evident by the statistical analysis, which showed no statistical significance between baseline and post - cpp - acp application group, whereas post - cola drink exposure group when compared to baseline and cpp - acp application group individually showed a statistically significant difference in calcium solubility of enamel at 5% implying that cpp - acp provided significant protection to enamel against erosion caused by cola drinks . A significant decrease in calcium solubility of enamel using spectrophotometric method after application of remineralizing agent this may be explained by the fact that phosphorus content typically seems to be less susceptible to changes during both demineralization and remineralization . This is in accordance with the changes that occur during demineralization process where during the initial stage, calcium decreases markedly, but phosphorus content only slightly (borovsky et al . ). Sem was used to study the surface topography of eroded and remineralized enamel at the microscopic level . In the present study, the morphologic analysis carried out with sem showed that enamel surface exposed to cola drinks produced an early pattern of demineralization with evidence of interprismatic mineral loss . Sem of enamel surface treated with cpp - acp after exposure to cola drinks resulted in no alteration in surface morphological changes of the tooth substrate when compared with the control surface morphology; thus, indicating that cpp - acp paste promoted remineralization, preventing demineralization of enamel . In previous studies by reynolds and sudjalim, et al . Cpp - acp has been proven to promote remineralization of enamel in - vitro conditions . Sem observations from the present in - vivo study confirmed such a remineralizing property of cpp - acp as the cpp - acp application group did not show enamel dissolution as compared to cola drink exposure group and the surface morphology of cpp - acp application group was similar to the surface morphology of baseline group . This can be clearly seen in the photograph-19 where in the post - cola drink exposure group, interprismatic mineral loss is seen, which is not seen in the baseline and tooth mousse application group . The erosion of tooth substrate depends on the number and duration of the acid attacks as well as the ph of the acidic agent (oshiro, et al . The present study selected subjects with salivary ph and buffering capacity at par . Moreover, oral hygiene practices were monitored and same toothpaste provided by us was used by all participants making it a well - controlled clinical model . Furthermore, the fluoride content of drinking water at home / school was measured before starting the study and was found to be in a low range of 0.014 - 0.04 ppm . On every day of in - situ cola drink exposure; we had achieved zero plaque level by providing prophylaxis . This was carried out to avoid any additional demineralization that could be caused by plaque deposited in the oral cavity . Within the limitations of this in - situ study model, the results of the present study support the following conclusions:- cpp - acp significantly promoted remineralization of enamel eroded by cola drinks [flowchart]it aids in the remineralization by increasing available calcium ions at the tooth surface, which was revealed by the significant surface morphological changes seen in sem magnificationcola drinks play a potential role in the etiology of enamel erosion seen in both sem and quantitative analyses of enamel substrates of post - cola drink samples . Hence, preventive advice on their consumption should be given to young children and adolescentssince the balance between remineralization and demineralization is the key to progression or reversal of caries, the practice of cola drink intake and use of cpp - acp paste, post - exposure to colas could be used for tipping the balance toward protective remineralization . Cpp - acp significantly promoted remineralization of enamel eroded by cola drinks [flowchart] it aids in the remineralization by increasing available calcium ions at the tooth surface, which was revealed by the significant surface morphological changes seen in sem magnification cola drinks play a potential role in the etiology of enamel erosion seen in both sem and quantitative analyses of enamel substrates of post - cola drink samples . Hence, preventive advice on their consumption should be given to young children and adolescents since the balance between remineralization and demineralization is the key to progression or reversal of caries, the practice of cola drink intake and use of cpp - acp paste, post - exposure to colas could be used for tipping the balance toward protective remineralization . Sample selection protocol for group a and b further in - vivo studies are suggested to evaluate the amount of protection offered by cpp - acp to enamel eroded by cola drinks as compared to other remineralizing agents such as fluorides, xylitol gum, etc.
Intrathecal baclofen (itb) is becoming a popular modality for management of severe spasticity [13]. Spasticity is defined as hypertonia in which one or both of the following signs are present (1) resistance to externally imposed movement that increases with increasing speed of stretch and varies with the direction of joint movement, and/or (2) resistance to externally imposed movement rises rapidly above a threshold speed or joint angle . It is a sensorimotor phenomenon related to the integration of the nervous system motor responses to sensory inputs . Although most commonly considered as a velocity - dependent increase to tonic stretch, it is related to hypersensitivity of the reflex arc and changes that occur within the central nervous system (cns), most notably, the spinal cord . Injury to cns results in loss of descending inhibition, allowing for the clinical manifestation of abnormal impulses . Although spasticity is part of the upper motor neuron syndrome, it is frequently tied to the other presentations of the said syndrome . Contracture, hypertonia, weakness, and movement disorders can all coexist as a result of the upper motor neuron syndrome . Spasticity is a common phenomenon in patients with a wide variety of neurological disorders like cerebral palsy, multiple sclerosis, cardiovascular accidents, strokes, traumatic brain, and spinal cord injury [6, 7]. These patients not only suffer from severe contractures and deformities but also severe pain that incapacitates them . Several oral and parenteral medications have been used to treat spasticity; their mechanisms of action are different and they influence various aspects of the neuromuscular pathophysiology . Benzodiazepines, for example, diazepam exert a medullary and supraspinal inhibitory effect mediated by gabaa receptors [813]. Benzodiazepines can lead to habituation; withdrawal symptoms may occur when the medication is abruptly discontinued [813]. Dantrolene acts directly on the skeletal muscle, without interference with the neurological circuitry; it inhibits release of sequestered calcium from the sarcoplasmic reticulum . A third group of antispasticity drugs are 2 adrenergic agonists, for example, clonidine and tizanidine [11, 12]. They hyperpolarize the motor neuron cell membrane, and they have an antinociceptive effect, which may indirectly reduce muscular hypertonia as well . Side effects include drowsiness, dizziness, nausea, light headedness, vertigo, ataxia, headache, tolerance, and physical dependence . The most useful oral medication in the treatment of spasticity is baclofen, a gabab receptor agonist that causes presynaptic inhibition of mono- and polysynaptic reflex pathways; it also works at the spinal cord level after crossing the blood - brain barrier . An increasing oral dose easily causes side effects including sedation, dizziness, weakness, and dizziness [14, 15]. Itb administration has been introduced, therefore, to maximize baclofen's effects and minimize its side effects . It has been shown to be useful in the majority of patients to treat severe or intractable spasticity and dystonia leading to a decrease in muscle spasms, pain, and an increase in functional motor activity and control [1618]. We set out to identify and describe complications of itb pump and to report avoidance and management of complications . Sharing our knowledge regarding patients with itb is important because as a result of the increasing use of this device, familiarity with the workup of possible implant malfunction is important . Complications of itb vary from overdose, withdrawal, mechanical implant dysfunction: tear at metal connector to the pump (within protective silicon covering),inappropriate trimming of catheter, tear at metal connector to the pump (within protective silicon covering), inappropriate trimming of catheter, retrieval of old intrathecal catheter fragment through limited hemilaminotomy with durostomy leads to csf leak with tract formation disturb wound healing, dehiscence, and infection . Complications can decrease therapeutic effect, thus need to be identified and treated promptly . The patients were followed by single operative and clinical team at the department of neurosurgery at our hospital: henry ford and oakwood health systems . After the approval of the hospital internal review board, all itb pumps inserted at our facility through the period of 20022006 were identified (excluding previously performed surgery outside our own personal experience with our patients). Patients who had itb pump insertion and reasons for insertion were identified and reviewed . We identified those patients who had revision surgery, reasons for revision, and diagnostic workup needed to identify complications as well as type of complications, type of treatment instituted to alleviate complication, and how to identify these complications in the future . Since 2002 itb pump was implanted in 44 patients: 24 children (16 f/8 m) versus 20 adults (7 f/13 m), 30 primary - implant - patients (table 1) 16 children (10 f/6 m) & 14 adults (5 f/9 m), 14 revision - only - patients (table 2) 8 children (6 f/2 m) versus 6 adults (2 f/4 m). Clinical charts and operative and imaging reports were reviewed to evaluate reasons for revision surgery and diagnostic workup requirements . We analyzed reasons for revision surgeries and diagnostic workup requirements in order to identify these complications early and manage them accordingly . Slowly increasing baclofen - resistant spasticity was encountered in seven patients; four of them had unsuspected pump - catheter connector defects with either: subcutaneously dislocated intrathecal catheter n = 1, (figure 1), x - ray - documented pump - catheter connector defect n = 1, an eight - years - old boy with posttraumatic spastic quadriplegia and right - sided myoclonic intention tremor . He underwent 18 ml itb implant on 2002 with good spasticity control then on 2005 left thalamic dbs was done with good tremor control . In 2006, he developed withdrawal symptoms and interventional radiology with pump injection showed tear at metal connector to the pump within protective silicon covering, so revision with trimming of catheter and exchange of the pump to 40 ml pump markedly reduced his baclofen needs (figure 2). X - ray demonstrated fractured catheter with intrathecal fragment n = 2; the first patient was a 12-year - old boy with spastic quadriplegic cp required laminectomy . He underwent multiple revisions in 2001, 2003, and 2004 . In 2003, imaging showed adhesive arachnoiditis at the catheter tip . In 2005, he developed mild withdrawal symptoms . Plain x - ray showed fractured catheter with intrathecal fragment . Following retrieval of old it catheter fragment through limited hemilaminotomy with durotomy, followed by placement of a new it catheter and replacement of old 10 ml pump with new 40 ml programmable pump injection studies revealed intrathecal pericatheter arachnoiditis: 53-year - old male with spastic quadriplegic cp with secondary scoliosis . Plain x - ray showed perforating tear at the metal connector to pump with connector protrusion . Revision was done with catheter trimming; exchange of itb pump to 40 ml pump resulted in marked reduction of his baclofen needs . The first one was a three - year - old boy with cerebral palsy, postpump exchange secondary to manufacturer - related mechanical pump failure; his pump was removed, covered with appropriate antibiotics, and then reinsertion of a new pump without further complications followed . The second case was a five - year - old boy with cerebral palsy, postabdominal wound dehiscence, and catheter exposure; antibiotics failed to save the implant, so his pump was removed followed by reinsertion of a new pump without further complications . The third case was an eight - year - old girl with cerebral palsy, postabdominal wound dehiscence, and catheter exposure; her pump was removed; course of appropriate antibiotics was given followed by reinsertion of a new pump without further complications . The fourth case was a twenty - eight - year - old male with cerebral palsy with p. aeruginosa in catheter left in situ during previous pump removal (> 1 yr) at outside institution treated with appropriate antibiotic . His new implant was not infected occult csf leakage occurred in a 37-year - old male with itb implanted in 2003 with good spasticity control . In 2004, he developed abdominal csf collection . Pump injection showed leakage, catheter tear was discovered at pump connector site, and revision surgery was done . He remained to have recurrent csf collections at abdominal site with negative pump injection studies . However, no specific csf tract was found intraoperatively n = 1, (see figure 3); removal of the old intrathecal catheter with extensive catheter tract obliteration and placement of a new it catheter resulted in no further csf accumulation anymore . The difference in effectiveness between oral and intrathecal administration of baclofen is due to a significantly higher drug concentration that can be achieved in the csf through itb . In addition, there is a 4 to 1 gradient in drug distribution between the caudal and rostral parts of the spinal cord following itb, thus providing for a beneficial effect at the spinal level without undesired side effects in the brain . Although itb is highly gratifying, it has predominant technique - related complications during implant life . Meticulous surgical technique, high clinical suspicion, appropriate workup, and timely surgical management are emphasized to reduce surgical itb complications . Thorough workup is crucial to rule out implant system dysfunction if clinical evaluation is atypical . Obtaining preoperative imaging, at least a plain x - ray, has been proven to be a safe and effective method of evaluation, although in our centre we have a low threshold to perform pump injection studies with contrast . In our series, itb revision surgery for both groups primary - implant - patient and revision - only - patient population (n = 44). 33 additional revision procedures performed on 22 of 44 patients itb surgery carry significant morbidity that needs extended care and hospitalization requirements (tables 1 and 2). We recommend a standardised implantation technique that can be used as a guide for a safer itb implants and may help reduce the incidence of complications . During an informed consent, we elaborated on pros and cons of continuing conservative therapy versus implantation of the itb . We also acquainted patient of the goals and benefits, possible risks, and complications . Preoperatively, patient's general medical condition was assessed by excluding infection, integrity of the contemplated operative sites, and prophylactic antibiotic within one hour of the incision time . Although the procedure can be performed using local anesthesia and sedation, general anaesthesia was preferred because many of the patients were children . Incision should be long enough (i.e. 1.5 to 2) to expose the wound sufficiently and to minimize potential interaction of the implanted catheter with the skin borders, which are the predominant source of surgical infection . Then, the lumbar puncture is performed using the 14 g tuohy needle supplied by the manufacturer in the implant kit . Once the needle tip is in adequate position and csf flow is achieved, the slightly curved tuohy needle tip needs to be rotated superiorly in order to guide the catheter superiorly . The first critical point is when the catheter reached the tip of the tuohy needle . It is preferable to check fluoroscopically the correct positioning of the catheter at this point: especially important is to ensure that the catheter travels into cranial direction and that it is not looping on itself . The presence of the guide wire and an additional small metallic bead at the catheter tip makes fluoroscopic tracking of the catheter usually relatively easy . Once the initial correct positioning is verified, the catheter can be advanced more, which generally goes without difficulty . The final level of the catheter is determined by the relative spasticity of the upper versus the lower extremities and to what extent spasticity control is targeted for the upper versus the lower extremities . If the catheter cannot be advanced easily, it is better to leave it at that level instead of forcing it more . If the surgeon decides that the catheter needs to be withdrawn because he noted a looping or the catheter is primarily going into caudal direction, the catheter should never be withdrawn by itself, but rather the tuohy needle should be withdrawn: otherwise, there is a significant risk to cause a cut in or transection of the catheter . Once the catheter is in its final position, a purse string stitch is placed very close around the needle penetration site through the fascia . Then the tuohy needle is withdrawn and subsequently the guide wire . Following removal of the guide wire, the purse string stitch can be tied in such a way that the intrathecal catheter cannot be moved easily anymore through the fascia penetration site . Patency of the catheter should be obvious by the appearance and continuous dripping of csf from the catheter end . The catheter is now also anchored to the lumbar fascia with a manufacturer supplied anchor, which is attached to the catheter and the fascia with nonresorbable sutures . Take care that this does not result in acute catheter angles that may lead to catheter obliteration . The catheter end is clamped gently with a rubber shod mosquito to avoid excessive csf loss . The abdominal portion of the procedure is usually done at the time of successful lumbar puncture in order to save overall procedural time . The abdominal incision is made and a pocket is created in the subcutaneous adipose layer . The pump pocket is designed such that the pump access ports will not be exactly underneath the incision line . It is useful to have the pump placed on the patient's abdominal fascia because this facilitates secure attachment of the pump and tends to prevent pump hypermobility that can interfere with future pump access for either refill or diagnostic purposes . The pump cavity should be large enough to accommodate the pump . Once the abdominal and the lumbar sites are prepared adequately and the intrathecal catheter is in situ and anchored, a custom - bent tunneler is passed subcutaneously from the abdominal site to the lumbar site . This requires the tunneler to be substantially bent in order to follow the patient's flank around, carefully passing the tunneler through the subcutaneous layer usually without need for counter incisions with guided assistance, tunneling direction towards the lumbar incision . It is important to make sure that enough catheter remains within the lumbar wound to make a small strain relief loop at that site . On the abdominal side, the intrathecal catheter is trimmed as needed to avoid too much looping catheter length but leaving enough material in place to be able to have a loop . At this point, patency of the catheter is double - checked when the rubber shod mosquito is removed form the catheter end . The pump - catheter connector is attached to the catheter: this requires gentle manipulation of the catheter to advance it into the connector . The pump is then placed into the pump cavity created earlier, securing the pump to the fascia using the suture loops of the pump . The excess catheter is gently placed underneath the pump prior to securing the device in situ . We feel, using the above - mentioned protocol can reduce the complications, which have been described above . The knowledge of the peculiarities of itb treatment is important, as there is an increased risk for the patients if these implants are not functioning well . The physician who may be called upon to evaluate the itb pump patient needs to have good understanding of the diagnostic challenges when faced with a possible device malfunction . This also assumes with the familiarity with diagnostic and therapeutic preimplant workup with surgical implant technique and with the postimplant maintenance management ., patients will be able to sleep better, become more independent with mobility, and their ability to do self - care helps improve urinary function . A decrease in muscle pain and fatigue that accompany spasm thus effective baclofen therapy can be delivered using itb pump, where effects of baclofen are maximised, while its side effects are minimised.
Essential tremor (et) is one of the most common kinetic disorders, and inversely depends on age . An et is a kinetic tremor that commonly occurs in the arms during voluntary movements such as pouring, drinking, eating, writing, and other daily activities, but especially occurs in the head, neck, and voice, and occasionally in the tongue, trunk, legs and so on [1, 2]. The prevalence of et varied from 0.008% to 22%, but the range of prevalence estimates with other specified method was 0.4%-3.9% . A population - based study in turkey reported that the prevalence of et was 4.0% among individuals age 40 yr or older . Et has been treated with diverse methods such as propranolol, primidone, topiramate, clozapine, botulinum toxin type a, thalamic deep - brain stimulation (dbs), subthalamic nucleus dbs, and so on . Sa - am five - element acupuncture is one of the most representative acupuncture techniques in korea, and was proposed by sa - am about 360 yr ago . This technique use five - transporting points according to the principle of tonification and sedation [5, 6]. Pharmacopuncture is a new form of acupuncture combining acupuncture that has been promoted in korea and is based on the meridian theory and a natural herbal medicine based on qi and flavor theory [7, 8]. Eight - principle pharmacopuncture (epp) among diverse types of pharmacopuncture is a method of treating diseases with the founding eight principles (yin / yang, cold / heat, exterior/ interior, and deficiency / excess) as the traditional medicine theory, and with acupoints and meridians serving as supplemental resources . Several studies on sa - am five - element acupuncture treatment of an et such as management of an et after dbs, and of a submaxillary tremor have been reported [9, 10], but the treatments used these studies were the treatment of combination among acupuncture or western drugs, and oriental herbal medicines . Therefore, this study reports three cases of an et treated with a combination of sa - am five - element acupuncture and pharmacopuncture . We had the medical record officer select the medical records of patients have treated for an et by using diverse types of acupuncture without herbal medicine or by using other physical therapies at sangji university korean medicine hospital from march 2006 to december 2011, from which the three cases reported here were selected . The medical records included data such as gender, age, diagnosis, past history, family history, current medical history, intervention, information on symptom improvement (scale or progress, etc . ), other related information (laboratory tests, imaging, etc . ), and western medication . The medical records that included a history of herbal medication, anti - et drug, such as proranolol, primidone, etc ., use, anti- parkinsonian drug, such as levodopa, catechol - o - methyl transferase inhibitors, monoamine oxidase inhibitors, bromocriptine, anti - cholinergics, amantidine, use, and so on were excluded . Three outpatients were finally selected after the secondary data had been reviewed to eliminate individual information . This study was performed with the approval of institutional review board (no: sj irb 120229) for a retrospective review of medical records . The three cases that were finally selected involved women in their 70s to 80s who had been treated using acupuncture and pharmacopuncture, namely, standard methods of treatment for et in our hospital . The details are as follows: for acupuncture treatment, 0.25 mm 3.0 mm sterilized stainless - steel needles (dongbang acupuncture inc ., korea), were applied at lu8 and lr4 with tonification and at ht3, and lr2 with sedation on the right side of the body at depths of 0.2 - 0.4 cm, for a total of 4 needles, by using only directional supplementation and draining () without manipulation for 20 min [5, 6]. For the pharmacopuncture treatment, a 0.2-ml dosage of hwangyeonhaedoktang pharmacopuncture (hhp), among diverse types of epp, was applied at cv23 and cv17, respectively, at a 0.5-mm depth and a perpendicular angle by using the tapping method [8, 11]. The method to evaluate the progress was the numeric rating scale (nrs) in all cases . The nrs was an 11point horizontal scale ranging from 0 to 10 (nrs 10 for the most severe conditions of et on first visit; nrs 0 for no symptoms of et). Case 1 was an 81-yr - old woman complaining of symptoms such as jaw tremor, tremors in both hands upon action, pain and swelling in the right knee and the right ankle, heart palpitations, red tongue, and tight and rapid pulse, which had started about 9 months earlier . The neurological examination at our hospital and the brain computed tomography (brain ct) scan and other examinations at another hospital showed no abnormal findings . She had no past history of tremors and no history of medication, but had had left tinnitus and deafness before the onset of the et symptoms . The severity of tremors was decreased 30% on the 4th day after treatment, 70% on the 23th day after treatment, 90% on the 29th day after treatment . The tremor occurred again the next year (case i-2nd), but the symptom was decreased 90% after treatments . No improvements in knee pain, tinnitus, and deafness, in spite of two periods of treatment, were noted . Case 2 was a 76-yr - old woman complaining of the tremor in both her hands and in her jaw and mouth on action, red tongue without fur, tight and rapid pulse, and tenderness in cv17, which had started 20 days earlier . She had the past history of myocardial infarction, hypertension, diabetes mellitus, hypoglycemia shock and et . The brain ct was normal, but the laboratory test showed blood urea nitrogen (bun) 48 mg / dl, creatinine 3.6 (0.6 - 1.4) mg / dl, red blood cells 2.43 (3.5 - 5.5) 10ul, hemoglobin 7.5 (11.5 - 17) g / dl, which implied renal failure . Case 3 was a 77-yr - old woman complaining of jaw tremor, headache, and nausea . A mild jaw tremor had occurred intermittently during the previous 7 months, but had worsened during the last 2.5 months . She was diagnosed with chronic renal failure based on the laboratory test and the normal finding on the brain ct scan at another hospital . We diagnosed her as having an et based on the jaw tremor with no hand tremor and on the normal neurological examination and brain ct . The symptoms showed good improvement (from nrs 10 to nrs 1) after 3 treatments, despite the long duration of the et . We had the medical record officer select the medical records of patients have treated for an et by using diverse types of acupuncture without herbal medicine or by using other physical therapies at sangji university korean medicine hospital from march 2006 to december 2011, from which the three cases reported here were selected . The medical records included data such as gender, age, diagnosis, past history, family history, current medical history, intervention, information on symptom improvement (scale or progress, etc . ), other related information (laboratory tests, imaging, etc . ), and western medication . The medical records that included a history of herbal medication, anti - et drug, such as proranolol, primidone, etc ., use, anti- parkinsonian drug, such as levodopa, catechol - o - methyl transferase inhibitors, monoamine oxidase inhibitors, bromocriptine, anti - cholinergics, amantidine, use, and so on were excluded . Three outpatients were finally selected after the secondary data had been reviewed to eliminate individual information . This study was performed with the approval of institutional review board (no: sj irb 120229) for a retrospective review of medical records . The three cases that were finally selected involved women in their 70s to 80s who had been treated using acupuncture and pharmacopuncture, namely, standard methods of treatment for et in our hospital . The details are as follows: for acupuncture treatment, 0.25 mm 3.0 mm sterilized stainless - steel needles (dongbang acupuncture inc ., korea), were applied at lu8 and lr4 with tonification and at ht3, and lr2 with sedation on the right side of the body at depths of 0.2 - 0.4 cm, for a total of 4 needles, by using only directional supplementation and draining () without manipulation for 20 min [5, 6]. For the pharmacopuncture treatment, a 0.2-ml dosage of hwangyeonhaedoktang pharmacopuncture (hhp), among diverse types of epp, was applied at cv23 and cv17, respectively, at a 0.5-mm depth and a perpendicular angle by using the tapping method [8, 11]. The method to evaluate the progress was the numeric rating scale (nrs) in all cases . The nrs was an 11point horizontal scale ranging from 0 to 10 (nrs 10 for the most severe conditions of et on first visit; nrs 0 for no symptoms of et). Case 1 was an 81-yr - old woman complaining of symptoms such as jaw tremor, tremors in both hands upon action, pain and swelling in the right knee and the right ankle, heart palpitations, red tongue, and tight and rapid pulse, which had started about 9 months earlier . The neurological examination at our hospital and the brain computed tomography (brain ct) scan and other examinations at another hospital showed no abnormal findings . She had no past history of tremors and no history of medication, but had had left tinnitus and deafness before the onset of the et symptoms . The severity of tremors was decreased 30% on the 4th day after treatment, 70% on the 23th day after treatment, 90% on the 29th day after treatment . The tremor occurred again the next year (case i-2nd), but the symptom was decreased 90% after treatments . No improvements in knee pain, tinnitus, and deafness, in spite of two periods of treatment, were noted . Case 2 was a 76-yr - old woman complaining of the tremor in both her hands and in her jaw and mouth on action, red tongue without fur, tight and rapid pulse, and tenderness in cv17, which had started 20 days earlier . She had the past history of myocardial infarction, hypertension, diabetes mellitus, hypoglycemia shock and et . The brain ct was normal, but the laboratory test showed blood urea nitrogen (bun) 48 mg / dl, creatinine 3.6 (0.6 - 1.4) mg / dl, red blood cells 2.43 (3.5 - 5.5) 10ul, hemoglobin 7.5 (11.5 - 17) g / dl, which implied renal failure . Case 3 was a 77-yr - old woman complaining of jaw tremor, headache, and nausea . A mild jaw tremor had occurred intermittently during the previous 7 months, but had worsened during the last 2.5 months . She was diagnosed with chronic renal failure based on the laboratory test and the normal finding on the brain ct scan at another hospital . We diagnosed her as having an et based on the jaw tremor with no hand tremor and on the normal neurological examination and brain ct . The symptoms showed good improvement (from nrs 10 to nrs 1) after 3 treatments, despite the long duration of the et . For acupuncture treatment, 0.25 mm 3.0 mm sterilized stainless - steel needles (dongbang acupuncture inc ., korea), were applied at lu8 and lr4 with tonification and at ht3, and lr2 with sedation on the right side of the body at depths of 0.2 - 0.4 cm, for a total of 4 needles, by using only directional supplementation and draining () without manipulation for 20 min [5, 6]. For the pharmacopuncture treatment, a 0.2-ml dosage of hwangyeonhaedoktang pharmacopuncture (hhp), among diverse types of epp, was applied at cv23 and cv17, respectively, at a 0.5-mm depth and a perpendicular angle by using the tapping method [8, 11]. The method to evaluate the progress was the numeric rating scale (nrs) in all cases . The nrs was an 11point horizontal scale ranging from 0 to 10 (nrs 10 for the most severe conditions of et on first visit; nrs 0 for no symptoms of et). Case 1 was an 81-yr - old woman complaining of symptoms such as jaw tremor, tremors in both hands upon action, pain and swelling in the right knee and the right ankle, heart palpitations, red tongue, and tight and rapid pulse, which had started about 9 months earlier . The neurological examination at our hospital and the brain computed tomography (brain ct) scan and other examinations at another hospital showed no abnormal findings . She had no past history of tremors and no history of medication, but had had left tinnitus and deafness before the onset of the et symptoms . The severity of tremors was decreased 30% on the 4th day after treatment, 70% on the 23th day after treatment, 90% on the 29th day after treatment . The tremor occurred again the next year (case i-2nd), but the symptom was decreased 90% after treatments . No improvements in knee pain, tinnitus, and deafness, in spite of two periods of treatment, were noted . Case 2 was a 76-yr - old woman complaining of the tremor in both her hands and in her jaw and mouth on action, red tongue without fur, tight and rapid pulse, and tenderness in cv17, which had started 20 days earlier . She had the past history of myocardial infarction, hypertension, diabetes mellitus, hypoglycemia shock and et . The brain ct was normal, but the laboratory test showed blood urea nitrogen (bun) 48 mg / dl, creatinine 3.6 (0.6 - 1.4) mg / dl, red blood cells 2.43 (3.5 - 5.5) 10ul, hemoglobin 7.5 (11.5 - 17) g / dl, which implied renal failure . Case 3 was a 77-yr - old woman complaining of jaw tremor, headache, and nausea . A mild jaw tremor had occurred intermittently during the previous 7 months, but had worsened during the last 2.5 months . She was diagnosed with chronic renal failure based on the laboratory test and the normal finding on the brain ct scan at another hospital . We diagnosed her as having an et based on the jaw tremor with no hand tremor and on the normal neurological examination and brain ct . The symptoms showed good improvement (from nrs 10 to nrs 1) after 3 treatments, despite the long duration of the et . This method of sa - am five - element acupuncture consists of tonification - sedation between deficiency and excess, which is well known as the four - needle technique [6, 13] or the eight - needle method [5, 14]. The principle of this method is based on the engendering () and the restraining () cycles of the five - element theory . The method of liver excess (; lem), among sa - am five - element acupuncture methods, tonifies the destroyer point of the destroyer channel (lu8) and of the self - channel (lr4) and sedates the son point of the son channel (ht3) and of the self - channel (lr2), and has been used for the treatment of liver disease, neuromuscular and movement disease in excess syndrome, and liver qi depression syndrome on the grounds that the wood element is connected with the liver and the muscles [5, 6]. We presume that lem has been used because an et is related to a movement disorder . Hhp, among epp, was extracted by collecting distilled water from boiling hwangyeonhaedoktang(coptis chinensis franch, scutellaria baicalensis, phellodendron amurense ruprecht ., gardenia jasminodies ellis), adjusting the ph and the concentration of the distilled water, and then filtrating and sterilizing the product . Hhp has been used to treat headache, insomnia, atopic dermatitis, liver fire syndrome, and heart fire syndrome in korea [17, 18]. We infer that hhp was selected to treat et because the symptoms of et are worsened under stress, anxiety, and depression [1, 2], which is related to liver qi depression syndrome or heart deficiency syndrome . All three cases were improved, and a recurred et was also improved by using the same treatment . Case 1 - 2nd and case 3 showed dramatic improvements after at 2 to 3 treatments . In accordance with a previous similar study, the shorter the morbid duration is, the shorter the treatment time is based on the results of case 1 and case 2 . We suggest that this result will provide basic data on korean medicine treatment for an et and that this combined treatment can be applied to patients to whom drugs cannot be administered because they suffer from diseases such as renal failure, even though this conclusion is based on only three cases . This study has limitations in that the results of three case reports cannot be generalized because of loss of control and an insufficient number of subjects and because which treatment, acupuncture or pharmacopuncture, might have been more effective, if either, could not be identified . Nevertheless, the results suggest that combined treatment of sa - am five - element acupuncture and hhp, two types of korean medicine, may be effective for treating an et . In the future, additional systemic research will be needed to find ways to treat an et by using either acupuncture or pharmacopuncture.
Lymph nodes of the axilla have been studied in the context of breast cancer since before halsted published his study proposing that this lymphatic drainage was a pathway for metastasis and recommending axillary node dissection (and). Sentinel lymph node biopsies (snb) allowed for detection of smaller micrometastases that have previously gone undetected . Understanding the true benefit for the use of and with snb has been a topic of discussion, and a recent trial has suggested that there is no advantage of and in patients with a negative snb . In contrast, an earlier report slightly favored disease - free survival and overall survival in and patients over just snb (albeit with a limited number of patients). This comes 10 years after data was published describing a 30-year followup of internal mammary node dissections that did not improve survival of breast cancer patients . The questioning of the therapeutic value of axillary node dissection in certain patient populations has allowed for further exploration of the prognostic and/or predictive value of these organs . A clearer picture of the molecular mechanisms of lymph node metastases is the next step to designing optimal therapeutic options and to create new treatment modalities . One such molecular avenue is chemokine receptor cxcr4, a seven transmembrane g protein - coupled receptor that has been implicated in the invasion and metastasis of several cancers, including breast . Over 20 chemokine receptors have been identified and are keys to pathways that include the body's response to allergy, inflammation, and metastasis . Although a great deal of research into cxcr4 began by focusing on its role in hiv entry of cd4 + cells [5, 6], mller et al . Discovered that cxcr4 was integral for the pathway that activates actin polymerization and pseudopodia formation in breast cancer cells . Cxc chemokine ligand-12 (cxcl12), also known as stromal - derived factor-1 (sdf-1), is the ligand for cxcr4 . Mller's lab noted that cxcl12 was found in high concentrations at sites that were common for metastasis, such as brain and bone . For this paper, we will only use the term cxcl12 . A litany of studies have emerged in the last five years examining cxcr4 and axillary lymph nodes, covering multiple approaches of how cxcr4 in the setting of axillary lymph nodes can impact our understanding of breast cancer . This review aims to coalesce several papers across the spectrum of this research to tie together molecular pathways and illustrate emerging trends to help direct future research into cxcr4 as a prognostic and/or predictive marker for breast cancer . Cxcr4 was initially discovered as humstr and lestr and later renamed according to proper nomenclature for chemokine receptors . The action of cxcr4 leads to intracellular signaling cascades that are involved with trafficking, migration, and proliferation . One major site of involvement is in hematopoiesis, due to its expression on cd34 + cells in bone marrow . It is also a factor in immune system cells, including monocytes, dendritic cells, nk cells, and nave t cells . The proposed role of cxcr4 is to help the immune system migrate to sites of injury, but mller et al . Have shown it to be actively involved in metastasis at sites expressing its ligand, cxcl12, playing an important role in the tumor microenvironment . The ligand cxcl12 has been further characterized by crump et al . To understand how it binds to cxcr4 . The rffesh loop on cxcl12 initially binds with an n - terminal segment of cxcr4 . This allows for access to a second receptor site of cxcr4 for the n - terminal region of cxcl12 to bind, altering the conformation of the cxcr4 transmembrane helices and activating the g - protein signal pathway . That signal is able to affect multiple targets, including erk1/2, mapk, jnk, and akt paths, with the end result being events such as chemotaxis, pseudopodia formation, and actin polymeriazation [1214]. In addition to its role within the immune and hematopoietic systems, cxcr4 has also been implicated as a component in angiogenesis [15, 16]. A well - known component of angiogenesis in tumor cells is vascular endothelial growth factor (vegf), which has also shown to be prognostic in colon and gastric cancer [17, 18]. Cxcr4 has been connected with vegf, as increased stimulation of cxcr4 leads to increased secretion of vegf and ultimately angiogenesis and metastasis [1921]. To achieve metastatic potential tumor cells must break through the protective extracellular matrix (em) in order to reach the lymph or blood vessels . Matrix metalloproteinases (mmps) are essential for this component of invasion, as they cause degradation of em . In addition to cxcr4/cxcl12, vegf, and mmps, hif-1 has also shown to be a component of this pathway . Hypoxic conditions are known to promote angiogenesis and have been connected to increased hif-1 and vegf . The connection between hypoxia, cxcr4, and invasive cancer has been outlined by sun et al . In a series of experiments that illustrated the connection and molecular pathway between hypoxia in chondrosarcoma, cxcr4 expression, and matrix metalloproteinases . Hypoxic conditions that produced higher levels of hif-1 were observed to subsequently increase cxcr4 expression through the binding of hif-1 to the promoter region of cxcr4 . Subsequent cxcr4/cxcl12 signaling via the erk pathway increased mmp expression and activity . While this pathway was worked out on cell lines for chondrosarcoma, hif-1 increases in hypoxic conditions have also been shown to upregulate cxcr4 in carcinoma of the breast . Another component that has been linked to cxcr4 upregulation is nitric oxide (no). While already known to induce vegf, nakamura et al . Have been able to show that no also induces the lymphangiogenic factor vegf - c . In more recent work from their laboratory, mda - mb-231 cell lines incubated with no revealed an increased cytoplasmic cxcr4 staining . Cytoplasmic cxcr4 significantly correlated with nitrotyrosine levels, lymph node metastasis, and distant metastasis . The location of cxcr4 staining is a common feature in several of the papers to be described in this review . The cxcr4 receptor resides on the membranes of cells, but ihc has helped reveal patterns between cytosolic and nuclear expression of cxcr4 . Salvucci et al . Noted that cytoplasmic cxcr4 was seen more often in ductal carcinoma in situ (dcis) patients when compared to nuclear staining . That group speculated that cytoplasmic cxcr4 staining could be indicative of active cxcr4 functioning, as if the cancer cells are ready to leave the primary tumor . While nuclear staining of cxcr4 has been tested and observed in many studies, the reasons behind its difference in expression from cytoplasmic cxcr4 has not yet been uncovered . A viable pathway illustrating the role of cxcr4 in breast carcinoma migration from the primary site does not explain how these cells are guided to axillary lymph nodes . Studies have shown cxcl12 to be expressed on the luminal surface of high endothelial venules (hevs) in peripheral lymph nodes . Cxcl12 is a factor in hematopoietic precursors moving from the bone marrow into the circulation, and ultimately to peripheral tissues . Designed a study that showed that cxcl12-induced migration mediated by cxcr4 controlled the migration of human peripheral blood lymphocytes into lymph nodes previously transplanted into scid mice . Liu et al . Performed a series of experiments exhibiting cxcl12 concentrations to be significantly higher in lymph node metastases compared to their primary breast cancer tumor . The location - based chemotaxic ability of cxcl12, combined with its affect on cxcr4-expressed cells, creates a microenvironment for tumor migration (figure 1). With knowledge of the molecular connections between cxcr4, vegf, and mmps, hao et al . Asked if there was a any association between these three components of metastasis and lymph node status in breast cancer patients . The location of cxcr4 staining was studied in breast cancer tissue samples, benign tissue samples that were adjacent to tumor tissue, and atypical hyperplasia samples . The malignant samples had significantly higher rates of cxcr4, vegf, and mmp-9 compared to the benign and nontumor (hyperplastic) samples (p <0.01). Looking at clinicopathologic factors, statistical significance was found upon analyzing either cxcr4 or vegf with the tumor's tnm stage . In addition, all three markers had significant association with advanced histologic grade . When analyzing the primary tumors, increased expression levels of cxcr4, vegf, and mmp-9 associated with the presence of lymph node positive breast cancer (p <0.001). Results showed a lymph node metastasis rate of 79% with tumors expressing high levels of both cxcr4 and vegf compared with a 45% rate when only one of these factors is high (p = 0.007). In contrast, a 6% rate was observed (p <0.001) when neither factor was highly expressed . Any combination of two of the three markers, each highly expressed, had a significant increase in lymph node metastases . Finally, this study showed that high cxcr4 expression was positively associated with increased vegf and mmp-9 expression (table 1). Kang et al . Have shown that high cxcl12 expression in breast cancer tissue is linked to nodal and distant spread of breast cancer cells, as well as a link to overall survival . To follow up this study, this group focused on cxcr4's relation to metastasis and survival, as opposed to its ligand . Using immunohistochemistry, cxcr4 was detected in both breast cancer cell lines as well as normal mammary tissue . It was shown that node - positive tumors had a significantly increased expression of cxcr4 when compared to node - negative tumors . Cxcr4 expression was higher in the metastatic cohort compared to the nonmetastatic group, but significance was not achieved when looking at a relationship between elevated cxcr4 and presence of distant metastases or overall survival (table 1). Parker et al . Evaluated a cohort of 185 node - positive breast cancer patients and found that cxcr4 overexpression level in primary tumors independently predicted a poor outcome for these patients . The 5-year overall survival for patients with low and high cxcr4 overexpression was 69% and 57%, respectively, (p = 0.02, table 1). These results suggest that even within this high risk group (i.e., node positive patients), cxcr4 can be employed to identify those patients who have a more aggressive disease course and therefore can be targeted for more intensive and/or novel therapy . Cabioglu et al . Studied cxcr4 as a predictive marker for lymph node metastasis along with ccr7, another chemokine receptor that has been shown to be expressed in breast cancer cells . The group attempted to reduce confounding effects that can accompany t2 - 4 lesions by limiting this study to only t1 lesions . Differences in cxcr4 and ccr7 staining location were tested, with node - positive tumors showing higher cytoplasmic ccr7 and her2 staining than node - negative tumors . There was an increased rate of cxcr4 in node - positive patients (11.2% versus 5.1%), but this difference was not significant (table 1). The authors theorized that ccr7 is associated with lymph node metastasis, while cxcr4 expression aids in the reliability of ccr7 as a biomarker . When liu et al . Investigated the relationship between cxcr4 and ccr7, they found in their data set that cxcr4 and ccr7 each significantly associated with lymph node metastasis . A lower overall survival was noted via the kaplan - meier survival analysis of both cxcr4 and ccr 7 overexpression . The difference between nuclear and cytoplasmic cxcr4 staining has emerged as an important factor in cxcr4's prognostic / predictive ability . Su et al . Examined the expression location of cxcr4 in breast cancer cells and tested for associations in marker staining and metastasis . The study was designed to compare 3 groups: (1) patients with sentinel and nonsentinel lymph node metastasis, (2) patients with only sentinel lymph node metastasis, and (3) patients with neither sentinel or nonsentinel metastasis . Combining groups 2 and 3 together (they chose for sole sentinel node positivity to be equivalent to no metastasis) revealed that high cytoplasmic cxcr4 expression was associated with axillary lymph node status (p = 0.0325, table 1). Their data did not show any other correlations with cytoplasmic or nuclear cxcr4 staining and any other clinicopathological factor . Essentially, these results show that elevated cytoplasmic cxcr4 are indicative of spread beyond the sentinel lymph node . The knowledge that stromal cells express cxcl12 opens the theory that location, along with concentration, can be important in predicting outcome . Kang et al . Found that when adding cxcl12 to the cell line mda - mb-231, there was increased migration and invasion ability . That study showed an inverse relationship between cxcl12 expression levels and disease - free and overall survival in breast cancer patients . Mirisola et al . Conducted a series of experiments to help explain the autocrine / paracrine effect of cxcl12 . When analyzing 100 breast cancer samples, ihc studies showed that groups highly expressing cxcl12 tended to be smaller tumors and lymph node negative (p = 0.04, p = 0.002). Also noted was a significant association between dfs and the expression pattern of cxcl12, specifically expression at the tumor periphery (p = 0.002). Tumors expressing cxcl12 had a better clinical outcome than those that lost the chemokine . The authors' explanation is that when cxcl12 is produced by the tumor, the autocrine function of cxcl12 renders the tumor insensitive to its effects and cancels any metastatic potential . Tumor growth via the erk pathways and vegf are still in play, but metastatic potential is lost . Thus, it can be inferred that tumors not overly expressing cxcl12 show a paracrine effect and maintain metastatic potential . The idea that cxcl12 can inhibit the effect of cxcr4 was further explored by shim et al . . First, they were able to produce results that showed breast cancer lymph node metastases were overexpressed at a lower rate than they were at the primary tumor . Next, they moved to explain how increased cxcl12 concentrations can affect cxcr4, a finding previously noted in liu et al . . After creating an expression score to quantify cxcr4 expression in their breast cancer and lymph node specimens, this group was able to show that primary breast cancer specimens exhibited a higher score than lymph node metastases (p <0.001). 58% of primary tumor samples had membranous staining of cxcr4 predominate, versus 80% of lymph node metastases having cytoplasmic staining predominate . In the reviewed papers hao et al ., su et al ., yasuoka et al ., and liu et al . This group studied cxcl12 mrna levels of 10 primary breast cancer tumors along with their matching lymph node metastases and observed cxcl12 levels to be higher in lymph node tumors than the primary breast tumor (p <0.001). For a control, however, after incubation with cxcl12 for 30 minutes, cxcr4 expression was found in the cytoplasm . Furthering this experiment, mda - mb-231 cells were exposed to 100 and 200 ng / ml concentrations of cxcl12 for 48 hours . Cxcr4 was then measured by western blot, and expression as found to be significantly decreased . This group then tested chloroquine, known to inhibit proteolysis of lysosomes, with the mda - mb-231 cell line and found cxcr4 expression returned while still in the presence of high concentrations of cxcl12 . Have altered this belief with a study documenting the ability of cxcl12 to bind to cxcr7 (rdc1, ccx cjr2), a novel receptor that was first characterized as a chemokine receptor in this paper . They were able to show that cxcl12 binds to cxcr7 by transfecting a cell line lacking cxcr4 and cxcr7 with the rdc1 gene, resulting in high - affinity cxcl12 binding even in the presence of the cxcr4 inhibitor, amd3100 introduced cxcr7 into breast cancer cell line mda mb435s and documented an increase in cell growth and increased adhesion to human umbilical vein endothelial cells . This lab's continued investigation of cxcr7 has since shown that it promotes breast and lung cancer in murine models . Additionally, cxcr7 was undetectable or at low levels in normal human breast tissue from mammoplasties, but was clearly detected in over 30% of human breast cancer specimens . It was also detectable in 97% of blood vessel specimens from human breast cancer, versus being searching for new biomarkers is more complex than locating factors with changed expressions from their benign baseline, according to ransohoff and gourlay . They state that several forms of bias might account for the fact that while many targets have been identified as biomarkers, very few have had clinical value . This bias possibly occurs before a specimen arrives to a laboratory in the form of collection and storage . One example cited details a group investigating prostate cancer that questioned whether differences in storage time between the cancer and noncancer specimen groups affected the end results . Ransohoff and gourlay's assessment of bias concludes that subject selection is of utmost importanceinequality of specimen groups is a major source of bias in experiments where the outcomes are observations, not laboratory results . They believe that improving the attention given to specimens, both in selection and management once acquired, might improve the quality of results in biomarker identification research . The molecular pathway for its action, along with associated factors, is continuing to be broken down piece by piece . A myriad of components appear to play important roles in the overexpression of cxcr4, from no and vegf to mmps and hif-1. Differences have been noted in cxcr4 between primary tumors and lymph node metastases, specifically in the amount of overexpression: cxcr4 has been found to be more highly overexpressed at the primary tumor than at lymph node metastases . Repeated in many papers is the fact that cytoplasmic cxcr4 staining is noted to associate with lymph node metastasis while nuclear cxcr4 staining has not had significant results . Studies into the responsibilities of cxcr4's ligand, cxcl12, have revealed increased concentration of the ligand at distant sites, specifically the lymph nodes . Another important issue with cxcl12 is the idea that tumors that produce high amounts of the chemokine effectively downregulate cxcr4 receptors, while tumors without high cxcl12 expression maintain a prometastatic ability . The role of cxcr7 further clouds the picture when attempting to understand what is more important to target while grasping cxcl12's effect on both cxcr7 and cxcr4 in the same tumor microenvironment . Cxcr4 has been identified as a receptor for cxcl12, changes in expression location patterns of cxcr4 have been described, and positive associations with disease outcome have been derived . New discoveries concerning cxcr7, paracrine / autocrine cxcl12 effects, and more careful planning in discovery and examination of biomarkers will help shape the future directions of this research . Possibilities exist for collaboration and shared information; the results of which could alter the current understanding and treatment of breast cancer, both local and systemic.
Obstetric and gynecologic physiotherapy is a subspecialty in physiotherapy concerned with promotion of health throughout the child - bearing period, and helps the mother to adjust advantageously to the physical and psychologic changes of pregnancy and the post - natal period, so that the stresses of child - bearing are minimized . Physiotherapists specializing in obstetrics and gynecology require a mature blend of attributes, enabling women to disclose confidently what may be some of the most intimate and personal details of their lives.1 the role of the physiotherapist in obstetrics and gynecology involves pregnancy, labor, and the puerperium, and the preoperative and postoperative periods.2 however, the extent of utilization of physiotherapy services by obstetricians and gynecologists will depend on their knowledge and attitude towards physiotherapists . Physiotherapy in nigeria operates on a referral system, so utilization depends on the attitudes of physicians towards physiotherapy . Physiotherapists in nigeria hold a bachelor s degree, and some also have a master s degree or doctoral qualifications . Utilization of individual professional skills depends on cooperation between health team members and the extent to which they value the knowledge of other team members in discharging their services to the patient, who is the main focus of the team.3 therefore, there is a need for interdisciplinary cooperation between health care professionals, including obstetricians, gynecologists, midwives, physiotherapists, medical laboratory scientists, and social workers.4 ogbona reported that physicians who trained in nigeria had a poor knowledge and awareness of the physiotherapy profession compared with their counterparts who trained in the west.5 this limited knowledge may affect appropriate utilization of physiotherapy services by doctors, and could have an adverse effect on overall health care delivery in the country . In contrast, ikhizama3 observed an increase in knowledge of physicians trained in nigeria about physiotherapy services compared with that reported by stephenson.4 however, both ogbona and abayomi observed that, despite the positive attitude of obstetricians in selected hospitals in ibadan township and ogun state towards physiotherapists, utilization of physiotherapy services was poor.5,6 several studies have been carried out to assess the awareness, knowledge, attitudes, and utilization of physiotherapy services in various medical conditions.3,6,7 inclusion of physiotherapy services in obstetrics and gynecology is pivotal to delivery of an optimal health care service . However, in nigeria, there is limited information concerning the attitudes of obstetricians and gynecologists towards the involvement of physiotherapists in the management of patients with obstetric and gynecologic conditions as well as factors affecting their utilization of these services . This study was designed as a descriptive survey in which the participants were consultants and senior registrars in obstetrics and gynecology selected from seven hospitals in south - western nigeria . The investigators identified the names of all senior registrars and consultants in the selected hospitals from hospital records . This was a population study because of the limited number of obstetricians practicing in the region, so all senior registrars and consultants were invited to participate, and all those who gave their consent were included . Sixty - seven (52.76%) of the 127 senior registrars and consultants working in the selected hospitals participated in the study . The hospitals selected were university college hospital in ibadan, obafemi awolowo university teaching hospital in ile - ife, lagos university teaching hospital in idi - araba, lagos, ladoke akintola university teaching hospital in osogbo, olabisi onabanjo university teaching hospital in sagamu, the federal medical centre in idi - aba, abeokuta, and lagos state university teaching hospital in ikeja, lagos . These hospitals are located in the south - western part of nigeria, and the majority of obstetricians in the country are trained and located in these institutions . The study instrument was a 28-item self - reported questionnaire in the english language adapted from a standardized questionnaire used in previous work.6 the questions were selected from the earlier questionnaire, the language of which was modified to suit the nigerian context, with addition of some other items deemed to be relevant . The questionnaire was then presented at a seminar for expert face and content validation . Expert consensus was reached and the questionnaire was piloted in another location outside the study population . This was done on two occasions within one week to test the reliability of the instrument . The questionnaire was in three sections, ie, demographic characteristics, attitude of obstetricians and gynecologists to the role of physiotherapists in obstetrics and gynecology, and extent of utilization and factors affecting utilization of physiotherapy services by obstetricians and gynecologists . The attitude and utilization ethical approval for the study was obtained from the institutional review committee at university college hospital . Permission to conduct the study was obtained from the heads of departments of obstetrics and gynecology in each of the selected facilities . Informed consent was obtained from the participants in this study and the questionnaires were self - administered . The questionnaires were collected immediately after completion, and those who could not complete their questionnaire immediately were contacted for collection on a return visit or through a contact person . The questionnaires were anonymous, so the researcher did not know who did or did not complete the questionnaire . The data were analyzed using descriptive statistics of frequency, percentages, and chi - square inferential statistics, with the statistical significance level set at p <0.05 . Sixty - seven participants, comprising 26 (38.8%) consultants and 41 (61.2%) senior registrars from seven selected hospitals, were included in this study . Three (4.47%) of the 67 questionnaires were not completed, so were not included in the analysis . The age range of the participants was 3150 (modal age range 3140) years . The study group included 61 (91.0%) men and six (9.0%) women . The majority (75.5%) of the participants knew the role of physiotherapists in obstetrics and gynecology . The majority (80.6%) of participants strongly agreed and 13.4% agreed to involvement of physiotherapists in obstetric palsy, followed by muscle weakness (79.1% strongly agreeing and 20.9% agreeing) and gait postural alteration (77.6% strongly agreeing and 22.4% agreeing, respectively). Further, 11.9% strongly agreed and 34.3% agreed to involvement of physiotherapists in the management of dyspareunia, while 34.3% strongly agreed and 13.3% agreed to involvement of physiotherapy in pelvic inflammatory disease . It was noted that 94.0% and 1.5% of participants strongly agreed and agreed, respectively, that physiotherapy service does not cause patients any harm, 92.5% and 4.5% strongly agreed and agreed, respectively, that physiotherapy cannot be replaced with drugs and instructions, and 92.5% agreed that physiotherapists are competent to manage patients with obstetric and gynecologic conditions, as shown in table 3 . Also, 86.6% and 1.5% of gynecologic patients while 76.1 and 1.5% of obstetric patients strongly agreed and agreed, respectively, that physiotherapy service may contribute significantly to the complete well - being of gynecologic patients . Further, 80.6% of participants strongly agreed that a physiotherapy service would not be too expensive for patients, 50.7% and 6.0% strongly agreed and agreed, respectively, that physiotherapy is time - consuming, 56.7% and 10.4% strongly agreed and agreed, respectively, that physiotherapists should be allowed to attend surgical procedures for patients with gynecologic conditions, and 38.8% and 16.4% strongly agreed and agreed, respectively, that physiotherapists should be allowed to attend the labor ward, while 41.8% and 13.4% strongly disagreed and agreed in that order that physiotherapists maintained adequate interprofessional relationships . Sixty - three (94.0%) of the participants reported having referred patients for physiotherapy, while four (6.0%) had not done so (see table 4). Forty - eight (71.6%) of participants had referred patients with a prescription, while 14 (20.9%) had referred patients without a prescription . One (1.5%) participant had referred patients with and without a prescription, and four (6.0%) did not refer at all . Thirty - eight (60.3%) participants referred patients to general / state hospitals, eight (11.9%) to their hospital of practice, six (9.0%) to a private physiotherapy clinic, five (7.5%) to both a private physiotherapy clinic and a general / state hospital, three (4.5%) to a private physiotherapist, two (3.0%) to a physical health educator, one (1.5%) to both a private physiotherapy clinic and a private physiotherapist, and four (6.0%) did not refer at all, as shown in table 4 . Sixty - five (97.0%) of the participants had a physiotherapy department in their hospital of practice, 17 (25.4%) had a physiotherapy clinic within the vicinity of their hospital, and 63 (94.0%) had physiotherapists as close friends . Thirty - four (50.7%) participants reported that the physiotherapy service in their hospital of practice is not too expensive and 62 (92.5%) considered that the physiotherapy service had not worsened the condition of their patients . Thirty - one (46.3%) of the respondents reported that there were not enough physiotherapists in their hospital of practice to cover the obstetrics and gynecology wards . Forty - seven (70.1%) had worked previously with physiotherapists in the management of obstetric patients, while 49 (73.1%) had worked previously with physiotherapists in the management of gynecologic patients . Forty - five (67.2%) of the participants reported that a physiotherapy training program existed as a degree course in their college of basic medical training . However, only 10 (14.9%) had physiotherapists posted in their hospitals and seven (10.4%) had attended ward rounds with physiotherapists, while 56 (83.6%) had a physiotherapy training program in their institution of residency training (see table 5). It was noted that 94.0% and 1.5% of participants strongly agreed and agreed, respectively, that physiotherapy service does not cause patients any harm, 92.5% and 4.5% strongly agreed and agreed, respectively, that physiotherapy cannot be replaced with drugs and instructions, and 92.5% agreed that physiotherapists are competent to manage patients with obstetric and gynecologic conditions, as shown in table 3 . Also, 86.6% and 1.5% of gynecologic patients while 76.1 and 1.5% of obstetric patients strongly agreed and agreed, respectively, that physiotherapy service may contribute significantly to the complete well - being of gynecologic patients . Further, 80.6% of participants strongly agreed that a physiotherapy service would not be too expensive for patients, 50.7% and 6.0% strongly agreed and agreed, respectively, that physiotherapy is time - consuming, 56.7% and 10.4% strongly agreed and agreed, respectively, that physiotherapists should be allowed to attend surgical procedures for patients with gynecologic conditions, and 38.8% and 16.4% strongly agreed and agreed, respectively, that physiotherapists should be allowed to attend the labor ward, while 41.8% and 13.4% strongly disagreed and agreed in that order that physiotherapists maintained adequate interprofessional relationships . Sixty - three (94.0%) of the participants reported having referred patients for physiotherapy, while four (6.0%) had not done so (see table 4). Forty - eight (71.6%) of participants had referred patients with a prescription, while 14 (20.9%) had referred patients without a prescription . One (1.5%) participant had referred patients with and without a prescription, and four (6.0%) did not refer at all . Thirty - eight (60.3%) participants referred patients to general / state hospitals, eight (11.9%) to their hospital of practice, six (9.0%) to a private physiotherapy clinic, five (7.5%) to both a private physiotherapy clinic and a general / state hospital, three (4.5%) to a private physiotherapist, two (3.0%) to a physical health educator, one (1.5%) to both a private physiotherapy clinic and a private physiotherapist, and four (6.0%) did not refer at all, as shown in table 4 . Sixty - five (97.0%) of the participants had a physiotherapy department in their hospital of practice, 17 (25.4%) had a physiotherapy clinic within the vicinity of their hospital, and 63 (94.0%) had physiotherapists as close friends . Thirty - four (50.7%) participants reported that the physiotherapy service in their hospital of practice is not too expensive and 62 (92.5%) considered that the physiotherapy service had not worsened the condition of their patients . Thirty - one (46.3%) of the respondents reported that there were not enough physiotherapists in their hospital of practice to cover the obstetrics and gynecology wards . Forty - seven (70.1%) had worked previously with physiotherapists in the management of obstetric patients, while 49 (73.1%) had worked previously with physiotherapists in the management of gynecologic patients . Forty - five (67.2%) of the participants reported that a physiotherapy training program existed as a degree course in their college of basic medical training . However, only 10 (14.9%) had physiotherapists posted in their hospitals and seven (10.4%) had attended ward rounds with physiotherapists, while 56 (83.6%) had a physiotherapy training program in their institution of residency training (see table 5). Our findings indicate that consultants tend to be more aware and have better knowledge than senior registrars about the role of physiotherapy in obstetrics and gynecology due to exposure resulting from years of experience . The majority (79.1%) of participants knew of the role of physiotherapists in obstetrics, with postnatal care having the highest score (98.5%), followed by antenatal care (82.1%) and parturition (56.7%). These findings agree with those of another report.6 we found that 66 (98.5%) of participants knew the role of physiotherapy in uterine prolapse, 47 (70.1%) in hysterectomy, 22 (32.8%) in pelvic inflammatory disease, and five (7.5%) in cervical incompetence, indicating that participants were knowledgeable about the role of physiotherapy in obstetrics and gynecology . However, the low score observed for knowledge of the role of physiotherapy in pelvic inflammatory disease indicates that although obstetricians and gynecologists had general knowledge of the role of physiotherapy service, they had limited knowledge with regard to specific conditions . This also shows that obstetricians had not been involving physiotherapists in the management of conditions such as pelvic inflammatory disease . It was observed that of all the 28 obstetric and gynecologic conditions listed, 80% strongly agreed about the role of physiotherapists in obstetric palsy . This is consistent with a previous report that physiotherapy is the main management modality for this condition.8 however, it is noteworthy that 43.4% and 41.8% of the participants did not agree about the role of physiotherapy in the management of episiotomy care perineal tears, respectively, even though it has already been pointed out that management of episiotomy requires more physical therapy than is currently appreciated.8 most of our study participants (86.6% and 76.1%, respectively) agreed that patients with obstetric and gynecologic conditions also require physiotherapy services . This is in agreement with two other reports.6,7 the majority of participants strongly agreed that physiotherapy would not cause harm to patients, and 92.5% strongly agreed that physiotherapy services cannot be replaced with drugs and instructions, and that physiotherapists are competent to manage obstetric and gynecologic conditions . More than 80% of participants strongly agreed that a physiotherapy service is not expensive and could be afforded by patients, while 50.7% considered it to be time - consuming . Also, 56.7% of participants strongly agreed that physiotherapists should be allowed to attend surgical procedures for patients with gynecological conditions, and 38.8% strongly agreed that physiotherapists should be allowed to attend the labor ward . It is agreed that physiotherapists can attend the labor ward, but should not interfere in any way in its normal operation but merely reinforce to the mother the teaching she had received in the antenatal period . Underutilization of physiotherapy may be due to limited knowledge on the part of obstetricians and gynecologists about the role of physiotherapists in parturition . Further, 41.8% of participants strongly agreed that physiotherapists have not performed adequately in their interprofessional relationships . This is indicative of a need for improved communication in the form of seminars, workshops, and attendance at grand rounds . The majority (94.0%) of participants referred patients for physiotherapy, while 6.0% did not, and this could be due to the fact that the participants had better knowledge, a better attitude, and hence improved utilization of physiotherapy service . Most (76.2%) of the participants referred obstetric and gynecologic patients with a prescription while 20.9% referred patients without a prescription, and the majority of the participants referred patients to general / state hospitals . This could be due to nonavailability of a department of physiotherapy in their hospitals of practice . Our findings in this regard are consistent with those of adegoke.9 referral with a prescription does not show regard for professionalism and needs to be investigated . Ninety - seven percent of the participants had a physiotherapy department in their hospital of practice, 94.0% had physiotherapists as close friends, 83.6% had a physiotherapy training program in their institution of residency, 73.1% and 70.1% had worked with physiotherapists before in the management of gynecologic patients and obstetric patients, respectively, 67.2% had physiotherapy as a degree program in their school of basic medical training, and 92.5% noted that physiotherapy had not worsened the condition of their patients . It is noteworthy that only 14.9% of the participants had physiotherapy postings in their hospital and only 10.4% went on ward rounds with physiotherapists . It was observed that the present status of the participants resulted in better knowledge of the role of physiotherapy service in obstetrics and gynecology but not necessarily their attitudes . Senior registrars had a better attitude than consultants towards the role of physiotherapists in obstetrics and gynecology, despite their lesser knowledge . Our findings indicate that consultants tend to be more aware and have better knowledge than senior registrars about the role of physiotherapy in obstetrics and gynecology due to exposure resulting from years of experience . The majority (79.1%) of participants knew of the role of physiotherapists in obstetrics, with postnatal care having the highest score (98.5%), followed by antenatal care (82.1%) and parturition (56.7%). These findings agree with those of another report.6 we found that 66 (98.5%) of participants knew the role of physiotherapy in uterine prolapse, 47 (70.1%) in hysterectomy, 22 (32.8%) in pelvic inflammatory disease, and five (7.5%) in cervical incompetence, indicating that participants were knowledgeable about the role of physiotherapy in obstetrics and gynecology . However, the low score observed for knowledge of the role of physiotherapy in pelvic inflammatory disease indicates that although obstetricians and gynecologists had general knowledge of the role of physiotherapy service, they had limited knowledge with regard to specific conditions . This also shows that obstetricians had not been involving physiotherapists in the management of conditions such as pelvic inflammatory disease . It was observed that of all the 28 obstetric and gynecologic conditions listed, 80% strongly agreed about the role of physiotherapists in obstetric palsy . This is consistent with a previous report that physiotherapy is the main management modality for this condition.8 however, it is noteworthy that 43.4% and 41.8% of the participants did not agree about the role of physiotherapy in the management of episiotomy care perineal tears, respectively, even though it has already been pointed out that management of episiotomy requires more physical therapy than is currently appreciated.8 most of our study participants (86.6% and 76.1%, respectively) agreed that patients with obstetric and gynecologic conditions also require physiotherapy services . This is in agreement with two other reports.6,7 the majority of participants strongly agreed that physiotherapy would not cause harm to patients, and 92.5% strongly agreed that physiotherapy services cannot be replaced with drugs and instructions, and that physiotherapists are competent to manage obstetric and gynecologic conditions . More than 80% of participants strongly agreed that a physiotherapy service is not expensive and could be afforded by patients, while 50.7% considered it to be time - consuming . Also, 56.7% of participants strongly agreed that physiotherapists should be allowed to attend surgical procedures for patients with gynecological conditions, and 38.8% strongly agreed that physiotherapists should be allowed to attend the labor ward . It is agreed that physiotherapists can attend the labor ward, but should not interfere in any way in its normal operation but merely reinforce to the mother the teaching she had received in the antenatal period . Underutilization of physiotherapy may be due to limited knowledge on the part of obstetricians and gynecologists about the role of physiotherapists in parturition . Further, 41.8% of participants strongly agreed that physiotherapists have not performed adequately in their interprofessional relationships . This is indicative of a need for improved communication in the form of seminars, workshops, and attendance at grand rounds . The majority (94.0%) of participants referred patients for physiotherapy, while 6.0% did not, and this could be due to the fact that the participants had better knowledge, a better attitude, and hence improved utilization of physiotherapy service . Most (76.2%) of the participants referred obstetric and gynecologic patients with a prescription while 20.9% referred patients without a prescription, and the majority of the participants referred patients to general / state hospitals . This could be due to nonavailability of a department of physiotherapy in their hospitals of practice . Our findings in this regard are consistent with those of adegoke.9 referral with a prescription does not show regard for professionalism and needs to be investigated . Ninety - seven percent of the participants had a physiotherapy department in their hospital of practice, 94.0% had physiotherapists as close friends, 83.6% had a physiotherapy training program in their institution of residency, 73.1% and 70.1% had worked with physiotherapists before in the management of gynecologic patients and obstetric patients, respectively, 67.2% had physiotherapy as a degree program in their school of basic medical training, and 92.5% noted that physiotherapy had not worsened the condition of their patients . It is noteworthy that only 14.9% of the participants had physiotherapy postings in their hospital and only 10.4% went on ward rounds with physiotherapists . It was observed that the present status of the participants resulted in better knowledge of the role of physiotherapy service in obstetrics and gynecology but not necessarily their attitudes . Senior registrars had a better attitude than consultants towards the role of physiotherapists in obstetrics and gynecology, despite their lesser knowledge . Obstetricians and gynecologists in south - western nigeria have a general knowledge of physiotherapy services in obstetrics and gynecology . They also demonstrate a positive attitude towards involvement of physiotherapists in the management of patients with obstetric and gynecologic conditions . However, their knowledge about the value of a physiotherapy service in specific conditions is limited . Physiotherapy posting during basic medical training and better interaction between obstetricians, gynecologists, and physiotherapists in the form of seminars, workshops, and grand rounds, could enhance knowledge and attitudes of obstetricians towards involvement of physiotherapists in patient management.
A 32-year old male patient visited our institution with the chief complaint of pain in the right hip and the lower back which started after he had experienced a minor traffic accident ten months prior to his visit . The pain became severe when he bent his waist, and an paresthesia was found with a numbness going to the tip of the right middle toe . The physical examination showed a positive finding in the straight leg raising test (20 degree/60 degree). The lumbosacral plain film showed that the disc space between l4 and l5 was narrow . The patient's pain was not relieved but continued even after a caudal epidural steroid injection as well as after interlaminar epidural steroid injections given at one week intervals . Because the magnetic resonance imaging (mri) showed a central herniated lumbar disc between l4 and l5 and compression of the right l5 nerve root, we decided to perform elnd . The patient was hospitalized one day before the operation, and provided written informed consent . He started fasting eight hours before the operation and showed nothing unusual in the preoperative blood test . On the day of the operation, cefazolin 1 g was intravenously injected one hour before the beginning of the operation for the purpose of preventing an operation related infection . The patient was put into the prone position on the surgical table after arriving at the operating room . The position was adjusted with a wilson frame and a pillow at the abdomen so that lumbar flexion could be unfolded and the upper body could be a little bit higher than the lower body . Afterwards, a wide area around the sacral hiatus was disinfected with aseptic technique . Local anesthesia was performed in the region to be operated on with 1% mepivacaine . Under direct fluoroscopy guidance, an 18 g tuohy epidural needle was inserted into the sacral hiatus through the epidural space, and a 0.8 mm guide wire was inserted through the tuohy needle . Keeping the guide wire in position, the tuohy needle was carefully removed . In the process of making a small incision on the skin with a no . 11 blade and inserting a dilator through the guide wire, an unexpected resistance was found with the access . Despite repeated attempts carried out several times, the insertion to the sacral canal failed . It was found in the image that the conjugate diameter of the top 1/3 of the s4 spinal canal was 3.40 mm, which was smaller than the 3.96 mm outer diameter of the dilator for the epiduroscopy introducer set used in the operation (4007 epiduroscopy introducer set, myelotec, usa), and smaller than the 3.89 mm outer diameter of the introducer sheath (fig . 1). Therefore, we decided to perform a s4 laminotomy at the entrance of the narrowed sacral canal with a hiatus rasp (fig . 2) designed to widen the canal opening . After making an incision of about 2 cm on the skin and on the sacrococcygeal ligament, the rasp was inserted into the narrowed region expanding the narrow sacral canal space by applying repeated rotational force (fig ., the dilator was normally inserted, and the channel and the space leading to the epidural space were widened, and the procedure could be stably completed . The patient's symptoms improved, and he was discharged two days after the operation . Elnd has been recently introduced and is drawing attention as a new method for diagnosis and treating not only herniated disc, spinal stenosis, and failed back surgery syndrome but also chronic refractory low back pain which is not treated well by other interventional treatments including c - arm guided epidural steroid injection . In particular, jo and yang asserted that epiduroscopy may be useful in investigating the causes of low back pain because it is applied to not only the treatment of chronic refractory low back pain but also to the diagnosis of low back pain, and predicted that the application of epiduroscopy would increase . The outer diameter of the video guided catheter (myelotec, usa) was increased to 3.0 mm because the system came with two working channels for the manipulation of the fiberoptic endoscope and the laser fiber . In addition, the outer diameter of the dilator inserting the catheter into the sacral canal and that of the introducer sheath were increased to 3.96 mm and 3.89 mm, respectively . This indicates that an epidural space even greater than the outer diameter of the 15 g rx coude needle (1.83 mm) for the conventional racz catheter procedure and that of the introducer sheath of the navi catheter (2.31 mm) is required . For this reason, an anatomical variation at the sacral canal opening including stenosis may often make access of a device needed for the procedure impossible, thus causing the failure of the procedure, bringing about a loss in time, effort and cost for the patient and medical staff, and even decreasing the usefulness of the procedure . Reported two such cases . In one case, when the seldinger technique was performed at the sacral hiatus region to perform epiduroscopic adhesiolysis, a 0.9 mm guide wire was inserted but the 2.0 mm diameter dilator was not inserted . A vertical incision was made at the sacral hiatus, and hyperplastic cartilaginous tissue was found after dissecting the tissue until the hiatus was exposed, and the procedure was continued after removing it with a kerrison rongeur . In the other case, the tissue surrounding the sacral hiatus was removed by blunt dissection, and the opening was widened, and then, the procedure was continued . In anatomical studies on the sacrum with cadavers, senoglu et al . Reported that the mean conjugate diameter of the sacral hiatus measured at the apex level was 4.5 mm (1.0 to 7.0 mm); aggarwal et al . Reported that it was 4.0 mm (1.1 to 9.3 mm); and sekiguchi et al . Reported that it was 6.0 mm (1.9 to 11.4 mm) they stated that the ratio of a diameter smaller than 2.0 mm was 6.25%, 6.1%, and 1%, respectively [4 - 6]. In a study where the sacrum and the caudal space were observed by mri in 37 adult patients, crighton et al . Reported that the mean canal conjugate diameter at the hiatal apex level was 4.6 mm (1.0 to 8.0 mm), and that only one patient showed a diameter smaller than 2.0 mm . Senoglu et al . Reported that the ratio of the sacral hiatal agenesis was 6.25% . Sekiguchi et al . Reported that the hiatal agenesis was 4%, bony septum 2%, and complete agenesis 1% at the sacral hiatus . These reports suggest that variations in the sacral canal opening region may cause difficulties, although rare, not only in epiduroscopy but also in all interventional procedures using a caudal approach . Therefore, it cannot be overemphasized that preoperative evaluation through various imaging techniques, including ultrasonography, computed tomography, and mri, is important, and that the medical staff should be prepared in advance for patients who are expected to have difficulty in the procedure based on the preoperative evaluation results . The anatomical studies of the sacrum [4 - 8] were not conducted by keeping the elnd in view because they were conducted before the introduction of elnd . Nevertheless, pain physicians should pay more attention when performing elnd because the devices for elnd currently have the greatest outer diameter among interventional procedures through the caudal opening at the sacral hiatus level . In addition, it is important to acquire knowledge on rare anatomical variations at the sacrococcygeal region, perform an evaluation in advance, and learn a method to cope with the variation for stable access to the epidural space for elnd . The rasp used in this case report was designed as a cone with a helical surface . The total height of the cone was 32.0 mm; the diameter of the cone base was 6.0 mm, and the diameter of the cone at 1/2 the level of the cone height, which was 16.0 mm away from the cone vertex, was 4.0 mm . There has been no study or report until now regarding stenosis for what sacral level could be resolved or safely operated on without any possibility of nerve damage by using this device in the case where there is stenosis at the sacral hiatus opening region as in our case . However, we assume that the possibility of damage to the surrounding tissue and nerves could be minimized by considering the results of the sacrum anatomical studies mentioned above [4 - 8], by locating the rasp at the center of the sacral hiatus as much as possible under the c - arm guide, and by expanding the space by gradually moving to the fore while observing pain or other dysaesthesia through conversation with the conscious patient . We also expect that relevant studies will be actively conducted as elnd becomes more popular . In this case report, a specially designed operative rasp was used to expand the canal space and to continue the elnd procedure in a patient whose canal around the hiatal opening was narrow at our institution . Meticulous care and caution by pain physicians are required while performing the procedure described in this case report.
The incidence of delirium in the intensive care unit (icu) ranges from 45% to 87% . Delirium is an independent risk factor for death in the icu, and can result in over sedation, increased duration of mechanical ventilation and increased length of icu stay . Risk factors for delirium include metabolic impairment, substance withdrawal, severe sepsis, drugs like atropine, organophosphorus compound poisoning (opcp) and sleep deprivation . Various drugs such as dexmedetomidine, benzodiazepines and antipsychotics have been tried to treat and prevent delirium; however, these drugs are associated with adverse effects . The endogenous hormone melatonin is very well known to influence the circadian rhythm, and has effects on sleep quality and cycle which can be used in the management of delirium . Few animal studies have shown the benefit of melatonin in opcp - induced delirium, by reducing oxidative stress and lipid peroxidation of the brain caused by opcp . Hence, this study was conducted with the primary aim of assessing the effect of melatonin on delirium and recovery profile in opcp patients . This prospective, randomised, double - blind, placebo - controlled study was conducted between september 2014 and december 2015 . Patients aged between 18 and 50 years, presenting with history and clinical syndrome suggestive of organophosphorus compound poisoning (opcp) with low pseudocholinesterase levels (<5320 iu / l) were included in the study . Acute physiology and chronic health evaluation ii (apache ii) scores were assessed at the time of admission and patients whose score was> 20 were excluded . Postcardiac arrest patients, patients on chronic opioids and opioid antagonists, selective serotonin reuptake inhibitors, monoamine oxidase inhibitors, central nervous system depressants, warfarin, angiotensin converting enzyme inhibitors, diuretics, moderate to severe hepatic or renal dysfunction, known psychiatric disorder through history from relatives and patients with history of cardiac disease were excluded from this study . Injection atropine intravenous (iv) was administered as 2 mg boluses, till signs of atropinization were achieved (heart rate> 80 beats / min, systolic blood pressure> 90 mm of hg, drying of oral and tracheobronchial secretions) and then it was followed by a titrated infusion to maintain heart rate of 80100/min . Injection pralidoxime (p2am) iv 30 mg / kg was administered as loading dose, followed by 810 mg / kg / h infusion over 48 h. patients who developed acute respiratory failure due to opcp - induced cholinergic crisis or intermediate syndrome during admission to icu or during the course of stay in icu were intubated and mechanically ventilated . Using a computer generated randomisation scheme, the drug and the placebo (same coloured sugar tablets as melatonin) were removed from their original packs and placed in similar looking sachets numbered as per computer generated random numbers by the nurse not involved in the study . The details of the sachet number, its contents and the patient receiving it, was maintained by the principal investigator and not revealed to others till the end of the study . The nurse who administered the drug, the patient who received it and the doctor who observed the findings were all blinded to the contents of the sachet . Group m received tablet melatonin 3 mg, at 9 pm through the ryle's tube daily from the day of admission and group c received a placebo tablet at the same time in the same manner throughout the duration of icu stay . Delirium was assessed in two steps by confusion assessment method for icu (cam - icu). The level of consciousness was first assessed using the richmond agitation - sedation scale (rass), (a 10-point scale ranging from + 4 to 5). Rass score of 0 represents calm and alert patient and scores of 4, and 5 correspond to coma in whom delirium cannot be assessed . The cam - icu assesses patients for four features of delirium (1) acute onset of mental status changes or a fluctuating course, (2) inattention, (3) disorganised thinking and (4) altered level of consciousness . The presence of at least three out of these four features was considered for a diagnosis of delirium . The level of sedation and delirium were assessed 3 times a day at 9 pm, 8 am and 4 pm daily (every shift), and the patient was diagnosed to have delirium if icu - cam was positive even on one occasion of assessment . In case of agitation or intolerance to mechanical ventilation, (rass 2), rescue sedation with injection midazolam 1 mg iv and injection fentanyl 30 g iv bolus followed by infusion of a drug solution containing injection midazolam (0.4 mg / ml) and injection fentanyl (5 g / ml), was given and infusion titrated to maintain the rass scale between 2 and + 1 . In those who were not intubated, injection lorazepam 4 mg iv boluses were used to maintain rass scale between 2 and + 1 . Primary outcome measures were, effect of melatonin on the duration of delirium during icu stay in opcp, overall prevalence of delirium and sedation (fentanyl and midazolam or lorazepam) requirement . The requirement of atropine, number of patients requiring mechanical ventilation, the duration of mechanical ventilation and the total duration of icu stay were secondary outcome measures . Intensive monitoring of heart rate, systolic and diastolic blood pressure, oxygen saturation and electrocardiogram were done throughout the icu stay . Other significant events and side effects such as headache, nausea, vomiting if any were observed . On the basis of an unpublished pilot study conducted in our icu, the average duration of delirium in opcp patients was observed to be 8.5 2.5 days . We hypothesised that melatonin administration would reduce the duration of delirium . To detect a minimum of 25% reduction in duration of delirium, assuming normal distribution of values, at least 44 subjects would be required with 80% power and 5% probability of type i error to reject null hypothesis . Percentage of patients with delirium was calculated by keeping number of patients having delirium on numerator with total number of patients assessed for delirium on that day as denominator . The average of the percentage of delirium over 10 days is depicted as the prevalence of delirium . Doses of atropine, midazolam, lorazepam, fentanyl were categorised as increased, decreased or no change and ventilation requirement as present or absent . Multiple comparisons were performed using analysis of variance test for repeated measurements (rmanova). Paired student's t - test was used for paired numerical data with normal variance . Time taken to be delirium free was analysed by log - rank (mantel - cox) test . Statistical analysis was done using statistical package for social sciences (spss) version 21 software (ibm, north castle, new york). A total of 60 patients were screened for the study but only 56 patients were included for final analysis [figure 1]. The demographic variables, basal apache ii score and pseudocholinesterase levels were comparable between the two groups . Neither of the patients were intubated nor on vasopressors at admission [table 1]. Consort diagram showing the number of patients included and analysed demographic characteristics the average time taken to be delirium free was 9.05 2.75 days in group c compared to 6 2.92 days in group m. analysis done with log - rank test indicated a significant difference between the two groups (chi - square = 10.710,) (p = 0.001) [figure 2]. The overall prevalence of delirium in group m (50.85%) was lower compared to group c (84.81%) (p <0.001). There was a significant reduction in the prevalence of delirium in group m after day 3, compared to day 1 (p <0.004). Less than 30% of patients in group m had delirium after day 5 compared to> 50% patients in group c which was clinically and statistically significant (p <0.001). Meir curve analysis done with log - rank test indicates that the time taken to be delirium free is significantly different in the two groups chi - square = 10.71, (p = 0.001). Group c (represented as group 1 in figure) took significantly longer time to be delirium free than group m (represented as group 2 in figure) (9.053 days vs. 6.0 days) the consumption of fentanyl and midazolam was also lower in group m compared to group c [table 2 and figure 3a, b]. The requirement for lorazepam and atropine was not different between the two groups [table 2]. Comparison of outcome measures between two groups (a and b) comparison of average daily requirement of fentanyl (a), midazolam and atropine (b) between groups, fentanyl and midazolam requirement was significantly lower in group m after day (p <0.05) the mean heart rate was lower in group m compared to group c; however, it was statistically significant only on days 2, 6, 7, 8, 9 and 10 . The mean arterial blood pressures were comparable between two groups throughout the period of icu stay [figure 4]. Number of patients requiring mechanical ventilation was 21 (56.76%) in group c as compared to 16 (43.24%) in group m (p = 0.50). The mean number of days of ventilation was 5.26 5.52 days in group c as compared to 3.88 3.52 days in group m (p = 0.26) [table 2]. Both were not statistically significant duration of icu stay was 9.36 6.35 days in group c as compared to 7.65 3.58 in group m (p = 0.21) [table 2] which was not statistically significant . Comparison of mean heart rate and mean arterial pressures between groups anova and rmanova tests were used for intergroup and intragroup comparison of drug consumption over first 4 days . Atropine (p = 0.151), lorazepam (p = 0.708) consumption showed no significant difference within or between groups . Fentanyl and midazolam consumption was significantly lower in group m compared to group c. further, stratified analysis using cochrane - mantel - hanzel chi - square test to reduce the effect of confounding variables (midazolam, fentanyl, apache score) also showed more delirium free subjects in group m compared to group c (p = 0.0010). There was no significant association between the number of patients having delirium and the duration of mechanical ventilation . There were no side effects observed in any of the patients such as vomiting, headache, rashes and itching following drug administration . Five patients in group c developed sepsis and one patient in group m developed ventilator - associated pneumonia . Three patients required tracheostomy in view of prolonged ventilation of> 10 days in group c as compared to none in group m. there was no mortality in any of the groups during icu stay . The present study shows that time taken to be delirium free was shorter and prevalence of delirium was lower in opcp patients receiving melatonin . The requirement of sedation was also reduced . However, there was no difference in the duration of mechanical ventilation and icu stay . Society of critical care medicine recommends that all icu patients should be evaluated for delirium, and it is evaluated by cam - icu . The cam - icu method was originally validated by ely et al . For assessing delirium and it was further used by other authors later on . It was found to be highly sensitive and specific, with a high inter - rater reliability, which allows easy and reliable assessment of delirium, even by non - psychiatric physicians and others . Delirium commonly seen in opcp may be due to inhibition of acetylcholinesterase and imbalance between antioxidants and oxidants . It can also be due to pesticide itself, hypoxia, alcohol, other medical conditions and, atropine at therapeutic doses causes toxicity (delirium). Delirium, sleep deprivation or excessive sedation can interfere with the assessment of patient's neck muscle weakness and general condition . This can lead to difficulty in weaning from mechanical ventilation in opcp patients, leading to increased duration of icu stay and an overall increase in the costs . Melatonin is mainly produced in the pineal gland from tryptophan, and acts through multiple receptor sites including opioidergic, benzodiazepinergic, muscarinic, nicotinic and most importantly melatonergic receptors present in the central nervous system and dorsal spinal cord . The drug melatonin (3 mg) has been approved by drug controller general of india as a sedative for sleep disorder, jet lag and circadian rhythm disorders . Studies with different doses of melatonin on sleep and sedation in critically ill patients was found to be safe . In a study assessing the pharmacokinetic property of the drug, melatonin at a dose of 3 mg, in critically ill patients had satisfactory oral bio - availability and also pharmacological levels were maintained up to 10 h following administration . Studies assessing the effect of melatonin on delirium have shown contrasting results . In a recent study, administration of 0.5 mg oral melatonin in elderly patients at night resulted in a reduction of incidence of delirium, whereas a dose of 3 mg in elderly patients with hip fracture did not reduce the incidence of delirium but reduced the duration of delirium . In the present study, administration of melatonin decreased the duration of delirium and prevalence was reduced from the 3 day significantly . Administration of oral melatonin perioperatively produced clinically relevant anxiolytic, sedative and analgesic - sparing effect in various types of surgeries . It also reduced tourniquet - related pain and produced analgesia in orthopaedic upper limb surgeries, in the present study, it was observed that melatonin administration decreased the requirement of midazolam and fentanyl . It has been observed that melatonin added to p2am and atropine in the treatment of acute opcp poisoning increases acetylcholinesterase activity in brain tissue, and shows a beneficial effect on brain injury by decreasing lipid peroxidation and oxidative stress in brain tissue which may explain the beneficial effects observed in our study . In a recent meta - analysis, assessing the influence of delirium on outcome in icu patients, the overall risk ratio for death in patients, severity of illness and the adjusted risk of mortality was high in patients with delirium . In similar analysis, there was increased length of stay and duration of mechanical ventilation in intensive care in patients with delirium . We did not find any difference in the number of patients requiring mechanical ventilation and duration of mechanical ventilation and icu stay which may be attributed smaller sample size . Since the primary aim of this study was to assess the effect of melatonin on the duration of delirium due to opcp and its treatment, we excluded patients with apache score> 20 (severely ill). There was attrition of data after 4 days, due to shift out of the patients to wards and hence validity of the study is limited . We could not follow the patients in the wards, and there was data loss on retrospective analysis of their case sheets and hence we are not able to comment about hospital stay or mortality after discharge from icu . However, none of the patients included in the study died during icu stay . Effect of melatonin on sleep quality of these patients could not be commented since sleep quality was not monitored in the present study, which is a major limitation . In this study, we did not obtain the basal blood levels of melatonin which would have thrown further light on the possible effect of opcp on melatonin and consequently, delirium . Future multicentric studies with larger sample size, sufficiently powered enough to assess the effect of melatonin on the overall outcome of the patient may be required before using this drug on a routine basis . Melatonin when given to organophosphate compound poisoning patients at a dose of 3 mg orally reduces the prevalence and duration of delirium.
Laparoscopic sleeve gastrectomy (lsg) is currently one of the most commonly performed bariatric surgeries in the world . Known perioperative complications include haemorrhage, leak, small bowel obstruction and infections (mostly wound and intra - abdominal abscess). Intra - abdominal abscess presents in <1% of all procedures, and, to the best of our knowledge, only six cases of splenic abscess as a complication of lsg exist in the literature [26]. A 45-year - old woman with a past medical history significant for essential hypertension, asthma and morbid obesity status post lsg 20 days before admission, presented with abdominal pain of 10 days duration . The pain was localized to the left upper quadrant and was associated with fever, chills, nausea and infrequent vomiting . At the time of the lsg, her post - operative course was uneventful and she was discharged home 3 days after admission . However, she had not attempted any solid food due to nausea . On admission, physical exam was significant for mild pain on palpation of the left upper abdominal quadrant . A computed tomography (ct) of the abdomen was obtained and showed a well - circumscribed 7.1 by 5.4 cm air - fluid collection in the medial aspect of the spleen . Of note, an upper gastrointestinal series with gastrografin showed no evidence of leak from her gastrectomy staple line . The patient was started on empiric piperacillin / tazobactam and a ct - guided drainage of the abscess was performed . The patient was treated with meropenem and linezolid for 4 days, and then switched to intravenous ceftriaxone once the microbiology results became available . She was discharged home to complete 2 weeks of intravenous antibiotics . However, after 3 weeks the patient returned to the hospital with new left upper abdominal pain that referred to the left shoulder, poor oral intake, fever and shortness of breath . A repeat ct of the abdomen showed an air - fluid collection in the medial spleen comparable in size to the one present at post drainage . A ct - guided drainage of the splenic abscess was performed and the patient was discharged home to complete 2 weeks of intravenous ceftriaxone and oral metronidazol . Splenic abscess is a rare occurrence, with the vast majority of the available literature consisting of case reports and series from tertiary care centres . Splenic abscess as a complication of lsg appears to be an extremely rare entity with only six cases in the literature [26]. These patients were ages 1946, none had a reported immunosuppressive condition, presented in the late post - operative period, and only one had an intraoperative complication (table 1). Previous authors have pointed out that splenic abscess in the bariatric population could have a different aetiology from the classically described in the general population . Among the proposed factors are extension from a gastric staple - line leak, splenic injury during surgery and inadvertent splenic ischaemia [3, 6]. Regarding the latter, in a recently published series of 565 lsg, 0.53% presented with splenic abscess in post - operative days 914 . Interestingly, the authors of this paper reviewed the video recordings of all cases and reported a rate of spleen infarcts of 7.79% . All splenic abscesses in this series had evidence of infarct during the original procedure, leading them to suggest that they are both related . A similar study with closer follow - up suggested this as well . In our case, there was no evidence of intraoperative injury to the spleen, staple - line leak or splenic ischaemia . The causative agent was s. anginosus, usually found as a commensal of the oral cavity and gastrointestinal tract, but capable of suppurative infections that are often associated with antecedent disruption of the gastrointestinal mucosa . In the present patient, without any obvious perforation or anastomotic leak, haematogenous spread caused by transient bacteraemia during the surgical procedure is certainly a possibility . She responded well to the combination of intravenous antibiotics and percutaneous drainage, and there was no need for splenectomy . Table 1characteristics of previous case reports of splenic abscess as a complication of lsg.case (reference)age / seximmunosuppressionimmediate complicationspost - operative day of presentationtreatmentevidence of leakagecultured organismrojas et al . 46/fnohaemoperitoneum, splenic hilum and hepatic injury14iv antibiotics, percutaneous drainageyess . No75iv antibiotics, percutaneous and laparoscopic drainagenostaphylococcusspp.,enterobacter cloacae, streptococcus mitis and oralisavulov et al . 44/mnono70iv antibiotics, percutaneous drainage, splenectomynoklebsiella pneumoniae, streptococcus pneumoniae, acinetobacterspp.current study, 201645/fnono20iv antibiotics, percutaneous drainagenos . Anginosus characteristics of previous case reports of splenic abscess as a complication of lsg . In conclusion, splenic abscess is an uncommon complication of lsg, albeit one that should be entertained in the patient with abdominal pain and fever given its high mortality . A ct of the abdomen with contrast is the preferred diagnostic tool; patients should be treated with a combination of intravenous antibiotics and either percutaneous drainage or splenectomy . Further studies with a larger sample of lsg patients should be conducted in order to elucidate the role of splenic ischaemia in abscess formation.
Besides its classical role in calcium and bone homeostasis, vitamin d is considered a potent immunomodulator that can affect the pathogenesis of several autoimmune diseases . Our aim is to evaluate the effect of vitamin d correction to a patient with new onset graves disease (gd) with an underlying vitamin d deficiency . We describe the effect of vitamin d3 on untreated graves disease with vitamin d deficiency . A healthy saudi woman in her 40s sought consultation with a three - month history of palpitation . She denied any history of heat intolerance, weight loss, menstrual irregularity or sweating . . Physical examination revealed a mild diffusely enlarged and non - tender thyroid gland with no bruit . The initial thyroid function test, which was done in an outside hospital, revealed a tsh, 0.01 miu / l; ft4, 22.5 vitamin d 25-oh level was done in our hospital and showed a result of 26.0 nmol / l with a tsh, 0.013 miu / l; ft4, 16.7 tc-99 m thyroid scintigraphy demonstrated an enlarged thyroid gland with increased radiotracer trapping and heterogeneous distribution . The patient was given only oral cholecalciferol 4000 iu per day since november 2012 (prescribed by an outside hospital) then from may 2013 onwards she was given 50,000 iu per month . Follow - up laboratory exams revealed improved vitamin d levels as well as tsh and ft4 . Vitamin d deficiency may exacerbate the onset and/or development of gd and correction of the deficiency may be able to reverse it . However, further prospective clinical studies will be needed to define the role of vitamin d treatment in gd . More recently, vitamin d has been shown to be a modulator in both innate and adaptive immunity.1 there is a well - established link between vitamin d deficiency and various autoimmune diseases, including type 1 diabetes mellitus (t1 dm), systemic lupus erythematosus (sle), rheumatoid arthritis (ra), inflammatory bowel disease (ibd), and multiple sclerosis (ms). Furthermore, it has been found that the supplementation of vitamin d can prevent the onset and/or development of different kinds of autoimmune disorders in human beings and animal models.2 in addition, it has been shown that the prevalence of vitamin d deficiency is common in patients with graves disease (gd),3 and is associated with higher thyroid volume.4 in our case report, we evaluated the effect of vitamin d correction to a patient with new onset gd with an underlying vitamin d deficiency . A healthy saudi woman in her 40s sought consultation with a 3 months history of palpitation . She denied any history of heat intolerance, weight loss, menstrual irregularity, diarrhea, or sweating . There was no personal or family history of thyroid disease and no specific medication history . Physical examination revealed a mild diffusely enlarged and non - tender thyroid gland with no bruit . The initial thyroid function test, which was done in an outside hospital, revealed a tsh, 0.01 miu / l; ft4, 22.5 vitamin d 25-oh level was done in our hospital and showed a result of 26.0 nmol / l with a tsh, 0.013 miu / l; ft4, 16.7 anti - thyroid antibodies showed a tg, 17.1 iu / ml; tpo, 0.19 iu / ml with a positive tsh receptor antibody . Tc-99 m thyroid scintigraphy demonstrated an enlarged thyroid gland with increased radiotracer trapping and heterogeneous distribution (fig . The patient was given only oral cholecalciferol 4000 iu per day since november 2012 (took it from an outside hospital) then from may 2013 onwards she was given 50,000 iu per month . The serial thyroid function tests, vitamin d levels, and titer autoantibodies are summarized in table 1 . Follow - up laboratory exams revealed improved vitamin d levels as well as tsh and ft4 . Written informed consent was obtained from the patient for the publication of this case and accompanying images . It has become apparent that multiple factors contribute to the etiology of gd, including genetic and environmental factors . These activated t cells in turn increase the secretion of thyroid - specific autoantibodies from b cells . The prevalence of vitamin d deficiency was reported to be common in patients with gd.3 whether vitamin d deficiency has a causal relationship with gd remains a controversial issue . Misharin et al.5 observed that vitamin d deficiency was found to modulate graves hyperthyroidism induced in balb / c mice by thyrotropin receptor immunization . In this study, balb / c mice on a vitamin d deficient diet were more likely to develop persistent hyperthyroidism than other mice receiving adequate vitamin d supply . In another study, combination treatment with methimazole and vitamin d3 (1,25 (oh)2d) in patients with gd has more rapid euthyroidism achievement compared with patients receiving methimazole alone.6 in addition, vitamin d supplementation has been shown to inhibit inflammatory responses in human thyroid and t cells.7 interestingly, vitamin d deficiency is found to be associated with higher thyroid volume in patients with newly onset gd.4 it has been recently discovered that vitamin d - receptor gene and vitamin d - binding protein gene polymorphisms are associated with gd.8,9 our present case supports the current literature and strongly suggests that vitamin d deficiency may exacerbate the onset and/or development of gd and correction of which may be able to reverse it . However, further prospective clinical studies will be needed to define the role of vitamin d treatment in gd.
Obesity has reached epidemic proportions in the united states, with recent data indicating that more than 78 million adults (36%) and 12.5 million children and adolescents (17%) in the united states have this disorder [1, 2]. The enormous health and economic tolls of obesity and its profound adverse effects on quality of life underscore the need for both increased prevention and effective treatment [3, 4]. Obesity has been linked to more than 65 comorbidities, including coronary artery disease, type 2 diabetes mellitus, hypertension, hypercholesterolemia, more than a dozen cancers, and a host of other disease processes . Although obesity has a substantial impact on patient care in all disciplines in medicine, physician and medical student education about obesity is limited [6, 7]. These educational gaps may leave physicians inadequately prepared to address the needs of this substantial and growing portion of their patient population . Previous studies of physician treatment of obesity demonstrate that there is limited physician - directed care in obesity . Others recognize obesity as a disease but choose not to address obesity during their limited time with patients [811]. Few studies, however, have assessed the root cause of physician perceptions about obesity and its treatment . Attitudes about healthcare in general and obesity in particular are often shaped during medical school and residency training . In order to adequately train physicians to tackle obesity, evidence strongly suggests that primary care providers lack confidence in their knowledge and skills in providing obesity care . In our study, we sought to determine whether obesity training correlated with knowledge, beliefs, and attitudes about the etiology of and treatment of patients with obesity . We therefore hypothesize that primary care physicians who have undergone obesity training will be more likely to answer questions correctly regarding care for patients with obesity and to consider multiple modalities of treatment to help patients achieve durable control of their obesity and its sequelae [15, 16]. Among the many important targets for physician education about obesity are better understanding of its physiologic basis, complexity, and heterogeneity; diminishing negative attitudes towards patients with obesity; mitigation of obesity bias; and recognition that even modest weight reduction can lead to a substantial improvement or prevention of comorbidities which appear to be particularly important [1720]. We established an online survey for adult primary care physicians in practices affiliated with the massachusetts general hospital (mgh). Within partners healthcare, mgh provides primary care to more than 200,000 patients in 15 locations in greater boston on an annual basis . We surveyed internal medicine, internal medicine / pediatrics, and family medicine physicians through the partners healthcare research electronic data capture (redcap), a secure, web - based application designed to support data capture for research studies . Of the 237 surveys sent to mgh primary care physicians via redcap, 76 survey participants (32%) completed the survey . Participants who completed the survey were offered educational materials from the 2014 harvard medical school course in obesity medicine . We obtained demographics including (a) primary medical specialty, (b) gender, (c) degree type, (d) racial / ethnic background, (e) age, (f) weight, (g) height, (h) personal history of overweight or obesity, (i) year of medical school graduation, (j) county of birth, and (k) personal history of chronic diseases . In addition to demographics, we obtained information on primary care physician's personal health habits (i.e., frequency of disclosure of nutrition, physical activity, stress reduction methods, and use of smartphone application to manage weight), obesity training (i.e., duration and type of obesity training: lecture, online training, group discussion, hospital rotation, and special topic course), frequency of recording a diagnosis of overweight or obesity in the electronic medical record, knowledge of bariatric surgery care, perceptions, attitudes, and beliefs regarding obesity treatment . We used descriptive statistics to characterize our sample according to whether or not physicians received obesity related training . We calculated mean body mass index (bmi) for each training group, and we characterized obesity training into two categorical variables: no obesity training and some obesity training . No obesity training was defined as those who received less than one hour of training of any type (e.g., lecture, online training, group discussion, hospital rotation, and special topic course). Chi - square analyses and fisher's exact test were used to evaluate differences in proportions for those who received obesity training and those who did not receive obesity training . In addition, we conducted multivariable logistic regression models and classified those who received some obesity training and those who were confident in their ability to treat obesity as the outcome . Gender, age, and bmi were used as explanatory predictor variables for those who received some obesity training and for those who were confident in their ability to treat obesity . To characterize differences in those who received obesity training, we conducted an additional multivariable model, which examined the association between age and physicians' confidence in treating obesity and receiving obesity training (outcome) or receiving no obesity training (outcome). 59% of physician survey respondents (41 physicians) received at least one hour of obesity training . In both categories (no obesity training versus some obesity training), adult primary care physician survey respondents were most likely to have the following demographics: normal bmi, female, caucasian, no chronic disease processes, and completion of an internal medicine residency . Younger physician respondents, those aged 2039, were more likely to have received some obesity training compared to physicians 40 and older . Table 2 characterizes physician's perceptions of obesity by obesity training . While these results were not statistically significant, physicians with obesity training were more likely to believe that obesity is a chronic disease process, refer appropriate patients for bariatric surgery evaluation, and feel that bariatric surgery is a safe and useful tool for appropriate patients . Physicians with obesity training were significantly more likely to answer bariatric surgery knowledge questions correctly when compared with those without training . In table 4, age, specifically being in the 2039 age group, was significantly associated (p <0.05) with the likelihood that a physician survey respondent received some obesity training . In table 5, younger physicians (age 2039), physicians with normal weight, and those with some obesity training were more likely to feel confident in treating obesity . In table 6, persons who did not receive any obesity training appear more confident in their ability to treat obesity, but this result was not statistically significant . As noted in figure 1, physicians with some obesity training were more likely to disclose their own personal habits to influence the behavior of their patients . Physicians with some obesity training were most likely to consider the following to be major barriers to evaluating and/or managing patients with overweight and obesity in their practice: (1) not having enough time, (2) not being part of my professional role, (3) inadequate training, (4) fear of offending the patient, (5) too difficult for patients to change, (6) lack of effective tools and information to give to patients, and (7) long wait times for referrals to obesity medicine specialists (supplemental figure 1 in supplementary material available online at http://dx.doi.org/10.1155/2015/841249). Alternatively, physicians with no obesity training were most likely to consider the following to be major barriers to evaluating and/or managing patients with overweight and obesity in their practice: (1) inadequate reimbursement, (2) lack of adequate referral services for diet, physical activity, and weight, (3) patients being generally not interested in improving their weight status, and (4) lack of effective treatment options . Across all questions in which physician survey respondents were given a scenario to consider various treatment modalities for patient with obesity, physicians with some obesity training were more likely to consider all possible treatment options to help a patient lose weight (self - direction, allied health, and physician directed therapy, weight loss medications, and bariatric surgery) than those with no obesity training (supplemental figures 24). In june 2013, the american medical association (ama) voted to acknowledge obesity as a chronic disease, and it has promoted a robust discussion in the medical community about the range of interventions which should be utilized to prevent and treat obesity . Bleich and colleagues evaluated physician practice patterns of obesity diagnosis and weight - related counseling in a national cross - sectional study . They found that primary care physicians overwhelmingly supported additional training in obesity, and these physicians felt that nutritionists / dietitians were most qualified to provide obesity care . Jay and colleagues evaluated internal medicine, pediatrics, and psychiatry physicians from an academic institution, and they determined that physician attitudes towards obesity are associated with competency (more competency with better attitudes), specialty (pediatrics specialists with more positive attitudes than psychiatry and internal medicine specialists), and years since postgraduate training (those with fewer years since postgraduate training with more positive attitudes). Unfortunately, a majority of patients with obesity do not receive any weight loss advice from health professionals, and when they do receive advice it is usually restricted to information on calorie reduction and increased physical activity [26, 27]. Physicians should investigate other factors which might contribute to increased weight such as poor sleep quality and duration, circadian rhythm disturbances, and use of weight promoting medications . In addition, studies have shown that rates of weight counseling by primary care physicians have declined despite increased rates of overweight and obesity in the united states [26, 28]. In a review conducted by teixeira and colleagues of thirteen studies between 1991 and 2011 in which they synthesized the main investigation results regarding beliefs, attitudes, and practices of healthcare providers, they found that lack of appropriate understanding and adequate competence regarding obesity likely contributes to ambivalent belief development and negative attitudes toward obese individuals, who are described as unmotivated, lazy, and lacking self - control . Physicians with greater knowledge, more positive attitudes toward obesity management, and access to more resources are more likely to provide weight management in primary care settings . One important barrier that impedes optimal care delivery to patients with obesity is weight bias and stigma . In a national sample of over 4700 medical students, they determined that a majority of students exhibited implicit (74%) and explicit (67%) weight bias . In another study of postgraduate health discipline students, puhl and colleagues reported that patients with obesity are a common target of negative attitudes and derogatory humor by peers (63%), healthcare providers (65%), and instructors (40%). It must be noted that physicians themselves also experience weight bias from patients as studies have demonstrated that providers perceived to be overweight or obese are vulnerable to biased attitudes from patients and that providers' excess weight negatively affects patients' perceptions of their credibility, level of trust, and inclination to follow medical advice . In this cross - sectional web - based survey, we assessed primary care physician knowledge and training in obesity, obesity treatment and referrals patterns, and attitudes and beliefs about obesity . Younger physicians (aged 2039) were most likely to have received some obesity training . Physician survey respondents who were young (age 2039), had obesity (bmi 30 kg / m), and had some obesity training (> 1 hour) were significantly more likely to answer bariatric survey knowledge questions correctly compared to their peers . They were also more likely to consider multiple modalities to treat patients who have obesity . The results of our study should be interpreted in the context of its limitations . While our survey ascertained several aspects of obesity and perceptions, knowledge, and attitudes of our physician survey respondents, it is difficult to generalize our results to all primary care physicians . Our study was conducted at a large academic medical center in which there are practitioners with less racial / ethnic and medical training diversity than other sites which indicates that survey respondents are not likely representative of physicians throughout the united states . Additionally, our survey respondents have access to a large tertiary care referral center in which obesity medicine physicians, psychologists, and dietitians provide care to patients whom they have difficulty helping to achieve a healthy weight . There was likely selection bias in the survey respondents with regard to physicians who have an interest in obesity, and this bias likely contributed to a lower than expected response rate to the survey . Finally, many physician survey respondents did not receive more than one hour of obesity education in their entire postgraduate training . It is challenging to decipher whether this small amount of training can be correlated with better patient outcomes . Our current study supports previous studies which show that physicians do not receive adequate training in obesity . Survey responses indicate that obesity training increases physician knowledge of obesity treatment and may improve treatment rates and diversify treatment options for patients with obesity . Given the high prevalence of obesity and its role in causing, exacerbating, or complicating many other chronic diseases, there appears to be an important need for educational programs focused on improving resident and physician knowledge about obesity and comorbidities . Physicians should be knowledgeable about the impact of obesity in their patient population and be adequately prepared to assess obesity and administer care to patients with obesity in inpatient and outpatient settings . Finally, they should strive to eliminate their implicit and explicit weight bias towards patients with obesity so they are able to provide unparalleled care to this growing segment of the population.
Keratoconus is described as a degenerative bilateral, progressive, noninflammatory corneal disorder characterized by ectasia, thinning, and increased curvature.1,2 it is associated with loss of visual acuity particularly in relation to progressive cornea irregularity,3,4 and usually is manifested asymmetrically between the two eyes of the same patient.5,6 occasionally, the patient may present with symptoms of photophobia, glare, and monocular diplopia . The problem of specificity and sensitivity of keratoconus assessment, particularly the diagnosis of early signs of ectasia and/or subclinical keratoconus, and for monitoring the progression of the disease, has been extensively studied.7 the commonly used options for the clinician include optically - based anterior segment imaging modalities, eg, placido corneal topography8,9 and slit or scheimpflug imaging,10 that provide corneal surface qualitative and quantitative data . Rotating camera scheimpflug imagery (pentacam, oculus optikgerte gmbh, wetzlar, germany), provides a multitude of corneal refractive (keratometric), topometric, tomographic, and pachymetric data.11,12 in addition, specific anterior - surface irregularity indices have been developed for the grading and classification of keratoconus development, as well as the post - operative assessment.1319 the aim of this study was to investigate the values of these indices, the repeatability of their measurement, and their correlation with best spectacle - corrected distance visual acuity (cdva), keratometry, and commonly used keratoconus classification in a large pool of clinically diagnosed keratoconic eyes . Rotating camera scheimpflug imagery (pentacam, oculus optikgerte gmbh, wetzlar, germany), provides a multitude of corneal refractive (keratometric), topometric, tomographic, and pachymetric data.11,12 in addition, specific anterior - surface irregularity indices have been developed for the grading and classification of keratoconus development, as well as the post - operative assessment.1319 the aim of this study was to investigate the values of these indices, the repeatability of their measurement, and their correlation with best spectacle - corrected distance visual acuity (cdva), keratometry, and commonly used keratoconus classification in a large pool of clinically diagnosed keratoconic eyes . This study received approval from the ethics committee of the authors institution, adherent to the tenets of the declaration of helsinki . Informed consent was obtained from each subject at the time of the first clinical visit . Subjects ages ranged from 1957 years (average 31.9 7.5 years). Each case was subjected to a complete ocular examination, including subjective refraction, cdva measurement with this refraction, and slit - lamp biomicroscopy for clinical signs of keratoconus . Inclusion criteria included a minimum age of 18 years and definite findings consistent with keratoconus, such as those described by the cleck (collaborative longitudinal evaluation of keratoconus) group.20 exclusion criteria included systemic disease, previous corneal surgery, history of chemical injury or delayed epithelial healing, and pregnancy or lactation during the study (for the female patients). Anterior segment evaluation, including anterior segment imaging measurements with the pentacam scheimpflug rotating camera, was performed on each case . The pentacam measurements were obtained and processed via the examination software (version 1.17r47). For each eye, four consecutive measurements were obtained and processed to test for data acquisition repeatability . Descriptive and comparative statistics, analysis of variance between keratoconus amsler krumeich stage subgroups, and linear regression were performed with statistics tools provided by minitab version 1.6 (minitab inc, coventry, uk) and origin version 9 (originlab corporation, northampton, ma, usa). Subjects ages ranged from 1957 years (average 31.9 7.5 years). Each case was subjected to a complete ocular examination, including subjective refraction, cdva measurement with this refraction, and slit - lamp biomicroscopy for clinical signs of keratoconus . Inclusion criteria included a minimum age of 18 years and definite findings consistent with keratoconus, such as those described by the cleck (collaborative longitudinal evaluation of keratoconus) group.20 exclusion criteria included systemic disease, previous corneal surgery, history of chemical injury or delayed epithelial healing, and pregnancy or lactation during the study (for the female patients). Anterior segment evaluation, including anterior segment imaging measurements with the pentacam scheimpflug rotating camera, was performed on each case . The pentacam measurements were obtained and processed via the examination software (version 1.17r47). For each eye, four consecutive measurements were obtained and processed to test for data acquisition repeatability . Descriptive and comparative statistics, analysis of variance between keratoconus amsler krumeich stage subgroups, and linear regression were performed with statistics tools provided by minitab version 1.6 (minitab inc, coventry, uk) and origin version 9 (originlab corporation, northampton, ma, usa). The sample population consisted of 212 cases, which consisted of 65 female and 147 male patients . The preponderance towards males in the population is consistent with the authors clinical experience in male / female incidence in keratoconic patients21 and keratoconus incidence studies.22 of the 212 eyes, 113 were the right eye and 99 were the left eye . The average age of all patients was 31.77 7.23 (range 1957) years . The average standard deviation cdva (expressed decimally) for all eyes was 0.626 0.244 (range 0.101.00). Average, standard deviation, maximum and minimum corneal surface keratometry, and topometric indices for all eyes in the study are reported in table 1 . Intraindividual repeatability was assessed via the standard deviation of the four consecutive measurements undertaken for each eye . The average standard deviation of repeatability for the seven topometric indices in all 212 eyes measured is reported in table 2 . The sample was presented with an average keratometry on the anterior surface flat axis of 46.7 5.89 d and 51.05 6.59 d on the steep axis . The statistical analysis showed that 95% of the sample population had a steep axis keratometry> 46.025 d, consistent with the clek group standards.20 paired statistics between cdva and the index of height decentration (ihd), index of surface variance (isv), index of vertical asymmetry (iva), keratoconus index (ki), central keratoconus index (cki), index of height asymmetry (iha), and minimum radius of curvature (rmin) (in the 8 mm zone) and specifically the coefficient of determination (r) and pearson linear regression data between cdva and the ihd, isv, iva, ki, cki, iha, and rmin indices within all eyes in the study group (n = 212) are reported in table 3 . The correlations between the seven keratoconic anterior surface topometric indices with cdva are illustrated in figure 1a g . Specifically, the scatter and fitted line plots of isv (figure 1a), iva (figure 1b), ki (figure 1c), cki (figure 1d), iha (figure 1e), ihd (figure 1f), and rmin (figure 1 g) versus cdva are plotted, in addition to the 95% confidence (ci) and 95% prediction interval (pi) lines . The paired data present with coefficient of determination (r) of linear correlation with cdva of 0.557 for isv, 0.34 for iva, 0.424 for ki, 0.396 for cki, 0.107 for iha, 0.393 for ihd, and 0.516 for rmin . The pearson correlation values versus cdva were 0.746 for isv, 0.584 for iva, 0.680 for ki, 0.642 for cki, 0.344 for iha, 0.627 for ihd, and 0.718 for rmin . In all cases, the 212 eyes were subjected to keratoconus amsler - krumeich stages grading23 by the pentacam software . The resulting grading designated n1 = ten eyes as stage i, n12 = eleven eyes as stage i ii, n2 = 32 eyes as stage ii, n23 = 22 eyes as stage ii iii, n3 = 54 eyes as stage iii, n34 = 45 eyes as stage iii iv and n4 = four eyes as stage iv the correlations between cdva and the seven scheimpflug anterior surface keratometric and topometric indices with the above keratoconus grading are illustrated in figure 2a h . Descriptive statistics for the keratoconus grading subgroups for cdva and the seven topometric indices are presented in table 4, and two - sample t - test results (not assuming equal variances) between the keratoconus grading subgroups for cdva and the seven topometric indices are presented in table 5 . The sample population consisted of 212 cases, which consisted of 65 female and 147 male patients . The preponderance towards males in the population is consistent with the authors clinical experience in male / female incidence in keratoconic patients21 and keratoconus incidence studies.22 of the 212 eyes, 113 were the right eye and 99 were the left eye . The average age of all patients was 31.77 7.23 (range 1957) years . The average standard deviation cdva (expressed decimally) for all eyes was 0.626 0.244 (range 0.101.00). Average, standard deviation, maximum and minimum corneal surface keratometry, and topometric indices for all eyes in the study are reported in table 1 . Intraindividual repeatability was assessed via the standard deviation of the four consecutive measurements undertaken for each eye . The average standard deviation of repeatability for the seven topometric indices in all 212 eyes measured is reported in table 2 . The sample was presented with an average keratometry on the anterior surface flat axis of 46.7 5.89 d and 51.05 6.59 d on the steep axis . The statistical analysis showed that 95% of the sample population had a steep axis keratometry> 46.025 d, consistent with the clek group standards.20 paired statistics between cdva and the index of height decentration (ihd), index of surface variance (isv), index of vertical asymmetry (iva), keratoconus index (ki), central keratoconus index (cki), index of height asymmetry (iha), and minimum radius of curvature (rmin) (in the 8 mm zone) and specifically the coefficient of determination (r) and pearson linear regression data between cdva and the ihd, isv, iva, ki, cki, iha, and rmin indices within all eyes in the study group (n = 212) are reported in table 3 . The correlations between the seven keratoconic anterior surface topometric indices with cdva are illustrated in figure 1a g . Specifically, the scatter and fitted line plots of isv (figure 1a), iva (figure 1b), ki (figure 1c), cki (figure 1d), iha (figure 1e), ihd (figure 1f), and rmin (figure 1 g) versus cdva are plotted, in addition to the 95% confidence (ci) and 95% prediction interval (pi) lines . The paired data present with coefficient of determination (r) of linear correlation with cdva of 0.557 for isv, 0.34 for iva, 0.424 for ki, 0.396 for cki, 0.107 for iha, 0.393 for ihd, and 0.516 for rmin . The pearson correlation values versus cdva were 0.746 for isv, 0.584 for iva, 0.680 for ki, 0.642 for cki, 0.344 for iha, 0.627 for ihd, and 0.718 for rmin . In all cases, paired statistics between cdva and the index of height decentration (ihd), index of surface variance (isv), index of vertical asymmetry (iva), keratoconus index (ki), central keratoconus index (cki), index of height asymmetry (iha), and minimum radius of curvature (rmin) (in the 8 mm zone) and specifically the coefficient of determination (r) and pearson linear regression data between cdva and the ihd, isv, iva, ki, cki, iha, and rmin indices within all eyes in the study group (n = 212) are reported in table 3 . The correlations between the seven keratoconic anterior surface topometric indices with cdva are illustrated in figure 1a g . Specifically, the scatter and fitted line plots of isv (figure 1a), iva (figure 1b), ki (figure 1c), cki (figure 1d), iha (figure 1e), ihd (figure 1f), and rmin (figure 1 g) versus cdva are plotted, in addition to the 95% confidence (ci) and 95% prediction interval (pi) lines . The paired data present with coefficient of determination (r) of linear correlation with cdva of 0.557 for isv, 0.34 for iva, 0.424 for ki, 0.396 for cki, 0.107 for iha, 0.393 for ihd, and 0.516 for rmin . The pearson correlation values versus cdva were 0.746 for isv, 0.584 for iva, 0.680 for ki, 0.642 for cki, 0.344 for iha, 0.627 for ihd, and 0.718 for rmin . In all cases, the 212 eyes were subjected to keratoconus amsler - krumeich stages grading23 by the pentacam software . The resulting grading designated n1 = ten eyes as stage i, n12 = eleven eyes as stage i ii, n2 = 32 eyes as stage ii, n23 = 22 eyes as stage ii iii, n3 = 54 eyes as stage iii, n34 = 45 eyes as stage iii iv and n4 = four eyes as stage iv the correlations between cdva and the seven scheimpflug anterior surface keratometric and topometric indices with the above keratoconus grading are illustrated in figure 2a h . Descriptive statistics for the keratoconus grading subgroups for cdva and the seven topometric indices are presented in table 4, and two - sample t - test results (not assuming equal variances) between the keratoconus grading subgroups for cdva and the seven topometric indices are presented in table 5 . The pentacam software compares the measured values with the means and standard deviations of a normal population, and helps provide color - coded flags . For example, measured values which exceed the standard deviation by a factor of more than 2.5 are classified as abnormal and highlighted in yellow, and pathological values, ie, values that exceed the standard deviation by a factor of more than three, are highlighted in red . Namely, these indices are the following: isv the unitless standard deviation of individual corneal sagittal radii from the mean curvature . It is elevated in all types of corneal surface irregularity (eg, scars, astigmatism, deformities caused by contact lenses, pachymetry). According to the manufacturer s user manual,24 an isv larger than 37 is considered abnormal (marked with yellow) and larger than 41 is pathological (marked with red). Iva: measure (expressed in mm) of the mean difference between superior and inferior corneal curvature (similar to the commonly used inferior / superior ratio).25 iva is thus the value of curvature symmetry, with respect to the horizontal meridian as the axis of reflection . An iva larger than 0.28 is considered abnormal, and larger than 0.32 is pathological . Ki: a unitless index is expressing the ratio between mean radius values in the upper and lower segment (r sagittal superior to r sagittal inferior). A ki value larger than 1.07 is considered abnormal and/or pathological . Cki: the ratio between mean radius values in a peripheral ring divided by a central ring: r sag (mean peripheral) to r sag mean center (no units). Cki is elevated especially in central pachymetric, and increases with the severity of central keratoconus . Iha: the mean difference between height values superior minus height values inferior with horizontal meridian as mirror axis (expressed in m). Iha is calculated by the height data symmetry comparison of the superior and inferior area, and provides the degree of symmetry of height data with respect to the horizontal meridian as the axis of reflection . Iha is similar to the iva but based on corneal elevation, and is thus more sensitive . An iha value larger than 19 is considered abnormal, and larger than 21 is pathological . Ihd: the value of the decentration of elevation data in the vertical direction (expressed in m), and is calculated from a fourier analysis . This index provides the degree of decentration in the vertical direction, calculated on a ring with radius 3 mm . An ihd value larger than 0.014 is considered abnormal, and larger than 0.016 is pathological . It is a measurement of the smallest radius of sagittal corneal curvature (ie, the maximum steepness of the cone). Values of rmin less than 6.71 mm are considered abnormal and/or pathological, considering that the average radius of the anterior corneal surface is 7.87 0.27 mm.26 association with these indices with clinical keratoconus observations is provided by the manufacturer and is listed in table 6 . The clinical suspicion of early - stage keratoconus may be based on refraction criteria such as a change in refractive power and the axis of astigmatism, fluctuating refraction, and several clinical findings (eg, conspicuous retinoscopy signs). Optical imaging, such as topometry and topography, provides valuable supplementary information, and it has long been supported that the contribution of proper evaluation and analysis of anterior surface irregularity derived from topography27 or more recently from pentacam topometry (eg, the seven topographic indices studied in this manuscript), may provide an invaluable aid in the diagnosis and progression evaluation of the disease.28 only two reports have been identified that address this matter of correlation of the above pentacam - derived indices with cdva29 and the severity of keratoconus classification.30 the correlation between the seven anterior surface topographic indices and cdva appears not very strong in our study . The rmin (r = 0.516, p <0.001) and isv (r = 0.557, p <0.001) were found to be the strongest correlated indices with cdva, in comparison to the other indices . The least correlated index was iha (r = 0.107, p <0.001). This could be a result of significantly worse intraindividual repeatability of this index, possibly as a result of the complicated nature of its algorithm . As indicated in table 2, repeatability, measured by the standard deviation of the measured index over four consecutive acquisitions, was as good as 1.50% on average for rmin and up to 4.6% for ihd and iva; however, the iha index had a distinctive 43.78% average standard deviation among any four consecutive measurements, indicating very poor repeatability . In addition, the iha index had the worst correlation with keratoconus severity (figure 2f) with two stages not statistically significant and the remaining also borderline . This study indicates that the correlation between keratoconus severity, and possibly very early progression indicators, and the anterior surface topographic indices can be better described with the isv (with the exception of the highest stage [stage iv], all other p - values were <0.001), followed by the ihd (with the exception of the lowest stage [stage i], all other p - values were <0.001). In addition, our results indicate that the visual performance in keratoconus was not clearly predicable for keratoconus severity, and thus cdva cannot be a dependable indicator of keratoconus severity and/or progression and therefore cannot be employed in postoperative assessment aiming to arrest keratoconus progression by, for example, crosslinking with riboflavin.31 it is customary to assess severity based on visual function and, as noted above, appears to be deceiving . For example, the data presented in this work (figure 2a) suggest that cdva is not very well correlated with the keratoconus severity, as the spread of cdva measurements within the same severity stage the average coefficient of determination (r) was in the order of 0.5, in agreement with previous studies.32 the above results are in agreement with the authors past clinical experience with a significant number of keratoconic patients followed for over 15 years . The observation has been that visual acuity can present with large variations, and can sometimes be unexpectedly good for the corresponding keratometry and overall corneal asymmetry . (ie, adaptable) cornea in addition to possible advanced neural processing development in the individual . However, these advantages are, to a large degree, compromised by the procedure of crosslinking with riboflavin applied in young (1825 years old) keratoconus patients in long - term clinical observations . Although not specifically studied herein, clinical assessment of this group is that cdva is poorly correlated to keratoconus severity mainly in younger patients . As older keratoconus patients were encountered (ie, those over 30 years old and in most of those over 40 years old), their cdva started to correlate with the isv and ihd . This observation poses an even greater reason for clinicians to employ the strongest clinical suspicion in younger patients that may be at risk for developing keratoconus and may be labeled normal if a very good cdva performance is maintained . This may be explained by the higher elasticity of the pathologic cornea in younger keratoconus patients . This age - related difference may allow them to achieve high cdva values with monocular testing by squinting and/or head tilting . Isv and ihd assessment in younger patients with relative low keratometric values may be the crucial factor in early diagnosis of keratoconus . We have encountered this clinical finding exaggerated in very young (1822 years) keratoconic patients that had in the past undergone just cross - linking stabilization . We theorize that by increasing the biomechanical stability with cxl, these patients start to more appreciate the existing corneal irregularity.31,33,34 the isv and iha, both derived from scheimpflug corneal imaging, may be more sensitive and specific tools than cdva in evaluating early diagnosis and possible progression in keratoconus patients and corneal ectasia . They may become a novel benchmark for future studies, and may aid in the development of new keratoconus diagnostic and follow - up criteria.
Il-8 also possesses a clear role in eosinophil chemotaxis in allergic respiratory diseases [2, 3]. On the other hand, il-15 effect on human eosinophil is through inhibition of the spontaneous apoptosis via the autocrine production of gm - csf and thus may perpetuate allergic inflammation by prolonged eosinophil survival . Nonetheless, the role of il-15 in the pathophysiology of allergic airways diseases is still in its infancy and remains a controversial issue [59]. Nk cells activation plays a pivotal role in viruses and tumor lyses; however, they also produce cytokines and thus are thought to play a proinflammatory role . The secretagogue activity of nk cells includes ifn-, il-10, tnf-, mip-1, mip-1, and gm - csf . These cytokines are augmented by il-15, a cytokine produced by activated monocytes / macrophages [12, 13]. Some investigators demonstrated the ability of nk cells to differentiate in the presence of il-4 into nk cell subsets secreting distinct cytokines patterns similar to th2 profile such as il-5 and il-13 [14, 15]. A more recent study demonstrated the existence of type 2 cytokine - secreting nk cells in ar and showed increased number and enhanced cytotoxicity of nk cells . Nonetheless, whether nk cells are able to attract eosinophils through il-8 secretion is not known . Increasing evidence supports a novel immunoregulatory role for vitamin d in allergic diseases such as asthma and ar [17, 18]. The ability of vitamin d to reduce cytokines from inflammatory cells is also well acknowledged . Therefore, the therapeutic potential of vitamin d as an anti - inflammatory agent in allergic diseases remains a subject of interest . Herein, we show a novel crosstalk between human nk cell and eosinophil recruitment through il-15/il-8 axis . Results are discussed in relation to the possible novel therapeutic effect of vitamin d in downregulating this inflammatory event, and the possible role for nk cells in the pathophysiology of ar . Nk cells were isolated from buffy coats to obtain large amount of cells for culture purposes, and eosinophils were freshly isolated from the peripheral blood of sixteen ar patients sensitized to different aeroallergens that were confirmed by skin tests and/or radioallergosorbent test (rast). Eosinophils and nk cells were further purified by negative selection immunomagnetic cell separation (macs; miltenyi biotec, bergisch gladbach, germany), using anti - cd16 magnetic beads for eosinophils purification, and a cocktail of biotin - conjugated antibodies against lineage - specific antigens and a cocktail of microbeads (nk cell isolation kit - human, miltenyi biotec, bergisch gladbach, germany) for nk (cd56+ve cd3-ve) cells purification . Nk cells (1 10 cells) were incubated in the presence or absence of 1 ng / ml il-15 (r&d systems; minneapolis, mn), 10 m concentration of vitamin d3 (cayman chemical), 10 m concentration of h-89 dihydrochloride (vwr - calbiochem), a pka inhibitor, 10 m concentration of bisindolylmaleimide (vwr - calbiochem), a pkc inhibitor, 10 m concentration of sb203580 (vwr - calbiochem), a p38 map - kinase inhibitor, or 1 m concentration of genistein (sigma), a tyrosine kinase inhibitor, at 37c-5% co2 with 1 ml rpmi-1640 supplemented with 100 u penicillin / ml and 100 g streptomycin / ml (lonza, verviers, belgium), 10% of inactivated fetal calf serum (lonza) in 24 wells plate (bd biosciences). After 72 h incubation period, supernatants were carefully collected and analysed for their eosinophilotactic activity or il-8 content . As for the measurement of il-8 content induced by peripheral blood nk cells from ar patients before and after nasal challenge, peripheral blood nk cells were purified from additional four ar patients to house dust mite (hdm). After obtaining the patients consent, 30 mls of peripheral blood was obtained before and 6 hours after nasal challenge with hdm allergen . Purified nk cells at the concentration of 3 10 cells / ml were incubated in the culture medium for 72 hrs . Chemotaxis assays were performed in triplicate in a 48-well microchemotaxis boyden chambers incubated in 5% co2 at 37c for 90 min . Aliquots of 29 l of the nk supernatant were placed in the lower wells and 50 l of eosinophils suspension (10 cells / ml) were placed in the upper wells . The two chambers were separated by a 5.0 m pore polycarbonate membrane (nuclepore, whatman, middlesex, uk). Migrated cells adherent to the lower surface were counted in 5 selected high power fields / well under a light microscope (5 hpf; x400). As for blocking experiments, nk supernatants were preincubated for 1 h and during the chemotaxis assay, with different doses (1010 g / ml) of the monoclonal anti - il-8ab that neutralizes the biological activity of il-8 (r&d systems; minneapolis . The content of il-8 was measured in supernatants of nk cells using human il-8 cytoset kit (invitrogen corporation, usa) according to the manufacturers' recommendations . Nk cells treatment with the optimal dose of 1 ng / ml il-15 during the culture period resulted in significant augmentation of nk cells supernatant - induced eosinophil chemotaxis from ar patients to almost 3-fold chemotaxis index . These results indicate a novel autocrine activity for nk cells in recruiting eosinophils and highlight a novel role for il-15 in up - regulating this effect . Figure 2 shows that eosinophil chemotaxis of ar patients against nk supernatant of cells treated by il-15 was significantly blocked by anti - il-8 ab . The blocking activity was in a dose - dependent fashion, but was not completely blocked to the control level . These results indicate that nk cells stimulated by il-15 secrete eosinophilotactic chemokines that include at least in part il-8 among others . To confirm this, we next measured by elisa the amount of il-8 spontaneously secreted by nk cells, and the modulatory effects of il-15 and vitamin d3 on il-8 secretion . We tested the amount of il-8 secreted by nk cells after 72 h culture period in the presence and absence of the optimal doses of il-15 or vitamin d3 . As can be seen in table 1, cultured nk cells for 72 h secreted il-8 . The amount of recovered il-8 was increased from 88.64 21.5 to 178.9 23.6 pg / ml and was significantly reduced by vitamin d3 to 59.2 16.3 pg / ml . These results indicate the ability of il-15 to upregulate the il-8 secretagogue activity by nk cells, and the ability of vitamin d3 to significantly inhibit the il-8 secretagogue activity of nk cells . Furthermore, it confirms the contribution of il-8 to the eosinophilotactic cytokines secreted by nk cells . However, to gain insight into the possible signal pathway involved in nk cell induced - il-8 modulation by il-15 and vitamin d3, we treated nk cells with different kinases inhibitors during the culture period . Dihydrochloride, bisindo - lylmaleimide, or genistein did not modulate the amount of il-8 secreted by nk cells (data not shown). However, as can be seen in table 1, il-8 secretion by nk cells was sensitive to sb203580 and resulted in reduction of il-8 to 15 0.5 pg / ml . Similarly, the augmentation of il-8 secretion by il-15 was reduced by sb203580 to 54.75 5.7 . These results may indicate the involvement of p38 map - kinase pathway in the signal transduction of il-8 secretion by nk cells . Finally to further correlate our results to the pathophysiology of ar, we challenged ar patients to hdm with hdm allergen . Nk cells purification before and at 6 h postchallenge were cultured for 72 h. collected supernatants were checked by elisa for the amount of il-8 recovered . As demonstrated in figure 3, after nasal challenge nk cells secreted a significantly higher amount of il-8 . This result indicates the importance of nk cells as a source for il-8 in the pathophysiology of ar . In the current communication, we demonstrated a novel crosstalk between nk cells and eosinophils via il-15/il-8 axis . This may indicate a role for il-15 in the pathophysiology of allergic rhinitis late - phase reaction and the promotion of eosinophilic inflammation . In ar disease, the mixed in vivo milieu of th2 cytokines especially induced after allergen exposure prime eosinophils . Herein, we show that nasal allergen challenge of ar patients also primes nk cells to secrete larger amounts of il-8 . Further, the ability of nk cells to secrete il-8 in their supernatants that contributed to the attraction of eosinophils from ar patients may provide a further explanation to eosinophil recruitment in ar . Il-15 prolongs eosinophil survival and thus acts as a proeosinophilic inflammatory mediator . In the current study, il-15 demonstrated a further novel indirect role in helping eosinophil recruitment, at least in part through secretion of il-8 from resting nk cells . Vitamin d binds to its nuclear receptor, the vitamin d receptor (vdr) through which it signals in its target cells . We demonstrated a significant inhibition of il-8 by nk cells in the presence of vitamin d3 . This is consistent with an earlier study that demonstrated that vitamin d3 repressed il-8 promoter activity induced by tnf- in human melanoma cell line by 50% compared to 30% inhibition by dexamethasone, as well as tnf--induced il-8 release and il-8 mrna level . The fact that il-8 secretion by nk cells was sensitive to p38 map - kinase inhibition may indicate that il-15 and vitamin d3 modulated il-8 autocrine activity of nk cells through the same pathway . It is then reasonable to assume that il-15 may induce il-8 secretion by nk cells through stimulation of p38 map - kinase activity and that vitamin d3 reduces il-8 secretion from nk cells through blocking effect on the p38 map - kinase pathway ., our results may indicate the following: a novel role for nk cells in the pathophysiology of ar through recruiting eosinophils, a novel modulatory role for il-15 in inducing eosinophils chemotaxis from ar patients through the nk cells secretagogue activity, identifying il-8 as an important cytokine that contributes to the eosinophilotactic agents secreted by nk cells, indicating that vitamin d3 may be an effective therapeutic modality . Our results open channels for other researchers to further elaborate on the exact mechanism(s) involved in nk - induced il-8 modulation by il-15 and vitamin d3 and p38 map - kinase inhibition.
Osteoporosis - related fractures are a major public health problem mainly in postmenopausal women and the elderly . Osteoporosis affects an estimated of 75 million people in europe, united states of america, and japan . There are several treatment options available including calcium, vitamin d, parathyroid hormone, strontium, and bisphosphonates . Alendronate (fosamax, merck & company, inc .) Is one of the first bisphosphonates to be licensed and used . Recently, however, there is an emerging concern regarding long bone stress fractures secondary to long - term alendronate intake . We present a case of bilateral femoral shaft insufficiency fractures secondary to long - term alendronate therapy . A 74-year - old lady presented to orthopaedic clinic with a four - month history of bilateral thigh pain . She had history of breast cancer treated with lumpectomy 10 years ago and has a history of well - controlled asthma, for which she did not require corticosteroid treatment . Radiographs revealed lateral cortical thickening of the mid - diaphysis of both femurs (figure 1). The patient underwent a bone scan to rule out the possibility of metastases due to her previous history . Four days after consultation, she tripped and sustained a transverse fracture of the left femur and underwent uneventful femoral intramedullary nailing (figures 3(a) and 3(b)). Bone mineral density scan was organized, and she was started on teriparatide treatment . Because there was no progressive right thigh pain, no further surgical management was offered beyond close followup . At four months postoperatively, the left femur fracture showed good radiological union (figure 3(c)). There was still persistent pain in the right femur and a definite linear lucency in the lateral femoral cortex on plain radiographs . She underwent prophylactic intramedullary nailing of the right femur and had eventual complete relief of her symptoms . The lifelong risk of having a fracture related to osteoporosis is one in two for women and one in four for men . Bone formation coupled to resorption is also decreased resulting in an overall reduction of bone remodelling . Bisphosphonates also combine with calcium and become incorporated in the crystal structure of bone and retained within the skeleton for long periods of time . Therefore, they have the potential to exert efforts long after the treatment has been discontinued . Alendronate is the first bisphosphonate to be approved for the treatment and prevention of osteoporosis . Several previous studies have shown that alendronate reduces the risk of osteoporotic fractures and osseous resorption in high turnover bone disease . It has an excellent benefit to risk ratio for women with osteoporosis when used for 3 - 5 years . In addition to other well - known side effects of bisphosphonates, there is a recent concern regarding the association of cortical insufficiency fractures and low - energy femoral fractures with long - term alendronate use . Several published case series and case reports suggest femoral shaft, and subtrochanteric femur fractures can be associated with long - term alendronate use [24]. Have shown a significant proportion of patients, in their study of low - energy sub - trochanteric and diaphyseal femur fractures, were on long - term bisphosphonates . The characteristic features include prodromal pain in the thigh for several months prior to the fracture (76% of the reported cases), bilateral fractures either sequential or simultaneous, and fractures with trivial trauma . The radiological features of these fractures are lateral cortical thickening, cortical spiking or beaking over the medial cortex, and transverse or short oblique fractures . Neviaser et al . Reported in their study that 19 of the 25 patients on alendronate demonstrate a simple transverse fracture with a unicortical beak in an area of cortical hypertrophy . In contrast, this fracture pattern was seen in only one patient who was not being treated with alendronate, indicating that the fracture pattern is typical in alendronate users . Alendronate acts as a strong inhibitor of osteoclastic bone resorption which reduces the overall bone turnover . This has a negative effect on bone healing and is likely one of the reasons why many of the insufficiency fractures have delayed healing . Since alendronate inhibits osteoclastic remodeling, endochondral fracture repair is the preferred method of fracture healing . Intramedullary reconstruction with full - length nails accomplishes this goal and protects the entire femur . Sayed - noor and sjdn reported a case series of delayed union even after internal fixation of a femoral insufficiency fracture in a patient who was on long - term alendronate . Capeci and tejwani and ha et al . Reported union at an average of four and five months, respectively, after internal fixation [7, 8]. In our case, the left femur fracture was treated with a reamed intramedullary nail with union at four months . Because of the nonprogressive pain from the right femur stress fracture, close observation with protective weight - bearing was initially chosen but proved to be insufficient despite stopping alendronate . We support the view of capeci and tejwani and ha et al . To treat even the incomplete insufficiency fractures with internal fixation . As well, we feel clinicians should not be lured into conservative management by the radiographic features of focal cortical hypertrophy . Dietary calcium and vitamin d status should be assessed, and adequate supplementation should be prescribed . Although there is strong evidence supporting short - term alendronate therapy to reduce the risk of osteoporotic fractures, there is not enough evidence to suggest benefit in long - term use beyond five years . The continuation of alendronate therapy after five years should be tailored to individual patients after appropriate followup and the need for ongoing therapy reassessed annually . Any patients with prodromal symptoms such as thigh pain should be investigated with routine bilateral radiographs of the femur looking for stress reaction, and if necessary, advanced imaging - like bone scan or magnetic resonance imaging . This is not the first case report on insufficiency diaphyseal fractures related to long - term alendronate therapy . However, this is a case report with characteristic features and bilateral involvement which highlights the importance of evaluating patients on long - term alendronate therapy and recommends early prophylactic internal fixation of these fractures . Patients on more than 5 years of alendronate therapy should be reevaluated annually regarding continuation of treatment and need close observation.
Prescription writing is a complex and challenging task that requires diagnostic skills, knowledge of medicines, communication skills, an understanding of the principles of clinical pharmacology, and appreciation of risk . In recent years, medical researchers observe deficiencies in health care occurring due to many prescribing errors, which arise because of two factors . One could be due to decision making and the other due to defect in the art of writing prescriptions . The factors related to the former could be inappropriate prescription, irrational prescription, under prescribing, or over prescribing . The illegibility of the prescription or omission of any of the details in a prescription order could result in misinterpretation and medication errors . A good prescription should be legible and possess all the essential information necessary for the pharmacist to dispense and the patient to follow in such a way to avoid possible errors and thereby the complications introduced by such defaults . Although prescription writing is a part of the medical students' curriculum, their prescribing skills are still poor either as a part of their examinations or as they go out as qualified health professionals . Although many prescribing errors are unintentional, studies have shown that the prescribing performance of interns and medical students are poor partly because of inadequate training . Furthermore, studies reveal that many medical graduates feel under - prepared to take on prescribing responsibilities after graduation even though prescription writing is taught by lectures or case - based teaching . Educational interventions such as problem - based tutorials, interactive electronic tutorials, teaching sessions based on who prescribing guide, case scenario - based methods, etc ., have been tried by researchers to improve the skill . However, most of the trials failed to provide a definitive answer and a strong evidence to support the use of above interventions . Patient - based teaching is one of the educational interventions to teach clinical skills using real patients . This offers lifelike preparation and has more relevance to the trainee s future, i.e., their day - to - day performance as a doctor . This intervention may improve prescribing skills since the learning occurs within the context of real patients and is easier to recall . Based on the above facts, this study was conducted to determine the role of educational intervention (patient - based teaching) to improve the prescribing skill of ii year medical students . This prospective comparative study was done in a tertiary care medical college after obtaining permission from the institutional ethics committee . As this is a pilot study in its aspect to test a newer intervention, we decided to select a small sample size . Two groups of 25 students were selected randomly from ii mbbs to participate in this study . The control group included all the 25 students who were posted to surgery postings and the test group included whole of the 25 students who were posted in general medicine department . Written informed consent was obtained from the participants and permission obtained from the heads of the concerned departments . Both groups of students (n = 50) participating in the study were given general introduction about prescription writing, prescribing format and the who guidelines for selecting the preferred drug after making clinical diagnosis . Five common clinical conditions were chosen for teaching prescription writing to both the groups (peptic ulcer, bronchial asthma, new case of hypertension and diabetes mellitus, hypothyroidism). The participants of the test group were subjected to patient - based teaching which was carried out in the general medicine department of our hospital exposing the students of test group to real patients suffering from the above mentioned clinical conditions . After briefing about clinical conditions and appropriate prescriptions, students were given 10 min duration to interact with patients . Students of control group were trained on prescription writing by explaining five clinical conditions using case scenarios in the department of pharmacology . After allowing the participants of both the groups to undergo self - study for 2 days, they were asked to write prescriptions in the standard format for the same five clinical conditions discussed . Then, assessment of their prescribing skill was done by analyzing scores obtained [figure 1]. To prevent teaching and evaluation biases, teaching for both the groups were done by the first author, evaluation by the second author and providing dummy numbers to prescriptions of the students of both the groups . Scoring for the prescriptions written by all the participants was done by a modified 14-point scoring format . The mean scores obtained by both the groups for the five prescriptions were analyzed using unpaired t - test and the individual parameters in the 14-point score were compared by chi - square test . An open - ended feedback was obtained from the test group students who were exposed to the newer educational intervention [figure 1]. The five prescriptions written by each student were scored and the average obtained for each student and the mean score calculated for both the study groups . The mean score for the five prescriptions obtained by the students in control group (by 14-point score) was 9.6 and that of the test group was 12.04 [figure 2]. Comparison of mean score of both groups on comparison of the mean score obtained by both the group of students by unpaired student s t - test, there was a significant difference between both the groups (p <0.001). The performance of students in both the groups with regard to the individual parameters of the 14-point score was also assessed . A total of 125 prescriptions obtained from each group were compared for the individual components of the score by chi - square test . There was a significant difference between groups in writing the doctor s particulars, patient particulars, diagnosis, quantity of the drugs and duration of medications to be taken, follow - up particulars and doctor s signature . There was no obvious difference noted in mentioning the parameters such as patient name, doctor name, drug name, dosage, and date of prescription [table 1]. Comparison of individual parameters on 14-point scoring on consolidating the open - ended feedback from all students of test group, they concisely opined that patient - based teaching was more interesting and motivating, gave more focus, they felt more responsible, felt empathic toward patients, and this way of teaching made them to remember the subject easily . Prescriptions are orders that are issued to communicate between the prescriber and the patient or pharmacist . Case - based teaching is an established method of teaching prescription writing to ii mbbs students since it provides student motivation, activates self - directed learning and imparts deeper knowledge . However, a review by koh et al . Reveals that such type of teaching methods would not be much fruitful for skills such as prescribing, patient education, and doing procedures . Furthermore, in the upcoming competency - based medical education, there is emphasis on teaching clinical skills and the assessment at the performance level . Hence, it is essential to introduce better educational interventions which would give a lifelike experience while learning that could improve the prescribing confidence of undergraduate students . This study based on the above facts identifies the usefulness of patient - based teaching of prescriptions to medical students . The performance of students after patient - based teaching is significantly more than those who were trained by case based teaching (p <0.001). There are studies to mention about the marked weakness of newly graduating medical students regarding prescribing skill . A study done in nigeria among final year students found that the students possess only knowledge about drugs, but their prescribing skills do not match the knowledge insisting on a more practice - based teaching of prescription writing . The analysis of the individual parameters of the 14-point score between both groups showed no significant difference invariables such as mentioning the doctor s name, patient s name, date of prescription, the drug name, and its strength . This shows that the students were able to memorize the drug information and reproduce it in both methods of teaching . On contrary, there was a significant difference noted between the groups in fulfilling the following parameters (patient address, age / sex, doctor s address, degree, registration number, diagnosis, directions for use and signature - p <0.001 and quantity / duration - p <0.05). This proves the fact that the patient based teaching offers more impact on writing complete prescriptions than the traditional case - based teaching . Every element in the prescribing format is absolutely important and essential for both legal and therapeutic requirements . The study proves this lacuna of the current teaching of prescriptions which is drug centered rather than practice centered to offer the complete skill of prescribing . In patient - based teaching, the students have added advantages of communicating with patients, visualizing their agony and giving follow - up advice to them . These advantages help the students to gain real - life experience which enhances their memory and performance in prescription writing . Feedback obtained from students also brought out the fact that the patient - based teaching improves their learning, motivation, and makes them to remember all the essential components of the prescribing format . Apart from these, this method also provides better attitude of students toward patients and make them more empathic . Most of the studies on educational interventions to improve prescriptions used objective structured clinical examination (osce) as assessment method (at performance / does level of miller s pyramid). In this study, since the control group was not exposed to patients, instead of osce, the scoring system was used for assessment (at the knows how level) and the students were evaluated for prescribing competence rather than prescribing performance . The limitations expected with this newer intervention in teaching prescription writing are the difficulty in organization for a larger group of students and the availability of adequate faculty . Studies with longer duration can check the long term memory of students . Furthermore, before and after studies of patient - based teaching with osce as scoring would very well assess the communication skill of students also which offers holistic approach to prescribing skill . Patient - based approach for prescription writing enables students to develop prescribing skills in a complete and professional way along with adequate medical knowledge . The use of real patients in teaching prescription writing should be considered more widely, as it provides strong contextualization and more relevance to learning.
It was recently suggested that endometriosis may commence as an endometrial disease provoked by the aberrant expression of aromatase in this tissue, as this appears to play a pivotal role in its survival in ectopic locations.4 gene array studies have shown that the expression profiles of endometriosis lesions and the eutopic endometrium are similar, which supports the hypothesis that endometriosis is an endometrial disease.6 it is biologically plausible that the presence of aromatase activity in the endometrium is pivotal for the development of endometriosis by blocking phagocytosis by activated macrophages and may also be responsible for the exacerbation of menstrual symptoms whose onset predates the diagnosis of this pathology.1,4,7 in this hypothesis, endometriosis would be a late consequence of enzymatic changes that occur in the endometrium prior to its establishment outside the uterus, which could explain the lag that is often reported between the onset of symptoms and diagnosis of the disease . This hypothesis could be tested by examining patients with severe dysmenorrhea or infertility to determine whether laparoscopy reveals endometriosis despite aromatase expression already being positive in the endometrium . In the present study, aromatase expression was determined in the eutopic endometrium of patients with severe menstrual symptoms and/or infertility who underwent laparoscopy and hysteroscopy as a part of their diagnostic work - up . A total of 106 patients of reproductive age (range = 1847 years) received a laparoscopy and hysteroscopy with endometrial biopsy that was carried out using a 4 mm karman curette attached to a 10 ml syringe to produce a vacuum, which is the standard procedure for the evaluation of menorrhagia, severe dysmenorrhea, or infertility in the day hospital where the current study was carried out . All patients included in this group had reported at least two of these three symptoms for periods ranging from 2 to 8 years . The control group consisted of sixteen patients who received a laparoscopy for reasons unrelated to infertility or severe dysmenorrhea and who were found to be endometriosis - free during the examination . The indications for laparoscopy in this group were either benign non - endometriotic ovarian cysts (seven patients) or tubal ligation (nine patients). In these patients, an endometrial biopsy was performed at the time of the laparoscopy using a 4 mm karman curette . The patients enrolled in the study gave written informed consent for immunohistochemical studies to be carried out on the endometrial biopsy specimens obtained as part of their standard medical care . Laparoscopies were performed either during the proliferative phase (n = 72) or in the secretory or menstrual phase (n = 34), since the timing of the procedure depended on the availability of the surgical theater and the specifics of the institution s waiting list . The laparoscopy reports and color images were retained in the patients files for further evaluation if necessary . During the laparoscopy procedure, the surgical team ascertained the presence of endometriosis and graded the stage of the disease in accordance with the american society of reproductive medicine (asrm) classification . 8 using laparoscopic classification criteria, the patients with endometriosis were divided into four groups according to the severity of their lesions, using the asrm classification of minimal (stage i), mild (stage ii), moderate (stage iii), or severe (stage iv). The severity of menstrual symptoms such as dysmenorrhea, the presence or absence of infertility, and the reason for laparoscopy were recorded in the patients files . Aromatase expression was investigated using the commercially available monoclonal antibody mca2077 clone h4 (serotech, raleigh, nc). Antigen retrieval was performed using tris - edta buffer (ph 8.0; sigma - aldrich, so paulo, brazil). The presence of aromatase expression was rated as positive if there was any detectable staining reaction in the glandular epithelium or negative when no reaction was observed . Placental tissue and an atrophic endometrial sample were used as positive and negative controls, respectively, in all immunostaining reactions for aromatase p450 . Statistical analysis was performed using the one - tailed chi - square test for differences in percentages, using an unnamed online interactive calculation tool for chi - square tests of goodness of fit and independence, which is hosted at http://quantpsy.org . In the group of patients with severe dysmenorrhea, endometriosis was diagnosed in 90/106 patients . In the remaining 16 cases, aromatase expression in the eutopic endometrium was detected by immunohistochemistry mainly in the glandular epithelium (figure 1). The staining reaction was positive in 66/92 patients (72%) with endometriosis and symptoms of dysmenorrhea and/or infertility, and there were no significant differences between the phases of the patient s menstrual cycle . In symptomatic patients who were found to have normal pelvic results during the laparoscopy, aromatase expression was still positive in the endometrium in 13/14 cases (95%), though this difference was not statistically significant (p = 0.09). In the asymptomatic control group without endometriosis, however, aromatase expression was negative in the eutopic endometrium in all cases . In the subset of symptomatic patients with a laparoscopic diagnosis of endometriosis, the percentage of endometrial samples positively expressing aromatase in the glandular epithelium showed a trend toward greater positivity as the severity of the disease increased in accordance with the asrm criteria . Aromatase expression was detected in the eutopic endometrium of 28/45 patients with stage i endometriosis (62%), 11/14 patients with stage ii (78%), 14/20 patients with stage iii (70%) and 12/13 patients with stage iv endometriosis (92%). However, only the difference between stages i and iv of the disease was statistically significant (p = 0.04) (table 1). The present study not only showed an association between the presence of aromatase expression in the eutopic endometrium and the severity of endometriosis lesions at laparoscopy but also suggests that this expression was already present in symptomatic patients in whom pelvic endometriosis was not found . These findings agree with the hypothesis that endometriosis may commence as an endometrial disease resulting from functional changes in the endometrium before the disease establishes outside the uterus . The presence of similar epigenetic changes in the eutopic endometrium and the endometriotic lesions further corroborates the hypothesis that endometriosis is an endometrial disease.6 the positive correlation between mrna levels in the eutopic endometrium and the severity of endometriosis and adenomyosis also supports this hypothesis . 9 whether endometriosis starts as an endometrial disease before establishing itself elsewhere in the pelvis6,7 cannot be proven by the present study, but previous work shows that the onset of symptoms associated with this pathology may commence many years prior to its diagnosis, which support this hypothesis . 1 the occurrence of severe dysmenorrhea for many years prior to a diagnosis of endometriosis may reflect these initial endometrial changes favoring the upregulation of both estradiol and prostaglandin production in this tissue.4,6,7 the occurrence of such symptoms in patients with a normal pelvis at laparoscopy, as shown in the present study, may suggest that these functional changes in the endometrium are not only associated with the onset of endometriosis - related symptoms but that they may occur prior to the diagnosis of any pelvic pathology by laparoscopy . Functional endometrial changes leading to an increase in aromatase expression may therefore predate the development of endometriosis, initially provoking dysmenorrhea and possibly infertility before triggering the development of the disease outside the uterus.4 it still remains to be determined whether this group of symptomatic patients represents a high - risk population for the development of endometriosis . In patients with an established diagnosis of endometriosis, however, endometrial positivity for aromatase tends to increase with the severity of the disease . This may be due to the greater possibility of spontaneous regression of early stage endometriosis, which may occur because of reduced aromatase activity in the eutopic endometrium . Although aromatase expression in the eutopic endometrium may be pivotal for the onset and progression of endometriosis, it has yet to be clarified how this enzyme affects the development of endometriosis . The role played by estrogens in inhibiting immune surveillance by activated macrophages has been suggested as one of the likely mechanisms by which aromatase affects the course of endometriosis.4,7,10 this local estrogen production in the endometrial cells shed to the pelvis in retrograde menstruation may favor their survival in these ectopic locations by directly preventing their destruction by activated immune cells through the inhibition of the phagocytosis mechanism.1013 the presence of aromatase in the eutopic endometrium may therefore represent the initial step in the development of endometriosis and could be necessary for the development of lesions outside the uterus.7 the similar genetic alterations found between endometriotic lesions and the respective eutopic endometrium also indicate a common histological origin.7 the current study s finding that aromatase expression is detectable by immunohistochemistry in the endometrium of symptomatic, endometriosis - free patients agrees with the hypothesis that this enzyme initially exacerbates dysmenorrhea or causes infertility prior to facilitating the development of endometriosis elsewhere in the pelvis . A previous study has shown that aromatase expression in the endometrium reduces implantation rates in patients undergoing in vitro fertilization, however, which may help to explain the lower fertility rate of women with endometriosis.14 the presence of aromatase and other enzymes related to estrogen metabolism in the eutopic endometrium will ultimately create a hyperestrogenic milieu, resulting in increased prostaglandin production, particularly because cox-2 expression is upregulated by estradiol in this tissue.69,12,13 this would explain why the pelvis of a patient with severe dysmenorrhea or infertility may be normal, as was reported in the current study aromatase expression in the eutopic endometrium may be sufficient to provoke these symptoms by enhancing the production of proinflammatory prostaglandins in this tissue . However, the possibility that some of these endometriosis - free patients have adenomyosis cannot be completely excluded in this study, despite the fact that myometrial findings were normal at transvaginal sonography . Estrogens produced locally in the endometriotic lesions and eutopic endometrium result in the mechanism of decreased immune surveillance and enhanced tolerance found in endometriosis,14 which may explain the inverse relationship between estrogen levels and impaired nk - cell function found as a function of the severity of the disease . 15 local estrogen production would also stimulate the production of vegf, growth factors, and inflammatory cytokines by immune cells, thus favoring the progression of endometriosis.12,15,16 the blockade of phagocytosis by the local production of estrogens and the concomitant stimulation of growth and inflammatory factors would explain the paradoxical effects of macrophages in endometriosis, which seem to interact with rather than destroy these ectopic endometrial cells, thus enhancing their growth and angiogenesis.12,17 in conclusion, a vicious cycle of enhanced inflammation and local estrogen production mediated by cox-2 and aromatase expression in the eutopic endometrium of endometriosis patients may play a pivotal role not only in determining the clinical course of this disease but also in defining the intensity of its debilitating symptoms . In the pelvic cavity, the ensuing inflammatory reaction provoked by the arrival of endometrial cells will further exacerbate their preexisting aromatase activity, thus augmenting local estrogen production and halting phagocytosis by activated macrophages.6,7
The preventive strategy for cervical cancer is based on identification and treatment of high - grade cervical lesions (hg - cin) in order to prevent cancer progression . Thus, although conservative, it represents a surgically - based approach (usually by means of laser, cold - knife cone biopsy, or loop electrosurgical excision procedure [leep]), which results in an overall high - rate of success . Nevertheless, treatment failures within 2 years (in terms of residual or recurrent high - grade cervical disease) may occur in approximately 5 - 15% of cases, or even more [,,,], thus often requiring subsequent re - excisional therapy . Moreover, cin2 and mainly cin3 treated patients (recognized as the true pre - cancer cervical lesion) remain at high - risk for cervical or other lower - genital tract hpv - related diseases over time . Indeed, for many years the post - treatment risk of invasive cervical cancer is still five - fold greater in such women than that in the general population []. Furthermore, it has been estimated in the uk that 16% of diagnosed cervical cancers had previously been treated for intraepithelial neoplasia [], confirming the need for a careful and close follow - up of such patients, at least for 10 years after therapy . For these reasons, high - grade cin - treated patients are usually kept under clinical post - treatment surveillance, including a combination of cytology, hpv - dna testing and colposcopic examination . The objective of these monitoring activities is the early detection of patients at high - risk for residual / recurrent disease, with the aim of intensifying the diagnostic procedures or, conversely, returning to normal screening intervals . Although many patient - related factors (age, smoking habits, number of sexual partners) and pathological characteristics (surgical margins, glandular involvement, lesion size, histological grade and antecedent cytological result) may affect the clinical outcome, the recurrence risk prediction is suboptimal . Women with clear margins following conservative treatment could be at risk for disease recurrence because a multifocal lesion may occur . Conversely, most women with positive resection margins (which suggest an incomplete excision of the lesion) do not develop recurrent disease over time, indicating a limited usefulness of this marker . Moreover, although usually conducted in the surveillance work - up, colposcopic examination has been shown to add little information to the detection rate of residual / recurrent hg - cin 7, 8.therefore an accurate test (or combination of tests) able to successfully predict clinical outlook, allowing reduction in the follow - up period and related negative issues (such as anxiety, psychosexual outcomes and overall health cost), would be particularly helpful . Currently, despite the low - accuracy in detection of recurrent disease (corresponding to high sensitivity, but low specificity 9), most women treated for high - grade cin are still monitored by periodical cytological examination . Before returning to routine screening luesley 10 proposed for cin2 + patients a cytological follow - up at 6 and 12 months after therapy, and thereafter annually for the next nine years . Indeed, the pap - smear is probably still the most widely accepted follow - up procedure after conization, since the european guidelines for clinical management of abnormal cervical cytology 11 also recommend this test at 6, 12 and 24 months after cone biopsy . However, a false - negative rate of pap - smears during follow up after treatment has been reported so far 1, 12, 13, 14 . Moreover, in the past decade it has emerged that hpv - dna testing plays a relevant predictive role, over cytology, after ablative cervical excision . A positive post - treatment hpv - dna test could predict hg - cin recurrence more accurately than either cytology, or positive surgical margins, as described in the regression analysis by paraskevaidis in 2001 12 and in a subsequent systematic review 1 . To date, a wide range of literature from observational studies of prospective cohorts 7, 15, 13, 17, 19, 20, retrospective case - control study 21, 22, a large study conducted in an integrated health system 23 and meta - analyses or systematic reviews 1,18, 24, 25,27 attest to the usefulness of hpv - dna test in clinical management after hg - cin treatment . It has been documented 28 that the vast majority of cin3 patients are clear of hpv infection after 6 months from the excisional therapy, dramatically reducing the risk of actual / subsequent recurrence and thus being widely protected against cancer progression . Conversely, hpv infection persistence (and in particular of high - risk genotypes, hr - hpv) during the follow - up period is strictly related to residual or relapsed disease 1,29 . This is because, as already stated 4, ablative treatment removes the dysplastic lesion but not necessarily all the infected tissue . Effective treatment thus results both from removal of the entire lesion and viral clearance as well . Therefore, hr - hpv - dna persistence after therapy, which is a prerequisite of the original intraepithelial lesion and a critical key - point in cervical cancer oncogenesis 30, 69, may over time further promote the recurrence of disease 31,32 . In other words, the persistent positivity of hpv - dna testing in the follow - up surveillance after cin2+treatment (detected in up to one - third of women 1, 12, 19 and even more 29) assumes a true predictive role . According to this background, surveillance strategies including a pooled hr - hpv - dna testing (also defined as a test - of - cure) are reported to be more effective than conventional cytology alone, predicting treatment failure with significantly higher sensitivity and similar (or not - significantly lower) specificity compared to repeat cytology (table 1). Being a post - therapy monitor activity on high - risk women, not within a normal screening setting on general population, surveillance strategies should prefer sensitivity over the specificity rate, in order not to miss any recurrent disease . Indeed, a high sensitivity is repeatedly reported in the literature for hpv - dna testing 6 months after conization, ranging from 90 to 100%, as well as a high negative predictive value, which is a relevant index to safely return to a normal screening schedule . Furthermore, hr - hpv - dna test of cure would also be cost - saving compared with follow - up cytology, as reported by legood et al 33 in a national health service cervical screening programme setting . Moreover, the combination of cytology and pooled hr - hpv - dna testing 7, 34 in a test - of - cure - setting 35 has been reported to offer greater sensitivity (over 93%) than cytology alone and excellent post - treatment negative predictive value (close to 99% or over), which is highly relevant in this post - treatment group of patients . Therefore, despite the fact that follow - up after cin2 + conservative treatment has not yet been standardized (varying in terms of timing, interval, and methods), it should include cytology and hr - hpv - dna testing at 6 months, for early detection of any patients at increased risk of recurrence and cancer progression . The negative result of the two combined tests may further omit the scheduled 12 months check - up examination, to move directly to 24 months after treatment, thus being a less costly procedure . In this regard, kocken et al 4, 27 stated, through a meta - analysis, that the 5-year risk of post - treatment cin2 + after three consecutive negative cytological smears or negative co - testing (cytology and hr - hpv testing) at 6 and 24 months was similar to that of women with normal cytology in population - based screening . However, although the combination strategy promises to better monitor cin2 + treated patients compared with using cytology alone, it still does not represent the standard follow - up so far . In fact, cochrane review by van der heijden et al 36 found no useful randomized clinical studies directly comparing the two modalities of follow - up strategy (pooled hr - hpv - dna testing with cytology vs conventional post - treatment cytological at 6 - 12 months), thus advocating the need for appropriate perspective studies . To date, in this surveillance setting, few clinical studies have been conducted to evaluate whether hpv - genotyping will even more accurately predict outcome of hg - cin - treated patients than will the pooled - probe hr - hpv test . The objective of the type - specific hpv - test is to distinguish, after conservative therapy, the persistence of the same oncogenic papillomavirus involved in the cervical lesion . Indeed, by definition, to be classified as persistent the cervical infection should be ascertained as being related to the same genotype found within the original intraepithelial lesion . Since up to one - third of treated women are still hpv - positive at follow - up, the clinical question is whether this persistence is related to the same original genotype, or belongs to a new infection . In this regard caution must be applied into the evaluation of younger women who may have, after the treatment, a high rate of transient infection . The literature on this matter, although based on few studies and a small number of patients, agrees to assign a prognostic role of type - specific hpv - testing, with a steady increase in sensitivity rate and a significantly higher specificity . Kreimer et al within the alts study 37, comparing three follow - up strategic methods, showed a better sensitivity for hr - hpv persistence with a better specificity compared with conventional follow - up . Analogous findings were reported by heymans 21, where hpv genotyping showed both a significantly higher sensitivity and specificity to predict residual / recurrent cin2 + . Strand et al 38, recently reported that specific hpv genotype persistence predicts recurrent or residual disease more accurately than does simple pooled hpv - testing, improving the specificity (up to 100%) when using in post - treatment surveillance . Over three years of follow - up, no women with type - specific hpv - negative had recurrent disease and, vice versa, all of the recurrences were persistently positive with the same type . Similar data was also reported by nobbenhuis 28, where 90% of recurrent cin2 + were found to be infected by the same high - risk hpv type as before the initial treatment and, conversely, no recurrent disease has been reported in hpv - type specific negative cases . Similarly, outcomes have been reported by kang et al 39 who stated that detection of the same hr - hpv genotype during follow - up was related to a sensitivity and negative predictive value of 100% for predicting residual / recurrent disease . 40 reported a reduction of sensitivity rate from 100% to 60%, as compared to oncogenic pooled test . Similarly to sensitivity, specificity and positive predictive value are consistently described as increased due to hpv - genotyping 17,21,39,40 . As expected, among hpv - positive women during the follow - up period, different genotypes confer different risks for post - therapy recurrence and, within the same genotype, variants may also provide additional risk stratification 41 . Patients still infected at 6 months from non - carcinogenic types had a very low - risk of recurrence over 2 years (1.5%), thus very close to hpv - negative women 17 . In this regard, after ablative therapy, a repopulation of cervical and/or vaginal epithelium has been described with low - risk hpv types (from previously infected vaginal walls, or from subsequent contamination), which therefore do not show any significant cancer risk . Conversely, among high - risk genotypes, patients with hpv16 infection have a greater risk of developing cin3 + 42, and hence its persistence during the follow - up time may be associated with higher recurrence risk and warrant separate detection . In recurrent patients hpv-16 tends to clear slowly and lesser than the other oncogenic types 22, confirming the clinical evidence of the alts trial 17 and other studies 22,43,21,39, where persistent hpv-16 has been detected more frequently associated with recurrent disease . Women positive for hpv-16 at 6 months from cone biopsy 17 have higher risk (37%) of developing recurrent disease over 2 years, compared to those positive to hpv-18 (18.5%) or other carcinogenic genotypes (10.8%). Consistent with these data, vintemyr et al . In a retrospective registry - based study in norway 44, reported that 75% of recurrent cin2 + cases were associated with types hpv 16/18 . More recently, also andrade et al . 22 confirmed a 3-fold greater risk of recurrence for hpv-16 persistence . Although it has been recently reported 20 that a high percentage of hg - lesions related to hpv 16 or 18 may regress before treatment (thus suggesting that a pretreatment test would not have predictive information), hr - hpv genotyping promises to be useful into the clinical risk stratification . Women affected by hpv-16 high - grade disease need a more appropriate and intensive post - surgical follow - up, providing the opportune methodological test to identify its persistence over time . Conversely, although requiring more confirmation from the literature, a post - therapy detection of hpv genotype different from that present before cone - biopsy, may allow a reduction of the intensity of follow - up . Finally, also viral load may be regarded as an hpv proxy measure of disease persistence . Many authors 7, 45, 46, 47 have reported that patients with low viral load were less likely to develop recurrent or persistent disease, while other do not confirm this 48, 49 . Although elevated hr - hpv loads have been associated with extensive lesions (more likely to recur), its predictive role is still debated . Indeed, many critical issues (regarding the value of single vs repeated load, pre- vs post - conization sample analysis, the impact of single vs multiple genotypes, the cut - off level expressed in rlu and the selected method for measurement as well) need to be further valued . However, they differ in their analytical performance, in terms of genotypes included, type - specific sensitivities and specificities . One of the main problems is the lack of standardization, and therefore the impossibility of comparing the results obtained by different laboratories . The results of an international proficiency study were recently published 50: forty - three reference samples were prepared with complete genome of 17 hpv types (12 hr and 5 lr), cloned into plasmid vectors . The more widely - used hpv genotyping systems were represented, as 96 laboratories participated, some of them providing data on different methods . The results of this survey indicate that, although there was an improvement over the results of the previous survey performed in 2008 51, the systems still differ in their performance, and this could be due both to the test and to the overall performance of the laboratory the first group is able to give a' partial genotyping', as these tests can detect, through dedicated channels, the presence of hpv-16 and of hpv-18 individually, while the other hr - hpv are detected in pool . These systems have undergone analytical and clinical validation 52, 53, 54, 55, 56, and some of them have also been cleared by the us fda for the triage of ascus cytology and recently the cobas4800 hpv test (roche diagnostics, pleasanton, usa) was cleared as a primary test in screening . Like the cobas 4800 hpv test, the abbott real time high risk hpv test (abbott molecular, des plaines, il, usa), belongs to the group of next - generation real - time - pcr based hpv dna assays in which the detection of 14 hpv genotypes is combined with concurrent genotyping for hpv-16 and hpv-18: this test was launched on the european market in january 2009 and is currently used in many laboratories worldwide for routine detection of high risk hpv 57 . Another hpv test clinically validated for hpv genotyping is the cervista hpv 16/18 test (hologic, inc ., this was the first hpv genotyping test approved by the fda, and permits the differentiation only of hpv-16 and hpv-18 genotypes 58 . Among the different systems available, qiagen hr - hpv 16/18/45 probe set test is a signal amplification assay based on the most widespread hybrid capture technology (the first fda validated method) using a probe mix comprising short sequence - specific synthetic probes designed for hpv-16, -18 and -45 detection . Although these systems may provide sufficient information in more than 50% of patients, who are hpv-16 or hpv-18 positive with cin2 + lesions, they are not suitable for the follow up of women bearing another hr - hpv . In these cases a second group of hpv genotyping methods, which provide an' extended' genotyping, should be used . They can give a specific response on the presence of single or multiple infections, and are based on different approaches . For example the linear array hpv genotyping test (roche diagnostics) is a partially manual method, which is based on reverse line blot hybridization for the detection of 37 genotypes 59 . The same approach is also used for the innolipa hpv genotyping extra (innogenetics, belgium), although the l1 region of the hpv genome used for amplification is much smaller compared to the linear array and the genotypes detected number twenty - eight 56 . Examples include the greiner bio - one papillocheck assay (greiner bio - one gmbh, germany), based on the amplification of a 350 bp fragment within the e1-region, which allows the simultaneous identification of 24 genotypes 60, 61, or the clart papillomavirus humano 2 (genomica, spain), which can detect 35 genotypes 62, or the fully automated infiniti analyzer, based on the detection of different groups of hpv genotypes by using three different reagent kits 63 . Other systems will appear in the near future, and many are now under clinical validation . For example the bd onclarity hpv assay(bd diagnostics, sparks, md, usa): the onclarity is a fully - automated e6-e7 dna - based real time pcr assay that detects 16, 18, 31, 45, 51, 52 as single genotypes and the remaining eight genotypes in three groups (33/58, 56/59/66, 35/39/68)64 . The large number of methods available means that it is important to be aware of the performance characteristics of the particular system in use, and to observe strict standardization of the process and observation of quality assurance criteria . Since hg - cin recurrence after surgical therapy is a major marker for progression to invasive cancer, the strategy and procedures of follow - up represent a critical point for risk stratification . Monitoring activity with pooled hr - hpv - dna testing during the surveillance period has been identified as an independent risk factor associated with recurrent disease, and thus may select those women at high - risk for recurrence 21, 17, reducing unnecessary and expensive procedures . The combination of pooled hr - hpv - dna testing with cytology represents an accurate index of disease clearance and has been widely accepted (though not formally included into nationwide guidelines) in the routine post - treatment work - out of hg - cin - treated patients . Furthermore, positive hpv - testing has been also identified, at any time during follow - up, as the most significant independent predictor of recurrent disease in the management of adenocarcinoma in situ 66 . Moreover, based on scientific knowledge and recent emerging data, type - specific hpv after hg - cin therapy may be an even more significant marker (compared to pooled - based testing) for the development of disease recurrence . Detection at 6 months after conization of the same high - risk hpv genotype is reported to be a better predictor of recurrence in respect to pooled hr - hpv - dna testing, with a comparable sensitivity and accompanied by a higher specificity . In particular, persistence of hpv 16/18 genotypes are reported to significantly impact on the recurrence rate after conization, thus requiring a close follow - up with immediate reference to colposcopy . Conversely, women negative for hpv type - specific persistence are considered at very low risk for recurrence, leading to a more individualized follow - up schedule . In table 3, a flow - chart for surveillance of hg - cin, with an integration of hpv genotyping and cytology 6 months after conservative treatment, is suggested . In conclusion, the excellent clinical performance of the combination strategy with hpv genotyping and cytology is considered a powerful tool for managing the post - treatment follow - up of high - grade cervical intraepithelial lesions . In addition, the choice of hpv - test remains of relevant importance given the increasing number of available assays on the market . All of the authors of the present review use, in their own institution, validated hpv - test (hc2, cobas 4800 or abbott real time) in a strategy as shown in table 3 to follow cin2 + treated patients . Although most of the commonly used assays were sensitive for detection of cin2 + disease after therapy 67, 68, it is necessary to be aware of the performance of the system, observing strict standardization of the process and adhering to quality assurance criteria.
Water disturbance may occur in hemorrhagic and ischemic stroke patients because of the major role that the central nervous system plays in water homeostasis [13]. Post - stroke hypernatremia is generally the consequence of central diabetes insipidus, but it can also take place if the patients do not have free water access, usually as the result of neurological sequels which prevents them from drinking water or even asking for it from their relatives and caretakers . Hypodipsia secondary to lesions of the thirst center, not accompanied by other serious neurological damage, is a rare cause of post - stroke hypernatremia, but it may cause significant morbidity if not properly diagnosed and managed . A 56-year - old caucasian man was admitted to the cardiology ward of our hospital due to lethargy and muscle weakness, attributed to the presence of bradycardia . Routine admission laboratory tests revealed high plasma sodium levels (na: 157 meq / l), which motivated, on the following day, a request for nephrology evaluation . At nephrology consultation his past medical history revealed that 9 years previously he had had a hemorrhagic stroke and needed brain surgery to clamp a ruptured aneurysm of the anterior communicating artery and to drain a cerebral hemorrhage . A representative figure of patient s cranial computed tomography (ct) done at that occasion is presented in figure 1 . The stroke resulted in some impairment of the capacity of space location, moderate reduction of the recent and fixation memory and a certain aversion to water . New laboratory tests were ordered and confirmed hypernatremia: plasma sodium of 155 meq / l and plasma chloride of 116 meq / l . Urinalysis: urine - specific gravity of 1026, no blood or protein and a normal sediment . Plasma potassium, creatinine and urea were, respectively, 4 meq / l, 1.07 mg / dl and 41 mg / dl . In the 24 h that followed nephrology consultation, the patient passed only 400 ml of urine . The diagnosis of possible hypernatremia secondary to post - stroke hypodipsia was then made and supervised water intake of 2 l a day was initiated . After this simple measure, there was an increase in diuresis and plasma sodium was reduced to 150 meq / l on the third day and to 144 meq / l on the fourth day after admission . Two weeks after hospital discharge, he had gained 3 kg and referred marked improvement in lethargy and muscle weakness . The evolution of the patient s laboratory tests, including the ones collected 2 weeks after hospital discharge, are presented in table 1 . Evolution of plasma sodium and other laboratory tests after patient s hospital admission cranial ct scan showing diffuse subarachnoid hemorrhage (inferior white arrow), frontal left intraparenchymatous hematoma (superior white arrow), intraventricular hemorrhage (inferior black arrow) and nodular slightly hyperdense image with peripheral calcifications on anterior communicating artery topography, suggestive of giant aneurysm (superior black arrow). Hypernatremia is relatively frequent in clinical practice, being common in the elderly and in critically ill patients . In patients with free access to water when plasma sodium (the main determinant of plasma osmolality) increases, two defense mechanisms are triggered: stimulation of the thirst center and secretion of antidiuretic hormone (adh). This combination results in increased water intake and reduction in urinary water loss, leading, thus, to normalization of plasma osmolality . This mechanism is highly efficient, keeping plasma osmolality in a narrow range, despite the daily variation of water and sodium intake . In the reported case, the patient s mechanism of adh liberation and the urinary concentration were preserved: when faced with significant hypernatremia, the patient s 24-h urine volume was only 400 ml, and the urine had high specific gravity (1.026); normalization of plasma sodium concentration, urine dilution and weight gain occurred when supervised water intake was warranted . This case illustrates the fact that even when the mechanisms of adh liberation and urine concentration are intact, and if the thirst mechanism is damaged, the body is not capable of maintaining normonatremia [3, 6, 7]. Post - stroke hypodipsia may be the result of damage to the hypothalamic thirst center, believed to be present in the lamina terminalis of the third ventricle in the presented case, there was extensive intraventricular hemorrhage but this may occur even in the absence of ct evidence of hypothalamic damage, possibly due to a cortical central nervous system lesion that interferes with cortical perception of thirst . The clinical symptoms that motivated the patient s hospital admission and that were at the first attributed to bradycardia were apparently caused by hypernatremia . In fact, this patient had been presenting muscle weakness and lethargy very frequently in his daily life and his wife reported that these symptoms had begun after the stroke . Indeed, the review of his past laboratory test values revealed that in the course of medical evaluations done in the past, high values of plasma sodium were documented (170 meq / l in september 2007 and 151 meq / l in february 2009) but were misinterpreted as laboratory artifacts since the patient presented no physical sequels of the hemorrhagic stroke and, as hypernatremia was chronic, significant neurological symptoms were absent . Sadly, a second measurement of plasma sodium was not ordered on neither of those two occasions . The patient s weight loss was secondary to true dehydration since it was quickly corrected after appropriate water intake . No medical reason was found for the patient s bradycardia, but when discharged from hospital, his heart rate was 72 b.p.m.
Although the prevalence of early onset dementia (eod) (dementia in individuals <65 years old) was once assumed to be very low, additional data have shown that prevalence has varied between 15.143.9/100,000 for early onset alzheimer s disease (ad),1 while the prevalence of frontotemporal dementia (ftd) has varied from 2.7/100,000 in the netherlands2 to 15.1/100,000 in cambridge, uk.3 in japan, a new study published in stroke showed that the overall prevalence of eod was 42.3/100,000 divided into vascular dementia (42.6%), ad (25.6%), traumatic brain injury (7.1%), dementia with lewy bodies, and parkinson s disease (6.2%), ftd (2.6%) and other (16%).4 in europe, according to an ad europe 2009 study, all dementia prevalence was 38420/100,000 with ad being 15.1153/100,000 and ftd being 4.015.4/100,000.5 however uncommon, eod poses a real problem to the patient, their family members and caregivers, doctors, health services, and residential programs.6 the challenges faced include difficulty in making the diagnosis, the impact of the diagnosis on family members and children (as eod patients may still have younger offspring), employment, family and personal finances, and quality of life . In this pilot study, we seek to identify the work - up and interventions sought in the process of diagnosis, shedding light on the limited help offered after a diagnosis is made under the current system . We end by putting forth possible solutions to the challenges encountered in treating and caring for these individuals at both an individualized and system level of care . We conducted a medical record chart review, after internal review board review and approval, for patients presenting to a memory disorder unit in boston, massachusetts, from 2005 to 2008 . Patients charts were flagged if the presenting complaint was to rule out a dementia diagnosis and if they were <65 years old . Dementia was defined as a group of symptoms in more than one domain affecting intellectual and social functions severely enough to interfere with daily functioning . 7 this resulted in the study of the charts of 85 patients (mean age [standard deviation]: 55.19 [7.51] years). We define social work intervention to include full psychosocial assessment including family and individual patient history, current strengths, and supports and assessment of risk factors . Social workers are part of the interdisciplinary team within the clinic and therefore are accessible to all patients and family members, either at their own request or at the request / referral from a provider . It should be noted that social work intervention was obtained at the discretion of the physician; the incidence of social work intervention did not necessarily reflect issues related to the patient (as difficult family dynamics, for instance, often prompt intervention) or disease severity . They have the option of keeping the appointment and deciding on the extent of social work involvement . The social work visits for both patients and their families were counted in the study . The outcome measures included the type of work - up the patient received (magnetic resonance imaging [mri], positron emission tomography, single positron emission computed tomography, neuropsychological evaluation, or any combination of these), the type of medications the patient was given, any changes in patient location / treatment over time, or any newly developing medical complaints . Data were analyzed with pasw statistics (v 18.0; ibm corp, armonk, ny), using an alpha level of 0.05 for significance . The relationship between categorical variables of interest was investigated using pearson s chi - square analyses; the distribution of variables of interest within the sample was assessed using chi - square goodness of fit tests . To examine trends in the mini - mental status exam (mmse) data which was used to measure dementia severity, univariate analysis of variance was utilized . Analyses investigating the impact of social work intervention on the outcome variables excluded patients whose final diagnosis was cognitive decline due to severe executive dysfunction as a result of attention deficit disorder or major depressive disorder . Patients with either of these disorders were included in the initial data sampling procedure as they presented to the clinic with eod symptoms but were excluded from analyses when their final diagnosis was linked to long - standing single - domain cognitive and/or emotional difficulty . We conducted a medical record chart review, after internal review board review and approval, for patients presenting to a memory disorder unit in boston, massachusetts, from 2005 to 2008 . Patients charts were flagged if the presenting complaint was to rule out a dementia diagnosis and if they were <65 years old . Dementia was defined as a group of symptoms in more than one domain affecting intellectual and social functions severely enough to interfere with daily functioning . 7 this resulted in the study of the charts of 85 patients (mean age [standard deviation]: 55.19 [7.51] years). We define social work intervention to include full psychosocial assessment including family and individual patient history, current strengths, and supports and assessment of risk factors . Social workers are part of the interdisciplinary team within the clinic and therefore are accessible to all patients and family members, either at their own request or at the request / referral from a provider . It should be noted that social work intervention was obtained at the discretion of the physician; the incidence of social work intervention did not necessarily reflect issues related to the patient (as difficult family dynamics, for instance, often prompt intervention) or disease severity . They have the option of keeping the appointment and deciding on the extent of social work involvement . The social work visits for both patients and their families were counted in the study . The outcome measures included the type of work - up the patient received (magnetic resonance imaging [mri], positron emission tomography, single positron emission computed tomography, neuropsychological evaluation, or any combination of these), the type of medications the patient was given, any changes in patient location / treatment over time, or any newly developing medical complaints . Data were analyzed with pasw statistics (v 18.0; ibm corp, armonk, ny), using an alpha level of 0.05 for significance . The relationship between categorical variables of interest was investigated using pearson s chi - square analyses; the distribution of variables of interest within the sample was assessed using chi - square goodness of fit tests . To examine trends in the mini - mental status exam (mmse) data which was used to measure dementia severity, univariate analysis of variance was utilized . Analyses investigating the impact of social work intervention on the outcome variables excluded patients whose final diagnosis was cognitive decline due to severe executive dysfunction as a result of attention deficit disorder or major depressive disorder . Patients with either of these disorders were included in the initial data sampling procedure as they presented to the clinic with eod symptoms but were excluded from analyses when their final diagnosis was linked to long - standing single - domain cognitive and/or emotional difficulty . The disorders requiring the most visits until a final diagnosis was made were early onset dementia alzheimer type and ftd . Looking closely at the neurodegenerative disorders as a unique group resulted in the data presented in table 2, concerning specific patient work - up . It should be noted that the majority of the individuals within the study were on one or two medications ([4, n = 76] = 24.13, p <0.001). Additionally, as dementia severity advanced as assessed by the mmse, so did polypharmacy (f = 6.17, p <0.001; 0 meds: mmse = 28.00 [1.46] versus four medications: mmse = 21.00 [1.31] [mean (standard deviation)]). Interestingly, there was no difference in mmse score between the groups receiving or not receiving social work intervention . Neuropsychological testing was the most used diagnostic modality (alone or in combination) regardless of patients diagnoses . Patients would move on to have positron emission tomography when brain mri was negative for specific findings but clinical suspicion was high for a neurodegenerative disease . Although social work intervention was rated as the most meaningful supportive intervention, it did not significantly correlate with any of the outcome measures (type or number of medications, type or number of patient work - ups, and reason for medical visit). Social work intervention did not limit polypharmacy or the number of diagnostic procedures patients undertook until a diagnosis was made . Additionally, social work intervention did not correlate with the patient s location at diagnosis nor their last recorded location . The out - of - home placement is generally considered for patients with severe agitation and/or severe incontinence . The authors note again that this decision is often family centered and closely related to access to those facilities . Given this, in this study, it was not surprising to find that the majority of the group was at home at diagnosis ([1, n = 76] = 64.47, p <0.001) and at last follow - up ([3, n = 76] = 169.37, p <0.001). In fact, only five patients experienced a change in their treatment setting over the course of the 3 years that they were followed . Of those five individuals, three had a social work intervention, while two did not . Eod poses a significant diagnostic challenge as it frequently presents in a young adult population burdened by a wide range of behavioral, cognitive and psychiatric symptoms . Predominant psychiatric presentation without significant cognitive deficits or atypical presentation of a common dementia challenges the family and the health care provider, often leading to diagnosis delay.811 in addition, when a diagnosis is made, while this brings relief for the already frustrated caregiver, it launches the much more tasking phase of ensuring that adequate care is provided for the patient . Beyond these challenges already advanced in a previously published body of work6 the stigma and taboo of cognitive illness and losing one s mind instead, they often interfere with appropriate communication within the family, creating additional hurdles for the care of the patient.12,13 this study shows that the issues for patients and their families move quickly from diagnostic to psychosocial.13,14 social work consultation is integrated into care as early dementia affects patients who are still at an active age and vibrant in their social circles; the financial, health, wellbeing, social structure, and family losses create chaos in the family; wreak havoc in marital dynamics; and bring major uncertainties in terms of unemployment, financial issues, and long - term health care.13,15 given these concerns, a social work intervention is often sought, although it is unclear if this changes the course and/ or the delivery of care . The cost of social work consultation is usually covered by health insurance and is billable under the patients mental health benefit . Worth noting is the family s preference for keeping patients at home or placing them in a facility . Assessment tools specifically targeting this young population are not generally readily available and those that are fail to portray and quantify the severity of the deficit in executive functions and instrumental activities of daily living.6,12,1416 in fact, clinicians are often confronted with a young adult who, although having a somewhat preserved mmse score, performs poorly when it comes to executive functioning (such as planning, organization, good judgment, etc). The answers to those unbearable changes is often medication, which is quickly escalated to poly - pharmacy, with little effect on behavior . This puts the patient at higher risk from side effects without alleviating the disease symptomatology . In fact, these deficits are the hallmark of how a patient s life will fair . Moreover, with no solutions in sight, the cognitive impairment coupled with the behavioral changes are felt as a burden to the whole family and impact heavily on the public health sector, which is unable to meet the demands and needs of the young population . Clinicians have to adjust quickly to a list of complaints presented by family members and they address this knowing they cannot do much to alleviate this suffering . Family members are left in the dark in attending to a high level of stress and depression due to a crippling burden of care . Although caregiver s burnout is often recognized by clinicians, few know how to deal with its consequences and, if they do know, they find themselves unable to offer much as community services are a rare commodity.17,18 the authors recognize the importance of social worker intervention to help caregivers deal with stress and ultimately avoid burnout . In addition, stigma against those with dementia remains high and numerous psychosocial issues exist for patients and families affected by eod . The emotional challenge of adjusting to a difficult and debilitating diagnosis affecting the life course of the patient and their family is horrendous . 19 families are alone as they face unique caregiver challenges.13,20,21 as the young eod patient is often forced to stop working, the patient s partner or child, often identified as the main caregiver, must face the challenge of full- or part - time employment in addition to overseeing the patient s care and other household responsibilities . The caregiver often files for family leave or ends up doing odd jobs at odd hours to be able to care for their loved ones at home while maintaining some form of income.19 as shown in this study, the dearth of services for patients with eod, coupled with a lack in coverage of community services, leads to the majority of individuals remaining at home for many years after their diagnosis is established . The resource access challenge is evidenced on the home front as well.16,22 home - based services remain inaccessible to many especially those without considerable financial resources . As shown in figure 1, the state of massachusetts still lacks a comprehensive holding environment, public programs, and services for eod patients . Currently, the authors know of no facilities dedicated to providing care to patients with eod . They may be placed in nursing homes or hospitals that cannot meet all their needs as young patients with a different course or manifestation of illness . They receive some care, but it is not optimal to their needs or to the needs of their families when it comes to specific athletic, recreational, or occupational activities . Because of their younger age, their spouse and children may have different needs than the family members of older patients . To date, there are few programs that include training for facility staff and family members, although no one refutes that those specialized training centers would provide the best care to patients with eod in the long run . Given the issues enumerated, this study despite its small scale found that the current state of affairs should not continue as such . Of course, one could extrapolate, for example, on the number of underdiagnosed eod cases due to alcoholism that create problems in the public health system with its current available resources and scarce finances . This study has shown that, regardless of the etiology of the dementia, there is a lack of treatment and resources . The study offers the limitations of a retrospective pilot study in describing the findings in a limited group of patients already self - selected as they were attending a memory disorder unit . The results should be assessed with this in mind and should not be generalized before longitudinal studies are undertaken . In addition, this study may have failed to consider available services if they were not visible to the studied community, although all known state agencies, eod support groups, and social work resources were enlisted before observations were stated . Extensive population studies on the incidence and prevalence of eod are for the most part still lacking.23 for this and many other reasons, the practical matching of resources to eod patients still lags . The interventions to date, including social work, are not sufficient to tackle the problem when there is a lack of resources and absence of policy targeting the rights and needs of a younger population . While the authors acknowledge the limitations of this retrospective pilot study, they consider that the data collected and presented on the eod patient population are invaluable . They encourage future research to validate the results in longitudinal studies and rely on a strong legislature . Future recommendations include education; increased awareness placed on the needs of this younger population suffering from dementia; and flexibility in giving space to potential emerging roles to be performed in nursing, social work, and hospice and palliative care coupled with statewide initiatives ., the authors would like to open the floor to a serious discussion among caregivers, patients, legislatures, insurance companies, and places of residence that will not shy away from tackling the tough issues and the formulation of a sustainable working plan for caring for patients with eod.
Osteoarthritis (oa) of the hip induces regressive changes in the hip joint cartilage and subsequent abnormality in the synovial membrane and articular capsule, leading to the impairment of joint function, and osseous changes also occur . The prevalence of this disease is not high,1 but coxalgia and surrounding pain and limitation of the range of motion occur, and subsequently limit adl with the progression of lesions . Oa of the hip is classified into primary and secondary cases based on the presence or absence of causes . Primary oa of the hip is defined as coxarthrosis with normal hip joint alignment and acetabular formation.2 in japan, primary cases account for only 0.65%, and many cases are secondary.2 the cause of secondary oa of the hip in which lesions are localized in the hip joint includes congenital hip joint dislocation, acetabular dysplasia, necrosis of the femoral head, and perthes s disease . When acetabular dysplasia remains in the growth period, it may become oa of the hip.3 when the femoral head is impaired with the treatment of congenital hip joint dislocation, deformation of the femoral head and neck occurs . The natural course of this disease is diverse and classified based on the severity of joint deformation into pre-, early, progressive, and end - stage coxarthrosis, but it does not necessarily progress with aging . The natural course is influenced by the lifestyle, and it has been reported that x - ray radiographic findings improved in some cases.4 conservative or surgical treatment is selected in the natural course, and the timing is dependent on individual cases . In japan, kampo has been clinically applied for rheumatic diseases for centuries . In this study, we applied kampo for progressive to end - stage coxarthrosis in a female in her 50 s, and achieved improvement of the hip joint function and qol . We encountered a 52-year - old woman with end - stage oa of the hip accompanied by acetabular dysplasia in whom the quality of life (qol) was improved by kampo treatment . She had demonstrated acetabular dysplasia at birth, and dislocation of the hip was treated with a plaster cast . Although anterior coxarthropathy was noted by a general practitioner at the age of 31, she was observed without treatment, due to the absence of joint symptoms . At the age of 42, she developed pain in the left hip joint, and early - stage oa of the hip was diagnosed . Therefore, she took non - steroidal anti - inflammatory drugs (nsaids), and received conservative therapies such as diet and muscle training . However, pain in the hip joint increased and her adl decreased at the age of 50 . Nevertheless, she continued to receive conservative therapies, although her symptoms did not change . At the age of 52, she consulted our department requesting japanese oriental (kampo) medicine . Hip joint x - ray showed end - stage oa in the left hip joint (fig . 1). We administered the kampo formulae; keishikaryojutsubuto (12tab / day: kracie co. ltd . Treatment for 3 months resulted in a decrease in hip joint pain as well as improvement of her adl . One year later, her joint symptoms have not increased, and both the harris hip score6 and the japanese orthopaedic association (joa) hip score7 have improved (table 1). Although kampo treatment continued over one year without discontinuation, there were no adverse effects . Osteoarthritis of the hip begins with degeneration or wear of the joint cartilage, and various articular changes progress . It is considered that degeneration and wear of cartilage occur when mechanical loads, such as labor, exercise, and trauma, are added to background factors, such as race, gender, aging, obesity, and heredity . The metabolic disorder of chondrocytes occurs and cartilage destruction progresses, which induces inflammation of the synovial membrane and causes swelling of the joint and bone destruction . It progresses from precoxarthrosis early stage progressive stage end stage in the general natural course, and various clinical symptoms appear in each disease stage . Secondary osteoarthritis of the hip, as described above, and the presented case involved acetabular dysplasia - associated secondary coxarthrosis . In japan, most patients with this disease are female, as was this patient . In treatment, conservative treatment is prioritized, such as instruction in daily living and physical and drug therapies, but some physicians consider that surgery in the early stage is desirable, even though symptoms are mild, when progression is apparently predicted . Various surgical methods have been proposed corresponding to the condition and stage of acetabular dysplasia and coxarthrosis (various osteotomy procedures, shelf operation, and total hip replacement). The patient showed end - stage coxarthrosis on x - ray radiography, and felt pain not only while going up and down stairs but also when walking, limiting adl . However, pain was rapidly alleviated after the initiation of kampo treatment (keishikaryojutsubuto and boiougito) and adl improved . Methods to judge therapeutic effects on osteoarthritis of the hip are roughly divided into comprehensive health scales8,9 widely covering physical functions through mental health and disease - specific scales specialized for specific diseases including coxarthrosis . Of the latter, it is comprised of pain (44 points), function (47 points), deformation (4 points), and range of motion (5 points). Pain is divided into 6 categories, and function is comprised of the walking ability (33 points) including claudication, support for walking, walking distance, and daily living activities (14 points) including going up and down stairs, wearing shoes and socks, sitting, and the use of public transportation . The clinical evaluation criteria of osteoarthritis of the hip most commonly used in japan are the hip joint function assessment criteria established by the japanese orthopedic association (joa hip score).7 the current joa hip score was prepared in 1995 based on the old joa hip score established in 1971, and it is comprised of the following 4 items: pain (40 points), range of motion (20 points), walking ability (20 points), and daily living activities (20 points). Categories proposed by charnley, such as unilateral, bilateral, and multiple joint developments, were adopted . The maximum score of the range of motion is 20 points, accounting for a large proportion of the overall score, compared to that in the harris hip score . In this patient, the joa and harris hip scores improved over the about one - year course, and so we consider that the objective effect of kampo treatment was exhibited . In japan, arthralgia has been treated with kampo for centuries, and many kampo formulations are administered for osteoarthritis,10 rheumatoid arthritis,11 and psoriatic arthritis.12 this kind of remedy is often used with several joints such as a knee joint13 in addition to hip joint caused by some pathogenesis such as degeneration, metabolism or inflammation . Although there has been no report on administrations of boiogito and keishikaryojutsubuto for osteoarthritis of the hip, an effect on osteoarthritis of the knee comparable to that of nsaids and synergistic effect with nsaids have been reported.14 the mechanism of the effect of kampo on osteoarthritis has not been clarified . Pathologically, cracks and erosion occur in the cartilage surface in excessively loaded regions, loosing joint cartilage, in osteoarthritis of the hip . In the deep layer of joint cartilage, blood vessels invade calcified cartilage, and subchondral bone comes to exhibit a bone effect . On the other hand, an immunomodulatory effect of kampo has been shown,15 and the inhibition of bone destruction in some cases has been reported.16 the inhibition of bone turnover in osteoarthritis is assumed . Additionally, there is another problem in this kind of treatment . Namely, kampo medicine has the important feature that differ from western medicine; the diagnostic system in kampo medicine is different from that in western medicine . Therefore, it is surely thought that kampo diagnosis may not be easy for readers to understand . When we treat ra patients with kampo medicine, it is necessary to make a kampo diagnosis as well as a diagnosis by western medicine . This issue makes it difficult to perform controlled clinical trials . In this case, we selected the keishikaryojutsubuto and boiogito according to the traditional diagnosis system . The target group for keishikaryojutsubuto and boiogito is follows: easy fatigability, coldness, obesity, sweating with swollen joints.5,17 furthermore, kampo formulae are generally composed of several herbal components, but not purified chemical compound . Therefore it is considered that these remedies are safe . However, pseudoaldosteronism by licorice root is well known to be an adverse effects of herbal medicine, and there are also allergic effects, such as skin eruptions and liver injury, that can be induced by crude drugs.1820 in summary, we reported a patient with end - stage osteoarthritis of the hip accompanied by acetabular dysplasia in whom the qol was improved by kampo treatment . Although the clinical use of this remedy should be with careful deliberation due to the absence of evidence, the course of this disease varies depending on the lifestyle among patients and kampo formulations may offer safe, potent supplemental treatment . The clinical course of a present patient may open the way to the achievement of randomized controlled trials and the further basic analysis of this remedy in the future.
In the elderly, frailty is an extremely common clinical state and a serious health problem in which there is an increase in an individual's vulnerability for developing increased dependency and/or mortality when exposed to a stressor [1, 2]. Overall, it appears that low levels of vitamin d play an important role in frailty . Vitamin d insufficiency may exacerbate frailty by affecting mainly two aspects, bone formation and neuromuscular function [3, 4]. Vitamin d is expected to be a treatment for frailty in an aging society [5, 6]. Studies examining the relationship between total circulating 25-hydroxyvitamin d [25(oh)d] levels and frailty have yielded mixed results . Many epidemiologic investigations have suggested that lower levels of 25(oh)d have been linked to muscle strength and increased risk of frailty [715]. Additionally, vitamin d supplementation reduces falls and improves muscle function in people with low 25(oh)d levels [1618]. However, not all observational studies have confirmed the relationship between 25(oh)d and the risk of frailty . In several randomized trials, no effect of vitamin d supplementation on the risk of frailty was observed [19, 20]. It is possible that, in these studies by using total 25(oh)d levels as an only measure of vitamin d status, individuals may be misclassified as sufficient or insufficient in vitamin d. the free hormone hypothesis postulates that only hormones liberated from binding proteins enter cells and produce biologic action . 25(oh)d circulates bound to vitamin d binding protein (dbp) (85% to 90%) and albumin (10% to 15%), with less than 1% of circulating hormone in its free form . However, the link between the biologic activity of 25(oh)d and frailty is not clear yet . We hypothesized that the joint effect of serum 25(oh)d and dbp levels is tightly linked to the risk of frailty and serum dbp levels might affect the correlation of 25(oh)d and frailty . From november 2012 to march 2013, 1048 aged men who were 70 years old were recruited in changsha city and its surrounding area in hunan province of china . Individuals were originally excluded if they were unable to walk without the assistance of another person or their renal function and liver function were being abnormal . Five hundred sixteen subjects had sufficient blood samples for analysis, and their characteristics are presented in table 1 . The study protocol was approved by the second xiangya hospital of central south university ethics committees in accordance with the declaration of helsinki and good clinical practices guidelines . Fasting morning blood was collected and serum was divided into aliquots and they were stored at 70c until they were shipped on dry ice to a central laboratory, where they were stored at 70c until analysis . Analysis was performed using the radioimmune assay kit (diasorin, stillwater, mn, usa) to measure 25(oh)d . Intra- and interassay coefficients of variation (cvs) for 25(oh)d were 6.3% and 9.1%, respectively . Dbp was measured by commercial enzyme - linked immunosorbent assay (elisa; r&d systems, minneapolis, mn, usa) according to the manufacturer's instructions . The assay was conducted after diluting serum with intra- and interassay cv 6.1% and 10.2%, respectively, for dbp . The manufacturer reports that dbp has no significant cross - reactivity with human albumin, vitamin d3, or a - fetoprotein . Intact pth was measured by electrochemiluminescence immunoassay on the cobas e160 automated analyzer (roche diagnostics, indianapolis, in, usa). The intra- and interassay cvs for intact pth measurement were 4.7% and 9.6%, respectively . Calcium and albumin levels were measured by dye - based photometric assays on an automated analyzer . Free levels of 25(oh)d were calculated using the following equation: (1)free 25(oh)d = total 25(oh)d1+(6103albumin)+(7108dbp). The reported correlation coefficient between calculated free 25(oh)d using this equation and measured free 25(oh)d by centrifugal ultrafiltration is 0.925 . Participants completed a questionnaire and were interviewed at the examinations and asked about health status, educational achievement, and smoking status . A selected medical history including a history of a physician diagnosis of stroke, cancer, dementia, hypertension, parkinsonism, diabetes mellitus, coronary heart disease, and chronic obstructive lung disease was obtained . Participants were asked to bring all medications including nonprescription supplements to clinic for verification of use . Body weight and height measurements were used to calculate a standard body mass index (bmi). Participants were classified as frail, prefrail, and nonfrail according to a validated screening tool based on the presence or absence of five measurable characteristics by fried and walston: weakness, low physical activity, slow walking speed, exhaustion, and weight loss . Weakness was defined as grip strength in the lowest quintile within groups defined by sex and bmi . Participants reported their level of daily leisure physical activity in the past year; low physical activity was defined as either complete inactivity or performing low - intensity activities less than 1 h / wk . Slow walking speed was defined as usual walking speed in the slowest quintile within groups defined by sex and height . Walking speed was measured on a 4-m course using photocell recordings at the course start and finish . Exhaustion was indicated by a response of occasionally or often / always to the statement, i felt that everything was an effort . Weight loss was measured as self - reported unintentional weight loss more than 4.5 kg within the past year . Individuals with a critical mass of 3 or more of the five components were defined as frail, those with one or two components were defined as prefrail, and those with none were defined as nonfrail . Distributions of sociodemographic and health characteristics, total 25(oh)d, and free 25(oh)d and dbp levels were summarized according to frailty status . The spearman rank correlation coefficient was used to describe the correlation between 25(oh)d and dbp levels . Linear regression analysis was used to study the relationship between total 25(oh)d (as independent variable) and dbp levels (as dependent variable), adjusting for age, education, bmi, and smoking status . Logistic regression models were used to assess the effects of 25(oh)d and dbp levels on the risk of being frail versus nonfrail cross - sectionally at baseline . Because exploratory analyses suggested potential nonlinear associations of 25(oh)d and dbp levels with frailty, 25(oh)d and dbp levels interaction terms were added to the main effects model to explore potential synergy between 25(oh)d and dbp levels in their associations with frailty . There was no significant difference in age, education, bmi, physical activity during leisure time, season of blood draw, vitamin d, and calcium supplementation among the four groups . 25(oh)d and dbp levels were correlated (spearman correlation coefficient = 0.16, p <0.05) adjusting for age, education, and bmi . Calculated free 25(oh)d levels were positively correlated with total 25(oh)d levels (r = 0.24, p <0.05). Table 2 reports baseline demographic and health - related characteristics, 25(oh)d, and dbp and free 25(oh)d levels of the study sample across frailty categories . There were significant differences in mean 25(oh)d and dbp levels across frailty categories (p <0.05 for stepwise increase or decrease trend). Compared with nonfrail participants, frail participants were older (p <0.05) and were less educated (p <0.05). To investigate potential joint association of 25(oh)d and dbp levels with frailty, odds ratios (ors) of participants being frail versus nonfrail were assessed across quartile of 25(oh)d and dbp levels . As shown in table 3, participants in the lowest quartile of 25(oh)d (q1a) and the highest quartile of dbp (q4b) levels, those in the lowest quartile of 25(oh)d (q1a) and the lowest quartile of dbp (q1b), and those in the lowest quartile of dbp (q1b) and the lower quartile of 25(oh)d (q2a) levels had significantly higher or of being frail compared with those in the highest quartile of 25(oh)d (q4a) and lowest quartile of dbp (q1b) (reference group), with or of 3.18 (95% ci: 1.464.56, p <0.05), 2.63 (95% ci: 1.313.68, p <0.01), and 2.52 (95% ci: 1.223.52, p <0.05), respectively, adjusting for age, bmi, and education . These results showed that, in the setting of the lowest quartile of 25(oh)d levels, both the lowest and the highest dbp levels confer increased risk for frailty, suggesting a u- shaped joint association of 25(oh)d and dbp levels with frailty, and that, in the setting of the lowest quartile of dbp levels, both the lowest and lower 25(oh)d levels confer increased risk for frailty . The interaction terms between quartile of 25(oh)d and dbp, however, were not statistically significant . This study has observed multiplicative interaction in the associations of dbp and 25(oh)d levels with frailty . The results suggest an association of increased levels of dbp and decreased levels of 25(oh)d with frailty (table 3). Therefore, a high level of dbp or low level of 25(oh)d may increase the risk of frailty, whereas a low level of dbp or high level of 25(oh)d may reduce the risk of frailty . Vitamin d status is determined by vitamin d stores in vivo and its biologic activity . The free hormone hypothesis postulates that only hormones liberated from binding proteins enter cells and produce biologic action . 25(oh)d circulates binds to vitamin d binding protein (dbp) (85% to 90%) and albumin (10% to 15%), with less than 1% of circulating hormone in its free form . In the present study, we have found that calculated free 25(oh)d levels were positively correlated with total 25(oh)d levels . Consistent with the free hormone hypothesis, the results of our study suggest that circulating dbp is an inhibitor of the biologic action of vitamin d in frailty patients . Unlike binding to dbp, binding to albumin does not inhibit the action of 25(oh)d . Dbp behaves similarly to other serum hormone carrier proteins and has broad clinical applications . Like thyroid hormone - binding globulin and sex hormone - binding globulin, dbp may act as a serum carrier and reservoir, prolonging the circulating half - life of vitamin d while at the same time regulating its immediate bioavailability to target tissues . Thus hormonal activity and sufficiency may be reflected by the amounts of bioavailable vitamin, not by total levels . So, a low dbp level may be beneficial due to the higher level of bioavailable 25(oh)d but may also be a bad thing considering vitamin d effects in tissues that express megalin . Indeed, as dbp is internalized in some cells through a megalin cubilin uptake, a higher dbp concentration may be a favourable point for these effects . The affinity of dbp for 25(oh)d depends on the dbp genotype with important consequences on the calculation of free or bioavailable 25(oh)d . A recent paper by powe et al . Reports that community - dwelling black americans had low levels of total 25(oh)d and dbp, resulting in similar concentrations of estimated bioavailable 25(oh)d as compared with whites . Racial differences in the prevalence of common genetic polymorphisms provide a likely explanation for this observation . Currently, clinical testing for vitamin d deficiency is based on measurement of total serum concentrations of 25(oh)d . Our data suggest that concentrations of total serum 25(oh)d may not be the best measure of assessing vitamin d insufficiency or sufficiency status in frailty patients . For example, aged men with high levels of dbp may appear to be 25(oh)d - sufficient but actually there may be higher risk of frailty due to deficient in bioavailable 25(oh)d . Joint examination of serum 25(oh)d and dbp concentrations could be better to reflect overall vitamin d stores and the biologic action of vitamin d. clinical trials of vitamin d supplementation in older frailty patients with low vitamin d status mostly report improvements in muscle performance and reductions in falls [1618]. The underlying mechanisms are probably both indirect via calcium and phosphate and direct via activation of the vitamin d receptor (vdr) on muscle cells and bone by 1,25-dihydroxyvitamin d [1,25(oh)2d3]. Vdr activation at the genomic level regulates transcription of genes involved in calcium handling and muscle cell or osteoblast differentiation and proliferation [3, 4, 27, 28]. First, sample size of the subgroups in the analysis across quartiles of dbp and 25(oh)d levels is relatively small and provides limited statistical power . Cautious interpretation of these results is warranted, and further investigation of the joint effects of dbp and 25(oh)d levels on frailty is needed . Third, other endocrine factors including igf-1 and testosterone have been identified for their interactions with dbp and 25(oh)d as well as their associations with frailty . Therefore, findings from this study should be interpreted in the context of the complexity of the nutrition and endocrine systems as well as multifactorial nature of the frailty syndrome . Despite these limitations, results from this study do support the free hormone hypothesis and we conclude that the joint effect of serum 25(oh)d and dbp levels may be tightly linked to frailty, or serum dbp levels modify 25(oh)d - frailty relationship in the older men . Our findings support the hypothesis that the biologic activity of 25(oh)d may be altered by dbp in frailty patients and suggest that joint examination of serum 25(oh)d and dbp concentrations in future studies could shed additional light on the role of vitamin d and its pathway cofactors in the aetiology of frailty.
Surgical goals and patient expectations of cataract surgery have evolved considerably over the past decade . Many patients now desire spectacle independence not only for distance but also for near and intermediate vision . Multifocal intraocular lenses (iols)1 provide spectacle independence by producing two or more focal points for distance, intermediate, and near vision.24 however, multifocality can result in reduced image contrast and unwanted photic phenomenon in the form of halos and glare.1,3 diffractive multifocal iols provide better uncorrected near visual acuity, contrast sensitivity, and reading performance with less photic phenomenon than refractive multifocal iols,5,6 but they have still been associated with some reduction in visual quality.7 material and design developments have contributed to improved optics . For example, the correction of spherical aberration8,9 with aspheric diffractive multifocal iols has been shown to improve visual quality and outcomes.2,10,11 additionally, materials with low chromatic dispersion and a high abbe number can reduce chromatic aberration and improve contrast sensitivity.12 the tecnis multifocal iol is an aspheric diffractive multifocal iol that comes in either silicone (three - piece [zm900]) or a low - dispersion high abbe number (55) hydrophobic acrylic (one - piece [zmb00] and three - piece [zma00]).12 a full diffractive surface with steps of uniform height is present over the posterior surface of the optic, providing a + 4.0 d near and with equal distribution of light to distance and near regardless of pupil size,13 helping to provide good functional vision under varied lighting conditions.14 the tecnis multifocal iol has been demonstrated to yield high levels of spectacle independence, low residual refractive error, and good distance and near visual acuity, resulting in high levels of patient satisfaction.2,4,15 however, none of the published papers report visual acuity at intermediate with this lens . This study was designed to evaluate monocular as well as binocular visual acuity at distance, intermediate, and near under photopic and mesopic lighting conditions in patients bilaterally implanted with this aspheric diffractive multifocal one - piece iol . Sixteen patients (13 females and three males) with a mean age of 66.29.2 years (range: 5081 years) who had previously undergone bilateral phacoemulsification surgery with implantation of the tecnis multifocal one - piece iol (zmb00; abbott medical optics, inc ., santa ana, ca, usa) at empire eye and laser center, bakersfield, ca, usa, between june 2010 and june 2011 were examined prospectively for visual acuity assessment under different lighting conditions and were asked to report satisfaction based on a subjective questionnaire . Careful centration was done in all surgeries and manual limbal relaxing incisions were performed in eyes with astigmatism 0.75 d. eyes with significant ocular pathology, previous refractive surgery, or intraoperative adverse events were excluded . The study was approved by the western institutional review board, olympia, wa, and written informed consent was obtained from all patients prior to participation . All patients were evaluated prospectively at least 3 months following surgery on the second eye . At the single study visit, monocular and binocular uncorrected and distance - corrected visual acuities were measured using the good - lite esv1500 self - calibrated illuminated cabinet for distance (20 ft/6 m), intermediate (2832 in/7080 cm), and near (1416 in/3540 cm) under photopic (85 cd / m) and mesopic (3 cd / m) lighting conditions . Statistical analysis of the data was carried out using spss software (v 17.0; spss inc ., variables were presented as mean standard deviation and cumulative percentages of eyes with different levels of visual acuity . Visual acuity measurements performed under photopic and mesopic light conditions were assessed for normality using quantile quantile plot and then compared using the paired t - test . Statistical analysis of the data was carried out using spss software (v 17.0; spss inc ., variables were presented as mean standard deviation and cumulative percentages of eyes with different levels of visual acuity . Visual acuity measurements performed under photopic and mesopic light conditions were assessed for normality using quantile quantile plot and then compared using the paired t - test . Patients were examined at a mean follow - up of 9.43.8 months (range: 4.716.2 months). The mean residual manifest refraction spherical equivalent was 0.0040.289 d. mean values and cumulative percentages of photopic uncorrected distance visual acuity and corrected distance visual acuity, measured binocularly and monocularly, are presented in figure 1a and b and reveal better visual outcomes under photopic conditions . Likewise, the binocular and monocular intermediate (figure 2a and b) and near (figure 3a and b) visual acuities were observed to be significantly better under photopic conditions than mesopic . (12.5%) or very satisfied (87.5%) with their postoperative vision without using glasses or contact lenses (figure 4). Nearly all patients (93.8%) reported that they never or hardly ever wore glasses (figure 5). Additionally, all patients reported that it was much more or more convenient to see without glasses while performing normal daily activities when compared with before surgery . While all patients reported that it was very easy or easy to see far away without glasses (figure 6), 6.3% reported difficulty in reading small print in dim light without glasses, 6.3% reported difficulty in seeing at arm s length without glasses, and 12.5% reported difficulty in driving at night without glasses . Overall, 75% of patients reported that the distance at which it was comfortable to read was perfect, whereas 25% of patients reported that the distance was a little too close (figure 7). Furthermore, 87.5% of patients did not notice any fluctuations in their vision; the other 12.5% of patients said that they noticed fluctuations in vision only occasionally when reading small print in dim light or driving at night . With respect to photic symptoms, 87.5% of patients reported no glare at night; 6.3% reported mildly bothersome glare, and only 6.3% reported very bothersome glare (figure 8). In addition, 68.8% of patients reported no halos around lights at night, 18.8% of patients reported halos to be present but not bothersome or mildly bothersome, and 12.5% had moderately bothersome or very bothersome halos (figure 8). Only 6.3% of patients experienced double images / ghosting, which was reported to be a total of 93.8% patients stated that they would definitely or most likely choose to have the same lens implanted again (figure 9). Patients were examined at a mean follow - up of 9.43.8 months (range: 4.716.2 months). The mean residual manifest refraction spherical equivalent was 0.0040.289 d. mean values and cumulative percentages of photopic uncorrected distance visual acuity and corrected distance visual acuity, measured binocularly and monocularly, are presented in figure 1a and b and reveal better visual outcomes under photopic conditions . Likewise, the binocular and monocular intermediate (figure 2a and b) and near (figure 3a and b) visual acuities were observed to be significantly better under photopic conditions than mesopic . All patients were overall satisfied (12.5%) or very satisfied (87.5%) with their postoperative vision without using glasses or contact lenses (figure 4). Nearly all patients (93.8%) reported that they never or hardly ever wore glasses (figure 5). Additionally, all patients reported that it was much more or more convenient to see without glasses while performing normal daily activities when compared with before surgery . While all patients reported that it was very easy or easy to see far away without glasses (figure 6), 6.3% reported difficulty in reading small print in dim light without glasses, 6.3% reported difficulty in seeing at arm s length without glasses, and 12.5% reported difficulty in driving at night without glasses . Overall, 75% of patients reported that the distance at which it was comfortable to read was perfect, whereas 25% of patients reported that the distance was a little too close (figure 7). Furthermore, 87.5% of patients did not notice any fluctuations in their vision; the other 12.5% of patients said that they noticed fluctuations in vision only occasionally when reading small print in dim light or driving at night . With respect to photic symptoms, 87.5% of patients reported no glare at night; 6.3% reported mildly bothersome glare, and only 6.3% reported very bothersome glare (figure 8). In addition, 68.8% of patients reported no halos around lights at night, 18.8% of patients reported halos to be present but not bothersome or mildly bothersome, and 12.5% had moderately bothersome or very bothersome halos (figure 8). Only 6.3% of patients experienced double images / ghosting, which was reported to be a total of 93.8% patients stated that they would definitely or most likely choose to have the same lens implanted again (figure 9). Patients seeking multifocal iol implantation have high expectations for their vision at all distances and under all lighting conditions . It is, therefore, important to assess the quality of vision at distant, intermediate, and near under different illumination settings monocularly as well as binocularly . This study evaluated visual outcomes of patients bilaterally implanted with the tecnis multifocal one - piece iol (model zmb00) and found excellent distance, intermediate, and near visual acuity outcomes yielding a high degree of spectacle independence and a low level of photic phenomena, resulting in high patient satisfaction . In general, all patients were satisfied with their vision without using glasses for seeing far away and most of the patients felt comfortable in performing activities such as reading small print in dim light, seeing at arm s length, and driving at night . The visual acuity results of this study are comparable to or better than those reported in previous publications with tecnis multifocal iols (zmb00, zma00, and zm900) and other presbyopia - correcting iols.1,2,1523 since most studies do not state whether visual acuity was measured under photopic or mesopic light conditions, visual acuities are assumed to be photopic unless otherwise specified . Mean binocular distance visual acuities (figure 1a) are either comparable to or better than those reported in previous studies with three - piece silicone (zm900), one - piece acrylic (zmb00), and three - piece acrylic (zma00) versions of the tecnis multifocal iol.2,4,16,19,22 likewise, mean monocular distance visual acuities (figure 1b) are comparable to or better than those reported by previous authors.1,15,1723 a comparison of cumulative percentages of patients achieving visual acuity of 20/20 revealed that 87.5% of patients had uncorrected distance visual acuity of 20/20 or better in this study (figure 1a), compared with the corresponding values of 30% and 57.9% reported by ngo et al24 and packer et al,3 respectively, in patients with the three - piece silicone (zm900) lens . The corresponding value for corrected distance visual acuity (20/20 or better) was 100% in this study, compared with the studies by ngo et al24 (43.3%) and packer et al3 (~70%) reported previously . Furthermore, comparison with other models of refractive and diffractive multifocal iols also revealed that the binocular distance visual acuity found in the current study is either equivalent or better.2528 the development of posterior capsular opacification may degrade optical quality with a diffractive iol and might be expected to disproportionately affect visual acuity with the study iol compared with other lenses . However, posterior capsular opacification was not found to be significant in any eye in the current study . The mean binocular photopic and mesopic near visual acuities in the current study are better than those reported in previous paper evaluating the one - piece acrylic tecnis multifocal iol (zmb00).4 similarly, in comparison to the three - piece acrylic (zma00; abbe number 55) and the three - piece silicone (zm900) versions (abbe number 42), the near visual acuities reported here are either comparable or better.3,16,19,22,23 the near visual outcomes in this study are also similar to or better than those reported for other diffractive and refractive multifocal iols.2630 the improvement in distance and near visual outcomes found in the current study may be due to a number of factors . A change in lens material from silicone (zm900) to a particular hydrophobic acrylic (zma00 and zmb00) with significantly less intrinsic chromatic aberration and chromatic dispersion (higher abbe number) may be a contributor.12 additionally, the rings on the one - piece acrylic version (zmb00) provide an enhanced diffractive profile that is designed to improve night vision symptoms . Differences in surgical technique, which included the correction of astigmatism in this study, as well as careful centration,31 may also have contributed . Finally, variability of testing conditions, particularly when comparing a multicenter study with a single center study, could account for some differences as well . Along with distance and near visual acuity, this study examined intermediate visual acuity under both photopic and mesopic light conditions and found comparable or better results than in previous studies with the tecnis multifocal iols and other diffractive and refractive multifocal iols.16,22,27,30 comparison of mean visual acuity data revealed that distance visual acuity outcomes were the best, followed by near and intermediate . While the distance visual acuities were ~0.51 line better than the near visual acuities, the near visual acuities were 11.5 lines better than the intermediate visual acuities . Furthermore, photopic visual acuities were 12 lines better than mesopic acuities at any distance . Finally, due to expected gains from binocular summation, binocular visual acuities were 0.51 line better than the monocular visual acuity.32 for evaluation of visual performance and patient satisfaction following presbyopic iol implantation, visual acuity data alone are not sufficient . Patient satisfaction, spectacle independence, ease of performing vision - dependent tasks, and problems with photic phenomena can all be further evaluated with patient - reported outcome (pro) questionnaires . As more specific functional visual outcome analyses are needed, pro devices are becoming an increasingly important tool in these assessments . With respect to spectacle independence, the present study reports 81.3% of patients never wore glasses after surgery on a 5-point scale . In the us food and drug administration (fda) premarket approval study with the three - piece silicone iol (zm900), 86.2% of patients never wore glasses (one year) after surgery on a 3-point scale.25 interestingly, if the data from the present study were pooled into a 3-point scale, 93.8% of patients would fall into a never or hardly ever wear glasses category . Either way, this study compares favorably to other studies with diffractive or refractive multifocal iols, which have reported spectacle independence for distance in the 80%100% range1,3,4,17,19,21,25 and for near in the 12%98% range.1,3,17,19,21,25 with respect to photic phenomenon, in the present study, one patient (6.3%) reported very bothersome glare and two patients (12.5%) had moderately bothersome or very bothersome halos around lights at night (figure 8). Corresponding values for mildly bothersome glare and halos were 6.25% and 12.5%, respectively . In two other studies with the one - piece acrylic zmb00, bautista et al15 reported combined photic effects as moderate in 1.4% and mild in 10% of subjects, and schmickler et al4 reported glare to be present in 8% of patients at night and in 4% during day . Schmickler et al4 did not report corresponding information on halos . When compared with the fda premarket approval study data with the three - piece silicone (zm900) iol, severe night glare and halos were reported to be as low as 2.4% and 5.4%, respectively, in nondirected responses and as high as 16.6% and 18.3%, respectively, in a prompted - choice questionnaire.25 as such, it seems that the current study demonstrates photic phenomenon comparable to previous reports.4,15,25 differences in patient - reported outcomes for photic phenomena may in part be due to differences in the method of questioning as well as the scoring strategy . For example, bautista et al15 used a 4-point scale to assess glare or halos (none, mild, moderate, and severe), this study used a 5-point scale (not present, present but not bothersome, mildly bothersome, moderately bothersome, and very bothersome) and the fda study used as high as a 7-point scale . Other variables in pro construction, such as differences in wording and directed versus nondirected questioning, can affect the results . Thus, it would be beneficial to have validated pro questionnaires for future studies of presbyopia - correcting iols . In spite of the variation in the scope and content of different questions for the same variable in the pro surveys, however, the sex difference and small sample size may have affected the pro . Future studies with larger sample size and equivalent distribution of males and females may validate the current study results . Nevertheless, the current study results are indicative of good patient satisfaction after tecnis multifocal iol implantation . Bilateral implantation of tecnis multifocal one - piece iols provided good distance, intermediate, and near visual acuity under photopic as well as mesopic lighting conditions . High levels of spectacle independence with low levels of photic phenomenon were achieved, resulting in excellent patient satisfaction.
Melanoma is the malignant tumor of melanocytes which may present in a wide morphological spectrum including highly pigmented to amelanotic appearance . Clinically there are four main subtypes of cutaneous melanoma: superficial spreading melanoma, lentiginous melanoma, nodular melanoma and acral lentiginous melanoma . The diagnosis of amelanotic variants of melanoma may especially be challenging both clinically and histologically . In addition to clinical variants of melanoma, in the literature various atypical histological variants of melanoma have been reported, such as fibroblastic, desmoplastic, chondroid, osteoid, and myxoid melanoma, which were classified according to stromal changes [13]. Myxoid melanoma is an unusual variant of malignant melanoma, which is characterized by atypical spindle cells and dense mucin deposition in dermis . The prevalence of this melanoma variant is not well known and may develop on cutaneous or extracutaneous sites, including the sino - nasal passages . This tumor may be confused with other mucin - containing neoplasms, histologically benign or malignant, and clinically is usually reported in elderly people with a similar progress to other variants of melanoma . A 28-year - old male presented to our outpatient clinic with a history of an asymptomatic pink nodule which had been growing slowly for last 6 months . Dermatological examination revealed a 2.5 x 2 cm diameter pink, mildly infiltrated tumoral lesion with two pigmented papular lesions on left arm (figure 1). Dermoscopic examination revealed pink - white cristalline structures and blue - grayish ovoid globules (figure 2). The lesion was totally excised with 3 mm margins with the initial diagnosis of basosquamous carcinoma, amelanotic melanoma and basal cell carcinoma . Histopathological examination was consistent with myxoid melanoma with breslow thickness 11.6 mm, clark level v (figure 3a, b). There was no vascular, lymphatic or perineural invasion histologically, and mitoses 2/1 per mm . Strong positivity was detected with s100 and hmb45 staining, and widespread positive staining was detected with pas - alcian blue for mucin deposition (figure 4a, b). Laboratory tests, including complete blood count, routine biochemistry, lactate dehydrogenase and beta-2 microglobulin and imaging test for metastasis, including pet - ct and sentinel lymph node biopsy, were all clear . The patient is currently well and clinically free of recurrence 18 months after the diagnosis . The presence of myxoid stroma in malignant melanoma was first published by bhuta et al in 1986 in four metastatic malignant melanomas . Clinically these tumors were reported to be amelanotic, but in some cases melanogenesis was also shown with fontana masson preparations . Histologically, this rare variant of melanoma is characterized by large malignant melanocytes and a basophilic mucinous matrix . In all cases, the myxoid stroma is comprised of mesenchymal acidic mucopolysaccharides, as opposed to neutral epithelial mucins . Mucinous material is usually located around the tumor cells, as in our case, but not within the tumor cells as in cytoplasmic localization, confirming that the myxoid matrix is produced as a response to the stromal cells in the tumor rather than being a product of the tumor cells . Myxoid changes are more often reported in metastatic tumors than in primary malignant tumors, but in our patient due to the completely intradermal location of tumor cells with no junctional component, ith a nodular architecture, features of malignancy, no ulceration, the absence of peripheral nerves, and an absence of preexisting melanocytic nevus, he was diagnosed as primary dermal melanoma . Additionally, based on the histopathologically myxoid stromal changes, he was diagnosed as primary myxoid melanoma . Also no other metastatic or primary malignant lesion typically, s100 staining is strongly positive, but immunostaining with hmb-45 is less uniform and both positive and negative results were reported in the literature . In our patient both s100 and hmb45 staining were strongly positive . The differential diagnosis of myxoid melanoma is broad, including several other benign and malignant myxoid neoplasms of soft tissue as well as epithelial cancers such as myxoid liposarcoma, myxoid malignant fibrous histiocytoma, low - grade fibromyxoid sarcoma, myxoid chondrosarcoma, myxoid peripheral nerve sheath tumors, dermatofibrosarcoma protuberans and metastatic adenocarcinomas . The clinical and the prognostic significance of mucin deposition in melanomas is challenging due to presence of myxoid material both in primary benign or malignant tumors . Some authors claimed that mast cells and secretion of transforming growth factor beta stimulates fibroblast secretion of mucin contributing to the tumor s invasive potential; however, in the absence of compelling contrary data, the current series of cases suggests that myxoid stroma is more significant in diagnosis rather than prognosis of myxoid melanoma . Although the real importance of myxoid changes in tumors is not well known, awareness of this stromal pattern in malignant melanomas may prevent misdiagnosis and therapeutic errors.
Since 1997, there were many changes in the employer practices affecting the organization of work in both the developed and developing countries from economic crisis . Thailand being a developing country is of no exception in such economic crisis (1, 2). One of these changes has been often - repeated rounds of downsizing and restructuring by employers . Frequently related to other practices like outsourcing, contractual jobs, downsizing, restructuring job intensification, multi - tasking, and changes in management behavior at workplace have increased the level of job insecurity among employees (35). Employees (e.g. Nurses, lecturers, doctors, farmers etc .) Had poor mental health (e.g. Job stress, job insecurity, job condition, anxiety, burnout etc .) From downsizing / reorganization (611) and have sever health problems like stress linked to a heart attack (myocardial infarction), cardiovascular disease, stork, and autoimmune disease . Occupational stress is associated with cardiovascular disease, although, mechanisms of controlling them are ambiguous and needs further investigation (12). In thailand, both government and private sectors has been affected from the global economic crisis way back since 1997 (1). The thai government efforts to downsizing / and reorganizing of government sector is part of the intervention program as suggested by the international monetary fund (imf). The new government university policies introduced in year 2000 about employment conditions, have affected the academic staffs in government university . Policy a brain of thailand which is the academic staffs holding a masters or doctoral degree are required to sign a contract to work with the government universities between 6 month to 5 years with an inclusion of those who have taken the government scholarships and have to pay back in term of service period requirement . This also led into difference of social and health inequality in each of the government university at workplace in thailand (13). Occupational stress is a psychosocial dimension of occupational health concept on social determinants of health, especially, in job and environmental conditions (1417). Recently, universities staff network in thai government universities have called the higher education commission and ministry of education to resolve this issue and get them relief from government education policy (e.g. Inequity salary, poor welfare, law, job and environment conditions etc .) Which is leading towards job insecurity, physical and mental health problems of the employees from occupational stress (13). It focused on occupational stress dimension based on social determinants of health to investigate a causal relationship of occupational stress among the academic university employees in thailand and examine each variables (job & environment condition, wage, family support, and periods of duty) on stress . The operational definitions of this research consisted of job & environmental condition, periods of duty, family support, wage, and stress . Job & environmental condition means job tasks, job hours, job environments, welfare, job securities, and workload by using a 4-point likert - type of scale of none, coded as 1 (least), 2 (less), 3 (more), and 4 (most). A period of duty is an individual factor that calculated from number of working year among participants . Family support is a social variable to measure dimension of family support (e.g. Adaptation, resolve, growth, affection, and partnership) by using the family apgar questionnaire . Stress used the summarized scores of the suanprung stress test-20, which is a standard measurement from department of mental health, ministry of public health, thailand . Hypothesis of this original article were as follows; (i) job & environmental condition, wage, family support, and periods of duty variables had direct effect to stress . The aim of this original article was to investigate a causal relationship of occupational stress among the academic university employees in thailand . This cross sectional research was conducted in 2014 among 2,000 academic university employees at government universities using stratified random sampling . The eligibility criteria included thai academic university employees who could communicate in the thai language, and work as academic staffs of university employees at government universities of thailand, both female and male academic staffs, and 20 to 60 years old . The criteria excluded thai academic staffs of university employees at government universities of thailand who were> 60 years old, and thai academic staff of university employees at private universities in thailand . The sampling method was stratified random sampling . First strata was grouped in 49 new government universities, and 24 original government universities of thailand from 5 regions in thailand by stratified random sampling . After 10 new government universities and 6 original government universities of thailand were selected by random sampling . Academic staffs university employees both new government universities and original government universities of thailand were selected by random sampling from these 16 government universities of thailand . Therefore, thai academic staff university employees in this original article totaled 2,000 cases who had worked in 16 government universities of thailand . They had worked in two groups (new government universities, and original government universities). Sample size was calculated as no less than 384 cases at a 95% confidence level . For the causal analysis, 2,000 participants were used according to the rule of 5 subjects per parameter which participants of this research had enough to confirm and confidence of the results . Research started when the researchers sent the quantitative questionnaire to the ethics committee for human research at mahidol university to examine the ethics of the research before the approval . The instruments of this original article were questionnaires about demographic general data and occupational stress among university employees at government universities . These instruments were sent to five professors in order to verify content and construct validity . After that, researchers and assistance researchers started to the next research process for data collection . Three important domains have been discussed in this research (i.e. Individual, family, social and environment) which were independent variables, and a dependent variable (stress). Family factor was divided into five dimensions (adaptation, resolve, growth, affection, and partnership) by the family apgar questionnaire . Name of university, province, sex, and education were used to measure general data . The job & environmental variable and their questions were measured related to the dimension of job task (teaching task, research task, social service task, thai culture task, multi - task, others), working hours (period of teaching, research, social service, thai culture, others, and much working hours), quantitative job task for teaching, research, thai culture, job environment (e.g. Enough to equipment for your job, and job environment followed by the concept of occupational health and safety), welfare (e.g. Your university had welfare equal to welfare of government officer, administer had welfare policy to practice in every dimensions, and university had welfare motivation for university employees), and job insecurity (e.g. You had job security, the evaluation for working and bonus had effect to your security, and period of contracted university employees had effect to your job insecurity). These items were replied using a 4-point likert - type of scale of none, coded as 1= least, 2= less, 3= more, 4= most and an open question is how the relationship of job & environment condition, family, wage, and others have an effect? . The latter, was interval scales (0= hardly ever, 1= some of the times, 2= almost usually). These were divided into three levels; 710 scores = highly family support, 46 scores = moderately family support, 03 scores = severely family support . A point of 0 to 5 suggests a less stress than a normal level, point of 6 to 17 suggests a stressed at a normal level, point of 18 to 25 suggests a moderate level of stress, point of 26 to 29 suggests high level of stress, and 30 points and above suggests a severe stress (20). The main measure of predictor variables (family support, sex, job & environmental condition, wage, and periods of duty) in the questionnaire used in this research were interval scale in path model . The questionnaires were evaluated to be reliable at no less than 0.8 by using spss / pc+ for windows to find cronbach s alpha coefficient . The reliability of the predictor variables, family support variable and stress were 0.82, 0.8 and 0.91 respectively . The primary data collected from the academic university employees who were academic staffs at government universities of thailand . The principal investigator explained the entire questionnaire to data collectors . If participants had difficulty understanding the questions, data collectors provided further explanations by face - to - face surveys, and using social network . The data analysis were analyzed by minimum and maximum scores, skewness, kurtosis, mean, standard deviation, and pearson correlations to measure predictor variables on stress among university employees by spss program in version 20.00 . The relationships of occupational stress among university employees were verified by causal relationship using the m plus program in version 5.2 (21). The causal relationship was used to analyze r square and measure the fit of the model . The criteria of rule for test of path model using the m plus program is as follows: chi - square not equal to 0, degrees of freedom not equal to 0, p - value more than 0.05, cfi (comparative fit index) more than 0.95, rmsea (root mean square error of approximation) less than 0.07, srmr (standardized root- mean - square residual) less than 0.05 . This criteria of rule for test of path model was appropriated to population (more than 250 samples), and it used observe variables (less than 12 variables). Individual parameters test considered total relationship, direct relationship, and indirect relationship of independent variables on dependent variables and causal diagram . The mean and standard deviation for the age of academic university employees is 40 6.992 . The mean and standard deviation for the periods of duty, and wage among academic university employees are 6.33 1.843, and 20,001 to 25,000 0.792 . The mean for job & environmental condition, family support, and stress level of academic university employees are more, some of the times, and moderate . The minimum and maximum age, and periods of duty are 24, 53, 1, and 14 years, respectively . The periods of duty, wage, job & environmental condition, and stress variables represent a positive skewness of 0.193, 0.331, and 0, respectively . The family support variable displays a negative skewness of 0.112 . The periods of duty, wage, job & environmental condition, family support, and stress variables showed a negative kurtosis of 0.779, 0.290 . 0.999, and 0.287, respectively (table 1). Based on goodness of fit results, which is most accurate for this sample having consideration is chi - square (0.405), p - value (0.5247), cfi (1.000), tli (1.001), rmsea (0.947), and srmr (0.001). R - square of wage, family support, and stress are 0.806, 0.283, and 0.147 (p value <0.05), respectively . Their results of a causal relationship of occupational stress among university employees are shown (table 2 and fig . 1). Statistical data among university employees (n = 2,000) direct and indirect effect of causal relationship among university employees (n = 2,000) a causal relationship of occupational stress among university employees (n = 2,000) p -value <0.05r - square of wage = 0.806 (p -value <0.05)r - square of family support = 0.283 (p -value <0.05)r - square of stress = 0.147 (p -value <0.05) r - square of wage = 0.806 (p -value <0.05) r - square of family support = 0.283 (p -value <0.05) r - square of stress = 0.147 (p -value <0.05) following by public health and occupational health concept focused on four dimensions (e.g. Physic, bio, environmental, and psychosocial dimensions). Occupational stress is one of the psychosocial dimensions in field of public health and occupational health . At present, various researches in accordance to who apply social determinants of health with public health and occupational health to drive the developmental perspectives for entire population (22). Results, showed causal relationship of occupational stress among academic university employees have goodness of fit indices and are most accurate for 2,000 academic university employees . It indicated that the important causal relationship due to occupational stress is job & environmental condition following by hypothesis ii (fig . 1) which is social and environment factors associated with work - related factors, and job task . Periods of duty is individual factor associated with occupational stress among academic university employees, whereas, wage, family support, and periods of duty variables had direct effect on stress following by hypothesis i. it indicated that these factors related to psychosocial dimension in field of public health, especially, occupational health based on social determinants of health . Job & environmental condition on occupational stress is a dimension related to social determinants of health (16, 17). The latter, is logic of thinking between social and public health with health for people in this world that it is discussed by world health organization . It is a major strength of this research that applies questions in fields of public health, especially, occupational stress based on social determinants of health . The result of this research is in consistence with the study of chinese academic staffs in universities . The latter, is a group of high risk to create occupational stress having an increase of job tasks within university in china . Not only it increases job task, but also it increases research task (18). The high job & environmental condition among academic staff in university linked into occupational stress (11, 22) and environmental factor linked into job satisfaction among academic staff in university (23). Administrator and service employees in university found that job & environmental condition (e.g. High timetable and job performance) is exogenous factor associated with occupation stress at moderate level (18). The results of this research found that occupational stress level among academic university employees is at moderate level these stress can accept to create active at individual level but it can increase stress from occupation . This strength of this research is focused on bio - psychosocial model by causal relationship (m pulse program) which is linked into individual and psychosocial factors . In addition, it can be explained to causal relationship of occupational stress among university employees, which are new employees group at government universities in thailand resulting from thai government policy . It indicated that independent variables to dependent variable (stress) were the good questions to explain and link into the causal relationship of occupational stress among academic university employees . The limitation and constraints of this research is shortage of budget along with delay in budget payment release . Respondents finished master and doctoral degree that had academic freedom with their occupations more than the other groups in university and they got limited family support have led into occupational stress at moderate level among academic university employees . There are important groups of high social status, referred as; brain of thailand . Government should pay attention on them before the situation gets worst (i.e. Brain drain among academic university employees). Researchers in future should look into the importance of psychosocial factors in relation to university employees who are new group in thailand as well as their impact on employees from different organizations across the country . This will help the policy makers to develop such policies that addresses the emerging psychosocial hazards problems national wide . Some suggestions for the next research are that researchers should be increase an important in bio - psychosocial research in thailand, especially, sem analysis (structural equation modeling analysis), and qualitative analysis both university employees who are new group in thailand, and the other employees to develop government policy in the future . The causal exogenous relationship of occupational stress among 2,000 academic university employees, which had direct effect to stress, is job & environmental condition, as social and environmental factor, and periods of duty as individual factor (p <0.05). The causal endogenous relationship (e.g. Family support, and wage) of occupational stress had direct effect to stress . The stress level of occupational stress among academic university employees in this research was at moderate level . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors . 2013/331.2811 which accepted on november 28, 2013 from documentary proof of the committee for research ethics (social sciences), faculty of social science and humanities, mahidol university, salaya campus, nakhon pathom province, thailand.
Giant inflammatory (filiform) polyposis is an uncommon benign lesion and is usually associated with inflammatory bowel disease (ibd). Long - term inflammation of the colonic mucosa during chronic ibd with alternating periods of ulceration and healing may lead to the formation of finger - like projections [1, 2]. In rare cases, a giant inflammatory polyposis forms a large tumor mass [3, 4, 5, 6, 7]. On colonoscopy and radiologic studies, numerous filiform polyps appear as a mass of worms or as a fungating mass; hence, this condition is easily confused with cancer . Inflammatory polyps or pseudopolyps are the most common lesions observed both in ulcerative colitis (uc) and crohn's disease (cd) [8, 9, 10, 11, 12]. Moreover, in some cases, the polyps contain both mucosal and submucosal tissue, indicating initial inflammatory involvement of the deeper bowel layers . They are composed of a central core of submucosal connective tissue coated by normal, non - inflamed mucosa . Here, we report the case of a patient with uc with large tumors obstructing the transverse and descending colon, who presented with severe diarrhea and melena . A 25-year - old japanese man with an uc history of 2 years and 6 months was successfully treated with prednisolone . The disease was in remission and his symptoms had been relieved . However, the disease flared up and the patient was admitted to our hospital because of severe abdominal pain and bloody diarrhea . Physical examination revealed direct soreness and masses in the upper and left lower abdominal sites . Blood examination revealed anemia (hemoglobin level 5.5 g / dl [normal 11.515.0]), hypoproteinemia (protein level 4.6 g / dl [normal 6.78.3]) and hypoalbuminemia (albumin level 1.9 g / dl [normal 3.85.3]). Computed tomography (ct) imaging showed bowel wall thickening of the transverse and descending colon, which raised suspicion of wall thickening of several segments of the small bowel . The ct scan also demonstrated localized high - density areas in the lumen of the transverse and descending colon (fig . A colonoscopy revealed a large mass with numerous white - pale reddish polyps of complex shape in the descending colon . Based on this examination, colon carcinoma was strongly suspected, and several biopsies were performed . Histology of the examined sections indicated uncharacteristic inflammatory changes in the mucosa, but no cellular dysplasia ., we observed one tumor measuring 23 18 cm in the transverse colon and another measuring 14 13 cm in the descending colon . There were no obvious areas of ulceration, although each tumor had a coral - reef - like surface with numerous soft, finger - like polyps (up to 5 cm in diameter) projecting into the lumen . The cross - section of the tumors showed that narrow strings of tissue were interconnected, forming multiple, variably sized spaces inside the tumors (fig . 2). The surrounding fat tissue was unaffected, and no suspicious lymph nodes were detected . Microscopic examination revealed that the tumors comprised strings of fibrotic connective tissue, lined by inflamed colonic mucosa, and the surrounding spaces were filled with fecal and mucoid materials . A fibrovascular core and inflammatory polyposis were evident from the submucosa to the proper muscular layer and the submucosa had partially disappeared in both the elevated and the depressed lesions . The polyps contained regenerative and hyperplastic muscularis mucosa with an arborized and thickened configuration (fig . The crypt architecture was normal, and no epithelial atypia of the polyps was noted . The mucosal inflammation consisted of lymphocytes, plasma cells, eosinophils and lymphoid follicles . Neutrophil infiltration, cryptitis, crypt abscess, which is characteristic of active uc, and paneth cell metaplasia were found in the transverse colon (fig . Sections through the bowel wall near the mass showed colonic mucosa with regenerative features, including architecturally mildly distorted glands, but without active inflammatory changes (fig . Finally, histopathological examination of the resected colon led to the diagnosis of giant inflammatory (filiform) polyposis associated with uc . Inflammatory polyps are a common complication in patients with ibds such as uc and cd, accounting for approximately 1020% of all cases . Inflammatory polyps may originate from the regenerative mucosa in the remission stage after an acute recurrence of uc or cd . In rare cases, numerous large - sized polyps are present, and this condition is known as giant inflammatory (filiform) polyposis [8, 9, 10, 11, 12]. These polyps are associated with cd in approximately two - thirds of cases and with uc in one - third of cases . Giant inflammatory polyposis can be localized in one segment of the colon, or numerous polyps can be diffusely involved in the entire colon . The transverse colon is the most common site, followed by the sigmoid and descending colon, the cecum and the splenic and hepatic flexures . In our case, the clinical features of the reported cases indicate that the time from the initial diagnosis of uc to confirmation of giant inflammatory polyposis ranged from 3 to 276 months . In our patient patients may present with various symptoms, including anemia, weight loss, cramping abdominal pain, diarrhea, passage of blood through the rectum and colonic obstruction . Most patients go undiagnosed until they develop signs and symptoms of obstruction, hemorrhage and anemia [1, 2, 14]. The pathogenesis of giant inflammatory polyposis is considered to result from enlarged mucosal tags, caused by repeated peristalsis and fecal stream . Giant inflammatory polyposis may be related to postinflammatory regeneration or hyperplastic proliferation of the colonic mucosa between ulcerations . The histopathological features include inflammatory infiltrates overlying the muscularis mucosae, deep fissure - like ulcers, chronic mucosal inflammation with lymphoid hyperplasia and nerve hyperplasia in the surrounding mucosa [1, 2, 4, 5, 6, 15]. Giant inflammatory polyposis in uc may be a consequence of severe inflammation rather than of increased duration of the disease . In summary, we present the case of a japanese patient with uc who was diagnosed with giant inflammatory polyposis localized in the transverse and descending colon . Severe ulcerative inflammation and its repair process may have caused the development of the giant inflammatory polyps.
The human jurkat t cell line was maintained in rpmi 1640 medium supplemented with 10% fcs, 10 mm hepes, and antibiotics (all from gibco brl, eggenstein, germany). The cd95-resistant jurkat subline jurkat - r was generated by continuous culture in the presence of anti - cd95 mab (igg3, 1 g / ml; cell diagnostica, mnster, germany) for 6 mo . Etoposide and mitomycin c were obtained from the clinical pharmacy (medical clinics, tbingen, germany). Doxorubicin, cycloheximide, and oligomycin were purchased from sigma (deisenhofen, germany) and staurosporine from boehringer mannheim gmbh (mannheim, germany). Mitomycin c was dissolved in methanol, and doxorubicin, etoposide, and staurosporine in ethanol and kept as stock solutions at 70c . Intracellular atp was depleted by incubating cells in glucose - free rpmi 1640 medium supplemented with 2 mm pyruvate, 0.1% fcs, and 2.5 m oligomycin, an inhibitor of f0f1-atpases, in order to prevent production of atp from both glycolysis and oxidative phosphorylation (25, 26). Cleavage of caspases and the caspase substrate poly(adp - ribose)polymerase (parp) was detected by immunoblotting . 2 10 cells were seeded in 24-well plates and treated with the apoptotic stimuli . After the indicated time periods, cells were washed in cold pbs and lysed in 1% np-40, 20 mm hepes, ph 7.9, 350 mm nacl, 20% glycerol, 1 mm mgcl2, 0.5 mm edta, 0.1 mm egta, 0.5 mm dithiothreitol, containing 3 g / ml aprotinin, 3 g / ml leupeptin, and 2 mm pmsf . Subsequently, proteins were separated under reducing conditions on an sds - polyacrylamide gel and electroblotted to a polyvinylidene difluoride membrane (amersham buchler gmbh, braunschweig, germany). Membranes were blocked for 1 h with 5% nonfat dry milk powder in tbs and then immunoblotted for 1 h with rabbit anti - parp antibody (1:2,000; boehringer mannheim gmbh) and mouse mabs directed against caspase-8 (1:10 dilution of a hybridoma supernatant; biomedia, baesweiler, germany) and caspase-3 (r&d systems, wiesbaden, germany). Membranes were washed four times with tbs/0.05% tween 20 and incubated with the respective peroxidase - conjugated secondary antibody for 1 h. after extensive washing, the reaction was developed by enhanced chemiluminescent staining using ecl reagents (amersham buchler gmbh). For analysis of cytochrome c release, cells were collected by centrifugation, washed with ice - cold pbs, and resuspended in 5 vol of buffer a containing 250 mm sucrose, 20 mm hepes, ph 7.5, 1.5 mm mgcl2, 10 mm kcl, 1 mm edta, 1 mm egta, 1 mm dithiothreitol, 0.1 mm pmsf, 10 g / ml leupeptin, and 10 g / ml aprotinin . The cells were homogenized with 15 strokes in a douncer, and the homogenates were centrifuged at 1,000 g to remove cell nuclei . The supernatants were transferred to a fresh tube and centrifuged at 10,000 g for 10 min to deplete mitochondria . The resulting supernatants, designated as cytosolic s10 fraction, from each sample were loaded on a 12%-sds polyacrylamide gel . Cytochrome c release was analyzed by immunoblotting with the mouse mab 7h8.2c12 (pharmingen europe, hamburg, germany). To evaluate the ability of cytochrome c to activate caspases in cytosolic extracts, 150 g of an s10 fraction was incubated with 1.25 m bovine cytochrome c (sigma) and 1 mm datp at 30c in a final volume of 25 l for the indicated time periods . At the end of the incubation, the reaction mixture was loaded on an sds - polyacrylamide gel and analyzed for caspase-3 and -8 cleavage as described above . For determination of apoptosis, 3 10 cells per well were seeded in microtiter plates and treated for the indicated time points with anti - cd95 or the chemotherapeutic agents . Leakage of fragmented dna from apoptotic nuclei was measured as described previously (27). In brief, apoptotic nuclei were prepared by lysing cells in a hypotonic buffer (1% sodium citrate, 0.1% triton x-100, 50 g / ml propidium iodide) and subsequently analyzed by flow cytometry . Nuclei to the left of the 2n peak containing hypodiploid dna were considered as apoptotic . All flow cytometry analyses were performed on a facscalibur (becton dickinson gmbh, heidelberg, germany) using cellquest analysis software . 10 cells were treated with the proapoptotic stimuli in the presence and absence of oligomycin . Triton x-100, 10 mm tris - hcl, ph 7.5, 1 mm edta and incubated for 10 min on ice . After removal of cell debris, atp content was measured with a luciferin / luciferase assay using a luminometer (model ml2200; dynatech deutschland gmbh, denkendorf, germany). The atp content was calculated using an internal standard, and the data were calculated as the mean from three experiments . The human jurkat t cell line was maintained in rpmi 1640 medium supplemented with 10% fcs, 10 mm hepes, and antibiotics (all from gibco brl, eggenstein, germany). The cd95-resistant jurkat subline jurkat - r was generated by continuous culture in the presence of anti - cd95 mab (igg3, 1 g / ml; cell diagnostica, mnster, germany) for 6 mo . Etoposide and mitomycin c were obtained from the clinical pharmacy (medical clinics, tbingen, germany). Doxorubicin, cycloheximide, and oligomycin were purchased from sigma (deisenhofen, germany) and staurosporine from boehringer mannheim gmbh (mannheim, germany). Mitomycin c was dissolved in methanol, and doxorubicin, etoposide, and staurosporine in ethanol and kept as stock solutions at 70c . Intracellular atp was depleted by incubating cells in glucose - free rpmi 1640 medium supplemented with 2 mm pyruvate, 0.1% fcs, and 2.5 m oligomycin, an inhibitor of f0f1-atpases, in order to prevent production of atp from both glycolysis and oxidative phosphorylation (25, 26). Cleavage of caspases and the caspase substrate poly(adp - ribose)polymerase (parp) was detected by immunoblotting . 2 10 cells were seeded in 24-well plates and treated with the apoptotic stimuli . After the indicated time periods, cells were washed in cold pbs and lysed in 1% np-40, 20 mm hepes, ph 7.9, 350 mm nacl, 20% glycerol, 1 mm mgcl2, 0.5 mm edta, 0.1 mm egta, 0.5 mm dithiothreitol, containing 3 g / ml aprotinin, 3 g / ml leupeptin, and 2 mm pmsf . Subsequently, proteins were separated under reducing conditions on an sds - polyacrylamide gel and electroblotted to a polyvinylidene difluoride membrane (amersham buchler gmbh, braunschweig, germany). Membranes were blocked for 1 h with 5% nonfat dry milk powder in tbs and then immunoblotted for 1 h with rabbit anti - parp antibody (1:2,000; boehringer mannheim gmbh) and mouse mabs directed against caspase-8 (1:10 dilution of a hybridoma supernatant; biomedia, baesweiler, germany) and caspase-3 (r&d systems, wiesbaden, germany). Membranes were washed four times with tbs/0.05% tween 20 and incubated with the respective peroxidase - conjugated secondary antibody for 1 h. after extensive washing, the reaction was developed by enhanced chemiluminescent staining using ecl reagents (amersham buchler gmbh). For analysis of cytochrome c release, cells were collected by centrifugation, washed with ice - cold pbs, and resuspended in 5 vol of buffer a containing 250 mm sucrose, 20 mm hepes, ph 7.5, 1.5 mm mgcl2, 10 mm kcl, 1 mm edta, 1 mm egta, 1 mm dithiothreitol, 0.1 mm pmsf, 10 g / ml leupeptin, and 10 g / ml aprotinin . The cells were homogenized with 15 strokes in a douncer, and the homogenates were centrifuged at 1,000 g to remove cell nuclei . The supernatants were transferred to a fresh tube and centrifuged at 10,000 g for 10 min to deplete mitochondria . The resulting supernatants, designated as cytosolic s10 fraction, from each sample were loaded on a 12%-sds polyacrylamide gel . Cytochrome c release was analyzed by immunoblotting with the mouse mab 7h8.2c12 (pharmingen europe, hamburg, germany). To evaluate the ability of cytochrome c to activate caspases in cytosolic extracts, 150 g of an s10 fraction was incubated with 1.25 m bovine cytochrome c (sigma) and 1 mm datp at 30c in a final volume of 25 l for the indicated time periods . At the end of the incubation, the reaction mixture was loaded on an sds - polyacrylamide gel and analyzed for caspase-3 and -8 cleavage as described above . For determination of apoptosis, 3 10 cells per well were seeded in microtiter plates and treated for the indicated time points with anti - cd95 or the chemotherapeutic agents . Leakage of fragmented dna from apoptotic nuclei was measured as described previously (27). In brief, apoptotic nuclei were prepared by lysing cells in a hypotonic buffer (1% sodium citrate, 0.1% triton x-100, 50 g / ml propidium iodide) and subsequently analyzed by flow cytometry . Nuclei to the left of the 2n peak containing hypodiploid dna were considered as apoptotic . All flow cytometry analyses were performed on a facscalibur (becton dickinson gmbh, heidelberg, germany) using cellquest analysis software . 10 cells were treated with the proapoptotic stimuli in the presence and absence of oligomycin . Triton x-100, 10 mm tris - hcl, ph 7.5, 1 mm edta and incubated for 10 min on ice . After removal of cell debris, atp content was measured with a luciferin / luciferase assay using a luminometer (model ml2200; dynatech deutschland gmbh, denkendorf, germany). The atp content was calculated using an internal standard, and the data were calculated as the mean from three experiments . Caspase-8 has been identified as the most proximal caspase which is recruited to the disc by its unique ded (79). In most cells, caspase-8 is synthesized as two isoforms of 55 kd (caspase-8/a and -8/b) which, after formation of intermediate cleavage products of 43 and 41 kd, are processed to a p18 and p10 heterodimer (28, 29). As assessed with an anti - p18 antibody, treatment of jurkat t lymphocytes with agonistic anti - cd95 antibody resulted in the cleavage of procaspase-8 into its characteristic intermediate fragments and the active p18 subunit (fig . 1). Interestingly, an identical cleavage pattern was obtained after treatment with other apoptotic stimuli, including the protein kinase inhibitor staurosporine, the anticancer drugs doxorubicin and mitomycin c, and cycloheximide, an inhibitor of the protein synthesis (fig . 1). Because apoptosis mediated by anticancer drugs has been proposed to induce the expression of cd95l and elicit cell death by subsequent cd95 interaction (20, 21), we also used the subclone jurkat - r, which was selected for resistance to cd95 signaling . Incubation with staurosporine, anticancer drugs, and cycloheximide induced caspase-8 cleavage to a similar extent in cd95-resistant and -sensitive cells, whereas virtually no cleavage was observed by anti - cd95 in the cd95-resistant jurkat - r cell line (fig . 1). Additional experiments revealed that anticancer drugs induced caspase-8 activation with similar kinetics and dose dependency in both cell types (data not shown). Therefore, these results suggest that caspase-8 activation is not restricted to apoptosis mediated by death receptors, but is also induced by other proapoptotic stimuli in a cd95-independent pathway . It has been suggested that the cellular energy charge acts as control point of cell death by either necrosis or apoptosis, and that atp is necessary for the execution of the apoptotic program (25, 26, 30). In conjunction with cytochrome c, atp is required for the function of apaf-1, which initiates caspase activation in the mitochondria - controlled pathway (12, 13, 15). Therefore, we investigated whether manipulation of intracellular atp levels can be used to analyze the involvement of the cytochrome c / apaf-1 pathway during apoptosis triggered by certain stimuli . Atp levels were depleted in jurkat cells by incubating cells in glucose - free medium and oligomycin, an inhibitor of mitochondrial f0f1-atpases . Under these conditions, treatment of jurkat cells with anti - cd95 induced a marked cleavage of caspase-8 within 1 h that was not affected upon depletion of atp by oligomycin (fig . Furthermore, activation of caspase-3 was observed with slightly delayed kinetics in both atp - depleted and nondepleted cells . We also analyzed the cleavage of parp, an enzyme involved in dna repair, which has been shown to serve as a substrate for caspase-3 (31). 2 demonstrates that parp, a 116-kd protein, was cleaved into its characteristic 89-kd fragment with similar kinetics as caspase-3, regardless of the presence or absence of atp . In contrast to the cd95 pathway, atp depletion strongly inhibited caspase-8 and -3 activation as well as parp cleavage in response to the receptor - independent apoptotic stimuli . After treatment with staurosporine, caspase-8 activation was detectable within 2 h and maximal after 3 h. inhibition of atp production strongly prevented caspase-8 activation (fig . In addition to staurosporine, caspase activation in response to chemotherapeutic drugs was almost completely abolished in atp - depleted cells . Doxorubicin - induced caspase-8 activation started within 46 h, and was most pronounced after 10 h (fig . Interestingly, similar to cd95, caspase-3 activation and parp cleavage followed caspase-8 processing . However, in contrast to cd95, activation of both caspases was strongly abrogated by oligomycin . Therefore, the differential requirement of atp for caspase activation by either cd95 or chemotherapeutic drugs indicates distinct regulatory pathways for the two types of apoptosis . Recent evidence has demonstrated that mitochondria participate in the execution of apoptosis by release of cytochrome c (10, 11, 1719). Binding of cytochrome c to apaf-1 results in the cleavage of procaspase-9 or other caspases, which in turn activate caspase-3 (13). Preparation of cytosolic fractions confirmed that anti - cd95, staurosporine, etoposide, and cycloheximide (fig . 3 a), as well as the other chemotherapeutic drugs (data not shown), induced the redistribution of cytochrome c. it has been shown that caspase-9 and -3 can be activated in cell - free systems upon incubation of cytosolic fractions with cytochrome c and datp (12, 13, 15). Because caspase-8 activation so far has been observed only after formation of an fadd - containing death receptor complex, we investigated whether caspase-8 can be also activated in vitro by the addition of cytochrome c. indeed, incubation of cytosolic extracts with cytochrome c resulted in a potent processing of caspase-8 that was even more pronounced than caspase-3 cleavage by cytochrome c (fig therefore, the data demonstrate that the initiator caspase-8 can be activated not only at the disc level but also by cytochrome c. future studies will show whether caspase-8 activation is mediated directly by atp and cytochrome c bound apaf-1 or by another proximal caspase, such as caspase-9 . The above experiments suggested that drug - induced caspase-8 activation is cd95-independent and entirely controlled by an atp - dependent step, most probably apaf-1 activation . Therefore, we investigated the effects of atp depletion on apoptotic dna fragmentation and cell death . Stimulation of jurkat cells with anti - cd95 resulted in the rapid formation of hypodiploid dna, which was comparable in atp - depleted cells and cells kept under normal growth conditions (fig ., staurosporine - induced nuclear apoptosis was completely abrogated when atp generation was inhibited (fig . 4 b), however, atp depletion did not prevent final cell death, as assessed by membrane uptake of propidium iodide into cells . Instead, in the presence of oligomycin, cell death occurred by necrosis . Very similar effects of atp depletion were found when nuclear apoptosis and cell death in response to chemotherapeutic drugs were analyzed (data not shown). 4 c demonstrates that treatment of cells with oligomycin resulted in a strong decrease in atp production . However, anti - cd95 and staurosporine themselves only slightly affected intracellular atp levels in early stages of apoptosis . In summary, manipulation of intracellular atp levels is a useful means by which to discriminate between the involvement of distinct apoptotic pathways . Although atp may affect other events, such as chromatin condensation (32), the requirement for atp can be most likely attributed to its stimulatory function on apaf-1 in the mitochondrial pathway . Our data reveal that caspase activation induced by staurosporine and chemotherapeutic drugs is entirely mediated by this signaling pathway and does not require cd95 interaction as previously proposed (20, 21). In contrast, cd95 signaling, although it activates mitochondria (33, 34), can circumvent this evolutionary conserved pathway in order to activate caspases . Whether this bypass holds true for all cell types or whether it is dependent on the degree of disc formation (34) our findings convincingly demonstrate that the cytochrome c / apaf-1 pathway and receptor - triggered signaling events are not necessarily linked to each other . 10 cd95-sensitive jurkat or cd95-resistant jurkat - r cells were cultured in normal growth medium and then either left untreated (control) or treated with anti - cd95 (1 g / ml, 3 h), staurosporine (stauro; 2.5 m, 6 h), doxorubicin (doxo; 2 g / ml, 12 h), mitomycin c (mito; 25 g / ml, 8 h), or cycloheximide (chx; 25 g / ml, 6 h). Cellular proteins were separated by sds - page, and proteolytic processing of caspase-8 was detected by immunoblotting with an antibody against the caspase-8 p18 subunit . Open arrowheads, the two isoforms of procaspase-8/a and -8/b, which are cleaved into the intermediate forms p43 and p41 (filled arrowheads) and finally processed to the active p18 subunit (arrow). Atp depletion differentially affects caspase activation and cleavage of the caspase substrate parp in response to anti - cd95 and drug treatment . Jurkat cells were kept in glucose - free medium in either the absence or presence of 2.5 m oligomycin, and triggered with different apoptotic stimuli . Anti - cd95 (a), staurosporine (b), doxorubicin (c), and mitomycin c (d) were used at the drug concentrations described in the legend to fig . Total cell lysates were subjected to 15% sds - page to detect caspase-8 processing, and to 815% gradient sds - page to detect cleavage of caspase-3 and parp . Separated proteins were immunoblotted with caspase-8, caspase-3, and parp - specific antibodies . Top, caspase-8 cleavage; only sections of the immunoblots indicating the cleaved intermediate forms (p43 and p41) of caspase-8/a and -8/b are shown . Middle, processing of caspase-3; the immunoblots denote the position of procaspase-3 and its p17 active subunit . Bottom, parp cleavage; filled arrowheads indicate the uncleaved p116 and open arrowheads the cleaved p89 form of parp . Jurkat cells were either left untreated in normal culture medium or incubated with anti - cd95 (1 g / ml, 3 h), staurosporine (stauro; 2.5 m, 6 h), etoposide (etop; 25 g / ml, 6 h), or cycloheximide (chx; 25 g / ml, 5 h). Cells were then homogenized, and the s10 fraction depleted of mitochondria was subjected to 12% sds - page . (b) in vitro activation of caspases by cytochrome c. aliquots of an s10 fraction (150 g) were incubated for the indicated time with 1.25 m cytochrome c in the presence of datp . A control fraction was incubated for 6 h in the absence of cytochrome c. proteolytic processing of caspase-8 (left) and jurkat cells were either left untreated (open symbols) or pretreated for 45 min with oligomycin (filled symbols) and then incubated with anti - cd95 (1 g / ml), staurosporine (2.5 m), or medium control (dashed line). (a) formation of apoptotic nuclei was determined by flow cytometry of hypodiploid dna . (b) membrane damage was measured by the uptake of propidium iodide into cells and flow cytometry . Extracts of control cells and cells treated for 2 h with anti - cd95 or staurosporine (stauro) in the presence and absence of oligomycin were analyzed for atp content using a bioluminescence assay.
Throughout the world rapid population ageing is occurring, with a large proportion of older adults preferring to stay living at home . Most older people experience one to three chronic diseases and, in very advanced age, frailty, disability, and social isolation are common . At the same time there are increasing demands on health service providers due to the low availability of home and community services, low uptake of e - health and smart technologies by healthcare professionals, and an ageing health workforce . Although many older people express their desire to stay in the familiar social environment of their own home, many cannot do so due to impairments, immobility and social isolation . Many older people who live at home are at high risk of falls and injuries and report difficulty accessing health care services when they need them . As previously discussed by rowe and kahn the definition of successful aging requires three pillars . Firstly, there is a low probably of disease and/or disability from disease; secondly a high cognitive and physical functioning capacity; and three, the combination of the first two with an active engagement in life . In affecting successful aging, particularly with the nexus to an active engagement in life, there is a need for development of, and access to, smart technologies to monitor and maintain health and wellbeing, as well as to link older people with communities and healthcare professionals . Robots are now available that provide services such as home cleaning, appliance operation, and safety monitoring . These service robots can be excellent for monitoring, surveillance, and basic tasks of everyday living yet they lack artificial intelligence . Morris et al . Argued the need for smart robotic technologies that not only respond to an individual's needs, but can also learn and modify their behaviour based upon their owner's requirements . This is particularly the case for older individuals who would need to interact with their robot to maintain mobility, health, safety, and social connectedness . Service robots currently include commercialised domestic robots, such as self - navigating vacuum cleaners and mops, known as roomba and scooba respectively . Service robots also include pet or sociable robots, such as the aibo robotic pet dog, paro the robotic pet seal, and similar robotic animals that use pet therapy to assist older people to maintain mobility, and to keep active . One example of this is the iward project in germany where modular designed robots have been adapted for different roles for independent living, health, and safety . They can also act in a team to service the needs of medical and other health professional staff such as for remote consultations and communication between staff in different wards . For example, popular opinion holds that robotic technologies are only applied to individuals when they are disabled . However, there is a small yet increasing awareness that robotic technologies can also complement current health care service provision by monitoring older people within their home environment and assisting them to mobilise safely and prevent falls . Narrative literature reviews on the role of robotics in health care [8, 1113] or social assistance robots have previously been completed mainly speculating about the future of robotics in health . The aim of this systematic review was to identify specific evidence - based research answering questions to address the potential of robotic technologies to monitor older individuals' health and wellbeing and to assist with activities of daily living . Another aim was to review the extent of robotic technologies currently tested and used in the home environment for older individuals . We identified two key questions for the systematic review of the literature addressing robotics and ageing in the home environment . What is the range of robotic devices available to enable older people to remain mobile, independent and safe? What is the evidence demonstrating that robotic devices are effective in enabling independent living in community dwelling older people? What is the range of robotic devices available to enable older people to remain mobile, independent and safe? What is the evidence demonstrating that robotic devices are effective in enabling independent living in community dwelling older people? Where possible, in each database, searches for all topics were limited to peer - reviewed publications between january 1990february 2012, published in english . We included human participants aged 45 years and older, as it is generally accepted that many chronic conditions may have their onset from approximately this age onwards . This broader definition of older individuals' was adopted by the authors, defined by mesh heading definitions of middle - aged 4564 years, aged (6579 years) and aged 80 + years with the understanding that older individuals were a heterogeneous group . This included establishments providing residence and care for special needs, such as retirement villages and aged care facilities providing low care services, service integrated housing, and supported accommodation . To answer question 1, randomised controlled studies, quasi - experimental studies, and comparative studies with and without concurrent controls, case - series and feasibility studies, systematic and general review articles, and government reports (where relevant to topic area) were included to identify available technologies . The following publications were excluded from the paper: narrative reviews, descriptive or narrative papers without presentation of data, limited - review conference proceedings and abstracts, higher degree research theses (phd / masters), undergraduate research theses (honours) and books . To answer question 2, data extraction and quality assessments were predominantly performed on studies that met the criteria for question 1, however these studies were required to demonstrate that testing and/or data collection had been completed in a home (or simulated) environment . Data base searches were limited to studies assessing humans and those published in english and included: web of science, science direct, medline, psychinfo, scopus, cinahl, expanded version of the cumulative index to nursing and allied health by ebsco, australasian medical index, national library for health, rehabilitation research (usa), and trove . Two independent, trained reviewers evaluated the title and abstracts of the yield articles against the decision rules inclusion criteria . The title of each article was scanned and the two reviewers independently excluded articles not related to the topic . The full texts of the articles were then obtained for data extraction, categorized according to national health and medical research council (nhmrc) guidelines on levels of evidence, and the quality of each article was assessed using the downs and black quality appraisal tool . Downs and black was specifically selected to assess the articles as it can be used for both experimental and quasi - experimental research designs . Lack of agreement about inclusion of articles, data extracted, or grading against quality criteria was reconciled by mutual agreement . Figure 1 illustrates the breakdown of articles following the predetermined inclusion and exclusion criteria . The major reason for exclusion was that articles were descriptive and did not contain data providing evidence of effectiveness, feasibility, or validity . Table 1 shows the studies that have provided evidence of technologies assisting older people . The yield of articles in response to question 1 showed that robotic technology is currently available to assist older people and people with physical disabilities . Smart robots per se, with no artificial intelligence interface, and the majority of these articles were lower limb exoskeleton technologies . Robotic exoskeletons are fitted to the outside of the limbs, rather than being internally fixed using surgical methods and supplies at the energy (or part of the energy) for limb movement . The lokomat was the most widely tested robotic exoskeleton for the lower limbs [25, 27, 29, 33, 37, 48, 49] to trial its suitability as a supportive structure for walking . Other technologies to assist with walking and mobility included robotic walkers and robotic guidance systems [30, 38]. These systems, such as the guido, are extensions on the non - motorised walker frames, where the individual can control the speed of locomotion but also obtain environmental feedback, via sensors, to assist in obstacle avoidance and in navigating through doorways . Upper limb technologies included both upper limb exoskeleton systems to guide arm movements and haptic visuomotor feedback systems to assist in compensation for disorders of sensation and visual impairment . The mit - manus, a visuomotor guidance system, was the most utilised of the upper limb robotic systems, particularly for people who were recovering from stroke [17, 19, 21, 24, 35] table 2 shows the articles that met the inclusion criteria for question 2 . To date, four investigations have tested robots within a home, residential care setting, or simulated home environment . Generally, these studies demonstrated that robots are able to help older people with mobility issues around the home environment . However, this data presented was only low to moderate in terms of their level of evidence and research quality . Investigated the effectiveness of a lower limb exoskeleton device using a pre - post single group design in older healthy females within an independent home living facility . Unlike other lower limb robots, such as the lokomat which is a relatively large driven gait orthosis that automates locomotion therapy, the exoskeleton technology in this study was smaller and more compact this study reported improvements in walking speed and reduced energy expenditure (due to fitness gains) following 3 months of 2 sessions (90 minutes duration) per week of assisted walking using the exoskeleton technology with elderly females . Investigated the effectiveness of a robotic personal mobility aid with sensors to guide elderly ambulatory individuals away from obstacles . Analysis of the effectiveness of the technology was difficult to interpret as only descriptive data were presented in the paper . Presented a case study describing the use of an upper limb robotic trainer in an elderly woman two years post hemiparesis . Improvements in motor function were reported in musculature of the proximal arm compared to the distal hand and alterations in cortical representation maps of the affected area were suggestive of plastic adaptations . However, these cortical representation changes were not correlated with changes in movement performance of the hemi paretic upper limb . Finally, a recent study by carlson and demiris demonstrated improvements in wheelchair mobility when combined with a robotic interface (collaborative control) compared to when participants had to control the wheelchair manually without robotic assistance . Moreover these authors showed, via self - reported questionnaire, that participants found manoeuvering the wheelchair less mentally demanding during collaborative control . This systematic review has highlighted that robotics is still an emerging field in terms of its application to health and rehabilitation for community dwelling older people . Despite these studies being of a lower design quality, the evidence to date shows that robotics research is used widely in engineering laboratories and, to a lesser extent, in clinical settings . Only a very small number of controlled clinical trials evaluated the effects of implementing robotic technology in the home for the purposes of potentially assisting with daily living activities, home care, home maintenance and housework, security, safety, falls detection, or social interaction . Moreover, none of the studies on robotics presented costing of the devices, discussed safety concerns to the user, whether the devices could be mass produced, or social issues such as acceptance by older people in their home environment . It was also notable that the studies in this paper focussed on application of robotic technologies for purposes of movement rehabilitation in people who had impairments and disabilities arising from conditions such as arthritis, back pain, balance impairment, stroke, or spinal cord injury . To date no studies have objectively measured the potential application of robotic technologies as monitoring devices in the home setting . Potentially artificial intelligence could be used to measure the health status of their owner, provide reminders for specific medications to be taken; or provide contingency procedures in the case of an adverse event such as a slip, trip, or fall . One study in this paper demonstrated an increased exercise capacity when healthy older participants utilised a robotic exoskeleton for walking training in a home setting; however as the study was limited to only one group, with no direct comparison to an age - matched control group who participated in the walking program without the exoskeleton, it is difficult to rigorously evaluate the effectiveness of the use of the robotic exoskeleton in this study . Moreover, follow - up data measures were not taken, therefore it is not possible to ascertain the long - term effectiveness of the technology in assisting in maintaining independence . However, this paper has demonstrated that applications of robotic technologies have progressed much further than what the general public perceive robots are capable of undertaking . Robotic technology studies, despite being methodologically weak, have demonstrated capability of functional improvements following loss of function in upper and lower limbs, or to assist with mobility in indoor environments . The range of the robotic technologies presented in in table 2 show that the technology is now progressing to the point that that home trials of these different robotic technologies will be undertaken in the near future . Therefore it is possible that studies of testing robotics in the home environment have been completed, but were not included in this paper as they were published in languages other than english . A second limitation of this review was the decision by the authors to exclude robotic interventions for uses relating to cognitive decline / successful brain aging . Indeed, recent reviews have discussed the use of robotics for cognitive healthcare in the elderly; however, the primary aim of this paper was to review evidence for robotics in addressing physical mobility to reduce disability and loss of independence in the home . Further, although outside the scope of this review and thus also excluded was the emergence of nanotechnology . It is plausible to suggest that progress in nanotechnology research (also known as nanorobotics) could potentially reduce hazards in the home . Robotics will improve, in a number of different directions, to the point of assisting older people to live independently and safely in their homes, and enjoy excellent quality of life in their communities . Living better report from the australian federal government in response to the productivity commission's report on care of older australians recommends the major expansion of home care supportive services, although these are largely conceptualized as intensive case management services . However, the aged housing and care industry in australia is moving ahead with the rapid take up of new technologies to assist older people to live more independently at home and in supported accommodation in association with the rollout of a new broadband network nationally . Robotics are perhaps one of the newest technology areas to have entered the home care market, being previously largely developed for application in heavy industry and acute health . Looking forward, however, the potential for robotic application in the home is wide open . Some of the major barriers relate to cost of development, the incorporation of artificial intelligence in new design applications, and the encouragement of greater interdisciplinary convergence between the many research fields now involved in the development of new robotic technologies . At this point in time in australia, progress on home grown robotic applications is limited, given the substantial infrastructure required in the start - up phase . In light of the research reviewed, a number of key recommendations can be provided as follows: the evidence from the current systematic review has clearly demonstrated that robotics research needs to be conducted in the home environment . To date, only four studies have attempted to conduct research within the home environment [28, 32, 40, 51]. These studies have demonstrated positive outcomes, providing a good rationale to take robotics into environments outside of laboratories or hospital clinics . The majority of robotic technology studies found in the current review were directed at movement rehabilitation . However, for the elderly population, healthy living includes prompting and reminding for effective monitoring . Development of robotic technologies should include technologies that can provide gentle reminders for medications, continually scan the environment to ensure no falls have taken place, and have a protocol in place to advise relevant authorities if an incident has occurred . Similarly, robotics has the potential to allow for social connectedness by providing company for elderly people living alone, or to serve as interfaces for connecting with family and friends using existing technologies (e.g., skype). The final recommendation would be to investigate ways of reducing the costs of technologies . As shown in this paper, it would be anticipated that with commercial development and mass production, these costs would reduce significantly . However, at the present time costs appear to be a barrier towards broad adoption of robots in the home environment . In conclusion, this systematic review has shown that robotic technologies have the potential to assist older people and people with disabilities to remain mobile and to live safe and healthy lives at home . Further research and training of the heath and disability workforces is needed to the adoption of robotics as an effective, routine, and practical option within the home environment . The evidence demonstrates that robots already exist to assist with movements, obstacle - avoidance, and functional rehabilitation, but require further development to realise their full potential for safety monitoring, falls, and social connectedness . Future robot design needs to consider development from a different perspective, considering not only assisted mobility, but also interfacing artificial intelligence for interaction with older individuals, to monitor their health, provide medication prompts, encourage exercise, and provide them with confidence to maintain independent living.
Celiac disease (cd) is an immune - based enteropathy triggered by dietary wheat gluten and similar proteins in barley and rye in genetically susceptible individuals . Recently, the espghn (european society of paediatric gastroenterology, hepatology and nutrition) proposed that cd may be defined as an immune - mediated systemic disorder elicited by gluten and related prolamins in genetically susceptible individuals and characterized by a variable combination of gluten - dependent manifestations, cd - specific antibodies, and hla - dq2 or hla - dq8 haplotypes, causing duodenal chronic inflammation . Cd is a t - cell mediated disease, in which gliadin - derived peptides activate lamina propria infiltrating t lymphocytes . This leads to the release of proinflammatory cytokines, such as ifn- and il-15 which are responsible for the activation of the cytotoxic activity of intraepithelial lymphocytes (iels) that leads to a profound tissue remodeling . This is a complex disorder, with environmental and immune - genetic factors contributing to its etiology . The main genetic influence on cd is the hla locus, specifically mhc class ii genes that encode hla - dq2 (hla - dq2.5 and hla - dq2.2) and hla - dq8 heterodimers . The prevalence of disease is usually reported to be about 1% in the general us population but there are emerging data suggesting an increase in some countries . Although there is a strong genetic predisposition, resulting from the presence of the hla gene dq2/dq8 in the development of cd, and gluten is the main environmental factor responsible for the signs and symptoms of this disorder, neither genetic nor environmental factors show 100% correlation . Thus other immune, genetic, and environmental factors must be involved in cd onset . Evidence for a genetic component is best exemplified by the strong dependence on the presence of the hla - dq2 (encoded by the alleles dqa105 and dqb102) and hla - dq8 (dqa103 and dqb1 - 0302) haplotypes . More than 95% of those with cd express hladq2 while the rest express hla - dq8 . However, about 3040% of the general population expresses hla - dq2, so while these hla genes are necessary, they are not sufficient for developing disease and clearly non - hla genes are also involved . At least 39 non - hla genes have been identified through genome - wide association studies as strongly associated with cd . Most of these genes are involved in control of the innate and adaptive immune response . However, the role of these genes in the development of cd is not completely clear . The primary environmental trigger is gluten, the protein fractions of wheat, barley, and rye . The incomplete digestion of this protein by humans, due to high concentrations of glutamine and proline, results in the formation of residual partially digested peptides . These peptides are responsible for innate and adaptive immune responses underlying the disease in genetically predisposed subjects . Currently, some studies are evaluating the role of the modifications of gut microbiota as a factor contributing to the onset of disease . Although the precise immune mechanisms that are involved in the progressive destruction of the small intestinal mucosa remain to be elucidated, the hallmark of cd is an immune - mediated enteropathy that involves both of the innate and adaptive immune system . In relation to innate immune system response, we should consider that some gluten peptides can induce tissue damage by directly activating components of innate immunity . The peptide (-gliadin 31 - 43) p31 - 43/49 has been shown to activate the production of il-15 and the nk receptor - mediated cytotoxicity by iels [11, 12], independent of tcr specificity, and to induce apoptosis of enterocytes, upregulate mhc class i molecules, activate map kinase pathway, and upregulate the expression of cd83, a maturation marker of dendritic cells . The presence of a receptor for p31 - 43/49 in intestinal epithelial cells has not been found yet and, thus, the molecular mechanism underlying the biological effects observed as a consequence of the interaction of this peptide with the gut mucosa remains still unclear . The dq2 and dq8 molecules confer susceptibility to cd by presenting disease - related peptides to t - cells in the small intestine or by shaping the t - cell repertoire during t - cell development in the thymus . Initially, paracellular passage of gliadin peptides is due to an increase of gut permeability which, in turn, is due to an upregulation of zonulin, an intestinal peptide involved in epithelial tight junction control . Also, il-15 contributes to promoting the cd4 + t - cell adaptive immune response [3, 16]. Il-15 up - regulates both cd94/nkg2c and nkg2d nk receptors boosting their ability to lyse enterocytes . The adaptive immune response in cd is characterized predominantly by production of the proinflammatory cytokine interferon- (ifn-) from gluten - specific cd4 + t - helper cells triggered by gluten - derived peptides recognized by hla - dq2 or hla - dq8 heterodimers of antigen - presenting cells (apcs). Tissue transglutaminase-2 (ttg2) converts noncharged glutamine into negatively charged glutamic acid through a process called deamidation . In fact, the peptide - binding motifs of dq2 and dq8 predict a preference for negative charges at anchor positions of the bound peptides . Dq2 has a preference for negatively charged residues at the p4, p6, and p7 anchor positions, whereas dq8 has a preference for negatively charged residues at anchor positions p1, p4, and p9 . Generally, gluten proteins contain few negatively charged residues but in active cd the level of expression of enzyme tg2 is increased and the ratio of deamidation to transamidation is markedly increased . In active cd tg2 is expressed at the epithelial brush border, as well as being expressed extracellularly in the subepithelial region . The ph in the proximal small intestine is ~6.6 which should allow marked tg2-mediated deamidation of peptides in the brush border . This process increases the negative charge on the peptide molecule and enhances binding of the peptide within the peptide binding groove of the hla - dq2 molecule on the surface of the apcs . This is a prerequisite for a gluten - specific t - cell response as well as a b - cell response that results in production of the anti - ttg antibodies that represents an epiphenomenon of the cd pathogenesis and may be used in the diagnostic pathway [15, 21]. Furthermore, deamidated gluten peptides are presented to cd4 + t - cells that release proinflammatory cytokines activating cytotoxic cd8 iels (cd8 + tcr+ and tcr+ t - cells) contributing to a profound tissue remodeling and damage [13, 22]. While iga antibodies against either gluten or the autoantigen tg2 serve as a highly useful means of testing for cd, their precise role in the immunopathogenesis of the condition remains yet unknown . Whether they are byproducts of the intestinal adaptive immune response or they play a direct role in cd pathogenesis remains unclear . There is evidence that il-21 plays a role in the pathogenesis of cd as high levels of this cytokine can be demonstrated in biopsies from those with active disease that are not on treatment . However, the mechanism whereby il-21 is produced and the precise role it plays in the disease process remains unexplained . More recently, it has been proposed that, in the intestine of cd subjects, normal gluten peptides may be complexed to intraluminal secretory iga, bound to an iga receptor and transported, and protected from lysosomal degradation by a specific transcytosis pathway involving the transferrin receptor cd71 . Compared to nonceliac subjects or cd subjects on a gluten - free diet, cd71 expression is increased in cd sufferers and colocalizes with iga at the apical enterocyte membrane . In summary, the disease develops as a result of an abnormal cd4 + t - cell - initiated immune response to gluten . Generally, gluten gains access to peyer's patches physiologically via m cells or supraphysiologically during periods of increased epithelial permeability; thus, it is processed by peyer's patches dendritic cells and presented to cd4 + t - cell . In nonceliac subjects the presentation of gluten peptides on hla - dq2/dq8 induces a th2 response; in celiac subjects in the presence of ttg2 activity and deamidation of gluten peptides in the apcs the response is biased towards th1 response . Presentation of gluten to t - cells could be carried out not only by dendritic cells but also by macrophages, b - cells, and even enterocytes that express hla class ii . Enterocytes can present antigens to lipoprotein lipase (lpl) via evaginations through the basement membrane and can express costimulatory molecules under inflammatory conditions . The primed cd4 + t - cells would then recirculate to the lamina propria [32, 33], and subsequent contact with gluten would induce their activation and proliferation, with production of proinflammatory cytokines, such as tnf-, il-1, il-6, il-15, il-17a, il-17f, il-21, il-22, il-23, and il-26 (figure 1) [34, 35]. This would result in synthesis and release of metalloproteases mmp-1, mmp-3, and keratinocyte growth factor (kgf) by stromal cells, which would induce cryptal hyperplasia . The next stage, villous atrophy, would be due to enterocyte death induced by iels [39, 40]. In fact cd8 + iels from cd patients have been shown to respond to gluten peptides presented by hla - a2 . Additionally, there is an overexpression of membrane bound il-15 on enterocytes in active cd which induces the expression of the nk receptors cd94 and nkg2d by cd3 + iels . The ligand for nkg2d and mic - a is overexpressed on enterocytes in active cd, and this supports the involvement of the mic - a / nkg2d pathway in the epithelial atrophy of cd . It is characterized by an interplay between different cells and their defense systems, food particles, molecules derived from digestion, and the vast array of residing microbial species with their secretory products . These microorganisms present in the gut lumen form the microbiota that performs several physiological functions, that is, the absorption and digestion processes, tolerance to non - self - food antigens, and defense from pathogens . The composition of main bacterial populations does not stabilize until after the first few years of life . In this period, the microbiota gradually colonizes the mucosal and skin surfaces of the neonate and exerts the greatest effect on the development of the immune system . Components of the intestinal microbiota play a crucial role in the postnatal development of the immune system . During the early postnatal period, the intestinal microbiota stimulates the development of both local and systemic immunity, while later on these components evoke inhibitory regulatory mechanisms intended to keep both mucosal and systemic immunity in check . In this postnatal period, components of the normal microbiota induce a transient physiological inflammatory response in the gut associated with enlargement of the mucosal - associated lymphatic tissue and increases in its cellularity [43, 44]. Many studies have shown that microbial colonization of animals living in germ - free conditions results in an increase in immunoglobulin levels, the production of specific antibodies, and substantial changes in mucosal - associated lymphocyte tissues and cell populations [45, 46]. Interestingly, the microbial colonization of germ - free mice also speeds up the biochemical maturation of enterocytes, resulting in a shift in the specific activities of brush - border enzymes nearly to the extent found in conventional mice . Moreover, a similar introduction of microorganisms alters the synthesis of sugar chains in membrane - associated glycoproteins, which could influence the gut barrier function [4749]. In some cases, impaired function of the intestinal barrier leads to an increase in antibodies directed against antigens present in the intestinal lumen . It was recently shown that the appearance of these antibodies or / and autoantibodies in individuals lacking clinical symptoms may have important predictive value for the development of inflammatory and autoimmune diseases [50, 51]. In the case of autoimmune diseases, considerable effort has been made to understand mechanisms leading to the loss of self - tolerance . A principal function of the microbiota is to protect the intestine against colonization by exogenous pathogens and potentially harmful indigenous microorganisms . However, in certain conditions, some species of bacteria are thought to be capable of causing disease by producing inflammation, infection, or increasing cancer risk for the host . Particular bacterial populations that are typically found in very low abundance can acquire pathogenic properties . These conditions include inherent immune defects as well as changes in diet and/or acute inflammation and can result in the disruption of the normal balanced state of the gut microbiota, which is referred to as dysbiosis . Dysbiosis involves the abnormal accumulation or increased virulence of certain commensal populations of bacteria, thereby transforming former symbionts into pathobionts . The breakdown of the normal microbial community contributes to increase in the risk of pathogen infection and the overgrowth of harmful pathobionts and inflammatory disease . The intestinal dysbiosis of cd patients is characterized by increases in numbers or proportions of bacteroides spp . And reductions in those of bifidobacterium spp . And b. longum, which were not completely normalized after patient adherence to a gluten - free diet (gfd) [5456]. E. coli and staphylococcus numbers were also higher in feces and biopsies of untreated cd patients than in those of controls, but the differences were normalized after gluten withdrawal . The analyses of the prevalence of bacterial species associated with duodenal biopsies also revealed a reduction in bacteroides species diversity in patients, untreated and treated with the gfd, in comparison with controls . In addition to dysbiosis, infections may also disrupt the intestinal homeostasis leading to chronic inflammation and tissue damage, which could eventually contribute to reduced gluten tolerance . In fact, infections have often been considered to initiate the process in genetically predisposed individuals . These include polyclonal lymphocyte activation, increased immunogenicity of organ autoantigens secondary to infection - mediated inflammation, or antigen mimicry molecular mechanisms . One major hypothesis explaining how infectious components can cause autoimmune reactions is based on the concept of cross - reactivity, also known as molecular mimicry, that is the similarity between the epitopes of autoantigens and epitopes of harmless environmental antigens . The adjuvant activity of microbial components may participate in the stimulation of apcs, such as dendritic cells, that leads to the abnormal processing and presentation of self - antigens . Homeostasis of the intestinal mucosa may be disturbed by pathogenic microorganisms and toxins attacking the intestine or by inadequately functioning components of the immune system, as observed in immunodeficiency or in cases of dysregulated mechanisms of the mucosal immune system . The intestinal mucosa can be affected as a consequence of either insufficient activity or exaggerated activation of the immune system . Various complex diseases may occur as a consequence of disturbances of mucosal barrier function or of changes in mechanisms regulating mucosal immunity to food or component of the microbiota [62, 63]. The complexity and interindividual variation of the gut microbiota composition in humans represent a confounding factor in the efforts to determine the possible significance of individual commensal microbial organisms in disease pathogenesis . Recent data have described a possible link between cd onset in susceptible patients and diverse infectious agents, which may have occurred as early as during the perinatal period . . Demonstrated a possible protective role that infections with ebv, cmv, and rubella may have on susceptible individuals; it seems that encountering certain infections may establish a particular immunological background that disfavours the evolution of autoimmune conditions . Moreover, several intestinal viral triggers including adenovirus, hepatitis c virus (hcv), and rotavirus and bacterial infections capable of initiating or augmenting gut mucosal responses to gluten were suggested to play a role in the pathogenic mechanism of cd . An environmental factor, such as an infectious agent, is thought to precipitate the disease, via various pathogenic mechanisms, such as molecular mimicry, resulting in modulation of the host's immune tolerance . Several other gastrointestinal pathogens have been associated with the development of cd, with varying outcomes; most are isolated case reports . Other pathogens such as campylobacter jejuni, giardia lamblia, rotavirus infection, and enterovirus infection have also been associated with development of cd . Abnormal components found among the microbial inhabitants adhering to the diseased jejunal mucosa have been described and recently analyzed using new microbiological methods . Profound changes in the fecal and duodenal microbiota composition of patients with active disease who are on a gluten - free diet have also been demonstrated . Bacteroides and clostridium leptum groups were more abundant in faeces and biopsies of cd patients than in controls regardless of the stage of the disease . Escherichia coli and staphylococcus counts were also higher in faces and biopsies of nontreated cd patients than in those of controls . Interestingly, some commensal bacteria, such as escherichia coli, promoted the activation of innate immune cells by gliadin, whereas others such as bifidobacteria exerted inhibitory effects . Dietary factors seem particularly relevant at early stages when the immature neonate's gut is acquiring and shaping its own microbiota and undergoing major physiological and immunological developments up to the point when the immune system acquires full competence and tolerance to nonharmful antigens . The period in which the human host is most acutely influenced by the microbiota is the postnatal period, during which the germ - free neonate moves from the sterile environment of its mother's uterus into a world full of microorganisms and during which the neonate's mucosal and skin surfaces become gradually colonized . Particularly relevant as early as the seventies, it had become clear that the introduction of gluten in the diet after the fourth month of life would reduce the incidence of cd onset . Infants who carry either the hla - dr3 or dr4 alleles or who have a first - degree relative affected by cd have a fivefold increased risk of developing cd autoimmunity with the presentation of positive tissue transglutaminase (ttg) autoantibody if they are exposed to gluten in the first three months of life . Infants introduced to gluten at 7 months or later also had an increased risk of cd compared with those exposed between 4 and 6 months . For the increased risk of cd when first gluten exposure occurs in younger and older children instead of at the age of 46 months . On the one hand, in younger children, early introduction of solid foods (i.e., before the intestinal immune system reaches a certain level of maturation) may lead to intolerance . The increased risk of cd in children introduced to gluten at 7 months or older might be due to the larger amounts of gluten intake at the first exposure . The espghan committee on nutrition has outlined possible practical suggestions on the introduction of complementary feeding to avoid both early (<4 months) and late (7 months) introduction of gluten and to gradually introduce small amounts of gluten whilst the infant is still breast - fed in order to reduce the predisposition to cd later in life . However, the time of first exposure to potentially allergenic foods in infants differs significantly between countries and occurs much earlier than recommended in some countries, as reported in . A recent meta - analysis of observational retrospective studies was used to analyze the protective role of breast - feeding against cd onset and concluded that increased duration of breastfeeding is associated with a reduced risk of cd . A study of 627 cases with confirmed cd revealed that the risk of cd was reduced in a group of children aged <2 years if they were still being breast - fed when dietary gluten was introduced and the risk increased when the gluten was introduced in the diet in large amounts . It is also important to examine further whether favorable infant dietary patterns postpone cd onset or in fact reduce the overall lifetime risk of the disease . Other recent studies have pointed to the role of breast - feeding in delaying cd in infancy . D'amico et al . Showed that children with cd who had been exclusively breast - fed had a delayed onset and less severe disease symptoms than those who had not been exclusively breast - fed . In spite of all the evidence reported, it remains unclear whether those children breast - fed during the introduction of gluten are more likely to develop an extraintestinal (atypical) cd . A series of 162 celiac children registered by the university of chicago revealed that children breast - fed at the time of gluten introduction were just as likely to develop both intestinal and extraintestinal symptoms, whereas children who were not breast - fed when weaned with gluten had a much higher chance of developing intestinal symptoms . Human milk provides many bioactive factors, including antimicrobial and anti - inflammatory agents, enzymes, hormones, and growth factors, many of which are involved in gut maturation and development of the infant's innate and acquired immunity . Breast - feeding might affect tolerance induction in infants because of the possible transfer of small amounts of gluten and gluten - specific iga antibodies through breast milk and the presence of factors in breast milk that affect immune system maturation and responses . Also, it seems that the lymphocyte subset profile of breast - fed infants is associated with a better response to gliadin after gluten introduction . Other reasons that could explain a protective effect of breast - feeding against cd development could be related to the role human milk plays in defining microbiota composition and in the incidence of infections . In particular, innate immunity cells, located in the lamina propria, promote immunological unresponsiveness to commensal bacteria, which is important for maintaining gut homeostasis . Specifically, gut - resident phagocytes are hyporesponsive to microbial ligands and commensal bacteria, and they do not produce biologically significant levels of proinflammatory molecules upon stimulation . However, the microbiota is essential for upregulating the production of pro - il-1, the precursor to il-1, in resident innate immunity cells . This role is, at least partly, mediated by its ability to induce the expression of endothelial adhesion molecules that contribute to neutrophil recruitment and pathogen clearance in the intestine . Initiation of the innate immune response in the intestine is triggered by pathogen - recognition receptors (prrs). These prrs serve as sensors of pathogen - associated molecular patterns (pamps) from the intestinal lumen . Tlrs are transmembrane proteins that are typically expressed by intestinal epithelial cells either on the cell surface or in endosomes . Tlr signaling in the intestine is involved in epithelial cell proliferation, immunoglobulin a (iga) production, and antimicrobial peptide expression, functions that are crucial for maintaining a healthy epithelial barrier . Prrs are also expressed by other immune cells in the lamina propria and they can activate an inflammatory response involving both innate and adaptive immune system . Unfortunately, in some cases the innate immune system's attempts to protect the host fail and chronic inflammation and intestinal autoimmunity occur, such as in the case of celiac disease and ibd . Recent experimental data demonstrated the existence of a strong and direct interaction between tlrs and intestinal microbiota . For example, cheng et al . Demonstrated that pediatric cd patients have lower duodenal expression of tlr2 and higher expression of tlr9 as compared to healthy controls confirming that microbiota may have a role in cd . In fact, cheng and colleagues concluded that the overall composition, diversity, and the estimated microbe associated molecular pattern (mamp) content of microbiota were comparable between cd and healthy subjects, but a subpopulation profile comprising eight genus - like bacterial groups was found to differ significantly between healthy subjects and cd . In healthy subjects, increased tlr2 expression was positively correlated with the expression of tight junction protein zo-1 . In cd, the expression of il-10, ifn - gamma, and cxcr6 was higher as compared to healthy subjects . Other recent data comparing the composition of microbiota between cd patients and healthy controls demonstrated that tlrs activation by intestinal microbiota may determine different effects on the human gut of cd patients and healthy controls . These data suggest that microbiota and altered expression of mucosal receptors have a role in cd . In cd subjects, the increased expression of il-10 and ifn - gamma may have partly resulted from the increased tlr9 expression and signaling . Studied the expression of tlrs and cytokines and revealed that they occur in duodenal mucosa and are elevated in both children and adult celiac patients . Cd patients with high levels of tlr4 also showed high levels of proinflammatory cytokines (il-1, il-6, il-8, and il-17) as well as transcription factors (irak4, myd88, and nf-b). These data support the hypothesis that a unique pattern of tlr expression is associated with cd independently of age at diagnosis . The evidence that pediatric and adult patients have a similar inflammatory profile will encourage treatment of both with the same immunological therapy in the future . The only approved treatment for cd is the lifelong complete exclusion of the gluten from the diet . Indeed, we need novel strategies, targeting various factors at different levels in cd pathogenesis . For example, the reduction of gluten antigenicity and/or elimination of toxic peptides from gluten could be walkable; in this manner, the food gluten would not have the negative effect on activation of host immune system and the consequential gut inflammation . These modifications of gluten antigenicity may be achieved in several manners, from the selection of natural cereal cultivars to the genetic modification of gluten peptide sequences or more likely producing genetically modified organisms, in which toxic sequences are deleted or silenced . The other translational strategy of cd therapy derives from the knowledge of immunomodulatory mechanisms of disease . In fact, in cd, food gluten peptides activate lamina propria t - cells to produce inflammatory cytokines leading to tissue destruction . Thus, a way to block this pathogenetic event in cd could be a specific modulation of gluten reactive pathogenetic target t - cells . This modulation in gluten related to t - cell reactivity may be borrowed from the actual evidences on other immune hypersensitivity related diseases, such as allergy and autoimmune diseases . In fact, in these diseases, such as in cd, there is a pivotal role of cd4 + t - helper cells in driving and orchestrating gut inflammation and tissue destruction . The goal of pathogenetic translational therapy may be to develop vaccines consisting of synthetic peptides representing t - cells epitopes that may have the function to restore the balance between inflammatory and regulatory responses to the causative antigens [91, 92]. In cd, this could be achieved using a therapeutic vaccination constructed with the panel of most immunodominant gluten epitopes . The efficacy of vaccine therapy has been just demonstrated in allergy in which it is able to reduce allergen sensitivity and improve regulatory t - cell function . Furthermore, there are recent findings in the alterations of the microbiota in various medical conditions, such as cd, inflammatory bowel disease, allergy, and colorectal cancer . Even though changes of the microbiota could be linked to the etiopathogenesis of these diseases, further studies are needed to understand how to modulate microbiota to ameliorate the morbidity of cd . Chronic inflammatory diseases have multifactorial etiologies that involve environmental components and many immune and genetic factors . An environmental factor that precipitates disease is known (gluten); the hla molecules that confer predisposition to the disease have been identified (hla - dq2/hla - dq8); and access to the small intestine is simple . Thus, understanding the interaction of the microbiota with pathogens and host might provide new insights into the pathogenesis of disease, as well as novel avenues for preventing and treating intestinal and systemic disorders . The high increase in incidence of autoimmune disorders cannot be explained only by genetic drift and is thought to be the result of changes in the environmental factors and in their complex interaction with innate and adaptive immunity . Although there is strong support for the role of microorganisms as triggers of innate immune activation, there is no evidence of a role for molecular mimicry in cd . In other words, we do not have any evidence so far that cd pathogenesis is the result of a t - cell response against a microbial peptide cross - reacting with gluten . The gut microbiota has been studied for more than a century; however, we have only recently begun to understand the ever - expanding roles for these microscopic organisms in health and disease . Despite the complexity of the gut microbiota, there is a delicate balance in bacterial populations such that any disruption in this balance leads to dysbiosis and, consequently, to decreased resistance to pathogen colonization, to the favoured growth of pathobionts, and to pathological both innate and adaptive immune responses . So, in genetically predisposed individuals, gluten in association with microbial antigens can stimulate and modulate innate and adaptive immune response, sustaining a chronic mucosal inflammation, underlining this chronic disease . In summary, cd may be considered as a model to explain the pathogenesis of several other autoimmune diseases . In particular, how in the steady state condition homeostasis is maintained due to the complete balance between pro- and anti - inflammatory factors whereas, during disease, this balance is altered . The breakdown of the interaction among microbiota, innate immunity, and genetic and dietary factors leads to the disruption of homeostasis leading to inflammation and tissue damage . Thus, focusing the attention on this interaction and its breakdown may allow a better understanding of the cd pathogenesis and finally get novel translational avenues for preventing and treating this widespread disease.
Patients with end - stage renal disease (esrd) on hemodialysis (hd) have very high cardiovascular mortality . Interestingly, the usual risk factors for atherosclerotic diseases in the general population fail to explain the increased cardiovascular mortality in the hd population . For example, unlike the general population, mild - to - moderate elevation of cholesterol or blood pressure does not correlate with increased atherosclerotic complications or mortality in hd patients . As a result, several nontraditional uremia - related risk factors have been considered, including elevated levels of oxidative stress [1, 2]. Intravenous (iv) iron administration has become an integral part of anemia management in esrd patients; however, exposure to iv iron is among the factors associated with the increase in oxidative stress in the dialysis patients [36]. Whether chronic exposure to low maintenance doses of iv iron increases the risk of cardiovascular events has yet to be determined . The oxidative stress markers, malondialdehyde (mda), lipid hydroperoxide (lhp), and f2 isoprostane (fip), represent products formed by the reactive oxygen species generated following administration of iv iron . Mda is an end product of peroxidation of polyunsaturated fatty acids and is a reactive aldehyde that causes toxic stress in cells . Mda has been shown to increase rapidly (within 15 to 30 minutes) in patients with chronic kidney disease (ckd) and in hd patients following iv iron administration [3, 4]. Formation of lhp is indicative of lipid peroxidation, which results in oxidative damage in cell membranes, lipoproteins, and other lipid - containing structures . Isoprostanes are prostaglandin - like substances produced in vivo primarily by free radical - induced peroxidation of arachidonic acid . Fips are a group of 64 compounds isomeric in structure to cyclooxygenase - derived pgf2 and serve as ideal markers of oxidative stress since they are chemically stable, increase substantially during oxidant injury, and are specific products of peroxidation . Interventions that have been attempted to counteract the effects of heightened oxidative stress in dialysis patients include administration of substances with antioxidant activities, such as -tocopherol, angiotensin converting enzyme inhibitors, and vitamin e, a hemolipodialysis procedure, and the use of a vitamin e coated dialyzer membrane . Administration of n - acetylcysteine prior to iv iron administration has also been reported to reduce oxidative stress in patients with ckd; however, the results have been equivocal [3, 6]. The antioxidant -lipoic acid is more palatable than n - acetylcysteine and has shown benefit in preventing events associated with oxidative stress including diabetic neuropathy and glomerular injury . In humans, -lipoic acid has been used successfully to treat symptomatic diabetic polyneuropathy, an effect believed to be induced by enhanced formation of reactive oxygen species . In a comparative study involving -lipoic acid and -tocopherol supplementation in human subjects, -lipoic acid administration was associated with comparable decreases in oxidative stress markers (urinary fip, plasma protein carbonyls, and ldl oxidizability); thus, it is plausible that administration of this agent may reduce oxidative stress induced by iv iron . The purpose of this study was to test the hypothesis that a single oral dose of -lipoic acid given prior to administration of iv sodium ferric gluconate attenuates formation of oxidative stress markers and to determine if changes in iron indices correlate with changes in these markers . Adult male and female subjects with esrd requiring chronic hd and under the care of nephrologists at the university of tennessee, division of nephrology, were evaluated for participation in this study . Eligible subjects had to be between 18 and 80 years of age, receiving hd 3 times a week for at least 3 months, without residual kidney function (i.e., no urine output). Subjects were excluded if they had any form of dialysis catheter, had an active infection, had a documented history of chronic liver disease, elevated iron indices indicating iron overload (i.e., serum ferritin> 800 ng / ml and/or transferrin saturation> 50%), were pregnant or breastfeeding, or were taking medications with antioxidant properties including hmg - coa reductase inhibitors, angiotensin converting enzyme inhibitors, vitamin e, aspirin, or any form of steroids . Previous studies reported a 50% change in the oxidative stress marker mda following administration of iv iron; therefore, the target sample size was 10 subjects to allow detection of a 25% change in oxidative stress markers with a power of 0.87 (= 0.05). The institutional review board of the university of tennessee health sciences center and the university of tennessee clinical research center (ut crc) approved the study . Eligible subjects participated according to the study protocol, which required two separate visits, intervention and control visits . The sequence of control and intervention visits was assigned randomly for each participant (i.e., intervention followed by control visit or control visit followed by intervention visit). The study visits were scheduled on nondialysis days and were at least one week apart . Both the control and intervention visits subjects received 125 mg of sodium ferric gluconate (ferrlecit, watson pharmaceutical inc .) Blood samples were drawn for measurement of the oxidative stress markers and iron indices at the start (time 0) and 15, 30, 60, 90, 120, 150, and 180 minutes after administration of iv iron . Iron indices included serum iron, total iron binding capacity (tibc), transferrin saturation [(serum iron / tibc) 100], and serum ferritin . Hemoglobin, hematocrit, and serum albumin were measured from the sample drawn at time 0 . Blood pressure and heart rate were monitored prior to the infusion and 30 and 60 minutes following the infusion . During the intervention visit participants received 600 mg of racemic -lipoic acid (nutraceutical sciences institute, boynton beach, fl) orally 30 minutes prior to iv iron administration . During the intervention visit, blood glucose level was measured at the time of -lipoic acid administration and at 60 minutes after iv iron administration . The 600 mg dose of -lipoic acid has been used successfully to treat polyneuropathy in diabetic patients [14, 16]. Information on the pharmacokinetics of a single dose of 600 mg in patients with esrd indicates that this agent is rapidly absorbed (tmax 30 minutes) with a half - life of approximately 21 minutes and that urinary elimination is not a significant pathway of elimination suggesting that the dosing regimen selected for this study is appropriate [17, 18]. Based on this information we chose to give the 600 mg dose of -lipoic acid 30 minutes prior to the administration of iv iron . The plasma was separated by centrifugation at 1500 g for 15 minutes and stored at 70c until assayed . Plasma mda concentrations were measured using the thiobarbituric acid methodology; plasma lhp concentrations were determined by a colorimetric assay after methanol - chloroform extraction, and fip was measured using enzyme immunoassay methodology [19, 20]. Reagents were obtained from cayman chemical co., ann arbor, mi . The local ut crc laboratory measured all iron indices, albumin, hemoglobin, and hematocrit . Continuous data was presented as mean sd or as median (interquartile range). Repeated measures analysis of variance was used to test the trend in serum iron, total iron binding capacity, transferrin saturation, and ferritin over time . A mixed - effect model for repeated measures was used to determine the effect of the -lipoic acid administration on the oxidative stress markers . For each oxidative stress marker model, respective baseline oxidative stress marker data have been introduced as a covariate . Post hoc tests were performed by using contrast analysis to test differences between control and intervention at each time point and also between baseline to 15, 30, 60, 90, 120, 150, and 180 minutes follow - up . Differences in the area under the curve (auc) for the oxidative stress markers were compared using a paired t - test . All tests were 2-sided and a p value <0.05 was considered significant, unless otherwise stated . Statistical analysis was conducted using sas version 9.2 (sas institute inc ., cary, nc, usa). Ten african - american esrd subjects met inclusion criteria and were enrolled in the study . All patients were dialyzed three times a week using a high - flux biocompatible membrane according to a standardized treatment protocol for outpatient chronic hd patients . Nine subjects were receiving scheduled iv iron as iron sucrose; eight subjects received therapy 3 times a week and 1 subject received weekly doses . Seven patients were on erythropoietic stimulating agents (esas) administered with every dialysis session . There were no significant differences in laboratory values at baseline between the control and intervention visits except for the transferrin saturation, which was higher for the intervention visit (table 1). Changes in iron indices after infusion of iv iron are shown in figures 1(a), 1(b), 1(c), and 1(d). There was a sharp increase in serum iron, total iron binding capacity, and transferrin saturation levels after iron infusion that reached a peak level within 15 minutes . There was no significant change in serum ferritin after iv iron infusion during the sampling period . The changes in iron indices over time after iron infusion were similar for the control and intervention visits . Baseline serum fip, lhp, and mda levels were similar between the control and intervention visits (table 1). Mean serum levels of all 3 oxidative stress markers increased significantly after administration of sodium ferric gluconate and reached peak levels at 60 minutes (figure 2). There was no significant correlation between the oxidative stress marker levels at baseline and the variables of age, gender, baseline hemoglobin, serum iron, ferritin, total iron binding capacity, transferrin saturation, esas, or iv iron dose . There were differences in serum fip levels after -lipoic acid administration characterized by a significant global effect of -lipoic acid (p = 0.0017), time (p <0.0001), and -lipoic time interaction (p = 0.0187) (figure 2(a)). In particular, the serum fip level was significantly higher after -lipoic acid administration at 60 and 120 minutes . Similarly, serum lhp levels showed a significant global effect of -lipoic acid (p <0.0001), time (p <0.0001), and -lipoic time interaction (p = 0.0165) (figure 2(b)). Compared to the control group, the serum lhp level increased significantly in the intervention group after -lipoic administration at 15 minutes and remained elevated throughout the study period . There was no overall effect of -lipoic acid (p = 0.1091) or any interaction between -lipoic acid and time (p = 0.4037) on serum mda level (figure 2(c)). However, a significant time effect (p <0.0001) was observed on serum mda level indicating that after iv iron infusion the serum mda level changed from baseline, but there was no significant difference between the control and intervention groups . The area under the plasma concentration versus time curves (auc) for each of the oxidative stress markers is shown for the intervention and control groups in figures 2(a), 2(b), and 2(c). The auc for intervention visits is significantly greater compared to control visits for fip (22046 5921 versus 15694 3873 pg / ml min, p = 0.0045) and lhp (1025 353 versus 956 375 m min, p <0.001) indicating greater production of these oxidative stress markers following -lipoic acid administration . There was no significant difference in the auc between the intervention and control visits for mda (6851 5020 versus 5043 3134 m min, p = 0.1087). This study demonstrated that iv iron administration in hemodialysis patients was associated with a rise in oxidative stress markers; however, pretreatment with the antioxidant -lipoic acid failed to prevent this increase in oxidative stress . In fact, -lipoic acid administration was associated with a further rise in oxidative stress markers demonstrating a potential prooxidant effect . Iv iron and esas administration have become an integral part in the management of anemia in hemodialysis patients . In recent years, the safety concerns of esas have led to the significant restrictions on the use of esas and renowned interest in the more aggressive use of iv iron . The association of iv iron administration and increases in oxidative stress markers in ckd and dialysis patients is well documented [36]. Some variations in oxidative stress response are reported in hemodialysis patients among the available iron preparations (sodium ferric gluconate, iron dextran, and iron sucrose) with sodium ferric gluconate being associated with the highest serum mda levels compared to other iron preparations . It can accept an electron in low valence state fe (ferrous) and donate an electron in high valence state fe (ferric). Both the storage form of iron as ferritin and the carrier form as transferrin keep iron in a stable state and prevent participation of unbound iron in redox activities . In disease conditions where there are possibilities for superoxide (o2) production, the storage form of iron, ferritin becomes vulnerable to the attack by o2 . This results in release of stored metal iron in fe state [o2 + fe o2 + fe]. The released iron can react with h2o2 and produce oh radicals [h2o2 + fe oh + oh + fe]. This ros can attack any class of biological macromolecules and cause various damaging reactions such as inactivation of enzymes, depolymerization of polysaccharides, and lipid, protein, and carbohydrate peroxidation . These macromolecules have a longer half - life than the ros itself and can be measured . They represent the markers for oxidative stress . In the current study oversaturation of iron (transferrin saturation> 100%) was observed within 15 minutes of iv iron administration (figure 1). This indicates the availability of free iron, which becomes susceptible to the action of superoxide and formation of ros . The rise in transferrin saturation is preceded by the upsurge in oxidative stress marker levels . The increase in oxidative stress markers in intervention group cannot be attributed to increases in iron indices since the change in iron indices was similar with and without -lipoic acid administration (figure 1). Evidence of the prooxidant effect of -lipoic acid comes from observations of a significant effect of -lipoic acid on fip and lhp concentrations and the higher auc observed for fip and lhp following -lipoic acid administration (figure 2). The prooxidant effect of -lipoic acid has been reported in several in vitro and animal studies, but not in humans [24, 25]. The unexpected findings from this study may be attributed to the actions of dihydrolipoic acid (dhla), the reduced thiol form of -lipoic acid . Both -lipoic acid and dhla are powerful antioxidants and produce antioxidant actions by chelation of several metals including iron [26, 27]. In contrast, dhla can also produce a prooxidant effect in the presence of a transitional metal such as iron by reducing fe to fe, which can promote oxidative damage by hydroxyl radicals . Dhla can also generate sulfur - containing radicals, which can damage certain proteins, such as -1 antiproteinase and creatine kinase . Vitamin c and n - acetylcysteine usually have well - established antioxidant effects; however, in the presence of inflammation and free iron, administration of these substances has been associated with increase in oxidative stress marker levels . In conclusion, this study highlights the potential undesirable interaction of antioxidant therapy with -lipoic acid and available free iron in hemodialysis patients . Supplementation of -lipoic acid in such conditions does not appear to be beneficial or innocuous and may further exacerbate oxidative stress injury . The effect of chronic supplementation of -lipoic acid in patients with elevated free iron and inflammation warrants further study.
Nanotechnology is considered as a cutting edge technology in the 21 century . In ancient period also people prepared and used nanoparticles in different fields of art and medicine, without knowing their in - depth physico - chemical properties, but believing their potential to prevent diseases . Window glasses and ceramic containers in the roman empire were found to contain gold, copper and silver nanoparticles to give them eternal bright colour12 . Gold nanoparticles were being used in medicines in china and india . In india, till now gold nanoparticles are used in medicine as in 1857, michael faradayfirst prepared the pure colloidal gold nanoparticles, and named it as activated gold5, though the first introduction of the concept of modern nanotechnology was by renowned noble laureate physicist, richard phillips feymann in 1959 in his famous talk called robert curl, harold kroto, and richard smalley were awarded nobel prize in chemistry in 1996 for their roles in the discovery of buckyballs or fullerenes (spherical carbon nanoparticles), the first synthetic nanoform with known characteristics7 . Nanos which means dwarf, denoting a factor of 10 (1meter= 1,000,000,00 nano meter). Nanotechnology is the understanding and control of matter at the nanoscale, at dimensions between approximately 1 and 100 nanometers, where unique phenomena enable novel applications89 . Nanoscale dimension acquires some special characteristics (e.g. Optical, magnetic, electrochemical, etc .) Which are neither present in bulk material nor in molecular state810111213 . A good example is gold nanoparticles which remain in colloidal phase and are red in colour, though bulk gold is solid in nature and is yellow in colour . This unique colour phenomenon of gold nanoparticles is due to surface plasmon resonance (spr), found only in nanoscale dimension . Therefore, these exclusive nano - specific properties make them unique entity in classical chemistry . Interestingly, one can easily modify or customize these properties just by modulating shape, size and/or surface topology of nanoforms14 . In a nutshell, the maneuverability of designing the materials at the nanoscale and tunability on its surface make this an independent branch of science having wide applicability . It involves vast area of chemistry, physics, electronics, material science as well as biology1516 . Among all of these areas application of nanotechnology in biology is thought to be one of the most successful and wide spread areas of utility, which includes basic understanding of biological event as well as medical diagnosis, surgery and therapy17181920 . Biomolecule compatible size distribution of nanoforms along with their tuneable properties (physical, chemical, topological) help nanotechnology to merge with biology to give birth to one of the most advanced fields of science - nanobiotechnology212223 . Depending on the constituting material, mode of synthesis, surface topologies, mode of applications, etc . Some of these basic nanoforms synthesized so far and are proposed to be used in biomedical field are given in table i. different types of synthesized nanoforms the ultra small dimension and uniform size distribution (compared to liposome), specialized optical, physico - chemical, electrical, magnetic properties; high cellular penetration power, tuneable size, shape, texture, unique surface topology and surface chemistry make nanoparticles to play promising role in the biomedical field (e.g. Therapy, drug delivery, diagnostics, etc. )404142 . The nanoforms that belong to this category (bio - medical) are listed in table ii . Biomedical application of primitive era nanotechnology was mostly in the field of cancer434449, though with advanced exploration, it encompasses almost all fields of biomedical research . Diagnosis, drug delivery, stem cell therapy, tissue engineering, stent surgery, are the few other areas where nanotechnology imprints its signature . The most promising area however, is the nanomaterial based improved clinical imaging, e.g. Nanoimaging of cardiovascular diseases50 . After extensive research, it was hypothesised that nanoparticles could be unique contributors in the field of the medical imaging, due to their special features, which are as follows: (i) biocompatible size distribution: the ultra small nano size helps them to accommodate with different biocomponents even inside the subcellular organelle52 . (ii) high penetration power: this is another aspect fulfilled by nanoparticles for bio - medical imaging53 . (iii) image contrasting ability: paramagnetic nanoparticles are magnetic resonance imaging (mri) contrast agents . Iodinated nanoparticles can be used as computed tomography (ct) contrast agents, whereas quantum dots can act as fluorescent enhancers54 . (iv) surface tuneable property: nanosurface can be modified with the molecules of choice . Thus, it is possible to conjugate a nanomaterial with multimodal entity, for example, target specific molecules (targeted delivery), imaging probes and/or therapeutic molecules5556 . (iv) stability: contrast enhancer nanomaterials are much more stable than a chemical image probe57 . (v) half life: in case of carrier nanoforms, used as image contrast agents, the half life of the chemical image probes is also increased due to their conjugation with nanoparticles . Thus, atypical size distribution, target specific delivery, high contrast capability, increase lifetime are the key features that make nanomaterials indispensable in the future medical imaging . Nano based cardiovascular imaging can monitor the live physiological system in a noninvasive manner, with almost no pain . This live imaging is not only important for proper diagnosis or therapy, but is also beneficial for the basic understanding of the pathological conditions, which in turn helps us to develop future advanced techniques . Though majority of the nano - based cardiovascular imaging modules are in the field of diagnosis, but with advancement of this technology, it has entered in the domain of therapy and surgery also . In most of the cases, the nano based imaging are not discrete, but are inter - connected between the fields of diagnosis, therapy or surgery . Thus for the better understanding, nano - cardiovascular - imaging can be broadly divided into four categories depending on the site of detection and/or mode of action: (i) thrombus imaging; (ii) theranostic approach; (iii) stem cell imaging; and (iv) graft imaging (i) thrombus imaging: acute coronary syndrome (acs) is one of the leading causes of death in the world5859606162 . Atherosclerotic plaques in humans consist of different bio - components which are heterogeneous in nature, i.e. Macrophages, smooth muscle, endothelial cells, other undefined mesenchymal cells, etc63 . Proper detection of the plaques, in a non - invasive way is crucial and is the most demanding diagnostic procedure for the accurate treatment of the disease . In modern physics different non - invasive imaging techniques have been developed for the detection of plaques which generally require contrast agents6465 . First, these show sometimes toxic effects and second, these get non - specifically distributed to the whole body by circulation due to absence of any target specificity . This is where nano - based imaging system can come as a rescuer over the conventional clinical imaging techniques . For example, one of the most reliable imaging methods for the detection of plaques is by cardiac magnetic resonance imaging (cmri), which requires a contrast agent gadolinium (gd), that often exerts toxic effects66 . It has been found recently that intracellular self - assembled gadolinium nanoparticles show enhanced mri contrast ability with reduced toxicity67 . One way to reduce this toxicity is by using chelating agents, for example, diethylene triamine pentaacetic (dtpa). It has been shown that gd - dtpa exhibits less toxicity than gd alone6869, though there are some reports about the possibility of leakage of free ions from gd- chelate complex70 . It has also been shown that nano - gd complex exhibits large loading capacity as well as large ionic relaxivity which in turn increases the contrast ability7172 . Anti - fibrin antibody conjugated oleate modified gd - dtpa nanoparticles (microemulsion) can effectively detect fibrin in vulnerable plaques73 . Again, gd - chelate conjugation, incorporating nanoparticles reduces the toxicity to a significant extent74 . Though nanotechnology based approaches manage some initial success to reduce gd toxicity, search is still on for new nontoxic agents for mri . In that direction, ultra - small super - paramagnetic iron oxide nanoparticles (spion) are thought to be an ideal substitution, as in the laboratory conditions these have shown high contrast ability with no toxicity75 . One report shows that spions have high efficacy for cmri without manifesting any toxic effect in humans76 . Same as spion, perfluorocarbon nanoparticles contain fluorine, generate good contrast without any background signal, and can also be used in cmri45 . Another advantage of spion is that these can be easily conjugated by any surface ligand, therefore, are efficient enough for targeting and therapy, compared to gd - chelate complex . The last and most effective point is that spion are degraded by lysosomes and free iron from particles is released into the intracellular iron pool; hence, there is no chance of deposition inside the body77 . The atherosclerotic plaques are mainly of two types; stable plaques (fibrous plaque) and unstable plaques (lipid plaque). Vulnerable plaques are made up of large amount of lipids, covered by a thin fibrous cap . Destruction of this fibrous cap makes the plaques unstable and these become detached from the endothelial layer79 . This phenomenon activates circulating resting platelets and the consequence is the formation of platelet rich thrombus . Detection of the vulnerable plaques is a crucial step to initiate therapy for this disease . Macrophages being one of the key components of atherosclerotic plaque play a decisive role in plaque destabilization80 . These get attached to the thin fibrous cap of the plaques and secrete proteolytic enzymes which dissolve the fibrous cap81 . Phagocytic activity, which is the key feature of macrophages, has been exploited for the identification of the vulnerable plaque . It has been shown that macrophages can effectively take up a wide range of nanomaterials, including contrast enhancing nanoforms83 . Therefore, nanoform loaded inflammatory macrophages on the plaque can be easily identified by non - invasive imaging techniques8485868788 . Now, the choice of imaging techniques will depend on the constituent of nanomaterials, or vice versa . For example, if macrophages are loaded with spion, then cmri will be the ideal technique, whereas ct scan can be done if the particles are iodinated . It has been found that gold nanoparticles have three times greater photon absorption capacity compared to iodinated contrast agent and, therefore, can enhance image contrast ability8990 . In addition, high contrast ability, inert character and surface modification are the other additional advantages of gold nanoparticles (aunp). It has been found that cna35 (small peptide which has excellent affinity for collagen) conjugated aunp effectively identify myocardial scar signature by ct scan91 . Au - hdl nanoparticles (gold nanoparticles coated with apolipoprotein a1, phospholipid and rhodamine lipid) specifically target macrophages of plaques and are identified in multicolour ct92 . Specific targets of the plaque, choice of nanoforms and corresponding imaging techniques are listed in table iii . Different nano - conjugates and their mode of action amino acid sequence specific targeting of plaque destabilize proteases (secreted by the inflammatory macrophages) can also be used as an identifier of atheromata . It was found that polymeric nanoparticles with fluorochrome labelled oligo - l - lysine cleavage sequence (target for plaque specific proteases) can efficiently detect inflammatory plaque93 . Factor xiii is another important constituent of acute thrombus; it converts linear fibrin to crosslink fibrin (fibrin - and -chains), ultimately increases fibrinolytic resistance, and increases the plaque lifetime . Therefore, nano - mediated factor xiii specific targeting and imaging is another approach to detect thrombus . Magnetic nanoparticles coated with factor xiii, as well as fibrin specific peptide act as effective contrast agents for the detection acute thrombus, especially when thrombus is in its growing phase94 . Reactive oxygen species (ros) and reactive nitrogen species (rns) are generated by atheroscerosis induced inflammation . Under certain circumstances these oxidizing species can neutralize local antioxidant defences, thus leading to oxidative stress and tissue injury . These oxidation reactions are mainly catalyzed by myeloperoxidase (mpo), a heme protein secreted from activated phagocytes in human atherosclerotic lesions99 . Though in vivo imaging of ros / rns has significant clinical impact, yet there is no conventional method for their detection . An oxazine nano based imaging method has been developed to monitor hypochlorous acid (hocl / ocl) formation by peroxynitrite, a reactive nitrogen species and myeloperoxidase (mpo), thereby identify the oxidative damage by atherosclerosis95100 . Theranostics is a newly established term in clinical medicine which deals with a treatment strategy in combination with therapeutics and diagnostics101 . It can be defined as a modified diagnostic procedure equipped with therapeutic molecules/ device. Theranosis nanoparticles can themselves act as diagnostic probes (image contrast agent) and get conjugated with therapeutic or diagnostic molecules or vice versa . Nanoimaging . Simultaneous detection and volume reduction (thrombolysis / fibrinolysis) of thrombus is one such approach . The sole component of the thrombolytic/ fibrinolytic pathway is plasminogen, which gets converted into plasmin (serine proteinase) by plasminogen activators, i.e. Tissue - type pa (tpa) and urokinasetype pa (upa). This plasmin then degrades fibrin and different extracellular matrix proteins (fibronectin, laminin, proteoglycan, and type iv collagen), thus reducing the plaque volume102 . Recombinant tissue plasminogen activator (rtpa) is now being recognized as an effective clinically used therapeutic molecule to dissolve plaque103 . In this context, a nano - based theranostic approach can be conceptualised to monitor as well as to reduce plaque volume . It has been already found that iron oxide nanoparticles tagged with rtpa can efficiently dissolve clot96 . A real time monitoring on thrombolytic effect has been done using nanoparticles coated with fluorophores . Therefore, diagnosis of plaque and reduction in its volume can be carried out simultaneously with the help of nanotechnology . Neovascularisation is directly associated with plaque progression, risk of plaque rupture; therefore the subsequent consequence is myocardial infarction105 . Integrin 3 is only expressed in angiogenic vasculature, not in mature vasculature; hence can act as a marker of active angiogenesis106 . To get molecular image (mri) of angiogenesis, ultra small super paramagnetic iron oxide nanoparticle has been developed to target integrin 3 receptor107 . The research in this direction has further led to the detection and quantification of early angiogenesis (through mri) by integrin 3 targeted perfluorocarbon108 . The ultimate nanotechnology based theranostic approach shows that fumagillin (potent angiogenic inhibitor) incorporated with paramagnetic nanoparticle not only detects early angiogenesis, but also effectively inhibits it98 . Magnetic nanoparticles tagged with near infrared fluorophores and light activated therapeutic moieties can be used to detect and destroy inflammatory macrophages in atherosclerotic plaques . Intravenous administration of these nanoparticles in murine system showed that these were readily taken up by the macrophages and killed (phototoxic effect due to activation of therapeutic moiety thpc) them after exposure at 650 nm light . (iii) stem cell imaging: the most recent approach though is under in - depth investigation, shows a hope of using stem cell technology in the treatment of cardiovascular diseases109110 . Infarcted myocardium cannot be replaced spontaneously; the reason behind it is that human cardiomyocytes are post - mitotic cells; therefore cannot proliferate after birth111 . Recent findings show that mesenchymal stem cells (mscs) are the bone marrow stromal cells which can differentiate into cardiomyocytes in an appropriate condition112113 . Most excitingly, transplantation of mscs can improve cardiac activity in patients with myocardial infarction (mi)114115 . But the proper implementation of the mscs that are going to be transplanted in terms of fraction (%) of cells reached to the infracted myocytes is of great importance in respect to prognosis of the disease . Super paramagnetic iron oxide nanoparticle labelled stem cell tracking and targeting has been piloted effectively in animal models with chronic mi46116 . Cellular magnetic resonance imaging is found to be convenient method for the study of spion guided delivery of mscs to the infarcted muscle47 . (iv) graft imaging: heart transplantation is the only treatment for patients with end - stage heart failure or severe coronary artery disease117 . Even after heart transplantation, patients have to undergo repeated endomyocardial biopsies to see transplant graft rejection118 . This procedure has significant risk, prone to sampling error and can induce fibrotic tissue build up at the site of biopsies119 . A recent nanotechnology based approach has shown that fluorophore tagged iron oxide nanoparticle can efficiently diagnose this pathological condition9697 . Macrophages and cathepsin (protease) play a key role during graft rejection; therefore, these are attractive molecular imaging targets . These fluorescent conjugated magnetic nanoparticles have been used as a marker for macrophages with phagocytic activity and prosense-680 nano - construct (fluorogenic particle) for determination of cathepsin activity50 (table iii). With the increasing demand of nanotechnology in day to day life, one should be concerned about its negative effects also . It is already established that one of the main targets that can be affected by nanotoxicity is cardiovascular system . The general toxicity effect is mainly due to nanoparticles present in atmosphere, in fuel exhausts from car, though in some cases it has also been found that designer nanoparticles (chemically synthesised nanoparticles in laboratory) can also exert toxic effect, if not properly modified . Peters and colleagues120 have shown that there is a consistent and clear dependence of duration of exposure to traffic with onset of myocardial infarction . The most common and ambient nanoparticles in traffic are carbon nanoparticles generated from diesel exhaust which show toxic effect on vascular cells121 . Air borne particulate matter enters into our body through alveolar wall during inhalation . After penetrating the alveolar wall it comes in contact with blood and thus gets access into the cardiovascular system122 and induces cytotoxic injury, inflammation in endothelium, inhibition of celll growth, and cardiovascular toxicity123 . Apart from the carbon black nanoparticles most of the metallic nanoparticles are found to induce platelet activation and aggregation thus increase the cardiac risk124125126 . Cosmetics with nanoparticles [titanium oxide (tio2), silicon oxide (sio2)] also can increase the risk of cardiac arrest by inducing plaque progression, vasodialatory dysfunction, myocardial ischaemic damage, atrio - ventricular blockage, etc.127128 . Copper oxide (cuo) nanoparticle increases the oxidative stress, and ros generation which ultimately activates plasminogen activator inhibitor-1 expression, and increases the risk of myocardial infarction129 . Nickel nanoparticles have been shown to induce atherosclerosis during long term exposure in mice model130 . Nanotoxicity of industrial nanoforms the toxic effects that seem to be induced by nanoforms might not be due to the nanoscale . The adverse effects are possibly due to the corresponding ions that get adsorbed on the outer surface of bare nano - forms, during the leaching of particles, when they are in solution phase131134 (fig . Compared to the bare nanoparticles, ion coated nanoforms are easily taken up by cells as nanoparticles by virtue of their good penetration power136 . This concept is well correlated with some experimental facts, where it has been shown that surface modified nanoparticles do not show any toxicity (as leaching of ions are much less due to surface stability) compared to the bare nanoforms137138139140 . The carbon nanoparticle mediated toxic effect is probably due to a different mechanism . In this case, their (carbon nanoparticles) amorphous (nanotubes, or carbon black) and super hydrophobic nature is the major cause of their toxic effect141 . Zero valent metallic nanoparticles rarely show toxicity but the ions leaching from it.often adsorbed onto outer surface and can induce oxidative stress while permeating healthy normal cell (ions themselves cannot penetrate cell membrane). Nanoparticles along with their own unique properties (image contrast capacity, electromagnetic properties, bio - size compatibility, etc .) The nano - based diagnosis covers detection of disease condition, appropriate therapy, as well as detection of post- surgery conditions (fig . 2). Though several techniques have already been developed to make nanoparticles as a potent candidate in the cardiovascular imaging field, yet one important aspect is related to the stent technology . With the advancement of technology drug eluting stents nano - mediated drug eluting stents are more efficient than the only drug eluting stent as nanoforms can increase the half life of the drug, by sustained release . Therefore, a new nano - based technique can be conceptualised with spion, or nanoparticle with imaging probe, in drug eluting stent that will not only slow down the drug release, but also can be monitored in real time, by imaging devices . Gold nanowire is a good scaffold for the delivery of stem cell in the infarcted myocardium as it has the ability to synchronize the electrical signal in the cardiac stem cells . Therefore, one can hypothesize a spion and gold nanowire based model scaffold system that will not only synchronize the rhythm but also be monitored on a real time basis . The same holds good for the theranosis of urokinase mediated thrombus reduction . In conclusion, nanotechnology imposes a huge scope in future clinical imaging field of cardiovascular diseases . Schematic representation of potential nano - mediated cardiovascular imaging in diagnosis and therapy (e.g. Identification of thrombus, monitoring graft rejection, stem cell tracking, and identification of angiogenesis, etc.)
Bicuspid aortic valve is an autosomal dominant hereditary disease with incomplete penetrance and represents the most common congenital disease that can be found in the general population, with prevalence between 1% and 2% . However, a threefold higher male predominance one was observed, suggesting that this disease may be related to an x - linked hereditary . This structural alteration seems to be a consequence of an abnormal developmental process of the aortic cusps during embryogenesis [29]. Patients with bicuspid aortic valve have a higher morbidity and mortality owing to the associated cardiovascular complications . Aortic coarctation, dilatation, and consequent aneurysm or dissections of the ascending aorta are very common in this group of patients . Aortic stenosis / insufficient valve is very common in these patients and it is related to gradual calcification of the valve . In these patients a valve replacement is necessary and the surgical rational is similar to the valve replacement of the tricuspid one . It is generally accepted that replacement of the ascending aorta should be performed, at the time of aortic valve replacement, when the aortic diameter exceeds 4045 mm; however, it is still open to doubt which procedure should be performed and if it should be performed, especially in young patients . In fact a dilatation of the ascending aorta could occur, even after the valve replacement, so the followup of the aorta in these patients is needed . Echocardiography is considered the first standard examination for the diagnosis and the followup of this disease, especially if performed via transthoracic approach, with sensibility of 87% and specificity of 91% . Ecg - gated ct has been shown to provide accurate information about the aortic valve and root and may be considered as an alternative imaging technique [1113]. The aim of our study is to compare the results of the tee (transthoracic echocardiography) with the results obtained by the ecg - gated 64 slices ct during the followup of patients with bav, after aortic valve replacement; in particular we evaluated the aortic root and the ascending aorta looking for a new algorithm in the followup of these patients . From january 1999 to december 2009, 369 patients with bicuspid aortic valve were submitted to surgical treatment by cardiac surgery division of tor vergata university foundation . In particular our attention was focused on 67 patients with isolated surgical substitution of aortic valve (48 male, 19 female; mild age of 61 15, min age 21, max age 88), selected for clinical and instrumental preoperative and postoperative studies with echo - cardiac and mdct exams, on the bases of ascending aortic diameters <45 mm at the moment of surgical treatment, absence of genetic disease (e.g., marfan syndrome), general ct exam contraindications, and also for geographical territory distribution . Preoperatory characteristics of this selected population of patients are shown in table 1 . The study was approved by the local ethics committee and all the patients provided informed consent to the examination . An echo - cardiac transthoracic exam (table 2) and mdct (table 3) were performed before surgical treatment . A preoperative coronary study was also performed by means of a conventional coronarographic study in 60 patients and a mdct in 7 patients . All these patients underwent surgical implanted valves; in particular, 30 of them received a biological prosthesis (lifesciences edwards c - e perimount) and 37 of them a mechanical prosthesis (24 sorin bicarbon, 12 carbomedics, 1 st.jude medical). After dismissal, all of these patients were strictly observed with clinical exams, ecg, transthoracic echocardiography, and in selected cases with mdct . During the period between may to september 2010, these patients underwent their last evaluation, and clinical exams, ecg, transthoracic echocardiography and an ecg - gated - mdct were performed . An echo - cardiac transthoracic exam was performed in order to measure the diameter of the aortic root, sinotubular junction, and ascending aorta . A measurement of parietal thickness, telediastolic and telesystolic left ventricular diameter and left ventricular ejection fraction was also obtained . As regards the prosthesis aortic valve, we evaluated transvalvular maximum and medium gradients and the presence of reflux; we also studied the other valves and systolic pulmonary arterial pressure . Mdct was also performed before surgical treatment to measure the aortic root diameter, sinotubular junction, and ascending aorta (at the bifurcation of pulmonary trunk) and proximal aortic arch . Cardiac frequency <75 bpm was required for the execution of the examination; in the case of higher frequency a beta blocker was administrated (5 mg propranolol ev . ). Ct exams were performed with a 64-slice ct scanner (lightspeed vct, general electric medical system, milwaukee, wi, usa), and by a retrospective synchronization technique . A preliminary unenhanced scan was done in order to determine the scan extent and calculate the calcium score (smartscore protocol). The acquisition stack extended from the pulmonary apex to the diaphragm a second image stack was then acquired after intravenous administration of iodinated contrast material using a dual - head automated injector (stellant, medrad, pittsburgh, pa, usa). A dose of 90 ml of nonionic iodinated contrast material (iomeron 400, bracco, milan, italy) was administered through an 18-gauge needle cannula placed in an antecubital vein, followed by a 40 ml saline solution injection, both at a rate of 5 ml / s . To synchronize the acquisition start with the arrival of the contrast agent in the aortic root parameters for the contrast - enhanced scan were beam collimation 64 0.625 mm, slice thickness 0.625 mm, reconstruction increment 0.625 mm, table feed 2.9 mm / rotation, tube rotation 0.35 s, tube voltage 120 kv, dose modulation protocol (intensity 140750 ma), and craniocaudal scan direction . Scan duration was 1012 s. image reconstruction was carried out using 75% of the cardiac cycle, corresponding to the r - r interval or end diastole . The data - set was sent to a workstation console and elaborated using a dedicated software (advantage windows with cardioiq software, version 4.4; ge healthcare, milwaukee, usa) to get multiplanar reconstruction (mpr), maximum intensity projection (mip), and volume rendering (vr) images . The data was expressed as means plus one standard deviation (sd) or as percentages . The comparison between groups was obtained using the test and the student's t - test, as appropriate . During the period between may to september 2010, these patients underwent their last evaluation; clinical exams, ecg, transthoracic echocardiography, and an ecg - gated - mdct were performed . The average time of the followup was 55 35 months (range 9137 months, median 44 months). Table 4 shows all the clinical characteristics of the population during the followup . Tte results show an aortic root of 36.7 4 mm and an ascending aorta of 39.6 4.8 mm (table 5). Ecg - gated ct shows an aortic root of 37.9 5.5 mm and an ascending aorta of 43.1 5.2 (table 6). The comparison between preoperative and postoperative eet shows a significant long - term dilatation of the ascending aorta (37.5 4.4 mm versus 39.6 4.8 mm; p <0.0001), while the aortic root diameter seems to be stable (36.4 4.1 versus 36.7 4.1 mm; p <0.0001). All the patients underwent ecg - gated ct and none of them were excluded during the examination . Ecg - gated ct confirms the stability of the aortic root diameter (38.2 5.3 mm versus 37.9 5.5 mm; <0.0001) and the increasing diameter value of the ascending aorta (40.2 3.9 mm versus 43.1 5.2 mm; p = 0.0156). In particular, we noticed that in 7 (10.4%) patients, the diameter of the ascending aorta was 50 mm (figure 1). Comparing this group of patients with the rest of the population we discovered that the only statistical difference was in the period of followup; in fact these 7 patients have been observed for a period longer than 60 months . Ecg - gated ct acquisition allowed us an evaluation of the coronary tree in all patients: 43 (64.1%) patients did not show coronary stenosis, while 21 (31.3%) of them had a nonsignificant coronary stenosis (<50%) and 3 (4.4%) had a significant coronary stenosis (50%). Bicuspid aortic valve (bav) is the most common congenital cardiac malformation, affecting 1 - 2% of the population, with strong male predominance . It has been recognized as a syndrome incorporating aortic valve disorders and aortic wall abnormalities . These intrinsic defects in the aortic wall end up in late complications such as aortic root dilatation, ascending aortic aneurysm, often asymmetric, and dissection . Because these complications, with a potentially fatal outcome, will develop in approximately one third of all patients with a bicuspid aortic valve, it is of the utmost importance to correctly detect and treat this type of congenital malformation, and also to follow these possible complications over time . For this reason, different surgical options have been developed for these patients, including not only aortic valve replacement but, in some cases, also concomitant prophylactic surgery of the aorta . According to the guidelines of the american college of cardiology and of the american heart association, patients with bav should undergo elective repair of the aortic root or replacement of the ascending aorta, at the time of aortic valve replacement, if the diameter of these structures exceeds 45 mm . In fact, the risk of combined surgery on the aortic valve and ascending aorta is almost comparable to the risk of isolated valve replacement, but it is considerably lower than the risk of a possible resurgery in election, or even worse, in emergency . In case of only aortic valve replacement, a close followup is required after surgery, to evaluate aortic dilatation and to avoid late complications . Indeed, in patients with bav without dilatation of the ascending aorta, even successful valve replacement is not able to prevent long - term dilatation of the ascending aorta . Transthoracic echocardiography (tte) is the first standard examination during the followup of these patients . Currently, in patients with previous bav and aortic valve replacement, transthoracic echocardiographic followup is performed twice a year and it is integrated with angio - ct in the case of initial signs of aortic disease or of suspicious echocardiographic findings . Followup evaluation includes the state of the heart chambers, the functioning of prosthetic aortic valve, and the size of thoracic aorta . Tee is an excellent method for studying the aortic root, although this technique has some limitations: it is operator dependent and has a high incidence of artefacts in the evaluation of the upper ascending aorta . The interposition of the trachea and left main bronchus between the aorta and the oesophagus can cause a the presence of severe aortic wall calcifications may lead to misdiagnosis because of the resulting acoustic shadows . Additionally, the examination may be undetermined by the lack of a suitable acoustic window due to body habitus and artefacts related to the presence of prostheses . Furthermore, the use of tte does not permit the visualization of the descending aorta . The introduction of the latest generation of 64-slice ct scanners with short acquisition times and their high spatial and temporal resolution allows images to be acquired during a single short breath - hold and thus with a high level of anatomical detail of the whole thoracic aorta and of the other anatomic thoracic structures . Furthermore, ecg - gated synchronization with its reconstruction algorithms permits a correct evaluation of cardiovascular structures minimizing cardiac motion artefacts; the advantage of cardiac ct in these patients is that it allows a better visualization of the aortic root and aortic valve and that permits a simultaneous evaluation of the coronary arteries . A heart rate <70 bpm, whether spontaneous or induced by -blockers, is considered sufficient to increase diastolic time and duration of end - diastole, when the heart, the valves, the aortic root, and coronary arteries are nearly motionless . The volume of data acquired during scanning time can be subsequently reelaborated by a postprocessing procedure . Multiplanar reconstruction (mpr), maximum intensity projection (mip), and volume rendering (vr) techniques provide a comprehensive depiction of the prosthesis valve, the aortic root, the thoracic aorta, and coronary artery tree . All this information is achieved with values of an absorbed dose of between 810 msv . However, when the heart rate is stable and lower than 65 bpm, a prospective ecg - gated ct protocol could be used with a significant reduction in the adsorbed dose, up to 35 msv, without decreasing the image quality . In our study we investigated the clinical applicability and image quality of retrospectively ecg - gated 64 slices ct for the followup of patients with aortic valve replacement due to bav, in comparison with transthoracic echocardiography . In particular, our evaluation included thoracic aorta diameters at different levels: aortic root, sinotubular junction, ascending aorta, and aortic arch . In all patients the study was also extended to the descending aorta and completed with an evaluation of the coronary artery tree . We observed a statistically significant difference between ct and tte in the evaluation of ascending aorta diameters . In particular, in 7 patients, the ascending aortic diameter measured by ct exceeded 50 mm, while echocardiographic measurements were lower . These results disagree with those of other studies, in particular the study by tamborini et al . Moreover, it is important to notice that in these patients we observed the longest followup overall, 60 months . This evidence underlines the progression of ascending aorta dilatation and also enhances the importance of long - term evaluation, with an accurate imaging technique, in patients with a prosthesis substitution of bav . The most important issue emerging from our study is that ascending aorta shows a progressively long - term dilatation while aortic root's diameters seem to be more stable . Probably, this happens because in patients with bav syndrome the defects of the valve had previously caused a hemodynamic stress of the ascending aorta wall associated with a congenital alteration of the structures of the aortic wall . Due to the different findings between ct and tte studies, angio - ct should no longer be considered as a complementary exam in the followup of these patients, but as a fundamental role since it is a real necessity . We think that should be necessary to perform two angio - ct exams in followup, respectively 12 months and 48 months after aortic valve replacement . Indeed, if between these observation times there are changes in the clinical history of the patient, it is important to perform also one more angio - ct study . Our study demonstrated that angio - ct is a compulsory diagnostic step, in the followup of patients with previous bav who have undergone aortic valve replacement, to avoid late complications . The information provided by angio - ct regarding the thoracic aorta is more complete and exhaustive than that obtained by tte.
The first macrolide, erythromycin, was discovered in 1952 and since then macrolides have had an important role in treating infectious diseases (kirst, 2002). Erythromycin had moderate activity against gram - positive pathogens, while the newer semi - synthetic derivatives azithromycin, clarithromycin, and ketolides have broader antibacterial activity . Macrolides, lincosamides, and streptogramins (mls), though chemically distinct, are usually considered together because most share overlapping binding sites on the 50s subunit of the ribosome and many bacteria carry acquired resistance genes which confer resistance to more than one drug within this group (sutcliffe and leclercq, 2003). These antibiotics inhibit protein synthesis by binding within the exit tunnel, adjacent to the peptidyl transferase center, and inhibit translation by preventing progression of the nascent chain inducing peptidyl - trna drop off (auerbach et al ., 2010; starosta et al ., different antibiotics within the mls group interact and bind with different rrna residues which may account for why a bacterium may be resistant to the macrolide erythromycin but susceptible to semi - synthetic erythromycin telithromycin (bulkley et al . However for most bacteria acquisition of new genes coding for; (a) rrna methylases which generally results in resistance to macrolides, lincosamides, and streptogramin b antibiotics (mlsb); (b) two types of efflux pumps which pump the drug(s) out of the cell; or (c) one of four types of inactivating enzymes which chemically modify the antibiotic preventing it from binding to the ribosome that is the most important way they become mls resistant (table 1) data taken from following http://faculty.washington.edu/marilynr/ vga(a)lc is a variant of vga(a) but it is worth separating in table 2 because it is the only recognized variant because of it is extended range in conferring resistance to streptogramin a and lincomycin (novotna and janata, 2006) and variants confer resistance to lincosamides, streptogramin a, and pleuromutilins (kadlec and schwarz, 2009); has been shown to confer resistance to lincosamides, streptogramin a, and pleuromutilins (kadlec and schwarz, 2009); confers resistance to lincosamides, oxazolidinones, streptogramin a, phenicols, and pleuromutilins (phlospsa) but not macrolides . Tetracyclines are one of the oldest classes of antibiotics and the first broad spectrum class of antibiotics . Bacteria may become resistant to tetracyclines by mutation, while the majority of bacteria become tetracycline resistant because they acquire new genes which; (a) pump tetracycline out the cell (efflux); (b) protect the ribosome from the action of tetracyclines; or (c) enzymatically deactivate tetracyclines (table 2). Tetracyclines interact with the bacterial ribosomes by reversibly attaching to the ribosome which blocks protein synthesis . Tet (u) has been sequenced but does not appear to be related to either efflux or ribosomal protection proteins; tetb(p) is not found alone and teta(p) and tetb(p) are counted as one operon; tet(x) and tet(37) are unrelated but both are nadp - requiring oxidoreductases: tet(34) similar to the xanthine guanine phosphoribosyl transferase genes of v. cholerae;not related to other tet efflux genes; tet(37), tet(43). Different classes of mls and tetracycline (tet) resistance genes are defined as having <79% amino acid identity with all previously characterized genes . Two genes are of the same class if they share> 80% amino acid sequence identity over the entire length of the protein . For a tet or a mls resistance gene to be assigned a new gene designation, it has to be completely sequenced and its amino acid composition compared with all currently known classes . Mcmurry, tufts university) are assigned a new resistance gene name which should be used for submission to genbank and for publication . Demonstration that the gene confers antibiotic resistance is required and data mining genomes looking for dna and amino acid similarities to known genes is not adequate to be recognized as a new gene . A website with the mls and tetracycline resistance genes provides updated information taken from published papers and abstracts presented at scientific meetings . The majority of both the mls and tet genes are associated with mobile elements and thus have the capacity to spread through the bacterial ecosystem (roberts, 1997). Today most characterization of antibiotic resistance genes carried by specific bacteria is done by pcr assays . However only rarely are the pcr products verified by either sequencing or hybridization with a known labeled probe . As a result there is potential for false positive and false negative results to be reported in the literature . Therefore if unusual results occur, such as finding the gram - negative tet(b) gene in a gram - positive bacterium, this should be further verified by sequencing of the pcr product and further testing . In the current review only genes that have been given approved mls or tet genes will be include in the discussion though other genes which confer mls or tetracycline can be found in the literature and genbank . There are 70 different mls genes of which 33 are rrna methylase genes (erm; table 1). These genes code for enzymes which add one or two methyl groups to a single adenine (a2058 in escherichia coli) in 23s rrna (roberts, 2005). This modification prevents the mls antibiotics from attaching to the ribosome and protein synthesis is not impeded . The erm genes confer resistance to mlsb, while the genetically distinct cfr gene confers resistance to lincosamides, oxazolidinones, streptogramin a, phenicols, and pleuromutilins (phlospsa) but not macrolides (table 1). Sixteen (48%) of the erm genes [erm(h), erm(i), erm(n), erm(o), erm(r), erm(s), erm(w), erm(z), erm(30), erm(31), erm(32), erm(34), erm(36), erm(39), erm(40), and erm(41)] are unique to environmental bacteria, which for this review are defined as those species and genera which are primarily found outside of humans and animals . The erm(37) gene is found in mycobacterium tuberculosis and not considered unique to environmental bacteria, while the erm(39), erm(40), and erm(41) genes are found in one or more environmental mycobacterium species (nash et al ., 2006). There are 17 efflux genes that code for proteins that pump one or more of the mls antibiotics out of the cell and are either atp - transporters or major facilitator transporters . Recently variants of the vga(a) gene and the vga(c) genes have been shown to confer resistance not only to lincosamides but to streptogramin a and pleuromutilins (gentry et al ., 2008; kadlec and schwarz, 2009). Six (37.5%) of the efflux genes [car(a), lmr(a), ole(b), ole(c), srm(b), tlr(c)] are unique to environmental bacteria and are each found in streptomyces spp . There are 19 genes which code for inactivating enzymes including 2 esterases, 2 lyases, 11 transferases, and 4 phosphorylases (table 1). These genes code for proteins which modify the antibiotics by hydrolyzing the lactone ring [ere(a), ere(b)], adenylylating [lnu(a), lnu(b), lnu(f)], acetylating [vat genes], or phosphorylating the antibiotic which disrupts the structure and inactivates the antibiotic . Forty - three gram - negative, 22 gram - positive genera plus mycobacterium, streptomyces, and ureaplasma spp . Have been shown to carry one or more of the mls resistance gene . This list includes innate genes which are limited to a single genus or in some case, species . For example there are 5 different innate rrna methylases macrolide resistance genes [erm(37), erm(38), erm(39), erm(40), erm(41)] each found in different intrinsically macrolide resistant mycobacterium spp ., and 10 different rrna methylases macrolide and 6 different innate efflux resistance genes in antibiotic producing streptomyces spp . These genes have traditionally been included because they confer mls resistance and are related to resistance genes found in non - antibiotic producing bacteria and are important for this review because they are unique to environmental bacteria (table 3). Among the rrna methylases classes, the most commonly carried is erm(b) [24 genera], followed by erm(f) [24 genera], erm(c) [24 genera], erm(a) [8 genera], erm(g) and erm(e) [7 genera each], erm(q) [6 genera], erm(t) and erm(x) [4 genera each], erm(v) [3 genera], erm(d), erm(r), cfr [2 genera each]. The erm(a)erm(g), erm(q) and erm(v) genes are found in both gram - positive, ureaplasma spp ., and gram - negative genera as well as aerobic and anaerobic species, the erm(35) gene is found in gram - negative genera and the remaining 26 mls genes are found in gram - positive, anaerobic bacteriodes, and/or streptomyces spp . The most prevalent efflux gene is mef(a) [27 genera] followed by msr(d) [22 genera] and are found in gram - positive, ureaplasma spp . These two genes are normally linked on the same mobile element suggesting that they have the same host range, though msr(d) is often not included in surveillance studies . The msr(a) gene has been identified in eight genera including gram - positive, ureaplasma spp ., and gram - negative genera . The recently described mef(b) gene is found in escherichia spp ., while the vga(b) gene is in two genera and the remaining 13 mls resistance genes (76%) are found in gram - positive genera or streptomyces spp . Distributions of the 19 inactivating enzymes are as follows; ere(a) [11 genera] and ere(b) [8 genera] found in both gram - positive and gram - negative genera; vgb(a) [2 genera], vgb(b) [1 genus] both gram - positive genera;lnu(a) [3 genera], lnu(b) [4 genera],], lnu(d) [1 genus] all gram - positive genera; lnu(c) [1 gram - positive, 1 gram - negative genus] lnu(f) [2 gram - negative genera]; vat(a), vat(c), vat(d) [1 gram - positive genus each], vat(b), vat(e) [2 gram - positive genera each]; vat(f) [1 gram - negative genus]; mph(a) [11 genera], mph(b) [4 genera], mph(d) [6 genera] all gram - negative genera and mph(c) [1 gram - positive, 1 gram - negative genus] (roberts, 2004). There are 43 different known tet / otr genes which confer resistance to tetracyclines (table 2) of which 17 (39%) are unique to environmental bacteria (table 4). The majority of the tet / otr genes are associated with mobile elements which allow for gene exchange and spread throughout different ecosystems (roberts, 1997). Twenty - seven of the genes encode for energy - dependent efflux proteins, 12 code for ribosomal protection proteins, 3 code for inactivating enzymes and one gene is of unknown mechanism of resistance (table 2). The efflux proteins are able to reduce intracellular concentrations of tetracycline by exchanging a proton for the tetracycline - cation complex against a concentration gradient and require intact cells to function (palm et al ., 2008). Twenty - six of 27 genetically distinct efflux genes export and confer resistance to tetracycline and doxycycline but not minocycline or tigecycline, while the gram - negative tet(b) gene exports and confers resistance to tetracycline, doxycycline, and minocycline . Twelve (41%) of the efflux genes [teta(p), tet(v), tet(z), tet(30), tet(33), tet(35), tet(39), tet(41), tet(42), otr(b), otr(c), tcr] are unique to environmental bacteria (table 4). Seventy - six gram - negative and 47 gram - positive genera have been identified that carry tetracycline efflux resistance genes . Many of these genes and genera are found in environmental bacteria but can also be found in bacteria associated with man and/or animals . The tet(b) gene is the most common efflux gene among gram - negative bacteria and has been identified in 31 genera, while the tet(a) gene [20 genera], tet(c) gene [10 genera], tet(d) gene [16 genera], tet(e) gene in [10 genera], tet(g) gene [13 genera], the tet(h) gene [8 genera], and the tet(35) [2 genera]. The tet(k) gene is found in 12 gram - positive genera and the otr(b) gene is found in mycobacterium and streptomyces spp . The tet(l) gene is found in 14 gram - negative and 19 gram - positive genera, the tet(39) gene is found in 4 gram - negative and 3 gram - positive genera, while the tet(42) gene is found in 4 gram - positive and 2 gram - negative genera (table 2). Twelve (44%) of the efflux genes including the tet(j), teta(p) tet(v), tet(y), tet(z), tet(30), tet(31), otr(c), tcr, tet(33), tet(40), and tet(41) are found in a single genera . The tet(43) gene was isolated from a metagenomic dna library and has yet to be identified in a specific bacterial species or genus . Suis, an obligate intracellular species, contains a13-kb fragment of foreign dna which includes a truncated repressor gene, tetr(c), and a functional tet(c) gene . The 13-kb region is closely related to the pras3.2 plasmid from the environmental water bacterium aeromonas salmonicida (l'abbe - lund and sorum, 2002). The hypothesis is that c. suis could have acquired the tet(c) gene when other bacteria carrying the 13-kb region with the tet(c) gene co - infected the same eukaryotic cell; this is the first example of horizontal transfer of an antibiotic resistance gene into this group of bacteria . Trachomatis containing the 13-kb tet(c) region inserted within the ribosomal cluster of the chromosome and is the first example of horizontal transfer between obligate intracellular bacteria . It is likely that other antibiotic resistance genes may be introduced and become established in other obligate intracellular bacteria . There are 12 ribosomal protection tc genes of which three [25%; tetb(p), otr(a), tet] are unique to environmental bacteria (table 4). The ribosomal protection genes code for cytoplasmic proteins of 72.5 kda which protect the ribosomes from the action of tetracyclines in vitro and in vivo and confer resistance to tetracycline, doxycycline, and minocycline but not tigecycline (roberts, 2005). These proteins have sequence similarity to the ribosomal elongation factors, ef - g and ef - tu and are grouped in the translation factor superfamily of gtpases (leipe et al ., 2002). The ribosomal protection proteins are hypothesized to interact with the h34 ribosomal protein causing allosteric disruption of the primary tetracycline binding site(s) which releases the bound tetracycline . The tet(m) gene has been identified in clinical enterococcus spp . Isolated between 1954 and 1955, approximately the same time as the first gram - negative tet efflux genes were identified (watanabe, 1963; atkinson et al ., 1997). Thus both the tet efflux and tet ribosomal protection genes have been in the bacterial population for a considerable time . Forty - nine gram - negative genera have been characterized which carry one or more ribosomal protection tet gene(s). Thirty - eight gram - positive genera carry ribosomal protection genes of which 15 carry a single gene and 23 carry one or more ribosomal protection and/or both ribosomal protection and efflux tet genes . The tet(m) gene is the most commonly found tc gene in bacteria, identified in 36 gram - negative genera, and 31 gram - positive genera, mycoplasma, mycobacterium, streptomyces, and ureaplasma spp . The tet(w) gene has been identified in 25 genera [15 gram - negative, 10 gram - positive], the tet(q) gene has been identified in 22 genera [12 gram - negative, 10 gram - positive], the tet(o) gene has been found in 20 genera [8 gram - negative, 12 gram - positive], the tet(s) gene has been identified in 7 genera [3 gram - negative, 4 gram - positive], while the otr(a) gene has been found in 3 gram - positive genera, the tet(t), tet(32), and tet(44) genes have been found in 2 gram - positive genera each, the tet gene has been identified in streptomyces, and the tetb(p) found in one gram - positive genera . The tetb(p) gene is unique among the ribosomal protection genes because all isolates that carry this gene also carry a teta(p) gene encoding an inducible efflux protein . The two genes are transcribed from a single promoter which is located 529 bp upstream of the teta(p) start codon; the tetb(p) gene overlaps the teta(p) gene by 17 nucleotides (johanesen et al ., 2001). The teta(p) gene alone confers tc to the bacterial host, while it is not clear if the tetb(p) gene alone would confer clinically relevant levels of tetracycline resistance . A few of the ribosomal protection genes have been found to be part of mosaic genes consisting of regions from two or three different known tet genes (stanton et al ., 2005; patterson et al . Identification of mosaic genes requires sequencing of the complete gene which is rarely done in current studies . Hence misnaming the gene present is possible as originally occurred with the tet(32) gene (patterson et al ., 2007). One such gene is a hybrid between the tet(o) at one end and tet(w) at the other end of the gene labeled tet(o / w). Another hybrid between the tet(o) and tet(w) genes has been identified which has a partial tet(o) sequence between the ends of the tet(w) gene [tet(w / o / w)]. Mosaic tc genes can only be defined by sequencing the complete gene and at this time, the number of different genera known to have them is very limited (bifidobacteria, lactobacillus, megasphaera). In addition, studies have found mosaic tet genes from metagenomic samples taken from human and animal feces and human saliva samples (patterson et al . The first mosaic genes sequenced were from megasphaera elsdenii and a new designation was suggested for hybrid genes which code for proteins made of> 50 amino acid residues in a single stretch derived from different genes (levy et al . Mosaic genes currently identified include tet(o / w), tet(o / w / o), tet(w/32/o), tet(o/32/o), tet(o / w/32/o), tet(o / w/32/w / o), tet(o / w/32/o / w / o) which include genes with fewer then 50 amino acid residues suggesting that a modification of the current recommendation for mosaic genes may need to be considered (stanton et al ., 2005; patterson et al ., 2007; van hoek et al ., 2008). The tet(u) gene produces a small protein (105 amino acids) which confers low level tetracycline resistance (chopra and roberts, 2001). The tetu protein has 21% similarity over its length to the tetm protein, but it does not include the consensus gtp - binding sequences, which are thought to be important for tetracycline resistance in these proteins . The tet(u) gene has been identified in only one gram - positive genus . The tet(x) gene encodes for a flavin nadp - dependent monooxygenase that inactivates by region selectively adding a hydroxyl group to the c-11a position of the antibiotic . This action requires oxygen and confers resistance to tetracycline, doxycycline, minocycline, and tigecycline and is found in two genera (yang et al . The tet(37) gene has only been cloned from the oral metagenome and no bacterial isolate has been identified that carrying this gene . The tet(34) gene has been found in three gram - negative genera [pseudomonas, serratia, and vibrio] and is unique to environmental bacteria (table 4; nonaka and suzuki, 2002). Among the culturable bacteria, some genera are found only in the environment, others are found in the environment and animals and/or man but the distinction between environmental and clinical bacteria has been blurred over the years as more classically environmental bacteria are found as the source of disease in immunocompromised patients . Complication the situation is the fact that some species within a genus are strictly environmental while other species within the same genus are associated with animals and/or man such as m. tuberculosis thus making it difficult to distinguish environmental vs clinical genera . In the past it has been assumed that most environmental bacteria were not well adapted to live in man or animals . However this perception is changing as medicine progresses allowing severely immunocompromised patients to live in the community, others people have productive lives with foreign objects permanently implanted, these and other technological changes in society have provided new opportunities for environmental bacteria to cause disease (trujillo and goodfellow, 2003; rowlinson et al ., 2006). Human activity has resulted in only rare remote ecosystems where mankind and civilization's waste are absent . Thus, today it is more difficult to distinguish environmental from non - environmental bacteria . As a result there is constant mixing of environmental and non - environmental bacteria which provides multiple opportunities for horizontal genetic exchange of antibiotic resistance genes . In addition antibiotic resistance genes associated with mobile elements can be transferred back and forth between environmental and non - environmental bacteria thus reducing the number of resistance genes which are unique to the environment . Both antibiotics and antibiotic resistant bacteria are moved by water and wind, as well as, by transportation of goods and people around the world . One result of this has been the spread of specific strains around the world such as the recently identified clostridium difficile nap1/027/bi (gould and limbago, 2010). Originally c. difficile was thought to be a nosocomial disease associated with the hospital setting, but today c. difficile is considered a foodborne and community pathogen . Were thought to be primarily environmental in origin where it is well adapted to grow at different temperatures and ph, using a variety of carbon and energy sources to persist in both moist and dry places for extended time periods . However, today a. baumannii is an opportunistic pathogen which is of major concern to the because it has become multidrug resistant due to the inheritance of a mosaic genomic 86 kb chromosomal antibiotic resistance island which carries integrons and non - integron regions encoding both antibiotic and heavy metal resistance including two copies of the tet(a) gene (abbo et al ., 2005; fournier et al ., 2006). A more recent study from adams et al . (2010) has demonstrated variability in the composition of the resistance island between various a. baumannii strains suggesting that the resistance in this bacterium is evolving . Antibiotics are used for both human and agricultural activities for prevention and treatment of infections, as well as food additives and growth promoters in food production in most parts of the world and also used in animal husbandry, aquaculture, fruit crops, and bee - keeping . All of these activities contaminate the environment and provide selective pressure on the resident environmental bacteria to become antibiotic resistant and increases transfer of specific antibiotic resistance genes including tet genes (facinelli et al ., 1993). Antibiotic residues are associated with domestic animal manure which may be transferred to the immediate environment when it is applied to fields or stored in ponds . Antibiotics are sprayed onto crops which contaminate the surrounding soil, sediment, and ground water as well as small wild mammals in the area (kozak et al . Antibiotics may be impregnated in food given to farm animals and fish and uneaten food contaminates the surrounding environment . Antibiotics from human therapeutic use, especially from hospital effluents, are a continual source of pollution and are considered part of the emerging contaminants in municipal waste with concentrations of tetracycline varying from ng / l to g / l (verlicchi et al ., 2010). At these levels antibiotics may select for antibiotic resistant environmental bacteria which may persist for extended time periods and become reservoirs of antibiotic resistance genes . The mobile elements associated with mls and tet antibiotic resistance genes are often linked to genes which confer resistance to other classes of antibiotic, heavy metal, and detergents (baker - austin et al ., 2006; soge et al ., heavy metals are found naturally in the environment but copper is found in biocides used in agricultural settings, while mercury and silver can be found in antiseptics . Various studies have found a correlation between exposure to heavy metals and co - selection of antibiotic resistance bacteria (baker - austin et al ., 2006; stepanauskas et al ., 2006; berg et al ., antibiotic resistant bacteria from human activity may contaminate the environment either directly, such as occurs when manure is applied to enrich agricultural fields or indirectly due to sewage contamination . Tc bacillus cereus strains carrying the tet(m) gene, on a functional tn916 element, were found in animal manure and in the fields where the manure was spread . This suggests that the presence of the tet(m) carrying b. cereus in the fields was a direct result of manure application to the soil . Whether the tet(m) carrying b. cereus would act as a donor and transfer the tet(m) gene to related b. anthracis, and/or b. thuringiensis is unknown, however toxin encoding plasmids are shared between the three species (agerso et al ., 2002). How human wastes may increase antibiotic resistant bacteria in wild animals was illustrated by a 1980s study which examined three groups of wild baboons in kenya . Three groups of baboons were examined and the two groups which lived in their natural habitat, with limited or no human contact, had low levels of antibiotic resistant gram - negative enteric bacteria . The third group of baboons lived close to a tourist lodge and had daily contact with unprocessed human refuse and these animals carried high levels of antibiotic resistant gram - negative enteric bacteria with> 90% tc . This study suggests that contact with human refuse greatly increased the carriage of tc bacteria in wild animals (rolland et al ., 1985). Unfortunately the surrounding environmental bacteria were not sampled, but one could speculate that the level of tc bacteria was most likely higher than in the areas where the other baboon groups lived . Human and animal tc bacteria share the majority of the efflux and ribosomal protection genes with environmental bacteria . Recently studies have shown carriage of tc bacteria from arctic and sub - arctic seals (glad et al ., 2010); wild boars (poeta et al ., 2009); and wild rabbits (silva et al ., tetracyclines have been extensively used in aquaculture and tc bacteria including fish pathogens and environmental bacteria associated with fin fish aquaculture have been characterized (depaola and roberts, 1995; furushita et al ., 2003; akinobowale et al ., 2007; jacobs and chenia, 2007; tc bacteria can be found in fish feed, the sediment under the fish pens, as well as the water entering and leaving fresh water ponds (kerry et al ., 1995; some of the greatest diversity in bacterial tc genes has been identified in the aquaculture environment . In one of our studies, we found that 40% of the tc bacteria isolated from chilean salmon fish farms carried previously unidentified tc genes suggesting tet resistance gene diversity present in this ecosystem, higher than routinely found in collections from man or food animals (miranda et al ., 2003). We also identified new genera carrying previously characterized tet genes however they were not readily transferred under laboratory conditions raising the question on how some of the genes were being transferred to bacteria across the world and from very different environments (miranda et al ., 2003). The diversity of type and number of tc bacteria found in aquaculture suggests that this environment favors rapid evolution of tc bacteria which then can be transferred to other environments and ecosystems . More recently, a diverse group of tc bacteria, carrying a range of tet genes, isolated from surface water receiving effluent from an oxytetracycline production plant has been reported (li et al ., many of the tet gene combinations reported were novel however detection was without verification of the pcr products . Nevertheless this study suggests that waste treatment from antibiotic production plants is a potential hot spot for spread of known and uncharacterized antibiotic resistance genes into the environment . The environments are so physically diverse that many associated bacteria are distinct from those normally found in animals and/or man . Most environmental bacteria have not been characterized and it is estimated that <1% of the total number of bacterial species present in different environments have been identified (kummerer, 2004). Therefore antibiotic resistance genes associated with unculturable bacteria may only be identified by molecular methods such as those used to isolate the tet(43) gene, which along with other antibiotic resistance genes was isolated from metagenomic analysis of apple orchard soil from an which received repeated treatment with streptomycin (donato et al . One can hypothesize that using this approach on other environmental samples will identify additional novel antibiotic resistance genes in the future however the bacteria carrying these genes may never be identified . Macrolides, lincosamides, and streptogramins resistance genes are found in waste lagoons and groundwater wells at swine farms with a history of tylosin use and erm(a), erm(b), erm(c), and erm(f) genes were detected at high frequency with only a weak correlation with the distribution patterns of tet genes . Many of the rna methylase genes were associated with bacteria found in animal waste while tylosin resistance genes were rare, this suggests limited levels lack of tylosin - producing streptomyces genes in either the lagoons or wells and may indicate that lagoon leakage as sources of groundwater contamination (koike et al . This study suggests that there could be alternative sources of mls resistance genes and/or background antibiotic resistant environmental bacteria contributing to the levels of mls genes, since the most common erm genes, erm(b), and erm(c), identified in the study are also found in environmental bacteria . Antibiotic resistant bacteria are widely distributed throughout the world and have been isolated from deep subsurface trenches, in waste water, surface and ground water, sediments, and soils . They are present also in places which are relatively untouched by human civilization such as mammals from antarctica and the arctic (kummerer, 2004; rahman et al ., 2008; donato et al ., 2010; glad et al twenty - two (31%) of the 70 mls and 17 (40%) of the 43 tet genes are unique to environmental bacteria (tables 2 and 4). Whether this represents a true separation between mls and tet genes that are unique to environmental bacteria or because the genes are innate to environmental bacteria or that the resistance genes have not been used in surveillance studies of animal / human bacteria is not known . It is possible that over time these unique tet genes will move into bacteria associated with animals and/or man as studies with the tet(x) gene suggests (ghosh et al ., 2009). The antibiotic resistance gene complement of environmental bacterial populations should be studied in greater detail as illustrated by the d'costa et al . This work quantified the density and diversity of antibiotic resistant soil streptomycetes and even identified genes with novel mechanisms of antibiotic resistance to the recently approved telithromycin and daptomycin . (2007) suggest that the number of antibiotic resistance genes in environmental bacteria has been underestimated and given that they found a new mechanisms of drug resistance more studies with environmental bacteria are essential . The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
A minor change in the thyroid hormone concentration has been reported with changes in cognitive and affective functions . Hashimoto's encephalopathy was first reported in 1966 and was associated with hashimoto's thyroiditis . Although it is a controversial disorder, hashimoto's encephalopathy is considered an autoimmune disease because of its association with immunological disorders, such as myasthenia gravis, primary biliary cirrhosis, and pernicious anemia . Hashimoto's encephalopathy, an unusual neurological disorder with female preponderance, has its typical onset in the fifth decade of unclear etiology, pathogenesis, and management . Hashimoto's encephalopathy presents with neurological manifestations such as generalized / focal tonic - clonic seizures, status epileptics, myoclonus, stroke, hyperreflexia, and tremors . Neuropsychiatric manifestations such as psychosis, visual hallucination, paranoid delusion, mania, depression, dementia, and catatonia have been reported in 25 - 36% patients . These manifestations respond well to steroids rather than the conventional treatment, highlighting an autoimmune origin of the disorder . Although hashimoto's encephalopathy is rare among the pediatric group, it is a diagnostic challenge in child psychiatry and neurology . Managing the symptoms of this condition is often difficult because of the unpredictable nature of hashimoto's thyroiditis . In a recent review, only 50 cases aged <18 years were identified among 300 pubmed articles until july 2013 . We report the first case of atypical presentation of hashimoto's encephalopathy in an adolescent who recovered successfully with nonsteroid agents and levothyroxine . A 16-year - old girl presented with acute onset of sadness of mood, decreased interest to work and pleasurable activities, irritability, aggressiveness and abusiveness, impulsivity, reduced appetite, easy fatigability, and sleep disturbance, and was unable to concentrate on work for more than a day . On mental status examination, she was agitated, irritable, hostile, impulsive, emotionally labile, and unable to sustain attention . She was premorbidly well - adjusted with an unremarkable developmental and familial history of mental and thyroid illness . Five months back, she noticed a small swelling on her thyroid region along with menstrual irregularities called oligomenorrhea and menorrhagia . Her thyroid function tests were suggesting hypothyroidism, which was treated with homeopathic medicine [table 1]. Her brain magnetic resonance imaging (mri) findings demonstrated infarcts in the bilateral gangliocapsular region and left frontal periventricular deep white matter lesion [figure 1]. Her ultrasonography (usg) of the thyroid revealed a well - defined cystic lesion measuring 3.8 mm 3.2 mm in the right thyroid lobe, followed by fine needle aspiration cytology of swelling, indicating lymphocytic thyroiditis . Anti - thyroid peroxidase antibody levels were elevated to 289 iu / ml . The erythrocyte sedimentation rate (esr) increased to 50 mm / h with a slight increase in the leucocyte count . Her liver function test, renal function test, electrocardiogram, chest x - ray, usg of the abdomen and pelvis, and electroencephalogram were normal . Laboratory findings in the index case axial magnetic resonance images of brain demonstrating infarcts in the bilateral gangliocapsular region and left frontal periventricular deep white matter . (a) t1-weighted magnetic resonance imaging . (b) t2-weighted magnetic resonance imaging she was initially administered fluoxetine 20 mg / day, which was increased gradually to 40 mg / day . However, she showed no improvement in depressive symptoms and impulsivity . On the basis of laboratory findings and responses to drugs, we considered treatment - resistant depression secondary to hashimoto's encephalopathy . The patient was administered levothyroxine for the thyroid state and aspirin as an anti - inflammatory agent . Adding levothyroxine (50 g / day) with aspirin (150 mg / day) for a week resolved her symptoms completely . Her elevated esr and antimicrosomal antibodies returned to normal, and she remained in the euthyroid state with a normal sensorium and behavior for approximately 3 years . Hashimoto's encephalopathy is a rare neurological disorder that occurs primarily in the fifth decade with a male to female ratio of 1:4 . It is mainly present in two subtypes: a sudden vasculitis type (up to 25% cases) and diffuse progressive type (up to 75% patients) characterized by cognitive decline, dementia, confusion, and psychiatric manifestation . In the index case, the patient's clinical course was more consistent with the sudden vasculitis type because of the abrupt onset of depressive symptoms without a focal neurological deficit and mri findings . Most common presentations reported include a neurological presentation, the involvement of the pyramidal tract, seizure, and tremor in the descending order . The neuropsychiatric presentation that includes schizophrenia - like psychotic disorder, mania and depression was reported with lower incidence . Pathogenesis of neuropsychiatric manifestation in hashimoto's encephalopathy remains unknown, and no correlation exists between the concentration of thyroid antibodies and severity of symptoms . The formation of autoantibodies against the n - terminal of -enolase (nae) may cause infarcts in the bilateral gangliocapsular region and left frontal periventricular deep white matter lesion in our case . The -enolase antigen is found in both endothelial cells of the blood vessel and thyroid gland, indicating the possibility of an underlying autoimmune vasculitis mechanism . Therefore, autoantibodies against the nae may be a potential biomarker of hashimoto's encephalopathy, and this possibility is being supported by most recently published studies in japan . Hashimoto's thyroiditis is characterized by bouts of hypothyroid, euthyroid, and hyperthyroid states . Thus, one should highly suspect a possibility of hashimoto's encephalopathy in a nonresponsive patient and a patient showing an initial response followed by unresponsiveness to conventional antidepressants . In most recently published reviews, the clinical response was observed in 98% patients treated with steroids, 92% with steroids and levothyroxine, and 67% with levothyroxine . However, only a few have responded well with mood stabilizers, antidepressants, and antipsychotics . The role of steroids in the acute management of ischemic the recently published cochrane review recommends that steroids, considered magic drugs in neurology in the past, play no active role in the management of acute ischemic stroke . Moreover, they increase the risk of gastrointestinal bleed, infection, and hyperglycemia . The long - term use of steroids, which is often required in hashimoto's encephalopathy, predisposes to several side effects including hypertension, osteoporosis, cataract, cushing syndrome, and growth retardation . The index case appears unique in this aspect because the patient responded well when levothyroxine and nonsteroidal anti - inflammatory drug (nsaid) (aspirin) along with fluoxetine was used to treat her depressive symptoms . Although using nsaids has been attempted in the management of chronic thyroiditis, to the best of our knowledge, response is not documented for any other case report or study with the neuropsychiatric presentation . In addition to the anti - inflammatory properties of aspirin, it is an antiplatelet drug, which may be helpful in preventing further infarcts and procrastinating the relapsing and remitting nature of the illness . Hashimoto's encephalopathy, a rare disorder, is unrelated to the thyroid status of a patient . Most patients present with variable neuropsychiatric manifestations and course, indicating pathogenesis through both autoimmune and vasculitis mechanisms . They may have treatment - resistant psychiatric and neurological illnesses and respond dramatically to steroids with serious and potential side effects; however, aspirin or other nsaids along with levothyroxine, mood stabilizers, and antipsychotics may be considered for treatment . A psychiatrist should be aware of this often unrecognized entity to ensure accurate diagnosis and timely treatment, particularly among the pediatric group.
Despite advances in total hip arthroplasty (tha), severe developmental dysplasia of the hip continues to pose a challenge to the orthopedic community.123 there are many anatomic deformities in a dysplastic hip, including increased proximal femoral anteversion, deficient acetabular bone, a small and narrow femoral canal, as well as soft tissue contracture.45 it is generally recommended that the acetabular component should be placed in the true acetabulum for better biomechanics.3567 however, several studies have been published reporting that a leg lengthening of over 4 cm can result in sciatic nerve palsy.389 fortunately, evidence has shown that the risk of postoperative nerve palsy can be substantially reduced by femoral shortening.1011 a variety of proximal femoral osteotomies have been described for the treatment of severe developmental dysplasia of the hip.4510121314 multiple studies have shown relatively good clinical results when these techniques were used as part of the treatment protocol.581215 however, there are some problems and potential pitfalls associated with proximal femoral shortening such as nonunion, difficult surgical technique and is time consuming.511 consequently, the optimal osteotomy strategy for treating severely dysplastic hip remains controversial . To overcome the above shortcomings at our institute, we have adopted cementless arthroplasty with a distal femoral shortening osteotomy especially, midterm and long term clinical results of this technique have not been reported . The aim of this study was to describe the surgical technique, outline the advantages of the technique when compared with proximal femoral shortening osteotomy, and to report our mid to long term clinical results . 12 patients with crowe type iv dysplasia underwent surgery at our institution in which cementless arthroplasty with a distal femoral shortening osteotomy is performed between january 2004 and december 2010 . Mean age at the time of surgery was 47 years (range 30 - 75 years). All hips were managed with a proximally hydroxyapatite coated femoral component (depuy, warsaw, indiana). Porous coated acetabular components with dome screws were used in all hips (depuy, warsaw, indiana). The main reason for tha in all patients was pain around the hip and abnormal gait . Patients were placed in the supine position . An incision centered over the greater trochanter was made . After resection of the femoral head, all fibrous scar tissue and osteophytes covering the true acetabulum were excised to facilitate proper placement of the acetabular component . Dissection of the inferior part of the elongated capsule permitted exposure of the true acetabulum . The adductors and parts of the iliotibial tract were split, if necessary, the iliopsoas was released . In addition frequent checks of the depth of reaming was made to ensure that the medial wall was not violated . After the acetabular component had been inserted in the true acetabulum, the process of femoral intramedullary reaming was started if the proximal femoral cortex was thin, a cerclage wire was placed around the proximal femur to prevent an inadvertent fracture . Next, an appropriate size femoral component was inserted . The precise degree of anteversion determined by the broach was reproduced . If it was difficult to reduce, it was checked for soft tissue or neurovascular tension . The lateral aspect of the femur was exposed through a standard straight incision, starting distally to the epicondyle and extending the incision about 10 cm proximally . A retractor was placed under the posterior aspect of the femoral metaphysis to protect the vessels and to fully expose the femur so as to place the plate in the desired position . It was noteworthy that the osteotomy performed parallel to the landmark, the exact site of the osteotomy varied on the basis of the patient's anatomy, but it was generally four finger breadth above the lateral epicondyle . The corresponding length of bone was excised from the distal femur to allow reduction of the hip [figure 1]. While performing the osteotomy, it was important to regularly check progress to ensure the direction of the cut . The bone block of resected femur was longitudinally divided into two pieces, of which one was used as an osteotomy site graft [figure 2]. Later, the plate was positioned on the lateral femoral cortex and stabilized with screw under radiographic control . Finally, with the hip reduced, range of motion and stability was confirmed . Intraoperative photograph showing traction being applied to the extremity and the corresponding length of bone was excised from the distal femur fluoroscopic views taken intraoperatively showing placement of medial bone block illustration demonstrating the process of cementless arthroplasty with a distal femoral shortening osteotomy postoperatively, prophylactic antibiotics (1.5 g of cefazoline) were administered intravenously 3 times a day for the first 24 h, low - molecular - weight heparin (enoxaparin 40 mg / day) was given prophylactically for 5 days . Immediately after the surgery, passive motion exercises were begun to keep the joint mobile until active motion of the joint as possible . The patients were mobilized with partial weight bearing on two crutches for 8 weeks postoperative until radiological signs of healing were seen . Clinical and radiographic followup examinations were evaluated preoperatively, at 6 weeks, 3 months, 6 months, and 1 year postoperatively; and annually thereafter until the latest followup . The harris hip score was used to determine the functional level and evaluate pain.16 trendelenburg sign was used to measure abduction strength . Healing of the osteotomy site was assessed, radiological union was considered to have occurred when osteotomy line was no longer visible on both the ap and the lateral views . The radiographs were also examined for acetabular and the femoral components . On the acetabular side, radiolucent lines around the implant and the stability of the acetabular components were assessed according to the criteria of delee and charnley.17 on the femoral side, the stability of the femoral component was assessed by the criteria of engh et al.18 patients were placed in the supine position . An incision centered over the greater trochanter was made . After resection of the femoral head, all fibrous scar tissue and osteophytes covering the true acetabulum were excised to facilitate proper placement of the acetabular component . Dissection of the inferior part of the elongated capsule permitted exposure of the true acetabulum . The adductors and parts of the iliotibial tract were split, if necessary, the iliopsoas was released . In addition, the attachments of the rectus femoris could be transected in some cases . Frequent checks of the depth of reaming was made to ensure that the medial wall was not violated . After the acetabular component had been inserted in the true acetabulum, the process of femoral intramedullary reaming was started if the proximal femoral cortex was thin, a cerclage wire was placed around the proximal femur to prevent an inadvertent fracture . Next, an appropriate size femoral component was inserted . The precise degree of anteversion determined by the broach was reproduced . If it was difficult to reduce, it was checked for soft tissue or neurovascular tension . The lateral aspect of the femur was exposed through a standard straight incision, starting distally to the epicondyle and extending the incision about 10 cm proximally . A retractor was placed under the posterior aspect of the femoral metaphysis to protect the vessels and to fully expose the femur so as to place the plate in the desired position . It was noteworthy that the osteotomy performed parallel to the landmark, the exact site of the osteotomy varied on the basis of the patient's anatomy, but it was generally four finger breadth above the lateral epicondyle . The corresponding length of bone was excised from the distal femur to allow reduction of the hip [figure 1]. While performing the osteotomy, it was important to regularly check progress to ensure the direction of the cut . The bone block of resected femur was longitudinally divided into two pieces, of which one was used as an osteotomy site graft [figure 2]. Later, the plate was positioned on the lateral femoral cortex and stabilized with screw under radiographic control . Finally, with the hip reduced, range of motion and stability was confirmed . Intraoperative photograph showing traction being applied to the extremity and the corresponding length of bone was excised from the distal femur fluoroscopic views taken intraoperatively showing placement of medial bone block illustration demonstrating the process of cementless arthroplasty with a distal femoral shortening osteotomy postoperatively, prophylactic antibiotics (1.5 g of cefazoline) were administered intravenously 3 times a day for the first 24 h, low - molecular - weight heparin (enoxaparin 40 mg / day) was given prophylactically for 5 days . Immediately after the surgery, passive motion exercises were begun to keep the joint mobile until active motion of the joint as possible . The patients were mobilized with partial weight bearing on two crutches for 8 weeks postoperative until radiological signs of healing were seen . Clinical and radiographic followup examinations were evaluated preoperatively, at 6 weeks, 3 months, 6 months, and 1 year postoperatively; and annually thereafter until the latest followup . The harris hip score was used to determine the functional level and evaluate pain.16 trendelenburg sign was used to measure abduction strength . Healing of the osteotomy site was assessed, radiological union was considered to have occurred when osteotomy line was no longer visible on both the ap and the lateral views . The radiographs were also examined for acetabular and the femoral components . On the acetabular side, radiolucent lines around the implant and the stability of the acetabular components were assessed according to the criteria of delee and charnley.17 on the femoral side, the stability of the femoral component was assessed by the criteria of engh et al.18 the average harris hip score improved from 41 (range 28 - 54) preoperatively to 85 (range 79 - 92) at the final followup . The mean preoperative pain component of the harris hip score was 20.2 (range 10 - 40). The mean postoperative pain score was 42.5 (range 18 - 44). At last followup, the average length of bone removed was 30 mm (range 25 - 40 mm). The abduction strength of 7 (58.3%) of the 12 hips was graded as good or slightly decreased . Radiologically, the mean lengthening discrepancy decreased from 38 mm (range 28 - 52 mm) at the time of surgery to 12 mm (range 6 - 20 mm) at the last review . The mean leg lengthening achieved was 32 mm (range 24 - 42 mm). All the femoral components showed radiographic evidence of bone ingrowth at the last followup evaluation . The average time to union at the osteotomy site was 13 weeks (range, 10 - 16 weeks). Intraoperative fracture of the proximal fragment occurred in one patient, which was successfully stabilized by wiring . The transverse osteotomy is relatively technically simple, but nonunion of the osteotomy is the major complication because of inherent instability.28 masonis et al ., in a study of 21 hips treated with subtrochanteric transverse osteotomy, reported that 2 hips required revision surgery because of nonunion . Furthermore, krych et al.8 have reported on 28 patients with crowe type iv developmental dysplasia who underwent a transverse osteotomy . A step - cut or oblique osteotomy may increase the overall contact area between the two fragments . However, accurate reduction is extremely difficult . Unfortunately, this technique is both complex and time consuming.2 hence, there is still controversy concerning the best method of osteotomy in such cases . To address the above problems koulouvaris et al.19 showed a similar technique . In a study of 24 patients with this technique that combines tha with a distal femoral shortening in severely deformed hips compared to the femur shaft shorting, metaphysis has a rich blood supply and can provide better biomechanical stability, enhancing the rate of osteotomy site healing and minimizing the risk of nonunion . Furthermore, we insert the osteotomy gap with bone from the resected bone block, which can provide good mechanical support and increase the bone mass in the osteotomy gap [figure 4]. In this study, the time of the union of the osteotomy site ranged from 10 to 16 weeks and there were no cases of postoperative nonunion . X - ray anteroposterior view of left hip joint in a 36 years old male showing high dislocation of hip (b) anteroposterior and lateral radiographs immediately after surgery showing distal femoral shortening osteotomy and uncemented thr there are several advantages of using a distal femur osteotomy over a proximal femur osteotomy . First, it is relative easier to do particularly the intraoperative rotational adjustments between osteotomy sites, which is difficult to perform in a proximal femoral osteotomy.11 in addition, the distal osteotomy avoids requiring an extensive dissection in the proximal soft tissues, which may increase the risk of muscle weakness and subsequent hip instability.2021 moreover, it preserves the proximal bone stock, whereas proximal femur osteotomy has been established to be associated with bone loss.5 although our is a retrospective case series, we observed satisfactory functional outcomes in crowe type iv developmental hip dysplasia after a mean of 52 months followup . First, it is difficult to correct anteversion of the femoral component in the presence of excessive anteversion deformity, which has been mentioned in literature . However, we only used a femoral component with a straight stem, the appropriate version could be achieved in all hips . In our analysis, if the offset and anteversion are not satisfactory, a modular stem can be selected . Several studies have revealed that the use of the modular stem could provide an appropriate version.1522 we have had no loosening or revisions in these 12 patients with mid to long term followup . Finally, knee stiffness is a potential complication after distal femur osteotomy . As a result, . The limitations of this study are first, it is not a comparative study, so we cannot draw conclusions regarding the outcomes of this osteotomy technique when compared with other osteotomies . Secondly, our sample size is relatively small, which limits the statistical power of our results . However, the indication for this procedure is uncommon and it is difficult to obtain a larger series from a single center . In summary, on the basis of the encouraging outcomes in the current study, we believe that this osteotomy technique is an option in the treatment of severe developmental dysplasia of hip.
A 38-year - old male patient was referred to asan medical center due to severe shock attributable to contained aortic rupture around the aortic root . The patient had been treated with systemic corticosteroids after being diagnosed with behcet s disease 14 years previously . The patient had previously undergone aortic valve surgery three times in another hospital for the management of aortitis and consequent aortic regurgitation associated with underlying behcet s disease . The first two mechanical aortic valve replacement (avr) procedures had been performed 14 years previously, followed by a ross procedure two years after the second operation . When the patient presented to our emergency department, he was in severe shock (systolic blood pressure, 65 mmhg) despite maximal intravenous inotropic support (epinephrine and norepinephrine), and exhibited a drowsy mental state . On enhanced computed tomography, a contained aortic rupture was found around the aortic root and the ascending aorta, abutting the sternum . 1). An emergency operation was planned . A transesophageal echocardiography performed in the operating room showed mild aortic regurgitation (ar) and severely depressed cardiac function with a left ventricular (lv) ejection fraction of 17% despite full inotropic support . Massive hemorrhage during the reopening of the sternum and consequent catastrophic events were anticipated; therefore, deep hypothermic circulatory arrest (dhca) was implemented before opening the sternum, using femoral cardiopulmonary bypass (cpb) with direct trans - apical lv venting through a left - side mini - thoracotomy (fig . Once the nasopharyngeal temperature cooled to 18c, sternal opening was attempted using an oscillating saw . As expected, a massive hemorrhage occurred from the ruptured aorta while the hematoma was being removed after sternal opening, at which point the cpb was stopped . Distal ascending aorta clamping was achieved securely within one minute of dhca, and cpb was restarted . Two discrete rupture sites were found in the aorta: one at the distal anastomosis site of the previous ross procedure and the other at the right coronary button site (fig . 3). After complete adhesiolysis of the mediastinum and the removal of the previously implanted pulmonic autograft, several tiny pseudoaneurysms were identified at the level of the aorto - ventricular junction, and further resection of this area was therefore conducted . Dhca was then reimplemented (15 minutes) in order to conduct hemiarch replacement using a 28-mm hemashield vascular graft (boston scientific, boston, ma, usa), which was followed by the reimplementation of cpb and systemic rewarming . During this period, complete root replacement was carried out, using a 27-mm composite mechanical valved conduit (st ., st paul, mn, usa). The circulatory arrest and cardiac ischemic times were 16 minutes and 188 minutes, respectively . The patient failed to be weaned from cpb due to profound lv dysfunction, therefore, cpb was substituted with venous - arterial extracorporeal membrane oxygenation (ecmo). Massive hemorrhage from the surgical sites continued despite meticulous hemostatic maneuvers and massive blood product transfusions . The patient was transferred to the intensive care unit (icu) with an open sternum . The transfusion of large quantities of blood products for two days resulted in adequate hemostasis . Follow - up echocardiography showed a significant recovery of lv function at this point, and the patient was successfully weaned off ecmo after four days of ecmo support, after which a delayed sternal closure was performed . The follow - up computed tomography images and echocardiogram were unremarkable in that neither paravalvular dehiscence nor leakage on the anastomosis site was observed . Lv function was found to be normal, with an ejection fraction of 56% without any inotropic support . The patient was discharged on postoperative day 31 without any neurologic sequelae or residual complications . On the echocardiographic follow - up performed six months after the surgery, cardiac function was completely normal, with adequate function of the mechanical valve and no pathologic findings around the aortic root and ascending aorta . The patient has undergone 14 months of follow - up while prescribed an oral corticosteroid medication, and has exhibited no cardiovascular complications . Cardiovascular involvement in behcet s disease is a rare but life - threatening condition; in particular, involvement of the aortic root is known to be the leading cause of death in patients with behcet s disease . Surgical treatment of the aortic valve is required in these conditions, however, conventional avr is frequently complicated by prosthetic valve detachment due to the fragility of the aortic tissue and recurrent inflammation . Various surgical methods have been suggested to improve the outcomes of the surgical treatment of aortic root diseases associated with behcet s disease [46]. Since observations have revealed that the inflammation in behcet s disease primarily involves the aorto - ventricular junction of the aortic root, the complete resection of the inflammatory tissue in this area has been considered important for preventing the recurrence of the disease . With this in mind, aortic root replacement (arr) is considered an ideal surgical option for ar attributable to behcet s disease . The largest series of aortic valve operations in patients with behcet s disease presented 19 patients who underwent 46 aortic valve procedures and demonstrated an 80% reoperation rate after avr alone due to valve dehiscence, whereas excellent results were observed with arr . The authors suggested that arr should be performed as the initial surgical treatment of ar in patients with behcet s disease . Ando et al . Also reported excellent results of arr procedures in eight patients with behcet s disease; only one patient died of arrhythmia, while the other seven patients survived through a long follow - up period . Of those seven patients, only one patient required reoperation due to valve detachment over the course of a mean follow - up period of 74 months . In agreement with these previous studies, we believe that ar attributable to behcet s disease should be treated with arr as the initial surgical procedure in order to prevent prosthetic valve detachment . In the present case, ar attributable to behcet s disease was initially treated with conventional avr that was followed by a repeated avr procedure and a ross procedure due to recurrent prosthetic valve detachment . The patient ultimately presented with contained aortic rupture with pseudoaneurysm formation around the aortic root and ascending aorta twelve years after the third surgery . Since a massive hemorrhage and consequent cardiac arrest were anticipated during the opening of the sternum, we decided to induce dhca with transapical lv venting before opening the sternum . Through a left - side mini - thoracotomy, it was possible to achieve lv venting without encountering severe mediastinum adhesion or fatal hemorrhage from the ruptured aorta . This strategy enabled the prompt identification of the ruptured location and the complete resection of the diseased aortic tissue . Since this patient had been suffering from cardiac insufficiency attributable to preoperative shock, preventing lv distention injury during dhca was believed to be crucial for minimizing further myocardial damage associated with the surgical procedures . The intensive transfusion of blood products, including platelet concentrate and fresh frozen plasma, was performed after transferring the patient to the icu . Serious mediastinal bleeding and a coexisting low cardiac output state requiring ecmo support gradually improved during postoperative icu care after the correction of coagulopathy . We believe that an optimal surgical strategy and dedicated intensive care allowed the patient to recover from a desperate condition . In conclusion, we report the case of a patient with behcet s disease presenting with a contained aortic rupture in the previous surgical sites of the aortic root, who was treated with a sophisticated surgical approach and postoperative care . The long - term outcomes associated with this procedure need to be addressed in further studies.
Deafness or hearing loss can be due to genetic or environmental causes or a combination of both . The genetic hearing loss is classified as syndromic or nonsyndromic . Among the many disorders classified as syndromic hearing loss, the pathology varies widely, but in nonsyndromic hearing loss, the defect is generally sensorineural . Autosomal recessive nonsyndromic deafness is genetically heterogeneous and is the most common form of inherited hearing loss . Autosomal recessive genes are responsible for about 77% of the cases of hereditary nonsyndromic deafness, with over 85 loci and 21 different genes identified to date (http://hereditaryhearingloss.org/). The high degree of genetic heterogeneity of deafness reflects the great diversity of specialized proteins that are required to make sense of sound, and continuing discovery of common and rare mutations associated with deafness in humans has provided many serendipitous points of entry into the biology of hearing . Bartter's syndrome (bs) is characterized by hypokalemic, hypochloremic metabolic alkalosis with normal or low blood pressure despite high plasma renin activity and serum aldosterone . Antenatal bs with bilateral sensorineural deafness (bsnd) was first described in children born to a consanguineous couple from a bedouin family of southern israel . Bs type iv, bsnd variant, occurs because of a mutation in the bsnd gene on chromosome 1p31 coding for protein barttin which forms the subunit of cickb and cicka channels located on the basolateral membrane of tal and inner ear epithelium . The clinical features of bartter syndrome type iv include sensorineural deafness and peculiar facies, distinguished by the triangular face, large eyes, and protruding ears (1). Comparison of the protein sequence of bsnd with closely related species takes place and find out conserved regions . Other bioinformatics analysis such as protein modeling and proteins docking before the onset of the study, approval from the institutional review board, islamabad, and informed consent was obtained from all individuals . The families were visited at their places of residence to generate pedigrees and collect other relevant information . Blood samples from available affected and normal individuals of each family were collected for dna extraction . High molecular weight dna was extracted from leukocytes following the standard method as described by sambrook et al . . Genomic dna was quantified by spectrophotometer readings at od260 and diluted to 40 ng / ul for amplification by polymerase chain reaction (pcr). To elucidate the gene defect in the family presented here, an initial search for linkage was carried out by using polymorphic microsatellite markers mapped within autosomal recessive nonsyndromic deafness loci listed on the hereditary hearing loss homepage . Genome - wide screening was conducted with microsatellite markers (linkage mapping set 10, invitrogen, usa). Two - point linkage analysis was carried out using mlink of the fastlink computer package . Multipoint linkage analysis was performed using allegro . For the analysis, an autosomal recessive mode of inheritance with complete penetrance and a disease allele frequency of 0.001 equal allele frequencies were used in the analysis . However, since it is well known that using allele frequencies, which are too low, can lead to false positive results, a sensitivity analysis was performed . Haplotypes were constructed using simwalk2 [8, 9]. To screen for mutation in the bsnd gene, exons and splice junction sites were pcr amplified from genomic dna using the four primer sets . The purified pcr products were subjected to cycle sequencing using big dye terminator v 3.1 ready reaction mix and sequencing buffer (pe applied biosystems, foster city, calif, usa). The sequencing products were purified to remove unincorporated nucleotides and primers with centriflex tm gel filtration cartridge (edge biosystems, gaithersburg, md, usa). These purified products were resuspended in 10 l of tsr (template suppression reagent) and were placed in 0.5 ml septa tubes to be directly sequenced in an abi prism 310 automated sequencer (pe applied biosystems, foster city, calif, usa). Chromatograms from normal and affected individuals were compared with the corresponding control gene sequences from ncbi (national center for biotechnology information) database to identify the aberrant nucleotide base - pair change . Sam_t08 [1014] was used to model the bsnd protein and its interacting protein with highest confidence score (i.e., 0.990) clcnkb . For their further evaluation, clustalw program was subjected to analyze the phylogenetics relationship of different animals having bsnd protein . Conserved amino acids were predicted by using uniportkb tool available on expasy server . Protein interactor of bsnd was found out by string server, an online database of known and predicted protein interactions which includes direct (physical) and indirect (functional) associations . Protein docking of both the normal and the mutant bsnd was carried out using hex tool with its interactive proteins clcnkb and ren . Ages of affected individuals varied between 12 and 65 years at the time of study . Clinical examination of the hearing impaired individuals did not reveal the presence of signs or symptoms, which are hallmarks of the bartter syndrome type iv . Urinary and blood biochemistry was tested at the islamabad diagnostic centre, including testing for liver function, renal function, electrolytes, and hematology . Blood hematology and biochemistry markers were within the normal range, except that renin level was at borderline in one of the affected subject (vi: 5, 2.53 ml / h). Detailed clinical and biochemical features of normal and affected members are mentioned in table 1 . An audiometric evaluation of selected affected members by measuring the threshold of hearing at 2508000 hz for pure - tune air conduction and bone conduction showed severe hearing loss across all frequencies . Renal sonography ruled out the presence of nephrocalcinosis or metabolic alkalosis in these affected individuals . Nor have the affected individuals displayed problems with polydipsia, polyuria, nocturnal enuresis, and hypocalciuria . Analysis of the results obtained from genome search performed on the ten individuals of the family (iii-1, iii-3, iv-1, v-1, v-2, v-4, v-5, vi-1, vi-3, and vi-5) (figure 1) identified an area of interest on chromosome 1 . Two - point analysis generated lod score of 2.027 at marker d1s193 (73.21 cm) and 2.05 at marker d1s3462 (247.23 cm) on chromosome 1 (table 2). In order to test linkage to these two regions, additional markers located in the vicinity of d1s3462 and d1s193 were chosen from marshfield map and genotyped in all the ten family members . Multipoint linkage analysis for the family derived a maximum lod score of 3.42 at marker d1s1661 (table 3). The three - unit multipoint support interval contained a 10.48 mb region, which span from markers d1s3721 to d1s2690 . Haplotypes analysis delimited the centromeric boundary defined by a recombination between markers d1s1596 and d1s2770 in individual v-1 . Recombination event between d1s2706 and d1s3721, defined the telomeric boundary in the same individual (v-1). Therefore, the minimum critical region of 18.36 mb identified for disease locus and shared by all the affected individuals between the markers d1s2706 and d1s1596 . The critical interval (17.27 cm) identified in this pakistani family overlaps with the critical region to which dfna2 was mapped on 1p34 in a large indonesian family with autosomal dominant, progressive and sensorineural hearing loss . The dfna2 locus maps between markers d1s255 (65.47 cm) and d1s211 (73.81 cm), and thus shares a region of 2.68 cm with dfnb interval identified in our family . Identified 1.5 mb in four kindred segregating nonsyndromic deafness at the chromosome 1 . Through a database search, we identified several genes mapping between the linkage interval in the family (human genome project - santa cruz; http://genome.ucsc.edu/, may 2004). Among these, kcnq4 (mim 603537), cldn19, foxe3 (mim 601094), foxd2 (mim 602211), tspan1, and bsnd (mim 606412) were plausible candidate candidates in the interval of our family . We started sequencing of these and completely sequenced two genes (kcnq4 and cldin19), but we found no mutation in both . . Showed that mutation in bsnd can cause nonsyndromic deafness and is the molecular basis of dfnb73 locus in four pakistani families segregating nonsyndromic deafness . As the critical interval identified in the family contains potential candidate gene barttin (bsnd, mim 606412) as well; therefore, it was sequenced to search for the mutation . Sequence analysis of exon 1 of the bsnd gene in our family also revealed missense mutation involving t to c transition at nucleotide number 35 (35 t> c), which resulted in substitution of isoleucine to threonine at amino acid position 12 (i12 t) (figure 2). Models of bsnd clcnkb and ren proteins were generated by sam_t08 server and visualized by rasmol (figure 3(a)3(c)). Rampage values for bsnd were number of residues in favored region 95.6%, the number of residues in allowed region 3.1%, and the number of residues in outlier region 1.4% (figure 4(a)); however, the clcnkb and ren values were little varying . Its values were the number of residues in favored region: 94.8%, 97%, the number of residues in allowed region: 4.2%, 3%, and the number of residues in outlier region is 0.9% for clcnkb and 0% for ren (figure 4(c)). Comparison of conserved amino acid of human bsnd with closely related species like mouse, rat, and rabbit shows that isoleucine at position 12 is highly conserved, so mutation at this point can be significant (figure 5(a)). The evolutionary relationship between human, mouse, rat, and rabbit the analysis represents that the bsnd of mouse and rat is closely related to each other and shows homology with human and rabbit (figure 5(b)). Our mutation (i12 t) of bsnd was generated by swisspdb server and was analyzed by viewerlite . This substitution of isoleucine with threonine altered the bonding capacity with other side chains as well as other interactors (figure 6(a)-(b)). According to string database, clinical assessment showed the reduced chlorine level in all the affected individuals . According to further clinical assessments, renin level was at border range in one affected individual, so ren protein was also selected to check the effect of the respected mutation on this protein . However, other interactors are col7a1, arl2, clcn5, kcnj1, casr, slc12a1, slc12a3, and clcnka (figure 7). Both the proteins were docked with hex v 6.1, taking bsnd as receptor and clcnkb and ren as a ligand . The total energy value calculated for bsnd - clcnkb molecules was 229094.6 and bsnd - ren was 1145.7 . However, the total energy value for the mutant (i12 t) on docking with clcnkb was maximized to 218782.3 and with ren was 1149.8 . This values fluctuation ultimately results in reduced binding affinity with clcnkb and increased binding affinity with ren and so may be the case with other interacting proteins . Pathophysiological pathway leading from a specific mutation to a specific phenotype has remained elusive in syndromic as well as nonsyndromic hearing loss families . Individuals with the same mutation can fall along a clinical spectrum ranging from asymptomatic to severely affected and can even have completely different diseases with different mutation in the same gene . But there are no subclinical renal metabolic changes in our family as reported by riazuddin et al . . Renin level is at boarder range only in one affected individual, while renal sonography ruled out the presence of nephrocalcinosis in these affected individuals . Nor have the affected individuals displayed problems with polydipsia, polyuria, nocturnal enuresis, metabolic alkalosis, and hypocalciuria . It might be possible that partial loss of function of barttin induced by t12i allele cause only selectively hearing loss and appear to have less pronounced effects . However, the genotype does not always predict the clinical phenotype, which varies both within and between families carrying the mutation in the same gene, implying the existence of other genetic and/or environmental factors that influence phenotype . Several disease - causing bsnd mutations have been identified and functionally analyzed . In all cases, there is a genotype - phenotype relationship in that the level of function of mutant barttin predicts the renal phenotype . Our results support the relationship between missense bsnd mutation (i12 t) and nonsyndromic hearing loss . It is a secondary report that the bsnd as causal gene in nonsyndromic deafness . The protein sequence of bsnd is highly conserved in closely related species of human, mouse, rat, and rabbit, and it contains 2 putative transmembrane domain starting from 7 to 26 amino acid and 31 to 53 amino acid . Bioinformatics analysis of mutation in bsnd protein suggest that isoleucine, a hydrophobic amino acid, is being converted into threonine, a polar amino acid, which is more susceptible to posttranslation modifications, affecting the quaternary structure of protein resulting in mutant protein . Barttin (bsnd) is an accessory subunit that modifies protein stability, subcellular distribution, and voltage - dependent gating of clc - k chloride channels expressed in renal and inner ear epithelia . Clc - k channels are double - barreled channels with two identical protopores that may be opened by individual or common gating processes . Potassium (k) secretion by strial marginal cells and vestibular dark cells require cl to recycle in the basolateral membrane via a major cl conductance . This cl conductance is composed of the cl channels clcnka / bsnd and clcnkb / bsnd . Cl channels clcnka / bsnd and clcnkb / bsnd consist of the pore - forming clcnka -subunits and clcnkb and the bsnd -subunit . Proved that bsnd protein is an essential subunit for clcnka and clcnkb chloride channels, with which it colocalizes in basolateral membranes of renal tubules and of potassium - secreting epithelia of the inner ear . Disease - causing mutations in either clcnkb or bsnd compromise currents through heteromeric channels . The clcnka and clcnkb channels are members of the clc family, which comprises at least 9 mammalian chloride channels . The prototype of the family in torpedo is gated by both voltage and chloride . Docking results of both normal and mutant interaction with clcnkb suggested that there is a reduced binding affinity on mutation which may results the reduced down regulating or up regulating interactions; however, the mutant does not effect the interaction with renin (ren). So, we can conclude that the boarder range of renin level in one affected individual is not dependent upon this mutation . Identification of mutation in bsnd gene in more families will give valuable insight into the genetic mechanisms underlying nonsyndromic hearing disorder . This work is a fundamental step in the bioinformatics analysis of bsnd and provides basics for further analysis . Marshfield medical research foundation database website: http://research.marshfieldclinic.org / genetics/. National center for biotechnology information: http://www.ncbi.nlm.nih.gov/. Ucsc genome browser: http://genome.ucsc.edu/.
Unilateral absence of pulmonary artery (uapa) is a rare congenital abnormality, with an estimated prevalence of 1 in 200,000 . Some patients with uapa are totally asymptomatic while others may have severe pulmonary hypertension, hemoptysis, congestive heart failure, and cyanosis . We report a 2.5-year - old girl with congenital absence of the right pulmonary artery with associated congenital cystic adenomatoid malformation (ccam) of the right lower lobe, patent ductus arteriosus (pda), and atrial septal defect (asd), who presented with ortner's syndrome due to severe pulmonary hypertension . A 2.5-year - old girl presented with hoarseness of voice noticed since 3 months of age, breathlessness for the past 15 days and failure to thrive . She had been admitted elsewhere for lower respiratory tract infection at 3 months of age . The child was noticed to have a weak cry and an exaggerated suck - rest - suck cycle and sweating over the forehead while feeding . Pulse oximetry in room air showed an oxygen saturation varying between 60% and 70% in all four limbs . Weight and height were 7 kg and 77 cms, respectively both below the third percentile for age and sex . An ejection systolic murmur grade 3 was heard in the right parasternal region in the fourth and fifth intercostal spaces . The liver was palpable 2 cm below the right costal margin in the mid - clavicular line . Chest x - ray [figure 1] revealed cardiomegaly with a cardio - thoracic ratio of 0.6 and deviation of the trachea and mediastinum to the right . Two - dimensional (2d) echocardiography showed decreased flow in the right pulmonary artery, a small asd with a right - to - left shunt, and a dilated right atrium and right ventricle with severe tricuspid regurgitation, suggestive of severe pulmonary hypertension . Multiple detector computerized tomography aortogram [figure 2] confirmed the findings of asd with pulmonary hypertension, absent right pulmonary artery and hypoplastic right lung with small cystic lesions suggestive of ccam in the right lower lobe . Chest x - ray posterioranterior view showing cardiomegaly and shift of trachea and mediastinum to the right multiple detector computerized tomography aortogram showing absent right pulmonary artery, and cystic lesions in the right lower lobe suggestive of congenital cystic adenomatoid malformation (arrow) of lung at admission, the patient was started on oxygen, furosemide, enalapril and intravenous cefotaxime, on a provisional diagnosis of congenital cyanotic heart disease with increased pulmonary blood flow, lower respiratory infection, and congestive cardiac failure . Despite these measures, there was persistent hypoxemia and worsening of cardiac failure in the form of tachycardia and bilateral basal crepitations . The child was intubated and ventilated and started on pressors, but sustained a cardiac arrest on the 4 hospital day from which she could not be resuscitated . Complete arrest of pulmonary artery supply results in the arrest of early bronchial development leading to agenesis of the affected lobe or segment . Pulmonary agenesis is usually unilateral, right sided absence of pulmonary artery being more common . More than 50% of children with pulmonary agenesis have associated congenital anomalies that involve the cardiovascular (pda and patent foramen ovale), gastrointestinal, skeletal, and genitourinary systems . Our patient had asd and pda . While some patients with uapa are totally asymptomatic, others may have severe pulmonary hypertension, hemoptysis, congestive heart failure, and cyanosis . Chest x - ray may show an absent hilar shadow, a shrunken affected lung, and shift of the mediastinum to the affected side . An early interruption in the development of the pulmonary artery could result in the continued development of the primitive capillary supply to a region of the lung with resultant abnormal development of the supplied region . The magnitude of the insult would determine the exact development of the affected lung tissue and final blood supply, resulting in pulmonary sequestration, ccam, or a combination of the two lesions . The incidence of pulmonary hypertension in patients with isolated uapa varies between 18% and 44% . In patients with uapa with pda as in our patient, the incidence of pulmonary hypertension was observed to be as high as 86%, those with pulmonary hypertension dying at an early age . Ortner syndrome or cardiovocal syndrome refers to hoarseness of voice due to recurrent laryngeal nerve paralysis secondary to cardiovascular disease . This syndrome was first described by ortner in 1897 in two patients who had mitral stenosis and left recurrent laryngeal nerve paralysis . The syndrome has since been described in adults with various cardiovascular disorders, but reports in children are less common . The pulmonary artery, enlarged due to pulmonary hypertension, has been implicated as the main mechanism of nerve injury . Fetterolf and norris studied the anatomic relations of the left recurrent laryngeal nerve in cadavers and concluded that the nerve must be squeezed between the enlarged left pulmonary artery and the aorta or ligamentum arteriosum . Unilateral absence of pulmonary artery should be considered in the differential diagnosis of children who present with cyanosis, pulmonary hypertension, or recurrent lower respiratory tract infections.
The principal types of cells present in the blood are red blood cells (rbc), wbcs, and platelets . The percentage of wbc subtypes observed in human blood normally ranges between the following values: neutrophils 50 - 70%, eosinophils 1 - 5%, basophils 0 - 1%, monocytes 2 - 10%, lymphocytes 20 - 45% . The observation of whole blood smears under a microscope provides important qualitative and quantitative information regarding the diagnosis of various diseases including leukemia . Wbc identification and classification into these subtypes is frequently manually performed by experienced technicians or pathologists and involves two main elements . The first is the qualitative study of the morphology of the wbcs which gives information about the adequacy of the smear among other parameters including morphologic features of the cells . The second is quantitative and it consists of differential counting of at least 100 wbcs . The accuracy of cell classification and counting is markedly affected by individual operator's abilities and experience . In addition, the identification and differential count of blood cells is a time - consuming, repetitive task . Substituting automatic detection of wbcs for the manual process of locating, identifying, and counting different classes of cells is an important challenge in the domain of clinical diagnostic laboratories . Examples of wbc subtypes distribution of wbc subtypes while other technologies such as automated blood analyzers can perform a rapid and inexpensive five part differential, there is no morphologic correlate with these methods which is frequently an important factor in diagnosis . Even samples which have normal differential counts may have morphologic clues to underlying conditions such as myelodysplasia, infection, or b12 or folate deficiency . Our proposed method is best viewed as a complement to the traditional laboratory analysis (such as a cbc) rather than a replacement . Other technologies such as flow cytometry can also perform accurate differential cell counts, but the cost using this technology for a differential count far outweighs the benefit unless phenotypic analysis is also needed . Amnis image stream offers a rather unique technology which merges flow cytometery and imaging technologies . However, in addition to the costs associated with standard flow cytometry it is also uncertain how cellular and subcellular details in this setting which uses fluorescent antibody labeled cells would compare to those of wright staining . However, our technique is the first known implementation of these techniques on whole slide images . The advantages of using whole slide imaging for this study include leveraging existing hardware, enhancing the software to facilitate development of other applications, and annotating the wsi so that the cells may be classified and identified in the context of the original image . Our proposed method has been applied successfully to a large dataset and achieves good classification accuracy for all of the wbc subtypes considered . The software is in the development stage and our initial data only evaluated normal wbcs from manually selected regions of the wsi . Our method has been implemented using matlab 2009a, a high level technical computing language on a system with intel dual - core t4200 processor, 2ghz, 4 gb ram . The functions from the image processing toolbox and statistics toolbox have been used to develop our algorithm . The segmentation step is crucial because the accuracy of the subsequent feature extraction and classification step depends on correct segmentation of wbcs . It is also a difficult and challenging problem due to the complex appearance of these cells, uncertainty and inconsistencies in the microscopic image with variations in illumination . Many automatic segmentation methods have been proposed, most of them based on local image information such as histogram of regions, pixel intensity, discontinuity, and clustering techniques . Many of the segmentation algorithms introduced are based on the edge information present in images . Wbcs were segmented using active contour models (snakes and balloons) which were initialized using morphological operators . This method works well only if the wbcs have dark cytoplasm and are distinctly separate from adjacent rbcs . Kumar defined a new edge operator, the teager energy operator, to highlight the nucleus boundary which is very effective for segmenting the nuclei in cell images . They also used a simple morphological method to segment the cytoplasm from the background and the rbcs . The cytoplasm segmentation works well when the rbcs and wbcs are not close to each other . Jiang and colleagues, introduced a novel wbc segmentation scheme by combining scale - space filtering and watershed clustering . Watershed clustering in 3-d hsv (hue, saturation, value) histogram is processed to extract the cytoplasm . This method may not be sufficient in the case of high density of cells, where the rbcs are clustered close to the wbcs . To overcome the difficulty associated with the high density of cells, dorini introduced the use of some simple morphological operators and explored the scale - space properties of a toggle operator to improve the segmentation accuracy in the wbcs . To avoid leaking, a common problem in cell images due to the low contrast between nucleus, cytoplasm and background, they used a scale - space toggle operator for contour regularization . In this method, cytoplasm segmentation presents a few limitations: the rbcs touching the wbc are also detected as part of the cytoplasm . In our method edge detection methods do not work very well when not all cell details are sharp . But these methods work well if the contrast between the background and the gray internal membrane of the cell is stretched using a contrast stretching filter as stated by piuri and scotti . Sadeghian's method used zack's simple thresholding method for cytoplasm segmentation, which is based on the fact that the color intensity of rbc in a blood image is quite different from that of cytoplasm . A few approaches that were introduced recently dealt only with the segmentation of the nucleus of the wbc . For instance, hamghalam and ayatollahi used histogram analysis and measurement of distance among nuclei . Rezatofighi introduced a novel method based on orthogonality theory and gram - schmidt process for segmenting the wbc nuclei . To apply gram - schmidt orthogonalization for the segmentation of nucleus of wbc, a 3d feature vector was defined for each pixel using the rgb components of the images . Then, according to the gram - schmidt method, a weighting vector w was calculated for amplifying the desired color vectors and weakening the undesired color vectors . . The successful segmentation of the cytoplasm along with the nucleus segmentation aids in the automatic classification of the wbcs . Pathologists traditionally report normal wbcs as classified into five classes, i.e., monocytes, lymphocytes, neutrophils, eosinophils, and basophils . Since the chosen features affect the classifier performance, deciding which features must be used in a specific data classification problem is as important as the classifier itself . Hematology experts examine the cell shape, size, color, and texture in combination with the nuclear features . It is important to reflect the rules and heuristics used by the hematology experts in selection of the features . As proposed by ongun, several types of features such as intensity- and color - based features, texture - based features, and shape - based features are utilized for a robust representation of wbcs . Classification methods used in this work include k - nearest neighbors, learning vector quantization, multilayer perceptron, and support vector machine . Scotti and piuri evaluated the binary images of the cytoplasm and nucleus to characterize the feature set . The standard set of features like area, perimeter, convex areas, solidity, major axis length, orientation, filled area, eccentricity were separately evaluated for the nucleus and the cytoplasm . In addition features like the ratio between the nucleus and the cell areas, the nuclear rectangularity (ratio between the perimeter of the tightest bounding rectangle and the nuclear perimeter), the cell circularity (ratio between the perimeter of the tightest bounding circle and the cell perimeter), number of lobes in nucleus, area, and mean gray - level intensity of the cytoplasm were computed . The performance was compared using different classifiers like nearest neighbor classifiers, feed - forward neural network, radial basis function neural network, parallel classifier built with feed - forward neural network . In our method, we suggest a preliminary classification of the wbc based on the number of lobes (single or multi - lobed) in the nucleus along with the feature set to achieve better classification rate for each of the wbc subtypes . Our approach aims at achieving a method to identify wbcs from manually prepared, wright - stained wsi . The manually prepared wright - stained peripheral smear is easily and routinely performed at low cost . A manual differential count is routinely performed in many laboratories when a standard cbc has an abnormal value or when requested by a clinician . The personnel time associated with performing a 100 cell count can range from 1 - 2 minutes per slide . However, considering the volume of peripheral smears reviewed in a day, the time dedicated to cell counting can be considerable . In addition, the technologist time per slide can be considerably greater when the white cell count is very low . By utilizing our existing whole slide imaging technology, we sought to investigate the feasibility of automating the identification of wbcs from digital images . This is a preliminary investigation in which we sought to determine if these techniques were flexible enough to use without performing additional stains or cell preparations, adding additional steps, or interrupting the current procedures or workflow . We propose a simple segmentation scheme based on the difference in color channels and morphological operations to segment the wbcs . Two - step classification with the aid of a comprehensive feature set is helpful in realizing better accuracy rates in the classification of wbcs . In this initial work we implemented the segmentation algorithm proposed by dorini and the features selected for classification were based on the features implemented by scotti and piuri . The segmentation step is crucial because the accuracy of the subsequent feature extraction and classification step depends on correct segmentation of wbcs . It is also a difficult and challenging problem due to the complex appearance of these cells, uncertainty and inconsistencies in the microscopic image with variations in illumination . Many automatic segmentation methods have been proposed, most of them based on local image information such as histogram of regions, pixel intensity, discontinuity, and clustering techniques . Many of the segmentation algorithms introduced are based on the edge information present in images . As proposed by ongun, wbcs were segmented using active contour models (snakes and balloons) which were initialized using morphological operators . This method works well only if the wbcs have dark cytoplasm and are distinctly separate from adjacent rbcs . Kumar defined a new edge operator, the teager energy operator, to highlight the nucleus boundary which is very effective for segmenting the nuclei in cell images . They also used a simple morphological method to segment the cytoplasm from the background and the rbcs . The cytoplasm segmentation works well when the rbcs and wbcs are not close to each other . Jiang and colleagues, introduced a novel wbc segmentation scheme by combining scale - space filtering and watershed clustering . Watershed clustering in 3-d hsv (hue, saturation, value) histogram is processed to extract the cytoplasm . This method may not be sufficient in the case of high density of cells, where the rbcs are clustered close to the wbcs . To overcome the difficulty associated with the high density of cells, dorini introduced the use of some simple morphological operators and explored the scale - space properties of a toggle operator to improve the segmentation accuracy in the wbcs . To avoid leaking, a common problem in cell images due to the low contrast between nucleus, cytoplasm and background, they used a scale - space toggle operator for contour regularization . In this method, cytoplasm segmentation presents a few limitations: the rbcs touching the wbc are also detected as part of the cytoplasm . In our method, we eliminate the rbcs before detecting the wbcs . Edge detection methods do not work very well when not all cell details are sharp . But these methods work well if the contrast between the background and the gray internal membrane of the cell is stretched using a contrast stretching filter as stated by piuri and scotti . Sadeghian's method used zack's simple thresholding method for cytoplasm segmentation, which is based on the fact that the color intensity of rbc in a blood image is quite different from that of cytoplasm . A few approaches that were introduced recently dealt only with the segmentation of the nucleus of the wbc . For instance, hamghalam and ayatollahi used histogram analysis and measurement of distance among nuclei . Rezatofighi introduced a novel method based on orthogonality theory and gram - schmidt process for segmenting the wbc nuclei . To apply gram - schmidt orthogonalization for the segmentation of nucleus of wbc, a 3d feature vector was defined for each pixel using the rgb components of the images . Then, according to the gram - schmidt method, a weighting vector w was calculated for amplifying the desired color vectors and weakening the undesired color vectors . The successful segmentation of the cytoplasm along with the nucleus segmentation aids in the automatic classification of the wbcs . Pathologists traditionally report normal wbcs as classified into five classes, i.e., monocytes, lymphocytes, neutrophils, eosinophils, and basophils . Since the chosen features affect the classifier performance, deciding which features must be used in a specific data classification problem is as important as the classifier itself . Hematology experts examine the cell shape, size, color, and texture in combination with the nuclear features . It is important to reflect the rules and heuristics used by the hematology experts in selection of the features . As proposed by ongun, several types of features such as intensity- and color - based features, texture - based features, and shape - based features are utilized for a robust representation of wbcs . Classification methods used in this work include k - nearest neighbors, learning vector quantization, multilayer perceptron, and support vector machine . Scotti and piuri evaluated the binary images of the cytoplasm and nucleus to characterize the feature set . The standard set of features like area, perimeter, convex areas, solidity, major axis length, orientation, filled area, eccentricity were separately evaluated for the nucleus and the cytoplasm . In addition features like the ratio between the nucleus and the cell areas, the nuclear rectangularity (ratio between the perimeter of the tightest bounding rectangle and the nuclear perimeter), the cell circularity (ratio between the perimeter of the tightest bounding circle and the cell perimeter), number of lobes in nucleus, area, and mean gray - level intensity of the cytoplasm were computed . The performance was compared using different classifiers like nearest neighbor classifiers, feed - forward neural network, radial basis function neural network, parallel classifier built with feed - forward neural network . In our method, we suggest a preliminary classification of the wbc based on the number of lobes (single or multi - lobed) in the nucleus along with the feature set to achieve better classification rate for each of the wbc subtypes . Our approach aims at achieving a method to identify wbcs from manually prepared, wright - stained wsi . The manually prepared wright - stained peripheral smear is easily and routinely performed at low cost . A manual differential count is routinely performed in many laboratories when a standard cbc has an abnormal value or when requested by a clinician . The personnel time associated with performing a 100 cell count can range from 1 - 2 minutes per slide . However, considering the volume of peripheral smears reviewed in a day, the time dedicated to cell counting can be considerable . In addition, the technologist time per slide can be considerably greater when the white cell count is very low . By utilizing our existing whole slide imaging technology, we sought to investigate the feasibility of automating the identification of wbcs from digital images . This is a preliminary investigation in which we sought to determine if these techniques were flexible enough to use without performing additional stains or cell preparations, adding additional steps, or interrupting the current procedures or workflow . We propose a simple segmentation scheme based on the difference in color channels and morphological operations to segment the wbcs . Two - step classification with the aid of a comprehensive feature set is helpful in realizing better accuracy rates in the classification of wbcs . In this initial work we implemented the segmentation algorithm proposed by dorini and the features selected for classification were based on the features implemented by scotti and piuri . The segmentation step is crucial because the accuracy of the subsequent feature extraction and classification step depends on correct segmentation of wbcs . It is also a difficult and challenging problem due to the complex appearance of these cells, uncertainty and inconsistencies in the microscopic image with variations in illumination . Many automatic segmentation methods have been proposed, most of them based on local image information such as histogram of regions, pixel intensity, discontinuity, and clustering techniques . Many of the segmentation algorithms introduced are based on the edge information present in images . As proposed by ongun, wbcs were segmented using active contour models (snakes and balloons) which were initialized using morphological operators . This method works well only if the wbcs have dark cytoplasm and are distinctly separate from adjacent rbcs . Kumar defined a new edge operator, the teager energy operator, to highlight the nucleus boundary which is very effective for segmenting the nuclei in cell images . They also used a simple morphological method to segment the cytoplasm from the background and the rbcs . The cytoplasm segmentation works well when the rbcs and wbcs are not close to each other . Jiang and colleagues, introduced a novel wbc segmentation scheme by combining scale - space filtering and watershed clustering . Watershed clustering in 3-d hsv (hue, saturation, value) histogram is processed to extract the cytoplasm . This method may not be sufficient in the case of high density of cells, where the rbcs are clustered close to the wbcs . To overcome the difficulty associated with the high density of cells, dorini introduced the use of some simple morphological operators and explored the scale - space properties of a toggle operator to improve the segmentation accuracy in the wbcs . To avoid leaking, a common problem in cell images due to the low contrast between nucleus, cytoplasm and background, they used a scale - space toggle operator for contour regularization . In this method, cytoplasm segmentation presents a few limitations: the rbcs touching the wbc are also detected as part of the cytoplasm . In our method, we eliminate the rbcs before detecting the wbcs . Edge detection methods do not work very well when not all cell details are sharp . But these methods work well if the contrast between the background and the gray internal membrane of the cell is stretched using a contrast stretching filter as stated by piuri and scotti . Sadeghian's method used zack's simple thresholding method for cytoplasm segmentation, which is based on the fact that the color intensity of rbc in a blood image is quite different from that of cytoplasm . A few approaches that were introduced recently dealt only with the segmentation of the nucleus of the wbc . For instance, hamghalam and ayatollahi used histogram analysis and measurement of distance among nuclei . Rezatofighi introduced a novel method based on orthogonality theory and gram - schmidt process for segmenting the wbc nuclei . To apply gram - schmidt orthogonalization for the segmentation of nucleus of wbc, a 3d feature vector was defined for each pixel using the rgb components of the images . Then, according to the gram - schmidt method, a weighting vector w was calculated for amplifying the desired color vectors and weakening the undesired color vectors . The successful segmentation of the cytoplasm along with the nucleus segmentation aids in the automatic classification of the wbcs . Pathologists traditionally report normal wbcs as classified into five classes, i.e., monocytes, lymphocytes, neutrophils, eosinophils, and basophils . Since the chosen features affect the classifier performance, deciding which features must be used in a specific data classification problem is as important as the classifier itself . Hematology experts examine the cell shape, size, color, and texture in combination with the nuclear features . It is important to reflect the rules and heuristics used by the hematology experts in selection of the features . Several types of features such as intensity- and color - based features, texture - based features, and shape - based features are utilized for a robust representation of wbcs . Classification methods used in this work include k - nearest neighbors, learning vector quantization, multilayer perceptron, and support vector machine . Scotti and piuri evaluated the binary images of the cytoplasm and nucleus to characterize the feature set . The standard set of features like area, perimeter, convex areas, solidity, major axis length, orientation, filled area, eccentricity were separately evaluated for the nucleus and the cytoplasm . In addition features like the ratio between the nucleus and the cell areas, the nuclear rectangularity (ratio between the perimeter of the tightest bounding rectangle and the nuclear perimeter), the cell circularity (ratio between the perimeter of the tightest bounding circle and the cell perimeter), number of lobes in nucleus, area, and mean gray - level intensity of the cytoplasm were computed . The performance was compared using different classifiers like nearest neighbor classifiers, feed - forward neural network, radial basis function neural network, parallel classifier built with feed - forward neural network . In our method, we suggest a preliminary classification of the wbc based on the number of lobes (single or multi - lobed) in the nucleus along with the feature set to achieve better classification rate for each of the wbc subtypes . Our approach aims at achieving a method to identify wbcs from manually prepared, wright - stained wsi . The manually prepared wright - stained peripheral smear is easily and routinely performed at low cost . A manual differential count is routinely performed in many laboratories when a standard cbc has an abnormal value or when requested by a clinician . The personnel time associated with performing a 100 cell count can range from 1 - 2 minutes per slide . However, considering the volume of peripheral smears reviewed in a day, the time dedicated to cell counting can be considerable . In addition, the technologist time per slide can be considerably greater when the white cell count is very low . By utilizing our existing whole slide imaging technology, we sought to investigate the feasibility of automating the identification of wbcs from digital images . This is a preliminary investigation in which we sought to determine if these techniques were flexible enough to use without performing additional stains or cell preparations, adding additional steps, or interrupting the current procedures or workflow . We propose a simple segmentation scheme based on the difference in color channels and morphological operations to segment the wbcs . Two - step classification with the aid of a comprehensive feature set is helpful in realizing better accuracy rates in the classification of wbcs . In this initial work we implemented the segmentation algorithm proposed by dorini and the features selected for classification were based on the features implemented by scotti and piuri . An aperio cs scanner (aperio technologies, vista, ca) outfitted with an olympus uplansapo 20, 0.75 numerical aperture objective lens and basler l301kc trilinear - array ccd line scan camera was used to create the whole slide images . Ten sequential, wright - stained peripheral blood slides submitted for hematopathologist review were scanned at 20. slides were prepared manually according to the lab protocol and our current workflow . A drop of blood was pulled between two slides at roughly 45 angle to create a blood film slide which was allowed to air dry . Slides were then cover slipped prior to scanning at 20. the use 20 vs. 40 is frequently an issue of discussion in digital pathology . While 20 provides faster scan times and smaller files, the image quality is better with a 40 scan . We chose 20 as a starting point to demonstrate proof of concept with a secondary goal of comparing the performance of the algorithms on 40. scan times ranged from 5 - 10 minutes per slide . Whole slide imaging captured a technician selected area of the blood film (ranging from 17 mm - 22 mm in height by 15 mm - 25 mm in length) using automated focus . Images were compressed at a quality setting of 70% during the capture process with resulting file sizes averaging between 20 and 60 megabytes . Similarly, we manually selected optimal regions adjacent to feathered edge and stored the images corresponding to the thin sections of the blood smear . While regions were manually selected in this preliminary study, additional work is being done to automate this process . Each of these images has 2 - 15 wbcs . For easy identification of the wbcs, the whole blood slides are stained with wright's stain, which produces a dark intensity in nuclei of wbcs . We convert the images from rgb (red, green, blue) to hsv (hue, saturation, value) space . First, using the saturation image, we threshold it to approximately identify the nuclei . A threshold value of 0.55 is used in our experiment (saturation range = 0 - 1). The advantage of using the saturation image for thresholding is to eliminate variations in illumination that occur . Finally, we crop the part around the nucleus making sure that the whole wbc is captured . If the distance between two nuclei is less than 5.52 m, then they belong to the same wbc . The advantage of using only the cropped image is that the regions containing mostly rbcs (which lack nuclei) are eliminated . The advantage of this method is that we do not have any false negatives in the detection of the wbcs . We do capture some redundant cells (false positives) which have been stained, but we eliminate them in further processing by manually assigning them to a noise class . Figure 3 depicts the flowchart for wbc detection . Flowchart for wbc detection we have implemented a novel, simple, and robust segmentation scheme for segmenting wbcs . Rbcs are mostly pink / red in color and the wbcs have a dark stained nucleus . First we threshold (threshold value = 0.9 255) the given subimage based on intensity and eliminate small regions to obtain a binary image . Thresholding and smoothing the difference in the red and blue channels helps in identifying the rbcs (threshold value = 0.1 255). Subtracting the rbcs and the background from the original image results mostly in an image of wbcs . Hence, we are left with wbcs which may have small parts of rbcs attached to them . We fill in details lost due to our thresholding operation using a standard hole filling algorithm . Using a disk - shaped structuring element we get rid of the thin parts (morphological opening) of the rbcs which are attached to the wbc . Once the wbc boundary has been extracted we concentrate on separating the wbc region into cytoplasm and nucleus . This thresholding (threshold value = 0.55) operation yields a binary image of the nucleus . By taking the difference between the wbc image and the nucleus image hence this simple, extremely fast method can be used to segment the blood image to get the desired results . Flowchart for wbc segmentation wbcs can be broadly classified into cells with segmented nuclei and cells with nonsegmented nuclei as shown in figure 6 . The nucleus shape is the key factor in deciding the class to which the wbc belongs . We have found that deciding whether the nucleus is segmented or nonsegmented first gives a significant advantage to the final classification process . Ambiguities associated with connected nuclear lobes are resolved by detecting local maximum curvature points, detecting concavities, and partitioning them through geometric rules . The flowchart in figure 7 gives the steps for the classification of wbc into segmented and nonsegmented wbcs . The process of classification of the wbc into these two broad classes can be described in the following steps: examples of wbc with (a) segmented and (b) nonsegmented nucleus step 1 of classification steps representing segmented vs. nonsegmented nucleus classification, (a) white blood cell image; (b) nucleus boundary superimposed on the white blood cell image; (c) maximum curvature points; (d) triangulation of maximum curvature points; (e) removal of background edges; (f) retaining edges if the tangents are in opposite directions; (g) retaining edges if the edge vector and tangent vector are perpendicular; (h) retains edges if the end points have curvatures in the same direction detection of maximum curvature points: the goal of this step is to identify local curvature maxima corresponding to sharp bends (corners). After contour extraction we compute the curvature using equation and retain the local curvature maxima points . Where x(s) and y(s) represent the x - coordinates and y - coordinates of the boundary points respectively . X and y represent the first derivatives with respect to s. x and y represent the second derivatives with respect to s. elimination of low curvature maxima is done by calculating an adaptive threshold according to the mean curvature within a region of interest . The region of interest (roi) of a maximum curvature point is defined as the segment of the contour between the two nearest curvature minima points surrounding it denoted by l1 and l2 . The roi of each maximum curvature point is used to calculate a local threshold adaptively where p is the position of the maximum curvature point on the contour, and r is a coefficient: where is the mean curvature of the roi and i is the index of the point on the nucleus boundary . The absolute value of the curvature is used to distinguish between low curvature maxima points against high curvature maxima points . A round corner (low curvature maxima) tends to have absolute curvature smaller than t(p), while a sharp corner (high curvature maxima) tends to have an absolute curvature larger than t(p). The reasoning for choosing an appropriate value of r can be found in reference 12 . Delaunay triangulation of points of maximum curvature: the goal of this step is to construct the set of all potential edges that might correspond to the boundaries between the different lobes of a segmented nucleus . The high curvature maxima found in the previous step are used as the candidate vertices for these edges . A triangle s from t satisfies the delaunay criterion if the interior of the circumcircle through the vertices of s does not contain any points . If all triangles satisfy the delaunay criterion, then the triangulation t is called delaunay triangulation . We apply the delaunay triangulation (dt) to all points of maximum curvature to find candidate edges which potentially separate different segments of the nuclei . A set of conditions based on observations are first checked to see if a wbc has segmented nuclei . We eliminate all edges if the nucleus has a roundness ratio> 1 and classify the cell as nonsegmented nucleus type . The roundness ratio is calculated as the ratio of the area and the square of the perimeter of the contour as shown in equation (3). A circle has the value 1 and for structures with increasing irregularity, the value tends to 0 . Eliminate all edges if the ratio of the original area of nucleus to the convex hull of nucleus> 1 and classify the cell as of nonsegmented nucleus type . A set a is said to be convex if the straight line segment joining any two points in a lies entirely within a. the convex hull h of an arbitrary set> is the smallest convex set containing s. find the ratio of the area of the red / pink regions to the area of the entire of wbc . The red / pink regions are found by taking the difference between the red and blue image (red - blue) and thresholding it to obtain a binary image . If the ratio is> 3, then the nucleus is classified directly without further processing as a segmented nucleus . If there are two or more nuclei present in one cell, the nucleus is directly classified as a segmented nucleus; if the above reasons are not satisfied, a series of geometric rules helps us in separating the cells with segmented nucleus from the cells with nonsegmented nucleus . Let sij be the edge connecting two points of maximum curvature maxima pi and pj . Ti and tj are the unit vectors representing the tangent directions at pi and sij . The following set of rules is used: we need to retain edges that are inside the nucleus only . Hence, we eliminate edges that pass through the background and edges that intersect the boundary [figure 8e]. For a valid edge separating two lobes, the edge sij is eliminated if ti tj ti> th1; observe here that the dot product of these two tangents will be negative always if these tangents are oppositely directed [figure 8f]. We eliminate edges if if the edges and the tangents are orthogonal, the dot product of vectors along these vectors will be approximately 0 [figure 8 g]. We need to ensure that the endpoints of the edges have curvatures in the same direction as in figure 9a . To check this condition, we calculate the product of the curvature values at the endpoints of the edge . The product is negative if the points have curvatures in different directions as shown in figure 9b . This condition eliminates edges if the end points of the edge have opposite curvatures [figure 8h]. Examples to illustrate the curvature of convex and concave regions we used th2 = 0 and th2 = 0.4 . We check the above conditions for each edge in the delaunay triangulation . After the above conditioning, we label as segmented nucleus if the number of detected edges is larger than zero . Figure 8d shows the triangulation of the points of maximum curvature to find the candidate edges . In figure figure 8f retains edges if the angle between tangents is close to radians . Figure 8 g retains edges if the edge vector and tangent vector are close to perpendicular . Finally, three edges are present in the end indicating that the nucleus has three segments that are interconnected . To classify the wbc to its respective subtype, we use features that describe the characteristics of the cytoplasm and the nucleus . We choose 19 features such as area, perimeter, convex area, solidity, orientation, eccentricity, separately evaluated for the nucleus and the wbc . The result obtained from the previous step gives us information about the broad nucleus type (segmented or nonsegmented). In addition features like circularity (ratio between the perimeter of the tightest bounding circle and the nuclear perimeter) of the nucleus, nucleus to cytoplasm ratio, ratio of nucleus area to area of wbc, entropy of the cytoplasm, and mean gray - level intensity of the cytoplasm (all three color channels) are computed . We use a linear discriminant in this six - dimensional space to classify the data to their respective type . Linear discriminant analysis (lda) is used to find a linear combination of the features which characterizes or separates these five classes of wbcs . The classifier is biased using the number of samples in each class . The system is evaluated using 10-fold cross - validation . Cross - validation is a technique for assessing how the results of a statistical analysis will generalize to an independent dataset . It is mainly used in settings where the goal is prediction, and one wants to estimate how accurately a predictive model will perform in practice . One round of cross - validation involves partitioning a sample of data into complementary subsets, performing the analysis on one subset (called the training set), and validating the analysis on the other subset (called the validation set or testing set). To reduce variability, multiple rounds of cross - validation are performed using different partitions, and the validation results are averaged over the rounds . The functions from the statistics toolbox in matlab have been used to analyze the data . An aperio cs scanner (aperio technologies, vista, ca) outfitted with an olympus uplansapo 20, 0.75 numerical aperture objective lens and basler l301kc trilinear - array ccd line scan camera was used to create the whole slide images . Ten sequential, wright - stained peripheral blood slides submitted for hematopathologist review were scanned at 20. slides were prepared manually according to the lab protocol and our current workflow . A drop of blood was pulled between two slides at roughly 45 angle to create a blood film slide which was allowed to air dry . Slides were then cover slipped prior to scanning at 20. the use 20 vs. 40 is frequently an issue of discussion in digital pathology . While 20 provides faster scan times and smaller files, the image quality is better with a 40 scan . We chose 20 as a starting point to demonstrate proof of concept with a secondary goal of comparing the performance of the algorithms on 40. scan times ranged from 5 - 10 minutes per slide . Whole slide imaging captured a technician selected area of the blood film (ranging from 17 mm - 22 mm in height by 15 mm - 25 mm in length) using automated focus . Images were compressed at a quality setting of 70% during the capture process with resulting file sizes averaging between 20 and 60 megabytes . Similarly, we manually selected optimal regions adjacent to feathered edge and stored the images corresponding to the thin sections of the blood smear . While regions were manually selected in this preliminary study, additional work is being done to automate this process . Each of these images has 2 - 15 wbcs . For easy identification of the wbcs, the whole blood slides are stained with wright's stain, which produces a dark intensity in nuclei of wbcs . We convert the images from rgb (red, green, blue) to hsv (hue, saturation, value) space . First, using the saturation image, we threshold it to approximately identify the nuclei . A threshold value of 0.55 is used in our experiment (saturation range = 0 - 1). The advantage of using the saturation image for thresholding is to eliminate variations in illumination that occur . Finally, we crop the part around the nucleus making sure that the whole wbc is captured . If the distance between two nuclei is less than 5.52 m, then they belong to the same wbc . The advantage of using only the cropped image is that the regions containing mostly rbcs (which lack nuclei) are eliminated . The advantage of this method is that we do not have any false negatives in the detection of the wbcs . We do capture some redundant cells (false positives) which have been stained, but we eliminate them in further processing by manually assigning them to a noise class . Figure 3 depicts the flowchart for wbc detection . Flowchart for wbc detection we have implemented a novel, simple, and robust segmentation scheme for segmenting wbcs . Rbcs are mostly pink / red in color and the wbcs have a dark stained nucleus . First we threshold (threshold value = 0.9 255) the given subimage based on intensity and eliminate small regions to obtain a binary image . Thresholding and smoothing the difference in the red and blue channels helps in identifying the rbcs (threshold value = 0.1 255). Subtracting the rbcs and the background from the original image results mostly in an image of wbcs . Hence, we are left with wbcs which may have small parts of rbcs attached to them . We fill in details lost due to our thresholding operation using a standard hole filling algorithm . Using a disk - shaped structuring element we get rid of the thin parts (morphological opening) of the rbcs which are attached to the wbc . Once the wbc boundary has been extracted we concentrate on separating the wbc region into cytoplasm and nucleus . This thresholding (threshold value = 0.55) operation yields a binary image of the nucleus . By taking the difference between the wbc image and the nucleus image hence this simple, extremely fast method can be used to segment the blood image to get the desired results . Wbcs can be broadly classified into cells with segmented nuclei and cells with nonsegmented nuclei as shown in figure 6 . The nucleus shape is the key factor in deciding the class to which the wbc belongs . We have found that deciding whether the nucleus is segmented or nonsegmented first gives a significant advantage to the final classification process . Ambiguities associated with connected nuclear lobes are resolved by detecting local maximum curvature points, detecting concavities, and partitioning them through geometric rules . The flowchart in figure 7 gives the steps for the classification of wbc into segmented and nonsegmented wbcs . The process of classification of the wbc into these two broad classes can be described in the following steps: examples of wbc with (a) segmented and (b) nonsegmented nucleus step 1 of classification steps representing segmented vs. nonsegmented nucleus classification, (a) white blood cell image; (b) nucleus boundary superimposed on the white blood cell image; (c) maximum curvature points; (d) triangulation of maximum curvature points; (e) removal of background edges; (f) retaining edges if the tangents are in opposite directions; (g) retaining edges if the edge vector and tangent vector are perpendicular; (h) retains edges if the end points have curvatures in the same direction detection of maximum curvature points: the goal of this step is to identify local curvature maxima corresponding to sharp bends (corners). We utilize global and local curvature properties in extracting the maximum curvature points . After contour extraction we compute the curvature using equation and retain the local curvature maxima points . Where x(s) and y(s) represent the x - coordinates and y - coordinates of the boundary points respectively . X and y represent the first derivatives with respect to s. x and y represent the second derivatives with respect to s. elimination of low curvature maxima is done by calculating an adaptive threshold according to the mean curvature within a region of interest . The region of interest (roi) of a maximum curvature point is defined as the segment of the contour between the two nearest curvature minima points surrounding it denoted by l1 and l2 . The roi of each maximum curvature point is used to calculate a local threshold adaptively where p is the position of the maximum curvature point on the contour, and r is a coefficient: where is the mean curvature of the roi and i is the index of the point on the nucleus boundary . The absolute value of the curvature is used to distinguish between low curvature maxima points against high curvature maxima points . A round corner (low curvature maxima) tends to have absolute curvature smaller than t(p), while a sharp corner (high curvature maxima) tends to have an absolute curvature larger than t(p). The reasoning for choosing an appropriate value of r can be found in reference 12 . Delaunay triangulation of points of maximum curvature: the goal of this step is to construct the set of all potential edges that might correspond to the boundaries between the different lobes of a segmented nucleus . The high curvature maxima found in the previous step are used as the candidate vertices for these edges . A triangle s from t satisfies the delaunay criterion if the interior of the circumcircle through the vertices of s does not contain any points . If all triangles satisfy the delaunay criterion, then the triangulation t is called delaunay triangulation . We apply the delaunay triangulation (dt) to all points of maximum curvature to find candidate edges which potentially separate different segments of the nuclei . A set of conditions based on observations are first checked to see if a wbc has segmented nuclei . We eliminate all edges if the nucleus has a roundness ratio> 1 and classify the cell as nonsegmented nucleus type . The roundness ratio is calculated as the ratio of the area and the square of the perimeter of the contour as shown in equation (3). A circle has the value 1 and for structures with increasing irregularity, the value tends to 0 . Eliminate all edges if the ratio of the original area of nucleus to the convex hull of nucleus> 1 and classify the cell as of nonsegmented nucleus type . A set a is said to be convex if the straight line segment joining any two points in a lies entirely within a. the convex hull h of an arbitrary set> is the smallest convex set containing s. find the ratio of the area of the red / pink regions to the area of the entire of wbc . The red / pink regions are found by taking the difference between the red and blue image (red - blue) and thresholding it to obtain a binary image . If the ratio is> 3, then the nucleus is classified directly without further processing as a segmented nucleus . If there are two or more nuclei present in one cell, the nucleus is directly classified as a segmented nucleus; if the above reasons are not satisfied, a series of geometric rules helps us in separating the cells with segmented nucleus from the cells with nonsegmented nucleus . Let sij be the edge connecting two points of maximum curvature maxima pi and pj . Ti and tj are the unit vectors representing the tangent directions at pi and sij . The following set of rules is used: we need to retain edges that are inside the nucleus only . Hence, we eliminate edges that pass through the background and edges that intersect the boundary [figure 8e]. For a valid edge separating two lobes, the edge sij is eliminated if ti tj ti> th1; observe here that the dot product of these two tangents will be negative always if these tangents are oppositely directed [figure 8f]. We eliminate edges if if the edges and the tangents are orthogonal, the dot product of vectors along these vectors will be approximately 0 [figure 8 g]. We need to ensure that the endpoints of the edges have curvatures in the same direction as in figure 9a . To check this condition, we calculate the product of the curvature values at the endpoints of the edge . The product is negative if the points have curvatures in different directions as shown in figure 9b . This condition eliminates edges if the end points of the edge have opposite curvatures [figure 8h]. Examples to illustrate the curvature of convex and concave regions we used th2 = 0 and th2 = 0.4 . We check the above conditions for each edge in the delaunay triangulation . After the above conditioning, we label as segmented nucleus if the number of detected edges is larger than zero . Figure 8d shows the triangulation of the points of maximum curvature to find the candidate edges . In figure figure 8 g retains edges if the edge vector and tangent vector are close to perpendicular . Finally, three edges are present in the end indicating that the nucleus has three segments that are interconnected . A set of conditions based on observations are first checked to see if a wbc has segmented nuclei . We eliminate all edges if the nucleus has a roundness ratio> 1 and classify the cell as nonsegmented nucleus type . The roundness ratio is calculated as the ratio of the area and the square of the perimeter of the contour as shown in equation (3). A circle has the value 1 and for structures with increasing irregularity, the value tends to 0 . Eliminate all edges if the ratio of the original area of nucleus to the convex hull of nucleus> 1 and classify the cell as of nonsegmented nucleus type . A set a is said to be convex if the straight line segment joining any two points in a lies entirely within a. the convex hull h of an arbitrary set> is the smallest convex set containing s. find the ratio of the area of the red / pink regions to the area of the entire of wbc . The red / pink regions are found by taking the difference between the red and blue image (red - blue) and thresholding it to obtain a binary image . If the ratio is> 3, then the nucleus is classified directly without further processing as a segmented nucleus . If there are two or more nuclei present in one cell, the nucleus is directly classified as a segmented nucleus; if the above reasons are not satisfied, a series of geometric rules helps us in separating the cells with segmented nucleus from the cells with nonsegmented nucleus . Let sij be the edge connecting two points of maximum curvature maxima pi and pj . Ti and tj are the unit vectors representing the tangent directions at pi and sij . The following set of rules is used: we need to retain edges that are inside the nucleus only . Hence, we eliminate edges that pass through the background and edges that intersect the boundary [figure 8e]. For a valid edge separating two lobes, the tangent vectors at the endpoints are in opposite directions . The edge sij is eliminated if ti tj ti> th1; observe here that the dot product of these two tangents will be negative always if these tangents are oppositely directed [figure 8f]. We eliminate edges if if the edges and the tangents are orthogonal, the dot product of vectors along these vectors will be approximately 0 [figure 8 g]. We need to ensure that the endpoints of the edges have curvatures in the same direction as in figure 9a . To check this condition, we calculate the product of the curvature values at the endpoints of the edge . The product is negative if the points have curvatures in different directions as shown in figure 9b . This condition eliminates edges if the end points of the edge have opposite curvatures [figure 8h]. Examples to illustrate the curvature of convex and concave regions we used th2 = 0 and th2 = 0.4 . We check the above conditions for each edge in the delaunay triangulation . After the above conditioning, we label as segmented nucleus if the number of detected edges is larger than zero . Figure 8d shows the triangulation of the points of maximum curvature to find the candidate edges . In figure figure 8f retains edges if the angle between tangents is close to radians . Figure 8 g retains edges if the edge vector and tangent vector are close to perpendicular . Finally, three edges are present in the end indicating that the nucleus has three segments that are interconnected . To classify the wbc to its respective subtype, we use features that describe the characteristics of the cytoplasm and the nucleus . We choose 19 features such as area, perimeter, convex area, solidity, orientation, eccentricity, separately evaluated for the nucleus and the wbc . The result obtained from the previous step gives us information about the broad nucleus type (segmented or nonsegmented). This result is a novel binary feature added to our classifier . In addition features like (ratio between the perimeter of the tightest bounding circle and the nuclear perimeter) of the nucleus, nucleus to cytoplasm ratio, ratio of nucleus area to area of wbc, entropy of the cytoplasm, and mean gray - level intensity of the cytoplasm (all three color channels) are computed . We use a linear discriminant in this six - dimensional space to classify the data to their respective type . Linear discriminant analysis (lda) is used to find a linear combination of the features which characterizes or separates these five classes of wbcs . The classifier is biased using the number of samples in each class . The system is evaluated using 10-fold cross - validation . Cross - validation is a technique for assessing how the results of a statistical analysis will generalize to an independent dataset . It is mainly used in settings where the goal is prediction, and one wants to estimate how accurately a predictive model will perform in practice . One round of cross - validation involves partitioning a sample of data into complementary subsets, performing the analysis on one subset (called the training set), and validating the analysis on the other subset (called the validation set or testing set). To reduce variability, multiple rounds of cross - validation are performed using different partitions, and the validation results are averaged over the rounds . The functions from the statistics toolbox in matlab have been used to analyze the data . This system has been tested using images obtained from the arup laboratory, university of utah . Our dataset consists of 320 images at 20 magnification that contain 1938 expert labeled wbcs . The false positives consist of regions of artifact or debris that have stain and color characteristics which fall within the thresholding parameters . The performance of the segmentation algorithm was evaluated by comparing our proposed method with a hematologist's visual segmentation . The segmentation algorithm was applied to 1938 subimages of wbcs; 1804 of them were accurately segmented . Some of the examples present segmentation results for more complex images, with a complicated background and containing several rbcs close to the wbc . The resulting dataset (1938(number of cells)19 (features)) has been used to determine the subtype of the wbc segmented using linear discriminants as described in the methods section . We observed that there is a lot of misclassification between various classes as seen in table 1 . The rows in the confusion matrix represent the real subtype and the columns represented the detected subtype . An initial classification of the wbcs into cells with a segmented nucleus (neutrophils, eosinophils, basophils) and cells without nuclear segmentation (lymphocyte, monocyte) improves the performance of the classification . Confusion matrix for the comparison method (five subtypes) rows represent the correct classification by experts . For each row, diagonal entries indicate correct classification and are indicated in bold confusion matrix using our novel two - step classification (five subtypes). Diagonal entries indicate correct classification and are indicated in bold this five subtype classification is generally performed by pathologists . We obtain very good classification results for the given dataset as seen in table 2 . Experiments show that the two - step classification implemented achieves a 93.9% overall accuracy in the five subtype classification . Results indicate that the morphological analysis of white blood cells is achievable and it offers good classification accuracy . A higher segmentation accuracy would result in lowering the error rate in the classification process . This system has been tested using images obtained from the arup laboratory, university of utah . Our dataset consists of 320 images at 20 magnification that contain 1938 expert labeled wbcs . The false positives consist of regions of artifact or debris that have stain and color characteristics which fall within the thresholding parameters . The performance of the segmentation algorithm was evaluated by comparing our proposed method with a hematologist's visual segmentation . The segmentation algorithm was applied to 1938 subimages of wbcs; 1804 of them were accurately segmented . Some of the examples present segmentation results for more complex images, with a complicated background and containing several rbcs close to the wbc . The resulting dataset (1938(number of cells)19 (features)) has been used to determine the subtype of the wbc segmented using linear discriminants as described in the methods section . We observed that there is a lot of misclassification between various classes as seen in table 1 . The rows in the confusion matrix represent the real subtype and the columns represented the detected subtype . An initial classification of the wbcs into cells with a segmented nucleus (neutrophils, eosinophils, basophils) and cells without nuclear segmentation (lymphocyte, monocyte) improves the performance of the classification . Confusion matrix for the comparison method (five subtypes) rows represent the correct classification by experts . For each row, the columns represent the classification made by the approach used in the comparison method . Diagonal entries indicate correct classification and are indicated in bold confusion matrix using our novel two - step classification (five subtypes). Diagonal entries indicate correct classification and are indicated in bold this five subtype classification is generally performed by pathologists . We obtain very good classification results for the given dataset as seen in table 2 . Experiments show that the two - step classification implemented achieves a 93.9% overall accuracy in the five subtype classification . Results indicate that the morphological analysis of white blood cells is achievable and it offers good classification accuracy . A higher segmentation accuracy would result in lowering the error rate in the classification process . There are currently wbc classification systems based on morphology in clinical use such as the cellavision system . However, the classification performed by cellavision utilizes small snap shot images obtained directly from a glass slide . In contrast the techniques described in this paper allow identification of wbcs from a whole slide image . The use of wsi technology allows some advantages over the cellavision system including leveraging of capital equipment, expansion of software to include other applications involving wsi, and identifying and localizing the wbcs in the context of the original wsi . While the localization functions were not part of the current study, further work is currently being pursued to implement some of these benefits . Viewing the classified cells in their original context on wright stained wsi allows the pathologist to also evaluate red blood cells, platelets, and smear adequacy data in addition to the wbcs . This technique may facilitate work flow by replacing tedious and monotonous work with automation while maintaining all of the digitized data in the original smear . Even though the time to scan and analyze the slide may is longer than a manual differential count, the time associated with pathologist review may actually be decreased by completing the automated analysis prior to the pathologist spending any time on the case . In addition, scanning and classifying the cells is mostly machine driven and requires very little hands on time, thus allowing personnel to perform other duties . This is a report of a developmental step to assess the viability of a larger scale automated solution . The methodology achieves a semiautomated system for the detection and classification of normal wbcs from scanned wsi . Experiments show that the two - step classification implemented achieves good overall accuracy in the five subtype classification . Results indicate that the morphological analysis of white blood cells is achievable and it offers good classification accuracy . Further studies will be focused on detecting and segmenting abnormal wbcs, comparison of 20 and 40 data, and expanding the applications for bone marrow aspirates . In the future, we will also perform the elimination of false positives in wbc detection in an automated manner using linear discriminants on the same feature set used for classification.
Inflammatory bowel disease (ibd) is a chronic and multifactorial gastrointestinal inflammatory condition that is clinically categorized as ulcerative colitis (uc) or crohn's disease (cd). Ibd fibrosis can occur in both uc and cd, but it is much more prevalent in cd . Typical cd presentations include discontinuous involvement of various portions of the gastrointestinal tract and the development of complications including strictures, abscesses, or fistulas [1, 2]. Current anti - inflammatory therapies neither prevent fibrosis nor reverse established strictures, which may present years after remission of active inflammation . Prohibitin, which can inhibit oxidative stress and mitochondrial dysfunction, has been shown to have significant anti - inflammatory activities . Prohibitin is a ubiquitously expressed, multifunctional protein implicated in many cellular processes, including mitochondrial function and protein folding . It has been implicated in the regulation of proliferation, cellular apoptosis, and gene transcription [4, 5]. Moreover the protein sequences of mouse and rat prohibitin are virtually identical, and these differ from the human protein sequence by a single amino acid . A recent study showed that prohibitin levels are decreased in crohn's disease colonic mucosal biopsies, and little is known about the regulation and role of prohibitin during intestinal inflammation . Prohibitin has been shown to exhibit an antifibrotic effect in animal models of cirrhosis and renal fibrosis . Current studies with prohibitin focus on the acute phase in inflammation rather than the expression and role in the fibrosis course of ibd . Of all the cytokines and growth factors involved, transforming growth factor (tgf)-1 is one of the most potent fibrogenic cytokines in not only cd but also in several other fibrotic diseases such as systemic sclerosis and hepatic cirrhosis [11, 12]. Therefore, regulating tgf-1 expression has been investigated as a potential therapeutic for preventing and treating intestinal fibrosis . -smooth muscle actin (-sma) is one of six actin family members . In the adult, prominent -sma expression can be found in vascular smooth muscle cells and myoepithelial cells . Epithelial - mesenchymal transition (emt) which contributes to tissue fibrosis is also associated with cells that eventually express -sma as myofibroblasts . Interleukin-10 (il-10) is a pluripotent cytokine that plays a pivotal role in the regulation of immune and inflammatory responses . Il-10 has been shown to suppress the production of proinflammatory mediators and downregulate costimulatory molecules that are critical for the activation of t cells . In this study, we used il-10ko mice that spontaneously form symptoms similar to crohn's disease as an inflammatory bowel disease model to establish a colon mice intestine fibrosis model . The aim was to detect and investigate if the effects of il-10 on prohibitin has antifibrotic effects and prevents the progression of intestinal fibrosis in the il-10ko mice model of cd and to determine the role of prohibitin in intestinal fibrosis of murine colitis . We purchased 5-week - old female homozygous il-10 knockout (il-10ko) and wild - type (wt) 129/svev mice from jackson laboratory (spf). The primers for tgf-1, nf-b, nrf2, il-10, collagen i, and -sma were synthesized by abi co., ltd . Antiprohibitin was obtained from sigma - aldrich (st . Louis, mo, usa). Specific pathogen - free (spf) female homozygous il-10 knockout (il-10ko) and wild - type (wt) 129/svev mice (jackson laboratory) of 5 weeks of age and weighing 1923 g were used for this study . The animals were randomly allocated into three groups: group a (control group, 18 wt mice), group b (il-10ko mice group, 18 il-10ko mice), and group c (il-10 treatment group, 12 il-10ko mice). The animals were housed under spf and temperature - controlled conditions, with light / dark cycles of 12/12 hours and free access to water and standard rodent chow at the animal center of the sixth people's hospital affiliated to shanghai jiao tong university . This study was carried out in strict accordance with the recommendations in guidelines for the care and use of laboratory animals . The protocol was approved by the committee on the ethics of animal experiments of the shanghai sixth people's hospital affiliated to shanghai jiao tong university (permit number: syxk [hu] 2011 - 0128). All surgery was performed under lidocaine anesthesia, and then mouse was sacrificed by cervical dislocation and all efforts were made to minimize suffering . Using aseptic techniques, the mice of the treated group and model group were treated with intraperitoneal injections of il-10 (5 g / kg body weight, three times per week) and 0.9% physiological saline since week 12 . The control group received no treatment; then mice of control group and il-10ko mice group were sacrificed at weeks 12, 14, and 16, and the treated group was sacrificed at week 14 and 16 . Mice were housed until the appropriate age, and then they were sacrificed by cervical dislocation . In this model, il-10ko mice developed spontaneous colitis between 6 and 8 weeks . Then, a spontaneous chronic intestinal inflammation and prominent fibrosis occurred at week 12 . Sections were stained with hematoxylin and eosin (h&e) reagent and masson's trichrome stain . We harvested colonic tissues from il-10ko and wt mice at 12, 14, and 16 weeks of age . From each tissue sample, this trichrome system stains collagen blue, nuclei purple - brown, and cytoplasm pink . Collagen area was defined as the distinct blue color region and was distinguished from muscle, blood, and inflammatory cells . The collagen area was also measured by using a sircol collagen assay kit according to the manufacturer's instructions . The histological severity of colitis was evaluated by h&e - stained and coded sections by modifying the validated scoring system described by tamaki et al . . All slides were scored by a gastrointestinal pathologist in a blinded manner for inflammation based on the scoring system for inflammation (macrophage, lymphocyte, and neutrophil infiltration in the lamina propria or submucosa) was scored for severity as follows: normal, 0; minimal, 1; mild, 2; moderate, 3; marked, 4; and severe, 5 . In brief, the inflammation score for a given tissue section is the sum of the scores given to the four regions or features assessed for inflammation . Rt of the rna was conducted with 200 u of m - mlv rt rnase h - deletion mutant (promega) at 42c for 60 min by using the 7500 sequence detection system (applied biosystems). The pcr primer sequences were as follows: prohibitin, 5-tgg cgttagcggttacaggac-3 and 5-gaggatgcgtagtgtgatcttgac-3; nrf2, 5-cctcgctggaaaaagaagtg-3 and 5-ggagaggatgctgctgaaag-3, tgf-l, 5-tgagcactga agcgaaagcc-3 and 5-gattcaagtcaactgtggagcaac-3, collagen i, 5-aatggtgctcctggtattgc-3 and 5-ctcctttggcaccagtgtct-3, -sma, 5-tgctgtccctctatgcctct-3 and 5-gaaggaatagccacgctcag-3 and gapdh, 5-ggtatcctgaccctgaagta-3 and 5-ggggtgttgaaggtctcaaa-3. For pcr, after an initial incubation for 30 s at 95c, 40 cycles were performed consisting of 5 s at 95c, 5 s at 60c, and 30 s at 72c for extension . Briefly, the cycle number at which the transcript being analyzed became detectable (ct) was normalized to the cycle number at which the gapdh gene transcript was detected, referred to as ct . For immunohistochemical analysis of prohibitin and -sma colon tissue fixed with 4% buffered paraformaldehyde after deparaffinization, antigen retrieval was performed by immersing the section in 10 mm citrate buffer (ph 6.0) and heating twice in a microwave oven (95c) for 5 min each time . Endogenous peroxidase activity was blocked by incubation with 1% hydrogen peroxide in distilled water for 10 min . Then, we used the image analysis software to measure the integral optical density (iod) of prohibitin and -sma . Data analysis was performed using spss version 18.0 (spss, chicago, il, usa) statistical software . One - way analysis of variance (anova) was used to analyze the differences between groups . Nonparametric data were analyzed by kruskal - wallis and mann - whitney u tests and pearson's correlation coefficient was used to determine the relationships between the indicators . There were significant differences in the mean weight of the control group, il-10ko mice group, and il-10-treated group in all of the experiments . The il-10ko group exhibited a marked decrease in their body weight as compared to the control group at 12, 14, and 16 weeks (p <0.05). The mice were sacrificed on wk 12, 14, and 16 and various degrees of edema and adhesion were found over the distal colon in a length of 35 cm and 13 cm in the model group and il-10ko treatment group, respectively . Severe strictures associated with the dilatation of the proximal segment were exhibited gradually over time . Administration of il-10 led to a significant increase in body weight at 14 and 16 weeks as compared to the il-10ko mice group (p <0.05). At the end of study, the surviving mice in the il-10-treated group gradually regained their weight but still failed to reach the initial weight (figure 1). The h&e staining histologic findings revealed colonic epithelial hyperplasia, crypt abscess, glands arranged in disorder, and the forming of edema and ulceration of submucosa in the propria of the colonic tissue from il-10ko mice at 12, 14, and 16 weeks of age (figures 2(d)2(f)). Il-10 treatment led to a significant amelioration of colonic epithelial hyperplasia and cellular infiltration with il-10 treatment (figures 2(b) and 2(c)). The histopathological colitis score in the il-10ko mice group was significantly increased with age and was greater in il-10ko mice than in the control group at each time point . In treatment group, the histopathological colitis score was decreased significantly than those in il-10ko mice group at week 16 (table 1, p <0.05). Masson's trichrome stain sections of the colon were analyzed for collagen content as described in section 2 (figure 4). In wt mice, collagen deposition in il-10ko mice was localized not only in the mesenchymal but also in the mucosa, submucosal, and muscularis propria areas . We then found that collagen deposition was increased with age, specifically at 12-, 14-, and 16-week time points (figures 3(d)3(f)). Furthermore, the amount of collagen deposited in the submucosal areas and muscularis propria was markedly reduced in the il-10-treated group compared to that in the il-10ko mice (figures 3(b) and 3(c), p <0.05). The gene expressions of tgf-1, collagen i, and -sma in the il-10ko mice group were upregulated in a time - dependent manner and were much more significant compared to those in the control group . In addition, gene prohibitin expression of nrf2 in the colonic tissue of il-10ko mice was down - regulated in a time - dependent manner . Moreover, prohibitin and nrf2 mrna expression were significantly up - regulated and tgf-1, -sma mrna expression was markedly reduced in the il-10-treated group when compared with the il-10ko mice group at 14, 16 wk (table 2). We further detected protein expression levels of prohibitin and -sma in colonic tissues by measuring the integral optical density . The protein levels of prohibitin were lower in the il-10ko mice group than in the control group (figures 5(d)5(f)) and that of -sma in the il-10ko mice group was much more significant compared with that in the control group . Moreover, there was a significant difference in prohibitin and -sma in the treatment group and the il-10ko mice group . Prohibitin protein expression levels were significantly up - regulated (figures 5(b) and 5(c)) and -sma was markedly reduced in the il-10-treated group when compared with the control group at 14 and 16 weeks (table 3). Protein expression of prohibitin was negatively correlated with the histologic colitis score (r = 0.859, p <0.01) and -sma protein expression (r = 0.798, p <0.05). In ibd, especially in the cd, long - term recurrent intestinal chronic inflammation and excessive damage repair could cause intestinal tract fibrosis and intestinal stricture . Research shows that about a third of the cd patients developed stenosis of bowel and needed surgery . However, after the surgery, about 70% of the postoperative patients developed stenosis of the bowel . The findings in the present study demonstrated that prohibitin is critically involved in the development of organ fibrosis and indicated that regulation of prohibitin might prevent and alleviate intestinal fibrosis associated with human ibd . The masson collagen trichrome staining in il-10ko mice showed massive amounts of collagen deposition, mainly in the lamina propria, submucosal areas, and muscularis propria in the colonic tissues of il-10ko mice with colonic inflammation, and the amounts increased with age . In addition, we found that the gene expressions of tgf-1, -sma, and collagen i in il-10ko mice were markedly increased when compared to those in wt mice, especially at 16 wk . However, the expression of prohibitin and nrf2 in il-10ko mice was markedly reduced over that of wt mice . Protein expression of prohibitin negatively correlated with the histologic colitis score and -sma protein expression . Decreased prohibitin levels was associated with increased ecm (extracellular matrix) levels (-sma and collagen i). . Found that the therapeutic delivery of prohibitin to the colon reduces the severity of dss - induced colitis in mice . These findings suggested that chronic intestinal inflammation of il-10ko mice reduced prohibitin, resulting in intestinal fibrosis . In this investigation, we found that il-10 treatment in mice was associated with increased expression of prohibitin and nrf2, attenuation of the lesion in the intestinal fibrosis, and significant reduction in the expressions of tgf-l, -sma, and collagen . We also found that in il-10-treated mice at 16 wk in histological and immunological findings were significantly improved, and colonic mucosa edema was lowered and the degree of disorder in the intestinal mucosa gland arrangement was reduced . These results show that il-10 can ameliorate intestinal fibrosis; this effect is probably related to the regulation of prohibitin by il-10 . Prohibitin is a highly conserved, ubiquitously expressed, multifunctional protein whose expression is decreased during ibd . Additionally, prohibitin is regarded as an apoptosis - regulating protein . The best characterized function of the prohibitin is as a chaperone involved in the stabilization of mitochondrial proteins . It is also thought to play a role in maintaining normal mitochondrial function and morphology . Berger and yaffe found that loss of function of prohibitin leads to altered mitochondrial morphology, loss of normal reticular morphology, and disorganized mitochondrial distribution . Reported that the elevation of prohibitin in the surface epithelial cells of the colon could reduce the severity of colitis in mice, suggesting that prohibitin may be a novel therapeutic target for inflammatory bowel disease . The results from the abovementioned studies suggest that prohibitin is associated with cell / tissue injury . Correlation analysis showed that prohibitin protein expression was negatively correlated with the histologic colitis score and protein expression of -sma . Therefore, prohibitin regulation may prove to be a major therapeutic target for treating intestinal fibrosis in human ibd . Of all the cytokines and growth factors involved, tgf-1 is known as one of the most potent fibrogenic cytokines in several fibrotic diseases [1113, 22]. Therefore, we examined tgf-1 expression in the colonic tissue of il-10ko mice . As expected, tgf-1 expression was upregulated in a time - dependent manner in the colonic mucosa . The present study has shown the importance of regulating the local production of tgf-1 as a therapeutic strategy for preventing and suppressing intestinal fibrosis . However, tgf-1 also has diverse important biologic functions such as immunosuppressive function, enhancement of tissue regeneration, and wound healing [24, 25]. In the progression of the fibrosis processes, it cannot only increase the secretion of extracellular matrix, but it can also prevent fiber activator generation . Therefore, tgf-1 may not be an ideal target for preventing fibrosis in patients with inflammatory bowel disease . We therefore investigated another transcription factor in chronic intestinal inflammation, nrf2, a transcriptional regulator of antioxidant responses . Nrf2 is very sensitive to the cellular oxidation reduction status; therefore, any changes in the cellular oxidation reduction can lead to the change of the nrf2 transcriptional regulation action . [28, 29] found that transcriptional activity of nrf2 increases with low or moderate doses of tnf- and decreases with high doses of tnf-. Another study showed that prohibitin is the regulator of nrf2 and can sustain activation of the nrf2, which can decrease oxidative stress and colitis . In this investigation, we found similar results that prohibitin acts as a regulator of antioxidant response and regulation of prohibitin can sustain activation of the nrf2 . Therefore, these findings indicate that regulation of prohibitin might prevent the development of therapeutic agents for intestinal fibrosis in human ibd . Garca - prieto et al . Found that inhibiting the matrix metalloproteinase-8 (matrix metalloproteinases-8, mmp-8) can enhance il-10 expression and increase bleomycin - induced pulmonary fibrosis in rat models . In this experiment reported that improving prohibitin expression in intestinal epithelial cells can effectively relieve the degree of colonic inflammatory reaction in mice . In this study, our results were similar to those in previous studies that showed that il-10 exhibits an inhibitory effect on the intestinal fibrosis process . Moreover, there is a strong correlation between il-10 administration and prohibition expression, which ultimately slows fibrosis formation . Our data revealed that administration of il-10 treatment remarkably decreased collagen deposition in the colonic tissues of il-10ko mice . Therefore, we demonstrated that regulation of prohibitin plays an important role in preventing and ameliorating intestinal fibrosis related to intestinal inflammation . In conclusion, lowered expression of prohibitin is associated with intestinal fibrosis progression, and il-10 treatment is associated with increased prohibitin in il-10ko mice . Based on these findings, regulation of prohibitin may be a promising option for the treatment of intestinal fibrosis related to ibd in the future . However, cell culture and further investigations should be conducted to investigate the detailed mechanism.
Electroencephalographic (eeg) recordings of brain activity are dominated by periods of rhythmic activity . This activity is seen across a very broad range of frequencies, from <1 hz, up to> 100 hz . Spectral analysis of long epochs of eeg activity (> 1 min) reveal relationship between power and frequency such that the power at a given frequency (its contribution to the overall waveform) decreases smoothly as the frequency increases a relationship common in many cortical activity patterns and other natural dynamic systems (plenz and thiagarajan, 2007). Considering this 1/f power relationship alone suggests that the brain can generate a continuum of different frequencies of rhythmic activity, but reveals little if anything about how such dynamics may be used functionally . However, when averaging over long time periods to produce smooth frequency / power relationships, a large amount of information is lost cortical dynamics are extremely rich, being exquisitely sensitive to sensory and neuromodulatory inputs that can change on timescales as short as a few milliseconds . Experiments designed to control and quantify these factors reveal discrete frequencies of rhythmic activity that can be related functionally to psychophysical processes (e.g. Baker et al ., 2006; tallon - baudry et al ., 1999; these observations are consistent with the assumption that the 1/f pattern of long - term eeg activity is generated by a time - averaged and smoothed collection of multiple, discrete frequencies of rhythm generation in cortex . ? Detailed observations of dynamic activity in hippocampus and supragranular neocortex have shown that at least three discrete frequencies delta (13 hz), theta (69 hz) and gamma (3050 hz) are often co - expressed (penttonen and buzsaki, 2003). These three rhythms can be associated with further, much slower rhythms (steriade, 1999) and also much faster rhythms in vivo and in vitro (traub et al ., 2003; ylinen et al ., an insightful extrapolation from many observations of brain rhythms suggests that there are finite, discrete frequency bands arranged according to the natural log (e) of centre frequency (buzsaki and draguhn, 2004). However, this scheme may underestimate the number of discrete frequencies that are available to neocortical networks . For example, separable, clearly functionally distinct sub - bands within the classical beta and gamma bands have been reported in humans (haenschel et al ., 2000; sanchez et al . One method that is useful in attempts to define the nature and number of distinct oscillation modes possible in cortex is the in vitro cortical slice preparation . Such a reductionist approach removes the ability to directly imply cognitive or motor relevance to a population rhythm, but this is balanced by an absolute ability to control cortical input patterns and neuromodulatory state . In other words, the local cortical networks that remain intact in the slice preparation can be an advantage of this process is that, as the state of the cortical network is stable, rhythms that may perhaps occur only transiently in vivo can be generated constantly for many hours in vitro thus facilitating detailed quantification and dissection of underlying mechanisms, which can then be used to further understand network dynamics using mathematical and computational models . This type of study has revealed in vitro correlates of the two subtypes of beta and gamma rhythms indicated in human studies above (figure 1, roopun et al ., 2008) along with many other persistent oscillation modes . Figure 1 illustrates the pattern of discrete frequencies that can be produced by a single area of neocortex in vitro in the spectral range from 1 to 100 hz . The modal peak frequencies fall into distinct bands, with approximately twice as many bands as expected from a natural log distribution . Instead, the bands appear approximately distributed according to phi (the golden mean) rather than e a constant commonly associated with the organisation of complex natural systems (atela et al ., 2002). It is interesting to note that, even in such a reduced system, most attempts to generate single frequencies of rhythm for study actually generate multiple coexistent frequencies . This multi - scale dynamic feature of cortical rhythms may be vital for cortical information processing (palva et al ., 2005), with interactions between frequency bands being as important as the individual frequencies themselves a phenomenon termed spectral processing . All rhythms were generated in secondary somatosensory (parietal) cortical slices maintained in artificial cerebrospinal fluid (acsf). Rhythms were recorded as local field potentials (lfps), resulting spectra (from 60 s epochs of data) are plotted with powers normalised to modal peak . Delta1 (1, c.1.5 hz) rhythms were generated in control slices spontaneously after> 1 h incubation in normal acsf . Delta2 (2, 23 hz) rhythms were generated by bath application of cholinergic agonist carbachol (2 m). Theta (, 68 hz) rhythms were recorded in layers ii / iii in the presence of the glutamatergic receptor agonist kainate (10 nm) and occurred concurrently with 2 rhythms in lv . Alpha (, c.10 hz) rhythms were generated following transient activation of cortex by pressure ejection of glutamate . Peak amplitude was in lv and was present concurrently with and 1 rhythms in lii / iii and liv, respectively . Beta1 (1, 1317 hz) rhythms were generated alone by partial blockade of ampa / kainate receptors following tonic activation by kainate (400 nm). Beta2 (2, 2227 hz) rhythms were generated in lv by kainate (400 nm) and always occurred concurrently with gamma1 (1, 3050 hz) rhythms in lii / iii in this brain region . Gamma2 (2, 5080 hz) rhythms were also generated by kainate (400 nm) but occurred in lv in acsf with reduced chloride ion concentration . Additional peak frequencies at 100 hz are generated by brief, intense periods of excitation but rarely meet criteria for persistence and so are not considered here . At the most basic level, if different frequencies are generated by entirely different local networks it is reasonable to suggest that the purpose is to keep activity coded in each frequency band separate the pattern of neuronal connectivity within a single cortical column is extremely rich (binzegger et al ., 2004; thomson et al ., 2002). A solution to the interference problem can be found if the ratio of frequencies is in this situation the two rhythms never fully synchronise and the phase relationship between frequencies constantly changes . Coexistent gamma and beta2 rhythms in association cortex provide an example of this method from minimising interference . The two rhythms are generated in different cortical laminae and survive physical separation of these laminae (roopun et al ., 2006). The ratio of modal peak frequencies is approximately phi, resulting in a periodic pattern of change in low - level synchrony between laminae with period equal to the sum of the two periods of oscillation present . This phenomenon can occur, to some extent, with any pair of co - expressed frequencies . However, in using phi as a common ratio between adjacent frequencies in the eeg spectrum (figure 1), the neocortex appears to have found a way to pack as many, minimally interfering frequency bands as possible into the available frequency space . (a) when frequency ratio (r) is irrational the phase relationship between two concurrently generated frequencies is non - stationary . Traces show lfp activity in superficial and deep cortical laminae during concurrent 1 and 2 rhythm expression (roopun et al ., 2008). In this case average synchrony between oscillators is near - zero, with a periodic change in instantaneous phase corresponding to the sum of the periods of the two rhythms shown . (b) when r is an integer a stable phase difference can be seen between the two rhythms recorded from single or pairs of brain regions . The figure shows band - pass filtered activity the 1 and bands in meg recordings, and the corresponding plot of phase difference between the bands (modified and reproduced with permission from palva et al ., 2005). The phenomenon is observed as an amplitude modulation of one frequency relative to the phase of a lower frequency . The figure shows the nesting of spontaneous 1 rhythms within a concurrent rhythm, and the concurrent amplitude modulation of the rhythm by a coexistent 1 rhythm in macaque supragranular cortex (figure modified and reproduced with permission from lakatos et al ., 2005). If the cortex uses different frequency bands to process different aspects of incoming information then it must also possess the ability to combine information held in these bands to reconstruct this input . Patterns of sensory information are capable of subtle modification of peak frequencies associated with processing input (gieselmann and thiele, 2008) such that the background framework of minimally interfering multiple frequencies (above) is disrupted . In such a situation it is possible that frequency ratios may become more favourable for direct temporal interaction between bands . When frequency ratios are integer values, strong phase synchrony can be seen in human meg recordings (palva et al ., 2005). The key feature of this relationship is that phase between two frequencies must be non - randomly ordered . Stable (i.e. Non - random) phase relationships (figure 2b) are seen between frequencies with ratios of 2, 3 and 4 during mental arithmetic tasks in topographically localised regions of neocortex, and the phenomenon has been proposed to be involved in memory matching and attention (sauseng et al ., 2008). Perhaps the most readily observable form of cross - frequency interaction is that of nesting. Here the amplitude (power) of a discrete frequency band is modified according to the phase of a lower frequency, coexistent rhythm (figure 2c). This pattern is seen when considering gamma rhythms coexisting with theta frequency oscillations in hippocampus (bragin et al ., 1995). Nesting of delta, theta and gamma rhythms exists both in hippocampus (penttonen and buzsaki, 2003) and neocortex (lakatos et al ., 2005). This arrangement of rhythms ensures successively higher frequencies are maximally expressed in a manner dependent on the lower frequencies in the hierarchy and does not, per se, imply precise phase relationships . However, when nesting is seen it is possible to discern stable phase relationships between different frequencies in a manner, at least superficially, similar to phase synchrony (lakatos et al ., 2005). However, it is also possible for a local circuit generating a single frequency rhythm to switch frequencies . Such changes in the modal peak frequency of cortical local circuits are facilitated by a range of mechanisms including changes in neuronal intrinsic conductances and non - reciprocal interactions with other regions oscillating at a similar frequency . Evidence for the first of these examples comes from work using transient, tetanic stimulation of afferent input to hippocampal area ca1 or neocortex . When a small area of cortex is stimulated a gamma frequency rhythm is generated riding on a post - stimulus depolarisation of both principal cells and local circuit interneurons (traub et al ., 1996). The basic feature of this form of gamma rhythm is the locally synchronous activity generated by interneuron networks, with resulting inhibitory postsynaptic potentials (ipsps) governing the times at which principal cells may generate action potentials . These principal cell action potentials feed back to local interneurons to generate and modify interneuronal spiking . However, when stimulation is more intense, or more than one region is co - activated, this gamma rhythm transforms into a beta frequency oscillation, with this frequency being approximately half that of the original gamma rhythm . Firstly, and most importantly, an increase in principal cell spike afterhyperpolarisation (ahp) is seen as the post - tetanic response progresses . After a few seconds the ahp becomes both larger and longer than the underlying ipsps received by principal cells, preventing them from firing action potentials on each period of the on - going interneuron network gamma rhythm the cells effectively miss alternate beats (figure 3a). Secondly, if principal cell recurrent excitatory synaptic potentials are sufficiently large the system organises such that most principal cells fire on the same gamma period, and thus miss the next period owing to large ahps . As most principal neurons are missing alternate beats together the network output switches to near - half the original gamma rhythm a beta frequency (whittington et al ., 1997) the resulting beta rhythm may facilitate long - range synchronisation of activity (kopell et al ., 2000) and can serve to temporally segregate co - active networks on the basis of magnitude of excitation received (olufsen et al ., 2003). The figure shows three frequency transform examples, along with cartoons of relevant network components . Only the main components responsible for the oscillations and their transition are represented in the cartoons . (a) gamma to beta transition induced by increased afterhyperpolarisation (ahp) conductance in principal cells . Large - amplitude gamma rhythms induced by brief tetanic stimuli in hippocampus may switch abruptly to beta frequencies when principal cell ahp duration becomes longer than that of synaptic gabaa receptor - mediated inhibition producing beat skipping. The graph shows instantaneous interspike intervals from ca1 pyramidal cells during such a transition (graph modified and reproduced with permission from whittington et al ., a similar frequency - halving phenomenon can be induced when feedforward excitation to local circuit interneurons combines with local excitation to produce multiple interneuron action potentials on alternate gamma periods . The graph shows spectra from lfps in area ca1 when the region passively responds to input from the ca3 gamma generator (black line), and when ca1 also generates its own gamma rhythms locally (red line). (c) concatenation of two different local circuit periods through reciprocal interaction . In neocortex, reducing excitation to co - active networks generating 1 and 2 frequencies results in a single 1 frequency rhythm . Graphs show spectrograms of local field potential recordings from parietal cortex lii (1) and lv (2) before application of low concentration of nbqx (1). However, a similar missed beat beta transformation can be seen when spike rates are very low (c.1 hz). The excitatory connectivity between hippocampal areas ca3 to ca1 is non - reciprocal, with gamma rhythms in vivo and in vitro being generated in area ca3 and propagated to a mainly passive ca1 via schaffer collaterals (csicsvari et al . In such a situation the ca1 network generates gamma rhythms because of the phasic, feedforward excitation from ca3 onto fast - spiking (fs) interneurons . However, if ca1 principal cells are co - activated, or spike frequency increased with serotoninergic neuromodulation, then local interneurons may receive double the synaptic excitation (bibbig et al ., 2007). This profile of excitatory inputs generates two action potentials per gamma period, with long interspike intervals relative to the interneuron doublet spikes seen for reciprocally interacting networks (traub et al ., 1996). These multiple interneuron spikes produce a much larger ipsp onto principal cells . With large ipsps, principal cell membrane potential fails to repolarise to threshold for spike generation before the next barrage of feedforward excitation onto ca1 interneurons and so, again, alternate beats of the original gamma rhythm projected from ca3 are missed thus effectively halving the network frequency (figure 3b). The previous sections described examples of interactions between rhythms in which the frequencies generated by two participating networks are unchanged (section interactions between stable frequency bands) or, in contrast, the frequency generated by a single network is altered (section transformation of single frequency bands: gamma to beta frequency transitions). We have recently defined an additional type of interaction where features of both these processes are evident: a gamma frequency rhythm generated by a superficial layer neocortical network can interact with a beta2 frequency rhythm generated by a deep layer neocortical network . The combined network generates a different frequency (beta1: 1317 hz), but the intrinsic periodicity of both network components is preserved (roopun et al ., 2008, figure 3c). The transition between minimal - interference between the gamma and beta2 networks (figure 2a) and a stable phase relationship at beta1 frequencies (figure 4a) appears related to the pattern of excitation each network receives . With strong tonic excitation of deep and superficial cortex the networks operate in a minimal - interference model . However, if excitation is partially lowered, to mimic the fade in excitatory drive, over time, from ascending thalamocortical inputs, then both rhythms, as local field potentials are transformed into a beta1 rhythm . Detailed analysis of the behaviour of some individual cells types in deep and superficial cortical networks, and the functional connectivity between them has been used to construct a computational model of the circuits involved (kramer et al . (i.e. One period of the original gamma rhythm followed by one period of the beta2 rhythm) continued activity in lv intrinsically bursting (ib) neurons, during the lowered excitation is revealed to be key . In the model this continued activity is generated by nmda receptor - dependent synaptic plasticity and, experimentally, nmda receptor blockade destroys the transformation of coexistent gamma and beta2 rhythms into a single beta1 frequency rhythm (kramer et al ., the observed sequence of events in a single beta1 period is as follows: output from lv principal neurons excite superficial layer, fs interneurons (thomson and morris, 2002). The resulting fs interneuronal spike induces an ipsp in superficial layer regular spiking (rs) principal cells (figure 4b). Action potentials are generated in the rs cell on the rebound from this ipsp (see below). This output, in turn, activates superficial layer, low threshold spiking (lts) interneurons which provide a slower, dendritic gabaergic ipsp back onto lv principal cells (e.g. See silberberg and markram, 2007). Lv cells then generate output on the rebound from this dendritic inhibition and the process repeats itself . A mechanism underlying period concatenation of superficial 1 and deep 2 cortical rhythms . (a) (a) the principal feature of the 1 rhythm as a concatenation sum of co - expressed 1 and 2 rhythms is an asymmetric cross correlogram when comparing local field potential (lfp) activity in superficial (lii) and deep (lv) cortical laminae . Prior to concatenation, cross correlogram of 1 and 2 rhythms is almost flat (black line). During the 1 rhythm correlation peaks however, peak lead and lag, relative to 0 ms, are 25 and 40 ms the histogram (b) shows the distribution of lv intrinsically bursting neuronal units relative to single units from lii neurons . (b) representative neuronal activity patterns in four major cell types all aligned to the peak of the concurrently recorded lfp . In the sequence covering a single 1 period the initial spike generation is in lv intrinsically bursting neurons (ib, red). This is rapidly followed by spiking in superficial fast - spiking interneurons (fs, green). Approximately one gamma period later a spike is generated on the rebound of the superficial layer regular spiking neuron (rs, blue), rapidly followed by a spike from the liii low threshold spiking neurons (lts, black). (c) the concatenation sequence is readily observable in synaptic inputs to individual lts neurons . Both excitatory postsynaptic potentials (epsps) and inhibitory postsynaptic potentials (ipsps) occur with interevent intervals that alternate between one 1 and one 2 period ., modelling predicts an absolute requirement for h - current in both deep and superficial layer principal cells . Testing this prediction by blocking h - current with zd7288 in cortical slices showed that the beta1 rhythm was indeed abolished (kramer et al ., 2008). In addition, the mechanism underlying the observed beta2 period in the concatenated beta1 rhythm was different to that governing beta2 periodicity before concatenation occurred . With beta2 rhythms existing alone in lv the period length was generated, for the most part, by bursting in ib neuronal axons coupled by gap junctions (roopun et al ., 2006). In contrast the beta2 period seen during concatenated beta1 rhythms arose from the kinetics of lts cell - mediated inhibition to lv principal cell dendrites . Thus, the principal cells active in the original two concurrently generated frequencies (gamma and beta2 rhythms) remain active in the concatenated rhythm . But instead of deep and superficial circuits generating oscillations separately, their activity is combined via feedforward inhibition between laminae with activation of superficial layer fs cell input to superficial rs cells providing a loop delay of approximately one gamma period in duration and activation of lts cell input to deep layer ib cells providing a loop delay of approximately one beta2 period . During activity in this combined network principal cell activity flip - flops between lv and lii / iii neurons with alternate application of the two delays above . It appears therefore, that in the concatenation process the basic timecourses of local circuits responsible for the component frequency bands are still active, but the nature of their interaction with each other governs the spectral content of the network rhythm observed . However, it is interesting to note that in neocortex the ratio of adjacent frequency bands is approximately phi (see above). This pair of observations (concatenation and the phi frequency ratio) suggests that any pair of adjacent frequency bands may concatenate to form a third in the sequence illustrated in figure 1 . For example, we have shown how gamma and beta2 rhythms may concatenate for form a beta1 frequency rhythm . But with a constant ratio of phi between frequencies it is also possible that beta2 and beta1 rhythms may concatenate to form an alpha rhythm and so on . Thus a single, simple phenomenon (concatenation) may provide a substrate to link every one of the rhythms seen in neocortex in vitro . The authors are not aware of this being shown in human and in vivo animal recordings to date, but sufficiently controlled experiments, on going in a number of laboratories, are possible to establish or dismiss this idea . Can interactions between multiple spatiotemporal scales of activity tell us anything about how the cortex processes sensory information? One answer may come in the form of slow feature extraction (wiskott and sejnowski, 2002). In the temporal domain, the ability of a system to sort rapidly changing features of an input from more slowly changing features provides an efficient means to detect optimal solutions in object recognition tasks . A hierarchical arrangement of feature detection, over a range of temporal scales, can reproduce many properties of individual neurons in visual cortex (berkes and wiskott, 2005). Thus, from a computational perspective, it is advantageous for the cortex to process different temporal scales of information separately . If this separation is performed using different frequencies of cortical rhythms then this also imparts a spatial, anatomical scale to activity patterns it has been shown that rhythms with larger temporal scales (slower frequencies) facilitate interactions (within the synchronisation framework of neuronal assembly formation) over greater distances in cortical networks (kopell et al ., 2000). Considering this phenomenon in visual cortex suggests that slower rhythms may synchronise over larger areas of the retinotopic map this leads to the possibility of a role for different frequencies of cortical rhythm in processing sensory information on different spatial scales also . A connection between cortical rhythm frequency and the spatial frequency of sensory input comes from insightful psychophysical experiments using the bubbles technique (gosselin and schyns, 2001). In a visual task designed to test perceptual shifting from features of an object with low spatial frequency to those with high spatial frequency, a direct correlation was seen between spatial scale of the sensory object and the temporal scale (frequency) of associated cortical rhythms (smith et al ., 2006). However, if different scales of information are processed on different scales of temporal neuronal activity (frequencies of brain rhythm) the brain must have a means to combine information in these frequency channels in order to fully represent a sensory object . Cross - frequency phase synchronisation constitutes a possible substrate for such a combination . While previous studies have shown phase synchronisation between frequencies with integer ratios (palva et al ., 2005), stable phase relationships are also generated by period concatenation (figure 4a, roopun et al ., 2008). Thus concatenation of multiple coexistent cortical rhythms, on different temporal scales, may provide a putative mechanism by which an object whose features are presented with high spatial frequency may be represented within the context of accompanying features presented at lower spatial frequencies . Figure 5a shows an image containing a pocket watch with main dial and smaller secondary dial . To identify the smaller dial as part of the watch as a whole the higher spatial scale of the secondary dial detail needs to be registered with the lower spatial scale of the main dial . This not a problem if the entire image is sampled with a high spatial scale, but a far more computationally efficient process is to use two different spatial scales, each with the same information content (number of pixels in this example). In this manner the higher spatial scale required to recognise the secondary dial can be placed in the context of the watch as a whole with only a two - fold increase in overall information content . Figure 5b illustrates a schematic of how this may be achieved with concatenation of different frequencies . Higher spatial scale information, required to recognise the secondary dial corresponds to higher temporal scale (frequency) of cortical rhythm timing the barrage of action potentials generated on presentation of the image . The contextual information (lower spatial scale of the main dial) is concurrently processed at a lower temporal scale (frequency) of cortical rhythm . By concatenation of these two frequency channels stable cross - frequency phase relationships are generated, indicating that both scales of information may be co - registered in a single, lower frequency, rhythm the concatenation sum . (a) what is the most efficient way to recognise the smaller dial of a pocket watch as secondary to the main dial? The image on the left is rendered from a 512 512 pixel digital image . From this it is easy to answer the above question, but a very large amount of information is needed (> 260 k pixels). If the image is split into two different spatial scales the process can be achieved more efficiently . The upper image in the middle panel is a downsampled, smoothed representation of the secondary dial (rendered from 128 128 pixels). The lower image in the middle panel is an identically downsampled, smoothed version of the entire image (again, rendered from 128 128 pixels). A partial composite of the information held at these two spatial scales provides sufficient information to answer the above question using c.10% of the original information [2 (128 128) = c.32 k pixels]. (b) a schematic representation of how period concatenation may facilitate the process described in (a). Spike activity corresponding to neurons activated by sensory input contain transiently synchronous patterns of activity at different interspike intervals . The cartoon on the left shows coincident spikes recurring with high frequency (red) and lower frequency (blue) within the overall pattern of activity . Extrapolating two spatial frequencies of input to two temporal frequencies of cortical rhythm provides a putative framework for independent processing of the two information streams (middle panel). Concatenation of the activity in local circuits responsible for generating the two frequencies produces a third, lower frequency (the concatenation sum) containing sequential periods of the original two rhythms . Period concatenation constitutes a robust mechanism for interaction between the many discrete frequencies of rhythm observable in neocortical networks . Data on period concatenation of gamma and beta2 rhythms into a beta1 frequency rhythm reveal a combination of features seen in previously described frequency interactions and transformations: firstly, concatenation stabilises the phase relationship between the gamma and beta2 generating networks a phenomenon critical to the establishment of phase synchrony . Secondly, the periodicity of both component networks is still manifest in the pattern of synaptic interaction between individual neurons, as seen for single, gamma - generating networks producing beta rhythms as a subharmonic . In addition, the constant ratio of adjacent frequency bands seen in in vitro neocortical rhythm studies (figure 1) suggests that all observed bands may be interrelated via concatenation . With a ratio of c.1.6 not only can gamma and beta2 rhythms concatenate to form a beta1 rhythm, but beta2 and beta1 rhythms may concatenate to form an alpha rhythm and alpha and beta1 rhythms concatenate to form a theta rhythm etc . Thus a hierarchical arrangement of frequencies may exist through concatenation in a similar manner to that seen for nested rhythms, but on a finer temporal scale . Such an arrangement fits the hierarchical organisation of network anatomy in the brain very well (sporns et al ., 2004), and has been inferred from the dynamic profile of human eeg data (weiss and weiss, 2003). This pattern of inter - relationships between discrete rhythms may provide a possible network dynamic substrate for multi - scale, parallel processing of sensory information over a range of temporal (wiskott and sejnowski, 2002) and spatial scales (smith et al ., 2006). The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Exchange experiments involving the transfer of heteronuclear longitudinal magnetization of product operator terms such as izsz or sz were introduced by montelione et al . To quantitate transitions between different conformations of biomolecules for which isolated resonances are observed (montelione and wagner 1989). These experiments have played an important role in nmr dynamic studies of biological systems ever since, because they provide access to functionally important dynamic processes occurring on time scales ranging from ~0.5 to ~50 s. in addition, they offer the possibility to resolve these processes on a per - residue basis and without perturbing the system from thermodynamic equilibrium, a feature that makes nmr spectroscopy an indispensable instrument for the analysis of macromolecular dynamics (mittermaier and kay 2009). Longitudinal exchange experiments are based on the quantification of magnetization transfer between exchanging conformers during a mixing time . In the standard (frequency - labeled) setup, four peaks are observed for each spin, i.e. Two direct correlation (diagonal) peaks and two exchange cross peaks (fig . 1). In order to measure the interconversion rates between the exchanging conformers, a series of spectra is recorded for a range of mixing times, and the magnitudes of the four peaks are quantified by fitting the appropriate theoretical curves to the experimental data (fig . Several variants of this setup have been described, including 2d, 3d and pseudo-4d trosy selected / detected versions (hwang and kay 2005; sahu et al . 2002) as well as zero - quantum / double quantum coherence versions to resolve chemical shift degeneracy (robson et al . 2010).fig . 1a scheme of a 2d longitudinal exchange experiment (montelione and wagner 1989). After frequency - labeling in an indirect dimension, t1, magnetization associated with state a (b) (shown in red and black, respectively) either remains a (b) or is converted to b (a) during a variable mixing time (mix). Subsequent frequency - labeling in the direct dimension (t2) gives rise to two direct correlation (aa and bb) and two exchange cross peaks (ab, ba), respectively . B if the order of chemical shift evolution (t1) and mixing times is interchanged, exchange cross peaks are not resolved but remain part of the two direct correlation peaks a and b, which corresponds to the collapse of aa with ba and bb with ab, respectivelyfig . 2a time dependence of normalized direct correlation peaks aa and bb (red and blacksolidlines, respectively) and exchange cross peaks ab and ba (red and blackdashedlines), simulated using (1) and (2). Parameters: kab = 0.8 s, kba = 1.2 s, r1a = 2.0 s, r1b = 2.0 s. b as in a, but without normalization by maa(0) and mbb(0) (but maa(0) + mbb(0) set to 1). C time dependence of normalized direct correlation peaks a and b [(3), red and blackdashedlines], as well as aa and bb [(1), red and blacksolidlines], using the same parameters as in a. the curves for a and b are identical if r1a = r1b . By taking the difference between a and aa (b and bb) curves it is possible to reconstruct the correctly normalized exchange curves ab (ba) shown in a. d as in c but without normalization by ma(0), maa(0) and mb(0), mbb(0), respectively . Here, the differences between a and aa (b and bb) are equal a scheme of a 2d longitudinal exchange experiment (montelione and wagner 1989). After frequency - labeling in an indirect dimension, t1, magnetization associated with state a (b) (shown in red and black, respectively) either remains a (b) or is converted to b (a) during a variable mixing time (mix). Subsequent frequency - labeling in the direct dimension (t2) gives rise to two direct correlation (aa and bb) and two exchange cross peaks (ab, ba), respectively . B if the order of chemical shift evolution (t1) and mixing times is interchanged, exchange cross peaks are not resolved but remain part of the two direct correlation peaks a and b, which corresponds to the collapse of aa with ba and bb with ab, respectively a time dependence of normalized direct correlation peaks aa and bb (red and blacksolidlines, respectively) and exchange cross peaks ab and ba (red and blackdashedlines), simulated using (1) and (2). Parameters: kab = 0.8 s, kba = 1.2 s, r1a = 2.0 s, r1b = 2.0 s. b as in a, but without normalization by maa(0) and mbb(0) (but maa(0) + mbb(0) set to 1). C time dependence of normalized direct correlation peaks a and b [(3), red and blackdashedlines], as well as aa and bb [(1), red and blacksolidlines], using the same parameters as in a. the curves for a and b are identical if r1a = r1b . By taking the difference between a and aa (b and bb) curves it is possible to reconstruct the correctly normalized exchange curves ab (ba) shown in a. d as in c but without normalization by ma(0), maa(0) and mb(0), mbb(0), respectively . Here, the differences between a and aa (b and bb) are equal the apparent simplicity of the analysis of longitudinal exchange experiments is, however, deceiving, as there are several pitfalls that have to be accounted for in order to avoid systematic errors . First, different relaxation properties of the two species result in different transfer efficiencies during inept step(s) (tollinger et al . Second, and more importantly, the analysis of kinetic properties from this experiment may suffer from substantial systematic errors if the line - widths of the two species are different (fig . Unless precautions are taken to ensure precise determination of peak volumes, errors due to systematic over- or underestimation of the magnitudes of exchange cross peaks can have a significant impact on the fitting results.fig . A peaks associated with state a during t2 detection (aa direct correlation and ba exchange cross peaks) have identical line widths (lwa) in the direct dimension, which can be different from that of bb and ab (lwb). Because quantification of ab (ba) exchange cross peaks requires normalization by aa (bb) direct correlation peaks at zero mixing time, exact peak volumes rather than intensities or partial peak volumes have to be used for analysis of the data . B simulation of the effect of approximating peak volumes by intensities for normalized exchange curves, using (2). Parameters: kab = 1.0 s, kba = 1.0 s, r1a = 2.0 s, r1b = 2.0 s. assuming lorentzian line shapes (where int = vol / lw), normalized exchange curves based on intensity measurements are simulated for lwa / lwb = 0.7, 0.8, 0.9, and 1.0 . Ab and ba exchange curves are shown in red and black, respectively . Only if lwa = lwb, or if exact (direct correlation and exchange cross peak) volumes are used, ab and ba exchange curves are identical, as is expected for kab = kba (superimposed red and blackdashedlines) effect of differential line - broadening in 2d frequency - labeled experiments . A peaks associated with state a during t2 detection (aa direct correlation and ba exchange cross peaks) have identical line widths (lwa) in the direct dimension, which can be different from that of bb and ab (lwb). Because quantification of ab (ba) exchange cross peaks requires normalization by aa (bb) direct correlation peaks at zero mixing time, exact peak volumes rather than intensities or partial peak volumes have to be used for analysis of the data . B simulation of the effect of approximating peak volumes by intensities for normalized exchange curves, using (2). Parameters: kab = 1.0 s, kba = 1.0 s, r1a = 2.0 s. assuming lorentzian line shapes (where int = vol / lw), normalized exchange curves based on intensity measurements are simulated for lwa / lwb = 0.7, 0.8, 0.9, and 1.0 . Ab and ba exchange curves are shown in red and black, respectively . Only if lwa = lwb, or if exact (direct correlation and exchange cross peak) volumes are used, ab and ba exchange curves are identical, as is expected for kab = kba (superimposed red and blackdashedlines) because determining peak volumes by integration requires fitting to a functional form, this is particularly challenging in cases where non - canonical line - shapes (resulting from conformational exchange processes occurring on the mss time scale) are encountered, which are not known a priori . Moreover, it can sometimes be impractical to precisely measure the volumes of small exchange cross peaks with low signal - to - noise ratio, as typically encountered for short mixing times, in particular in the vicinity of strong direct correlation peaks . To circumvent integration, peak volumes are often approximated by partial peak volumes that are obtained by summation of the intensities of data points within a defined interval . Partial peak volumes are, however, dependent on the choice of the summation interval with respect to the line - width (rischel 1995), thereby complicating the normalization of peaks with different line - widths . To improve the precision in the determination of longitudinal exchange kinetics, a quadratic approximation was proposed for the analysis of the data by employing a composite ratio of exchange and direct correlation peak intensities . This approach does, however, require that equilibrium constants can be determined from other experiments (miloushev et al . We present a simple and robust alternative to the standard setup of multidimensional longitudinal exchange experiments for biomolecules . Our approach is based on collecting two complementary data sets, one where exchange cross peaks are resolved, and a second one where they are not . This strategy is reminiscent of (one - dimensional) approaches comparing selective and non - selective inversion recovery measurements, as pioneered by hoffman and forsen (1966a, b). Combining the two data sets eliminates systematic errors that can be caused by differential line - broadening and enables reliable quantification of kinetic and relaxation parameters . As an example, we have used this experimental setup to characterize conformational exchange in a selectively c labeled sample of a bistable dna oligomer . A sample of bistable dna (tcgtaccggaaggtacgaaccttccg) (puffer et al . 2009) was synthesized and purified as described (kloiber et al . 2011), introducing isolated methyl (chd2) labels into thymidines to avoid complications due to cross - correlated relaxation in the methyl group . The nmr sample contained 1.0 mm dna, 50 mm sodium arsenate buffer, ph6.5, and 100% d2o, all nmr spectra were recorded at 33c . 2-dimensional longitudinal exchange experiments were recorded using pulse sequences that are based on the scheme described by farrow et al ., but employing the exchange of two - spin heteronuclear order, izsz (farrow et al . C frequency labeling preceded the mixing time, while in the second experiment the order of indirect evolution (c frequency labeling) and mixing times was interchanged . Deuterium decoupling was employed during c (t1) and h (t2) detection . Nmr spectra were recorded on a varian inova spectrometer operating at a larmor frequency of 500 mhz . Series of 10 2d spectra (with and without frequency labeling) were collected, with mixing times ranging from 10 to 800 ms . Spectra were recorded as complex data matrices composed of 512 38 points, with maximum acquisition times of 127 and 64 ms in the c and h dimensions, respectively . 32 scans per fid were obtained with a recycle delay of 2 s, resulting in a total experimental time of 18.5 h for each series . 1995) and in - house written fitting scripts . The t1 (t2) time domain data were apodized using a gaussian function, linear predicted to 128 data points (t1), and zero filled to 4,096 256 points . Partial peak volumes were obtained by adding the intensities in boxes of 7 7, 5 5 or 3 3 data points centered on the peak maximum . A least - squares fitting procedure was employed to extract kab, kba and r1a, r1b by fitting the expressions given in (1) and (3) to the measured partial peak volumes, along with maa(0), mbb(0) and ma(0), mb(0) values, respectively . For comparison, the two direct correlation peaks along with the single resolved exchange cross peak for each spin label were used to extract kab, kba and r1a, r1b by fitting the appropriate expressions given in (1) and (2) to the measured partial peak volumes (3 3 data points). In all cases, experimental uncertainties were estimated via a monte carlo approach in which 200 synthetic data sets were generated from the best - fit values of kab, kba and r1a, r1b by adding random errors based on the signal - to - noise ratio to the best - fit curves . Errors quoted in the paper are the standard deviations in fitted parameters that were obtained in this procedure . A sample of bistable dna (tcgtaccggaaggtacgaaccttccg) (puffer et al . 2009) was synthesized and purified as described (kloiber et al . 2011), introducing isolated methyl (chd2) labels into thymidines to avoid complications due to cross - correlated relaxation in the methyl group . The nmr sample contained 1.0 mm dna, 50 mm sodium arsenate buffer, ph6.5, and 100% d2o, all nmr spectra were recorded at 33c . 2-dimensional longitudinal exchange experiments were recorded using pulse sequences that are based on the scheme described by farrow et al ., but employing the exchange of two - spin heteronuclear order, izsz (farrow et al . 1995). In one experiment c frequency labeling preceded the mixing time, while in the second experiment the order of indirect evolution (c frequency labeling) and mixing times was interchanged . Deuterium decoupling was employed during c (t1) and h (t2) detection . Nmr spectra were recorded on a varian inova spectrometer operating at a larmor frequency of 500 mhz . Series of 10 2d spectra (with and without frequency labeling) were collected, with mixing times ranging from 10 to 800 ms . Spectra were recorded as complex data matrices composed of 512 38 points, with maximum acquisition times of 127 and 64 ms in the c and h dimensions, respectively . 32 scans per fid were obtained with a recycle delay of 2 s, resulting in a total experimental time of 18.5 h for each series . Data were processed and analyzed using nmrpipe and nmrdraw software (delaglio et al . 1995) and in - house written fitting scripts . The t1 (t2) time domain data were apodized using a gaussian function, linear predicted to 128 data points (t1), and zero filled to 4,096 256 points . Partial peak volumes were obtained by adding the intensities in boxes of 7 7, 5 5 or 3 3 data points centered on the peak maximum . A least - squares fitting procedure was employed to extract kab, kba and r1a, r1b by fitting the expressions given in (1) and (3) to the measured partial peak volumes, along with maa(0), mbb(0) and ma(0), mb(0) values, respectively . For comparison, the two direct correlation peaks along with the single resolved exchange cross peak for each spin label were used to extract kab, kba and r1a, r1b by fitting the appropriate expressions given in (1) and (2) to the measured partial peak volumes (3 3 data points). In all cases, experimental uncertainties were estimated via a monte carlo approach in which 200 synthetic data sets were generated from the best - fit values of kab, kba and r1a, r1b by adding random errors based on the signal - to - noise ratio to the best - fit curves . Errors quoted in the paper are the standard deviations in fitted parameters that were obtained in this procedure . The first one is analogous to the two - dimensional experiment described by montelione et al ., where heteronuclear chemical shift evolution precedes the mixing time and four resonances, two direct correlation and two exchange cross peaks, all frequency - labeled in both dimensions, are observed for each spin (montelione and wagner 1989). In the second experiment, the order of chemical shift evolution and mixing times is interchanged, so that exchange cross peaks are not resolved but remain part of the corresponding direct correlation peaks (fig . 1). Analysis of the time dependence of only the direct correlation peaks in the two experiments with and without frequency - labeling eliminates systematic errors that arise from differential line broadening effects, as described below . In the frequency - labeled experiment, the time dependence of the direct correlation peaks of a two - site exchanging system is given by (farrow et al . 2001)1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} {{{\text{m}}_{\text{bb}} \left (t \right)} \mathord{\left/ {\vphantom {{{\text{m}}_{\text{bb}} \left (t \right)} {{\text{m}}_{\text{bb}} \left (0 \right)}}} \right . \kern-\nulldelimiterspace} {{\text{m}}_{\text{bb}} \left (0 \right)}} & = \frac{1}{{\left ({\lambda_{1} - \lambda_{2}} \right)}}\left [{\left ({a_{11} + \lambda_{1}} \right) \cdot e^{{\lambda_{1} t}} - \left ({a_{11} + \lambda_{2}} \right) \cdot e^{{\lambda_{2} t}}} \right] \\ {{{\text{m}}_{\text{aa}} \left (t \right)} \mathord{\left/ {\vphantom {{{\text{m}}_{\text{aa}} \left (t \right)} {{\text{m}}_{\text{aa}} \left (0 \right)}}} \right . \kern-\nulldelimiterspace} {{\text{m}}_{\text{aa}} \left (0 \right)}} & = \frac{1}{{\left ({\lambda_{1} - \lambda_{2}} \right)}}\left [{\left ({a_{22} + \lambda_{1}} \right) \cdot e^{{\lambda_{1} t}} - \left ({a_{22} + \lambda_{2}} \right) \cdot e^{{\lambda_{2} t}}} \right] \\ \end{aligned} $$\end{document}where maa and mbb are the magnitudes of the direct correlation peaks corresponding to sites a and b, which are normalized by the amount of magnetization associated with states a and b (the magnitudes of the direct correlation peaks at the start of the mixing period, maa(0) and mbb(0), respectively). The eigenvalues of the spin density matrix which includes magnetization transfer effects due to chemical exchange, 1/2, are given by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\lambda _ {1/ 2} = 1/ 2 [- ({a _ {1 1} + {\text{a}} _ {2 2}) \pm [({a _ {1 1} - a _ {2 2}}) ^ {2} + 4a _ {1 2} a _ {2 1}] ^ {1/ 2}}] $$\end{document}, where elements aij are defined as \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$a _ {1 1} = k_{\text{ab}} + r _ {1}^{\text{a}}, a _ {2 2} = k_{\text{ba}} + r _ {1}^{\text{b}}, a _ {1 2} = - k_{\text{ba}} $$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$a _ {2 1} = - k_{\text{ab}} $$\end{document}. Parameters kab and kba denote the microscopic kinetic rate constants that describe the interconversion between states a and b, while r1a and r1b are the longitudinal relaxation rates of magnetization in sites a and b. likewise, the normalized magnitudes of the associated exchange cross peaks in the frequency - labeled experiment are given by (farrow et al . 2001)2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} {{{\text{m}}_{\text{ab}} \left (t \right)} \mathord{\left/ {\vphantom {{{\text{m}}_{\text{ab}} \left (t \right)} {{\text{m}}_{\text{aa}} \left (0 \right)}}} \right . \kern-\nulldelimiterspace} {{\text{m}}_{\text{aa}} \left (0 \right)}} & = \frac{1}{{\left ({\lambda_{1} - \lambda_{2}} \right)}}\left [{- a_{21} \cdot e^{{\lambda_{1} t}} + a_{21} \cdot e^{{\lambda_{2} t}}} \right] \\ {{{\text{m}}_{\text{ba}} \left (t \right)} \mathord{\left/ {\vphantom {{{\text{m}}_{\text{ba}} \left (t \right)} {{\text{m}}_{\text{bb}} \left (0 \right)}}} \right . \kern-\nulldelimiterspace} {{\text{m}}_{\text{bb}} \left (0 \right)}} & = \frac{1}{{\left ({\lambda_{1} - \lambda_{2}} \right)}}\left [{- a_{12} \cdot e^{{\lambda_{1} t}} + a_{12} \cdot e^{{\lambda_{2} t}}} \right]. \\ \end{aligned} $$\end{document} in the experiment without frequency labeling only two direct correlation peaks are observed, one of them with a magnitude, ma, that corresponds to the sum of aa and ab, while the magnitude of the second peak, mb, results from bb and ab . The normalized dependencies of ma and mb are then given by3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} {{{\text{m}}_{\text{a}} \left (t \right)} \mathord{\left/ {\vphantom {{{\text{m}}_{\text{a}} \left (t \right)} {{\text{m}}_{\text{a}} \left (0 \right)}}} \right . \kern-\nulldelimiterspace} {{\text{m}}_{\text{a}} \left (0 \right)}} & = \frac{1}{{\left ({\lambda_{1} - \lambda_{2}} \right)}}\left [{\left ({a_{22} - a_{21} + \lambda_{1}} \right) \cdot e^{{\lambda_{1} t}} - \left ({a_{22} - a_{21} + \lambda_{2}} \right) \cdot e^{{\lambda_{2} t}}} \right] \\ {{{\text{m}}_{\text{b}} \left (t \right)} \mathord{\left/ {\vphantom {{{\text{m}}_{\text{b}} \left (t \right)} {{\text{m}}_{\text{b}} \left (0 \right)}}} \right . \kern-\nulldelimiterspace} {{\text{m}}_{\text{b}} \left (0 \right)}} & = \frac{1}{{\left ({\lambda_{1} - \lambda_{2}} \right)}}\left [{\left ({a_{11} - a_{12} + \lambda_{1}} \right) \cdot e^{{\lambda_{1} t}} - \left ({a_{11} - a_{12} + \lambda_{2}} \right) \cdot e^{{\lambda_{2} t}}} \right] \\ \end{aligned} $$\end{document}where ma(0) and mb(0) are the magnitudes of the peaks a and b at zero mixing time . Using the standard frequency - labeled strategy to extract r1a, r1b and kab, kba involves simultaneous least - squares fitting of (1) and (2) to exchange cross peaks and direct correlation peaks (fig . 2). It is obvious from (2), however, that this requires the normalization of the two exchange cross peaks mab(t), mba(t) by the direct correlation peaks maa(0), mbb(0), respectively . Because mab and maa (as well as mba and mbb) have different line widths in the direct (t2) dimension in most cases (see fig . 3), special care has to be taken to ensure precise determination of peak volumes in order to avoid errors due to systematic over- or underestimation of exchange cross peak magnitudes, and concomitant over- or underestimation of the corresponding kinetic rate constants . This complication can be avoided by using the four direct correlation peaks in experiments with and without frequency - labeling, maa, mbb and ma, mb, respectively, for the analysis of longitudinal exchange . In this case all peaks are normalized by their respective magnitudes at the start of the mixing period, maa(0), mbb(0) and ma(0), mb(0), with inherently identical line widths . Thus, longitudinal relaxation and kinetic rate constants (r1a, r1b and kab, kba) can be extracted from the four direct correlation peaks by simultaneous fitting of (1) and (3) to the experimental data, yielding values that are not distorted by differential line - broadening effects . Consequently, the results are independent of the peak integration method, i.e. Intensities, partial peak volumes or (exact) peak volumes can be used . We have applied this simple strategy to a bistable dna 26-mer that exists in two different conformational (hairpin) sub - states a and b, which interconvert slowly on the nmr chemical shift time scale (puffer et al . Both states are populated to a considerable extent at ambient temperature and in aqueous buffer (ph 6.5), and discrete sets of resonances are observed for a and b (fig . Selective c labeling (chd2-methyl) in thymidines enables the measurement of longitudinal exchange (2-spin order) between folds a and b in time series of 2-dimensional experiments performed with and without c frequency - labeling, respectively . Two thymidines, t4 and t22, were chosen as probes for the interconversion process between the two sub - states because the t22 spin label clearly displays differential line - broadening in folds a and b, consistent with the presence of an a - t / a - t step (a10-t23/a11-t24) in fold b (lingbeck et al . The ab exchange cross peaks of t4 and t22 overlap at 500 mhz and 33c in the chd2-methyl labeled sample, preventing straightforward analysis of the interconversion process between folds a and b by the standard (frequency - labeled) approach.fig . A thymidine methyl group region of a 2-dimensional hc correlation spectrum without (top) and with (bottom) frequency - labeling in (t1) (mixing time 120 ms). Duplex dna, which does not participate in the exchange process, is indicated by an asterisk . B normalized partial peak volumes of a, b, aa and bb direct correlation peaks of spin labels t4 and t22, together with best - fit curves (dashedlines for a, b, solidlines for aa, bb). All four curves ((1) and (3)) were fitted simultaneously to the experimental data for each spin label to yield kinetic rate constants kab = 0.51 0.08 s (t4), kab = 0.42 0.07 s (t22), kba = 0.41 0.07 s (t4), kba = 0.49 0.06 s (t22), and longitudinal relaxation rate constants r1a = 1.21 0.04 s (t4), r1a = 0.67 0.05 s (t22), r1b = 0.90 0.04 s (t4) and r1b = 1.59 0.04 s (t22). Uncertainties were derived from a montecarlo approach experimental longitudinal exchange data recorded for (t4, t22)-methyl c labeled bistable dna . A thymidine methyl group region of a 2-dimensional hc correlation spectrum without (top) and with (bottom) frequency - labeling in (t1) (mixing time 120 ms). Duplex dna, which does not participate in the exchange process, is indicated by an asterisk . B normalized partial peak volumes of a, b, aa and bb direct correlation peaks of spin labels t4 and t22, together with best - fit curves (dashedlines for a, b, solidlines for aa, bb). All four curves ((1) and (3)) were fitted simultaneously to the experimental data for each spin label to yield kinetic rate constants kab = 0.51 0.08 s (t4), kab = 0.42 0.07 s (t22), kba = 0.41 0.07 s (t4), kba = 0.49 0.06 s (t22), and longitudinal relaxation rate constants r1a = 1.21 0.04 s (t4), r1a = 0.67 0.05 s (t22), r1b = 0.90 0.04 s (t4) and r1b = 1.59 0.04 s (t22). Uncertainties were derived from a montecarlo approach figure 4 shows the experimental data obtained for the aa, bb, a and b direct correlation peaks in experiments with and without frequency - labeling, together with best - fit curves using (1) and (3). Kinetic rate constants of kab = 0.51 0.08 s (t4) and kab = 0.42 0.07 s (t22), as well as kba = 0.41 0.07 s (t4) and kba = 0.49 0.06 s (t22) were obtained, with uncertainties derived from a montecarlo approach . Despite the considerable difference in line - broadening between folds a and b for t22, the extracted kinetic rates for this spin label are in good agreement with those of t4, which is consistent with a collective two - state conformational transition between the two folds . As expected, the extracted parameters do not depend on the peak integration method: using partial peak volumes by adding the intensities in 7 7 grids centered on the peak maximum yields values that are identical (within experimental uncertainties) to the ones obtained using 5 5 or 3 3 grids, or by using peak intensities . For comparison, the frequency - labeled data set was used to determine kinetic rate constants by analyzing the single (ba) exchange cross peak that is resolved for each spin label along with its two direct correlation peaks . In this case, only values for one rate constant (kba) could be determined reliably . Only for the t4 spin label the value of kba (0.58 0.10 s) is in good agreement with the value obtained by analyzing aa, bb, a and b direct correlation peaks, while for t22 the magnitudes of normalized ba exchange cross peaks are overestimated due to considerable line - broadening of fold b, which results in an increase of kba (1.17 0.21 s). It is evident from (1) and (3) and fig . 2 that the bi - exponential decays of a and b direct correlation peaks differ from those of the aa and bb direct correlation peaks by an amount that corresponds to the pertinent exchange peak.1 thus, subtraction of normalized aa intensities from a (and bb intensities from b) can, in principle, be employed to formally reconstruct the (correctly!) Normalized magnitudes of the corresponding exchange cross peaks ab (ba) that are not affected by differential line - broadening, as they are computed from two peaks with identical line - widths, and irrespective of cross peak overlap . These exchange cross peak intensities can then be analyzed, together with aa and bb direct correlation peaks, as in the conventional frequency - labeled approach using (1) and (2) to obtain longitudinal exchange and kinetic rate constants . We opt not to do so, however, since analysis of the four direct correlation peaks directly is robust and straightforward . We have presented an alternative way of analyzing longitudinal exchange in two - state exchanging systems by recording pairs of two- (or more) dimensional spectra with and without frequency - labeling in an indirect dimension . Analysis of the time - dependence of the four (2 + 2) direct correlation peaks that are observed in the two experiments enables reliable and robust quantification of the interconversion rates between the two species, along with their longitudinal relaxation rates . This approach partly resolves the issue of cross peak overlap and eliminates errors caused by differential line - broadening of the two species, thereby expanding the applicability of longitudinal exchange experiments to systems with additional conformational exchange on the mss time scale . While our approach increases the experimental time by a factor of two, it significantly reduces the number of sources for systematic errors . We recommend to generally use this strategy in cases where (1) resonances show different line broadening, or (2) exchange cross peaks are overlapped or close to intense direct correlation peaks (which may preclude the determination of their exact volumes).
The information generated from the genome projects will be of the greatest value if it can be converted into functional data, particularly if this increases our understanding of normal gene function and allows strategies to be developed for prevention and treatment of human disease . Likewise, the output of genetic variants of human disease uncovered by the international hapmap project requires effective tools to accurately translate this growing knowledge to model systems for functional studies . Bacterial artificial chromosomes, or bacs, are fertility- (f-) factor - based plasmid vectors that replicate stably in low copy number [2, 3]. Because of their large insert capacity, bacs can carry complete genes containing flanking distant regulatory dna that provide signals for correct spatio - temporal gene expression [49]. As the average size of the protein - coding genes annotated in human genome project is 27 kb, thus, bacs carrying full - length genes in their natural chromosomal setting is becoming an attractive resource for studying genome structure and function, representing an exciting alternative to conventional vector systems . However, until about a decade ago, the large size of bacs has presented major hurdle for their precise manipulation to introduce specific changes such as mutations, reporter genes, and markers for functional studies in the mammalian environment [1113]. To address this problem, a number of techniques were developed in the late 1990s that were based on homologous recombination pathways, which meant they were not limited by the size of a bac, permitting much more flexible engineering compared to conventional genetic engineering using restriction enzymes or site - specific recombination methods . One of these is recombineering (recombination - mediated genetic engineering), which was adapted from bacteriophage where the recombination genes were carefully delineated and moved to mobile plasmid systems that were transferable to host e. coli strains . Recombineering technology has gradually evolved into a powerful new approach to studying genetic function using genes in their natural genomic context that were widely available from clones in bac libraries . Furthermore recombineering have been further improved by combining with other genetic engineering methods such as site - specific integration systems for more sophisticated bac manipulations [1619]. This paper will focus on the rise of recombineering as the major homologous recombination - mediated approach for bac modifications, as well as its novel applications and future prospects in the art of genetic tinkering . Recombineering is defined as homologous recombination mediated by phage - based recombination systems, which include the rac prophage - derived rece pathway and also the e. coli phage red pathway (table 1) (reviewed by copeland et al . ). The rece pathway principally involves rece and rect proteins, while the red pathway is mediated by its exo and beta proteins (reviewed by court et al . ). The key feature of recombineering strategies is that it is independent of e. coli endogenous homologous recombination functions, and it therefore, can be transferred using mobile plasmids into hosts that are recombination deficient (e.g., reca background) to introduce recombination proficiency transiently [2124]. Transient systems that expose the target dna for only a short time to the recombination enzymes provide the added benefit of facilitating the stable modification of dna substrates that are traditionally prone to rearrangements due to recombination, for example, bacs containing repetitive dna . Recombineering can be used for many modes of bac mutagenesis as well as cloning, based on the design of the targeting substrate (figure 1). The target site can be either on a resident plasmid, chromosomal region, or even exogenous source of dna, while the incoming targeting substrate can either be a linear dsdna [21, 22] or single - stranded oligonucleotides [27, 28]. As the required length of shared homology for efficient recombineering is typically only 4050 bp, targeting substrates can be easily produced by standard pcr procedures or oligo synthesis . The ability of recombineering to mediate recombination with open - ended linear dsdna is made possible by the additional expression of gamma (gam) protein to the red [21, 29] and rece pathways [22, 23]. Gam inhibits the exonuclease activity of recbcd and spares linear dsdna from degradation, allowing it to recombine to its target [30, 31]. With coordinated control of gam expression, bacs can be modified in recbcd+ host strains with linear dsdna while avoiding the deleterious effects of recbcd null mutation and constitutive gam expression on cell viability [23, 31, 32]. On the other hand, recombineering with single - stranded oligos requires only the function of beta or rect and is only slightly affected by recbcd in the absence of gam expression . By incorporating homologous sequences at the two ends of the targeting substrate to correspond to sequences flanking a target site, recombination at the two homologous sites can effectively insert the targeting substrate in place of the target site (figure 1(a)). This is a straightforward one - step strategy to delete a gene of interest while introducing a foreign sequence, usually a selectable antibiotic marker gene or a transgene of interest . If no native dna needs to be removed, new sequences can also be introduced by designing the flanking homology arms of the targeting substrate to correspond to the target site without any gap in between (figure 1(b)). Operational sites such as antibiotic marker and recombinase recognition sites (loxp, frt, etc .) Besides the removal, insertion, or replacement of large segments, subtle modifications with no operational sequence introduced can be achieved by the selection / counter - selection strategy (figure 1(c)). This two - round recombineering strategy first involves the replacement of the target site with a selectable cassette, of which the presence can be selected for and against . The cassette is then subsequently replaced by a modified version of the target site, and the correct recombinants are recovered by selecting against the selectable cassette . Popular options of counter - selection markers include sacb, rpsl, i - scei endonuclease, as well as markers that can both be selectable for and against including galk, thya, and tolc . Subtle mutations such as nucleotide substitution can also be generated in single - step recombineering with ss - oligo as targeting substrate; however, screening of colonies will be required to detect correct recombinants . One remarkable use of recombineering is the effective gap repair cloning of any target site of interest, which is similar to transformation - associated recombination (tar) cloning in recombination - proficient yeast . This is done by constructing a cloning vector with homology arms corresponding to the target site, which is joined to form circular closed plasmid following recombination (figure 1(d)). This in vivo cloning application is a powerful method as it can facilitate retrieval of a target site from various origins, including linear dsdna cassette, resident plasmid, chromosome, and even genes from a complex mixture of total genomic dna . However, due to the difficulty of rescuing large genes from total dna, so far, this technique has not been used to directly clone genomic fragments into bac clones . To deal with the large size that is inherent of bacs, several novel methods were tested based on site - specific recombination systems, including the p1-derived cre - lox [40, 41], the baker's yeast saccharomyces cerevisiae flp - frt machineries, as well as traditional homologous recombination methods, but they have mostly had limited success (table 1). First, they require the ready presence or introduction of strategically placed recombination sites on both the donor and recipient dna molecules, which will be left as footprints in the modified constructs [43, 44]. Additionally, the effects of pseudoattachment sites in a system, if any, must be investigated ahead in order to eliminate retargeting to unwanted sites . Furthermore, the reversible reactions of some integrases (e.g., cre and flp) must be taken into consideration as the frequency of correct recombination could be reduced . Nevertheless the precision, and in some cases reversibility, offered by site - specific integration systems are very useful properties for flexible genetic engineering . Hence, recombineering and site - specific integration systems can complement each other in a synergistic manner as recombineering can accurately position integrase attachment sites in any location of choice . In e. coli, the 5g - c - t - g - g - t - g - g 3octamer, known as chi (crossover hotspot instigator), is a hotspot that stimulates recombination close to this sequence via the recbcd pathway . A chi - based strategy was used to target fusion of the green fluorescent protein reporter gene into a zebrafish gata-2 bac, in which the authors used a non - replicative targeting linear construct containing properly oriented chi sites located near each end to stimulate homologous recombination . The resulting gata-2 promoter gfp - fusion bac displayed the correct expression pattern of the reporter gene in developing skin evl cells, neurons, and circulating blood cells . Although this strategy simplified the targeting and identification of recombinant bacs, like site - specific integration systems, its major limitation is the time - consuming step of generating targeting dna flanked by chi sites (table 1). Bacs are generally maintained in the e. coli host strain dh10b because it has many suitable qualities, including permissive for cloning of methylated eukaryotic dna, enhanced transformation of very large dna, high transformation efficiency, and the ability to yield high - quality dna during dna isolation [3, 49]. However, because this host is recombination deficient (reca-), exploiting its intrinsic homologous recombination mechanism for bac manipulation had been challenging . Early homologous recombination strategies for bacs were thus developed in other e. coli mutant strains . One of the earliest methods using the recbcd pathway of e. coli was described by o'connor et al . The authors used a combination of complex steps of homologous and site - specific recombination in e. coli to recombine overlapping regions of large genomic fragments carrying the drosophila ultrabithorax (ubx) gene, a technique they called chromosomal building used this rather tedious technique to mutagenize the mouse cytomegalovirus (mcmv) genome, contained in a 230 kb bac and to generate virus mutants . Soon after, this technique was extended into e. coli dh10b by transiently supplying the reca gene . The lacz gene was fused in - frame with the promoter of the ru49 gene located on a 131 kb bac and shown to correctly express in a spatio - temporal fashion in mice . The recombination potential of the recf pathway that operates in recbc sbcbc mutant strains has also been applied to construct plasmids by in vivo cloning a dna fragment into a linearised vector via the gap repair approach [53, 54] (figure 2(b)). Similarly, the endogenous recf pathway of e. coli bj5183 was used to clone and mutagenize the complete adenovirus genome, simplifying the process of generating adenovirus variants [55, 56] (figure 2(c)). Curiously, low - efficiency gap repair activity was reported in the reca- e. coli strain dh5 but the pathway(s) mediating the homologous recombination was not explained and this result has not been verified by other publications since . These studies highlighted the exciting use of endogenous homologous recombination pathways directly in e. coli to generate precise gene modifications, but technical limitations exist for these strategies (table 1). Firstly, the high levels of background rearrangements observed in some cases [6, 51, 52] was a concern . Moreover, traditional recombination technologies typically require long homologous sequences of about 1 kb for efficient recombination rate, which is too long to accurately synthesise with standard pcr procedures . As these reca - dependent strategies only work in strains with specific mutant backgrounds (e.g., recbc sbcb for recf pathway and reca for transient reca), they are either not transferable to general strains or bacs will need to be shuttled from the specific strain out after modification . It became clear that although it was possible to engineer changes to large bacs using various established conventional strategies in e. coli, a straightforward, efficient, and stable bac manipulation technique in e. coli that leaves no modification footprints behind would be more favourable . The quest for such a tool resulted in development of recombineering technology . Recombineering is advantageous over conventional bac modification strategies in several aspects (table 1). Most importantly, recombineering facilitates the introduction of almost unlimited modifications to bacs with very high efficiency compared to traditional homologous recombination [21, 22]. Virtually, any position on a bac can be targeted as long as its sequence is known and the required homology size (40 bp) is short enough to be synthesised in vitro . In addition to its tremendous target flexibility, the development of mobile recombineering systems [2123, 29], where the recombination function can be introduced into any host via a plasmid, greatly enhances its scope of application in various bacterial strains (figure 2(f)). The simplicity of recombineering strategies also translates to technical ease, while more sophisticated recombineering strategies can introduce clean mutagenesis without any footprints as site - specific recombination does . Early research that led to the development of recombineering (figure 2) can be traced back to the exploitation of e. coli mutant strains that carry functional phage recombination mechanisms derived from lambda and the rece / rect genes from the rac prophage (figures 2(d)-2(e)) [58, 59]. However, it was not until the advent of regulatable and defined recombineering systems in late 1990s (figure 2(f)) that the technologies and potential of recombineering became well established . E. coli k12 strains carrying the defective rac prophage has been utilised for mutagenesis of e. coli chromosomes and plasmids since the 1980s . The recombination proficiency in this strain was eventually discovered to be attributed to sbca mutation which causes overexpression of the rece pathway, leading to recombination activity that phenotypically suppresses the recbc mutations . In 1987, kiel et al . Constructed mutants of k12 strains by exchanging the target chromosomal segment with a mutant gene carried by an incoming plasmid, utilising the rece pathway endogenous to k12 (figure 2(d)). About a decade later, the potential of recombineering for gene replacement was tapped into by inducible expression of red genes and recet (figure 2(f)). Soon after, the red - mediated recombineering was used to construct a series of chromosomal gene replacement strains, using pcr cassettes as targeting substrates [63, 64]. Similarly the gap - repair ability of a recbc sbca strain, where the rece pathway operates, was used to directly clone pcr products in vivo by oliner et al . Kawaguchi and kuramitsu followed by adapting this approach to describe a cloning method in a recbc sbca strain that they designated homologous ligation, with homology length as short as 20 bp . The power of recombineering in gap repair cloning was eventually demonstrated by zhang et al . (figure 2(e)), who conducted highly efficient in vivo subcloning in e. coli using a concept similar to tar cloning in yeast (see above). The milestone in recombineering development is the establishment of defined recombineering systems, which consist of rece / rect or red exo / beta under inducible promoters for tight expression regulation (figure 2(f)). Despite not being involved in the actual recombination reaction, red gam is incorporated into these systems to facilitate the use of open - ended linear dsdna as targeting substrates by protecting them from recbcd degradation [2123] (figure 2(f)). These plasmid - based systems permit tight regulation of the recombineering genes, thereby limiting unwanted recombination events, and also allow transfer of the systems for use in various strains and even species (table 1). As the prophage carries all the necessary red genes for recombineering, a system based on defective prophage was developed (figure 2(f)). Among the key features of this system is the temperature - sensitive regulation of red genes based on ci repressor and also its mobility to other e. coli strains by p1 cotransduction . However the elimination of this defective prophage - based system requires additional effort, as a specific recombination reaction to replace the prophage with selectable cassette is necessary . Because of the incompatibility of the defective prophage system with certain bacs this mini- is deleted for lethal genes and can be easily excised out via attachment sites . The reported recombination efficiency was so high that direct screening of recombinant clones without selection was feasible . The frequency obtained was 1 in 61 for direct nucleotide substitution by ss - oligo recombineering as confirmed by sequencing . Next, a unique hybrid recombineering system that brings together reca and red - mediated homologous recombination techniques was developed (figure 2(f)), following the establishment of reca - mediated recombination method in neuroscience research [67, 68]. In this method, the reca - dependent technique was integrated with the red recombineering for seamless modification of bacs . This hybrid recombineering utilizes red recombineering to insert (pop - in) a dna sequence of interest alongside marker genes and reca on a selectable cassette, followed by reca expression from the cassette to excise (pop - out) vector sequences . In another work, reca was incorporated into a different red recombineering system but not for its recombination function (figure 2(f)). Instead, transient reca expression was induced to increase survival rate of transformants, leading to about 4- to 5-fold improvement in transformation efficiency and consequently up to 8-fold increase in recombination frequency . While not experimentally proven yet, transient expression of reca might be beneficial to recet recombineering as it does to red recombineering . Although the one - step recombineering strategy for mutagenesis is easy and straight forward, often operational sequences like antibiotic resistance gene will be left behind . In order to create clean mutation without the potential disruptive effects of integrated operational sequences, a counterselection strategy is employed (see figure 1(c)). While antibiotic resistance genes are generally the choice for selection markers, the option for counter selection is constantly being explored (figure 2(g)). One of the earliest counter - selection genes used in recombineering is sacb (figure 2(g)), which enables counterselection by sucrose addition . Spontaneous mutations in sacb that ablate sucrose sensitivity do arise during the course of recombination, however, so careful screening of recombinant clones is necessary for the confirmation of desired genotype . Another counter - selection marker used is the wild - type rpsl+ allele (figure 2(g)), which was first used by imam et al . For pac modifications in streptomycin - resistant rpsl dh10b . However, rearrangements on the clones were observed, warranting the need for additional recombinant screening . One novel counterselection strategy is the use of the highly specific i - scei endonuclease (figure 2(g)), by expressing it to cleave the 18 bp i - scei recognition site present only in nonrecombinant clones . Unfortunately, the observation of high false positives, due to background deletion of i - scei gene and recircularisation events, required extra effort in ensuring high i - scei expression level and in vitro linearisation of recombinant bacs before electroporation . Compared to counter - selection markers that need to be used in conjunction with another selection marker, marker genes that serve the dual purpose of selection and counter - selection are more convenient to use . One such example is galk (figure 2(g)), which is adapted for use in recombineering by warming et al . In galk strains . By having only one marker gene in the selectable cassette, selection / counter - selection is easily accomplished by simply alternating the substrate (galactose for selection, 2-deoxy - galactose for counter - selection) during the two - step recombineering . Nevertheless, low level of spontaneous deletions spanning galk was observed although they were concluded to be due to background reaction in dh10b . Another example of dual - selectable marker gene for use in recombineering is thya (figure 2(g)), which can be selected for in the absence of thymine, and against by the addition of thymine and trimethoprim in minimal growth media . As this selection method must be performed in thya null mutant background, it might be restricted for use in general strains or require additional thya knockout step for adaptive use . Nevertheless, it is a highly efficient approach that gives over 90% of accurate selection frequency with low levels of backgrounds up to 0.08% . More recently, the tolc gene which encodes an outer membrane protein (figure 2(g)) was adapted for selection / counter - selection purpose in recombineering . This technique takes a similar approach to thya and galk selection, as a tolc background is required for the mutant tolc gene to be selectable by sds addition and counterselectable by colicin e1 . Again, spontaneous background mutational events were observed for colicin e1 selection, warranting the need to screen potential recombinant colonies . The exciting potential of recombineering was expanded further when single - stranded oligonucleotides as short as 30 nt were found to effectively mediate recombinering (figure 2(h)). Furthermore, this method only requires the beta or rect function, with only slight dependence on gam expression . Interestingly, comparable efficiencies between rect and beta in mediating ss - oligos recombineering have been demonstrated in some work, while rect protein has been observed to be slightly less efficient than beta in other . Recombineering is invariably more efficient when the targeting oligos correspond to the lagging strand in relation to the replication origin, a phenomenon termed strand bias this is thought to reflect the more abundant availability of exposed ssdna for beta or rect binding at the lagging strand during replication . Recombineering by ss - oligos was taken a step further by using oligos that overlap as little 6 bp to create dsdna substrates with single - stranded overhangs (figure 2(h)). While only beta is needed for efficient recombineering of dsdna with 3 overhangs, a surprising observation was that when exo was coexpressed a higher recombination rate of dsdna with 5 overhangs was obtained . Recombineering has been an invaluable tool in mouse transgenesis . Because of the large insert capacity of bacs, the introduced transgenes are less sensitive to positional effects due to inclusion of regulatory sequences in the insert and hence effective in building disease model systems with expression profile reflecting actual pathogenesis . Besides introducing transgene one excellent demonstration of this application is the engineering of homozygous knockouts in mouse embryonic stem (es) cells (figure 2(i)). Two knockout bac constructs that targeted the same gene were introduced to mouse es cells in two rounds of injections, with targeting efficiency ranging from 7% to as high as 28% . More recently, this method was successfully adapted to create homozygous knockouts in human es cells (figure 2(i)), expanding the applications of transgenesis bacs from mouse to human model systems . The accuracy of recombineering in manipulating very large dna molecules makes it a practical option for joining large dna fragments to construct big artificial chromosomes (figure 2(j)). This application was first demonstrated in the fusion of two separate but overlapping bacs, typically to reconstitute large genes that span more than one clone into a single recombinant bac clone [19, 66, 73] (figure 2(j)). Following the success of joining related bacs, kotzamanis et al . Retrofitted a ~70 kb - alphoid dna into a human bac clones via the red recombineering system in an attempt to build human artificial chromosomes (hacs) (figure 2(j)). After transfection, the resulting fusion minichromosome contained a functional centromere, and the subcloned gene was expressed correctly . Plasmid to join the two targets by providing homology sequences, it is a small price to pay for a universal method to link two or more unrelated bac clones . One notable use of homologous recombination is its successful applications in manipulation of clinically important viruses (figure 2(k)). As virus genomes can reach over 200 kb in size (e.g., the genome size of cytomegalovirus is 235 kb), modification of large virus genomes in its entirety poses technical challenges . However, with the high efficiency of recombineering in manipulating large dna plasmids, virus genomes can be subcloned into an appropriate vector and essentially undergo engineering as bacs would . Recombinant viruses have been constructed using conventional homologous recombination technologies [51, 55, 56, 74], but overall with lower efficiency than recombineering . From vaccinia virus, herpes virus, to baculovirus (figure 2(k)), mutagenesis and production of these viruses were greatly facilitated by recombineering technologies, as the virus genomes can be directly modified on a bac vector, which can subsequently serve as the production host once it is transfected into a suitable cell host for virus reconstitution . This strategy saves tremendous time and effort, as clonal viruses can be produced without tedious plaque purification procedure . An important breakthrough in recombineering application came about when a scalable, liquid, culture - based recombineering pipeline was developed in 2006 for caenorhabditis elegans (figure 2(l)). In just four days, this red - mediated recombineering pipeline could facilitate egfp tagging and subcloning of multiple bac clones simultaneously ., this improved pipeline enables high - throughput transgenesis method such as protein tagging in any model system, including mammalian cell cultures . Very recently, a specialised recombineering pipeline was developed for generation of specific constructs targeting conditional alleles, through a series of recombineering reactions involving replacement, gap repair, and insertions . One novel application of recombineering developed recently is its use to introduce structural on top of sequential changes to bacs (figure 2(m)). By integrating the telomeric sequences tos of the linear prophage n15 into a large 100 kb bac construct followed by appropriate expression of the phage's telomerase teln, the bac was able to stably replicate as a linear episome with resistance to recbcd exonuclease attack in vivo in e. coli (figure 2(m)). After transfer into hela cells, this linear bac produced accurately spliced -globin mrna, suggesting that this conformation may potentially be useful as a vector for mammalian gene expression or assembly of artificial chromosomes . Bac homologous recombination technologies have benefited the research community in ways unimaginable only decades before . From microbiology, virology to human genetics, neuroscience, and proteomics, the power to clone and manipulate large pieces of intact genetic information with high fidelity has enabled researchers to design and conduct insightful studies in their respective fields . With recombineering being increasingly applied in creative ways, the only limiting factor for the potential of recombineering is our imagination . As functional homologues of recombineering enzymes are being discovered in a broader range of bacteria and their phages, more novel and improved recombineering technologies could be on the horizon . Coli species (e.g., vibrio cholera, yersinia pseudotuberculosis, and pseudomonas aeruginosa), as well as the successful transfers of phage dna - modifying enzymes (e.g., phic31 and cre - loxp) from traditional hosts (e. coli) to mammalian cells are encouraging signs that their adaptation for use in eukaryotic systems is not too far from becoming reality.
Neuroserpin, or proteinase inhibitor 12 (gene symbol serpini1), was first found in cultured chicken neuronal axons and is predominantly expressed in human neurons of both the central and peripheral nervous systems . Sequence analysis has shown that neuroserpin is a new member of an old proteinase family, the serine proteinase inhibitor (serpin) superfamily . A high neuroserpin expression level is detected during the late stage of neuronal development throughout the central nervous system (cns); however, it is only detected in some regions of the adult brain, such as the hippocampus, hypothalamus, cerebellum, amygdala and sympathetic nerves, where tissue - type plasminogen activator (tpa) mrna and/or protein has also been found, during the early stage of neurogenesis . The spatial and temporal analysis of neuroserpin and tpa expression suggests a role for neuroserpin in maintaining the proteolytic balance in the cns, which is crucial for axonogenesis, synaptic connection, and synaptic plasticity . The co - expression and preferential interaction with tpa indicates that neuroserpin is a selective inhibitor of tpa in the cns . The active balance and interaction between these two proteinases are very important for both physiological and pathological events . Under normal conditions, neuroserpin and tpa both participate in processes such as learning, memory, behavior and the regulation of permeability between vascular compartments and the nervous system . During pathological courses, such as neurodegeneration, cerebral ischemia and seizures, neuroserpin displays neuroprotective effects by eliminating tpa deleterious proteolytic activity . However, many members of the serpin superfamily have shown nonproteinase - inhibitory roles in many processes, such as hormone transport, protein folding, tumor progression, chromatin condensation, and blood pressure regulation . Neuroserpin also has roles that are independent or partly independent of its tpa inhibitory capacity . In this review, we aim to clarify the tpa - independent roles of neuroserpin in the cns . The serpin superfamily, which contains inhibitory and non - inhibitory members, is one of the earliest defined and largest protein superfamilies . Serpins are ubiquitously expressed in all branches of life, and are important regulators in many critical physiological processes, including coagulation, fibrinolysis, inflammation, metastasis and apoptosis . The typical molecular structure of this family is very conserved and has been well defined, containing at least 30% amino acid sequence homology with the archetype protein, 1-antitrypsin . This protein is composed of eight or nine -helices and three -sheets, and characterized by an exposed peptide loop . This loop, named the reactive center loop, is composed of 20 residues and works as a pseudosubstrate for the target enzyme . The structural transformation between the reactive center loop and -sheet is critical for the proteinase inhibition capacity . Neuroserpin is a fully functional inhibitor of trypsin - type proteinases, preferentially reacting with tpa and to a minor extent with the urokinase - type plasminogen activator (upa) plasmin, but has no inhibitory activity towards thrombin . Ischemic stroke comprises approximately 88% of the total stroke, which is the leading cause of disability and the second largest contributor to mortality in the world . It is often caused by an occlusion of a certain cerebral artery, and directly results in an absence of blood flow to this artery and the supplied brain tissue . Lack of oxygen and glucose could induce an energy metabolism disorder, which in turn triggers a collapse of ion gradients and an excessive release of excitotoxic neurotransmitters, such as glutamate and dopamine, ultimately leading to neuronal death and development of infarction . One effective treatment for acute ischemic stroke is early thrombolytic therapy, and tpa is the only agent approved by the food and drug administration for thrombolytic treatment . Meanwhile, tpa is capable of activating matrix metalloproteinase, degrading laminin, interacting with the n - methyl - d - aspartate receptor, and converting plasminogen to plasmin, which also contributes to blood - brain barrier degradation . These extravascular deleterious effects of tpa aggravate brain parenchyma injury when administrating tpa beyond its therapeutic window . This damaging side effect of tpa has also been shown by experiments carried out in the presence of tpa deficiency; these showed a significant reduction in ischemic lesion volume, an increase in neuronal survival, and a better long - term outcome . Moreover, neuroserpin over - expressing mice and adjuvant treatment with neuroserpin both provided neuroprotective effects and increased the therapeutic window of tpa administration . Based on these findings, it seems that the neuroprotective effect of neuroserpin following cerebral ischemia is associated with tpa, by balancing the proteolytic activity of tpa, or by regulating tpa mediated seizure spreading . However, tpa has also been shown to rescue neurons from apoptosis induced by serum deprivation, and the elevation of tpa expression and activity induced ischemic tolerance and promoted neuronal survival in the murine hippocampus . In these models, additionally, a recent study showed that neuroserpin provides prominent neuroprotective effects in both wild - type and tpa - deficient mice during ischemic - hypoxic injury . These findings suggest the existence of a tpa - independent neuroprotective role of neuroserpin during cerebral ischemia . In fact, tpa is just one of the substrates of neuroserpin, which also reacts with upa and plasmin . A previous study showed that upa was upregulated following ischemia, and that this could be inhibited by amiloride providing a better outcome . A prior study indicated that plasmin was capable of activating protease - activated receptor-1 (par-1), and the activation of par-1 increased infarct volume by approximately 68% compared with par-1-null mice . Neuroserpin had already been showed to abrogate the excitotoxic neuronal death induced by plasmin and kainic acid . There are 20 methionine residues in neuroserpin, and these contribute to the oxidative tolerance produced by this serpin protein . This molecular structural character of neuroserpin explains a part of its neuroprotective effects against oxidative stress . It was reported that neuroserpin possessed anti - inflammatory activity in systemic arteries, modifying th cell responses and reducing plaque growth . Since systemic inflammatory stimuli are detrimental to stroke outcomes, we assume that the anti - inflammatory activity of neuroserpin also plays a neuroprotective role in cerebral ischemic conditions . The human neuroserpin gene is localized to chromosome 3q26 . Despite its predominant expression in neurons, neuroserpin mrna and/or protein has also been detected in pancreas, heart, kidney, testis, placenta, liver, pituitary and adrenal glands . The role of neuroserpin in these tissues is still unclear, and recent research has shown that neuroserpin participates in tumorigenesis and tumor migration, including in brain tumor tissue . The genomic locus of the programmed cell death gene pdcd10 is close to that of serpini1 (the gene encoding neuroserpin) and the two genes are oriented in a head - to - head configuration . Serpini1-pdcd10 had been found to be regulated by the oncogenic transcription factor c - myc, and is possibly involved in cns diseases such as brain tumors . Moreover, there is evidence showing that the neuroserpin gene is downregulated in the brain tumor tissues and even absent in two brain cancer cell lines: u-87 mg and h4 . These findings suggest that the neuroserpin gene is a cancer - associated gene, and that neuroserpin functions as a tissue - specific tumor - suppressor gene in the brain . However, this tissue - specific tumor - suppressive character is not only observed with neuroserpin, but also with some other members of the serpin family, such as pancpin and maspin . Mapsin was downregulated in breast cancer, like neuroserpin, while the transgenic high - expression of mapsin resulted in a reduction of tumor progression . Based on this the currently poor understanding of how neuroserpin produces its tumor - suppressive effect needs to be addressed . Contrarily, high neuroserpin gene expression was detected in high - grade prostate cancer and hepatocellular carcinoma, where it was associated with a poorer outcome . This result suggests a need for suspicion towards the potential use of neuroserpin as a chemotherapeutic agent . Tpa converts inactive plasminogen into active plasmin, which is capable of degrading most of the extracellular matrix, and tpa itself degrades laminin and activates matrix metalloproteinase contributing to the degradation of extracellular matrix . Sequentially, the breakdown of the extracellular matrix facilitates the invasion of cancer cells and enables tumor migration . The absence of neuroserpin, a crucial inhibitor of tpa in the cns, may promote brain tumorigenesis . The tpa - inhibitory function of neuroserpin is necessary in this tumor - suppressive process . However, neuroserpin is not only a protease inhibitor: its expression has also been detected in pituitary and adrenal glands, suggesting a possible role for neuroserpin in the endocrine system . Both the att-20 cell line and pc12 cells, two endocrine cell lines, responded to altered neuroserpin expression levels by extending neurite - like outgrowths . Interestingly, compared with the parent and neuroserpin- overexpressing cell lines, there was only a small activation of tpa expression and no accumulation of tpa - neuroserpin complex was observed . These results suggest an effect of neuroserpin in mediating neurite outgrowth, and that this process is tpa independent . Lee et al, using pc12 cells treated with nerve growth factor, showed that the high expression of neuroserpin induced an increased level of cell - cell adhesion and higher n - cadherin expression . One mutation was in the reactive site of neuroserpin, blocking recognition by tpa; the other mutation was at the hinge p14 serine residue, preventing reactive center loop insertion into -sheet a, which resulted in a noninhibitory neuroserpin . This finding implied that neuroserpin could mediate cell - cell adhesion and alter the expression of n - cadherin, and this function was independent of its enzyme inhibitory activity . These tpa - independent capabilities of neuroserpin, neurite outgrowth mediation and cell adhesion encouragement possibly result in the promotion of cancer cell metastasis and enhancement of the connection between tumor cells and local normal cells, promoting a secondary lesion . Although the innate protease inhibitory activity of neuroserpin provides us with a potential target for brain tumor treatment, the multiple tpa - independent roles of neuroserpin may lead an opposite result during tumorigenesis . These processes all require neuronal plasticity, but the mechanisms underlying their effects remain undefined . Explorative behavior analysis revealed that these mice had a selective reduction of locomotor activity in a new environment, an anxiety - like response in the o - maze, and a neophobic response to novel objects . Surprisingly, zymographic analysis of brain extracts revealed unchanged tpa activity in neuroserpin - deficient mice . This finding suggested that neuroserpin was a novel regulator of behavior and emotion, and that this role of neuroserpin was tpa independent . It also indicated that other inhibitors, such as pai-1, which was found to form complex with tpa in demyelinating multiple sclerosis lesions, contributed to the regulation of tpa activity in the brain and compensated for the defect of neuroserpin activity . As mentioned above, noninhibitory neuroserpin is also capable of mediating n - cadherin expression . Through the rho - family gtpases, n - cadherin plays a key role in synapse formation, controlling dendritic spine maturation, and participating in long - term potentiation . Moreover, a higher level of neuroserpin expression can alter dendritic spine shape and induce an increase in the density of dendritic protrusions . This suggests a regulatory role of neuroserpin in neuronal structural plasticity . Additionally, neuroserpin has a partly tpa - independent activity in promoting neurite outgrowth, while the extension and remodeling of neurites also play critical roles in neuronal development and plasticity . Because neuronal plasticity is an essential composition for emotional and behavioral processes, the roles of neuroserpin in modulating n - cadherin expression, neuronal structural plasticity and neurite outgrowth reveal novel effects of neuroserpin in mediating emotion and behavior . Five point mutations of the neuroserpin gene, ser49pro, ser52arg, his338arg, gly392glu and gly392arg, have been shown to induce deposition of ordered neuroserpin polymers within the neuronal endoplasmic reticulum (er). Fenib patients show clinical features such as cognitive dementia, tremor, seizures and progressive myoclonus . A very clear genotype - phenotype correspondence has been revealed in this disease, which can be explained by the rate of polymerization . For example, compared with ser49pro, patients with the ser52arg mutation exhibit more rapid polymerization, a greater number of inclusion bodies, an earlier age of onset and more serious clinical symptoms . Although the lack of tpa - inhibitory activity of mutant neuroserpin, resulting in an imbalance of these two important proteins in the cns, underlies the etiology of fenib, the overload of er stress seems to be more harmful . Normally, both active neuroserpin and neuroserpin - tpa complexes are recognized and internalized by membrane receptors, typically the ldl receptor - related protein, and degraded predominantly by er - associated degradation (erad) and autophagy . However, mutant neuroserpin significantly decelerates secretion and resists erad, resulting in a massive collection of neuroserpin polymers within the er, dramatically increasing er stress . This er overload damage has also been identified in liver cirrhosis caused by mutant 1-antitrypsin, in which the sequestration of mutant 1-antitrypsin from inclusion bodies is a cell - protective mechanism to maintain er function . Furthermore, the cellular toxicity of mutant neuroserpin was confirmed by a fly fenib model and a rat fenib model . In these two models the extent of neuroserpin polymer accumulation was directly linked to the severity of locomotor deficits and a selective dysfunction or loss of a specific neuronal population, respectively . A recent study showed that neuroserpin polymers were capable of activating the calcium - dependent nuclear factor-b pathway . Because chronic activation of nuclear factor-b could induce cell death, the regulation of nuclear factor-b by neuroserpin polymers contributes to neuroserpin - associated cellular toxicity . This finding reveals a novel mechanism used by neuroserpin to achieve motor and cognitive regulation, and suggests a new strategy for the treatment of fenib . Neuroserpin is an important protein in the cns . Through its interaction with its main substrate, tpa, to maintain a proteolytic balance, neuroserpin plays essential roles in both physiological and pathological processes . Importantly, neuroserpin is not only a tpa inhibitor, it also reacts with upa and plasmin, and these interactions underlie neuroserpin's protective effects during cerebral ischemia . A better understanding of the roles of neuroserpin in the inflammatory system will widen its use in the treatment of adult stroke as well as neonatal hypoxic - ischemic encephalopathy . Additionally, neuroserpin is a tpa - independent mediator of neurite - like outgrowth, cell - cell adhesion, and n - cadherin and nf-b expression . The tpa - independent regulatory effect of neuroserpin participates in tumorigenesis, as well as emotional and cognitive processes . Further characterization of the multiple roles of neuroserpin and its polymers will be helpful for developing new strategies to treat the associated diseases.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.