text
stringlengths
1
22.8M
Ćurkovica is a village in the municipality of Vranje, Serbia. According to the 2002 census, the village has a population of 13 people. References Populated places in Pčinja District
```javascript export chars from './chars' export ensureLeft from './ensureleft' export inequal from './inequal' export prepend from './prepend' export rightPad from './rightpad' export surround from './surround' export truncate from './truncate' export collapseWhitespace from './collapsewhitespace' export ensureRight from './ensureright' export insert from './insert' export prependArray from './prependarray' export rightTrim from './righttrim' export toCamelCase from './tocamelcase' export urlDecode from './urlDecode' export append from './append' export compare from './compare' export equal from './equal' export isLowerCase from './islowercase' export removeEmptyStrings from './removeemptystrings' export safeTruncate from './safetruncate' export toDecamelize from './todecamelize' export urlEncode from './urlencode' export appendArray from './appendarray' export contains from './contains' export first from './first' export isString from './isstring' export removeLeft from './removeleft' export shuffle from './shuffle' export toKebabCase from './tokebabcase' export at from './at' export containsAll from './containsall' export format from './format' export isUpperCase from './isuppercase' export removeNonWords from './removenonwords' export slice from './slice' export toLowerCase from './tolowercase' export base64decode from './base64decode' export containsAny from './containsany' export hexDecode from './hexdecode' export last from './last' export removeRight from './removeright' export slugify from './slugify' export toSnakeCase from './tosnakecase' export base64encode from './base64encode' export countSubstr from './countsubstr' export hexEncode from './hexencode' export lastIndexOf from './lastindexof' export removeSpaces from './removespaces' export split from './split' export toStudlyCaps from './tostudlycaps' export between from './between' export decDecode from './decdecode' export htmlDecode from './htmldecode' export leftPad from './leftpad' export repeat from './repeat' export startsWith from './startswith' export toUpperCase from './touppercase' export binDecode from './bindecode' export decEncode from './decencode' export htmlEncode from './htmlencode' export leftTrim from './lefttrim' export replace from './replace' export transliterate from './transliterate' export binEncode from './binencode' export endsWith from './endswith' export indexOf from './indexof' export reverse from './reverse' export substr from './substr' export trim from './trim' export default exports ```
Papagou-Cholargos () is a municipality in the North Athens regional unit, Attica, Greece. The seat of the municipality is the town Cholargos. Municipality The municipality Papagou-Cholargos was formed at the 2011 local government reform by the merger of the following 2 former municipalities, that became municipal units: Cholargos Papagou The municipality has an area of 7.325 km2. References Municipalities of Attica Populated places in North Athens (regional unit)
Sinopterus (meaning "Chinese wing") is a genus of tapejarid pterodactyloid pterosaur from the Aptian-age Lower Cretaceous Jiufotang Formation of Chaoyang, Liaoning, China. It was first described and named by Wang Xiaolin and Zhou Zhonghe. Historically, there were multiple species attributed to the genus although only one is considered to be valid. Sinopterus is known for its proportionally large skull, which has a birdlike pointed beak, a long bony crest that starts with a tall premaxilla and goes back along the middle of the skull to form a point overhanging the rear of the skull, and its lack of teeth. Description The type species, S. dongi, is based on IVPP V13363, an articulated, nearly complete skeleton. The skull of this individual was 17 centimeters (6.7 inches) long, and the wingspan was estimated to be 1.2 meters (3.9 feet). The authors suggested that it was an omnivore, and noted that it was the first record of a tapejarid outside of Brazil, and the earliest and most complete tapejarid. The maximum adult wingspan of this pterosaur would have been , and an individual of this size would have weighed . Classification Sinopterus is known from numerous specimens, some of which have been assigned to unique species and even different genera over the years. The type species, Sinopterus dongi, is known from one specimen described in 2003. A second specimen, BPV-077, was also described in 2003 by Li, Lü, and Zhang, who classified it in its own species, S. gui. It was said to differ from S. dongi mainly in its smaller size (only about half the size of S. dongi) and the presence of a notarium, though this was later disproved. Some later studies found S. gui to simply represent a younger specimen of S. dongi, though one large analysis in 2014 found it to be a more primitive tapejarid. A third specimen was referred to Sinopterus in 2007, again classified as a new species, this time given the name S. jii. This species was first named by Lü & Yuan in 2005 as the type species of a new genus which they named Huaxiapterus. Two later studies in 2007 and 2011 both showed that H. jii was in fact more closely related to Sinopterus than to the two other species also assigned to Huaxiapterus, "H." corollatus and "H." benxiensis. Both groups of researchers concluded that Huaxiapterus jii should therefore be reclassified as Sinopterus jii, and that the other two species of "Huaxiapterus" require a new genus name. However, a more complete phylogenetic analysis suggested that Sinopterus may actually be an intermediate step in the grade between H. jii and the other two Huaxiapterus species, making Sinopterus paraphyletic if H. jii is included. In 2016, another species, S. lingyuanensis, was named. It purportedly differed from the other species in the proportions of its nasoantorbital fenestra, its rostral index, the relative sizes of its femur and tibia, and the relative sizes of the first and second wing digits. In the same paper describing this species, the species Huaxiapterus atavismus was also named. However, Xinjun Zhang and colleagues in 2019 considered Huaxiapterus an invalid genus and therefore reassigned H. atavismus to Sinopterus, which created the new combination Sinopterus atavismus. A 2021 study by Darren Naish and colleagues of variation within pterosaur growth stages noted that numerous species had been classified as Sinopterus or "Huaxiapterus", most based only on a single specimen, and most differentiated from each other by features like wing proportions, skull length, and crest shape and size. Naish et al. pointed out that all of these features are known to be variable within a single species due to growth, and that there were unlikely to be such a high diversity of extremely similar species in the same ecosystem when their differences are more likely due to variation within a few species. They suggested that a larger study would be needed to untangle the question of how many species of Sinopterus-like pterosaurs actually existed in the Jiufotang ecosystem, and how they are related to each other. In a preliminary opinion, these scientists stated that there is likely only one valid species of Sinopterus, S. dongi, but that "Huaxiapterus" corollatus might be a valid second species based on unique wing and leg proportions. In 2023, Rodrigo V. Pêgas et al. reviewed the recent taxonomic histories of the tapejarids. In their article, they made S. gui and S. lingyuanensis synonymous with S. dongi. In addition, the genus Huaxiapterus was synonymized with Sinopterus as a result of H. jii and H. atavismus being reclassified as synonyms of S. dongi and "H." corollatus being reclassified to the new genus Huaxiadraco from which Huaxiapterus benxiensis became synonymous with. Relationships The cladogram below follows the 2014 analysis by Brian Andres and colleagues, showing the placement of two Sinopterus species ("S." gui and S. dongi) within the clade Tapejaromorpha. In 2019, a different analysis, this time by Alexander Kellner and colleagues, had recovered Sinopterus within the Tapejarinae, a subfamily within the larger group Tapejaridae, sister taxon to both Eopteranodon and Huaxiapterus. The cladogram of their analysis is shown below: Paleobiology Growth Sinopterus is known from several specimens at various stages of growth, which has allowed scientists to study the changes these animals went through during their life histories. At least one very small juvenile (possibly hatchling) specimen has been attributed to Sinopterus. This specimen was originally classified as a distinct genus in 2008, Nemicolopterus crypticus. The name Nemicolopterus comes from the Greek words "Nemos" meaning "forest", "ikolos" meaning "dweller", and the Latinised "pteron" meaning "wing". The specific name crypticus is derived from the Greek "kryptos", meaning "hidden". Thus "Nemicolopterus crypticus" means "Hidden flying forest dweller". The type specimen of N. crypticus, catalog number IVPP V-14377, is housed in the collection of the Institute of Vertebrate Paleontology and Paleoanthropology in Beijing, China. The fossil was collected from the Jiufotang Formation, like all adult Sinopterus specimens. It was discovered in the Luzhhouou locality of Yaolugou Town, Jianchang County, Huludao City, western Liaoning Province in northeastern China. It has a wingspan of slightly under 25 centimeters (10 in), making it smaller than all but a few specimens of hatchling pterosaurs. Wang et al. (2008), who originally described the specimen, concluded that it was immature, citing the amount of bone fusion and the ossification of the toes, gastralia, and sternum as indicating that it was a sub-adult rather than a hatchling. However, Darren Naish argued on his popular weblog that, due to the hypothesis that pterosaurs were highly precocial, bone fusion and ossification could have occurred very early in life, and that Nemicolopterus might in fact be a hatchling Sinopterus. This identification was formally presented in 2021 study, which found that Nemicolopterus fit into a growth series as a young juvenile or hatchling Sinopterus hatchling. An analysis of pterosaur relationships by Andres and colleagues in 2014 found the specimen in a sister group relationship with "Sinopterus" gui. Based on study of hatchling Sinopterus skeletons as well as comparison with hatchlings of other pterosaur species, Naish and colleagues (2021) found that the wing proportions and bone strength/flexibility of hatchlings were similar to adults, and concluded that Sinopterus was capable of powered flight very shortly after hatching. They found that while young juveniles would have been excellent gliders, they would not have been reliant on gliding alone as opposed to true flight. Juveniles also seem to have been more adapted to flight in closed environments, like dense forests, compared to adults. Juveniles therefore probably occupied different ecological niches than adults, transitioning between different niches as they grew. See also List of pterosaur genera Timeline of pterosaur research References Tapejaromorphs Early Cretaceous pterosaurs of Asia Jiufotang fauna Fossil taxa described in 2003 Taxa named by Zhou Zhonghe
Songs in the Key of Gold is the first remix album and fifth overall by American recording artist Leslie Hall, released on December 14, 2013, via Hefty Hideaway. The album features dance remixes of Hall's songs by Titus Jones. It features songs from each of Hall's previous albums: Gold Pants, Door Man's Daughter, ceWEBrity, Back 2 Back Palz, and Destination Friendship. It also contains four new songs: "Neon Blood", "#1 Cat in America", "Happy Birthday", and "Of Course You Wear Glasses". To promote the album, Leslie Hall embarked on a nationwide tour that lasted from January to March 2014. Background Prior to Songs in the Key of Gold, Leslie Hall created all of her music in GarageBand. Leslie Hall said in an interview that her music "always thought they lacked that oomph. I’m always trying to sound like the classics, like Britney and Rihanna, and they never had that." For the album's production, she enlisted Titus Jones, who she discovered after he mashed up one of her songs with Britney Spears and Rihanna's music. Critical reception Lisa Dip of Web Wombat gave the album a highly positive review, calling the album "gloriously shameless, endlessly catchy and highly original- the way pop music should be." She noted "Tight Pants/Body Rolls," "Shazam I'm Glamorous," "Shake Your Hips," and "#1 Cat in America" as highlights from the album. She additionally praised producer Titus Jones for adding "seamlessness and energy in the album." Laura Fontaine Haines of Bust Magazine praised the production, writing that the songs got either a "serious kick up (“Power Cuddle”)" or "just a fabulous makeover (“Blame The Booty”)." Promotion Singles and new songs "No Pants Policy" was released as the album's lead single on November 12, 2013. Its music video has reached over 1 million views, making it one of her most successful singles to date. "Neon Blood", "#1 Cat in America", "Happy Birthday", and "Of Course Your Wear Glasses" were all new songs recorded specifically for Songs in the Key of Gold. Tour dates Leslie and the LY's embarked on a tour in 2014 to promote Songs in the Key of Gold. The tour ran from January 12, 2014, to March 21, 2014. 1/12 San Francisco, CA – Rickshaw Stop 2/5 Kansas City, MO – The Riot Room 2/6 St Louis, MO – Plush Saint Louis 2/7 Chicago, IL – The Empty Bottle 2/8 Grand Rapids, MI – The Pyramid Scheme 2/9 Madison, WI – High Noon Saloon 2/10 Pontiac, MI – The Crofoot (The Pike Room) 2/11 Columbus, OH – TBA 2/13 Cambridge, MA – Middle East Restaurant and Nightclub 2/14 Providence, RI – AS220 2/15 Brooklyn, NY – Knitting Factory Brooklyn 2/16 Philadelphia, PA – Johnny Brenda's 2/17 Washington, DC – DC9 Nightclub 2/19 Chapel Hill, NC – Local 506 2/20 Charlotte, NC – TBA 2/21 Atlanta, GA – The EARL 2/22 Birmingham, AL – Bottletree Cafe 2/23 Nashville, TN – 12th & Porter 2/24 New Orleans, LA – TBA 2/25 Houston, TX – Fitzgerald's Houston 2/26 Dallas, TX – Club Dada 2/27 Austin, TX – Red 7 3/1 Tucson, AZ – Club Congress 3/2 Las Vegas, NV – TBA 3/3 San Diego, CA – Soda Bar 3/4 Los Angeles, CA – The Satellite 3/7 Seattle, WA – The Vera Project 3/8 Portland, OR – Branx Blow Pony 3/10 Salt Lake City, UT – Urban Lounge 3/12 Denver, CO – Hi-Dive Denver 3/13 Omaha, NE – The Waiting Room Lounge 3/14 Minneapolis, MN – Triple Rock Social Club 3/15 Des Moines, IA – Wooly's 3/21 Iowa City, IA – Blue Moose Tap House Track listing Release history References 2013 albums Remix albums by American artists Leslie Hall albums
Melnikovo () is a rural locality (a selo) and the administrative center of Melnikovsky Selsoviet, Novichikhinsky District, Altai Krai, Russia. The population was 947 as of 2013. There are 10 streets. Geography Melnikovo is located 19 km west of Novichikha (the district's administrative centre) by road. Novichikha is the nearest rural locality. References Rural localities in Novichikhinsky District
Sunlit Chemical is a Taiwanese chemical company. History Sunlit Chemical was founded in 1972. They were the first company in Taiwan to produce hydrofluoric acid and fluoride. In 2021 they controlled 75% of the global oral care sodium fluoride market. Operations In 2022 Sunlit broke ground on a 900,000 sq ft manufacturing facility on a site in Phoenix, Arizona to supply a TSMC fab being built in the same city. They had acquired the 17 acre site in 2021. Products Sodium fluoride hydrofluoric acid Ammonium fluoride Phosphoric acid Hydrogen fluoride References Multinational companies headquartered in Taiwan Chemical companies of Taiwan
Laeti , the plural form of laetus , was a term used in the late Roman Empire to denote communities of barbari ("barbarians"), i.e. foreigners, or people from outside the Empire, permitted to settle on, and granted land in, imperial territory on condition that they provide recruits for the Roman military. The term laetus is of uncertain origin. It means "lucky" or "happy" in Latin but may derive from a non-Latin word. It may derive from a Germanic word meaning "serf" or "half-free colonist". Other authorities suggest the term was of Celtic or Iranian origin. Origin The Laeti may have been groups of migrants drawn from the tribes that lived beyond the Empire's borders. These had been in constant contact and intermittent warfare with the Empire since its northern borders were stabilized in the reign of Augustus in the early 1st century. In the West, these tribes were primarily Germans, living beyond the Rhine. There is no mention in the sources of laeti in the Eastern section of the Empire. Literary sources mention laeti only from the late 3rd and 4th centuries. Although the literary sources mention laeti only from the 4th century onwards, it is likely that their antecedents existed from as early as the 2nd century: the 3rd-century historian Dio Cassius reports that emperor Marcus Aurelius (ruled 161–180) granted land in the border regions of Germania, Pannonia, Moesia and Dacia, and even in Italy itself, to groups of Marcomanni, Quadi and Iazyges tribespeople captured during the Marcomannic Wars (although Marcus Aurelius later expelled those settled in the peninsula after one group mutinied and briefly seized Ravenna, the base of the Adriatic fleet). These settlers may have been the original laeti. Indeed, there is evidence that the practice of settling communities of barbari inside the Empire stretches as far back as the founder-emperor Augustus himself (ruled 42 BC - 14 AD): during his time, a number of subgroups of German tribes from the eastern bank of the Rhine were transferred, at their own request, to the Roman-controlled western bank, e.g. the Cugerni, a subgroup of the Sugambri tribe, and the Ubii. In 69, the emperor Otho is reported to have settled communities of Mauri from North Africa in the province of Hispania Baetica (modern Andalusia, Spain). Given the attestation of several auxiliary regiments with the names of these tribes in the 1st and 2nd centuries, it is likely that their admission to the empire was conditional on some kind of military obligations (Tacitus states that the Ubii were given the task of guarding the West bank of the Rhine) i.e. that they were laeti in all but name. The name Laeti may have become more widely used after Quintus Aemilius Laetus managed the support of the Danubian Legions for Septimius Severus and eventually took 15 thousand Danubians to the Praetorian Guards in Rome. The Severan dynasty lasted for 42 years, during which Danubians served as Praetorian Guards. Organisation The precise constitutions which regulated laeti settlements are obscure. It is possible that their constitutions were standard, or alternatively that the terms varied with each individual settlement. There is also doubt about whether the terms governing laeti were distinct from those applying to gentiles ("natives") or dediticii ("surrendered barbarians") or tributarii (peoples obliged to pay tribute). It is possible that these names were used interchangeably, or at least overlapped considerably. On the other hand, they may refer to juridically distinct types of community, with distinct sets of obligations and privileges for each type. Most likely, the terms laeti and gentiles were interchangeable, as they are listed in the same section of the Notitia, and both referred to voluntary settlements. In addition, the Notitia often places the two terms together e.g. the praefectus laetorum gentilium Svevorum at Bayeux and the praefectus laetorum gentilium at Reims. Reproductively self-sufficient groups of laeti (i.e. including women and children) would be granted land (terrae laeticae) to settle in the empire by the imperial government. They appear to have formed distinct military cantons, which probably were outside the normal provincial administration, since the settlements were under the control of a Roman praefectus laetorum (or praefectus gentilium), who were probably military officers, as they reported to the magister peditum praesentalis (commander of the imperial escort army) in Italy. This officer was, in the late 4th/early 5th centuries, the effective supreme commander of the Western Roman army. In return for their privileges of admission to the empire and land grants, the laeti settlers were under an obligation to supply recruits to the Roman army, presumably in greater proportions than ordinary communities were liable to under the regular conscription of the late empire. The treaty granting a laeti community land might specify a once-and-for-all contribution of recruits. Or a fixed number of recruits required each year. A possible parallel is the treaty with Rome of the Batavi tribe of Germania Inferior in the 1st century. It has been calculated that in the Julio-Claudian era, as many as half of all Batavi males reaching military age were enlisted in the Roman auxilia. There is considerable dispute about whether recruits from laeti settlements formed their own distinct military units or were simply part of the general pool of army recruits. The traditional view of scholars is that the praefecti laetorum or gentilium mentioned in the Notitia were each in command of a regiment composed of the laeti ascribed to them. Some regiments of laeti certainly existed. The praesentales armies in both East and West contained scholae (elite cavalry units) of gentiles. There is also a mention of a regular regiment called Laeti in the clash between emperors Constantius II and Julian in 361; and a regiment called Felices Laetorum in 6th century Italy. The units ala I Sarmatarum and numerus Hnaufridi attested in 3rd century Britain may have been formed of laeti. But Elton and Goldsworthy argue that laeti were normally drafted into existing military units, and only rarely formed their own. The main support for this view is a decree of 400 AD in the Codex Theodosianus which authorises a magister militum praesentalis to enlist Alamanni and Sarmatian laeti, together with other groups such as the sons of veterans. This probably implies that laeti were seen as part of the general pool of recruits. In this case, the praefecti laetorum/gentilium may have been purely administrative roles, especially charged with ensuring the full military levy from their cantons each year. Notitia Dignitatum Much of our information on laeti is contained in the Notitia Dignitatum, a document drawn up at the turn of the 4th/5th centuries. The document is a list of official posts in the Roman Empire, both civil and military. It must be treated with caution, as many sections are missing or contain gaps, so the Notitia does not account for all posts and commands in existence at the time of compilation. Furthermore, the lists for the two halves of the Empire are separated by as much as 30 years, corresponding to ca. 395 for the Eastern section and ca. 425 for the West. Therefore, not all posts mentioned were in existence at the same time, and not all posts that were in existence are shown. The surviving Notitia only mentions laeti settlements in Italy and Gaul - and even the two lists of laeti prefects extant are incomplete. But the Notitia suggests that laeti settlements may have existed in the Danubian provinces also. Furthermore, the lists probably contain errors. The list of praefecti laetorum in Gaul contains prefects for the Lingones, Nervii and Batavi: but these tribes had been inside the empire since its inception under Augustus. Thus, their classification as laeti is problematical. Most likely the text is corrupt. However, it has been suggested that these names may relate to Roman people displaced from their home areas. List of known laeti settlements Title XLII of the Western part contains two lists of laeti prefects, one for the praefecti laetorum in Gaul, and one for the praefecti gentilium Sarmatarum (prefects of Sarmatian gentiles i.e. "natives") in Italy and Gaul, all under the command of the magister peditum praesentalis- the commander of the imperial escort army in Italy (despite his title, which means "master of infantry", this officer commanded cavalry as well as infantry units). Praefecti laetorum in Gaul Batavi and Suevi at Baiocas (Bayeux, Normandy) and Constantia (Coutances, Normandy) Suevi at Ceromannos (Le Mans, Maine) and at another, unknown location Franks at Redonas (Rennes, Brittany) Teutoniciani (Teutones?) at Carnunta (Chartres, Maine) Suevi in Arumbernos (Auvergne) Lingones dispersed over Belgica I province Acti at Epuso, Belgica I Nervii at Fanomantis (Famars, Picardy) Batavi Nemetacenses at Atrabatis (Arras, Picardy) Batavi Contraginnenses at Noviomagus (Nijmegen, Netherlands) unspecified gentiles at Remo (Reims, Champagne) and at Silvamectum (Senlis) Lagenses near Tungri (Tongres, Belgium) [substantial section missing] Praefecti gentilium Sarmatarum in Italy Apulia et Calabria (the region still known in English as Apulia, the "heel" of the Italian "boot", and part of Calabria) Bruttii et Lucania (the regions today known as Calabria, Basilicata and Cilento, southern Italy) Forum Fulviense Opittergum (Oderzo, Friuli, NE Italy) Patavium (Padua, Italian Padova, Veneto, NE Italy) (placename missing) Cremona (Cremona, Lombardy, northern Italy) Taurini (Turin, Italian Torino, Piedmont, NW Italy) Aquae sive Tertona (Tortona, Piedmont, NW Italy) Novaria (Novara, Piedmont, NW Italy) Vercellae (Vercelli, Piedmont, NW Italy) Regio Samnites (Sannio, Campania, southern Italy) Bononia in Aemilia (Bologna, Emilia-Romagna, N central Italy) Quadratae et Eporizium (Quadrata now Verolengo near Chivasso and Ivrea - ancient Eporedia, in Piedmont, NW Italy) (in Liguria) Pollentia (Pollenzo, Piedmont, NW Italy) Praefecti gentilium Sarmatarum in Gaul Pictavi (Poitiers west central France): N.B. Taifali also mentioned here a Chora Parisios usque (Paris region) inter Remos et Ambianos Belgica II (Champagne region) per tractum Rodunensem et Alaunorum (Rennes area? NW France) : N.B. Alauni (Alans) were probably also present here Lingones (Langres, NE France) Au... (name unintelligible) [entire folio - two pages - missing] Marcomanni The Notitia also mentions a tribunus gentis Marcomannorum under the command of the dux Pannoniae et Norici and a tribunus gentis per Raetias deputatae (tribune of natives in the Raetian provinces). These Marcomanni were probably laeti also and may be the descendants of tribespeople settled in the area in the 2nd century by Marcus Aurelius. Alternatively (or additionally), they may have been descended from Germans settled in Pannonia following Gallienus's treaty with King Attalus of the Marcomanni in AD 258/9. The Notitia thus contains 34 entries concerning laeti. But some entries relate to several settlements, not just one, e.g. the Sarmatian settlements in Apulia and Calabria. Furthermore, more than two pages of entries appear to be missing. The number of settlements may thus have been in the hundreds, in the western half of the empire alone. Impact The Notitia lists of laeti settlements, incomplete as they are, show their considerable proliferation over the fourth century. This, together with the large numbers of military units with barbarian names, gave rise to the "barbarisation" theory of the fall of the Roman empire. This view ultimately originates from Edward Gibbon's magnum opus, the Decline and Fall of the Roman Empire. According to this view, a critical factor in the disintegration of the western Roman empire in the 5th century was the Romans' ever-increasing reliance on barbarian recruits to man (and lead) their armies, while they themselves became soft and averse to military service. The barbarian recruits had no fundamental loyalty to Rome and repeatedly betrayed Rome's interests. This view does not distinguish between laeti, foederati and mercenaries. This view has remained in history writing since the more than 200 years since Gibbon wrote his narrative. In recent times the views of Gibbon has been generally discounted. According to Goldsworthy, there is no evidence that barbarian officers or men were any less reliable than their Roman counterparts. Instead, the evidence points to the conclusion that laeti were a crucial source of first-rate recruits to late Roman army. Recruitment of Barbarians was not something new and had been present since the days of the Roman Republic, Julius Caesar and Marc Antony recruited defeated Gallic and German horsemen which served in their campaigns. The practice was taken up by the first emperor Augustus with the establishment of the auxiliaries, incorporating the defeated Barbarians into the Roman army. The Laeti, like the auxiliaries, were set on a path of Romanization. See also Late Roman army Saxon shore Citations References Ancient Notitia Dignitatum (late 4th century) Modern Birley, Anthony (2002), Band of Brothers: Garrison Life at Vindolanda Elton, Hugh (1996), Roman Warfare 350-425 Goldsworthy, Adrian (2000), Roman Warfare Goldsworthy Adrian, (2005), The Complete Roman Army Jones, A. H. M. (1964), Later Roman Empire Mattingly, David (2006), An imperial possession: Britain in the Roman empire Neue Pauly-Wissowa Walde, A. and Hofmann, J.B. (1965), Lateinisches etymologisches Wörterbuch. Late Roman military units Military of ancient Rome Military units and formations of ancient Rome
Events from the year 1991 in Portuguese Macau. Incumbents President - Mário Soares Governor - Carlos Montez Melancia (until 23 April), Vasco Joaquim Rocha Vieira (starting 23 April) Years of the 20th century in Macau Macau Macau 1990s in Macau
Photon-Induced Near-field Electron Microscopy (PINEM) is a variant of the Ultrafast Transmission Electron Microscopy technique and is based on the inelastic coupling between electrons and photons in presence of a surface or a nanostructure. This method allows one to investigate time-varying nanoscale electromagnetic fields in an electron microscope. For visible light, such inelastic coupling between electrons and light, i.e. direct absorption or emission of photons, is forbidden in free space (vacuum) since it is not possible to simultaneously conserve both energy and momentum. This constraint can be circumvented when photon momentum is broadened as a result of light being reflected or scattered from a surface or nanostructure. This process would then generate evanescently confined near-fields with a broad momentum distribution, reaching high intensities in a nanoconfined space and thus also boosting the cross section of electron-light coupling. Theoretically, the analytical description of the phenomenon has been provided by Park et al., Garcia de Abajo et al. and Feist et al. In these works the authors demonstrated that the strength of electron-light interaction depends on the linear coupling to the electric field projection along the electron propagation direction. In particular, Feist et al. also experimentally demonstrated that the interaction process results in a coherent spectral redistribution of the electron wave packet producing Rabi oscillations of a multi-level quantum ladder in which the states are separated by the photon energy. Particularly appealing for photonics application is the fact that the spectral, spatial and momentum distributions of the electrons subjected to such inelastic scattering process are strictly correlated with the near-field distribution mediating the electron-light coupling. The latter can be thus mapped in space and time with ultrafast electron microscopy methods, providing femtosecond movies of nanoscale fields in and around nanostructures. More interestingly, the PINEM method can also be used to dynamically manipulate the wave properties of the electron beam by using suitably prepared electromagnetic field configuration. In such a way, one can modulate coherently the amplitude and phase of the electron beam along both the longitudinal and the transverse directions. See also Transmission electron microscopy Electron energy loss spectroscopy (EELS) Energy filtered transmission electron microscopy (EFTEM) References Electron beam Electron microscopy techniques Scientific techniques Quantum electrodynamics Photonics
Vinson Massif () is a large mountain massif in Antarctica that is long and wide and lies within the Sentinel Range of the Ellsworth Mountains. It overlooks the Ronne Ice Shelf near the base of the Antarctic Peninsula. The massif is located about from the South Pole. Vinson Massif was discovered in January 1958 by U.S. Navy aircraft. In 1961, the Vinson Massif was named by the Advisory Committee on Antarctic Names (US-ACAN), after Carl G. Vinson, United States congressman from the state of Georgia, for his support for Antarctic exploration. On November 1, 2006, US-ACAN declared Mount Vinson and Vinson Massif to be separate entities. Vinson Massif lies within the unrecognised Chilean claim under the Antarctic Treaty System. Mount Vinson is the highest peak in Antarctica, at . It lies in the north part of Vinson Massif's summit plateau in the south portion of the main ridge of the Sentinel Range about north of Hollister Peak. It was first climbed in 1966 by an American team led by Nicholas Clinch. An expedition in 2001 was the first to climb via the Eastern route, and also took GPS measurements of the height of the peak. As of February 2010, 1,400 climbers have attempted to reach the summit of Mount Vinson. Geography The Vinson Massif extends between Goodge Col and Branscomb Glacier to the northwest, Nimitz Glacier and Gildea Glacier to the southwest and south, and Dater Glacier and its tributary Hinkley Glacier to the east. The southeastern part of the massif ends at Hammer Col, which joins it to the Craddock Massif, of which the highest point is Mount Rutford (). The massif comprises both the high central Vinson Plateau with its few peaks rising to over , and several side ridges mostly trending southwest or northeast from the plateau. The current height () of Mount Vinson was measured by a GPS survey that was conducted by the 2004 Omega Foundation team comprising Damien Gildea of Australia (leader) and Rodrigo Fica and Camilo Rada of Chile. Since 1998 and continuing through 2007, the Omega Foundation has placed a GPS receiver on the summit for a suitable period of time to obtain accurate satellite readings. Geology Steeply inclined strata known as the Crashsite Group forms Vinson Massif. It consists of of shallow-water, mostly marine, tan, green, and red quartzose sandstones (quartzites) and argillites. In ascending order, the Crashsite Group is subdivided into the Howard Nunataks Formation (), the Mount Liptak Formation (), and the Mount Wyatt Earp Formation (). Erosion-resistant and steeply inclined beds of the Mount Wyatt Earp Formation comprise the crest of the Vinson Massif, including Mount Vinson. The steeply inclined strata of the Crashsite Group are part of the western limb of a major syncline that forms the core of the Sentinel Range within the Ellsworth Mountains. The Mount Wyatt Earp Formation contains Devonian fossils. The transition beds at the base of the Crashsite Group contain Late Cambrian trilobites. The intervening lower parts of the Crashsite Group likely include Ordovician and Silurian strata. Climate and glaciers The climate on Mount Vinson is generally controlled by the polar ice cap's high-pressure system, creating predominantly stable conditions but, as in any polar climate, high winds and snowfall are a possibility. Though the annual snowfall on Mount Vinson is low, high winds can cause base camp accumulations up to in a year. During the summer season, November through January, there are 24 hours of sunlight. While the average temperature during these months is , the intense sun will melt snow on dark objects. Over successive years, the limited amount of snow that falls on Vinson Massif compacts and is transformed into ice, forming glaciers. These glaciers follow the topography and flow down the mountain's valleys. The uppermost glacier occupies Jacobsen Valley on the north face of Mount Vinson, and flows either into Branscomb Glacier to the west or Crosswell Glacier to the east. The Crosswell Glacier flows into the Rutford Ice Stream via Ellen Glacier. The south face of Mount Vinson is drained by Roché Glacier, which flows westwards into Branscomb Glacier, with the latter leaving Vinson Massif to join Nimitz Glacier. History A high mountain, provisionally known as "Vinson", was long suspected to be in this part of West Antarctica, but it was not actually seen until January 1958, when it was spotted by US Navy aircraft from Byrd Station. It was named after Carl Vinson, United States Representative from Georgia who was a key supporter of funding for Antarctic research. The first measurement of the Vinson Massif was established in 1959 at the elevation of . First ascent In 1963, two groups within the American Alpine Club (AAC), one led by Charles D. Hollister and Samuel C. Silverstein, M.D., then in New York, and the other led by Peter Schoening of Seattle, Washington, began lobbying the National Science Foundation to support an expedition to climb Mount Vinson. The two groups merged in spring 1966 at the urging of the National Science Foundation and the AAC and Nicholas Clinch was recruited by the AAC to lead the merged expeditions. Officially named the American Antarctic Mountaineering Expedition (AAME) 1966/67, the expedition was sponsored by the AAC and the National Geographic Society, and supported in the field by the U.S. Navy and the National Science Foundation Office of Antarctic Programs. Ten scientists and mountaineers participated in AAME 1966/67. In addition to Clinch they were Barry Corbet, John Evans (University of Minnesota), Eiichi Fukushima (University of Washington, Seattle), Charles Hollister, Ph.D. (Columbia University), William Long, (Alaska Methodist University), Brian Marts, Peter Schoening, Samuel Silverstein, (Rockefeller University) and Richard Wahlstrom. In the months prior to its departure for Antarctica the expedition received considerable press attention, primarily because of the reports that Woodrow Wilson Sayre was planning to fly in a Piper Apache piloted by Max Conrad, the "flying Grandfather", with four companions into the Sentinel Range to climb the Mount Vinson. Sayre had a reputation for problematic trips as a result of his unauthorized, unsuccessful, and nearly fatal attempt to climb Mount Everest from the North in 1962. His unauthorized incursion into Tibet led China to file an official protest with the U.S. State Department. In the end, the purported race did not materialize as Conrad had difficulties with his plane. According to press reports, he and Sayre were still in Buenos Aires on the day the first four members of AAME 1966/67 reached Mount Vinson's summit. In December 1966 the Navy transported the expedition and its supplies from Christchurch, New Zealand to the U.S. base at McMurdo Sound, Antarctica, and from there in a ski-equipped C-130 Hercules to the Sentinel Range. All members of the expedition reached the summit of Mount Vinson. The first group of four climbers summited on December 18, 1966, four more on December 19, and the last three on December 20. On August 17, 2006, from nomination by Damien Gildea of the Omega Foundation, US-ACAN approved naming the subsidiary peaks south of Mount Vinson for the AAME 1966/67 members Nicholas Clinch, Barry Corbet, Eiichi Fukushima, Charles Hollister, Brian Marts, Samuel Silverstein, Peter Schoening and Richard Wahlstrom. Other peaks in the Sentinel Range had previously been named for John Evans and William Long. Later ascents The climb of Vinson offers little technical difficulty beyond the usual hazards of travel in Antarctica, and as one of the Seven Summits, it has received much attention from well-funded climbers in recent years. Multiple guide companies offer guided expeditions to Mount Vinson, at a typical cost of around US$45,000 per person, including transportation to Antarctica from Chile. First ascent from east side While the vast majority of prior climbs to the summit have used the western side of the massif from the Branscomb Glacier, the first ascent from the east side was successfully completed by an eight-person team sponsored by NOVA in January 2001. The team consisted of: Conrad Anker – expedition leader Jon Krakauer – mountaineer and author Dave Hahn – mountain guide with 34 ascents, including ascents to Gardner, and Shinn. Andrew Mclean – extreme skier Dan Stone – glaciologist Liesl Clark – producer John Armstrong – cameraman Rob Raker – assistant cameraman and sound recording The team not only made the first ascent from the east side but also performed scientific research into snow accumulation at different elevations as well as taking the first ground-based GPS reading from the summit. The GPS reading gave the elevation of the highest point in Antarctica as , eclipsing the earlier established heights recorded in 1959 and 1979. Another first was the successful aircraft landing of a Twin Otter on the Upper Dater Glacier on the eastern slopes of Mount Vinson. NOVA named the production "Mountain of Ice", which first aired on PBS in February 2003. See also Vinson Plateau Mount Sidley – highest volcano in Antarctica Seven Summits Maps Vinson Massif. Scale 1:250 000 topographic map. Reston, Virginia: US Geological Survey, 1988. D. Gildea and C. Rada. Vinson Massif and the Sentinel Range. Scale 1:50 000 topographic map. Omega Foundation, 2007. Antarctic Digital Database (ADD). Scale 1:250000 topographic map of Antarctica. Scientific Committee on Antarctic Research (SCAR). Since 1993, regularly updated. References External links The Vinson Massif. Explorers Dream Mountains of Ellsworth Land Seven Summits Ellsworth Mountains Filchner-Ronne Ice Shelf Four-thousanders of Antarctica
Giuseppe Mercanti, best known as Pino Mercanti (16 February 1911 – 3 September 1986), was an Italian director and screenwriter. Life and career Born in Palermo, Sicily, Mercanti was a pioneer of the Sicilian cinema as the leading filmmaker and the artistic director of the production company O.F.S. (a.k.a. Organizzazione Filmistica Siciliana), founded by the brothers Francesco and Girolamo Gorgone with the purpose of promoting the production of films on Sicilian soil. Following the bankruptcy of the company, Mercanti moved to Rome, where he directed a number of melodramas, adventure films, Spaghetti Westerns and other genre films, often international co-productions. He was sometimes credited as Joseph Trader. Selected filmography For the Love of Mariastella (1945) I cavalieri dalle maschere nere (1948) Serenata amara (1952) La voce del sangue (1952) Revenge of a Crazy Girl (1952) I cinque dell'Adamello (1954) Tears of Love (1954) Primo applauso (1957) Knight of 100 Faces (1960) The Black Duke (1963) Gentlemen of the Night (1964) Tres dólares de plomo (1965) Special Code: Assignment Lost Formula (1966) References External links 1911 births 1986 deaths Italian film directors 20th-century Italian screenwriters Italian male screenwriters Film people from Palermo 20th-century Italian male writers
Gears of War is a 2006 third-person shooter video game developed by Epic Games and published by Microsoft Game Studios. It is the first installment of the Gears of War series, and was initially released as an exclusive title for the Xbox 360 in November 2006. A Microsoft Windows version, developed in conjunction with People Can Fly, was released in November 2007. The game's main story, which can be played in single or co-operative play, focuses on a squad of troops who assist in completing a desperate, last-ditch attempt to end a war against a genocidal subterranean enemy, the Locust, and save the remaining human inhabitants of their planet Sera. The game's multiplayer mode allows up to eight players to control characters from one of the two factions in a variety of online game modes. Gameplay features players using cover and strategic fire in order to win battles. The game was a commercial success, selling over three million copies within ten weeks of its launch. It became the fastest selling video game of 2006, the second-most played game over Xbox Live during 2007, and one of the best-selling Xbox 360 games. The game received universal acclaim for its gameplay and detailed visuals, and is considered to be one of the greatest video games ever made, winning over 30 "Game of the Year" awards in 2006 and helped popularize the use of a cover system. A remastered version, Gears of War: Ultimate Edition, was developed primarily by The Coalition. Ultimate Edition was released for the Xbox One in August 2015, and for Microsoft Windows in March 2016. Gears of War'''s success led to the development of a franchise, including four sequels: Gears of War 2 (2008), Gears of War 3 (2011), Gears of War 4 (2016), and Gears 5 (2019), and two prequels, Gears of War: Judgment (2013) and Gears Tactics (2020). In addition, it has also spawned adaptations for books and comics, and a film based on the series is currently in development. GameplayGears of War is a third-person shooter that places emphasis on using cover to avoid taking damage while moving towards enemy forces. The game uses a number of weapons, but predominately featured is the Lancer Assault Rifle, which has a mounted chainsaw bayonet that can deal melee damage at close range. Playable characters can carry two primary weapons, grenades, and a smaller, secondary weapon such as the Snub Pistol. Weapons are reloaded with a tap of the RB button, and a second tap within a given time (active reload) rewards the player with a damage bonus. However, failing to perform the "Active Reload" correctly will cause the gun to become momentarily jammed while the player's character fixes it. When the player takes damage, the "Crimson Omen", a red cog representing the player's health gauge, will fade into the screen, becoming more defined with larger amounts of damage. The player can seek cover to recover their health, but if they take too much damage, they will become incapacitated. Once this occurs, a skull will fill the center void of the omen. The player can then be revived by a teammate, executed by an enemy, or remain incapacitated until they "bleed out", dying from blood loss. The game features a five-act campaign that can be played alone or cooperatively with another player. The campaign focuses on COG Army soldiers Marcus Fenix and Dominic Santiago and their efforts in the Delta Squad to wipe out the Locust forces on their planet Sera. The player is joined by AI teammates that will help fight the Locust. Certain sections of the campaign feature two paths that can be taken as selected by the first player. If there is a second player, their character will automatically take the other. The campaign can be played at three difficulty settings in the first game. From easiest to hardest, these are "Casual", "Hardcore" and "Insane". The "Insane" difficulty is unlocked once the game is beaten on either the "Casual" or "Hardcore" difficulty. Multiplayer Gears of War features up to four-on-four competitive gameplay, with teams representing the Gears or the Locust. Players must execute downed foes, otherwise these will revive after a time. In Assassination matches, the team's leader is the only one that can track the other team's leader and pick up new weapons, after which teammates can pick them up, with the goal to eliminate the foe's leader. An Xbox 360 patch added the "Annex" mode, which is similar to King of the Hill, in which players must try to control a shifting control point for a certain amount of time to win. The PC version of Gears introduced "King of the Hill", a mode not present in the Xbox 360 version, which uses a fixed control point but varies the conditions on which it is controlled. Synopsis Setting and charactersGears of War takes place on the planet Sera. A liquid called Imulsion became a highly valued power source after a scientist discovered how to use it, and the economic shockwave led to several wars between nations. The Coalition of Ordered Governments (COG) originally existed only as an obscure world-government philosophy, but it evolved into a legitimate, though minor, political party during the 79-year-long Pendulum Wars. The soldiers of the COG are called "Gears". After "Emergence Day" (E-Day), when the Locust began their attack on humanity, the COG were the ones who took the necessary steps to ensure the survival of human civilization, instituting martial law and taking charge of the effort against the Locust. Fourteen years later, the COG is the only human government left on Sera. One year after E-Day, after losing multiple military battles to the Locust, the COG launched a Pyrrhic tactical and strategic campaign using the satellite-based weapon of mass destruction known as the "Hammer of Dawn" on human cities with extremely destructive results. The result gave the citizens of Sera three days to evacuate to the Jacinto Plateau, the only place Locust could not dig through, before going through with the attack. The game primarily focuses on Marcus Fenix (John DiMaggio) and his comrades in Delta Squad: Dominic "Dom" Santiago (Carlos Ferro), Augustus Cole (Lester Speight), and Damon Baird (Fred Tatasciore). Side characters, such as Colonel Victor Hoffman, Private Anthony Carmine, Lieutenant Minh Young Kim, Lieutenant Anya Stroud, and an elderly Stranded man known as Chaps, also aid Delta Squad throughout the narrative. The game's main antagonist is General RAAM, a powerful leader of the Locust Horde's armed forces. Players take control of Fenix in the campaign; while in co-op mode, the second player controls Santiago. All four Delta squad members are available for play during multiplayer games, along with Carmine, Kim, and Hoffman, in addition to various Locust characters. Plot The game's plot begins fourteen years after Emergence Day (E-Day), when the Locust Horde overran and killed many COG soldiers and civilians, declaring war against humanity. Marcus Fenix, a former COG soldier, is reinstated into the military after spending four years in prison for abandoning his military post in order to make a vain attempt to save his father, Adam Fenix. Dominic "Dom" Santiago, Marcus' best friend and fellow COG, successfully extracts Fenix from the prison, and takes him to meet Delta Squad. The group seeks to obtain the "resonator", a device that will map "The Hollow", the caverns which the Locust inhabit and later deploy the "Lightmass Bomb", which will destroy the heart of the Locust forces inside the Hollow. Fenix and his allies recover the device, but suffer multiple casualties in the process including Anthony Carmine and Squad leader Kim. Fleeing RAAM's forces, Fenix leads the remaining soldiers through the ruins of Ephyra to claim a "Junker" APC, drive to a mining facility, and finally into the planet's depths. Delta Squad successfully detonates the resonator, but the device fails to map enough of the tunnel network. They discover a larger map of the network that originates from Fenix's old home, specifically his father's laboratory. The group ventures to the Fenix estate at East Barricade Academy, where Fenix originally attempted to rescue his father. When they arrive, Delta encounters heavy Locust resistance. After collecting the data, the group fights their way past Locust forces and boards a train carrying the Lightmass Bomb. Fenix and Santiago battle their way through the train, and are able to kill General RAAM, before uploading the data. Fully activated, the Lightmass Bomb launches into the Hollow, and eradicates the Locust tunnel networks. In the game's final sequence, Hoffman delivers a victory speech as the tunnels collapse and explode, whereupon the voice of the Locust Queen promises that the Locust will continue to fight onward, despite their losses. Development Design The first concept for the game was conceived around the years 2000 and 2001 as Unreal Warfare, which was much closer to the multiplayer-driven Unreal series than the game that would eventually become Gears of War. The original concept for the game featured character classes and mechs, being played in a closed arena against other players or bots. The game was put on standby as Epic focused on the Unreal Tournament series, and when the team went back to it, the industry had shifted towards single-player games and the aim of the game was changed. According to Rod Fergusson, the game was at one point intended to be a horror game influenced by Band of Brothers, Resident Evil 4 and Kill Switch. A romance subplot was considered for the game but was eventually dropped. In an interview with Cliff Bleszinski, lead developer for Epic Games, he cites three games that were the primary influences in the game's design, including the pacing and over-the-shoulder third-person perspective from Resident Evil 4 and the tactical-cover system from Kill Switch; Bleszinski also cited Bionic Commandos influence on the cover system, equating the actions of moving from cover to cover as similar to the action of swinging from platform to platform in the latter game. These design choices reflect themselves in the gameplay, as Gears of War focuses mainly on squad team-based and cover-dependent tactics with limited weapons rather than brute force. Bleszinski also cited the influence of The Legend of Zelda, including its storytelling and world-building elements, acquiring and mastering of tools, and underground environments. The game's title itself is a homage to Metal Gear, an early formative influence on Bleszinski. The total cost of development was $10 million, according to Epic's Mark Rein, and 20 to 30 people were involved with the development at any time. However, these figures do not include the proprietary Unreal Engine 3.Gears of War was first shown as an unnamed exclusive for the Xbox 360 in a behind-closed-doors presentation by Epic Games at the 2005 Game Developers Conference. The demo was presented as a technology showcase for Unreal Engine 3 that would run on the Xenon processor at the center of the new Xbox. It showcased a group of human soldiers patrolling a city at night that fell under ambush. The demo was noted for its overall realism, suspense, and visual clarity, helping to reinforce the argument advanced by Epic Games' founder Tim Sweeney for Microsoft to double the memory in the Xbox 360 from the planned 256 MB to 512 MB. This decision that would ultimately cost Microsoft tens of millions of dollars and restrict the number of Xbox 360 consoles available at launch, but allowed Gears of War and many other Xbox 360 games to run at 720p resolution.Gears of War lead designer Cliff Bleszinski said he hoped for the game to expand into graphic novels and eventually film. On November 21, 2006, Microsoft Corporate VP of Global Marketing and Interactive Entertainment Business Jeff Bell stated Gears of War is the first in a trilogy, through sequences on E-Day and the battle of Jacinto Plateau, as well as information on Adam Fenix and his research. Epic Games Vice President Mark Rein posted a message on the official Gears of War Internet forums, stating "It's not over until it is not fun anymore", and, in his view, Gears of War may become the next Halo series in terms of popularity. The ending to Gears of War heavily suggested a sequel, and at the 2007 Game Developers Conference, Bleszinkski confirmed that Epic Games did "intend to do a sequel" to Gears of War. The game's sequel, Gears of War 2 was officially confirmed on February 20, 2008, and was released at midnight on November 7, 2008. On January 27, 2014 Microsoft announced that they have acquired all rights to the franchise from Epic Games and that Rod Fergusson had rejoined Microsoft Studios to lead development on future Gears of War games. Ports News of the franchise's future has emerged multiple times since the game's release. PC Gamer accidentally released an image in its 2006 holiday issue where Gears of War can be seen in a Games for Windows display, which led to suspicion that Gears of War would be released for the PC; however, the image was later stated to be a mock-up. Possible leaked pictures were released on February 13, 2007, leading to more suspicion of Gears on the PC. In an interview with Xbox fan site TeamXbox, Mark Rein stated that the game would eventually come to the PC; Epic was not currently ready to release it on that format, but the upcoming release of Unreal Tournament 3 was "helping (Epic) get optimization on the PC". On July 11, 2007 at the E3 conference, it was revealed that Gears of War would indeed be released for Windows. New features include three new multi-player maps, an extension of five new single-player chapters to act five which describes events of Delta Squad escaping a giant Brumak between acts four and five (which Mark Rein claims is "about 20 percent extra" over the existing Xbox 360 content), new game modes, a game editor, and Games for Windows – Live support integrated into Unreal Engine 3. When asked about bringing the additional content to the Xbox 360 version, Mark Rein of Epic Games stated that "it is unlikely we will bring that content to 360". He then states, "Unfortunately the version it's built on is not really compatible with the 360 and so it would involve a massive patch, a patch larger than all five we've done so far, to Gears of War to do that." Additionally, the PC and Xbox 360 versions will not allow for cross-platform play; Cliff Bleszinski stated that "while this feature does add value, it just wasn't that desired nor worth the extra months of design and development time. We want Gears of War to be out this holiday on PC." This news angered many owners of Gears of War on the Xbox 360 due to the game no longer living up to its "Exclusively for the Xbox 360" title and not receiving the additional content. Mark Rein noted that despite their original label of the game as an Xbox 360 exclusive, Microsoft allowed them to develop the game as part of the Games for Windows moniker, as has been done previously with Halo 2. A patch was released on November 28 to fix performance issues and also the Games for Windows – Live update issue. The patch was only released for American and Western European versions of the game; legitimate purchasers of the Eastern European and Russian versions were informed that "the game would continue to function without the patch" and never issued a corresponding version. A macOS version was confirmed by Mark Rein at the end of E3, on the Game Head television program on July 14, 2007, along with Unreal Tournament 3, but no release time frame was specified. As of August 2014, nothing more has been mentioned. Digital certificate issue In early 2009, an issue with a digital certificate, used to sign certain game-critical files as part of the anti-cheat mechanism, which expired on January 28, 2009, rendered the game unplayable without a temporary workaround of resetting the system clock to before the certificate expired. Initial information from sources led people to believe the issue was related to DRM within the game. Epic later acknowledged the problem, claiming it was not in relation to a form of DRM but instead to a form of Anti-Cheat, and notified end users that they "[were] working with Microsoft to get it resolved." This issue was corrected as of February 6, 2009 with a downloadable patch. Music The music was composed by Kevin Riepl who has previously worked with Epic Games on the soundtracks for Unreal Tournament 2004 and Unreal Championship 2: The Liandri Conflict. Riepl began receiving early builds and cinematics about halfway through the development process, closely collaborating with the development team on the influence the music should have on the player and the story. The theme of 'Destroyed Beauty' that had inspired the game's visuals guided the music too, creating mood suited to a beautiful city in ruins and the emotional desperation of its inhabitants. The score includes many mechanical percussive elements, altered samples of explosions, hits and impacts, and electric guitar stingers that punctuate the game's combat encounters. To complete the score these elements were combined with the organic sounds of a live orchestra. The orchestral score was orchestrated and conducted by Corey Status and performed by the Northwest Sinfonia orchestra. The title track was written and performed by thrash metal band Megadeth, with an instrumental version of the song being used for the soundtrack; a revised version with lyrics was featured on the band's 2007 album United Abominations. Megadeth performed the track live as headliners of Gigantour, a twenty-five stop metal tour sponsored by Microsoft as part of the promotion for the game. A soundtrack was released on July 31, 2007 by Sumthing Else Music Works. Ultimate Edition During a press conference at E3 2015, Microsoft announced a remaster of Gears of War entitled Gears of War: Ultimate Edition. It brought about a number of improvements, including updates to the gameplay from later titles and enhanced graphics featuring remodeled characters, environmental assets and other stylistic changes. It was subsequently released worldwide for the Xbox One in North America and Asian-Pacific countries on August 25, 2015, and in Europe on August 28, and Microsoft Windows on March 1, 2016. Marketing Promotional videos Microsoft produced a thirty-minute documentary, titled Gears of War: The Race to E3, that aired on MTV2 on May 19, 2006 to promote the game. The program was produced in a reality TV style and featured Cliff Bleszinski, Epic Games president Mike Capps, and producer Rod Fergusson in the weeks leading up to the Gears of War gameplay reveal at the Xbox Media Briefing at E3 2006. The program captures several stressful moments including Xbox executive Peter Moore's desire to remove the chainsaw rifle from the E3 demo days before the show. The chainsaw remained and after the demo was given Bill Gates confided to Cliff "I love that chainsaw." The Gears of War television ad reveals Marcus Fenix alone in the ruined streets of Sera as he moves to avoid threats that appear throughout a dark and deserted city. The spot was widely praised and has been described as one of the most iconic game trailers of the last decade. The spot, set to the Gary Jules' cover of "Mad World" and directed by Joseph Kosinski, is melancholy and reflective in tone and was a significant departure for videogame advertising at the time, especially a fast-paced shooter game. According to Kosinski, David Fincher was slated to direct the ad but had to drop out from a scheduling conflict, leading to Kosinski being brought on to direct. Visual effects company Digital Domain created the visuals inside the Unreal Engine 3 game engine, the same engine that powered Gears of War on the Xbox 360. While the spot was pre-rendered, the production method gave consumers an accurate preview of the game's textures and subtle facial expressions. The popularity of the commercial built a bigger audience for "Mad World" which would reach the #1 spot on iTunes five years after it was initially recorded. The melody remains heavily associated with the Gears of War franchise and was later adopted into the soundtrack of Gears of War 3. Bleszinski said in 2015 that he chose the song as it was his "anthem" at the time to cope with the failure of his first marriage. Limited Collector's Edition At the game's release, Epic Games released a "Limited Collectors Edition". Some of the notable differences are a steel case instead of the regular plastic case and an extra disc which contains artworks of environments and stages including Locust that did not made it to the game, and extra content and behind-the-scenes footage of the making of Gears of War. The disc also contains a time-lapse on the creation of the "Emergence" mural. The game's disc and case has a different cover and instead features the Omen background. Another of the Collector's Edition extras is a book titled Destroyed Beauty which illustrates the game's back-story and includes concepts, sketches, and descriptions of the game's characters. The Collector's Edition also includes the same instruction manual and 48-hour Xbox Live Gold trial as the regular game does. Downloadable content Epic Games began working on new content for Gears of War in August 2006. The updates would remain free according to Epic Games president Mike Capps. The first of these updates was released over Xbox Live on January 9, 2007, with two new maps released the following day on January 10, 2007. The two maps reflected background scenes from the game's storyline, known as Raven Down and Old Bones, which depict Gears fighting Locust amidst the crash site of a King Raven chopper and a museum. Another update was released for Gears of War on January 22, 2007, which, according to Epic Games' Marc Rein, is said to fix some compatibility issues with the release of Gears of War in Japan, and that no game play or functionality features were changed. On April 9, 2007, Epic Games released their third update, containing a new game mode titled Annex, which requires teams to capture and hold certain areas of each map, as well as additional gameplay tweaks and fixing up some glitches, bugs and exploits. The update was free of charge. Epic Games initially said that four new maps would be released in conjunction with the third patch. However, due to disagreements between Microsoft and Epic Games, Epic decided instead to "put these maps on sale at a reasonable price then make them free a few months later," according to Mark Rein of Epic Games. The map pack, titled "Hidden Fronts", was released on Xbox Live Marketplace on May 3, 2007, and included the maps Bullet Marsh, Garden, Process, and Subway. Free downloads of these maps were made available on September 3, 2007, four months after their initial release. A fourth update on June 14, 2007 added 250 additional Achievement points (bringing the total possible achievement points to 1250), in eight Achievements related to Annex mode and the maps from Hidden Fronts. Additionally, the update includes improvement of roadie run to keep the player from sticking to cover areas, and a patch to prevent the Annex clock from counting during connection errors. Other "housekeeping" issues were also addressed. Reception Critical Upon its release, Gears of War received universal acclaim from critics, maintaining an average review score of 93.97% at GameRankings and 94/100 at Metacritic. It was the second highest rated game of 2006 on both sites. Metacritic erroneously lists the 2007 version of Out of the Park Baseball as its highest rated game of the year, conflating it with its 2006 counterpart. This is also assuming that both iterations of The Legend of Zelda: Twilight Princess are taken together as a single game. Most reviewers praised the game for its concept visuals, presentation and sound. IGN's review of the game called it "the most gorgeous looking game on the Xbox 360" and that "the sound design is worthy of awards." While the game received high praise, reviewers did point out that Gears of War did not offer anything significantly new in its core gameplay. Eurogamer's review of the game states: "let's not pretend that we're wallowing in the future of entertainment. What we have here is an extremely competent action game that's as polished and refined as it could be, and is therefore very enjoyable. But if Epic had applied the same widescreen scope and ambition to the gameplay as it did to the engine we'd be much more excited than we are." The game's story was noted for not being very deep, as GameSpot's review states "The lack of exposition feels like a missed opportunity to make the characters and the setting even more compelling." The PC release of the game received similar praise as the 360 version, with reviewers noting various differences between the two versions. IGN commented that "The mouse and keyboard allow for more precise control, and the graphics have been improved as well;" however, 1UP stated that "the control scheme's a very central obstacle" to the game. GameSpot noted that the additional chapter felt out of place as "it changes things up a bit in ways that betray the difficulty progression of the game." Hypers Cam Shea commends the game for its "visual, solid gameplay, killer multiplayer and reload mechanics". However, he criticised it for "potential frustration, pointless squad commands and chainsaw mechanics". The Lancer weapon was later featured in an Electronic Gaming Monthly article that discusses its practicality and historical precedents. Keirsey criticized this weapon by noting that in real life, "chainsaws are heavy." He noted that the closest historical precedents are "medieval bludgeoning weapons". Awards Leading up to the game's release, Gears of War was one of the most anticipated games of 2006. The game premiered during the 2005 E3 show, and won, among others, several "Best 360 Game" awards, including from IGN, 1UP, and GameSpy. The game continued to win several awards at following 2006 E3 show prior to the game's release. These included the Game Critics Awards for "Best Console Game" and "Best Action Game", IGN's "Best 360 Action Game", "Best 360 Multiplayer Game", and "Best Overall Multiplayer Experience", and GameSpy's "Best Console Multiplayer", "Best Action Game", and "Xbox 360 Game of Show". Upon release, Gears of War received numerous awards from many publications. IGN named Gears of War as the "Xbox 360 Game of the Year" among other awards. GameSpot named the game its "Game of the Year" as well as "Best Xbox 360 Game", among other accolades. Official Xbox Magazine named Gears of War as their "Xbox 360 Game of the Year". G4 TV during the 2007 G-Phoria awards, named Gears of War its "Game of the Year" in addition to other awards.Gears of War won eight awards at the 10th Annual Interactive Achievement Awards during the D.I.C.E. Summit, which includes "Overall Game of the Year", "Console Game of the Year", "Action/Adventure Game of the Year", and outstanding achievements in "Animation", "Art Direction", "Visual Engineering", "Online Gameplay", and "Character Performance - Male". The game received the awards of "Ultimate Game of the Year" and "Xbox Game of the Year" at the 2007 Golden Joystick Awards. In addition, the characters within the game received additional awards. GameSpot gave their 2006 "Best New Character(s)" award to the Delta Squad of Gears of War. G4 TV named Marcus Fenix the "Best New Character" and gave Lester Speight's performance for "Augustus 'Cole Train' Cole" the award for "Best Voiceover". The game was given the Interactive Achievement Award for "Outstanding Character Performance – Male" for its voicework. The Berserkers were named as Official Xbox Magazines "Enemy of the Year". Guinness World Records awarded Gears of War with 5 world records in the Guinness World Records: Gamer's Edition 2008. These records include, "First Console Game to Use the Unreal 3 Engine", "Fastest Selling Original Xbox 360 Game", and "First Music Single to Top the Chart After Promoting a Video Game" for the Gary Jules version of "Mad World", which was originally released in 2003, but topped the download charts in November 2006 after it was used as background music during the TV commercial for Gears of War. SalesGears of War was a hit upon its release. On November 7, 2006—the day that it was released—it became the most popular game on the Xbox Live service, until the release of Halo 3, overtaking Halo 2 which had held the spot since its launch in November 2004. Gears was the second most-played game on the Xbox Live service throughout 2007. Gears of War sold one million copies in its first two weeks on sale making it the fastest-selling Xbox 360 game to date. By January 19, 2007, just ten weeks after its debut, over three million units of the game had been sold. It received a "Double Platinum" sales award from the Entertainment and Leisure Software Publishers Association (ELSPA), indicating sales of at least 600,000 copies in the United Kingdom. As of November 7, 2008, the game has sold 5.88 million copies worldwide. Gears of War'' was also the first Xbox or Xbox 360 game to sell out and reach the top ten charts in Japan. Film adaptation In March 2007, New Line Cinema bought the rights to make a film adaptation, with Stuart Beattie writing the script along with Marty Bowen and Wyck Godfrey. In June 2008, Len Wiseman was confirmed to direct before dropping out in 2010. On October 5, 2016, The Coalition, the franchise's current developer, announced that the film rights shifted to Universal Studios and a new film was in development, unrelated to the previous New Line Cinema project. Notes References External links 2006 video games Cancelled macOS games Cooperative video games Dystopian video games Epic Games games Games for Windows Gears of War Microsoft games Military science fiction video games Multiplayer and single-player video games Post-apocalyptic video games Third-person shooters Unreal Engine games Video games developed in the United States Windows games Xbox 360 games Video games set on fictional planets Golden Joystick Award for Game of the Year winners Game Developers Choice Award for Game of the Year winners
Northanger Abbey is a 2007 British television film adaptation of Jane Austen's 1817 novel of the same name. It was directed by British television director Jon Jones and the screenplay was written by Andrew Davies. Felicity Jones stars as the protagonist Catherine Morland and JJ Feild plays her love interest Henry Tilney. The story unfolds as the teenaged Catherine is invited to Bath to accompany some family friends. There she finds herself the object of Henry Tilney's and John Thorpe's (William Beck) affections. When she is asked to stay at Northanger Abbey, Catherine's youthful and naive imagination takes hold and she begins to confuse real life with the Gothic romance of her favourite novels. Northanger Abbey was one of three novels adapted for ITV's Jane Austen season. It was shot on location in Ireland from late August 2006 on a budget of £2 million. The drama was co-produced by Granada Productions and American studio WGBH Boston. Northanger Abbey premiered on 25 March 2007 in the United Kingdom and on 16 December 2007 in Canada. It was broadcast in the United States and Australia in 2008. The drama was viewed by 5.6 million people in the UK, making it the second most watched of the 2007 adaptations. Northanger Abbey garnered mostly positive reviews from television critics, with many praising the cast's performances. Plot Seventeen-year-old Catherine Morland, daughter of Mr. and Mrs. Morland, is a tomboy with a wild imagination and a passion for Gothic novels. Family friends Mr. and Mrs. Allen invite Catherine to spend the season in Bath and she readily accepts. At her first ball, Catherine meets and dances with Henry Tilney. The following day, Catherine makes the acquaintance of the Thorpe family. She becomes good friends with Isabella Thorpe and she meets Isabella's brother, John, when she is reunited with her own brother, James. John flirts with Catherine at a ball, but she is more interested in meeting with Henry and his sister, Eleanor. Catherine is pressured by Isabella and John into riding to Blaise Castle, despite having made plans for a walk with Henry and Eleanor. John assures her that he saw Henry driving a phaeton to Wick Rocks, but while Catherine is in John's carriage, she sees the Tilneys walking along the street. Catherine asks John to stop, knowing he lied to her, but he refuses. Catherine runs into the Tilney family at the opera and makes her apologies, before planning another walk. John tells Henry's father, General Tilney, that Catherine is the Allens' heir, and the General invites her to spend the day with the family. Catherine is delighted when she learns Henry and Eleanor love books as much as she does. On her return home, Isabella tells Catherine that she and James are engaged. James and John announce that they are to leave Bath for a few weeks and after talking about marriage with Catherine, John leaves believing she is in love with him. Isabella catches the eye of Henry's older brother, Captain Frederick Tilney, and flirts with him after she learns how low James' income will be. General Tilney invites Catherine to stay with his family at Northanger Abbey and she accepts. When Isabella tells Catherine that John is going to propose to her, Catherine tells her friend to write to him and explains that he is mistaken. Isabella continues to flirt with Frederick and Catherine asks Henry to convince his brother to leave her alone. However, he tells Catherine that Frederick will be leaving town soon to re-join his regiment. Catherine states that Northanger Abbey looks exactly as she imagined it and she becomes intrigued by Mrs. Tilney's death. Due to her overactive imagination, Catherine starts to believe that General Tilney murdered his wife. Henry catches her in his mother's chamber and becomes offended when he realises what she has been thinking. Catherine apologises and Henry tells her that perhaps it is possible to read too many novels. Catherine receives a letter from James, in which he reveals that his engagement to Isabella has been called off, because she allowed Frederick to seduce her. Eleanor explains to Catherine that her brother has no intention of marrying Isabella. Catherine gets a letter from Isabella, asking her to apologise to James for her, but Catherine states that she will do no such thing. General Tilney returns home from a trip away and orders Eleanor to send Catherine home to Fullerton that night. Catherine endures the trip alone and believes that Henry told the General about her suspicions. A few days later, Henry comes to Fullerton and explains that the General discovered that Catherine's family were not as rich as John led him to believe. He apologises for his father's actions and explains that even though he will probably be disinherited, he loves Catherine and proposes. Catherine accepts and the couple marry. Production Conception and adaptation On 10 November 2005, Julia Day from The Guardian reported that ITV controller of drama, Nick Elliott, had ordered three new adaptations of Mansfield Park, Northanger Abbey and Persuasion. Elliot commented that the adaptations would be "important remakes for the new generation". He explained, "About every 10 years, all the great stories need retelling. These films will be very much 2007 films... we've asked and pushed the production team to make them young. Her stories always make great TV drama and our Jane Austen season will feature the absolute cream of British acting talent." Elliott revealed that he had deliberately shied away from ordering adaptations of Pride and Prejudice and Sense and Sensibility to focus on Austen's lesser known works. Each of the productions were made by a different company, cast, and directors, so they had "a distinct look". They were also made to appeal to a younger audience that might have previously switched off other Austen adaptations. Northanger Abbey was given a budget of £2 million, and it marked only the second filmed adaptation of the book; with the first being made and broadcast in 1987. Andrew Davies, the screenwriter who adapted Pride and Prejudice for the BBC, was commissioned to write the script for Northanger Abbey. He had previously written an adaptation of the novel for Weekend Television in 1998. It was optioned by Harvey Weinstein for Miramax Films and drafts from other writers were added, before the project was abandoned. Davies told The Daily Telegraph's Hugh Davies that Northanger Abbey was much more straightforward to adapt than Pride and Prejudice, which was "quite a fiendish bit of compression". The reporter explained, "A young heroine thinks she has stumbled across a Gothic conspiracy of murder and concealed corpses. In fact, the true crimes are those of psychological cruelty and selfishness. Davies said that part of the back story was having the heroine read the 1764 best-seller The Castle of Otranto by Horace Walpole, which he uses to fill Catherine's head with the expectation of unspeakable secrets in the Abbey." The writer admitted that he used artistic license when it came to the scene in which Catherine's friend, Isabella, goes off with Captain Frederick Tilney. Austen did not state what happened to them in the novel, but Davies believed Frederick would have seduced Isabella. During an interview with Marion McMullen from the Coventry Evening Telegraph, Davies explained that the Gothic elements to the novel gave him inspiration to add dream sequences and fantasies to the script. He told McMullen, "I've been very faithful to the book, but one of the differences has been writing the scenes showing Catherine's fantasies. Catherine is a great reader of horror fiction – the gothic novel was fairly popular in those days, like a young girl today who would read a lot of rather steamy romances. In this production, we see some of Catherine's fantasies, some of which are quite steamy for a young girl." Davies admitted that he was proud of his reputation for "sexing up" the novels he had adapted and commented that none of his scenes were gratuitous. He told McMullen that he often looked for excuses to get the characters out of their clothes, as he felt they were always being "buttoned up to the neck". Producer Keith Thompson said Davies had made Northanger Abbey a bit more erotic than the novel and thought the script had "a wonderful cheekiness to it." Davies chose to use a narrator to speak Austen's words and help set the scene at the beginning and end of the film. Casting Karen Price from the Western Mail reported ITV were looking for "big names" and promised the best British acting talent, while they were casting the three adaptations. In July 2006, Thompson revealed the cast had yet to be confirmed and that the casting agent, John Hubbard, was "scouring" Ireland and the United Kingdom for actors to fit the roles. On 14 August, a writer for the Irish Film and Television Network stated the casting for Northanger Abbey had finished and had been confirmed. British actress Felicity Jones was chosen to play Catherine, the protagonist and eldest daughter of the Morland family. Jones received the part upon her first audition, just two weeks after graduating from Oxford University. She revealed that she really wanted the role, explaining "sometimes when you read a script, you think 'God, I'd love to do that.'" While speaking of his fondness for the characters, Davies commented that Jones' casting as Catherine was "perfect". American-born actor JJ Feild was cast as Henry Tilney, the "highly eligible young clergyman", and William Beck received the role of John Thorpe, Henry's rival for Catherine's affections. Actress Carey Mulligan was given the role of Catherine's shallow and selfish friend Isabella Thorpe. The actress had previously worked with Davies on an adaptation of Bleak House. Speaking to Graham Fuller of The Arts Desk, Mulligan commented, "I wanted to play Isabella because I'd never played a character like that before." Irish actor Hugh O'Conor was chosen to play James Morland, Catherine's brother and Isabella's fiancé. Other Irish actors cast in the production included Liam Cunningham as the "eccentric" General Tilney and Gerry O'Brien and Julia Dearden as Mr. and Mrs. Morland respectively. Desmond Barrit and Sylvestra Le Touzel were cast as Mr. and Mrs. Allen, the wealthier older couple who invite Catherine to go to Bath with them. Le Touzel previously portrayed Fanny Price in the 1983 adaptation of Mansfield Park. Catherine Walker and Mark Dymond appeared as Henry's siblings Eleanor and Captain Tilney. Geraldine James was credited as the narrator and voice of Austen. Filming Northanger Abbey was shot on location in Ireland from late August 2006. The Independent's Sarah Shannon stated that ITV had filmed in the country "largely thanks to the generous tax incentives offered by the republic's government." Filming lasted for five weeks and the drama was shot on Super 16 mm film. Twenty-first century Dublin streets doubled for nineteenth century Bath, the setting for the novel. Shannon thought some viewers might be annoyed with this and Thompson commented, "But isn't that shot of the Royal Crescent in Bath a bit of a cliché? What we've done is create our own Bath." Lismore Castle in County Waterford was chosen as Northanger Abbey, home of the Tilney family. Higginsbrook House, near Trim, County Meath, served as the exterior to the Morland family's home. The house was later used in Becoming Jane, a film about Austen's early life. Other shooting locations included Dublin Castle, Ardbraccan House and Charleville Castle. Jones told Paul Byrne of the Evening Herald that she enjoyed shooting in Ireland as she got to see a lot of the country. Music and choreography British composer Charlie Mole wrote the score to Northanger Abbey, while the Pemberley Players provided other authentic pieces of music. Sue Mythen choreographed the ballroom scenes. Speaking to Benji Wilson of the Radio Times, Jones revealed the dance sessions were the most taxing part of the shoot. She explained that the cast had to learn all of the ballroom dances from scratch and they spent a week going over them to make sure they were right. She explained, "But what happens is as soon as you put the dialogue in, the dancing just goes to pot! So it's all about putting the movement and the dialogue together and remembering what your character is supposed to be thinking at the same time – that's quite tricky!" Jones praised Mythen and said the teacher often reminded the actors to relax into the dance and remember that their character would have been doing it for years, as they would have learnt at an early age. Jones added "the novelty for us with three weeks of dancing is not quite the same!" Promotion and broadcast ITV launched a nationwide campaign to promote its Jane Austen Season. The campaign included three television adverts and cinema, outdoor and press adverts. ITV Creative made the 20, 30 and 60 second promotional trailers, which began airing on ITV channels from 25 February 2007. The following day adverts began appearing in selected national press publications. The outdoor and press adverts were created by M&C Saatchi and MindShare carried out the media buying. Northanger Abbey was the second of the Austen adaptations to be shown in the UK. It was broadcast on ITV at 9:00 pm on 25 March 2007. The drama aired on the TVOntario channel in Canada on 16 December 2007. Northanger Abbey was shown on 20 January 2008 on the US channel PBS as part of their Austen Masterpiece Theatre series. On 15 June, the film was broadcast on Australia's ABC1 channel. Home media Northanger Abbey was released on a single disc DVD and as part of a box-set in the UK on 26 March 2007. The Region 1 DVD was released on 22 January 2008. In April of that year, ITV announced they would be making a range of classic programmes, including the adaptation of Northanger Abbey, available to purchase through the iTunes Store. Reception Upon its first broadcast in the United Kingdom, Northanger Abbey was viewed by 5.6 million people and had a 26.6% audience share. This made it the second most popular of the adaptations, behind Mansfield Park. 931,000 Australians watched the drama when it aired on ABC1 in June 2008. Northanger Abbey garnered mostly positive reviews from critics. Shortly before it aired in the UK, reporters for four newspaper publications selected the drama as their "Pick of the Day." Jade Wright of the Liverpool Echo thought the adaptation had showed "a good-natured and frank Catherine", with Jones managing to "combine humility and humour with perfect aplomb." Wright praised the decision to cast Mulligan and said the actress "shone" as Isabella. A The Guardian reporter included Northanger Abbey in their feature on the week's television highlights, saying "Yes, yes, more Austin, but Andrew Davies' adaptation of one of her lighter novels is the perfect Sunday evening blend of eruditeness and pretty frocks." The Sydney Morning Herald's Lenny Ann Low also praised the cast and their performances, stating "Lush with straining bosoms, knowing looks and segments bringing Morland's wild dreams and fantasies to life, Northanger Abbey is well cast. Felicity Jones catches Morland's mix of youthful naivety, heart-whole feelings and mindful beliefs perfectly and J.J. Feild, as the dishy but sensible Tilney, grows in appeal as this feature-length drama builds to a climax." Low's colleague, Joyce Morgan later selected Northanger Abbey as one of the week's best television programmes. However, Ruth Ritchie, writing for the same newspaper, stated that the makers of the adaptation tried "desperately to create an air of mystery about the dastardly deeds at Northanger Abbey," but the audience knew it was about as scary as "a ninja turtle." Ritchie likened the ITV Austen adaptations to a "Posh Country Home and Away." Mary McNamara of the Los Angeles Times wrote "Northanger Abbey the novel was as fun as it gets for Austen, and the television film quite lives up to the same standard." Ginia Bellafante, a critic for The New York Times, proclaimed the drama gave the audience "innocent faces and heaving breasts, hyperbolizing the sex that always lurks beneath the surface of Austen's astringent presence." She went on to say Northanger Abbey was made to be a television movie and commented that it was more fun than the book. The San Francisco Chronicle's David Wiegand wrote "Persuasion is a bigger challenge to try to squeeze into 90 minutes, the real difference between that film and Northanger is the latter's consistency of high-quality performances, a careful and attentive adaptation by Andrew Davies and solid direction by Jon Jones." Writing for The Daily Telegraph, James Walton observed "Northanger Abbey was a perfectly acceptable costume drama – but not one that ever really caught fire." Simon Hoggart, writing for The Spectator, commented that Davies's adaptation of Northanger Abbey "was much bolder and more confident than Mansfield Park the week before." The Hollywood Reporter's Ray Bennett praised Northanger Abbey, calling it "a wonderfully evocative version", which was "written with flair and imagination by Andrew Davies". He proclaimed "Capturing vividly the flush and wonder of adolescence, the film mines Austen's first-written but last-published novel to find purest nuggets of wit, romance and social satire. The story's 18th-century heroine, Catherine Morland, has a fevered imagination and Davies draws on Austen's droll illustrations of it to create scenes of gothic adventure." Bennett added "the film is shot beautifully by Ciarán Tanham while composer Charlie Mole's score adds to the quickening pace of Catherine's fantasies." For his work on Northanger Abbey, cinematographer Tanham was nominated for Best Director of Photography at the 5th Irish Film and Television Awards. References External links Northanger Abbey at PBS 2007 television films 2007 films 2000s English-language films British television films Films based on works by Jane Austen Films directed by Jon Jones (director) Films set in Bath, Somerset Films shot in Ireland Films with screenplays by Andrew Davies ITV television dramas Northanger Abbey Television series by ITV Studios Television series set in the 19th century Television shows based on works by Jane Austen Television shows produced by Granada Television
The Parajito Formation is a geologic formation in Oklahoma. It preserves fossils dating back to the Cretaceous period. See also List of fossiliferous stratigraphic units in Oklahoma Paleontology in Oklahoma References Cretaceous geology of Oklahoma
Eduard Kanhäuser, also known as Edi (born 18 September 1901-missing in action 22 May 1944) was an Austrian international footballer. Kanhäuser played as a goalkeeper for Wiener Sport-Club. His brother was fellow player Karl Kanhäuser. World War II and death Kanhauser served as an Unteroffizier (Corporal) in the German Army in World War II. He was reported missing in action in Italy on 22 May 1944 aged 42 and is commemorated at the German Military Cemetery at Monte Cassino. References 1901 births 1944 deaths Austrian men's footballers Austria men's international footballers Wiener Sport-Club players Men's association football goalkeepers German Army personnel killed in World War II German Army soldiers of World War II Missing in action of World War II Place of birth missing
Kalispell (YTB-784) was a United States Navy named after Kalispell, Montana. Construction The contract for Kalispell was awarded 14 January 1965. She was laid down on 14 September 1965 at Marinette, Wisconsin, by Marinette Marine and launched 13 December 1965. Operational history Placed in service 3 May 1966, Kalispell served in the 5th Naval District at Norfolk, Virginia until the Vietnam war when she was reassigned to Task Force 117, the Mobile Riverine Force and participated in many campaigns. After the war she served in Subic Bay, Republic of the Philippines and Diego Garcia before being scrapped in 2005. She earned eight campaign stars for Vietnam War service. References NavSource Online: Service Ship Photo Archive Kalispell (YTB-784) External links Natick-class large harbor tugs Ships built by Marinette Marine 1965 ships
Andrid (, Hungarian pronunciation: ) is a commune situated in Satu Mare County, Romania. It is composed of three villages: Andrid, Dindești (Érdengeleg) and Irina (Iriny). References Communes in Satu Mare County
Glatton is a village and civil parish in Cambridgeshire, England, some south-west of Peterborough, near the villages of Conington, Yaxley and Stilton. It lies in the non-metropolitan district of Huntingdonshire, which is part of Cambridgeshire as well as being a historic county. A World War II airfield (RAF Glatton) built nearby is now known as Peterborough's Conington Airport. History In 1085 William the Conqueror ordered that a survey should be carried out across his kingdom to discover who owned which parts and what it was worth. The survey took place in 1086 and the results were recorded in what, since the 12th century, has become known as the Domesday Book. Starting with the king himself, for each landholder within a county there is a list of their estates or manors; and, for each manor, there is a summary of the resources of the manor, the amount of annual rent that was collected by the lord of the manor both in 1066 and in 1086, together with the taxable value. Glatton was listed in the Domesday Book in the Hundred of Normancross in Huntingdonshire; the name of the settlement was written as Glatune in the Domesday Book. In 1086 there was just one manor at Glatton; the annual rent paid to the lord of the manor in 1066 had been £10 and the rent was the same in 1086. The Domesday Book does not explicitly detail the population of a place but it records that there was 35 households at Glatton. There is no consensus about the average size of a household at that time; estimates range from 3.5 to 5.0 people per household. Using these figures then an estimate of the population of Glatton in 1086 is that it was within the range of 122 and 175 people. The Domesday Book uses a number of units of measure for areas of land that are now unfamiliar terms, such as hides and ploughlands. In different parts of the country, these were terms for the area of land that a team of eight oxen could plough in a single season and are equivalent to ; this was the amount of land that was considered to be sufficient to support a single family. By 1086, the hide had become a unit of tax assessment rather than an actual land area; a hide was the amount of land that could be assessed as £1 for tax purposes. The survey records that there were sixteen ploughlands at Glatton in 1086 and that there was the capacity for a further eight ploughlands. In addition to the arable land, there was of meadows and of woodland at Glatton. The tax assessment in the Domesday Book was known as geld or danegeld and was a type of land-tax based on the hide or ploughland. It was originally a way of collecting a tribute to pay off the Danes when they attacked England, and was only levied when necessary. Following the Norman Conquest, the geld was used to raise money for the King and to pay for continental wars; by 1130, the geld was being collected annually. Having determined the value of a manor's land and other assets, a tax of so many shillings and pence per pound of value would be levied on the land holder. While this was typically two shillings in the pound the amount varied; for example, in 1084 it was as high as six shillings in the pound. For the manor at Glatton the total tax assessed was eight geld. By 1086 there was already a church and a priest at Glatton. In the 1870s, John Marius Wilson described the village as "GLATTON, a village and a parish in the district of Peterborough and county of Huntingdon. The village stands 3 miles SSW of Stilton, and 3½ WSW of Holme r. station." In 1881 Glatton had a total population of 249. Government As a civil parish, Glatton has a parish council, the lowest tier of government in England. It consists of five councillors and it has a parish clerk. It normally meets on a Wednesday, some 4–6 times a year. Glatton was in the historic and administrative county of Huntingdonshire until 1965. From 1965, the village was part of the new administrative county of Huntingdon and Peterborough. Then in 1974, following the Local Government Act 1972, Glatton became a part of the county of Cambridgeshire. The second tier of local government is the Huntingdonshire District Council of Cambridgeshire, with its headquarters in Huntingdon. Its 52 councillors represent 29 district wards. Glatton is a part of the district ward of Sawtry and represented on the district council by two councillors. District councillors serve four-year terms. For Glatton, the highest tier of local government is Cambridgeshire County Council, based in Cambridge. It consists of 69 councillors representing 60 electoral divisions. Glatton is part of the electoral division of Sawtry and Ellington and represented by one county councillor. At Westminster Glatton is in the parliamentary constituency of North West Cambridgeshire, held by Shailesh Vara (Conservative) since 2005. The previous member was Brian Mawhinney (Conservative) between 1997 and 2005. Demography Population In the period 1801 to 1901 the census population of Glatton ranged between 189 in 1901 and 358 in 1821. All population census figures from report Historic Census figures Cambridgeshire to 2011 by Cambridgeshire Insight. In 2011, the parish covered an area of , giving a population density in 2011 of 90.7 persons per square mile (35 per square kilometre). Of the 2011 population of 308, 35 were in the 0–19 cohort, 62 aged 20–44, 142 aged 45–74 and 79 over 75 years old. The structure is weighted to the older population; 72 per cent are above 45 years old. Census records show a decline until 1951, to 136, then a relatively swift rise. Occupations In 1881 there was a clear gender divide in occupations. Most men worked in agriculture (74 per cent), with a fairly even spread among other occupations. Most women had were of unknown occupation or worked in domestic services/ offices. In the 2011 census, both men and women had the highest levels of employment in associate professional and technical occupations, with a far greater number in management or as professionals. There was still some gender-specific employment, for example administrative and secretarial jobs employed more women (5:1) and the skilled trade sector more men (4:1). However, men and women appear more evenly across all occupations in the later census. Agricultural and domestic jobs, the commonest in 1881, were non-existent in 2011. Education There are no schools in Glatton. The closest is Stilton Church of England VC Primary School 1.8 miles (2.9 km) away. The closest secondary school is Sawtry Community College 2.1 miles (3.4 km) away. Landmarks Among the listed buildings in Glatton are St Nicholas's Parish Church and the Addison Arms, which won the Rural Pub of The Year award in Huntingdonshire in 2014. Transport The A1 (M) is the closest motorway, about a mile to the east of Glatton parish. There is a railway line about 3 miles east of Glatton, but the closest station is Peterborough, about 10 miles away. Parish church Glatton has a parish church dedicated to St Nicholas belonging to the Diocese of Ely. The church is mentioned in the 1086 Domesday Book, but none of that building remains. A notable feature of today's church is its tower, built about 1500. Its four bells bear the inscriptions 1) COMM COMM AND PREAY 1595, 2) SEARVE GOD AND OBEAY THY PRINCE 1595, 3) J.TAYLOR & CO FOUNDERS LOUGHBOROUGH 1863, and 4) OMNIA FAINT AD GLORIAM DEI SOLI THO. EAYRE 1736. References External links Glatton Village Official website www.glatton.org.uk Villages in Cambridgeshire Huntingdonshire Civil parishes in Cambridgeshire
```smalltalk /* This file is part of the iText (R) project. Authors: Apryse Software. This program is offered under a commercial and under the AGPL license. For commercial licensing, contact us at path_to_url For AGPL licensing, see below. AGPL licensing: This program is free software: you can redistribute it and/or modify (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the along with this program. If not, see <path_to_url */ using System; using System.Collections.Generic; using iText.IO.Font; namespace iText.Kernel.Pdf { public class PdfDocumentInfo { //\cond DO_NOT_DOCUMENT internal static readonly PdfName[] PDF20_DEPRECATED_KEYS = new PdfName[] { PdfName.Title, PdfName.Author, PdfName.Subject, PdfName.Keywords, PdfName.Creator, PdfName.Producer, PdfName.Trapped }; //\endcond private PdfDictionary infoDictionary; //\cond DO_NOT_DOCUMENT /// <summary>Create a PdfDocumentInfo based on the passed PdfDictionary.</summary> /// <param name="pdfObject">PdfDictionary containing PdfDocumentInfo</param> internal PdfDocumentInfo(PdfDictionary pdfObject, PdfDocument pdfDocument) { infoDictionary = pdfObject; if (pdfDocument.GetWriter() != null) { infoDictionary.MakeIndirect(pdfDocument); } } //\endcond //\cond DO_NOT_DOCUMENT /// <summary>Create a default, empty PdfDocumentInfo and link it to the passed PdfDocument</summary> /// <param name="pdfDocument">document the info will belong to</param> internal PdfDocumentInfo(PdfDocument pdfDocument) : this(new PdfDictionary(), pdfDocument) { } //\endcond public virtual iText.Kernel.Pdf.PdfDocumentInfo SetTitle(String title) { return Put(PdfName.Title, new PdfString(title, PdfEncodings.UNICODE_BIG)); } public virtual iText.Kernel.Pdf.PdfDocumentInfo SetAuthor(String author) { return Put(PdfName.Author, new PdfString(author, PdfEncodings.UNICODE_BIG)); } public virtual iText.Kernel.Pdf.PdfDocumentInfo SetSubject(String subject) { return Put(PdfName.Subject, new PdfString(subject, PdfEncodings.UNICODE_BIG)); } public virtual iText.Kernel.Pdf.PdfDocumentInfo SetKeywords(String keywords) { return Put(PdfName.Keywords, new PdfString(keywords, PdfEncodings.UNICODE_BIG)); } public virtual iText.Kernel.Pdf.PdfDocumentInfo SetCreator(String creator) { return Put(PdfName.Creator, new PdfString(creator, PdfEncodings.UNICODE_BIG)); } /// <summary> /// Sets a producer line for the /// <see cref="PdfDocument"/> /// described by this instance. /// </summary> /// <param name="producer">is a new producer line to set</param> /// <returns>this instance</returns> public virtual iText.Kernel.Pdf.PdfDocumentInfo SetProducer(String producer) { GetPdfObject().Put(PdfName.Producer, new PdfString(producer, PdfEncodings.UNICODE_BIG)); return this; } public virtual iText.Kernel.Pdf.PdfDocumentInfo SetTrapped(PdfName trapped) { return Put(PdfName.Trapped, trapped); } public virtual String GetTitle() { return GetStringValue(PdfName.Title); } public virtual String GetAuthor() { return GetStringValue(PdfName.Author); } public virtual String GetSubject() { return GetStringValue(PdfName.Subject); } public virtual String GetKeywords() { return GetStringValue(PdfName.Keywords); } public virtual String GetCreator() { return GetStringValue(PdfName.Creator); } public virtual String GetProducer() { return GetStringValue(PdfName.Producer); } public virtual PdfName GetTrapped() { return infoDictionary.GetAsName(PdfName.Trapped); } public virtual iText.Kernel.Pdf.PdfDocumentInfo AddCreationDate() { return Put(PdfName.CreationDate, new PdfDate().GetPdfObject()); } /// <summary>Remove creation date from the document info dictionary.</summary> /// <returns>this instance.</returns> public virtual iText.Kernel.Pdf.PdfDocumentInfo RemoveCreationDate() { infoDictionary.Remove(PdfName.CreationDate); return this; } public virtual iText.Kernel.Pdf.PdfDocumentInfo AddModDate() { return Put(PdfName.ModDate, new PdfDate().GetPdfObject()); } public virtual void SetMoreInfo(IDictionary<String, String> moreInfo) { if (moreInfo != null) { foreach (KeyValuePair<String, String> entry in moreInfo) { String key = entry.Key; String value = entry.Value; SetMoreInfo(key, value); } } } public virtual void SetMoreInfo(String key, String value) { PdfName keyName = new PdfName(key); if (value == null) { infoDictionary.Remove(keyName); infoDictionary.SetModified(); } else { Put(keyName, new PdfString(value, PdfEncodings.UNICODE_BIG)); } } public virtual String GetMoreInfo(String key) { return GetStringValue(new PdfName(key)); } //\cond DO_NOT_DOCUMENT internal virtual PdfDictionary GetPdfObject() { return infoDictionary; } //\endcond //\cond DO_NOT_DOCUMENT internal virtual iText.Kernel.Pdf.PdfDocumentInfo Put(PdfName key, PdfObject value) { GetPdfObject().Put(key, value); GetPdfObject().SetModified(); return this; } //\endcond private String GetStringValue(PdfName name) { PdfString pdfString = infoDictionary.GetAsString(name); return pdfString != null ? pdfString.ToUnicodeString() : null; } } } ```
Coptotomus venustus is a species of predaceous diving beetle in the family Dytiscidae. It is found in North America and the Neotropics. References Further reading Dytiscidae Articles created by Qbugbot Beetles described in 1823
Nehmeh group of companies is one of the oldest and established multidisciplined business enterprises in the State of Qatar. Headquartered in Doha, the company was founded in 1955 by Antoine Nehme. Subsidiaries Anton Nehmeh Establishment As one of the oldest companies in operation in Qatar, Anton Nehmeh Establishment's offerings includes various performance tools and equipment for the automotive, construction, service and woodworking industries. Nehmeh Entreprises & Industries Nehmeh Entreprises & Industries (formerly known as National Radiator Factory) was originally established in the early 1993 as the first manufacturer of heat exchangers in the country. With a new corporate identity and a new facility, it has become the first manufacturing base of Air Handling Units to be made in Qatar. References Conglomerate companies established in 1955 1955 establishments in Qatar Conglomerate companies of Qatar Companies based in Doha
Naussannes (; ) is a commune in the Dordogne department in Nouvelle-Aquitaine in southwestern France. Population See also Communes of the Dordogne department References Communes of Dordogne
is a retired Japanese freestyle wrestler. He won a silver medal at the 1960 Olympics and placed fifth at the 1961 World Championship. References External links 1939 births Living people Olympic wrestlers for Japan Wrestlers at the 1960 Summer Olympics Japanese male sport wrestlers Olympic silver medalists for Japan Olympic medalists in wrestling Medalists at the 1960 Summer Olympics 20th-century Japanese people 21st-century Japanese people
Fenestra is a genus of grasshoppers in the subfamily Gomphocerinae with species found in South America. Species The following species are recognised in the genus Fenestra: Fenestra bohlsii Giglio-Tos, 1895 Fenestra ensicorne Rehn, 1913 Fenestra orientalis (Bruner, 1913) Fenestra platyceps (Hebard, 1924) References Acrididae
Erik Holmgren (born 17 December 1964) is a retired football defender. During his club career, Holmgren played for HJK Helsinki, GAIS, FinnPa, Pallokerho-35 and FC Jokerit. He made 60 appearances for the Finland national team, scoring 2 goals. External links 1964 births Living people Finnish men's footballers Sportspeople from Porvoo Footballers from Uusimaa Finnish expatriate men's footballers Finland men's international footballers Men's association football defenders Veikkausliiga players Allsvenskan players Helsingin Jalkapalloklubi players GAIS players FinnPa players FC Jokerit players Expatriate men's footballers in Sweden
Montia diffusa is a species of flowering plant in the family Montiaceae known by the common names branching montia and spreading miner's lettuce native to North America. Distribution It is native to western North America from British Columbia to northern California, where it occurs mainly west of Cascade Range crest. It grows in moist to wet wooded areas, including areas recently affected by wildfire. Description Montia diffusa is an annual herb growing erect to about 20 centimeters in maximum height, its stem branching intricately. The diamond or lance-shaped leaves are alternately arranged and measure up to 5 centimeters in length, not counting their long petioles. The inflorescence is a raceme of 3 or more flowers. Each flower has usually five pink or white petals under half a centimeter in length blooming from a nearly closed cup of small green sepals wrapped around their bases. References External links Jepson Manual Treatment - Montia diffusa Montia diffusa - Photo gallery diffusa Flora of the Sierra Nevada (United States) Flora of California Flora of British Columbia Flora of the West Coast of the United States Flora without expected TNC conservation status
The Kold Kage is the fifth album by saxophonist Gary Thomas recorded in 1991 and released on the JMT label. Reception The AllMusic review by Thom Jurek states, "Far from academic, this is fire-breathing music, one that forces not only confrontation but, from any open-minded music listener, a reexamination of the jazz terrain as a once, present, and future music." Track listing All compositions by Gary Thomas except as indicated "Threshold" - 6:59 "Gate of Faces" - 6:57 "Intellect" (Gary Thomas, Joe Wesson) - 7:09 "Infernal Machine" (Thomas, Wesson) - 6:58 "The Divide" - 7:25 "Peace of the Korridor" - 6:51 "First Strike" (Thomas, Wesson) - 7:18 "Beyond the Fall of Night" (Anthony Perkins) - 1:53 "The Kold Kage" (Thomas, Wesson) - 7:11 "Kulture Bandits (To Be Continued)" (Joe Lee, Gary Thomas) - 1:30 Personnel Gary "GTX" Thomas - tenor saxophone, flute, synthesizer, rap vocals Joe "BMW" Wesson - rap vocals (tracks 3, 4 & 7) Kevin Eubanks (tracks 1, 3 & 6) - guitar Paul Bollenback (tracks 2 & 5) - guitar, guitar synthesizer Michael Cain (tracks 1 & 6), Tim Murphy (tracks 8 & 9) - piano, synthesizer Mulgrew Miller - piano (tracks 2 & 7) Anthony Perkins - synthesizer (tracks 8 & 10) Anthony Cox - bass Dennis Chambers - drums Steve Moss - percussion References 1991 albums Gary Thomas (musician) albums JMT Records albums Winter & Winter Records albums
Ranunculus hydrocharoides is a species of buttercup known by the common names frogbit buttercup, or frog's-bit buttercup. It is native to western North America, including the southwestern United States and Mexico. It is also known from Guatemala. It is aquatic or semi-aquatic, growing floating in water or in wet land near water. Typical habitat includes marshes, streams, and lakes. Stems are up to 25 centimeters long, prostrate on the ground when terrestrial, or floating when aquatic. The shiny green leaves have heart-shaped or oval blades up to 3 centimeters long which are borne on petioles which may be 15 centimeters in length. Flowers have 5 to 8 shiny yellow petals a few millimeters long with many stamens and pistils at the center. The fruit is an achene borne in a spherical cluster of 9 or more. References External links Jepson Manual Treatment Photo gallery hydrocharoides Flora of Northern America
Euodia Samson (born 1970), is a South African actress and TV personality. She is best known for the roles in the television serials such as; SOS, Arendsvlei, Big Okes, Madam & Eve and Fishy Feshuns. Personal life Euodia Samson was born in 1970 in Cape Flats, Cape Town, South Africa. After finishing high school, she joined with the drama group in Lavender Hill. Then she performed in many productions at the Baxter Theatre. During this period, she was offered a bursary by Mavis Taylor to study at University of Cape Town (UCT). Then in 1993, she graduated with a degree in Performer's Diploma in Speech and Drama from the UCT. She met her husband in 1994 who was a sound engineer at the Baxter at that time. The couple has three sons. Career During her life at UCT, she performed at the stage plays such as: Romeo and Juliet, Othello, The Cherry Orchard, Antigone and Animal Farm. Meanwhile, she also worked for Cape Performing Arts Board (CAPAB), and on their Schools Program called "War on Waste". In the preceding years, she continued to appear in stage apart from cinema and television, and Euodia performed in many theatre productions such as; Freaks, A Winter's Tale, A Midsummer Night's Dream, Dying Breed and Sister Breyani, Dying Breed (CAPAB 1993), Suip! (1993), The Winter's Tale (1997), Ons Hou Konsert (1999), Buckingham Palace, District Six (2000-2001), Vatmaar (2002 and 2003), Die Joseph en Mary Affair (2007 and 2008), Sister Breyani (2007 and 2009). Then she played the role "Roxy" for the Baxter Theatre and as "Mustardseed" in 1995 production of A Midsummer Night's Dream produced by Maynardville. In 1995, she made film debut with direct-to-video film The Pink Leather Chair where she played the role of "Gloria". Then in 1996, she made television debut with the serial Tussen Duiwels and played the role "Gawa September". In 1997, she played the role "Amina Davids" in SABC2 comedy drama Onder Draai die Duiwel Rond. In 2003, Euodia played the role "Christina" in the third season of SABC2 comedy Fishy Fêshuns. In 2006, she acted in the Heartlines film "The Piano" with the role "Elsie Daniels". In 2011, she acted in the film Black Butterflies with the role "Muslim woman". In the same year, she joined with the SABC2 variety comedy series Colour TV and played multiple roles. Meanwhile, she also voiced in the radio play Goud en Silwer for SABC. In 2015, she teamed up with the Tim Noakes Foundation and Groote Schuur Hospital doctor Hassina Kajee. They conducted the Banting program in Ocean View. Apart from them, she also appeared in the television serials such as SOS, Big Okes, Madam & Eve, all telecast in e.tv and then in the serials: Backstage, Tussen Duiwels, Newshounds and Khululeka. In the preceding years, she acted in the films such as; Cape of Good Hope, Ali Barber, and Crossroads. In 2017, Euodia appeared in three serials: as "Sharifa Cassim" in the danZ!, as "Fiona Abrahams" in the Waterfront and as "Gevangenis se 'Ma'" in the Die Byl. In 2018, she appeared in the kykNET & kie telenovela Arendsvlei. She continued to play the role for three consecutive seasons. In the meantime, she joined with three seasons: Projek Dina, Projek Dina and Sara se Geheim in 2020. In the same year, she played the role "Zainab Petersen" in the film Twisted Christmas. Filmography References External links IMDb 1970 births Living people South African film actresses South African television actresses South African stage actresses
L'Ascension de la rosière, released in the United States as Honeymoon in a Balloon and in Britain as The Ascension of a Communicant, is a 1908 French short silent comedy film directed by Georges Méliès. The film is now considered lost. Plot At a May Day festival, a young bride-to-be is crowned the May Queen. Her bridegroom decides to take a flight with a balloonist who has set up at a nearby fairground. The bride, running to join him, arrives just as the balloon is lifting off; not quite able to get into the basket, she is caught by the balloon's anchor as it floats into the clouds. Onlookers, realizing what has happened, make a mad dash to keep up with the balloon, but their hectic chase proves futile. Bride and balloon make a crash landing through the ceiling of a large hall, where the town mayor and his worthies are banqueting. The couple are finally reunited, and the bride has her May Queen crown of flowers restored to her as all celebrate the safe conclusion of the adventure. Release The film was released by Méliès's Star Film Company and is numbered 1347–1352 in its catalogues. It is currently presumed lost. References External links Films directed by Georges Méliès Lost French films French silent short films French black-and-white films French comedy short films 1908 comedy films 1908 lost films Lost comedy films 1908 short films Silent French comedy films 1900s French films
Thomas Brown Manuel, was a Florida community leader, politician, and state official, often referred to as the "Father of the Florida's Turnpike" for his efforts to bring about the first major highway in Florida, and for his contributions generally to economic development in the state. Early life He was born November 3, 1898, near Freetown, Jackson County, Indiana, the second child of Sarah Jane and Asbury Hill Manuel. His paternal grandfather, Dr. Grafton Manuel, was the attending physician at his birth. Thomas had two sisters Estella (1893–94) and Mary Catherine (1903-1935) as well as four brothers Virgil (1886-1957), Herschel (1887-1976 ), William (1891-1970) and Paul (1895-1925). Seeking adventure and angered by Pancho Villa's raid on a New Mexico town, at 17, he enlisted in the army, and saw action in the Mexican Expedition of 1916, remaining in the army afterward, he eventually saw action in France during World War I. Following his discharge from the army, Manuel attended the University of Illinois, earning a degree in animal husbandry, and setting out start a farm in Palm Beach County, Florida, near modern-day Delray Beach. He would ultimately settle further south, in Fort Lauderdale, where he and his wife Margaret would start a family. Daughter Ann was born in 1926. A second child died as an infant. Son and namesake Thomas Brown Manuel, Junior, was born in 1928. Civic leadership To house their growing family, the Manuels bought a house at 543 Victoria Park Road from William Reed, a prominent South Florida pioneer and politician. Reed and Manuel became close friends, with Reed serving as mentor to Manuel. Reed encouraged Manuel's increasing involvement in the civic affairs of Fort Lauderdale. Manuel served a two-years term as mayor beginning in 1937. After serving as a mayor, he re-entered the military and obtained a commission in 1940. He served with the 77th Infantry Division in the Pacific, seeing combat at Guam, Leyte Gulf, and Iwo Jima. In 1945, Manuel, who had been promoted to full colonel and would lead troops as they spent 45 consecutive days aboard ship under kamikaze attacks before participating in an amphibious landing on Okinawa. Finally retiring from the army in 1946, Manuel returned to Fort Lauderdale, and resumed his involvement in public affairs, joining and serving as an officer in local Rotary and Kiwanis organizations, as well as supporting various political causes. He began a "second career" as a banking executive, eventually helping found and serving as a director at five separate banks, including Barnett Bank of Port Everglades, later Barnett Bank of Broward County. Barnett would, in time, become part of NationsBank, which ultimately became Bank of America, the largest bank in the world. Statewide politics and the turnpike In 1952, seeking to end rural northern Florida's long dominance of state political affairs, Manuel and other like-minded leaders from the southern part of the state backed Dan McCarty, a young grovesman, fellow World War II veteran, and former speaker of the state house of representatives for governor. McCarty, ran on a platform of reform and economic progress, and was elected easily, but was felled by a massive heart attack only a few months into his term. Dismayed by McCarty's successor, Acting Governor Charley Johns, in the 1954 special election, Manuel supported LeRoy Collins. In the early 1950s Manuel had met another south Florida businessman, Charles "Charlie" Costar, who had convinced him of the need for a new road from the state line to south Florida, one that by-passed many of the sleepy beach towns that dot Florida's east coast. Largely due to Costar's lobbying efforts, the state legislature had passed the Florida Turnpike Act in 1953, and then-Governor McCarty signed it into law. During the interregnum of Charley John's acting governorship, the project largely languished. During the 1955 legislative session (the first during newly elected Governor LeRoy Collins' administration) there was a concerted effort to repeal the Turnpike Act and abolish the entire project, led by North Florida legislators known as the Pork Chop Gang. Having been appointed chairman of the Florida Turnpike Authority (the program's governing agency) in January 1955 by Governor Collins in one of his first official acts, Manuel almost single-handedly turned the situation around. By the end of the 1955 legislative session the bill to kill the Turnpike had been defeated 36–4, the original law had actually been amended to extend the planned route of the new road by another 110 miles from Fort Pierce to Miami, and a $70 million bond issue had been authorized to finance the first stage of construction. Father of the turnpike Colonel Manuel served as chairman of the Turnpike Authority from 1955 to 1961. During his tenure, the first phase of construction began on July 4, 1955. By late 1956, owing to the Federal government's announced plans for a comprehensive interstate network of highways which would become the Interstate Highway System, and which was to include a route down Florida's east coast, designated I-95, which largely duplicated the Turnpike's originally-contemplated "Coastal Route" from Jacksonville to Fort Pierce, all work on the Turnpike stopped, and plans for further construction were shelved. Construction had begun at what was expected to be the southern terminus of what was officially known as the Sunshine State Parkway, rather than near the (northern) state line, meaning the only portion to be completed before the hiatus was the 110 mile stretch between Fort Pierce and Miami - the extension Manuel had proposed and won approval for during the 1955 legislative session. The ribbon-cutting ceremony was held January 25, 1957. Throughout the greater part of his service on the Turnpike Authority, Chairman Manuel was forced to contend with opposition from diverse segments of the political world, including those who felt it was a waste of tax dollars, rural interests unenthusiastic about devoting resources to a project seen as largely benefiting urban areas, tourism-based interests in the coastal towns of the counties between St. Augustine and Fort Lauderdale, railroad lines, and others. Nonetheless, he managed to gather sufficient support to keep the Turnpike alive. Despite his initial disinclination to go forward with additional construction on the Turnpike, Governor Collins acknowledged the need for an extension of the Sunshine State Parkway that would connect Fort Pierce (and the under-construction I-95) with Orlando (and the proposed I-4 and I-75). The extension was approved in May, 1959. In 1960, he would receive a letter from Governor Collins praising Colonel Manuel for his leadership of the highway project. Later, near the end of his service on the Authority, another extension, adding 156 miles and connecting Orlando and Wildwood, would be approved. Days before both he and Manuel would leave office, Governor Collins authorized the sale of an additional $80 million in bonds to finance construction to Wildwood. That section would be dedicated July 24, 1964, and would mark the completion of the "Main Line" portion of the Parkway running from Miami to Wildwood. During his time as chairman, Colonel Manuel deliberately took an active role in the management of the Turnpike, frequently driving to various destinations, visiting construction sites, and inspecting land parcels under consideration for acquisition, talking to road construction workers and managers and motorists. On one notable occasion, witnessing an accident, he quickly pulled to the side of the road and dove into a canal, dragging the wrecked cars occupants from the murky water in what, sadly, turned out to be futile efforts to save their lives. Later life and continued service Leaving the chairmanship and the Turnpike Authority in 1961, Manuel resumed his banking interests, relocating to Plantation, Florida, a Fort Lauderdale suburb. A plaque memorializing Manuel's service to the State of Florida, and his successes as chairman of the Turnpike Authority marks the approach to the Thomas B. Manuel Bridge, which carries the Turnpike over the St. Lucie Canal, near Port Salerno, in east central Martin County. The plaque, near Mile Marker 130, officially recognizes Colonel Manuel as the "Father of the Turnpike". He retired following his wife's death in 1981, but continued to maintain an active interest in the affairs of the Turnpike, following developments affecting the system closely, often attending hearings and meetings, and frequently speaking publicly on issues pertaining to the Turnpike. Death At age 88, while attending a public hearing in Coconut Creek, and speaking against proposed toll increases, Manuel suffered a heart attack, collapsed, and was rushed to a hospital. He died soon thereafter, on August 13, 1987. He is buried in Evergreen Cemetery in Fort Lauderdale with his wife. References 1898 births 1987 deaths People from Jackson County, Indiana United States Army soldiers University of Illinois alumni Mayors of Fort Lauderdale, Florida United States Army personnel of World War I 20th-century American politicians People from Plantation, Florida
Seamus Ryan is a photographer, born in 1964. He learned the basics of photography in Dublin, and came to London around 1990. He has done work for among others Nike, BBC, and British Airways. Ryan performs "Sunday shoots", where he opens his studio to passers-by who wants him to take their picture. On one such occasion he photographed playwright Tom Stoppard, and the picture was purchased by London's National Portrait Gallery. In 2007 he founded Boothnation, a company that supplies custom-built photobooths for rental. References External links Official website Irish portrait photographers British portrait photographers 1964 births Living people 20th-century Irish photographers 21st-century Irish photographers 21st-century British photographers 20th-century British photographers Irish emigrants to the United Kingdom Place of birth missing (living people)
Santa Barbara Cottage Hospital is a community hospital in the city of Santa Barbara, California. It is owned and operated by the Cottage Health System. Services Santa Barbara Cottage Hospital is a full-service hospital, primarily serving the diverse population of Santa Barbara County. There are three other satellite hospitals within the Cottage Health system: Santa Ynez Cottage Hospital, Goleta Valley Cottage Hospital, and Cottage Rehabilitation Hospital. The hospital has regular medical-surgical beds as well as a CCU and an ICU. Several medical services are offered, including a neonatal intensive care unit and the hospital was recognized for its geriatric care. Santa Barbara Cottage Hospital is a Level I Trauma Center (upgraded from Level II in 2017) and the largest between Los Angeles and San Francisco. History The hospital opened on December 8, 1891 as a twenty-five bed hospital by Mary A. Ashley. The original building was designed by the prominent local architect Peter J. Barber. On June 4 2021, Princess Lilibet of Sussex, daughter of Prince Harry, Duke of Sussex and Meghan, Duchess of Sussex, and granddaughter of King Charles III, was born at the hospital. References External links Cottage Hospital Hospital buildings completed in 1888 Hospitals in Santa Barbara County, California Hospitals established in 1888 Buildings and structures in Santa Barbara, California Cottage hospitals Trauma centers
Smeed may refer to: People Smeed, Eben C. (1830-1892) an American civil engineer who was best known for his civil war work supporting Sherman's Atlanta and Savannah campaigns. Smeed, George (1812- 1881) Sittingbourne entrepreneur supplying bricks to Victorian London. Smeed Cross, Katherine (1858-1943) was an American social leader in Kansas. Smeed, Norah Lillian Emily (1900-1968) was a British actress of stage and screen. Smeed, Reuben CBE (1909–1976) was a British statistician and transport researcher. Other Eliza Smeed (1867) the biggest barge ever launched in Kent,U.K. and rigged as a barquentine fitted with leeboards. George Smeed a Thames barge built in 1882 by Smeed Dean & Co. Ltd. in Murston, U.K. Smeed's Law, empirical rule relating traffic fatalities to traffic congestion. Smeed Report, (1962-1964) a study into alternative methods of charging for road use, commissioned by the UK government. See also
Daniel Clifford (born 1979), better known by his stage name dbClifford, is a multi instrumentalist, singer, composer and producer of French and English descent. Born in France, he previously lived in Los Angeles, Victoria, Toronto, London and currently resides in Bergerac. His debut album, Recyclable, was released in 2007. The first single, "Simple Things", was a top 40 hit on Canadian, French and Dutch Hot AC radio and his second single "Don't Wanna" was a number-one hit in Japan. His second album Feet Above The Ground was released in 2011 and he won the John Lennon Songwriting Contest with the song "New State Of Mind" in the pop category. Lucky Me is the singer's third studio album, recorded at Abbey Road Studios in London and released in 2019 on Samadhi Music. The singer has performed at many international festivals such as Rock En Seine, North Sea Jazz Fest and the Festival De Nimes. Early life and education Born in Bergerac, Dordogne, France, to an English mother from Brighton, and a father of French and Tunisian descent, Clifford was raised mostly in the south of France, surrounded by music because of his father being a musician. dbClifford was able to play the opera Carmen on the piano at the age of five. At age eleven he branched out to play drums, bass, guitar and sax. At age eighteen he attended the prestigious CIAM School of Music in Bordeaux, France. Career After graduating, dbClifford played in a British band where he met the fellow musician with whom he recorded his first demo album in 2000, Supernova. After a short stint in L.A, he moved to Victoria, British Columbia, where he settled. The death of his mother saw him move back to France in 2003. By January 2004 he had written ten songs in his father’s house in the Périgord region. Shortly thereafter he returned to Victoria where he recorded the album. He produced and played all of the instruments on the album Recyclable, including piano, drums, bass, guitar, vocals and backing vocals. The Vancouver Sun described the album as having "a bit of R&B, a lot of happy piano pop, and even a taste of funk". The Province called it "optimistic, catchy stuff". The single "Simple Things" was a number-one hit in Japan. The second single from the album was "Don't Wanna". By the end of 2005 he signed with Nettwerk Management and Nettwerk One (Publishing). In early 2006 he signed on with Sony BMG Music (Canada) Inc. He toured Europe and Japan. Music critic John Britton of Chart reviewed his live performance as part of the 2007 Canadian music week at Toronto's Rivoli club giving it a 4.5 out of 5. Britton called dbClifford confident without being smug. He released the album Feet Above Ground in 2011. In the same year he co-founded Phonixamadhi together with William Cartwright and Arjun Magee, References External links Official site 1979 births Living people Canadian pop singers 21st-century Canadian male singers
Zachary "Zach" Pfeffer (born January 6, 1995) is an American former soccer player. In 2010 at the age of 15 he became the fourth-youngest player ever to sign a Major League Soccer contract. He retired from soccer in 2016 at 21 years of age. Early life Pfeffer is Jewish and was born in Dresher, Pennsylvania. He attended Upper Dublin High School, finishing on time as he played soccer for Union. He played for YMS Celtics, FC Delco Academy along with the Montgomery Maniacs as a young man in Pennsylvania before spending a semester at the U-17 national team residency at IMG in 2010. After retiring from soccer in 2016 at 21 years of age, as of January 2017, he was a junior at the Fox School of Business and Management department of Temple University; he became an investment banker thereafter. Career Philadelphia Union Pfeffer then spent several months training with the Philadelphia Union first team and made an appearance for them in a friendly against C.D. Guadalajara on September 1, 2010. Pfeffer was a member of Philadelphia's U-17 squad that competed in the MLS U-17 SUM Cup in Houston, Texas. On December 22, 2010, the Union signed Pfeffer at the age of 15 as their first-ever homegrown player. He was the fourth-youngest player ever to sign an MLS contract, behind Freddy Adu, Fuad Ibrahim, and Diego Fagundez. He scored his first goal for the Union in a preseason friendly against UCF on February 14, 2011, off a brilliant, long-range effort. He made his regular season Philadelphia Union debut on September 17 against Columbus Crew, at 16 years of age. In 2015 in 21 games (11 starts) he had two goals and an assist. Pfeffer was one of the longest-tenured Union players when he left the team. TSG 1899 Hoffenheim (loan) Pfeffer was loaned to TSG 1899 Hoffenheim for the whole of 2013, beginning on January 7, 2013. In the 2012–2013 campaign, Pfeffer scored 2 goals in 9 matches playing for the Hoffenheim U-19 side. Colorado Rapids Pfeffer was traded to the Colorado Rapids in January 2016 in exchange for the overall second pick in the 2016 MLS SuperDraft, which was used to draft defender Josh Yaro. In 2014 and 2015 he played in the Major League Soccer Homegrown Game. He decided to leave soccer, to go to college and then pursue a career in finance. Pfeffer explained: "I sat down and took a look where I wanted to be long-term, and I knew that in a year, five years, 10 years, the financial industry is where I wanted to be. Everything came together nicely with my contract expiring and where I was at academically and where I was professionally.... I looked at where my heart was and where my passions were. Obviously I love the game and I always will, but there was an overriding passion to pursue this next part of my life." Jim Curtin, who had been his manager at Union, said: "I want to say he should still be playing because he’s that talented... It’s too young to have a career come to an end." International Pfeffer represented the United States at the U-14 and U-15 levels and trained at the IMG Academy in Bradenton, Florida, as part of U.S. Soccer's U-17 residency program. On April 18, 2011, he was called up to the U-17 National Team to play in the Mondial Minimes Montaigu Tournament in Montaigu, France, from April 18–26. Pfeffer was called into the first U-18 National Team camp of 2012 by then-Manager Richie Williams. He was also called up to numerous U-18 National Team camps in 2012. He scored a goal in their November friendly against Canada. Career statistics Club Updated January 15, 2016 Career after soccer Pfeffer had taken Penn State online courses during his soccer career, and completed over three semesters of college before he stopped playing soccer. He as of 2020 was an investment banking analyst for Goldman Sachs. See also List of select Jewish football (association; soccer) players References External links U.S. Soccer Development Academy bio 1995 births Living people Jewish American sportspeople Jewish men's footballers American men's soccer players American expatriate men's soccer players Philadelphia Union players TSG 1899 Hoffenheim players Penn FC players Colorado Rapids players Charlotte Independence players Colorado Springs Switchbacks FC players Men's association football midfielders Soccer players from Pennsylvania American expatriate soccer players in Germany Major League Soccer players USL Championship players United States men's youth international soccer players United States men's under-20 international soccer players United States men's under-23 international soccer players Fox School of Business and Management alumni People from Upper Dublin Township, Pennsylvania Sportspeople from Montgomery County, Pennsylvania Homegrown Players (MLS) Goldman Sachs people 21st-century American Jews
Stevo Bednarsky (born August 8, 1998) is an American soccer player who plays for New York City FC II in the MLS Next Pro. Playing career Youth At the youth level, Stevo Bednarsky played for local club Stronghold SC in New Jersey, a club which his parents helped to organise. College Bednarsky attended Lehigh University in Pennsylvania for five years, between 2017 and 2022, majoring in Arts and Science. In five seasons he played 57 matches, scoring twice. On three occasions he was selected in an All-Patriot League team, and on one occasion was recognised at All-Atlantic Region level. Senior In 2018, Bednarsky signed on to appear for Premier Development League side Lehigh Valley United. He played nine times for them in 2018 before signing on for a second season in which he would play ten matches and score twice. In 2021 he returned to the USL and played four games for FC Motown. On March 24, 2022, Bednarsky was announced as an inaugural season signing for MLS Next Pro club New York City FC II, signing his first full professional contract. His competitive debut came in a loss on penalties to Orlando City B on April 3. Career statistics . References 1998 births American men's soccer players Men's association football midfielders Living people Lehigh Mountain Hawks men's soccer players Lehigh Valley United players New York City FC II players MLS Next Pro players
Valade or Valadè is a surname. Notable people with the surname include: Ambrogio Valadé (1937–2007), Italian footballer Aymeline Valade (born 1984), French model and actress Georges Valade (1922–1997), Canadian politician Jean Valade (1710–1787), French painter
Opposition to the Iraq War significantly occurred worldwide, both before and during the initial 2003 invasion of Iraq by a United States–led coalition, and throughout the subsequent occupation. Individuals and groups opposing the war include the governments of many nations which did not take part in the invasion, including both its land neighbors Canada and Mexico, its NATO allies in Europe such as France and Germany, as well as China and Indonesia in Asia, and significant sections of the populace in those that took part in the invasion. Opposition to the war was also widespread domestically. Rationales for opposition include the belief that the war is illegal according to the United Nations Charter, or would contribute to instability both within Iraq and the wider Middle East. Critics have also questioned the validity of the war's stated objectives, such as a supposed link between the country's Ba'athist government and the September 11, 2001 attacks on the United States, and its possession of weapons of mass destruction "certified" by the Niger uranium forgeries. The latter was claimed by the United States during the run-up to the war, but no such weapons were ever found. Within the United States, popular opinion on the war has varied significantly with time. Although there was significant opposition to the idea in the months preceding the attack, polls taken during the invasion showed that a majority of US citizens supported their government's action. However, public opinion had shifted by 2004 to a majority believing that the invasion was a mistake, and has remained so since then. There has also been significant criticism of the war from US politicians such as Bernie Sanders, national security and military personnel, including generals such as Anthony Zinni and Paul Eaton who served in the war and have since spoken out against its handling, including calling for former Secretary of Defense's Donald Rumsfeld resignation. Lieutenant General Gregory S. Newbold, openly critical of Rumsfeld's plans for the invasion of Iraq, resigned in protest prior to the invasion. Worldwide, the war and occupation have been officially condemned by 54 countries and the heads of many major religions. Popular anti-war feeling is strong in these and other countries, including the US' allies in the conflict, and many have experienced huge protests totalling millions of participants. Early opposition The opposition to the war manifested itself most visibly in a series of worldwide protests against the Iraq War during February 2003, just before the invasion of Iraq starting on March 20, 2003. Noam Chomsky said: Reasons for opposition Critics of the invasion claimed that it would lead collateral damage to deaths of thousands of Iraqi civilians and soldiers as well as Coalition soldiers, and that it would moreover damage peace and stability throughout the region and the world. Another oft-stated reason for opposition is the Westphalian concept that foreign governments should never possess a right to intervene in another sovereign nation's internal affairs (including terrorism or any other non-international affair). Giorgio Agamben, the Italian philosopher, has also offered a critique of the logic of preemptive war. Others did accept a limited right for military intervention in foreign countries, but nevertheless opposed the invasion on the basis that it was conducted without United Nations' approval and was hence a violation of international law. According to this position, adherence by the United States and the other great powers to the UN Charter and to other international treaties is a legal obligation; exercising military power in violation of the UN Charter undermines the rule of law and is illegal vigilantism on an international scale. There was also skepticism of U.S. claims that Iraq's secular government had any links to Al-Qaeda, the Islamic fundamentalist terrorist group considered responsible for the September 11 attacks on the World Trade Center and Pentagon. Some expressed puzzlement that the United States would consider military action against Iraq and not against North Korea, which claimed it already had nuclear weapons and had announced that it was willing to contemplate war with the United States. This criticism intensified when North Korea reportedly conducted a nuclear weapons test on October 9, 2006. There was also criticism of Coalition policy by those who did not believe that military actions would help to fight terror, with some believing that it would actually help Al-Qaeda's recruitment efforts; others believed that the war and immediate post-war period would lead to a greatly increased risk that weapons of mass destruction would fall into the wrong hands (including Al-Qaeda). Both inside and outside of the U.S., some argued that the Bush Administration's rationale for war was to gain control over Iraqi natural resources (primarily petroleum). These critics felt that the war would not help to reduce the threat of WMD proliferation, and that the real reason for the war was to secure control over the Iraqi oil fields at a time when US links with Saudi Arabia were seen to be at risk. "No blood for oil" was a popular protest cry prior to the invasion in March 2003. Administration officials denied these charges, and scholar Jeff Colgan writes that "there is still no consensus on the degree to which oil played a role" in the Iraq War. Some opponents of the war also believed that there would be no weapons of mass destruction in Iraq, and thus there was little reason for an invasion. Prominent among these was Scott Ritter, a former U.S. military intelligence officer and then a United Nations weapons inspector in Iraq, and who in 1998 had been hawkish enough toward Iraq as to be admonished by U.S. Senator Joe Biden, "The decision of whether or not the country should go to war is slightly above your pay grade." Investigations after the invasion failed to produce evidence of WMDs in Iraq (apart from a very small number of degraded chemical weapons shells located after the Iran–Iraq War ended in 1988). Generally, however, very few opponents of the Iraq invasion publicly expressed doubt as to whether the Saddam Hussein regime possessed weapons of mass destruction. During the occupation, some opponents accused President Bush of being indifferent to the suffering caused by the invasion. In 2006 for example he opined that when the history of Iraq is written the period would "look like just a comma", prompting criticism that he took the more than 2,700 US troop deaths lightly. Opposition in the United States Popular opposition The Iraq War was met with considerable popular opposition in the United States, beginning during the planning stages and continuing through the invasion subsequent occupation of Iraq. The months leading up to the war saw protests across the United States, the largest of which, held on February 15, 2003 involved about 300,000 to 400,000 protesters in New York City, with smaller numbers protesting in Seattle, San Francisco, Chicago, and other cities. Consistent with the anti-war sentiment of the protests, in the months leading up to the Iraq War, American public opinion heavily favored a diplomatic solution over immediate military intervention. A January 2003 CBS News/New York Times poll found that 63% of Americans wanted President Bush to find a diplomatic solution to the Iraq situation, compared with 31% who favored immediate military intervention. That poll also found, however, that if diplomacy failed, support for military action to remove Saddam Hussein was above 60 percent. Days before the March 20 invasion, a USA Today/CNN/Gallup Poll found support for the war was related to UN approval. Nearly six in 10 said they were ready for such an invasion "in the next week or two." But that support dropped off if the U.N. backing was not first obtained. If the U.N. Security Council were to reject a resolution paving the way for military action, only 54% of Americans favored a U.S. invasion. And if the Bush administration did not seek a final Security Council vote, support for a war dropped to 47%. Immediately after the 2003 invasion most polls within the United States showed a substantial majority of Americans supporting war. In a March 2003 Gallup poll, the day after the invasion, 76% of Americans supported military action against Iraq, but that trend began to shift less than a year after the war began. Beginning in December 2004, polls have consistently shown that a majority thinks the invasion was a mistake. As of 2006, opinion on what the U.S. should do in Iraq is split, with a slight majority generally favoring setting a timetable for withdrawal, but against withdrawing immediately. However, in this area responses vary widely with the exact wording of the question. Since the invasion of Iraq, one of the most visible leaders of popular opposition in the U.S. has been Cindy Sheehan, the mother of Casey Sheehan, a soldier killed in Iraq. Sheehan's role as an anti-war leader began with her camping out near President Bush's ranch in Crawford, Texas, and continued with a nationwide tour and trips to Europe and South America. Opposition from national security and military personnel Several prominent members of the military and national security communities, particularly those who favor a more realist approach to international relations, have been critical of both the decision to invade Iraq and the prosecution of the War. On July 28, 2002, less than eight months before the invasion of Iraq,The Washington Post reported that "many senior U.S. military officers" including members of the Joint Chiefs of Staff opposed an invasion on the grounds that the policy of containment was working. A few days later, Gen. Joseph P. Hoar (Ret.) warned the Senate Foreign Relations Committee that the invasion was risky and perhaps unnecessary. Morton Halperin, a foreign policy expert with the Council on Foreign Relations and Center for American Progress warned that an invasion would increase the terrorist threat. In a 2002 book, Scott Ritter, a Nuclear Weapons Inspector in Iraq from 1991–98, argued against an invasion and expressed doubts about the Bush Administration's claims that Saddam Hussein had a WMD capability. He later accused the Bush administration of deliberately misleading the public. I think [The Bush Administration] has stated that Iraq has weapons of mass destruction, and that's as simple as they want to keep it. They don't want to get into the nitty-gritty things such as if you bury a Scud missile to hide it from detection, there is a little thing called corrosion. Where do you hide the fuel, how do you make this stuff up, how do you align it. Because when you disassemble it, there is a process called re-alignment. There is a factory involved in that. And then you have to test launch it to make sure that the alignment works, and that's detectable, and they haven't done that. There is a lot of common sense things that go into consideration of whether or not Iraq has an operational weapons of mass destruction capability. Brent Scowcroft, who served as National Security Adviser to President George H. W. Bush was an early critic. He wrote an August 15, 2002 editorial in The Wall Street Journal entitled "Don't attack Saddam," arguing that the war would distract from the broader fight against terrorism and the Israeli–Palestinian conflict, which should be the U.S.'s highest priority in the Middle East. The next month, Gen. Hugh Shelton, former Chairman of the Joint Chiefs of Staff, agreed that war in Iraq would distract from the War on Terrorism. Retired Marine Gen. Anthony Zinni, former head of Central Command for U.S. forces in the Middle East and State Department's envoy to the Palestinian-Israeli conflict, echoed many of Scowcroft's concerns in an October 2002 speech at the Middle East Institute. In a follow-up interview with Salon, Zinni said he was "not convinced we need to do this now," arguing that deposing Saddam Hussein was only the sixth or seventh top priority in the Middle East, behind the Middle East peace process, reforming Iran, our commitments in Afghanistan, and several others. By January 19, 2003, Time magazine reported that "as many as 1 in 3 senior officers questions the wisdom of a preemptive war with Iraq." On February 13, 2003 Ambassador Joseph Wilson, former chargé d'affaires in Baghdad, resigned from the Foreign Service and publicly questioned the need for another war in Iraq. After the War started, he wrote an editorial in The New York Times titled What I Didn't Find in Africa that claimed to discredit a Bush Administration claim that Iraq had attempted to procure uranium from Niger. John Brady Kiesling, another career diplomat with similar reservations, resigned in a public letter in the New York Times on February 27. He was followed on March 10 by John H. Brown, a career diplomat with 22 years of service, and on March 19 by Mary Ann Wright, a diplomat with 15 years of service in the State Department following a military career of 29 years. The war started the next day. Prominent diplomat George Kennan, who famously advocated the policy of containment of Soviet expansion during the Cold War warned of the unforeseen consequences of waging war against Iraq, a war that "bears no relation to the first war against terrorism" and declared efforts by the Bush administration to associate Al-Qaeda with Saddam Hussein "pathetically unsupportive and unreliable". Kennan stated: Anyone who has ever studied the history of American diplomacy, especially military diplomacy, knows that you might start in a war with certain things on your mind as a purpose of what you are doing, but in the end, you found yourself fighting for entirely different things that you had never thought of before  ... In other words, war has a momentum of its own and it carries you away from all thoughtful intentions when you get into it. Today, if we went into Iraq, like the president would like us to do, you know where you begin. You never know where you are going to end. Lt. Col. Karen Kwiatkowski (Ret.) was political/military desk officer at the Defense Department's office for Near East South Asia (NESA) in the months before the war. In December 2003 she began to write an anonymous column that described the disrupting influence of the Office of Special Plans on the analysis that led to the decision to go to war. On June 16, 2004 twenty seven former senior U.S. diplomats and military commanders called Diplomats and Military Commanders for Change issued a statement against the war. The group included: William J. Crowe, Chairman of the Joint Chiefs of Staff under President Ronald Reagan Joseph Hoar, former Commander of U.S. forces in the Middle East H. Allen Holmes, former Assistant Secretary of Defense for Special Operations Donald McHenry, former Ambassador to the United Nations Merrill McPeak, former Air Force Chief of Staff Jack F. Matlock Jr., a member of the National Security Council under Reagan and former Ambassador to the Soviet Union John Reinhardt, former Director of the United States Information Agency Ronald I. Spiers, Under Secretary General of the United Nations for Political Affairs and a former Ambassador Stansfield Turner, former Director of the Central Intelligence Agency Richard Clarke, former chief counter-terrorism adviser on the National Security Council for both the latter part of the Clinton Administration and early part of the George W. Bush Administration, criticized the Iraq War along similar lines in his 2004 book Against All Enemies and during his testimony before the 9/11 Commission. In addition to diverting funds from the fight against al-Qaeda, Clarke argued that the invasion of Iraq would actually bolster the efforts of Osama bin Laden and other Islamic radicals, who had long predicted that the U.S. planned to invade an oil-rich Middle Eastern country. Similar arguments were made in a May 2004 interview and an August 2005 article by Lt. Gen. William Odom, former Director of the National Security Agency. In April 2006, six prominent retired generals publicly criticized Secretary of Defense Donald Rumsfeld's handling of the war, and called for his resignation. The group included two generals who commanded troops in Iraq: Maj. Gen. Charles H. Swannack Jr. (Ret.) and Maj. Gen. John Batiste (Ret.). One of the generals, Lieut. Gen. Greg Newbold (Ret.), who served as the Pentagon's top operations officer during the months leading up to the invasion, also published an article that month in Time Magazine entitled "Why Iraq Was a Mistake." On September 12, 2007, two retired U.S. Army generals, Lt. Gen. Robert Gard and Brig. Gen. John Johns, joined former Sen. Gary Hart in publishing a statement calling for withdrawal from Iraq. Robert Gard is the Senior Military Fellow at the Center for Arms Control and Non-Proliferation, John Johns is on the board of directors for the Council for a Livable World, and Gary Hart is the Council's chairman. In October 2007, Lieutenant General Ricardo Sanchez, former commander of coalition forces in Iraq, called the 2007 "surge" a "flawed strategy", and suggested that the political leadership in the US would have been court martialed for their actions, had they been military personnel. Opposition from soldiers There have been several individual refusals to ship (e.g., Pablo Paredes, and 1st Lt. Ehren Watada) or to carry out missions (e.g. 343rd Quartermasters). Soon after the war began, 67% of surveyed US soldiers in Iraq told Stars and Stripes that the invasion was worthwhile, though half described their units' morale as "low." A Zogby poll in March 2006 found that 72% of US soldiers in Iraq said the war should be ended within a year, and a quarter said that all troops should be withdrawn immediately. Iraq Veterans Against the War (IVAW) was formed in 2004 to help antiwar soldiers network and seek solidarity from one another. IVAW held a Winter Soldier event, from March 13 through March 16, 2008, in which U.S. veterans spoke of their experiences during the Iraq War. The Pacifica Radio network broadcast the proceedings live, and streaming audio and video of the event is also available. John Bonifaz filed a suit on behalf of 12 Congress members and various military families to try to stop the Iraq War. Using the example of GI resistance coffee housed during the Vietnam War some Iraq War veterans have founded anti-war coffeehouses near military bases to act as resources for soldiers opposed to the Iraq War. Two examples are Under the Hood Café near Fort Hood and Coffee Strong near Joint Base Lewis–McChord. Congressional opposition Opinion in the U.S. Congress leading up to the Iraq War generally favored a diplomatic solution, while supporting military intervention should diplomacy fail. The October 11, 2002 resolution that authorized President Bush to use force in Iraq passed the Senate by a vote of 77 to 23, and the House by 296 to 133. Leading opponents of the resolution included Senators Russ Feingold and Edward Kennedy. As the war progressed and the insurgency began to develop into what many believe is a civil war in Iraq, Congressional support for the Iraq campaign began to wane. A flashpoint came on November 17, 2005, when Representative John Murtha, a Vietnam combat veteran who voted to authorize the war and is widely regarded as an ardent supporter of the military, introduced a resolution calling for U.S. forces in Iraq to be "redeployed at the earliest practicable date" to stand as a quick-reaction force in U.S. bases in neighboring countries such as Kuwait. Since the introduction of the Murtha resolution, many members of Congress, particularly in the Democratic Party, have rallied around the strategy of a phased troop withdrawal. In the 2007 Congressional session, critics of the war have sought to tie additional war appropriations to a specific timetable for withdrawal. On March 23, 2007, the House of Representatives passed an Iraq spending bill that requires that troops begin withdrawing in March 2008 and that most US forces be out of Iraq by August 31, 2008. Congressional critics of the war have also opposed President Bush's plan to send an additional 20,000 U.S. soldiers to Iraq. On January 10, 2007, Senator Dick Durbin gave the Democratic response to this plan by saying: "We have given the Iraqis so much. ... Now, in the fourth year of this war, it is time for the Iraqis to stand and defend their own nation." Opposition from presidential candidates The Iraq War was the defining issue of the 2004 U.S. presidential campaign. All of the Republican candidates and most of the Democratic candidates supported the war, although most of the Democrats also criticized the war's prosecution. John Kerry, the Democratic nominee for President in 2004, voted to authorize the invasion, and said during his campaign that he stood by his vote. He also argued during the campaign that "the way he (President Bush) went to war was a mistake." In the 2008 U.S. presidential campaign, candidates Representatives Ron Paul and Dennis Kucinich, Senators Barack Obama, Chris Dodd and Mike Gravel were some of the most outspoken critics of the Iraq War. Ron Paul said that "The war in Iraq was sold to us with false information. The area is more dangerous now than when we entered it. We destroyed a regime hated by our direct enemies, the jihadists, and created thousands of new recruits for them. This war has cost more than 3,000 American lives, thousands of seriously wounded, and hundreds of billions of dollars." Barack Obama (who went on to win the election) was not a senator at the time of the voting of the Iraq War Resolution, but had repeatedly voiced his disapproval of it both before and during his senatorship, saying at an anti war rally in Chicago on October 2, 2002: "I am not opposed to all wars. I'm opposed to dumb wars." He also spoke of the "undetermined length ... undetermined cost, [and] undetermined consequences" which even a successful war would bring. Dodd voted in favor of the Iraq War Resolution in 2002, but Dodd has since become an opponent of the war. Dodd has said the Iraq War has been waged "for all the wrong reasons" and that it is eroding both the nation's security and its moral leadership. Opposition from lawyers specializing in international law Investigator of Nazi war crimes Ben Ferencz has suggested in an interview given on August 25, 2006, that not only Saddam Hussein should be tried in the International Criminal Court, but also George W. Bush because the Iraq War had been begun by the U.S. without permission by the UN Security Council. Ben Ferencz wrote the foreword for political analyst Michael Haas's book, talking about possible indictment of Bush administration over war crime charges, titled George W. Bush, War Criminal?: The Bush Administration's Liability for 269 War Crimes. Opposition in European countries Around the 2003 Invasion of Iraq and subsequent occupation of Iraq, polling data indicated that opposition to military action against Iraq was widespread in Europe. 'Anti-Bush' and anti-war sentiments were reflected in many western European countries, generally with the populace less sympathetic to the U.S. stance even when the government in a given country (e.g. the United Kingdom, or Italy) aligned themselves with the U.S. position. Opinion polls showed the population was against the war, with opposition as high as 90% in Spain and Italy, and also widespread in Eastern Europe. Some suggested that the reason for the EU's negative view of the war are Europe's economic interests in the region. However, the electorates of France and Germany were strongly opposed to the war and it would have been difficult for their governments to fail to reflect these views. After the first UN resolution, the US and the UK pushed for a second resolution authorizing an invasion. The French and German governments, amongst others, took the position that the UN inspection process should be allowed to be completed. France's then-Foreign Minister, Dominique de Villepin received loud applause for his speech against the Iraq War at the United Nations on February 14, 2003. Neither of these countries have sent troops to Iraq. However, despite popular opinion in their countries, the governments of Italy and Spain supported the war politically and militarily, although Spain ceased to do so after the election of a Socialist government in 2004. In the United Kingdom, both the governing Labour Party and the official opposition Conservative Party were in favour of the invasion. The Liberal Democrats insisted on a U.N. resolution; they opposed the war as a result. Outside parliament, anti-war sentiment was more widespread: the February 15, 2003 protest in London attracted between 750,000 and 2,000,000 supporters from various walks of life. Prominent politicians and other individuals expressing anti-war views included: Tory MP Ken Clarke, Charles Kennedy, Menzies Campbell, Tony Benn, George Galloway, future Labour party leader Jeremy Corbyn, Chris Martin, Damon Albarn, Ms. Dynamite, and Bianca Jagger. Two prominent Labour politicians resigned from their positions in opposition to the war. Leader of the House of Commons Robin Cook resigned from the Cabinet two days before the start of the invasion on 17 March. In a statement giving his reasons for resigning he said: Our interests are best protected not by unilateral action but by multilateral agreement and a world order governed by rules. Yet tonight the international partnerships most important to us are weakened: the European Union is divided; the Security Council is in stalemate. Those are heavy casualties of a war in which a shot has yet to be fired." and "The reality is that Britain is being asked to embark on a war without agreement in any of the international bodies of which we are a leading partner—not NATO, not the European Union and, now, not the Security Council." Secretary of State for International Development Clare Short supported the government's resolution in the House of Commons and remained in the Cabinet for two months but eventually resigned on 12 May. Deputy FCO Legal Adviser Elizabeth Wilmshurst resigned on 20 March 2003, three days after Lord Goldsmith's final advice to the British government reversed her legal opinion (in Lord Goldsmith's first secret memo 10 days earlier) that the invasion was illegal without a second United Nations Security Council Resolution to SCR 678. Opposition throughout the world Opinion polls showed that the population of nearly all countries opposed a war without UN mandate, and that the view of the United States as a danger to world peace had significantly increased. UN Secretary-General Kofi Annan described the war as illegal, saying in a September 2004 interview that it was "not in conformity with the Security Council." Nelson Mandela, former President of South Africa, called the US's attitude five months before the invasion a "threat to world peace". He said they were sending a message that "if you are afraid of a veto in the Security Council, you can go outside and take action and violate the sovereignty of other countries"; a message which "must be condemned in the strongest terms." Religious opposition On September 13, 2002, US Catholic bishops signed a letter to President Bush stating that any "preemptive, unilateral use of military force to overthrow the government of Iraq" could not be justified at the time. They came to this position by evaluating whether an attack against Iraq would satisfy the criteria for a just war as defined by Catholic theology. US civil-rights leader the Reverend Jesse Jackson condemned the planned invasion, saying in February 2003 that it was not too late to stop the war and that people "must march until there is a declaration of peace and reconciliation." The Vatican also spoke out against war in Iraq. Archbishop Renato Martino, a former U.N. envoy and current prefect of the Council for Justice and Peace, told reporters that war against Iraq was a preventive war and constituted a "war of aggression", and thus did not constitute a just war. The foreign minister, Archbishop Jean-Louis Tauran, expressed concerns that a war in Iraq would inflame anti-Christian feelings in the Islamic world. On February 8, 2003, Pope John Paul II said "we should never resign ourselves, almost as if war is inevitable." He spoke out again on March 22, 2003, shortly after the invasion began, saying that violence and arms "can never resolve the problems of man." Both the outgoing Archbishop of Canterbury, George Carey, and his successor, Rowan Williams, spoke out against war with Iraq. The executive committee of the World Council of Churches, an organization representing churches with a combined membership of between 350 million and 450 million Christians from over 100 countries, issued a statement in opposition to war with Iraq, stating that "War against Iraq would be immoral, unwise, and in breach of the principles of the United Nations Charter." Jim Wallis of Sojourners Magazine has argued that, among both evangelical Christians and Catholics, "most major church bodies around the world" opposed the war. Raëlians also protested the war, organizing demonstrations in which they held signs saying "NO WAR ... ET wants Peace, too!" Protests against the Iraq War Across the world popular opposition to the Iraq war has led to thousands of protests since 2002, against the invasion of Iraq. They were held in many cities worldwide, often co-ordinated to occur simultaneously worldwide. After the simultaneous demonstrations, on February 15, 2003, the largest in total turnout, New York Times writer Patrick Tyler claimed that they showed that there were two superpowers on the planet: the United States and world public opinion. As the war drew nearer, other groups held candlelight vigils and students walked out of school. The February 15, 2003, worldwide protests drew millions of people across the world. It is generally estimated that over 3 million people marched in Rome, between one and two million in London, more than 600,000 in Madrid, 300,000 in Berlin, as well as in Damascus, Paris, New York, Oslo, Stockholm, Brussels, Johannesburg, Montreal—more than 600 cities in all, worldwide. This demonstration was listed in the 2004 Guinness World Records as the largest mass protest movement in history. Support for Iraqi resistance and insurgency There has been a debate among those opposed to the U.S. invasion and subsequent occupation of Iraq in developed countries about how to relate to forces within Iraq. It is possible that Iraq paid the US in dinars for their efforts in the war. Prior to the invasion, while it was common to accuse opponents of providing objective, if not intentional, support to Saddam, none of the major antiwar organizations declared any support for him, however limited. After the invasion and the toppling of Saddam's regime, some who had opposed it now supported continuing U.S. occupation, arguing that the U.S.'s intervention had given it an obligation to stabilize the country. However, those who remained opposed to the U.S. presence had to determine their approach to the developing armed insurgency and peaceful opposition to the occupation carried out by groups like the Worker-communist Party of Iraq (WCPI). The most virulent divide has been about whether to support the insurgency. Of the major Western antiwar organizations, United for Peace and Justice has never supported the insurgency, but Act Now to Stop War and End Racism and the Stop the War Coalition have a more ambivalent stance on this subject. Of the smaller groups which participate in these coalitions, none support suicide bombings of Iraqi civilians, but some support violence against coalition soldiers. At a 2004 conference in Japan, Eric Ruder, of the U.S.-based International Socialist Organization, presented a case for supporting the guerrillas. Citing the primarily decentralized and domestic nature of the insurgency, the fact that a clear majority of attacks are directed against U.S. and British forces, and he also claimed there was widespread Iraqi support for violent insurgency, Ruder argues that the insurgents' cause and methods are, on the whole, just and deserve support. He claims that the Iraqi right to self-determination precludes Western opponents of the occupation placing conditions on their support of the Iraqi resistance, and argues that "If the Iraqi resistance drives the U.S. out of Iraq, it would be a major setback for Bush's agenda and the agenda of the U.S. imperialism. This would be a tremendous victory for our side—making it much more difficult for the U.S. to choose a new target in the Middle East or elsewhere in trying to impose its will." Sato Kazuyoshi, President of the Japanese Movement for Democratic Socialism, argues otherwise. Reporting on the discussion at the 2004 conference, he writes that, "We cannot support, nor extend our solidarity to, them on the grounds that their strategy excludes many Iraqi citizens—above all, women—and do great harm on the civilians, and will bring the Iraqi future society under an Islamic dictatorship." He cites in turn Mahmood Ketabchi of the WCPI, who criticizes Iraqi guerrilla groups for Baathist and Islamist connections, and attacks Ruder's view as a "Left Nationalism" which ignores divisions within Iraq. Countering the response that the best way to ensure that progressive forces, not reactionary ones, dominate post-occupation Iraq would be for progressives to take the lead in fighting the occupation, Ketabchi argues that this is not possible due to the present situation in Iraq. Nevertheless, he claims, "We do not have to choose between the US and Iraqi reactionary forces. Opposition to the US is not a progressive stand per se. What matters is the kind of future that this opposition represents and objectives it pursues." A third alternative is represented by what Kazuyoshi calls the "Civil Resistance." Official condemnation See also Governmental positions on the Iraq War prior to the 2003 invasion of Iraq for pre-war positions. The 55 following countries and unions have protested formally and officially the prosecution of this war. They oppose the Iraq War in principle, citing in some cases that they believe it is illegal, and in others that it required a United Nations mandate. (except Kuwait) Quotations "The option of war can appear initially to be the most rapid. But let us not forget that after winning the war, peace must be built." – Dominique de Villepin, French Foreign Minister, at the United Nations Security Council on February 14, 2003 "To a certain extent Saddam Hussein's departure was a positive thing. But it also provoked reactions, such as the mobilization in a number of countries, of men and women of Islam, which has made the world more dangerous." – French President Jacques Chirac, November 17, 2004 "Make no mistake about it, the ultimate aim that the Bush and Blair regimes have embarked upon is nothing less than 'universal or world domination.' Iraq is merely a stepping stone along the way."– David Comissiong (Barbadian Politician) "Iraq was not involved in 9-11, Iraq was not a terrorist state. But now that we have decimated the country, the borders are open, freedom fighters from other countries are going in and they have created more terrorism by going to an Islamic country, devastating the country and killing innocent people in that country." – Cindy Sheehan (American anti-war activist), Interview with CBS News' Mark Knoller, upon her arrival in Crawford, Texas on August 6, 2005 See also Japanese history textbook controversies 2003 invasion of Iraq Abu Ghraib torture and prisoner abuse Popular opinion in the United States on the invasion of Iraq British Parliamentary approval for the invasion of Iraq Canada and Iraq War resisters Chicago Coalition Against War & Racism Criticisms of the War on Terrorism Families of the Fallen for Change Guantanamo Bay detainment camp Human shield action to Iraq International public opinion on the war in Afghanistan Iraqi insurgency (Iraq War) List of Iraq War resisters List of peace activists List of anti-war organizations Opposition to the War in Afghanistan (2001–present) Opposition to the Vietnam War Post–September 11 anti-war movement Protests against the Iraq War 2005 anti-Japanese demonstrations Protests against the War in Afghanistan (2001–present) Strategic reset United Nations Security Council and the Iraq War Views on the 2003 invasion of Iraq Withdrawal of U.S. troops from Iraq (2007–2011) World oil market chronology from 2003 March 20, 2010 anti-war protest Notes and references External links Anti war dot com Anti-War Committee (U.S.) Arms Against War Human Shields Stop the war coalition Not One More! – Take the Pledge for Peace Women Against Military Madness (U.S.) Council for a Livable World JustWarTheory.com a non-profit resource for academic studies and commentary Anti-war train drivers refuse to move arms freight January 9, 2003, The Guardian (UK) About.com: Iraq War vote in 2002 – Complete Listing of 156 Congress Members Who Voted NAY Presidency of George W. Bush George W. Bush administration controversies Tony Blair Iraq War 2003 Anti-war protests Iraq War
FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are each encoded with a single ASCII character for brevity. It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA formatted sequence and its quality data, but has recently become the de facto standard for storing the output of high-throughput sequencing instruments such as the Illumina Genome Analyzer. Format A FASTQ file has four line-separated fields per sequence: Field 1 begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line). Field 2 is the raw sequence letters. Field 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again. Field 4 encodes the quality values for the sequence in Field 2, and must contain the same number of symbols as letters in the sequence. A FASTQ file containing a single sequence might look like this: @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 The byte representing quality runs from 0x21 (lowest quality; '!' in ASCII) to 0x7e (highest quality; '~' in ASCII). Here are the quality value characters in left-to-right increasing order of quality (ASCII): !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ The original Sanger FASTQ files split long sequences and quality strings over multiple lines, as is typically done for FASTA files. Accounting for this makes parsing more complicated due to the choice of "@" and "+" as markers (as these characters can also occur in the quality string). Multi-line FASTQ files (and consequently multi-line FASTQ parsers) are less common now that the majority of sequencing carried out is short-read Illumina sequencing, with typical sequence lengths of around 100bp. Illumina sequence identifiers Sequences from the Illumina software use a systematic identifier: Versions of the Illumina pipeline since 1.4 appear to use #NNNNNN instead of #0 for the multiplex ID, where NNNNNN is the sequence of the multiplex tag. With Casava 1.8 the format of the '@' line has changed: Note that more recent versions of Illumina software output a sample number (defined by the order of the samples in the sample sheet) in place of an index sequence when an index sequence is not explicitly specified for a sample in the sample sheet. For example, the following header might appear in a FASTQ file belonging to the first sample of a batch of samples: NCBI Sequence Read Archive FASTQ files from the INSDC Sequence Read Archive often include a description, e.g. In this example there is an NCBI-assigned identifier, and the description holds the original identifier from Solexa/Illumina (as described above) plus the read length. Sequencing was performed in paired-end mode (~500bp insert size), see SRR001666. The default output format of fastq-dump produces entire spots, containing any technical reads and typically single or paired-end biological reads. $ fastq-dump.2.9.0 -Z -X 2 SRR001666 Read 2 spots for SRR001666 Written 2 spots for SRR001666 @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/ @SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72 GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT +SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I Modern usage of FASTQ almost always involves splitting the spot into its biological reads, as described in submitter-provided metadata: $ fastq-dump -X 2 SRR001666 --split-3 Read 2 spots for SRR001666 Written 2 spots for SRR001666 $ head SRR001666_1.fastq SRR001666_2.fastq ==> SRR001666_1.fastq <== @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC @SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36 GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA +SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBI ==> SRR001666_2.fastq <== @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/ @SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36 AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT +SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36 IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I When present in the archive, fastq-dump can attempt to restore read names to original format. NCBI does not store original read names by default: $ fastq-dump -X 2 SRR001666 --split-3 --origfmt Read 2 spots for SRR001666 Written 2 spots for SRR001666 $ head SRR001666_1.fastq SRR001666_2.fastq ==> SRR001666_1.fastq <== @071112_SLXA-EAS1_s_7:5:1:817:345 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC +071112_SLXA-EAS1_s_7:5:1:817:345 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC @071112_SLXA-EAS1_s_7:5:1:801:338 GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA +071112_SLXA-EAS1_s_7:5:1:801:338 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBI ==> SRR001666_2.fastq <== @071112_SLXA-EAS1_s_7:5:1:817:345 AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA +071112_SLXA-EAS1_s_7:5:1:817:345 IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/ @071112_SLXA-EAS1_s_7:5:1:801:338 AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT +071112_SLXA-EAS1_s_7:5:1:801:338 IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I In the example above, the original read names were used rather than the accessioned read name. NCBI accessions runs and the reads they contain. Original read names, assigned by sequencers, are able to function as locally unique identifiers of a read, and convey exactly as much information as a serial number. The ids above were algorithmically assigned based upon run information and geometric coordinates. Early SRA loaders parsed these ids and stored their decomposed components internally. NCBI stopped recording read names because they are frequently modified from the vendors' original format in order to associate some additional information meaningful to a particular processing pipeline, and this caused name format violations that resulted in a high number of rejected submissions. Without a clear schema for read names, their function remains that of a unique read id, conveying the same amount of information as a read serial number. See various SRA Toolkit issues for details and discussions. Also note that fastq-dump converts this FASTQ data from the original Solexa/Illumina encoding to the Sanger standard (see encodings below). This is because the SRA serves as a repository for NGS information, rather than format. The various *-dump tools are capable of producing data in several formats from the same source. The requirements for doing so have been dictated by users over several years, with the majority of early demand coming from the 1000 Genomes Project. Variations Quality A quality value Q is an integer mapping of p (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score: The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the odds p/(1-p) instead of the probability p: Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately p > 0.05, or equivalently, Q < 13). At times there has been disagreement about which mapping Illumina actually uses. The user guide (Appendix B, page 122) for version 1.4 of the Illumina pipeline states that: "The scores are defined as , where is the probability of a base call corresponding to the base in question". In retrospect, this entry in the manual appears to have been an error. The user guide (What's New, page 5) for version 1.5 of the Illumina pipeline lists this description instead: "Important Changes in Pipeline v1.3 . The quality scoring scheme has changed to the Phred [i.e., Sanger] scoring scheme, encoded as an ASCII character by adding 64 to the Phred value. A Phred score of a base is: , where e is the estimated probability of a base being wrong. Encoding Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps). Also used in SAM format. Coming to the end of February 2011, Illumina's newest version (1.8) of their pipeline CASAVA will directly produce fastq in Sanger format, according to the announcement on seqanswers.com forum. PacBio HiFi reads, which are typically stored in SAM/BAM format, use the Sanger convention: Phred quality scores from 0 to 93 are encoded using ASCII 33 to 126. Raw PacBio subreads use the same convention but typically assign a placeholder base quality (Q0) to all bases in the read. Oxford Nanopore Duplex reads, called using the dorado basecaller are typically stored in SAM/BAM format. After changing to a 16-bit internal quality representation, the reported base quality limit is q50 (S). Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected) Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected). Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 "B", is used also at the end of reads as a Read Segment Quality Control Indicator. The Illumina manual (page 30) states the following: If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina's text-based encoding of quality scores)... This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses. Also, the quality score encoded as "B" letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example: @HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1 TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT +HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1 efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB An alternative interpretation of this ASCII encoding has been proposed. Also, in Illumina runs using PhiX controls, the character 'B' was observed to represent an "unknown quality score". The error rate of 'B' reads was roughly 3 phred scores lower the mean observed score of a given run. Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33). For raw reads, the range of scores will depend on the technology and the base caller used, but will typically be up to 41 for recent Illumina chemistry. Since the maximum observed quality score was previously only 40, various scripts and tools break when they encounter data with quality values larger than 40. For processed reads, scores may be even higher. For example, quality values of 45 are observed in reads from Illumina's Long Read Sequencing Service (previously Moleculo). SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS..................................................... ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX...................... ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII...................... .................................JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ..................... LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL.................................................... NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN........................................... PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ | | | | | | 33 59 64 73 104 126 0........................26...31.......40 -5....0........9.............................40 0........9.............................40 3.....9..............................41 0.2......................26...31........41 0..................20........30........40........50 0..................20........30........40........50..........................................93 S - Sanger Phred+33, raw reads typically (0, 40) X - Solexa Solexa+64, raw reads typically (-5, 40) I - Illumina 1.3+ Phred+64, raw reads typically (0, 40) J - Illumina 1.5+ Phred+64, raw reads typically (3, 41) with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold) (Note: See discussion above). L - Illumina 1.8+ Phred+33, raw reads typically (0, 41) N - Nanopore Phred+33, Duplex reads typically (0, 50) P - PacBio Phred+33, HiFi reads typically (0, 93) Color space For SOLiD data, the format is modified to a color space FASTQ sequence (CSFASTQ), where bases in the sequence are combined with the numbers 0, 1, 2, and 3, indicating how bases are modified relative to the previous base in the sequence (0: no change; 1: transition; 2: non-complementary transversion; 3: complementary transversion). This format matched the different sequencing chemistry used by SOLiD sequencers. Initial representations only used nucleotide bases at the start of the sequence, but later versions included bases embedded at periodic intervals to improve basecalling and mapping accuracy. The quality values for CSFASTQ are identical to those of the Sanger format. Alignment tools differ in their preferred version of the quality values: some include a quality score (set to 0, i.e. '!') for the leading nucleotide, others do not. The sequence read archive includes this quality score. FAST5 and HDF5 evolutions The FAST4 format was invented as a derivative of the FASTQ format where each of the 4 bases (A,C,G,T) had separate probabilities stored. It was part of the Swift basecaller, an open source package for primary data analysis on next-gen sequence data "from images to basecalls". The FAST5 format was invented as an extension of the FAST4 format. The FAST5 files are Hierarchical Data Format 5 (HDF5) files with a specific schema defined by Oxford Nanopore Technologies (ONT). Simulation FASTQ read simulation has been approached by several tools. A comparison of those tools can be seen here. Compression General compressors General-purpose tools such as Gzip and bzip2 regard FASTQ as a plain text file and result in suboptimal compression ratios. NCBI's Sequence Read Archive encodes metadata using the LZ-77 scheme. General FASTQ compressors typically compress distinct fields (read names, sequences, comments, and quality scores) in a FASTQ file separately; these include DSRC and DSRC2, FQC, LFQC, Fqzcomp, and Slimfastq. Reads Having a reference genome around is convenient because then instead of storing the nucleotide sequences themselves, one can just align the reads to the reference genome and store the positions (pointers) and mismatches; the pointers can then be sorted according to their order in the reference sequence and encoded, e.g., with run-length encoding. When the coverage or the repeat content of the sequenced genome is high, this leads to a high compression ratio. Unlike the SAM/BAM formats, FASTQ files do not specify a reference genome. Alignment-based FASTQ compressors supports the use of either user-provided or de novo assembled reference: LW-FQZip uses a provided reference genome and Quip, Leon, k-Path and KIC perform de novo assembly using a de Bruijn graph-based approach. Explicit read mapping and de novo assembly are typically slow. Reordering-based FASTQ compressors first cluster reads that share long substrings and then independently compress reads in each cluster after reordering them or assembling them into longer contigs, achieving perhaps the best trade-off between the running time and compression rate. SCALCE is the first such tool, followed by Orcom and Mince. BEETL uses a generalized Burrows–Wheeler transform for reordering reads, and HARC achieves better performance with hash-based reordering. AssemblTrie instead assembles reads into reference trees with as few total number of symbols as possible in the reference. Benchmarks for these tools are available in. Quality values Quality values account for about half of the required disk space in the FASTQ format (before compression), and therefore the compression of the quality values can significantly reduce storage requirements and speed up analysis and transmission of sequencing data. Both lossless and lossy compression are recently being considered in the literature. For example, the algorithm QualComp performs lossy compression with a rate (number of bits per quality value) specified by the user. Based on rate-distortion theory results, it allocates the number of bits so as to minimize the MSE (mean squared error) between the original (uncompressed) and the reconstructed (after compression) quality values. Other algorithms for compression of quality values include SCALCE and Fastqz. Both are lossless compression algorithms that provide an optional controlled lossy transformation approach. For example, SCALCE reduces the alphabet size based on the observation that “neighboring” quality values are similar in general. For a benchmark, see. As of the HiSeq 2500 Illumina gives the option to output qualities that have been coarse grained into quality bins. The binned scores are computed directly from the empirical quality score table, which is itself tied to the hardware, software and chemistry that were used during the sequencing experiment. File extension There is no standard file extension for a FASTQ file, but .fq and .fastq are commonly used. Format converters Biopython version 1.51 onwards (interconverts Sanger, Solexa and Illumina 1.3+) EMBOSS version 6.1.0 patch 1 onwards (interconverts Sanger, Solexa and Illumina 1.3+) BioPerl version 1.6.1 onwards (interconverts Sanger, Solexa and Illumina 1.3+) BioRuby version 1.4.0 onwards (interconverts Sanger, Solexa and Illumina 1.3+) BioJava version 1.7.1 onwards (interconverts Sanger, Solexa and Illumina 1.3+) See also The FASTA format, used to represent genome sequences. The SAM and CRAM formats, used to represent genome sequencer reads that have been aligned to genome sequences. The GVF format (Genome Variation Format), an extension based on the GFF3 format. References External links MAQ webpage discussing FASTQ variants Bioinformatics Biological sequence format
Lessie is an unincorporated community in Nassau County, Florida, United States. It is located near the center of the county. A post office called Lessie was established in 1899, and closed in 1908. Geography Lessie is located at (30.725, -81.7772). References Unincorporated communities in Nassau County, Florida Unincorporated communities in the Jacksonville metropolitan area Unincorporated communities in Florida
Mario Chiesa (; born in Milan, December 12, 1944) is an Italian former politician and member of the Italian Socialist Party. In 1992 Chiesa was arrested on charges of corruption, leading to the mani pulite trials, and eventually to a restructuring of Italian politics. In 2009 he was arrested again, under charges related to waste treatment in Milan. Notes 1944 births Living people Politicians from Milan Italian Socialist Party politicians
Daniel Fallins (born 12 August 1996) is an Australian cricketer. He made his List A debut for Cricket Australia XI in the 2017–18 JLT One-Day Cup on 13 October 2017. He made his first-class debut for Cricket Australia XI against England on 8 November 2017 in a tour match prior to the 2017–18 Ashes series. He made his Twenty20 debut for the Melbourne Stars in BBL07 on 12 January 2018. Domestic career Fallins was in the Cricket Australia XI squad for the 2017–18 JLT One-Day Cup. He played two matches, bowling only 11 overs and taking just one wicket. References External links 1996 births Living people Australian cricketers Place of birth missing (living people) Cricket Australia XI cricketers Melbourne Stars cricketers
Events and publications January January 7: Alex Raymond's Flash Gordon and Jungle Jim make their debut. Flash Gordon will run until 2003, while Jungle Jim lasts until 1954. January 22: Alex Raymond's Secret Agent X-9 makes its debut and will run until 1996. The original stories are written by famous detective writer Dashiel Hammett. February February - August: Hergé's Popol Out West is serialized in Le Petit Vingtième. March March 4: The final episode of Bucky Bug as part of the Silly Symphony feature is published. March 5: Frank Victor Martinek's Don Winslow of the Navy makes its debut. It will run until 30 July 1955. March 19: Will Gould's Red Barry makes its debut. April April: David Low's Colonel Blimp makes his debut. May Zeke Wolf and the three little pigs debut in comics, in a Tom Wood's table for the magazine Good Housekkeping. June June 11: Lee Falk and Fred Fredericks's Mandrake the Magician makes its debut. June 30: The first episode of the Mickey Mouse story Bobo the Elephant appears in print, by Floyd Gottfredson and Ted Osborne. This marks the debut of the villain Eli Squinch. July July 23: The first episode of Bud Counihan's Betty Boop newspaper comic is published. It will run until 1937. Famous Funnies #1 (Eastern Color Printing) - The first full-color comic book sold to the public. It set the standard of 68 pages, including covers, and sold for 10 cents. Early issues of this series, starting with #1, advertised the contents as "100 Comics and Games - Puzzles - Magic." August August 9: in Le petit Vingtième, first episode of The blue lotus, by Hergè. August 13: Al Capp's Li'l Abner makes its debut. September September 16: Ted Osborne and Al Taliaferro's Silly Symphony comic strip adapts the cartoon The Wise Little Hen, which marks the official debut of Donald Duck (who debuted in that animated short) as a comics character. September: Rube Goldberg's Boob McNutt comes to a close. Famous Funnies #2 (Eastern Color Printing) - With this issue, Famous Funnies would become the first monthly newsstand comic publication. October October 1: Fred Neher's Life's Like That makes its debut. October 7: Fred Harman's Bronc Peeler makes its debut. October 14: The first issue of the Italian comics magazine L'Avventuroso is published. It will run until 16 May 1943. October 21: First publication of the French Disney comics magazine Le Journal de Mickey. A test issue was already published on June 1, 1934. October 22: Milton Caniff's Terry and the Pirates makes its debut. Famous Funnies #3 (Eastern Color Printing) November November 17: In Billy DeBeck's Barney Google Snuffy Smith makes its debut, leading to an eventual title change as Barney Google and Snuffy Smith. Famous Funnies #4 (Eastern Color Printing) Adolphe Barreaux' Sally the Sleuth debuts in Spicy Detective. December December 13: E.O. Plauen's Vater und Sohn (Father and Son) makes its debut. December 16: The U.S. magazine The American Weekly prints the first episode of Les Mystères Surrealistes de New York, a comic strip drawn by famous painter Salvador Dalí. It will run until 7 July 1935 Famous Funnies #5 (Eastern Color Printing) Specific date unknown Walter Goetz launches his newspaper comics Colonel Up and Mr. Down and Dab and Flounder. Births January January 11: Antonio Seguí, Argentine cartoonist, (d. 2022). February February 18: Cor Blok, Dutch illustrator and comics artist (The Iron Parachute), (d. 2021). March March 10: Fujiko A. Fujio, Japanese manga artist (Ninja Hattori-kun, The Monster Kid, The Laughing Salesman), (d. 2022). December December 28: Herb Gardner, American playwright, screenwriter and comics artist (The Nebbishes), (d. 2003) from lung disease. Deaths February February 15: Louis Forton, French comics writer and artist (Les Pieds Nickelés, Bibi Fricotin, Ploum), dies at age 54. February 27: John Terry, American comics artist and animator (Scorchy Smith, continued Have You Seen Alonzo?), dies at age 53 or 54. June June 3: Chic Jackson, American comics artist (Roger Bean), dies at age 57 from a heart attack. July July 26: Winsor McCay, American comics artist and animator (Little Nemo in Slumberland, Dream of the Rarebit Fiend, Little Sammy Sneeze, Gertie the Dinosaur) dies at age 64 from a cerebral embolism. November November 23: Albert Funke Küpper, Dutch comics artist (Krelissie en Direkkie, continued Snuffelgraag en Knagelijntje), dies at age 40 in a car accident. December December 10: Dan Smith, American illustrator and comics artist (The Jungle Folk, comics based on the Bible), dies at age 69. Specific date unknown Lee Do-Yeong, Korean comics artist and illustrator, dies at age 49 or 50. August Roeseler, German cartoonist, caricaturist, illustrator and comics artist (worked for Fliegende Blätter and Simplicissimus), dies at age 77 or 78. First issues by title Famous Funnies on newsstands in May, cover dated July, published by Eastern Color Printing Company. References
Laskiainen () is a celebration with Finnish origins, which includes both pagan and ecclesiastic traditions, and is often described as a "mid-winter sliding festival". In clerical sense, Laskiainen is associated with Shrove Tuesday (a.k.a. Fat Tuesday) and is a celebration of the beginning of Lent that takes place before Easter. In Northern Europe, this tradition has been practiced from at least the 7th century onward, and in Catholic countries – in form of carnivals – even before that. Laskiainen in Finland Etymology The etymology of the word "laskiainen" has been uncertain. Candidates for the source of the word have been "laskeutua" ("to descend", as in descent to fasting) or "laskea" ("to count", as in counting days until Easter). According to a third proposal, the word comes from the old Romance term carne lasciare ("to leave meat"), with the latter part having changed into a Finnish form. As Laskiainen is called "fettisdag" ("fatty tuesday") in Swedish after the French name "Mardi Gras", one possible explanation for the Finnish name is simply "läskitiistai" ("fatty Tuesday"). The Finnish word "läski" comes from the Swedish word "fläsk" meaning pork meat and pork fat. "Fläsktisdag" is also part of Swedish culinary traditions. Traditions The traditions of Laskiainen consist largely of merrymaking and feasts. Many of the Finnish Laskiainen traditions are probably based from an old work feast, where women stopped altering linen, hemp and wool and spinning them into yarn. Surviving old Laskiainen traditions include downhill sled riding and riding a sled around a pole. Laskiainen is no longer connected with the growth of linen, but is instead a feast of saying goodbye to the dark winter and waiting for spring. After the Reformation, Finns no longer observed fasting, but many beliefs and restrictions stayed in the people's minds. Laskiainen remained a peasant work feast, most importantly as a day belonging to women's work. An ancient European New Year's Day is situated around Laskiainen, which has led to many folk beliefs and spells connected to it in historical Finland. Work had to be stopped early in the afternoon on Laskiainen, in order for work to succeed for the rest of the year. The time for sauna was during daylight and bathers had to be quiet in the sauna. Food Food-items typically enjoyed in Finland in Laskiainen include in many cases pea soup with ham, and cheeses. In the old times, Laskiainen was a time to eat hearty amounts of meat, because the next opportunity to eat meat only came on Easter after fasting. Traditional Laskiainen foods included fatty "rieska" bread and meat soup. The "rieska" bread was made from barley and spiced with pork fat. The meat soup was cooked from peas and rye grain and spiced with pig feet or pig head. The soup was also called pig foot soup. Desserts are also an integral part of Laskiainen. The best-known after-meal dessert of Laskiainen, often enjoyed either with coffee or tea, is laskiaispulla, which is a sweet roll filled with almond paste or strawberry jam, and whipped cream. This pastry started becoming common in the 19th century. There were also beliefs about food. Most importantly, food had to be fatty. The more fat glistened on people's fingers and mouths, the more milk the cows gave and the fattier the pigs got. Greasy fingers should not be wiped clean, instead the grease had to be left to clean away on its own. This guaranteed good skills with a scythe. Those who licked their fingers would wound themselves with a scythe. When food was left on the table for the whole day, this guaranteed plenty of food for the rest of the year. Laskiainen in North America In North America too, it is traditional in Laskiainen to have a meal of split-pea soup with ham, and for amusement – as in Finland – to slide down a hill on either snow-covered or iced tracks, often on toboggans. One of the places where Laskiainen is celebrated outside Europe in form of an annual festival is the community of Palo, located between Aurora and Makinen on the shores of Loon Lake in Minnesota. With this celebration, Palo is the home for one of the longest continuously-held annual Finnish-American festivals in the United States, others being e.g. various Saint Urho's Day festivals held each March 16 both in Canada and the United States, and the FinnFest USA festivals, which have taken place in locations throughout the United States, typically hosted by communities with connections to Finnish-American cultural history. Many Finnish-North-American groups and clubs host various Laskiainen celebrations, but the large one which developed and became more organized in Palo in the 1930s is notable for both its size and longevity. References European culture Culture of Finland Public holidays in Finland Finnish-American history Holidays based on the date of Easter Mardi Gras de:Fastnachtsdienstag es:Martes de Carnaval et:Vastlapäev fi:Laskiainen fr:Mardi gras ru:масленица sv:Fettisdagen
The Undermain Theatre is an 80-seat regional theater, home to the professional theater company, Deep Ellum Theatre Group. It is located in Deep Ellum, Dallas, Texas. Deriving its name from the actual location of the basement space "under Main Street", this ensemble group of theatre artists performs new and experimental works throughout Dallas, New York City and Europe and has become known for producing many contemporary writers. Undermain Theatre history In fall 1983, Katherine Owens and Raphael Parry arrived in Dallas. Both were interested in presenting new and experimental material with an ensemble company in the Deep Ellum area. They began producing together at Stage Number One's Greenville Avenue Theater, in association with Dallas Actor's Theater, on a triple bill of Action, Killer’s Head and Icarus's Mother by Sam Shepard. In early 1984, they found the vacant basement space of the now historical Interstate Forwarding Company building on 3200 Main Street. By spring 1984, they had their first production, Excavations: Killer’s Head, Twirler, Waking Up, in the Main Street space. Excavations was part of a Gallery Walk event and was presented in a promenade style due to the lack of seating in their basement theater space. The show was a series of one-acts that both Owens and Parry directed and performed in. By the end of their first season, they were on their way to building their ensemble. In April 1985, Bruce DuBose joined the cast of Dario Fo’s Can't Pay? Won't Pay!, beginning a longtime relationship that eventually took DuBose to the position of executive producer of Undermain Theatre. With each season, Undermain continued to thrive and grow. By its third season, Dallas critics began to take notice and by the end of the fourth season, in spring 1987, Undermain flew in the playwright John O’Keefe to develop his play, All Night Long. In September that year, Undermain developed a relationship with Jeff Jones while producing Seventy Scenes of Halloween. This friendship proved to be advantageous, leading to Undermain's long standing relationships with the playwrights Len Jenkin, Mac Wellman and Eric Ehn and the subsequent productions of Poor Folks Pleasure, Harm’s Way, A Murder of Crows and The Red Plays, among other shows, establishing Undermain Theatre's name among the language playwrights in New York City and around the US. Milestones 1984 – Undermain established in the Deep Ellum area of Dallas. 1986 – Actor's Equity Association contract signed. 1995 – Yugoslavian Republic of Macedonia invited the Undermain to perform Goran Stefanovski’s play Sarajevo in commemoration of the fiftieth anniversary of the United Nations. Undermain performed in Roman amphitheaters and on the steps of orthodox cathedrals. 2000 – Toured Serbia to perform at the DAH Eater celebration. 2000 – Began the production of plays in New York (six to date) including in the original adaptation of Neil Young’s Greendale. 2002 – Established an archival website in partnership with Texas Humanities which provides on-going production information to theaters and audiences. 2008 – Performed Greendale at the Ohio theatre's SoHo Think Tank Ice Factory Festival. 2009 – The Dallas Public Library produced Beneath the Surface, an exhibit celebrating 25 years of design at Undermain Theatre. 2010 – Completed on restoration of the historic Frank Lloyd Wright audience chairs. 2011 – Collaborated with David Rabe on his play, The Black Monk and on Port Twilight with Len Jenkin. The Black Monk was published by Simon and Schuster. Port Twilight was published by Broadway Play Publishing Inc.. 2013 – Produced the first full theatrical production at the Dallas City Performance Hall with Enda Walsh's Penelope, opening the space to capacity houses and rave reviews. Travel In 1995, Undermain Theatre traveled to the Republic of Macedonia to perform Goran Stefanvovski's Sarajevo in commemoration of the 50th anniversary of the United Nations. Undermain also performed at the ancient Roman Theatre at Bittola and at the Ohrid Theater Festival. In 2000, the theater company traveled to New York City for the first time, producing three shows there (Coaticook by Lenora Champagne, Gold Into Mud and Swedish Tales of Woe by Erik Ehn) as well as four shows in Dallas. In 2001, the company returned to the Balkans with a new work and performed at the DAH Teatar Anniversary Celebration in Belgrade, Yugoslavia. The building The unique building, constructed in 1913 by B.D. Milam and E.C. Connor as the first US Customs warehouse in Dallas, is a six-story, Chicago-style building billed as absolutely fireproof with an exterior that was made with red and ironspot bricks and concrete. Jim and Michelle Herling, the owners of the building in the early 1980s, were patrons of the arts, already housing an art gallery on the first floor of the building, and were willing to allow Owens and Parry to rent the entire basement floor at a very low price. From that, Owens and Parry transformed the warehouse basement into a unique performance space that became the home of Undermain Theatre. In 1989, Undermain Properties bought the building on 3200 Main Street. It was adapted for residential use in 1991 by Graham Greene & RTHL to include 28 residential units, keeping both the theatre and the art galleries in their respective places. The building became a Recorded Texas Historic Landmark in 1991 and was listed in the National Register of Historic Places in 2002. It is also a City of Dallas Landmark. The chairs The 90-seat house at Undermain Theatre is also unique. The chairs, designed by Frank Lloyd Wright, were originally housed in the Kalita Humphreys Theater. Obtained by the Undermain from the Dallas Theater Center in 1989, the seating was designed by Taliesin architects, the firm that completed many of Wright's projects after his death in 1959. Its design was based on a variety of ideas promoted by Wright himself and by Paul Baker (Director of the Dallas Theater Center in 1957). Critical acclaim "One of the best small theaters in America" – San Diego Union-Tribune "An unsung American treasure" – Backstage magazine "Undermain Theatre seeded the ground for a writer friendly town" – American Theatre magazine "Dallas’ cutting-edge theatrical flag bearer for more than two decades" – Lawson Taitte, Dallas Morning News Neil Young's Greendale "practically breathless with the beauty, hope, pathos and power of the music and the story" – Neil Strauss, New York Times "As presented by Undermain Theatre, Neil Young’s Greendale is a hellacious piece of rock ‘n’ roll. This baby kicks, you're not likely to hear a livelier performance in any area theater" – Jerome Weeks, KERA FM Awards 1994: 500 Inc's Ken Bryant Vision Award – "the most significant form of recognition for fostering creativity and innovation in the cultural arts of Dallas". 1992 to present: Dallas Morning News and Ft. Worth Star Telegram included Undermain in the "Top Ten Productions of the Season". 2005–2006: Margo Veil acclaimed number one of the "Top Ten" in the Dallas Morning News 2006–2007: Bruce DuBose critically acclaimed Waiting for a Train received the Dallas Ft. Worth Critics forum award for "Best New Play" 2008: Artistic director, Katherine Owens, received the Texas Woman of Distinction Award in the Arts and Culture category of the American Association of University Women 2009: Eurydice and Neil Young's Greendale chosen as “Top Ten” productions by the Dallas Morning News 2010: Port Twilight and The Black Monk tied for "Number One Production" by the Dallas Morning News. Undermain productions receive six citations from the Dallas Fort Worth Theater Critics Forum Awards for Direction (2), Actor, Ensemble, Design and Touring Production. 2010: "Best Theater" and "Best Actor" – DMagazine “Best of Culture” 2011: Five citations of excellence from the Dallas Fort Worth Critics Forum: Direction (2), Design (2) and Acting. 2012: Two citations of excellence from the Dallas Fort Worth Critics Forum: Direction and Ensemble Cast 2013: Three citations of excellence from the Dallas Fort Worth Critics Forum: Acting (2) and Design. Notable authors Mac Wellman, Jeffrey M. Jones, John O’Keefe, Erik Ehn, Susan Lori-Parks, Lenora Champagne, Howard Baker, Caryl Churchill, Goran Stefanovski, Octavio Solis, Lynne Alvarez, David Rabe, Connor McPherson, Young Jean Lee, Len Jenkin, Dario Fo, David Ray, Sam Shepard, Samuel Beckett, Collaborations The Dallas Museum of Art – Undermain Reads at the Museum The Dallas Foundation – Undermain holds its Undermain Theatre Endowment Fund at the Dallas Foundation The Dallas Public Library – The Dallas Public Library houses the Undermain archives Nasher Sculpture Center – Undermain Theatre presents at the Nasher Gallery Lab Southern Methodist University – Undermain Artistic Director Katherine Owens is a guest seminar lecturer for the theater division of the Meadows School of the Arts The City of Dallas Office of Cultural Affairs – With support from the City of Dallas, OCA, Undermain provides free and discounted rehearsal space to performing arts groups. References Performing arts in Dallas Buildings and structures in Dallas Theatres on the National Register of Historic Places in Texas National Register of Historic Places in Dallas
"Respectable" is a song by the English rock band the Rolling Stones from their 1978 album Some Girls. It was written by Mick Jagger and Keith Richards. In the liner notes to the 1993 compilation album Jump Back: The Best of The Rolling Stones (on which it was included), Jagger said, "It's important to be somewhat influenced by what's going on around you and on the Some Girls album, I think we definitely became more aggressive because of the punk thing..." Inspiration and recording Recorded from October through December 1977, "Respectable" was originally written by Mick Jagger to be a slower song, but guitarist Richards saw the advantages of speeding up the tempo and crafting a rocker out of the song. Jagger continued in the liner notes, "On ["Respectable"] I was banging out three chords incredibly loud on the electric guitar, which isn't always a wonderful idea but was fun here. This is a punk meets Chuck Berry number..." This resulted in Jagger and Richards having arguments over the song's tempo. The biting lyrics talk of a woman rising into high society and Jagger's attempts to remind her of where she came from. Jagger said at the time of its release, "'Respectable' really started off as a song in my head about how respectable we as a band were supposed to have become, 'We're so respectable'. As I went along with the singing, I just made things up and fit things in. Now we're respected in society... I really meant [the band]. My wife's a very honest person, and the songs's not about her... It's very rock & roll. It's not like Bob Dylan's 'Sara'. 'Respectable' is very lighthearted when you hear it. That's why I don't like divorcing the lyrics from the music. 'Cause when you actually hear it sung, it's not what it is, it's the way we do it..." Release and aftermath "Respectable" was released as a single in the United Kingdom in 1978, where it peaked at no. 23 on the UK Singles Chart. A memorable music video, which was directed by Michael Lindsay-Hogg, was made for the single, featuring a more "punk" Stones on display. A still from this video—with departed bassist Bill Wyman edited out—was used as the cover for the band's 2005 compilation album Rarities 1971–2003. It also appeared on later compilations such as Jump Back, and GRRR! A live version from their 1997-1998 Bridges to Babylon Tour was released on the album No Security. The Stones were joined on stage by John Mayer to play a live version during their 50 and Counting Tour on 13 December 2012 at the Prudential Center in Newark, New Jersey. Charts Personnel Mick Jagger – lead vocals, electric guitar Keith Richards – electric guitar Ronnie Wood – electric guitar Bill Wyman – bass guitar Charlie Watts – drums References 1978 singles 1978 songs Music videos directed by Michael Lindsay-Hogg The Rolling Stones songs Song recordings produced by Jagger–Richards Songs written by Jagger–Richards
There are at least nine video games that Michael Jackson has composed music for or are directly related to him. Sega was the developer for at least six of them: the arcade and Mega Drive/Genesis versions of Michael Jackson's Moonwalker, Michael Jackson in Scramble Training for arcades, Sonic the Hedgehog 3 for the Mega Drive/Genesis, and Space Channel 5 and Space Channel 5: Part 2 for the Dreamcast. The other three were produced by other companies: Moonwalker for home computers by U.S. Gold, Michael Jackson: The Experience by Ubisoft, and Planet Michael by SEE Virtual Worlds. Michael Jackson's Moonwalker Michael Jackson's Moonwalker is a franchise for several video games based on the film of the same name created by Sega (for arcades and the Mega Drive/Genesis) and U.S. Gold (for home computers) in 1989 and 1990 that incorporate the personage of and were co-developed by Jackson himself. The arcade version, home video games and home computer versions all differ in terms of gameplay, but the story and concept remain constant. The story, which is taken from the Moonwalker film, follows Michael, using various music and dance related abilities, on a quest to save kidnapped children from the hands of the evil "Mr. Big". The games incorporated synthesized versions of the musician's hits, such as "Beat It" and "Smooth Criminal". The games have now achieved cult status and are remembered for being a memorable point in Jackson's change to a different stage persona from "Thriller", to "Bad". The game's development dates back to 1988, when Michael Jackson contacted Sega about developing a video game that would capture his persona. Sega and Jackson then began working on an arcade video game based on his Moonwalker film and "Smooth Criminal" music video released that year. The Moonwalker arcade game was eventually introduced in 1990. Other Sega games Michael Jackson in Scramble Training Michael Jackson in Scramble Training is a laserdisc video game released for arcades in 1993, running on Sega's AS-1 motion simulator cabinet. It was an interactive film ride featuring pre-rendered 3D computer graphics and allowed up to eight players to interact with the game. Michael Jackson provided voice acting and occasionally appeared in live-action full-motion video (FMV) sequences, while some of his music was also used. Sonic the Hedgehog 3 Michael Jackson was allegedly involved in the music production of Sonic the Hedgehog 3. Conflicting accounts arose as to why he left the project, including the 1993 child sexual abuse accusations against him, or that he was unhappy with the sound quality of the Genesis which was generally considered inferior to Super Nintendo Entertainment System and other competing game consoles of the time period. On June 23, 2022, former Sonic Team leader Yuji Naka confirmed that Michael's songs were in the released game. Jackson was never officially credited within the game. Space Channel 5 and Space Channel 5: Part 2 In Space Channel 5 and its sequel Space Channel 5: Part 2, Jackson appears as a fictional character named Space Michael (スペースマイケル, Supēsu Maikeru), whose likeness and voice is provided by Jackson. In both versions of the game, Michael speaks in English, which is subtitled into Japanese in the Japanese version. In the first Space Channel 5 Michael uses his singing skills against a singing robot and joins her to fight against Purge after he is rescued by Ulala from the Rhythm Rogues. Originally meant to be a one-time cameo appearance, Jackson had a more prominent role in Space Channel 5: Part 2, where he became the new head of Space Channel 5. Whilst Ulala is distracted by a fake scoop, the headquarters are attacked and Space Michael is kidnapped by Purge and the Rhythm Rogues and has to be rescued by Ulala in a level featuring several of Michael's signature dance moves. He then joins Ulala in a confrontation against Purge. The May 2007 issue of EGM contains a quote from series creator Tetsuya Mizuguchi concerning what it was like to work with Jackson: "We were in the middle of production of Space Channel 5, in 1998 or 1999. I got a call from the U.S. from my partner - the executive producer of Space Channel 5 - and he said, 'Oh, Michael wants to act in Space Channel 5.' I said, 'Who's Michael?' 'Who is Michael Jackson?' he said, 'The Michael Jackson - the real Michael Jackson' My partner had shown him the 60-to-70 percent complete version, when it was almost at the end of the game. We had one month to finalize. But Michael wanted to do something, so we suggested that if he was OK with it, we could program the people in the game to do the Michael Jackson dance when taken over by aliens. he said 'yeah.' We initially had five aliens who danced. One of them became Michael Jackson.", Michael Jackson: The Experience Michael Jackson: The Experience is a music video game based on Jackson's music and songs. It was developed and published by Ubisoft and Triumph International (subsidiary by The Michael Jackson Company LLC), and was released on November 23, 2010, for the Wii, Nintendo DS, and PlayStation Portable. Later it was released on other platforms: Xbox 360's Kinect, PlayStation 3's PlayStation Move, Nintendo 3DS, PlayStation Vita, iOS. The game features many of Michael Jackson's hits, such as "Bad", "Beat It", "Smooth Criminal" and "Billie Jean". Planet Michael Planet Michael was a planned MMORPG based on Jackson's music. It was being developed by SEE MJ Virtual Worlds (The Michael Jackson Company LLC and SEE Entertainment) and was originally scheduled for release in 2011, but was eventually canceled. Planet Michael was to be based within the Entropia Universe. References Video games based on musicians
James Murray was a Republican politician from the state of Ohio. He was Ohio Attorney General in 1861 and 1862. James Murray was born in Scotland about 1830. In 1831, when about a year old, his family moved to Sidney, Ohio. He was educated in the public schools, and admitted to the bar in 1851. He immediately relocated to Perrysburg, Ohio. He was elected Ohio Attorney General in 1860, and served one term. He remained a resident of Wood County, Ohio until the close of his term, and then returned to Sidney, where he died in 1879. The only other political office he ever held was as mayor of Perrysburg. Notes References People from Perrysburg, Ohio People from Sidney, Ohio Ohio Attorneys General Ohio Republicans Ohio lawyers 1830 births 1879 deaths Mayors of places in Ohio Scottish emigrants to the United States 19th-century American politicians 19th-century American lawyers
Chong Hua Hospital () is a hospital in Cebu City, Philippines. It is a non-stock, non-profit organization, owned and managed by the . In 2009, it became the first hospital outside Luzón and third in the Philippines to be accredited by Joint Commission International. The hospital had been able to keep its agency accreditation until 2015. Chong Hua has 660 bed capacity and is located near the Fuente Osmeña Circle, a city landmark. See also List of hospitals in the Philippines References External links Official website of Chong Hua Hospital Promotional video of Chong Hua Hospital Buildings and structures in Cebu City Private hospitals in the Philippines
```makefile libavcodec/vorbisdsp.o: libavcodec/vorbisdsp.c config.h \ libavutil/attributes.h libavcodec/vorbisdsp.h libavcodec/vorbis.h \ libavcodec/avcodec.h libavutil/samplefmt.h libavutil/avutil.h \ libavutil/common.h libavutil/attributes.h libavutil/macros.h \ libavutil/version.h libavutil/avconfig.h libavutil/intmath.h \ libavutil/mem.h libavutil/error.h libavutil/internal.h libavutil/timer.h \ libavutil/log.h libavutil/cpu.h libavutil/dict.h libavutil/pixfmt.h \ libavutil/libm.h libavutil/intfloat.h libavutil/mathematics.h \ libavutil/rational.h libavutil/avutil.h libavutil/buffer.h \ libavutil/cpu.h libavutil/channel_layout.h libavutil/dict.h \ libavutil/frame.h libavutil/buffer.h libavutil/samplefmt.h \ libavutil/log.h libavutil/pixfmt.h libavutil/rational.h \ libavcodec/version.h libavutil/version.h ```
Sale Town Hall is a municipal building on School Road in Sale, Greater Manchester, England. The town hall was the headquarters of Sale Borough Council until the council was abolished in 1974. History After rapid development as a commuter town, which saw its population tripling by the end of the 19th century, Sale became an urban district in 1894. Civic leaders decided to procure a town hall and the site they selected on the north side of School Road had already been occupied by local council offices. The foundation stone for the new building (the eastern wing of the main frontage) was laid by the Chairman of the Public Offices Committee, James McDonald, on 9 May 1914. It was designed in the neoclassical style in red brick and was officially opened by the Chairman of the council, Ernest Jones, on 4 December 1915. A war memorial, which depicted a mourning Saint George on top of a stone pedestal, was designed by Arthur Sherwood Edwards to commemorate local service personnel who had died in the First World War and was unveiled by Major-General Arthur Solly-Flood on 23 May 1925. After Sale became a municipal borough in September 1935, civic leaders decided to extend the building. The foundation stone for the extension (the western wing of the main frontage) was laid by the Chairman of the Public Offices Committee, Alderman Paley Parrish, on 5 May 1937. It was designed in a similar style and was officially opened by the mayor, Alderman G. F. Gordon, on 2 July 1940. By this time, the design involved a symmetrical main frontage with nine bays facing onto School Road; the central section of seven bays, which slightly projected forward, incorporated a central bay which was faced with stone and featured a doorway on the ground floor with stone brackets supporting an entablature bearing the words "Sale Town Hall" and a coat of arms and balcony above; there was a French door, which was recessed, on the first floor and a pediment above. Sale Library on Tatton Road, which had been based just behind the town hall extension, was rebuilt around the same time. Internally, the principal room in the town hall was the council chamber which was panelled and was decorated in an Art Deco style. The building was hit by a series of German incendiary bombs on the night of 23 December 1940 during the Manchester Blitz, a part of the Second World War: there were no injuries but the building was badly damaged. A programme of restoration works, which included the installation of a new clock tower with cupola, was completed in 1952. The works included the re-instatement of a stained glass window on the main staircase depicting the coat of arms of the former local member of parliament, Sir William Cunliffe Brooks. The town hall continued to serve as the headquarters of Sale Borough Council for much of the 20th century, but ceased to be the local seat of government when the enlarged Trafford Council was formed in 1974. A further programme of works to refurbish the town hall, the library and the civic theatre was completed in November 2004. The works involved the conversion of the civic theatre into the new Waterside Arts Centre and the creation of the Robert Bolt Theatre, named after the playwright and a twice Oscar-winning screenwriter, Robert Bolt, behind the east wing of the town hall. References Government buildings completed in 1915 City and town halls in Greater Manchester Sale, Greater Manchester
```scala // THIS FILE IS AUTO-GENERATED. DO NOT EDIT package ai.verta.swagger._public.uac.model import scala.util.Try import net.liftweb.json._ import ai.verta.swagger._public.uac.model.IdServiceProviderEnumIdServiceProvider._ import ai.verta.swagger._public.uac.model.UacFlagEnum._ import ai.verta.swagger.client.objects._ case class UacGetUsersFuzzy ( email: Option[String] = None, pagination: Option[VertauacPagination] = None, username: Option[String] = None ) extends BaseSwagger { def toJson(): JValue = UacGetUsersFuzzy.toJson(this) } object UacGetUsersFuzzy { def toJson(obj: UacGetUsersFuzzy): JObject = { new JObject( List[Option[JField]]( obj.email.map(x => JField("email", JString(x))), obj.pagination.map(x => JField("pagination", ((x: VertauacPagination) => VertauacPagination.toJson(x))(x))), obj.username.map(x => JField("username", JString(x))) ).flatMap(x => x match { case Some(y) => List(y) case None => Nil }) ) } def fromJson(value: JValue): UacGetUsersFuzzy = value match { case JObject(fields) => { val fieldsMap = fields.map(f => (f.name, f.value)).toMap UacGetUsersFuzzy( // TODO: handle required email = fieldsMap.get("email").map(JsonConverter.fromJsonString), pagination = fieldsMap.get("pagination").map(VertauacPagination.fromJson), username = fieldsMap.get("username").map(JsonConverter.fromJsonString) ) } case _ => throw new IllegalArgumentException(s"unknown type ${value.getClass.toString}") } } ```
The Dog King is a 1995 novel by the Austrian writer Christoph Ransmayr. Its original title is Morbus Kitahara. A work of alternative history, it is set in Central Europe after World War II and the implementation of the Morgenthau Plan, which has deindustrialized the region and created a ruthless post-apocalyptic-esque society. The main character is the son of a blacksmith who becomes the bodyguard of the only man in the area who owns a car. An English translation by John E. Woods was published in 1997. The book received the 1996 Aristeion Prize. Reception Curt Fields wrote in the Chicago Tribune: "The themes are grand, but the writing is far from pompous. Ransmayr's story (and John E. Woods' translation from the original German) is elegant, incisive and never labored." In The New York Times, Gabriele Annan wrote about the book's use of allegory: "Whatever it symbolizes, the narrative is wildly arbitrary; but there is something so powerful, committed and solemn about Ransmayr's tone that it seems like a command to interpret his message". The critic continued: "This can have the opposite effect, of course, and Ransmayr has affectations that can be irritating. All the same, he is a marvelous writer, though, unlike most novelists, he writes more about sensations than feelings." Publishers Weekly wrote: "Ably translated by Woods, this novel paints a convincing postapocalyptic world sent back into a nearly pre-civilized state. But Ransmayr (The Terrors of Ice and Darkness), though clearly probing the question of how Germany is to view itself in the wake of the Holocaust and WWII, never pulls his story out of his dark, expressionist atmospherics into the clear light of an answer." References External links German publicity page 1995 science fiction novels 1995 novels 20th-century Austrian novels Alternate history novels Austrian speculative fiction novels Dystopian novels German-language novels Novels by Christoph Ransmayr Post-apocalyptic novels S. Fischer Verlag books
Scott Hicks (born April 3, 1966) is an American former college basketball coach. He was head coach at Le Moyne College, University at Albany, SUNY and Loyola University Maryland. Hicks came to Le Moyne as a student-athlete in 1984 to play for coach John Beilein. He was a four-year letterman for the Dolphins, leading the team to the East Regional of 1988 NCAA Division II men's basketball tournament. Following his college career, he played professionally for the Rheineck Sea Horses in New Zealand. He received his first college coaching job as an assistant at Hamilton College, where he served from 1988 to 1990. He then obtained a master's degree in higher education administration from Syracuse University, where he also served as a graduate assistant for the men's basketball team. In 1992, Hicks was hired by his alma mater as the youngest head men's basketball coach in the NCAA at age 26. He spent five seasons at Le Moyne, compiling a five-year record of 87–56. In 1997, Hicks was hired as head coach at Albany as the school was making a move from Division II to Division I status. Hicks led the Great Danes through the division transition process and led the team to an 11–17 record in its first season as a Division I independent in 1999–2000. He then left for the head coaching position at Loyola in Baltimore, Maryland. Hicks spent four seasons at the helm of the Greyhounds, compiling a record of 16–97. The 2003–04 season was a particularly dismal one for Hicks and the Greyhounds. The team extended a 31-game losing streak that threatened to match the NCAA futility record (33 games). Hicks was fired after his team went 1–27 for the season. References External links Division I coaching record Le Moyne HOF profile 1966 births Living people Albany Great Danes men's basketball coaches American expatriate basketball people in New Zealand American men's basketball coaches American men's basketball players Basketball coaches from New York (state) Basketball players from New York (state) College men's basketball head coaches in the United States Forwards (basketball) Hamilton Continentals men's basketball coaches Le Moyne Dolphins men's basketball coaches Le Moyne Dolphins men's basketball players Loyola Greyhounds men's basketball coaches People from Oneida, New York Syracuse University alumni
Inuvil is a town in the Northern Province of Sri Lanka, about 5 miles north of the city of Jaffna. It is located on the Jaffna-Kangesanthurai road. This road divides the town into two parts East Inuvil and West Inuvil. Inuvil is bordered by Uduvil to the north, Urumbarai to the east, Kondavil to the south, and Sudumala to the west. The town is known for its tobacco production, full of small plantations for agriculture. McLeod Hospital, a maternity hospital established by the American Mission, is the most famous. Until a few decades ago, people from many parts of the peninsula flocked to this clinic. People The town and the surrounding area have traditionally been populated by farmers. However, many have educated their children to be professionals. There are several people who have started their own business as well. The majority of the people are Tamils. The first revolutionary group (EROS) Eelam Revolutionary Organisation of Students formed by Eliyathamby Ratnasabapathy is from Inuvil. Many residents have immigrated to Western countries. The Inuvil diaspora is present in Canada, England, France, Germany, Switzerland, United States, Australia, Norway and Sweden. Education Inuvil Central College Inuvil Hindu College Inuvil Ramanathan College Faculty of Fine Arts, University of Jaffna Inuvil Public Library Inuvil Arivalayam Inuvil Central College Primary School Inuvil Ilanthondar Sabai Culture Most of them are Hindus Around 98–99% and follow Tamil Culture. There are many professional drummers who came from this village including famous Thadshanamoorthy. There is also a "Gurukulam" where most of the Hindu priests are educated here. Famous Hindu temples In the village of Inuvil, there are many temples. There are a few huge historical Tamil kingdom-era temples. These are still being well maintained by the people. The large temples in Inuvil are: Inuvai Pararajasekara pillaiyaar kovil Inuvai Kanthaswamy Kovil Inuvai Sivakami amman kovil Inuvai Karaikal sivan kovil Inuvil Segarajasekarap Pilliar Kovil Inuvil Manchathdy Murugan Kovil Diaspora Organizations Inuvil Thiruvoor Ontriam - Canada Inuvil Thiruvoor Ontriam - Canada is a non-profit Tamil organization created by the Inuvil diaspora living in Toronto started in the year 2000 to bring together all diaspora and their children for reunification in Toronto. Inuvil Thiruvoor Ontriam creates academic level Tamil language competitions, art shows, Bharata Natyam shows based on the Tamil culture and summer Barbecues yearly to bring gatherings of Tamil diaspora from Inuvil living in the province of Ontario. The organization creates charities to help with the war-torn development in Sri Lanka for orphanages, resettlement, and community development in Sri Lanka and Canada. Inuvil Thiruvoor Onrium keeps in touch with organizations like the National Council of Canadian Tamils and Canadian Tamil Congress to keep networked connections for its resources in charity and development projects in Sri Lanka. Inuvil Thiruvoor Ontriam plays an active role in the Tamil Canadians community living in the Greater Toronto Area, Brampton, Mississauga, Pickering, Ontario, Ajax, Ontario, Oshawa, Ontario and Whitby, Ontario. Official Inuvil Website www.inuvaiyur.com Transport Inuvil Railway Station Notable people Srikanthalakshmi Arulanandam References www.inuvaiyur.com Villages in Jaffna District Valikamam South DS Division
Mariana R. Pfaelzer (February 4, 1926 – May 14, 2015) was a United States district judge of the United States District Court for the Central District of California. Education and career Born to a Jewish family in Los Angeles, California in 1926, Pfaelzer received an Artium Baccalaureus degree from the University of California, Santa Barbara in 1949 and a Juris Doctor from the UCLA School of Law in 1957. She was in private practice in Los Angeles from 1957 to 1978. Federal judicial service On August 8, 1978, Pfaelzer was nominated by President Jimmy Carter to a seat on the United States District Court for the Central District of California vacated by Judge Francis C. Whelan. She was confirmed by the United States Senate on September 22, 1978, and received her commission the next day. She was the first female federal judge appointed to the district. She assumed senior status on December 31, 1997, serving in that status until her death. Notable cases She is noted for her role in striking down California's Proposition 187, which would have denied services to undocumented immigrants in California. Pfaelzer handed down a $600 million judgment against Countrywide Financial. Death and tributes On May 14, 2015, Pfaelzer died in Los Angeles after serving on the federal bench for nearly 40 years. George H. King, the Chief District Court Judge for the Central District of California, noted that she "was the epitome of what a federal judge ought to be . . . presi[ding] with brilliance, analytical rigor, practicality, wisdom, grace and courage." Personal Pfaelzer was married to Frank Rothman, an attorney who died in 2000. See also List of first women lawyers and judges in California References Sources 1926 births 2015 deaths People from Los Angeles Judges of the United States District Court for the Central District of California United States district court judges appointed by Jimmy Carter 20th-century American judges University of California, Santa Barbara alumni UCLA School of Law alumni 20th-century American women judges
Pertang is a state constituency in Negeri Sembilan, Malaysia, that has been represented in the Negeri Sembilan State Legislative Assembly. The state constituency was first contested in 1959 and is mandated to return a single Assemblyman to the Negeri Sembilan State Legislative Assembly under the first-past-the-post voting system. Demographics History Polling Districts According to the Gazette issued on 17 July 2023, the Pertang constituency has a total of 8 polling districts. Representation History Election results References Negeri Sembilan state constituencies
九州 ("nine provinces") may refer to: Kyushu, an island of Japan Nine Provinces, an ancient division of China Novoland
The Guided Missile Launching System (GMLS) is a device for launching guided missiles, and is found on many U.S. Navy ships. This list includes all launchers that are part of the designation series. Included on this list are missile launchers that have not been adopted for service in the United States Navy. Launchers by designation References Federation of American Scientists - US Navy Shipboard Combat Systems Ship-based missile launchers Naval guided missile launch systems of the United States Guided missile
Tracy Chamoun () (born on 22 October 1960) is a Lebanese author, diplomat and political activist of Lebanese and Australian descent. She was the Lebanese ambassador to Jordan from August 2017 until 7 August 2020 when she resigned after the 2020 Beirut explosion, saying the catastrophe showed the need for a change in leadership. Early life Tracy Chamoun was born in 22 October 1960 to the Chamoun political family. She is one of two surviving children of Dany Chamoun, the assassinated former leader of the National Liberal Party and son of former President Camille Chamoun; her mother is the late Patti Morgan Chamoun, an Australian fashion model and actress. A militia headed by the syrians under Elie Hobeika attacked her father's home and killed him, his second wife and two of their three young children. The Lebanese courts convicted Samir Geagea of the assassination. Career Dany Chamoun Foundation Through the Dany Chamoun Foundation, Tracy Chamoun has sought to perpetuate the legacy of her father, who, on 21 October 1990, was assassinated together with his second wife and two children. Many received amnesty. Eleven associates are also sentenced. Her autobiography, Au Nom du Pere, centered on her relationship with her father and his life and work. In it, she recounts the harrowing experience in which she and her mother were kidnapped in 1980 during a surprise attack on the National Liberal Party headquarters by Phalangist militiamen under the command of Bachir Gemayel, her father's former ally. Syrian occupation Chamoun was an outspoken critic of the former Syrian occupation of Lebanon. She has described her country's independence as a "myth". Before the Independence Day celebrations in 1990 she asked rhetorically: To what extent does the establishment believe that the population is so blind that it cannot see that the nation is far from independent? Like the myth of the emperor with no clothes, it is a charade that only the sycophants see and celebrate. Political views Chamoun is known for her moderate political views. She became the first woman to found a political party in the Arab world, called the "Liberal Democrats Party of Lebanon" (also translated as the Party of Liberal Democrats of Lebanon). She favors the building of a modern democracy, and has spoken out against what she sees as the feudal political system in which clan loyalties often play a more significant role than ideology in politics. Chamoun has vowed to continue to remind people of the truth behind the assassination of her slain father which she writes about in her books Le Sang De la Paix published by Lattes in France and () published by Antoine in Lebanon. Candidacy for presidency On 29 August 2022, she announced her candidacy for presidency in the 2022 presidential election. See also Samir Geagea References External links Further reading "Declaration on the anniversary of Dany Chamoun’s assassination", October 2008, Tayyar.org "Warlord gets life, but plans his vacation" Robert Fisk, The Independent, 25 June 1995 1960 births Living people Lebanese Maronites Lebanese people of Australian descent National Liberal Party (Lebanon) politicians 21st-century Lebanese women politicians 21st-century Lebanese politicians Chamoun family Ambassadors of Lebanon to Jordan Lebanese women ambassadors Lebanese memoirists Lebanese women memoirists Candidates for President of Lebanon People of the Lebanese Civil War
Sollacaro (; , ; ) is a commune in the Corse-du-Sud department of France on the island of Corsica. Geography The village is located at 450 m of altitude in the Taravo valley, on the departmental road 302, linking the Celaccia gap to Pisciatello (close to Ajaccio) via Pila-Canale. A large part of the village is on the northwest side of a hill therefore there is no morning sun except for the Torre and adjacent neighbourhoods situated on a rocky spur. Sollacaro is southeast from the prefecture, Ajaccio, north of the subprefecture Sartène and north of Propriano. Climate Sollacaro has a hot-summer mediterranean climate (Köppen climate classification Csa). The average annual temperature in Sollacaro is . The average annual rainfall is with November as the wettest month. The temperatures are highest on average in August, at around , and lowest in January, at around . The highest temperature ever recorded in Sollacaro was on 23 July 2009; the coldest temperature ever recorded was on 2 January 2002. Population See also Communes of the Corse-du-Sud department References Communes of Corse-du-Sud
Federal Highway 196 (Carretera Federal 196) is a Federal Highway of Mexico. The highway is a spur route that connects Chichihualco, Guerrero and Mexican Federal Highway 95 in the southeast. References 196
Gridwars (aka GRID WARS) was a programming contest announced in November 2002 by Engineered Intelligence (EI). The competition was devised to promote EI's product called CxC (a parallel programming language) introduced the same day. Gridwars was also announced in selected forums and through personal invitations. Four contests were held in total: in February 2003, in June 2003 (Gridwars II), in November 2003 (Gridwars Interactive), and in April 2004 (Gridwars III). EI was founded by Matt Oberdorfer; in the late 2005 EI discontinued CxC and announced a new product called "I/O accelerator". In the early 2006 EI changed name to Gear6 and replaced Gridwars front page with the announcement of discontinuation. Shortly after the web site www.gridwars.com was shut down. Game concept and core rules The game is played on a board aka "battlefield"—orthogonal grid of given size drawn on a torus (thus opposite edges of the field are in contact). Each cell of the battlefield can be either empty or owned by one of several codes competing for the cells of the battlefield. The code which manages to take over the battlefield or owns most cells after a specified number of cycles is the winner. The original terminology used by EI was peculiar in that it referred to the competing codes as "the warriors" and to the cells as "processors" of a virtual computing grid (hence "the battle for processors") capable, however, of "firing bullets" at each other. The game proceeds in turns (cycles). At the beginning of the game, each code owns one cell. Every cycle, codes are executed for cells they own. As it happens, framework program supplies the codes with some data: who are the cell's eight immediate neighbors (by warrior number, 0 for free cell) and its own warrior number. Based on this data, warriors can "fire three bullets" at one/two/three of its 8 neighbors. Gridwars II introduced a principal extension of original rules: warriors could now return 32-bit word, called communication variable or comvar for short, which framework program would supply to each of its 8 neighbors during the next cycle of battle execution. After all of the cells made their shots, control program evaluates how many bullets in total arrived at every cell from the neighboring warriors, i.e. cells executing the same code. Whichever warrior sends more bullets at the cell (and not less than three in total), takes it over. In case of a tie, cell ownership remains the same. In principle, the game can be played without a computer: on a board whose size is small enough to make it fun. Players can use private boards or paper to specify shooting directions for all of their cells and then show the shots and update the board together. Alternatively, firing directions can be specified on the main board in the cell-by-cell manner (using matches, for example), opponents taking turns. Winners With the exception of Gridwars Interactive, top three finishers in each competition were honored in EI's press releases and received prizes provided by Hewlett-Packard who sponsored Gridwars (pocket PCs, digital cameras, printers, and 5-node Xeon cluster to the winner of Gridwars III). Gridwars 1. Scott Balaban (Cleveland, Ohio) 2. John Ours (Cleveland, Ohio) 3. Robert Macrae (London, UK) Gridwars II 1. Vasiliy Gromov (Moscow, Russia) 2. Mark Wenig (Maryland, USA) 3. Robert Macrae (London, UK) MEGA GRID WARS league of Gridwars II 1. Robert Macrae (London, UK) 2. Paul Klinge (VTT, Finland) 3. Shanming Loh (Singapore) Gridwars III 1. Mark Wenig (Greenbelt, Maryland, USA) 2. Paul Klinge (VTT, Finland) 3. Chris Mueller (Katy, Texas, USA) In the interests of objectivity, table below provides additional details with regard to participation. There were reports in the forum that certain codes from a prior competition were resubmitted for participation by EI, and available information of this kind is taken into account. Press and media The event that attracted most attention from the press was, by far, Gridwars II. In particular, the final battle between programs written by Vasily Gromov and Mark Wenig: New Scientist: "Gladiator-style 'wars' select out weak programs" New Scientist: "Russian programmer defeats NASA in code war" BBC Russian: "NASA programmer was bitten by Cobra" Russian TV channel news: "Our Vasa has beaten NASA" Footnotes Programming contests
Palanga City Municipality is a city municipality of Lithuania, located in the west of the country, near the Baltic sea. It includes Šventoji, Nemirseta, Būtingė and other settlements. It is located in Klaipėda County, which is no longer an administrative entity, but only used for statistics. History Since 1970 most of Šventoji surroundings added to Palanga municipality. Municipality in current form created in 1995. Elderships A single eldership within municipality – Šventoji eldership, located in Šventoji, 14 km north of Palanga. Settlements Būtingė Nemirseta Palanga - city proper Šventoji External links Official website Municipalities of Lithuania
Madoryx oiclus is a moth of the family Sphingidae. It is known from Suriname, French Guiana and from Venezuela to Costa Rica. It has also been recorded in Paraguay, Argentina and Bolivia. Description The wingspan is 76–93 mm. Subspecies Madoryx oiclus oiclus (Paraguay, Argentina and Bolivia, Suriname, French Guiana and from Venezuela to Costa Rica) Madoryx oiclus jamicensis Neidhoefer, 1968 (Jamaica) References Dilophonotini Moths described in 1870 Moths of South America Taxa named by Pieter Cramer
Porn Time was an online streaming application formed from Popcorn Time, for the purpose of viewing pornographic content. It was released on June 6, 2015 and has since acquired a large user base. The desktop app was downloaded by 450,000 users in the first week after it launched, overloading the download servers. Torrentfreak quoted the development team saying: “We’re pretty shocked and find it a little hard to believe and amusing in a way. But Porn Time, the Popcorn Time for Porn, became an Internet phenomenon just one week after it went live!” The country which has the most downloads of Porn Time is the US, followed by France and Brazil. Porn Time was initially released for Windows, Mac and Linux, and is also available for Android devices. According to the team leader, Porn Time was created due to the demand for porn in Popcorn Time. See also Popcorn Time References External links 2015 software Free BitTorrent clients Free media players Peer-to-peer Streaming media systems Streaming software Video on demand services
Water polo was contested for men only at the 1978 Central American and Caribbean Games in Medellín, Colombia. References 1978 Central American and Caribbean Games 1978 1978 in water polo
Blasius Laubich (died 1608) was a Roman Catholic prelate who served as Auxiliary Bishop of Passau (1604–1608). Biography On 24 Nov 1604, Blasius Laubich was appointed during the papacy of Pope Clement VIII as Auxiliary Bishop of Passau and Titular Bishop of Symbalia. On 4 Dec 1604, he was consecrated bishop by Wolfgang von Hausen, Bishop of Regensburg, with Bartholomäus Scholl, Auxiliary Bishop of Freising, and Marcus Lyresius, Auxiliary Bishop of Eichstätt, serving as co-consecrators. He served as Auxiliary Bishop of Passau until his death on 5 Feb 1608. References 17th-century Roman Catholic bishops in Bavaria Bishops appointed by Pope Clement VIII 1608 deaths
Justin Time is a Canadian animated television series created by Brandon James Scott and developed by Frank Falcone, Mary Bredin, and James Scott. The series premiered on September 22, 2011, with the finale airing on June 24, 2016. A total of 76 segments in 39 episodes were produced. This show was made for Disney Junior in Canada. Overview The series revolves around the adventures of Justin. In every episode, Justin encounters a problem of everyday childhood (such as sharing, teamwork, or paying attention). Then, Justin and his shape-shifting sidekick Squidgy solve the problems by tackling them in adventures through time and around the world. In every adventure, Justin and Squidgy meet their best friend Olive, who always lives in the place and time they are visiting, and who usually needs their help to accomplish a task. Together, the three of them encounter the same problem that Justin faces in his world, and together they solve the problem before he gets called back by his parents to his world. In the original concept, Justin travelled via a time machine, which led to the title "Justin Time". Because the concept of "the past" is challenging for preschoolers, the TV series instead focuses on more developmentally appropriate adventures of fun. Episodes Characters Main Justin Pearson (voiced by Gage Munroe in seasons 1–2, and Drew Davis in season 3): A happy eight-year-old boy with a positive outlook on life. He likes to jump into the action, and he’s always on the go. Justin is the leader of the team, and he likes to take charge, even if he isn’t always sure he is going in the right direction. He is an "action boy" and never hesitates to dive into an adventure. Justin learns life skills in each episode. He is a caring person; he looks after his friends Olive and Squidgy. He's empathetic and is able to learn from his own mistakes and from the mistakes of others. Olive (voiced by Jenna Warren): A 13-year-old girl that stands for friendship in Justin Time. She appears in every place that Justin and Squidgy visit and is the first friend they meet as each adventure starts. She has black hair; her hair and attire always change to match the adventure. Usually through Olive's job, the trio encounters the problem that needs to be solved. Squidgy (voiced by Scott McCord): A big source of fun and comedy in Justin Time. He is described as "a tub of Kooky Clay come to life". Squidgy tends to want to befriend everyone and everything – from great furry mammoths to gangly pirates. He can speak to all animals except snakes, which he is afraid of. Supporting Hilda Pearson (voiced by Heather Bambrick): Justin's caring mother. Olive's Grandpa Cinderella: A young princess. Monty the mammoth: He is a mammoth. Cleopatra: A museum princess girl. Dawn: A girl that wears a brown hat, a white shirt, and brown vest. Pierre: A friend of Justin and Squidgy. Sammy: Justin’s neighbor. Production and reception In November 2014, it was announced that Disney Junior Canada and Netflix had ordered a third season of Justin Time, to be entitled Justin Time: The New Adventures on Netflix. The 13 half-hour episodes were to be released in 2016. Justin Time was nominated for a 2013 Daytime Emmy Award for Outstanding Preschool Animated Program, and twice for an Annie Award for Best Animated Television Production For Preschool Children. It was also nominated for three Canadian Screen Awards, in the Best Pre-School Program or Series category, winning one in 2014. Broadcast Justin Time aired on Disney Junior Canada in Canada, and Netflix in the United States. It also aired on Télémagino in French in Canada. References External links Justin Time on Family Jr. (Canada) Justin Time on Sprout (USA) Justin Time on Tiny Pop (UK) Justin Time on Clan (Spain) 2010s Canadian animated television series 2011 Canadian television series debuts 2016 Canadian television series endings NBC original programming Family Jr. original programming Canadian computer-animated television series Canadian preschool education television series Television shows set in Toronto Netflix children's programming English-language Netflix original programming Canadian children's animated science fantasy television series Animated television series about children 2010s Canadian time travel television series Animated preschool education television series 2010s preschool education television series
Brian Dzingai (born 29 April 1981) is a former Zimbabwean Olympic sprinter who specializes in the 200 metres He ran to his personal best time of 20.12 seconds in June 2004 in Austin, Texas. This is the current Zimbabwean record. Education He is an Old Georgian, and attended St George's College, Harare in Harare, Zimbabwe. He attended college at both Truman State University in Kirksville, MO and Florida State University in the United States, where he was a member of both track teams. He was also a member of the African Students Association at Truman. Shortly after completing his undergraduate degree at FSU, Brian earned a master's degree in Business Administration (MBA) from Florida State University. Career He finished sixth at the 2006 African Championships and won a bronze medal in 4 × 100 m relay at the 2007 All-Africa Games. He also competed at the 2003 World Championships, the 2004 Olympic Games and the 2005 World Championships. Dzingai represented Zimbabwe at the 2008 Summer Olympics in Beijing where he was selected as the flag-bearer for the Zimbabwean contingent. He competed in the 200 metres and placed first in his first round heat, just in front of Christian Malcolm with a time of 20.25 seconds. He improved his time in the second round to 20.23 seconds and won his race again, this time in front of American sprinter, Walter Dix. He ran his semi final race in 20.17 seconds and placed second after Churandy Martina, but again before Dix. With his appearance in the Olympic 200 meter final, Dzingai became the most accomplished sprinter in Zimbabwean history. In that race, Usain Bolt shattered the world record, and Dzingai ran a time of 20.22, which placed him unofficially in sixth place. However, due to the disqualifications of Martina (second) and Wallace Spearmon (third) he moved up to the fourth place overall, behind Dix and missing out on the bronze medal by 0.24 seconds. Dzingai has been a track and field coach at Illinois Institute of Technology since 2018. Achievements 4th in 200m Final at the Beijing Olympics. 5th Round 2, Heat 2 in the 200m at the 2004 Olympic Games. 6th in 200m at the 2006 African Championships. 6th in 200m at IAAF Final 2008. 5th IAAF World Athletics Final 2007. 11th in 2007 IAAF World Championships in Athletics. 9 (semi-final) 2003 World Championships in Athletics. 3rd in 4x100 relay at the 2007 All-Africa Games. Personal bests 100 metres: 10.19 200 metres: 20.12 Philanthropy He is an ambassador for Ndoro Children’s Charity. He is currently working on setting up his own Zimbabwean based charity, the Kushinga Foundation. References External links Official website 1981 births Living people Zimbabwean male sprinters Athletes (track and field) at the 2002 Commonwealth Games Commonwealth Games competitors for Zimbabwe Athletes (track and field) at the 2004 Summer Olympics Athletes (track and field) at the 2008 Summer Olympics Olympic athletes for Zimbabwe Sportspeople from Harare Alumni of St. George's College, Harare Florida State Seminoles men's track and field athletes Truman State University alumni African Games bronze medalists for Zimbabwe African Games medalists in athletics (track and field) Athletes (track and field) at the 2007 All-Africa Games
Hot Coko is the debut solo studio album by American R&B singer Coko. It was released by RCA Records on August 10, 1999. Hot Coko served as the singer's debut effort following the release of her band SWV's third album Release Some Tension (1997), which led towards the group's first disbandment in 1998. Guest appearances on the album are made by rapper Eve and singer Tyrese. Hot Coko features production from the likes of Damon Thomas, Rodney Jerkins, Marc Anthony, Missy Elliott, Timbaland and Brian Alexander Morgan, whom Coko worked with while a member of SWV earlier in the decade. The album debuted at number 68 on the US Billboard 200 and entered the top 20 of the US Top R&B/Hip-Hop Albums. It received generally mixed to positive reviews from music critics upon its release. Hot Coko spawned two singles that found minimal Billboard chart success, with its lead single "Sunshine", reaching the lower ranks of the US Billboard Hot 100 chart, where it reached the top seventy, becoming her sole appearance on that chart to date. Shortly after the album's underperformance on the Billboard charts, Coko departed RCA in late 1999. Background and recording Coko first rose to prominence in the 1990s as a member of the trio SWV. Following the group's disbandment in 1998, she pursued a solo music career. In a 1999 Billboard interview, Coko said that she had been unable to record solo music due to her SWV obligations. Her debut studio album was recorded in various studios in California and New York. Coko took more creative control of her music by co-writing songs and picking producers. She co-wrote music with Rodney Jerkins who also produced songs for the album. Although she described hip hop music as "cool", Coko identified herself as a R&B artist. She referred to the album as representing her "gospel roots" and likened her sound to Alvin and the Chipmunks with a "Coko twist". RCA executive Brett Wright believed that Coko would remain "true to her R&B roots" and cited the "urban crossover market" as her primary demographic. Composition and lyrics Billboard's Steven J. Horowitz wrote that "Sunshine" was an "ebullient ode to a loved one". Coko dedicated the song to her then three-year-old son Lil Tracy. Produced by Jerkins, the instrumentation consists of "interlocking jerky drum loops and squelching basslines" and a "stuttering production". Noisey's David Lehmann wrote it was similar to Jenkins' other late 1990s songs. Recording the song with "multi-layered vocals", Coko sings the lyrics: "Sunshine, sunshine / You brighten up my days / I love you always". Vibe's Larry Flick likened the lyrics to a nursery rhyme, and described "Bigger Than We" and "Try-Na Come Home" as soul ballads. Flick compared Coko's vocals for "Bigger Than We" to Gladys Knight, specifically due to the song's "layer rhythm-harmony arrangement". "Triflin'", featuring a rap verse from Eve, is an R&B song with hip hop influences and lyrics about a woman teasing her boyfriend. The hook includes: "Ghetto / Sorry / Oh no / Tired game / And that's such a shame / ... pitiful." Entertainment Weekly's Matt Diehl cited "Triflin'" and "I Ain't Feelin You" as examples of hip hop soul. Flick wrote that "I Ain't Feelin You" was a "funk anthem" and referred to "Everytime" as "smooth [and] warmly romantic". Coko recorded "If This World Were Mine", originally a 1967 single by Marvin Gaye and Tammi Terrell, as a duet with Tyrese. Flick described the cover as a slow jam. The standard edition of the album ends with "So Hard to Say Goodbye" which features backing vocals from Babyface and Kevon Edmonds. Reception Hot Coko was released to a generally mixed to positive reception. AllMusic editor Stephen Thomas Erlewine wrote that "[Coko] isn't the most charismatic singer, but she is blessed with a strong voice that sounds very inviting when placed in the right settings." He awarded the album three out of five stars. Matt Diehl from Entertainment Weekly found that Hot Coko "plays like a game of 'Name That Diva': Too often, she obliges Mary J. Blige fans with copycat vocals of their idol while faithfully replicating Faith Evans’ smooth sound. But when Coko’s flamethrower pipes cook the chocolaty-good hip-hop soul rhythms that drive ”Triflin”’ and ”I Ain’t Feeling You,” she’s not just a sister with a voice but with an attitude." Track listing Charts References External links 1999 debut albums Coko albums RCA Records albums Bertelsmann Music Group albums
Avèze is the name of two communes in France: Avèze, Gard, in the Gard department Avèze, Puy-de-Dôme, in the Puy-de-Dôme department See also Avezé
Larceny is a comedy film starring Andy Dick, Joshua Leonard, and Tyra Banks. References External links 2004 films American independent films 2000s English-language films 2000s American films
Bill Haley (? – ?) was an English footballer who played as a half-back. He made 101 appearances in all competitions and scored 54 times for Fulham. English men's footballers Fulham F.C. players English Football League players Men's association football midfielders Place of birth missing
The Middlesex Senior Cup is the most prestigious football cup competition in the historic county of Middlesex, England. The competition is run mainly for non-League clubs in the region, although league clubs have been known to enter the competition, including Brentford, Barnet and Chelsea. In order to be eligible to play in the Middlesex Senior Cup, clubs have to play at step 5 or above of the National League System. Finals See also Middlesex County Football Association Middlesex Senior Charity Cup George Ruffell Memorial Shield Notes References County Cup competitions Football competitions in London Sport in Middlesex
Juan Fernando Ortega (born March 2, 1957) is a singer-songwriter in contemporary Christian music. He is noted both for his interpretations of many traditional hymns and songs, such as "Give Me Jesus", "Be Thou My Vision" and "Praise to the Lord, the Almighty", and for writing clear and easily understood songs such as "This Good Day". Biography Ortega was born and raised in Albuquerque, New Mexico, near the banks of the Rio Grande. He started learning piano at eight years of age. Through his father's work with the United States Department of State, he also spent time in Ecuador and Barbados. His family lived in Chimayó, New Mexico, for eight generations, a legacy cited as an influence on his music. Ortega graduated from Valley High School and the University of New Mexico, where he received his bachelor's degree in music education. He is a member and former worship leader at an Anglican church in Albuquerque. It is from his heritage and classical training at the University of New Mexico that Ortega derives his sound, embracing country, classical, Celtic, Latin American, world, modern folk and rustic hymnody. Discography In a Welcome Field (1991/2000) Meditations of the Heart - piano solos (1993) Hymns and Meditations (1994) Night of Your Return (1996) This Bright Hour (1997) The Breaking of the Dawn (1998) Give Me Jesus – EP (1999) Home (2000) Camino Largo (2001) Storm (2002) Hymns of Worship (2003) Fernando Ortega (2004) Live In St. Paul – DVD (2004) Beginnings (2005) The Shadow of Your Wings: Hymns and Sacred Songs (2006) Christmas Songs (2008) Meditations of the Heart: Encore – piano solos (2011) Come Down O Love Divine (2011) Best Of – Live In St. Paul – CD (2015) The Crucifixion Of Jesus (2017) Other appearances include: Calvary Chapel Music Praise, Vol. 1 ("How I Love You Lord" and "Teach Me Your Ways") Calvary Chapel Worship Alive, Vol. 1 ("I Will Delight" and "Lord, Listen to Your Children Praying") Next Door Savior ("How Deep the Father's Love For Us") The Making of a Godly Man ("Jehová, Señor De Los Cielos" and "Jesus, You Are My Life") (1997) The Odes Project ("Sing Allelu" and "I Stretched Out My Hands") Unknown Albums: "I Will Sing the Wondrous Story" and "O For a Thousand Tongues to Sing" Charts Storm reached No. 197 on the Billboard 200 in 2002. Christmas Songs reached No. 36 on the Billboard Christmas Album Chart in 2009. Awards Dove Awards 1998 Bluegrass Song: "Children of the Living God" 2000 Inspirational Album: Home 2002 Special Event Album of the Year: City on a Hill (various artists) Gallery References External links Official Site 1957 births American gospel singers Christian music songwriters American male singers Living people American Anglican Church in North America members
Stanisław Plater (; 10 May 1784 – 8 May 1851) was a Polish-Lithuanian historian, geographer, officer. Biography Stanisław Plater was born in 1784 in Daugėliškis, Grand Duchy of Lithuania in the Polish–Lithuanian Commonwealth. He came from the noble Plater family. His father was Kazimierz Konstanty Plater, the last Lithuanian Vice-Chancellor, and his mother was Izabela z Borchów, the first editor of a children's magazine in Poland, who published the weekly magazine in Warsaw in 1789–1792. Plater had ten siblings: 4 sisters and 6 brothers. One of his brothers was Ludwik Plater (1775–1846), who was the senator-castellan of the Congress Poland who participated in the Kościuszko Uprising and November Uprising as well as a forestry activist. He was a graduate of the Vilnius Main School. In 1806–1815, he served as an officer in the army of the Duchy of Warsaw in the Russian campaign, rising to the rank of lieutenant. In 1815, he became a captain in the army of Congress Poland, but was soon dismissed. He moved to Greater Poland, where he married Antoniną z Gajewskich (1790-1866). He settled in Wroniawy, which was brought by his wife as a dowry. Later, he also lived for a long time in Poznań and in Paris. He published a number of works on geography, military and history in Polish and French. In 1827, he published a pioneering statistical work, Statistical Atlas of Poland and surrounding countries. Moreover, he was an encyclopedist and author of the two-volume . He was awarded the title of Knight of the Military Order of the Duchy of Warsaw (Virtuti Militari) and the Order of the Red Eagle of the Kingdom of Prussia. In 1851, he died in Wolsztyn and was buried in the parish church. References 1784 births 1851 deaths 18th-century Lithuanian people Lithuanian scientists Polish scientists Historians of Lithuania Historians of Poland
Stephen Fox is a British clarinetist, saxophonist and clarinet maker, based in Richmond Hill, Ontario, Canada. Born in England, Fox completed a master's degree in physics at the University of Saskatchewan before earning a degree in clarinet performance. He began a career in instrument repair in 1985 and started making clarinets in 1990. Fox makes modern soprano, basset, and bass clarinets, and basset horns. In addition he makes tárogatós, and is one of only a handful of makers of reproduction historical clarinets in the world. In 2006 he introduced the world's first Bohlen-Pierce clarinets. Fox clarinets are played by Toronto Symphony Orchestra principal clarinetist Joaquin Valdepenas, Canadian big band leader Don Pierre, klezmer artist Kurt Bjorling of the band Brave Old World, Norwegian clarinetist Terje Lerstad, Binghamton University music professor Timothy Perry, Swiss multi-instrumentalist Peter A. Schmid, and many others in Europe, Japan, the United States, and Canada. Fox also teaches musical instrument making at the Musikk Instrument Akademiet in Norway. As an instrumentalist, Fox performs and records with the chamber music groups Riverdale Ensemble and Ossia. References External links Stephen Fox Clarinets British clarinetists Clarinet makers British male saxophonists University of Saskatchewan alumni Living people 21st-century saxophonists 21st-century clarinetists 21st-century British male musicians Year of birth missing (living people)
Brawlout is a fighting game developed and published by Angry Mob Games for Microsoft Windows, Nintendo Switch, PlayStation 4, and Xbox One. The game was revealed at EVO in July 2016, and went into closed beta in December 2016. The game was initially released as early access for Microsoft Windows on April 20, 2017. Various outlets, such as Engadget, have compared Brawlout to the Super Smash Bros. series. Angry Mob Games partnered with UK publisher Merge Games to release physical retail copies for the Nintendo Switch in May 2018. Gameplay Brawlout is a platform fighter in which two to four players fight against each other, in an environment with various platforms. The game features 25 playable characters, including four guest fighters. Characters use a variety of fighting moves and special attacks. Each attack does damage, increasing the opponent's damage percent. When the damage increases, the victim flies further. The purpose of each battle is to throw one's opponents off the stage. Brawlout does not use blocking, and most characters are incapable of grabbing others. Instead, its gameplay is based on combos. Fighting builds up the player's Rage Meter, which fuels powerful special attacks, and adds an extra layer of strategy, by triggering the Combo Breaker or Rage Mode. Playable Characters Acolyte Apucalypse Apunaut Chief Feathers Condor X Dead Cells Dr. Tysonstein Funkmaster Gancho Puncho Juan Aguacate King Apu Mako Natu’ra Nightma’ra Olaf/Tyson Ooga/Tooga Paco Ripjack Senator Feathers Sephi’ra Sting’ra The Drifter Vandal Volt Yooka-Laylee Guest character Online modes Brawlout was designed for both couch and online play, with 2-4 player quick matches, ranked ladders, private lobbies, and Brawlout TV for watching live matches and featured replays and for making live tournaments easier to stream. Reception Brawlout has sold over 50,000 copies on the Nintendo Switch. The game won the award for "Game, Original Fighting" at the National Academy of Video Game Trade Reviewers Awards. The Nintendo Switch, Xbox One, and PlayStation 4 versions of the game have received "mixed or average reviews" according to review aggregate site Metacritic. References External links 2017 video games Crossover fighting games Early access video games Esports games Indie games Video games with 2.5D graphics Multiplayer and single-player video games Platform fighters Fighting games Nintendo Switch games PlayStation 4 games Xbox One games Video games developed in Romania Windows games Merge Games games Angry Mob Games games
Distance was a late-1980s rock/funk band led by bassist/producer Bernard Edwards, patterned after the Power Station. The band was composed of former Chic and Power Station members Edwards (bass) and Tony Thompson (drums) with future Bad Company member Robert Hart on lead vocals, and noted session musicians Eddie Martinez on guitar and Jeff Bova on keyboards. This "supergroup" released only one album, 1989's Under the One Sky on Reprise Records. The album failed to make the chart and produced no hits. Richard Drummie, one half of Go West, has a co-writing credit on the track "Everytime I Stand Up." Distance appeared as the club band in the 1987 Whoopi Goldberg movie, Burglar. Bernard Edwards was the film's Music Producer, and was credited for the songs that appeared within. Discography Studio albums Under the One Sky (1989) Soundtrack appearances "Bernie's Groove", "New Way of Living", "News at 11" (from Burglar) (1987) Film appearances Appeared as the club band in the Whoopi Goldberg movie, Burglar (1987) References Rock music supergroups American rock music groups Musical groups established in 1987
Ivan Hristov (; born 20 June 1977) is a football goalkeeper from Bulgaria currently playing for Bansko 1951 in the West B PFG. External links Living people 1977 births Bulgarian men's footballers FC Lokomotiv Mezdra players PFC Bansko players Men's association football goalkeepers
Stadium anthems or sports anthems or arena anthems are terms to refer songs that are played over the public address systems at stadiums and arenas during breaks in the action to rally the fans. Unlike college fight songs, most stadium anthems were not written primarily for use at sports events, though compilations such as ESPN Presents Stadium Anthems and the "Jock" series occasionally feature remixed versions of these songs designed to segue together or to accentuate the rhythm or other elements of the songs. Some football events have their own anthems, which are not played during breaks, but rather as entrance music, the most notable being the FIFA Anthem and the UEFA Champions League Anthem. Stadium anthems are characterized by a catchy uptempo rhythm and a repeated vocal call-response catchphrase, often a statement of pride (such as "We Will Rock You", "We Are the Champions" and "Another One Bites the Dust" by Queen). Most stadium anthems are drawn from popular rock and roll, dance or rap hits. At college football games, the schools' marching bands often add stadium anthems to their repertoires. In baseball, many stadium anthems are used as entrance music for various ballplayers. For example, AC/DC's "Hells Bells" was the entrance music for Trevor Hoffman and Metallica's "Enter Sandman" filled the same role for Mariano Rivera. Some stadium anthems are popular in a particular region, or with a specific team because of a reference in the song's lyrics. "You'll Never Walk Alone" is the club anthem of Liverpool F.C. "Just idag är jag stark" by Kenta is the club anthem of Hammarby Fotboll. The Dallas Cowboys made heavy use of "Should've Been a Cowboy" by Toby Keith in the 1990s, while sports teams in Alabama often use "Sweet Home Alabama" by Lynyrd Skynyrd. In a rare example of a team actually being mentioned in a song's lyrics, the University of Alabama marching band often plays "Deacon Blues" by Steely Dan due to the school being referred to as one of "the winners in the world", even though the reference was intended to be sarcastic. Popular sports anthems Association football FIFA Anthem AFC Anthem UEFA Champions League Anthem UEFA Europa League Anthem Major League Soccer Anthem J.League Anthem - "J'S THEME Japan Football Association Anthem - "Japanese Soccer Anthem" Versatile "Rock and Roll Part 2" by Gary Glitter "We Will Rock You" by Queen "We Are the Champions" by Queen "Another One Bites The Dust" by Queen "Thunderstruck" by AC/DC "Gonna Fly Now" by Bill Conti "Get Ready for This" by 2 Unlimited "Remember the Name" by Fort Minor "Na Na Hey Hey Kiss Him Goodbye" by Steam "Song 2" by Blur "Crazy Train" by Ozzy Osbourne "Blitzkrieg Bop" by The Ramones "Mr. Touchdown, U.S.A." by Ruth Roberts "Seven Nation Army" by The White Stripes "Sirius" by The Alan Parsons Project "Kernkraft 400" by Zombie Nation "Eye of the Tiger" by Survivor "Welcome to the Jungle" by Guns 'N' Roses "Don't Stop Believin'" by Journey "Heroes" by David Bowie "Sweet Caroline" by Neil Diamond "Swag Surfin" by Fast Life Yungstaz "Don't Look Back in Anger" by Oasis "Halftime (Stand Up and Get Crunk)" by Ying Yang Twins "Maria (I Like It Loud)" by Scooter See also Entrance music Fight song Football chant Theme music Music at sporting events Jock series References External links HockeyMusic.ca Sports culture Sports terminology Sports anthems
Sacred Heart Church or Sacred Heart Catholic Church or variations may refer to: Australia Sacred Heart Church, Hindmarsh, Adelaide, South Australia Austria Herz-Jesu-Kirche (Church of the Sacred Heart of Jesus), Graz Bosnia and Herzegovina Sacred Heart Church, Doboj Canada Sacred Heart Church of the First Peoples Sacred Heart Church (Peterborough, Ontario) China Sacred Heart Cathedral (Guangzhou) Sacred Heart Church, Zhongding, Yunnan Cuba Sacred Heart of Jesus Catholic Church (Sandino, Cuba) Fiji Sacred Heart Church (Fiji) France Sacré-Cœur, Paris Sacré Cœur (disambiguation) Germany Sacred Heart Church (Berlin) Sacred Heart Church, Lübeck Herz-Jesu-Kirche, Mainz, built in the honour of Ketteler Gibraltar Sacred Heart Church, Gibraltar Hungary Sacred Heart Church (Kőszeg, Hungary) India Sacred Heart Church, Chandannagar, West Bengal Sacred Heart Catholic Church, Mathura, Uttar Pradesh Sacred Heart Church, Mylapra, Kerala Basilica of the Sacred Heart of Jesus, Pondicherry Sacred Heart Church, Santacruz, Karnataka Sacred Heart Forane Church, Thiruvambady, Kerala Sacred Heart Church, Madagondapalli, Tamil Nadu Sacred Heart Church, Kelamangalam, Tamil Nadu Ireland Church of the Sacred Heart, Templemore, County Tipperary, Ireland Italy Sacro Cuore (disambiguation) Malta Sacred Heart Catholic Church in Fontana, Gozo, Malta Montenegro Church of the Holy Heart of Jesus, Podgorica Netherlands Sacred Heart Church, The Bottom, Saba Pakistan Sacred Heart Cathedral, Lahore Sacred Heart Church, Keamari Philippines Sacred Heart Parish Kamuning, Quezon City; see Cubao Cathedral Portugal Estrela Basilica or Royal Basilica and Convent of the Most Sacred Heart of Jesus, Lisbon Romania French Church (Bucharest), or French Church of the Sacred Heart, Bucharest Singapore Church of the Sacred Heart, Singapore Spain Sagrat Cor, Barcelona United Kingdom Sacred Heart Church, Battersea, London, England Sacred Heart Church, Blackpool, Lancashire, England Sacred Heart Church, Bournemouth, Dorset, England Sacred Heart Church, Caterham, Surrey, England Sacred Heart Church, Exeter, Devon, England Sacred Heart Church, Glasgow, Scotland Sacred Heart Church, Hillsborough, Sheffield, England Sacred Heart Church, Kilburn, London, England Sacred Heart Church, Leeds, West Yorkshire Sacred Heart Church, Liverpool, Merseyside Sacred Heart Church, Middlesbrough, North Yorkshire Sacred Heart Church, North Gosforth, Newcastle upon Tyne, England Sacred Heart Church, Petworth, West Sussex, England Sacred Heart Church, Teddington, London, England Our Lady of the Sacred Heart Church, Wellingborough Sacred Heart Church, Wimbledon, London, England Church of the Sacred Heart, Edinburgh Church of the Sacred Heart, Hove, East Sussex, England United States Arizona Sacred Heart Church (Phoenix, Arizona) Sacred Heart Catholic Church and Rectory (Prescott, Arizona) Sacred Heart Church (Tombstone, Arizona) California Sacred Heart Catholic Church (Alturas, California) Sacred Heart Church (Los Angeles, California), a Los Angeles Historic-Cultural Monument Sacred Heart Church (Saratoga, California) Colorado Sacred Heart Catholic Church (Alamosa, Colorado) Sacred Heart Church (Denver, Colorado), a Denver Landmark Sacred Heart Church (Pueblo, Colorado) District of Columbia Shrine of the Sacred Heart Florida Sacred Heart Catholic Church (Pensacola, Florida) Sacred Heart Catholic Church (Tampa, Florida) Georgia Basilica of the Sacred Heart of Jesus (Atlanta), Atlanta Sacred Heart Catholic Church (Augusta, Georgia) Hawaii Sacred Heart Catholic Church in Hawi Sacred Heart Church (Honolulu, Hawaii) Illinois Sacred Heart Church (Chicago), Illinois Sacred Heart Church (Lombard, Illinois) Iowa Sacred Heart Catholic Church (Dubuque, Iowa) Sacred Heart Catholic Church (Fort Dodge, Iowa) Kentucky Sacred Heart Church (Bellevue, Kentucky) Maryland Sacred Heart Church (Bowie, Maryland) Massachusetts Sacred Heart Church, Rectory, School and Convent, Cambridge Sacred Heart Parish Complex, Lawrence Sacred Heart Church Historic District, Southbridge Michigan Sacred Heart Church (Detroit) Minnesota Church of the Sacred Heart (Freeport, Minnesota) Sacred Heart Catholic Church (Heron Lake, Minnesota) Mississippi Sacred Heart Roman Catholic Church (Port Gibson, Mississippi) Missouri Sacred Heart Church, School and Rectory, Kansas City Sacred Heart Catholic Church and Parsonage (Rich Fountain, Missouri) Montana Sacred Heart Church (Glendive, Montana) Nebraska Sacred Heart Catholic Church (Omaha, Nebraska) New Jersey Sacred Heart Church (Trenton, New Jersey) Sacred Heart Church (Jersey City) New York Church of the Sacred Heart (Bronx) Church of the Sacred Hearts of Jesus and Mary & St. Stephen (Brooklyn) Church of the Sacred Heart of Jesus (New York City) Church of the Sacred Hearts of Jesus and Mary (Manhattan) Sacred Heart Church (Staten Island) North Carolina Sacred Heart Church (Raleigh, North Carolina) Sacred Heart Catholic Church (Salisbury, North Carolina) Pennsylvania Sacred Heart Church (Sharon, Pennsylvania) Ohio Sacred Heart Church (Columbus, Ohio) Sacred Heart Church (Dayton, Ohio) Oklahoma Sacred Heart Catholic Church and Rectory (Wilburton, Oklahoma) Texas Sacred Heart Catholic Church (Abilene, Texas), a historic place in Taylor County Sacred Heart Catholic Church and School, Palestine Sacred Heart Catholic Church (Galveston), a historic place in Galveston County Virginia Church of the Sacred Heart Parish (Petersburg, Virginia) Church of the Sacred Heart (Richmond, Virginia) Wisconsin Sacred Heart Church (Eau Claire, Wisconsin) Vietnam Church of the Sacred Heart of Jesus, Ho Chi Minh City (Tân Định Church) See also Basilica of the Sacred Heart (disambiguation) Sacred Heart Cathedral (disambiguation) Herz-Jesu-Kirche (disambiguation) Sacré Cœur (disambiguation) Sacro Cuore (disambiguation) Sacred Heart (disambiguation) :Commons:Structured gallery of Sacred Heart churches
The 1875 Cúcuta earthquake (also known as earthquake of the Andes) occurred on 18 May at 11:15 AM. It completely demolished Cúcuta, Villa del Rosario (Colombia), San Antonio del Tachira and Capacho (Venezuela). The earthquake killed many Venezuelans in San Cristóbal, La Mulata, Rubio, Michelena, La Grita, Colón, amongst others, and was felt in both Bogotá and Caracas. That day, the city of Cúcuta and the town of Villa del Rosario, in the Norte de Santander department (Colombia) and the municipalities of San Antonio del Táchira and Capacho, Táchira State (Venezuela) were destroyed totally by this catastrophic earthquake. Villa del Rosario was a historical and calm population. In 1821 had met in the main church (Historic church) to means to construct, the members of the First Congress of the Great Colombia, known as Congress of Cúcuta. Still it is observed the rest of the church that collapse during the great seismic movement, the houses of that time in the zone were of the purest Spanish colonial style. Geology The earthquake occurred in the Mérida Andes and scientists proposed it was associated with rupture on the Aguas Calientes Fault System or faults in the Cucuta graben. The Aguas Calientes Fault System is a northwestern extension of the Boconó Fault. Paleoseismic studies of the Aguas Calientes Fault System at the presumed earthquake epicenter revealed evidence of recent surface rupture. The central part of the Aguas Calientes Fault System was the likely source of the event. Its moment magnitude is estimated at 6.75. Death toll The exact number of victims is not known; Spokane Daily Chronicle reported that the figure was as many as 2,500, while other sources say that the death toll was about 1,000. Early newspaper reports put the number at 8 to 10,000. The Evening Post wrote that 5,000 died outright with a further 9,000 dying from the after effects such as fever and lockjaw. Affected areas The earthquake covered 5 degrees of Latitude and was 500 miles long. Populated areas affected were Villa of the Rosary, San Luis, Salazar, Woods of the Palms, Gramalote, Bochalema and San Faustino in Colombia. San Antonio, Capacho, San Cristóbal, the Mulata, Rubio, Michelena, La Grita, Colón in Venezuela. In addition it was also felt in Bogotá and Caracas. See also History of Colombia List of earthquakes in Colombia List of historical earthquakes References Further reading Cúcuta Earthquakes in Colombia Earthquakes in Venezuela Cucuta Cucuta Cucuta May 1875 events
The Luxapalila Valley Railroad is a 38-mile short line freight railroad that operates between Columbus, Mississippi, and Belk, Alabama. The LXVR interchanges with the Columbus & Greenville, Kansas City Southern and Norfolk Southern. Commodities transported include forest products and waste products. The LXVR was acquired by Genesee & Wyoming in 2008. References External links Luxapalila Valley Railroad official webpage - Genesee and Wyoming website Alabama railroads Mississippi railroads Genesee & Wyoming Spin-offs of the Norfolk Southern Railway
Deep operation (, glubokaya operatsiya), also known as Soviet Deep Battle, was a military theory developed by the Soviet Union for its armed forces during the 1920s and 1930s. It was a tenet that emphasized destroying, suppressing or disorganizing enemy forces not only at the line of contact but also throughout the depth of the battlefield. The term comes from Vladimir Triandafillov, an influential military writer, who worked with others to create a military strategy with its own specialized operational art and tactics. The concept of deep operations was a national strategy, tailored to the economic, cultural and geopolitical position of the Soviet Union. In the aftermath of several failures or defeats in the Russo-Japanese War or the First World War, the Soviet High Command (Stavka) focused on developing new methods for the conduct of war. This new approach considered military strategy and tactics, but also introduced a new intermediate level of military art: operations. The Soviet Union was the first country to officially distinguish the third level of military thinking which occupied the position between strategy and tactics. Using these templates, the Soviets developed the concept of deep battle, and by 1936, it had become part of the Red Army Field Regulations. Deep operations had two phases: the tactical deep battle, followed by the exploitation of tactical success, known as the conduct of deep battle operations. Deep battle envisaged the breaking of the enemy's forward defenses, or tactical zones, through combined arms assaults, which would be followed up by fresh uncommitted mobile operational reserves sent to exploit the strategic depth of an enemy front. The goal of a deep operation was to inflict a decisive strategic defeat on the enemy's logistical abilities and render the defence of their front more difficult, impossible or irrelevant. Unlike most other doctrines, deep battle stressed combined arms cooperation at all levels: strategic, operational, and tactical. History Before deep battle Russian military thinking had changed little over the course of three centuries prior to the 1920s. The Russian Empire had kept pace with its enemies and allies and performed well in its major conflicts in the run-up to the 19th century. However, despite some notable victories in the Napoleonic Wars (1803–1815) and in various Russo-Turkish Wars, Russian defeats in the Crimean War (1853–1856), Russo-Japanese War (1904–1905) and First World War (1914–1918), highlighted the inferiority of Russian methodology in organisation and training. After the Russian Revolution of 1917, the new Bolshevik regime sought to establish an entirely new military system that reflected the Bolshevik revolutionary spirit. The new Red Army (founded in 1918) combined the old and new methods. It still relied on the country's enormous manpower reserves; however, the Soviet program to develop heavy industry, which began in 1929, also raised the technical standards of Soviet arms industries to the level of other European nations. Once that had been achieved, the Soviets turned their attention to solving the problem of military operational mobility. Primary advocates of the development included Alexander Svechin (1878–1938), Mikhail Frunze (1885–1925), and Mikhail Tukhachevsky (1893–1937). They promoted the development of military scientific societies and identified groups of talented officers. Many of these officers entered the Soviet Military Academy during Tukhachevsky's tenure as its commandant in 1921–1922. Others came later, particularly Nikolai Varfolomeev (1890–1939) and Vladimir Triandafillov (1894–1931), who made significant contributions to the use of technology in deep offensive operations. Roots of deep battle In the aftermath of the wars with Japan as well as experiences gained during the Russian Civil War several senior Soviet Commanders called for a unified military doctrine. The most prominent was Mikhail Frunze. The call prompted opposition by Leon Trotsky. Frunze's position eventually found favour with the officer elements that had experienced the poor command and control of Soviet forces in the conflict with Poland during the Polish–Soviet War. That turn of events prompted Trotsky's replacement by Frunze in January 1925. The nature of this new doctrine was to be political. The Soviets were to fuse the military with the Bolshevik ideal, which would define the nature of war for the Soviet Union. The Soviets believed their most likely enemy would be the capitalist states of the west they had to defend themselves against before and that such a conflict was unavoidable. The nature of the war raised four major questions: Would the next war be won in one decisive campaign or would it be a long struggle of attrition? Should the Red Army be primarily offensive or defensive? Would the nature of battle be fluid or static? Would mechanized or infantry forces be more important? The discussion evolved into debate between those, like Alexander Svechin, who advocated a strategy of attrition, and others, like Tukhachevsky, who thought that a strategy of decisive destruction of the enemy forces was needed. The latter opinion was motivated in part by the condition of the Soviet Union's economy: the country was still not industrialized and thus was economically too weak to fight a long war of attrition. By 1928 Tukhachevsky's ideas had changed: he considered that given the nature and lessons of World War I, the next major war would almost certainly be one of attrition. He determined, however, that the vast size of the Soviet Union ensured that some mobility was still possible. Svechin accepted that and allowed for the first offensives to be fast and fluid; but ultimately he decided that it would come down to a war of position and attrition. That would require a strong economy and a loyal and politically-motivated population to outlast the enemy. The doctrine pursued by the Soviets was offensively oriented. Tukhachevsky's neglect of defense pushed the Red Army toward the decisive battle and cult of the offensive mentality, which along with other events, caused enormous problems in 1941. Unlike Tukhachevsky, Svechin determined the next war could be won only by attrition, not by a single or several decisive battles. Svechin also argued that a theory of alternating defensive and offensive action was needed. Within that framework, Svechin also recognised the theoretical distinction of operational art that lay between tactics and strategy. In his opinion the role of the operation was to group and direct tactical battles toward a series of simultaneous operational objectives along a wide frontage, either directly or indirectly, in order to achieve the stavka's ultimate strategic target(s). This became the blueprint for Soviet deep battle. In 1929, Vladimir Triandafillov and Tukhachevsky formed a partnership to create a coherent system of principles from the concept formed by Svechin. Tukhachevsky was to elaborate the principles of the tactical and operational phases of deep battle. In response to his efforts and in acceptance of the methodology, the Red Army produced the Provisional Instructions for Organizing the Deep Battle manual in 1933. This was the first time that "deep battle" was mentioned in official Red Army literature. Principles Doctrine Deep battle encompassed manoeuvre by multiple Soviet Army front-size formations simultaneously. It was not meant to deliver a victory in a single operation; instead, multiple operations, which might be conducted in parallel or successively, would induce a catastrophic failure in the enemy's defensive system. Each operation served to divert enemy attention and keep the defender guessing about where the main effort and the main objective lay. In doing so, it prevented the enemy from dispatching powerful mobile reserves to the area. The army could then overrun vast regions before the defender could recover. The diversion operations also frustrated an opponent trying to conduct an elastic defence. The supporting operations had significant strategic objectives themselves and supporting units were to continue their offensive actions until they were unable to progress any further. However, they were still subordinated to the main/decisive strategic objective determined by the Stavka. Each of the operations along the front would have secondary strategic goals, and one of those operations would usually be aimed towards the primary objective. The strategic objective, or mission, was to secure the primary strategic target. The primary target usually consisted of a geographical objective and the destruction of a proportion of the enemy armed forces. Usually the strategic missions of each operation were carried out by a Soviet front. The front itself usually had several shock armies attached to it, which were to converge on the target and encircle or assault it. The means of securing it was the job of the division and its tactical components, which Soviet deep battle termed the tactical mission. Terminology, force allocation and mission The concept of deep battle was not just offensive. The theory took into account all forms of warfare and decided both the offensive and defensive should be studied and incorporated into deep battle. The defensive phase of deep battle involved identifying crucial strategic targets and securing them against attack from all directions. As with the offensive methods of deep battle, the target area would be identified and dissected into operational and tactical zones. In defence, the tactical zones, forward of the objective would be fortified with artillery and infantry forces. The outer and forwardmost defences would be heavily mined, making a very strong static defence position. The tactical zones would have several defence lines, one after the other, usually 12 kilometres from the main objective. In the zone 1–3 km from the main objective, shock forces, which contained the bulk of the Soviet combat formations, would be positioned. The goal of the defence in depth concept was to blunt the elite enemy forces, which would be first to breach the Soviet lines, several times, causing them to exhaust themselves. Once the enemy had become bogged down in Soviet defences, the operational reserves came into play. Being positioned behind the tactical zones, the fresh mobile forces consisting of mechanized infantry, foot infantry, armored forces, and powerful tactical air support would engage the worn down enemy in a counter-offensive and either destroy it by attacking its flank or drive it out of the Soviet tactical zone and into enemyheld territory as far as possible. Tukhachevsky's legacy There are three standard doctrines about the military that help understand Deep Battle, as adopted by the US Army and the US Marine Corps: 1. Tactic The lowest level is tactical, an aspect of individual skill and organization size. 2. Strategy The highest level, an aspect of theater operation and the leadership of organization and of a government. 3. Operational Operational is the bridge between tactics and strategy. According to Colonel McPadden (US Army), the most precious legacy of Tukhachevsky is his concepts about all operations theory including the "operational art". Tukhachevsky is the first who used 'operational' as a systematic concept. According to McPadden, the main skill of a military commander is dependent on Tukhachevsky's Theory, which is the ability to integrate tactics and strategy. This involves the capability of a commander on "the use of military forces to achieve strategic goals through the design, organization, integration and conduct of theater strategies, campaigns, major operations and battles." Isserson; the factor of depth Georgii Samoilovich Isserson (1898–1976) was a prolific writer on military tactics and operations. Among his most important works on operational art were The Evolution of Operational Art (1932 and 1937) and Fundamentals of the Deep Operation (1933). The latter work remains classified to this day. Isserson concentrated on depth and the role it played in operations and strategy. According to his view, strategy had moved on from Napoleonic times and the strategy of a single point (the decisive battle) and the Moltke era of linear strategy. The continuous front that developed in the First World War would not allow the flanking moves of the pre-1914 period. Isserson argued that the front had become devoid of open flanks and military art faced a challenge to develop new methods to break through a deeply echeloned defence. To this end he wrote that "we are at the dawn of a new epoch in military art, and must move from a linear strategy to a deep strategy." Isserson calculated that the Red Army's attack echelon must be 100 to 120 km deep. He estimated that enemy tactical defences, in about two lines, would be shallow in the first and stretch back 56 km. The second line would be formed behind and have 12–15 km of depth. Beyond that lay the operational depth, which would be larger and more densely-occupied than the first by embracing the railheads and supply stations to a depth of 50–60 km. There, the main enemy forces were concentrated. The third zone, beyond the operational depth was known as the strategic depth and served as the vital link between the country's manpower reservoirs and industrial power-supply sites and the area of military operations. In this zone lay the headquarters of the strategic forces, which included the army group level. Isserson much like Varfolomeev divided his shock armies, one for the task of breaking the enemy forward (or frontline defences) and the other to exploit the breakthrough and occupy the operational zone, while destroying enemy reserve concentrations as they attempted to counter the assault. The exploitation phase would be carried out by combined arms teams of mechanized airborne infantry and motorised forces. The breadth of the attack zone was an important factor in Soviet calculations. Isserson asserted an attack over a frontage of 70–80 km would be best. Three or four rifle corps would make a breakthrough along a front of 30 km. The breakthrough zone (only under favourable conditions) might be expanded to 48–50 km with another rifle corps. Under these conditions, a rifle corps would attack along a 10–12 km front, with each division in the corps' first echelon allocated a 6 kilometre frontage. A fifth supporting rifle corps would make diversionary attacks along the flanks of the main thrust to tie down counterresponses, confuse the enemy as to the area of the main thrust and delay its reserves from arriving. Tactical deep battle Once the strategic objectives had been determined and operational preparation completed the Red Army would be tasked with assaulting the tactical zones of the enemy front in order to break through into its rear, allowing operationally mobile forces to invade the undefended enemy-held area to the rear. The Soviet rifle corps was essential to the tactical method. As the largest tactical unit it formed the central component of the tactical deep battle. The rifle corps usually formed part of a larger operational effort and would be reinforced with tanks, artillery and other weapons. Several corps would take part in the attack, some with defensive missions and others with offensive assignments. They were known as holding and shock groups, respectively. The order of battle was to encompass three echelons. The first echelon, acting as the first layer of forces, would come into immediate contact with opposing forces to break the tactical zones. The follow on echelons would support the breakthrough and the reserve would exploit it operationally. The holding group would be positioned on either flank of the combat zone to tie down enemy reinforcements via means of diversion attacks or blocking defence. Nevertheless, despite the diversion being a primary mission, the limited forces conducting holding actions would be assigned geographical objectives. Once the main thrust had defeated the enemy's main defence, the tactical holding forces were to merge with the main body of forces conducting the operations. In defence, the same principles would apply. The holding group would be positioned forward of the main defensive lines. The job of the holding echelons in that event was to weaken or halt the main enemy forces. If that was achieved, the enemy would be weakened sufficiently to be caught and impaled on the main defence lines. If that failed, and the enemy succeeded in sweeping aside the holding forces and breaching several of the main defence lines, mobile operational reserves, including tanks and assault aviation, would be committed. These forces would be allocated to holding and shock groups alike and were often positioned behind the main defences to engage the battle worn enemy thrust. The forces used to carry out the tactical assignments varied from 1933 to 1943. The number of shock armies, rifle corps, and divisions (mechanized and infantry) given to a strategic front constantly changed. By 1943, the year that the Red Army began to practice deep battle properly, the order of battle for each tactical unit under the command of a front were: Rifle army 3 rifle corps 7–12 rifle divisions 4 artillery regiments One field artillery regiment One anti-tank gun regiment anti-aircraft artillery regiment One mortar regiment One signal regiment One communication battalion One telegraph company One aviation communication troop Stavka operational forces 1–2 artillery divisions 3 artillery regiments 3 tank destroyer regiments 3–4 tank or self-propelled gun brigades 10 separate tank or self-propelled gun regiments 2 anti-aircraft divisions 1–2 mechanized corps These forces numbered some 80,000–130,000 men, 1,500–2,000 guns and mortars, 48-497 rocket launchers, and 30-226 self-propelled guns. Rifle corps 3 Rifle divisions One artillery regiment One signals battalion One sapper battalion Rifle division 3 Rifle regiments One artillery regiment One anti-tank battalion One sapper battalion One signal company One reconnaissance company The division numbered some 9,380 men (10,670 in a guards rifle division), 44 field guns, 160 mortars and 48 anti-tank guns. Deep operation Soviet analysts recognised that it was not enough to break through the enemy tactical zone. Although that was the crucial first step, tactical deep battle offered no solution about how a force could sustain an advance beyond it and into the operational and strategic depths of an enemy front. The success of tactical action counted for little in an operational defensive zone that extended dozens of kilometres and in which the enemy held large reserves. Such enemy concentrations could prevent the exploitation of a tactical breakthrough and threaten the operational advance. That was demonstrated during the First World War, when initial breakthroughs were rendered useless by the exhaustion during the tactical effort, limited mobility, and a slow-paced advance and enemy reinforcements. The attacker was further unable to influence the fighting beyond the immediate battlefield because of the limited range, speed and reliability in the existing weapons. The attacker was often unable to exploit tactical success in even the most favourable circumstances, as his infantry could not push into the breach rapidly enough. Enemy reinforcements could then seal off the break in their lines. By the early 1930s, however, new weapons had come into circulation. Improvements in the speed and range of offensive weaponry matched those of its defensive counterparts. New tanks, aircraft and motorised vehicles were entering service in large numbers to form divisions and corps of air fleets, motorised and mechanized divisions. Those trends prompted the Red Army strategists to attempt to solve the problem of maintaining operational tempo with new technology. The concept was termed "deep operations" (glubokaya operatsiya), which emerged in 1936 and was placed within the context of deep battle in the 1936 Field Regulations. The deep operation was geared toward operations at the Army and or Front level and was larger, in terms of the forces engaged, than deep battle's tactical component, which used units not larger than corps size. The forces used in the operational phase were much larger. The Red Army proposed to use the efforts of air forces, airborne forces and ground forces to launch a "simultaneous blow throughout the entire depth of the enemy's operational defense" to delay its strongest forces positioned in the area of operations by defeating them in detail; to surround and destroy those units at the front (the tactical zone, by occupying the operational depth to its rear); and to continue the offensive into the defender's operational and strategic depth. The central composition of the deep operation was the shock army, which acted either in co-operation with others or independently as part of a strategic front operation. Several shock armies would be subordinated to a strategic front. Triandafilov created this layout of force allocation for deep operations in his Character of Operations of Modern Armies, which retained its utility throughout the 1930s. Triandafilov assigned the shock army some 12–18 rifle divisions, in four to five corps. These units were supplemented with 16–20 artillery regiments and 8–12 tank battalions. By the time of his death in 1931, Triandafilov had submitted various strength proposals which included the assignment of aviation units to the front unit. This consisted of two or three aviation brigades of bomber aircraft and six to eight squadrons of fighter aircraft. Triandafilov's successor, Nikolai Efimovich Varfolomeev, was less concerned with developing the quantitative indices of deep battle but rather with the mechanics of the shock army's mission. Varfolomeev termed this as "launching an uninterrupted, deep and shattering blow" along the main axis of advance. Varfolomeev believed the shock army needed both firepower and mobility to destroy both enemy tactical defences, operational reserves and seize geographical targets or positions in harmony with other operationally independent, but strategically collaborative, offensives. Varfolomeev and composition of deep operations Varfolomeev noted that deep and echeloned tactical and operational defences should call for equal or similar counter responses from the attacker. That allowed the attacker to deliver a deep blow at the concentrating point. The new technological advances would allow the echelon forces to advance the penetration of the enemy tactical zones quickly, denying the enemy defender the time to establish a new defensive line and bring up reinforcements to seal the breach. Varfolomeev sought to organise the shock armies into two echelon formations. The first was to be the tactical breakthrough echelon, composed of several rifle corps. These would be backed up by a series of second line divisions from the reserves to sustain the tempo of advance and to maintain momentum pressure upon the enemy. These forces would strike 15–20 km into enemy tactical defences to engage his forward and reserve tactical forces. Once they had been defeated, the Red Army Front was ready to release its fresh, and uncommitted operational forces to pass through the conquered tactical zone and exploit the enemy operational zones. The first echelon used raw firepower and mass to break the layered enemy defences, but the second echelon operational reserves combined firepower and mobility, which was lacking in the former. Operational units were heavily formed from mechanized, motorised and Cavalry forces. The forces would now seek to envelope the enemy tactical forces as yet-unengaged along the flanks of the breakthrough point. Other units would press on to occupy the operational zones and meet the enemy operational reserves as they moved through his rear to establish a new defence's line. While in the operational rear of the enemy, communications, and supply depots were prime targets for the Soviet forces. With his tactical zones isolated from reinforcements, reinforcements blocked from relieving them, the front would be indefensible. Such a method would instigate operational paralysis for the defender. In official literature Varfolomeev stated that the forces pursuing the enemy operational depth must advance between 20–25 km a day. Forces operating against the flanks of enemy tactical forces must advance as much as 40–45 km a day to prevent the enemy from escaping. According to a report by the Staff of the Urals Military district in 1936, a shock army would number 12 rifle divisions; a mechanized corps (from its Stavka operational reserve) and an independent mechanized brigade; three Cavalry divisions; a light-bomber brigade, two brigades of assault aviation, two squadrons of fighter and reconnaissance aircraft; six tank battalions; five artillery regiments; plus two heavy artillery battalions; two battalions of Chemical troops. The shock army would number some 300,000 men, 100,000 horses, 1,668 smaller-calibre and 1,550 medium and heavy calibre guns, 722 aircraft and 2,853 tanks. Deep operations engagement Having organized the operational forces and secured a tactical breakthrough into the operational rear of the enemy front, several issues took shape about how the Red Army would engage the main operational enemy forces. Attacking in echelon formation denied the Soviet forces the chance to bring all their units to bear. That might lead to the defeat of a shock army against a superior enemy force. To avoid such a situation, echelon forces were to strike at the flanks of enemy concentrations for the first few days of the assault, while the main mobile forces caught up. The aim of this was to avoid a head-on clash and tie down enemy forces from reaching the tactical zones. The expected scope of the operation could be 150–200 km. If the attack proved successful at pinning the enemy in place and defeating its forces in battle, mechanized forces would break the flank and surround the enemy with infantry to consolidate the success. As the defender withdrew, mechanized cavalry and motorised forces would harass, cut off, and destroy his retreating columns which would also be assaulted by powerful aviation forces. The pursuit would be pushed as far into the enemy depth as possible until exhaustion set in. With the tactical zones defeated, and the enemy operational forces either destroyed or incapable of further defence, the Soviet forces could push into the strategic depth. Logistics The development of Soviet operational logistics, the complex of rear service roles, missions, procedures, and resources intended to sustain military operations by army and front groupings) clearly occupied a prominent place within overall Soviet efforts to formulate or adapt warfighting approaches to new conditions. As Soviet military theorists and planners have long emphasised, logistic theory and practice are shaped by the same historical and technological developments that influence Soviet warfighting approaches at every level. In turn, they play a major role in defining directions and parameters for Soviet methods. Soviet theory recognised the need for logistic theory and practice that were consistent with other components of strategy, operational art, and tactics. Despite the many changes in the political, economic, and military environment and the quickening pace of technological change, logistical doctrine was an important feature of Soviet thinking. Intended outcomes; differences with other methodologies During the 1930s, the resurgence of the German military in the era of the Third Reich saw German innovations in the tactical arena. The methodology used by the Germans in the Second World War was named by others blitzkrieg. There is a common misconception that blitzkrieg, which is not accepted as a coherent military doctrine, was similar to Soviet deep operations. The only similarities of the two doctrines were an emphasis on mobile warfare and offensive posture. Both similarities differentiated the doctrines from French and British doctrine of the time. Blitzkrieg emphasized the importance of a single strike on a Schwerpunkt (focal point) as a means of rapidly defeating an enemy; deep battle emphasized the need for multiple breakthrough points and reserves to exploit the breach quickly. The difference in doctrine can be explained by the strategic circumstances for the Soviet Union and Germany at the time. Germany had a smaller population but a better-trained army, and the Soviet Union had a larger population but a less-trained army. As a result, Blitzkrieg emphasized narrow front attacks in which quality could be decisive, but deep battle emphasized wider front attacks in which quantity could be used effectively. In principle, the Red Army would seek to destroy the enemy's operational reserves and its operational depth and occupy as much of his strategic depth as possible. Within the Soviet concept of deep operations was the principle of strangulation if the situation demanded it, instead of physically encircling the enemy and destroying him immediately. Triandafillov stated in 1929: The outcome in modern war will be attained not through the physical destruction of the opponent but rather through a succession of developing manoeuvres that will aim at inducing him to see his ability to comply further with his operational goals. The effect of this mental state leads to operational shock or system paralysis, and ultimately to the disintegration of his operational system. The success of the operational manoeuvre is attained through all-arms combat (combined arms) at the tactical level, and by combining a frontal holding force with a mobile column to penetrate the opponent's depth at the operational level. The element of depth is a dominant factor in the conduct of deep operations both in the offensive and defensive. The theory moved away from the Clausewitzian principle of battlefield destruction and the annihilation of enemy field forces, which obsessed the Germans. Instead deep operations stressed the ability to create conditions whereby the enemy loses the will to mount an operational defence. An example of the theory in practice is Operation Uranus in 1942. The Red Army in Stalingrad was allocated enough forces to hold the German Sixth Army in the city, which caused attrition that would force it to weaken its flanks to secure its centre. Meanwhile, reserves were built up, which then struck at the weak flanks. The Soviets broke through the German flanks, exploited the operational depth, and closed the pocket at Kalach-na-Donu. The operation left the German tactical zones largely intact, but by occupying the German operational depth and preventing their retreat the German Army forces were isolated. Instead of reducing the pocket immediately, the Soviets tightened their grip on the enemy forces and preferred to let the enemy weaken and surrender, starve him completely, or a combination of those methods before they delivered a final destructive assault. In that way, the Soviet tactical and operational method opted to besiege the enemy into submission, rather than destroy it physically and immediately. In that sense, the Soviet deep battle, in the words of one historian, "was radically different to the nebulous 'blitzkrieg'" method but produced similar, if more strategically-impressive, results. Impact of purges Deep operations were first formally expressed as a concept in the Red Army's "Field Regulations" of 1929 and more fully developed in the 1935 Instructions on Deep Battle. The concept was finally codified by the army in 1936 in the Provisional Field Regulations of 1936. By 1937, the Soviet Union had the largest mechanized army in the world and a sophisticated operational system to operate it. However, the death of Triandafillov in an airplane crash and the Great Purge of 1937 to 1939 removed many of the leading officers of the Red Army, including Svechin, Varfolomeev and Tukhachevsky. The purge of the Soviet military liquidated the generation of officers that had given the Red Army the deep battle strategy, operations and tactics and who also had rebuilt the Soviet armed forces. Along with those personalities, their ideas were also dispensed with. Some 35,000 personnel, about 50 percent of the officer corps, three out of five marshals; 13 out of 15 army group commanders; 57 out of 85 corps commanders; 110 out of 195 division commanders; 220 out of 406 brigade commanders were executed, imprisoned or discharged. Stalin thus destroyed the cream of the personnel with operational and tactical competence in the Red Army. Other sources state that 60 out of 67 corps commanders, 221 out of 397 brigade commanders, 79 percent of regimental commanders, 88 percent of regimental chiefs of staff, and 87 percent of all battalion commanders were excised from the army by various means. Soviet sources admitted in 1988: In 1937–1938 ...all commanders of the armed forces, members of the military councils, and chiefs of the political departments of the military districts, the majority of the chiefs of the central administrations of the People's Commissariat of Defense, all corps commanders, almost all division and brigade commanders, about one-third of the regimental commissars, many teachers of higher or middle military and military-political schools were judged and destroyed. The deep operation concept was thrown out of Soviet military strategy, as it was associated with the denounced figures that created it. World War II The abandonment of deep operations had a huge impact on Soviet military capability. Fully engaging in the Second World War (after the Winter War) after the German invasion of the Soviet Union in June 1941, the Soviets struggled to relearn the concept. The surprise German invasion (Operation Barbarossa) subjected the Red Army to six months of disasters. The Red Army was shattered during the first two months. It then faced the task of surviving, reviving and maturing into an instrument that could compete with the Wehrmacht and achieve victory. Soviet military analysts and historians divide the war into three periods. The Red Army was primarily on the strategic defensive during the first period of war (22 June 1941 – 19 November 1942). By late 1942, the Soviets had recovered sufficiently to put their concept into practice. The second period of war (19 November 1942 – 31 December 1943), which commenced with the Soviet strategic counteroffensive at Stalingrad, was a transitional period marked by alternating attempts by both sides to secure strategic advantage. After that, deep battle was used to devastating effect, allowing the Red Army to destroy hundreds of Axis divisions. After the Battle of Kursk, the Soviets had firmly secured the strategic initiative and advanced beyond the Dnepr River. The Red Army maintained the strategic initiative during the third and final period of war (1944–1945) and ultimately played the central role in the Allied victory in Europe. Moscow counteroffensive Deep battle plan Operation Barbarossa had inflicted a series of severe defeats on the Red Army. The German Army Group North was besieging Leningrad, the Army Group South was occupying most of Ukraine and threatening Rostov-on-Don, the key to the Caucasus, and Army Group Centre had launched Operation Typhoon and was closing in on Moscow. The Stavka halted the Northern and Southern Army Groups but was confronted with the German forces approaching the Soviet capital. The Soviet strategy was the defence of the capital and if possible, the defeat and destruction of Army Group Centre. By late November the German pincers either side of the capital had stalled. The Stavka decided to launch a counter offensive. The operational goals were to strike into the enemy operational rear and envelop or destroy the German armies spearheading the attack on Moscow. It was hoped a thrust deeper into the German rear would induce a collapse of Army Group Centre. Outcome Soviet rifle forces penetrated German tactical defenses and pushed into the operational depths on foot at slow speed. They were, however, deficient in staying power. Soon, growing infantry casualties brought every advance to an abrupt end. Soviet cavalry corps reinforced by rifle and tank brigades also penetrated into the German operational rear. Once there and reinforced by airborne or air-landed forces, they ruled the countryside, forests, and swamps but were unable to drive the more mobile Germans from the main communications arteries and villages. At best, they could force limited German withdrawals but only if in concert with pressure from forces along the front. At worst, these mobile forces were themselves encircled, only to be destroyed or driven from the German rear area when summer arrived. No encirclements ensued, and German forces halted the Soviet advance at the Mius River defenses. South of Moscow, the Red Army penetrated into the rear of the Second Panzer Army and advanced 100 kilometers deep into the Kaluga region. During the second phase of the Moscow counter offensive in January 1942, the 11th, 2nd Guards, and 1st Guards Cavalry Corps penetrated deep into the German rear area in an attempt to encircle German Army Group Center. Despite the commitment into combat of the entire 4th Airborne Corps, the cavalry corps failed to link up and became encircled in the German rear area. The ambitious Soviet operation failed to achieve its ultimate strategic aim, due largely to the fragile nature of Soviet operational mobile forces. Rzhev–Vyazma offensive Deep battle plan The Stavka judged that these operations had failed because of the Red Army's lack of large, coherent, mechanized, and armored formations capable of performing sustained operational maneuver. To remedy the problem, in April 1942 the Soviets fielded new tank corps consisting of three tank brigades and one motorized rifle brigade, totaling 168 tanks each. The Stavka placed these corps at the disposal of army and front commanders for use as mobile groups operating in tandem with older cavalry corps, which by now had also received a new complement of armour. The Stavka employed these new tank corps in an offensive role for the first time in early 1942. During this time, the Germans launched Operation Kremlin, a deception campaign to mislead the Stavka into believing that the main German attack in the summer would be aimed at Moscow. The Stavka were convinced that the offensive would involve Army Group South as a southern pincer against the Central Front protecting Moscow. To preempt the German assault, the Red Army launched two offensive operations, the Rzhev–Vyazma strategic offensive operation against Army Group Centre, and the Kharkov offensive operation (known officially as the Barvenkovo-Lozovaia offensive) against Army Group South. Both were directly linked as a spoiling offensives to break up and exhaust German formations before they could launch Operation Blue. The Kharkov operation was designed to attack the northern flank of German forces around Kharkov, to seize bridgeheads across the Donets River north east of the city. A southern attack would be made from bridgeheads seized by the winter-counter offensive in 1941. The operation was to encircle the Fourth Panzer Army and German Sixth Army as they advanced towards the Dnepr river. The operation led to the Second Battle of Kharkov. The battlefield plan involved the Soviet South Western Front. The South Western Front was to attack out of bridgeheads across the Northern Donets River north and south of Kharkov. The Soviets intended to exploit with a cavalry corps (the 3rd Guards) in the north and two secretly formed and redeployed tank corps (the 21st and 23rd) and a cavalry corps (the 6th) in the south. Ultimately the two mobile groups were to link up west of Kharkov and entrap the German Sixth Army. Once this was achieved, a sustained offensive into the Ukraine would enable the recovery of industrial regions. Outcome In fact, primarily due to Stalin's overriding his subordinates' suggestions, the Stavka fell for the German ruse. Instead of attacking the southern pincer of the suspected Moscow operation, they ran into heavy concentrations of German forces that were to strike southward to the Soviet oilfields in the Caucasus, the actual aim of Operation Blue. Although the offensive surprised the Wehrmacht, the Soviets mishandled their mobile forces. Soviet infantry penetrated German defences to the consternation of the German commanders, but the Soviets procrastinated and failed to commit the two tank corps for six days. The corps finally went into action on 17 May simultaneously with a massive surprise attack by First Panzer Army against the southern flank of the Soviet salient. Over the next two days, the two tank corps disengaged, retraced their path, and engaged the new threat. But it was too late. The German counterattack encircled and destroyed the better part of three Soviet armies, the two tank corps and two cavalry corps, totaling more than 250,000 men. The Kharkov debacle demonstrated to Stalin and Soviet planners that they not only had to create larger armoured units, but they also had to learn to employ them properly. Operation Uranus and Third Kharkov Deep battle plan The Battle of Stalingrad, by October 1942, was allowing the Soviets an ever tighter grip on the course of events. Soviet strategy was simple: elimination of the enemy field army and the collapse of Army Group South. In operational terms, by drawing the German Army into the city of Stalingrad, they denied them the chance to practice their greater experience in mobile warfare. The Red Army was able to force its enemy to fight in a limited area, hampered by the city landscape, unable to use its mobility or firepower as effectively as in the open country. The German Sixth Army was forced to endure severe losses, which forced the OKW to strip its flanks to secure its centre. This left its poorly equipped Axis allies to defend its centre of gravity—its operational depth. When Soviet intelligence had reason to believe the Axis front was at its weakest, it would strike at the flanks and encircle the German Army (Operation Uranus). The mission of the Red Army, then, was to create a formidable barrier between the cut off German army and any relief forces. The aim of the Soviets was to allow the German army to weaken in the winter conditions and inflict attrition on any attempt by the enemy to relieve the pocket. When it was judged the enemy had weakened sufficiently, a strong offensive would finish the enemy field army off. These siege tactics would remove enemy forces to their rear. Having practised the deep battle phase which would destroy the enemy tactical units (the enemy corps and divisions) as well as the operational instrument, in this case the Sixth Army itself, it would be ready to launch the deep operation, striking into the enemy depth on a south-west course to Rostov using Kharkov as a springboard. The occupation of the former would enable the Red Army to trap the majority of Army Group South in the Caucasus. The only escape route left, through the Kerch Peninsula and into Crimea, would be the next target. The operation would enable the Red Army to roll up the Germans' southern front, thereby achieving its strategic aim. The operation would be assisted by diversion operations in the central and northern sector to prevent the enemy from dispatching operational reserves to the threatened area in a timely fashion. Outcome Operation Uranus, the tactical deep battle plan, worked. However, the General Staff's deep operation plan was compromised by Joseph Stalin himself. Stalin's impatience forced Stavka into offensive action before it was ready. Logistically the Soviets were not yet prepared and the diversion operations further north were not yet ready to go into action. Nevertheless, Stalin's orders stood. Forced into premature action, the Red Army was able to concentrate enough forces to create a narrow penetration toward Kharkov. However, it was logistically exhausted and fighting an enemy that was falling back on its rear areas. The lack of diversionary operations allowed the German Army to recognise the danger, concentrate powerful mobile forces, and dispatch sufficient reserves to Kharkov. With the Red Army's flanks exposed, the Germans easily pinched off the salient and destroyed many Soviet formations during the Third Battle of Kharkov. The concept of the deep operation had not yet been fully understood by Stalin. However, Stalin recognised his own error, and from this point onward, stood back from military decision-making for the most part. The defeat meant the deep operation would fail to realise its strategic aim. The Third Battle of Kharkov had demonstrated the importance of diversion, or Maskirovka operations. Such diversions and deception techniques became a hallmark of Soviet offensive operations for the rest of the war. Kursk Deep battle plan {{quote box|quote=For the first time in the war, at Kursk the Soviets eschewed a preemptive offensive and instead prepared an imposing strategic defense, unparalleled in its size and complexity, in order to crush the advancing Germans. Once the German offense stalled, Soviet forces planned to go over to the offensive at Kursk and in other sectors. The script played as the Soviets wrote it. The titanic German effort at Kursk failed at huge cost, and a wave of Soviet counteroffensives rippled along the Eastern Front ultimately driving German forces through Smolensk and Kharkov back to the line of the Dnepr River.|source= Glantz, David M., Col (rtd.) Soviet Military Operational Art: In Pursuit of Deep Battle, p. 122|width=30%|align=right|style=padding:8px;}} The Battle of Kursk combined both the defensive and offensive side of deep battle. The nature of Soviet operations in the summer, 1943 was to gain the initiative and to hold it indefinitely. This meant achieving permanent superiority in the balance of forces, in operational procedure and maintaining initiative on the battlefield. The Soviet plan for the defence of the city Kursk involved all three levels of warfare coherently fused together. Soviet strategy, the top end of military art, was concerned with gaining the strategic initiative which would then allow the Red Army to stage further military operations to liberate Soviet territory lost in 1941 and 1942. To do this, the Stavka decided to achieve the goal through defensive means. The bulge in the front line around Kursk made it an obvious and tempting target to the Wehrmacht. Allowing the Germans to strike first at the target area allowed the Red Army the opportunity to wear down German Army formations against pre-prepared positions, thereby shaping the force in field ratio heavily against the enemy. Once the initiative had been achieved and the enemy had been worn down, strategic reserves would be committed to finish off the remaining enemy force. The success of this strategy would allow the Red Army to pursue its enemy into the economically rich area of Ukraine and recover the industrial areas, such as Kiev, which had been lost in 1941. Moreover, Soviet strategists recognised that Ukraine offered the best route through which to reach Germany's allies, such as Romania, with its oilfields, vital to Axis military operations. The elimination of these allies or a successful advance to their borders would deny Germany military resources, or at least destabilise the Axis bloc in the Balkans. The operational method revolved around outmanoeuvring their opponents. The nature of the bulge meant the Red Army could build strong fortifications in depth along the German axis of advance. Two rifle divisions defended the first belt, and one defended the second. A first belt division would only defend an area of 8–15 kilometres wide and 5–6 kilometres in depth. Successive defence belts would slow German forces down and force them to conduct slow and attritional battles to break through into the operational depths. Slowing the operational tempo of the enemy would also allow the Soviet intelligence analysts to keep track of German formations and their direction of advance, enabling Soviet reserve formations to be accurately positioned to prevent German spearheads breaking through each of the three main defence belts. Intelligence would also help when initiating their own offensives (Operation Kutuzov and Operation Polkovodets Rumyantsev) once the Germans had been bogged down in Soviet defences. The overwhelming contingent of Soviet armour and mechanised divisions was given to the operational reserves for this purpose. The tactical level relied heavily on fortified and static defences composed of infantry and artillery. Anti-tank guns were mounted throughout the entire depth of the defences. Few tanks were committed to the tactical zones and the nature of the defences would have robbed them of mobility. Instead, only a small number of tanks and self-propelled artillery were used to give the defences some mobility. They were distributed in small groups to enable localised counterattacks. Such tactics slowed the Germans, forcing them to expend strength and munitions on combating the Soviet forward zones. The Soviets had counted on the Germans being stopped within the tactical zones. To ensure that this occurred, they distributed large numbers of anti-AFV (armoured fighting vehicle) and anti-personnel mines to the defences. Outcome The Germans began their offensive, as predicted, on 5 July 1943, under the codename Operation Citadel. The Soviets succeeded in limiting them to a slow advance. In the north, the German 9th Army advanced south from Orel. The Germans failed to breach the main defence lines, stalling at the third belt. The German armies had been forced to commit their mobile reserves to the breakthrough. This allowed the Soviets to conduct the operational and offensive phase of their plan; Operation Kutuzov. Striking the 2nd Panzer Army, the Soviet's fresh operational forces, heavily mechanized, threatened to cut off the German 9th Army. Had they succeeded, nothing would have stood between the Red Army and the strategic depth of German Army Group Centre's front. However the Germans were able to stem the advance by committing their mobile reserves and organize a withdrawal. Still, the two German armies had been worn down, and the Soviet forces in the north had won the strategic initiative. In the south, the Soviet plan did not work as effectively and the contingency plan had to be put into effect. The German formations succeeded in penetrating all three Soviet defence belts. This denied the Soviets the opportunity to pin them down in the tactical defence belts and release their operational reserves to engage the enemy on favourable terms. Instead, operational forces for Operation Polkovodets Rumyantsev that were intended for the southern counteroffensive, were ordered to at and near Prokhorovka. This led to the Battle of Prokhorovka. While the tactical deployment and operational plan had not worked as flawlessly as it had in the north, the strategic initiative had still been won. Other campaigns With improved material means and tactical aptitude enabling complicated large-unit maneuvers, the following later campaigns were able to exhibit an improved application of the Deep operation doctrine: Dnieper–Carpathian Offensive Operation Bagration Second Jassy-Kishinev Offensive Vistula–Oder Offensive Cold War Central Europe The Soviet Union and its Warsaw Pact allies used their massive superiority in numbers and the idea of Deep Battle to intimidate NATO over the Inner German border. Some Western observers predicted that the Warsaw Pact could use a mixture of speed and surprise to overrun Western Europe in around 48 hours. While massive air strikes using enormous numbers of aircraft would devastate NATO infrastructure and reinforcements, VDV (airborne units), Spetsnaz ("special purpose troops", i.e. special forces) and naval infantry would clear the way for the torrent of tank and motor-rifle divisions that would soon cross the border. The forward units of these tank and motor rifle divisions would be given the task, rather unusually, of avoiding engagements with the enemy and simply to advancing as far and as fast as possible, therefore enabling a victory before any replacement aircraft and REFORGER units came to Europe from North America. Asia Ever since the 1960s when the Sino-Soviet alliance came to an abrupt end, the Soviet High Command considered invading China by deep battle offensive operations, envisaging a rapid drive deep towards the latter's main industrial centers before they could have a chance to mount a credible defense or even stage a counterattack. However, the extremely vast numbers of the Chinese People's Liberation Army and their knowledge of the terrain, coupled with their then-recent possession of nuclear weapons, made such a drive the Soviets were to execute extremely unlikely. Although both sides nearly went to war in three separate occasions in 1968, 1969 and 1979 respectively, the Soviets were rather hesitant to go to war and invade China, thanks to the fact that both possessed huge armed forces and nuclear weapons at their disposal. 21st century In the spring of 1999 came the crisis in Kosovo and NATO’s Operation Allied Force as a result of R2P doctrine. The Combat operations featured no land warfare, and therefore no frontline can be said to have existed. The air war over Serbia was a "deep battle" as Air Force bombed strategic targets and fielded forces. Army Major General Robert H. Scales came to the conclusion that the US needed "strategic pre-emption", defined as the "use of airpower to delay the enemy long enough for early arriving ground forces to position themselves between the enemy and his initial operational objectives." Major proponents Mikhail Tukhachevsky Vladimir Triandafillov Georgii Isserson Nikolai Efimovich Varfolomeev Georgy Zhukov See also Operational art Tank Corps (Soviet) Mechanized Corps (Soviet) Blitzkrieg References Citations Bibliography Glantz, David M., Col (rtd.) Soviet Military Operational Art: In Pursuit of Deep Battle, Frank Cass, London, 1991a. . Habeck, Mary. Storm of Steel: The Development of Armor Doctrine in Germany and the Soviet Union, 1919–1939. Cornell University Press, 2003. Harrison, Richard W. The Russian Way of War: Operational Art 1904–1940. Lawrence, Kan.: University Press of Kansas, 2001. Krause, Michael and Phillips, Cody. Historical Perspectives of Operational Art. Center of Military History, United States Army. 2006. Naveh, Shimon (1997). In Pursuit of Military Excellence; The Evolution of Operational Theory. London: Francass. . Simpkin, Richard. Deep Battle: The Brainchild of Marshal Tukhachevsky. London; Washington: Brassey's Defence, 1987. . Watt, Robert. Feeling the Full Force of a Four Point Offensive: Re-Interpreting The Red Army's 1944 Belorussian and L'vov-Przemyśl Operations. The Journal of Slavic Military Studies. Routledge Taylor & Francis Group. ISSN 1351-8046 External links Blythe, Wilson C. Jr. “The Conduct of War: Reemergence of Russian Military Strength Warrants Study of Soviet Operational Theory in the Interwar Era”, in The Officer'' (Winter 2015), accessible online at: https://www.academia.edu/31966162/The_Conduct_of_War_Re_emergence_of_Russian_Military_Strength_Warrants_Study_of_Soviet_Operational_Theory_in_the_Interwar_Era The Evolution of Operational Art by Georgii Isseson, 1936 – PDF, available on United States Army Combined Arms Center's website "Georgii Isserson: Architect of Soviet Victory in World War II": , a lecture by Dr. Richard Harrison, via the official channel of the U.S. Army Heritage and Education Center Military doctrines Deep Operations Doctrine Military strategy Military theory
The 69th Regiment Illinois Volunteer Infantry was an infantry regiment that served in the Union Army during the American Civil War. Service The 69th Illinois Infantry was organized at Camp Douglas at Chicago, Illinois and mustered into Federal service on June 16, 1862, for a term of three months. It served as camp guards of Camp Douglas during its time in service. The regiment was mustered out on September 27, 1862. Total strength and casualties The regiment suffered 25 enlisted men who died of disease, for a total of 25 fatalities. Commanders Colonel Joseph H. Tucker - mustered out with the regiment. See also List of Illinois Civil War Units Illinois in the American Civil War Notes References The Civil War Archive Units and formations of the Union Army from Illinois 1862 establishments in Illinois Military units and formations established in 1862 Military units and formations disestablished in 1862
John H. Devlin (May 27, 1891 – July 20, 1967) is a former Democratic member of the Pennsylvania State Senate who served from 1961 until his death in 1967. He also served in the Pennsylvania House of Representatives. Before serving in the Pennsylvania House of Representatives, Devlin served as a special agent of the FBI (1940-1947), was a real estate deputy for the Allegheny County Sheriff (1947-1951), had a legal practice in 1951, and was Assistant D.A. of Allegheny County (1956-1964). References 1967 deaths Politicians from Allegheny County, Pennsylvania Democratic Party Pennsylvania state senators Democratic Party members of the Pennsylvania House of Representatives 1891 births 20th-century American politicians
The 2022–23 Süper Lig, officially called the Spor Toto Süper Lig 2022–23 season, was the 65th season of the Süper Lig, the highest tier football league of Turkey. Galatasaray clinched their 23rd league title, and first since the 2018–19 season, on 30 May 2023 with two games to spare. Teams A total of 19 teams contested the league, including 16 sides from the 2021–22 season and 2021–22 TFF First League champions Ankaragücü, runners-up Ümraniyespor and play-off winners İstanbulspor. Ankaragücü immediately returned to top level, while Ümraniyespor competed in the Süper Lig for the first time in their history. İstanbulspor returned to top level after 17 years. Two teams were relegated to the 2023–24 TFF First League. Stadiums and locations Personnel and sponsorship Managerial changes League table Results Number of teams by region Statistics Top scorers Top assists Clean sheets Hat-tricks 4 Player scored four goals Awards Annual awards References External links Turkey 1 Süper Lig seasons
The mutiny at Sucro occurred in 206 BC, during the Second Punic War. A garrison of soldiers established in Iberia by Scipio Africanus grew dissatisfied with their pay, the division of plunder, the long duration of their military service, and shortages of supplies. Receiving word that Scipio was ill, the soldiers mutinied. Scipio recovered from his illness and negotiated with the men via a group of military tribunes, then quelled the uprising by arresting and executing its ringleaders. Afterward, Scipio reestablished and maintained the loyalty of his troops by ensuring they were properly paid and supplied. Ancient writers including the Greek historian Polybius and the Roman historian Livy stressed the significance of the event, portraying Scipio favorably and praising his decisive actions while downplaying the question of whether the mutineers' complaints were justified. References External links War in Spain (206–205 BC) Book XXVIII Chapter 24: Scipio ill; the Romans in Sucro revolt(206 BC) Scipio Suppresses A Mutiny in Spain Mutiny of Scipio's troops in Spain (206 BC) Battles of the Second Punic War Battles in the Valencian Community 206 BC 200s BC conflicts Mutinies Roman conquest of the Iberian Peninsula
"Hypnotized" is a song written by Bob Welch. The song originally featured on Fleetwood Mac's 1973 album Mystery to Me. The track was released on a single as the B-side of "For Your Love" and has been described as "gorgeous and lyrically strong", and referred to as the album's best track. Background and style The song features triple time rhythm on the drums by Mick Fleetwood and combines with acoustic guitar and electric keyboards. Fleetwood played the drum track straight through without any overdubs. Welch draws upon the use of jazz fourth chords in the song, playing in a minor key, and also features a guitar solo by Bob Weston covering many octaves. Hypnosis and dreaming are specifically referred to in the lyrics, and Welch also draws upon references to places such as Mexico and North Carolina. According to Welch, the atmosphere of the song was heavily influenced by his residence at the Benifold Mansion in Hampshire, England, a place he described as "rather spooky and strange even in summertime". In 1978, the song was covered by the Pointer Sisters on their album Energy. Reception Donald Brackett, in his 2007 book Fleetwood Mac, 40 Years of Creative Chaos, discussed the album Mystery to Me and the song "Hypnotized", which he described as "a gentle yet compelling hit for Welch on this record". In discussing Fleetwood Mac's change in direction in 1972 and 1973, he describes their stylistic changes as being better received at concerts in the United States, as at the time Americans were more open to them than the British, who were still in heavy demand for blues-oriented rock. Hal Horowitz describes the song as "the highlight of the Mystery to Me album, and undoubtedly one of Bob Welch's most fully realised songs for the band". In 1999, Welch received an award from ASCAP recognising 25 consecutive years of airplay for "Hypnotized" and "Sentimental Lady". Personnel Bob Welch – lead vocals, acoustic and electric guitar Bob Weston – electric guitar solo and rhythm, backing vocals Christine McVie – Hohner Pianet N II, keyboards, backing vocals John McVie – bass guitar Mick Fleetwood – drums References External links Hypnotized ranked 643rd in the top 1,000 rock songs, Thompson, Dave. 1000 Songs that Rock Your World. Krause Publications, 2011 All music guide to rock: the definitive guide to rock, pop, and soul, p. 413 My Appetite for Destruction: Sex, and Drugs, and Guns N' Roses Fleetwood Mac songs The Pointer Sisters songs 1973 songs Songs written by Bob Welch (musician) Reprise Records singles
Skares is a village in East Ayrshire, Scotland. Skares is located some southwest of Cumnock. It used to have a football team called Skares Bluebells. Skares consisted of an older core of a village and three miners terraces. They were called, The Old Raw, The New Raw and the Tap Raw. These were built as mining expanded in the area, although today the mining has gone, with the most recent mining activity being an opencast mine behind Skares, which closed in the mid 2010s. From 1872 to 1951 it was served by Skares railway station. External links Villages in East Ayrshire
Brokstedter Au () is a small river of Schleswig-Holstein, Germany. It flows into the Stör near Brokstedt. See also List of rivers of Schleswig-Holstein Rivers of Schleswig-Holstein Rivers of Germany
Bases Loaded, known in Japan as , is a baseball video game by Jaleco that was originally released for the Nintendo Entertainment System. It was first released in 1987 in Japan and in 1988 in North America, and a Game Boy port was released in July of 1990. A mobile phone version exists as well. For the Virtual Console, Bases Loaded was released on September 11, 2007, in Japan and on April 7, 2008, in North America for the Wii, at the cost of 500 Wii Points and on May 15, 2013, in Japan and on July 10, 2014, in North America for Nintendo 3DS. The Wii U version in North America (which later released in Japan on October 22, 2014) was also released at the same time as the Nintendo 3DS version. A port by Mebius and Clarice Games for the PlayStation 4 was released in Japan in 2015. The game is the first installment of the Bases Loaded series, followed by seven sequels across three generations of consoles. There are three more video games in the Bases Loaded NES series, Bases Loaded II: Second Season, Bases Loaded 3 and Bases Loaded 4. There was also a Game Boy version of Bases Loaded. The series continued onto the SNES platform with Super Bases Loaded, Super Bases Loaded 2, and Super Bases Loaded 3. The final entry to the series was Bases Loaded '96: Double Header, released for the Sega Saturn and PlayStation. Bases Loaded is also the first in a series of sports games by Jaleco known in Japan as Moero!!. Baseball games were localized in the Western markets as the Bases Loaded series while the basketball game was localized as Hoops, the tennis game as Racket Attack and the soccer game as Goal!. Two titles went unlocalized: a baseball game Shin Moero!! Pro Yakyū and a judo game Moero!! Juudou Warriors. Gameplay The game allows the player to control one of 12 teams in either a single game or a full season. For single games, there is also a two-player option. Bases Loaded featured a television-style depiction of the pitcher-batter matchup (previously seen in Intellivision World Series Baseball and Accolade's HardBall!), as well as strong play control and a relatively high degree of realism, which made it one of the most popular baseball games of the early NES. One unique feature of the game is that the pitcher can provoke a batter to charge the mound. Each team has only one batter (usually the team's best hitter) who can be provoked in this manner, however; it is up to the player to discover who it is. At the time Bases Loaded was released, few video games were licensed by North American major league sports. Therefore, the league depicted in Bases Loaded is a fictitious league of twelve teams.. Disembodied catcher's mitt One of the trademark images of the Bases Loaded franchise was the disembodied catcher's mitt, also referred to as the "phantom paw", that would catch pitches that were thrown extremely outside. Developer Heep Sop Choi claims it was programmed to show the catcher making some terrific snatches without any bodily movement. Release A defective chip was found during manufacturing, delaying the Nintendo Entertainment System version's North American release. A port for the Atari Jaguar was planned to be developed by Jaleco, after being signed by Atari Corporation to be a third-party developer for the system, but it was never released. Sequels The game saw three sequels on the NES: Bases Loaded II: Second Season (released in 1988 in Japan and 1990 in North America), Bases Loaded 3, released in 1991, and Bases Loaded 4, released in 1993. The game also had two arcade sequels: Moero!! Pro Yakyū Homerun, released in 1988, and Jitsuryoku!! Pro Yakyū, released in 1989. Japanese game magazine Game Machine listed Jitsuryoku!! Pro Yakyū on their September 1, 1989 issue as being the eighth most-successful table arcade unit of the month; the magazine has listed it in English as Bases Loaded. Super Bases Loaded was released for the SNES in 1991, and saw two sequels: Super Bases Loaded 2, released in 1994, and Super Bases Loaded 3, released in 1995. A 32-bit installment was also released: Bases Loaded '96: Double Header, released for the PlayStation and Sega Saturn in 1995. Reception Computer Gaming World compared the game unfavorably to Accolade's HardBall!, both focusing primarily on the confrontation of pitcher and batter. The review described Bases Loaded's viewpoint behind the pitcher as making it far too difficult to discern the position of, and subsequently hit, the ball. Other annoyances during gameplay, such as the inability to see where outfielders were before the ball got to them, were contrasted against the game's good graphics and animation. References External links Bases Loaded at GameFAQs Bases Loaded at Giant Bomb Bases Loaded at MobyGames 1987 video games Baseball video games Bases Loaded video games Cancelled Atari Jaguar games City Connection franchises Game Boy games Jaleco games Mobile games Multiplayer and single-player video games Nintendo Entertainment System games Tose (company) games Video games developed in Japan Virtual Console games Virtual Console games for Wii U Virtual Console games for Nintendo 3DS
Etobicoke North GO Station is a GO Transit train and bus station on the Kitchener line in the Etobicoke district of Toronto, Ontario, Canada. It is located at 1949 Kipling Avenue just north of Belfield Road, close to the junction of Highways 401 and 409. Overview The station has 3 mainline tracks and a single platform serving only the northernmost track. A fourth track passes along the north side of the station, but it is only used for local freight access so it is fenced off from the platform. The platform can accommodate trains up to 12 cars long, and contains heated shelters and upgraded LED lighting. History The station opened in late 1974, less than a year after GO Transit began operating the Georgetown (now Kitchener) line. In 2013, construction began on the Georgetown South railway expansion project. In order to accommodate a widened railway and a significantly increased number of express trains, the original tracks and platforms were demolished and replaced. While the previous arrangement had been a 2-track railway with a side platform on the south side, the new configuration would be a 3-track railway with a side platform on the north side. The north parking lot was expanded to accommodate a new passenger pick-up and drop-off area and a bus loop, and the station building was also upgraded. Until 29 June 2019, GO Transit operated connecting bus service at the station on route 38A, which operated during peak periods between Etobicoke North and Caledon via Humber College, Woodbridge and Bolton. Future , Metrolinx is considering replacing its Etobicoke North GO Station with a new GO station about 2 kilometres west, near Woodbine Racetrack. Demolishing the current Etobicoke North station would free up space for the railway to be widened from 3 mainline tracks to 4. Services The station is served by Kitchener line local train services, but not Kitchener line bus services or express train services. As a result, there is no service on weekends. Because the station only has a single platform, there is also no service during peak periods in the counter-peak direction. Via Rail, UP Express and GO Transit express trains pass through the station without stopping. It is the only station along the Union Pearson Express route where those trains do not stop. The spur line to Pearson International Airport branches away approximately four kilometres west of the station, just past the underpass with Highway 427. Connecting transit The closest bus stops are a short distance south on Kipling Avenue at Belfield Road, served by Toronto Transit Commission routes 45 Kipling & 945 Kipling Express. The station is connected by staircases and ramps from Kipling Avenue, which crosses below the tracks. References External links GO Transit railway stations Railway stations in Toronto Transport in Etobicoke Year of establishment missing Railway stations in Canada opened in 1974
Manisha Ramadass (born 27 January 2005) is an Indian professional para-badminton player. Having made her international debut in 2022, she became world number 1 in the SU5 category on 22 August 2022. She won her first title at the Spanish (level 2) Para-Badminton International in 2022. She currently lives in Thiruvallur, Tamil Nadu. Awards Achievements World Championships Women's singles Women's doubles BWF Para Badminton World Circuit (11 titles, 1 runner-up) The BWF Para Badminton World Circuit – Grade 2, Level 1, 2 and 3 tournaments has been sanctioned by the Badminton World Federation from 2022. Women's singles Women's doubles Mixed doubles References 2005 births Living people Paralympic athletes for India Indian disabled sportspeople Indian female badminton players Indian female para-badminton players
Karzai (; ) is an Afghan surname. Karzai means the person is from Karz and is assembled through the common construction of adding an Arabic letter "Ya" to the proper noun Karz which is a village. Karzai is pronounced Karzay because of the dialect of Kandahar, while others may pronounce it as Karzi. . Notable people with the surname include: Abdul Ahad Karzai, Afghan politician Ahmed Wali Karzai, Afghan politician Azizullah Karzai, Afghan diplomat Habibullah Karzai, tribal leader Hamid Karzai, President of Afghanistan ( 2001–2015 ) Hashmat Karzai, cousin of President Hamid Karzai, businessman in security and construction, killed by a suicide bomber in July 2014. Jamil Karzai, Afghan politician Mahmood Karzai, businessman, elder brother of President Hamid Karzai. Qayum Karzai, politician, elder brother of President Hamid Karzai. Yar Mohammed Karzai, relative of Afghan President Hamid Karzai, accidentally killed in a US raid in Afghanistan 2011. References
Karayusuflu is a neighbourhood in the municipality and district of Şehitkamil, Gaziantep Province, Turkey. Its population is 156 (2022). The village is inhabited by Turkmens of the Qiziq tribe. References Neighbourhoods in Şehitkamil District Turkoman settlements in Gaziantep Province