text stringlengths 3 7.38M | source_data stringclasses 5 values | info stringlengths 83 12.5k |
|---|---|---|
Posts tagged #artist
Being an Artist - It Takes a "Special" Person...
I was talking to my mother on the phone the other day and I was listing off the things I had done all week: Networking to attract sponsors; Landing an interview with the owner of Paul Mitchell; Transcribing interviews and editing photos for American Hair to be submitted to the Library of Congress; Sending out book proposals...blah, blah, blah, blah...Mom said, "You are so disciplined. Not everyone can do what you do." I said, "Well if you needed to eat, you would." She said, "I wouldn't be able to do it. I would have to get a job. It takes a special person to do what you do." I know she was giving me a compliment but I chuckled at that word — "special" and said, "Do you mean crazy? Or maybe irrational?" Most people wouldn't work 70 hours a week without a paycheck unless they were "special."
In my mind I feel like I don't have any other choice. I just wake up everyday and keep working towards my dream. I love my work and I'm grateful that I'm able to do it. But there have been many days when I've considered quitting, and right when I decide to walk away, something happens — a contract for an exhibit, a grant award, a call from ABC. These things never seem to happen when all is going well and I have money in the bank, it's usually after I've meagerly spent the majority of my savings and I'm leaning on the ropes crying "uncle." That's when the phone rings.
I'm not alone. I don't know any artist who doesn't ride this financial and emotional rollercoaster. It's so relentless that I didn't start saving for my retirement until I was 40 years old. I kept waiting for things to calm down, to gain more stability, only to realize that it would never come. That's not to say that I won't make money being an artist, but it comes in spurts and then nothing will happen for months (in some cases I've waited a year between payments). It's just the way it is. Once I started accepting that, life got easier.
Any artists/writers out there who want to share their thoughts? I'd love to hear your stories.
Posted on August 21, 2013 and filed under Producing Projects. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '7', 'language_id_whole_page_fasttext': "{'en': 0.9821275472640992}", 'metadata': "{'Content-Length': '88983', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:YSIRDSLCFDFNNTCS3JSGHI7NHITUWYGQ', 'WARC-Concurrent-To': '<urn:uuid:4c84e340-0906-4c14-9959-9970823f5ad8>', 'WARC-Date': datetime.datetime(2019, 5, 25, 11, 7, 16), 'WARC-IP-Address': '198.49.23.145', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:WXYRHD2TANSL6AQKJ72GXV3YAZWD5YHR', 'WARC-Record-ID': '<urn:uuid:6fcfc6f3-b5de-468f-8a2a-debf384a2d9e>', 'WARC-Target-URI': 'http://www.taylormadeculture.com/taylor-made-blog/tag/artist', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:87d0decd-2335-4669-87a5-4f7124289046>', 'WARC-Truncated': None}", 'previous_word_count': '386', 'url': 'http://www.taylormadeculture.com/taylor-made-blog/tag/artist', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-146-226-231.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.021878838539123535', 'original_id': 'a20e2bd5ade50500026c18b094ac9357a9c83f31e5c5688c4095353adccec2a6'} |
Kundalini Yoga
Kundalini yoga is a powerful technology for promoting health and a sense of well-being by improving the flow of energy through the body. It is a complete science, combining posture, breath, mantra and meditation in a potent and effective system of personal development and self-transformation. When our energy flows freely and easily we feel balanced, grounded and connected to ourselves and the universe. The kundalini yoga and meditation class on Saturday mornings 10:30-12:00 and is suitable for all levels of experience, including beginners. For more information, see www.kundaliniyoga.london | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9037069082260132}", 'metadata': "{'Content-Length': '18243', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:3F6ZL6OLFLKHI5KODJ3WDX2ZCBUSMLAX', 'WARC-Concurrent-To': '<urn:uuid:6f3a1cc9-4fca-476f-a547-50d701f9992e>', 'WARC-Date': datetime.datetime(2017, 10, 23, 7, 55, 25), 'WARC-IP-Address': '95.215.224.43', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:25KQB6H7YAUWXDR3IUN4BLQQ7BTWKOBB', 'WARC-Record-ID': '<urn:uuid:cc1c8bae-4ec3-4e26-ad6a-b302d5046638>', 'WARC-Target-URI': 'http://fitzroviacentre.org/content/kundalini-yoga?page=2', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2e7b4547-c170-45de-81b3-5fb7560389c6>', 'WARC-Truncated': 'length'}", 'previous_word_count': '89', 'url': 'http://fitzroviacentre.org/content/kundalini-yoga?page=2', 'warcinfo': 'robots: classic\r\nhostname: ip-10-137-158-248.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-43\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for October 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03872185945510864', 'original_id': 'eca5ce9c04ab26074e1b69ac3a8153ec1e0b312b93f6ad2e0787be4f3fd95974'} |
Top Banner
UK set to introduce ‘smart sensors’ to build efficiency in the National Health Service
A Scottish property technology startup is set to deploy non-intrusive 'smart sensors' in an effort to help the NHS build efficiency within its system. The new sensing technology developed by Scottish startup Beringar is set to drastically overhaul how the UK's National Health Service manages its physical assets in a much more effective manner.
The tech firm is working closely with the Scotland's Innovation Centre for Sensor and Imaging Systems (CENSIS). Its new cutting-edge revolutionary technology claims that it will significantly help the NHS understand how its moveable assets such as buildings, hospital beds and trolleys are utilized.
It aims to do this, by sending data wirelessly using a long range, low power, wide-area network, otherwise known as LoRaWAN or LoRa. The sensor will ultimately replace the existing ways used to measure and assess the utilization of buildings.
In addition to this, it has been disclosed that the technology can accurately count the number of people in the room, check for occupancy levels and identify trends in the ways that patients and staff use buildings. The sensors can also measure temperature and air quality, and monitor CO2 levels. As the technology undergoes further development, it has been claimed that it would potentially be used to sense which beds are vacant in a hospital in real-time.
It has been reported that the NHS spends an estimated £30bn every year managing its estates and facilities, although consultants have claimed that many of the NHS's building are only used to a fraction of their capacity. A recent trial of Beringar's technology at a Health Centre in Essex confirmed this analysis.
During the one-month trial, more than 160,000 data points were collected, and the smart sensors reportedly detected empty space which staff believed was in regular use. The sensor counted the number of occupants every 10 seconds, and then transferred data back to a specially-designed dashboard, which allowed estate managers to identify how they could boost the building's productivity.
Estates Director for the NHS, Carolyn Botfield said it was critical that the NHS was able to establish where it can improve its services and adapt to the requirements of its patients and local community. She claimed the smart sensors would empower them to be able to make 'smarter decision'.
She said, "It's important for us to identify where the NHS is adding value, and adapt our services to the requirements of the local community - over time, its needs change. Clinics are often block-booked, but we have no way of finding out if just a few people, or twenty patients, are attending every week. The sensor will allow us to achieve real-time feedback on how our buildings are being used, enabling us to make smarter decisions."
The NHS spends around a quarter of its budget every year on the provision and management of its buildings, but many rooms and equipment aren't used to their full potential.
When NHS health planners want to commission a new service, but can't see available space in their existing facilities, they might consider leasing or building a new property," according to Mark Sorsa-Leslie, co-founder of Beringar. He said, "The statistics show that there is a lot of free space in the NHS. Having the right data could reveal suitable space they already own in that location, saving a significant amount of money, which could be used to improve direct patient care." | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9682579636573792}", 'metadata': "{'Content-Length': '56258', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FU5T2U3CEPL6ODGFGVPVNIMGDJECKHXD', 'WARC-Concurrent-To': '<urn:uuid:011dcdc5-4e7b-47a1-ab2c-2b57eb4b5369>', 'WARC-Date': datetime.datetime(2020, 7, 15, 23, 49, 10), 'WARC-IP-Address': '198.54.116.133', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:Z4QVVTKAUURWCPNB6Q5JT532DCPHQSTI', 'WARC-Record-ID': '<urn:uuid:c6881632-3b9b-4a0e-bcee-37d40adcf75d>', 'WARC-Target-URI': 'http://www.smartcitiesworldforums.com/news/smart-cities-europe/5g-iot-eu/647-uk-set-to-introduce-smart-sensors-to-build-efficiency-in-the-national-health-service', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:24941c87-c913-4937-aeb7-d358e8f8044a>', 'WARC-Truncated': None}", 'previous_word_count': '569', 'url': 'http://www.smartcitiesworldforums.com/news/smart-cities-europe/5g-iot-eu/647-uk-set-to-introduce-smart-sensors-to-build-efficiency-in-the-national-health-service', 'warcinfo': 'isPartOf: CC-MAIN-2020-29\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for July 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-211.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.0889783501625061', 'original_id': '351c0dea1ff464abaa1597bbea731c7da5f47a2aa2d4d54701dfbcd5c1678b4e'} |
32 0.627930 0.577096 0.054609 0.048899
32 0.515484 0.937904 0.047438 0.064286
0 0.281000 0.492108 0.186344 0.972974
0 0.787117 0.564977 0.422766 0.870047
34 0.190023 0.811569 0.066453 0.375176
0 0.474953 0.704192 0.309344 0.591616
0 0.630453 0.456171 0.208406 0.341569
35 0.210203 0.566440 0.047625 0.093115
0 0.662859 0.558946 0.396844 0.844169
| the_stack | {'hexsha': '5aeb87b08ae7bb8a3628af941a30c2b68df13993', 'size': '346', 'ext': 'txt', 'lang': 'Text', 'max_stars_repo_path': 'coco/labels/train2017/000000035049.txt', 'max_stars_repo_name': 'phunc20/yolov5-single-class', 'max_stars_repo_head_hexsha': '779cba7157be9fad8d33e6ce291cb4ee88729bb3', 'max_stars_repo_licenses': "['MIT']", 'max_stars_count': '', 'max_stars_repo_stars_event_min_datetime': '', 'max_stars_repo_stars_event_max_datetime': '', 'max_issues_repo_path': 'coco/labels/train2017/000000035049.txt', 'max_issues_repo_name': 'phunc20/yolov5-single-class', 'max_issues_repo_head_hexsha': '779cba7157be9fad8d33e6ce291cb4ee88729bb3', 'max_issues_repo_licenses': "['MIT']", 'max_issues_count': '', 'max_issues_repo_issues_event_min_datetime': '', 'max_issues_repo_issues_event_max_datetime': '', 'max_forks_repo_path': 'coco/labels/train2017/000000035049.txt', 'max_forks_repo_name': 'phunc20/yolov5-single-class', 'max_forks_repo_head_hexsha': '779cba7157be9fad8d33e6ce291cb4ee88729bb3', 'max_forks_repo_licenses': "['MIT']", 'max_forks_count': '', 'max_forks_repo_forks_event_min_datetime': '', 'max_forks_repo_forks_event_max_datetime': '', 'avg_line_length': '34.6', 'max_line_length': '38', 'alphanum_fraction': '0.7658959538', 'original_id': '947559523a4656ffe597ad256f59f827f81c9600658e5b88effc9117357461e9'} |
Hope for the Unseasoned Visitor to Beirut?
With "Navigating the streets of Beirut, one landmark at a time," The Daily Star reporter Niamh Fleming-Farrell tells us about a new process for giving people directions in Beirut (http://www.dailystar.com.lb/Culture/Lifestyle /2011/Oct-29/152506-navigating-the-streets-of-beirut-one-landmark-at-a-time.ashx#ixzz1cMUoGnKb) . We'll see if this navigational tool of design firm PenguinCube catches on. It's a series of seven steps that could even fit on a business card. Some Beirutis have reservations about standardizing landmarks in their city and neighborhoods, since explaining to people where places are in their communities is a matter of identity as much as social conversation. Designer Tammam Yamout says he is trying to honor that, though. Who knows, perhaps there is hope for newcomers like me to be less late for appointments while honoring our hosts' cultural identity! | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9182680249214172}", 'metadata': "{'Content-Length': '46466', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FBULIXJSI4FRAID6T7O3WJC4HRGWFQKP', 'WARC-Concurrent-To': '<urn:uuid:450199dc-a398-44de-a20b-2b131d5f1cd1>', 'WARC-Date': datetime.datetime(2019, 3, 22, 5, 9, 3), 'WARC-IP-Address': '198.49.23.144', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:X3CHK2BMHFOI6TXCR6MUKFJCACLXZL4S', 'WARC-Record-ID': '<urn:uuid:6b7e58dc-955f-4e4e-b72b-aa765066351a>', 'WARC-Target-URI': 'http://www.civilstrategies.net/blog/2011/10/hope-for-unseasoned-visitor-to-beirut.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3c13ac62-aa2c-48a0-879b-c9bb75feb46f>', 'WARC-Truncated': None}", 'previous_word_count': '117', 'url': 'http://www.civilstrategies.net/blog/2011/10/hope-for-unseasoned-visitor-to-beirut.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-101-182-190.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04894411563873291', 'original_id': '64e5a447b33efaec7c250b1beaf26fda370a73cd11cbc90f85a66b82fb05c40e'} |
Friday, March 27, 2020
As government becomes more and more evil...
All political government is unethical. All of it, without a single exception. Sorry, but that's just the way it is.
Democracy is particularly disgusting because it fools otherwise sensible, ethical people into believing government can be good and that there's a "right way" to govern other people. It fools them into believing the lie "the government is the people".
Representative [sic] republicanism is no better, since it always goes through a stage of democracy as it rots from the inside out.
Once you accept the lies that government can be good or can be done right or that "the government is you and me", you've crossed the line to statism. Welcome to government-supremacism.
If you've been supporting government in the decades leading up to the current situation, the evil now being committed by government is partly your fault. If this has snapped you out of it, then that's wonderful! Welcome to the good side. Now be ready to fight for your liberty, since it looks as though the fight may be forced on us. Soon.
Writing to promote liberty is my job.
YOU get to decide if I get paid.
I hope I add something you find valuable enough to support.
1. The smiley mask is nearly off the tyrants and there is far less need for them to even use some of the nice sounding but contradictory euphemisms they've used in the past to herd people.
Already they are openly herding with the stick. The point of the stick is being sharpened. The table is set. Almost dinner time.
1. I wonder if they are moving too fast for their own safety. Or if "the public" will be too slow and stupid to resist. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.96928471326828}", 'metadata': "{'Content-Length': '1049045', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZGCAIFX5FEAM2VQSIE7JQWAY57EY22ZD', 'WARC-Concurrent-To': '<urn:uuid:8f1d3fc7-1feb-4777-9f33-8ba5d7321375>', 'WARC-Date': datetime.datetime(2020, 8, 10, 22, 2), 'WARC-IP-Address': '172.217.15.115', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:OBJOI7ZZ6QV6R56ZPFZ7OFHM6DNQMASG', 'WARC-Record-ID': '<urn:uuid:892e8bb6-c5a8-40f6-8968-e904e44e841e>', 'WARC-Target-URI': 'https://blog.kentforliberty.com/2020/03/as-government-becomes-more-and-more-evil.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3d0c2f68-ce25-44f5-ba70-6320a2ba6a16>', 'WARC-Truncated': 'length'}", 'previous_word_count': '294', 'url': 'https://blog.kentforliberty.com/2020/03/as-government-becomes-more-and-more-evil.html', 'warcinfo': 'isPartOf: CC-MAIN-2020-34\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for August 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-28.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.11381208896636963', 'original_id': '238a6a3d1d8be667bcc9039035e80bd62d190e8aab05ced06da2845f22fea83d'} |
Students can now use Bitcoin to pay for tuition in Prague. The CEVRO Institut University in Prague has become the next university to accept Bitcoin, following the Greek University of Nicosia, Draper University in California, and the University of Cumbria and King’s College in the UK.
This story was covered by Cointelegraph Czechoslovakia, a franchise of Cointelegraph.
Prague boasts one of the largest and most innovative cryptocurrency communities in the world. Not only can you study there using Bitcoin, but it also happens to be the city where the first pool was founded and the first hardware wallet was created. Bitcoin-only coffee is on sale, and the city is home to people who have inserted chips in their bodies to store private keys.
Alternative banking courses
It makes sense that one of the first universities in the world accepting bitcoin is in Prague. Professor Josef Šíma, rector of the university, explains what led him to the idea of accepting Bitcoin:
“As a first school in the Czech Republic we have opened unique Oxford style PPE (Philosophy, Politics, Economics) taught by a team of Czech and foreign professors in English and accepted many foreign students from US and Canada to India and China. One of them asked about the possibility to pay his tuition in bitcoin. And because we have hosted in past several lectures and conferences about this exciting new phenomenon and as a part of the PPE, and we will have courses dealing with alternative monetary schemes, free banking and cryptocurrencies, it was a really easy decision.”
The PPE program of the university is testament to the close connection between Bitcoin and modern studies of institutional change and policy reforms. The cryptocurrency question is a natural part of debates about limits of markets, individual liberties and state regulation. In addition, since the most well-known school defending entrepreneurship is the Austrian School of Economics, students can specialize in this school of thought and thus not only user Bitcoin for tuition payments, but also find it questioned in economics and political philosophy exams.
Students can choose a specialization in Austrian economics and study under leading scholars of this school who emphasize free market competition in money, and thus most of them like Bitcoin.
Pushing the limits
The accepting of Bitcoin by universities is a great step towards general recognition and serious academic debate about its role in society. One of the purposes of schools is to innovate and try and discuss alternative approaches. Professor Šíma agrees:
“Universities around the world teach students not to be afraid, to go out and innovate, but the schools themselves are often firmly conservative, live from subsidies and lose contact with the progress. Today most of the universities don’t even know that there is such a technology. We are always more than happy to push the limits and offer our students what they can’t find elsewhere.”
Bitcoin payments for master programs
“Now you can pay your tuition for CEVRO Institute’s PPE master’s program in bitcoins. We are among the first universities in the world which offer this choice to their students. We are proud to be among such schools as British King’s College or the University of Cumbria.”
“We do not want merely to teach about the beauty of markets, modern technologies and innovation, we want to be innovators ourselves! We want actively use most modern technologies and offer our students new opportunities which technologies made available,” says Professor Josef Šíma, president of CEVRO Institute and PPE Director.
The tuition fees in Bitcoin are calculated to be the same amount for non-Bitcoin payments, based on the current Bitcoin market exchange rate.
If you would like to pay for your tuition in Bitcoin, please contact the PPE Director at [email protected] | mini_pile | {'original_id': '0e238bce220be1a8fe60958bc00a9f1418b5aec733e6a315596c80fcffa041aa'} |
In November 2007, a band that blends various elements was formed in Beijing with its name called “LONGJIN”. LONGJIN is characterized by its beautiful melody, tranquil tone, unique instrumental combination, fresh and unconventional rhythm, and concise and meaningful lyrics. With each member’s professional musical accomplishments, transcendental music sense, and diverse experience, the band members of LONGJIN breathe new life into the music scene.
Gentle vocals, solid bass, clever guitar and sexy drums form the essence of WEDGE CUT - a unique reggae band from Beijing, that does not adhere to traditional norms of the genre by blending a variety of styles, and using their own language to tell the stories that Bob Marley never did.
Free Entrance
You have to sign in to post in the guestbook.
Powered by: Bloc | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9453117847442628}", 'metadata': "{'Content-Length': '38959', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:MEQPOBLTPISRL7NZN33HMXBYNYJGEX7V', 'WARC-Concurrent-To': '<urn:uuid:876f6753-cd1f-4463-80ec-f6f5321c3a44>', 'WARC-Date': datetime.datetime(2021, 3, 9, 1, 34, 7), 'WARC-IP-Address': '176.111.200.27', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:ZBFHJAF22WLYSUVH7V5MBX3PMNTRT3JB', 'WARC-Record-ID': '<urn:uuid:62f0508b-6ac9-4942-8fcc-f3fe73f2dec9>', 'WARC-Target-URI': 'https://www.weliveinbeijing.com/events/main.rails?eid=1000017617', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:9dadafaf-0d0e-4df8-8176-82604a8658b4>', 'WARC-Truncated': None}", 'previous_word_count': '133', 'url': 'https://www.weliveinbeijing.com/events/main.rails?eid=1000017617', 'warcinfo': 'isPartOf: CC-MAIN-2021-10\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February/March 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-127.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.05130290985107422', 'original_id': '84dc985258627868c0dd78b080591e05513d08e0d079b041e1e24dcc90a35a44'} |
Introduction
============
Interleukin-1β (IL-1β) is a prototypical multifunctional cytokine that plays an important role in intestinal inflammation of Crohn's disease (CD) and other inflammatory conditions of the gut \[[@b1]--[@b3]\]. CD is an immune mediated disorder characterized by chronic, relapsing inflammation of the gastrointestinal tract \[[@b4]\]. IL-1β is markedly elevated in intestinal tissue and serum of CD patients and a correlation between increasing levels of IL-1β and increasing severity of intestinal inflammation has been demonstrated in patients with CD \[[@b5]\]. An imbalance in IL-1β levels and its naturally occurring antagonist IL-1 receptor antagonist (IL-1ra) occurs in CD patients such that there is an excess of pro-inflammatory and deficiency of anti-inflammatory forms of IL-1 \[[@b6]--[@b8]\]. IL-1β gene polymorphism also exists in CD patients that determine the severity of intestinal inflammation in the affected patients \[[@b7], [@b9], [@b10]\]. Thus, IL-1β has been identified as an important pro-inflammatory mediator of CD and therapeutic strategies to inhibit IL-1β are being explored \[[@b3], [@b8]\].
An integral function of epithelial cells lining the intestinal tract is to act as a physical and functional barrier against noxious substances present in the intestinal lumen \[[@b11]\]. The bi-lipid apical membrane of the enterocytes is an effective barrier against transcellular permeation of passively absorbed hydrophilic substances present in the lumen \[[@b11], [@b12]\]. The intercellular tight junctions (TJs) that encircle the enterocytes at the apico-lateral membrane border act as a barrier against permeation of hydrophilic substances in-between cells (referred to as paracellular barrier function) \[[@b11], [@b12]\]. It is well established that patients with CD have a defective intestinal TJ barrier characterized by an increase in intestinal permeability to paracellular markers \[[@b13]--[@b15]\]. The defective TJ barrier allows paracellular permeation of luminal antigens that stimulate inflammatory response \[[@b11], [@b13]\]. Clinical studies have shown that therapeutic re-tightening of the intestinal TJ barrier is associated with rapid clinical improvement and prolonged clinical remission \[[@b16]--[@b18]\], and persistent elevation in intestinal permeability following medical therapy have been shown to be predictive of refractory disease and early recurrence of the disease \[[@b16], [@b18], [@b19]\].
It is well established that IL-1β causes an increase in intestinal epithelial TJ permeability *in vivo* and *in vitro*\[[@b20]--[@b22]\]. Previous studies from our laboratory suggested that the IL-1β-induced increase in Caco-2 monolayer TJ permeability was mediated by an increase in myosin light chain kinase (MLCK) gene and protein expression and that inhibition of MLCK synthesis or MLCK activity prevented the IL-1β-induced increase in TJ permeability \[[@b20]\]. However, the intracellular signalling pathways and the molecular processes responsible for the increase in MLCK gene and protein expression and the increase in intestinal TJ permeability remain unknown. The major purpose of this study was to delineate the signalling pathway and the molecular mechanisms that mediate the IL-1β-induced increase in intestinal TJ permeability using a commonly used *in vitro* intestinal epithelial model system consisting of filter-grown Caco-2 intestinal epithelial monolayers \[[@b20], [@b23]\].
Previous studies have shown that many of the pro-inflammatory actions of IL-1β are mediated by mitogen-activated protein kinases (MAPK) \[[@b24], [@b25]\]. Extracellular regulated protein kinase 1/2 (ERK1/2) is a key member of MAPK family of proteins and has been found to play an important role in mediating some of the biological actions of IL-1β\[[@b26], [@b27]\]. ERK1/2 pathways play an integral role in signal transduction processes leading to regulation of cell growth \[[@b28]\], differentiation \[[@b29]\] and gene activity that culminate in the production of cytokines, chemokines, adhesion molecules and effector proteins \[[@b30]\]. In this study, we examined the possibility that ERK1/2 signalling pathway plays a key role in the regulation of IL-1β-induced increase in intestinal epithelial TJ permeability. Our data show that IL-1β-induced activation of ERK1/2 pathways was required for the increase in intestinal TJ permeability. Additionally, our data provide new insight into the cellular and molecular processes that mediate the ERK1/2 kinase-induced activation of MLCK gene and increase in Caco-2 monolayer TJ permeability.
Materials and methods
=====================
Chemicals
---------
Cell culture media (DMEM), trypsin, foetal bovine serum (FBS) and related reagents were purchased from Life Technologies (Gaithersburg, MD, USA). Glutamine, penicillin, streptomycin and PBS were purchased from GIBCO-BRL (Grand Island, NY, USA). Anti-ERK1/2 (ERK1/2), Elk-1(Ets-like gene 1), phosphor-ERK1/2, MLCK, AP-1 (activator protein-1) and anti-β-actin antibodies were obtained from Sigma (St. Louis, MO, USA). Horseradish peroxidase (HRP)-conjugated secondary antibodies for Western blot analysis were purchased from Invitrogen (San Francisco, CA, USA). SiRNA of ERK1/2, MLCK, Elk-1 and AP-1 and transfection reagents were obtained from Dharmacon (Lafayette, CO, USA). ERK1/2 inhibitor 2′-amino-3′-methoxyflavone (PD-98059) was purchased from Sigma. All other chemicals were purchased from Sigma, VWR (West Chester, PA, USA) or Fisher Scientific (Pittsburgh, PA, USA).
Cell cultures
-------------
Caco-2 cells (*passage 18*) were purchased from the American Type Culture Collection (Rockville, MD, USA) and maintained at 37°C in a culture medium composed of DMEM with 4.5 mg/ml glucose, 50 U/ml penicillin, 50 U/ml streptomycin, 4 mM glutamine, 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) and 10% FBS. The cells were kept at 37°C in a 5% CO~2~ environment. Culture medium was changed every 2 days. Caco-2 cells were subcultured after partial digestion with 0.25% trypsin and 0.9 mM ethylenediaminetetraacetic acid (EDTA) in Ca^2+^- and Mg^2+^-free PBS.
Determination of epithelial monolayer resistance and paracellular permeability
------------------------------------------------------------------------------
An epithelial voltohmeter (World Precision Instruments, Sarasota, FL, USA) was used for measurements of the transepithelial electrical resistance (TER) of the filter-grown Caco-2 intestinal monolayers as previously reported \[[@b31]\]. The effect of IL-1β on Caco-2 paracellular permeability was determined using an established paracellular marker inulin (m.w. = 5000 g/mol) \[[@b32]\]. For determination of mucosal-to-serosal flux rates of inulin, Caco-2-plated filters having epithelial resistance of 400--500 Ω.cm^2^ were used. Known concentrations of permeability marker (2 μM) and its radioactive tracer were added to the apical solution. Low concentrations of permeability marker were used to ensure that negligible osmotic or concentration gradient was introduced.
Assessment of protein expression by Western blot analysis
---------------------------------------------------------
Caco-2 monolayers were treated with IL-1β (10 ng/ml) for varying time periods. At the end of the experimental period, Caco-2 monolayers were immediately rinsed with ice-cold PBS, and cells were lysed with lysis buffer (50 mM Tris.HCl, pH 7.5, 150 mM NaCl, 500 μM NaF, 2 mM EDTA, 100 μM vanadate, 100 μM phenylmethylsulfonyl fluoride (PMSF), 1 μg/ml leupeptin, 1 μg/ml pepstatin A, 40 mM paranitrophenyl phosphate, 1 μg/ml aprotinin and 1% Triton X-100) and scraped, and the cell lysates were placed in Microfuge tubes. Cell lysates were centrifuged to yield a clear lysate. Supernatant was collected, and protein measurement was performed with Bio-Rad Protein Assay kit (Bio-Rad Laboratories, Hercules, CA, USA). Laemmli gel loading buffer was added to the lysate containing 10--20 μg of protein and boiled for 7 min., after which proteins were separated on SDS-PAGE gel. Proteins from the gel were transferred to the membrane (Trans-Blot Transfer Medium, Nitrocellulose Membrane; Bio-Rad Laboratories) overnight. The membrane was incubated for 2 hrs in blocking solution \[5% dry milk in tris buffered saline (TBS)-Tween 20 buffer\]. The membrane was incubated with appropriate primary antibodies in blocking solution. After being washed in TBS-1% Tween buffer, the membrane was incubated in appropriate secondary antibodies and developed using the Santa Cruz Western Blotting Luminol Reagents (Santa Cruz Biotechnology, Santa Cruz, CA, USA) on the Kodak BioMax MS film (Fisher Scientific).
RNA isolation and reverse transcription
---------------------------------------
Caco-2 cells (5 × 10^5^/filter) were seeded into 6-well transwell permeable inserts and grown to confluency. Filter-grown Caco-2 cells were then treated with appropriate experimental reagents for desired time periods. At the end of the experimental period, cells were washed twice with ice-cold PBS. Total RNA was isolated using Qiagen RNeasy Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's protocol. Total RNA concentration was determined by absorbance at 260/280 nm using SpectrraMax 190 (Molecular Devices, Sunnyvale, CA, USA). The reverse transcription (RT) was carried out using the GeneAmp Gold RNA PCR core kit (Applied Biosystems, Foster City, CA, USA). Two micrograms of total RNA from each sample were reverse transcribed into cDNA in a 40-μl reaction containing 1× RT-PCR buffer, 2.5 mM MgCl~2~, 250 μM of each dNTP, 20 U RNase inhibitor, 10 mM DL-Dithiothreitol (DTT), 1.25 μM random hexamer and 30 U multiscribe RT. The RT reactions were performed in a thermocycler (PTC-100, MJ Research, Waltham, MA, USA) at 25°C for 10 min., 42°C for 30 min. and 95°C for 5 min.
Quantification of gene expression using real-time PCR
-----------------------------------------------------
The real-time PCRs were carried out using ABI prism 7900 sequence detection system and Taqman universal PCR master mix kit (Applied Biosystems, Branchburg, NJ, USA) as previously described \[[@b32], [@b33]\]. Each real-time PCR reaction contained 10 μl RT reaction mix, 25 μl 2× Taqman universal PCR master mix, 0.2 μM probe and 0.6 μM primers. Primer and probe design for the real-time PCR was made with Primer Express version 2 from Applied Biosystems. \[The primers used in this study are as follows: MLCK specific primer pairs consisted of 5′-AGGAAGGCAGCATTGAGGTTT-3′\[forward\], 5′-GCTTTCAGCAGGCAGAGGTAA-3′\[reverse\]; probe specific for MLCK consisted of FAM 5′-TGAAGATGCTGGCTCC-3′ TAMRA; the internal control glyceraldehyde 3-phosphate dehydrogenase (GAPDH)-specific primer pairs consisted of 5′-CCACCCATGGCAAATTCC-3′\[forward\], 5′-TGGGATTTCCATTGATGACCAG-3′\[reverse\]; probe specific for GAPDH consisted of JOE 5′-TGGCACCGTCAAGGCTGAGAACG-3′ TAMRA.\] All runs were performed according to the default PCR protocol (50°C for 2 min., 95°C for 10 min., 40 cycles of 95°C for 15 sec. and 60°C for 1 min.). For each sample, real-time PCR reactions were performed in triplicate, and the average threshold cycle (Ct) was calculated. A standard curve was generated to convert the Ct to copy numbers. Expression of MLCK mRNA was normalized with GAPDH mRNA expression. The average copy number of MLCK mRNA expression in control samples was set to 1.0. The relative expression of MLCK mRNA in treated samples was determined as a fold increase compared with control samples.
SiRNA of ERK1/2, MLCK, Elk-1 and AP-1
-------------------------------------
Targeted siRNAs were obtained from Dharmacon, Inc. (Chicago, IL, USA). Caco-2 monolayers were transiently transfected using DharmaFect transfection reagent (Lafayette). Briefly, 5 × 10^5^ cells/filter were seeded into a 12-well transwell plate and grown to confluency. Caco-2 monolayers were then washed with PBS twice and 1.0 ml Opti-Minimum Essential Media (MEM) medium was added to the apical compartment of each filter and 1.5 ml were added to the basolateral compartment of each filter. Five nanograms of the siRNA of interest and 2 μl of DharmaFect reagent were pre-incubated in Opti-MEM. After 5 min. of incubation, two solutions were mixed and incubated for another 20 min., and the mixture was added to the apical compartment of each filter. The IL-1β experiments were carried out 96 hrs after transfection. The efficiency of silencing was confirmed by Western blot analysis.
ELISA-based *in vitro* ERK1/2 kinase activity
---------------------------------------------
Biotinylated myelin basic protein (MBP) was diluted in PBS and coated on streptavidin 96-well plates at 37°C for 1 hr. The plates were washed three times with PBS, incubated with blocking solution (1 mg/ml bovine serum albumin in PBS) at 37°C for 1 hr, and then washed three times with PBS. The kinase reaction buffer (90 μl) (20 mM Tris/HCl pH7.5, 10 mM MgCl~2,~ 50 mM NaCl, 1 mM DTT, 1 mM NaF, 50 μM ATP) provided by the manufacturer (MBL International, Woburn, MA, USA) and the samples containing immunoprecipitated ERK1/2 (10 μl) were added to each well, and the kinase reaction (phosphorylation of MBP) was carried out at 37°C for 30--60 min. The reaction was stopped by removing the reaction mixtures and washing the plates three times with washing buffer (20 mM Tris-HCl at pH 7.4, 0.5 M NaCl and 0.05% Tween 20). The washed plates were incubated with the anti-phospho-MBP antibody (5 ng/ml) at room temperature for 1 hr. The plates were washed four times with washing buffer, and goat anti-rabbit IgG antibody (diluted at 1:2000 in washing buffer) was added to the wells, and the plates were incubated at 37°C for 1 hr. The plates were then washed four times and incubated with 100 μl substrate solution tetramethylbenzidine at 37°C for 5--15 min. A stop solution containing 0.5 N H~2~SO~4~ (100 μl) was added to stop the reaction. The absorbance at 450 nm was determined using the SpectrraMax 190 (Molecular Devices).
Nuclear extracts and ELISA for transcription factor activation
--------------------------------------------------------------
Filter-grown Caco-2 monolayers were treated with 10 ng/ml IL-1β for 30 min. Caco-2 monolayers were washed with ice-cold PBS, scraped, collected and centrifuged at 14,000 rpm for 30 sec. The cell pellets were resuspended in 200 μl of buffer A (in millimoles: 10 HEPES-KOH, 1.5 MgCl~2~, 10 KCl, 0.5 DTT and 0.2 PMSF \[pH 7.9\]), and incubated on ice for 15 min. After centrifugation at 14,000 rpm for 30 sec., pelleted nuclei were resuspended in 30 μl of buffer C (in millimoles: 20 HEPES-KOH (25% glycerol), 420 NaCl, 1.5 MgCl~2~, 0.2 EDTA, 0.5 DTT and 0.2 PMSF \[pH 7.9\]). After incubation on ice for 20 min., the lysates were centrifuged at 14,000 rpm for 20 min. Protein concentrations were determined using the Bradford method. The Elk-1, AP-1 and Signal Transducers and Activator-1 (STAT-1) DNA-binding assay was performed with Trans-AM ELISA-based kits from Active Motif according to the manufacturer's protocol. In brief, the binding reactions contained 1 pM biotinylated probe (Integrated DNA Technologies, Coralville, IA, USA) and 5 μg of nuclear extract in complete binding buffer with a total volume of 50 μl. After 30 min. of incubation, the solution was transferred to an individual well on 96-well plate and incubated for 1 hr. Appropriate antibody (2 μg/ml) was added to the well to bind the target protein in nuclear extract. After incubation for 1 hr, the antibody was removed, and 100 μl of HRP-conjugated secondary antibody was added to the well and incubated for 1 hr. Subsequently, 100 μl of developing solution was added for 2--10 min., and 100 μl of stop solution were added. The absorbance at 450 nm was determined using the SpectraMax 190 (Molecular Devices).
Cloning of the full length MLCK promoter region and deletion constructs
-----------------------------------------------------------------------
The MLCK promoter region was cloned using GenomeWalker system (Clontech, Mountain View, CA, USA). A 2091-bp DNA fragment (--2109 to --18) was amplified by PCR. The amplification condition was 1 cycle at 94°C for 2 min., followed by 43 cycles at 94°C for 1 min., 50°C for 1 min. and 72°C for 2 min. and 1 cycle at 72°C for 5 min. The resultant PCR product was digested with *Hin*dIII and *Kpn*I and inserted into pGL3-basic luciferase reporter vector (Promega, Madison, WI, USA). The sequence was confirmed by DNA services at the University of New Mexico. Construction of MLCK promoter reporter plasmids was carried out using the pGL-3 basic luciferase reporter vector. Deletions of MLCK promoter were done by the PCR method. The primers used for cloning two MLCK promoter deletion constructs are listed in [Table 1](#tbl1){ref-type="table"}. The PCR conditions were 1 cycle at 94°C for 2 min., followed by 43 cycles at 94°C for 1 min., 50°C for 1 min. and 72°C for 2 min. and 1 cycle at 72°C for 5 min. The resultant PCR products were cloned into pGL-3 basic luciferase reporter vector and the sequences were confirmed.
######
Sequences of cloning primers
Primer name Sequence (5′-3′)
-------------- ----------------------------------
FL-MLCK (+) GCCGGTACCGAGAAGCAGGAGAGTATTAAATG
MLCK-929 (+) CGGGGTACCCTCTGCCCTCTTGACTTAATC
MLCK-313 (+) GCCGGTACCATGGCCTTCCTCCCTCACCCCT
Transfection of DNA constructs and assessment of promoter activity
------------------------------------------------------------------
DNA constructs of MLCK promoters were transiently transfected into Caco-2 cells using transfection reagent lipofectamine 2000 (Life Technologies). Renilla luciferase vector (pRL-TK, Promega) was cotransfected with each plasmid construct as an internal control. Cells (5 × 10^5^/filter) were seeded into a 6-well transwell plate and grown to confluency. Caco-2 monolayers were then washed with PBS twice and 1.0 ml Opti-MEM medium was added to the apical compartment of each filter and 1.5 ml were added to the basolateral compartment of each filter. One microgram of each plasmid construct and 0.25 μg pRL-TK or 2 μl lipofectamine 2000 was preincubated in 250 μl Opti-MEM, respectively. After 5 min. of incubation, two solutions were mixed and incubated for another 20 min., and the mixture was added to the apical compartment of each filter. After incubation for 3 hrs at 37°C, 500 μl DMEM containing 10% FBS were added to both sides of the filter to reach a 2.5% final concentration of FBS. Subsequently, media were replaced with normal Caco-2 growth media 16 hrs after transfection. Specific experiments were carried out 48 hrs after transfection. At the completion of specific experimental treatments, Caco-2 cells were washed twice with 1 ml ice-cold PBS, followed by the addition of 400 μl 1× passive lysis buffer, incubated at room temperature for 15 min., scraped and transferred into an Eppendorf tube, and centrifuged for 15 sec. at 13,000 rpm in a microcentrifuge. Luciferase activity was determined using the dual luciferase assay kit (Promega). Twenty microlitres of the supernatant were used for each assay. Luciferase values were determined by Lumat LB 9507 (EG&G Berthold, Oak Ridge, TN, USA). The value of reporter luciferase activities were then divided by that of renilla luciferase activities to normalize for differences in transfection efficiencies. The average activity value of the control samples was set to 1.0. The luciferase activity of MLCK promoter in treated samples was determined relative to the control samples.
Site-directed mutagenesis
-------------------------
Mutagenesis of MLCK promoter was performed with the GeneTailor Site-Directed Mutagenesis System (Invitrogen). Briefly, primers (Mutant primer: forward: 5′-CTGCAGGAAGGCAGCTCCCACAATTCCTTCTTTCTACCCCTGCCA-3′; reverse primer: 5′-TGGGAGCTGCCTTCCTGCAGGTGAAAGGCA-3′) were generated that included the mutation site flanked by a wild-type sequence on either side. A PCR reaction produced a new complete copy of the plasmid containing the mutation coded for by the primers. The linear PCR product was subsequently transformed into DH5-T1 Escherichia coli, which circularized the PCR product and digested any remaining parent plasmid. DNA sequence was then verified by DNA services at the University of New Mexico.
Statistical analysis
--------------------
Results are expressed as means ± S.E. Statistical significance of differences between mean values was assessed with Student's t-tests for unpaired data and ANOVA analysis whenever was required. All reported significance levels represent two-tailed *P*-values. A *P*-value of \<0.05 was used to indicate statistical significance. Each experiment was performed in triplicate or quadruplicates (*n*= 3 or 4) and all experiments were repeated three to six times to ensure reproducibility.
Results
=======
ERK1/2 signalling pathway mediates the IL-1β induced increase in Caco-2 TJ permeability
---------------------------------------------------------------------------------------
The signalling pathways that regulate the IL-1β-induced increase in intestinal epithelial TJ permeability remain unknown. In the following studies, we examined the possibility that the IL-1β-induced increase in Caco-2 monolayer TJ permeability was regulated by ERK1/2 signalling pathways. The time-course effect of IL-1β (10 ng/ml) on ERK1/2 activation was determined by measuring ERK1/2 phosphorylation in filter-grown Caco-2 monolayers and by *in vitro* kinase assay of immunoprecipitated ERK1/2. IL-1β (10 ng/ml) caused a rapid increase in ERK1/2 phosphorylation in Caco-2 cells starting at about 10 min. and continuing up to 60 min. as determined by phospho-ERK1/2 immunoblotting ([Fig. 1A](#fig01){ref-type="fig"}). The total ERK1/2 level was not affected by the IL-1β treatment ([Fig. 1A](#fig01){ref-type="fig"}). The IL-1β effect on ERK1/2 kinase activity was also determined by an ELISA-based *in vitro* kinase assay. Following IL-1β treatment of filter-grown Caco-2 monolayers, Caco-2 cells were lysed and ERK1/2 immunoprecipitated using ERK1/2 antibody. The kinase activity of immunoprecipitated ERK1/2 was measured *in vitro* using MBP as the substrate as described in the *Methods* section. IL-1β caused a rapid increase in Caco-2 ERK1/2 kinase activity starting at about 5--10 min. ([Fig 1B](#fig01){ref-type="fig"}). The IL-1β-induced increase in ERK1/2 kinase activity paralleled the increase in ERK1/2 phosphorylation. These results indicated that IL-1β causes a rapid activation (within minutes) of ERK1/2.
{#fig01}
To determine the involvement of ERK1/2 pathway in IL-1β-induced increase in Caco-2 TJ permeability, the effect of ERK1/2 inhibition was examined. The IL-1β effect on Caco-2 TJ permeability was determined by measuring TER and transepithelial flux rate of paracellular marker inulin ([Fig. 2A and B](#fig02){ref-type="fig"}) \[[@b20], [@b32]\]. IL-1β caused a progressive drop in Caco-2 TER and an increase in transepithelial flux of inulin starting at about 12 hrs ([Fig. 2A and B](#fig02){ref-type="fig"}). The ERK1/2 inhibitor PD98059 (100 μM) inhibited the IL-1β-induced activation of ERK1/2 ([Fig. 2C](#fig02){ref-type="fig"}) and prevented the drop in TER ([Fig. 2D](#fig02){ref-type="fig"}) and the increase in inulin flux ([Fig. 2E](#fig02){ref-type="fig"}). These results showed that IL-1β-induced increase in Caco-2 TJ permeability required ERK1/2 activation. To further validate the requirement of ERK1/2 on IL-1β effect on Caco-2 TJ permeability, ERK1/2 expression was knocked down by Caco-2 transfection of ERK1/2 siRNA. The transfection of ERK1/2 siRNA caused a near-complete depletion of ERK1/2 in filter-grown Caco-2 monolayers ([Fig. 3A](#fig03){ref-type="fig"}). The knockdown of ERK1/2 inhibited the IL-1β-induced drop in Caco-2 TER ([Fig. 3B](#fig03){ref-type="fig"}) and increase in inulin flux ([Fig. 3C](#fig03){ref-type="fig"}), confirming the regulatory role of ERK1/2 in IL-1β-induced increase in Caco-2 TJ permeability.
{#fig02}
{#fig03}
ERK1/2 signalling pathway is involved in the regulation of MLCK gene and protein expression
-------------------------------------------------------------------------------------------
Previous studies from our laboratory indicated that the IL-1β-induced increase in Caco-2 TJ permeability was mediated by an increase in MLCK protein expression and activity \[[@b20]\]. However, the intracellular pathways and the molecular processes involved in the IL-1β regulation of MLCK gene and protein expression remain unclear. In the following studies, we examined the possibility that ERK1/2 pathways also mediate the IL-1β-induced up-regulation of MLCK gene and protein expression. As shown in [Figure 4A and B](#fig04){ref-type="fig"}, IL-1β caused an increase in Caco-2 MLCK protein and mRNA expression. The siRNA-induced knockdown of MLCK inhibited the IL-1β-induced drop in Caco-2 TER \[[@b20]\] and increase in inulin flux ([Fig. 4C](#fig04){ref-type="fig"}). The inhibition of ERK1/2 activity with pharmacologic inhibitor PD 98059 (100 μM) inhibited the IL-1β-induced increase in MLCK mRNA and protein expression ([Fig. 4B and D](#fig04){ref-type="fig"}). The siRNA-induced knockdown of Caco-2 ERK1/2 also inhibited the IL-1β-induced increase in MLCK mRNA and protein level ([Fig. 4E and F](#fig04){ref-type="fig"}). These findings indicated that ERK1/2 signalling pathway was involved in IL-1β regulation of MLCK mRNA and protein expression.
{#fig04}
IL-1β induces MLCK promoter activation
--------------------------------------
To delineate the molecular processes involved in IL-1β modulation of MLCK mRNA and protein expression, the IL-1β effect on MLCK promoter activity was determined. The IL-1β effect on MLCK promoter activity was determined by measuring luciferase activity (reporter gene) following transfection of filter-grown Caco-2 monolayers with plasmid vector containing the MLCK promoter region \[[@b34]\]. The IL-1β (10 ng/ml) treatment of MLCK promoter transfected Caco-2 cells resulted in an increase in MLCK promoter activity ([Fig. 5](#fig05){ref-type="fig"}), indicating that IL-1β has a stimulatory effect on MLCK gene activity.
{#fig05}
Elk-1 regulates the ERK1/2 signalling cascade induced increase in MLCK gene expression
--------------------------------------------------------------------------------------
In the following series of studies, the nuclear transcription factors involved in IL-1β/ERK1/2 signalling pathway induced increase in Caco-2 MLCK mRNA and protein was determined. Previous studies in different cell types suggested that transcription factors AP-1, Elk-1 and STAT-1 may be involved in IL-1β and ERK1/2 regulation of various biological activities \[[@b25], [@b35]\]. Using Genomatix/Promoter Inspector software, transcription factor binding sequences for AP-1, Elk-1 and STAT-1 were identified on the MLCK promoter region, suggesting the possibility that these transcription factors may have a regulatory role on MLCK gene activity. The IL-1β effect on transcription factor activation was determined by binding of the activated transcription factors to their respective DNA binding site using ELISA-based DNA binding assay \[[@b32], [@b36]\]. IL-1β treatment of Caco-2 cells resulted in an activation of Elk-1 and AP-1 but not STAT-1 ([Fig. 6A--C](#fig06){ref-type="fig"}), suggesting that AP-1 or Elk-1 (but not STAT-1) may be involved in IL-1β modulation of MLCK gene expression. Next, the involvement of AP-1 or Elk-1 in IL-1β-induced increase in MLCK mRNA and protein was determined by selective knockdown of AP-1 or Elk-1 *via* siRNA transfection. The siRNA-induced knockdown of AP-1 ([Fig. 7A](#fig07){ref-type="fig"}) did not affect the IL-1β-induced increase in MLCK gene or protein level ([Fig. 7B and C](#fig07){ref-type="fig"}). In contrast, siRNA-induced knockdown of Elk-1 ([Fig. 8A](#fig08){ref-type="fig"}) almost completely inhibited the IL-1β-induced increase in Caco-2 MLCK mRNA and protein levels ([Fig. 8B and C](#fig08){ref-type="fig"}). The siRNA-induced knockdown of Elk-1 also inhibited the IL-1β-induced drop in Caco-2 TER ([Fig. 8D](#fig08){ref-type="fig"}) and increase in inulin flux ([Fig. 8E](#fig08){ref-type="fig"}). Together, these results indicated that Elk-1 was required for the IL-1β-induced increase in MLCK gene and protein expression and increase in Caco-2 monolayer TJ permeability. Next, the involvement of ERK1/2 signalling pathway on Elk-1 activation was determined. The inhibition of IL-1β-induced activation of ERK1/2 by PD-98059 (100 μM) inhibited the activation of Elk-1 ([Fig. 9](#fig09){ref-type="fig"}).
{#fig06}
{#fig07}
{#fig08}
{#fig09}
Elk-1 regulates the MLCK promoter activity
------------------------------------------
To ascertain the molecular processes involved in IL-1β regulation of MLCK gene transcription, the involvement of Elk-1 in the regulation of MLCK promoter activity was determined. The siRNA knockdown of Elk-1 resulted in an inhibition of IL-1β-induced increase in MLCK promoter activity ([Fig. 10](#fig10){ref-type="fig"}), suggesting that Elk-1 was required for the activation of MLCK promoter. Next, to delineate the molecular determinants involved in IL-1β modulation of MLCK promoter activity, Elk-1 binding sequences were identified using Genomatix/Promoter Inspector software. Two Elk-1 binding motifs were identified on MLCK promoter region at --1118 to --1102 (TGGCCTTCCTCCCTC) designated as 'site A' and at --310 to --296 (GAAAATGGAAGTCCAAG) designated as 'site B' ([Fig. 11A](#fig11){ref-type="fig"}). Three MLCK promoter deletion constructs were generated that contained both Elk-1 binding sites (A and B) or those containing only the downstream binding site B (located within the minimal promoter region) ([Fig. 11A](#fig11){ref-type="fig"}). (The minimal MLCK promoter region had been previously localized between --313 and +118 \[[@b20]\].) Following IL-1β treatment, deletion constructs encoding only binding site B (MLCK-929 or MLCK --313) had a similar proportional increase in promoter activity as the full length (FL) promoter region containing both sites A and B ([Fig. 11B and C](#fig11){ref-type="fig"}), suggesting that binding site B (located within the MLCK minimal promoter region) was sufficient to cause an increase in MLCK promoter activity. To further validate the involvement of site B in the regulation of MLCK promoter activity, the binding site B was mutated *via* site-directed mutagenesis. The mutation of site B inhibited the increase in MLCK --313 promoter activity ([Fig. 11D](#fig11){ref-type="fig"}), confirming the requirement of site B for the up-regulation of promoter activity. Lastly, the effect of siRNA-induced silencing of Elk-1 on IL-1β-induced increase in MLCK promoter activity in MLCK --313 was determined. The siRNA-induced knockdown of Elk-1 inhibited the IL-1β-induced increase in promoter activity in MLCK --313 ([Fig. 11E](#fig11){ref-type="fig"}). In combination, these data indicated that Elk-1 binding site B located within the minimal promoter region was the regulatory site responsible for mediating the Elk-1 activation of MLCK promoter activity.
{#fig10}
{#fig11}
Discussion
==========
The cellular and molecular mechanisms that mediate IL-1β regulation of intestinal epithelial TJ barrier remain unclear. Previous studies from our laboratory indicated that the IL-1β-induced increase in Caco-2 monolayer TJ permeability was mediated by an increase in MLCK protein level and enzymatic activity \[[@b20]\]. In these studies, the inhibition of MLCK protein expression or activity prevented the IL-1β-induced increase in Caco-2 TJ permeability \[[@b20]\]. The major aim of the present study was to delineate the signalling pathway and the molecular mechanisms involved in IL-1β modulation of intestinal epithelial TJ barrier using filter-grown Caco-2 monolayers as the intestinal epithelial model system. Our data indicated that the IL-1β-induced increase in Caco-2 TJ permeability was mediated by activation of ERK1/2 signalling cascade. Additionally, our data showed that nuclear transcription factor Elk-1 played a key intermediary role in the regulation of Caco-2 TJ barrier function by targeting the MLCK promoter activity.
The pro-inflammatory cytokines including IFN-γ, TNF-α and IL-1β cause a disturbance in intestinal TJ barrier as demonstrated by an increase in intestinal TJ permeability \[[@b32], [@b37], [@b38]\]. In contrast, anti-inflammatory cytokine IL-10 causes an enhancement in the epithelial TJ barrier function \[[@b39], [@b40]\]. The cytokine-induced alteration in intestinal TJ barrier has been shown to be an important pathogenic factor in the development of intestinal inflammation in murine models of intestinal inflammation \[[@b33]\]. It has been previously shown that the development of enterocolitis in IL-10^−/−^ mice (an immune model of inflammatory bowel disease) is preceded by an initial increase in intestinal permeability \[[@b39]\], suggesting the possibility that an early defect in intestinal TJ barrier may allow an influx of noxious luminal antigens that lead to inflammatory response. In studying the causal relationship between intestinal TJ barrier defect and development of intestinal inflammation in IL-10^−/−^ mouse, Madsen and co-workers recently showed that pharmacologic enhancement of intestinal TJ barrier in IL-10^−/−^ mouse by oral administration of zonulin peptide inhibitor AT-1001 prevented the development of enterocolitis in IL-10^−/−^ mice and they concluded that 'in the IL-10^−/−^ mouse, abnormal small intestinal permeability not only precedes the development of colitis but is etiologically important'\[[@b41]\]. Similarly, in other murine models of intestinal inflammation, the maintenance of intestinal TJ barrier function also prevented the development of intestinal inflammation or inflammation associated clinical sequelae \[[@b42]--[@b44]\]. Thus, elucidating the intracellular signalling pathways and the molecular processes involved in cytokine modulation of intestinal TJ barrier has great significance in understanding the basic physiology of TJ barrier regulation and in developing potential therapeutic targets to enhance or preserve the intestinal TJ barrier function during inflammatory conditions of the gut.
Our results indicated that the IL-1β-induced increase in Caco-2 intestinal epithelial TJ permeability was mediated by ERK1/2 signalling pathway. Our data showed that ERK1/2 activation preceded the IL-1β-induced increase in Caco-2 TJ permeability and inhibition of ERK1/2 activity prevented the increase in TJ permeability. This is the first study to show that ERK1/2 signalling cascade plays a regulatory role in the modulation of intestinal epithelial TJ barrier. In other studies in intestinal epithelial cell systems, ERK1/2 inhibition did not have any effect on intestinal TJ barrier regulation \[[@b45], [@b46]\]. Reardon *et al.* reported that the inhibition of ERK1/2 pathway did not affect IFN-γ-induced increase in T84 TJ permeability \[[@b45]\]. Similarly, Savkovic *et al*. reported that inhibition of ERK1/2 activation did not prevent the enteropathogenic *E. coli* induced increase in T84 TJ permeability \[[@b46]\]. In contrast, our present data show that ERK1/2 signalling cascade plays an essential role in IL-1β regulation of Caco-2 TJ barrier function. (In separate studies, we also found that IL-1β treatment (10 ng/ml) causes a drop in T84 TER, and that the decrease in T84 TER required activation of ERK1/2 signalling pathway \[data not shown\].)
Previous studies from our laboratory indicated that the IL-1β-induced increase in Caco-2 TJ permeability was regulated by an increase in MLCK gene and protein expression \[[@b20]\]. These studies showed that the inhibition of IL-1β-induced increase in MLCK transcription or MLCK protein synthesis inhibited the increase in Caco-2 TJ permeability, leading to the conclusion that the IL-1β effect on intestinal epithelial TJ permeability was due to an increase in expression of downstream effector protein MLCK \[[@b20]\]. Our present data expand on those findings to show that IL-1β increase in MLCK gene and protein expression was mediated in part by the activation of ERK1/2 signalling pathway. Our data showed that the inhibition of ERK1/2 activity prevented the IL-1β increase in MLCK gene and protein level and Caco-2 TJ permeability. Thus, our results suggested that the IL-1β-induced increase in Caco-2 TJ permeability was mediated by ERK1/2 signalling pathway regulation of MLCK gene and protein expression. As for the intracellular mechanisms that mediate the MLCK modulation of intestinal TJ barrier, previous studies have suggested that peri-junctional acto-myosin filaments are involved in the TJ barrier opening \[[@b47]--[@b49]\]. In brief, these studies showed that MLCK catalyses the phosphorylation of peri-junctional myosin light chain, which in turn, causes a sequential activation of myosin-Mg^++^ ATPase and ATP-dependent contraction of peri-junctional actin/myosin filaments \[[@b47]\]. The contraction of peri-junctional actomyosin filaments cause mechanical tension near the cellular junctions, leading to a tension-induced retraction of apical membrane and opening of the TJs \[[@b47]--[@b49]\].
Our studies also identified Elk-1 as the transcription factor that mediated the IL-1β/ERK1/2 modulation of Caco-2 TJ permeability. Elk-1 belongs to the ETS domain transcription factor family and the ternary complex factor subfamily \[[@b50]\]. Elk-1 forms a ternary complex with the serum response factor protein and binds the serum response element, inducing an activation of target gene activity. Elk-1 contains two domains that serve as docking region for MAP kinases that cause phosphorylation at the C-terminal domain \[[@b50]\]. The Elk-1 phosphorylation is critical for the transcriptional regulation. Our results suggested that the IL-1β-induced activation of Elk-1 was also dependent on ERK1/2 signalling cascade. The inhibition of ERK1/2 activation prevented the IL-1β-induced activation of Elk-1. Our data also showed that Elk-1 played an essential role in IL-1β up-regulation of MLCK gene expression. Although potential binding sites for other ERK1/2 activated transcription factors STAT-1 and AP-1 were also present on the MLCK promoter region, only Elk-1 appeared to have a regulatory role in MLCK mRNA expression. Consistent with our previous data showing the requirement of MLCK up-regulation in IL-1β modulation of TJ barrier, our present data also indicated that Elk-1 modulation of Caco-2 TJ barrier was due to an increase in MLCK gene and protein expression. Our data indicated that Elk-1 activation was required for both the increase in MLCK expression and increase in Caco-2 TJ permeability and that knockdown of MLCK prevented the increase in TJ permeability. As far as we are aware, this is the first study to show that Elk-1 plays a regulatory role in TJ barrier modulation. Interestingly, in previous studies, we also showed that NF-κB activation was required for the IL-1β-induced increase in MLCK gene and protein expression \[[@b20]\]. This appears that both Elk-1 and NF-κB play a critical role in mediating IL-1β regulation of MLCK gene expression. Although the precise mechanisms involved in Elk-1 and NF-κB modulation of MLCK gene activity remain unknown, we suggest that NF-κB and Elk-1 interact with each other to affect their binding to the MLCK promoter and the subsequent activation of MLCK promoter. Further studies are needed to fully elucidate the molecular interaction between NF-κB and Elk-1 that leads to MLCK gene activation.
In this study, we also examined some of the molecular interactions involved in the IL-1β regulation of MLCK gene activity. First, we showed that the increase in MLCK mRNA expression was due to an increase in MLCK promoter activity. Our studies also indicated that ERK1/2 activation caused a downstream activation of Elk-1. The activated Elk-1 translocated to the nucleus, binding to the cis-binding motif located within the minimal promoter region (−310 to −296). The Elk-1 binding to the cis-binding site caused an activation of MLCK promoter, and sequential increase in MLCK transcription and translation.
In conclusion, our data provide new insight into the intracellular pathway and the molecular processes that mediate the IL-1β-induced increase in intestinal epithelial TJ permeability. Our studies show that the IL-1β-induced increase in Caco-2 TJ permeability was mediated by an activation of ERK1/2 signalling cascade ([Fig. 12](#fig12){ref-type="fig"}). The ERK1/2 signalling pathway activation caused a downstream activation of transcription factor Elk-1. The activated Elk-1 binds to the cis-binding motif on the MLCK promoter to cause an activation of MLCK promoter activity, resulting in an increase in MLCK protein synthesis and MLCK catalysed opening of the intestinal epithelial TJ barrier ([Fig. 12](#fig12){ref-type="fig"}). Thus, our results show for the first time that ERK1/2 signalling pathways and transcription factor Elk-1 play an essential regulatory role in IL-1β regulation of intestinal epithelial TJ barrier function.
{#fig12}
This research project was supported by a Veterans Affairs Merit Review grant from the Veterans Affairs Research Service and National Institute of Diabetes and Digestive and Kidney Diseases Grant R01-DK-64165 and R01-DK-081429 (to T.Y.M.).
| mini_pile | {'original_id': 'a86f63ff589ad06d7b157528d90897070adac2c5eebd071971f2ab2e5fdfe676'} |
\section{Box Topology may not be Coarsest Topology such that Projections are Continuous/Lemma}
Tags: Box Topology
\begin{theorem}
Let $\struct {X, \tau}$ be a topological space.
Let $U \in \tau$ such that $U \ne \O$ and $U \ne X$.
Let:
:$Y = \ds \prod_{n \mathop \in \N } X = X \times X \times X \times \ldots$
be the countable Cartesian product of $\family {X}_{n \in \N}$.
Let $\tau_T$ be the product topology on $Y$.
Let $\tau_b$ be the box topology on $Y$.
Let:
:$V = \ds \prod_{n \mathop \in \N } U = U \times U \times U \times \ldots$
be the countable Cartesian product of $\family {U}_{n \in \N}$.
Then:
:$V$ is an element of the box topology $\tau_b$
:$V$ is not an element of the product topology $\tau_T$
\end{theorem}
\begin{proof}
By the definition of the box topology:
:$V \in \tau_b$
Let $W \in \tau_T$.
\end{proof}
| math_pile | {'subset': 'ProofWiki', 'meta': "{'type': 'Theorem_Proof'}", 'original_id': '6effde3aa1d57b90af670ece844495a02fc416e08e8437686a834de731f20005'} |
| Share
Tor'ricel'li's law'
the law that states that the speed of flow of a liquid from an orifice is equal to the speed that it would attain if falling freely a distance equal to the height of the free surface of the liquid above the orifice.
Related Content | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '7', 'language_id_whole_page_fasttext': "{'en': 0.8711710572242737}", 'metadata': "{'Content-Length': '25257', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:UO6GTSAKUFC4CFB3MFO57GNWM2XRMD26', 'WARC-Concurrent-To': '<urn:uuid:a227ff78-6b48-4fd6-bd10-74cd7051b30f>', 'WARC-Date': datetime.datetime(2014, 7, 30, 4, 59, 20), 'WARC-IP-Address': '165.193.123.186', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:3CLWLK2RD3HHG3XVU6E5NWC6XFN3JZOL', 'WARC-Record-ID': '<urn:uuid:3be52523-ba7e-4db4-ac47-13234e6b8c23>', 'WARC-Target-URI': 'http://dictionary.infoplease.com/torricellis-law', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f5d6f0dd-25e5-4437-b11e-63c1d685c083>', 'WARC-Truncated': None}", 'previous_word_count': '63', 'url': 'http://dictionary.infoplease.com/torricellis-law', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.8697558641433716', 'original_id': '2ec064be29c6ecff79a6b42e85af720cddb03bd78deb782921e8db58faff9a3f'} |
High Temperature Alloy
From Discovery Wiki
(Redirected from High-Temperature Alloy)
Article possibly outdated (
High Temperature Alloy
High temp alloys.jpg
Cargo Space 1
Decay Rate no decay
Default Price 200
High temperature alloys are essential to the construction of Engine Components: Only a material with the strength of Cobalt and the temperature resistance of Niobium could withstand the tremendous amount of heat and pressure that exists within the combustion chamber of a fusion engine. However, the rarity of niobium and the complex fabrication methods employed mean that High Temperature Alloys are relatively expensive -- but without them, modern space travel would be impossible.
Buy/Sell Locations
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '115', 'language_id_whole_page_fasttext': "{'en': 0.8847988247871399}", 'metadata': "{'Content-Length': '54888', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:QDPTUWGFEORCFC4RDGPGWX3GFO3VUQ3J', 'WARC-Concurrent-To': '<urn:uuid:df5787dc-f88a-4a0e-9a81-fb0d689dc746>', 'WARC-Date': datetime.datetime(2019, 11, 11, 19, 25, 33), 'WARC-IP-Address': '51.15.132.164', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:5XH3AFAVIRTPV6CB7VORGC5CPWWZL7EX', 'WARC-Record-ID': '<urn:uuid:aa8918d1-38cd-4ddf-a7a7-d7517ab510db>', 'WARC-Target-URI': 'https://discoverygc.com/wiki/High-Temperature_Alloy', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:158ff22a-be1e-4c60-a502-667fbc78ac91>', 'WARC-Truncated': None}", 'previous_word_count': '205', 'url': 'https://discoverygc.com/wiki/High-Temperature_Alloy', 'warcinfo': 'isPartOf: CC-MAIN-2019-47\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-215.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.27236419916152954', 'original_id': '3797b6b2cec0f30a381e04f1c2043bf18fe2f703fbfc538e94c0de7f7a908441'} |
From Conservapedia
This is an old revision of this page, as edited by Karajou (Talk | contribs) at 17:32, 16 July 2012. It may differ significantly from current revision.
Jump to: navigation, search
Netherlands rel87.jpg
Netherlands location.PNG
Capital Amsterdam
Government Constitutional monarchy
Language Dutch (official)
Monarch Queen Beatrix
Prime minister Mark Rutte
Area 41,526 km² (18,41% water)
Population 2009 estimate 16,515,057
GDP per capita $35,078
Currency Euro (€) (EUR)
International dialing code 31
Internet top-level domain .nl
The Netherlands (Dutch: Nederland) is a country in the European Union in northwestern Europe, north of Belgium and France. It is a part of the Kingdom of the Netherlands. It is bordered by Belgium and Germany, and has a total population of 16.5 million (2009). Its system of government is constitutional monarchy. The country is often referred to as "Holland", this was originally the name of two densely populated provinces of the country (North-Holland and South-Holland), the cities of Amsterdam, Rotterdam and The Hague all lie in these provinces that have always been the most influential regions in the Netherlands. The official language is Dutch and the people are referred to in English as Dutchmen or collectively as the Dutch.
The major ethnic groups in the Netherlands are Dutch 94%, Surinamese 2%, Asians 2% and others 2%.
Dike system
The term "Netherlands" means "low country," and it is a very low-lying country. About a quarter of the land area, containing more than half of the population, is actually below sea level, and would flood if the sea were not held back by a system of dikes. The Dutch have a saying that "God created the earth, but the Dutch made Holland".
A major breach of the dikes occurred in 1953, killing 1800 people. To avoid a repeat of the disaster the Dutch began construction of the "Delta Project" to protect the country from future inundations. Begun in 1953 and completed in 2002 the Delta Project is considered a modern wonder of civil engineering. After Hurricane Katrina, a delegation of American engineers was invited by the Dutch government to see how the project works and how its technology can be applied in the United States for low-lying cities like New Orleans.
Major cities
Amsterdam, named for the Amstel river, is the largest city, and the capital of the Netherlands. Amsterdam is ringed by an extensive system of concentric canals. The seat of government, however, is located for historical reasons in The Hague (Den Haag).
Eindhoven is the location of the giant electronics corporation, Philips (full name: Koninklijke Philips Electronics N.V.), with annual revenue equivalent to about $40 billion. (The U.S. corporation General Electric has revenues of about $150 billion, but much of it is from non-electronics businesses). The Eindhoven area is known for its high concetration of high-tech industires, which include ASML, the world primary producer of lithography system for the production of semiconductors, and Océ, a leading producer of printers and copiers.
Groningen is home to many branches of KPN, the former state company of Post, Telegraphy and Telephony. It had its headquarters in Groningen when it was still state run, and move to The Hague since. KPN stands for Koninklijke PTT Nederland, or Royal PTT Netherlands. Groningen is also home to Gasunie (Gasunion), a public-private partnership that exploits the natural gas reseves in the province of Groningen and the adjoint North Sea.
Johan Barthold Jongkind, A Windmill near Delft, 1857.
Delft is a small town in South Holland, situated between Rotterdam and The Hague. It is noted for the blue-and-white Delft pottery, and as the home of the great artist Jan Vermeer.
Arnhem is a city in Gelderland, lying on the north bank of the Lower Rhine river. It was the scene of a major battle during Operation Market Garden in September 1944, when British and allied paratroop forces captured its strategic road bridge before being overwhelmed by German forces in the area.
Eindhoven is a city of the southern province of Brabant. It is known as a center of technology-related industry, and is the home of the electronics giant Philips, founded there as a light-bulb factory in 1891. PSV Eindhoven, one of the Netherlands' and Europe's major soccer teams, plays in the Philips Stadion and started life as a company team: PSV stands for Philips Sport Vereniging, 'Philips Sport Union'. Eindhoven has a population of 210,000.
Leeuwarden (Frisian: Ljouwert) is the capital of the northern province of Friesland; it was also the home town of the spy Mata Hari and the artist M.C. Escher. It has a population of 92,000.
Utrecht is a city of the central province of Utrecht. It is the seat of a bishopric and is a major communications hub and rail center. With a population of 290,000, it is the fourth largest city in the Netherlands. The city is best known as the site of lengthy peace negotiations to end the Wars of Spanish Succession in the 18th century. The resulting peace, called the Treaty of Utrecht, was signed in April of 1713.
Hoek van Holland ("Hook of Holland", literally 'corner of Holland') is a port in South Holland, and is administratively part of the city of Rotterdam. It lies at the outflow of the Nieuwe Waterweg canal and the North Sea, and is the base for ferry services to Harwich in eastern England.
South Holland contains the cities of The Hague and Rotterdam.
Flevoland is the youngest of the twelve provinces, having the least population (ca. 360,000). It was created in 1986 on two polders: just 80 years ago, there was no dry land but the Zuidersee. Its capital is Lelystad.
Friesland is a coastal province in the north, home to the Frisian language and people.
Gelderland borders Germany to the east, and extends north to the Ijsselmeer. Gelderland includes the major cities of Nijmegen and Arnhem, as well as the extensive heathland known as the Veluwe, now a national park.
North Brabant is often referred to as Brabant, as there is no south Brabant in the Netherlands. The southern part of the former duchy of Brabant (including the important cities of Antwerp and Louvain) now belongs to Belgium. While Eindhoven is the biggest city in North Brabant, its capital is 's-Hertogenbosch.
The Netherlands is the home of the Anglo-Dutch oil company Royal Dutch Shell . Other well known Dutch or partly Dutch multinationals are Unilever, a company owning many household brands, ING Group, a banking group, Ahold, an international chain of supermarkets, Reed Elsevier, a publishing house, Nielsen Company, owner of the Yellow Pages, and Randstad Holding, a company providing human resource services. The famous Dutch East India Company, which dominated trade in with South-East Asia in the 17th century, is regarded as the first multinational in history.
The Netherlands has long been famous for its production of flowers, and also for a related economic event, the "tulip mania" of 1636-1637. Tulips were traded on stock exchanges, and bid up to fantastic prices by people who understood that the prices were crazy but hoped to sell at a profit to even crazier investors. Many people mortgaged their homes for a single tulip bulb and in one case an entire brewery was exchanged for a few bulbs. As with all economic bubbles, when bidding began to lag people tried to sell and the bubble burst with disastrous consequences. Since then the Dutch have been renowned for their carefulness with money and have established a significant presence in the banking and financial sectors.
Drug policies
The Netherlands is noted for its low-crime rate (although comparable to other western European nations) and libertarian legislation. Examples are licensed prostitution in designated areas of major cities, such as Amsterdam's Red Light District, the legal soft drugs sold in the country's many coffee shops, abortion rights, same-sex marriages and euthanasia.
Consuming and carrying (for personal use only) the "soft drugs" (marijuana, hashish and hallucinogenic mushrooms) were made legal in the Netherlands in 1976 in a final attempt to stop drug-related crime in the 1970s. Soft drugs can be legally purchased by individuals over 18 in the famed (licensed) coffee shops, that do sell coffee as well, but are prohibited from serving alcohol. The Dutch policy regarding soft drugs (and previously prostitution) is called "gedoogbeleid" (condonement policy). This means that although certain behavior is officially prohibited by law, a condonement clause prevents law enforcement agencies from prosecuting this behavior. This clause is, legally speaking, not a law and can be reverted much easier than a regular law.
The main reason for this policy is to try to split the market for "soft drugs" from the one for "hard drugs", this to avoid that users "upgrade" from soft to "hard drugs" (the latter are still illegal). So in short, the law tries to prevent citizen's exposure to hard drugs by providing a legal context in which to purchase cannabis. The policy also allows the police to focus on the war on hard drugs and criminal trade, and avoid the exhaustive bureaucratic costs associated with low-profile possession busts. In fact, most major cities in the world have similar non-prosecution policies, but the Dutch one is the only nationwide one.
Growing marijuana and hashish for commercial purposes is still officially illegal (it is legal to own up to four plants per household), causing coffee shop owners to rely on illegal homegrown products. Only two state run companies are exempted from this rule in order to grow marijuana for medicinal purposes. Leftist movements have stated that the government should make its mind up: "either make growing marijuana and hashish legal, or ban soft drugs altogether".
Some argue that the legal status of soft drugs has had no significant adverse effects on Dutch society.[Who says?] This is probably due to the fact that it has become a more or less socially accepted drug like alcohol and tobacco, removing the need for dealers and effectively terminating cannabis' status as an anti-establishment symbol, and in effect diminishing its' popularity somewhat amongst youth. Some disagree:
• The head of Holland’s best-known drug abuse rehabilitation center has described what the new drug culture has created: The strong form of marijuana that most of the young people smoke, he says, produces "a chronically passive individual—someone who is lazy, who doesn’t want to take initiatives, doesn’t want to be active—the kid who’d prefer to lie in bed with a joint in the morning rather than getting up and doing something." [1]
Queen's Day
April 30th is known as Queen's Day - the national holiday to mark the official birthday of the monarch. This is actually the birthday of former Queen Juliana (Queen Beatrix's mother) but has been kept as the official holiday because of the better weather (Queen Beatrix's actual birthday is 31 January). Queen's Day is the one day of the year when ordinary Netherlanders are permitted to sell goods on the streets without a license. Consequently the whole country is turned into a gigantic flea market (garage sale). The primary effect of this is that people buy goods they do not want or need, solely in order to sell them the following year. In an act of patriotism, most of the populace wear orange colored clothing (the national color) to identify with the Royal House Of Orange-Nassau.
Those not involved with selling their surplus belongings celebrate the national holiday at outdoors parties in the cities or with fine weather, spend the free day on a terrace of a pub, or cycle in the national Fietsen op Dijken tour around the nation's dikes.
Anne Frank
Anne Frank was a famous Jewish girl who hid from Nazis in the house of friends in Amsterdam. She wrote a diary which was later published and became a best seller. Her family left Germany in 1933 because of the Nazis, but the Nazis caught up with her and sent her to Belsen death camp where she died before end of war in 1945. Anne Frank's house in Amsterdam is now a popular tourist attraction.
Same sex marriage has been recognized by the Dutch government since 2001.[1] Furthermore, legal prostitution, euthanasia, abortion and its drug policy (see above) make The Netherlands the most liberal country in the world by most standards. Religion was once the dominant factor in Dutch society and politics, but since the 1970s plays a secondary role in society, with only 9% of the population being Protestant (2009) and just under 30% are Roman Catholics. There is, however, a rising Muslim population (4%) which has caused social strains. An overall decline in religion can be seen as of 2004. These days The Netherlands are considered one of the least churchgoing countries in Europe.
See also
Current conditions
• Delsen, Lei. Exit Polder Model? Socioeconomic Changes in the Netherlands (2002) online edition
• Mathijs, Ernest, ed. The Cinema of the Low Countries. (2004). 268 pp.
• Vuijsje, Herman. The Politically Correct Netherlands: Since the 1960s. (2000). 244 pp.
• White, Colin, et al. The Undutchables: An Observation of the Netherlands, Its Culture And Its Inhabitants (2005)
History surveys
• Arblaster, Paul. A History of the Low Countries. (2006). 298 pp.
• Hooker, Mark T. The History of Holland (1999) 264pp excerpt and text search
• Israel, Jonathan. The Dutch Republic: Its Rise, Greatness, and Fall, 1477-1806 (1995) a major synthesis; complete online edition; also excerpt and text search
• van Oostrom, Frits, and Hubert Slings. A Key to Dutch History (2007)
• Pirenne, Henri. Belgian Democracy, Its Early History (1910, 1915) 250 pp. history of towns in the Low Countries online free
• Rietbergen, P.J.A.N. A Short History of the Netherlands. From Prehistory to the Present Day. 5th ed. Amersfoort: Bekking, 2002. ISBN 9061094402
• Vlekke, Bernard H. M. Evolution of the Dutch Nation (1945) 382 pp. online edition
Online resources | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '34', 'language_id_whole_page_fasttext': "{'en': 0.9539063572883606}", 'metadata': "{'Content-Length': '51775', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:7QE73UPBHYSUTVK5NUR4HVUUNUQY4HLP', 'WARC-Concurrent-To': '<urn:uuid:7d9015c8-3242-4f37-b6c8-6d62e505f5be>', 'WARC-Date': datetime.datetime(2017, 10, 18, 6, 2, 55), 'WARC-IP-Address': '65.60.9.250', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:BSHHPEFTMZAPADIELSI6TGCLPIMREL7Y', 'WARC-Record-ID': '<urn:uuid:f4f85296-254f-4d3a-8d2b-ed9fc5f0e3b6>', 'WARC-Target-URI': 'http://www.conservapedia.com/index.php?title=Netherlands&oldid=994060', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:737c67de-40fe-4eb9-9770-4e025e437c1b>', 'WARC-Truncated': 'length'}", 'previous_word_count': '2260', 'url': 'http://www.conservapedia.com/index.php?title=Netherlands&oldid=994060', 'warcinfo': 'robots: classic\r\nhostname: ip-10-51-200-95.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-43\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for October 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06210672855377197', 'original_id': '57a307ace456acce3534597f159bd6c0b70f2ec55c7fda2260f56223a29e2742'} |
Abstract
Bacteria contain DNA polymerase I (PolI), a single polypeptide chain consisting of ∼930 residues, possessing DNA-dependent DNA polymerase, 3′-5′ proofreading and 5′-3′ exonuclease (also known as flap endonuclease) activities. PolI is particularly important in the processing of Okazaki fragments generated during lagging strand replication and must ultimately produce a double-stranded substrate with a nick suitable for DNA ligase to seal. PolI's activities must be highly coordinated both temporally and spatially otherwise uncontrolled 5′-nuclease activity could attack a nick and produce extended gaps leading to potentially lethal double-strand breaks. To investigate the mechanism of how PolI efficiently produces these nicks, we present theoretical studies on the dynamics of two possible scenarios or models. In one the flap DNA substrate can transit from the polymerase active site to the 5′-nuclease active site, with the relative position of the two active sites being kept fixed; while the other is that the 5′-nuclease domain can transit from the inactive mode, with the 5′-nuclease active site distant from the cleavage site on the DNA substrate, to the active mode, where the active site and substrate cleavage site are juxtaposed. The theoretical results based on the former scenario are inconsistent with the available experimental data that indicated that the majority of 5′-nucleolytic processing events are carried out by the same PolI molecule that has just extended the upstream primer terminus. By contrast, the theoretical results on the latter model, which is constructed based on available structural studies, are consistent with the experimental data. We thus conclude that the latter model rather than the former one is reasonable to describe the cooperation of the PolI's polymerase and 5′-3′ exonuclease activities. Moreover, predicted results for the latter model are presented.
There are no comments yet on this publication. Be the first to share your thoughts. | mini_pile | {'original_id': 'b160f71cf305eda50265d06480bd1fa78537fd0152026674a4944fc33f034a5e'} |
Q:
declaring a global dynamic variable in python
I'm a python/programming newbie and maybe my question has no sense at all.
My problem is that I can't get a variable to be global if it is dynamic, I mean I can do this:
def creatingShotInstance():
import movieClass
BrokenCristals = movieClass.shot()
global BrokenCristals #here I declare BrokenCristals like a global variable and it works, I have access to this variable (that is a shot class instance) from any part of my script.
BrokenCristals.set_name('BrokenCristals')
BrokenCristals.set_description('Both characters goes through a big glass\nand break it')
BrokenCristals.set_length(500)
Fight._shots.append(BrokenCristals)
def accesingShotInstance():
import movieClass
return BrokenCristals.get_name()#it returns me 'BrokenCristals'
but if instead of doing that I declare a string variable like this:
def creatingShotInstance():
import movieClass
a = 'BrokenCristals'
vars()[a] = movieClass.shot()
global a #this line is the only line that is not working now, I do not have acces to BrokenCristals class instance from other method, but I do have in the same method.
eval(a+".set_name('"+a+"')")
eval(a+".set_description('Both characters goes through a big glass\nand break it')")
eval(a+".set_length(500)")
Fight._shots.append(vars()[a])
def accesingShotInstance():
import movieClass
return BrokenCristals.get_name()#it returns me 'BrokenCristals is not defined'
I tried this :
global vars()[a]
and this:
global eval(a)
but It gives me an error. What should I do?
A:
For completeness, here's the answer to your original question. But it's almost certainly not what you meant to do -- there are very few cases where modifying the scope's dict is the right thing to do.
globals()[a] = 'whatever'
A:
Instead of a dynamic global variable, use a dict:
movies = {}
a = 'BrokenCristals'
movies[a] = movieClass.shot()
movies[a].set_name(a)
# etc
| mini_pile | {'original_id': '93bc68841147a867dfd9dbaba13e965974b0c5df0512572cd45c9d67393f1890'} |
Take the 2-minute tour ×
During a job interview, I was asked to explain why the repository pattern isn't a good pattern to work with ORMs like Entity Framework. Why is this the case?
share|improve this question
migrated from stackoverflow.com Dec 28 '12 at 14:53
This question came from our site for professional and enthusiast programmers.
it was a trick question – Omu Dec 12 '12 at 21:34
I would probably have answered to the interviewer that Microsoft use the repository pattern very often while they demonstrate the entity framework :| . – Laurent Bourgault-Roy Dec 28 '12 at 17:12
So what was the interviewer's reason for it not being a good idea? – Bob Horn Dec 30 '12 at 15:42
The funny fact is that searching for "repository pattern" in Google gives the results which are mostly related to Entity Framework and how to use the pattern with EF. – MainMa Dec 31 '12 at 18:43
check ayende's blog ayende.com/blog. Base on what I know, he used to use Repository Pattern but eventually gave it up in favor of the Query Object Pattern – Daskul Feb 2 at 8:30
6 Answers 6
up vote 30 down vote accepted
I don't see any reason for Repository pattern to NOT work with Entity Framework. Repository pattern is an abstraction layer you put on your data access layer. Your data access layer can be anything from pure ADO.NET stored procedures to Entity Framework or an XML file.
In large systems, where you have data coming from different sources (database/ XML /Web service), It is good to have an abstraction layer. Repository pattern works well in this scenario. I do not believe Entity framework is enough abstractive to hide what is going behind the scene.
I have used Repository pattern with Entity Framework as my data access layer method and am yet to face a problem.
Another advantage of abstracting the db context with a Repository is unit testability, You can have your iRepositary interface to which has 2 implentation, one (the real Repositary) which uses dbContext to talk to the database and the second, FakeRepositary which can return in memory objects/mocked data. This makes your IRepositary unit testable, thus other parts of code which uses IRepositary
share|improve this answer
I didn't said it will not work , I am also worked with repository pattern with EF , but today I was asked why IT IS NOT GOOD to use the pattern with DataBase , application that using Database – StringBuilder Dec 12 '12 at 21:08
Ok , since this is the most popular answer I'll chose it as Correct Answer – StringBuilder Dec 15 '12 at 12:21
When was the last time that most popular == correct? – HDave Aug 30 '13 at 19:16
DbContext is already a repository, the repository is meant to be a low level abstraction. If you want to abstract different data sources create objects to represent those. – Daniel Little Dec 3 '13 at 4:34
There are many reasons not to use Repository pattern with OR Mappers. It's two years after this answer was given. Now you can find all of them easily on Google. – Peri Mar 5 at 23:09
The single best reason to not use the repository pattern with Entity Framework? Entity Framework already implements a repository pattern. DbContext is your UoW (Unit of Work) and each DbSet is the repository. Implementing another layer on top of this is not only redundant, but makes maintenance harder.
People follow patterns without realizing the purpose of the pattern. In the case of the repository pattern, the purpose is to abstract away the low-level database querying logic. In the old days of actually writing SQL statements in your code, the repository pattern was a way to move that SQL out of individual methods scattered throughout your code base and localize it in one place. Having an ORM like Entity Framework, NHibernate, etc. is a replacement for this code abstraction, and as such, negates the need for the pattern.
However, it's not a bad idea to create an abstraction on top of your ORM, just not anything as complex as UoW/repostitory. I'd go with a service pattern, where you construct an API that your application can use without knowing or caring whether the data is coming from Entity Framework, NHibernate, or a Web API. This is much simpler, as you merely add methods to your service class to return the data your application needs. If you were writing a To-do app, for example, you might have a service call to return items that are due this week and have not been completed yet. All your app knows is that if it wants this information, it calls that method. Inside that method and in your service in general, you interact with Entity Framework or whatever else you're using. Then, if you later decide to switch ORMs or pull the info from a Web API, you only have to change the service and the rest of your code goes along happily, none the wiser.
It may sound like that's a potential argument for using the repository pattern, but the key difference here is that a service is a thinner layer and is geared towards returning fully-baked data, rather than something that you continue to query into, like with a repository.
share|improve this answer
This appears to be the only correct answer. – Mike Chamberlain Jan 16 at 23:29
This is something I have been wondering as well, as it was my thought too that the DbContext is the Unit of Work, so there's no need to create a layer above it that essentially just delegates back to an internal instance of DbContext. About the only reason I can see for having an abstraction layer is that you can't mock DbContext, so you have to rely on an actual database with data to do unit/integration testing. – Wayne M Jan 24 at 15:01
You can mock DbContext in EF6+ (see: msdn.microsoft.com/en-us/data/dn314429.aspx). Even in lesser versions, you can use a fake DbContext-like class with mocked DbSets, since DbSet implements an iterface, IDbSet. – Chris Pratt Mar 6 at 0:23
this description sounds more like my idea of a repository layer. a wrapper that has methods that return and act on data entities. I guess my repos are pretty thin to begin with – TheZenker Mar 26 at 12:10
@TheZenker, you may not have been exactly following the repository pattern. The strictest difference is the return value. Repositories return queryables, whereas services should return enumerables. Even that's not really that black and white, as there's some overlap there. It's more in how you use it. A repository should just return the set of all objects, which you then further query into, while the service should return the final dataset, and should not support further querying. – Chris Pratt Mar 27 at 14:31
Here's one take from Ayende Rahien: Architecting in the pit of doom: The evils of the repository abstraction layer
I'm not sure yet whether I agree with his conclusion. It's a catch-22 - on the one hand, if I wrap my EF Context in type-specific repositories with query-specific data retrieval methods, I am actually able to unit test my code (sort of), which is almost impossible with Entity Framework alone. On the other hand, I lose the ability to do rich querying and semantic maintenance of relationships (but even when I have full access to those features I always feel like I'm walking on egg shells around EF or any other other ORM I might choose, since I never know what methods its IQueryable implementation might or might not support, whether it will interpret my adding to a navigation property collection as a creation or merely an association, whether it is going to lazy or eager load or not load at all by default, etc., so maybe this is for the better. Zero-impedance object-relational "mapping" is something of mythological creature - maybe that is why the latest release of Entity Framework was codenamed "Magic Unicorn").
However, retrieving your entities through query-specific data retrieval methods means that your unit tests are now essentially white-box tests and you have no choice in this matter, since you must know in advance exactly which repository method the unit under test is going to call in order to mock it. And you're still not actually testing the queries themselves, unless you also write integration tests.
These are complex problems that need a complex solution. You can't fix it by just pretending that all your entities are separate types with no relationships between them and atomize them each into their own repository. Well you can, but it sucks.
Update: I have had some success using the Effort provider for Entity Framework. Effort is an in-memory provider (open source) that allows you to use EF in tests exactly the way you would use it against a real database. I am consider switching all the tests in this project I'm working to use this provider, since it seems to make things so much easier. It is the only solution I've found so far that addresses all of the issues that I was ranting about earlier. Only thing is there is a slight delay when starting my tests as it's creating the in-memory database (it uses another package called NMemory to do this), but I don't see this as a real problem. There's a Code Project article that talks about using Effort (versus SQL CE) for testing.
share|improve this answer
Any architecture article without mentioning unit test are automatically sent to the trash bin for me. One of the point of repository pattern is to gain some test-ability. – Sleeper Smith Feb 19 '13 at 6:06
You can still have unit tests without wrapping the EF Context (which is already a repository). You should be unit testing your domain / services not database queries (they're integration tests). – Daniel Little Dec 3 '13 at 4:36
EF's testability has improved greatly in version 6. You may now fully mock DbContext. Regardless, you could always mock DbSet, and that's the meat of Entity Framework, anyways. DbContext is little more than a class to house your DbSet properties (repositories) in one location (unit of work), especially in a unit testing context, where all the database initialization and connection stuff is not wanted or needed anyways. – Chris Pratt Mar 6 at 0:29
The reason why you probably would do that is because it's a little redundant. Entity Framework gives you a wealth of coding and functional advantages, that's why you use it, if you then take that and wrap it in a repository pattern you are throwing those advantages away, you might as well be using any other data access layer.
share|improve this answer
In theory I think it makes sense to encapsulate the database connection logic to make it more easily reusable, but as the link below argues, our modern frameworks essentially take care of this now.
Reconsidering the Repository Pattern
share|improve this answer
I liked the article , but IMHO for enterprise apps , the abstraction layer between DAL and Bl MUST Have feature , since you couldn't know what exactly will be used tomorrow. But thanks for sharing the link – StringBuilder Dec 12 '12 at 21:15
While personally I think it's true for e.g. NHibernate (ISessionFactory and ISession are easily mockable), it's not that easy with DbContext, unfortunately... – Patryk Ćwiek Dec 28 '12 at 23:02
A very good reason to use the repository pattern is to allow the separation of your business logic and/or your UI from System.Data.Entity. There are numerous advantages to this, including real benefits in unit testing by allowing he use of Fakes or Mocks.
share|improve this answer
Your Answer
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '30', 'language_id_whole_page_fasttext': "{'en': 0.9295244216918944}", 'metadata': "{'Content-Length': '114203', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:P3VZJ3L72RWZQZHO6OOU6EIGN4LVIUJG', 'WARC-Concurrent-To': '<urn:uuid:f695a4b2-d49b-4f08-acdf-0ff54e398379>', 'WARC-Date': datetime.datetime(2014, 10, 31, 9, 7, 38), 'WARC-IP-Address': '198.252.206.16', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:B6BUCHCXOK4XAI73P6GJ3IMATOKJH45Q', 'WARC-Record-ID': '<urn:uuid:40f96852-e30d-4596-92f2-2a3d4fa99f7f>', 'WARC-Target-URI': 'http://programmers.stackexchange.com/questions/180851/why-shouldnt-i-use-the-repository-pattern-with-entity-framework/180853', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2a6e64d8-9d87-4d55-85be-a094e00437a1>', 'WARC-Truncated': None}", 'previous_word_count': '1967', 'url': 'http://programmers.stackexchange.com/questions/180851/why-shouldnt-i-use-the-repository-pattern-with-entity-framework/180853', 'warcinfo': 'robots: classic\r\nhostname: ip-10-16-133-185.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-42\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for October 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.12293171882629395', 'original_id': 'c0120f57b10c61f00b156c951198111021f64b362eefd3fd43a7910b179e32bd'} |
Tell me more ×
I'm working on a multi-user, multi-account App where 1 account can have n users. It is very important that every user can only access info from its account. My approach is to add an account_id to every model in the DB and than add a filter in every controller to only select objects with the current account_id. I will use the authorization plugin.
Is this approach a good idea?
What is the best way to always set the account_id for every object that is created without writing
object.account = @current_account
in every CREATE action? Maybe a filter?
Also I'm not sure about the best way to implement the filter for the select options. I need something like a general condition: No matter what else appears in the SQL statement, there is always a "WHERE account_id = XY".
Thanks for your help!
share|improve this question
add comment
4 Answers
up vote 5 down vote accepted
This is similar to a User.has_many :emails scenario. You don't want the user to see other peoples emails by changing the ID in the URL, so you do this:
@emails = current_user.emails
In your case, you can probably do something like this:
class ApplicationController < ActionController::Base
def current_account
@current_account ||= current_user && current_user.account
# In an imagined ProjectsController
@projects = current_account.projects
@project = current_account.projects.find(params[:id])
share|improve this answer
Well, I could do that and use my current_account method, but than I have to change every action. Isn't there an easier way? I even thought about patching the find / create method, because I'm always setting the same value (for one logged in user). – Øle Bjarnstroem Apr 27 '09 at 7:19
Doing it in every action is not a problem. It's a one-time only effort, and it takes you, what, 5 minutes? It also makes your code easy to understand -- it's right there, you don't have to look at the abstractions. – August Lilleaas Apr 27 '09 at 9:14
It is a little more than 5 min, but after a lot of hassle and monkeypathing with my solution I will just do it the rails way. Thanks. – Øle Bjarnstroem Apr 27 '09 at 10:45
add comment
To answer your second question, check out the new default_scope feature in Rails 2.3.
share|improve this answer
great, exactly what I needed! – Øle Bjarnstroem Apr 27 '09 at 9:20
add comment
I know, I know, if you access Session-variables or Instance variables in your Model you didn't understand the MVC pattern and "should go back to PHP". But still, this could be very useful if you have - like us - a lot of controllers and actions where you don't always want to write @current_account.object.do_something (not very DRY).
The solution I found is very easy:
Step 1: Add your current_account to Thread.current, so for example
class ApplicationController < ActionController::Base
before_filter :get_current_account
def get_current_account
# somehow get the current account, depends on your approach
Thread.current[:account] = @account
Step 2: Add a current_account method to all your models
ActiveRecord::Base.class_eval do
def self.current_account
Step 3: Voilá, in your Models you can do something like this:
class MyModel < ActiveRecord::Base
belongs_to :account
# Set the default values
def initialize(params = nil)
self.account_id ||=
You could also work with something like the before_validation callback in active_record and then make with a validation sure the account is always set.
The same approach could be used if you always want to add the current_user to every created object.
What do you think?
share|improve this answer
As I commented above, stating it in every action is not a problem. It's a one-time job, and it doesn't take long. – August Lilleaas Apr 27 '09 at 9:15
add comment
I understand that you don't want to bother about scoping you account all time. Lets be honest, it's a pain in the a**.
To add a bit magic and have this scoping done seamlessly give a look at the following gem
Hope this helps,
-- Sebastien Grosjean - ZenCocoon
share|improve this answer
Some combination of SO / Firefox means that link doesn't work for me - it 404s. Alternative link to the same location: – NeilS Nov 11 '09 at 13:58
Thanks for the url fix NeilS. – Sébastien Grosjean - ZenCocoon Nov 12 '09 at 19:11
add comment
Your Answer
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '22', 'language_id_whole_page_fasttext': "{'en': 0.8808056712150574}", 'metadata': "{'Content-Length': '65239', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:LSMZSKYEBVTSMZF5H5X3PWGKRC3Q7LLA', 'WARC-Concurrent-To': '<urn:uuid:50f2242f-1ff0-487c-b6de-34058289eab5>', 'WARC-Date': datetime.datetime(2013, 12, 13, 13, 26, 45), 'WARC-IP-Address': '198.252.206.16', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:PK6MSSV7LZSVEHVEK4XZYYN6FE2D4S3R', 'WARC-Record-ID': '<urn:uuid:299fc255-fd0e-41d5-8dda-31f9e8572c1e>', 'WARC-Target-URI': 'http://stackoverflow.com/questions/792475/how-to-always-set-a-value-for-account-scope-in-rails', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:99952b20-0d1b-4bbc-814d-f458f868c303>', 'WARC-Truncated': None}", 'previous_word_count': '723', 'url': 'http://stackoverflow.com/questions/792475/how-to-always-set-a-value-for-account-scope-in-rails', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.2259116768836975', 'original_id': '03ea2263a0db5bd586b7fe277c108b9fdc0fb4b03a4523193a42df91f0d8c0b1'} |
Pakistan protests against India's MFN status
Pakistan's pharma sector objects to MFN status to IndiaPak is apprehensive that if it allows pharma products import from India, local producers' livelihood might get impacted
Pakistan alleges that India does not follow the necessary drug regulation policies as prescribed by the World Health Organization (WHO) and should not be granted most-favoured nation (MFN) status
New Delhi: Pharmaceutical industry associations in Pakistan have protested against the granting of most-favoured nation (MFN) status to India alleging that India does not follow the necessary drug regulation policies as prescribed by the World Health Organization (WHO).
Furthermore, Pakistan is concerned that if it allows import of pharmaceuticals from India, business of local producers will get hindered, moreso because the pharma industry in Pakistan is at a nascent stage and is highly unorganised. It is expected that Pakistan will allow the import of only those drugs from India that are approved by the European pharmacopoeia.
Pakistan, in an effort to liberalize trade relations with India, for the first time ever issued a negative list of items that India cannot export to Pakistan. The list, which has been operational from March 2012, contains 1,209 items. Under the pharmaceuticals products category in this list, as many as 49 items were banned.
Some of the items that are banned include ibuprofen, paracetamol, penicillin, ampicillin, antibiotics containing insulin, eye drops, ointments and vaccines for veterinary medicine among others. If a MFN status is granted to India, the negative list will eventually be phased out. | mini_pile | {'original_id': 'd1c27e673650145bc8cf341531bd1dd74eb425e4521c5003cbf988a005984830'} |
Creative Nonfiction Prize
Meet the readers: Andris Taskans
We're introducing you to the 10 talented Canadian writers who helped narrow down the 2,300+ entries for the 2011-2012 CBC Creative Nonfiction Prize into the longlist.
Today, the founding editor of Prairie Fire on the value of holding on to your work until it's truly ready.
I live in Winnipeg and mostly I write grant applications and reports.
What's your day job?
I am the editor of Prairie Fire, a literary magazine I helped found in 1978.
What's your literary street cred?
I'm not sure I have any "street cred".
Why did you want to be a reader for the CBC Creative Nonfiction Prize?
One of my colleagues was a reader for the Fiction Prize a few years ago and said the money was good.
What do you like most about nonfiction?
I like that it obliges the writer to pay at least a modest amount of attention to the world as it is.
Where did you read the entries?
At home, in my living room and in my study.
When you're reading hundreds of stories and trying to choose the most exceptional ones, what are you looking for?
I'm looking for language that is fresh, characters and incidents that stay with me, a distinctive voice, something new.
As I recall, "Temp" started in a low key but as it progressed, told a compelling story of the ability of art (music, literature) to foster human relationships even in soul-destroying workplaces. The writer had a terrific ability to sketch characters in a few words. This story went up in my estimation every time I read it.
"The Year of Falling Apart" is the most poetic of my choices. It achieves its emotionally intense effect through a combination of repetition and progression, with well chosen language.
"The Man Who Invented Journalism" uses journalism's virtue of brevity to tell an intensely compact personal story enlivened with vivid vignettes.
What is it about a story that makes you put it in the YES pile?
At the simplest level, I have to enjoy reading it. For me, that means it has to be well written but also has to have a compelling subject.
Having read all these stories, do you have tips, any dos and don'ts for story writers?
I think too many writers send out their work before it's ready. If they've read or listened to previous winning stories, they've learned little or nothing from them. If you, the writer, can't tell the difference between your subpar effort and something that's been lauded, you haven't finished learning your craft.
What did you enjoy most about the experience?
Well, there's something bracing about reading so much in so short a time. I'm pleased that I can still remember the best and a few of the worst, too.
Andris Taskans is a founding editor of Prairie Fire magazine and a founding member of the Manitoba Writers' Guild. He was presented with the Lifetime Achievement Award at the 2008 Western Magazine Awards and received the Making a Difference Award at the Winnipeg Arts Council's Mayor's Luncheon for the Arts in 2009. He has published one poetry chapbook, Jukebox Junkie.
Comments are closed. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '8', 'language_id_whole_page_fasttext': "{'en': 0.9688489437103271}", 'metadata': "{'Content-Length': '43725', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ICYAVQNEJ4F6QWCKKJWVBT46FT3VN5AO', 'WARC-Concurrent-To': '<urn:uuid:8d4ba9c6-9027-49dc-9ebb-efbfd31c9851>', 'WARC-Date': datetime.datetime(2013, 12, 20, 8, 0, 21), 'WARC-IP-Address': '23.15.7.96', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:4DO56VY6NR7AZRG5TULJZISQLTTDCDKP', 'WARC-Record-ID': '<urn:uuid:04770398-be03-49ec-b944-c4bf4cc3740e>', 'WARC-Target-URI': 'http://www.cbc.ca/books/canadawrites/2012/07/meet-the-readers-andris-taskans.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:67faa155-7afa-4bde-b5c7-0ff28fa41d7e>', 'WARC-Truncated': None}", 'previous_word_count': '556', 'url': 'http://www.cbc.ca/books/canadawrites/2012/07/meet-the-readers-andris-taskans.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.0793042778968811', 'original_id': 'd1cd930b7cbd1554165948487b189570e7b299ffbad4aa4fb9567eb3ef5d206d'} |
Open Source
Scilla Systems values the importance of the Open Source Community and has made available the files below in compliance with the applicable licenses. These files are distributed WITHOUT ANY WARRANTY and are subject to the copyrights of the original authors and other copyright holders.
Scilla Systems does not provide support for the files. The entire risk as to the quality and performance of the program is with you, the end-user. Should the program prove defective, you assume the cost of all necessary servicing, repair or correction.
NOTICE: Use of these open source packages may require payment of patent royalties. You should consider this issue before you start building derivative works. Scilla Systems is not warranting or indemnifying you in any way for patent royalties. | mini_pile | {'original_id': '58329a51d62d4cda46830ae6bc3be277b9a726984ddb529cc9010d19dd216da3'} |
welcome to venus
Super Speciality Hospital
VENUS super specialty hospital, a one of its kind exclusive super specialty hopital was started in Baroda in 2010 January. The fusion of 3 different super-specialties (Vascular surgery, Neurosurgery and Urology Superspecialty) was the basis for naming it VENUS.
The five core doctors in our team wish to provide up to date ethical treatment to patients as well as maintain our academic considerations within the doctor community.
After a successful completion of 3 years in our previous address, we have now upgraded and shifted to our new hospital with better and updated infrastructure.
Affordable Health Care
With ever-inceasing cost of building and maintaining hospital infrastructure, the medical and surgical treatment costs have augmented exponentially over the years and the final burden falls on the patient. Super-specialty surgical treatment is often considered by people as synonymous with expensive healthcare as it involves super-specialist doctors, expensive medical equipment and high-quality infrastructure.
We, at VENUS hospital are committed to provide affordable state of the art treatment to our patients, irrespective of their finacial or social status. Our goal is to "make super-specialty treatment better yet reasonably priced". | mini_pile | {'original_id': '0a2b11b4911e92d94e0a90ea6051e1d92cb5ec98ce95041e72e636984010f948'} |
WorkBoard, a SaaS platform that helps companies assess their strategic plans, raises $23M Series B led by GGV after it more than tripled total revenue last year
Ashley Rodriguez / Quartz:
Stephen O'Grady / Redmonk:
A Redmonk study, combining GitHub and Stack Overflow data, finds TypeScript, Kotlin, and Julia usage is up, while Go, R, Scala, Clojure, Groovy usage is down — This iteration of the RedMonk Programming Language Rankings is brought to you by IBM. From Java to Node.js, IBM remains at the forefront of open source innovation.
Zack Whittaker / TechCrunch: | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '18', 'language_id_whole_page_fasttext': "{'en': 0.8587625026702881}", 'metadata': "{'Content-Length': '21472', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:P5J2W6EIOJNPZX2K6275BVERTBK3TAQC', 'WARC-Concurrent-To': '<urn:uuid:04000e21-6414-4b67-b54e-f7c0177277b8>', 'WARC-Date': datetime.datetime(2019, 11, 15, 1, 15, 38), 'WARC-IP-Address': '3.228.157.109', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:IGZA5BLN2GFFKJDR4SR7E4FZWIL3LQFE', 'WARC-Record-ID': '<urn:uuid:6d11b227-a743-4e42-a7c8-3e27bf201391>', 'WARC-Target-URI': 'https://www.tefter.io/bookmarks/88472/readable', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ccd73a4b-4409-4399-ab88-c8367b918d04>', 'WARC-Truncated': None}", 'previous_word_count': '88', 'url': 'https://www.tefter.io/bookmarks/88472/readable', 'warcinfo': 'isPartOf: CC-MAIN-2019-47\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-165.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.022469818592071533', 'original_id': '13e59284cc1beb6b3561babf0762fd94b0e4e4416ddc8853c0e767f095ed54de'} |
Tuesday, 8 November 2016
Leros (Greek: Λέρος) is a Greek island and municipality in the Dodecanese in the southern Aegean Sea. It lies 317 kilometres (171 nautical miles) from Athens's port of Piraeus, from which it can be reached by an 8.5-hour ferry ride (or by a 45-minute flight from Athens). Leros is part of the Kalymnos regional unit. The island has been also called in Italian: Lèro and in Turkish: İleriye.
The island is 74 square kilometres and has a coastline of 71 kilometres. The municipality includes the populated offshore island of Farmakonisi (pop. 10), as well as several uninhabited islets, including Levitha and Kinaros, and had a 2011 census population of 7,917, although this figure swells to over 15,000 during the summer peak. It is known for its imposing medieval castle of the Knights of Saint John possibly built on a Byzantine fortress.
Nearby islands are Patmos, Lipsi, Kalymnos, and the small islands of Agia Kyriaki and Farmakos. In ancient times it was considered the island of Parthenos Iokallis and linked to the Hellenistic and Roman literature on Meleager and the Meleagrides. The administrative centre and largest town is Agia Marina, with a population of 2,672 inhabitants. Other sizable towns are Lákki (pop. 1,990), Xirókampos (908), Kamára (573), and Álinda (542).
This post is part of the Our World Tuesday meme,
and also part of the Ruby Tuesday meme,
and also part of the Travel Tuesday meme,
and also part of the Wordless Wednesday meme.
1. Isn't that lovely?
2. Beautiful image. Greece looks lovely. :)
3. I love Greece so much. I can't wait to go back there next year
4. What a beautiful shot! Very good perspective. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '34', 'language_id_whole_page_fasttext': "{'en': 0.9388798475265504}", 'metadata': "{'Content-Length': '100891', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:OB2ZALQ3QVSKAFZYJ5ST6NND4DCMHVTG', 'WARC-Concurrent-To': '<urn:uuid:20bcc631-a963-4ff9-8c83-130db12430b0>', 'WARC-Date': datetime.datetime(2019, 6, 16, 3, 36), 'WARC-IP-Address': '172.217.15.65', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:U5TUWVJR57JCIKQSS33DR7HUQXCGENQ7', 'WARC-Record-ID': '<urn:uuid:75b8fc6b-98a6-46ca-866a-0e8d009717ef>', 'WARC-Target-URI': 'http://mydesktopdaily.blogspot.com/2016/11/desktop-1197-leros-greece.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:cbe79d58-bff1-4e77-9a41-925273608d3a>', 'WARC-Truncated': None}", 'previous_word_count': '290', 'url': 'http://mydesktopdaily.blogspot.com/2016/11/desktop-1197-leros-greece.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-26\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for June 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-165-255-234.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04522830247879028', 'original_id': 'de5200174febd5ffee0a4bf8a4782d0020b6bcf88d4cd0dc7b52c4c581ee846d'} |
Key Commands
- Juan Cardj
JUAN CARDJ had his first dishes at 1989, starting like professional Dj arround 1991, have had various names in whole professional way like dj dober or Doberdeejay mixing techno and house music. Was one of the various Djs that made possible the famous Valencian party on the 90's, due to his musical style what is techno, only can act out Spain on international Techno partys or like guest Dj in any Disco. The Quality & technics method in the mixer of this Dj is most than approved, his sessions remarks for his positions serious and relaxed at the dishes but at the same time mixing songs strongest and rotund, powerfull and technic are his personal stamp. Until today he has not any fixed residence at any hall and its open to get offers relation that. One Dj with more than 20 years of experience. LINKS: WEB: SOUNDCLOUD: MIXCLOUD: MYSPACE: | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9731074571609496}", 'metadata': "{'Content-Length': '88878', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:SN54PD6U3MMWLJSWESTPO53PP3IMURUD', 'WARC-Concurrent-To': '<urn:uuid:819bb74e-b357-4a9e-88db-0e593732d49a>', 'WARC-Date': datetime.datetime(2014, 9, 23, 14, 32, 51), 'WARC-IP-Address': '208.92.200.1', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:IHY2VCIQKPRGV2DLMGF7DRLDTZ2KZ7CU', 'WARC-Record-ID': '<urn:uuid:ae036aed-e5db-47cc-91ac-db83592b851e>', 'WARC-Target-URI': 'http://www.beatport.com/artist/juan-cardj/208243', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:7a5f5b49-c427-4f68-aa17-7f9ca6cfcc66>', 'WARC-Truncated': 'length'}", 'previous_word_count': '155', 'url': 'http://www.beatport.com/artist/juan-cardj/208243', 'warcinfo': 'robots: classic\r\nhostname: ip-10-234-18-248.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-41\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for September 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.10405027866363525', 'original_id': '65a9f1f561a23746d6002ba21c01b7536489ebcec1209f8fedefe9c73aa924cf'} |
I've read a bit about SK's relationship with his mother, but there is little mention of his father. I seem to recall his father left early in his life. That must have had an enormous impact on him. Did he ever keep in contact with his father? Don't ever recall him ever discussing it or how much it impacts his writing. I was reading recently that one trait of many overachieving males is the absence or death of a father early in life. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.998738169670105}", 'metadata': "{'Content-Length': '93090', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:GSYW7RLFLK535G3VIUA5IWGPYZ2CYRJK', 'WARC-Concurrent-To': '<urn:uuid:bb8157ac-89e3-44f1-9962-ecbef6f1dd36>', 'WARC-Date': datetime.datetime(2014, 3, 11, 21, 33, 41), 'WARC-IP-Address': '67.192.185.138', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:IXACW7IGANC6TNUIUUPE4TV23OX5GEX7', 'WARC-Record-ID': '<urn:uuid:3086c8ae-f3ca-4b69-87da-a14f0fe77a44>', 'WARC-Target-URI': 'http://www.stephenking.com/community/showthread.php/27730-King-s-Father?p=561725&mode=threaded', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:0133c737-da50-4df5-9a5a-1c0f4baf4e66>', 'WARC-Truncated': None}", 'previous_word_count': '83', 'url': 'http://www.stephenking.com/community/showthread.php/27730-King-s-Father?p=561725&mode=threaded', 'warcinfo': 'robots: classic\r\nhostname: ip-10-183-142-35.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-10\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for March 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.1194617748260498', 'original_id': '86e0647fff739751b3adc8104d64630a0d0f4ea85cee17be4190be9939ac21e7'} |
Study Finds Women See Female Lawmakers As More Competent, Having More Integrity
Enlarge this image toggle caption Chip Somodevilla/Getty Images Chip Somodevilla/Getty Images
This year has brought with it a wave of women interested in running for office, particularly among Democrats. And though Republicans have seen less of a wave, Congress has gained one GOP woman already this year: Georgia's Karen Handel.
A new study hints at where candidates and legislators can find their strongest supporters: Women tend to think more highly of female legislators on a variety of measures. With men, though, it depends on party; Republican men have reservations about the women representing them, whereas Democratic men in some ways rate women more highly than men.
Here is a rundown of what the researchers found, what it means and what it doesn't:
The basics
Mia Costa and Brian Schaffner, political scientists from the University of Massachusetts, Amherst, looked at survey data about Americans' attitudes toward their House members from 2010 through 2014. They narrowed their research down to the pool of Americans whose representatives in the House changed during that period but where the seat did not change party.
This took partisanship out of the question and allowed the researchers to better focus on gender: Whether those Americans' new representatives, though of the same party, were of a different gender.
Within that pool, the researchers studied how people felt about their members of Congress: whether respondents felt well-represented, how they rated their representatives on competency and integrity, and how close they felt to the representatives ideologically. Researchers also studied how often people contacted their congressional representatives — and how a legislator's gender might have affected those things.
What they found
On the whole, women tend to view a female representative as being more competent, having more integrity and representing the district well. They also tend to approve of female legislators more.
Meanwhile, men, on the whole, don't view women and men very differently on these measures.
But these attitudes don't hold steady across parties — Republican women in particular get a boost from fellow women.
"Women rate female Republican legislators more positively than they do male Republican legislators," the researchers write, "but neither women nor men rate Democratic legislators differently based on their gender."
Specifically, Republican women members of Congress got a 10 to 11 percentage point boost in the areas of "approval" and "representing the district well" among women respondents.
Costa and Schaffner also broke down the data based on the party and gender of the respondents.
"While Democratic men evaluate women legislators more favorably, the opposite is true for Republican men," the researchers write. "Republican men are the one group who provide lower evaluations of female elected officials."
Republican men rated women lower in the areas of competence (by around 6 percentage points) and integrity (by just over 7 percentage points).
Potentially related to all of this is the finding that women are less likely to engage with their legislators than men are. In particular, the researchers found that women are less likely to contact female Democratic members of Congress, and that Democratic women are likewise substantially less likely to contact members of Congress.
One guess the researchers had here is that "if women trust that their interests are more often prioritized by female legislators, they may see less of a need to contact them."
And it's possible that some female respondents perceived Democratic women in particular to be focused on things like equal pay and paid family leave, which are often considered "women's issues" and are policy areas that Democratic politicians often champion.
A difference between voting and approving
A caveat here, before going on: It's only one study, and there's plenty more to be mined here.
But in the well-studied field of how gender — both of voters and candidates — impacts politics, this study raises questions about exactly when and why gender does (and doesn't) affect some voters' opinions.
There is already good evidence that in the voting booth, gender just isn't that important, particularly compared with people's strong party allegiances.
"[I]n a more polarized climate, voters assess candidates based on whether there's an R or D next to their name, not on whether or not there's a Y chromosome in their DNA," wrote American University political science professor Jennifer Lawless and George Washington University professor Danny Hayes in May 2016.
"Candidate sex just doesn't matter much," they added.
Hence, the disdainful "I'm not voting with my vagina" attitude among women who voted for Bernie Sanders in the Democratic primary and women who voted for Trump in the general election.
Relatedly, Lawless has also found that a big reason women aren't represented well isn't so much external sexism as is the fact that they just don't run for office as often as men do.
This study doesn't necessarily contradict those findings, Costa said. Rather, this study may provide more depth. Gender may not usually be enough to sway a person's vote from one party to the other. But these results do suggest that gender can influence how satisfied people are with their representatives.
And that could have secondary effects — if gender does affect voter approval, that could affect how a female representative runs her re-election campaign and even how she reaches out to male versus female voters.
One thing the researchers didn't get to study (because they didn't have a large enough pool of data) is how these findings look through the lenses of party and gender at the same time: how Republican women view Republican women, how they view Democratic women, and so on. Figuring out how the data looks when sliced up that way could be a logical next research step. | mini_pile | {'original_id': '0225bcd9e09c629677117f5c62c84c9a504400c02434588bdaf5d2531c8f3818'} |
Strictly Country Magazine logo
Strictly Country Magazine - Nothin' Fancy Title
Capturing history…through song.
By: Gina Kay Singerhouse
He can remember it just like it was yesterday, he and a bunch of the other neighborhood boys would play soldiers. Pots and pans became helmets and sticks became guns. It was a fun time had by all.
He grew up in the heart of Virginia, a state so rich and deep in history. Within her borders, one hundred and twenty-two battles had been fought. She saw so much bloodshed that one would think her waters ran red.
He had studied her history in school, the history of the Civil War. It had peaked his interest so much that all he wanted to do with his life was be a soldier, fighting in some war.
When he turned eighteen, he marched off to the recruiting station. He wanted to be just like those brave and proud men that were depicted upon those posters he saw hung up around town… “Let ‘Em Have It!” “Build And Fight…” “Defend Your Country…” “Want action?”
Oh yeah, he wanted it all! But which branch to choose from? “Come on, pal...Enlist!” That he did. Two years later he was ‘over there’ in the heat of battle. But battle was not like he thought it was.
He had never been out of his state, let alone out of the country. Here he was in some unknown country fighting against some unknown ‘evil.’ He thought that the posters he saw said something about fighting for your country… More like fighting for his life.
Playing soldier as a child, never showed you the real carnages of war. Sure he had snuck into the theatre a few times, but they never showed anyone get blown apart like he saw just a bit ago. In the real war, bullets run out and people die. But most of all, it’s the smell of fear and death that lingers all around.
Every day he prays that he’ll make it back home to Virginia safe and sound. He keeps thinking about his family back home, his mother and father, brothers and sisters.
He thinks back to his childhood days... The best part of playing war back then, was every boy got to go home. Now, all he can think about is how many of these boys won’t be able to go home. Most of all, he thinks about the day when he can lay his weapon down…
To Lay My Weapon Down
(Mike Andes)
I am going far away
I’ll be leaving in the morning
The memories that I carry
Will ease the lonely pain.
For you my dearest sweetheart
I ask you not to worry
Just pray for my safe return
To your loving arms someday.
The dew drops on the hillside
Glisten in the sunlight
Resemblance of a tear drop
Fallen from my eye
I take one more look
At the homeplace I am leaving
Then turn to my loved ones
And softly wave goodbye.
I have never been across the deep wide ocean
I have never stepped upon any foreign ground
And the reason for the war to me is so uncertain
I just pray that I will live to someday lay my weapon down.
Well my body now is tattered
Weakened to the bone
The war they say is over
But the battle’s just begun
I make my final journey
Across this ocean deep
To my homeplace in Virginia
Where my sweetheart waits for me.
I have now been across the deep wide ocean
I have walked a many mile upon a foreign ground
And there is one thing that I know and I am certain
I am ready now to lay my weapon down.
In the heart of Virginia comes a Bluegrass group named Nothin’ Fancy. This group of talented men is made up of Mike Andes, Mitchell Davis, Caleb Cox, Chris Sexton and Tony Shorter. Recently they released their eleventh album called Where I Came From.
“I’ll tell you up front, we are not one of these bands that set out and set a tone for what our album is going to be. Some bands have a theme that they follow. With’s like throwing a handful of darts and seeing where they land.” shares lead vocalist and mandolin player Mike Andes. “With this particular album, it did come together as a theme unexpectedly. With us being from the Shenandoah valley of Virginia and the history that lies there—Lexington, Virginia, a lot of Civil War history there and all of us being right there. We’re all from there…”
The album opens with the title cut which captures the heart and soul of the songs to follow, including “To Lay My Weapon Down.” This is the first of three songs that we have taken from this album and nominated them for the Spirit Award’s Song of The Year Award. It is also one of two to earned a nomination for The Spirit of America Award.
The album continues with a remake of “Andersonville.” Written by Dave Alvin in 1991, the song captures the story of a Confederate prisoner-of-war camp.
Located in Georgia, Andersonville is also known as Camp Sumter. During the Civil War, Andersonville held approximately 45,000 Union prisoners in which 13,000 died. The conditions were so horrific that historians deem it the American Holocaust or American Auschwitz.
“Pretty much every concert we do, somebody comes up and asks that same question and then they’ll tell me about.” replies Mike when asked if he has ever visited the National Historic Site. “Everyone has the same conclusion—it’ll bring you to tears. It’s on my bucket list to do, especially now since we recorded this song.”
Nothin’ Fancy breathes a new life into this classic song with their haunting performance. One can hear the pure raw emotions that Mike performs with.
Another song from this album to hit our list of Songs For Soldiers is “The Legend of Long Mountain.” Caleb Cox teams up with Wade Cox to write a factious account of a Civil War battle that took place upon a hill.
“Well Caleb wrote that song and it’s a fictional song.” shares Andes. “It’s not an actual place, but he and a friend of his…were sitting around one night, jamming or whatever and they wanted to write a song. So they said let’s write a song and be thinking of how it would have felt if there was a battle like up here on this mountain and nobody knew about what happened. So that’s kind of their mindset when they wrote that song.”
As a listener, one can not imagine that this legend is not true as the storyline within the lyrics is bold and introspective.
Bluegrass music is known for capturing the vast stories that are part of the Civil War. However when you are from the heart of where the war took place, it is sure to be in your family blood.
“Yeah if you go back far enough, there’s great, great, great, great grandparents and things that were in the Civil War and again its in our heritage.” tells Mike. “Mitchell our banjo player lives right there in Lexington. I grew up in a small town called Timberville, Virginia, which is very near New Market. New Market they always did a reenactment, the Battle of New Market, every year. So that was huge for me growing up...Chris Sexton, our fiddle player, he loves Civil War history and his dad is a re-enactor in the Civil War stuff so he’s always reading about Generals and battles and things of that nature. He’s probably the biggest buff of us as far as the history of it. But all of us have an interest in it. Mitchell, he’s always studying and watching up stuff on it.”
The second song to earn a nomination for the Spirit Award’s Song of The Year Award and Spirit of America Award is a song about soldiers with “Bus Fare.” Unlike the two previous songs, this one takes place in more modern times as the song speaks about a homeless Veteran.
“Caleb always wanted to write a homeless man song and tie it in with a Veteran…” shares Mike. “Blue Highway recorded a song titled ‘Homeless Man.’ Caleb always loved that song and that’s where he got the idea...he loved that song. He said he always wanted to write one like that.”
The final song to earn a nomination for the Spirit Award’s Song of The Year Award is a fun song called “Daddy Made Moonshine.”
“No, not as far as I know!” laughs Mike when asked if his daddy had made moonshine. “I took this album...when my mom heard it…she’s eighty-seven years old...she’s the cutest thing you ever wanted to see! My dad’s passed. He’s been gone ten years now. Anyway, she said that song on there...Daddy Made’re daddy did not make moonshine! I just looked at her and I said ‘Oh, some things he told us boys he didn’t tell you.’ And she looked at me real funny...I said, ‘No, he didn’t make moonshine.’”
You can vote for these songs in the 22nd Annual Spirit Awards come December 10th.
As for the rest of the album, it is filled with a wide variety of songs including a very haunting remake of The Country Gentlemen’s song called “Bringing Mary Home” and a remake of the Wilburn Brothers’ song “Simon Crutchfield’s Grave” as well as a cover of John Prine’s “The Hobo Song.”
The band includes two more songs that were written by Mike Andes. The first “When I’m With You,” is a beautiful love ballad perfect for any wedding. The second is “Lord Hear My Plea,” a lovely inspirational Gospel song that features Nothin’ Fancy’s tight harmonies.
In the end, Nothin’ Fancy provides the listener with a wide range of songs that will entertain you for hours. Collectively, they have the rare ability to cleverly write delightful and brilliant songs that are well sculpted. More so, they have the ingenuity to capture their local history and bring it to the forefront of their music. This is one album and band that I highly recommend.
Virginia. Sweet home Virginia. If he makes it home, he will never look at her hallowed ground the same. As the soldiers who fought before him and he believes just as the soldiers who will fight after him… each will be counting down the days until they can…
lay their weapon down.
This article was printed in the May / June issue of Strictly Country Magazine.
© 1993 - 2019 Strictly Country Magazine
All Rights Reserved | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '4', 'language_id_whole_page_fasttext': "{'en': 0.9582077860832214}", 'metadata': "{'Content-Length': '81172', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:5GQJEND52J4L6SSCA4C5B5GQACNE3P6J', 'WARC-Concurrent-To': '<urn:uuid:f5a5d873-f96e-488f-9a51-ceb9a8d9e08e>', 'WARC-Date': datetime.datetime(2020, 1, 18, 3, 58, 55), 'WARC-IP-Address': '208.89.138.21', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:LQPVO7FESGQQ5WYVT4RXCY2MEU6PCFJJ', 'WARC-Record-ID': '<urn:uuid:41d4d70e-463b-4b87-9f4b-fc568bdb11cd>', 'WARC-Target-URI': 'http://www.strictly-country.com/nothin%20fancy-tolaymyweapondown.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a5c315e7-e74d-46f6-b658-fc47499ab430>', 'WARC-Truncated': None}", 'previous_word_count': '1748', 'url': 'http://www.strictly-country.com/nothin%20fancy-tolaymyweapondown.html', 'warcinfo': 'isPartOf: CC-MAIN-2020-05\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-62.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.029402971267700195', 'original_id': 'e91c575763bbb35dd292d0342f00adb01395eae6a3c876b0329ffb4ce10da947'} |
Monday, March 19, 2012
Check? No Thanks.
Remember how charities used to send you a nickel or a dime and expect you to be so overwhelmed with gratitude/guilt that you sent them a bunch of money? Today we got a check for $2.00 in the mail from the Christian Appalachian Project. There are no strings attached, unlike say, a check from a credit card company that automatically enrolls you in some overpriced identity protection plan. The enclosed letter says they did it just to get my attention, and I guess they succeeded.
Now let's look at my options:
• Of course I could send money to the charity, but that's not going to happen. My wife already wants to support every animal charity on the planet not to mention every sad case of kids with cancer or cleft palates (I'd send Smile Train twice as much if they'd promise not to send me any more photographs). We're already spread so thin that I question the value of sending $25 to each considering that they will spend $20 trying to convince me to send them more. It would make more sense to send $100 checks to fewer charities instead. Anyway, I guess the point is that although the Christian Appalachian Project got my attention with their gimmick, they won't get any money from me (regardless of whether they are a worthy charity, which I can't judge and won't bother to research).
• I could deposit the check, but -- aside from the obvious guilt factor of taking money from a charity -- making a deposit is a pain in the ass because none of the ATMs around here will accept a deposit for my credit union. I could deposit it online by scanning it, but the credit union's software doesn't run on Windows 7. That means I'd have to disconnect my desktop computer from the Internet and the scanner, boot up my Windows XP laptop (with the added hassle of having to set the date and time because it resets to 1/1/1980 when it's unplugged), connect the Internet and scanner cables to the laptop, scan my check, and finally reconnect the cables to my desktop. Damn, that isn't worth two bucks!
• But if I don't cash it, it's like leaving money on the table. What about this: can I take a $2 tax deduction for not cashing the check, treating it as if I had given $2 to the charity? Isn't not taking it the same as giving it? Seems fair to me, but I'm sure the IRS would disagree.
It would have been so much simpler to just slide a nickel into my pocket.
No comments: | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9695630073547364}", 'metadata': "{'Content-Length': '114140', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:PTWXBYJ53G222RUYUAC5SNG6CNDHV6P5', 'WARC-Concurrent-To': '<urn:uuid:c14f9bd3-d485-4a76-98be-2f1904083fe6>', 'WARC-Date': datetime.datetime(2019, 5, 23, 19, 21, 22), 'WARC-IP-Address': '172.217.15.115', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:G6SVOWLWEUYO6VHW6SFSR4H2MVQLTNZT', 'WARC-Record-ID': '<urn:uuid:edf20390-fdfc-4e25-9bd4-6c59630f8b95>', 'WARC-Target-URI': 'http://blog.davidjohnsen.com/2012/03/check-no-thanks.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ecfd9a0f-e7f2-4603-806e-5b19a6071d21>', 'WARC-Truncated': None}", 'previous_word_count': '433', 'url': 'http://blog.davidjohnsen.com/2012/03/check-no-thanks.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-142-79-158.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.1284223198890686', 'original_id': 'da9aa53bbc316c78cf42bbfdfe05506916e444b8898ac6ab7a45a68adec038bc'} |
WINNIPEG -- A Winnipeg woman received an unpleasant surprise when she opened her latest water bill: it was 20 times higher than her last one.
Kim Heinrichs has lived in her St. Norbert home for nearly two years. She rents it with her son and is responsible for the water bill.
"Most of the time when we started here it was like $96, just over $100 because it's just me and him," said Heinrichs.
Since moving in, her lowest water bill was about $82 while the highest was $323. The latest bill Heinrichs received on Jan. 29 showed she owed $2,299.13.
Kim Heinrichs
(Source: Stephanie Tsicos/ CTV News Winnipeg)
"I cannot make any sense of it. I cannot fathom or wrap my head around it," said Heinrichs. "It's literally keeping me awake at night."
Heinrichs said after she saw the bill, she immediately checked for any leaks both inside and outside her home, and contacted the city's Water and Waste Department.
"He told me to do some testing, which I went about doing, but I can't find any issues," she said.
"I can do a meter test, but it would cost me $104 or something out of my pocket to test the meter. They don't think it's the meter. Or I can have my landlord pay somebody to do some survey."
Kim Heinrichs
(Source: Stephanie Tsicos/ CTV News Winnipeg)
The city said customers who receive a high utility bill as a result of a water leak within their house or building may be eligible for the city's Water Leak Credit program.
"A leak as small as 1/16 inch could add $14 per day to a customer's water bill," said a city spokesperson in an email to CTV News.
The city said along with providing regular meter readings, customers should also perform basic leak checks on a regular basis.
Heinrichs said she plans on fighting the bill and hopes the next one won't be nearly as high.
"If somebody can give me a reason as to why it would happen, then maybe it wouldn't be such a hard pill to swallow, but it's like somebody came in here and robbed $2,400 of my money," said Heinrichs.
"I don't have that kind of money. I'm not paying that bill." | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9856396317481996}", 'metadata': "{'Content-Length': '154126', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:GPT44WLRLXW6HU2G663OJEFL4OQBHCQ6', 'WARC-Concurrent-To': '<urn:uuid:70a7d7d0-94da-4915-82da-ea5423a04fac>', 'WARC-Date': datetime.datetime(2021, 5, 16, 22, 42, 30), 'WARC-IP-Address': '23.51.189.157', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:BGZGIRLU4VZ4F6JP4E3EZJLS6JFSQWJI', 'WARC-Record-ID': '<urn:uuid:c48b3e62-e259-4350-b8d7-3c24da8050a9>', 'WARC-Target-URI': 'https://winnipeg.ctvnews.ca/i-m-not-paying-that-bill-winnipeg-woman-receives-nearly-2-300-water-bill-1.5325143?cache=yes%3FclipId%3D375756%3FautoPlay%3Dtrue%3FautoPlay%3Dtrue%3FclipId%3D89563%3FautoPlay%3Dtrue%3FcontactForm%3Dtrue&src=sdkpreparse', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:565f1ffd-91f7-42e4-8d59-fed7478248cf>', 'WARC-Truncated': None}", 'previous_word_count': '358', 'url': 'https://winnipeg.ctvnews.ca/i-m-not-paying-that-bill-winnipeg-woman-receives-nearly-2-300-water-bill-1.5325143?cache=yes%3FclipId%3D375756%3FautoPlay%3Dtrue%3FautoPlay%3Dtrue%3FclipId%3D89563%3FautoPlay%3Dtrue%3FcontactForm%3Dtrue&src=sdkpreparse', 'warcinfo': 'isPartOf: CC-MAIN-2021-21\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-74.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.09343069791793823', 'original_id': '3270065986a708f53191b5553650675bb8484ca8f2ce5291afb917fd9b26da9e'} |
• Ambassador says Armenians should not judge Europe by Conchita Wurst’s performance (video)
Armenians cannot be considered a nation that bears European values. Eastern traditions today dominate in the post-Soviet Armenia; say those who do not connect Armenia’s future to Europe. French ambassador to the Republic of Armenia, Henri Reynaud, holds a different opinion.
The ambassador believes that Armenia will continue to cooperate with the European Union after its accession to the Customs Union.
During his stay in Armenia and everyday communication with its people, the ambassador felt ‘European spirit and breath’ in Armenia.
Traian Hristea, Head of EU Delegation to Armenia, also perceives European customs in Armenia.
Lithuanian Ambassador to Armenia Erikas Petrikas regrets to say that not all people in Armenia have correct information about European values. Then he began enumerating the things that the EU had done for the development of Lithuania. The ambassador is concerned that some media outlets in Armenia made judgments about European values based on Austria’s victory at the Eurovision Song Contest that prompted an outpouring of anti-gay anger from different circles of the public.
The ambassadors of the EU member states remind that Europe keeps its doors open before Armenia though the latter did not initial the Association Agreement. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.8996475338935852}", 'metadata': "{'Content-Length': '59250', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:HWWC2AQLOETAFIPVI4E4Z7SZE5IWS2VO', 'WARC-Concurrent-To': '<urn:uuid:878d427a-d077-4c18-b84c-fb703275aa97>', 'WARC-Date': datetime.datetime(2014, 10, 31, 13, 30, 57), 'WARC-IP-Address': '144.76.103.42', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:NO5X5CZS223TD3C74RVFUN5NZFIYYQ45', 'WARC-Record-ID': '<urn:uuid:c67422a6-894b-4b77-a22b-065a48c217ad>', 'WARC-Target-URI': 'http://en.a1plus.am/1189667.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:b030565c-1603-443e-a54d-00d2385b8917>', 'WARC-Truncated': None}", 'previous_word_count': '190', 'url': 'http://en.a1plus.am/1189667.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-16-133-185.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-42\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for October 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.0533481240272522', 'original_id': '03962aee83784bdb0aab0086b0d2e5f3c44399c2682804f19f1501842b1bd365'} |
CHIEF COMPLAINT: , "I want my colostomy reversed.",HISTORY OF PRESENT ILLNESS: , Mr. A is a pleasant 43-year-old African-American male who presents to our clinic for a colostomy reversal as well as repair of an incisional hernia. The patient states that in November 2007, he presented to High Point Regional Hospital with sharp left lower quadrant pain and was emergently taken to Surgery where he woke up with a "bag." According to some notes that were faxed to our office from the surgeon in High Point who performed his initial surgery, Dr. X, the patient had diverticulitis with perforated sigmoid colon, and underwent a sigmoid colectomy with end colostomy and Hartmann's pouch. The patient was unaware of his diagnosis; therefore, we discussed that with him today in clinic. The patient also complains of the development of an incisional hernia since his surgery in November. He was seen back by Dr. X in April 2008 and hopes that Dr. X may reverse his colostomy and repair his hernia since he did his initial surgery, but because the patient has lost his job and has no insurance, he was referred to our clinic by Dr. X. Currently, the patient does state that his hernia bothers him more so than his colostomy, and if it were not for the hernia then he may just refrain from having his colostomy reversed; however, the hernia has grown in size and causing him significant discomfort. He feels that he always has to hold his hand over the hernia to prevent it from prolapsing and causing him even more discomfort.,PAST MEDICAL AND SURGICAL HISTORY:,1. Gastroesophageal reflux disease.,2. Question of hypertension.,3. Status post sigmoid colectomy with end colostomy and Hartmann's pouch in November 2007 at High Point Regional.,4. Status post cholecystectomy.,7. Status post unknown foot surgery.,MEDICATIONS:, None.,ALLERGIES: , No known drug allergies.,SOCIAL HISTORY: , The patient lives in Greensboro. He smokes one pack of cigarettes a day and has done so for 15 years. He denies any IV drug use and has an occasional alcohol.,FAMILY HISTORY: ,Positive for diabetes, hypertension, and coronary artery disease.,REVIEW OF SYSTEMS: , Please see history of present illness; otherwise, the review of systems is negative.,PHYSICAL EXAMINATION:,VITAL SIGNS: Temperature 95.9, pulse 67, blood pressure 135/79, and weight 208 pounds.,GENERAL: This is a pleasant African-American male appearing his stated age in no acute distress.,HEENT: Normocephalic, atraumatic. Pupils are equal, round, and reactive to light and accommodation. Moist mucous membranes. Extraocular movements intact.,NECK: Supple, no JVD, and no lymphadenopathy.,CARDIOVASCULAR: Regular rate and rhythm.,LUNGS: Clear to auscultation bilaterally.,ABDOMEN: Soft, nontender, and nondistended with a left lower quadrant stoma. The stoma is pink, protuberant, and productive. The patient also has a midline incisional hernia approximately 6 cm in diameter. It is reducible. Otherwise, there are no further hernias or masses noted.,EXTREMITIES: No clubbing, cyanosis or edema.,ASSESSMENT AND PLAN: ,This is a 43-year-old gentleman who underwent what sounds like a sigmoid colectomy with end colostomy and Hartmann's pouch in November of 2007 secondary to perforated colon from diverticulitis. The patient presents for reversal of his colostomy as well as repair of his incisional hernia. I have asked the patient to return to High Point Regional and get his medical records including the operative note and pathology results from his initial surgery so that I would have a better idea of what was done during his initial surgery. He stated that he would try and do this and bring the records to our clinic on his next appointment. I have also set him up for a barium enema to study the rectal stump. He will return to us in two weeks at which time we will review his radiological studies and his medical records from the outside hospital and determine the best course of action from that point. This was discussed with the patient as well as his sister and significant other in the clinic today. They were in agreement with this plan. We also called the social worker to come and help the patient get more ostomy appliances, as he stated that he had no more and he was having to reuse the existing ostomy bag. To my understanding, his social worker, as well as the ostomy nurses were able to get him some assistance with this., | the_stack | {'hexsha': '36abaa32ee54f595d56a16907468080002588f9b', 'size': '4432', 'ext': 'txt', 'lang': 'Text', 'max_stars_repo_path': 'IntermediateOutputs/AllTxtFiles/trans4472.txt', 'max_stars_repo_name': 'sanejait/WSDMedTextClassifier', 'max_stars_repo_head_hexsha': 'e85a9dfcde9afe5460cce0f41080dd68cc15ef4b', 'max_stars_repo_licenses': "['MIT']", 'max_stars_count': '', 'max_stars_repo_stars_event_min_datetime': '', 'max_stars_repo_stars_event_max_datetime': '', 'max_issues_repo_path': 'IntermediateOutputs/AllTxtFiles/trans4472.txt', 'max_issues_repo_name': 'sanejait/WSDMedTextClassifier', 'max_issues_repo_head_hexsha': 'e85a9dfcde9afe5460cce0f41080dd68cc15ef4b', 'max_issues_repo_licenses': "['MIT']", 'max_issues_count': '', 'max_issues_repo_issues_event_min_datetime': '', 'max_issues_repo_issues_event_max_datetime': '', 'max_forks_repo_path': 'IntermediateOutputs/AllTxtFiles/trans4472.txt', 'max_forks_repo_name': 'sanejait/WSDMedTextClassifier', 'max_forks_repo_head_hexsha': 'e85a9dfcde9afe5460cce0f41080dd68cc15ef4b', 'max_forks_repo_licenses': "['MIT']", 'max_forks_count': '', 'max_forks_repo_forks_event_min_datetime': '', 'max_forks_repo_forks_event_max_datetime': '', 'avg_line_length': '4432.0', 'max_line_length': '4432', 'alphanum_fraction': '0.7967057762', 'original_id': '1208b8fd4d98f56674ca7a469bee2c653f3706802a2e9feab40fa9b765553d7a'} |
{
"images" : [
{
"idiom" : "universal",
"scale" : "1x"
},
{
"idiom" : "universal",
"filename" : "home_tabbar_press_32x32_@2x.png",
"scale" : "2x"
},
{
"idiom" : "universal",
"filename" : "home_tabbar_press_32x32_@3x.png",
"scale" : "3x"
}
],
"info" : {
"version" : 1,
"author" : "xcode"
},
"properties" : {
"template-rendering-intent" : "original"
}
} | mini_pile | {'original_id': '3af73533729563792ffe9764a6944db5a030d4fabbad9e6df5ebb93e48eaa9e5'} |
Tuesday, May 15, 2012
Fibromyalgia, It's Not Real/Yes It Is
"Fibromyalgia doesn't exist; it's just a catch-all that doctors use when they don't know what else to tell you."
Do you believe this statement about fibromyalgia (FM)? Some people do. I posted a question on a email list for a professional group I belong to, asking something from people who have FM. I received a lengthy email in response from a colleague I'd never met. Her email outlined for me why FM is not a real illness and doesn't exist, and that she got upset whenever she heard someone saying that they were diagnosed with it. She said it was a phase that she hoped would go away, because telling someone they had FM did more harm than good.
This person pointed out that there are doctors who have written online that it doesn't exist and she had taken the time to find some and then copy and paste their words into the email. Then, after this lengthy email, she told me she had to cut it short because she had to go out.
I thought long and hard before responding. The email had started with something along the lines of "I hope you don't mind dissention," and it ended with something like "I hope I haven't offended you."
I don't mind dissention, as long as we are polite about it, which she was. I didn't think I was offended, but I wasn't sure.
I tried explaining to her through my carefully worded response that anyone can write anything on the Internet. This is one of the great things about the medium, but also one of the great drawbacks. That being said, there is much research going into this illness that has been around for generations, but called by different names. The name "fibromyalgia" was only given recently, as researchers learned more about it.
Physical findings
There are physical findings in people who have FM, such as an elevated level of substance P, a neurotransmitter in the cerebral spinal fluid. Although the illness is far from being solved, this increased level of substance P is one tiny piece of the puzzle that explains why people with FM feel more pain than people who don't have it.
There are many illnesses or health problems that don't have obvious and identifiable causes. Migraines are a good example, as is clinical depression. However, they are accepted as the medical problems that they are. I ended my note stating that I wasn't quite sure why she felt she needed to send me her email as it had nothing to do with the original request. I didn't ask about a debate over FM, I asked if anyone who had FM had any questions that I could use in a project I am working on.
The response
Unfortunately, my response wasn't taken in the way I hoped it was. I am a big believer in discussion, but I don't believe in the "I'm right and you're wrong" approach without discussion. I am perfectly willing to discuss why people may not believe in FM, but I would hope that they would listen to the arguments as to why people do believe it does exist. They don't have to accept them, but some back and forth about the ideas is always appreciated.
This wasn't the case here. Instead, her response was, more or less, "I was afraid you'd react this way but if thinking you have something called fibromyalgia makes you feel better, that's ok." Well, I'm very glad she's ok with it. I'm sure I'll sleep better now. :)
I have no intention of engaging with the email writer any further. Perhaps I shouldn't have responded in the first place. I find it interesting that some people - because I know this person isn't alone - feel so strongly about proving that FM isn't real. What is it about the issue that makes them feel this need to evangelize their thoughts about FM?
Living with fibromyalgia
In case you haven't guessed by now, I do have fibromyalgia. I have had it a very long time, but was only diagnosed a little over a year ago. While the diagnosis hasn't changed how I feel physically, because there are no treatments, it has changed how I feel mentally and emotionally. Even though I knew the pain and fatigue was real, now I really know it. I am one of millions of people who have a similar problem. I am not alone. This isn't in my head. I wasn't a hypochondriac all this time. I wasn't looking for attention.
Managing FM means trying to live a healthy lifestyle and I am working on that. I'm trying to exercise despite the pain. I began a Tai Chi course a few weeks ago. My body is not liking it, but I'm sticking it out for the next few weeks. I need to get moving and get my life back.
Because I'm a writer, I've been able to do research and speak to experts on FM for articles I have worked on. I have a lot of information that I haven't yet used, so I am working on something that involves the questions people have about FM.
If you have FM or love someone who does, what questions do you wish had been answered earlier or what questions do you have now that still haven't been answered?
If you leave your questions here, in the comment section, I will be sure to add them to my file.
By the way, earlier this year, I began to participate in a chronic pain/fibromyalgia program offered by a local rehab centre (Fibromyalgia Rehab Program - It's Worth a Try). Unfortunately, it was a bust. Although the people who are part of the program mean well, as far as I was concerned, it was a waste of time and I dropped out after three weeks. So did just about everyone else in the program (there were five of us who started).
For the most part, we sat in a group and listened to the appropriate therapists talk about various issues, sleep, chronic pain, adaptations, etc., but it was all so very basic. There were no questions asked about what we may already have known, so the information wasn't tailored at all. It was just assumed that we knew absolutely nothing, but that wasn't true. The therapists just read from the handouts we received. Although we were encouraged to ask questions, we didn't really have any, because - again - it was all stuff we already knew.
We were only in the gym once a week, for about an hour or so, where the physio gave us a simple program to follow. While this would have been helpful, once a week is not.
So, the intent of the program was good, but as far as I am concerned, I can't see it being very helpful. It needs to be thought out better and presented in a more user-friendly manner.
Sarah said...
I'm a physical therapy student and we recently learned about fibromyalgia. Our textbook (The American College of Sports Medicine Resource Manual for Guidelines for Testing and Prescription) mentioned that many people drop out of the training because it increased their pain levels. Because of this, they are having a hard time running trials to see what levels of exercise, how often and how long are the most beneficial. They did say that because of this, initially they suggest only doing it once or twice a week with the goal of three to four times a week.
Maybe that was the plan for your group.
Regardless, I wanted you to know that we were taught about fibromyalgia and it was never once referred to as something potentially made up. Hopefully that continues to be the trend with people entering the healthcare field.
Marijke Vroomen-Durning said...
Thanks so much for providing your experience Sarah. I'm glad to see that this is being addressed.
I do agree that it's hard to tell how much exercise can be done and it is so easy to stop doing it because it hurts. Frustrating.
Jackie Dishner said...
Hi Marijke,
I just forwarded a link to your blog post to a neighbor of mine who has Fibromyalgia. I think it's helpful for those of us without the illness to understand it more, but I also think it's probably helpful to those who do have it to understand that they are not alone.
Thanks for this.
Marijke Vroomen-Durning said...
Thanks Jackie.
Anonymous said...
Well, one question I have is can Fibromyalgia cause or contribute to chronic bursitis/tendonitis in multiple locations? I have, for years been diagnosed with one or the other in virtually every place you can have it. I have been diagnosed with Fibro for about 12 years. My Drs have always said no connection, but I have to wonder....
Anonymous said...
I was diagnosed a little over a year ago with crohn's related spondyloarthropathy and treated with enbrel. This helped my morning pain and stiffness tremendously, but I am a nurse ans work 12 hr shifts, and by the end of my shift I was in excruciating pain again. I can't take pain mess and work because I am really sensitive to them, so I was really beginning to get frustrated. My rheumatologist kept telling me that the pain with activity was not related to my inflammatory arthritis, but offered no other explanation other than it was "mechanical" pain. I could not understand how it wasn't related since it all started about the same time! I finally decided it was time for a change. I saw a new rheumatologist last week, and after a thorough exam, she told me that my residual pain is fibromyalgia. Now, I have been a RN for 17 years, so when I was in nursing school, fibro was discussed, but it was still believed to be a BS diagnosis. Working the ER we see so many people with drug seeking behavior that it gets really frustrating and quite annoying, and we tend to become hard and insensitive. And yes, we are even guilty of rolling our eyes when someone says they have fibromyalgia. Imagine my distress when my Dr told me that is what is wrong with me! I guess God is going to strike me with every illness I have ever doubted the severity of! (kidney stone, bulging disc, fibromyalgia, inflammatory arthritis) OK,OK!!! I get the picture! Needless to say, I have done some furthering of my education, and I am glad to see that things are changing and people are coming to understand that this is real. I can only pray for their sake, that they don't have to be stricken with it to believe it! Good luck, God bless, and may your days be pain free!
Kim H.,RN
Anonymous said...
Hi I was given a diagnosis of FMS last week - more blood work was done just to update my records and I desperately scoured the results for something to be abnormal. That meant it wasn't fibro didn't it!
I found a slightly raised CK and ESR. Hurray its not fibro !! Not so apparently, as a Advanced Nurse Practitioner why did I feel that the diagnosis was any less significant than having a more 'acceptable condition'. Still trying to get my head around it all but as a professional I am a little bit ashamed that I feel this way. Would I react the same if I had been diagnosed with RA or PMS somehow I doubt it.
My patients will hopefully benefit from this personal experience and I will empathise when they describe the pain and lethargy experienced with this condition.
Anonymous said...
It's not that I don't believe in Fibromyalgia. I believe that lame Rheumatologists don't look hard enough to figure out what it is. And because the symptoms are like Lupus and other autoimmune diseases like lupus. Most ppl with lupus are also diagnosed with fibro first. I also think the drug companies make quick money if the Drs. Diagnose it. I was diagnosed with lupus at 23. It had hit my kidneys and I was pretty sick for six months. Then it went into remission. I never saw a rheumatologist, my nephrologist diagnosed it. Then when I came out of remission years later...The rheumatologist said...Oh you have Fibro even before he looked at my file. The dum dum.
Marijke Vroomen-Durning said...
I understand your point but don't agree with the doctors making money with a diagnosis of FM. Most people I know with FM do not take any medications.
LGV said...
I have been living with FM since 2008 and i have had doctors tell me that "its in my head' etc. It was very difficult, recently my pain has worsened to such an extent where i have sleepless nights and get into work groggy and am in a fog all day. I am undergoing theraphy and am planning to take a break soon as it is getting too difficult. Of course it helps to have good friends. People who used to shrug off have finally realized that it is a condition after raising a lot of awareness. On a positive note: FM is an immune system disorder so no longer - in ur heads. You probably can send this link to the email writer that gets upset when people tell that they have FM :)
Bill said...
I am a 56 y/o male. I am/was fairly athletic, but at about age 30, I began to breakdown. Knee, ankle, shoulder, back, and, neck problems plagued me. In spite of this , I played hockey until I was 50. In my mid 30's I was benchpressing 330 lbs. Towards my late 30's I was frequently sick and never felt well. Co-workers thought that I was a hypochondriac. It turns out that I had leukemia, for which I was successfully treated. Injuries that I aquired in my early 30's persisted. I had 2 neck surgeries for disc problems, but still ended up with disabling nerve damage In my right arm. An ankle problem became diagnosed as chronic regional pain syndrome. I went to a pain clinic last week for my ankle pain. The doctor asked me lots of questions. He pressed on various areas of my body, and then told me that I have FM. What? He never looked at my ankle. He told me to get counseling and gave me a script for Savella. I took that for 3 days and then stopped because it caused me to have difficulty urinating. I am still in pain and now feel there is no end to my discomfort. He kind of made me feel that my real pain from my neck and ankle is all in my head.
I tried Lyrica before for nerve pain in my arm. It caused unpleasant side effects and did nothing for my pain.
kel said...
I would love to know something, who coined the the term fibromyalgia and how did the public and the medical community come to the conclusion that fibro was a psychological condition. i can tell you this pain is real i am down for the count right now simply because i went grocery shopping yesterday, will take 2 days to recover, then i will be i the same shape when i try to pick up my house in a few days, come to my house and tell me this is not real
Anonymous said...
I have been diagnosed with FMS and let me tell you...it IS VERY REAL. I pray that the people who think otherwise never develop this disease. I also believe that sooner rather than later, these same people will be eating their words.
Joining a Fibro support group online helped me very much.
Anonymous said...
I was diagnosed with fibro and still think it is a bs diagnosis. I am 35 years old and cant believe how much pain I am in! I have 2 children and rather go through that pain every day than what I experience now. It is pain in all my joints and some swelling in my joints. I don't know how much longer I can work with this pain. I don't want to loose everything!!
Marijke Vroomen-Durning said...
You say the fibromyalgia diagnosis you have is bs, which is your right - but then what explains all the pain? Denying that it is fibro isn't making it go away.
Anonymous said...
I guess I am just scared! I want a test that says yes it is! I just went to my first rheumatologist appointment so hope she comes up with a different diagnosis. My job will not accept a fibromyalgia diagnosis for the days that I just cant work or can not move as well as it seems I should. Is there any website that you recommend for me that can help? I am eating healthy and that does not work!!! How do you all keep working?
Anonymous said...
I am 39 and was diagnosed with Lupus at 30. About 4 years later when my bloodwork showed that I was in remission, I was told that I also have FM. It is extremely difficult to differenciate between the two sometimes. And as if these were not enough, I have also been hit with Hashimoto's as well. I have been told by 2 rheumy's that it is very common for a person who has one autoimmune disease to develop another. I have "Fibro Flares" that seem to be getting progressively worse, it is real. I work in the medical field as well, and the stigma that surrounds this diagnosis is cruel and unfair. I once told a co-worker who has FM ( this was before my diagnosis ) to suck it up and deal with it or just stay home. I thought along the same lines as one of my Dr. Friends, she is a middle aged unhappy woman. Then I was hit with
Lupus, and my whole world changed. When I found out that I also had FM, I was sickened. Here it was, did they think the same thing about me?? No, wait its not FM its
Lupus. WRONG. I deal daily with trying to understand what is happening to me. It is so frustrating. And by the way, I DID apologize to my co-worker, now we lean on each other.
Marijke Vroomen-Durning said...
These are such interesting comments. Thank you for adding your thoughts.
How do we keep working is a great question. Sadly, many with fibromyalgia can't, but equally sadly, many who have a very hard time have no choice but to continue in jobs that - in my opinion - could make things worse. And because all their energy goes into their work, little is left for them to care for themselves properly and they get sicker. Vicious cycle.
In my case, I have turned my very physical profession (nursing) into a physically easier one (writing)' so I set my own hours and work conditions. I know that not everyone is that fortunate, though.
T the last commenter, I am sorry that things occurred as they did, but I am glad that you and your coworker are able to help each other. It takes a big person to admit they were wrong.
lindacrosby said...
I am so thankful that I found your site.I am a member of Kimberly-clark community site where we do little surveys and kinda a focus group.In the discussions section a lady had posted the news findings of April,2012 with the link to your site . She was trying to get the word out to who ever has Fibro and help spread the word. I thanked her and told her my story.I will try and put in a nut shell if I can. I am getting tired and I type with one finger.I have only been on a pc for a couple of years ,did not know nothing about them till a friend gave me one. I do pretty good for self taught, but out of boredom because I am on disability for fibro since 1999.I have had bouts of fibro most of my life and would fight through them,but when i turned 46 ,that was it. by this time i had went through 3 husbands, 2 custody battles and had a good job at 3M.,but was trying to work 12 hr shifts.I got my kids. Had a small farm that was my dream,raising a few beef and my horse. I was 46 I ended up having to sell my farm, quit my job and go on disability.(took 2 years to get)I am now 62 feeling like 90. It has been 14 yrs since i was able to work.I fought through it while at 3M,but the nurse at 3m put me through hell and back.I had a GP doctor who would work with me and when things got real bad he would get me a week or 2 off. Well this nurse knew all about FB cause her friend had it and you had to work thought it you could not give up.Then she sent me to a pain management clinic that basically was just like the one you dropped out of. only difference is the psychiatrist did not feel I had FB but was a alcohol problem instead.
lindacrosby said...
by Linda J about 15 hours ago
OMG, I too have had Fibro my whole life. In the 80's and early 90's I have been told I was an alcoholic,it was in my head, I was lazy,and went through 3
OMG, I too have had Fibro my whole life. In the 80's and early 90's I have been told I was an alcoholic,it was in my head, I was lazy,and went through 3 divorces, 2 child custody fights and had the best job of my life and had to sell my farm and quit my job and go on disability, also was sent to pain management clinic. My son is 42 and has had it since he was 14. We went through hell going to Rochester,Min and being told he was missing a bone the size of a thumb nail between his 4 and 5 vertebrae, wanted to operate,because he was 17 and still considered a juvenile he had to see a pediatrician,she was a Korean doctor and she said You learn to live with it you have what i have and don't you dare let them cut you. BUT she never told us what it was. A chiropractor finally diagnosed him when he was 21. My life was basically over when I turned 46 that is when it really set in and now i am 62 and feel like i am 90 and my hips are in pain from arthritis and am 248 lbs cause i can't walk and exercise. I am taking Cymbala and amitriptyline and I am still in pain have all I can do just to take care of my personal hygiene and try to clean my house.
Mark as Unread
Anonymous said...
Okay so went to rheumatologist. Still no diagnosis so frustrated! This was 2 nd visit and she did not even examine me. She told me that I did not have to worry about what I ate cause there is no proof that it helps. I am going to continue to try and eat right but what Dr would not encourage you to eat right!? she also discouraged me from keeping my pain log. I can barely live life let a lone work. She put me on 2 antibiotic's but nothing but prednisone for pain. Any advice out there? Sed rate was 51 and have a little joint space problem in my neck and right ankle all other xray and blood work were normal. My hands and wrist are the worst now. I would appreciate any advice I can get!
Marijke Vroomen-Durning said...
I would get another opinion. Why did she give you antibiotics and two of them? Do you have an infection? Sounds odd.
Anonymous said...
I was just diagnosed yesterday with Fibromyalgia. I have been to doctors for over 10 years now, pleading for one of them to finally help me. And by the end, I was sent home with the diagnosis that nothing is wrong with me except that I must be depressed. Even though, depression doesn't cause my feet to BURN at the end of the day and hurt like I have broken bones!!
I was diagnosed with Lyme Disease before I ever began having symptoms of Fibromyalgia. I do believe that the Lyme Disease caused me to get Fibromyalgia. At least with the Lyme Disease, a blood test showed that I wasn't "making up" my symptoms.
I can't tell you the humiliation and complete degradation of having the doctor examine me, and being vulnerable to a doctor that just treated me like a crazy person. I've cried for so many years, begging for someone to please help me.
Before I finally found a Rheumalogist, I went to yet another PCP, who is from Duke, who apparently looked in the Duke healthcare system during my visit to see the "notes" on me. He took all about 5 minutes, asked if I felt like committing suicide, asked if I cry everyday, and wanted to put me on medication for depression! He just read the notes from the other doctor in the Duke system about how she thought I was "making up" my symptoms. I told that doctor that I am not depressed, my pain is real, and I'm not taking that medication! I never went back.
Thank God I found that Rheumatologist to help me!
Shashawn Dailey said...
I think I will thank you. Just don't know where to go next! Heals institute is supposed to be the best in Michigan do you recommend a place? Yea she put me on minocycline and plaquenil. CBC showed no infection. These antibiotic's I guess for ra, lupus type stuff. Per her notes I only had 3 of the sensitive areas for fibromyalgia. So what do you think could it still be fibromyalgia? Worked 17 hours so far this week and feel like I could amputate my own legs and hands! ( ok little drama queenish) but how much longer do us pain people have to deal with this pain! I love my job but going to get fired and would not blame them. Since you are a nurse with same issues I will take to heart anything you tell me please help. Thank you for helping and listing to us all ! I have posted a couple other thing prior as anonymous.
Foi Designs said...
Thank you for sharing your story. There are still so many people that believe Fibromyalgia is not real. I am sure many are misdiagnosed but there are still many that do have it and need awareness brought to the rest.
Robyne Larson said...
I just got diagnosed with Fibromyalgia I want answers would like to help
Anonymous said...
Hi, I'm an early 20s undergraduate psychology student and I was diagnosed with Fibro a year ago now, after having been on a rheumatologist referral waiting list for a year. My GP was very helpful as she made sure I had many blood tests over a period of time - if any irregularities were apparent then I might go up the waiting list a little, but any small changes in one were nulled in another.
When I was told when my appointment was, I had a little look at several different rheumatology conditions but without really knowing what I might have.
The rheumatologist who diagnosed me was the head of that hospitals, so I was at least confident he knew what was what but I was surprised that I had something which I thought of as "neurotransmitter screw ups". Fibro was explained to me without the jargon I knew, and chronic pain conditions had been lightly covered in a psychology module. I was prescribed 30mg Duloxetine which I've taken for 6 months, 4 month gap, and when the pain creeped back again to the excruciating pain I went back on it again.
My family have been supportive, as have my close friends and my boyfriend has somehow put up with it (we knew each other when I had the symptoms but not diagnosed 3+ years ago). But a couple of my friends in uni have straight-off said that Fibro isn't a real condition, that it's an umbrella term for something else that'll be wrong. I've only mentioned it twice, as I've never liked to say "ouch" unless it's really causing me problems and I might be walking a little slower (I'm a fast walker).
What I would like to know is what others think when they're faced with those responses, and I found this post really insightful - thank you! What I'm finding hard to work out, though, is exercise and Fibro. From 2006-2010 I used to participate competitively in athletics and hockey, but I would have these horrid pains of fibro! Obv it was without meds as I wasn't diagnosed, but exercise is meant to dissipate symptoms somewhat?
I need to look more into it, but a tutor has mentioned distractions for chronic pain conditions also included playing video games - which is relevant to me, and far more enjoyable than the likes of tai chi.
Anonymous said...
I am a professional health care worker IR/cath lab. I work frequently in the er as well. I have years of experience in dealing with fm patients personally and professionally. And it is horrible. The "patients" not the "disease". I have yet to hear a Dr. of any specialty say fm is a disease.
What concerns me the most is the similarities of the patients i.e. high strung, high stress, history of drug abuse, with an attitude of agree with me or else. Most seem to be completely uninterested in anything other than painkillers. Also, most if not all are on anti-depressants. Mostly, Low dose ssri's. Inevitably they end up on opioids for pain, lortab being the favorite.
It seems eerily similar to the ADHD phenomenon. Highly over diagnosed.
I hate to see someone in pain and I will help in anyway I can. But, I have serious concerns with these lump-sum diseases. I am sure my views and experiences are probably skewed based on the local population. It seems to be a fool-proof way to get opioids.
I am sure that the brilliant scientists in the world will be able to explain and help with this problem eventually.
Marijke Vroomen-Durning said...
Wow. I would not want you looking after me or anyone I care about if you are so prone to making such blanket statements. I can assure you that neither I nor many I know with fibromyalgia fall into your insulting and rather incorrect sweeping generalization of people with the disorder.
I, as many I know, am not on any medications at all, nor do I have a so-called attitude, unless I am dealing with a so-called healthcare professional with an attititude. I do take care of myself and work hard at staying healthy. I also pride myself on giving people the benefit of the doubt. Perhaps that is something you might consider.
lindacrosby said...
Whoa , no wonder we can't get help with fibro when these are the thinking's of health care supposedly professionals.
Amber said...
What an absolutely disgusting comment left by "anonymous". I assure you I am none of the above mentioned terms that you so carelessly threw out. To your dismay, I am quite the opposite. I am a professional, a hard worker, loving wife, and well educated. I don't ask for opioid medications, nor do I want them. But...if you lived even one day in the life of a Fibromyalgia patient, I would bet any amount of money that you would be the first person in line wanting help for chronic pain. Your comment sickens me and the fact that you have any part in our healthcare system is prime example as to where our system is failing. My heart aches for any patient that may come in contact with you during your career.
Anonymous said...
There is much research on fibromyalgia today. Finally. One can just add the word "scholarly" to a Google search to read about small fibre neuropathies, viral-mediated cytokines, substance P and more. It is closely connected with other autoimmune disorders, and there is even a blood test in trials at the moment. Naysayers are just ignorant of the facts. I've had this disease for nearly 30 years and have seen and lived with the indifference and hostility from the healthcare industry. I find it interesting that many who don't "believe" in FM apparently believe in it enough to diagnose it and use the diagnosis code to bill for it, which, if you think about it, is fraud-to diagnose someone with a disease you don't believe they have. They then command you to be well. Worse, those labeled with a big F on their charts are at risk for lack of care, because you are not "allowed" to develop any other medical condition. Chest pain? It's fibro. Spinal disc oozing into your spinal cord? We hate it for you. No, can't be tendinitis, because you have fibro-therefore you are drug seeking. Most of us who have FM avoid telling anyone. So in response to the ER nurse who sees drug-seeking FM patients, do you really think most of us would come to your ER, get humiliated, pay $25k for a shot of dilaudid? Sometimes a person comes to the ER because the very doctor who diagnosed him offers no treatment and he simply can't stand it anymore. He knows it's not an emergency, and the emergency room is the last place he wants to go. It IS the last place he goes. "High strung, anxious, history of drug abuse" should indicate a person with an undertreated chronic illness. You act like FM patients are out there shooting heroin. Trust me, we'd be too tired for that. Did you know that some of us actually pray to get diagnosed with something else just to please people like you? That most of us work full time while chronically ill, cover for other coworkers who call in with migraines or toothaches or menstrual pain, but we don't call in for fear of being labeled as malingering? I hope very soon that FM's root cause is identified and this disease is relabeled so that the stigma of FM, can finally be buried.
Beth said...
I was diagnosed with fibromyalgia a few months ago. I have been an LPN nurse for 13 years. I work as a home health care nurse currently. As I have noted a lot of other nurses and people in Healthcare who have fibro as well I was hoping someone would have ideas of a career in could transition to. I can no longer handle lifting and moving patients even in my "no lifting" job. So many of the patients I see don't have a working lift or even have onever in the home. I am on gabapentin and ibuprofen for my pain issues but sometimes the patients I see put me in a flare-up the next day. I have to take power naps in between patients just to make it through the day. My hips are my problem area. I have hurt for years but just figure don't it came with the job. I am dreading tomorrow as I am being sent to a patient that I know will send me into a flare the following day. I have told them I can't do her but still being sent. And they wonder why good nurses burn out. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '76', 'language_id_whole_page_fasttext': "{'en': 0.9881646633148192}", 'metadata': "{'Content-Length': '210348', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:RICSIYZKV2XFT5QWXWL2VNPZPENTKTCH', 'WARC-Concurrent-To': '<urn:uuid:1e46035e-77e6-46c9-adb5-3075627a911b>', 'WARC-Date': datetime.datetime(2017, 4, 26, 0, 15, 20), 'WARC-IP-Address': '172.217.7.129', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:EZ3G324SV76ZYJFSGYPVUSHJKZVFQJPU', 'WARC-Record-ID': '<urn:uuid:3abb61d2-39e3-481b-a72d-c4cc3c5449c9>', 'WARC-Target-URI': 'http://medhealthwriter.blogspot.com/2012/05/fibromyalgia-its-not-realyes-it-is.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:094992ca-a535-4700-9bd0-6ac3b54682ac>', 'WARC-Truncated': None}", 'previous_word_count': '5996', 'url': 'http://medhealthwriter.blogspot.com/2012/05/fibromyalgia-its-not-realyes-it-is.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-145-167-34.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-17\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for April 2017\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02476733922958374', 'original_id': '0dc3ef85eec25b366d7dcc1e9a30e8a48efc969f82c7d0e67052e8e7474c9827'} |
Monday, April 18, 2016
The Republican Race Gets Really Dirty
What do you have left in a country when you have this sort of thing happening?
"Donald Trump may have retroactively lost his Georgia delegate lead to Ted Cruz, even after scoring a decisive victory in the state primary on March 7.
Individual congressional districts met Saturday to select the 43 of the 76 delegates that would be going on to the Republican convention in Ohio at the end of July. Each of the 14 conventions picks three delegates and three alternates.
Despite Donald’s advantage in votes, Ted’s supporters now appear to make up the majority of Georgia’s representation going on to the state convention in Augusta."
God knows, I am not a supporter of Trump, but when a party is rigging its own selection process right out in the open, what exactly does our vaunted American democracy mean any more?
And I love the press response to this, which is to attack Trump for just being too unprepared and ignorant of the process to get the delegates that the people of Georgia awarded him. It is now the height of ignorance to expect that the Republican party will not sabotage the open vote of its own supporters, and a sign of incompetence to expect the Republican party to keep its end of the electoral deal.
Of course, no one with half a brain could expect anything less from Republicans- the entire competitiveness of the party in the last two decades has depended on deceit and cheating- but still, blaming the victim of this process is a really pitiful spectacle. Faced with what looked to be a sure Trump majority by the time of the Convention, it seems to be just fine for the party to stab its own voters in the back. Of course, that is what they do with every action they take, but not usually this openly.
This is not democracy, and anyone who thinks it is, is an idiot.
And let me end with a quote from Roy Edroso:
"The establishment has the juice to get Cruz the nod, it seems, but not the juice to make it look legit. But Cruz doesn’t care — and why should he? Come the general, he’ll have a whole army of rightbloggers lying their asses off for him..."
And a billion dollars or more to spend spreading the lies. I'll leave it at that.
No comments: | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9610843062400818}", 'metadata': "{'Content-Length': '90791', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:TJTC7FK2APPT4U672JCXL7U2T7IG4RA7', 'WARC-Concurrent-To': '<urn:uuid:7e1f7e7d-1fa1-4b0c-aa9e-77f5e00c31a7>', 'WARC-Date': datetime.datetime(2017, 4, 26, 23, 32, 3), 'WARC-IP-Address': '172.217.7.129', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:BAYJCZJPT6B4X7IEGXYEIGAIDBO4X35Q', 'WARC-Record-ID': '<urn:uuid:bde1fc58-eac5-40a5-9a86-1aec0918bcac>', 'WARC-Target-URI': 'http://largegreenbird.blogspot.com/2016/04/the-republican-race-gets-really-dirty.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:7122dd22-467a-4b5f-ade5-074b38dcf713>', 'WARC-Truncated': None}", 'previous_word_count': '400', 'url': 'http://largegreenbird.blogspot.com/2016/04/the-republican-race-gets-really-dirty.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-145-167-34.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-17\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for April 2017\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.018561363220214844', 'original_id': 'a25f8cb6059f5d7cccd8b3f766d049de8fb0194d1720e91ae96e9f9e86727966'} |
Monthly Archives: May 2014
Monterey Shed Removal and Breakdown
One of the last drive-in movie theatres in the Monterey area was the old Skyview Drive-in. Like some many other of these institutions, the Skyview was bulldozed over to make way for a more profitable enterprise. That’s a shame because so many families will miss out on the opportunity to take their kid to a drive-in movie theatre. Of course, you could have your own version of that right in your backyard. There are many companies who will rent a backyard screen and movie projector for you to watch a flick under the stars. Many of those screens are inflatable. If you have a pool, you could set up the screen and float in the waters while watching a blockbuster. To insure that your movie night is done right, you might first have to clear out some of the clutter in your backyard. This could mean finally taking care of that old shed removal. For that type of job, you need only call Junk King.
Most of the professional junk hauling appointments covered by Junk King would fall into the “in and out” category. The crew shows up at the appointed hour, you tell them what you want removed and it gets loaded on the truck. They are in and out in ten minutes or less. With a shed removal assignment, the Junk King might have to slow their roll a bit. They’ll want to make sure that structure is safely taken apart and all the pieces gathered up for disposal. Even if that takes a few extra minutes, you’re not going to be charged any additional labor costs. You’re only going to pay an estimated flat fee that is determined by the amount of space your junk will occupy on the back of the truck. Even if you’re estimated to take up one-third of the truck and your junk uses one-half, you’re still will pay that locked down estimate. This makes Junk King the fairest professional junk hauling company in Monterey.
Beyond the shed removal task, the Junk King crew can also help clear out the rest of rubbish taking up space on your property. If you’re having a backyard movie night, then you’ll want to get rid of the old patio furniture, planters, car parts and construction debris. Make way for those lawn chairs and blankets! With Junk King on the job, shed removal and total junk hauling is a thing of beauty.
Monterey Swing Set Removal
If there were one thing that is daily reminder of how great Monterey is it would be the sunsets. Depending on the location of your backyard, you could be treated to a wonderful show every day. Those sunsets are the perfect excuse to unwind from your day with a glass of California wine. All that could be standing in your way would be the backyard obstructions like an old swing set. If it has been years since the last kid took a swing, then clearly it is time for that playground to come down. Put Junk King on the assignment and watch how fast your swing set removal can be accomplished.
Taking stuff apart is a basic skill set that can be utilized when you apply the adage “lefty loosey, righty tighty.” Translation: turn screws to the left to get them undone. Just because you can do that with your swing set doesn’t mean you have to. Even if you were to take it apart, what are you going to do with those big pieces? They can’t go into the trash but they can certainly go onto the back of the Junk King truck. Another reason why you should turn your swing set removal over to the pros from Junk King.
As long as Junk King is taken away that old swing set, you can set them to task to take away anything else that is considered an eyesore in your backyard. That can include an old lawnmower, hammock, grill or patio furniture. Junk King can also handle the “organic” materials as well such as lawn clippings, palm fronds, shrubs and tree branches. Anything that came down during the last round of Santa Ana winds can be hauled off by Junk King.
After that crew has taken care of your backyard, point them in the direction of your garage, closets and spare rooms. That’s where you’re keeping the rest of your unwanted junk, right? Everything can go on the back of the Junk King truck in single removal appointment. It will only take a matter of minutes for the Junk King crew to load everything up. You can get back to your day while the Junk King crew heads off to the nearest recycling facility. Yes, they’ll be recycling as much of your junk as possible. Don’t let another sunset be blocked by yard clutter. Use Junk King for safe swing set removal and fast junk hauling. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '1', 'language_id_whole_page_fasttext': "{'en': 0.9609862565994264}", 'metadata': "{'Content-Length': '55004', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:LWSHSWS3UNCJOQXVKXAEGNRSB7OSD3JU', 'WARC-Concurrent-To': '<urn:uuid:a2ce91ec-cccb-465e-9963-d1e4c880f740>', 'WARC-Date': datetime.datetime(2019, 5, 23, 16, 45, 31), 'WARC-IP-Address': '72.52.231.236', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:JZGZHKR7LN5YMO2CF4OOH6YCDKZBRKCT', 'WARC-Record-ID': '<urn:uuid:957e92de-2fc3-45bf-a317-64d8174ea15a>', 'WARC-Target-URI': 'https://www.junk-king.com/locations/monterey/2014/05/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2c2a7f2b-3dd1-4b9b-9a4c-7c62fdfb2879>', 'WARC-Truncated': None}", 'previous_word_count': '824', 'url': 'https://www.junk-king.com/locations/monterey/2014/05/', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-146-226-231.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04180276393890381', 'original_id': '5a44fb7955497f4e9bf10cc9db4040356be913883f28667cc029da974600c359'} |
/**
* @license Angular v7.1.1
* (c) 2010-2018 Google, Inc. https://angular.io/
* License: MIT
*/
(function (global, factory) {
typeof exports === 'object' && typeof module !== 'undefined' ? factory(exports, require('@angular/core'), require('rxjs'), require('@angular/platform-browser')) :
typeof define === 'function' && define.amd ? define('@angular/http', ['exports', '@angular/core', 'rxjs', '@angular/platform-browser'], factory) :
(factory((global.ng = global.ng || {}, global.ng.http = {}),global.ng.core,global.rxjs,global.ng.platformBrowser));
}(this, (function (exports,core,rxjs,platformBrowser) { 'use strict';
/*! *****************************************************************************
Copyright (c) Microsoft Corporation. All rights reserved.
Licensed under the Apache License, Version 2.0 (the "License"); you may not use
this file except in compliance with the License. You may obtain a copy of the
License at http://www.apache.org/licenses/LICENSE-2.0
THIS CODE IS PROVIDED ON AN *AS IS* BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
KIND, EITHER EXPRESS OR IMPLIED, INCLUDING WITHOUT LIMITATION ANY IMPLIED
WARRANTIES OR CONDITIONS OF TITLE, FITNESS FOR A PARTICULAR PURPOSE,
MERCHANTABLITY OR NON-INFRINGEMENT.
See the Apache Version 2.0 License for specific language governing permissions
and limitations under the License.
***************************************************************************** */
/* global Reflect, Promise */
var extendStatics = function(d, b) {
extendStatics = Object.setPrototypeOf ||
({ __proto__: [] } instanceof Array && function (d, b) { d.__proto__ = b; }) ||
function (d, b) { for (var p in b) if (b.hasOwnProperty(p)) d[p] = b[p]; };
return extendStatics(d, b);
};
function __extends(d, b) {
extendStatics(d, b);
function __() { this.constructor = d; }
d.prototype = b === null ? Object.create(b) : (__.prototype = b.prototype, new __());
}
function __decorate(decorators, target, key, desc) {
var c = arguments.length, r = c < 3 ? target : desc === null ? desc = Object.getOwnPropertyDescriptor(target, key) : desc, d;
if (typeof Reflect === "object" && typeof Reflect.decorate === "function") r = Reflect.decorate(decorators, target, key, desc);
else for (var i = decorators.length - 1; i >= 0; i--) if (d = decorators[i]) r = (c < 3 ? d(r) : c > 3 ? d(target, key, r) : d(target, key)) || r;
return c > 3 && r && Object.defineProperty(target, key, r), r;
}
function __metadata(metadataKey, metadataValue) {
if (typeof Reflect === "object" && typeof Reflect.metadata === "function") return Reflect.metadata(metadataKey, metadataValue);
}
function __read(o, n) {
var m = typeof Symbol === "function" && o[Symbol.iterator];
if (!m) return o;
var i = m.call(o), r, ar = [], e;
try {
while ((n === void 0 || n-- > 0) && !(r = i.next()).done) ar.push(r.value);
}
catch (error) { e = { error: error }; }
finally {
try {
if (r && !r.done && (m = i["return"])) m.call(i);
}
finally { if (e) throw e.error; }
}
return ar;
}
function __spread() {
for (var ar = [], i = 0; i < arguments.length; i++)
ar = ar.concat(__read(arguments[i]));
return ar;
}
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* A backend for http that uses the `XMLHttpRequest` browser API.
*
* Take care not to evaluate this in non-browser contexts.
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var BrowserXhr = /** @class */ (function () {
function BrowserXhr() {
}
BrowserXhr.prototype.build = function () { return (new XMLHttpRequest()); };
BrowserXhr = __decorate([
core.Injectable(),
__metadata("design:paramtypes", [])
], BrowserXhr);
return BrowserXhr;
}());
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
(function (RequestMethod) {
RequestMethod[RequestMethod["Get"] = 0] = "Get";
RequestMethod[RequestMethod["Post"] = 1] = "Post";
RequestMethod[RequestMethod["Put"] = 2] = "Put";
RequestMethod[RequestMethod["Delete"] = 3] = "Delete";
RequestMethod[RequestMethod["Options"] = 4] = "Options";
RequestMethod[RequestMethod["Head"] = 5] = "Head";
RequestMethod[RequestMethod["Patch"] = 6] = "Patch";
})(exports.RequestMethod || (exports.RequestMethod = {}));
(function (ReadyState) {
ReadyState[ReadyState["Unsent"] = 0] = "Unsent";
ReadyState[ReadyState["Open"] = 1] = "Open";
ReadyState[ReadyState["HeadersReceived"] = 2] = "HeadersReceived";
ReadyState[ReadyState["Loading"] = 3] = "Loading";
ReadyState[ReadyState["Done"] = 4] = "Done";
ReadyState[ReadyState["Cancelled"] = 5] = "Cancelled";
})(exports.ReadyState || (exports.ReadyState = {}));
(function (ResponseType) {
ResponseType[ResponseType["Basic"] = 0] = "Basic";
ResponseType[ResponseType["Cors"] = 1] = "Cors";
ResponseType[ResponseType["Default"] = 2] = "Default";
ResponseType[ResponseType["Error"] = 3] = "Error";
ResponseType[ResponseType["Opaque"] = 4] = "Opaque";
})(exports.ResponseType || (exports.ResponseType = {}));
/**
* Supported content type to be automatically associated with a {@link Request}.
* @deprecated see https://angular.io/guide/http
*/
var ContentType;
(function (ContentType) {
ContentType[ContentType["NONE"] = 0] = "NONE";
ContentType[ContentType["JSON"] = 1] = "JSON";
ContentType[ContentType["FORM"] = 2] = "FORM";
ContentType[ContentType["FORM_DATA"] = 3] = "FORM_DATA";
ContentType[ContentType["TEXT"] = 4] = "TEXT";
ContentType[ContentType["BLOB"] = 5] = "BLOB";
ContentType[ContentType["ARRAY_BUFFER"] = 6] = "ARRAY_BUFFER";
})(ContentType || (ContentType = {}));
(function (ResponseContentType) {
ResponseContentType[ResponseContentType["Text"] = 0] = "Text";
ResponseContentType[ResponseContentType["Json"] = 1] = "Json";
ResponseContentType[ResponseContentType["ArrayBuffer"] = 2] = "ArrayBuffer";
ResponseContentType[ResponseContentType["Blob"] = 3] = "Blob";
})(exports.ResponseContentType || (exports.ResponseContentType = {}));
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* Polyfill for [Headers](https://developer.mozilla.org/en-US/docs/Web/API/Headers/Headers), as
* specified in the [Fetch Spec](https://fetch.spec.whatwg.org/#headers-class).
*
* The only known difference between this `Headers` implementation and the spec is the
* lack of an `entries` method.
*
* @usageNotes
* ### Example
*
* ```
* import {Headers} from '@angular/http';
*
* var firstHeaders = new Headers();
* firstHeaders.append('Content-Type', 'image/jpeg');
* console.log(firstHeaders.get('Content-Type')) //'image/jpeg'
*
* // Create headers from Plain Old JavaScript Object
* var secondHeaders = new Headers({
* 'X-My-Custom-Header': 'Angular'
* });
* console.log(secondHeaders.get('X-My-Custom-Header')); //'Angular'
*
* var thirdHeaders = new Headers(secondHeaders);
* console.log(thirdHeaders.get('X-My-Custom-Header')); //'Angular'
* ```
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var Headers = /** @class */ (function () {
// TODO(vicb): any -> string|string[]
function Headers(headers) {
var _this = this;
/** @internal header names are lower case */
this._headers = new Map();
/** @internal map lower case names to actual names */
this._normalizedNames = new Map();
if (!headers) {
return;
}
if (headers instanceof Headers) {
headers.forEach(function (values, name) {
values.forEach(function (value) { return _this.append(name, value); });
});
return;
}
Object.keys(headers).forEach(function (name) {
var values = Array.isArray(headers[name]) ? headers[name] : [headers[name]];
_this.delete(name);
values.forEach(function (value) { return _this.append(name, value); });
});
}
/**
* Returns a new Headers instance from the given DOMString of Response Headers
*/
Headers.fromResponseHeaderString = function (headersString) {
var headers = new Headers();
headersString.split('\n').forEach(function (line) {
var index = line.indexOf(':');
if (index > 0) {
var name_1 = line.slice(0, index);
var value = line.slice(index + 1).trim();
headers.set(name_1, value);
}
});
return headers;
};
/**
* Appends a header to existing list of header values for a given header name.
*/
Headers.prototype.append = function (name, value) {
var values = this.getAll(name);
if (values === null) {
this.set(name, value);
}
else {
values.push(value);
}
};
/**
* Deletes all header values for the given name.
*/
Headers.prototype.delete = function (name) {
var lcName = name.toLowerCase();
this._normalizedNames.delete(lcName);
this._headers.delete(lcName);
};
Headers.prototype.forEach = function (fn) {
var _this = this;
this._headers.forEach(function (values, lcName) { return fn(values, _this._normalizedNames.get(lcName), _this._headers); });
};
/**
* Returns first header that matches given name.
*/
Headers.prototype.get = function (name) {
var values = this.getAll(name);
if (values === null) {
return null;
}
return values.length > 0 ? values[0] : null;
};
/**
* Checks for existence of header by given name.
*/
Headers.prototype.has = function (name) { return this._headers.has(name.toLowerCase()); };
/**
* Returns the names of the headers
*/
Headers.prototype.keys = function () { return Array.from(this._normalizedNames.values()); };
/**
* Sets or overrides header value for given name.
*/
Headers.prototype.set = function (name, value) {
if (Array.isArray(value)) {
if (value.length) {
this._headers.set(name.toLowerCase(), [value.join(',')]);
}
}
else {
this._headers.set(name.toLowerCase(), [value]);
}
this.mayBeSetNormalizedName(name);
};
/**
* Returns values of all headers.
*/
Headers.prototype.values = function () { return Array.from(this._headers.values()); };
/**
* Returns string of all headers.
*/
// TODO(vicb): returns {[name: string]: string[]}
Headers.prototype.toJSON = function () {
var _this = this;
var serialized = {};
this._headers.forEach(function (values, name) {
var split = [];
values.forEach(function (v) { return split.push.apply(split, __spread(v.split(','))); });
serialized[_this._normalizedNames.get(name)] = split;
});
return serialized;
};
/**
* Returns list of header values for a given name.
*/
Headers.prototype.getAll = function (name) {
return this.has(name) ? this._headers.get(name.toLowerCase()) || null : null;
};
/**
* This method is not implemented.
*/
Headers.prototype.entries = function () { throw new Error('"entries" method is not implemented on Headers class'); };
Headers.prototype.mayBeSetNormalizedName = function (name) {
var lcName = name.toLowerCase();
if (!this._normalizedNames.has(lcName)) {
this._normalizedNames.set(lcName, name);
}
};
return Headers;
}());
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* Creates a response options object to be optionally provided when instantiating a
* {@link Response}.
*
* This class is based on the `ResponseInit` description in the [Fetch
* Spec](https://fetch.spec.whatwg.org/#responseinit).
*
* All values are null by default. Typical defaults can be found in the
* {@link BaseResponseOptions} class, which sub-classes `ResponseOptions`.
*
* This class may be used in tests to build {@link Response Responses} for
* mock responses (see {@link MockBackend}).
*
* @usageNotes
* ### Example
*
* ```typescript
* import {ResponseOptions, Response} from '@angular/http';
*
* var options = new ResponseOptions({
* body: '{"name":"Jeff"}'
* });
* var res = new Response(options);
*
* console.log('res.json():', res.json()); // Object {name: "Jeff"}
* ```
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var ResponseOptions = /** @class */ (function () {
function ResponseOptions(opts) {
if (opts === void 0) { opts = {}; }
var body = opts.body, status = opts.status, headers = opts.headers, statusText = opts.statusText, type = opts.type, url = opts.url;
this.body = body != null ? body : null;
this.status = status != null ? status : null;
this.headers = headers != null ? headers : null;
this.statusText = statusText != null ? statusText : null;
this.type = type != null ? type : null;
this.url = url != null ? url : null;
}
/**
* Creates a copy of the `ResponseOptions` instance, using the optional input as values to
* override
* existing values. This method will not change the values of the instance on which it is being
* called.
*
* This may be useful when sharing a base `ResponseOptions` object inside tests,
* where certain properties may change from test to test.
*
* @usageNotes
* ### Example
*
* ```typescript
* import {ResponseOptions, Response} from '@angular/http';
*
* var options = new ResponseOptions({
* body: {name: 'Jeff'}
* });
* var res = new Response(options.merge({
* url: 'https://google.com'
* }));
* console.log('options.url:', options.url); // null
* console.log('res.json():', res.json()); // Object {name: "Jeff"}
* console.log('res.url:', res.url); // https://google.com
* ```
*/
ResponseOptions.prototype.merge = function (options) {
return new ResponseOptions({
body: options && options.body != null ? options.body : this.body,
status: options && options.status != null ? options.status : this.status,
headers: options && options.headers != null ? options.headers : this.headers,
statusText: options && options.statusText != null ? options.statusText : this.statusText,
type: options && options.type != null ? options.type : this.type,
url: options && options.url != null ? options.url : this.url,
});
};
return ResponseOptions;
}());
/**
* Subclass of {@link ResponseOptions}, with default values.
*
* Default values:
* * status: 200
* * headers: empty {@link Headers} object
*
* This class could be extended and bound to the {@link ResponseOptions} class
* when configuring an {@link Injector}, in order to override the default options
* used by {@link Http} to create {@link Response Responses}.
*
* @usageNotes
* ### Example
*
* ```typescript
* import {provide} from '@angular/core';
* import {bootstrap} from '@angular/platform-browser/browser';
* import {HTTP_PROVIDERS, Headers, Http, BaseResponseOptions, ResponseOptions} from
* '@angular/http';
* import {App} from './myapp';
*
* class MyOptions extends BaseResponseOptions {
* headers:Headers = new Headers({network: 'github'});
* }
*
* bootstrap(App, [HTTP_PROVIDERS, {provide: ResponseOptions, useClass: MyOptions}]);
* ```
*
* The options could also be extended when manually creating a {@link Response}
* object.
*
* ### Example
*
* ```
* import {BaseResponseOptions, Response} from '@angular/http';
*
* var options = new BaseResponseOptions();
* var res = new Response(options.merge({
* body: 'Angular',
* headers: new Headers({framework: 'angular'})
* }));
* console.log('res.headers.get("framework"):', res.headers.get('framework')); // angular
* console.log('res.text():', res.text()); // Angular;
* ```
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var BaseResponseOptions = /** @class */ (function (_super) {
__extends(BaseResponseOptions, _super);
function BaseResponseOptions() {
return _super.call(this, { status: 200, statusText: 'Ok', type: exports.ResponseType.Default, headers: new Headers() }) || this;
}
BaseResponseOptions = __decorate([
core.Injectable(),
__metadata("design:paramtypes", [])
], BaseResponseOptions);
return BaseResponseOptions;
}(ResponseOptions));
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* Abstract class from which real backends are derived.
*
* The primary purpose of a `ConnectionBackend` is to create new connections to fulfill a given
* {@link Request}.
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var ConnectionBackend = /** @class */ (function () {
function ConnectionBackend() {
}
return ConnectionBackend;
}());
/**
* Abstract class from which real connections are derived.
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var Connection = /** @class */ (function () {
function Connection() {
}
return Connection;
}());
/**
* An XSRFStrategy configures XSRF protection (e.g. via headers) on an HTTP request.
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var XSRFStrategy = /** @class */ (function () {
function XSRFStrategy() {
}
return XSRFStrategy;
}());
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
function normalizeMethodName(method) {
if (typeof method !== 'string')
return method;
switch (method.toUpperCase()) {
case 'GET':
return exports.RequestMethod.Get;
case 'POST':
return exports.RequestMethod.Post;
case 'PUT':
return exports.RequestMethod.Put;
case 'DELETE':
return exports.RequestMethod.Delete;
case 'OPTIONS':
return exports.RequestMethod.Options;
case 'HEAD':
return exports.RequestMethod.Head;
case 'PATCH':
return exports.RequestMethod.Patch;
}
throw new Error("Invalid request method. The method \"" + method + "\" is not supported.");
}
var isSuccess = function (status) { return (status >= 200 && status < 300); };
function getResponseURL(xhr) {
if ('responseURL' in xhr) {
return xhr.responseURL;
}
if (/^X-Request-URL:/m.test(xhr.getAllResponseHeaders())) {
return xhr.getResponseHeader('X-Request-URL');
}
return null;
}
function stringToArrayBuffer(input) {
var view = new Uint16Array(input.length);
for (var i = 0, strLen = input.length; i < strLen; i++) {
view[i] = input.charCodeAt(i);
}
return view.buffer;
}
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
function paramParser(rawParams) {
if (rawParams === void 0) { rawParams = ''; }
var map = new Map();
if (rawParams.length > 0) {
var params = rawParams.split('&');
params.forEach(function (param) {
var eqIdx = param.indexOf('=');
var _a = __read(eqIdx == -1 ? [param, ''] : [param.slice(0, eqIdx), param.slice(eqIdx + 1)], 2), key = _a[0], val = _a[1];
var list = map.get(key) || [];
list.push(val);
map.set(key, list);
});
}
return map;
}
/**
* @deprecated see https://angular.io/guide/http
* @publicApi
**/
var QueryEncoder = /** @class */ (function () {
function QueryEncoder() {
}
QueryEncoder.prototype.encodeKey = function (key) { return standardEncoding(key); };
QueryEncoder.prototype.encodeValue = function (value) { return standardEncoding(value); };
return QueryEncoder;
}());
function standardEncoding(v) {
return encodeURIComponent(v)
.replace(/%40/gi, '@')
.replace(/%3A/gi, ':')
.replace(/%24/gi, '$')
.replace(/%2C/gi, ',')
.replace(/%3B/gi, ';')
.replace(/%2B/gi, '+')
.replace(/%3D/gi, '=')
.replace(/%3F/gi, '?')
.replace(/%2F/gi, '/');
}
/**
* Map-like representation of url search parameters, based on
* [URLSearchParams](https://url.spec.whatwg.org/#urlsearchparams) in the url living standard,
* with several extensions for merging URLSearchParams objects:
* - setAll()
* - appendAll()
* - replaceAll()
*
* This class accepts an optional second parameter of ${@link QueryEncoder},
* which is used to serialize parameters before making a request. By default,
* `QueryEncoder` encodes keys and values of parameters using `encodeURIComponent`,
* and then un-encodes certain characters that are allowed to be part of the query
* according to IETF RFC 3986: https://tools.ietf.org/html/rfc3986.
*
* These are the characters that are not encoded: `! $ \' ( ) * + , ; A 9 - . _ ~ ? /`
*
* If the set of allowed query characters is not acceptable for a particular backend,
* `QueryEncoder` can be subclassed and provided as the 2nd argument to URLSearchParams.
*
* ```
* import {URLSearchParams, QueryEncoder} from '@angular/http';
* class MyQueryEncoder extends QueryEncoder {
* encodeKey(k: string): string {
* return myEncodingFunction(k);
* }
*
* encodeValue(v: string): string {
* return myEncodingFunction(v);
* }
* }
*
* let params = new URLSearchParams('', new MyQueryEncoder());
* ```
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var URLSearchParams = /** @class */ (function () {
function URLSearchParams(rawParams, queryEncoder) {
if (rawParams === void 0) { rawParams = ''; }
if (queryEncoder === void 0) { queryEncoder = new QueryEncoder(); }
this.rawParams = rawParams;
this.queryEncoder = queryEncoder;
this.paramsMap = paramParser(rawParams);
}
URLSearchParams.prototype.clone = function () {
var clone = new URLSearchParams('', this.queryEncoder);
clone.appendAll(this);
return clone;
};
URLSearchParams.prototype.has = function (param) { return this.paramsMap.has(param); };
URLSearchParams.prototype.get = function (param) {
var storedParam = this.paramsMap.get(param);
return Array.isArray(storedParam) ? storedParam[0] : null;
};
URLSearchParams.prototype.getAll = function (param) { return this.paramsMap.get(param) || []; };
URLSearchParams.prototype.set = function (param, val) {
if (val === void 0 || val === null) {
this.delete(param);
return;
}
var list = this.paramsMap.get(param) || [];
list.length = 0;
list.push(val);
this.paramsMap.set(param, list);
};
// A merge operation
// For each name-values pair in `searchParams`, perform `set(name, values[0])`
//
// E.g: "a=[1,2,3], c=[8]" + "a=[4,5,6], b=[7]" = "a=[4], c=[8], b=[7]"
//
// TODO(@caitp): document this better
URLSearchParams.prototype.setAll = function (searchParams) {
var _this = this;
searchParams.paramsMap.forEach(function (value, param) {
var list = _this.paramsMap.get(param) || [];
list.length = 0;
list.push(value[0]);
_this.paramsMap.set(param, list);
});
};
URLSearchParams.prototype.append = function (param, val) {
if (val === void 0 || val === null)
return;
var list = this.paramsMap.get(param) || [];
list.push(val);
this.paramsMap.set(param, list);
};
// A merge operation
// For each name-values pair in `searchParams`, perform `append(name, value)`
// for each value in `values`.
//
// E.g: "a=[1,2], c=[8]" + "a=[3,4], b=[7]" = "a=[1,2,3,4], c=[8], b=[7]"
//
// TODO(@caitp): document this better
URLSearchParams.prototype.appendAll = function (searchParams) {
var _this = this;
searchParams.paramsMap.forEach(function (value, param) {
var list = _this.paramsMap.get(param) || [];
for (var i = 0; i < value.length; ++i) {
list.push(value[i]);
}
_this.paramsMap.set(param, list);
});
};
// A merge operation
// For each name-values pair in `searchParams`, perform `delete(name)`,
// followed by `set(name, values)`
//
// E.g: "a=[1,2,3], c=[8]" + "a=[4,5,6], b=[7]" = "a=[4,5,6], c=[8], b=[7]"
//
// TODO(@caitp): document this better
URLSearchParams.prototype.replaceAll = function (searchParams) {
var _this = this;
searchParams.paramsMap.forEach(function (value, param) {
var list = _this.paramsMap.get(param) || [];
list.length = 0;
for (var i = 0; i < value.length; ++i) {
list.push(value[i]);
}
_this.paramsMap.set(param, list);
});
};
URLSearchParams.prototype.toString = function () {
var _this = this;
var paramsList = [];
this.paramsMap.forEach(function (values, k) {
values.forEach(function (v) { return paramsList.push(_this.queryEncoder.encodeKey(k) + '=' + _this.queryEncoder.encodeValue(v)); });
});
return paramsList.join('&');
};
URLSearchParams.prototype.delete = function (param) { this.paramsMap.delete(param); };
return URLSearchParams;
}());
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* HTTP request body used by both {@link Request} and {@link Response}
* https://fetch.spec.whatwg.org/#body
*/
var Body = /** @class */ (function () {
function Body() {
}
/**
* Attempts to return body as parsed `JSON` object, or raises an exception.
*/
Body.prototype.json = function () {
if (typeof this._body === 'string') {
return JSON.parse(this._body);
}
if (this._body instanceof ArrayBuffer) {
return JSON.parse(this.text());
}
return this._body;
};
/**
* Returns the body as a string, presuming `toString()` can be called on the response body.
*
* When decoding an `ArrayBuffer`, the optional `encodingHint` parameter determines how the
* bytes in the buffer will be interpreted. Valid values are:
*
* - `legacy` - incorrectly interpret the bytes as UTF-16 (technically, UCS-2). Only characters
* in the Basic Multilingual Plane are supported, surrogate pairs are not handled correctly.
* In addition, the endianness of the 16-bit octet pairs in the `ArrayBuffer` is not taken
* into consideration. This is the default behavior to avoid breaking apps, but should be
* considered deprecated.
*
* - `iso-8859` - interpret the bytes as ISO-8859 (which can be used for ASCII encoded text).
*/
Body.prototype.text = function (encodingHint) {
if (encodingHint === void 0) { encodingHint = 'legacy'; }
if (this._body instanceof URLSearchParams) {
return this._body.toString();
}
if (this._body instanceof ArrayBuffer) {
switch (encodingHint) {
case 'legacy':
return String.fromCharCode.apply(null, new Uint16Array(this._body));
case 'iso-8859':
return String.fromCharCode.apply(null, new Uint8Array(this._body));
default:
throw new Error("Invalid value for encodingHint: " + encodingHint);
}
}
if (this._body == null) {
return '';
}
if (typeof this._body === 'object') {
return JSON.stringify(this._body, null, 2);
}
return this._body.toString();
};
/**
* Return the body as an ArrayBuffer
*/
Body.prototype.arrayBuffer = function () {
if (this._body instanceof ArrayBuffer) {
return this._body;
}
return stringToArrayBuffer(this.text());
};
/**
* Returns the request's body as a Blob, assuming that body exists.
*/
Body.prototype.blob = function () {
if (this._body instanceof Blob) {
return this._body;
}
if (this._body instanceof ArrayBuffer) {
return new Blob([this._body]);
}
throw new Error('The request body isn\'t either a blob or an array buffer');
};
return Body;
}());
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* Creates `Response` instances from provided values.
*
* Though this object isn't
* usually instantiated by end-users, it is the primary object interacted with when it comes time to
* add data to a view.
*
* @usageNotes
* ### Example
*
* ```
* http.request('my-friends.txt').subscribe(response => this.friends = response.text());
* ```
*
* The Response's interface is inspired by the Response constructor defined in the [Fetch
* Spec](https://fetch.spec.whatwg.org/#response-class), but is considered a static value whose body
* can be accessed many times. There are other differences in the implementation, but this is the
* most significant.
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var Response = /** @class */ (function (_super) {
__extends(Response, _super);
function Response(responseOptions) {
var _this = _super.call(this) || this;
_this._body = responseOptions.body;
_this.status = responseOptions.status;
_this.ok = (_this.status >= 200 && _this.status <= 299);
_this.statusText = responseOptions.statusText;
_this.headers = responseOptions.headers;
_this.type = responseOptions.type;
_this.url = responseOptions.url;
return _this;
}
Response.prototype.toString = function () {
return "Response with status: " + this.status + " " + this.statusText + " for URL: " + this.url;
};
return Response;
}(Body));
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
var _nextRequestId = 0;
var JSONP_HOME = '__ng_jsonp__';
var _jsonpConnections = null;
function _getJsonpConnections() {
var w = typeof window == 'object' ? window : {};
if (_jsonpConnections === null) {
_jsonpConnections = w[JSONP_HOME] = {};
}
return _jsonpConnections;
}
// Make sure not to evaluate this in a non-browser environment!
var BrowserJsonp = /** @class */ (function () {
function BrowserJsonp() {
}
// Construct a <script> element with the specified URL
BrowserJsonp.prototype.build = function (url) {
var node = document.createElement('script');
node.src = url;
return node;
};
BrowserJsonp.prototype.nextRequestID = function () { return "__req" + _nextRequestId++; };
BrowserJsonp.prototype.requestCallback = function (id) { return JSONP_HOME + "." + id + ".finished"; };
BrowserJsonp.prototype.exposeConnection = function (id, connection) {
var connections = _getJsonpConnections();
connections[id] = connection;
};
BrowserJsonp.prototype.removeConnection = function (id) {
var connections = _getJsonpConnections();
connections[id] = null;
};
// Attach the <script> element to the DOM
BrowserJsonp.prototype.send = function (node) { document.body.appendChild((node)); };
// Remove <script> element from the DOM
BrowserJsonp.prototype.cleanup = function (node) {
if (node.parentNode) {
node.parentNode.removeChild((node));
}
};
BrowserJsonp = __decorate([
core.Injectable()
], BrowserJsonp);
return BrowserJsonp;
}());
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
var JSONP_ERR_NO_CALLBACK = 'JSONP injected script did not invoke callback.';
var JSONP_ERR_WRONG_METHOD = 'JSONP requests must use GET request method.';
/**
* Base class for an in-flight JSONP request.
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var JSONPConnection = /** @class */ (function () {
/** @internal */
function JSONPConnection(req, _dom, baseResponseOptions) {
var _this = this;
this._dom = _dom;
this.baseResponseOptions = baseResponseOptions;
this._finished = false;
if (req.method !== exports.RequestMethod.Get) {
throw new TypeError(JSONP_ERR_WRONG_METHOD);
}
this.request = req;
this.response = new rxjs.Observable(function (responseObserver) {
_this.readyState = exports.ReadyState.Loading;
var id = _this._id = _dom.nextRequestID();
_dom.exposeConnection(id, _this);
// Workaround Dart
// url = url.replace(/=JSONP_CALLBACK(&|$)/, `generated method`);
var callback = _dom.requestCallback(_this._id);
var url = req.url;
if (url.indexOf('=JSONP_CALLBACK&') > -1) {
url = url.replace('=JSONP_CALLBACK&', "=" + callback + "&");
}
else if (url.lastIndexOf('=JSONP_CALLBACK') === url.length - '=JSONP_CALLBACK'.length) {
url = url.substring(0, url.length - '=JSONP_CALLBACK'.length) + ("=" + callback);
}
var script = _this._script = _dom.build(url);
var onLoad = function (event) {
if (_this.readyState === exports.ReadyState.Cancelled)
return;
_this.readyState = exports.ReadyState.Done;
_dom.cleanup(script);
if (!_this._finished) {
var responseOptions_1 = new ResponseOptions({ body: JSONP_ERR_NO_CALLBACK, type: exports.ResponseType.Error, url: url });
if (baseResponseOptions) {
responseOptions_1 = baseResponseOptions.merge(responseOptions_1);
}
responseObserver.error(new Response(responseOptions_1));
return;
}
var responseOptions = new ResponseOptions({ body: _this._responseData, url: url });
if (_this.baseResponseOptions) {
responseOptions = _this.baseResponseOptions.merge(responseOptions);
}
responseObserver.next(new Response(responseOptions));
responseObserver.complete();
};
var onError = function (error) {
if (_this.readyState === exports.ReadyState.Cancelled)
return;
_this.readyState = exports.ReadyState.Done;
_dom.cleanup(script);
var responseOptions = new ResponseOptions({ body: error.message, type: exports.ResponseType.Error });
if (baseResponseOptions) {
responseOptions = baseResponseOptions.merge(responseOptions);
}
responseObserver.error(new Response(responseOptions));
};
script.addEventListener('load', onLoad);
script.addEventListener('error', onError);
_dom.send(script);
return function () {
_this.readyState = exports.ReadyState.Cancelled;
script.removeEventListener('load', onLoad);
script.removeEventListener('error', onError);
_this._dom.cleanup(script);
};
});
}
/**
* Callback called when the JSONP request completes, to notify the application
* of the new data.
*/
JSONPConnection.prototype.finished = function (data) {
// Don't leak connections
this._finished = true;
this._dom.removeConnection(this._id);
if (this.readyState === exports.ReadyState.Cancelled)
return;
this._responseData = data;
};
return JSONPConnection;
}());
/**
* A {@link ConnectionBackend} that uses the JSONP strategy of making requests.
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var JSONPBackend = /** @class */ (function (_super) {
__extends(JSONPBackend, _super);
/** @internal */
function JSONPBackend(_browserJSONP, _baseResponseOptions) {
var _this = _super.call(this) || this;
_this._browserJSONP = _browserJSONP;
_this._baseResponseOptions = _baseResponseOptions;
return _this;
}
JSONPBackend.prototype.createConnection = function (request) {
return new JSONPConnection(request, this._browserJSONP, this._baseResponseOptions);
};
JSONPBackend = __decorate([
core.Injectable(),
__metadata("design:paramtypes", [BrowserJsonp, ResponseOptions])
], JSONPBackend);
return JSONPBackend;
}(ConnectionBackend));
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
var XSSI_PREFIX = /^\)\]\}',?\n/;
/**
* Creates connections using `XMLHttpRequest`. Given a fully-qualified
* request, an `XHRConnection` will immediately create an `XMLHttpRequest` object and send the
* request.
*
* This class would typically not be created or interacted with directly inside applications, though
* the {@link MockConnection} may be interacted with in tests.
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var XHRConnection = /** @class */ (function () {
function XHRConnection(req, browserXHR, baseResponseOptions) {
var _this = this;
this.request = req;
this.response = new rxjs.Observable(function (responseObserver) {
var _xhr = browserXHR.build();
_xhr.open(exports.RequestMethod[req.method].toUpperCase(), req.url);
if (req.withCredentials != null) {
_xhr.withCredentials = req.withCredentials;
}
// load event handler
var onLoad = function () {
// normalize IE9 bug (http://bugs.jquery.com/ticket/1450)
var status = _xhr.status === 1223 ? 204 : _xhr.status;
var body = null;
// HTTP 204 means no content
if (status !== 204) {
// responseText is the old-school way of retrieving response (supported by IE8 & 9)
// response/responseType properties were introduced in ResourceLoader Level2 spec
// (supported by IE10)
body = (typeof _xhr.response === 'undefined') ? _xhr.responseText : _xhr.response;
// Implicitly strip a potential XSSI prefix.
if (typeof body === 'string') {
body = body.replace(XSSI_PREFIX, '');
}
}
// fix status code when it is 0 (0 status is undocumented).
// Occurs when accessing file resources or on Android 4.1 stock browser
// while retrieving files from application cache.
if (status === 0) {
status = body ? 200 : 0;
}
var headers = Headers.fromResponseHeaderString(_xhr.getAllResponseHeaders());
// IE 9 does not provide the way to get URL of response
var url = getResponseURL(_xhr) || req.url;
var statusText = _xhr.statusText || 'OK';
var responseOptions = new ResponseOptions({ body: body, status: status, headers: headers, statusText: statusText, url: url });
if (baseResponseOptions != null) {
responseOptions = baseResponseOptions.merge(responseOptions);
}
var response = new Response(responseOptions);
response.ok = isSuccess(status);
if (response.ok) {
responseObserver.next(response);
// TODO(gdi2290): defer complete if array buffer until done
responseObserver.complete();
return;
}
responseObserver.error(response);
};
// error event handler
var onError = function (err) {
var responseOptions = new ResponseOptions({
body: err,
type: exports.ResponseType.Error,
status: _xhr.status,
statusText: _xhr.statusText,
});
if (baseResponseOptions != null) {
responseOptions = baseResponseOptions.merge(responseOptions);
}
responseObserver.error(new Response(responseOptions));
};
_this.setDetectedContentType(req, _xhr);
if (req.headers == null) {
req.headers = new Headers();
}
if (!req.headers.has('Accept')) {
req.headers.append('Accept', 'application/json, text/plain, */*');
}
req.headers.forEach(function (values, name) { return _xhr.setRequestHeader(name, values.join(',')); });
// Select the correct buffer type to store the response
if (req.responseType != null && _xhr.responseType != null) {
switch (req.responseType) {
case exports.ResponseContentType.ArrayBuffer:
_xhr.responseType = 'arraybuffer';
break;
case exports.ResponseContentType.Json:
_xhr.responseType = 'json';
break;
case exports.ResponseContentType.Text:
_xhr.responseType = 'text';
break;
case exports.ResponseContentType.Blob:
_xhr.responseType = 'blob';
break;
default:
throw new Error('The selected responseType is not supported');
}
}
_xhr.addEventListener('load', onLoad);
_xhr.addEventListener('error', onError);
_xhr.send(_this.request.getBody());
return function () {
_xhr.removeEventListener('load', onLoad);
_xhr.removeEventListener('error', onError);
_xhr.abort();
};
});
}
XHRConnection.prototype.setDetectedContentType = function (req /** TODO Request */, _xhr /** XMLHttpRequest */) {
// Skip if a custom Content-Type header is provided
if (req.headers != null && req.headers.get('Content-Type') != null) {
return;
}
// Set the detected content type
switch (req.contentType) {
case ContentType.NONE:
break;
case ContentType.JSON:
_xhr.setRequestHeader('content-type', 'application/json');
break;
case ContentType.FORM:
_xhr.setRequestHeader('content-type', 'application/x-www-form-urlencoded;charset=UTF-8');
break;
case ContentType.TEXT:
_xhr.setRequestHeader('content-type', 'text/plain');
break;
case ContentType.BLOB:
var blob = req.blob();
if (blob.type) {
_xhr.setRequestHeader('content-type', blob.type);
}
break;
}
};
return XHRConnection;
}());
/**
* `XSRFConfiguration` sets up Cross Site Request Forgery (XSRF) protection for the application
* using a cookie. See https://www.owasp.org/index.php/Cross-Site_Request_Forgery_(CSRF)
* for more information on XSRF.
*
* Applications can configure custom cookie and header names by binding an instance of this class
* with different `cookieName` and `headerName` values. See the main HTTP documentation for more
* details.
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var CookieXSRFStrategy = /** @class */ (function () {
function CookieXSRFStrategy(_cookieName, _headerName) {
if (_cookieName === void 0) { _cookieName = 'XSRF-TOKEN'; }
if (_headerName === void 0) { _headerName = 'X-XSRF-TOKEN'; }
this._cookieName = _cookieName;
this._headerName = _headerName;
}
CookieXSRFStrategy.prototype.configureRequest = function (req) {
var xsrfToken = platformBrowser.ɵgetDOM().getCookie(this._cookieName);
if (xsrfToken) {
req.headers.set(this._headerName, xsrfToken);
}
};
return CookieXSRFStrategy;
}());
/**
* Creates {@link XHRConnection} instances.
*
* This class would typically not be used by end users, but could be
* overridden if a different backend implementation should be used,
* such as in a node backend.
*
* @usageNotes
* ### Example
*
* ```
* import {Http, MyNodeBackend, HTTP_PROVIDERS, BaseRequestOptions} from '@angular/http';
* @Component({
* viewProviders: [
* HTTP_PROVIDERS,
* {provide: Http, useFactory: (backend, options) => {
* return new Http(backend, options);
* }, deps: [MyNodeBackend, BaseRequestOptions]}]
* })
* class MyComponent {
* constructor(http:Http) {
* http.request('people.json').subscribe(res => this.people = res.json());
* }
* }
* ```
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var XHRBackend = /** @class */ (function () {
function XHRBackend(_browserXHR, _baseResponseOptions, _xsrfStrategy) {
this._browserXHR = _browserXHR;
this._baseResponseOptions = _baseResponseOptions;
this._xsrfStrategy = _xsrfStrategy;
}
XHRBackend.prototype.createConnection = function (request) {
this._xsrfStrategy.configureRequest(request);
return new XHRConnection(request, this._browserXHR, this._baseResponseOptions);
};
XHRBackend = __decorate([
core.Injectable(),
__metadata("design:paramtypes", [BrowserXhr, ResponseOptions,
XSRFStrategy])
], XHRBackend);
return XHRBackend;
}());
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* Creates a request options object to be optionally provided when instantiating a
* {@link Request}.
*
* This class is based on the `RequestInit` description in the [Fetch
* Spec](https://fetch.spec.whatwg.org/#requestinit).
*
* All values are null by default. Typical defaults can be found in the {@link BaseRequestOptions}
* class, which sub-classes `RequestOptions`.
*
* ```typescript
* import {RequestOptions, Request, RequestMethod} from '@angular/http';
*
* const options = new RequestOptions({
* method: RequestMethod.Post,
* url: 'https://google.com'
* });
* const req = new Request(options);
* console.log('req.method:', RequestMethod[req.method]); // Post
* console.log('options.url:', options.url); // https://google.com
* ```
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var RequestOptions = /** @class */ (function () {
// TODO(Dzmitry): remove search when this.search is removed
function RequestOptions(opts) {
if (opts === void 0) { opts = {}; }
var method = opts.method, headers = opts.headers, body = opts.body, url = opts.url, search = opts.search, params = opts.params, withCredentials = opts.withCredentials, responseType = opts.responseType;
this.method = method != null ? normalizeMethodName(method) : null;
this.headers = headers != null ? headers : null;
this.body = body != null ? body : null;
this.url = url != null ? url : null;
this.params = this._mergeSearchParams(params || search);
this.withCredentials = withCredentials != null ? withCredentials : null;
this.responseType = responseType != null ? responseType : null;
}
Object.defineProperty(RequestOptions.prototype, "search", {
/**
* @deprecated from 4.0.0. Use params instead.
*/
get: function () { return this.params; },
/**
* @deprecated from 4.0.0. Use params instead.
*/
set: function (params) { this.params = params; },
enumerable: true,
configurable: true
});
/**
* Creates a copy of the `RequestOptions` instance, using the optional input as values to override
* existing values. This method will not change the values of the instance on which it is being
* called.
*
* Note that `headers` and `search` will override existing values completely if present in
* the `options` object. If these values should be merged, it should be done prior to calling
* `merge` on the `RequestOptions` instance.
*
* ```typescript
* import {RequestOptions, Request, RequestMethod} from '@angular/http';
*
* const options = new RequestOptions({
* method: RequestMethod.Post
* });
* const req = new Request(options.merge({
* url: 'https://google.com'
* }));
* console.log('req.method:', RequestMethod[req.method]); // Post
* console.log('options.url:', options.url); // null
* console.log('req.url:', req.url); // https://google.com
* ```
*/
RequestOptions.prototype.merge = function (options) {
return new RequestOptions({
method: options && options.method != null ? options.method : this.method,
headers: options && options.headers != null ? options.headers : new Headers(this.headers),
body: options && options.body != null ? options.body : this.body,
url: options && options.url != null ? options.url : this.url,
params: options && this._mergeSearchParams(options.params || options.search),
withCredentials: options && options.withCredentials != null ? options.withCredentials :
this.withCredentials,
responseType: options && options.responseType != null ? options.responseType :
this.responseType
});
};
RequestOptions.prototype._mergeSearchParams = function (params) {
if (!params)
return this.params;
if (params instanceof URLSearchParams) {
return params.clone();
}
if (typeof params === 'string') {
return new URLSearchParams(params);
}
return this._parseParams(params);
};
RequestOptions.prototype._parseParams = function (objParams) {
var _this = this;
if (objParams === void 0) { objParams = {}; }
var params = new URLSearchParams();
Object.keys(objParams).forEach(function (key) {
var value = objParams[key];
if (Array.isArray(value)) {
value.forEach(function (item) { return _this._appendParam(key, item, params); });
}
else {
_this._appendParam(key, value, params);
}
});
return params;
};
RequestOptions.prototype._appendParam = function (key, value, params) {
if (typeof value !== 'string') {
value = JSON.stringify(value);
}
params.append(key, value);
};
return RequestOptions;
}());
/**
* Subclass of {@link RequestOptions}, with default values.
*
* Default values:
* * method: {@link RequestMethod RequestMethod.Get}
* * headers: empty {@link Headers} object
*
* This class could be extended and bound to the {@link RequestOptions} class
* when configuring an {@link Injector}, in order to override the default options
* used by {@link Http} to create and send {@link Request Requests}.
*
* ```typescript
* import {BaseRequestOptions, RequestOptions} from '@angular/http';
*
* class MyOptions extends BaseRequestOptions {
* search: string = 'coreTeam=true';
* }
*
* {provide: RequestOptions, useClass: MyOptions};
* ```
*
* The options could also be extended when manually creating a {@link Request}
* object.
*
* ```
* import {BaseRequestOptions, Request, RequestMethod} from '@angular/http';
*
* const options = new BaseRequestOptions();
* const req = new Request(options.merge({
* method: RequestMethod.Post,
* url: 'https://google.com'
* }));
* console.log('req.method:', RequestMethod[req.method]); // Post
* console.log('options.url:', options.url); // null
* console.log('req.url:', req.url); // https://google.com
* ```
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var BaseRequestOptions = /** @class */ (function (_super) {
__extends(BaseRequestOptions, _super);
function BaseRequestOptions() {
return _super.call(this, { method: exports.RequestMethod.Get, headers: new Headers() }) || this;
}
BaseRequestOptions = __decorate([
core.Injectable(),
__metadata("design:paramtypes", [])
], BaseRequestOptions);
return BaseRequestOptions;
}(RequestOptions));
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
// TODO(jeffbcross): properly implement body accessors
/**
* Creates `Request` instances from provided values.
*
* The Request's interface is inspired by the Request constructor defined in the [Fetch
* Spec](https://fetch.spec.whatwg.org/#request-class),
* but is considered a static value whose body can be accessed many times. There are other
* differences in the implementation, but this is the most significant.
*
* `Request` instances are typically created by higher-level classes, like {@link Http} and
* {@link Jsonp}, but it may occasionally be useful to explicitly create `Request` instances.
* One such example is when creating services that wrap higher-level services, like {@link Http},
* where it may be useful to generate a `Request` with arbitrary headers and search params.
*
* ```typescript
* import {Injectable, Injector} from '@angular/core';
* import {HTTP_PROVIDERS, Http, Request, RequestMethod} from '@angular/http';
*
* @Injectable()
* class AutoAuthenticator {
* constructor(public http:Http) {}
* request(url:string) {
* return this.http.request(new Request({
* method: RequestMethod.Get,
* url: url,
* search: 'password=123'
* }));
* }
* }
*
* var injector = Injector.resolveAndCreate([HTTP_PROVIDERS, AutoAuthenticator]);
* var authenticator = injector.get(AutoAuthenticator);
* authenticator.request('people.json').subscribe(res => {
* //URL should have included '?password=123'
* console.log('people', res.json());
* });
* ```
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var Request = /** @class */ (function (_super) {
__extends(Request, _super);
function Request(requestOptions) {
var _this = _super.call(this) || this;
// TODO: assert that url is present
var url = requestOptions.url;
_this.url = requestOptions.url;
var paramsArg = requestOptions.params || requestOptions.search;
if (paramsArg) {
var params = void 0;
if (typeof paramsArg === 'object' && !(paramsArg instanceof URLSearchParams)) {
params = urlEncodeParams(paramsArg).toString();
}
else {
params = paramsArg.toString();
}
if (params.length > 0) {
var prefix = '?';
if (_this.url.indexOf('?') != -1) {
prefix = (_this.url[_this.url.length - 1] == '&') ? '' : '&';
}
// TODO: just delete search-query-looking string in url?
_this.url = url + prefix + params;
}
}
_this._body = requestOptions.body;
_this.method = normalizeMethodName(requestOptions.method);
// TODO(jeffbcross): implement behavior
// Defaults to 'omit', consistent with browser
_this.headers = new Headers(requestOptions.headers);
_this.contentType = _this.detectContentType();
_this.withCredentials = requestOptions.withCredentials;
_this.responseType = requestOptions.responseType;
return _this;
}
/**
* Returns the content type enum based on header options.
*/
Request.prototype.detectContentType = function () {
switch (this.headers.get('content-type')) {
case 'application/json':
return ContentType.JSON;
case 'application/x-www-form-urlencoded':
return ContentType.FORM;
case 'multipart/form-data':
return ContentType.FORM_DATA;
case 'text/plain':
case 'text/html':
return ContentType.TEXT;
case 'application/octet-stream':
return this._body instanceof ArrayBuffer$1 ? ContentType.ARRAY_BUFFER : ContentType.BLOB;
default:
return this.detectContentTypeFromBody();
}
};
/**
* Returns the content type of request's body based on its type.
*/
Request.prototype.detectContentTypeFromBody = function () {
if (this._body == null) {
return ContentType.NONE;
}
else if (this._body instanceof URLSearchParams) {
return ContentType.FORM;
}
else if (this._body instanceof FormData) {
return ContentType.FORM_DATA;
}
else if (this._body instanceof Blob$1) {
return ContentType.BLOB;
}
else if (this._body instanceof ArrayBuffer$1) {
return ContentType.ARRAY_BUFFER;
}
else if (this._body && typeof this._body === 'object') {
return ContentType.JSON;
}
else {
return ContentType.TEXT;
}
};
/**
* Returns the request's body according to its type. If body is undefined, return
* null.
*/
Request.prototype.getBody = function () {
switch (this.contentType) {
case ContentType.JSON:
return this.text();
case ContentType.FORM:
return this.text();
case ContentType.FORM_DATA:
return this._body;
case ContentType.TEXT:
return this.text();
case ContentType.BLOB:
return this.blob();
case ContentType.ARRAY_BUFFER:
return this.arrayBuffer();
default:
return null;
}
};
return Request;
}(Body));
function urlEncodeParams(params) {
var searchParams = new URLSearchParams();
Object.keys(params).forEach(function (key) {
var value = params[key];
if (value && Array.isArray(value)) {
value.forEach(function (element) { return searchParams.append(key, element.toString()); });
}
else {
searchParams.append(key, value.toString());
}
});
return searchParams;
}
var noop = function () { };
var w = typeof window == 'object' ? window : noop;
var FormData = w /** TODO #9100 */['FormData'] || noop;
var Blob$1 = w /** TODO #9100 */['Blob'] || noop;
var ArrayBuffer$1 = w /** TODO #9100 */['ArrayBuffer'] || noop;
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
function httpRequest(backend, request) {
return backend.createConnection(request).response;
}
function mergeOptions(defaultOpts, providedOpts, method, url) {
var newOptions = defaultOpts;
if (providedOpts) {
// Hack so Dart can used named parameters
return newOptions.merge(new RequestOptions({
method: providedOpts.method || method,
url: providedOpts.url || url,
search: providedOpts.search,
params: providedOpts.params,
headers: providedOpts.headers,
body: providedOpts.body,
withCredentials: providedOpts.withCredentials,
responseType: providedOpts.responseType
}));
}
return newOptions.merge(new RequestOptions({ method: method, url: url }));
}
/**
* Performs http requests using `XMLHttpRequest` as the default backend.
*
* `Http` is available as an injectable class, with methods to perform http requests. Calling
* `request` returns an `Observable` which will emit a single {@link Response} when a
* response is received.
*
* @usageNotes
* ### Example
*
* ```typescript
* import {Http, HTTP_PROVIDERS} from '@angular/http';
* import {map} from 'rxjs/operators';
*
* @Component({
* selector: 'http-app',
* viewProviders: [HTTP_PROVIDERS],
* templateUrl: 'people.html'
* })
* class PeopleComponent {
* constructor(http: Http) {
* http.get('people.json')
* // Call map on the response observable to get the parsed people object
* .pipe(map(res => res.json()))
* // Subscribe to the observable to get the parsed people object and attach it to the
* // component
* .subscribe(people => this.people = people);
* }
* }
* ```
*
*
* ### Example
*
* ```
* http.get('people.json').subscribe((res:Response) => this.people = res.json());
* ```
*
* The default construct used to perform requests, `XMLHttpRequest`, is abstracted as a "Backend" (
* {@link XHRBackend} in this case), which could be mocked with dependency injection by replacing
* the {@link XHRBackend} provider, as in the following example:
*
* ### Example
*
* ```typescript
* import {BaseRequestOptions, Http} from '@angular/http';
* import {MockBackend} from '@angular/http/testing';
* var injector = Injector.resolveAndCreate([
* BaseRequestOptions,
* MockBackend,
* {provide: Http, useFactory:
* function(backend, defaultOptions) {
* return new Http(backend, defaultOptions);
* },
* deps: [MockBackend, BaseRequestOptions]}
* ]);
* var http = injector.get(Http);
* http.get('request-from-mock-backend.json').subscribe((res:Response) => doSomething(res));
* ```
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var Http = /** @class */ (function () {
function Http(_backend, _defaultOptions) {
this._backend = _backend;
this._defaultOptions = _defaultOptions;
}
/**
* Performs any type of http request. First argument is required, and can either be a url or
* a {@link Request} instance. If the first argument is a url, an optional {@link RequestOptions}
* object can be provided as the 2nd argument. The options object will be merged with the values
* of {@link BaseRequestOptions} before performing the request.
*/
Http.prototype.request = function (url, options) {
var responseObservable;
if (typeof url === 'string') {
responseObservable = httpRequest(this._backend, new Request(mergeOptions(this._defaultOptions, options, exports.RequestMethod.Get, url)));
}
else if (url instanceof Request) {
responseObservable = httpRequest(this._backend, url);
}
else {
throw new Error('First argument must be a url string or Request instance.');
}
return responseObservable;
};
/**
* Performs a request with `get` http method.
*/
Http.prototype.get = function (url, options) {
return this.request(new Request(mergeOptions(this._defaultOptions, options, exports.RequestMethod.Get, url)));
};
/**
* Performs a request with `post` http method.
*/
Http.prototype.post = function (url, body, options) {
return this.request(new Request(mergeOptions(this._defaultOptions.merge(new RequestOptions({ body: body })), options, exports.RequestMethod.Post, url)));
};
/**
* Performs a request with `put` http method.
*/
Http.prototype.put = function (url, body, options) {
return this.request(new Request(mergeOptions(this._defaultOptions.merge(new RequestOptions({ body: body })), options, exports.RequestMethod.Put, url)));
};
/**
* Performs a request with `delete` http method.
*/
Http.prototype.delete = function (url, options) {
return this.request(new Request(mergeOptions(this._defaultOptions, options, exports.RequestMethod.Delete, url)));
};
/**
* Performs a request with `patch` http method.
*/
Http.prototype.patch = function (url, body, options) {
return this.request(new Request(mergeOptions(this._defaultOptions.merge(new RequestOptions({ body: body })), options, exports.RequestMethod.Patch, url)));
};
/**
* Performs a request with `head` http method.
*/
Http.prototype.head = function (url, options) {
return this.request(new Request(mergeOptions(this._defaultOptions, options, exports.RequestMethod.Head, url)));
};
/**
* Performs a request with `options` http method.
*/
Http.prototype.options = function (url, options) {
return this.request(new Request(mergeOptions(this._defaultOptions, options, exports.RequestMethod.Options, url)));
};
Http = __decorate([
core.Injectable(),
__metadata("design:paramtypes", [ConnectionBackend, RequestOptions])
], Http);
return Http;
}());
/**
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var Jsonp = /** @class */ (function (_super) {
__extends(Jsonp, _super);
function Jsonp(backend, defaultOptions) {
return _super.call(this, backend, defaultOptions) || this;
}
/**
* Performs any type of http request. First argument is required, and can either be a url or
* a {@link Request} instance. If the first argument is a url, an optional {@link RequestOptions}
* object can be provided as the 2nd argument. The options object will be merged with the values
* of {@link BaseRequestOptions} before performing the request.
*
* @security Regular XHR is the safest alternative to JSONP for most applications, and is
* supported by all current browsers. Because JSONP creates a `<script>` element with
* contents retrieved from a remote source, attacker-controlled data introduced by an untrusted
* source could expose your application to XSS risks. Data exposed by JSONP may also be
* readable by malicious third-party websites. In addition, JSONP introduces potential risk for
* future security issues (e.g. content sniffing). For more detail, see the
* [Security Guide](http://g.co/ng/security).
*/
Jsonp.prototype.request = function (url, options) {
var responseObservable;
if (typeof url === 'string') {
url =
new Request(mergeOptions(this._defaultOptions, options, exports.RequestMethod.Get, url));
}
if (url instanceof Request) {
if (url.method !== exports.RequestMethod.Get) {
throw new Error('JSONP requests must use GET request method.');
}
responseObservable = httpRequest(this._backend, url);
}
else {
throw new Error('First argument must be a url string or Request instance.');
}
return responseObservable;
};
Jsonp = __decorate([
core.Injectable(),
__metadata("design:paramtypes", [ConnectionBackend, RequestOptions])
], Jsonp);
return Jsonp;
}(Http));
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
function _createDefaultCookieXSRFStrategy() {
return new CookieXSRFStrategy();
}
function httpFactory(xhrBackend, requestOptions) {
return new Http(xhrBackend, requestOptions);
}
function jsonpFactory(jsonpBackend, requestOptions) {
return new Jsonp(jsonpBackend, requestOptions);
}
/**
* The module that includes http's providers
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var HttpModule = /** @class */ (function () {
function HttpModule() {
}
HttpModule = __decorate([
core.NgModule({
providers: [
// TODO(pascal): use factory type annotations once supported in DI
// issue: https://github.com/angular/angular/issues/3183
{ provide: Http, useFactory: httpFactory, deps: [XHRBackend, RequestOptions] },
BrowserXhr,
{ provide: RequestOptions, useClass: BaseRequestOptions },
{ provide: ResponseOptions, useClass: BaseResponseOptions },
XHRBackend,
{ provide: XSRFStrategy, useFactory: _createDefaultCookieXSRFStrategy },
],
})
], HttpModule);
return HttpModule;
}());
/**
* The module that includes jsonp's providers
*
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var JsonpModule = /** @class */ (function () {
function JsonpModule() {
}
JsonpModule = __decorate([
core.NgModule({
providers: [
// TODO(pascal): use factory type annotations once supported in DI
// issue: https://github.com/angular/angular/issues/3183
{ provide: Jsonp, useFactory: jsonpFactory, deps: [JSONPBackend, RequestOptions] },
BrowserJsonp,
{ provide: RequestOptions, useClass: BaseRequestOptions },
{ provide: ResponseOptions, useClass: BaseResponseOptions },
JSONPBackend,
],
})
], JsonpModule);
return JsonpModule;
}());
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* @deprecated see https://angular.io/guide/http
* @publicApi
*/
var VERSION = new core.Version('7.1.1');
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
// This file only reexports content of the `src` folder. Keep it that way.
/**
* @license
* Copyright Google Inc. All Rights Reserved.
*
* Use of this source code is governed by an MIT-style license that can be
* found in the LICENSE file at https://angular.io/license
*/
/**
* Generated bundle index. Do not edit.
*/
exports.ɵangular_packages_http_http_e = BrowserJsonp;
exports.ɵangular_packages_http_http_f = Body;
exports.ɵangular_packages_http_http_a = _createDefaultCookieXSRFStrategy;
exports.ɵangular_packages_http_http_b = httpFactory;
exports.ɵangular_packages_http_http_c = jsonpFactory;
exports.BrowserXhr = BrowserXhr;
exports.JSONPBackend = JSONPBackend;
exports.JSONPConnection = JSONPConnection;
exports.CookieXSRFStrategy = CookieXSRFStrategy;
exports.XHRBackend = XHRBackend;
exports.XHRConnection = XHRConnection;
exports.BaseRequestOptions = BaseRequestOptions;
exports.RequestOptions = RequestOptions;
exports.BaseResponseOptions = BaseResponseOptions;
exports.ResponseOptions = ResponseOptions;
exports.Headers = Headers;
exports.Http = Http;
exports.Jsonp = Jsonp;
exports.HttpModule = HttpModule;
exports.JsonpModule = JsonpModule;
exports.Connection = Connection;
exports.ConnectionBackend = ConnectionBackend;
exports.XSRFStrategy = XSRFStrategy;
exports.Request = Request;
exports.Response = Response;
exports.QueryEncoder = QueryEncoder;
exports.URLSearchParams = URLSearchParams;
exports.VERSION = VERSION;
Object.defineProperty(exports, '__esModule', { value: true });
})));
//# sourceMappingURL=http.umd.js.map
| mini_pile | {'original_id': 'cc628a0b114b2b23c466971603b73115d019b07eebd515343bede6637f2b32a4'} |
\section{Characterisation of Linearly Independent Set through Free Module Indexed by Set}
Tags: Module-Theory, Module Theory
\begin{theorem}
Let $M$ be a unitary $R$-module.
Let $S = \family {m_i}_{i \mathop \in I}$ be a family of elements of $M$.
Let $\Psi : R^{\paren I} \to M$ be the module homomorphism given by Universal Property of Free Module on Set.
Then the following are equivalent:
:$S$ linearly independent
:$\Psi$ is injective.
\end{theorem}
\begin{proof}
We have:
:$\map \Psi {\family {r_i}_{i \mathop \in I} } = 0$
{{iff}}:
:$\ds \sum_{i \mathop \in I} r_i m_i = 0$
{{explain|Justify the above statement.}}
Thus injectivity and linearly independent are equivalent.
{{explain|Justify the above statement.}}
{{qed}}
Category:Module Theory
\end{proof}
| math_pile | {'subset': 'ProofWiki', 'meta': "{'type': 'Theorem_Proof'}", 'original_id': '4be4b34dd9a40a8af07eb77b7f5aad9efe1d8dcbabf45e9ea71ceb0bb322f1e3'} |
Technical Abstract:
The glassy-winged sharpshooter (GWSS), Homalodisca vitripennis (Germar), and other sharpshooter (Cicadelline) leafhoppers transmit Xylella fastidiosa (Xf), the causative agent of Pierce’s disease of grapevine and other scorch diseases. Past research has supported that vectors have virtually no latent period for X. fastidiosa, because sharpshooters are able to inoculate bacteria within one hour of uptake, from either infected plants or artificial diets. Such findings usually have been interpreted as evidence of rapid attachment of bacteria onto the cuticle of the functional foregut. However, results presented herein show that green fluorescent protein-expressing (GFP) Xf, taken up by GWSS given a 24-hour acquisition access period (AAP) on artificial diets, did not bind to the foregut according to confocal examination immediately after the AAP. Acquisition diets contained 100 million CFU of bacteria primed for cuticular attachment. In addition, following the 24 hour AAP, sharpshooters were given an additional 24-hour holding period on bacteria-free diet or plants. Bacteria were not detected via quantitative polymerase chain reaction (qPCR) inside either insects or plants immediately after the holding period. In contrast, numerous GFP Xf were expelled into confocal-imaged salivary deposits, when sharpshooters were offered bacteria-free diet sachets immediately after the AAP. One possible explanation for these results is that bacteria could be held in a column of fluid in the stylets for minutes to hours after ingestion from diets. If so, then egestion of these unbound bacteria could represent a new inoculation mechanism that explains the absence of a latent period for Xf. | mini_pile | {'original_id': '3e382995d8d1f006742cf292115af7e74851c1a484fd5ba9e9f16400a024c1e5'} |
About Us
Welcome to IctElixir LLC
About IctElixir LLC Company:
We are a small Mom & Pop operation in Wichita Ks hence the Ict which is the freight and airport code for Wichita Ks. We do not have a huge overhead nor do we buy sports cars, vacation homes or other luxury items. We simply do our best at driving down the prices since our conception to keep things affordable for the average day folks, like us since 2002!
We Hand Craft flavor profiles developed by us, using only Professional top shelf flavors and Quality Kosher VG! "We don't claim to be premium nor do we have premium prices!"
All of our Hand Crafted blends are preaged four to six weeks before shipment, so there is less wait time on the consumer end. Many of our monthly consumers use our products right from the mail, although if you feel that you need to age them longer for your personal palate by all means feel free.
We use simple labeling instead of flashy and/or colorful labeling to cut cost to save everyone a ton of cash, so you can afford things in life that you want and/or need!
During our conception we realized the need for packs of juice so we put together discount pricing. We started off with 30ml sized bottles during our first six months and quickly moved into a full line of sizes and styles of bottles. While growing with our different sizing of bottles, we then decided to offer all bottles in juice packaged deals like our market orginal Buy 5 get one free deal (6 pack deal) on our 30ml bottle deal.
Hours (Unless a Feeral Holiday or posted time away on our website and Facebook Pages):
Monday Thru Fruiday 5am - 5pm
Saturday 5am - 11am
Normally we do try to reserve Saturday afternoon / evening as well as Sunday morning /afternoon for family time as we do have children, although during high volume times like when we run sales we prepare for them months in advance with product as well as help and overtime to move product in a timely manner to those that are so kind to allow us to seve them. .
Can I pick up locally?
No sorry pick up is not available as we are not a B&M so we do not have a public entrance in our secure facility, nor accidental insurance for the public. We do stay very busy 12-14 hrs per day and sometimes longer hours so our time is very restricted ensuring we are processing mail orders in a timely fashion.
Why do we only Accept Direct Visa card payments?
Very simply, attempted Extortion from Mastercard! Mastercard wanted several thousands more per year to process direct Mastercard payments, plus additional paperwork that would of cost thousands. This would of made our prices double if not triple, so we parted ways with Mastercard since they are no longer friendly to High Risk Payment Processing or our Industry!
Our mission is simple:
To keep our pricing affordable where you can still buy gas, groceries and pay your bills!
We strive daily at bringing back the ole world customer service that was lost long ago, promptly getting customers orders sent to them and into their hands. Let's face it no one likes to wait forever on something they paid for even if it is less expensive.
Social Media:
We do have a couple Social Media pages, although we are much to busy to play Social Media warrior adolesent games. So if you are in to Social Media drama please exclude us as we will not tolerate that kind of behavior.
If you would like to join us on Social Media here are the links to find us: | mini_pile | {'original_id': 'a00d8382a527335aae596c9813ed263ecf70aa9d2ec614eb1c8010a3b062dcb3'} |
Find a Cruise
Maureen Moran
Age: 28
Occupation:Travel Agent
Number of Cruises: n/a
Cruise Line: Costa
Ship: Costa Atlantica
Sailing Date: January 28th, 2001
Itinerary: Western Caribbean
Maureen Moran
When my husband and I were looking to go on a cruise sometime at the beginning of the year, his friend recommended a Super Bowl Cruise! Now I am not a sports nuts and thought I am not going on a cruise with a bunch of hooting and hollering men! They tried to reassure me but I wouldn't budge. I researched this Super Bowl Cruise myself and found that in fact it is not at all what I was picturing. Not only did Cruises Etc. have a detailed brochure but a fabulous web site as well! It was easy to make a decision that this is what we wanted!
We couldn't have made a better decision! The ship departed Fort Lauderdale on Super Bowl Sunday. The game was shown on a big screen in the huge theater! Now we know I am not the football screaming type but this was a great way to watch the big game! Especially when money is involved! Cruises Etc. gives away over $100,000 in cash and prizes! Talk about getting into the game! Well, we only walked away with a couple t-shirts and a sore throat but it was definatley worth it!
The next day we stopped at Key West. What excitement! After a few hours of shopping we ate lunch at Sloppy Joe's and hit a few bars! Their was an Irish Pipes and Drums Band marching down the street playing the Irish tunes! I almost started to jig when I noticed it was time to go back to the ship and get ready for dinner! Believe it or not but the band marched us right on the ship! They were sailing with Cruises Etc. and the Super Bowl gang!
Throughout the week we visited beaches, more shops, golf courses, we did it all! All the mean while we met wonderful friends and won money! Cruises Etc. gave away a ton of money daily! They had a cocktail party with a game they called "The Chip Dip"! They gave away more than $10,000 that night! And daily they had the "$5.00 Ding Dong"! Whoever wants to play, they just put their name on a five dollar bill and throw it in the hopper. Amazing! They gave away $9,500 one day!
We had a great week! The ship is endless with such beauty! The food delicious! The staff friendly and polite! Not to mention very helpful! I was so happy to find out that Cruises Etc. puts on this great theme cruise every year! Coincidently they have planned the 2002 Super Bowl Party on the Atlantica again and we are already signed up and ready to go! I would recommend to anyone!
Was this review helpful?
Yes No Email this review to a friend
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '2', 'language_id_whole_page_fasttext': "{'en': 0.965936541557312}", 'metadata': "{'Content-Length': '28095', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:6DA2UYNRYCL77MLWTAJ6WDIBDPLWR7TG', 'WARC-Concurrent-To': '<urn:uuid:e3c31b98-81e8-4e7f-9bd9-908fcab6b788>', 'WARC-Date': datetime.datetime(2014, 8, 2, 3, 20, 3), 'WARC-IP-Address': '98.158.195.149', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:DVWMQ4UQ4GPVJDWICL6BK5DIQNSUZIMM', 'WARC-Record-ID': '<urn:uuid:ff503f65-235d-4696-b5db-d12349cde8bd>', 'WARC-Target-URI': 'http://www.cruisereviews.com/Costa/CostaAtlantica18.htm', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f5043d12-5949-4381-bd9d-350721d13697>', 'WARC-Truncated': None}", 'previous_word_count': '497', 'url': 'http://www.cruisereviews.com/Costa/CostaAtlantica18.htm', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03328198194503784', 'original_id': '577063525a02e8b16e7d2004cd64d71993bec86836bc1df011a1eca23d2e66ce'} |
The most trusted and popular consumer complaints website
Recently Discussed Complaints
1. (20 mins ago)
2. (38 mins ago)
Cognizant Technology Solutions
Very poor service!
3. (1 hr 4 mins ago)
State Farm Insurance
No Response or Call Backs
4. (1 hr 5 mins ago)
Shame on them for their awful business methods
5. (1 hr 18 mins ago)
Consumer Tips & Tricks
Latest News & Stories
Latest Questions
Teletech @ Home, Colorado Complaints & Reviews - No good to work for
Teletech @ Home Contacts & Informations
Teletech @ Home
Posted: lizzard g
No good to work for
Complaint Rating: 95 % with 132 votes
Contact information:
Teletech @ Home
United States
This company is more concerned with call handle times than customer satisfaction. They have a lot of expectations of you for each call, yet they constantly pressure you to keep the call short. How can you give quality customer service while constantly watching the timer?
They are also not too concerned with your schedule. They change your shift whenever they feel like it to whatever they feel like making it, and it's up to you to try to get someone to switch with you ... good luck with that! My training class had over 25 people, and after 4 months, there are no more than 8 left.
To top it all, the pay is not worth the pressure they put on you, also the verbal abuse from some of the customers.
Comments United States Retail Stores
Share with others:
Was the above complaint useful to you?
More Teletech @ Home complaints
Teletech @ Home - Misguided Management
Sort by: Date | Rating
31st of Aug, 2010 by Draconis Regal 0 Votes
Unfortunately, this isn't atypical of just Teletech. ALL customer support centers have an emphasis on short handle times. It's critical to handling a large volume of customers in a short period of time and critical to their fulfillment of their contracts. Outsourced call centers are more pressured than Owned call centers /because/ of those same contracts. They're needed to /handle/ the heavy call volume. When you signed on, if you agreed to a flexible schedule, rather than a set shift, then its on you that the company is moving your shift almost seemingly at random. Its done to handle the business need of again, covering those large quantities of calls. 8 people left out of 25 over a 4 month period is actually pretty good for a call center handling customer support. Period. Most people don't have the temperament to handle it. A great deal of it boils down to attitude and perspective. Verbal abuse from the customers comes with the territory. Deal with it. They get more Bold on the phone than they will in person. Cowards, the lot of them. But, they still pay your check. As to the pay? Well, you haven't mentioned how much you're being paid.
19th of Nov, 2010 by GiGi126 +1 Votes
I feel that Teletech has a lot of issues. The CHat room cannot handle the volume of questions from the employees. I feel that the job is okay, and yes it can be nerve wrecking, but i'ts a work from home position. You are working from a cd so it's not as easy as web base. I'm not sure why they do not use the website for their customer.
16th of Dec, 2010 by customeradvocate1 +1 Votes
I am currently working for Teletech at home and in my training class (it started Nov 1, 2010) several dropped out before we finished training because they had one trainer (and she was great) for 42 trainees. I have been a software trainer in previous positions - training that number of people in one class is difficult face to face, but in an online class impossible. We started training on a Monday and discovered that we were lied to by their recruiting department. We were told Monday thru Friday until training was completed. Well guess what - We had training on that first Saturday. This was difficult as most of us had other commitments for the weekend but the only assistance Recruiting had was "training is 100% manditory you have to be there on Saturday". No acknowledgement from Recruiting that they didn't tell us the truth.
In training, we were shown what our screens would look like. We listened in to what the calls would be like. When we got out of training, all of the systems were changed and we had to learn to get into our programs differently, we had to set them up on separate screens as the combined screen would no longer work.
And then there are the chat rooms - 50 people trying to get an answer for the customer from one coach/team leader that may be working in 3 chat rooms at once - so you don't get fast answers to get to the customer and that slows down the time it takes for you to finish a call. But they harp on you to get this done fast - take more calls - get it done! Who cares what the customer needs just close the call and take another. If you consider the customer service rep an advocate of the customer then this is not the job for you.
4th of Jan, 2011 by Mica B +1 Votes
I agree and disagree with all the comments posted. It's a difficult job but what other job can your work while sitting in the comfort of your home in your Pj's?? There's a lot of aggravation but there is also the reward of not having to deal with the hustle and bustle of traffic, wearing business casual attire everyday, buying lunch, etc. YOU AR AT HOME! What did you expect training would consist of? Everything is online. If you cannot handle the job, quit and give someone else who needs the position that opportunity. Yes, it's difficult to get answers from Chat but realistically, all the answers are there for you. You simply need to look and not LEAN so much on the team leads for every simply question. They are also overwhelmed. All in all, the pay is good for sitting at home and when push comes to shove, there are people that can't even find employment. Count your blessings!
18th of Jan, 2011 by rampped +1 Votes
well that is the problem...teletech knows people need employment and like all other corps they are bound and determined to take advantage of that
11th of Feb, 2011 by mcassada +1 Votes
Who do I contact to have my password & username reset to apply for a work at home job? Also what is the rate of pay for a work at home job with TeleTech?
2nd of Mar, 2011 by TechnicalAgent 0 Votes
I am currently one of the employee in teletech work@home. Yes, must be 10mins the call handle time but you could stay longer 10mins if you educating cust about the service you'd offer based upon of their needs. You must reach their 15% of rating in sales the average. It's a great job if you are looking for work@home but it's a worse job if your computer is not compatible to their network adapter which may can work to their cd (cross your finger) and more nightmare if you do have bad ISP connection. My situation right now is keep dropping off to their database due to their cd is not compatible to my network adapter. My ISP connection is really great in my area but in some reason I keep dropping off all the time. They won't admit it's their cd is bad until two technicians told me their cd is very sensitive. I am losing money plus effort to tried be back on their database. They arent pay you if your out on the phone due to got kick out on their database either talking with their technician to find out why your applications disappeared. They only pay you when you picking calls, they wont pay you if all your applications disappeared or fail due to any reasons.
I tried to get sales and there are times during in the middle of conversation with the customers my apps disappeared. I called their technicians yes it work but good luck if you could stay longer on their database. I called my ISP there's none problem in their end plus my speed connection is excellent. It just their cd is not working well. Plan to resign due to not worth at all in staying longer with them due to their cd is not good.
2nd of Mar, 2011 by TechnicalAgent +1 Votes
The reason am here in this site because am searching in google about any teletech complaints from other people until I found this site. Glad I've found you all and read all your comments here.
The last teletech technician I spoke with, confirmed to me that teletech trying to improve their cd but might it will happen sometimes next year. But, I can't wait next year until their cd work...we/ I need it now because am/we're losing money everytime the database applications disappeared due to their cd is not good. Not only I have this problem, most of the agents do but because of economy crisis they aren't complaint as long as the apps back after several of trying accessing their cd. For me, I dont want to stay an hour until the cd work. Their cd are not compatible to any internal network adapters w/c they won't admit it unless if you been lucky somebody in their technician people open it to u the truth.
My best solution is to resign, am losing patience and got tired of many troubleshooting applies on your computer.
16th of May, 2011 by khomeworker 0 Votes
I have worked for Teletech for 2 years now and couldn't disagree more with these complaints. People please remember that this is a JOB which you are paid for, which is sometimes easy to forget when you are sitting in the comfort of your own home. Like any other JOB, there are requirements and expectations to be met and you will need to actually work and put forth some effort. Most of the complaints I am seeing seem to be an unwillingness to meet job requirements. I would ask these people how successful they have been on other jobs because it sounds like they do not want to work or put forth any effort, they seem to want it to be effortless. I really enjoyed training because it's fun and you get paid for the time, when I hit the virtual production floor, it was VERY stressful and fast paced, but if you are willing to do your best you can succeed in this job. I hope to make a career with this company because I think they are the best company to work for. I have found that they really do want you to succeed and do everything they can to make that happen. I just don't understand how anyone can complain because their are rules and requirements of them just like any other job. I highly recommend working for Teletech.
8th of Jun, 2011 by KeepItRealPlz 0 Votes
Stop. You are not telling the truth. Obiviously, you have never been out of a job and taken advantage of when you do get a lower paying job. Teletech takes advantage of its employees that work from home and blames all that goes wrong on those same employees. With that being said, some of those emloyees stick it out because "you do what you have to do to survive". But let's keep it real, okay?
8th of Jun, 2011 by khomeworker 0 Votes
Wow, while I'm not appreciating being called a liar, I can understand that you've been burned by jobs and Teletech didn't work out for you. I don't know what happened in your situation so I certainly can't defend on either side. All I can attest to is my experience with them, and the projects I was on and am currently on seem to give us every opportunity to succeed. Maybe I've been fortunate enough to be on the better projects, I don't know. I found it to be the most stressful thing I've ever done when I first started. But I stuck it out and now I'm very pleased to have the job. My experience has been a very positive one, and I certainly didn't mean to minimize anyone else's experience. I am sorry the job didn't work out and wish you well in your job search.
8th of Jun, 2011 by khomeworker 0 Votes
Oops sorry, not sure what's happening with all the extra character strings in that last posting!
8th of Jul, 2011 by kwinet +1 Votes
just wanted to ask some questions:-- the incoming calls for @home tech support are they through your computer or through the private phone line??
31st of Jul, 2011 by CCRNewbee 0 Votes
Good Question Kwinet...that's mine also as I am considering joining the Teletech team. I have many years of call center experience and I find that type of job a 'breeze' for me. But...THAT'S ME and MY personality. I'm just questioning the 'at home' thing and wondering exactly 'How' it works. For example, is it all instant chat? or verbal calls? or mixture of both? And being a "call-center", does that mean equipment purchase of a wireless headset so that you can be away from your computer and take a call while running to your monitor...I've never done anything from home and I like the idea. Just weird for me ssince I'm use to the public market and much prefer social intervention while at work, but hey, if it can pay my bills, I'm good with that!
31st of Jul, 2011 by khomeworker 0 Votes
ok to answer your question, it's both, through your land phone line via software on your computer, and they are incoming voice calls. You would be an excellent candidate for this company with your experience. The only thing you will probably be required to purchase is a telephone headset, assuming you already have the computer. Nothing is wireless for this type of job (for security purposes) and you will need to be in front of your computer, eyes on everything during your shift, with the exception of breaks and lunches. This is still a job just like in brick and mortar and requires your full attention. I would highly recommend you apply!
1st of Aug, 2011 by CCRNewbee 0 Votes
Thanks Khomeworker for answering my question and thanks for the suggestion. Seems you know a lot about this process so here's another question: Can I pick [or set] my own schedule, or am I at the mercy of the company needs? [[which I don't mind either]]. And, paycheck...HOW does Teletech pay? I mean, HOW do they know you've worked your shift or not in order to get your pay? Assuming, of course, that payment is direct deposited, but HOW does Teletech know you've completed the 'job requirements' and compensate you accordingly? --silly ques, I know--
I am Highly considering of applying and with your recommendation helping support my decision, I probably will do so within the next 24hrs.
1st of Aug, 2011 by khomeworker 0 Votes
you are subject to which schedules are available, you can tell them your preferences and they will work with you the best they can to accomodate. When you are logged in via the phone/computer that is how all your time is tracked. You are visible and on calls during your entire shift. Communication with other agents/coaches and your Team Leads is done through chat rooms. You are never left alone, there's lots of support in place and you are held accountable to your schedule.
1st of Aug, 2011 by mcmag 0 Votes
I have an interview tomorrow and i too have been in the customer service business for years, specifically call centers, in-bound as well as out-bound and i'm here to tell you, it is what you make it. You can't please every customer and there are some rude ones and the call flow is continuous but it's definitely something i'm very use to. I'm very eager to work from home, i mean if you get the luxury of working from home there has to be some 'actual' working to be done other wise it would be a 'too good to be true' kind of thing. khomeworker thanks for the info.
1st of Aug, 2011 by CCRNewbee 0 Votes
Thanks for all the info!! Great information, both positive and negative. I am an open minded person and am smart enough to balance both sides of a situation.
1st of Aug, 2011 by khomeworker 0 Votes
You are absolutely right it is what you make it. Teletech is a very good company for giving you every opportunity to succeed and it's very easy to move up in this company quickly if you prove yourself. I have been with Teletech as a seasonal agent, and now a permanent agent, with a total of 2 years, and I have already moved up. They are pioneers in the @home field and they are improving it all the time. I had absolutely no customer service experience yet they still hired me and gave me a chance and I proved myself. You may start out as a seasonal agent, but prove yourself and you will either be kept on or hired back for another project. You both have experience and a great attitude so you will do very well I think. I just think it's the best job in the world. I wasn't feeling very well the other day but was able to still fulfill my shift and was so grateful that I was at home and didn't have to get dressed and head out the door with the way I was feeling! I wish you both well and who knows, maybe I'll run across you on the job! And Mcmag, best of luck on your interview and you will do great I know it!
Post your Comment
Please check text spelling before submitting a comment
Your attitude towards ComplaintAgree Neutral Disagree
Comment text
Spell Check
Attach photos (optional)
Legal Strategies How to Deal with Collections
Latest Groups
Today's Mess-Up Photo
RSS Feed
Login close
Forgot your password? | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '7', 'language_id_whole_page_fasttext': "{'en': 0.9752954840660096}", 'metadata': "{'Content-Length': '90221', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FAQ77YV6SLT67UJDTBCM5GFSPWIA7G7L', 'WARC-Concurrent-To': '<urn:uuid:3fab3b3b-90f8-46a6-b592-bd93fc9940e3>', 'WARC-Date': datetime.datetime(2013, 12, 13, 13, 18, 52), 'WARC-IP-Address': '50.31.101.22', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:WFRAMXSIAYSG2TKUYQ634NPECP6NTMZN', 'WARC-Record-ID': '<urn:uuid:504e8dbe-c4de-460a-9c36-89ca640ff044>', 'WARC-Target-URI': 'http://www.complaintsboard.com/complaints/teletech-home-colorado-c323644.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:99952b20-0d1b-4bbc-814d-f458f868c303>', 'WARC-Truncated': 'length'}", 'previous_word_count': '3026', 'url': 'http://www.complaintsboard.com/complaints/teletech-home-colorado-c323644.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.025352895259857178', 'original_id': '33ec9f55232ad3fcebc181b182e301078210323d22f8c33f880e3af4211e3466'} |
This post is based on the following question from Max S:
Question: I had a couple questions about throwing the disk. The first is about throwing in crosswind. My understanding of crosswind throwing seems to be flawed. Example: Wind is going right to left. I’m throwing a big outside-in flick, or a big inside out-backhand. (I’m a righty). By my understanding, the wind should be pushing the bottom of the disk, therefore pushing it to the left and causing it to even out. So why is it that that doesn’t always happen? Instead of evening out, the disk sometimes drops into a blade, or evens out and then overturns (I can’t remember exactly which). In addition to that, the backhand inside-out and the flick outside-in tend to have different results when thrown in the same wind. The only obvious difference i can spot between the two is the spin of the disk: for backhand it is clockwise and for flick it is counterclockwise. This leads me to believe that the spin direction of the disk has an effect on the travel path of the disk in wind. Can you confirm this? Can you also offer some advice for throwing in cross-wind? I’ve been playing ultimate for a bit, so I can throw pretty much perfectly without wind, but this lack of understanding of cross-wind patterns is dragging me down. You have a pretty good article here on down and upwind throwing, but nothing on crosswind – I hope to see one soon? Brodie Smith doesn’t have a video for crosswind either, so there isn’t much resources for learning to throw crosswind
Answer: I like how you talked through the example and got into a bit of the physics of the disc. Let me go into a bit more detail for you. On an inside-out backhand, the spin of the disc will cause it to rise (since it’s spinning upwards), whereas an outside-in disc will always be falling since the disc is spinning downwards. So, when you have a right to left wind, you will want to throw a slightly inside-out backhand or a mostly flat backhand and start it right of your target since the wind will bring it to the left. You will want a lot of spin on the disc and try to not throw it with a lot of pitch on the disc (the front of the disc higher than the back of the disc). Think of a disc like a wing so the more the nose of the disc is up, the more it will stall out. The flatter the disc is, the more smoothly it will fly.
When you throw an outside-in backhand in the right to left wind, you would think the wind would hit the top of the disc causing it to flatten out but since the disc is fighting the wind, and because it’s spinning down, it will have a tendency to turn even more in and blade, as you’ve experienced.
As you mentioned, you see a difference in a backhand IO and a flick OI…that’s because of what I talked about above…the IO you throw low and it spins high; the OI you throw high and it spins low.
In a crosswind, I try to use the wind as much as possible. That’s why I find throwing it straight and flat or throwing a backhand IO works the best.
Ultimately the best way to learn the physics of a disc in flight is to throw different kinds of discs (only throwing ultimate discs will actually hinder your throwing – if you get into throwing golf disc and dog discs, your throwing will improve exponentially). Thank you for this question – I know one of the most fundamental things I ever learned was in my first year of playing – a guy taught me about the edges and the difference between an IO and an OI and how I wanted to throw the disc with an edge and have it end up flat ideally. Pretty eye opening at the time.
Written by Ultimate Rob
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '34', 'language_id_whole_page_fasttext': "{'en': 0.9501675963401794}", 'metadata': "{'Content-Length': '57171', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:LPJ2E2BUEWHNVBSYVOF7FNYLOIUUWKS3', 'WARC-Concurrent-To': '<urn:uuid:e1320d70-6370-40a9-95bd-cc64f62d2088>', 'WARC-Date': datetime.datetime(2017, 3, 25, 7, 53, 44), 'WARC-IP-Address': '173.201.97.1', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:PSTXU6FEQW7SIVSEOECMLDOMOSL73W6O', 'WARC-Record-ID': '<urn:uuid:a97d9d0e-289d-4262-874a-f0fc15c01cce>', 'WARC-Target-URI': 'http://www.ultimaterob.com/2013/09/09/throwing-in-a-crosswind/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:71c846fe-459a-41b1-94e9-ecba0d07a32e>', 'WARC-Truncated': 'length'}", 'previous_word_count': '701', 'url': 'http://www.ultimaterob.com/2013/09/09/throwing-in-a-crosswind/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-233-31-227.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-13\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for March 2017\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.612041175365448', 'original_id': 'c084ab24a03ee90e0924ada5933d81bfc09a6ae3bcaf3be17d7755f83f464d50'} |
Mama Bah-Yéré
Mama Bah-Yéré (born 22 July 1992) is a Beninese international footballer who plays for Lobi Stars, as a defender.
References
Category:1992 births
Category:Living people
Category:Beninese footballers
Category:Benin international footballers
Category:Buffles du Borgou FC players
Category:Lobi Stars F.C. players
Category:Nigerian Professional Football League players
Category:Association football defenders
Category:Beninese expatriate footballers
Category:Beninese expatriate sportspeople in Nigeria
Category:Expatriate footballers in Nigeria | mini_pile | {'original_id': '501b6c88cfe497d5d578598cf1c733dad6b482a258234a0e4cf50349e447f3f8'} |
Q:
pointer to object == pointer to first member?
Why does the if condition in the following code yield true?
struct A
{
int firstMember;
} a1;
if (&a1 == static_cast<void*>(&a1.firstMember)) std::cout << "equal";
I got a bit confused when reading Stroustrup's FAQ on empty classes, specifically the statement below:
if (p1 == p2) cout << "nice: good optimizer";
A:
There are no references involved in your code. Don't confuse the "address-of" operator (also &) with references.
Your condition returns true because in this case it happens that the object starts in the same place in memory as its first (and only) field. That's the case i.e. for so-called POD (plain-old-data) objects, but it's not always true.
For example it's likely for the condition to be false if your class contains any virtual functions. Don't depend on it.
| mini_pile | {'original_id': '68c6dda5f8c9ad4c63fd28f6ba0c07278fc4560b469139a4d27ad7a542aacb28'} |
who never saw a Ute, saw hundreds of acres of pine con- sumed. I resided in a district that was nearly all burned over in 1879, and tliere was not an Indian in it, thongh it was within fifty miles of the reservation. Old 5ettler8 said there had not been a mountain fire in the region for seven- teen years before. They also said the year was unnsnally dry, and that fires travelled and caught easily. It is true, however, that, owing to the reports, the whites generally be- lieved that the Indians were firing the forests at other places, to drive out the miners. It is true also that the Indians killed large quantities of game, as was complained, but so did every one. A man who failed to shoot at a deer because it was against the law would have been laughed at. Venison re- tailed, in season, at four and five cents the pound, while beef was fifteen to twenty. There was not a mountain stream in which dynan)ite was not exploded to kill trout, if .there were any trout in it. So with the forests. The United States law against cutting timber on public lands was no more regarded than if it had not been on the statute-books. The forests of stumps are there to-day to prove the statement. The people of Middle Park sent a memorial to General Pope, in 1877, representing that the Indians were slaughtering the game, " when a white man is not Allowed to kill a pound more than he can use to sustain life;" but if the people of Middle Park were any more virtuous or law-abiding, in this respect or any other, than the rest of the people in Colorado, no one ever discovered it. It was not many months later that half the county officials of Grand County (Middle Park) conspired to murder the countv commissioners, and did nmrder them. It is notorious that two of the signers of that memorial have committed suicide on account of their participation in that crime, and that Grand County to-daj' is a slumbering volcano of hate, remorse, distrust, and revenge, as a result of that aw- ful tragedy enacted on the shore of Grand Lake. Let it be distinctly understood that there were reputable, law-abiding people in Middle Park, and elsewhere in Colorado — plenty of them — but to all such representations of uniformly proper whites and uniformly villainous Indians, coming from any fron- tier settlement, I say : '' In the name of the Prophet — Bosh !" i WHITE RIVER AGENCY. 695 While the Utes behaved comparatively well in their sum- mer excursions, it cannot be questioned that these trips were a serious impediment to their civilization. Of course they would not settle down to farming while they could live by liunting. That would have been unnatural. But, worse than that, there were no restrictions to trade with them, off the reservation. There were four stores on Bear River, and many at other points, where they could obtain guns, ammu- nition, whiskey, or anything else that they were able to pay for. They were also thrown in contact with the worst class of whites, and there were some very bad white people for them to come in contact with. Aside from the ordinary riff- raff, there were a number of cattle-men about the reservation with more property than character. Two of thesi, who were the subjects of repeated complaints by the agent, were the Morgan brothers. They had large herds of cattle near the reservation, and were accused of permitting them to mix with the herd belonging to the White River agency, for the pur- pose of claiming the unbranded increase (mavpricks) of the agency herd. They were also charged with taking branded cattle and burning their brand, a double box (Q3), over the "ID" of the Indian Department. They were not the only ones. When the outbreak came, and the agency herd was scattered and uncared for, about twelve hundred of them disappeared. It was supposed at the time that t}ie Indians had taken them. It was afterwards learned that they were stolen by white men, rebranded, and sold to the government for beef. I had the honor to be acquainted with Wes Travis, one of the men engaged in this robbery — since suc- cumbed to the combined powers of bad whiskey and death — and have heard him tell, with great gusto, how he and a com- panion, after finishing the cattle job, killed an Indian that they met when coming out of the reservation. Morgan's partner, W. B. Hugus, and John Gordon, alias Sam- uel Lemon, were brought to trial for this affair, in Denver, but they had the good fortune to be acquitted. The Morgans escaped from the country. (J96 MASSACRES OF THE MOUNTAINS. The complaints made agaiiiBt tlie TTtcs, in tlic summer of 1879, flew on wings of the wind, growing as tbey went. Tlie only palpable foundation for tlieiu waa the alleged destruction of eoine property by two UteB called Ben- nett and Chinaman. It had been agreed by the Utee tbnt they would deliver up accused per- sons for trial, and tbey bad complied with this agreement usually, but on this occasion Doug- las refused to surrender these men to the officer who came for them, and informed him that he could not make the ar- rest on the reservation. The treaty also con- tained this clause: "Provided, That if any chief of either of the confederated bands make war against the people of the United States, or in any manner violate this treaty in any essential part, said chief shall forfeit his position as chief, and all rights to any of the bene- lita of this treaty : But, provided farther, Any Indian of these confederated bands who shall remain at peace, and abide by the terms of tins treaty in all its essentials, shall be entitled to its benefits and provisions, notwithstanding his particular chief and band may haye forfeited their rights thereto." Meeker, although he had no personal knowledge of what was occurring off the reservation, Joined in these complaints. On March 17 He reported that part of the Utes were going north " probably to supply ammunition to the hostiles," i. e., certain Sioux who were said to be on the war-path, and asked that the military send the Indians back to the reservation. Jack was several times confronted with reports of wrong-do- WHITE BIVER AGENCY. 697 ing, and the statement that his party wanted to go to war. Being conscience clear, he, with three others, went to Denver to see Governor Pitkin. He complained of this treatment and asked for Meeker's removal ; bnt being there confronted bj Meeker's letters, complaining of some things of which he had no knowledge, and of others that he could meet only by denial, he became disheartened and went back to the agency. In this interview he backed up his claim of Meeker's evil deeds by the statement that Meeker wanted their children to go to school and learn to work, neither of which the Utes wanted. Meeker had also promised him a wagon, and failed to give it to him, which satisfied him that Meeker could not be trusted. At the agency he got no satisfaction, and became impressed with the idea that Meeker was responsible for everything that was said about the Utes in the newspapers, a theory which the other Indians soon adopted. A more op- pressive burden could not be placed on any man's shoulders than such a responsibility. The Colorado press was sensa- tional, to say the least, and the contents of the papers were frequently communicated to the Indians by their white ac- quaintances. In the mean time a new trouble had arisen. Powell's Val- ley had been subdivided by Meeker with a view to its perma- nent settlement by the Indians. One street crossed it length- wise, and another at right angles to the first. The agency was located at the crossing, but the cross-street was as jet on paper only. Several small plots had been marked off for Indians who desired to work. The firet one provided for was John- son, a chief with "three cows and two wives," who showed a commendable disposition to civilize. A log- house was built for him, near the agency buildings, and for several months he was the " brag Indian " of the place. Horses were broken for him, and fed from the agency supplies to keep them in condi- tion for work; but, finally. Meeker discovered that Johnson was using these horses to race with the other Indians, whose ponies were picking a precarious living where they could find it. Johnson stock fell rapidly thereafter. Instead of culti- vating the land set off for him, Johnson used it to pasture his ponies, of which he had about a hundred and fifty. Early in 69S MASSACRES OF THE MOUNTAINS. September Meeker undertook to plough up a large amount of land near the agency, including that set off to Johnson and two or three others. These Indians objected, and could nei- ther be talked out of their objections nor induced to take oth- er locations. They got their guns, and ordered the ploughing stopped. The ploughing went on. In a few minutes a gun was fired in a clump of bushes near b}', and a bullet whizzed unpleasantly near the ploughman's ears. Meeker then stopped the work and appealed to Douglas ; but Douglas said the men who claimed land wanted it, and that Meeker should plough in some other place. Having exhausted his influence in that quarter. Meeker thought he would try the otlier faction. He sent for Jack, who came at once with his retainers. A council was held, and the conclusion reached that Jack and his men cared nothing about it, but that Meeker might plough a strip one hundred feet wide and half a mile long. He told them that this would do uo good ; that he wanted at least fifty acres, besides meadow land. He understood that they consented to this, but on the following morning the work was stopped again. Jack was sent for once more and another council was lield. They finally decided that Meeker might have the land if he would give Johnson a stove, move his corral, dig a well, and help build a house, to which the agent consented. He said, however, ^^ that it was the wish of all the Indians that plough- ing might be stopped, and that no more ploughing at all shall be done; but that the conclusion which they reached was based upon the danger they ran in opposing the government of the United States!" This influence wore off and the bad feeling of the Indians grew. Two days later (September 10) Johnson assaulted Meeker in his own house, drove him out, and beat him badly. Meeker would probably have been killed but for the interfer- ence of the employes. He sent at once for military aid, and. telegraphed the commissioner: ^^ Ploughing stops. Life of self, family, and employes not safe; want protection immedi- ately. Have asked Governor Pitkin to confer with General Pope." On the same day he wrote to W. N. Byers, of Den- ver, in regard to Johnson's attack, and added : ^'I think they will submit to nothing bat force. How many are rebellious I r WHITE Eiy£B AGENCY. 699 do not know ; bat if only a few are, and the rest laugh at their ontragcs, as they do, and think nothing of it, all are compli- cated. I didn't come here to be kicked and hustled out of my own house by savages, and if government cannot protect me, let somebody else try it. Yon know the Indians and under- stand the situation. Please see Governor Pitkin," etc. From that time to the outbreak, work at the agency was at a stand still. The feeling of the Indians, with very few exceptions, was that they would do no work; that the ploughing must stop; that Meeker was their enemy; that the soldiers were coming to have the land ploughed, to arrest Johnson, China- man, Bennett, and others, and, probably, to make everybody work ; that the soldiers ought not to come. Meeker's feeling may be inferred from his telegram to the commissioner, of September 17: "There is no particular change, either for worse or better. No ploughing is done, nor will until it can be done in safety. It remains to be seen whether the business and industries of this agency are to be conducted under the direction of the Indians or of yourself." In response to Meeker's application for protection, Major T. T. Thornburgh marched from Fort Fred Steele with a hun- dred men — three companies of cavalry and one of infantry. This post is in Wyoming, at the Union Pacific Railroad's cross- ing of the Platte. The road, which was the only ordinary ap- proach to the agency, runs to the southwest, crossing the Si- erra Madre at Bridger's Pass ; thence south, bearing east, to the crossing of Bear Kiver, at the mouth of Elk Head Creek. From this point its general course is southwest, striking the reservation at Milk Creek. On the 26th, Thornburgh was met at Bear River by a party of five Utes, including Jack and Colorow. They wanted to know why he was coming. He explained that the agent had sent for him ; that the Indians f had been acting badly. They denied everything, and asked that the soldiers should not come on the reservation. They proposed that he should leave the soldiers and go to the agen- cy, with four or five companions, to investigate the truth of the charges. Major Thornburgh informed them that his or- ders were to go on, but that he would find a good place to camp, closer to the agency, and leave his men there while he 700 MASSACKE8 OF THE M0UKTA1N8. went on. After some conversation, by which he thought they were brought into a pacific state of mind, they went away. Tliey returned to the agency and asked Meeker to stop tiie soldiers, but he said it was none of his busi- iiess. Finally he yield- ed to tlicir importuni- ties, and, on the 27tli, sent a letter to Tliorn- burgh advising him that it would be the better course to come on alone. To this Thombnrgh replied on the 28th that he would discontinue his march on the 29th, and come on with five men. On the 29th, in the morn- ing, the command reached Milk Creek and entered the reser- vation. The road, after coLORow. Milk Creek is passed half a mile, entei-e a caQon, the sides and top of which are covered with oak brash. It is called Eed CaBon. An Indian trail runs along the ad- joining ridge, or "hog-back," and joins the road near the creek. The Indians were in ambnsh along the tops of the canon. Just as tlie troops were beginning to enter it, shortly before noon, the advance guard, nuder Lieutenant Cherry, discovered some IndiiLns moving over a hill, half a mile in advance, and sepa- rated to reconnoitre. After flanking the caHon about two hun- dred yards, the ambuscade was discovered and at once reported. Cherry was ordered to make a reconnoissance on the right, and, if possible, communicate with the Indians, on the suppo- sition that hostilities might be averted by a parley. At the same time Jack started from the Ute position to talk with the soldiers; but when Cherry's command galloped oS to the WHITE RIVER AGENCY. 'J 01 right a body of Indians went out to oppose the movement, and both parties deployed. An Indian fired, and the fighting began on both sides. Captain Payne's company was at once thrown out on the left and Captain Lawson's on the right, in skirmish line. The wagon train, which was crossing a small plateau, between one and two hundred yards from the stream, was ordered to park. The Indians pressed the troops hotly. They were in strong force. Major Thornburgli saw that they were massing to cut ofi his retreat, and ordered his men to fall back on the wagon train. The movement was executed in excellent order, but in the midst of it the commander was shot and instantly killed. Captain Payne took command, being next in seniority. He set the entire force at work fortifying. Wounded horses were killed for temporary shelter for sharpshooters. Boxes, bundles of bedding, sacks of corn and flour, and everything available were piled up for cover, while pick and shovel were plied to make the protection more substantial. The men worked desperately — the groans of the dying, the agonized cries of the wounded, and the incessant cracking of the In- dians' rifles serving only as incentives to greater activity. To add to the geril of the situation, the Indians fired the grass and sago brush, and the wind was hurrying the roaring flames upon the little band. They worked on with feverish haste. The fire reached them, and stretched out its forked tongues to lick them up. There was no water within reach. They dropped their tools, and smothered the flames with blankets, blouses, and sacks. Some of the wagons took fire ; but, under cover of the stifling smoke, these were extinguished also. The greatest danger was now past. By burning the brush the Indians had deprived themselves of cover for close ap- proach, and were compelled to do their firing from the sur- rounding bluffs, at a distance of from four to six hundred yards. They commanded the situation, but could inflict no material damage. So long as the soldiers remained in their trenches they were safe from the bullets that were poured in on them. The news of the attack was carried to the agency, twenty- five miles below, by an Indian messenger who arrived at about one o'clock. The Indians did not breathe a word about it to 702 MASSACRES OF THE MOUNTAINS. the whites. They had held another council with Meeker, on the arrival of the messenger from Thornbnrgh, in regard to the advance of the soldiers, jnst as though nothing had oc- curred. Meeker prepared a note to Thornburgh, as follows: "I expect to leave in the morning with Douglas and Serrick to meet you ; things are peaceable, and Douglas flies the Unit- ed States flag. If you have trouble in getting through the eafion to-day, let me know in what force. We have been on guard three nights, and shall be to-night, not because we know there is danger, but because there may be. I like your last programme; it is based on true military principles." This message was dated September 29, 1 p. m. He little dreamed that Thornburgh was then lying cold and stark at the mouth, of the eafion. The "la€t programme" referred to was. Major Thornburgh's letter of the 28th, in which he informed Meeker that he would bring his troops "within striking distance" of the agency on the 29th. He said : " I have carefully consid- ered whether or not it would be advisable to have my com- mand at a point as distant as that desired by the Indians who were in my camp last night, and have reached the conclusion that, under my orders, which require me to march this com- mand to your agency, I am not at liberty to leave^it at a point where it would not be available in case of trouble." Meeker received this message at noon on the 29th. Previous to that hour, it seems certain that he was deceived in regard to Thorn- burgh's intentions. On the day of the attack, the 29th, he telegraphed Washington : " Major Thornburgh, 4th Infantry, leaves his command fifty miles distant, and comes to-day with five men. Indians propose to fight if troops advance. A talk will be had to-morrow. Captain Dodge, 9th Cavalry, is at Steamboat Springs, with orders to break up Indian stores and keep Indians on reservation. Sales of ammunition and guns brisk for ten days past. Store nearest sent back 16,000 rounds and 13 guns. When Captain Dodge commences to enforce law, no living here without troops. There was no evidence of it at the agency. According to Meeker's statement, guards were first ]iosted on the night of the 26tb. It was the opin- ion of Mi-8. Meeker, Josie Meeker, and the employes that the plot was arranged on the 28th, wiien the sol- diers had passed the fifty- mile limit. There was a war -dance that night, in Douglas's camp, which con- tinued till daybreak the next morning. The action of the Indians on Monday was marked by deep cunning; their behavior at the coun- cil deceived Meeker com- pletely. He despatched his note to Thornburgh by Wil- mer Kskridge, a man em- ployed at the agency as a sawyer. He was accom- antklopk. panied by two Indians- Antelope (Wah-sitz) and Ebenezer. After going two miles the Indians murdered Eskridge, and hastened back to the agency. In the mean tiiac the other Indians had managed to 704: MASSACRES OF THE MOUNTAINS. get into the Btore-room and secnre all the agency gnne, without attracting attention. The people at the agency were wholly nnsaspecting. Mrs. Meeker and Josie were washing dishes in their house. Mrs. Price was washing clothes outside. Shaduck Price, post- farmer, and Frank Dresser, laborer, were in a wagon, throw- ing dirt on the roof of the new building. Arthur Thompson, laborer, was on the roof, spreading the dirt. Meeker and William 11. Post, storekeeper and carpenter, were in the larger storehouse. The other employes were scattered about the place, engaged in their various duties. As Ebenezer and Antelope returned, about twenty Indians, armed with guns, started up from the river. They met Douglas, who was walk- ing towards his teepee, and all came on to the buildings to- gether. They began firing as soon as they reached the new building — Ebenezer, Antelope, and others having by that time secured positions for attacking the other men. At the first volley Price was killed and Thompson fell from the building. Frank Dresser was wounded in the leg, but managed to run to Meeker's house through a rain of bullets. Mrs. Price picked up her little boy and ran to her room. Dresser fol- lowed her. She gave him Price's gun, which lay on the bed. As he came out, the windows of the dining-room were broken in. He fired through the window and mortally wounded Johnson's brother. The Indians then left them and began plundering the stores. The inmates of the house went into Josie's room and hid under the bed, but as soon as their wits cleared they saw that this position afforded no safety. They then ran into the milk-house, a small adobe building close at hand. Here they remained all the afternoon undisturbed, Frank Dresser, the three women, and the children. They had the entrance barricaded, however, so that they could not see what was being done outside. For half an hour the fir- ing was kept up quite steadily; then there were intervals of quiet, broken by volleys. It is probable that some of this firing was from the explosion of cartridges in the burning buildings, and the rest was drawn by some of the emplo3'ds who had secured weapons and were fighting for their lives. Mrs. Price tells their story thus: "We were in the milk- WHITE RIVER AGENCY. 706 house until nearly sundown. They set Meeker^s house on fire first. The house sat east and west, with wings built on the south and north sides. The south wing was Josie's bed- room, and on the north was my bedroom. In the east part of the house was a room used as a dining-room and kitchen, and on the north of that the milk-house. They set Josie's room on fire first, and we stayed until we began strangling in the milk-house, and had to go out. We ran into Meeker's house. I do not think it is ten feet to the corner of my bed- room. We opened both doors and thought of secreting our- selves under the bed of Mr. Meeker. I said : 'No, that will not do.' We looked out to the north. The blinds were open. They were busy taking out goods ; they were taking the blan- kets, shirts, and everything else they could. I said : * Let's try and escape to the north, in the sage brush ; it will not do to stay here ; they will be here in a minute.' Frank said, ' Let's go while they are so busy,' and we went. I ran out- side of the fence ; Josie, Mrs. Meeker, and Frank opened the gate and went into the field, and I crossed over through the wire-fence. They then saw ns ; we had not got more than ten or fifteen steps from the corner of the fence north before they saw us and fired. They came running, on foot and po- nies, and fired at all of xis, and hit Mrs. Meeker. The bullets whizzed by my head and hit beside me. They shot at Frank Dresser, and, as he would take a step, the dust would fly. The last I saw of him he was about a quarter of a mile from the agency, in the field, still running. The Indians took us, and said we had to go with them. As I was going, I said I had read so much about their treatment of captives, that I was afraid they would want to bum me. They said: *No kill white squaw; heap like them.' I said, 'Yon are going to burn me,' and they said, ' No burn white squaw.' Then they took me on through the brush to the river." Mrs. Price's captor was Ahu-u-tu-pu-wit, a small, ill-favored Uncompaligr^. Josie Meeker says of her capture : " One called to me and said, ' Come to me ; no shoot you.' I said, ' Going to shoot V He said, ' No.' I said, ' Better not.' He said, *Come to me.' And then they took me down to the camp." This was Persune, a Tampa warrior. Douglas tried 45 706 MASSACBES OF THE MOUNTAmS. to take his captive from him, bnt Persune pnshed him away. They had an angry dispute, after which Douglas went away and took Mrs. Meeker, whom no one else had claimed. The Indians moved that night about twelve miles to the south, and camped on Pi-ce-ance Creek, on the Great Hogback of the Eoan or Book plateau. They had all been drinking. They were laden with plunder and flushed with success. That night the three women were " taken for squaws " by their respect- ive captors, and were so held during their captivity. Mrs. Price was also outraged by Johnson. The news of these affairs came to the settlements slowly. There were weary days of suspense, in which no trustworthy tidings could be had, and no assurance as to the extent of the war. Ouray was on a hunting expedition with his band. A messenger brought him word of the outbreak, and he returned at once to Los Pinos to report to the agent. A letter to the White Eiver chiefs was prepared and signed by Ouray, directs ing them to stop fighting. This was carried by Joseph Brady, miller at Los Pinos, accompanied by Sapavanari. On receipt of Ouray's message the Utes agreed to obey his directions. Brady also communicated with the soldiers, who were now under command of Colonel Merritt. The remnant of the original command had held their fortification alone, without further loss, until the morning of the 2d, when Dodge's company of colored soldiers arrived. These had marched from Grand River on September 27, on orders to report at White River agency. On the 1st of October they found a paper, on a sage bush by the road, with the words : " Hurry up. The troops have been defeated at the agency. — E.E. C." A few miles farther they reached the village of Hayden, which was deserted, but while here a party of citizens came up, and the facts of the situation were learned. The command moved on down Bear River and went into camp as usual, to deceive the Indian spies, if any should be watching. At half- past eight they packed up again. The train was sent to the supply camp on Fortification Creek, and the remainder of the force, forty in number, took an Indian trail for Milk Creek. They reached the intrenchment at daybi^eak, without moles- tation, and did gallant service there. Merritt arrived with r PLAN OF WHITE RIVER AGENCY. (As H 0 & Land which Meeker doBired to plough A. Agent's honee. G. Granary. C. Corral. H. Hay corral. D. Donglns'0 teepee. J. Johnson's house and lodge. E. Employe's qnarters. M. Milk-bouse. PP. Plongfaed fields. N. New building. 8& Stores. W. Well. ///. Fences of eucloeed fields. WHITE RIVER AGENCY. 709 reinforcementa on the morning of the 5th. He found the besieged men in good trim. No more killed had been added to the thirteen who fell on the first day, though several had been struck. The wounded numbered forty-three, nearly all of the wounds being slight. The Indians were preparing to fight Merritt when Bi-ady arrived with Ouray's order. No fighting was done afterwards, except that Lieutenant Weir and Captain of Scouts Hnmme were killed, and the scouting party of Lieutenant Hall, from which they had detached themselves, was attacked. The Indians claimed that this re- sulted from Humme's shooting at some Indians that he met, and this is the only evidence extant on the subject. On the 9th word was received at Los Pinos that the White Elvers would fight no more, and that the Southern Utes would not join in any hostilities. On the 11th Merritt advanced to White River agency. All along the road were ghastly evidences of savage fury. In a gulch, six miles from the agency, lay the body of Carl Gold- stein, a contractor who was taking supplies to Meeker. A hundred yards away was Julius Moore, one of his teamsters, with two bullet-holes in his breast, and his body hacked and mutilated. A little farther down the cafiion the soldiers came to the old coal-mine, in which was found the body of Henry Dresser, engineer at the agency. He lay on his back, with his head pillowed on his folded coat. By his side was a Win- chester rifle containing eight cartridges. In one of his pock- ets was Meeker's message to Thornburgh, with which Esk- ridge had started. It is evident that Dresser had escaped from the agency wounded. He found Eskridge's body, and, remembering that he bore a message, had taken the letter from his pocket to carry it forward. He had become weak, and crawled into the cave to rest, but his life was spent. The Indians had not found him. Two miles from White Eiver Esk- ridge was found, naked, with a bullet-hole through his head. The agency was a scene of overwhelming desolation. All the buildings but one were burned down. No sign of life was near, and the absence of life was emphasized by the hap- hazard scattering of articles of all kinds over the ground, in- dicating a season of riotous pillaging before the burning. Ly- 710 MASSACRES OF THE MOUNTAINS. ing hero and there were the bodies of the victims. Father Meeker lay naked, on his back, one hnndred yards from the aeheB of his house. A bullet had pierced his braiD, and the left side of hie head was mashed in with a club. A barrel stave was driven into his month. Around his neck was a chain, by which he had probably Iwen dragged from the store- house. These indignities to him meant that their hatred was directed chiefly towards him. Frank Dresser's corpse lay over in the iield, with a bullet through the heart. George Eaton, one of the la- borers, lay naked, shot through theleft breast. From some strange fancy, the Indians had placed a bundle of pa- per bags ID his arms, after stripping him. The wolves had been eating him. These bodies, with those of Thompson, Price, and the others, were all picked up and bnried. The first object to ' which thegovernment directed its attention, after the outbreak was checked by Onray, was the recovery of couoLts. the captive women. This was undertaken by General Charles Adams, special agent of the Indian De- partment, who, with an escort of fifteen Utes, started from Los Finos for the hostile camp, on October 21, to secaro their release. A stormy council was held on his arrival. Part of the Indians wanted to give up the captives and make peace. The rest wished to kill Adams and go on with the war. It was understood that the Uintahs, Shoshonees, and others prom- ised assistance, but this was largely a result of MormoD mis- WHITE RIVER AGENCY. 711 representations. There were a few members of other tribes who would have aided the hostiles, but the majority favored preserving the peace. The Mormons unquestionably tried to help on the war. There were two of their emissaries in the hostile camp while Adams was there. The friendly Utes always said that the Mormons promised aid, and the hostiles wonld neither admit nor deny it. There was found, be- hind the breastworks of the Indians who besieged the force on Milk Creek, the body of an unknown white man, in the at- titude of firing, just as he had been killed. He did not be- long in that locality. The chances are about ten to one that he had a Mormon brand on his soul. Opposing these influ- ences were Ouray's authority, the apprehension of being worsted by the soldiers, and the influence of a little knot of friendly Indians. Prominent among these were two squaws, Susan and Jane. Susan was a wife of Johnson and a sister of Ouray. She felt under obligations to the whites. Years before, when Governor Evans presided over the affairs of Col- orado Territory, she had been captured by the Arapahoes. They were making preparations to burn her, when she was rescued by soldiers and taken to Fort Collins. Anxious to get to lier people, she slipped away from the fort and nar- rowly escaped recapture by the Arapahoes, who were looking for her. She was saved by a ranchman, who bid her under some cabbages in his wagon when he saw the Arapahoes coming. She was taken to Central City, furnished with a horse, and returned in safety to her people. Slie not only treated the captives kindly, but also went boldly into the council, an almost unheard-of thing among the Utes, and in- sisted on their release. Jane was the wife of Pah-vitz. She had been cured of a serious illness by Mrs. Meeker, and had been treated kindly by her and her daughter. She manifested her gratitude by numerous acts of friendship. There was another influence that affected the Indians. It was their rage over some pictures that they claimed to have found on the body of some dead person, but this was directed more particularly towards Meeker. The story is somewhat in- coherent, and possibly was not correctly understood. It was to the effect that they had found, on this body, pictures of 712 MASSACRES OF THE MOUNTAINS. Meeker, Mrs. Meeker, Josie, and Mrs. Price, each showing a wound in some mortal part, and each covered with blood. Meeker's showed a wound in the head, Josie's in the breast, and the others similarly. These, the Indians said, had been sent to make bad feeling against them. Whenever the subject was introduced they became furious. Some thought there was nothing in it, but Miss Meeker and Brady were both of the opinion that there was, because the story was repeated so often, by different Indians, and always the same. Captain Payne offered two possible explanations. One was that in his trunk, which was captured by the Indians, there was a picture of an Indian that had been given him a short time before by one of the scouts. When Thornbnrgh's body was recovered this picture was lying on his breast, held by a small stone. The Indian was not known to Payne, but was said by the Utes to be one of the Uncompahgrfe. This occurrence, however, has so little identity with the story that it may be left out of consideration as an explanation. The second was that a team- ster found on a bush a sheet of paper bearing rough drafts of the bodies of three or four men, with holes through them, that might have been meant for representations of bullet-wounds. Under the figures were wavy lines like writing, "fliis was brought to Payne on the night of the attack at Milk Creek. The only objections to this are that the pictures were recog- nized by the Indians as those of the persons mentioned, and that this picture did not fall into the hands of the Indians. On the other hand, it may have been in the possession of the Indians before it was found, and the identity of the figures may have been indicated by some of the signs used in their system of pictography. It is possible that the body referred to may have been that of Eskridge, and he may have had in his pockets photographs, which had been defaced, as photo- graphs sometimes are, hy pencil or ink marks. But to resume: the tribe at length decided that the cap- tives should be given up, and therd remained no objection ex- cept from Persune, who had become madly infatuated with Miss Meeker. He implored her to cemain with him ; prom- ised that she should never do any work ; that all his posses- sions should be hers, and similar rash vows. He wept like a WHITE EIVER AGENCY. cbild, bat his prayers and tears were of do avail. The other Indians regarded all this as a good joke on Persane, and after- wards, when the news of her death, while a Treasury clerk in Washington, came to them on Uintah Valley reservation, they nndged one another slyly, winked sigiiiticantly, and said that Fersnne ought to put on his mourning paint for his wife. General Adams, with the captives, reached Merritt's camp on the night of the 23d, and conveyed them thence to Los Pinoe. Tlie captives then claimed that they had not been subjected to indignity, and General Adams stated afterwards that this 714 MASSACRES OF THE MOUNTAINS. was his reason for urging the withdrawal of the troops. They did not make a fall statement of their treatment to any of the officials until their depositions were taken at Greeley, on No- vember 4, and then very reluctantly, and under promise that the newspapers should not have information of it. The pub- lic did not learn the facts for several weeks. The story of the remainder of the Ute trouble is mainly the record of the tedious sessions of two cotnmissions. The government demanded the surrender of the parties guilty of the massacre and the attack on Thornburgh, but could get no legal evidence of their identity. The white survivors could not testify to the killing of any white man by any Indian. The Indians denied everything, except what favored them. They had learned the white man's maxim: "No man can be com- pelled to criminate himself," and had evidently added to it the words, " or any of his friends." Not a man could be found who knew any one that had been implicated. The chiefs who undoubtedly led in the attacks swore that they were not pres- ent, or, if present, were trying to preserve the peace. Finally, General Hatch demanded the surrender of the parties against whom there was the greatest show of evidence ; vis. : Douglas, Jolmson, Antelope, Ebenezer, Persune, Alm-u-tu-pn-wit, Johnny (Douglas's son-in-law), Sah-witz (Sawa-wick, Sow-er- wick, Berwick, Serrick), Crepah, Tim Johnson, Thomas (an Uintah), and Pah-vitz. The proceedings were also delayed by the death of Ouray, on August 24, 1880, and of Ka-ni-a- che, who was struck by lightning two days after the death of Ouray. In one sense the death of Ouray furthered the final adjustment of the difficulty. He did not wish to move, though he finally consented to it, and he did not wish to leave his tribe. He had repeatedly said : " Ouray will never leave the great mountains." He and his tribe had the clear right to re- main and retain the reservation, under the treaty. They had not only not been hostile, but also had prevented a general war. | common_corpus | {'identifier': 'massacresmounta01dunngoog_30', 'collection': 'English-PD', 'open_type': 'Open Culture', 'license': 'Public Domain', 'date': '1886.0', 'title': 'Massacres of the mountains : a history of the Indian wars of the far West', 'creator': 'Dunn, Jacob Piatt, 1855-1924, author', 'language': 'English', 'language_type': 'Spoken', 'word_count': '6878', 'token_count': '9115', '__index_level_0__': '2422', 'original_id': 'd4c6f21ded1cb678b1093bef5cf26911eeba60e25ebaeef5c13012ad37f3caf3'} |
namespace MSR.CVE.BackMaker
{
public interface IViewManager
{
void Activate();
object GetViewedObject();
void Dispose();
}
}
| mini_pile | {'original_id': '1c66ea1d6beb6fe95272c6f802d2686fbc7564919abfeb57ed6bbdb5be5bdefc'} |
In the case where the orthogonal transform basis indicated by the orthogonal transform basis ID is not yet held in the orthogonal transform basis storage unit 103 (in the case of N in S205), the orthogonal transform basis transfer control unit 102 reads out the orthogonal transform basis indicated by the orthogonal transform basis ID from the orthogonal transform basis accumulation unit 110. In addition, the orthogonal transform basis transfer control unit 102 writes the orthogonal transform basis to an area which is of the orthogonal transform basis storage unit 103 and stores the orthogonal transform basis referred to least frequently so far (S206). Here, the orthogonal transform basis transfer control unit 102 identifies the orthogonal transform basis referred to least frequently with reference to the management table for reference history of orthogonal transform bases 201.
Next, the orthogonal transform basis transfer control unit 102 updates the management table for reference history of orthogonal transform bases 201 (S207). Next, the orthogonal transform basis transfer control unit 102 increments the number of times of reference of the orthogonal transform basis referred to in the management table for reference history of orthogonal transform bases 201.
In addition, the orthogonal transform basis transfer control unit 102 updates the management table for storage states of orthogonal transform bases 104 (S208). More specifically, the orthogonal transform basis transfer control unit 102 updates, to “held”, the storage state which is of the read-out orthogonal transform basis and is indicated in the management table for storage states of orthogonal transform bases 104, and updates the orthogonal transform basis storage state of the erased orthogonal transform basis to “not held”.
In the opposite case where the orthogonal transform basis indicated by the orthogonal transform basis ID is already stored in the orthogonal transform basis storage unit 103 (Yes in S205), the orthogonal transform basis transfer control unit 102 does not read out the orthogonal transform basis from the orthogonal transform basis accumulation unit 110, and proceeds to S209.
Next, the inverse quantization unit 111 inversely quantizes the quantized coefficients of the picture (or the macroblocks making up the picture) output by the decoding unit 101, and outputs orthogonal transform coefficients (S209).
Next, the inverse orthogonal transform unit 112 reads out the orthogonal transform bases stored in the orthogonal transform basis storage unit 103, and sets the read-out orthogonal transform bases as the orthogonal transform bases for use in inverse orthogonal transform (S210). The inverse orthogonal transform unit 112 performs inverse orthogonal transform on the orthogonal transform coefficients of the picture (or the macroblocks making up the picture) output by the inverse quantization unit 111, using the set orthogonal transform bases (S211), and outputs a prediction error signal to the adder 108.
Next, the prediction image generating unit 107 generates a prediction image (S212). More specifically, the reference image transfer control unit 105 reads out a reference image used to generate a prediction image from the memory 109 as necessary, based on the prediction mode, the motion vector, and the reference picture information decoded and output by the decoding unit 101 in S204, and writes the reference image into the reference image storage unit 106. The prediction image generating unit 107 sets the prediction mode and the motion vector decoded by the decoding unit 101 in S204, reads out the reference image stored in the reference image storage unit 106 as necessary, and performs intra prediction or inter prediction to generate the prediction image. The prediction image generating unit 107 outputs the generated prediction image to the adder 108.
Next, the adder 108 adds the prediction image output by the prediction image generating unit 107 in S212 and the prediction residual signal output by the inverse orthogonal transform unit 112 in S211 (S212).
Next, the decoding unit 101 determines whether or not the decoding of the whole coded stream is already completed (S214). When the answer is YES (Y in S214), the decoding unit 101 completes the decoding. On the other hand, when there remains any block that is not yet decoded (N in S214), the decoding unit 101 returns to S204 and repeats S204 and the following processing.
In this way, the decoding apparatus 200 performs the decoding operations.
As described above, according to this embodiment, the orthogonal transform basis referred to least frequently is identified with reference to the management table for reference history of orthogonal transform bases 201. In addition, the orthogonal transform basis transfer control unit 102 writes the orthogonal transform bases to an area which is of the orthogonal transform basis storage unit 103 and stores the orthogonal transform bases referred to least frequently so far. Accordingly, the orthogonal transform basis unlikely to be referred to is not stored in the orthogonal transform basis storage unit 103. Thus, it is possible to hold the orthogonal transform basis highly likely to be referred to frequently in the orthogonal transform basis storage unit 103. As a result, it is possible to reduce the number of times of access to the orthogonal transform basis accumulation unit 110.
For this reason, it is possible to reduce the memory bandwidth and the memory access latency required for the orthogonal transform basis.
In this embodiment, when the orthogonal transform basis storage unit 103 does not store the orthogonal transform basis indicated by the orthogonal transform basis ID, the orthogonal transform basis referred to least frequently is identified with reference to the management table for reference history of orthogonal transform bases 201. In the above description, the orthogonal transform basis transfer control unit 102 reads out, from the orthogonal transform basis accumulation unit 110, the orthogonal transform basis indicated by the orthogonal transform basis ID, and writes the read-out orthogonal transform basis to an area which is of the orthogonal transform basis storage unit 103 and stores the orthogonal transform basis referred to least frequently. However, the area to which the orthogonal transform basis is written is not limited thereto. For example, the orthogonal transform basis may be written to: an area that stores the orthogonal transform basis used least frequently recently (a predetermined past period); an area that stores the orthogonal transform basis used most frequently recently; or an area that stores the orthogonal transform basis referred to most frequently so far. Any other area selection method is possible as long as the method enables reduction in the access to the orthogonal transform basis accumulation unit 110 and reduction in the required capacity of the orthogonal transform basis storage unit 103.
In this embodiment, the orthogonal transform basis accumulation unit 110 is a storage unit other than the memory 109, but the same storage unit may function as the orthogonal transform basis accumulation unit 110 and the memory 109. In other words, the orthogonal transform basis accumulation unit 110 may be configured to include or to be included in the memory 109.
In this embodiment, the orthogonal transform bases are included in the coded stream. However, this is exemplary. It is also good that only the orthogonal transform basis ID is included in a coded stream, and that orthogonal transform bases predefined between a coding apparatus and a decoding apparatus may be stored in the orthogonal transform basis accumulation unit 110.
Embodiment 3
FIG. 9 is a block diagram showing a structure of a decoding apparatus according to Embodiment 3 of the present invention. Each of FIG. 10 and FIG. 11 is an example of information held in a management table for statistical information of orthogonal transform bases. In FIG. 9, the same structural elements as those in FIG. 1 are assigned with the same reference signs, and the same descriptions thereof are not repeated.
The decoding apparatus 300 shown in FIG. 9 includes a decoding unit 101, an orthogonal transform basis transfer control unit 102, an orthogonal transform basis storage unit 103, a management table for storage states of orthogonal transform bases 104, a reference image transfer control unit 105, a reference image storage unit 106, a prediction image generating unit 107, an adder 108, a memory 109, an orthogonal transform basis accumulation unit 110, an inverse quantization unit 111, an inverse orthogonal transform unit 112, a pre-decoding unit 301, and a management table for statistical information of orthogonal transform bases 302. Unlike the decoding apparatus 100 according to Embodiment 1, the decoding apparatus 300 shown in FIG. 9 includes the management table for statistical information of orthogonal transform bases 302.
The pre-decoding unit 301 decodes, from a coded stream, at least a part of identification information (orthogonal transform basis ID), prior to decoding by the decoding unit 101. More specifically, the pre-decoding unit 301 decodes at least part or all of the coded stream generated according to a standard of a video compression technique, prior to the decoding by the decoding unit 101 by at least one bit in the coded stream. Here, the pre-decoding unit 301 has a function of outputting at least the orthogonal transform basis ID.
Here, the pre-decoding unit 301 may be included in a CABAC decoding unit additionally provided to the decoding apparatus 300. Such a CABAC decoding unit decodes arithmetic codes such as Context-based Adaptive Binary Arithmetic Coding (CABAC). Alternatively, the pre-decoding unit 301 may be provided at a pre-stage of the decoding unit 101. In other words, it is only necessary for the pre-decoding unit 301 to decode the orthogonal transform basis ID from the coded stream prior to the decoding by the decoding unit 101 by at least one bit in the coded stream without decoding an image, and output it to the management table for statistical information of orthogonal transform bases 302.
The management table for statistical information of orthogonal transform bases 302 corresponds to a statistical information management unit in the CLAIMS of the present application. The management table for statistical information of orthogonal transform bases 302 manages the use state of each of the orthogonal transform bases decoded based on identification information (orthogonal transform basis ID) by the pre-decoding unit 301 and to be decoded by the decoding unit 101. More specifically, the management table for statistical information of orthogonal transform bases 302 has a function of receiving, as inputs, the pieces of orthogonal transform basis ID output by the pre-decoding unit 301, and outputting the number of times of use of each orthogonal transform basis shown by a corresponding one of the pieces of orthogonal transform basis ID included in the coded stream to be decoded (later or in the future) by the decoding unit 101.
The management table for statistical information of orthogonal transform bases 302 holds, for example, information as shown in FIG. 10. More specifically, the management table for statistical information of orthogonal transform bases 302 holds the orthogonal transform basis ID included in the header information of the coded stream decoded by the pre-decoding unit 301. In addition, the management table for statistical information of orthogonal transform bases 302 holds, as the number of times of future reference to orthogonal transform bases in the stream, the number of times of future reference to the orthogonal transform bases up to a reference to the orthogonal transform basis that is identified based on the orthogonal transform basis ID and is referred to in the decoding by the decoding unit 101. In addition, the management table for statistical information of orthogonal transform bases 302 may hold, for example, information as shown in FIG. 11. More specifically, the management table for statistical information of orthogonal transform bases 302 may hold the orthogonal transform basis ID included in the header information of the coded stream decoded by the pre-decoding unit 301. In addition, the management table for statistical information of orthogonal transform bases 302 may hold, as information indicating at which block (how many times ahead) in the stream the orthogonal transform basis indicated by the orthogonal transform basis ID is to be referred to in the decoding by the decoding unit 101.
The decoding apparatus 300 is structured as described above. More specifically, by managing the occurrence frequency of the orthogonal transform basis ID to be used for decoding by the decoding unit 101 using the management table for statistical information of orthogonal transform bases 302, it is possible to check, in advance, the occurrence probability of the orthogonal transform basis ID to be used for the decoding by the decoding unit 101. Accordingly, it is possible to store the orthogonal transform basis having a high occurrence probability into the orthogonal transform basis storage unit 103, and to discard the orthogonal transform basis having a low occurrence probability from the orthogonal transform basis storage unit 103. This makes it possible to enable reduction in the number of times of access to the orthogonal transform basis accumulation unit 110, and to enable reduction in the memory bandwidth required for the orthogonal transform basis storage unit 103.
Here, taking an example, a description is given of the difference in the effect of the information indicating the next reference order of the orthogonal transform basis for a block in the stream as shown in FIG. 10 and the information indicating the number of times of reference to be made to the orthogonal transform basis in the stream as shown in FIG. 11.
Each of FIGS. 12A and 12B and FIGS. 13A and 13B is an illustration or a table showing how orthogonal transform bases in the orthogonal transform basis storage unit are updated based on the management table for statistical information of orthogonal transform bases. Here, FIGS. 13A and 13B are consecutive in time to FIGS. 12A and 12B, respectively. Compared to FIGS. 12A and 12B, FIGS. 13A and 13B show how a macroblock which is next to the macroblock decoded in FIGS. 12A and 12B is decoded by the decoding unit 101. Here, the pre-decoding unit 301 performs decoding of the coded stream, prior to the decoding by the decoding unit 101 by two macroblocks. In addition, the orthogonal transform basis storage unit 103 is assumed to store only two orthogonal transform bases.
As shown in FIG. 12A, the pre-decoding unit 301 performs decoding of the coded stream prior to the decoding by the decoding unit 101 by, for example, three macroblocks, and the information as shown in FIG. 12B is held in the management table for statistical information of orthogonal transform bases 302. For example, the management table for statistical information of orthogonal transform bases 302 holds the pieces of orthogonal transform basis ID (0, 1, and 2) decoded so far in the decoding of the coded stream by the pre-decoding unit 301, and holds the pieces of information (∞, 2, and 1) each indicating at which block (how many times ahead) in the stream the corresponding one of the orthogonal transform bases is referred to. Here, in FIG. 12B, ∞ shows that there is no orthogonal transform basis ID 0 at the macroblock decoded by the pre-decoding unit 301 prior to the macroblock decoded by the decoding unit 101 by two blocks. On the other hand, the orthogonal transform basis ID 1 is referred to by the decoding unit 101 in the future decoding (of the block to be decoded next). Likewise, the orthogonal transform basis ID 2 is referred to by the decoding unit 101 in the future decoding (of the block to be decoded next to the next).
For this, the orthogonal transform basis transfer control unit 102 changes the area in which the orthogonal transform basis corresponding to the orthogonal transform basis ID 0 is stored from among the orthogonal transform bases corresponding to the pieces of orthogonal transform basis ID (0, 1) stored in the orthogonal transform basis storage unit 103, with reference to the management table for statistical information of orthogonal transform bases 302 and the management table for storage states of orthogonal transform bases 104. In other words, the orthogonal transform basis transfer control unit 102 changes the orthogonal transform basis corresponding to the orthogonal transform basis ID 0 stored in the orthogonal transform basis storage unit 103 to the orthogonal transform basis corresponding to the orthogonal transform basis ID 2.
The case as shown in FIGS. 13A and 13B is similar to the above case. More specifically, the orthogonal transform basis transfer control unit 102 determines, as the orthogonal transform basis that should be changed, one of the orthogonal transform bases corresponding to the pieces of orthogonal transform basis ID (2, 1) stored in the orthogonal transform basis storage unit 103, with reference to the management table for statistical information of orthogonal transform bases 302 and the management table for storage states of orthogonal transform bases 104. Here, it is possible to determine to change the area that stores the orthogonal transform basis corresponding to the orthogonal transform basis ID 2 with reference to the management table for statistical information of orthogonal transform bases 302. However, the orthogonal transform basis transfer control unit 102 can find out that the orthogonal transform basis storage unit 103 stores the orthogonal transform basis corresponding to the orthogonal transform basis ID 1 with reference to the management table for storage states of orthogonal transform bases 104. The orthogonal transform basis transfer control unit 102 determines that there is no need to make any modification for the orthogonal transform basis storage unit 103, and thus does nothing for (does not transfer anything to) the orthogonal transform basis storage unit 103.
In this way, it is possible to reduce the number of times of access to the orthogonal transform basis accumulation unit 110 by checking, in advance, the occurrence probability of the orthogonal transform basis ID to be used for the decoding by the decoding unit 101.
Next, a description is given of decoding operations performed by the decoding apparatus 300 configured as mentioned above. FIG. 14 is a flowchart of the decoding operations performed by the decoding apparatus according to Embodiment 3 of the present invention.
As shown in FIG. 14, in the decoding apparatus 300, the decoding unit 101 decodes the header information in an input coded stream (S301), and outputs, as header information, at least one orthogonal transform basis. Next, the orthogonal transform basis transfer control unit 102 writes, to the orthogonal transform basis accumulation unit 110, all the orthogonal transform bases decoded, in Step S301, by the decoding unit 101 (S302).
Next, the pre-decoding unit 301 decodes the coded stream prior to the decoding by the decoding unit 101 (S304), and updates the management table for statistical information of orthogonal transform bases 302 (S305). More specifically, prior to the decoding by the decoding unit 101, the pre-decoding unit 301 performs decoding of the coded stream, and writes, in the management table for statistical information of orthogonal transform bases 302, the occurrence frequency of the orthogonal transform basis ID in the part that is of the coded stream and is not yet decoded by the decoding unit 101.
Next, the decoding unit 101 decodes the header information and the quantized coefficients of the plurality of pictures (or macroblocks making up the plurality of pictures) composing the coded stream, and outputs at least the orthogonal transform basis information ID as header information (S306).
Next, the orthogonal transform basis transfer control unit 102 checks whether or not the orthogonal transform basis storage unit 103 stores the orthogonal transform bases indicated by the pieces of orthogonal transform basis ID decoded in S306, with reference to the management table for storage states of orthogonal transform bases 104 (S307).
In the case where the orthogonal transform basis indicated by the orthogonal transform basis ID is not yet stored in the orthogonal transform basis storage unit 103 (in the case of N in S307), the orthogonal transform basis transfer control unit 102 reads out the orthogonal transform basis indicated by the orthogonal transform basis ID from the orthogonal transform basis accumulation unit 110. In addition, the orthogonal transform basis transfer control unit 102 writes the orthogonal transform basis to, for example, an area which is of the orthogonal transform basis storage unit 103 and stores the orthogonal transform basis to be referred to least frequently (S308). Here, the orthogonal transform basis transfer control unit 102 identifies the orthogonal transform basis to be referred to least frequently in the decoding by the decoding unit 101, with reference to the management table for statistical information of orthogonal transform bases 302.
Next, the orthogonal transform basis transfer control unit 102 updates the management table for storage states of orthogonal transform bases 104 (S309). More specifically, the orthogonal transform basis transfer control unit 102 updates, to “held”, the storage state which is of the read-out orthogonal transform basis and is indicated in the management table for storage states of orthogonal transform bases 104, and updates the orthogonal transform basis storage state of the erased orthogonal transform basis to “not held”.
In the opposite case where the orthogonal transform basis indicated by the orthogonal transform basis ID is already stored in the orthogonal transform basis storage unit 103 (Yes in S307), the orthogonal transform basis transfer control unit 102 does not read out the orthogonal transform basis from the orthogonal transform basis accumulation unit 110, and proceeds to S310.
The processes from S310 to S315 are the same as the processes from S209 to S214, and thus the same descriptions thereof are not repeated.
In this way, the decoding apparatus 300 performs the decoding operations.
As described above, according to this embodiment, the pre-decoding unit 301 performs decoding of the stream prior to the decoding by the decoding unit 101, and the occurrence frequency of the orthogonal transform basis ID to be used for the decoding by the decoding unit 101 is managed using the management table for statistical information of orthogonal transform bases 302. In this way, it is possible to check, in advance, the occurrence probability of the orthogonal transform basis ID used for the decoding by the decoding unit 101. Accordingly, by storing the orthogonal transform basis having a high occurrence probability in the orthogonal transform basis storage unit 103, it is possible to reduce the number of times of access to the orthogonal transform basis accumulation unit 110.
For this reason, it is possible to reduce the memory bandwidth and the memory access latency required for the orthogonal transform bases.
In this embodiment, when the orthogonal transform basis storage unit 103 does not store the orthogonal transform basis indicated by the orthogonal transform basis ID, the orthogonal transform basis to be referred to least frequently is identified with reference to the management table for reference history of orthogonal transform bases 302. In the above description, the orthogonal transform basis transfer control unit 102 reads out, from the orthogonal transform basis accumulation unit 110, the orthogonal transform basis indicated by the orthogonal transform basis ID, and writes the read-out orthogonal transform basis to an area which is of the orthogonal transform basis storage unit 103 and stores the orthogonal transform basis to be referred to least frequently. However, the area to which the orthogonal transform basis is written is not limited thereto. For example, the orthogonal transform basis is written to an area that stores the orthogonal transform basis that is not to be used for a while or that is not to be referred to frequently for a predetermined future period. Any other area selection method is possible as long as the method enables reduction in the access to the orthogonal transform basis accumulation unit 110 and reduction in the required capacity of the orthogonal transform basis storage unit 103.
In this embodiment, the orthogonal transform basis accumulation unit 110 is a storage unit other than the memory 109, but the same storage unit may function as the orthogonal transform basis accumulation unit 110 and the memory 109. In other words, the orthogonal transform basis accumulation unit 110 may be configured to include or to be included in the memory 109.
In this embodiment, the orthogonal transform bases are included in the coded stream. However, this is exemplary. It is also good that only the orthogonal transform basis ID is included in a coded stream, and that orthogonal transform bases predefined between a coding apparatus and a decoding apparatus may be stored in the orthogonal transform basis accumulation unit 110.
In the above embodiment, the decoding apparatus 300 includes the decoding unit 101, the orthogonal transform basis transfer control unit 102, the orthogonal transform basis storage unit 103, the management table for storage states of orthogonal transform bases 104, the reference image transfer control unit 105, the reference image storage unit 106, the prediction image generating unit 107, the adder 108, the memory 109, the orthogonal transform basis accumulation unit 110, the inverse quantization unit 111, the inverse orthogonal transform unit 112, the pre-decoding unit 301, and the management table for statistical information of orthogonal transform bases 302. However, this structure is exemplary. As shown in FIG. 15, it is only necessary that the decoding apparatus 300 includes a decoding apparatus unit 350 as its essential element. More specifically, it is only necessary for the decoding apparatus 300 to include the decoding apparatus unit 350 including the decoding unit 101, the orthogonal transform basis transfer control unit 102, the orthogonal transform basis storage unit 103, the orthogonal transform basis accumulation unit 110, and the pre-decoding unit 301. FIG. 15 is a block diagram showing a minimum structure of a decoding apparatus according to Embodiment 3 of the present invention.
More specifically, the decoding apparatus unit 350 may include: a decoding unit 101 configured to decode, from a coded stream, identification information identifying orthogonal transform bases for use in the inverse orthogonal transform; a pre-decoding unit 301 configured to decode, from the coded stream, at least a piece of the identification information identifying the orthogonal transform bases, prior to the decoding by the decoding unit 101; an orthogonal transform basis accumulation unit 110 configured to store the plurality of orthogonal transform bases for use in the inverse orthogonal transform of the decoded stream; an orthogonal transform basis storage unit 103 configured to store at least one orthogonal transform basis required for the inverse orthogonal transform among the orthogonal transform bases stored by the orthogonal transform basis accumulation unit 110; and a orthogonal transform basis transfer control unit 102 configured to transfer, from the orthogonal transform basis accumulation unit 110 to the orthogonal transform basis storage unit 103, the at least one orthogonal transform basis identified based on the identification information (the orthogonal transform basis ID) decoded by the pre-decoding unit 301.
The decoding apparatus shown in FIG. 15 including at least the decoding apparatus unit 350 as its essential element performs pre-reading and pre-analysis of the stream using the identification information (orthogonal transform basis ID) decoded by the pre-decoding unit 301, and stores the at least one orthogonal transform basis for use in the inverse orthogonal transform into the orthogonal transform basis storage unit 103. Accordingly, the following advantageous effect is provided: when the at least one orthogonal transform basis is stored in the orthogonal transform basis storage unit 103, it is possible to reduce the number of times of direct access to the orthogonal transform basis accumulation unit 110 by using the orthogonal transform basis stored in the orthogonal transform basis storage unit 103.
Embodiment 4
FIG. 16 is a block diagram showing a structure of a decoding apparatus according to Embodiment 4 of the present invention. In FIG. 16, the same structural elements as those in FIG. 1 are assigned with the same reference signs, and the same descriptions thereof are not repeated.
The decoding apparatus 400 shown in FIG. 16 includes a decoding unit 101, an orthogonal transform basis transfer control unit 102, an orthogonal transform basis storage unit 103, a reference image transfer control unit 105, a reference image storage unit 106, a prediction image generating unit 107, an adder 108, a memory 109, an orthogonal transform basis accumulation unit 110, an inverse quantization unit 111, an inverse orthogonal transform unit 112, a reversible coding unit 401, and a reversible decoding unit 402. Here, unlike the decoding apparatus 100 according to Embodiment 1, the decoding apparatus 400 shown in FIG. 16 includes the reversible coding unit 401 and the reversible decoding unit 402, and does not include the management table for storage states of orthogonal transform bases 104.
The reversible coding unit 401 reversibly codes the orthogonal transform bases included in the coded stream in order to be used for inverse orthogonal transform. More specifically, the reversible coding unit 401 has a function of reversibly coding orthogonal transform bases decoded by the decoding unit 101 and writing the reversibly coded orthogonal transform bases into the orthogonal transform basis accumulation unit 110.
The reversible decoding unit 402 reversibly decodes an orthogonal transform basis identified based on identification information (orthogonal transform basis ID) among the orthogonal transform bases reversibly coded by the reversible coding unit 401, and writes the identified orthogonal transform basis into the orthogonal transform basis accumulation unit 110 via the orthogonal transform basis transfer control unit 102. More specifically, the reversible decoding unit 402 has a function of reading out the orthogonal transform bases stored in the orthogonal transform basis accumulation unit 110, reversibly decoding the read-out orthogonal transform bases, and writing the reversibly-decoded orthogonal transform bases to the orthogonal transform basis storage unit 103 via the orthogonal transform basis transfer control unit 102. It is to be noted that, the reversible decoding unit 402 may write the at least one orthogonal transform basis to the orthogonal transform basis storage unit 103 without the control by the orthogonal transform basis transfer control unit 102.
Next, a description is given of decoding operations performed by the decoding apparatus 400 configured as mentioned above. FIG. 17 is a flowchart of the decoding operations performed by the decoding apparatus according to Embodiment 4 of the present invention.
As shown in FIG. 17, in the decoding apparatus 400, the decoding unit 101 decodes the header information in an input coded stream (S401), and outputs, as header information, at least one orthogonal transform basis. Next, the reversible coding unit 401 reversibly codes (reversibly compresses) the orthogonal transform bases decoded by the decoding unit 101 (S402). Next, the orthogonal transform basis transfer control unit 102 writes, to the orthogonal transform basis accumulation unit 110, the orthogonal transform bases reversibly coded by the reversible coding unit 401 (S403).
Next, the decoding unit 101 decodes the header information and the quantized coefficients of the plurality of pictures (or macroblocks making up the plurality of pictures) composing the coded stream, and outputs, as header information, at least the orthogonal transform basis information ID, motion vector information, and quantized coefficients (S405).
The processes from S408 to S413 are the same as the processes from S108 to S113, and thus the same descriptions thereof are not repeated.
In this way, the decoding apparatus 400 performs the decoding operations.
As described above, this embodiment makes it possible to reduce the data size of the orthogonal transform bases to be stored in the orthogonal transform basis accumulation unit 110 by compressing the orthogonal transform bases using the reversible coding unit 401. In this way, it is possible to reduce the memory capacity required for the orthogonal transform bases.
It is to be noted that the decoding apparatus 400 shown in FIG. 16 may include at least the aforementioned management table for pa storage states of orthogonal transform bases 104. Alternatively, the decoding apparatus 400 may additionally include one of the management table for reference history of orthogonal transform bases 201 and the management table for statistical information of orthogonal transform bases 302. The latter option is preferable because it is possible to reduce the memory bandwidth and the memory access latency as described earlier, in addition to reduction in the memory capacity required for the orthogonal transform bases.
This embodiment describes a case where the decoding unit 101 decodes orthogonal transform bases once, the reversible coding unit 401 codes the decoded orthogonal transform bases and stores the coded orthogonal transform bases in the orthogonal transform basis accumulation unit 110, and the reversible decoding unit 402 decodes the coded orthogonal transform bases. However, this case is exemplary. For example, it is also good that the decoding unit 101 stores an orthogonal transform basis part in a coded stream into the orthogonal transform basis accumulation unit 110 without decoding the orthogonal transform bases in the coded stream, and that the reversible decoding unit 402 decodes the orthogonal transform bases stored therein.
In addition, the coding algorithm for use in the reversible coding unit 401 may be any coding scheme as long as the coding scheme makes the output size of the orthogonal transform bases smaller than the input size thereof.
In this embodiment, the orthogonal transform basis accumulation unit 110 is a storage unit other than the memory 109, but the same storage unit may function as the orthogonal transform basis accumulation unit 110 and the memory 109. In other words, the orthogonal transform basis accumulation unit 110 may be configured to include or to be included in the memory 109.
In this embodiment, the orthogonal transform bases are included in the coded stream. However, this is exemplary. It is also good that only the orthogonal transform basis ID is included in a coded stream, and that orthogonal transform bases predefined between a coding apparatus and a decoding apparatus may be stored in the orthogonal transform basis accumulation unit 110.
Embodiment 5
FIG. 18 is a block diagram showing a structure of a coding apparatus according to Embodiment 5 of the present invention.
A coding apparatus 500 shown in FIG. 18 is an image coding apparatus which generates a coded stream including identification information identifying orthogonal transform bases (an orthogonal transform basis matrix) for use in inverse orthogonal transform. The coding apparatus 500 includes a coding unit 501, an orthogonal transform basis transfer control unit 502, an orthogonal transform basis storage unit 503, a management table for storage states of orthogonal transform bases 504, a reference image transfer control unit 505, a reference image storage unit 506, a prediction image generating unit 507, an adder 508, a memory 509, an orthogonal transform basis accumulation unit 510, an inverse quantization unit 511, an inverse orthogonal transform unit 512, a subtractor 513, an orthogonal transform unit 514, a quantization unit 515, and an orthogonal transform basis generating unit 516.
The coding unit 501 has a function of receiving, as inputs, at least the quantized coefficients output by the quantization unit 515, orthogonal transform bases, and the ID of the orthogonal transform bases, coding the inputs according to a standard of an image compression technique, and outputting a coded stream including the coded input information.
The orthogonal transform basis transfer control unit 502 corresponds to a transfer control unit in the CLAIMS of the present application, and transfers the orthogonal transform basis identified based on the identification information (orthogonal transfer basis ID) from the orthogonal transform basis accumulation unit 510 to the orthogonal transform basis storage unit 503 only when the orthogonal transform basis identified based on the identification information (orthogonal transfer basis ID) is not yet stored in the orthogonal transform basis storage unit 503. More specifically, the orthogonal transform basis transfer control unit 502 has a function of writing, into the orthogonal transform basis accumulation unit 510, the orthogonal transform bases generated by the orthogonal transform basis generating unit 516 and to be used for orthogonal transform. Furthermore, the orthogonal transform basis transfer control unit 502 has a function of referring to information in the management table for storage states of orthogonal transform bases 504, based on the identification information (orthogonal transform basis ID) indicating which one of the orthogonal transform bases generated by the prediction image generating unit 507 is to be used for orthogonal transform of a current prediction image. Furthermore, the orthogonal transform basis transfer control unit 502 checks whether or not the orthogonal transform basis indicated by the orthogonal transform basis ID is stored in the orthogonal transform basis storage unit 503, based on information in the management table for storage states of orthogonal transform bases 504.
For example when orthogonal transform basis transfer control unit 502 finds out that the orthogonal transform basis indicated by the orthogonal transform basis transform ID is not yet stored in the orthogonal transform basis storage unit 503, the orthogonal transform basis transfer control unit 102 reads out the orthogonal transform basis indicated by the orthogonal transform basis ID from the orthogonal transform basis accumulation unit 510, and writes the orthogonal transform basis into the orthogonal transform basis storage unit 503 (transfers it thereto). In the opposite case where the orthogonal transform basis transfer control unit 502 finds out that the orthogonal transform basis indicated by the orthogonal transform basis transform ID is already stored in the orthogonal transform basis storage unit 503, the orthogonal transform basis transfer control unit 502 does not read out the orthogonal transform basis from the orthogonal transform basis accumulation unit 510 (does not transfer it therefrom).
Here, the orthogonal transform basis transfer control unit 502 may issue, to the prediction image generating unit 507, a write instruction for writing the orthogonal transform basis into the orthogonal transform basis accumulation unit 510, and the prediction image generating unit 507 may write the orthogonal transform basis into the orthogonal transform basis accumulation unit 510. Likewise, the orthogonal transform basis transfer control unit 502 may issue, to the orthogonal transform basis storage unit 503, only a read instruction for reading the orthogonal transform basis indicated by the orthogonal transform basis ID from the orthogonal transform basis accumulation unit 510, and the orthogonal transform basis storage unit 503 may read out the orthogonal transform basis indicated by the orthogonal transform basis ID from the orthogonal transform basis accumulation unit 510 and store the read-out orthogonal transform basis.
The orthogonal transform basis storage unit 503 corresponds to a storage unit in the CLAIMS of the present application, and is intended to store the orthogonal transform basis required to perform current inverse orthogonal transform, from among the plurality of orthogonal transform bases stored in the orthogonal transform basis accumulation unit 510. More specifically, the orthogonal transform basis storage unit 503 has a function of storing at least one kind of orthogonal transform basis transferred from the orthogonal transform basis accumulation unit 510, and a function of setting the orthogonal transform basis indicated by the orthogonal transform basis ID to the orthogonal transform unit 514 and inverse orthogonal transform unit 512. Here, the orthogonal transform basis storage unit 503 may store the orthogonal transform basis indicated by the orthogonal transform basis ID, and the orthogonal transform basis transfer control unit 502 may set the orthogonal transform basis indicated by the orthogonal transform basis ID to the orthogonal transform unit 514 and the inverse orthogonal transform unit 512.
The management table for storage states of orthogonal transform bases 504 corresponds to a storage state management unit in the CLAIMS of the present application. The management table for storage states of orthogonal transform bases 504 manages information indicating whether or not the orthogonal transform bases identified based on the identification information (the orthogonal transform basis ID) are stored in the orthogonal transform basis storage unit 503. More specifically, the management table for storage states of orthogonal transform bases 504 has a function of receiving an input of orthogonal transform basis ID and outputting information indicating whether or not the orthogonal transform basis indicated by the orthogonal transform basis ID is already stored in the orthogonal transform basis storage unit 503. For example, as shown in FIG. 3 mentioned earlier, the management table for storage states of orthogonal transform bases 504 holds, as a table (information), the storage states indicating whether or not each orthogonal transform basis identified based on the orthogonal transform basis ID is already stored in the orthogonal transform basis storage unit 503.
The reference image transfer control unit 505 has a function of reading out, from the memory 509, reference pixels required by the prediction image generating unit 507 to generate a prediction image, based on at least the position information of a current block, and writing the read-out reference pixels into the reference image storage unit 506.
The reference image storage unit 506 has a function of storing the reference images transferred from the memory 509.
| common_corpus | {'identifier': 'US-201113321857-A_2', 'collection': 'USPTO', 'open_type': 'Open Government', 'license': 'Public Domain', 'date': '2011.0', 'title': 'None', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '6736', 'token_count': '7712', '__index_level_0__': '9397', 'original_id': '7a35e1f1a6f9f6db20f01b14c02cb4f48fba4a591f32c3cc1d94d3c5962b6591'} |
Sauzens Aqueduct
The Sauzens Aqueduct () is one of several aqueducts on the Canal du Midi. It is near the village of Villesèquelande, France.
See also
Locks on the Canal du Midi
Canal du Midi
References
Category:Aqueducts on Canal du Midi | mini_pile | {'original_id': 'a729cae6e5700c72d983ece9fb87928ce8d339508dd64e0b850cc1c22ec63956'} |
Shakespeare Themes: Mercutio, Tybalt, and Verona
In “Romeo and Juliet,” there’s a climactic fight scene between Mercutio and Tybalt, two men who… had no interaction before that moment? Why exactly are they on such a collision course then? I investigate why in the latest installment of “Shakespeare Themes”.
Follow me on Facebook, on Twitter at @Cassius614, and on Tumblr for more Shakespeare fun! | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.8654323816299438}", 'metadata': "{'Content-Length': '42146', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:UONSK56GJBC5RK5CVBDHKTUBL4ILLHN3', 'WARC-Concurrent-To': '<urn:uuid:ddfacf60-cae8-468d-85f8-96f7e1650a19>', 'WARC-Date': datetime.datetime(2021, 1, 21, 1, 50, 5), 'WARC-IP-Address': '192.0.78.25', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:YD7NDCEQJACU6TLIYRLBEFNFULNQWJQB', 'WARC-Record-ID': '<urn:uuid:4c911bda-61ca-4415-bb33-5f20ed4f01c0>', 'WARC-Target-URI': 'https://theshakespeareminute.org/tag/juliet/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:bb7d8f56-7950-4a9a-8695-f10e5617b47f>', 'WARC-Truncated': None}", 'previous_word_count': '59', 'url': 'https://theshakespeareminute.org/tag/juliet/', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-90.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.8389062285423279', 'original_id': 'd967e43ce1d7e2c2b0bdad9292bfcc6e14562cc70e74839bcc1219ec8538dbc2'} |
<?php
// Text
$_['text_refine'] = 'Upřesnit vyhledávání';
$_['text_post'] = 'Příspěvky';
$_['text_error'] = 'Kategorie nenalezena!';
$_['text_empty'] = 'V této kategorii nejsou žádné příspěvky';
$_['text_sort'] = 'Třídit';
$_['text_default'] = 'Výchozí';
$_['text_name_asc'] = 'Název (A - Z)';
$_['text_name_desc'] = 'Název (Z - A)';
$_['text_limit'] = 'Omezení';
$_['text_read_more'] = 'Číst více';
$_['text_author'] = 'Autor';
$_['text_published'] = 'Publikováno dne'; | common_corpus | {'identifier': 'https://github.com/Sellato/opencart-materialize/blob/master/source/opencart_3.0.x/upload/catalog/language/cs-cz/blog/category.php', 'collection': 'Github Open Source', 'open_type': 'Open Source', 'license': 'MIT', 'date': '2022.0', 'title': 'opencart-materialize', 'creator': 'Sellato', 'language': 'PHP', 'language_type': 'Code', 'word_count': '54', 'token_count': '237', '__index_level_0__': '12372', 'original_id': 'df12bd7272c27cdf4029076f9c97e4827580b69808642ed6cf20dd70ca4598aa'} |
<!DOCTYPE html>
<html lang="en">
<head>
<meta charset="UTF-8">
<meta name="viewport" content="width=device-width, initial-scale=1.0">
<title>PandaJS</title>
<link rel="stylesheet" href="src/css/styles.css">
</head>
<body>
<div class="container-for-author-logo">
<div class="author">
<h1 data-name="PANDA.JS">Panda.JS</h1>
</div>
</div>
<section class="projects">
<h2>my work</h2>
<div class="nav">
</div>
<ul>
<li>
<a href="files/pulse_effect/index.html">Эффект при клике мышкой</a>
</li>
<li>
<a href="files/http-status-code/public/html/index.html">Поиск кодов состояния HTTP</a>
</li>
<li>
<a href="files/volume_calculator/index.html">Калькулятор объёма прямоугольной формы</a>
</li>
<li>
<a href="files/auto_write_text/index.html">Самопечатающийся текст</a>
</li>
<li>
<a href="files/carousel/index.html">Карусель</a>
</li>
<li>
<a href="files/converting_from_binary/index.html">Конвертер из двоичного в десятичный</a>
</li>
<li>
<a href="files/slider/index.html">слайдер на чистом JavaScript</a>
</li>
<li>
<a href="files/covid19/index.html">Статистика Covid-19</a>
</li>
<li>
<a href="files/n_kg/index.html">Перевести Н в кг и обратно</a>
</li>
<li>
<a href="files/passwordGenerator/index.html">Генератор пароля</a>
</li>
<li>
<a href="files/calculator/index.html">Красивый калькулятор</a>
</li>
<li>
<a href="files/battery_status/index.html">батарея устройства</a>
</li>
<li>
<a href="files/gradientGenerator/index.html">Генератор градиента фона</a>
</li>
<li>
<a href="files/to-do-list/src/index.html">Простой to-do-list</a>
</li>
</ul>
</section>
<!-- <script src="src/js/index.js"></script> -->
<!-- <script src="src/js/jquery.min.js"></script> -->
<!-- <script src="src/js/likeControl.js"></script> -->
</body>
</html> | the_stack | {'hexsha': '510b90be8f17bf4ba84c8c73b748889d7d11c92e', 'size': '2409', 'ext': 'html', 'lang': 'HTML', 'max_stars_repo_path': 'index.html', 'max_stars_repo_name': 'Pan9aJS/panda.github.io', 'max_stars_repo_head_hexsha': 'bc7a1e7704a32f024b6fc2cdaf9b18329e8cf87c', 'max_stars_repo_licenses': "['Apache-2.0']", 'max_stars_count': '', 'max_stars_repo_stars_event_min_datetime': '', 'max_stars_repo_stars_event_max_datetime': '', 'max_issues_repo_path': 'index.html', 'max_issues_repo_name': 'Pan9aJS/panda.github.io', 'max_issues_repo_head_hexsha': 'bc7a1e7704a32f024b6fc2cdaf9b18329e8cf87c', 'max_issues_repo_licenses': "['Apache-2.0']", 'max_issues_count': '', 'max_issues_repo_issues_event_min_datetime': '', 'max_issues_repo_issues_event_max_datetime': '', 'max_forks_repo_path': 'index.html', 'max_forks_repo_name': 'Pan9aJS/panda.github.io', 'max_forks_repo_head_hexsha': 'bc7a1e7704a32f024b6fc2cdaf9b18329e8cf87c', 'max_forks_repo_licenses': "['Apache-2.0']", 'max_forks_count': '', 'max_forks_repo_forks_event_min_datetime': '', 'max_forks_repo_forks_event_max_datetime': '', 'avg_line_length': '31.2857142857', 'max_line_length': '105', 'alphanum_fraction': '0.495226235', 'original_id': '05839d07bf3f7b8cde6e98f983bf92fa85ddbb6d5b5373656fa28834fa219ffc'} |
Marco Rubio won’t be endorsing Ted Cruz during the Republican presidential primary, but he’s likely to back the Texas senator at a contested convention — if it gets that far.
The de facto plan, Rubio’s backers say, is designed to help Cruz. It also, however, protects Rubio's political future, including if he decides to make another run for the White House.
Immediately after Rubio dropped out of the presidential contest following his home state loss March 15, the Florida senator told supporters he would endorse Cruz under two conditions: if the Texas senator wanted the endorsement and if it would make a difference. But Rubio came to believe that neither Cruz nor he would really gain from an endorsement so far.
“At this point, No. 1, it’s not a year where endorsements matter very much,” Rubio told POLITICO. “And No. 2: I’ll just let it play itself out and work through it. I really want to come back and focus 100 percent on my work in the Senate.”
Rubio has already helped Cruz by renting him his fundraising list, calling him “the only conservative left in the race,” withdrawing his name from the primary ballot in select states so as not to siphon votes from Cruz and petitioning to hang on to some of the 171 delegates he won to keep them from going to Donald Trump.
Just as those maneuvers helped Cruz or weakened Trump’s prospects, Rubio is likely waiting for a contested Republican National Convention to make his next big move.
“Marco has significant political capital: his delegates, the delegates he won and those delegates who would show up at the convention and, when unbound from another candidate, would listen to what Rubio would say,” said one Rubio insider.
“Marco wants Donald to lose. If he thought his endorsement would help in California or in Indiana, which it won’t, then he would probably do it,” the source said. “But what Marco isn’t going to do is just endorse Ted, watch Trump win anyway and then, in four years, watch Cruz use Marco’s endorsement against him if they both run for president again,” the source said.
Asked about swinging delegates at a contested convention to Cruz, Rubio said he’ll discuss it later.
“We’ll see if it gets to that point. Indiana will vote Tuesday and a handful of states after that, and if Donald Trump has 1,237 delegates or more, he’s going to be the nominee. And if he doesn’t, then I’ll see,” Rubio said. “We’ll talk about it at that time, but that’s neither something at this point I can influence, really.”
Trump’s prospect for winning the 1,237 delegates needed look relatively good. He so far has 996 to Cruz’s 565. Trump is the only candidate not mathematically eliminated from amassing enough delegates before the convention.
“It’s going to play itself out. Voters are deciding,” Rubio continued. “If Donald Trump continues to win by the margins he won in the last couple of Tuesdays, he’s going to be the nominee. And if he can’t, then something different might happen.”
At a contested convention, Rubio would likely win a prime speaking slot as well, reinforcing his importance as a political player in national GOP politics.
Officials with Cruz’s campaign would not comment for this story.
Rubio donors also worry about an endorsement that could have negative consequences for Rubio if he and Cruz run against each other in 2020.
“A lot of our donors haven’t done much for Cruz because they don’t really see him winning anyway,” another Rubio insider said. "Many of them don’t really like him. And they think like, with Marco’s endorsement, it really won’t do much. And some of them have told him that Cruz would just use the endorsement as a cudgel against him. There’s no gain.”
Rubio donors haven’t been too keen on contributing to Cruz. According to BuzzFeed, only 120 of the Florida senator’s former presidential donors have given to Cruz since the Florida primary, offering a total of about $126,650.
But it’s not as if Rubio and his supporters want Cruz to lose this year; quite the opposite.
“Trust me, for us, the best scenario is for Ted Cruz to be the nominee this year,” another top supporter said. “It would knock Trump out. Then Cruz would run against Hillary and get slaughtered and he won’t be our problem in four years if Marco runs again. And I think he’ll run again.”
Rubio wouldn’t discuss those scenarios. He said 2020 is so far away and “I don’t even know what I’ll be doing in January 2017,” when he leaves the Senate.
Some die-hard Rubio backers don’t want to wait four more years. They hope he could emerge as a consensus candidate at a contested convention, but Rubio said that’s not how the process will work. The nominee will likely be Trump or Cruz, people who have won a significant number of states, not someone who barely competed in the contest or didn’t compete at all.
“I don’t think there’s going to be a white knight,” Rubio said when asked whether he’d be interested in getting the nomination. “I’ve spent zero time thinking about that; we're not working on anything like that. It’s not going to happen.”
Asked whether that’s a “no” to being a “white knight,” Rubio quickly answered in the affirmative: “Yeah.” | mini_pile | {'original_id': 'a155065a42bfa13a8ab964a91290950635498a0a2cacdc207c53448857cabd18'} |
Side effects of Dwight Howard's move
Dwight Howard is getting ready to join the franchise where Moses Malone and Hakeem Olajuwon once defined the pivotman's role. But what does his move mean for those he didn't pick-and-roll past en route to his new home?
Our panel goes 5-on-5:
1. What does Dwight Howard's decision mean for Kobe Bryant?
Henry Abbott, Kobe will have to learn a new skill -- convincing free-agent superstars he can happily share the spotlight and the ball -- or he'll never win another title.
Bryan Gutierrez, Two Man Game: Now, the Lakers will be his team for as long as he wants them to be. It likely would have been that way had Howard stayed, but the team is unquestionably his now. Howard's departure likely added fuel to Bryant's fire. He will want to prove he can recover from his injury and show he can carry and lead the Lakers.
James Herbert, Hardwood Paroxysm: Bryant is in for another frustrating season when he comes back from injury. This Lakers roster is looking mighty thin in an increasingly stacked Western Conference. Just making the playoffs will be tough.
Michael Pina, Red94: The chances Bryant wins another championship with the Lakers just went from slim to impractical. It's a huge blow to a great player on the mend.
Darius Soriano, Forum Blue and Gold: A more difficult path back to the top of the mountain. Kobe and Dwight may have had their personality conflicts, but Howard represented, at least for the immediate future, the Lakers' best chance of regaining championship glory. With Howard in Houston (assuming his move becomes official Wednesday), the search for another franchise cornerstone, and championship partner, continues.
2. What does Dwight Howard's decision mean for Mike D'Antoni?
Abbott: D'Antoni was a pioneering genius. He did change NBA offenses forever. Now is the time for his ideas. But the pioneering new stuff -- all that space, all those pick-and-rolls, all that 3-point shooting -- isn't unique anymore. The system alone doesn't have the same value anymore, especially when it turns off free-agent All-NBA big men.
Gutierrez: D'Antoni's leash got a little bit longer. Honestly, the Lakers didn't really have much of an alternative for a new coach if they let him go. Now that Howard made his decision, D'Antoni will have to try to operate his offensive system with the pieces that remain. He has to deliver results, or the spotlight will shine on him even brighter.
Herbert: D'Antoni will not have to worry about keeping both Howard and Pau Gasol happy offensively anymore. On the flip side, his team might be hopeless on the defensive end and still doesn't have the young legs required for his preferred style of play.
Pina: All Howard's departure will do is soften palatial expectations -- enough, perhaps, to cool any reddening coals beneath D'Antoni's sideline seat.
Soriano: Less stress in how to manage his offense. The Dwight and Gasol pairing in the frontcourt meant a path divergent from the one D'Antoni prefers on the offense. With only Gasol remaining, D'Antoni can shift back to his offensive comfort zone and forge a team identity that more closely mirrors his past teams.
3. What does Dwight Howard's decision mean for James Harden?
Abbott: He left the Thunder because he wanted to be The Man, and then he went to Houston and had the ball in his hands as much as any other NBA player, including Bryant. He also got to play at a crazy high tempo. Presumably all that will be changing.
Gutierrez: The stage is set for him to succeed at a new level. Harden showed he would sacrifice in Oklahoma City by coming off the bench. He will now have to sacrifice to thrive with a legitimate big man, something he hasn't had in his four seasons in the league. A true running mate for Harden could be huge.
Herbert: Harden gets a dominant big man to play with for the first time in his career. Their two-man game has the potential to be devastating and allows Harden to envision a trip back to the NBA Finals in the near future. With less of a scoring load, he can focus more on the other aspects of the game.
Pina: Last season, Harden was the fifth-most efficient pick-and-roll scorer in the league, according to Synergy Sports, and his bread-and-butter sequence was a high screen-and-roll with Omer Asik. Nothing against Asik, but Harden should be even better next season with Howard setting those screens instead, providing a multipronged attack that defenses won't be able to stop without fouling.
Soriano: Potentially, a shift in style of play. Of all the swingmen in the league, Harden attempted the fifth-most shots at the rim last season. There's a real chance that with Dwight in the paint both as a roll man and a post-up option, some of Harden's most prized real estate will be ceded to his new teammate.
4. What does Dwight Howard's decision mean for Dirk Nowitzki?
Abbott: Ouch. I guess the title window has closed in Dallas. Missing out on Chris Paul, Deron Williams, Dwight Howard -- not to mention Tyson Chandler -- is no shame. But breaking up a title winner, in Dirk's declining years, to get a great free agent, and then getting none ... that hurts.
Gutierrez: Dirk will remain the lone star in Dallas. Throughout his career, Dirk hasn't had reliable or consistent star support by his side, and that will continue for the immediate future. He will have to hope that the front office can give him enough support to find success as his career heads down the homestretch.
Herbert: Nowitzki has no chance to fast-track back to the Finals now, but that was always a long shot. He'll now have to trust Mark Cuban to fill out the roster with less-than-superstar talents around him as his career winds down.
Pina: Sad to say, but the stakes of Nowtizki's fictional relationship with Howard run parallel to Kobe Bryant's. Both planned to team up with Howard next season, take hometown discounts next July, then add a third max-contract-caliber player for 2014-15. As with Kobe, it wasn't meant to be in Dallas, and the likelihood Nowitzki ever makes a third Finals appearance with the Mavericks has most likely been vaporized.
Soriano: Another year of waiting for his organization's big plans to pay dividends. After dismantling a title team, the Mavs left Dirk on an island waiting for a reload that hasn't yet come. Although he's hinted at frustration the past two seasons, I imagine those rumblings will grow louder as another year of his career is essentially wasted on a non-contender.
5. What does Dwight Howard's decision mean for Pau Gasol?
Abbott: Lakers owners have been openly enthusiastic about the imminent departure of Gasol, and his big contract, since last fall. So it would seem to be a foregone conclusion that Gasol is auditioning for another job in another city. But on the other hand, funny things can happen. More touches, post-Howard, from a system that loves shooting bigs, give Gasol the potential for a renaissance.
Gutierrez: Gasol should have a little more freedom to operate. He's still considered one of the more versatile big men in the league, especially in the post. With Gasol, D'Antoni will have to tweak his system to ensure he can maximize what he has. Gasol will have pressure to perform as he enters the final year of his deal.
Herbert: If Howard had stayed, Gasol's future as a Laker would have been up in the air. As it stands, he figures to be D'Antoni's starting center, which should make him much more comfortable than he was last season. Alas, if they had traded him or waived him via the amnesty clause, he might have wound up on a better team.
Pina: Gasol could walk out of this mess a huge winner. All he needs to do is take advantage of the increased touches as Los Angeles' starting center, and Gasol could set himself up for a big payday once his current contract expires next summer. Teams will court him; if those knees hold up, Gasol's game should age like wine.
Soriano: A return to the post and the opportunity to reclaim his role as the Lakers' featured big man. Since winning the 2010 championship the Lakers displaced Pau in favor of featuring Andrew Bynum and Howard. But, with Bynum and now Dwight gone, the pivot is again Gasol's primary residence. I expect him to show this team that he still has plenty to give.
Related Content | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9742157459259032}", 'metadata': "{'Content-Length': '57565', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:RERI7QMK6CO7SXTBF2ZRSCDTMNBZU6FW', 'WARC-Concurrent-To': '<urn:uuid:3dfaa1bb-a89f-4c20-92f0-ad43727dba66>', 'WARC-Date': datetime.datetime(2013, 12, 13, 10, 1, 27), 'WARC-IP-Address': '68.71.212.186', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:RXHN4OV2UEG4OLL73QJWJJNKDKRMXRFY', 'WARC-Record-ID': '<urn:uuid:ab051683-ee32-47db-89fd-20b2af74cfa1>', 'WARC-Target-URI': 'http://espn.go.com/espnw/news-commentary/article/9457606/stars-affected-dwight-howard-decision', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:b5495b7d-bacb-4488-9982-d9a2f566fdde>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1426', 'url': 'http://espn.go.com/espnw/news-commentary/article/9457606/stars-affected-dwight-howard-decision', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.020409047603607178', 'original_id': '7da0d32de3cde7ab61aa33c195a7f6e5cfd1683a651f64ff9a735209c86f638d'} |
My Faves: Time Travel Fiction and Media
Fans of NPR’s Weekend Edition may have caught a familiar voice when listening to the segment on time travel fiction. I had a great time talking to Petra Mayer about time travel, a topic near and dear to my heart. Yes, I am still writing a novel with time traveling twins (same world as my story in Diverse Energies). Now that all of NPR knows about it I guess I should finally finish.
In the mean time you can enjoy my best-loved time travel books, stories, and other media!
“It’s All True” by John Kessel (contained in his collection The Baum Plan for Financial Independence and Other Stories)
I mentioned this during the time travel panel at ReaderCon. In this story, a future society has invented time travel and they use it to go to parallel worlds, travel back in time, get famous people from the past, then bring them forward in time back to their own timeline. Thus avoiding changing their future. I swear this makes sense. The story centers around one guy’s attempt to convince Orson Wells to come to the future.
the freedom maze and kindred
The Freedom Maze by Delia Sherman and Kindred by Octavia Butler
I mention these two together because they share a basic premise (but are very different in sensibility as well as plot). In both, a person from modern times is thrown back into the era of American slavery, ends up with people who are her ancestors, and has to live as a slave for some portion of time. In Kindred the person is a grown woman who is pulled backward in time multiple times. In The Freedom Maze the person is a young girl who is actually white, but because she’s very tan is mistaken for a mulatto. She stays in the past for weeks and it’s unclear whether she’ll ever get back home. Both novels explore modern perspectives on the past in interesting ways.
Past Tense” and “Trials and Tribble-ationsStar Trek: Deep Space Nine
Some people will try to tell you that the best Star Trek episode about time travel is “The City on the Edge of Forever”. I don’t mind telling you that those people are wrong. As with so many things Star Trek, DS9 has the best episodes using this story vehicle. My ultimate favorite is, of course, the tribble one where the crew of DS9 travel back to the episode “The Trouble With Tribbles” and have to blend in with the original Enterprise crew. It’s awesome on so many levels from how seamlessly the effects crew blended the footage from TOS with the new footage to moments like this:
However, “Past Tense” has stayed with me all these years for a different reason. DS9 was often very social justice oriented, and this episode was chock full of it. For once, when Star Trek people ended up in the past on Earth it was not in the 20th century. Instead, they land in 2024 (still in San Francisco, though) in a dystopian America that is sadly not that hard to imagine. People who are poor, sick, or just undesirable are cordoned off into ghettos. And not just ghettos in the urban sense, but actual ghettos with walls and fences and an inability to get out where people have to fight over food rations and only get a place to sleep if the local gangs think you’re okay. It’s terrifying and not that far off the mark. This episode aired about 20 years ago. 2024 is 10 years from now. Think Star Trek will prove prescient?
Terminator: The Sarah Connor Chronicles
This series didn’t get a chance to flourish fully and it ends on what could be a cliffhanger or what could seem like a satisfying end given that we sort of know what happens after. The second season dragged in the middle for sure, but overall this is one of the best entries in the Terminator franchise, right up there with T2 and way better than T3 or what weird one with Christian Bale.
The main characters in SCC don’t do much time traveling themselves. What I loved about the time travel elements is that the war between Skynet and the humans takes place not only in the future but across both the relative past, the future, and the present. Several people and Terminator models are sent back in time at different points for specific and long term missions. And each time a person or group of people are sent back, it changes the future. So that woman you knew in the resistance and see again on the street might not be the exact person you knew, but a version of them.
And even when they strike a blow against Skynet, be it by destroying tech that will lead to it or getting rid of a Terminator come to kill someone, it doesn’t necessarily mean Skynet won’t still rise, it’ll just rise at a different date. All these elements are key to the plot, and kudos to the show for making all of this relatively straightforward and understandable. It’s not just some jumbled timey-wimey mess.
I am always looking for more time travel fiction to add to my to-read pile. Rec me some in the comments, if you would!
Standing Up For Sisko And Janeway
Standing Up For Sisko And Janeway
Ben Sisko DS9Over on my Star Trek post I noticed something that I often see but don’t always comment on: the dismissal of Captains Janeway and Sisko (and their shows) as being bad, or mediocre, or not as good as Kirk/TOS, Picard/TNG or even Archer/ENT (wtf?).
I’m used to Janeway hate. Voyager started shaky, founds its footing, then fell on its face when a blond in a skin-tight jumpsuit wandered by. There were many individual moments of great television, but nothing that truly cohered. Plus, Janeway is a woman, and the sexism-laced commentary about her being too manly or too feminine or too whatever have flowed since the show began.
What I don’t understand is the lack of love for Sisko, who was by far the best Star Trek captain since Kirk. Deep Space Nine was the most ambitious and complex of all the shows, and explored issues that were sometimes touched on in the original series but rarely approached in The Next Generation. I realize that Star Trek began as Wagon Train in space, but is there no room in the franchise for a show that required a bit of deep thought?
What I’ve always wanted to do, and am now taking the chance to do, is to ask: what exactly do you dislike about Janeway and/or Sisko? And let’s not pussyfoot around here: I want concrete examples, not vague “she was too feminine!” bullcrap. I want to know in what way did Janeway’s femininity made her worse or negatively different than Kirk or Picard or Archer, if that’s your stance. Whatever your issue, bring it on.
Star Trek Universe Prime
Star Trek Universe Prime
Today on I’m mourning the loss of the Prime Star Trek Universe. You know, the one that now only exists in Spock’s memories? It saddens me, because I think Universe Prime deserves a good send-off at the very least. We have yet to see Captain Sisko’s return, perhaps many years later when Admiral Janeway and Captain Picard are on one last mission. sigh I can only dream, I fear. Anyway, if you feel the way I do (or think I’m a nutter) go chat on about it. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9509193301200868}", 'metadata': "{'Content-Length': '76409', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:BP3QUN3ZVX7PAJUN27XPIFKXXSLBHDXO', 'WARC-Concurrent-To': '<urn:uuid:40415062-14a1-47a4-9d5f-fe16e58fbe07>', 'WARC-Date': datetime.datetime(2018, 8, 18, 21, 40, 55), 'WARC-IP-Address': '173.248.188.5', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:27ZH6XUILOE4UG723GDIKMMZUR5INWG2', 'WARC-Record-ID': '<urn:uuid:66232a86-4b87-4098-856e-91ef7a434b8a>', 'WARC-Target-URI': 'https://tempest.fluidartist.com/tag/star-trek-deep-space-nine/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6d3ab7bb-cf8f-4593-8636-fc1d65317ea8>', 'WARC-Truncated': None}", 'previous_word_count': '1249', 'url': 'https://tempest.fluidartist.com/tag/star-trek-deep-space-nine/', 'warcinfo': 'isPartOf: CC-MAIN-2018-34\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for August 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-43-195-133.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.018960893154144287', 'original_id': 'a986f76be7f09014c40ab87a1860c6d3237a6ead06fa16d6ada4113f611cbce8'} |
No recent wiki edits to this page.
Paste-Pot Pete
Paste-Pot Pete
Peter Petruski first appeared in Strange Tales #104 with the nickname Paste-Pot Pete and was an enemy of the Human Torch. He robbed a bank and captured the Human Torch, stole a missile and tried to send a weakened Human Torch off by tying him to it. Johnny Storm fights through it and forces Pete to attempt a hasty getaway, consisting of attaching a wire of his paste to the bottom of an airplane. Pete's escape fails and he is forced to bail while being flown over the ocean.
Peter Petruski was created by Stan Lee, Larry Lieber and Jack Kirby in 1963 and first appeared as Paste-Pot Pete in Strange Tales # 104. He later changed his name to The Trapster in Fantastic Four #38.
Major Story Arcs
A Brief Change of Heart
Returning, Paste-Pot Pete would again attempt to defeat the Human Torch to no avail. Eventually he would be captured and arrested. However his talents in chemistry were needed and assisted in earning him parole. Petruski aided the Avengers by creating a solvent that could dissolve Baron Zemo's Adhesive-X, which had captured Captain America and earned him a parole from prison. But Petruski could not give up his criminal ways and his activities against the Human Torch and Fantastic Four would soon land him back in jail.
Frightful Four
Petruski would break out of jail with the Sandman and serendipitously they found the Wizard who was stuck drifting about because of a malfunction in his anti-gravity discs. The three deadly criminals formed an alliance against their mutual enemies the Fantastic Four. Wanting to make a counter part to the F4, Wizard, Paste-Pot Pete, and the Sandman recruited a forth member, Medusa and called themselves the Frightful Four, with the Wizard as the leader. It was shortly after this point that Petruski changed his name to the Trapster.
Retroactively, it was revealed that part of his motivation for the abrupt name change came from an encounter with Spider-Man who started laughing uncontrollably from the PPP alliteration when Petruski introduced himself. He hates his former name but he would never live it down. Heroes and villains alike remind him of the goofy name to make him furious.
The Frightful Four would nearly defeat the Fantastic Four on a few attempts, but they were thwarted by unlucky interference and chance encounters with the wrong people. However, there were two exceptions to this rule. First, the Frightful Four absolutely defeated the Fantastic Four in FF #38, " Defeated by the Frightful Four". After Medusa captured the Invisible Girl, Trapster pasted the blonde girl to make certain she could not escape. The Wizard then flew the four of them to an isolated Pacific island where a perfect trap had been prepared by the Wizard. They placed the unconscious Sue Storm in an underground chamber next to a Q-bomb, a powerful nuclear device. Then they waited for the rest of the Fantastic Four to arrive. When the FF came a battle ensued, but the Frightful Four managed to escape, leaving the FF on the island. The bomb exploded and while the FF survived, they totally lost their powers. The second win by the Frightful Four came in FF #41, when the Wizard captured the Thing and brainwashed him. With the Thing's might, the evil FF easily defeated their foes.
Trapster defeats Susan Storm
Trapster defeats Susan Storm
However, Trapster can boast of three very meaningful successes that he secured without the aid of his evil F.F. partners as follows: (1) His most amazing victory of all time came when he and his new team temporarily defeat and capture Annihilus in Fantastic Four #44, volume 3. (This follows a holographic Trapster victory over Annihilus in FF #40, volume 3.) Considering that Annihilus is one of the greatest foes that the Fantastic Four have ever faced, this is quite an achievement. (2) Trapster defeats the Invisible Girl all by himself and very nearly finishes her off. Disguised as Daredevil, he comes to the Baxter Building in Daredevil #35 and finds Sue Storm all alone. Before she can react, Trapster pastes the blonde girl helplessly to the floor. Then he brilliantly sets a powerful bomb go off, as soon as anyone might enter the room to try and save the doomed Invisible Girl, presumably the rest of Fantastic Four. Fortunately for Susan Storm, Daredevil hears someone leaving the building in Daredevil #36 and so he senses something is wrong. He is able to get rid of the bomb just in time to save the blonde girl's life. (3) Another superb solo victory by Trapster is in Fantastic Four #10, volume 3, when he defeats Mr. Fantastic but good! So much for the legendary leader of the Fantastic Four! Many foes have taken him on, one-on-one, but very few have beaten him. Trapster's victories over Annihilus, Sue Storm and Reed Richards, all without the help of his Frightful Four allies, should dispel the view of some comic fans that he is little more than a joke.
What Peter Petruski lacks in strength and combat skills, he makes up for in intelligence. He has also shown growth in his stature since the early days, as leadership is now one of his qualities, thanks to his being the leader of the team that took on and temporarily captured mighty Annihilus. It should also be noted that in FF #218, Trapster has two key victories. Even though is part of the Frightful Four in this issue, his battle wins come all by himself. Dressed up in a Spiderman costume, he first defeats the Human Torch and he then beats the mighty Thing!
Making a Name for Himself
For the sake of recognition Trapster tried to challenge lower level heroes on his own, but eventually blundered embarrassingly when he tried to take over the Baxter Building and was defeated by its robotic security.
Humiliated and frustrated by constant defeats, Trapster would seek out the Tinkerer's aid in redesigning his arsenal. They adding wrist-pumps for his glue, which would change his costume, and also a variety of explosives to his repertoire.
An oddity regarding Trapster is that he has done what few humans can accomplish. His original appearance artwork in the Strange Tales comic makes him look like a somewhat older middle aged man. Later when he enters the scene as a member of the Frightful Four in Fantastic Four, he suddenly looks like he has gone back in time 20 years and has a much younger look.
Alternative Realities
Marvel Zombieverse
He is one of the zombies that attacks the Thing and Nova on the SHIELD Helicarrier as they rescue civilians taking shelter.
Ultimate Spider-Man Animated Series
The Trapster will be a feature villain in the upcoming Ultimate Spider-man cartoon series in 2012.
Powers and abilities
The Trapster does not possess any superhuman powers, but relies on a variety of technological devices. He designed a costume of synthetic stretch fabric equipped with storage canisters for paste and lubricant, and adhesive-rigged boots and gloves to enable walking up walls. His primary weapon has always been projectile glue, initially delivered by a pistol connected by an armored tubing to a container on his person, then wrist paste-shooter cannons, and eventually shot straight from the tips of his gloves. He can shoot out a stream of liquid glue that immediately gels into a springy rope, allowing him to duplicate Spider-Man's web-shooters (to the point where he is the only person Spider-Man knows who can even create an approximate duplicate of his webbing). He was able to create a fire-proof paste. Pete also has designed boots that allow him to walk up walls by sequentially releasing a powerful glue and then a solvent. Petruski has also created lubricants that can render a surface frictionless, and discovered a way to dissolve the extremely powerful "Adhesive X" created by Baron Heinrich Zemo. Pete has also created a dust capable of rendering Mister Fantastic's unstable molecules inert. Trapster is an expert chemist, a skilled marksman, and a talented disguise artist. He has used other devices such as anti-gravity discs, explosive caps, ultrasound transmitters, an anti-gravity platform, and various mechanical traps used to restrain or entangle opponents.
This edit will also create new pages on Comic Vine for:
Comment and Save
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '236', 'language_id_whole_page_fasttext': "{'en': 0.9730167984962464}", 'metadata': "{'Content-Length': '239199', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:V4CKYSP7ZYYP7BCZDVDTYYD3FZ7UCN6H', 'WARC-Concurrent-To': '<urn:uuid:67de8d64-2154-4d87-b7f2-5ff44446af73>', 'WARC-Date': datetime.datetime(2019, 11, 22, 19, 56, 15), 'WARC-IP-Address': '151.101.249.188', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:JXXVABNEUGJQJRPR3XSAF5VATKHGVCRB', 'WARC-Record-ID': '<urn:uuid:18d1c93f-fde8-4bfb-9290-79596e55c9b1>', 'WARC-Target-URI': 'https://comicvine.gamespot.com/trapster/4005-4328/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:74fc9991-1ba4-41ee-8083-93babb4f2b8f>', 'WARC-Truncated': None}", 'previous_word_count': '1454', 'url': 'https://comicvine.gamespot.com/trapster/4005-4328/', 'warcinfo': 'isPartOf: CC-MAIN-2019-47\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-5.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03613680601119995', 'original_id': '890536227070b956ec1e5cbf3ba56ac4a5bc12e0237d0632a2efb82841dcc6cf'} |
Call us toll-free 1-888-599-5299
The Kicking Horse River History
The Kicking Horse River in the Canadian Rockies near Golden BC begins as glacial meltwater streams flowing down the western slope of the Rocky Mountains. It begins high up on the Wapta icefields, so the water we see on the river during our adventures was locked in a glacier for thousands of years. It is a wild, untamed river and the Canadian Rockies premiere Whitewater Rafting River
The river received its unusual name during the famous Palliser Expedition of 1858, when James Hector he expedition doctor, was kicked in the chest by his horse attempting to cross the swift-flowing waters of the Kicking Horse. Canada’s first transcontinental railway – the Canadian Pacific Railway- and in present day the Trans Canada Highway follows the river’s course. The Kicking Horse provides a thrilling ride for rafters, stand up paddleboarding, and those looking for gentle river adventures.
Canadian Rockies Whitewater Rafting History
Whitewater Rafting in the Canadian Rockies began in the late 70’s. Likely the first Whitewater Rafting trips were taken in the Banff area, on the Bow River. These days, Whitewater Rafting in the Canadian can be enjoyed on half a dozen rivers which include the Bow, the Kananaskis, the Maligne, the Sunwapta, the Kicking Horse, Beaver and Columbia Rivers.
Whitewater Rafting on the Kicking Horse River began in the mid 1980’s. Alpine Rafting is pleased to be on of the pioneers of Whitewater Rafting on the Kicking Horse River opening it’s doors in 1984. 34 years later, whitewater rafting on the Kicking Horse River is considered the Premiere rafting river in the Canadian Rockies
The History of the Kicking Horse River
The Kicking Horse River has a pretty wild & interesting past. 80 Million years ago, glaciers carved it’s wild landscape. A century and a half ago, the first explorers came thru the area looking for a mountain pass for the CPR to complete is route to the west. After all these years we are pretty lucky that the Kicking Horse is still a wild untamed river. It flows freely from it’s source high up on the Wapta Icefield near Field, BC all the way to it’s terminus in the Town of Golden where it joins with the Columbia River.
• Golden, BC
It was adventure that brought the first explorers over the Rocky Mountains. But it was the treasures of Golden that made them stay. The area still exudes the same feeling of discovery and exploration the first pioneers felt.
• Discovery
In 1807, David Thompson first crossed over the Rocky Mountains and traveled along the Blaeberry River to the future site of Golden. In search of the Columbia River and, ultimately, a passage to the Pacific Ocean, it was Thompson’s sense of exploration that led him here. Thompson’s travels took him to the junction of the legendary Columbia and Kicking Horse Rivers.
• How did the River gets it’s name? The Kicking Horse River gets it’s name from when one of the explorers, James Hector fell off his horse and was left for dead along the banks of the Kicking Horse River. In the end Hector survived the incident, and the nearby mountain pass and river were named in honour of the incident
• How did Golden get its name? In an attempt to outdo a camp to the east, which called itself “Silver City”, the name “Golden City” was chosen. The gold mining industry didn’t meet the optimistic expectations and soon the term “City” became a little too pretentious for most and the town became known simply as Golden.
• The History of the Railway in Golden – Golden would simply not exist without the Canadian Pacific Railway (CPR). In fact, the railway’s presence helped establish Golden’s place in Canada. As the CPR constructed its cross-country network of rails, it used Golden as a base camp as it extended further into the western part of B.C. The railway was completed in 1885 and Golden soon became a prominent stop on the line. The CPR also paved the way for the Trans-Canada Highway, which helped to transform the area from a forest outpost to a true community. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9491817355155944}", 'metadata': "{'Content-Length': '71032', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:HQUFQG3SCX63HHRHKCDQQTPI3RHCX3PM', 'WARC-Concurrent-To': '<urn:uuid:a98d5f9b-8d1d-4014-93c6-4f3a390628ec>', 'WARC-Date': datetime.datetime(2018, 4, 19, 9, 41, 26), 'WARC-IP-Address': '104.199.121.221', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:L33TQQFF2I7OPW5GQ3AND4OKDXS6OL22', 'WARC-Record-ID': '<urn:uuid:c1d40527-e6a4-4744-8de6-bb39c1ff8ac6>', 'WARC-Target-URI': 'https://alpinerafting.com/kicking-horse-river-history/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:285b0f6f-bf13-45ed-84b6-3ee5e2d09328>', 'WARC-Truncated': 'length'}", 'previous_word_count': '678', 'url': 'https://alpinerafting.com/kicking-horse-river-history/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-228-198-53.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2018-17\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for April 2018\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.034716904163360596', 'original_id': 'd17bbd959767d3d3e4979b4014a20c555e2053b00ed92dcec650d50ce24ae316'} |
How To Pick Penny Stocks
[mage lang="" source="flickr"]how to pick penny stocks[/mage]
How do you pick penny stocks to invest in when there are thousands to choose from?
I mean, let’s say you’re really serious about investing and want to invest in a penny stock or two among other stocks. How would you choose them among the numerous options without reading every single prospectus or set of financial statements out there? Thanks
Penny Stock comes under Higher risk and Higher return category of Stocks. Penny stocks attracts a lot traders due to their ability for higher investment gains,but because of their highly volatile nature and most unpredictable form of investment in the stock market.
Still if you are sure to invest in them you must know:
1) There are various companies which usually have no track record of solid financial performance due to which penny stocks can get manipulated.So have a look on that.
2)You must know which Penny stocks you have to keep away
a)stay away from companies that reflect negative EPS or earnings per share.
b)stay away from penny stocks whose average daily volume of is very less.
c)Have a look on the stock technicals, it should be in an uptrend and above support levels.
d)In addition, always check and read news concerning stocks.
How To Pick Penny Stocks – How To Pick Penny Stocks Online
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '5', 'language_id_whole_page_fasttext': "{'en': 0.9425494074821472}", 'metadata': "{'Content-Length': '24813', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:HIOFEILH42TNYSMFCGFF3NMG2HENLAKI', 'WARC-Concurrent-To': '<urn:uuid:ed824f16-2ce0-4dff-911a-e3289bd22c5f>', 'WARC-Date': datetime.datetime(2019, 3, 21, 11, 27, 56), 'WARC-IP-Address': '74.208.236.27', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:JQBT3UBOWJVBLVYOEW7KELEMOIOW2MIB', 'WARC-Record-ID': '<urn:uuid:6396c1cd-677e-4baf-a3e8-827d966edc2f>', 'WARC-Target-URI': 'http://www.penny-stock-fortunes.info/2012/04/29/how-pick-penny-stocks/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2dbdfd04-6a46-4c94-8029-060a0b570433>', 'WARC-Truncated': None}", 'previous_word_count': '237', 'url': 'http://www.penny-stock-fortunes.info/2012/04/29/how-pick-penny-stocks/', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-143-92-167.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.08677184581756592', 'original_id': 'b13446365b0a204bd9da2d7dbb2da23e23bde50712d6cf5a0834d12d99ee2546'} |
A man who snatched a screaming six-year-old girl from her front yard near Wagga Wagga, raped her and later dropped her near her home and said "you can walk from here" has had more than two years cut from his minimum sentence.
Adam Gilbert Jolly was last year sentenced to 22 years and nine months, with a non-parole period of 15 years and nine months for kidnapping and several child-sex offences.
Jolly appealed against the sentence, in part arguing that it was "manifestly excessive".
On Tuesday, the Court of Criminal Appeal handed down a new sentence of 18 years and nine months, with a non-parole period of 13 years and four months.
On the morning of February 14, 2010, Jolly, then aged 27, approached the girl as she sat on the steps in her front yard and asked her: "Is your mum home?" | mini_pile | {'original_id': '8559ea6d7fe9e092838ef96ccbf2581c2b76951850298425bd22f1e634856cf2'} |
TITLE: The Tongue Is An Excellent Aid In CPR
AUTHOR: Doctor Strangelove (strangelove317@hotmail.com)
DESCRIPTION: James trys to explain to Lily why the tongue is a useful tool in CPR. Takes place during their fifth year.
GENRE: Romance/Humor
RATING: PG-13 for language, implied snogging, and mild slash (which is m/m romance so if you don't like that sort of thing don't read).
PAIRING: James/Lily, Sirius/Remus
DISCLAIMER: It all belongs to J. K. Rowling.
FEEDBACK: I'd love it. Flames are welcome too.
James and Lily were quietly studying for their transfiguration final when Lily suddenly dropped her book and started making weird gestures with her hands. "Lily, what's wrong?" James asked his usually beautiful girlfriend who was now turning blue in the face. She pointed at her throat and then at a bag of Bertie Bott's Every Flavor Beans that was lying on the table. "Oh, you're choking!" Lily nodded. "I know just what to do!" Without warning James grabbed Lily by the head and pulled her into a tight kiss.
Lily pushed James off of her and started coughing, a dark brown bean flew out of her mouth and rolled along the table, resting next to a book entitled Transfiguring Barnyard Animals For Fun and Profit. "Ugh, hair!" Lily moaned before turning attention back to James, "James, what the hell were you doing!?"
"You were choking!" He stated, like shoving your tongue down someone's throat was the obvious thing to do in that situation.
"So you tried to make out with me?"
"Lily, of course I wasn't doing that!"
"Then what were you doing?"
"Lily, the tongue is an excellent aid in CPR." Lily just stared at him. "I know, I was shocked too, but let me explain."
Okay, it was about two months ago, it was around two in the morning and I was coming back from that walk we had around the lake-
I remember that!
Please, Lily, let me tell my sorry.
It's okay. Anyway, I was coming back from our walk and when I went into the common room and I was in for a shock. Remus was lying on the table with Sirius on top of him, and their mouths were pressed together like they were making out.
They were what!?
Lily, please!
Like I was saying, they were on the table and it look like they were making out and there was even some moaning. Let me finish, Lily. "What the hell?" I said, and they looked up and saw me, because I was so shocked that I had dropped my invisibility cloak.
"James!" Sirius said, and he stood up quickly and Remus followed suit.
"James, this isn't what it looks like," Remus stated and started to smooth his hair back down.
"Right!" Sirius shouted, "You see, Remus and I were studying, and he was, um…"
"Choking! I was choking!"
"Yes! He was choking on, a, uh…"
"Chocolate Frog!"
"Right! And I was trying to dislodge it from his throat."
"Using your tongue?" I asked skeptically.
"Yes, my tongue, James. Did you know that the tongue happens to be an excellent aid in performing CPR? No, of course you wouldn't, because you never pay attention in class, you're too busy passing notes to Lily. How would you be if Lily started choking, James? You'd be like, 'Oh no! Lily's choking! Maybe I should stick my tongue down her throat! No, that's be weird and put us in a very compromising situation!' And you would just sit there while she choked to death!"
"But-but-but, I-I don't want Lily to die."
"It's too late. She's dead, James. You killed her."
"…I didn't mean to."
"Then maybe you should believe me when I tell you about the use of tongue when someone's choking. It's very effective."
"Very," Remus echoed with a smile on his face.
"Oh, wow," I said, "I'm so glad you guys opened my eyes to this. It really scared me when I thought Lily might choke to death.""
"I bet it did. Well, having a near-death experience really tuckers me out. I think I'm going to head on to bed." Remus turned and started to walk up the stairs when he stopped and turned back, "Coming Sirius?"
"Oh, right! Coming. G'night James!" and Sirius hurried up the stairs with Remus.
"And that's what happened," James finished his story.
Lily again just stared at him, "Um, James?"
But he wasn't listening, "I guess Remus must be allergic to Chocolate Frogs or something because I walked in on Sirius giving him CPR a bunch of other times and they always said that Remus was choking."
"James, I don't think that-"
"Which is weird because I once saw Remus eat twenty-five Chocolate Frogs in one sitting and he was fine. Maybe it's because he's eating them while he's studying."
"James, listen to me."
"But why were he and Sirius studying in a closet that one time?"
"There was always one thing I didn't understand about that night I walked in on Remus choking two months ago."
Lily had finally given up trying to explain to James that she didn't think the reason he kept finding Remus and Sirius with locked lips had anything to due to studying or an allergy to chocolate, "What's that, James?"
"Why were they studying naked?" | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9895898103713988}", 'metadata': "{'Content-Length': '41122', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:3HQ4IIUFYWKHTJV5ZPBEAXLHJG26GKJ6', 'WARC-Concurrent-To': '<urn:uuid:174e8f55-4ef3-4af8-8f42-da9f0e771c1b>', 'WARC-Date': datetime.datetime(2016, 7, 29, 18, 54, 4), 'WARC-IP-Address': '173.205.184.6', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:FCWXJKRBDZU26F5V3BG4RBQIKIIIPXOV', 'WARC-Record-ID': '<urn:uuid:3c9aeacb-5dda-472a-a2e7-8dbcfb78bf3c>', 'WARC-Target-URI': 'https://www.fanfiction.net/s/847074/1/The-Tongue-Is-An-Excellent-Aid-In-CPR', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6f099a4c-0e7b-4006-962b-c586227a94c2>', 'WARC-Truncated': None}", 'previous_word_count': '840', 'url': 'https://www.fanfiction.net/s/847074/1/The-Tongue-Is-An-Excellent-Aid-In-CPR', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-27-174.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2016-30\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for July 2016\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.2669861912727356', 'original_id': 'c08b6df00d3018874a890a369951db426542e3e2ada01bb957933cba19f599e8'} |
The invention relates to the decoding of encoded data.
When data is moved from place to place, it is often the case that the transfer process will create errors in the data. Accordingly, it is common practice to encode data to mitigate the impact of errors introduced by a transfer process. Normally, encoded data has to be decoded in order to be put to its intended use. Both the encoding and decoding of data represent a processing burden. This burden can be quite heavy in the case of modern encoding schemes. The use of encoding schemes to protect against data transfer errors is widespread but such use is particularly heavy in the telecommunications industry, especially in the wireless communications sector.
There exists a wide range of data encoding techniques and complimentary data decoding techniques. In the wireless communications sector, convolutional encoding techniques are commonly used. Various techniques can be used for decoding a convolutionally encoded signal, such as the Viterbi algorithm, the MAP (maximum a posteriori probability) algorithm and the log-MAP algorithm. Convolutional encoding and Viterbi, MAP, log-MAP and max-log-MAP decoding algorithms will be well known to those skilled in the art of wireless telecommunications engineering but readers less familiar with the field can find an introduction to these subjects in the book entitled “Digital Communications”, by John G. Proakis, fourth edition, published by McGraw-Hill.
A paper by Gambe et at entitled “An Improved Sliding Window Algorithm for Max-Log-MAP Turbo Decoder and Its Programmable LSI Implementation” (IEICE Trans. Electron., Vol. E88-C, 3 Mar. 2005, pages 403 to 412) describes a sliding window approach to max-log-MAP turbo decoding in which certain metrics calculated in one turbo decoding iteration are carried over to provide window commencement metrics for a subsequent iteration. | mini_pile | {'original_id': 'fddb1e807a527fc3eacbbcb110c73b935721f5b9c0df8312a27ff8956c9350a1'} |
The difference between git pull, git fetch and git clone (and git rebase)
Update: So, over a year later and I’ve had some feedback from a colleague (thanks Ben!). Nothing here is drastically wrong, but some clarifications should help!
When I started out with git …
… who am I kidding, I’m still a git n00b. Today, I tweeted about git. I wanted to know what the differene between pull, fetch and clone is. After discovering that, really, 140 characters isn’t enough to answer the questions, I had a play around.
Git Pull
From what I understand, git pull will pull down from a remote whatever you ask (so, whatever trunk you’re asking for) and instantly merge it into the branch you’re in when you make the request. Pull is a high-level request that runs ‘fetch’ then a ‘merge’ by default, or a rebase with ‘–rebase’. You could do without it, it’s just a convenience.
%> git checkout localBranch
%> git pull origin master
%> git branch
* localBranch
The above will merge the remote “master” branch into the local “localBranch”.
Git fetch
Fetch is similar to pull, except it won’t do any merging.
%> git checkout localBranch
%> git fetch origin remoteBranch
%> git branch
* localBranch
So, the fetch will have pulled down the remoteBranch and put it into a local branch called “remoteBranch”. creates a local copy of a remote branch which you shouldn’t manipulate directly; instead create a proper local branch and work on that. ‘git checkout’ has a confusing feature though. If you ‘checkout’ a local copy of a remote branch, it creates a local copy and sets up a merge to it by default.
Git clone
Git clone will clone a repo int a newly created directory. It’s useful for when you’re setting up your local doodah
%> cd newfolder
%> git clone
%> git branch
* master
Git clone additionally creates a remote called ‘origin’ for the repo cloned from, sets up a local branch based on the remote’s active branch (generally master), and creates remote-tracking branches for all the branches in the repo
Git rebase
Finally, git rebase is pretty cool. Anything you’ve changed by committing to your current branch but are no in the upstream are saved to a temporary area, so your branch is the same as it was before you started your changes, IE, clean. It then grabs the latest version of the branch from the remote If you do ‘git pull –rebase’, git will pull down the remote changes, rewind your local branch, then replays all your changes over the top of your current branch one by one, until you’re all up to date. Awesome huh?
If you get stuck, run ‘git branch -a’ and it will show you exactly what’s going on with your branches. You can see which are remotes and which are local. This is a good headsup before you start to break things! It’s worth remembering that git branches are basically just a pointer, so to be able to work with those commits you need a local branch which points to somewhere from which those commits are reachable.
Thanks to Ben for the extra stuff, clarifications and calling me an idiot when I get git wrong, because I am, as it’s really pretty simple, except for the simple.
34 thoughts on “The difference between git pull, git fetch and git clone (and git rebase)
1. So in fetch what kind of data are we pulling exactly? Is it code? If so, where does it go? The manual seems to hint that we are grabbing some kind of structural information but I don’t really know what.
1. So, from the git book:
The command goes out to that remote project and pulls down all the data from that remote project that you don’t have yet.
and a but further down it says:
So, git fetch origin fetches any new work that has been pushed to that server since you cloned (or last fetched from) it.
So, to me, it sounds like it pulls everything down. But it won’t merge, you’ll need to do that manually. When you do a git status you’ll probably see unstaged modifications.
1. Everything said by Mike was correct except for: “When you do a git status you’ll probably see unstaged modifications.”. You will only see unstaged modifications if you had unstaged modifications before you fetched. Git fetch will not change any unstaged modifications at all. This is what git fetch really does. Lets say you are on your master branch and you’re pulling from the origin remote’s master branch (which is probably what will happen by default if you do a “git fetch”). Your master branch will be unchanged and your staged files will also be unchanged. Your origin/master branch will be updated. The origin/master branch represents that state of the files on the origin’s master branch if you do a git pull it also updates the origin/master branch and then merges origin/master to your master. So with the scenario listed above a git pull is equivelent to a git fetch && git merge origin/master.
2. Nice day,
Can I ask something… maybe its not too related to your post but I just want to ask… I am also new to GIT… I am trying to pull, fetch, rebase and clone as well as push… I dont know why, I cant do it because of an error stating “The remote end hung up unexpectedly” :This is the code I wrote: git push file://// repo.git …. Can you help me with it?…. TYSM
3. Will git pull just pull on the current working branch and not all your remotely tracking branches? For example, I have a dev/homepage and a dev/footer. If I’m in dev/homepage and I git pull will it only pull on that branch or my dev/footer as well?
4. I’m still having problems wrapping my head around all this. What is the purpose of “checkout” as compared to “clone”, “fetch”, and “pull”? In what cases does one use this?
1. `checkout` allows you to turn your working directory into a particular revision or branch of a repo. For example, you can do `checkout 82jj282` and it will checkout a particular revision or `checkout my-lovely-branch` and it’ll switch from whatever branch you’re on (probably master) to the my-lovely-branch branch.
`checkout` is almost entirely local, whereas clone, fetch and pull are working with remote versions of your repo.
1. Mike, thank you, but this is only partly clear. If I understand your explanation correctly, “checkout” puts a copy of a particular branch from the remote repo in your local working directory. But so do clone, fetch, and pull. The differences that I see:
– clone if you don’t have anything yet in your working directory;
– pull to update your working directory with the edits from the same branch on the remote repository, and merge with your local edits;
– fetch will overwrite your working directory with the current revision of the current branch on the remote repo;
– checkout to overwrite your existing working directory with a particular branch from the remote repository.
5. What I want usually is not any of these.. What I’m usually wanting to do is a command that will force my local branch to 100% match the remote, downloading anything it needs and deleting anything that doesn’t belong. No “replay” of local changes at all, I want to UNDO them. I’d like to see that as a huge button in the Git Extensions GUI. What I end up doing instead is to completely delete my local tree and then I clone the repository anew. I guess I need to write a script to do the delete/re-clone since it’s not clear anything else produces the same result. Delete/re-clone seems clumsy, like most everything in Git. Yeah, Git is more powerful but what I actually need is ease of use.
1. Your changes should all be done on a new branch so you’re not breaking master. That way, if things get out of hand, you can delete your branch, switch back to your master branch and create a new branch from the untouched master.
6. Ok, so I will try to word this correctly.
1. I did a git clone of a remote repo in order to do something. The repo I cloned is updated by developers daily
2. I need to update my clone weekly, basically overwrite what I currently have.
3. Is it git pull?
7. What the hell is an “upstream”? And what do you mean by “replays”. I think it might help to explain your explanations.
8. Yeah, got so confused with checkout. I only did checkout and thought the staged changes will be based to the related remote origin. I committed the changes. My colleague came and did a fetch. When I push, I had to merge remote branch with my local branch. Just the source tree looks bad. Instead of a direct push, there’s a merge branch from outside.
9. I would argue that branches aren’t just _pointers, as you so put it;
Asume you have two branches on your remote: DEV and MASTER.
If you work on a hotfix, you make a branch for it, titled “HOTFIX#”. Modify the respective file, then, after the commit, Git will add just those changes that you made to that file when you want to merge it to the MASTER branch on the live site, even if other changes have been made TO THE SAME FILE, that are inbound from other branches that your colleagues have edited.
This way you can have a major release on Monday by merging the DEV branch to MASTER. And minor releases on Tuesday, Wednesday,… by merging small HOTFIX branches to MASTER. And this can be done by modifying the same file. You can also merge the HOTFIX branches to the DEV branch, if you so please.
10. So branches take with them, upon the merge, only the respective file modification that you’ve made and Git knows on which row to place it and to not let it be overwritten by colleagues; except when you’re actually working on the same row. That will generate a conflict.
Leave a Reply to Johnny Cancel reply
You are commenting using your account. Log Out / Change )
Google photo
Twitter picture
Facebook photo
Connecting to %s | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '9', 'language_id_whole_page_fasttext': "{'en': 0.9236404895782472}", 'metadata': "{'Content-Length': '111747', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:5A7O526ONHC3KHC7DANYHZSJ76QV5TGG', 'WARC-Concurrent-To': '<urn:uuid:b5ea49b8-2f0c-46e9-a6a2-5f4d1f11e5c4>', 'WARC-Date': datetime.datetime(2019, 5, 23, 18, 59, 51), 'WARC-IP-Address': '192.0.78.12', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:WSTSZAONOPYN427ZHDKFT7SIXAUU655G', 'WARC-Record-ID': '<urn:uuid:44dd0ac7-56fe-43ed-9174-fe925697ede7>', 'WARC-Target-URI': 'https://blog.mikepearce.net/2010/05/18/the-difference-between-git-pull-git-fetch-and-git-clone-and-git-rebase/?replytocom=8429', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:add5bec3-c170-41bc-8d6b-b2ea305fc0bc>', 'WARC-Truncated': None}", 'previous_word_count': '1713', 'url': 'https://blog.mikepearce.net/2010/05/18/the-difference-between-git-pull-git-fetch-and-git-clone-and-git-rebase/?replytocom=8429', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-171-61-111.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.3512123227119446', 'original_id': '2412d743695f573e18d93d0f98c04a480eda3017042877a3c7c6e3adff23d47e'} |
Saturday, June 1, 2013
Just Stop Being Offended.
I have some useful advice for basically everyone that will make their lives a lot easier and less stressful. Here it is: Just stop being offended.
Now, this may seem impossible to some of you... and I understand that it might be difficult, but I assure you, it is both possible and necessary if you no longer wish to have your mental and emotional well-being constantly compromised by other people whose words and actions are beyond your control.
What's more, I've found over the years that some people are not just offended by things intended to be offensive, but instead, seem to be looking for reasons to take offense to anything and everything that anybody does.
For example... Just today, one of my favorite Facebook friends posted a Salon article about the supposed homophobia present in Disney movies: "Why are there no gay Disney characters?"
And sure... There aren't any gay Disney "princesses", and no sweeping same-sex love-affairs in their whole universe really. Perhaps that's a tragedy... But I actually have far too many other (and I think actually much more substantive) criticisms of most of the messages contained in Disney movies to spend a ton of time on why there aren't any overtly gay characters.
However, that article did have a lot of linked content, and one of those links took me to another article about the supposed "gay slurs" and perhaps nascent homophobia found in Disney Animation Studios' wonderful film, "Wreck-it Ralph".
Here's the thing, though... I loved Wreck-it Ralph and noticed absolutely nothing in it that could be remotely described as "homophobic". In fact, to the contrary, the film has two central themes (first, that you get to choose who you want to be and don't need to be stuck in the roles society has defined for you... and second, that you're ok as you are, even if people think you're a little weird) and both are - or conceivably should be - inspiring to anyone who is a little outside the norm.
Gay people obviously included.
That said, of course I'm not gay, so perhaps I just wouldn't ever be able to pick up on the kind of homophobic references someone who's been attuned to it his whole life might more easily recognize. So... Here's what author, Chris Bogia, had to say in "They Wrecked It: Reflecting on Homophobia in Disney's Wreck-It Ralph":
"I was crestfallen when the game's villain turned out to be yet another mincing gay stereotype. At first I let it go -- I really wanted to enjoy Wreck-It Ralph.
That's when Ralph, the lovable hero (depicted perhaps uncoincidentally as an exaggeratedly tough masculine guy), quips about the King of Candy's palace color story, pink. A gag is had at the defensive king's lispy expense: "IT'S SALMON!" Pink would have been a bad choice for a palace made of candy?
Then it gets much worse.
After some limp-wristed gesticulating by our villain, Ralph grabs him, shakes him, and calls the confectionary monarch a "nelly wafer" (it's like Nilla Wafer, get it?)
That word is hardly thrown around these days, and I'm sure most young kids seeing Wreck-It Ralph wouldn't know what it means. However, when entered into Google for anyone that didn't already know it's definition, here it is:
"Offensive Slang: Used as a disparaging term for an effeminate homosexual man."
There's very little grey area here. The hero of the Disney animated movie I just saw shook the mincing, effeminate villain and called him a homophobic slur (after already insulting his decorating taste!)."
Ok. I think I see the problem now. Maybe Bogia just doesn't know anything about the history of film, and perhaps he was actually looking for something to be offended by.
First of all, King Candy (not "The King of Candy"... an error that makes me question whether or not Mr. Bogia really paid that much attention to the film) isn't actually a "gay stereotype" at all.
He might be lispy and effeminate in certain ways, but he is - in fact - a virtually spot-on impersonation of 1930s-1950s comedian and character actor, Ed Wynn, as voiced by the utterly fantastic Alan Tudyk.
Ed Wynn started in Vaudeville in the 1920s, and became a well-known radio actor by the 1930s. And of course, the film & television industry grew directly out of those two traditions by the 1940s... and some people, like Wynn, stuck around.
Although you might not have seen Ed Wynn's performances on "The Twilight Zone" or "What's My Line?", I can pretty much assure you that you do, in fact, know his work as the Mad Hatter in Disney's classic 1951 animated feature, "Alice and Wonderland":
Wynn certainly isn't mocking gay people, he's doing Vaudeville schtickle while voicing one of the most absurd characters in Disney's pantheon. And of course, the fact that Wynn's voice is so heavily tied to Disney feature animation, and the fact that the King Candy character is based almost directly on Wynn's Mad Hatter, makes it hardly surprising that Alan Tudyk would be doing a ridiculously over-the-top lispy homage.
Also, on a purely aesthetic note, I'd simply point out that there's just nothing about Wynn's lisp or inflection that is stereotypical "gay man". Not all lisps are created equally.
Compare Wynn's Mad Hatter (which is basically just... Ed Wynn), to say... Mario Cantone (a little NSFW):
Also... Try to forget that Mario Cantone is actually a gay man, thus rendering the whole notion of this lisp as an inherently insulting stereotype a bit weak.
The point here is that when people do the "gay lisp" to mock (or celebrate!) gay people, they're doing Mario Cantone, Nathan Lane, or maybe Harvey Fierstein... They're not doing the Mad Hatter.
These are different things.
So... Right out of the gate, there's probably nothing intentionally homophobic or offensive by the vocal character of King Candy. To me, Bogia's interpretation of it as homophobic strikes me as at best a simple misunderstanding of the characters being referenced and an ignorance of cinema.
No crime there... But.... It's hard for me to imagine getting offended by that.
And, fair enough, Mr. Bogia says that didn't bother him that much, but that what really got to him was Ralph's use of the word "Nelly" in the phrase, "Nelly Wafer". Yet, curiously, Mr. Bogia leads his explanation of why this is offensive by noting that "the word is hardly thrown around anymore". As far as I'm concerned, that's a massive understatement. Except through extensive Googling, would you have ever assumed that word to be a gay-slur?
I've heard the word "Nelly" used in literally only one context - and it's an ancient one: "Nervous Nelly".
My guess is that your experience lines up with mine pretty closely. Furthermore, in the context of "Nervous Nelly", there's really no sense of sexual orientation being involved. Effeminate, sure... Wimpy, definitely... But...... Gay?
Not really.
But even if it did have that connotation, it's a connotation that absolutely no one in the audience - and I'm guessing on the writing team - had any knowledge of. Instead, while I was reading Bogia's article, I suspected that what was more likely was simply that sometimes writers are looking for unique, silly or clever ways of working dialogue into the story that both fits the tone and makes sense.
The character's name is "King Candy". He's surrounded by candy. He has two donut guards named Wynnchell (*cough* Wynn *cough*) and Duncan. The entire universe being inhabited is filled with puns!
Beard Papa was a security guard.
Speaking as a scriptwriter, I would be looking for every available opportunity to cram another candy-related pun into the movie. So to assume that "Nelly Wafer" is a gay slur, you really have to assume quite a bit else as well.
Namely, that:
1. The writer had ever heard it used as such (which, I seriously doubt, as it's incredibly obscure)
2. That there are literally no other possible interpretations (obviously false),
3. That the writer was to some extent deliberately sneaking in homophobic or anti-gay messages into a movie about being true to yourself and accepting yourself you are.... even if you have giant hands or glitch all the time.
None of those things seem especially likely to me... And what's more, I went looking on Disney's wikia about Wreck-it Ralph, and curiously enough, instead of "Nelly Wafer" being listed under the "other names" section, the word is actually "Nilly Wafer". They also directly confirm my observation that the character is based on Ed Wynn's Mad Hatter.
What's more, I also looked at a copy of the screenplay. Here's the scene [emphasis mine]:
Well, maybe I’ll just have to have a little talk with the winner then.
Is that a threat I smell-- beyond the halitosis you so obviously suffer from?
Listen Nillie Wafer, I’m not leaving without my medal.
Yes, you are. Wynnchel, Duncan, get him out of that cupcake and on the first train back home. And if I ever see you here again, Wreck-it Ralph, I’ll lock you in my fungeon.
Fun Dungeon. It’s a play on words.... Nevermind. Now, I’ve got a glitch to deal with, thanks to you. Goodbye Wreck-it Ralph. It hasn’t been a pleasure.
Nillie/Nilly (as in... "Nilla", obviously). Not Nellie.
So it's even more likely that Mr. Bogia is getting upset because he heard something in John C. Reilly's performance that merely sounded to him like something that virtually no one else in the world would even know was insulting.
And again... It's just a pun.
Is there any reason to believe for a second that it's some covert slight against gay people? A secret homophobic slur or a gay-bashing "dogwhistle"? Really?
Can common sense enter into the picture at some point? For some people, the answer to that question is unfortunately.... No.
Far too many people I encounter on a regular basis seem to be looking for a fight or to get their feelings hurt. Maybe I should be more sympathetic to people who grew up as victims of frequent insults and bullying, but this really brings me full circle.
It's up to Chris Bogia whether or not to be offended by things that happen in life. It's up to all of us to choose how to react to the world outside our control. And spending your life on constant high-alert that people might sometime... somewhere... be saying hurtful things about you as an individual or as part of some specific group just isn't healthy.
It leads people - like perhaps Mr. Bogia - to see insults and offenses where none truly exist. For those of you who will yell at me about being white, straight and male... I'm guilty as charged. I don't know what Chris Brogia's life has been like (neither does he know what mine is like... I've been "bullied" and mocked too, you know), and I cannot judge the way he feels about anything. His feelings are his own. But I can say that regardless of how he felt, the offenses he's reacting to are imagined.
The solution to this is to remember a few things about life.
• First: Nobody thinks about you as much as you think about yourself. The world doesn't - contrary to every feeling you might have - revolve around you. So don't assume that everything is some secret coded message designed to make fun of you or make you feel bad.
• Second: The only person you can control is yourself. So get a grip. Unless someone actually means to offend you, try not to be offended. In spite of what you might wish to believe, it's not actually everyone else's responsibility to know in advance what may or may not hurt your feelings and tip-toe around them at all times. It's not fair or even possible to expect others to read the minds of every person they meet and avoid every touchy area for each and every one of them. You can't and don't do it for them... Don't expect everyone else to do it for you.
• Third: When someone does say something actually offensive, and they mean for it to offend you, take a step back and ask yourself whether or not the source or the content of the offense is even worth the headache. Is the offending person someone whose opinion you actually care about? Was this person just lashing out in anger during an argument? Did they know you would be offended by what they said and say it anyway? Are a few words you didn't want to hear worth ruining your day over?
In short. Just STOP being offended so much.
If you do, you'll make the world a much better and less stressful place for yourself, you'll avoid assuming the worst in everyone else, you'll also reduce your level of narcissism, and you'll completely dis-empower everyone who seeks to get under your skin by saying mean things to you,
Chris said...
I agree with this article in many ways.
The first three lines pretty much says what I've been saying since I stood up to my bullies and name callers.
Showing a couple videos and giving a background in this situation was a great way to get your point across.
And the solution list is great advice for every one.
Thank you for writing this article and saying, in a much better way than myself, what I've been saying for a long time.
I'm glad I shared this and I'll never forget the rhyme I learned as a kid, "Sticks and stones may break my bones but words will never hurt me."
Thank you again.
casus fortuitus said...
Wow. There's a lot wrong with presuming to tell people what they should be offended by (especially if they're a member of an historically oppressed minority group, and you're a member of the group that has traditionally done the oppressing), but probably the most egregious theme in this rant is that someone's intent actually matters when they give offence.
Here's a tip that will help you stop being such a condescending douche (on the assumption you care about being a decent person): intent isn't magic. (
Sean W. Malone said...
1. There's far more wrong with presuming you know what's in someone else's heart and assuming the worst.
2. YES, of COURSE INTENT matters when it comes to being offended. As I said throughout this "rant", the expectation that someone else has to just know what you are or are not offended by is a ridiculous and impossible expectation. You cannot control the rest of the world - only yourself. If someone says something that hurts your feelings, it matters a hell of a lot whether or not they meant it to be offensive. And personally, I think that it would be you - or anyone who assumes the worst motives of another person - who is being indecent as a person. Not to mention the fact that that those kinds of assumptions are actually condescending, as opposed to what I wrote here.
3. "Groups" aren't oppressed nor do they do any oppressing. Individuals are, and do. Spare me the ludicrously sloppy - and frankly insultingly broad - thinking that goes into assuming that just because you know the barest and most superficial traits about someone (skin color, gender, etc.) that you know what their life experiences are or what harm they should be held responsible for.
Even where its useful to generalize about "historical oppression", that abstraction doesn't override individual cases. There's little I could think of that is actually more condescending than the idea that a person in minority group is automatically a victim, or one in a majority group is automatically a tyrant. You're skipping over a lot of important information there.
Lastly, I would say - as I said in the piece - you can be offended by whatever you'd like to be offended by. It's your life. I'd merely suggest that living your life worried about what other people are thinking and being on constant high alert, ready at a moment's notice to police what everyone else has to say - as you did here in your comment even - must be exhausting. There are some pretty heavy trade offs to being bitter and petty.
Anonymous said...
But it isn't about being offended, is it? Neither does it mean that they have a secret anti-gay agenda if they use these stereotypes and slurs. It is just that homophobia is so strongly ingrained in our society that it can even pop up in works of well meaning yet uncaring people. That is the sole point of it.
I also don't believe that people who made films such as Beauty and the Beast were sexist. Their intention was to make a beautiful fairy-tale. But since sexism is an important part of many of these stories, they just unthinkingly put it in the film. Doesn't mean they have an agenda. Also doesn't mean we can't criticize it.
Sean W. Malone said...
Absolutely, you can criticize it. But you should probably be more aware of the subject matter and film history if you're going to do that.
In this case, I do suspect it's about being offended.
Anonymous said...
Let me guess... You're a white male (and as stated, heterosexual). I would suggest you look up the term "white privilege" to understand the lens that help you ward off offense so easily.
Sean W. Malone said...
Sure... It's definitely easier not to be offended when people aren't routinely saying deliberately offensive things to you. But this post isn't about those kinds of things, is it? It's about not taking offense to the imaginary slights you experience thanks to your own assumptions and insecurities.
Besides, if it was merely "white privilege" that made it easy for people to go through life controlling their emotional reactions to the dozens of things we all encounter per day that we could take offense to, then it would be reasonable to expect to see offense normally being taken almost exclusively by non-white, non-straight, less-privileged people.
But that's not actually what I see at all.
A huge percentage of the perpetual outrage types I encounter today, and have encountered since I was a kid, have been white, straight, and generally wealthy. You know... Privileged people.
I grew up with mostly straight white people. Some were capable of coping with the world without breaking down every few minutes because of something someone else said that they took offense to. Some weren't, and found themselves spending day after day angry and outraged at things they couldn't control. I also have a bunch of friends and co-workers now who are not white or straight, and yet who are competent adults who handle the world rationally and don't fall to pieces or make wild assumptions about other people's intentions.
And if you look at the places on the internet where the privilege narrative is the most prominent - Facebook and Tumblr, etc. - you'll see that demographic data on those sites skews white and wealthy, and since the vast majority of the world is straight, everything skews that way.
So, while "white privilege" is a conveniently bias-confirming grand narrative for a lot of people, it's pretty bad at actually explaining the world if reality enters the picture.
This issue is fundamentally about philosophy, not privilege.
Every one of us has choices to make every day as to how we're going to interact with other people, and with our own emotions.
In my experience, the people who go through life perpetually outraged or offended set themselves up for perpetual failure, while the ones - of any race, gender, sexual orientation, etc. - who have a thicker skin and a better handle on their emotional reactions set themselves up for success.
Take from that what you will.
Being gay is a sin. I do not like gay people.
Sean W. Malone said...
Jack Williams' comment above reinforces the point of the post... Disney, and Alan Tudyk, are not being anti-gay by referencing the Mad Hatter/Ed Wynn in a film with a very similar character. Jack Williams' "I do not like gay people" is anti-gay.
Different things. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '7', 'language_id_whole_page_fasttext': "{'en': 0.9759557247161864}", 'metadata': "{'Content-Length': '114339', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:KFMO6E3ILXYTRGXHQUV5K3Q77TXMO3SF', 'WARC-Concurrent-To': '<urn:uuid:e90bbc94-37ad-4d8a-8256-db542f92230b>', 'WARC-Date': datetime.datetime(2017, 3, 25, 5, 44, 54), 'WARC-IP-Address': '172.217.7.225', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:4PKTB57KJ3J5GCC65PGFG4GCYCNIXEDB', 'WARC-Record-ID': '<urn:uuid:63645155-db29-4ba0-be44-f8ffa694af37>', 'WARC-Target-URI': 'http://seanwmalone.blogspot.com/2013/06/just-stop-being-offended.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a56042e6-e6e0-40cb-bb8c-2ead950c5f80>', 'WARC-Truncated': None}", 'previous_word_count': '3301', 'url': 'http://seanwmalone.blogspot.com/2013/06/just-stop-being-offended.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-233-31-227.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-13\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for March 2017\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.5310186743736267', 'original_id': '80cc9f7dabffe96b7c7ae5bed34f2585f5e0e196a01abfd9c4c4eda418a56754'} |
Dell Inspiron 1420 cannot power on at all
By Elliah
May 24, 2008
What could have caused this problem?
2. kimsland
kimsland Ex-TechSpotter Posts: 14,524
Unless it's the power adaptor that's actually faulty?
Try removing the power adaptor and battery
Did it work?
3. Elliah
Elliah TS Enthusiast Topic Starter Posts: 84 did not work...the moment i plug the adapter into my computer it sort of goes out...and there's absolutely no response from the laptop whatsoever
4. kimsland
kimsland Ex-TechSpotter Posts: 14,524
Ok try the above, and then just plug in the battery (assuming the battery has some charge)
5. Elliah
Elliah TS Enthusiast Topic Starter Posts: 84
i've tried that too..and my laptop still doesnt give any sign of life...
6. raybay
raybay TS Evangelist Posts: 7,241 +9
Always check the adapter socket. They cause this problem if the soldered connection goes bad. But it is usually the adapter that fails.
Time for a trip to eBay. Get the information from the back of your current adapter, then buy a new one that is an Official Dell unit. Too many of the Hong Kong and Singapore imitations emit spurious responses that affect radio, wireless, and some TV connections.
All adapters go out eventually. Yours is unfortunate, but not unusual. Feel lucky it did not damage your laptop. (or hope it didn't)
7. Elliah
Elliah TS Enthusiast Topic Starter Posts: 84
sorry if i sound completely clueless..but which part is the adapter socket?
8. raybay
raybay TS Evangelist Posts: 7,241 +9
That is the hole into which your power adapter from the wall to the brick to your computer plugs. It is the interface between the laptop and the power adapter. You might call it the "recepticle". It is the power hole on the back or side of the laptop.
9. Elliah
Elliah TS Enthusiast Topic Starter Posts: 84
so what am i supposed to be checking for in my adapter socket?
10. raybay
raybay TS Evangelist Posts: 7,241 +9
You need somebody with a volt-ohm or multimeter to check the connection from inside the case.
The usual failure is a loose connection. If it wobbles, or feels loose under light pressure from a wooden probe, it could be bad. Sometimes due to the pressure of constant use, it can break loose from its "flat surface" soldered connection.
First test, really, is the output of your power adapter... or buy a new one, Dell branded, on eBay.
Replacing the socket is not for beginners. It requires a special soldering iron, usuall a "cold solder", that can perform soldering on the flat surfaces. You need to know how to solder two flat surfaces together without ruining something else. Not many techs can do it at all, let alone well. Anything less than a first class job by a a very skilled technician can make it impossible to fix at all.
Check other things first, then consider sending it to Dell.
11. Elliah
Elliah TS Enthusiast Topic Starter Posts: 84 i called dell tech i am based in kuala lumpur, malaysia, i don't know if this applies to other countries...but i find dell tech support here excellent...i called in on monday morning and told them about my problem and on tuesday morning a technician shows up with a spanking new motherboard and replaced it on the computer works fine now....
12. kimsland
kimsland Ex-TechSpotter Posts: 14,524
You're in Dell's home town.
But yes, under warranty, they will do the same anywhere in the world, for free.
Topic Status:
Not open for further replies.
Similar Topics
Add New Comment
TechSpot Account You may also... | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '160', 'language_id_whole_page_fasttext': "{'en': 0.9209856986999512}", 'metadata': "{'Content-Length': '63406', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:32BES77O6K7KMEGI7LHKV5SDRURNO43P', 'WARC-Concurrent-To': '<urn:uuid:12e80998-fbb6-4af1-9ce4-9679ce80959c>', 'WARC-Date': datetime.datetime(2016, 7, 30, 7, 37, 32), 'WARC-IP-Address': '184.173.241.66', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:ETMWN4X6H3RKVQPVT2RKACMIKV5R3PLZ', 'WARC-Record-ID': '<urn:uuid:2de4952e-4bb3-4e13-a08c-e9c5ab28faf2>', 'WARC-Target-URI': 'http://www.techspot.com/community/topics/dell-inspiron-1420-cannot-power-on-at-all.105558/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:0afbf71f-602c-4280-bf99-6eefc3ff5129>', 'WARC-Truncated': None}", 'previous_word_count': '817', 'url': 'http://www.techspot.com/community/topics/dell-inspiron-1420-cannot-power-on-at-all.105558/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-27-174.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2016-30\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for July 2016\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.024993419647216797', 'original_id': '6eed3fd65f0a69b22e713dc56b2a3b6b1842a0db78babe619bafc00ebd46cfdb'} |
January 15, 2005 | Bioinformatics researchers have re-created part of the genome sequence of an ancestral mammal that lived 70 million to 80 million years ago. If it all sounds a little like the plot of Michael Crichton's bestseller Jurassic Park, that's not surprising. However, lead investigator David Haussler (University of California at Santa Cruz) stresses that his motives are rooted in evolution rather than economics.
Researchers in comparative genomics align stretches of DNA sequence from different species to monitor rates of mutation during evolution. For example, Eric Green (National Human Genome Research Institute), who collaborated with Haussler's team, has sequenced 1.1 million bases of chromosomal DNA flanking the cystic fibrosis gene from 19 mammals.
Using that data set, Haussler and former postdoc Mathieu Blanchette, now at McGill University, decided to re-create this stretch of the genome from the common ancestor of all placental mammals — a shrew-like animal found in Asia. They succeeded, claiming 98-percent accuracy in the paper published in December's Genome Research.
REALLY OLD GENES: David Haussler led the effort to sequence a mammal that lived about 70 million years ago.
"What we come up with is not going to take us anywhere near Jurassic Park," Blanchette insists. "There are many reasons why the ancestral genome could not be put in a living organism — technical reasons, it is difficult to synthesize long DNA sequences. But the main thing is we show we can reconstruct the ancestor with 98-percent accuracy, and that's nice, but it's not enough to make that organism livable. There will be a few [DNA] errors in crucial places."
Blanchette's approach of "computerized paleogenomics" re-created in silico the DNA sequence of the "boreoeutherian" mammalian common ancestor. He wrote a computer program that aligned the 19 mammalian genome sequences, including human, chimpanzee, gorilla, mouse, dog, and cat, charting positions where DNA bases had been substituted, inserted, or deleted. "Then we try to figure out the evolutionary events that could produce the events that led to the alignment," Blanchette says.
Simulation studies show that the reconstructed ancestral sequence could account for the evolution of present-day mammalian species with an estimated 95-percent accuracy. By including additional mammalian sequences, Blanchette says that accuracy would reach 98 percent.
The authors write that "in coming years, such reconstructions may help in identifying and understanding the genetic features common to eutherian mammals and may shed light on evolution of human or primate-specific traits." Blanchette says he is now preparing to extrapolate this approach to the entire genome. "There's no big technical issue in scaling up to the whole genome," he says. | mini_pile | {'original_id': '7e5ac23e74cafbd9feb8100b17e8e5a3424204b236158def551327962f59f861'} |
<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8" />
<meta name="viewport" content="width=device-width, initial-scale=1.0" />
<title>toto.inputs package — Toto 1.0 documentation</title>
<link rel="stylesheet" type="text/css" href="../_static/pygments.css" />
<link rel="stylesheet" type="text/css" href="../_static/alabaster.css" />
<link rel="stylesheet" type="text/css" href="../_static/gallery.css" />
<link rel="stylesheet" type="text/css" href="../_static/gallery-binder.css" />
<link rel="stylesheet" type="text/css" href="../_static/gallery-dataframe.css" />
<link rel="stylesheet" type="text/css" href="../_static/gallery-rendered-html.css" />
<script data-url_root="../" id="documentation_options" src="../_static/documentation_options.js"></script>
<script src="../_static/jquery.js"></script>
<script src="../_static/underscore.js"></script>
<script src="../_static/doctools.js"></script>
<script crossorigin="anonymous" integrity="sha256-Ae2Vz/4ePdIu6ZyI/5ZGsYnb+m0JlOmKPjt6XZ9JJkA=" src="https://cdnjs.cloudflare.com/ajax/libs/require.js/2.3.4/require.min.js"></script>
<link rel="index" title="Index" href="../genindex.html" />
<link rel="search" title="Search" href="../search.html" />
<link rel="next" title="toto.inputs.cons" href="toto.inputs.cons.html" />
<link rel="prev" title="toto.filters.spike_removal" href="toto.filters.spike_removal.html" />
<link rel="stylesheet" href="../_static/custom.css" type="text/css" />
<meta name="viewport" content="width=device-width, initial-scale=0.9, maximum-scale=0.9" />
</head><body>
<div class="document">
<div class="documentwrapper">
<div class="bodywrapper">
<div class="body" role="main">
<a class="reference internal image-reference" href="../_images/calypso.png"><img alt="../_images/calypso.png" class="align-right" src="../_images/calypso.png" style="width: 150px;" /></a>
<div class="section" id="module-toto.inputs">
<span id="toto-inputs-package"></span><h1>toto.inputs package<a class="headerlink" href="#module-toto.inputs" title="Permalink to this headline">¶</a></h1>
<p>Input formats</p>
<div class="toctree-wrapper compound">
<ul>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.cons.html">toto.inputs.cons</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.cons.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.cons.html#examples">Examples</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.linz.html">toto.inputs.linz</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.linz.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.linz.html#examples">Examples</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.mat.html">toto.inputs.mat</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.mat.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.mat.html#examples">Examples</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.moet.html">toto.inputs.moet</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.moet.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.moet.html#examples">Examples</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.msl.html">toto.inputs.msl</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.msl.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.msl.html#examples">Examples</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.nc.html">toto.inputs.nc</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.nc.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.nc.html#examples">Examples</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.rsk.html">toto.inputs.rsk</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.rsk.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.rsk.html#examples">Examples</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.tryaxis.html">toto.inputs.tryaxis</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.tryaxis.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.tryaxis.html#examples">Examples</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.txt.html">toto.inputs.txt</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.txt.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.txt.html#examples">Examples</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="toto.inputs.xls.html">toto.inputs.xls</a><ul>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.xls.html#parameters">Parameters</a></li>
<li class="toctree-l2"><a class="reference internal" href="toto.inputs.xls.html#examples">Examples</a></li>
</ul>
</li>
</ul>
</div>
</div>
</div>
</div>
</div>
<div class="sphinxsidebar" role="navigation" aria-label="main navigation">
<div class="sphinxsidebarwrapper">
<h1 class="logo"><a href="../index.html">Toto</a></h1>
<h3>Navigation</h3>
<p class="caption" role="heading"><span class="caption-text">Contents:</span></p>
<ul>
<li class="toctree-l1"><a class="reference internal" href="../install.html"> How to install</a></li>
<li class="toctree-l1"><a class="reference internal" href="../convention.html"> Conventions</a></li>
<li class="toctree-l1"><a class="reference internal" href="../input.html"> Inputs</a></li>
<li class="toctree-l1"><a class="reference internal" href="../filters.html"> Filter functions</a></li>
<li class="toctree-l1"><a class="reference internal" href="toto.interpolations.html"> Interpolation functions</a></li>
<li class="toctree-l1"><a class="reference internal" href="toto.selections.html"> Selection functions</a></li>
<li class="toctree-l1"><a class="reference internal" href="../plugins.html"> Plugins functions</a></li>
<li class="toctree-l1"><a class="reference internal" href="../customize.html"> Customization</a></li>
<li class="toctree-l1"><a class="reference internal" href="../gallery/index.html"> Gallery</a></li>
<li class="toctree-l1"><a class="reference internal" href="../support.html"> support</a></li>
</ul>
<p class="caption" role="heading"><span class="caption-text">API documentation:</span></p>
<ul class="current">
<li class="toctree-l1 current"><a class="reference internal" href="modules.html">Toto open-source</a><ul class="current">
<li class="toctree-l2 current"><a class="reference internal" href="toto.html">toto package</a></li>
</ul>
</li>
</ul>
<div class="relations">
<h3>Related Topics</h3>
<ul>
<li><a href="../index.html">Documentation overview</a><ul>
<li><a href="modules.html">toto</a><ul>
<li><a href="toto.html">toto package</a><ul>
<li>Previous: <a href="toto.filters.spike_removal.html" title="previous chapter">toto.filters.spike_removal</a></li>
<li>Next: <a href="toto.inputs.cons.html" title="next chapter">toto.inputs.cons</a></li>
</ul></li>
</ul></li>
</ul></li>
</ul>
</div>
<div id="searchbox" style="display: none" role="search">
<h3 id="searchlabel">Quick search</h3>
<div class="searchformwrapper">
<form class="search" action="../search.html" method="get">
<input type="text" name="q" aria-labelledby="searchlabel" autocomplete="off" autocorrect="off" autocapitalize="off" spellcheck="false"/>
<input type="submit" value="Go" />
</form>
</div>
</div>
<script>$('#searchbox').show(0);</script>
</div>
</div>
<div class="clearer"></div>
</div>
<div class="footer">
©2021, Calypso Science.
|
Powered by <a href="http://sphinx-doc.org/">Sphinx 4.1.2</a>
& <a href="https://github.com/bitprophet/alabaster">Alabaster 0.7.12</a>
|
<a href="../_sources/source/toto.inputs.rst.txt"
rel="nofollow">Page source</a>
</div>
</body>
</html> | the_stack | {'hexsha': '82404a539f9078fe6c86d6b7b560ed9b43f73ff3', 'size': '8805', 'ext': 'html', 'lang': 'HTML', 'max_stars_repo_path': 'docs/_build/html/source/toto.inputs.html', 'max_stars_repo_name': 'calypso-science/Toto', 'max_stars_repo_head_hexsha': '85e90421343bf3dcf6d730767287647b5bc189bb', 'max_stars_repo_licenses': "['MIT']", 'max_stars_count': '1', 'max_stars_repo_stars_event_min_datetime': '2022-03-24T23:41:16.000Z', 'max_stars_repo_stars_event_max_datetime': '2022-03-24T23:41:16.000Z', 'max_issues_repo_path': 'docs/_build/html/source/toto.inputs.html', 'max_issues_repo_name': 'calypso-science/Toto', 'max_issues_repo_head_hexsha': '85e90421343bf3dcf6d730767287647b5bc189bb', 'max_issues_repo_licenses': "['MIT']", 'max_issues_count': '12', 'max_issues_repo_issues_event_min_datetime': '2021-02-24T22:30:52.000Z', 'max_issues_repo_issues_event_max_datetime': '2021-11-16T01:51:38.000Z', 'max_forks_repo_path': 'docs/_build/html/source/toto.inputs.html', 'max_forks_repo_name': 'calypso-science/Toto', 'max_forks_repo_head_hexsha': '85e90421343bf3dcf6d730767287647b5bc189bb', 'max_forks_repo_licenses': "['MIT']", 'max_forks_count': '1', 'max_forks_repo_forks_event_min_datetime': '2021-09-21T11:37:09.000Z', 'max_forks_repo_forks_event_max_datetime': '2021-09-21T11:37:09.000Z', 'avg_line_length': '46.5873015873', 'max_line_length': '189', 'alphanum_fraction': '0.6758659852', 'original_id': 'a8c021cebfff38a3b9a875dade74f819134ae161a3b5f235d208fc0e22050037'} |
Director's Statement
COCKTAIL PARTY, the film like the Akutagawa Prize winning novella that inspired it, was born of an independent spirit. The story depicts the underrepresented perspectives of the Okinawan people as it provides insight into a situation of military deployment that has lasted nearly 70 years. If we can understand the complicated human relationships that have developed in Okinawa, we may be provided with a blueprint for future relations between Americans, military and civilian, and the people who live where the United States operates permanent military bases.
The film also challenges the prejudices felt towards the Okinawan people not only by members of the US military but also by representatives of the Government of Japan who continue to ask Okinawa to bear the burden of numerous military bases. Through the story of Uehara confronting his demons from the past as he tries to aid a young businessman’s quest for justice, while at the same time searching for a way to save his business, illustrates the double edged sword faced by all Okinawans. They want their island back, but the base is an undeniable source of revenue and livelihood for many.
The project was born from my fascination with Okinawa that dates back to my first trip to Japan in 1990. As a NEA/Bunka-cho Creative Artist Fellow, I spent six months in Japan observing the work of the esteemed director Yoji Yamada. As I was winding down my time in Japan and thinking I would probably never return again, I travelled to Okinawa because it was known for diving. My first night on the island of Zamami is unforgettable. The owner of the small inn found me seated alone and asked if I wanted to take a walk. I agreed and she took me on a tour of the cliffs where Okinawans jumped to their deaths fearing torture at the hands of the US military, a rumor that had been spread by the Japanese Imperial army. Finally at the end of the walk, we climbed to the top of an observation post. This was where US commanders stood as they began the assault known as the Battle of Okinawa. On the way back we stopped at a small shrine and I placed a paper crane amongst many. The cranes symbolize peace. From that moment, I wanted to make a film about Okinawa.
Okinawan stories figured into all my documentaries made in Japan from 1992 to 2000 but it was after a presentation in the US of one of those films that a representative approached me from Fulbright and invited to submit a proposal to travel to Okinawa as a Journalist Fellow. From 2003 to 2004 I spent 9 months in Okinawa researching many stories but it was the novel “Cocktail Party” by Tatsuhiro Oshiro that made the strongest impression. Unlike most of the literature that took a very strident anti-base, anti-US stance, “Cocktail Party” examined the grey areas, the conflicting relationships that can occur as the result of long-term occupation. Oshiro generously granted me permission to develop the novel for the screen and worked with me to create a contemporary story based on his Akutagawa Prize winning novel.
The production struggled for many years to get made. Financing was difficult and at one point I was unsure the film would be made. The project was picked to participate in TIFFCOM (Tokyo International Film Festival Content Market) in 2012 and that provided a boost in visibility. Finally by means of my teaching young filmmakers and a relationship with Emerson College in Boston, that a way out of no way was created. Colleague and noted cinematographer Harlan Bosmajian (LOVELY AND AMAZING and EARLY MORNING) came on board and along with a cadre of film students and professionals, we began filming. Because of the mixed cast of Americans and Japanese, casting proved to be a challenge but luckily there were some fine young actors in Boston and New York to portray the Marine roles and I made an astounding discovery of a good number of Japanese born actors living in New York who welcomed the opportunity. I brought in a former Marine to drill the actors with Marine behavior and adjusted the dialogue to capture the style and flair of the military. With the assistance of my Supervising Producer, Sayuri Nakata-Alsman, we rehearsed the Japanese cast in a separate location bringing together the two teams on the set. Over the course of four years, on soundstages in the US and exterior filming in Okinawa the movie was made.
COCKTAIL PARTY also allows an audience to see themselves as part of a global community. The desire of the Okinawan people to determine their own future and live a life without the shadow of a military presence is a life we would wish for ourselves.
Regge Life: Known for his award winning documentary work in Japan, COCKTAIL PARTY is Regge Life’s first narrative feature. He received his M.F.A. in directing film and theater from New York University; and is the recipient of 3 CINE Golden Eagles, an NEA/Bunka-cho Creative Artist fellowship under the mentorship of Yamada Yoji, a Fulbright Journalist scholar, a Japan Foundation Fellow and a Sony Innovator. He wrote and produced REUNION starring Denzel Washington and produced NATIVE SON, the life and work of Richard Wright, for Discovery Networks. His most recent documentaries are LIVE YOUR DREAM: The Taylor Anderson Story, chronicling the lives of two Americans who lost their lives in the 2011 earthquake and tsunami in Japan, and REASON TO HOPE, about the 2010 earthquake in Haiti.
© 2020 by Lifecycle Productions Inc. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '58', 'language_id_whole_page_fasttext': "{'en': 0.96299409866333}", 'metadata': "{'Content-Length': '186958', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:N3IRMMAHIOFBVIIRPQKAO3ZFMBY5RVEE', 'WARC-Concurrent-To': '<urn:uuid:f0a40632-67e4-4a08-a80b-5f042765c068>', 'WARC-Date': datetime.datetime(2020, 9, 27, 9, 20, 48), 'WARC-IP-Address': '185.230.60.177', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:66WJSTX7FZODVKKSWTPNQ5IUZ4W4XZ5U', 'WARC-Record-ID': '<urn:uuid:0c85ac45-8882-4cf0-8ac8-112b4fdcda0c>', 'WARC-Target-URI': 'https://www.cocktailpartythemovie.com/from-the-director', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:c9b46741-6f2d-40ce-8eba-7ef7d4a55b54>', 'WARC-Truncated': None}", 'previous_word_count': '929', 'url': 'https://www.cocktailpartythemovie.com/from-the-director', 'warcinfo': 'isPartOf: CC-MAIN-2020-40\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-232.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02547132968902588', 'original_id': '3172252a7c2b76658225aec1184636ed7271bf85c92909c5a911c1e7d19dcc4f'} |
package selector
// Options used to configure a selector
type Options struct{}
// Option updates the options
type Option func(*Options)
// SelectOptions used to configure selection
type SelectOptions struct{}
// SelectOption updates the select options
type SelectOption func(*SelectOptions)
// NewSelectOptions parses select options
func NewSelectOptions(opts ...SelectOption) SelectOptions {
var options SelectOptions
for _, o := range opts {
o(&options)
}
return options
}
| mini_pile | {'original_id': '0fa8f0b6da5df06ebbf2abd2bce2c465208ebc5acb7b40543552b2eb5a4d251d'} |
Keep your home and life mess-free
(photo from
Imagine yourself coming home late at night—you’re dead tired from your work, but you see your family all safe and sound on their beds. You relaxed a bit, knowing that finally, you’re home, and finally, you can call it a day after long hours of working in and out of the office. However, you noticed something that caught your attention. It makes you feel anxious. It makes you quite irritated. You caught the sight of the sink and it’s full of dirty dishes. You saw the laundry area, and you immediately wondered the last time you made laundry. You checked the kids’ bedroom, and you stumbled upon that piece of clothing and toys scattered on the floor. Everywhere you look, there are stuff that’s not supposed to be there. You just can’t help but sigh to the unlikely sight of your home. You want to pick up those pieces and start cleaning, but you wondered how and what to start.
In order to avoid these scenarios, you might as well want to put things in order before you leave your home for work and some errands. You might think that you cannot do it, given the circumstances of your busy work loads. You also find your weekends fully packed of family outings and friendly reunions. Now, when will you really start? The first thing that you have to keep in mind is to know how to balance you work and life schedule during weekdays and weekends. Despite of your busy schedules, you have to find time in cleaning those dishes in the sink and doing your laundry at least once a week. Now, you have to set a particular and define schedule on when to do a certain task. You have to allot at least 20 minutes a day- every day- to do some home errands, like cleaning the dishes, cooking meals for the family, and even folding those ironed (and not ironed) clothes. If you can manage to do things one at a time, you’ll just be amazed on how many things you can accomplish in a short period of time. It will also be easier for you if you follow a calendar or a timeline, for you to be able to keep track of the things that you need to accomplish. You may also adjust this list of yours should there be a need to do so (if there are a sort of family requirements, etc.).
To help you in sorting your daily house chore needs, here are some of the tips and habits that can use to keep your home clean.
1. Practice a ‘put it away’ habit
When we arrange stuff in our homes, we often find ourselves still keeping the things that are of no use to us and are meant to be put away. These things should not be put down, instead, they should be put away in order to de-clutter the area. The clothes that are filling up the cabinet spaces but will never be used again should be moved away and instead donate or give it to someone who will need and use it. The papers and other paraphernalia under your study table should be removed also in order to create more breathing space in your room. You will be amazed by how much space you have saved by de-cluttering your area and by putting away the things that should not be put down.
2. No to cleaning procrastination
What can be done today should not be done tomorrow. We often hear those words in a classroom or work environment, but needless to say, those words are also applicable in doing our house chores. Why wait for few more days if you can clean your kitchen sink today? Why not do your laundry on your free weekend this month instead of doing it next month? We should make it a habit of cleaning anything that needs immediate attention. By doing so, you can be assured that you can keep your house cleaner for a long time and this will also avoid the long hours of general cleaning.
3. Clean as you go
Take a tour around your house and see the things that you can pick up in order to lessen the mess that you see. When going upstairs, check the cupboard for some things that you can throw right away. Pick up those clothes and put them in the laundry bag. Arrange the books and papers piled up on the bed and put them accordingly on the shelves. After watching the television in the living room, pick up and straighten those throw pillows and toys. Make it a habit also of washing the dishes after every meal. When you see finger smudges on the door trim or food splatters on kitchen cabinets and floors, make sure to clean it by damping a micro-fiber cloth that’s been lightly sprayed with an all-purpose cleaner. This simple and easy cleaning can contribute much in keeping your home mess-free.
4. Designate an entry area
One way to make sure that you’ve been doing well in your housekeeping duties is by seeing your things packed and arranged in an organized manner and in specific entry areas. Your personal things like shoes, clothes, bags, books, among others should be well-kept in certain areas inside your room—shoes in the shoe racks, clothes, ties, pants, coats and others hanged in your closet and folded neatly on your cabinet, bags and make-ups in your dresser. Whereas kitchen stuff should be kept in cabinets in your kitchen and personal care should be in the bathroom. You should organize things inside your house in order to avoid confusion when searching for the things that you needed in the moment. Also, organized things are good to the eye sight.
Organize your things to save space and to keep them in good condition. (photo not owned)
5. Create a schedule
Tasks like cleaning bathrooms, changing sheets and curtains, clearing out cobwebs, vacuuming the carpet and other heavy home duties should be scheduled. Mark your calendar for these duties and make sure to follow and stick to your schedule to avoid time constraints. Also, designate a family member in doing those tasks. Assign someone to clean the bathroom, while the other one is changing sheets and curtains. Simple chores like cleaning the bedroom can be assigned to the youngest member of the family. Everyone lives under one roof, so it’s everybody’s task to keep the house clean.
Make a schedule on your daily and weekly house chores (photo not owned)
6. De-clutter your life and your home
The above habits will not be put into good use if you don’t keep in mind that the best way to organize your life and your home is by de-cluttering your life, removing all the things that are of no use to you and your family. These things can only add up to that little space in your room, wherein you can just use that space as your reading nook. Keeping a pile of three years’ worth of newspapers and magazines are no good; you can just give it to the junkshop. Add more personal space in your room by fixing your things and putting away all the stuff that you don’t need. Make your kitchen and dining room more appetizing by removing the tough stains on the sink and counter tops. Create a friendlier atmosphere in your living room by using color coordination, and removing the excess furniture that only blocks space. Remember, less is more. Practice all these habits and you’ll have always have a wonderful home.
Create some breathing space in your living room. (photo not owned)
Truly, it’s more fun staying at home 🙂
Keep your kitchen stain-free and inviting to every family members and visitors
A family that cleans and enjoys together, stays together 🙂
(Reference: Kathryn Weber, Bellaonline Cleaning Editor)
Disclaimer: Photos are ours, unless stated otherwise. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9554101228713988}", 'metadata': "{'Content-Length': '40762', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:QNLZUY47GXVVBCHDJITDV4VDWLLGO7PX', 'WARC-Concurrent-To': '<urn:uuid:4599978f-4c7e-4cb5-9ade-7232e2925460>', 'WARC-Date': datetime.datetime(2019, 11, 16, 0, 55, 56), 'WARC-IP-Address': '192.0.78.12', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:VDIISXTBPAJTZCV7BZDBGJGPBMP3XJWU', 'WARC-Record-ID': '<urn:uuid:3eb66d52-122f-4450-a3b3-d4c861c8f409>', 'WARC-Target-URI': 'https://prstateland.wordpress.com/tag/house-keeping/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:77656a5c-7c3b-463e-8124-cd7d7b9ce51d>', 'WARC-Truncated': None}", 'previous_word_count': '1326', 'url': 'https://prstateland.wordpress.com/tag/house-keeping/', 'warcinfo': 'isPartOf: CC-MAIN-2019-47\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-120.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06400877237319946', 'original_id': 'c1b68d91110593f657ebbffc43e2654c192ee935880de4b7be421f4cfcdc2e89'} |
Fastest way to make image blink --> so fast that you didn't see it
I'm looking for a way to make image blink so fast I cannot see it (and then avoid some screenshoting):
var img = document.getElementsByTagName('img')[0];
var i = true;
setInterval(blink,10);
function blink(){
if(i){
img.style.visibility="visible";
i=false;
}else{
img.style.visibility="hidden";
i=true;
}
}
But I still see the blink, and I think I could not lower than 10ms .
I was thinking initially that below 24 f/s I would not notice it, but it doesn't seems to be the case.
What could I change to make it faster ?
Is it even possible ?
Final target is to avoid screen shooting .
"Make it blink, so fast that you cannot see it blink?" - Then why the blinking in the first place?
Sry I edit my message, it's to avoid some screenshoting
you are limited to relatively long pauses in computers - nothing you can absolutely control.
you can't avoid screen shotting.
unless you screenshot when it's visible?
I can just disable JavaScript to circumvent your "screenshot prevention"
Why disable javascript, just go to devtools, check the cached images, "save as".
Yes but most of people don't know about dev tool
Besides it should be noted, that it is hell for batteried devices like mobile phones and tablets.
The target was to avoid 90% of people to download the image, with this solution and other tricks
@Iyashi yes totaly agree ^^ but It's a proof of concept
Making the image blink is not gonna prevent people from screenshotting the image unless they're very very very unlucky.
Yes, @ibrahimmahrir , but it will add some difficulty to copy the picture, that' the target .
But yeah you are completely right
I imagine going to a website, that wants to show me some image, and it blinks every now and then for a frame. Afterwards, my bug report gets closed with "working as intended, it's screenshot protection". It would take some time to convince me that wasn't a joke.
The standard refresh rate for monitors is 60Hz - 60 times per second. This is a hardware limitation - even with perfect software timing, there's no way to display frames more frequently than that - and humans paying attention to a screen can easily see something that appears for 1/60th of a second.
Your only option is to have the image appear and disappear with every frame (which can be done more precisely than setInterval with requestAnimationFrame - but it'll still be visible to those watching closely).
// Ensure browser is not busy
setTimeout(() => {
window.requestAnimationFrame(() => {
document.body.classList.toggle('blue');
window.requestAnimationFrame(() => {
document.body.classList.toggle('blue');
});
});
}, 1000);
.blue {
background-color: blue;
}
It's not possible for the monitor to display something for a low enough duration that it's not perceivable.
Thanks for that explanation :D
The fastest solution I can think of is to CSS animate the opacity property. The opacity property is animated on the GPU. This means less load on the CPU and the mainthread.
#box {
width: 100px;
height: 100px;
position: relative;
background: red;
animation: 1ms steps(2, jump-none) 0s infinite running blink;
}
@keyframes blink {
from { opacity: 0; }
to { opacity: 1; }
}
<div id="box">Secret Image</div>
| common_corpus | {'identifier': 'https://stackoverflow.com/questions/64625093', 'collection': 'StackExchange', 'open_type': 'Open Web', 'license': 'CC-By-SA', 'date': '2020.0', 'title': 'Stack Exchange', 'creator': 'ASDFGerte, Andreas, Daniel A. White, Iyashi, LexaGC, https://stackoverflow.com/users/11561373, https://stackoverflow.com/users/13762301, https://stackoverflow.com/users/23528, https://stackoverflow.com/users/3206306, https://stackoverflow.com/users/402037, https://stackoverflow.com/users/6692606, https://stackoverflow.com/users/9867451, ibrahim mahrir, pilchard', 'language': 'English', 'language_type': 'Spoken', 'word_count': '541', 'token_count': '903', '__index_level_0__': '31652', 'original_id': '9f874401d1257cc64c2301b328cb6313568107b168e59e743ec045f26c41fdcb'} |
PHP pthreads die main thread when error in the child
I am using php pthreads extension. I run console script and it must work permanently. That script create several child threads. The problem is when fatal error occurred in the child thread - main thread and other child still works. I need script will be died when error occurred in the child.
It's a big project, using Spot 2 ORM and other untypical PHP extension. TRY and CATCH it's not so easy to solve that problem. When script works a lot time, several hours, the error "mysql server has gone away" begins to appear
Isn't this just a case of try and catch then killing the scripts within the catch? I'm curious what the solution is here tbh. Maybe you can provide some code so that someone with more experience in this can provide an answer?
I have updated my post
If possible, could you provide code samples? doesn't need to be all of it, just how you are managing your threads (creating, starting, joining, etc...are you using Workers, Pool, etc... ) ? Any more info could be helpful.
| common_corpus | {'identifier': 'https://stackoverflow.com/questions/49513469', 'collection': 'StackExchange', 'open_type': 'Open Web', 'license': 'CC-By-SA', 'date': '2018.0', 'title': 'Stack Exchange', 'creator': 'IsThisJavascript, Mikael, falomir, https://stackoverflow.com/users/237746, https://stackoverflow.com/users/3961074, https://stackoverflow.com/users/7831222', 'language': 'English', 'language_type': 'Spoken', 'word_count': '189', 'token_count': '248', '__index_level_0__': '37468', 'original_id': '399cceebb18c66b4889374807ab416801ae52a46f400a24f30bdc6d9d4c30edc'} |
hello again,
it is me again, i was woundering if it is possible to reuinion the Family in five months? five months before you be an adult 18!
thank youn
asked Dec 13, 2016 in Legal advice by Johnny
Hi Waseem, May I ask you to explain a bit better your question? Using your own words, could you let me know more so that I can link somebody with the right expertise to this question? You are currently in Germany and you want to get Family reunion with which part of your family? Are they also living in Germany? =)
Yes, actually my family is not here, and I want to reunion them! Could it be possible to do that in only five months! I'm 17 now, and I'm going to be 18 in May. Reunion from outside of Germany!
Thank you so much @paolo for answering my question.
I see, perhaps @Marcel can help us out with this. I'm not super good with law but there is always somebody that finds the time to share his knowledge =)
Do you have already asylum granted ?
Please log in or register to answer this question.
1 Answer
+6 votes
Hi Johnny/Waseem,
it may be possible. You must be 17 when the German embassy and the Ausländerbehörde decide on the application for a visa. The date of the application is not relevant. There are possibilities to enforce a fast treatment by court applications in case you have the impression that your case is not handled fast on purpose.
But you should keep the following in mind:
- Only your parents are allowed to apply for a visa for family reunion. Sisters/brothers can only apply once your parents are in Germany with a residence permit.
- The visa/residence permit of your parents expires on the date you turn 18; they will have no automatic right to stay on further, they will need a different ground to apply for residence permit. (They may be granted a residence permit due to their status as parents only if they are too old and in need of care by you.) So it is questionable whether they can stay on.
answered Dec 14, 2016 by Marcel
Thanks everyone :)
one more question, please!
how can i make an application? do i have to apply or my Family home?
Hi Johnny, <br></br> your family has to apply in a German embassy for visa. This is only possible as long as you are under 18 and have a higher status than just subsidiary protection. Please see the steps for family reunification for minors <br>and this article about hardened family reunification for minors with subsidiary protection:</br>
2,938 questions
3,682 answers
134,037 users | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '4', 'language_id_whole_page_fasttext': "{'en': 0.9609135389328004}", 'metadata': "{'Content-Length': '55611', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:OYWT7CZSYE6DIHSGCCKU36IPP3FCYTOE', 'WARC-Concurrent-To': '<urn:uuid:30e8b3a8-43b6-4f5a-a828-7ca024199eaa>', 'WARC-Date': datetime.datetime(2020, 4, 4, 1, 21, 15), 'WARC-IP-Address': '23.97.221.175', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:DXI6PF2RQZYAKN2TI33FO7DFXG4FKSUH', 'WARC-Record-ID': '<urn:uuid:d0b30f01-7853-404c-996d-6f1e04df2bc5>', 'WARC-Target-URI': 'https://www.wefugees.de/101767/is-it-possible-for-a-minor-to-do-family-reunion?show=602966', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:845bd674-444e-44c3-9928-6f2937105bc9>', 'WARC-Truncated': None}", 'previous_word_count': '455', 'url': 'https://www.wefugees.de/101767/is-it-possible-for-a-minor-to-do-family-reunion?show=602966', 'warcinfo': 'isPartOf: CC-MAIN-2020-16\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March/April 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-155.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04610973596572876', 'original_id': '668fa1f5db54beb3e21cab32ab731e0dee69772d1191ccc368eaccc70264c9e8'} |
4575 Alpine Road, Portola Valley, CA 94028
Phone: (650) 851-1777
At Ormondale School, we believe that students are naturally inquisitive. Investigative learning is a philosophy in which teachers and students work together to wonder, question, explore, research, and evaluate. Experiences are crafted to prompt students to investigate the world around them. IL compliments all aspects of the curriculum, transforming learning into an active and reflective process. Within the classroom, this approach can generate long term projects, exploratory introductions, brainstorming sessions, or impromptu research to answer a pertinent question. For students, this process fosters dynamic problem solving, a sense of responsibility, meaningful collaboration with peers, and many more skills essential for success. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.925842821598053}", 'metadata': "{'Content-Length': '70708', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:CFGMT7SJCP7GFOR2KN624CQOOCTM76AY', 'WARC-Concurrent-To': '<urn:uuid:f34c1194-e500-4f11-984d-c085ee1ba4d0>', 'WARC-Date': datetime.datetime(2014, 4, 18, 3, 7, 22), 'WARC-IP-Address': '207.54.156.1', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:LUMRRTYGS3AZJPGJPBB3MEDHI5EESTHB', 'WARC-Record-ID': '<urn:uuid:ede4acc5-10c6-49d8-85c0-29fb025fd045>', 'WARC-Target-URI': 'http://www.pvsd.net/domain/25', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:0fea7b2c-1a6d-4c7e-8bc0-307401622992>', 'WARC-Truncated': None}", 'previous_word_count': '110', 'url': 'http://www.pvsd.net/domain/25', 'warcinfo': 'robots: classic\r\nhostname: ip-10-147-4-33.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-15\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for April 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.28232401609420776', 'original_id': 'fc66719ba95988e73deda7e9844a6e8362ebd6486c9e7147316849d4e0e58e71'} |
two-state solution
RAMALLAH: US President Donald Trump's break with decades of support for a two-state solution to the Israeli-Palestinian conflict is irresponsible and does not advance peace, a senior Palestinian official said on Wednesday.
"This does not…
UNITED NATIONS: Palestinian president Mahmud Abbas told the UN General Assembly on Thursday that Israel's settlement expansion in the occupied West Bank was destroying any hope of a two-state solution. | mini_pile | {'original_id': '8cc43bcce1352a75980a994377785b1fdc358d2cd31fbd707685e3e77d5f7246'} |
Patent Lawyer
Patent Lawyer | Patent Attorney
Patent Lawyer is a generic term to describe a Licensed Legal Practitioner qualified to give legal advice in Patent Law. Whereas the Patent Attorney is a Lawyer eligible to represent clients within a specific court jurisdiction. Some Lawyers handle a variety of legal problems; others specialize in specific areas of Patent Law. The Patent Lawyer advises clients to their rights under Patent law and help protect the interests of businesses and individuals. The Lawyer can help explain legal rights, and the strengths and weaknesses of your case. The Lawyer assists with court litigation, contracts, depositions and other legal matters. An experienced Patent Attorney can make a big difference making a successfulcaseto a judge or jury.
In the US, Lawyer applies to any Attorney. In other parts of the World, the practice of Patent Law is divided into Solicitors and Barristers. The Patent Solicitor is permitted to conduct litigation in court but not to plead cases in open court. The Barrister represent clients in open court and may appear at the bar. Depending on your income and the nature of your legal problem, legal aid may be available from local legal services programs. Call each Lawyer and ask questions about their expertise in Patent Law. Ask about any similar cases that the Attorney has handled. Ask the Lawyer to explain the various steps involved in handling your problem. A Patent Lawyer will consider the complexity of the case and the amount of court time it could take in determining the fee agreement. Make sure you and your Lawyer have the same goals. Be wary of any Patent Attorney who guarantees results.
Patent Lawyer Services provide an opportunity for informal confidential discussion of problems and complaints outside formal channels. The Lawyer helps to clarify the issues, complicated situations, and prioritize concerns. The Patent Lawyer may suggest a range of feasible complaint settlement options and help evaluate the pros and cons. Lawyer can educate individuals on their rights. They can perform neutral fact-finding investigations to protect against unfair treatment and help resolve complaints. With permission, the Patent Attorney can act as an intermediary to initiate problem-solving, including facilitating a mediation session. Taking steps to reduce the risk of litigation is a smart decision.
The Patent Lawyer is an advocate for fairness and the equitable treatment, serves as a source of information and support. Evaluating and hiring an Attorney usually involves an initial consultation. Most Patent Attorneys provide case consultation free of charge.
Do you have a question about Patent Law? If you need legal help, The Lawyer Attorney Directory can put you in touch with a Lawyer who can help you with your case. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '271', 'language_id_whole_page_fasttext': "{'en': 0.938772976398468}", 'metadata': "{'Content-Length': '33541', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:Z2UCKA2CBS2RVK2VBPG4D3CXZY5TRY7D', 'WARC-Concurrent-To': '<urn:uuid:7879a0fb-ffd9-4aff-a74c-ef9d25d35286>', 'WARC-Date': datetime.datetime(2018, 4, 19, 9, 39, 8), 'WARC-IP-Address': '74.208.236.49', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:OUEPAULN7NBX6UKGV6LLCZNGVOBR27XG', 'WARC-Record-ID': '<urn:uuid:7ba6e937-f205-43c1-8e33-016dffee48bf>', 'WARC-Target-URI': 'http://locatelawyerattorney.com/list-category/patent.php', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:9d2c0f61-a1b4-4af8-b714-0f7a41bb3b58>', 'WARC-Truncated': 'length'}", 'previous_word_count': '449', 'url': 'http://locatelawyerattorney.com/list-category/patent.php', 'warcinfo': 'robots: classic\r\nhostname: ip-10-158-89-8.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2018-17\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for April 2018\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.033869385719299316', 'original_id': '4f02c2c31d391f334817aaed9e33d75aac13fbe5c9fce588fab08e6044046d82'} |
Wednesday, October 29, 2008
Are all people sexual? Three options
If we take asexuality seriously and accept it as legitimate, there the three general ways to answer the question, “Are all people sexual beings?” No, Yes and Huh? In this post, I’m going to give a general outline of each of these three options. In later posts, I will try to explore each one in more depth.
No. Many asexuals have a strong sense that they are not sexual. They take a look at sexuality as they see it around themselves and say “This is not me.” Taking this in combination with the fact that ‘sexuals’ and ‘sexual people’ are terms for the out-group, statements like “all humans are sexual beings,” are often understood to limit humanity to the out-group, functionally telling asexuals that they are non-human or sub-human. Or such statements are interpreted as meaning, “I know you’re deepest, inmost thoughts and feelings better than you do. If you understood your own feelings, you would realize that you really are just like everyone else (i.e. 'normal' people.)"
However, if we answer the question based on the intuition of asexuals who strongly feel that they are not sexual, this is not without its difficulties. One of the biggest is that it has some very counterintuitive implications. Things like attraction, falling in love, masturbation, sexual fantasies, etc. are seen as inseparably connected with sexuality. Given that some asexuals experience/do one or more of the above, calling such people “asexual” makes little sense to some. In order to maintain the view that people who feel/do these can be asexual, it is necessary to explain how such activities/feelings can be “not sexual.”
Yes. Rather than saying that asexuals are not sexual, “sexual” is understood in a way broad enough to include people who don’t experience sexual attraction, people who prefer not to have sex, etc. There are some asexuals who are comfortable with this option. It would require divorcing asexuality from its etymological meaning of ‘not sexual,’ but the term would still be used because no one can think of a better one. Having a term is empowering and very useful for creating asexual discourse.
This option faces two major challenges. The first is figuring out how to (re)define sexuality in a broad enough way so that it includes asexuals without denying, ignoring or marginalizing their experiences. Second, this option has to justify why exactly we would want to do so and what the point of insisting that all people are sexual beings is.
Huh? This option doubts that the claim "All people are sexual beings" is even a meaningful one. If such a broad view of sexuality is taken that it includes the full range of the experiences of people, including asexual people, is anything even worth saying? Especially considering how such statements are supposed to be bold and daring ones that are fundamental to how we think about sexuality, not vague, weak ones that say virtually nothing at all? Moreover, if the enormous variation in how sexuality is thought about from culture to cultural and even person to person within a culture is taken seriously, can the claim that all people are sexual beings be maintained? Or does such a claim commit gross anachronism (and whatever the synchronic equivalent is)? Do such claims privilege the experiences of the claimants and those like them at the expense of experiences of people that don’t fit the hegemonic ideology of sexual-normativity?
Next time, I will start with exploring “No” and how to deal with its major problems.
Saturday, October 25, 2008
Are all people sexual? Introduction
One claim often made in discourses about sexuality is that all people are sexual beings. It seems especially common in the context of sex education. There slight variations in wording, and sometimes phrases are added like “at all ages” or “from birth until death” to emphasize the point. A few quick google searches will find you plenty of examples.
Planned Parenthood says, “All people are sexual beings from birth to death.” They say that their organization “works to ensure that sexuality is understood as an essential, lifelong aspect of being human.”
A doctor writing on MSNBC gives advice to a mother about how to talk to her daughter about sexuality: “All humans are sexual beings who have sexual feelings. Sex is a normal part of life.”
This past summer, I took my university’s class on human sexuality. Our textbook opens, “Being sexual is an essential part of being human.”
The fact that there are some people going around calling themselves asexual raises serious questions concerning this.
In Erwin J. Haeberle’s Critical Dictionary of Sexology, we find the following definition:
[Note: Since writing this post in 2008, Haeberle has updated the entries for "asexual" and "asexuality."]
In one article on asexuality,* Eli Coleman, director of the program in human sexuality at University of Minnesota, said that he thinks more effort should be put into looking at the question of whether asexuality is a sexual orientation. "In a sense, asexuality defies one of the basic tenets of sexuality: That we are all sexual beings. Some people may not have much of a sexual drive. But does that make it an orientation? It’s a very interesting question worthy of investigation."
If asexuality is taken seriously in discourses on sexuality—especially ones in which sexuality is stressed as being an essential, fundamental part of being human—there is a question that needs to be addressed. “Are all humans sexual beings?” If asexuality is accepted as legitimate, there are three main ways to answer the question. 1.) No. 2.) Yes. 3.) Huh?
In this series of posts, I hope to try to think through some of these issues. I personally lean in favor of number 3. Next time I’ll take a brief look at these three options.
*Melby, Todd “Asexuality gets more attention, but is it a sexual orientation?” Contemporary Sexuality. November 2005. vol 39, No. 11.
Edit: Since writing this, an entry for asexuality" has been added to the Critical Dictionary of Sexology.
Monday, October 20, 2008
Research on asexuality
An expanded list can be found on the page Exising Research on Asexual Explorations the website.
I am sometimes interested in seeing what searches people use to find my blog, and I’ve noticed that one of the most common is from people looking for the article “Asexual and Autoerotic Women: Two Invisible Groups” by Myra T. Johnson published in 1977. (I hadn't expected this to a common search for finding my site.) Because of this, I thought that I would post something to people some time in trying to find it. And while I’m at it, I figured that I would post a list of published materials on asexuality along with some thoughts on them and information on how to get a hold of them. (I had already been working on this list.) Hopefully this will be useful to anyone doing research on asexuality, whether to publish something, or to do something for a class, or simply out of curiosity--It was largely my own curiosity that caused to me find most of it. I realize that there are places (like the AVEN wiki) that have pages for this, but I don’t feel comfortable opining on wikis, whereas I have absolutely no qualms about doing so on my blog.
Papers on asexuality
1.) Johnson, Myra. (1977) "Asexual and Autoerotic Women: Two invisible groups." in ed. Gorchros H.L. and Gochros J.S. The Sexually Oppressed. New York: Associated Press.
This is the first known publication on asexuality. Asexuality is defined a little differently than in modern usage. She distinguishes autoerotic women (women who masturbate but don’t desire sex) from asexual women (women with desire from neither.) In current usage, both of these groups are contained under the term “asexual.” Also, she defines asexuality in terms of sexual preference rather than sexual attraction or asexual self-identification. Her data come from letters to the editor in women’s magazines in the 1970’s. Even though this chapter is almost 30 years old, it remains one of the best discussions of the topic that exists. The book may be a little hard to get a hold of, but should be available via interlibrary loan or something. At my university, it is kept in off-site storage. There is a (low-quality) PDF version available if you know who to email, but you can’t find it via a search engine. (Joining Apositive or PMing someone on AVEN would be a good idea.)
2.) Bogaert A.F. (2004) Asexuality: Its Prevalence and Associated Factors in a National Probability Sample. The Journal of Sex Research, 41, 279-287
After the Johnson chapter, the next academic publication on asexuality did not appear for another quarter of a century. (Rather ironic if we consider the title of Johnson’s piece.) Data came from a 1994 probability sample done in the UK that gave several options for sexual orientation, including “I have never felt sexually attracted to anyone at all.” This study does a series of regressions using the respondents who chose this answer. There are significant methodological shortcomings, but the author does a good job discussing them. This paper is available online by clicking the above link.
3.) Bogaert A.F. (2006) Toward a Conceptual Understanding of Asexuality. Review of General Psychology, Vol. 10, No. 3. pp.241-250
After publishing the above quantitative paper, Bogaert published another discussing how to conceptualize asexuality. He has some important things to say, and my only real criticism of it is the section on defining asexuality—this section is primarily based on his own speculation of what he thinks asexuals would be like rather than actual knowledge of people who report not experiencing sexual attraction. I was able to download this with my university library account.
4.) Prause, Nicole & Cynthia Graham (2007) Asexuality: Classification and Clarification. Archives of Sexual Behavior. 36 p.341-35
This paper was designed to be an exploratory study on people who identify as asexual. They did two studies—one was a qualitative study and the other was a quantitative one. The only thing that worries me is that some readers will use the qualitative study (n=4) to construct an image of “the asexual," taking these four as prototypical of asexuals more generally. The quant. section leaves much to be desired, though it was simply designed merely to be an exploratory study.
5.) Scherrer, Kristin (2008). "Asexual Identity: Negotiating Identity, Negotiating Desire" Sexualities 2008; 11; p. 621
Participants were recruited from AVEN and asked to fill out an open ended questionnaire. The focus is on asexual identity, and this qualitative study was based on a much larger sample size than the one used in Prause and Graham (2007). (n=102 people rather than n=4.)
Some other published literature dealing with asexuality
5.) Storms, M. D. (1978) "Sexual Orientation and Self-Perception" in P. Pliner K. R. Blankenstein and I.M. Spigel (Eds), Advances in the Study of Communication and Affect vol. 5 Perception of Emotion in Self and Others. New York. Plenum
6.) Storms M. D. (1980) "Theories of Sexual Orientation." Journal or Personality and Social Psychology 1980, 38, 783-792
7.) Stein, Edward "The Mismeasure of Desire: the Science, Theory, and Ethics of Sexual Orientation." Oxford University Press. 1999
Storms argued for a model of sexual orientation that includes asexuality in two papers published a while ago. Both papers are fairly similar and are based on the same study. Stein gives a slightly expanded argument for that model in chapter two of his book. The 1979 paper may be a little difficult to get a hold of (I had to go to a dark and scary part of the library to get a book that hadn’t been checked out in over a decade), but the main parts are repeated in the 1980 paper as well as in Stein. (I was able to download Storms 80 with my university account. Stein’s book shouldn’t be too hard to find in a library.) Also, Storms defined asexuality in terms of (low/lack of) sexual attraction and sexual fantasies towards/about males or females.
A couple conference papers
Poston, D. L. and Baumle, A. K. , 2006-08-11 "Patterns of Asexuality in the United States" Paper presented at the annual meeting of the American Sociological Association, Montreal Convention Center, Montreal, Quebec, Canada Online
This is available online
Methodologically, the quantitative section was really lousy. The discussion before the quantitative section, however, may be of interest.
There are a few other papers that mention asexuality, but will be of less interest.
Nurius, Paula S. "Mental Health Implications of Sexual Orientation." The Journal of Sex Research" Vol. 19, NO 2 pp. 119-136.
This is one of the few attempts to use a 2-dimensional model for sexual orientation. Asexuality is defined in terms of sexual preference (at the time of taking the survey.)
Lever, Janet et. al "Behavior Patterns and Sexual Identity in Bisexual Males" Journal of Sex Research Vol 29. #2 May 1992 p.141-167
In their data, there were some people who wrote asexual (as a write in?) as their sexual orientations. The author decided to remove them from the study.
Andres-Hyman, Raquel, et al. "Ethnicity and Sexual Orientation as PTSD Mitigators in Child Sexual Abuse Survivors" Journal of Family Violence, vol 19, no. 5 October 2004
They included asexual as a possible sexual orientation (They define asexual in terms of self-identification.)
Berkey, B. R., Perelman-Hall, T., & Kurdek, L. A. (1990). The multidimensional scale of sexuality. Journal of Homosexuality, 19, 67-87.
They include asexuality in their list of orientations, but define it as not experiencing sexual attraction to males or females, not falling in love with males or females, and not having sex with males or females. No one in their study qualified as asexual, which they, bizarrely, attributed to asexuality being “rare” rather than the fact that they recruited people for their study based on their sexual orientations. (To back up their claim that asexuality is rare, they cite a human sexuality textbook by Masters, Johnson, and Kolodny, though I wasn't able to find in that book what they were referring to. I do hate it when journal articles cite books without using page numbers.)
Ingudomnukul, Erin, Simon Baron-Cohen, Sally Wheelwright and Rebecca Knickmeyer. Elevated rates of testosterone-related disorders in women with autism spectrum conditions. Hormones and Behavior. Vol 5. Issue 51 May 2007. pp.597-604.
Part of this study involved sexual orientation of women with austism spectrum conditions and asexual was an option. A rather large portion of the women chose "asexual" though how this should be interpreted is unclear.
I was able to download all of these though my university account except for the Multidimensional Scale of Sexuality, which also required a trip to a scary, dark part of the library. Also, you can take the multidimensional scale of sexuality as an online test, which seems to use the same questions (and hence, it is possible to see how they define asexuality. (Evidently, it can also be taken at OKCuipid as well.)
Also, there is one more source of information that I didn't mention--the stats on "X" in Kinsey's work.
I think that there are a few case histories that exist here and there, but I haven't personally run across many of these.
I'm not entirely sure who exactly this information will appeal to, but hopefully someone will find it useful.
Saturday, October 18, 2008
My blog so far
Wanting to be a Groupie
Some reflections on coming to identify as asexual
Asexy Ambivalence
Then I had a two-part series on asexuality’s negative definition
Some reelections on a negatively defined identity
More reflections on a negatively defined identity
Thoughts on coming out part I: early attempts
Thoughts on coming out part II: words
Grammar Part 2: More thoughts on words
Asexual people of the past: should we care?
Asexuality and Celibacy
Asexuality and Celibacy: Part 2
What is celibacy?
Then, I moved to the topic of defining asexuality.
Defining Asexuality
You’re not a real asexual! Resisting pressure for a narrow definition
Alternate ways of defining asexuality
Asexuality-the history of a definition, part I
Asexuality-the history of a definition, part II
Asexuality—the history of a definition, part II
Saturday, October 11, 2008
Asexuality-the history of a definition, part I
To finish off my series on defining asexuality, I decided to take a look at how and why the definition is what it currently is. To a large extent, this is a historical question and so I decided to do some research on the history of the asexual community in an attempt to understand it.
There are only a few (three that I know of) places where the history of the asexual community has been outlined. On the AVENwiki, the page about AVEN itself has a short history of the site. An early (and very brief outline) is given by AVENguy in an early post on AVEN. The longest description I know of is the podcast titled history lesson on the podcast/blog “Love from the Asexual Underground.” These are very interesting and I found them helpful, but there is a lot that I wanted to know about that they don’t say. (Also, (Also from Love from the Asexual Underground, Asex 101 isn’t primarily about asexual history, but it does have some information relevant to this topic.)
In trying to do my own research, there are some important sources that still exist. According to the above mentioned outlines of the history of the asexual community, throughout the 90’s people would occasionally describe something like asexuality on some sexuality message boards, but they weren’t able to connect with other asexuals. In 1997, there came out an article called “My Life as an Amoeba” that allowed people to post to it, and thus allowed asexuals to communicate with each other, creating the first online “asexual community.” This article still exists on, but the posts seem to be lost and the link to the original has gone dead. The most important early (preaven) asexual community was a yahoo group called Haven for the Human Amoeba (I’ll call it HHA.) This still exists and is the most important source of information on the early asexual community. However, there are a few problems. First, there are far too many posts for a mere amateur historian like myself to read all of them—I’ve read a few hundred, but after a while, I started skipping a lot and relied a fair bit on searches. Another problem is that a good number of the sites that are linked have gone dead (including the earliest version of AVEN.) Another important source of data comes from AVEN itself—many early posts still exist. For example, if you go to Q & A on the AVEN forums and go to the oldest posts, you can find some of them (I linked to one earlier.) (Using the search tool and going to the older posts is helpful here as well but you’ll need to use the advanced search features.) Another important source of data is Internet Archive, which has some old websites (for example the Official Nonlibidoist Society’s now defunct website.) I’ve also corresponded with David Jay, and he has helped fill in a few gaps here and there. As a caveat, because of the way I’ve gone about this, my claims are largely a matter of impression. I’ve tried to find as many posts about defining asexuality, but much of this was done by searching for the words “definition” and “define” on HHA and AVEN, and so I have likely overlooked other posts discussing this issue without using these words. So take my history for what it’s worth.
My narrative begins with the yahoo group “Haven for the Human Amoeba.” This group was formed in October 2000 but, other than the introductory post, there was no conversation until Feb 2001 when the founder was curious who the other people who had joined (but not said anything) were. In the following discussion, one person asked what an asexual was and the group founder said that being asexual means being not sexual—with reference to people, this means not being sexually attracted to men or women (or horses, cats, dogs or anything else someone might want to joke about.) What relationship, if any, this group had to the “community” formed around the 1997 article isn’t clear (in April 2001, a link to that article was posted by the group’s founder without indication of how long she had known about it.) HHA started out as a very small group.
At first, discussion was pretty sporadic. Sometimes, when a new person would join, they would give some kind of introductory post or two; this would create a bit of discussion, and then it would die out for a while—sometimes a month or two—until a new person came and gave an introductory post. Beginning in July 2007, posts had become pretty regular, probably because their numbers had grown enough to generate sustained discussion. In August 2008, things really took off, going from 17 posts from Oct 2000 to June 2001, to 18 posts in July 2001, and 130 posts in August 2001.
Meanwhile…in the 2000-2001 school year, there was a college freshman at Wesleyan University by the name of David Jay. David had considered himself asexual since high school, and after going to college, he had gone to the LGBT office trying to find out everything they knew about asexuality. They didn’t know anything about it. During this time, he found the above mentioned “My life as an Amoeba,” and this was the first time he had ever seen the word “asexual” used to refer to people outside of his own writings. This prompted him to create a page about asexuality on his Wesleyan account, calling it AVEN—the Asexual Visibility and Education Network. Before finding that article, he had already been thinking about doing this, but it provided the necessary impetus to get things started. There wasn’t much information on this page—mostly just a definition of the term asexual and his email, asking anyone who knew anything about the subject to contact him. The original definition was something like “a person who is attracted to neither gender.” He then emailed his page to the heads of LGBT groups on college campuses around the US in an attempt to find other asexuals. One of them wrote back to him about the “neither gender” part, informing him about trans issues. In response to this, David modified the definition so that it did not assume a gender binary. This was around March or April of 2001.
This initial definition—a person who is attracted to neither gender—fits well with the (now abandoned) meaning of the AVEN triangle, which I believe was also on the original AVEN page. The top line is based on the Kinsey scale: one end is other-sex attraction, and the other end is same-sex attraction, allowing for all sorts of combinations of these in the middle. The existence of another dimension was postulated —amount of attraction—which formed the vertical axis, bisecting the Kinsey scale. As attraction decreased, gender preference vanishes, making a triangle. After learning about the experiences of other asexuals, this theory didn’t last long, but the symbol has survived. In the theory that this symbol represents, the definition “a person who is attracted to neither gender” makes a lot of sense.
In August 2001, the summer after David’s freshman year, someone who had joined HHA in July 2001 (and had info about asexuality on her webpage, which is now dead so I have no idea what was on it) found David’s site and contacted him, telling him about HHA and asking if he wanted to join a webring she was putting together of asexual sites. It was early August when she contacted him, and a week later he joined HHA. This was shortly after the time that the group had started to get enough members to have sustained conversation. It was also around this time that people began to get an idea of the diversity that existed even within their small group. One person who considered herself asexual said that she masturbates, and another was very confused by this. She thought of asexuality as a lack of sexual attraction (likely reflecting the founder’s definition), and thought this was the same as sex drive (if you don’t experience sexual attraction, what’s the point?) At this time, the concept of undirected sex-drive was introduced into asexual discourse and several people found it to be useful and adopted it. A couple weeks after David joined, he suggested that the thing that unified people on HHA was not experiencing sexual attraction—this suggests that by this point, he had changed the phrase “attraction/attracted” to “sexually attracted/sexual attraction,” probably on the influence of the founder of HHA’s definition and the one or two others who had adopted it. The first instance of the present definition in HHA was in a discussion on defining asexualism (asexualism and asexuality were used interchangeably back then) in a post by David in late September 2001.
In present asexual discourse, one reason the term “sexual attraction” is used in the definition is to contrast it with other kinds of attraction (i.e. emotional/romantic attraction.) When the above definition was proposed, this distinction had not become standard in asexual discourse. As far as I can tell, this issue came up in late December 2001 and was more-or less worked out in January 2002. Interestingly, this requires a change in the meaning of “a person who does not experience sexual attraction” without requiring any change in the language.
Late in 2001, there was a decent amount of discussion on issues involving defining asexuality. The consensus opinion (at least the one expressed the most) was that asexuality is undefinable—each person had their own reason for calling themself asexual, and there was too much diversity in their (still very small) asexual community for any one definition to cover everyone. However, people also agreed that it would be useful to have a definition that they could give to people—having a definition would be helpful for asexual visibility. This was discussed, and there was no consensus. David had proposed his definition, but there didn’t seem to be any strong support for it or disagreement with it. My impression is that the majority opinion was to think of asexuality not in terms of sexual attraction, but in terms of sexual preference. Seen in this light, the Collective Identity Model makes a lot of sense: No single definition encompasses all asexual people, so the common theme is that asexuals are people who call themselves asexual because they disidentify with sexuality—i.e. they prefer not to have sex, and this affects how they go about forming relationships. (The parts about identity and relationships were particular emphases found in David Jay’s writings more than in other members, but by and large, this definition fits pretty well with the early consensus.) In this context, I think the definition “a person who does not experience sexual attraction” was intended to fill the need of a definition to be used for the purpose of asexual visibility rather than as the one that the community was based on.
Reading the history this way, David’s comment that I mentioned in a recent post makes perfect sense: “A person who does not experience sexual attraction” is the definition used outside the asexual community. “A person who calls themself asexual” is the one used inside the asexual community.
Having seen how one person came up with the definition “A person who does not experience sexual attraction,” the question becomes how this definition became the standard one in asexual discourse. Once it came to be the definition (prominently displayed) on one asexual website, I think that there are two main questions to address. The first is why AVEN came to be the main asexual website. The second is why AVEN’s initial definition continues to be its definition today. I’ll start with the first part.
Early in the asexual community, there were some other asexual websites that are linked in HHA, but these have gone dead. In terms of asexual community—places where asexuals can gather and converse with each other—I am aware of three places online that existed early on. The first, HHA, isn’t very active anymore. The design isn’t particularly good for large groups and other sites do things much better. AVEN first started its forums in May 2002. However, there was one other important site which continues to be active—the asexual community on LiveJournal was formed in April 2002, about a month and a half before the AVEN forums began. If we look at the “about” section of its profile, it says, “This is a community for asexual people to discuss living without sexuality. We welcome anyone with no or very little sexual attraction to others, people with low or no libido, and their allies.” One thing you will find is that “a person who does not experience sexual attraction” does not appear. The community was created because the community “asexuals” was considered too judgmental and was generally celibate people (termed “lifestyle asexuals”) rather than people with little or no sexual attraction (“classic asexuals”) and they spent a lot of time criticizing the sexual behaviors of others. The language that is used on the asexuality community on LJ’s profile is the same sort of language that can be found on the AVEN forums by the founder of asexuality on LJ. (For example, on the introductory post of the founder of the Official Asexual Society. LJ’s founder is paranoidgynandroid on that post.)
The founder of this community on LJ was perfectly aware of AVEN’s definition—in fact, she was heavily involved in redesigning AVEN in March 2002, was the author of AVEN’s general FAQ and was also responsible for AVEN’s present color scheme (this explains why terms like “little or no sexual attraction” are used in the FAQ, and also why asexuality on LJ’s profile links people to AVEN’s FAQ for more information.) While she knew about AVEN’s definition, she felt no need to adopt it, but given her role in early AVEN, I imagine that she saw no important conflict between her definition and AVEN’s.
The reasons AVEN has risen to prominence are listed in the above linked “History Lesson.” The domain name,, was easier to remember than other asexual sites, the graphics were better, the software was better, David was a better webmaster, and the forums enabled there to be multiple conversations going on at the same time. He also mentions AVEN’s inclusive approach, though I’m not really convinced how important this is. The less inclusive sites seemed to me to be somewhat at the fringe of asexuality. (For example, the Official Asexual Society/The Official Nonlibidoist Society’s design made it largely a one-woman show and didn’t give people much of a chance to communicate with one another the way AVEN or LJ did, meaning that it could not be the basis of enabling large numbers of asexuals to connect with each other.) If you read the early LJ posts, you’ll find that in several key aspects, it actually has a more inclusive approach than AVEN (LJ’s definition includes people who experience very little sexual attraction, people who experience sexual attraction but have such a low sex-they feel no desire to act on it, and a sharp distinction between asexuality and celibacy is not made.) My suspicion is that AVEN’s inclusive approach was a necessary condition for its rise to prominence, but not a particularly strong factor since other sites also had inclusive approaches.
Another important factor is that once AVEN started to be an important site, this created positive feedback--whenever it was mentioned in an article about asexuality, it's the page that people would be referred to for more information. One big advantage of having the site rather than the HHA yahoo group, is that it was findable on google, so that people who typed in asexual came to be able to connect with other asexual people.
My intuition tells me that the main reason for AVEN’s success is its superior design, especially with the forums, which enables it to do a lot more than LJ can. (Which LJ has no problem with because it’s close connection with AVEN predates its founding. Also, in July 2002, the founder of asexuality on LJ directed people over to AVEN, highly recommending it, especially because they were having more discussion than on the LJ community.) Because of AVEN’s forum design, people are able to participate in the discussions and feel like they have a place in the asexual community—this is important for keeping them involved. More than this, as the site grew, there came to be more work to be done than any single person could do. By including additional people in having key roles—key roles in maintaining the site, moderating the forums, doing visibility and education work, talking to people in the media, etc.—this makes those people more involved and have a greater sense of investment in the asexual community. In order for the asexual community to grow, this is necessary. It cannot be just a one-person show (like the Official Asexual Society had been.)
Now that we’ve seen how the present definition came to be the one on AVEN’s mainpage and how AVEN came to be the main asexual site, the question is why the definition hasn’t changed during AVEN’s rise to prominence. I think the first major reason is definitional inertia—once a definition is there on the main page, it’s going to be harder to change than if there was no “standard” definition and people were trying to hammer one out in a discussion somewhere. Not just that, but the way it is portrayed is significant. LJ more or less has a definition, but it isn’t clearly stated in an easily quotable form and you have to read through the page a bit to get to it. But on, “Asexual: A person who does not experience sexual attraction” is in big letters right in the middle of the screen so that it stands out and is one of the very first things people see when coming to the site.
The issue of defining asexuality didn’t come up much in early AVEN discussions. There was one thread, several months after the forums were created where David opened up the question of whether anyone wanted to change the definition of asexuality. (The context, as it turns out, was making T-shirts. If people are going to buy asexual T-shirts, is there a different definition they would rather exhibit via their clothing?) One person suggested saying that asexuals are people who have little or no sex-drive, but this was rejected because of the fact that some asexuals have an “undirected sex-drive.” Other than this, no one else proposed any alternatives. In response to the “little or no” part of the rejected alternative, David mentioned a couple possible modifications: “experiences little or no sexual attraction” or “experiences negligible sexual attraction.” He acknowledged these to be more accurate but was afraid that they would be confusing. No one else commented on this, and no other definitions were proposed.
There was one thread I’ve found in 2002 in which one person tries to attack AVEN’s definition, but the arguments don’t make a lot of sense. The majority opinion on that thread indicates that most people were perfectly aware of problems with the AVEN definition—it has difficulties dealing with the gray areas—but people didn’t seem to want to change the definition because they recognized that any definition is going to run into similar problems. There is no perfect definition of asexuality.
From time to time, there have been some people proposing alternative definitions, but these tend to have even bigger problems than the standard definition, and none of these proposals has managed to gain widespread support. The longer the standard definition is on AVEN’s frontpage, the more inertia it gains. As AVEN became larger and was managed not by a single person, but by a group of admods, this makes changing the definition even harder. Also, people have become used to the definition “a person who does not experience sexual attraction,” and for many it is an important part of their decision to identify as asexual, so this adds to the definitional inertia.
In my next post, I want to take a look at what I see as the effects of the standardization of this definition of asexuality.
Friday, October 3, 2008
Alternate ways of defining asexuality
There are generally three main ways to define asexuality: in terms of sexual attraction, sexual desire, or sexual preference. Then, for each of these, we can frame the definition as being absolute (e.g. no sexual attraction) or gradient (e.g. little or no sexual attraction.) All of these three options make sense, but all have their problems as well.
“Asexual: a person who has (little or) no desire to have sex.”
The biggest problem with this definition is that “sexual desire” difficult to characterize because there are lots and lots of reasons people have sex. Would desire to have sex out curiosity or social pressure disqualify someone from being asexual? Also, I’ve read somewhere that there are some women who report that when they’re not in a romantic relationship, they have no interest in sex, but when they form a new romantic relationship, they become very interested. (I don’t know about men because the author was writing about differences between male and female sexuality, and, like many discussions of gender difference, treated “men” as a fairly homogeneous group sexually, though intra-gender variation for women was acknowledged.) These don’t seem to be the sort of people we call asexual either. Another problem with defining asexuality in terms of sexual desire is that it’s not really clear what sexual desire is, especially since many people who don’t experience sexual attraction do experience some sort of “sex-drive,” but feel that it isn’t directed towards anyone. They may be completely satisfied (or even prefer) to deal with these desires by themselves, and so this desire is some sort of sexualish desire, and yet not desire to have sex. But for people who aren’t asexual, the experience of sex-drive that are often the motivation to masturbate are frequently closely connected with their desire for sex.
“Asexual: A person who prefers not to have sex.”
For this definition, I’m not sure how well a gradient definition works. (“A person who prefers to have little or no sex” is ambiguous because it could mean somebody who isn’t really into sex and wants little at most, but it could also mean someone who would prefer to have some sex, just not that much. The former seems to fit with what we want to mean by “asexual” but the latter doesn’t.) One problem with this definition is that there a quite a lot of reasons to prefer not to have sex. Some people choose to be celibate because, even though they do have sexual desires, after a long string of bad relationships, they feel that sex isn’t really worth it. Others choose to be celibate because it grants a level of autonomy not possible to those in a long-term sexual/romantic relationship (and they’re not interested in short-term sexual relationships.) People in both of these groups may feel sexual desire and may enjoy sex, but they prefer not to because they don’t think that it’s worth the cost. But this doesn’t seem to be who we want to call asexual.
“Asexual: A person who experiences (little or) no sexual attraction.”
This also has its problems: many people who identify as asexual do experience some kinds of attraction, and if they’ve never felt sexual attraction, they don’t know what sexual attraction feels like, so it’s hard to know whether they don’t experience sexual attraction or not. In fact, one of the ways that some asexuals express their lack of sexual attraction is by noting that even when they are attracted to someone, they a.) still have no desire to have sex with that person or b.) would still rather not have sex with that person. In these cases, lack of sexual attraction is frequently expressed in terms of sexual desire or sexual preference.
Even though the sexual attraction definition is the most commonly cited one in asexual discourse, it’s not the only one that’s used by people in the asexual community. In my last post, I wrote about a woman who identifies as asexual who said she does experience sexual attraction, but feels no desire to have sex with anyone. According to the sexual desire and (probably) sexual preference definitions, she would be asexual, but based on the sexual attraction one, she is not. This highlights one of the key problems in deciding among the various definitions: each deals with the grey area between sexual and asexual differently—each excludes some people who would be included by another definition.
Some people who don’t experience sexual attraction feel more or less indifferent about sex. They don’t necessarily prefer not to have sex, but they don’t really prefer to have sex either. Also, some people who don’t experience sexual attraction find that they can enjoy some partnered sexual behaviors—sometimes they find that they enjoy giving their partner pleasure even though they aren’t experiencing sexual desire themselves, and maybe even prefer not to be sexually stimulated. For such people, they may be asexual in terms of sexual attraction and sexual desire, but it’s really unclear how to characterize their sexual preference. Still, identifying as asexual makes a lot of sense because their sexual experience and feelings completely fail to conform to societal expectations or models of sexuality they find around them.
One advantage of making the definition about sexual attraction rather than sexual preference is that people are given more freedom to explore themselves and try different behaviors while still being allowed to identify as asexual. I think that this makes asexual identity more helpful for real people's lives (especially those in the gray areas.) In making asexuality about attraction rather than preference, it enables asexuality to be more descriptive in how we think about ourselves rather than prescriptive, to borrow an idea from the avenite Shockwave that he borrowed from linguistics' identity politics as it tries to justify its status as science and seeks to separate itself from the things we learned about grammar in school.
The right to identify as asexual is important for many people. They sense that their own feelings completely fail to conform to images of sexuality presented in TV and movies, talked about by their friends and peers, even what is acknowledged to exist in sex education. In identifying as asexual, there is a sense that people are not alone, that they are not broken. Their experiences are valid, and they are no longer an inexplicable anomaly among the human population whose very existence is unacknowledged. For many people, a sense of belonging, a feeling of fitting in is important. A sense of being normal. Identifying as asexual grants this to many people.
Still, as much as we want asexual identity to be a tool for thinking about our lives, an identity to insist that we are not broken, a means for communicating our selves to others, I doubt that it could be used entirely descriptively. My suspicion is that there will always be a temptation to use it prescriptively, in order to help us feel a part of a group rather than an isolated anomaly with no one like ourselves telling us that it is okay for me to be me. In Shockwave's post, he wants to use an asexual identity descriptively precisely because he had been succumbing to the temptation to use it prescriptively and wanted a way to think about not using it that way. I doubt that there is a way to avoid this temptation and the only way to deal with it is simply to be aware of it and always be willing to reflect on our lives and reevaluate our ideas—something of value regardless of how you identify. Still, if asexuality were defined in terms of sexual preference—what kind of behavior we prefer (not) to do—I suspect that the temptation to use it prescriptively to retain that sense of validation would be stronger than it is now. I don’t think it would allow people as much freedom to experiment with sexuality (for those interested) while still retaining an asexual identity.
Still, whichever way we define asexuality—in terms of preference, desire or attraction—the definition will always exclude some who don’t fit the definition we’ve chosen but does fit one or two of the others. It is possible to define asexuals as people who fit any one (or more) of these three, and something in me likes this and something else recoils at it. The scientist in me doesn’t like disjunctive definitions, but, on the other hand, if we think of asexuality primarily as an identity, the science becomes irrelevant. On the other, other hand, the study of asexuality will be an important part of our future visibility and acceptance, and any researcher using self-identification as asexual as an operational definition must be aware of this problem—especially if they want to do a quantitative study. (If they’re studying asexual identity, this isn’t really a problem.) Another part of me has an entirely different reason for recoiling at the definition “an asexual is someone who experiences little or no sexual attraction, little or no sexual desire, and/or prefers not to have sex.” It’s just long, complicated, and annoying.
Still, if we look at what actual asexual people say, we can find people defining their asexuality in terms of any of these three things. The standard AVEN definition uses sexual attraction, but other people conceptualize it different. For example, even on the AVEN static content, we can find some variation. In the top ten responses to asexuality the author says her asexuality can be summed up in one sentence. “I don’t want to have sex. Plain and Simple.” She then expands on this: “It is not a case of avoiding sex out of fear, or as a result of a perceived moral obligation, or out of disinterest in starting a family. I just seem to have been spared the development of sexual inclination--maybe I have a biologically nonexistent libido, or maybe I have a psychological disinterest in physical intimacy, or maybe some of both . . . but the end result is simply that I have no interest in sex, and I like it that way.” She does not define her asexuality in terms of sexual attraction. She defines it in terms of sexual preference, and then explains this in terms of sexual desire. This isn’t at all uncommon. Lots of asexuals explain their asexuality in terms these. (Try googling either one of the following phrases, in quotes, along with the word asexual. “I’m not interested in sex.” “I have no desire to have sex.” You get a decent number of hits.)
Each asexual person is different and has a somewhat different idea of what being asexual means to them. There is no need to stick stringently to the standard AVEN definition or to any other. That really isn’t what the definition is designed for. It’s supposed to me more of a guidepost for people, something to help people think about their lives and something to be useful in presenting asexuality to audiences unfamiliar with it. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '2077', 'language_id_whole_page_fasttext': "{'en': 0.9680938720703124}", 'metadata': "{'Content-Length': '157818', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:35BN27OEER2JH66RNULQ5ZI7DFZ3ZYDC', 'WARC-Concurrent-To': '<urn:uuid:67bf3d66-3b08-4c0f-abab-fdf153ad3192>', 'WARC-Date': datetime.datetime(2018, 7, 21, 7, 51, 36), 'WARC-IP-Address': '172.217.8.1', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:QBUS6463ZEEQGILZF4SKM73KPK5MV3GD', 'WARC-Record-ID': '<urn:uuid:f2a779d8-befa-424b-9560-bd9020a3edc5>', 'WARC-Target-URI': 'http://asexystuff.blogspot.com/2008/10/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a66d2465-5b80-4c93-b775-cc9d4723a725>', 'WARC-Truncated': None}", 'previous_word_count': '9613', 'url': 'http://asexystuff.blogspot.com/2008/10/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-30-43-194.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2018-30\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for July 2018\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.042659759521484375', 'original_id': '36a078f1b47ed29a2cd3956a36e529403a6747543bbc32339b8fd44fb7bbee5b'} |
Please create an account to participate in the Slashdot moderation system
Forgot your password?
Comment This would be great (Score 1) 720
Having more automation not just for fast food but all restaurants for taking orders and for things like requesting another drink would be awesome. I don't eat fast food that much but when I do they screw up my order a lot, this would hopefully cut down on errors at least at the order submission level. More efficiency is great and not just to cut down on the amount of staff needed.
Comment Re:TV will get smart, next tech war in living room (Score 1) 314
It's just a computer with a tv card attached to an HDTV.
No, it's a super-sized iPad. You won't watch channels any more, you'll watch apps. Some apps will be for regular TV channels (eg. NBC, ESPN), some will be for specific shows, some will be for shows you can't get on regular TV (vintage, foreign, etc.), some will be for internet video services like YouTube, some will access your PC's media libraries, and some will have nothing to do with video content (games, email, web, etc.). It will all be controlled by voice (eg. Siri) with iPad, iPod, or iPhone remotes. There will, of course, be an Android version, but it will be all over the place in terms of quality and app completeness, as different set manufacturers try to differentiate from each other.
This is exactly what is happening on the xBox 360 today, they even call them 'apps' after the most recent update. There is an app for NetFlix, ESPN3, Hulu Plus, UFC, and a variety of other news type video sources and movie sources (there is an HBO app coming soon too). This is exactly what I want as long as it stays reasonably priced because instead of paying the crazy costs of cable/satellite TV and only watching a small set of the channels that are paid for this new system is more a la carte. The only problem I see in the future is a bandwidth problem because if the majority of people switched to getting their TV entertainment over the internet it is going to be a huge strain without major upgrades. The bandwidth issue is the only thing I can see holding back this revolution in entertainment that has been growing over the last few years.
Personally I love that more and more content is becoming available online (legally). I dumped my cable TV about 3 years ago and have not looked back in remorse yet, I get nearly everything I want on my xBox 360 and most of it is even commercial free. They have even been increasing the sports content which is what I missed the most after dropping cable TV and this year I got to watch every BCS bowl game live at no extra cost using the ESPN3 app, it is great.
Comment Re:Can't wait for the voice controlled TV's (Score 0) 314
The Kinect still requiers a good amount of lighting to see me waving on the couch, and with my 2 year old running around making noise, it's difficult for the TV to pickup my voice. The Kinect was designed for the perfect livingroom with couples who have no little kids to deal with.
I agree it does require a good amount of light if you are using the Kinect in a fashion needing a camera but that makes no difference for controlling "TV" entertainment such as on Netflix and Hulu Plus and the other apps. I have a far from perfect living room and for such usage it works GREAT, all I have to do is say "xbox, next episode" or whatever command and you can even do searching now by voice so your comment is incorrect if you are running the latest updates. You also can't blame the Kinect for having a problem if your kid is running around yelling and making noises, sounds like a parenting issue to me.
Comment Re:It's a big deal (Score 1) 518
Haha the old "Fox News is EVIL" rant. Please go on right now and bring up a story that encourages active hatred of fellow Americans, I dare you. If they are "highly destructive" then this should be an easy task. Do not mistake political disagreements as hatred though. It is funny how people like you think one of the ONLY right leaning news sources is "biased" while nearly all other news sources are left leaning. Yes, that makes you a hypocrite, learn to respect free speech even if it hurts your poor little feelings or disagrees with you.
Comment Re:Summary can't add (Score 1) 234
So the drive for privatisation and contract out all government task, as driven and controlled by lobbyists is working well for the US. One wonders how much it would have cost if done internally by full time employees with lobbyist interaction.
So is this government waste or typical corrupt private corporation manipulation of government spending ie the privatisation campaign dollar at work. So who drove the project, who employed that individual, were they a 'political' appointee.
This is most certainly government waste, I can't blame the private companies for taking a chance to get way overpaid. I would say this is either one of two things, the first being the person in charge of awarding the contract(s) to a company they got along with the best and also had a cost closest to what was budgeted. I have heard so many first hand stories of those in the government making sure to spend all money in a budget for fear of the budget being cut, there is no benefit to cutting costs apparently. My second guess is the contract was awarded to companies run/own/invested in by buddies of whoever was in charge of the contract without worrying if they were qualified, similar to how the White House got Solyndra their loan even with warnings that the company was doomed.
If on the off chance the person in charge of awarding the contract was not doing either of those things then this is a prime example of management making decisions on things they have NO CLUE about. I can guarantee if I were to mention to some of my developer friends that I could get a contact for such basic work for such extreme fees that they would bust out laughing at how much the contract awarder was overpaying. Seriously, this is the results you can get with non-technical management making technical management decisions, they have no idea what it takes to complete such a project and figure since magic wizards developers are involved they are getting a good deal even though they are getting hugely ripped off.
Even though the project is pretty pointless I think a better alternative would have been to offer the gig kind of like an internship to a college student or team of students. The project is so simple that I don't see why even only one student would have a problem completing an app for each platform and offer either a small stipend or even let the developer keep one of each of the 3 platforms phones for free to do with as they wish. I am usually not an advocate for working semi-free but when I was nearing graduating college I would have jumped at the chance to get some great real world experience for a widely known organization like OSHA and get to expand my mobile device development skills as well as pick up some cool electronics in the deal. I mean seriously this would only take working a few nights for a few weeks and some weekends as well, there is an API to get GPS information so that is dead easy to grab, it is trivial to use a GPS coordinate to query for temperature in that region, and then you would just have to add in a small collection of information/warning messages. Sounds like a perfect project for a younger developer looking for experience.
Comment Re:I swear I've seen this before—Cranberry D (Score 1) 261
The discs you mentioned are from the same source, Cranberry was just a company (that does not seem to exist any longer) that handled the marketing of the MDiscs. The technology has been around a while, I used one of the drives and played around with the media a few years ago at my former employers office and at that time I think the discs went by the names Cranberry DiamondDisc as well as the manufacturers name M-ARC disc.
Slashdot Top Deals
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '45', 'language_id_whole_page_fasttext': "{'en': 0.972631573677063}", 'metadata': "{'Content-Length': '108995', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:L4FCE5WTDSF2FBWTR67YIFG6THIOU5CQ', 'WARC-Concurrent-To': '<urn:uuid:aa1fabee-aad1-4a56-9760-b9259ecba9f7>', 'WARC-Date': datetime.datetime(2017, 2, 25, 7, 12, 6), 'WARC-IP-Address': '216.34.181.48', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:Z4JWP32UMSURY7OT2M3JQR3F6H3B2V2B', 'WARC-Record-ID': '<urn:uuid:436f5fdc-a12e-452e-9f1b-87dcdd10d372>', 'WARC-Target-URI': 'https://beta.slashdot.org/~Danga', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:c0764a6a-09bb-4f00-94d7-525fbb62e9d6>', 'WARC-Truncated': None}", 'previous_word_count': '1476', 'url': 'https://beta.slashdot.org/~Danga', 'warcinfo': 'robots: classic\r\nhostname: ip-10-171-10-108.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-09\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for February 2017\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06356096267700195', 'original_id': '4d639d0acf2252cb0dd2d59cd8b656cc8ccf06f48573087db7ae3a5db3ac9d6e'} |
You are here
Redundant ethernet configuration with bonding and VLANs
Network hardaware failures often cause unnecessary downtimes of important services. This article describes a configuration that provides servers with redundancy, so that if a single switch, network cable or network adapter fails, the server remains reachable.
Theme by Danetsoft and Danang Probo Sayekti inspired by Maksimer | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.8308752179145813}", 'metadata': "{'Content-Length': '10767', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:5QDNPXH6OSO6O7VQSDW55BTQKQMP7JTT', 'WARC-Concurrent-To': '<urn:uuid:36bbd022-21f9-4022-bed5-dbfa3361d908>', 'WARC-Date': datetime.datetime(2019, 4, 22, 8, 33, 42), 'WARC-IP-Address': '78.46.72.57', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:ICBXG7NBLS7WO3MDYVHNMF7JNO2SI7FX', 'WARC-Record-ID': '<urn:uuid:514570d9-1ccc-4f88-a56c-d495df298e34>', 'WARC-Target-URI': 'https://blog.iwakd.de/taxonomy/term/15', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:1bc02de6-5860-4e8b-a4e7-7fca10106815>', 'WARC-Truncated': None}", 'previous_word_count': '57', 'url': 'https://blog.iwakd.de/taxonomy/term/15', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-169-175-90.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.7321333289146423', 'original_id': '2f7b4efd4079efc00a3972b8c84a6ac9c241e0cd11809dc2861c48d3748e15c2'} |
Prometheus Unbound (Ataque al Prometeo en España) es el duodécimo episodio de la octava temporada de la serie de televisión de ciencia ficción Stargate SG-1. Corresponde al episodio N.º 166 de la serie.
Trama
En el SGC, Daniel Jackson está tratando de convencer al general O'Neill de que le deje ir en la misión a Atlantis, cuando se encuentran con el general Hammond, sentado en la oficina de O'Neill. Él les informa que el comandante de la misión requiere al Dr. Jackson debido a sus conocimientos de los Antiguos, pero Jack le pide a Hammond que le diga al comandante que se necesita a Daniel en el SG-1. Ante esto, Hammond le responde que O’Neill mismo acaba de decírselo, revelando así, que es el propio General Hammond el comandante de la misión a realizar. Hammond deniega a O'Neill su petición, comunica a Jackson que parten al día siguiente, y se va, aunque antes informa que también se llevará al sargento Walter.
Al día siguiente, el Prometheus parte rumbo hacia la galaxia Pegaso. A bordo, se realiza una reunión en la que Jackson habla sobre lo último que se supo de la Expedición Atlantis, por qué no se han comunicado, y la ubicación exacta en la galaxia Pegaso del planeta adonde llegaron.
Daniel conoce y conversa con la Dra. Lindsey Novak, quien al parecer rechazó la oportunidad de ir en la primera misión a Atlantis, cuando suena repentinamente una alarma de la nave. Daniel va al puente, donde informan que recibieron una llamada de socorro a 50 años luz de distancia.
El Prometeo desvía su curso para ir a revisar, y al llegar se encuentra con un Al’kesh y una nave de carga inmóviles en medio del espacio. El SG-3, al mando del coronel Reynolds, es enviado al Al’kesh a investigar, encontrando a bordo a varios jaffa muertos. En ese momento, alguien activa los anillos y entra al Prometeo; es un guerrero Kull. El Sargento Harriman pronto informa que varios controles no responden y que todas las comunicaciones dentro de la nave fueron cortadas. Hammond ordena a Jackson activar el cierre de emergencia desde la sala de motores, pero en el camino se topa con el guerrero Kull, que dispara con un Zat a todos los tripulantes que ve y los transporta al Al’kesh usando los anillos goa'uld, los cuales el SG-3 descubre que fueron intervenidos para evitar que regresen al Prometeo. Tras evitar ser visto por el supersoldado, Daniel va a la sala de armas a buscar un disruptor Kull. Entre tanto, el guerrero Kull alcanza el puente de mando, y obliga a Hammond, y al resto de la tripulación a abordar el Al'kesh. Desde allí, el general Hammond y Reynolds ven como el Prometeo es puesto en marcha y se aleja, pero, pronto, el sargento Harriman reporta que falta el Dr. Jackson.
En la nave terrestre, Daniel va al puente donde esta el guerrero Kull, y le dispara con el disruptor, pero el arma parece no tener efecto en el supersoldado, que rápidamente lo aturde con un Zat.
Mientras tanto, la tripulación del Prometheus intenta hacer funcionar de nuevo el Al’kesh. Novak informa que los cristales de control están dañados, por lo que su única opción es reemplazarlos, pero no queda ninguno más en la nave, aunque es posible que su haya en la nave de carga. Sin embargo, el soporte vital allí es mínimo, por lo que será una misión arriesgada, la cual el mismo General Hammond decide realizar. Apenas respirando él se mueve por el Tel’tak y saca los cristales, alcanzándolos a enviar al Al’kesh, antes de caer inconsciente. Tras recoger los cristales, Reynolds va a rescatar a Hammond, que pronto vuelve en si y ordena poner en línea la nave.
Daniel despierta atado en el puente, donde intenta tener una pequeña conversación con el guerrero Kull, quien para su sorpresa le habla. Tras unos momentos, éste se saca su casco, revelando ser una mujer, llamada Vala Mal Doran. Ella intenta sacarle a Daniel el código de mando del Prometheus, pero él se resiste, y finalmente logra liberarse y retomar el control de la situación. Sin embargo, Vala reescribió los de acceso de las computadoras y pronto un Al'kesh aparece en los radares, resultando ser el de la tripulación del Prometeo. Vala aprovecha para tirar el arma de Daniel y ambos se enfrascan en una lucha que finalmente gana Daniel, aunque no antes de que el Prometheus entre al hiperespacio.
Jackson encierra a Vala en un cuarto de la nave, y regresa al puente, aunque no puede acceder a los controles de navegación. Intenta que Vala le diga como, pero no tiene éxito. Durante la conversación que tienen, ella le cuenta que hasta hace un tiempo ella fue el goa’uld que regía su mundo natal. Tras una rebelión incitada por los Tok’ra, fue capturada y golpeada por los aldeanos hasta que la Tok'ra la rescató y le extrajo el simbionte. Poco después el Señor de la guerra Camulus invadió el planeta, y ordenó exterminar a la población que se negaba a rendirse. Su gente escapo a una luna sin portal, a bordo de varias naves que controlaban, pero cuando muchas fueron derribadas, quedaron atrapados. Tras la derrota de Camulus ante Ba’al, éste comenzó a revisar todos los dominios del otro goa'uld, por lo que pronto su gente será descubierta. Ella dice que por eso robó primero el Al'kesh, y después el Prometheus. No obstante, pese a esta explicación, Daniel decide mantener a Vala encerrada, y poco después el Prometeo llega al escondite de la gente de Vala.
Daniel aterriza la nave y rápidamente se prepara a bajar, no alcanzando a oír que Vala le confiesa que no son refugiados con quienes se reuniría. En el exterior, Daniel vestido con la armadura del guerrero Kull se encuentra con unos alienígenas, y pronto descubre que son traficantes a los que Vala cambiaria la nave a cambio de Naquadah refinado para armas avanzadas. Sin embargo, en ese momento varios deslizadores de la muerte goa’uld aparecen, y Daniel aturde con un Zat traficantes, para luego volver al Prometeo.
Ya a bordo, Jackson se ve obligado a liberar a Vala para que pueda hacer volar la nave. Sin embargo, no pueden entrar al hiperespacio debido a que el casco está muy dañado, por lo que se ven forzados luchar usando armas rail y misiles contra los planeadores y Al'kesh que los atacan. Justo cuando los escudos del Prometheus empiezan a fallar y el armamento se agota, otro Al’kesh aparece, pero abre fuego contra las naves goa’uld. El bombardero resulta ser el de la tripulación del Prometeo, la cual finalmente obliga al resto de los deslizadores a huir. Tras esto, Daniel logra convencer a Vala de que desbloqueé los anillos y la tripulación aborda la nave. Al ser consultado por Vala sobre que harán con ella, Daniel admite no estar seguro, pero cuando Vala intenta decir algo reconciliador, él la deja inconsciente con un Zat.
Poco después, la Dra. Novak informa que el Prometeo registra graves dañado en el casco como para seguir con el viaje a Atlantis, por lo que Hammond decide regresar a la Tierra. En ese instante, una alarma suena; Vala escapó y a bordo al Al'kesh, transportando a los miembros del SG-3 inconscientes de vuelta al Prometeo. El general Hammond ordena al sargento Harriman disparar a los motores del Al'kesh, pero éste entra al hiperespacio antes. Al final, Jackson sentencia que ella es buena.
Notas
Este episodio marca la primera aparición de Vala Mal Doran (Claudia Black) en la serie.
Este episodio es el único de todos los de la serie en el que no aparece Teal'c (Christopher Judge), aunque sí aparece en los créditos del Opening.
Artistas Invitados
Claudia Black como Vala Mal Doran
Don S. Davis como George Hammond
Ellie Harvie como Lindsey Novak
Gary Jones como Walter Harriman.
Eric Breker como el Coronel Reynolds
Morris Chapdelaine como Tenat
Christopher Pearce como Bosworth.
Geoff Redknap como el Alienígena.
Dan Payne como el supersoldado.
Referencias
Enlaces externos
Sumario En SciFi (en inglés)
Guía del Episodio (en inglés)
Ficha del Episodio en IMDb
Episodios de Stargate SG-1
Episodios de televisión de 2005 | common_corpus | {'identifier': 'https://es.wikipedia.org/wiki/Prometheus%20Unbound%20%28Stargate%20SG-1%29', 'collection': 'Wikipedia', 'open_type': 'Open Web', 'license': 'CC-By-SA', 'date': '2023.0', 'title': 'Prometheus Unbound (Stargate SG-1)', 'creator': 'https://es.wikipedia.org/w/index.php?title=Prometheus Unbound (Stargate SG-1)&action=history', 'language': 'Spanish', 'language_type': 'Spoken', 'word_count': '1363', 'token_count': '2241', '__index_level_0__': '4870', 'original_id': 'e7f3ee572ac8a5aa2c0b181d305e4f5a2d7fcef7ac5ecbf5f350e12e41ff7201'} |
Add to Collection
Illustration & Graphic Design.
The majority of tracks are wonderful 2-3 minute bursts of energy, like the glitched out 'Starseeder' or the experimental house templates on 'Una Palmera Flotando En El Espacio'. Tracks like 'Traps' come at you a little harder with distorted bass and pounding kicks, but before they get too carried away, Nino feathers them out, eventually mutated into another form.
The collaboration with label mate Alex Hentze showcases both of their styles well. Hentze's more relaxed, melodic style is evident here. The looping main phrase rolls around in glorious reverb whilst the skittering beats accentuate the tempo. The album winds down to a close with the melancholic 'Friends', a collage of micro-edited guitars and thin rhythms. On teh digital album only, we round off with the trip-hop beats of 'Nothing Without You'. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '116', 'language_id_whole_page_fasttext': "{'en': 0.8857266902923584}", 'metadata': "{'Content-Length': '220836', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:R46HKGM5HCOAOXIZXIWIUAJKN67NYP44', 'WARC-Concurrent-To': '<urn:uuid:a4d85a25-7fc7-4e89-907f-ea4c5ff1a067>', 'WARC-Date': datetime.datetime(2016, 7, 30, 11, 58, 52), 'WARC-IP-Address': '74.205.63.94', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:ZEVY46KXTR3D3LDVYEEWAT4E57OKAHZX', 'WARC-Record-ID': '<urn:uuid:2741220e-a946-49e7-9858-3679c9c710b2>', 'WARC-Target-URI': 'https://www.behance.net/gallery/Santiago-Nino/6210513', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:c1476d91-cce1-45cd-a138-cb7a73a37856>', 'WARC-Truncated': 'length'}", 'previous_word_count': '256', 'url': 'https://www.behance.net/gallery/Santiago-Nino/6210513', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-27-174.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2016-30\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for July 2016\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03110790252685547', 'original_id': 'e18ceabd2f6bc1e9f9bdd7ed110f20354a12a250e34120d44ef75cff22a62d8e'} |
View Single Post
Old 10-17-2007, 10:57 PM #2
kr045 kr045 is offline
Junior Member
Join Date: Oct 2007
Location: USA
Posts: 37
kr045 HB User
Re: I feel like a horrible person
I don't know about in your area, but most areas have a caregiver support network at little to no cost. You can have someone come out for a while and just sit with your mom, read to her, play games, watch tv, whatever she's interested in and you can take a break. I used to go sit at a park for an hour or two, or even just go take a hot bath that lasted an hour or two every so often. It sounds like you need to do something for you. As for that "friend," if your mom is of sound mind, ask her honestly what's going on. She may not give you an honest answer, but if you sit down with her and discuss how upset the friend made you (and sounds like understandably so), she may think twice next time if it so happens that she did say or do something that caused the friend to act like that. Either way, the friend had no right to go off on you. If that friend honestly felt you were putting your mom in danger in some way, you'd think she would have called the appropriate authorities, not have gotten in your face. If all else fails, try to deal with the friend the best you can if that's all your mom really has other than you. Maybe try talking with the friend, keeping your own feelings of rage to yourself until after she leaves, and talk calmly no matter what. Ask the friend what prompted her outburst and explain to your friend that if you didn't care about your mom, you wouldn't be there with her or be talking with the friend to find out what's going on in the first place. Caregiving is hard work, it's a full time job all on it's own, plus some because of the emotions it causes. If you don't take care of yourself, you won't have anything left for anyone else.
Just to suggest what to look for in the way of assistance, here it's called "Center for the aging" and they're WONDERFUL!
Good luck. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9822939038276672}", 'metadata': "{'Content-Length': '27571', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ITLJ2M64EUMSNNY6OKFJUJNR4CHGQVWC', 'WARC-Concurrent-To': '<urn:uuid:e496b6ea-e5ed-4050-992d-97cfc791db0c>', 'WARC-Date': datetime.datetime(2015, 3, 2, 0, 44, 36), 'WARC-IP-Address': '98.158.195.148', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:6UEDZNZLOHFOEEEQIPEXW2N5UPKNWTV4', 'WARC-Record-ID': '<urn:uuid:a3e723f4-e38b-4c47-bf23-3de329032509>', 'WARC-Target-URI': 'http://www.healthboards.com/boards/3263376-post2.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a995192d-66d6-4c3e-9f63-f2e6a98e6044>', 'WARC-Truncated': None}", 'previous_word_count': '382', 'url': 'http://www.healthboards.com/boards/3263376-post2.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.3816337585449219', 'original_id': '8dd3fe27daca7ed98d26ee508df265fcafae6c028fa3f0650bd9bfb4c2191d12'} |
Caisson cap
ABSTRACT
A cap formed of cast steel is permanently attached to the top end of a tubular metal caisson to facilitate the handling of the caisson and its installation with a sonic or vibratory driver/extractor mechanism. The cap has an annular base formed with a relatively large central opening. A plurality of bolt-receiving holes are formed in the base and are spaced in an arrangement for subsequent mounting of a superstructure on the caisson. A pair of diametrically spaced clamping plates is formed integrally with the base for cooperative engagement with the vibratory mechanism. A pair of diametrically spaced lifting lugs are mounted on the base between the clamping plates to facilitate the handling of the cap and caisson. The clamping plates each have a straight chordlike center section and may have a pair of end sections. The cap has a size slightly larger than the size of the caisson top end and is secured thereon by one or more welds.
This is a continuation of application Ser. No. 330,371, filed Dec. 14, 1981, now abandoned.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The invention relates to foundations for supporting superstructures and particularly to caissons which are vibrated into the soil for supporting a superstructure on the top end thereof. More particularly, the invention relates to an improved cap adapted to be permanently mounted on the top of the caisson to facilitate the installation of the caisson and to provide an attachment plate for the base of a superstructure to be supported thereon.
2. Description of the Prior Art
There are numerous types, styles and arrangements of foundations which are placed in the soil for supporting a superstructure on the top thereof, whether the superstructure be a building, pole, tower, bridge, etc. These foundations can be metal, concrete or a combination of both. One type of foundation herein referred to as a caisson is a circular or polygon-shaped elongated hollow tubular member with an open bottom, which is vibrated into the soil usually by a sonic or vibratory driver/extractor mechanism.
A sonic or vibratory driver/extractor drives a caisson by being rigidly connected to the caisson, usually by clamps, and by oscillating the caisson into the soil. The vibration "fluidizes" the soil particles in contact with the caisson thereby reducing friction and affecting rapid drive rates. Vibratory driver/extractors incorporate the unique capability of being instantly converted from caisson driver to caisson extractor by merely pulling up on the vibratory crane secondary hoist line.
To install caissons using a sonic or vibratory driver/extractor, the caisson must be raised into a vertical position and the sonic or vibratory driver/extractor attached to the caisson before driving can begin.
Caissons with open tops can be raised into a vertical position by use of lifting holes in the caisson walls near the top end. After the open top caisson is erect, the sonic or vibratory driver/extractor is attached by means of clamps which firmly grip the caisson wall on opposite sides. Upon completion of driving the sonic or vibratory driver/extractor clamps are released and the driving equipment can proceed to the next operation.
After installation of an open top caisson, the superstructure may be attached by various methods including: (1) field welding; (2) anchor bolts embedded in concrete enclosed by the caisson; (3) the lower part of the superstructure may be telescoped inside or outside the caisson top and held in place by bolts and grout.
There are project locations or conditions where use of the above superstructure attachment methods to an open top caisson are not practical or economically feasible. Field welding is prohibited by many specifications. Transportation and placing of concrete and/or grout may be impractical. To minimize superstructure attachment problems, a closed top or capped caisson may be used.
Closed top caissons capped with an integral plate incorporating means of attaching a superstructure may be raised into a vertical position and driven by use of a portable driving head which is bolted to the integral caisson cap before raising and removed after the driving is completed. The portable driving head incorporates lifting holes to aid in raising the caisson and plates for attachment of the sonic or vibratory driver/extractor clamps. Attachment of the portable driving head to the integral caisson cap must be carefully done since the effectiveness of the sonic or vibratory driver/extractor is dependent on a rigid connection. It is difficult and time-consuming to make a rigid bolted connection since the nuts must be tightened sufficiently to minimize gap between the faying surfaces of the portable driving head and the caisson cap. The fact that plates of the sizes involved may have sizeable permissible variations in flatness adds to the difficulties. Use of the vibratory crane to handle the portable driving head is usually not economical, so an additional piece of equipment may be required to assist in installing and removing portable driving heads.
A portable driving head is not required for installing closed top caissons or caissons capped with an integral plate if a pair of diametrically-spaced rectangularly-shaped plates are welded to the caisson top adjacent to its periphery. These plates provide a place for attachment of the sonic or vibratory driver/extractor clamps. Since the clamping plates transmit the vibratory driving forces into the caisson, their alignment and attachment to the caisson top must be done with care.
After installation of a closed top caisson, the superstructure may be attached by various methods including: (1) field welding; (2) bolting into drilled and tapped holes in the caisson top; (3) bolting through holes in the caisson top that match holes or bolts in the mating surface of the superstructures.
In the past, steel plates has been used as the top or cap for the closed top caissons described above. When considerable forces are involved, structural analysis may require not only an excessively thick top plate, but the opening in the center may become so small that access to the inside of the caisson from the top becomes difficult. Liberal access to the inside of the caisson through the top or cap is desirable for: (1) ease of applying and inspection of any internal weld that may be specified between the bottom surface of the caisson top or cap and the inside wall of the caisson tube; (2) removal of dangerous welding gases and fumes which may be hazardous to the worker's health from the partially closed interior of the caisson during application of any interior weld; (3) ease of insertion of bolts through the caisson top in a predetermined bolt pattern which will be used for attaching a superstructure. The bolts normally would be inserted from the caisson interior with the bolt head bearing against the underside of the caisson top; (4) almost unlimited observation of the interior of the driven caisson before a worker puts his hand inside for any reason. The void left inside the top portion of the caisson after it has been driven has been used in the past as a gathering place for wildlife, including snakes.
Accordingly, the need has existed for an improved caisson cap which eliminates the various problems described above which are present in existing caisson top or caisson cap construction. There is no known caisson cap construction of which I am aware which eliminates these problems by providing a cap formed of cast steel having a relatively large central opening in addition to the unique features and advantages described below.
SUMMARY OF THE INVENTION
Objectives of the invention include providing an improved caisson cap formed of cast steel which has an annular configuration and is provided with a central opening which is relatively large with respect to the width of the cap without sacrificing the required high structural strength needed for the superstructure to be mounted and bolted thereon. Another objective is to provide such a caisson cap in which the sonic or vibratory driver/extractor clamping plates may be formed integrally with the annular base thereby eliminating separate welding operations for attaching such clamping plates to the top of the caisson cap, in which a pair of lifting lugs also can be formed integrally on the cap to provide for easier handling during manufacturing, galvanizing, shipping and during field installation of the caisson, and in which the cap, lifting lugs and clamping plates have contours generally free of sharp corners and pockets which minimizes structurally objectionable stress raisers and provides for a better and more satisfactory galvanized finish than prior cap constructions having sharp corners and edges.
Another objective of the invention is to provide such a caisson cap in which the clamping plates may have curved end sections which extend partially about the perimeter of the cap to distribute more evenly the vibratory loads to the caisson than in prior rectangular clamping plate configurations, in which the curved ends stiffen the clamping plate to resist lateral loads and to reduce breakage. Another objective is to provide such a caisson cap in which better dimensional uniformity is achieved due to the cast forming of the cap, especially in maintaining the distance between the clamping plates and their orientation on the cap base than is possible with prior caps having welded clamping plates.
A still further objective of the invention is to provide such a caisson cap in which the cast forming thereof enables a relatively large central opening to be formed which provides easier access to the interior of the caisson which enables any interior weld between the bottom surface of the cap and the inside wall of the caisson to be performed by workmen situated externally of the cap and in which inspection of the weld is easier, in which the enlarged central opening facilitates initial installation and/or tightening of the anchor bolts should preinstalled bolts become loosened during the driving operation, and in which this enlarged central opening enables workmen to check for snakes and other wildlife which may be located within the void of the upper portion of the caisson before performing work through the central opening due to the greater visibility provided by the enlarged opening.
A further objective of the invention is to provide such an improved caisson cap which enables the size of the caisson to be reduced for certain installations since the unique design and construction of the cap provides high structural strength, thereby reducing caisson weight resulting in easier handling and possible use of smaller installation equipment, which reduces the amount of steel, freight and handling costs, and which reduces the amount of circumferential cap welding without sacrificing the required strength and rigidity as a foundation for a superstructure to be supported thereby. Another objective is to provide such a cap in which reference marks may be accurately formed on the cap during the cast forming thereof to facilitate the alignment of the caisson and cap during fabrication and field installation.
These objectives and advantages are obtained by the improved cap construction of the invention, the general nature of which may be stated as including a cast steel base formed with a central opening, said central opening having an area approximately 50% of the area defined by the periphery of the base; a plurality of spaced bolt-receiving holes formed in the base; clamping plate means mounted on the base for cooperative engagement with a vibratory mechanism for driving the caisson into the soil; and lifting lugs cast on the base for ease of handling during manufacture and field installation.
BRIEF DESCRIPTION OF THE DRAWINGS
A preferred embodiment of the invention, illustrative of the best mode in which applicant has contemplated applying the principles, is set forth in the following description and shown in the accompanying drawings, and is particularly and distinctly pointed out and set forth in the appended claims.
FIG. 1 is a fragmentary diagrammatic view of the improved caisson cap mounted on a caisson partially driven into the soil by a sonic or vibratory driver/extractor mechanism shown in dot-dash lines;
FIG. 2 is a sectional view taken on line 2--2, FIG. 1;
FIG. 3 is a sectional view taken on line 3--3, FIG. 1;
FIG. 4 is an enlarged top plan view of the caisson cap looking in the direction of arrows 4--4, FIG. 1;
FIG. 5 is a fragmentary sectional view taken on line 5--5, FIG. 4;
FIG. 6 is a fragmentary sectional view taken on line 6--6, FIG. 4;
FIG. 7 is a fragmentary sectional view taken on line 7--7, FIG. 4;
FIG. 8 is a fragmentary sectional view of a modified form of the cap showing bosses formed on the bottom surface thereof;
FIG. 9 is a fragmentary sectional view taken on line 9--9, FIG. 4, showing a superstructure being bolted to the top of the improved caisson cap;
FIG. 10 is a reduced top plan view similar to FIG. 4 of a modified caisson cap; and
FIG. 11 is an enlarged fragmentary sectional view taken on line 11--11, FIG. 10.
Similar numerals refer to similar parts throughout the drawings.
DESCRIPTION OF THE PREFERRED EMBODIMENT
The improved caisson cap is indicated generally at 1, and is shown in FIG. 1 mounted on the top of a caisson 2 which is shown being partially driven in soil 3 by a sonic or vibratory driver/extractor represented by dot-dash lines 4. Caisson 2 is shown as an elongated cylindrical-shaped tubular steel member with no bottom having a circular cross-sectional configuration (FIG. 2). Caisson 2 may have other configurations, such as a corrugated or multi-faced polygon cross-sectional contour, without affecting the concept of the invention. Caisson cap 1 can be mounted on the top of these caissons having such different styles and configurations and provide the improved results and advantages without difficulty.
Cap 1 includes an annular-shaped base, indicated generally at 6 (FIG. 4), which has an annular-shaped top surface 7 and a similarly shaped bottom surface 8 (FIG. 3) connected by concentric inner cylindrical wall 9 and outer cylindrical wall 10. A plurality of bolt-receiving holes 12 are formed in base 6 and extended between top and bottom surfaces 7 and 8 for receiving the mounting bolts of a superstructure to be supported by cap 1 and caisson 2, as shown in FIG. 9. Bolt holes 12 are arranged in a spaced pattern on base 6 and may vary in pattern and number depending upon the particular application with which cap 1 is to be used. Tweleve bolt-receiving holes 12 are shown in the particular embodiment shown in the drawings. A pair of diametrically spaced galvanizing drain holes 13 are formed in base 6 in addition to a pair of diametrically opposite water drain holes 14 spaced 90° from drain holes 13. The purpose of holes 13 and 14 is discussed in greater detail below.
In accordance with one of the main features of the invention, base 6 is formed with a central opening 16 which has a size relatively large with respect to the overall size of base 6. As shown in the drawings, the opening 16 is approximately 70% of the size of cap 1. However, this relationship may vary depending upon the particular design of cap 1 for a particular caisson and amount of strength required for the supported structure. Also, the size of opening 16 may vary in relationship to the thickness of base 6. This enlarged central opening provides a considerable number of advantages not present with known caisson caps. A pair of lifting lugs 18 are mounted diametrically opposite of each other on top surface 7 of base 6 and project upwardly therefrom. Lugs 18 preferably have an inverted U-shaped configuration and are formed integrally with base 6 during the cast forming thereof.
In accordance with another feature of the invention, a pair of clamping plates, indicated generally at 19, are provided on top surface 7 of base 6 and are spaced 90° with respect to lifting lugs 18, as shown in FIGS. 4, 5 and 6. Clamping plates 19 are similar to each other, each having a straight central section 20 which terminates in a pair of integrally joined end sections 21 and 22. Central section 20 preferably is a rectangular-shaped flat member (large enough to accommodate the driving clamps of the sonic or vibratory/extractor equipment) and extends in a chordlike fashion across a portion of base 6 (FIG. 4). End sections 21 and 22 each has a contour preferably equal to the contour of the outer peripheral wall 10. For the configuration represented by FIG. 4, the end sections 21 and 22 extend along the periphery of the base 6 so that the total angle included by 19 is approximately 90°. Top edges 24 and 25 of curved end sections 21 and 22 preferably extend downwardly outwardly away from central section 20, as shown in FIG. 6, and top edge 28 of central section 20 preferably is parallel with top surface 7 of base 6.
In accordance with another of the main features of the invention, base 6, clamping plates 19, and lugs 18 are formed as an integral one-piece metal member that is formed of cast steel.
Cap 1 may be mounted on the open top end 5 of caisson 2 by inner and outer welds 26 and 27 (FIGS. 5 and 6) which extend between the inside wall of caisson 2 and bottom surface 8 and between the outside wall of caisson 2 and bottom surface 8 of base 6. In accordance with one of the advantages of the invention, a workman can form interior weld 26 from the exterior of cap 1 due to the relatively large size of cap opening 16. This feature saves considerable time and convenience in forming weld 26, in addition to enabling the workman to form a more satisfactory weld which can be inspected easily after completion. Other types of welds that develop the structural requirements of the connection may be employed.
After cap 1 is welded on the top of caisson 2, a secondary hoisting line from the vibratory crane can easily raise the caisson and cap to a vertical position by means of lifting lugs 18. After the sonic or vibratory driver is connected to clamping plates 19 and installation has begun, lugs 18 enable the caisson and cap to be raised upwardly to adjust for any misalignment of the caisson which can occur if sections of the caisson wall come into contact with hard rock or buried objects or to remove the caisson entirely if required. The sonic or vibratory driver can remain rigidly connected to the caisson with clamping plates 19 during such adjustment since the vibratory crane secondary hoist line can remain attached to lugs 18 to temporarily raise the caisson and cap the required distance, after which the sonic or vibratory driver can continue the installation of the unit.
After caisson 2 has been driven to the desired depth in soil 3, a plurality of bolts 30 are installed in holes 12 for mounting a superstructure 31 on the top of cap 1. Bolt heads 32 are clamped against bottom surface 8 of base 6 by nuts 33 with washers 34 being interposed between top surface 7 of base 6 and nuts 33 (FIG. 9). If desired, bolts 30 can be initially installed in openings 12 by nuts 33 prior to vibrating the caisson into the soil. Should nuts 33 become loosened during the driving operation, they can be retightened easily by a workman reaching through the enlarged central opening 16 to hold the bolt head 32 in place while the nut 33 is retightened. Bolts 30 also can be installed after the caisson has been embedded in the soil, which is considerably easier than in prior caisson cap constructions due to the enlarged size of opening 16. After bolts 30, nuts 33 and washers 34 have been installed, base plate 36 of superstructure 31 then can be secured on top of cap 1 by additional nuts 37 and 38 and washers 39 and 40.
FIG. 8 shows a modification of cap 6 in which bosses 42 are formed integrally with base 6 during the casting thereof, and extend downwardly from bottom surface 8 axially aligned with bolt holes 12. Bosses 42 provide contact areas for bolt heads 32 and increase clearances from the bolt heads to the caisson welds to facilitate installation of the bolts.
A modified form of the improved caisson cap is indicated generally at 45, and is shown in FIGS. 10 and 11. Cap 45 is similar in most respects to cap 1 except that it is formed with eight bolt-receiving holes 46 instead of the twelve bolt-receiving holes 12 of cap 1. Cap 45 also is provided with center line alignment projections 47 formed on outer cylindrical wall 48 and spaced 90° from each other. Projections 47 are located adjacent lifting lugs 18 and the center of clamping plates 19. Galvanizing drain holes 13 and water drain holes 14 are formed in the base 49 of modified cap 45 adjacent lugs 18 and clamping plates 19, as in base 6 of cap 1.
One of the main differences between modified cap 45 and cap 1 is that the bottom of cap base 49 is formed with a plurality of recesses or cutouts 50. Recesses 50 have a somewhat oval configuration and are formed in the vicinity of drain holes 13 and 14. Recesses 50 merely reduce the amount of metal in base 49 without sacrificing the required strength since the base remains sufficiently thick in the areas of the base surrounding bolt-receiving holes 46. Thus by forming recesses 50 in those areas of the base where the extra metal is not required for strength, the weight as well as the cost of the cap can be reduced without sacrificing strength. The remaining features and construction of cap 45 are similar to those described above with respect to cap 1.
Representative examples of caissons with improved caisson caps 1 and 45 are as follows. Caisson 2 has a length of approximately thirty feet and is formed of tube steel meeting the criteria of ASTM standard A36. The caisson has an outside diameter of approximately forty-two inches and is hot dipped galvanized, as are caps 1 and 45. Caps 1 and 45 are formed of cast steel to ASTM specifications A148-80, GR105-85 and have an outside diameter of approximately forty-four inches. Cap 1 has a thickness of approximately three inches, and cap 45 has a thickness of three and one-half inches. In accordance with one of the main advantages of the invention, openings 16 each has a diameter of approximately thirty inches which is approximately 70% of the outer diameter of base 6. This important relationship also can be expressed by the relationship of the area of opening 16 with respect to the area circumscribed by the periphery of base 6 and base 49. For the examples given above the area of opening 16 is 46%, or approximately 50% of the area bounded by the periphery of bases 6 and 49.
Central sections 20 of clamping plates 19 have a thickness of approximately one inch and a length and height of approximately twelve inches, with the thickness of curved end sections 23 and 24 also being approximately one inch. These dimensions and specifications are for a preferred type of construction and are set forth as examples only and can vary without affecting the concept of the invention.
During the galvanizing of caissons with caps 1 or 45, the caissons are suspended above the various processing tanks in a position whereby the longitudinal axis of the caisson is inclined slightly from horizontal with the capped end at the lowest point. The caisson is held in this position by two hoist lines, one to a lifting lug 18 and the other to an attachment device at the other end of the caisson 2. The caissons are inserted in the tanks at an inclined angle with the capped end downward which enables the caissons to descend easily below the level of the processing liquids.
Galvanizing drain holes 13 permit processing liquids to flow into the descending caisson and minimize the tendency of the caisson to float before the liquid level reaches the lowest point of the central opening 16. The descending caisson continues to fill with processing liquids flowing through the central opening 16 until the high point of the central opening is reached. As the caisson descends further, the processing liquids will continue to fill the interior of the caisson since the air that normally would be trapped between the bottom surface 8 of the cap 1 or 45 and the inside wall of the caisson 2 is vented through the galvanize drain hole 13 at the upper level of the liquid. As the caisson is removed from the various galvanize processing tanks, the galvanize drain holes 13 minimize entrapment of the liquids between the bottom surface 8 of caps 1 or 45 and the inside wall of the caisson 2.
Water drain holes 14 prevent water from damming up adjacent to clamping plates 19 on top surface 7 of bases 6 and 49 after the caissons are installed in the field, which can occur if the cap plate is not perfectly horizontal. A pool of water continuously standing behind one of the clamping plates 19 could result in rust and corrosion problems. Therefore, in the event that cap 1 or 45 is installed or assumes an uneven position, drain holes 14 will prevent such an accumulation of water.
Accordingly, improved case steel caisson caps 1 and 45 provide a construction which provides high structural strength, for example 85 ksi yield, with a relatively large central opening without substantially thickening the plate. This is in contast to the prior non-cast steel plates which have a considerably smaller central opening diameter for the same thickness plate. The improved cap is lighter in weight and in size, which reduces shipping costs and facilitates handling thereof, reduces the amount of galvanizing material required for coating the same, and due to the curved configuration of the cap and components thereof results in better galvanizing coating than in prior constructions having sharp points, edges and pockets. Also elimination of sharp points, edges and pockets minimizes structurally objectionable stress raisers. The cast forming of the sonic or vibratory driver/extractor clamping plates integrally with the base ensures uniformity and accurate positioning of the clamping plates on the base at all times, eliminating misalignments that can occur when the clamping plates are individually welded to the top of each cap, as in prior constructions. The curved ends of the lifting plates also distribute the stresses placed thereon more evenly to the caisson and act as stiffeners to resist lateral loads reducing breakage.
The enlarged central opening enables an interior annular cap weld to be performed by a workman exterior of the caisson instead of interiorly, and enables the weld to be easily visible for inspection after completion. Installation of the supported superstructure bolts is facilitated due to the enlarged opening, and the workman will have clearer visibility into the interior of the caisson at all times.
Another advantage is the attachment or integral forming of a pair of lifting lugs on the top surface of the cap, which can be used during manufacturing, shipment, galvanizing and field installation of the caisson. The lugs also can be used to adjust for misalignment that can occur during driving of the caisson into the soil.
Accordingly, the construction as simplified, provides an effective, safe, inexpensive and efficient device which achieves all the enumerated objectives, provides for eliminating difficulties encountered with prior devices and solves problems and obtains new results in the art.
In the foregoing description, certain terms have been used for brevity, clearness and understanding, but no unnecessary limitations are to be implied therefrom beyond the requirements of the prior art, because such terms are used for descriptive purposes and are intended to be broadly construed.
Moreover, the description and illustration of the invention is by way of example, and the scope of the invention is not limited to the exact details shown or described.
Having now described the features, discoveries and principles of the invention, the manner in which the improved caisson cap is constructed and used the characteristics of the construction, and the advantageous, new and useful results obtained, the new and useful structures, devices, elements, arrangements, parts and combinations are set forth in the appended claims.
I claim:
1. A cap construction for mounting on the top of an elongated generally tubular foundation caisson, said construction including:(a) a cast steel base formed with a central opening, said central opening having an area approximately 50% of the area defined by the periphery of the base; (b) a plurality of spaced bolt-receiving holes formed in the base; and (c) clamping plate means mounted on the base for cooperative engagement with a mechanism for driving the caisson into the soil, with said plate means being located radially outwardly of the bolt-receiving holes and extending upwardly from the base.
2. The cap construction defined in claim 1 in which the base has an annular configuration; in which the clamping plate means includes a pair of diametrically spaced clamping plates formed integrally with the base; and in which each of the clamping plates includes a central section which extends in a chordlike fashion with respect to the periphery of the base and a pair of end sections which have contours approximately equal to the contour of the annular base.
3. The cap construction defined in claim 2 in which the central section of each clamping plate is a generally flat rectangular-shaped member; and in which the end sections of each plate have upper curved edges which curve downwardly and away from the central section toward the base.
4. The cap construction defined in claim 2 in which each of the end sections of the clamping plates has a length such that the total angle encompassed by the central section and the adjacent end sections is approximately 90°.
5. The cap construction defined in claim 1 in which a pair of lugs is mounted on the base to provide attachment points for lifting the cap.
6. The cap construction defined in claim 5 in which the lugs are located diametrically opposite of each other on the base and project outwardly therefrom.
7. The cap construction defined in claim 5 in which the lugs are formed integrally with the base of cast steel.
8. The cap construction defined in claim 5 in which a drain hole is formed in the base adjacent each of the lugs.
9. The cap construction defined in claim 1 in which the base has an annular configuration and the central opening is circular in cross section; and in which the diameter of the central opening is approximately 70% of the base diameter.
10. The cap construction defined in claim 1 in which a plurality of alignment projections are formed integrally with the base at spaced locations about the periphery of said base.
11. The cap construction defined in claim 1 in which drain hole means is formed in the base adjacent the clamping plate means for preventing water from collecting adjacent said clamping plate means.
12. A caisson construction including:(a) an elongated generally tubular metal member having open top and bottom ends; (b) a cast steel integral one-piece cap mounted on the top end of the tubular member; said cap including: (i) a base formed with a central opening; (ii) a plurality of spaced bolt-receiving holes formed in the base; (iii) clamping plate means formed integrally with the base and located radially outwardly from the bolt-receiving hole and projecting upwardly from the base for operative engagement with a mechanism for installing the caisson in the soil; and (iv) lug means formed integrally with the base for engagement by a lifting mechanism.
13. The caisson construction defined in claim 12 in which the base has an annular configuration with a diameter larger than the diameter of the top end of the tubular member.
14. The caisson construction defined in claim 13 in which weld means is formed between the base and top end of the tubular member for mounting the base on the top end of the tubular member.
15. The caisson construction defined in claim 12 in which the base clamping plate means is a pair of diametrically spaced clamping plates; in which the lug means is a pair of diametrically spaced lugs spaced 90° from the clamping plates.
16. The caisson construction defined in claim 15 in which the clamping plates are similar to each other, and each has a straight center section and a pair of end sections.
17. The caisson construction defined in claim 12 in which the base has generally flat top and bottom surfaces; and in which the clamping plate means extends upwardly from the top surface and is located closely adjacent the periphery of the base.
18. The caisson construction defined in claim 17 in which a plurality of recesses are formed in the bottom surface of the base.
19. The caisson construction defined in claim 12 in which a plurality of alignment projections are formed integrally with the base and are spaced about the periphery of said base.
20. The caisson construction defined in claim 12 in which the central opening has an area at least 50% of the area defined by the periphery of the base..
| common_corpus | {'identifier': 'US-49700283-A_1', 'collection': 'USPTO', 'open_type': 'Open Government', 'license': 'Public Domain', 'date': '1983.0', 'title': 'None', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '5580', 'token_count': '6739', '__index_level_0__': '3932', 'original_id': '05c9d3e856e49475cb86102486510d665c1c7e9bfc11d0afa980db43627451cb'} |
SANTA CLARA, Calif. -- Marcus Lattimore has announced his intention to retire from the San Francisco 49ers before he was able to play a down in the NFL because of a devastating knee injury suffered in college. Frank Gore is in the final year of hi...
ARLINGTON, Texas -- Dez Bryant went into Sunday's opener with big expectations. He had hoped he would have a contract extension by the time the season started that would have made him a Dallas Cowboy for life - or close to it at least. He hoped he...
SANTA CLARA, Calif. -- Colin Kaepernick's salary cap-friendly contract extension was constructed that way, in part, to help free up money for the San Francisco 49ers to lock up other key cogs on the roster. But with right guard Alex Boone's holdou...
The San Francisco 49ers announced Tuesday afternoon the signing of defensive tackle Glenn Dorsey to a two-year contract extension through 2016, though Dorsey is recovering from a potential season-ending injury to his left biceps.
Bengals quarterback Andy Dalton said Tuesday afternoon that he'd have no problems accepting a contract extension similar to the controversial, clause-filled six-year deal given to San Francisco 49ers quarterback Colin Kaepernick last week.
The initial buzz surrounding Colin Kaepernick's contract extension with the San Francisco 49ers was that the deal was for up to $126 million and that it allowed the Niners enough salary-cap flexibility to keep other impact players in the fold going f...
GREEN BAY, Wis. -- It is not uncommon for NFL contracts to become outdated in a hurry. Someone is always signing a new deal or an extension to become the highest-paid this or the highest-paid that. So when Colin Kaepernick signed his contract e...
UPDATE: As noted below, Vernon Davis has been skipping offseason workouts in an attempt to garner a contract extension, and there have been hints that he could skip minicamp this month. However, Davis told ESPN Niners reporter Bill Williamson Thur...
San Francisco 49ers tight end Vernon Davis, who is angling for his own contract extension, said he believes that the New Orleans Saints' Jimmy Graham deserves more than just a tight end franchise-tag salary.
The Lions, lying in wait for the new year... A high-profile player signed a much-anticipated, long-awaited contract extension Wednesday afternoon and unfortunately for the Detroit Lions, that player was not named Ndamukong Suh. San Francisco 49...
The San Francisco 49ers had two major goals to accomplish this offseason. They are halfway to accomplishing them. The 49ers signed quarterback Colin Kaepernick to a lucrative contract extension through the 2020 season on Wednesday. Kaepernick w... | mini_pile | {'original_id': 'ef9c3e4006955da2b6933ecf94dca7e4907398d2a989491e0f864ce5231045e0'} |
Speak of the devil: Aphasia vs. delirium
Jim Siegler
Two weeks ago, I was called to the emergency room to see a patient who was confused. She was 71 years old, carried a history of hypertension and mild cognitive impairment, but was fully independent at baseline. She was brought in by her family because that evening she was not acting like herself. Her son, who she lives with, found her sitting alone in the study and staring at the wall. When he asked her if she was ok, she responded, “Oh, yeah, the wall needs new paint.” He escorted her to her bedroom, but when he asked if she was going to brush her teeth, she replied, “I’m just taking my time.” After a few more questions, it became obvious to him that she did not understand what he was asking her. So he brought her to the emergency room. Eventually, I was called to evaluate the patient to determine if this was delirium, or if it was aphasia.
But, before even getting into the differences between aphasia and delirium, why is this even important? Who cares?
The reason it’s important to recognize aphasia from delirium is because their causes and management are polar opposites. Aphasia is caused by a focal cortical lesion—like a stroke, tumor, or neurodegenerative syndrome. In contrast, delirium is caused by a systemic disturbance—like sepsis, hypoglycemia, or uremia—which causes global cerebral dysfunction.
So how does a neurologist approach this?
The first tip here is to figure out how to describe the features of a patient’s language. How is the patient’s language produced and understood? Are the words clearly enunciated (favoring aphasia) or slurred (favoring delirium)? Is the patient’s speech grammatically correct (delirium) or lacking in appropriate syntax (aphasia)? Is the patient’s prosody—or pattern of speech—fluent (delirium) or irregular (aphasia)? Can the patient understand spoken language (delirium) or is there a major difficulty with following simple verbal/written commands (aphasia)? Naming and repetition should also be assessed as part of any neurologic examination, but impairment in these modalities is not as useful in distinguishing delirium from aphasia.
What if the patient suddenly has difficulty following commands or the speech is nonsensical?
Is it delirium, or is it a receptive (sensory) aphasia? Recall that delirium is defined by its (1) fluctuating course and (2) inattention whereas aphasia lacks both of these features. In an acutely altered patient, the provider should identify whether the patient can maintain attention or not. This can be evaluated using a number of tasks that may rely on spoken language (assessing serial 7’s, spelling “WORLD” backward) or doesn’t (giving the patient a drawing task). The motor evaluation of inattention in a delirious patient involves testing for asterixis, either with arms and wrists fully extended or having the patient squeeze the fingers of the examiner (the “milk maid’s sign”). A delirious patient will struggle with these tasks, the extended hands may flap or the fingers may intermittently lose their grip. The aphasic patient, in contrast, may not have trouble with this.
Misery loves company.
Neurologic deficits don’t always occur in isolation. A keen examiner can often recognize more than one clue which would help him or her to localize the lesion. Consider language lateralization for this aspect. In nearly every right-handed patient, language localizes to the left cerebral hemisphere. I don’t always count on this for left-handed patients, where a quarter of patients are right hemisphere dominant or even have a more “distributed” language function. In knowing the patient’s handedness, the examiner might attend more closely to functions of neighboring brain regions in order to distinguish a focal neurologic deficit from a global cerebral impairment. That is the third pearl. For instance, in a right-hand dominant patient, one might really try to tease out a pronator drift of the right hand (signifying corticospinal tract injury), or relatively slower tapping of the right fingers or feet (also indicating subtle corticospinal tract dysfunction). In the left-handed patient, one might look for those subtle signs on either hemibody.
Back to our patient…
Regarding the 71-year-old woman I saw back in the emergency department, she was ultimately diagnosed with aphasia. Her words were clearly enunciated although her speech was not perfectly grammatically correct, and she made inappropriate comments to questions and commands—in keeping with the first clinical pearl. She was able to maintain attention well—the second pearl—and on further neurologic assessment, she had mild weakness in her right face and arm. The final pearl. A beautiful localization to the left posterior frontal and parietal lobes for all the neurologists out there.
And when you suspect a focal cortical lesion in the setting of presumed delirium, don’t be afraid to speak up. Your patient may not be able to.
-Jim Siegler
CEO and Producer of the BrainWaves Podcast
I hope you enjoyed this special guest article! If you haven’t checked out Dr. Siegler’s site & podcast please check it out here. Both the site and podcast are packed with clinically useful information for neurologists and non-neurologists alike. Also, if you haven’t subscribed to this blog yet, you can do so by clicking here. You can also follow the site on Facebook and Twitter. Thanks for reading! Until next time, stay safe and treat aggressively!
One Reply to “Speak of the devil: Aphasia vs. delirium”
Leave a Reply
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '6', 'language_id_whole_page_fasttext': "{'en': 0.9427127242088318}", 'metadata': "{'Content-Length': '104882', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:GALJLHISRQWUK34EL2LXAMSFNO5XR6UM', 'WARC-Concurrent-To': '<urn:uuid:aec4f0b1-4c59-455e-8c42-22c60579bcfc>', 'WARC-Date': datetime.datetime(2018, 12, 13, 23, 24, 20), 'WARC-IP-Address': '67.205.14.178', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:CFQGZUNU27VFVNIPOGX2TDHKJ7WWEFDG', 'WARC-Record-ID': '<urn:uuid:11c74931-311f-4e4f-a11c-cc5323e3a8fd>', 'WARC-Target-URI': 'https://www.ditchdocem.com/2017/04/03/aphasia-vs-delerium/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3290334d-2bf8-4d63-a47a-13e0e4a5cf28>', 'WARC-Truncated': None}", 'previous_word_count': '885', 'url': 'https://www.ditchdocem.com/2017/04/03/aphasia-vs-delerium/', 'warcinfo': 'isPartOf: CC-MAIN-2018-51\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for December 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-182-98-18.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04164457321166992', 'original_id': '719711e5f943b18d0fd6de76ca25e8ed9c1e62c4f51a9931e82b2064c3c4a7af'} |
Foundation Ring Earth, Foundation Ring Earthing, Natural Earth Electrodes
Home » Foundation Ring Earth
Foundation Ring Earth (type B earthing) as per IS/IEC 62305
Type B earthing which is Ring or Foundation earthing meets all the requirements of a lightning Protection system for complex buildings & buildings located in rocky area. It helps in conduction of lightning current to earth, Equipotential bonding of all down conductors and controlling potential near the building. Type B earthing shall be either a ring earthing or foundation earthing embedded in the concrete. In Ring earthing, Earthing conductor shall be buried preferably 0.5 meter below and 1 meter away from the external walls of the building. 80 percentage of the conductor shall be below the soil , so that the installation shall be considered as ring earthing , otherwise it can be considered only as a Type A earthing ( Vertical electrode). Generally a Type A earthing is applicable for small buildings like family houses. Ring earthing is possible in existing buildings and helps to control the dangerous ground potential rise when the lightning current is dissipated to ground. A combination of ring earthing and SPD (Surge Protective Device) is the best practice to ensure protection of electrical system and the people protection inside the building
Foundation Ring Earthing & Natural Earth Electrodes
Concrete used for the foundations of buildings has good conductivity and generally a large contact area with the soil. Therefore bare metal electrodes completely embedded in concrete can be used for earthing purpose. The hygroscopic characteristics of concrete generally produce a sufficiently low earth electrode resistance. If the reinforcement of the concrete and any other steel constructions of a structure are connected both externally and internally so that the electrical continuity & against physical damage is achieved.
Interconnected reinforcing steel in concrete foundations or other suitable metal structures should preferably be used as an earth electrode. When the metallic reinforcement in concrete is used as an earth electrode, special care shall be exercised at the interconnections to prevent mechanical splitting of the concrete. In a typical Industrial plant,a number of associated structures are nearby , and a large number of power and signal cables are installed in between the buildings. The earth terminations systems of such structures are very important for the protection of the electrical systems. A low impedance earth system reduces the potential difference between the structures and so reduces the interference injected into the electrical lines. The reinforcing rods of the foundation, foundation slab and outer walls in the region below the soil surface of such structures form an excellent foundation earth electrode. The magnetic field generated by the current in the reinforcing steel mesh is weak due to the low current density and the parallel current paths generating opposing electromagnetic fields. Also, interference with neighboring internal electrical conductors is correspondingly reduced. The reinforcing rods of the foundation and the buried walls used as a foundation earth gives good earthing at minimum cost. In addition this system offers good potential references to the electric power supply, telecommunication and electronic installations of the structure. A connection from the steel reinforcement shall be brought outside concrete by a rust free material and shall be used to connect ring earthing, vertical earthing and the protective conductor from the equipment.
The continuity of the reinforcing rods should be established by clamping or welding (with the permission from civil engineer). Where welding the reinforcing rods is not permitted/possible, clamps or additional conductors should be used & bonded with the steel reinforcement with the clamps tested for the requirements of IEC 62561-1. These additional conductors can be made of steel, mild steel, galvanized steel or copper.
Meshed earth termination system gives a low impedance between buildings and has significant EMC advantages. The size of the meshes near to the building shall be in the order of 20 x 20. Beyond a 30m distance they may be enlarged to the order of 40 x 40m.
Foundation Ring Earth
Mesh/ring earthing- reduction of step potential.
Where large numbers of people frequently assemble in an area adjacent to the structure to be protected, further potential control for such areas should be provided. More ring earth electrodes should be installed at distances of approximately 3 m from the first and subsequent ring conductors. Ring electrodes further from the structure should be installed more deeply below the surface i.e. those at 4 m from the structure at a depth of 1 m, those at 7 m from the structure at a depth of 1,5 m and those at 10 m from the structure at a depth of 2 m. These ring earth electrodes should be connected to the first ring conductor by means of radial conductors.. This arrangement controls the potential and protects people from dangerous step potential.
In General, implementing foundation or ring earthing is easy and economical, if it is planned at initial stages of a project. A proper coordination among LPS designers and installers, architect, builder and electrical system designer is required to achieve best result at minimum cost.
Send Enquiry
Contact Us
L P Consultants International Pvt. Ltd.
No.O-37, Bharathidasan Street,Thiru Nagar,
Jafferkhanpet,Chennai (TN) - 600 083,
Tel: 044- 4380 6348
E-mail: india@lpci.in
Powered by Concern Infotech Pvt Ltd | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '8', 'language_id_whole_page_fasttext': "{'en': 0.8918420672416687}", 'metadata': "{'Content-Length': '20077', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:63EZ2XMLEV5IPIV4SMS4E5XLUJTB3ZAR', 'WARC-Concurrent-To': '<urn:uuid:868c5d7d-1b3b-4b6e-8354-6d9423fa15f3>', 'WARC-Date': datetime.datetime(2017, 9, 22, 4, 36, 49), 'WARC-IP-Address': '115.112.232.11', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:E6FMA4OXVAOYROESHQ6ZC5P774RCCNAY', 'WARC-Record-ID': '<urn:uuid:83ac128c-0aca-45d4-9cef-b45863d6cd5b>', 'WARC-Target-URI': 'http://lpci.in/foundation-ring-earth.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2a21847a-1b63-44f8-9951-a474bf2217fa>', 'WARC-Truncated': None}", 'previous_word_count': '884', 'url': 'http://lpci.in/foundation-ring-earth.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-37-236-142.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-39\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for September 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.021604835987091064', 'original_id': 'a901c8f797d8590486ed45a6664be662b620550c9a4871edd67351ecbc662dbc'} |
Cognitive changes 5 years after coronary artery bypass grafting: is there evidence of late decline?
To determine the long-term (preoperative to 5 years postoperative) and late (1-5 years postoperative) changes in cognitive test performance in patients after coronary artery bypass grafting. The departments of surgery and neurology at The Johns Hopkins University School of Medicine, Baltimore, Md. A group of 102 patients who completed preoperative and follow-up cognitive testing up to 5 years after coronary artery bypass grafting. A battery of neuropsychological tests, assessing 8 cognitive domains (attention, language, verbal and visual memory, visuoconstruction, executive function, and psychomotor and motor speed), was administered preoperatively and at 1 month, 1 year, and 5 years postoperatively. Significant changes in neuropsychological test scores from baseline to 5 years were observed in only 3 of the 8 domains: there were declines in visuoconstruction and psychomotor speed and an improvement in executive function. When the period from baseline to 5 years was divided into 2 intervals, we found that cognitive test scores generally improved from baseline to 1 year. By contrast, between 1 and 5 years, there was significant decline in all cognitive domains except for attention and executive function. Some potential explanatory covariates (demographic, medical history, and surgery variables) were associated with changes from baseline to 5 years in some cognitive domains, but few covariates were statistically significant in more than 1 cognitive domain. The change in cognitive test performance between baseline and 5 years is likely related to several factors, including low baseline performance and practice effects. The significant decline in performance between 1 and 5 years, however, raises the possibility that a late cognitive decline may be occurring in this population. Additional studies, with the use of a nonsurgical control group, are needed to determine if the observed cognitive decline is related to bypass surgery itself, normal aging in a population with cardiovascular risk factors, or some combination of these and other factors. | mini_pile | {'original_id': 'd029d2aba3dffc40d2e4569285668cc79a77ade25d0ddcb79a8a1942259860f8'} |
\section{Dominance Relation is Ordering}
Tags: Set Theory, Orderings, Order Theory
\begin{theorem}
Let $S$ and $T$ be cardinals.
Let $S \preccurlyeq T$ denote that $S$ is dominated by $T$.
Let $\mathbb S$ be any set of cardinals.
Then the relational structure $\struct {\mathbb S, \preccurlyeq}$ is an ordered set.
That is, $\preccurlyeq$ is an ordering (at least partial) on $\mathbb S$.
\end{theorem}
\begin{proof}
From the definition, a cardinal is a set, so standard set theoretic results apply.
So, checking in turn each of the criteria for an ordering:
\end{proof}
| math_pile | {'subset': 'ProofWiki', 'meta': "{'type': 'Theorem_Proof'}", 'original_id': '0b4cc3930d155d82803702518fc0dd22f4b73ca20389cee7b52954a6fca8a181'} |
Christianity in Today's America
3/21/13 at 01:49 PM 13 Comments
Keep Your Religious Views about Abortion out of Politics!
text size A A A
But what if 'religion' and 'fact' are not opposites?
That leads to some very important questions: is it really the case that Christianity consists of articles of faith that do not correspond to the real world? Or, to put it another way, is it a fact, or not, that Jesus rose from the dead? Or: is it a fact, or not, that people are made in the image of God, male and female? Is it a fact, or not, that God made 'marriage' in this way largely with children in mind? Or, is it a fact, or not, that since we are made in the image of God, we have intrinsic value that comes from Him, and not from Man? Moreover, if it is a fact that God became man, and in Jesus redeemed mankind, is it not true, in fact, that God has doubled down on humanity, deepening the intrinsic value of each and every individual.
If, in fact, we should keep our religion out of politics, and these statements above are merely articles of faith and not grounded in reality or fact, then by all means, we should keep our views on abortion out of politics.
On the other hand, this cuts both ways. As it happens, many of the 'facts' entertained by 'secularists' as 'facts' have no better basis than Christians have for their views. That being the case, why should the secularist be allowed to impose their ideas on us, but we don't have the right to try to do the same to them?
At its core, the issue of abortion centers around whether or not one feels it is appropriate to make the judgment that some people are of less value than other people. Debates about 'personhood' or 'when life begins' are important, but secondary. This is evidenced by the fact that we can find people who support abortion on demand who nonetheless concede that life begins at conception, and perfectly willing even to accept that they are 'persons.' (Here is one such example of the former.)
Secularists tend to believe that society, rather than God, has the right to decide the value of a person. I ask you, dear secularist, on what basis of fact do you have for this view? Is it not merely your opinion that people do not have intrinsic value? Is this not, in actuality, your own religious view? How about you keep your religious views about abortion out of politics, too?
As it happens, many secularists do believe that there is a factual basis for giving such power to 'society,' but they are usually very shy about making the connections explicit. They didn't use to be so shy--say, from about 1860 to 1945. Some aren't very shy today, but generally they prefer not to be to clear about that, because it would horrify most of the population.
Bottom line: this whole idea about 'religion' and 'fact' being opposites and religion the stuff of 'opinion' is all a smokescreen and a tactic designed to get Christians to exclude themselves from the public domain, and giving the secularists unfettered free rein.
But the issue of abortion is literally a matter of life and death. We do not dare exclude ourselves from such an important debate. It is not an accident that Christians tend to be pro-life and secularists tend to be pro-choice. Each group has its own reasons for how it views the real nature of people, as a matter of fact. We should know our facts and be as confident acting on them as anyone else would be if they thought they had the facts on their side.
Unfortunately, as already indicated, and as many I think will agree, Christians tend to view their own assessments of just what the facts are as 'religious' and fall into the trap of thinking that 'facts' and 'religion' are incompatible contradiction in terms.
This is a trap we must not allow ourselves to fall into. The consequences if we do could be, and I believe, will be, and in fact, already are, dire.
To counteract this tendency within the Christian church, I am pleased that my ministry's fourth annual online apologetics conference is drawing a clear line between the propositions that Christianity takes to be actual fact and the implications of those facts to life issues.
I have discovered that people are willing to advocate for something in proportion to their confidence in the validity and truthfulness of their position, so insofar as people have solid reasons for believing that Christianity is actually true, they will more likely be 'pro-life.' And they will also be more willing to stand up for the unborn, the handicapped, the disabled, the old, and the infirm.
Given the fact that tens of millions of unborn people have already died, I find it hard to say that this willingness is needed more than ever, but with the implementation of Obamacare and universal 'health' insurance right around the corner (*cough* rationing *cough*), I fear it is accurate.
And this isn't a mere political sentiment; the Gospel itself is at stake, because according to the Gospel, Christ died for all--including those who had not yet been born. We cannot in good conscience allow our society to further institutionalize the notion that people's value must be measured according to what they can offer to the state, or their burden on the same... to be dispensed with, once they no longer have utility.
And that's a viewpoint that I think most would agree really ought to be imposed on our fellow man.
If you were so inclined, you can learn more and register for the conference here:
It is April 21-23. Sunday the 21st is free, paid registration is required the other days. Steven Mosher of the Population Research Center is the keynote presenter. The conference takes place entirely online. Sessions are recorded and those with paid registration will be able to view them at their convenience later on.
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '219', 'language_id_whole_page_fasttext': "{'en': 0.9674046635627748}", 'metadata': "{'Content-Length': '57189', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FPCCCEIYZDI4YO4H5NMKJ5ZJG7CJFBWX', 'WARC-Concurrent-To': '<urn:uuid:285ec8bc-f828-47e6-b730-24ec4dd021f5>', 'WARC-Date': datetime.datetime(2015, 2, 28, 17, 26, 47), 'WARC-IP-Address': '54.174.223.26', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:JQQXDOYEEDR36WJBCK3BESLIYCIAVEPR', 'WARC-Record-ID': '<urn:uuid:31e84056-6db9-4508-86d0-a9edb8e01a2b>', 'WARC-Target-URI': 'http://blogs.christianpost.com/christianity/keep-your-religious-views-about-abortion-out-of-politics-15211/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ba844a92-bde6-44ba-a0b1-4db930e9c336>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1210', 'url': 'http://blogs.christianpost.com/christianity/keep-your-religious-views-about-abortion-out-of-politics-15211/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.024402201175689697', 'original_id': '9f1f0d8828f969b47b8489b5346a80cfa7b186750c3ff305be9523b62aa0f35e'} |
5 Visual Communication Tools that Build Brands
August 11, 2016 Debra Ruehlman
When you hear the term “product demonstration,” you typically think of a TV commercial showing how your product delivers its brand promise. Over the past 38 years, I’ve created hundreds of product demos for television for some of the leading consumer product companies, including Procter & Gamble, Keurig Green Mountain Coffee, and Unilever. But I’ve also developed several other creative ways to use visual communication, particularly video, to inspire R&D and creative work, test ideas, sell products, and communicate complex technology.
Here are 5 of my favorite visual communication techniques that help build brands:
1. Sights and Sounds
This is a video that highlights your product and how it is used. Every consumer touchpoint can be examined: product design, packaging, the in-store shopping experience, how the product is stored at home, and how the product is used. Video provides endless visual flexibility, from tight shots that examine complex technology to wide shots that demonstrate product use within context and location, and everywhere in between. You might think this methodology can only be applied to existing products. However, it is also an extremely powerful way to demonstrate concepts and ideas for products that don’t even exist yet. For example, one client with a very complicated product idea came to us asking for help. R&D was having a difficult time explaining the technology to their management, much less to people outside the organization. We created a Sights & Sounds video that visually communicated the product idea. This video not only sold the management team on moving forward, it was also shown to investors … and one investor bought 10% of the company!
2. Desired Consumer Experience
This video visualizes how your perfect product fits consumer desires. They are particularly helpful when emotional benefits are critical to category performance and brand differentiation. By design, they are inspirational and aspirational, and provide guidance not only for the initial product design and launch, but for on-going product improvements as well. For example, a consumer experience video that was shot in 1995 provided an R&D team with a clear understanding of the tangible and emotional benefits they needed to deliver from products targeted to address the needs of an un-served segment of category users. The initial product they designed, and each subsequent step-by-step upgrade moves them closer and closer to delivering the desired consumer experience demonstrated in the initial video, which continues to guide their work. Today, that product segment alone is a $5 billion business.
Although these videos are initially used as inspiration for product development, they can (and should!) also be used to gain internal management alignment, provide agency direction, for training, and in sales presentations to customers.
3. Concept Videos
Essentially concept statements brought to life, these videos set up a problem, provide a solution, the reason to believe and a benefit. They look a lot like TV commercials, but are not constrained by timing and are shot “quick and rough”, without expensive props, sets, locations or talent. Because of that, once the “problem” is shot, variations on how the solution is presented, talked about, and demonstrated can be made quickly and efficiently, allowing for testing of various production elements until the best combination is identified. Concept videos also help product development design and build products with greater consumer input: should it be pointed or flat? Pink or purple? Straight or curved? Video allows you to evaluate a broader range of features and attributes, as well as get input from a much larger sample of consumers, without the extra time and expense required to create and build prototypes.
4. Demo Exploratories
Established brands constantly need something new to say. New products often need to explain something complex in a short amount of time. You’re stumped and just not sure what to say or how to say it. Recall that one of Michael Mason’s 5 Principles for Creating Powerful Product Demonstrations is “Go Play!” Demo Exploratories are one way to do just that while tackling these tough communication situations.
A cross-functional team is brought together to ideate against a specific communication objective. The initial goal is to come up with as many different ways to visualize the desired message as possible, without the limitation of legal and protocol constraints. Go for quantity and strive for at least one really WOW! idea. Once all the ideas are captured, the team selects the top ones. Storyboards are created for these leading concepts and shot in a “quick and rough” manner: not perfect, but enough to understand the idea. These videos are then shown to consumers to help select the best ideas for further development and identify any changes that may need to be made. Now you are ready to go into full-up demo development. Take that one great idea and concentrate on making it perfect and legal, following established protocols. Why waste your time on developing protocols for a not-so-great idea?
Demo Exploratories are also used to identify the production elements that work best: which background best shows off your product? Which color of lipstick and what skin tone makes white teeth pop? Which surface best reflects your product’s glow? Which type of pie is the most appetizing? These are all things that can be checked out in a quick and cheap way, rather than when you have a high-priced director, crew, and talent standing around waiting to shoot a final commercial.
5. Signature Visuals
I believe that every brand should have a signature visual that they, and they alone, own. It might include sound, as well. These are powerful images that in one quick swoop communicate your brand name and benefit. Examples are a bottle of Downy fabric softener falling into a pile of towels and bouncing up because the towels are so soft; the sound and the puffy dough that emerges when a tube of Pillsbury biscuits is opened; and the drop of Dawn dish washing detergent moving grease out of the way to reveal the brand logo. Ideas for signature visuals often come out of the work done for the Sights & Sounds, Desired Consumer Experience, Concept, and Demo Exploratory methodologies described above. They can then be confirmed through appropriate protocols and consumer research.
Video is a terrific tool for quickly demonstrating your ideas and can be used in a variety of creative ways to accelerate innovation, communication, and adoption. That said, visual communication isn’t limited to just video. There are also highly immersive and experiential methods to demonstrate your product and/or message.
For more information on new methods to increase your brand equity? Click here to watch the A Picture is Worth 1,000 Words webinar and see how we can help you develop powerful product demonstrations to help your brand grow!
About Debra Ruehlman: Debra is a Visual Communication expert with nearly 40 years of experience, including 26 years with Procter & Gamble and 10 years as a Visual Communication Consultant for leading consumer product companies. Her career spans television production and writing, advertising production, and product development. She began her Procter & Gamble career in TV commercial production and then transitioned to upstream product development, where she worked with engineers, designers and product researchers to visualize and communicate complex technical concepts and ideas into easily-understood communications for management and consumer evaluation. A YourEncore expert since 2006, Debra helps clients bring their concepts and products to life through highly creative, innovative, and unexpected visual and experiential methods.
Previous Article
4 Creative Visual Demos That Go Beyond Video
4 Creative Visual Demos That Go Beyond Video
Last week, I shared 5 visual communication tools that I use to inspire R&D and creative work, te...
Next Article
The Playbook for Demo Visualization Success
The Playbook for Demo Visualization Success
Last week I discussed the critical role that claims and demos play in positioning and differenti... | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9378979206085204}", 'metadata': "{'Content-Length': '113746', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:B5OC2733WWKUKODGP6ZAM6VI4MDZAROQ', 'WARC-Concurrent-To': '<urn:uuid:d19d2a57-144d-482b-9202-fd235276293b>', 'WARC-Date': datetime.datetime(2019, 12, 9, 1, 6, 43), 'WARC-IP-Address': '52.60.160.16', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:45TKBNM5LKKF3TBFC4GPIP27VIENCXL5', 'WARC-Record-ID': '<urn:uuid:9eb00955-aeaf-4401-bfc9-be2b4e3d699e>', 'WARC-Target-URI': 'https://thoughtleadership.yourencore.com/innovation/5-visual-communication-tools-that-build-brands-2', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f035e65f-c26b-4d23-95a5-45df4eb920e4>', 'WARC-Truncated': None}", 'previous_word_count': '1295', 'url': 'https://thoughtleadership.yourencore.com/innovation/5-visual-communication-tools-that-build-brands-2', 'warcinfo': 'isPartOf: CC-MAIN-2019-51\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for December 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-73.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.022762000560760498', 'original_id': 'ada37200a4d3b7f9a0566b628e3f05c50eb7df1056b8405778ea9f7336d1b226'} |
A gritty, hard-at-it midfielder, Vandenberg took a while to develop into an important senior player after being picked up with the 78th pick in the 1997 National Draft.
A New South Welshman by birth, Vandenberg came to Melbourne and tried to get on the Carlton list before playing with the University Blues in the VAFA. Thought of as a defensive midfielder who worked hard, Vandenberg struggled to get senior games until the end of 2001 where his form skyrocketed to the point where he was one of our best in the finals series.
A big pre-season in 2002 led Vandenberg to increase his leg speed to the point where he was one of the quickest at the club, and with confidence from the match committee he was a vital cog in the improved Hawthorn midfield. Injuries hampered the start of his 2003 season, but a return to fitness and form coincided with the club's revival, and by season's end Vandenberg was edging closer to his very best.
Vandenberg provided a rare highlight in 2004 for Hawthorn fans, when he beat the living crap out of Adam McPhee during the brawl against Essendon. The Butcher earnt 6 weeks for the indiscretion, but plenty of new fans.
Butche was made captain at the start of 2005, and although he had his critics for his limited ability, his hard work and leadership was valued in a young side. He struggled through injury in 2007, but managed to have a fitting send off, thrashing Andrew McLeod in a finals match before retiring the following week after a loss to the Kangaroos. | mini_pile | {'original_id': 'ea03bd7ddbe52af2ad0ae4c533c3857ed6a3b28df10335a68e5ebca5475a0257'} |
1.6K members online now
1.6K members online now
Guide Me
Keyword planner gives different figures
Visitor ✭ ✭ ✭
# 1
Visitor ✭ ✭ ✭
Keyword planner gives different figures for "average monthly searches" in following two scenarios.
1) When a specific product category is selected.
2) When it is set for all product categories. How is it possible?
People who search in google do not have the option to select or filter product category rather they just type the keyword or what they search for. What is this product category in Keyword planner exactly? Maybe I’m not getting it correctly. Please help
1 Expert replyverified_user
Re: Keyword planner gives different figures
Top Contributor
# 2
Top Contributor
Could you upload screenshots to illustrate? | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '37', 'language_id_whole_page_fasttext': "{'en': 0.7994252443313599}", 'metadata': "{'Content-Length': '179997', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:5YYXHQTYD4FY6RAFFREESVUPS7LCJIKD', 'WARC-Concurrent-To': '<urn:uuid:db751ea8-44ff-4dc9-b911-f7e322107b7d>', 'WARC-Date': datetime.datetime(2018, 8, 18, 23, 39, 45), 'WARC-IP-Address': '23.1.47.172', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:V3KGD4STSAAQLRS7CYIK6OFSRJ3WZCFE', 'WARC-Record-ID': '<urn:uuid:d30df5ae-cecc-47ce-a2eb-bcf38f3445e8>', 'WARC-Target-URI': 'https://www.en.advertisercommunity.com/t5/Performance-Optimization/Keyword-planner-gives-different-figures/td-p/433403?nobounce', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ae942653-387d-4c01-955d-02fab678ebe4>', 'WARC-Truncated': None}", 'previous_word_count': '184', 'url': 'https://www.en.advertisercommunity.com/t5/Performance-Optimization/Keyword-planner-gives-different-figures/td-p/433403?nobounce', 'warcinfo': 'isPartOf: CC-MAIN-2018-34\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for August 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-113-243-226.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04305553436279297', 'original_id': '6bb9d33254fcbe50e5d6a3134496de2305dbf2806f92d745a46c406ca583845b'} |
Don't Miss
Home / Opinion / Kominicki: The July sweeps winner is …
Kominicki: The July sweeps winner is …
John Kominicki
John Kominicki
The July television sweeps are being tallied and the winner is … ding, ding, ding … Univision.
Correctamundo. For the first time in television history, a Spanish-language network has taken the top spot, thrashing second-place FOX by 21 percentage points and winning the key 18-34 and 18-49 demographics, which sounds redundant to me, but hey, I’m a print guy.
You are likely thinking, “Of course Univision won. Spanish speakers are the fastest-growing population segment in America and that’s why the Republicans let Marco Rubio speak at their convention last year.” And you would be right, in part.
But Univision topped the sweeps by attracting viewers of all ethnic classes, meaning plenty of English speakers were tuning in as well.
The full answer includes better and original programming, including hugely popular soap operas like the steamy “Porque El Amor Manda” and “Amores Verdaderos.” Univision also scored with a CONCACAF soccer tournament and concerts by Jennifer Lopez and the Latin rapper Pitbull.
Playing at No. 2 FOX: Reruns of “Bones” and “The Mindy Project.”
And then there’s that youth demographic, which Univision increasingly owns outright. The median age on the Spanish network is 37, compared to 47 at FOX and the mid-50s for ABC and NBC, with CBS at a crusty 58.
How do you say “time for a pill” in Spanish?
One comment
1. Can you say ¿Qué pasó?
Scroll To Top | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.936694860458374}", 'metadata': "{'Content-Length': '81239', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:W3KDEQV7GF3GLLUDMGJVNJ2EVRSLZ4HU', 'WARC-Concurrent-To': '<urn:uuid:98f57178-27e0-4a57-98dc-3b52a42de03b>', 'WARC-Date': datetime.datetime(2015, 3, 6, 12, 37, 27), 'WARC-IP-Address': '64.244.52.200', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:R3LPGLEX6DUAA4QW4ZLEGJYDSSQRPWGH', 'WARC-Record-ID': '<urn:uuid:31d692dc-c15a-4ccc-90dd-c47a38d56101>', 'WARC-Target-URI': 'http://libn.com/2013/07/26/kominicki-the-july-sweeps-winner-is/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:43ca0bae-9b3c-4b2c-9a28-b188446a9f0d>', 'WARC-Truncated': 'length'}", 'previous_word_count': '241', 'url': 'http://libn.com/2013/07/26/kominicki-the-july-sweeps-winner-is/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.01938474178314209', 'original_id': '9620a6837e47f9bd70df000ce8e7e35bfc35dd0d9c73febc57a63c887e19579f'} |
Jamie Maslin is a British author, adventurer and bushcraft survival instructor. He is best known for his travel memoirs: Iranian Rappers & Persian Porn: A Hitchhiker's Adventures in the New Iran (Skyhorse Publishing, 2009), Socialist Dreams & Beauty Queens: A Couchsurfer's Memoir of Venezuela (Skyhorse Publishing, 2011), and The Long Hitch Home, (Skyhorse Publishing, 2015).
Books
Maslin's first book, Iranian Rappers & Persian Porn: A Hitchhiker's Adventures in the New Iran, chronicled his journey hitchhiking from England to Iran and subsequent travels around the Islamic republic. The book was controversial for its portrayal of some of the less than Islamic aspects of Iranian youth culture, which Maslin both witnessed and participated in. These included getting drunk on surgical spirit (96% ethanol), attending illegal parties where there wasn't a compulsory hejab headscarf in sight, and even viewing hardcore porn films with a group of anti establishment students. As a result, Maslin has been banned from re-entering the country.
Maslin's second book, Socialist Dreams and Beauty Queens: A Couchsurfer's Memoir of Venezuela, is part travel memoir, part political thesis. The travelogue details Maslin's experiences using CouchSurfing in Venezuela. Politically, the book explores the policies of Venezuelan president Hugo Chavez and the impact organisations such as the International Monetary Fund and World Bank have had on Venezuela and Latin America in general.
Maslin's third book, The Long Hitch Home, details an eighteen thousand mile hitchhiking trip he made, travelling over land and sea, from Australia to England. The journey took him across three continents and through nineteen countries: Australia, Indonesia, Malaysia, Thailand, Laos, China, Kyrgyzstan, Kazakhstan, Azerbaijan, Georgia, Turkey, Bulgaria, Croatia, Serbia, Slovenia, Austria, Germany, France, and England. It took Maslin over 800 hitchhiking rides to complete his journey.
Bushcraft
Maslin is a former senior instructor for the British Bushcraft School, and inventor of a new method of creating fire by friction, The Maslin Leg Drill, that enables a person to create fire by friction using only one arm—theoretically making it possible to do with a broken arm.
Publications
Iranian Rappers and Persian Porn, published by Skyhorse Publishing in 2009 ()
Socialist Dreams and Beauty Queens, published by Skyhorse Publishing in 2011 ()
The Long Hitch Home, published by Skyhorse Publishing in 2015 ()
Reaction
Maslin's books have received some critical acclaim.
William Blum wrote approvingly of Socialist Dreams & Beauty Queens: A Couchsurfer's Memoir of Venezuela:"Jamie Maslin has put together an exciting mix of progressive politics and adventurous travelogue. Making his way through Venezuela, Maslin visits slums and country clubs, rainforests and Caribbean beaches, while coping with anti-Chavistas and the country's ubiquitous criminals, and learning why Hugo Chávez has so many loyal followers. A welcome antidote to the common mainstream media distortions peddled against Venezuela."
Commenting on Iranian Rappers & Persian Porn: A Hitchhiker's Adventures in the New Iran Cindy Sheehan wrote:"In a time where an understanding of different cultures is more important than ever, I’m so glad we have books like Jamie Maslin’s. Both informative and entertaining, Maslin paints a picture of Iran in stark contrast to the caricature one fed to us by the mainstream media. A riveting, off-the-beaten-track tale of adventure and self-discovery that can't fail to provide new insight on a country unfairly demonized in the West."
In 2009 Simon Van Booy described Maslin's writing as:"Bill Bryson meets Jack Kerouac."
In 2011 Daily Kos also invoked Jack Kerouac, commenting that:"Jamie Maslin is cool – and he has adventures far beyond anything Jack Kerouac could ever dream of."
Internet memes
The Roger Bucklesby Bench Plaque – In the middle of August 2013, Maslin reportedly installed this plaque in a London park to his fictional character Roger Bucklesby – a misanthropic failed author. The bench plaque reads, "In memory of Roger Bucklesby who hated this park, and everyone in it." The image was originally posted on a Twitter account under the description "I was walking through London and came across this bench" and within hours its image went viral, receiving over 2 million views on image sharing website Imgur, thousands of retweets and over half a million likes on Facebook with ten thousand corresponding comments. "We had no plans for this to turn into an internet hit" said Maslin, "we just hoped the occasional passerby would see it and have a giggle. It seems we've done plenty of that."
See also
List of hoax commemorative plaques
References
External links
Jamie Maslin author page on Skyhorse Publishing's Website
Kirkus review of Iranian Rappers & Persian Porn
Kirkus review of Socialist Dreams and Beauty Queens
Publishers Weekly review of Iranian Rapper's & Persian Porn
Jamie Maslin interviewed on CNN
Frost, Roger (2013). In Memory of Roger Bucklesby Who Hated This Park and Everyone In It. Unpublished play manuscript.
Year of birth missing (living people)
Living people
British travel writers | common_corpus | {'identifier': 'https://en.wikipedia.org/wiki/Jamie%20Maslin', 'collection': 'Wikipedia', 'open_type': 'Open Web', 'license': 'CC-By-SA', 'date': '2023.0', 'title': 'Jamie Maslin', 'creator': 'https://en.wikipedia.org/w/index.php?title=Jamie Maslin&action=history', 'language': 'English', 'language_type': 'Spoken', 'word_count': '797', 'token_count': '1219', '__index_level_0__': '23372', 'original_id': '55874b7f93c4e2a28e18d553df537d63637cf1968e4156a5b96d6f7128b06372'} |
Q:
Constructors not setting this pointer to const causes undetected issues
Cutting my classes to the bare-minimum for readability:
#ifndef MESSAGEFOLDER
#define MESSAGEFOLDER
#include <string>
#include <set>
class Message;
class Folder{
public:
void addMsg(Message* m) { messages.insert(m); }
~Folder() { removeFromMessages(); }
private:
std::set<Message*> messages;
void removeFromMessages(); //removes its pointers from Messages
};
class Message{
friend class Folder;
public:
Message(const std::string &s = ""): contents(s) { }
Message(const Message& rhs): contents(rhs.contents), folders(rhs.folders) { addToFolders(); }
Message& save(Folder&);
~Message() { removeFromFolders(); }
private:
std::string contents;
std::set<Folder*> folders;
void addToFolders();
void removeFromFolders(); //removes its pointers from Folders
};
#endif // MESSAGEFOLDER
In MessageFolder.cpp
void Message::addToFolders(){
for(const auto& f : folders)
f->addMsg(this);
}
Message& Message::save(Folder& f){
folders.insert(&f);
f.addMsg(this);
return *this;
}
This code could cause some "problems" (albeit everything runs fine) when defining const versions of messages. The constructors for Message do not assume const of the this pointer. So even though addToFolders is a non-const function the code
Message a("hello");
Folder f;
a.save(f);
const Message b(a);
would compile fine. There is an issue here because b is a const message but the copy-constructor sets b's address (through addToFolders()) to a Folder consisting of a set of Message* - the low-level const is lost. Indeed if I were to then define a function in Folder which changed the underlying messages I could change the contents of the const Message b seemingly with no compile error.
A solution would be to change the Folder's set to set<const message*> but this disallows me to change messages through the folders (which I do actually desire). How would I prevent const objects of message being created or, even better, force that the this pointer in the constructors is const so that addToFolders() would fail?
A:
You can't prevent const instances being constructed.
If you use this in your constructor it is up to you to be suitably careful - you can explicitly const_cast it to a const *, for example.
Generally it works better if the management of the object is not handled within the object's own class. For example, you could restrict things so that the object can only be created via a folder, and the folder can then ensure it is handled correctly. (This is really just an example of separation of concerns.)
| mini_pile | {'original_id': 'dfc86ce8bd76e8098f856341ea574fe831b39f9e9d9d531cc68af351db95ecf5'} |
How Social Media Drove Tupperware to Laugh
This article originally published at
The Harvard Business Review recently examined the internal use of social media by corporations. Can social media be used internally within an organization to drive increases in revenue? Can it improve employee retention? Increase productivity? This study reveals just what is possible.
How social media drove Tupperware to laugh
We think of social media as a magic set of tools we use to reach the masses to help us promote our wares. But what about using social media as a way to build goodwill within your organization? What if you could retain employees longer? How much money would that save you? How much would it mean to you if you could easily socialize new company policies, products, and best practices throughout your organization? Would it help, just a wee bit, if you could increase revenue simply because your employees were happier?
How does social media help you accomplish this?
Managing director Stein Ove Fenne at global giant Tupperware set out with these goals in mind when he rolled out social media technologies across the company. He focused on what he called “building emotional capital” in driving the social initiative. What the hell does that mean? Building emotional capital means that you are attempting to increase positive feelings about the company, about employees jobs, and about coworkers (as nimrodish as some of your coworkers may be).
The premise is simple. If your employees are happy, they produce more. If instead you are a jerkwad towards your employees, you make them unhappy and they do anything to avoid work.
Tupperware set out to increase the happyness-factor by using social media to communicate four things.
Authenticity – Pride – Community – Fun
Be authentic with your use of social media
To be authentic, Fenne made sure that what he communicated across social media channels mimicked his attitude and actions in the real world. Now get this – if your social media messages are all happy and fun, but you are a real nimnod to your employees in person, then employees are going to scoff at your social posts. Fenne went so far as to build relationships in real life with the employees to which he was communicating on social channels. Imagine that – building relationships with our followers. Hmmmm, I’m sure I’ve read that as a best practice somewhere recently….
Use social media to make employees proud of their work at your org
If you want to build pride in your organization, use social media to tout the accomplishments of workers to the rest of the company. If done in a genuinely, a sense of employee pride ensues. Employees proud to work for your company will outproduce the pants off of employees that you instead rule by threats and intimidation. To build pride in the Tupperware organization, Fenne hosts a social-powered radio show to showcase the accomplishments of Tupperware sales teams who have sold tons of their plastic food container thingeys. Listeners to the radio show can post comments to a Facebook wall – everyone gets involved.
You want my employees to talk about non-work stuff at work?
To build community you should encourage your employees to conduct non-business related conversations across the company’s social media system. What?!? Is this guy insane?! Now calm down for a second and let me explain. If your employees feel free to talk about non-work related stuff at the office with their coworkers, they build community with each other by finding commonalities. Workers who have things in common with each other are more productive because frankly, they like each other better. Here is the hidden benefit that Tupperware discovered:
If employees talk about non-work related stuff at work, they are more likely to talk about work-related stuff outside of the office.
Having fun is not allowed at work
What? Having fun at work is not supposed to be forbidden. In that vain, Tupperware routinely produces videos that use humor to convey their business objectives. These videos are shared across the internal social media networks. Using humor and sharing the giggles across social networks causes the videos to be watched at a much higher rate. Fenne uses social media to promote humor in what are actually product training videos. Let me ask you a question – do your employees love watching your product training videos?
Social media is not about just reaching people with a message. It’s about creating connections between people.
If you can further those connections by incorporating emotions, your success of using social media internally in your organization will go up exponentially.
Suggested: Why 1700 CEOs are Wrong about Social Media
About Nate Goodman
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '47', 'language_id_whole_page_fasttext': "{'en': 0.9456994533538818}", 'metadata': "{'Content-Length': '31449', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:PLQZBR4DVRAZMG3Z3IEQ5BO2XKDM6NJO', 'WARC-Concurrent-To': '<urn:uuid:3c1d25f0-a66b-4840-bdbe-0f84fb8c3ac8>', 'WARC-Date': datetime.datetime(2019, 3, 22, 23, 17, 55), 'WARC-IP-Address': '74.208.236.133', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:YSGXYRMX4NH5YSTDFW7CI62VW5KSWP4E', 'WARC-Record-ID': '<urn:uuid:9143b30d-bbe3-442e-924a-357dc1cc799e>', 'WARC-Target-URI': 'http://thoughtreach.com/how-social-media-drove-tupperware-to-laugh/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:dfe17d9a-d73e-4b14-9fe3-8de687aabc27>', 'WARC-Truncated': None}", 'previous_word_count': '809', 'url': 'http://thoughtreach.com/how-social-media-drove-tupperware-to-laugh/', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-140-246-66.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06738412380218506', 'original_id': '788d6cd3b3373cd728a7e9c54a5093ab6037dc5e3555f7afcd96c34cd40a1a25'} |
What is an ACH Payment?
ACH is short for Automated Clearing House. An ACH payment is an electronic debit or credit transfer that allows vacation home rental customers to make payments from their bank accounts. Many vacation rental properties prefer to accept ACH payment rather than debit and credit cards. In turn, many renters choose to pay with check online.
ACH Payment Processing for Vacation Rental Properties
ACH payment processing utilizes advanced technologies to allow vacation rental properties to accept ACH payments online. Payment processors are merchant-appointed companies that handle ACH payment/eCheck processing. The time saved gives vacation rental properties a chance to avoid the hassle of paper checks and concentrate on the things that matter, like running their business.
VacationRentPayment: ACH Payment in Check Dominated Industries
VacationRentPayment brings you the convenience of electronic payments, including ACH payment processing options. We stand out from our competitors thanks to our innovative API payment solution and our broad vertical expertise and experience. When you partner with VacationRentPayment, you can rest easy knowing that your ACH payment processing is well covered.
How does ACH Payment/eCheck Processing Work?
ACH payment processing happens in a moment or two yet there are various steps that need to occur to ensure a successful transaction:
Step 1: Guest Initiates Online Payment Using ACH Payment Method
The guest decides to pay for a vacation rental via VacationRentPayment; selects ACH payment from a list of online payment methods; and provides information such as name, checking or savings account number, and bank routing number. When payment is submitted, the backend processes initiate.
Step 2: Payment Gateway & Merchant Account
VacationRentPayment’s front end interface for ACH payment processing of eChecks (the payment gateway), sends the transaction details (name, checking or savings account number, routing number, and the amount) to its merchant acquirer, also known as the payment processor.
Step 3: Payment Processor & ACH Network (A)
The payment processor (merchant acquirer) validates payment details by giving its bank, also known as the Originating Depository Financial Institution (ODFI), the job of sending them through the Automated Clearing House (ACH) network via an ACH file. Details are then sent to the vacation rental customer’s bank for verification.
Step 4: Guest’s Originating Bank
The vacation rental customer’s bank validates or denies the transaction based on the accuracy of the information. The bank sends the ACH file back to the ACH networks, and if the payment is approved, the guest’s bank transfers the funds to the ACH network less the interchange fees.
Step 5: Payment Processor & ACH Network (B)
The ACH network forwards the transaction details and the approved/denied status back to the payment processor and transfers the funds via the ACH file less the assessments charge. In good faith, the payment processor’s merchant acquiring bank sends money to the payment gateway to be processed. The processor tries to complete the direct payment transaction via ACH debit or ACH credit and waits for reimbursement from the vacation rental customer’s bank. Depending on processing time, it can take up to five business days to clear. The Electronic Payments Association, formerly known as the National Automated Clearing House Association, requires ACH credits to be settled in one or two business days and ACH debits on the next business day.
Because fund verification is not immediate, the payment processor bears the risk of insufficient funds. In that event, the vacation rental customer’s bank, which usually credits the merchant acquiring bank, calls the funds back and assesses a non-sufficient funds (NSF) fee. The payment processor then charges the payment gateway who charges the merchant who, in turn, passes the fee to the customer. The NSF fee charged to the payment processor is separate and independent of the NSF fee charged by the bank to the guest.
Step 6: Payment Gateway & Merchant Account (B)
VacationRentPayment’s payment gateway sends the transaction approved/denied status to the guest via the online payment interface. If ACH payment is rejected, VacationRentPayment’s payment gateway sends the information back to the site and ACH payment processing is halted.
Step 7: Payment Via Merchant Receiving Bank
Now, the funds are ready for transference from the merchant acquiring bank account, known as the Receiving Depository Financial Institution (RDFI), to the vacation home rental property’s bank account. Due to the fact that they are a partner and have a sub-merchant account with VacationRentPayment, the payment gateway disburses the net payment into their bank account. Upon completion of ACH payment processing, the vacation rental customer receives notification that payment was succesful and is shown a confirmation screen. A receipt is emailed to the customer and reports are updated in real time indicating that an ACH payment has been processed.
Why Accept ACH Payments with VacationRentPayment
VacationRentPayment sees you as a valued partner more than a customer. We understand that building a relationship with you is to our mutual benefit. Working together, we benefit from your valued business, and you benefit from our vast industry expertise in using online payment methods for collecting vacation rental charges.
Vacation rental properties of all sizes accept ACH payments using VacationRentPayment. Considering we processed millions of ACH payments in the last 12 months, we really are well on our way to changing the way the world pays. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.909627377986908}", 'metadata': "{'Content-Length': '19944', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:BKEUSFFOUYS36GDFA7YKAJUKJ3LCQRZI', 'WARC-Concurrent-To': '<urn:uuid:b2500926-acf6-4738-b222-244b3c5c4a62>', 'WARC-Date': datetime.datetime(2019, 2, 16, 22, 36, 45), 'WARC-IP-Address': '52.24.239.127', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:NJP277B2NXXDEHLZHLU3NGD4T3LS53AK', 'WARC-Record-ID': '<urn:uuid:cbc0b028-3ce8-454a-a220-951ba29074f0>', 'WARC-Target-URI': 'https://vacationrentpayment.com/payment-methods/payment-methods-ach/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:54ec43e8-fead-420f-862c-4074596b74e8>', 'WARC-Truncated': None}", 'previous_word_count': '853', 'url': 'https://vacationrentpayment.com/payment-methods/payment-methods-ach/', 'warcinfo': 'isPartOf: CC-MAIN-2019-09\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-30-205-180.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.11692404747009277', 'original_id': 'bcd78d6d59998ef7b3a89d88515f1c6d35fec8ca028e1ffedea80bbce449a4cc'} |
E3 Roundup: Microsoft
The opening weekend of E3, the biggest expo of corporations pretending they’re cool and a contingent of people saying you shouldn’t poke fun at corporations for being sketchy because they’re making games, has come and gone. This weekend brought us three big players, EA, Microsoft, and Bethesda. Next up, Microsoft!
We’re kind of bad at covering Microsoft here. The reason is kind of straight-forward… Ace doesn’t own an Xbox One. I do, but I rarely play games on it… there just isn’t much to bring you to the console that isn’t available elsewhere, in better forms. When there is an exclusive title, I can play it on my PC just fine, thanks to Microsoft’s cross-play, which makes my Xbox mostly a streaming platform for the rest of the family.
I’m admittedly not a big fan of the One, but was a huge fan of the Xbox 360, and still think it had one of the best UIs and user experiences in a console. With the One, though, Microsoft apparently saw every misstep that was made by Sony with the PS3 and Nintendo by the WiiU, and went “Hold My Beer.” It’s long struggled to find an identity, because Microsoft has no idea what they want it to be (hint, it’s a game console, maybe it should be about the games). Unless you’re a huge fan of Gears of War, Halo, and Forza (and I am, to a certain extend, fans of all of those), there’s little reason to get games on the system when you have other options.
All of that aside, Microsoft’s conference wasn’t bad at all; there weren’t any huge knockouts, but there was a lot of focus on games. A lot are games that will be available elsewhere, compounding the problem, but we got to see them first. The biggest, for me, has to be Shadow of the Tomb Raider. I know that Ace feels similarly about this game, but it’s exciting to see the third installment of what’s been a great series. It looks like it’s getting even deeper into the “Tomb Raiding” part of the game, and taking some queues from Uncharted… and those are actually great. Not sure what platform I’ll get it for yet, but I will be getting it.
Of course, when it comes to exclusive, nothing is bigger than Halo, and we got that with the announcement of Infinite. The last Halo was a fine, though not overly memorable (given that I’m having problems recalling what it was even about)… and the trailer doesn’t tell us all that much. There was also the sequel to Ori and the blind Forest, Ori and the Will of the Wisps, which had been announced previously, still looks great, and is still coming next year.
It did seem that they were leaning a lot more into the exclusive camp, given the announcement that they acquired four studios directly: Ninja Theory, Playground Games, Undead Labs and Compulsion Games. If you’re a fan of the Forza Horizon series (and you should be, it’s great), you’ve likely heard of playground. Ninja Theory is another one that people are probably familiar with through their work, if not their name. They did the loved/hated DmC release, and more recently, the incredibly designed Hellblade: Seluna’s Sacrifice (a game that deserved far more attention than it got… and should be played with headphones). Undead worked on State of Decay, which I can’t tell you much about, and Compulsion Games has been working on We Happy Few for some time, which looks really interesting, but is more of a niche title.
Crackdown 3 got announced, a game that’s silly like what Saint’s Row became (RIP, Saint’s Row, I loved you so), and now features 100% more Terry Crews. I’m fully on board with that. Forza Horizon 4, which had been leaked heavily before now and everyone knew was coming, was shown, taking the series to the UK. I love the Horizon games and will play it, though will also say that 3 was the weakest of the series. I’m hoping they can right the ship (and give me more rally races).
The big player at the event, though, was really Gears of War, Microsoft’s other “big” title. The first release was just bizarre… a Funko-themed Gears of War game. It looked like a joke at first, but apparently is entirely real. Everyone around here should be familiar with the premise, given the profile of LEGO games, but Gears will be a weird fit for it. There was also a strategy game announced, something that has failed to catch on before (see, Halo Wars) in Microsoft properties, as well as a new entry into the main-line Gears of War series, maybe named Gears of War 5. I know Microsoft wants Gears to be as big as Halo, but that will never happen. Gears is a great game, and one worth playing… but it’s simply not going to have that same draw that Master Chief has.
A lot of the other stuff wasn’t exclusive to the Xbox… Fallout 76 got some play, which I’ll cover more in the Bethesda stuff. Sekiro: Shadows Die Twice, is a game that looks like Nioh, which was Team Ninja’s attempt to make a Dark Souls game, except that it’s made by From, the makers of dark souls. So… Bloodborninja? I suck at From games, but I’d still probably try it. Metro and the Division are both getting sequels, and that’s all I can tell you about them.
I wouldn’t touch the Division with a 20′ pole after what they did to ruin Siege, the spiritual successor to one of my favorites of all time in Vegas/Vegas 2. Dying Light 2 made a showing, and also a tells-us-nothing sneak that Battletoads is coming back. For those who don’t know, Battletoads is a terrible game that people inexplicably love back from the waning days of the NES. Just Cause 4 also got an official trailer, but it had been leaked a couple of weeks ago.
There were three other big games, though I’ll admit, I only care about one of them. First up, Kingdom Hearts III. I’ve never played a KH game, but know enough about them to understand a few facts:
SquareEnix is screwing with us with how they number these games
Despite the fact that they said “Early 2019” the chances of this game meeting that date are somewhere between 0 and 0.0001%
Fans are going to go bonkers that Frozen is in there… but now I’ll probably have to buy it for my daughter
The game Jump Force, which is a terrible name, came out of nowhere as far as I know, but I bet a lot of people will be excited about it. I’m not one of them… anime isn’t my cup of tea, but a lot of people here do love it. Basically, a fighting crossover game on a lot of properties that make sense to have in a fighting game.
The last of the big ending trailers is the one I care about the most, Cyberpunk 2077. Not because I like Cyberpunk… I really don’t care about it one way or the other, but because it’s being made by CD Projekt RED. They made the Witcher III, and I’ll play almost anything else they make because of that. The game looks incredible, and they put love and care into what they make.
There were other things and trailers in there as well, but Microsoft did a pretty strong showing. Like I said, few surprises that just blew me away, but plenty of games I’ll want to play. It just remains to be seen if I want to play them on an Xbox…
I'm in what looks to be a permanent dark age, but I still enjoy writing about the stuff related to our site, even if not LEGO itself. You can also check out my infrequently-used personal blog, dwhisper.com, for things I may or may not share here.
2 COMMENTS
[…] are some huge games in the pipeline for SquareEnix: we saw Kingdom Hearts III shown at the Microsoft conference, so this was a perfect opportunity for them to give even more and convince people that it’s […]
[…] down, and we’re now through the majority of the conferences. EA and SquareEnix underwhelmed, Microsoft did Microsoft, and Ubisoft and Bethesda shined. How are Sony and Nintendo going to answer? Well, we […]
We're just a bunch of old crotchety dudes trying to have fun on the internet. We're not affiliated with or owned by The LEGO Group, WBIE, Disney, or any other company we talk about here. We don't claim any ownership on their stuff that we feature on this site, just copyright on our words and self-made videos. | mini_pile | {'original_id': 'a52ea6346a74811e3fdc8b2d868132863f2c2400b7ad8b850ea0e0d95a575da6'} |
Khan Academy - Building an Exercise: Part 2
Part Two: Interactive tools
The next step in creating my cryptography exercises for Khan Academy involves creating a set of interactive tools. By combining visual elements as well as interactive mouse events, it will make the individual problems a lot more engaging.
A pirates favorite kind of Graph...
For the first tool, I wanted to create a letter frequency bar graph that compares the average letter frequency of English to the letter frequency in a Caesar Cipher. This allowed the user to compare the difference between the two, and then figure out how much they would have to shift the graph in order for them to line up. There were already a few exercises that utilized bar graphs for mean, median, and mode exercises; which would serve as a good template for what I wanted to do.
The way the Khan framework builds a bar graph is using the graphie.js library (which works on top of raphael.js). This library gives you a series of functions to draw lines and basic geometric shapes on a web page. So in order to build something like a bar graph, every single line, rectangle, and letter has to be placed individually, using a absolute position relative to the image space. While out of context these shapes can be relatively meaningless, putting it all together results in the following image...
In this case, each of the blue rectangles were drawn in a loop, where the vertical value stayed the same but the horizontal value incremented for each pass of the loop. Same for the orange rectangles (and the alphabet labels), except they would have a slight offset such as +0.5 so they appeared next to the blue rectangles. Even the border of the bar graph was created using two separate class to a draw line function.
Getting the height of the rectangles was simply a matter of using the functions I had already created in my crypro library. One to return the array for the English language frequency, and another to dynamically build a frequency array based on a given encrypted message. Both of these arrays were normalized, and then scaled so they could be fitted to the size of the graph.
Eventually I might come back and add some more functionality to this graph. But the first version of this graph turned out rather well. So on to the next tool and the start of my problems...
Crossing the line
The next goal was to create a way for students to quickly translate an encrypted alphabet to its decrypted counterpart. While this is possible without a tool, it is a very time consuming task; and once a student has translated the first few letters they have probably already gotten the point. Khan has an example of one such tool in their programing sandbox, but I wanted a version that could be included on the exercise page (And didn't allow the student to outright spoil the answer by typing it in).
To accomplish this, I took advantage of a Khan library called interactive.js, which had been used in a few exercises to build interactive number lines. In these exercises, you could click and drag an orange dot to a specific point on the line to indicate an answer. This was accomplished using mouse click events, and even offered several options such as making sure the dot would 'snap' into position at certain points, or restrict its movement to a specific space.
For these exercises, I wanted the marks on the line to indicate letters with one side being the original alphabet and the other being the encrypted alphabet. Moving the orange dot to the right would then update the labels on the encrypted alphabet so you could see what a specific letter mapped to when you applied a specific shift. I could then reuse this tool on any number of crypto exercises. Encrypting or Decrypting. Caesar or Viegenere Ciphers.
The final result for my interactive slider looks like this.
Alphabet Cipher mapping tool
However, things were a bit more complicated this time...
Performance Anxiety
My first attempt using both graphie.js and interactive.js, resulted in two issues.
While the interactive library automatically updated the position of the orange dot as it slides along the line, I would have to manually update the labels. This was currently done using a loop that drew each label individually at a specific position. But if I tried to run that loop again, every time the dot position was updated, it would paint those letters over the existing letters making them unreadable. I might have been able to get around this, if I first tried to draw a background colored rectangle across all of the letters to 'disappear' them, if not for the second issue.
When ever I started moving the orange dot on the number line, with the redraw loop in place, the page would freeze. For some reason, trying to redraw 26 individual letters caused the code to run slow enough that the interactive line wouldn't update smoothly anymore. Even when I constrained the loop to only redraw 5 letters, it was still moving unacceptably slow and choppy.
This means I would have to find some other way to update a string of alphabet characters on the web page...
Workaround 1: JavaScript CSS
Recently, I've been writing a lot of small Grease Monkey script's for some side projects. These GM scripts can be told to activate when you visit specific URL's, where it will then use JavaScript to remove, add, or replace HTML elements within that page before it loads. For instance, I could write a GM script that runs whenever I visit Google, and have it replace the Google image with my favorite cat and/or ninja picture. The key point here is that JavaScript can be used to change the content at a specific point in a web page.
First I replaced the labels used for the bottom part of the interactive slider with an HTML span. Next, taking advantage of my existing crypto library, I can send a message comprised of the letters of the alphabet and it will return it to me with all of the letters shifted in place. So now whenever the Interactive slider update event fired, it would only need to make a single call to update the page, using the string returned by my function. This seemed to work great and was a lot more responsive then trying to paint 26 individual letters.
While implementing this for the encrypted alphabet, I decided to expand on this idea and created another HTML element that would contain a copy of the encrypted message. During the same slider event, I would re-encrypt that secret message with the new shift so users could see the message decrypted in real time. As the user gradually drags the slider over the actual shift used to encrypt the message, they can see the words suddenly transition from random gibberish into a meaningful sentence.
A little to the left... just a little bit more...
Of course this new approach brought a new set of problems. While the graphie version had drawn the labels using absolute positions (x,y), my new approach was relying on HTML formatting and spacing. In some fonts letters take up different amounts of space; Various internet browsers render HTML in different ways; and users may have different settings across even the same type of browser such as text size or zoom...
First I had to try and line up the alphabet string with the interactive slider ticks and the letters above. Using CSS to control the HTML style for this element, I set it to a mono-spaced font so all of the characters would take up the same amount of space. I also ended up tweaking both the space between characters, and the space between tick marks in the original graphie code to get it lined up with the spacing of the font. But since the code had been using the x position of the tick mark to calculate the message shift, adjusting the value (to 1.2) meant a bunch of other changes to various equations to compensate.
After a few of these tweaks, it was finally looking good on my current development browser! But now my code was slightly more complicated, and had a new CSS section added that wasn't there before. And introducing CSS means checking how it looks in other versions of other browsers...
90% of the time writing code, the other 90% fixing Browser compatibility issues
No. Seriously. Developing the mock up exercises was relatively easy to do, even with the slight detours. But I ended up spending the same amount of time it took to code all four exercises, as I did just trying to track down a single browser compatibility issue...
So at first glance the interactive slider looked great in Firefox. It even looked great in Chrome. But once someone tried using it in IE, a new issue quickly became apparent.
Alphabet Cipher Slider Compatability Issue with IE
Specifically, the CSS setting for letter spacing apparently renders differently in Internet Explorer then it does in Firefox and Chrome. Setting the value to something that looked correct in IE changed how it looked in FF, and vice versa. So now I needed to find a new work around to fix my current workaround...
My initial research of dealing with IE compatibility issues introduced me to the concept of IE conditional comments. These are specially formatted HTML comments which most other browser will ignore, but when structured a certain way will allow Internet Explorer to implement the HTML or code inside the comment. You can even target specific versions of IE. It looked like a really good fix, so when I tried to use these conditional comments myself they failed miserably.
Internet Explorer would just completely ignore the conditional comments completely, and I had no idea why. One theory I had was that somewhere in the Khan Academy framework, it striped out specific HTML or scripting elements for security reasons. But I just didn't know if that was true, or where to even begin trying to suss out this issue. I ended up banging my head on this for a few hours over a few days, and ended up trying to research a few alternative approaches unsuccessfully.
Work around 2: CSS Hack
After a while, something started gnawing at the back of my mind. On the IE conditional comments pages, most of them referenced a specific version of IE, with the highest version referring to IE 9. My version of IE was version 10, though it could be those pages were simply out of date. So I did a specific search for IE 10 conditional comments. This quickly revealed that IE 10 had stopped supporting them all together... A fact which all of the other older sites suggestion the use of conditional comments failed to mention. *table flip*
In fact, wikipedia currently (6/6/2013) says IE 10 still supports them on the conditional comments page. But says it doesn't support them on the IE 10 page...
A little wiser now, doing a targeted search for IE 10 compatibility workarounds came up with a CSS hack that does work. A css hack usually involves taking advantage of some obscure browser option or setting that only exist on a specific version of a specific browser. Even if this browser option is completely unrelated to what you are trying to do, it can sometimes be used to target browser specific changes.
Most sites also generally warn that CSS hacks are a bad idea, since they are taking advantage of unintended behavior and may be unreliable. On the other hand, because of the ridiculousness of many browser incompatibility issues, they still get used.
Using this hack to set a separate CSS letter spacing value just for Internet Explorer, the interactive slider formatted correctly for the latest version of all three major browsers! Now I just had to worry about older versions of IE, as well as Safari, Opera, Tablets, iPhone... Actually just kidding! There's still an obscure formatting issue with the modern browsers!
And other fairly stupid fairy tales
Remember this paragraph from way back when? "In some fonts letters take up different amounts of space; Various internet browsers render HTML in different ways; and users may have different settings across even the same type of browser such as text size or zoom...". That's called foreshadowing.
So yet another way to change the way your browser formats an HTML page is by changing the text size on the screen. One of the easiest ways to do this is the zoom function, which you can commonly change by holding Ctrl + scrolling the mouse wheel (Go ahead and try it!). People with prehistoric mouses can usually find the zoom option in the view drop down of their browser.
Once again, different browsers handle this differently. Some browsers change the size of text, while others scale the image of the entire page being rendered, or even some combination of the two.
Funnily enough IE worked at any Zoom level without a hitch, now that it had the correct letter spacing applied. It was Firefox and Chrome causing the trouble this time. And they had been doing so well...
So when a user views this page in FF or Chrome while they have a significant zoom value, all of the carefully crafted formatting would would fail spectacularly. This is espsecialy horrible because it is a non-intuitive problem. Users may not even realize they are on a non-default browser zoom, either because they changed it some time long ago and forgot, or they accidentally adjusted it without realizing. And it is definitely not appropriate that you ask users to change that setting before using your website.
Any zoom that went below 80% or above 120% would mess up the formatting. And if the letters won't line up properly, that defeat's the purpose of having the slider in the first place.
Seeing that this would likely involve an even more complex browser specific work around, I decided to take a brief detour. Maybe this HTML formatting approach wasn't so great after all. Maybe there was some other way I could approach the problem using absolute positioning again...
So join me next time in part 3 of my Khan Academy Exercise project, as I chase after the next great workaround!
Leave a Reply
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '31', 'language_id_whole_page_fasttext': "{'en': 0.9493361115455629}", 'metadata': "{'Content-Length': '41160', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:SSCVNOXPYPVOYZSIPBFUJQPVCFD5KGJZ', 'WARC-Concurrent-To': '<urn:uuid:0650fcec-8a42-4574-aaa8-55d04de1bfd6>', 'WARC-Date': datetime.datetime(2019, 8, 25, 23, 38, 23), 'WARC-IP-Address': '74.114.89.123', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:JRJPYVDGICTV6VNBILDOYXI5VKKPUSEY', 'WARC-Record-ID': '<urn:uuid:2ee0d487-bfbb-419e-8cc0-7f3fbf804ac1>', 'WARC-Target-URI': 'http://www.technologyimprov.com/posts/khan-academy-building-an-exercise-part-2/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6c3ec936-0fea-4c1f-b928-696cee46bc8f>', 'WARC-Truncated': None}", 'previous_word_count': '2416', 'url': 'http://www.technologyimprov.com/posts/khan-academy-building-an-exercise-part-2/', 'warcinfo': 'isPartOf: CC-MAIN-2019-35\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for August 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-207.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.4302341341972351', 'original_id': 'addf464f92d6a3091f0006fe32dc87c52166fc02f156559d6fee2b5480abb1da'} |
66% or better
SGI 10,000 core concept
[via Hacked Gadgets]
1. nemo says:
A couple of those, some giant heat sinks, and you have yourself some awesome high tech radiators. Save on your heating bill and do a huge number of calculations per second.
2. BigD145 says:
10,000+ watts saves on a heating bill? I doubt that.
3. tbjr6 says:
Maybe you could play Crysis at max settings
4. dan says:
5. Solenoidclock says:
6. Edward Nardella says:
Just put it in a river of oil cooled by 4-5 auto rads with an industrial fan on each, that should do it.
7. arthur92710 says:
or they can use the Uber Bong posted a few weeks ago! Btw my bong’s almost finished!
8. Prophetnoise says:
What would be great is converting as much of that heat back into some sort of useable energy, instead of dispersing it into the air and wasted… or using even more energy trying to cool the unit.
9. i think a waterproof bag and 800lbs of ln2 would be enough to cool it
10. Hirudinea says:
Just put a sheet of metal on the top, toss on some burgers and you can open “Joe’s Render Farm and Grill”!
11. KaD says:
its impossible….its…..OVER 9000!!!
12. Brtus says:
Put a griddle on top of it.
McDondald’s could sell the proc time and cook their burgers for free.
13. Alcoholic says:
14. nick says:
15. Mike says:
Is that how many atom processors it takes to run vista decently? :)
16. Hatecrime69 says:
Nice in concept, but the atom??? Enough of them together and you might have enough power to almost match an i7…maybe
17. nick says:
18. kenny says:
Imagine a beowulf cluster of those…
19. mike says:
they should max out the cores with the max allowed ghz (3.6 ghz range). that way it would be 10,000×3.6 instead of 1.8. double the speed.
Leave a Reply
WordPress.com Logo
Twitter picture
Facebook photo
Google+ photo
Connecting to %s | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '357', 'language_id_whole_page_fasttext': "{'en': 0.9230459928512572}", 'metadata': "{'Content-Length': '94873', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:WRQ6KES6JRTVMC2QTUJPC4U2AXHBAPIK', 'WARC-Concurrent-To': '<urn:uuid:c6803a53-44d8-487f-8bb8-25c9a0ca3a86>', 'WARC-Date': datetime.datetime(2014, 7, 24, 17, 47, 1), 'WARC-IP-Address': '192.0.82.250', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:IUF3ZGAXFOI67I6WSWAXXP4UI7VGBQTQ', 'WARC-Record-ID': '<urn:uuid:3af4e0d4-eac9-47e4-b1e1-38507fbe2200>', 'WARC-Target-URI': 'http://hackaday.com/2008/11/19/sgi-10000-core-concept/?like=1&source=post_flair&_wpnonce=39eb77acf0', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:fdef6989-4479-463d-9fb0-fd9f213660ce>', 'WARC-Truncated': 'length'}", 'previous_word_count': '752', 'url': 'http://hackaday.com/2008/11/19/sgi-10000-core-concept/?like=1&source=post_flair&_wpnonce=39eb77acf0', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-131-23.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.18658840656280518', 'original_id': 'b36481ec240a021ce5dca22932339716b6a7f78c95d96912c5995fd76f10a7f0'} |
No Bank-account? <a href=""></a> 6 kinds of debts for everyone. Featured impression from Pixabay
The majority of loan providers call for their clients to get a banking account. Especially for web financial institutions, which is crucial. A primary reason is the loan company will have to shift deposits to their consumers. But what when you need emergency earnings and you've got no banking account? Exactly what then?
At least once that you know, you've almost certainly discovered in a jam any time you necessary an instant hold of cash for unexpected emergency spending. Perhaps you couldn't see any individual you could borrow the amount of money from, however you still had to cope with the condition taking place. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '1', 'language_id_whole_page_fasttext': "{'en': 0.967940628528595}", 'metadata': "{'Content-Length': '54909', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:YWPBJDR67SLXHYLTYGYRXH2O3XTXYXUN', 'WARC-Concurrent-To': '<urn:uuid:dd8f9788-f8b0-495c-9466-98e3049e12db>', 'WARC-Date': datetime.datetime(2021, 9, 26, 12, 4, 11), 'WARC-IP-Address': '89.46.105.82', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:B3NY4NXLBKSM2URSX64T6V2M2JNQ7BPT', 'WARC-Record-ID': '<urn:uuid:e965bb6b-7057-466a-91b0-fec8af185edd>', 'WARC-Target-URI': 'https://www.consorziosalernitano.it/category/1800-payday-loans/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e4b8300d-6124-40d7-9b0f-1f3ec7134652>', 'WARC-Truncated': None}", 'previous_word_count': '117', 'url': 'https://www.consorziosalernitano.it/category/1800-payday-loans/', 'warcinfo': 'isPartOf: CC-MAIN-2021-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-156\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.025690019130706787', 'original_id': 'fc8025af4a812d34cd9ea260bc8a59dc9ca21e60073920035fa10edcd0a78840'} |
[Adequancy of the pharmacological disponibility in a Department of Internal Medicine to the WHO essential drug list].
Since several years ago, the World Health Organization (WHO), publishes the Essential Drug List (EDL) including medicines that are used to cover the mayor health community problems. Drugs are selected in terms of importance, usefulness, safety and cost-effectiveness. There is no enough data about adequacy between this list and the current medical practise in Internal Medicine. Both EDL (13 edition, reviewed on April 2003) and the list of medicines used in the Internal Medicine Department from the Hospital da Barbanza, Riveira, A Coruña (Spain), Fundación Pública del Servizo Galego de Saúde in 2004-2005 were compared. From the 27 groups included in the EDL, 2 groups were excluded because no regular use in Internal Medicine. Among the other 25 groups there were significant differences in 24 groups. Just in one group both lists were identical. In all the 24 groups with differences, we used an smaller amount of drugs that recommended in the EDL. We analysed 15 groups (the groups with at least 5 differences between both lists). Causes identified were as follows: drugs used in diseases that we used to send to another hospital (Reference Hospital) in groups 6,8 and 12; drugs not commonly prescribed in Internal Medicine in groups 1,4,13,14,18,19 and 21, and finally drugs not currently financed by the National Health System (group 27). After examining the adequacy of the list of drugs prescribed in Internal Medicine in a Community Hospital we conclude that its use is significantly lower than the standard recommendations derived from de WHO. Identified causes are treatments not covered in a Community Hospital needing to transfer patients to another hospital and the inclusion of drugs not commonly used in Internal Medicine. The WHO estimates that over 2000 million people can not currently access to essential drugs nor vaccines all over the world. The problem is not just a health problem but also a social, economic and ethic one. So, an accurate use of such essential drugs in developed Health Systems could be a good example of efficiency. | mini_pile | {'original_id': 'e3e346e059c8133723ac7e9a1cbdd67b0f3824fa74a0d155bbdfff61a3b125f5'} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.