Split (2)

validation · 215k rows

text stringlengths 1 3.78M	meta dict
Introduction {#Sec1} ============ There is a clinical need for efficient and cost-effective grafts in urethral reconstructive surgery. Current surgical techniques require harvesting from autologous sites eg. buccal mucosa and penile skin tissue^[@CR1]^. This increases the risk of complications, the possible lack of tissue availability and patient discomfort. Certain oral pathologies are contraindications for buccal mucosal graft harvesting^[@CR2]^. Both cell-free and cell-seeded urethral grafts have been investigated. To date, cell-based grafts have shown better functional results in preclinical large animal models and inconclusive results in subsequent clinical trials^[@CR3]^. In 2015 and 2017, the clinical outcome of a commercial cell-seeded tissue engineered buccal mucosa product, was published^[@CR4],[@CR5]^. This product requires a buccal biopsy to be taken, followed by ex-vivo cell culturing in a GMP facility and a 3-week manufacturing time. The cost-effectiveness and efficacy of these grafts have been debated^[@CR6],[@CR7]^. Therefore, it is unlikely that this approach will become standard clinical practice for the patient with limited financial resources or insurance coverage. To overcome these problems we have targeted the development of a cell-free urethral graft that is cost-effective and adequate also to be used in third world countries. In vitro the mechanical niche is an important parameter to be considered for controlling cell fate. For example, mesenchymal stem cells are known to differentiate into different cell lineages, depending on the substrate stiffness^[@CR8]^. Previous studies have shown that fluid content or collagen fiber density relates to the stiffness and influenced material properties of the collagen gels^[@CR9],[@CR10]^. The more extracted fluid from the collagen gels, the stiffer the collagen material gets. In this manuscript we address the question if collagen fiber density of a collagen graft influences the functional regeneration of the rabbit urethra? Two different cell-free bovine tubular collagen grafts were manufactured, one with polarized and low collagen fiber density distribution (LD-graft) and one control with uniform and high collagen fiber density distribution (HD-graft). Polarization was achieved by specific compression and the collagen density increased towards the luminal side of the tube. These grafts were implanted in rabbits and were examined post-implantation by histology and immunohistochemistry, and the functional outcome was assessed by voiding cystourethrography and mating. Materials and Methods {#Sec2} ===================== Preparation of collagen grafts {#Sec3} ------------------------------ Tubular collagen grafts were fabricated under sterile conditions, utilizing liquid type I bovine collagen (5 mg/mL, Symatese, F). 8.5 mL of collagen solution were added to 0.8 mL of 10 × MEM and neutralized with 1 M NaOH (approx. 1.85 mL). The neutralized solution was set in a mold previously used for manufacturing tubular constructs of 3 mm inner diameter^[@CR10]^. To fabricate the LD-graft, the gelated collagen was manually compressed by rolling it on filter paper, followed by an air-drying step (Fig. [1A](#Fig1){ref-type="fig"}). To fabricate the HD-graft, only air-drying was applied to achieve a desired liquid content of 1% w/w (Fig. [1A](#Fig1){ref-type="fig"}). Monitoring of the water content of collagen gels/grafts were done with a balance (Mettler Toledo, CH). The fabricated grafts were kept in PBS supplemented with 1% Penicillin/Streptomycin (Gibco, CH) and 2.5 mg/mL Fungizone (Gibco) until used.Figure 1Manufacturing technique of the low-density graft (LD-graft) and high-density graft (HD-graft) (A) Two methods were utilized to manufacture the density controlled collagen grafts by monitoring the water content removed either by rolling compression or air-drying. The polarized collagen fiber distribution characteristics of the LD-graft were achieved by utilizing both a rolling compression followed by air-drying. The uniform collagen fiber distribution characteristics of the HD-graft were achieved by only air-drying the collagen. (B) By weighing and monitoring the collagen gel during production, we could achieve our polarized (compressed and air-dried: LD-graft) and uniform (only air-dried: HD-graft) collagen fiber distribution characteristics. Note: Images in Fig. 1A are Sirius red stained paraffin sections with scale bars of 200 µm. Scanning electron microscopy {#Sec4} ---------------------------- The samples were fixed with 1% tannic acid and 1.25% glutaraldehyde, then washed with 0.1 M cacodylate, and dehydrated in increasing ethanol concentrations prior to critical point drying. Thereafter coated with gold/palladium and imaged at a voltage of 10 kV using a scanning electron microscope (SEM, XLF30, Philips). Mechanical evaluation {#Sec5} --------------------- Burst pressure, ultimate tensile strength (UTS) and Young's modulus of grafts (N = 4 in each group) were measured with an electronic manometer (Extech instruments HD750) or an Instron tensile machine (Norwood, MA, USA) as described previously^[@CR10]^. Surgical implantation of the graft and evaluation in rabbits {#Sec6} ------------------------------------------------------------ Following approval by the Animal Ethics Committees of the Canton of Vaud (Authorization number: VD-2740), Switzerland and of the Faculty of Medicine of the University of Malaya (Authorization number: 2013-07-19/SUR/R/TCR), Kuala Lumpur the experiments were performed on New Zealand white male rabbits (2.5--3.5 kg; Charles River Laboratories France, and Harlan and Bred, Singapore) in Lausanne and Kuala Lumpur. All experiments were done in compliance with national directives for the care and use of laboratory animals. The surgical steps and post-operative monitoring were done as previously described^[@CR10]^. Rabbits from the long-term study group were involved in the in-house breeding program of the Animal Experimental Unit of the Faculty of Medicine, University Malaya. Cysto-urethrography {#Sec7} ------------------- Animals were submitted under general anesthesia for macroscopic evaluation and voiding cysto-urethrography (Visipaque 270 mg/mL). All images were collected with a Philips BV Pulsera. The diameter of the urethra was measured utilizing a scale. Knowing that the graft was sutured at 0.5 cm proximal to the base of the glans and it measured 2 cm in length, the position of the graft could be determined on the radioscopic images. It was then possible to estimate the potential presence of stenosis at the anastomotic sites. Stenosis was defined as a persistent 50% reduction of the diameter of the urethra at the same location. Histology and immunohistochemistry {#Sec8} ---------------------------------- Entire penises were harvested and fixed in 4% PFA. Specimens were embedded in paraffin, and 8 µm thick sections were prepared. Antibodies used: Mouse anti-α-smooth muscle actin (1:150, Abcam, CH), Goat anti-uroplakin-2 (1:150, Labforce, CH), Mouse anti-caldesmon (1:400, Sigma, D), Rabbit anti-CD31 (1:100, Abcam, CH), Donkey anti-mouse Alexa 647 (1:800, Abcam, CH), and Donkey anti-goat Alexa 546 (1:800, Abcam, CH). Images were taken with a Leica DM5500 microscope (Leica, D) and with a LSM 700 microscope (Zeiss, D). Alpha smooth muscle actin (α-SMA) expression was quantified with Fiji imaging program (ImageJ) as previously described^[@CR10]^. Statistical analysis {#Sec9} -------------------- Statistical analyses were performed using Prism v5.0a (GraphPad), using the test mentioned in the figure legends. A p-value of less than 0.05 was considered significant. All error bars in diagrams represent the standard deviation (SD). Data Availability {#Sec10} ----------------- The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. Results {#Sec11} ======= Manufacture of HD- and LD-grafts {#Sec12} -------------------------------- By applying a fast compression step, resulting in a less than 50% liquid loss followed by a slow air-drying step, we could control the liquid content of our produced grafts and therefore also the collagen grafts final density (Fig. [1B](#Fig1){ref-type="fig"}). This procedure yields a controlled polarized collagen fiber distribution, with a more dense structure at the compressed outer surfaces while the internal luminal part of the collagen tubular wall was left with a less dense collagen structure as shown by SEM (Fig. [2A](#Fig2){ref-type="fig"}). This graft hereafter is referred to as the LD-graft. In comparison, in the only air-dried collagen grafts, the latter become highly dense and with a uniform non-polarized collagen structure (Fig. [2B](#Fig2){ref-type="fig"}). This graft is hereafter referred to as the HD-graft. The denser HD-grafts showed significantly better mechanical properties, in terms of measured burst pressure, UTS and Young's Modules compared to the LD-graft (Supplementary Figure [1](#MOESM1){ref-type="media"}).Figure 2Description and characterization of manufactured collagen graft with controlled spatial orientation. (A and B) SEM images of LD- and HD-grafts with three different magnifications. Short-term rabbit evaluation of implanted HD- and LD-grafts {#Sec13} ----------------------------------------------------------- The LD-grafts were associated with a fistula formation rate of 15.4% (2 out of 13 rabbits) compared to one of 33% (3 out of 9 rabbits) in the HD-graft (Fig. [3A](#Fig3){ref-type="fig"}). No urethral stricture formation was observed. No mortality was seen as a result of graft implantation. At 1 month, it was noticed that the HD-graft still had not been completely remodelled by the surrounding tissue as shown by the persistance of implanted collagen visualized by Hemotyxlin & Eosin (H&E) and Masson's Trichrome (MT) staining (Fig. [3B](#Fig3){ref-type="fig"}). In LD-grafts, the remaining collagen could be identified to a lesser extent in the histological samples at 1 month (Fig. [3C](#Fig3){ref-type="fig"}). The luminal side of both grafts had shown overgrowth of urothelial cells within the first month of implantation (Fig. [3B,C](#Fig3){ref-type="fig"}). Pronounced ingrowth of smooth muscle cells was still lacking at 1 month, irresepective of the graft type (Fig. [3B,C](#Fig3){ref-type="fig"}). The urothelial cells had covered the grafted region in the HD-graft at 3 months with an organized multilayered urothelial cell distribution (Fig. [3B](#Fig3){ref-type="fig"}). This was still lacking in the LD-graft at 3 months (Fig. [3C](#Fig3){ref-type="fig"}). At 6 months, the urothelium, irrespective of the graft type, showed normal stratification (Fig. [3B,C](#Fig3){ref-type="fig"}). H&E and MT stained sections showed signs of vascular structures already at 1 and 3 months in both grafts, this was confirmed by immunohistochemistry for a vascular marker, CD31 (Supplementary Figure [2](#MOESM1){ref-type="media"}). More smooth muscle cell ingrowth from the native tissue into the LD-graft was seen at 3 and 6 months when compared to the HD-graft (Fig. [3B,C](#Fig3){ref-type="fig"}). Image analyis of regenerated smooth muscle, using anti-α-smooth muscle actin (α-SMA) antibodies, confirmed the difference between the two grafts to be significant (Fig. [3D,F](#Fig3){ref-type="fig"}). A second smooth muscle cell marker, caldesmon, confirmed the α-SMA result of smooth muscle cell ingrowth (Supplementary Figure [3](#MOESM1){ref-type="media"}). Uroplakin-2, a specific antibody for terminal urothelial differentiation, also confirmed an earlier differentiation of urothelium in the HD-graft compared to the LD-graft area at 1 and 3 months (Fig. [3G,H](#Fig3){ref-type="fig"}). At 6 months, the LD-graft also showed normal Uroplakin-2 expression.Figure 3In vivo evaluation of high-density (HD) and low-density (LD) collagen grafts in a rabbit urethral defect model. (A) Functional surgical outcome analyzed by micturating cysto-urethrography of rabbit implanted with LD- and HD-grafts for 1, 3 and 6 months. (B) H&E and MT stained sections of the grafted area of HD-graft 1, 3 and 6 months after implantation. (C) H&E and MT stained sections of the grafted area of low-density graft 1, 3 and 6 months after implantation. (D) Quantification of SMA expression in grafted areas for rabbits implanted with LD- and HD-graft after 1, 3, and 6 months. (E) Immunohistochemistry for compared to the HD-grafts-SMA of LD-graft implanted for 1, 3 and 6 months. (F) Immunohistochemistry for SMA of HD-graft implanted for 1, 3 and 6 months. (G) Immunohistochemistry for Uroplakin-2 (Up2) of LD-graft implanted for 1, 3 and 6 months. (H) Immunohistochemistry for Up2 of HD-graft implanted for 1, 3 and 6 months. Note: areas circled in dashed black line indicating the remaining collagen pieces of the grafts after 1 month (Scale bar H&E and MT 250 µm, Scale bar SMA and Up-2 50 µm). (Error bars represent the standard deviation of four independent samples. \\p \< 0.01, Student t-test). Long-term rabbit evaluation of implanted LD-grafts {#Sec14} -------------------------------------------------- LD-grafts were implanted in 5 rabbits for 9 months and 2 rabbits for 11 months. No complications were noted in these rabbits (Fig. [4A](#Fig4){ref-type="fig"}). At 9 and 11 months, the urothelial layer appeared comparable to the native rabbit urethra (Figs [4B,E and H](#Fig4){ref-type="fig"}) and there was pronounced ingrowth of smooth muscle cells, however, the appearance was not comparable to native rabbit urethra (Figs [4C,D,F,G,I and K](#Fig4){ref-type="fig"}). All animals in the long-term group were able to mate normally and had produced offspring (Fig. [4L](#Fig4){ref-type="fig"}).Figure 4Long-term in vivo evaluation of low-density collagen grafts in a rabbit urethral defect model. (A) Functional surgical outcome analyzed by micturating cysto-urethrography of rabbits with an artificially created, circumferential urethral defect that was bridged with a LD-graft (N = 5 rabbits for 9 months, N = 2 rabbits for 11 months). (B,C,E,F, and H,I) H&E and MT stained sections of LD-graft implanted for 9 and 11 months, and a control native rabbit urethra. (D,G and J) Immunohistochemistry for α-SMA of LD-graft implanted for 9 and 11 months, and a control native rabbit urethra. (K) Quantification of SMA expression in LD-graft compared to a control native rabbit urethra. (L) A photo of rabbit offspring from fathers implanted with a LD-graft. Note: green arrow pointing at offspring (Scale bar H&E and MT 250 µm, Scale bar SMA 50 µm). Error bars represent the standard deviation of four independent samples. Discussion {#Sec15} ========== In order to answer the question if collagen fiber density of a graft influences the urethral regeneration in vivo, we had to develop two fabrication methods to produce both a polarized low- density and a uniform high-density collagen graft. Our rabbit results show that the low-density graft had an improved smooth muscle regeneration compared to the implanted high-density graft. Previous studies have shown that fluid content or collagen fiber density relates to the stiffness and influences material properties of the collagen gels^[@CR9],[@CR10]^. The more extracted fluid from the collagen gels, the stiffer and more mechanical strong the collagen material gets. We experienced the same for our two grafts, where the surgeons reported that the HD-graft was more mechanically strong compared to the LD-graft. The HD-graft was designed to serve as a control, to represent a dense and stiff matrix (approximately 0.1 MPa), although it was not in the similar high range as the well studied SIS grafts (Small-intestine submucosa, approximately 7.2 MPa)^[@CR11]^, it was still two times stiffer than the LD-graft. Importantly, the SIS is reported to have been tried with patients for urethral reconstruction but has failed and is therefor not recommended to use in urethral reconstruction^[@CR12]^. According to literature the native rabbit urethra seems to have a stiffness of approximately 0.2 MPa, which is more in the range of our engineered scaffolds as compared to the SIS urethral scaffolds^[@CR13]^. We would like to challenge the current opinion in urethral reconstructive surgery that a cell-free graft is ineffective to bridge a urethral defect, and to rephrase this statement to: A cell-free graft, which is too dense or stiff, is ineffective for urethral defect grafting. Published studies have already demonstrated the failure of using stiff cell-free grafts in this clinical indication^[@CR12]^. However, when these graft are seeded with cells they have shown promising result in pre-clinical models but ultimately only limited success in clinical applications^[@CR3]--[@CR5],[@CR14]--[@CR17]^. In our graft implantation study in rabbits, the LD-graft exhibited more ingrowth of smooth muscle cells with formation of muscle bundles, due to its less dense collagen structure or, whereas the HD-graft demonstrated faster urothelial regeneration due to its denser collagen structure. This confirms similar reports where denser/stiffer grafts have been implanted in animals and showed good urothelial regeneration but has lacked an adequate smooth muscle regeneration^[@CR18]^. The accelerated ingrowth of smooth muscle cells into the low-density grafts is likely due to the lower surface area of collagen that needs to be degraded and remodeled by the infiltrating cells. Examining closer the HD-graft, it showed limited smooth muscle cell ingrowth in the center of grafted areas, but a normal muscle bundle structure was observed at the interface of the graft and native tissue (Supplementary Figure [3F and G](#MOESM1){ref-type="media"}). Both implanted grafts showed no signs of urine erosion. This is most likely due to the fact that all grafts showed early urothelial regeneration protecting the underlying graft. Interestingly, the onset of fully differentiated urothelium, is delayed in the less dense grafts compared to the highly dense collagen grafts. It can be speculated that this difference in density influencing the "mechanical niche" favoring either urothelial or smooth muscle cell growth. Improved smooth muscle regeneration is an advantage, as the primary pathology of urethral stricture is due to muscular fibrosis^[@CR19]^. By 6 months, the LD-graft had significantly more expression of α-SMA compared to the HD-grafts. At 11 months, cystourethrography showed urethral patency and normal urine flow and bladder voiding. Successful mating resulting in progeny could also be seen proving clinical relevant functional regeneration of the grafted areas. Our study has limitations. The rabbit model used had an artificially created urethral defect, with healthy urethral tissue on the edges. The graft was implanted to replace a totally excised urethral segment, what is not always mandatory as in clinical practice only partial circumferential replacement is often performed^[@CR20],[@CR21]^. Although the grafts were prepared under sterile conditions, the production needs to be transferred into a GMP setting to allow translation of this technology to human application. This translation is allowed if the bioburden is lower than the sterility assurance levels set by governing authorities. To further reduce the bioburden, final sterilization can be attempted, however, it is known that sterilization can change the material properties of the grafts which might compromise the final outcome of the graft^[@CR22]^. An off-the-shelf urethral graft without the incorporation of cells and growth factors, showing adequate urothelial and smooth muscle cell ingrowth into the implanted graft, represents an important pre-clinical breakthrough. This was demonstrated by the comparable encouraging results of experimental studies conducted in two research centers in Switzerland and Malaysia opening the way for clinical translation of this cost effective, cell-free grafting for application in urethral reconstruction. Electronic supplementary material ================================= {#Sec16} Supplementary material H. M. Larsson and G. Vythilingam contributed equally to this work. Electronic supplementary material Supplementary information accompanies this paper at 10.1038/s41598-018-27621-9. Publisher\'s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. The authors would like to thank: Dr. Haryanti Azura (UM), Prof. Andrea Superti-Furga, Marco Bürki, and Jacques Barraud (CHUV) for their advice and support. This work was funded by the University Malaya with two research grants (UMRG) (RP005G-13HTM and RU028-2015 UM.0000216/HRU.OP), an international short-term research fellowship (SNSF: IZK0Z3-171101) and a grant from the Commission of Technology and Innovation of the Swiss Government (CTI project no-16627.1 PFLS-LS). H.M.L. Performed experiments, analyzed data, prepared figures, co-wrote manuscript. G.V. Performed experiments, analyzed data, co-wrote manuscript. K.P. Performed experiments. E.V. Performed experiments. E.M.E. Analyzed data and revised manuscript. S.S. Performed experiments. R.C.T. Performed experiments, analyzed data and revised manuscript. T.K. Analyzed data and revised manuscript. J.A.H. Analyzed data and revised manuscript. P.F. Analyzed data, co-wrote manuscript and financed study. Competing Interests {#FPar1} =================== The authors declare no competing interests.	{ "pile_set_name": "PubMed Central" }
The Big Mac Index invented by The Economist is an informal way of measuring the purchasing power parity (PPP) between two currencies. The calculation of PPPs is based on the assumption that the dollar cost for a Big Mac in a particular country would be the same as in the United States. The indicator is chosen by The Economist magazine, as a measure of PPP, is based on the fact that the ingredients used in the preparation of Big Mac are the same over the globe, and hence the variation in dollar cost in any country is a direct measure on the valuation of the currency. The study also points to the fact that some of the developing countries, purposely undervalue their currency, in an effort to be competitive in the global market.	{ "pile_set_name": "OpenWebText2" }
Maurism Maurism (Maurismo in Spanish) was a conservative political movement that bloomed in Spain from 1913 around the political figure of Antonio Maura after a schism in the Conservative Party between idóneos ('apt ones') and mauristas ('maurists'). Its development took place in a period of crisis for the dynastic parties of the Spanish Restoration regime. The movement, which fragmented in several factions in the 1920s, has been portrayed as a precursor of the Spanish radical right. History The 1913 refusal by Antonio Maura to accept the terms of the turno pacífico (the alternation in government between the two major parties in the Restoration two-party system) and assume the presidency of the Council of Ministers led to a schism in the Conservative Party between idóneos (supporters of Eduardo Dato and dynastic normality) and the followers of Maura, leading to the establishment of a new movement, maurismo. In October 1913 a seminal speech by Ángel Ossorio y Gallardo delivered in Zaragoza gave birth to the so-called maurismo callejero ('street Maurism'). This side of Maurism became active in street politics using popular agitation, even physical violence. Maurism, aside from the figure of Antonio Maura, was partially inspired by historian Gabriel Maura (son of Antonio Maura), and received some influences from the ideas of French monarchist Charles Maurras—Maura and Maurras wrote to each other—and Action Française. However, Antonio Maura never got to lend support to the radical side of the movement created around him. Other notable Mauristas were José Calvo Sotelo, José Félix de Lequerica, Fernando Suárez de Tangil and César Silió. Miguel Ángel Perfecto identified three inner factions within the movement: the social Catholic one of Ossorio, the liberal-conservative strand of Gabriel Maura and the neoconservatives of Goicoechea. Additionally, the followers of Juan de la Cierva within the Conservative Party, as they drifted away from the orthodoxy of Eduardo Dato, ended up orbiting around authoritarian stances close to Maurism, but they did not merge into the organizational structure. The social strata prevalent among mauristas, whose first National Assembly was held in January 1913, were young people from the aristocracy and the wealthy middle classes. The movement built up its own organic structure and related media, created Maurist circles and even worker associations and presented candidates for local and general elections. Maurists were noted for the wide dissemination of their propaganda, embracing the catch-phrase "¡Maura Sí!" ('Yes to Maura!'). Attempts were made to reach capture working class support but these did not succeed as it was perceived as too middle class and establishment-minded, with republican groups managing to mobilise the workers much more successfully. Presenting itself as an antithetical to the Restoration regime instituted by Antonio Cánovas del Castillo (canovismo), Maurism tried to lead a conservative modernization, endorsing an interventionist, nationalist and corporative ideological project. It has been characterised as a regenerationist movement. It shared with that movement the belief that defeat in the Spanish–American War had been the fault of a political system that was rife with incompetence and corruption, with Maurism prescribing the imposition of a new patriotic system from above by elites. Another feature of Maurism was confessional Catholicism. The movement's social action could be described as paternalist, with a tutelary function of the upper classes over the lower ones. During World War I, Maurists largely supported Germanophile stances, although Maura himself defended neutrality and Ossorio endorsed Germanophobia. In the 1917 Madrid local elections nine Maurist councillors were elected. At this election non-dynastic unconventional candidates (Maurists and the republican-socialist coalition) took marginally more seats than the candidates elected by the traditional Restoration parties. The 1919 Maura cabinet, that included three Maurists, Goicoechea, Silió and Ossorio, was a window of opportunity for Maurism but it ended up in failure. Maura had become aware of the difficulties in fulfilling the Maurist agenda without the support of the dynastic forces. Since then the movement shifted towards fragmentation. In the 1920 election to the Cortes the Maurist fraction only got 22 members of the parliament. Two "antagonistic" factions split from Maurism. In one side the scion led by Ángel Ossorio y Gallardo, supportive of social Catholicism and Christian democracy, founded the Partido Social Popular in 1922. On the other side Antonio Goicoechea led an anti-liberal and authoritarian scion, vouching for an "organic democracy", concept later advanced by Francoism. In 1922 the Maurists around Manuel Delgado Barreto and the journal La Acción looked to Italian Fascism. Goicoechea insisted on a proclaimed popular support in Spain for the rise of "a Mussolini" in the country. The very vagueness that underpinned Maurism, which insisted on a "revolution from above" but left the interpretation of this vague concept up to individual adherents, has been characterised as encouraging this factionalism and preventing it from fully emerging as a coherent ideology. For his part Maura never addressed these issues, preferring to remain an aloof figurehead rather than seeking to lead an organised political movement. Maurists such as José Calvo Sotelo and Goicoechea gave support after the September 1923 Primo de Rivera coup d'etat to the dictatorship of the later — whose coming was cheered by the overwhelming majority of the Maurists — and they would finally participate in Renovación Española ('Spanish Renovation') during the Second Republic. José Luis Rodríguez Jiménez notes that Maurism added at some point the "Neither Right Nor Left" rhetoric, identified by the author as a feature of a drift from liberal conservatism towards authoritarian conservatism. References Bibliography Category:Conservatism in Spain	{ "pile_set_name": "Wikipedia (en)" }
Severability of Legislative Veto Provision A legislative veto provision in the S elective Service Act, w hich w ould authorize either H ouse o f C ongress to disapprove contracts in excess o f $25,000,000, is unconstitutional under Im m igration a n d N aturalization Service v. Chadha, but is severable from the rest o f the statute. T his unconstitutional provision m ust be severed from the statute in its entirety, including its language callin g fo r notification to C ongress o f proposed contracts. February 28, 1991 M e m o r a n d u m O p in io n f o r t h e A c t in g G e n e r a l C o u n s e l F ed era l Em ergency M anagem ent A gency This responds to your request for the opinion of this Office concerning the severability of an unconstitutional legislative veto provision in section 18(a) of the Selective Service Act of 1948, 50 U.S.C. app. § 468(a). The statute authorizes the President to secure expedited delivery of materials procured for the military forces of the United States. It also contains a provision added in 1973 that would enable one House of Congress to disap prove contracts of more than twenty-five million dollars. We conclude that the unconstitutional legislative veto is severable from the statute’s grant of authority to the President to obtain expedited delivery of military contracts. We further conclude that the better view, under the unsettled authority, is that the portion of the statute added by the 1973 amendment constitutes the provision that must be severed from the statute. I. Section 18(a) of the Selective Service Act of 1948 provides: Whenever the President after consultation with and receiv ing advice from the National Security Resources Board determines that it is in the interest of the national security for the Government to obtain prompt delivery of any articles or materials the procurement of which has been authorized by the Congress exclusively for the use of the armed forces of 49 the United States, or for the use o f the Atomic Energy Com mission, he is authorized, through the head o f any Government agency, to place with any person operating a plant, mine, or other facility capable of producing such articles or materials an order for such quantity of such articles or materials as the President deems appropriate, except that no order which re quires payments thereunder in excess of $25,000,000 shall be placed with any person unless the Committees on Armed Ser vices of the Senate and the House of Representatives have been notified in writing of such proposed order and 60 days of continuous session of Congress have expired following the date on which such notice was transmitted to such Commit tees and neither House of Congress has adopted, within such 60-day period, a resolution disapproving such order. 50 U.S.C. app. § 468(a). Section 18(b) of the Act directs contractors to give precedence to orders placed pursuant to the statute. 50 U.S.C. app. § 468(a). The statute did not contain a legislative veto as originally enacted. Congress added the clause in section 18(a) that begins “except that no order” in 1973. See Department of Defense Appropriation Authorization Act, 1974, Pub. L. No. 93-155, § 807(d)(1), 87 Stat. 605, 616 (1973). II. The provision authorizing one House of Congress to disapprove an order of more than twenty-five million dollars is unconstitutional. Immigration and N aturalization Service v. Chadha, 462 U.S. 919 (1983). Chadha states that congressional “action that ha[s] the purpose and effect of altering the legal rights, duties, and relations of persons . . . outside the Legislative Branch,” id. at 952, must comply with the constitutional requirements of passage by both Houses of Congress and presentment to the President for approval or veto. U.S. Const, art. I, §§ 1, 7. The resolution of disapproval authorized by the 1973 addition to section 18(a) authorizes one House of Congress to limit the President’s legal powers. The congressional disap proval mechanism, therefore, may not constitutionally be employed. III. A. The next question is whether the legislative veto may be severed from the remaining provisions of the statute that grant the President authority to order articles and materials on an expedited basis. The Supreme Court has de cided the severability of a legislative veto provision on two occasions. See 50 Alaska Airlines, Inc. v. Brock, 480 U.S. 678 (1987); Chadha, 462 U.S. at 931-35. Both cases employ the standard test for severability questions: “Unless it is evident that the Legislature would not have enacted those pro visions which are within its power, independently of that which is not, the invalid part may be dropped if what is left is fully operative as a law.” Alaska Airlines, 480 U.S. at 684; Chadha, 462 U.S. at 931-32.1 Writing with specific reference to legislative vetoes, the Court in Alaska Airlines emphasized that “ [t]he more relevant inquiry in evaluating severability is whether the statute will function in a manner consistent with the intent of Congress.” 480 U.S. at 685. Additionally, unconstitutional provisions are presumed to be severable from the remainder of a statute. See Regan v. Time, Inc., 468 U.S. 641, 653 (1984) (plurality opinion). Finally, unconsti tutional provisions are further presumed to be severable if they are contained in a statute that includes a severability clause. See, e.g., Alaska Airlines, 480 U.S. at 686; Chadha, 462 U.S. at 932. The absence of such a clause, however, does not give rise to a presumption against severability. See Alaska Airlines, 480 U.S. at 686.2 The grant of authority to the President in section 18(a) would remain fully operative as a law if the congressional disapproval language is excised. The language authorizing the President to order materials needed for na tional security was part of the statute as originally enacted in 1948. It was fully operational in its original form. The congressional disapproval mecha nism was added by Congress in 1973 to provide congressional review o f a Presidential decision to place orders over $25,000,000. As the Court ex plained in Alaska Airlines, provisions of this sort are by their “very nature . . . separate from the operation of the substantive provisions of a statute,” and do not affect the capacity of the balance of the legislation to function indepen dently. 480 U.S. at 684-85. Next, the law that results when the legislative veto provision is severed is not one that Congress would not have enacted. See Alaska Airlines, 480 U.S. at 685 (severance improper where it would produce a statute that Con gress would not have accepted). O f course, “the absence of the veto necessarily alters the balance of powers between the Legislative and Executive Branches of the Federal Government,” Alaska Airlines 480 U.S. at 685, but that is not enough to preclude severance. Rather, the appropriate inquiry is whether the delegation to the President of the power to enter into these military contracts is “so controversial or so broad that Congress would have been unwilling to make the delegation without a strong oversight mechanism.” Id. There is no reason to believe that Congress would have refused to grant this power. Congress made such a grant in 1948, and added the legislative veto provision only in 1973. In this case, then, the proper question is whether in 1973 Congress would have repealed the 1948 law if it had known that the 1 This is the C ourt’s longstanding test for severability. See Champlin Refining Co. v. Corporation Comm 'n, 286 U.S 2 1 0 ,2 3 4 (1932). 2 Neither the 1948 act nor the 1973 amendments include a severability clause. 51 legislative veto provision was impermissible. We are aware of no indication that Congress would have taken such a step, and the legislative history of the 1973 amendment strongly suggests that it would have done no such thing. Congress added the legislative veto to the statute in 1973 as one of a group o f amendments to four statutes giving the President emergency pow ers in an attempt to “reassert congressional control over backdoor financing of defense contractors.” 119 Cong. Rec. 30,873 (1973) (statement of Sen. Proxmire). The initial Senate version of the 1973 amendment would have provided that no order over twenty-million dollars could be placed “except with the prior approval of the Congress.” Id. at 30,872. The Conference Committee changed this and the other three provisions because “[w]hile the House conferees were sympathetic to the purposes of the amendment, they were concerned that the language was unduly restrictive and could result in delays on important weapons programs.” H.R. Conf. Rep. No. 588, 93d Cong., 1st Sess. 44 (1973) (explaining amendment to 10 U.S.C. § 2307). In short, Congress wanted a legislative veto, but not at the price of destroying the President’s authority to act in an emergency. Refusal to sever the legislative veto would produce the harsh result Congress was careful to avoid. Accord ingly, the legislative veto may be severed from the remainder of the statute. 1. Because of the way in which this statute is phrased, we must determine the proper way in which to sever the unconstitutional provision. The 1973 am endment reads: except that no order which requires payments thereunder in excess of $25,000,000 shall be placed with any person unless the Committees on Armed Services of the Senate and the House o f Representatives have been notified in writing of such pro posed order and 60 days of continuous session of Congress have expired following the date on which such notice was transmitted to such Committees and neither House of Con gress has adopted, within such 60-day period, a resolution disapproving such order. 50 U.S.C. app. § 468(a). If the entire provision were severed, the statute would return to the form it had when first enacted. The language also permits another line of severance. If only the disapproval mechanism — i.e., the words “and neither House of Congress has adopted, within such 60- day period, a resolution disapproving such order” — were removed, the provision would in effect be transformed into a report-and-wait requirement.3 3 T here is at least one other alternative: severance of the words "and 60 days of continuous session of C ongress have expired following the date on which such notice was transmitted to such Com mittees and neither House o f Congress has adopted, within such 60-day period, a resolution disapproving such order.” Severance o f this clause would elim inate the sixty-day delay period and the disapproval require m ent but would preserve the reporting requirement. The C ourt’s decisions, however, lend no support to this choice. 52 In order to decide this question, we must identify the portion of the statute that constitutes the unconstitutional legislative veto. Neither Alaska Airlines nor Chadha addressed this as a separate issue, although each case in some sense decided it, because each case described the statute that would remain after severance. The Court’s unexplained decisions in the two cases point in opposite directions: Alaska Airlines supports severance of the entire provi sion added in 1973, but Chadha supports the line of severance that would leave a report-and-wait requirement. While the existing authorities thus do not provide a certain answer, we believe the better view to be that the entire clause added in 1973 constitutes the legislative veto that must be severed from the valid remainder of the statute. Severance o f the entire provision is supported by textual analysis and by Alaska Airlines. First, the legislative veto is most naturally read as a single requirement; it is only an accident of phrasing that makes it possible to produce a report-and-wait procedure by deleting certain words. The require ment of a report to Congress is integral to the operation of the legislative veto itself. It gives each House of Congress the notice and information needed to exercise its veto power, and provides a time-table for the one- house veto procedure. Without these, the legislative veto could not function, but they have no independent importance. There is therefore no reason to give the notification rule any independent status. Nothing in the legislative history demonstrates any perception of separate requirements for reporting, waiting, and disapproval. Instead, Congress seemingly viewed the entire clause as indivisible, with the reporting requirement and the sixty-day delay period operating only to facilitate the exercise of the disapproval power. The 1973 amendment therefore would not operate in the manner that Con gress intended if only the disapproval mechanism is removed from the statute. Alaska A irlines , in which the Supreme Court most recently considered questions of severability in depth, reinforces this conclusion. The statute at issue in that case authorizes the Secretary of Labor to issue regulations for the administration of an airline employee protection program. 49 U.S.C. app. § 1552(0(1)- The statute further provides: The Secretary shall not issue any rule or regulation as a final rule or regulation under this section until 30 legislative days after it has been submitted to the Committee on Commerce, Science, and Transportation of the Senate and the Committee on Public Works and Transportation of the House of Repre sentatives. Any rule or regulation issued by the Secretary under this section as a final rule or regulation shall be submit ted to the Congress and shall become effective 60 legislative days after the date of such submission, unless during that 60- day period either House adopts a resolution stating that that House disapproves such rules or regulations, except that such rules or regulations may become effective on the date, during 53 such 60-day period, that a resolution has been adopted by both Houses stating that the Congress approves o f them. 49 U.S.C. app. § 1552(f)(3). The Court characterized the entire second sentence o f this subsection as the “legislative-veto provision which gave rise to this litigation,” 480 U.S. at 682, and severed that provision from the rest of the statute. Likewise, the legislative veto provision added to the Selective Service Act in 1973 has the same three components: a report requirement, a wait requirement, and a disapproval mechanism. According to the opinion in A laska A irlines, those provisions together constitute the legislative veto and should be treated as a unit for purposes of severance. W hile we take some guidance from Alaska Airlines, we do not suggest that the case is dispositive. For one thing, the disputed question in that case was whether the regulatory authority the statute gives to the Secretary of Transportation survived the invalidation of the legislative veto. Once the Court determined that the legislative veto could be severed from the grant of authority to issue regulations, the Court did not have to decide what the “legislative veto” was. Also, the statute at issue in Alaska Airlines already contains a report-and-wait requirement (the first sentence of 49 U.S.C. app. § 1552(0(3)) distinct from the provision the Court severed (the second sen tence of 49 U.S.C. § 1552(0(3)). Thus, severance did not eliminate all statutorily-mandated congressional oversight, a point the Court made in its opinion. See 480 U.S. at 689 (“should Congress object to the regulations issued, it retains a mechanism for the expression o f its disapproval that re duces any disruption of congressional oversight caused by severance of the veto provision”). By contrast, severance of the entire provision added to section 18(a) of the Selective Service Act in 1973 would eliminate any statu tory oversight procedure. Severance of the disapproval mechanism alone is supported by other strands o f the C ourt’s severability analysis and by the Court’ opinion in Chadha. Severance of the last clause of the 1973 amendment instead of the whole 1973 amendment results in legislation that Congress might have en acted. If the purpose of the 1973 amendment was to facilitate congressional oversight, preservation of a report-and-wait requirement would further this goal, albeit less successfully than the legislative veto Congress drafted.4 Chadha lends some support to this line of severance. In Chadha, the Court’s mode of severance removed the congressional disapproval mechanism while 4 It also m ight be argued that this line o f severance is most faithful to the Court’s command to “refrain from invalidating more of the statute than is necessary.” Alaska Airlines, 480 U.S. at 684. We doubt, however, that the C ourt’s point is to save as many words as possible. Rather, the goal is to preserve “unobjectionable provisions separable from those found to be unconstitutional.” Id. at 684 (quoting Regan v. Time, Inc., 468 U.S. at 652) (em phasis added). That rule cannot be applied until we have decided w hether the words that would produce a report-and-wait procedure constitute a separate “pro vision." 54 leaving a report-and-wait requirement.5 Application of this technique to sec tion 18(a) of the Selective Service Act would eliminate the congressional disapproval mechanism but preserve the rest of the section, thus effectively creating a report-and-wait requirement. Chadha , however, can be distinguished from the situation we confront here. The history of the Immigration and Nationality Act indicates that Congress sought to confer substantial power on the Attorney General but also to retain some active role in the deportation process, whether or not that role involved the specific legislative veto in force at the time of Chadha.6 The Court concluded on the basis of this history that the legislative veto was severable because Congress would not have simply returned to the private- bill system had it known the one-house veto to be impermissible. 462 U.S. at 934. The history also supported the conclusion that Congress was deter mined to retain an active role, and thus accorded with the Court’s decision to sever the legislative veto so as to produce a report-and-wait mechanism. There is no similar evidence concerning the 1973 amendment to the Selec^ tive Service Act. Congress had not tinkered with the relative powers of the two branches and gave no indication that it had any strong separate interest in being involved in the decision if the legislative veto was unavailable. Under these circumstances, to change the legislative veto into a report-and- wait mechanism would represent a rewriting of the statute based on nothing more than speculation as to Congress’s probable preferences. The C ourt’s approach in Alaska Airlines avoids these difficulties. To the extent the two cases are in tension, Alaska Airlines is authoritative, both because it is more recent and because it deals with severability in greater detail and therefore is more likely to represent the Court’s consid ered judgment on the matter. The outcome in Alaska Airlines may represent a judgment (or at least an intuition) by the Court that the severance of entire legislative-veto mechanisms is less likely to produce statutes that Congress would never have written than is the speculative process of removing the portion of a single mechanism that seems to contain the legislative veto in isolation. 5 The legislative veto appeared in section 244(c) of the Immigration and Nationality Act, 8 U.S.C. A. § 1254(c) (1970), which has since been amended, see 8 U S C. § 1254(c) Section 244(c)(1) of the Act required the Attorney General to report to Congress when he suspends the deportation o f an alien. 8 U.S.C. § 1254(c)(1) (1970). Section 244(c)(2) of the Act provided. [T]f during the session of the Congress at which a case is reported, or prior to the close of the session o f the Congress next following the session at which a case is reported, either the Senate or the House o f Representatives passes a resolution stating in substance that it does not favor the suspension of such deportation, the Attorney General shall thereupon deport such alien or authorize the alien’s voluntary departure at his own expense under the order of deportation in the manner provided by law. If, within the time above specified, neither the Senate nor the House of Representatives shall pass such a resolution, the Attorney General shall cancel deportation proceedings. 8 U.S.C. § 1254(c)(2) (1970). Thus, the first subsection contained a report requirement, and the second subsection contained both a wait requirement and a disapproval mechanism In Chadha the Court ex cised the disapproval mechanism but retained the wait requirement contained in the sam e subsection, observing that “ [wjithout the one-House veto, § 244 resembles the ‘report and w ait’ provision approved by the Court in Sibbach v. Wilson <6 Co., 312 U.S. 1 (1941).” 462 U.S. at 935 n.9. 55 CONCLUSION In sum, the one-House veto clause added to section 18(a) of the Selective Service Act in 1973 is unconstitutional. The legislative veto is severable from the remainder of the section 18(a). Under the best understanding of the Supreme Court’s approach to severability, the 1973 amendment should be severed in its entirety, thus returning the statute to the form it had when originally adopted in 1948. As a matter of comity, however, you may wish to inform Congress of a contract of more than twenty-five million dollars. More over, depending on the urgency of the situation, you may wish to allow Congress time to decide if it wants to take legislative action concerning a contract. JOHN C. HARRISON Deputy Assistant Attorney General Office o f Legal Counsel * As the Court explained. Congress originally permitted deportable aliens to remain in the United States through private bills. 462 U.S. at 933. In 1940, Congress authorized the Attorney General to suspend deportations but provided that Congress could overrule a suspension by a concurrent resolution. Id. at 933-34. W hen the concurrent resolution mechanism also proved burdensome, it was replaced with the schem e at issue in Chadha, under which the Attorney G eneral’s decision could be overridden by a one-H ouse resolution. Id. at 934. 56	{ "pile_set_name": "FreeLaw" }
// Code generated by linux/mkall.go generatePtracePair(arm, arm64). DO NOT EDIT. // +build linux // +build arm arm64 package unix import "unsafe" // PtraceRegsArm is the registers used by arm binaries. type PtraceRegsArm struct { Uregs [18]uint32 } // PtraceGetRegsArm fetches the registers used by arm binaries. func PtraceGetRegsArm(pid int, regsout PtraceRegsArm) error { return ptrace(PTRACE_GETREGS, pid, 0, uintptr(unsafe.Pointer(regsout))) } // PtraceSetRegsArm sets the registers used by arm binaries. func PtraceSetRegsArm(pid int, regs PtraceRegsArm) error { return ptrace(PTRACE_SETREGS, pid, 0, uintptr(unsafe.Pointer(regs))) } // PtraceRegsArm64 is the registers used by arm64 binaries. type PtraceRegsArm64 struct { Regs [31]uint64 Sp uint64 Pc uint64 Pstate uint64 } // PtraceGetRegsArm64 fetches the registers used by arm64 binaries. func PtraceGetRegsArm64(pid int, regsout PtraceRegsArm64) error { return ptrace(PTRACE_GETREGS, pid, 0, uintptr(unsafe.Pointer(regsout))) } // PtraceSetRegsArm64 sets the registers used by arm64 binaries. func PtraceSetRegsArm64(pid int, regs PtraceRegsArm64) error { return ptrace(PTRACE_SETREGS, pid, 0, uintptr(unsafe.Pointer(regs))) }	{ "pile_set_name": "Github" }
Saliva and serum concentration of lamotrigine in patients with epilepsy. The authors examined the interindividual correlation between saliva and serum concentrations of lamotrigine (LTG) and the relationship between LTG concentration in saliva and the free LTG concentration in serum in 40 patients with epilepsy, aged 16 to 73 years, receiving stable doses of LTG and comedication. Saliva was collected before and after stimulation of salivary flow. The free LTG fraction was determined by equilibrium dialysis and ultrafiltration. Drug analysis was performed by high-performance liquid chromatography. The correlation between LTG daily dose and serum concentration was weak but significant (r = 0.47). There was high correlation between LTG concentration in serum and unstimulated (r = 0.85) or stimulated (r = 0.94) saliva, and between total LTG concentration in serum and the free LTG fraction as determined by ultrafiltration (r = 0.95) and equilibrium dialysis (r = 0.93). Lamotrigine concentration in stimulated saliva was significantly correlated to the free LTG fraction. Protein binding of LTG calculated from concentration in stimulated saliva, as determined by ultrafiltration and equilibrium dialysis, was 51.8% +/- 13.03%, 68.05% +/- 7.59%, and 58.72% +/- 7.68% (mean +/- standard deviation) respectively. The differences between the three methods were significant. The authors conclude that saliva sampling may be a useful alternative to blood tests for monitoring LTG treatment.	{ "pile_set_name": "PubMed Abstracts" }
Betta History The splendid warrior. Bettas originated in the wild as native fish from southeast asia. They were found in slow moving streams and rice paddies of Siam (now Thailand), Laos, Malaysia, Vietnam, Cambodia and parts of southern China. They were a drab greenish brown color. The native male fish were territorial and naturally aggressive. Known in Siam as Plakad lukmoh and Plakat pah, centuries ago they were originally bred for fighting contests. Initially the desired characteristics were small fins and fierce attitudes. These Siamese fighting fish were pitted against one another in fighting contests with bets on the winner. For reasons unknown and lost in history, they were then bred for appearance. Long fins and colors were sought after. Long fins made the fish inherently poor fighting fish. History records that they were introduced to the west in an article published by a doctor in the Bengal medical service, Dr. Theodor Cantor. Initially named Macropodus pugnax, they were renamed as as a separate species as Betta splendens by Mr. Tate Regan. Betta is believed to be derived from “Bettah” a warrior-like tribe and splendens, latin for radiant, brilliant and splendid. Hence splendid warrior. And splendid indeed as the species has been bred for a variety of fin shapes, sizes and colors. The domestic variety bears little resemblance to the original native fish still found in the waters of Thailand.	{ "pile_set_name": "Pile-CC" }
genre: Holy Hip Hop streams: 32 audio file: , , 00:04:13 Tags Share This About DaRhema DaRhema (meaning the revealed spoken Word of God) whose real name is Emmanuel Archy is a holy hip-hop artiste who hails from Ohafia in Abia State, Nigeria. His music is all about the Living God, His worship and praises, His power, dominion, majesty and mandate for man. It is the “Spoken Word of God” come alive in music! His debut album “Baal Perazim – The Master Who Xpodes” is due to be released soon before the end of this year. He first grabbed a microphone back as D.E.T (Dope Extra Terrestrial) years ago while he was an undergraduate, when he hooked up with his friends Leo Kusi (a.k.a L Cube D) and Merry Okoro (a.k.a Merry Daddy) to form the very impressive but now defunct rap group RHYMES UNABATED PHAT LYRICS COMMAND. He has also won a couple of awards. He later felt God calling him back to himself so he recommitted his life to Jesus, and gave up "secular" rap music. Now he is using his lyrical skills to reach young people with the gospel of the Lord Jesus. DaRhema is a now pastor, teacher and worship leader in his local church. Now a vessel is here, armed with the Spoken Word of God, aimed at the youths of his generation. All glory be to God.	{ "pile_set_name": "Pile-CC" }
Conventional and diffusion-weighted MRI findings of methotrexate related sub-acute neurotoxicity. We describe longitudinal diffusion-weighted MRI findings of sub-acute leukoencephalopathy following methotrexate therapy in a 24-year-old man diagnosed with pre-B-cell acute lymphoblastic leukemia (ALL), presenting with right-sided paralysis and aphasia after second consolidation with intrathecal triple-drug therapy given intrathecally. This case demonstrates the value of DWI in evaluation and diagnosis of sub-acute toxic leukoencephalopathy in patients being treated with methotrexate. The longitudinal follow up DWI findings suggest reversible metabolic derangement rather than ischemia as the cause of these findings.	{ "pile_set_name": "PubMed Abstracts" }
Lunedì 4 settembre 2017 - 16:15 Twitter blocca Fabrizio Bracconeri per gli insulti a Kyenge Rimosso l'account dopo i tweet sulle violenze di Rimini Roma, 4 set. (askanews) – Twitter ha deciso di bloccare l’account di Fabrizio Bracconeri dopo gli insulti all’europarlamentare del Pd Cecile Kyenge. L’attore televisivo, in due tweet, aveva rivolto frasi irrispettose nei riguardi dell’ex ministro dell’Integrazione e legate agli stupri di Rimini, commessi da quattro giovani stranieri di origine africana. In un primo momento Bracconeri aveva scritto “Non mi viene in mente il nome della buzzicona muslim che era ministro”. Dopo ha cinguettato di nuovo attaccando direttamente Kyenge: “Ti ho trovata @ckyenge non dici niente dei tuoi fratelli merde muslim? Sei abituata, conosci i vostri usi con capre, no? Fate schifo!! Viaaa”. Twitter ha così deciso di rimuovere l’account del volto televisivo che, nel frattempo, era stato inondato di commenti dagli altri utenti. Adx/int5	{ "pile_set_name": "OpenWebText2" }
Q: TypeERROR after yarn upgrade (ReactJS project) I ran the command yarn upgrade and then I got this error next time I did yarn start, and I have no idea why? Hoping someone can tell me whats going on here? No idea what to do to solve it. Tried googling it, without much luck as to what is wrong. TypeError [ERR_INVALID_ARG_TYPE]: The "path" argument must be of type string. Received type undefined at validateString (internal/validators.js:113:11) at Object.join (path.js:375:7) at noopServiceWorkerMiddleware (C:\Users\perni\Projects\prime\node_modules\react-dev-utils\noopServiceWorkerMiddleware.js:14:26) at Layer.handle [as handle_request] (C:\Users\perni\Projects\prime\node_modules\express\lib\router\layer.js:95:5) at trim_prefix (C:\Users\perni\Projects\prime\node_modules\express\lib\router\index.js:317:13) at C:\Users\perni\Projects\prime\node_modules\express\lib\router\index.js:284:7 at Function.process_params (C:\Users\perni\Projects\prime\node_modules\express\lib\router\index.js:335:12) at next (C:\Users\perni\Projects\prime\node_modules\express\lib\router\index.js:275:10) at launchEditorMiddleware (C:\Users\perni\Projects\prime\node_modules\react-dev-utils\errorOverlayMiddleware.js:20:7) at Layer.handle [as handle_request] (C:\Users\perni\Projects\prime\node_modules\express\lib\router\layer.js:95:5) at trim_prefix (C:\Users\perni\Projects\prime\node_modules\express\lib\router\index.js:317:13) at C:\Users\perni\Projects\prime\node_modules\express\lib\router\index.js:284:7 at Function.process_params (C:\Users\perni\Projects\prime\node_modules\express\lib\router\index.js:335:12) at next (C:\Users\perni\Projects\prime\node_modules\express\lib\router\index.js:275:10) at handleWebpackInternalMiddleware (C:\Users\perni\Projects\prime\node_modules\react-dev-utils\evalSourceMapMiddleware.js:42:7) at Layer.handle [as handle_request] (C:\Users\perni\Projects\prime\node_modules\express\lib\router\layer.js:95:5) A: Try running yarn cache list to print out your cached packages, then you can compare with the version in your package.json to make sure they match. If you still get errors, run yarn cache clean to clear your entire cache and run yarn install to repopulate them.	{ "pile_set_name": "StackExchange" }
#!/usr/bin/env python # -- coding: utf-8 -- # # Generated from FHIR 4.0.0-a53ec6ee1b on 2019-05-07. # 2019, SMART Health IT. import os import io import unittest import json from . import detectedissue from .fhirdate import FHIRDate class DetectedIssueTests(unittest.TestCase): def instantiate_from(self, filename): datadir = os.environ.get('FHIR_UNITTEST_DATADIR') or '' with io.open(os.path.join(datadir, filename), 'r', encoding='utf-8') as handle: js = json.load(handle) self.assertEqual("DetectedIssue", js["resourceType"]) return detectedissue.DetectedIssue(js) def testDetectedIssue1(self): inst = self.instantiate_from("detectedissue-example-allergy.json") self.assertIsNotNone(inst, "Must have instantiated a DetectedIssue instance") self.implDetectedIssue1(inst) js = inst.as_json() self.assertEqual("DetectedIssue", js["resourceType"]) inst2 = detectedissue.DetectedIssue(js) self.implDetectedIssue1(inst2) def implDetectedIssue1(self, inst): self.assertEqual(inst.id, "allergy") self.assertEqual(inst.meta.tag[0].code, "HTEST") self.assertEqual(inst.meta.tag[0].display, "test health data") self.assertEqual(inst.meta.tag[0].system, "http://terminology.hl7.org/CodeSystem/v3-ActReason") self.assertEqual(inst.status, "final") self.assertEqual(inst.text.div, "<div xmlns=\"http://www.w3.org/1999/xhtml\">[Put rendering here]</div>") self.assertEqual(inst.text.status, "generated") def testDetectedIssue2(self): inst = self.instantiate_from("detectedissue-example-dup.json") self.assertIsNotNone(inst, "Must have instantiated a DetectedIssue instance") self.implDetectedIssue2(inst) js = inst.as_json() self.assertEqual("DetectedIssue", js["resourceType"]) inst2 = detectedissue.DetectedIssue(js) self.implDetectedIssue2(inst2) def implDetectedIssue2(self, inst): self.assertEqual(inst.code.coding[0].code, "DUPTHPY") self.assertEqual(inst.code.coding[0].display, "Duplicate Therapy Alert") self.assertEqual(inst.code.coding[0].system, "http://terminology.hl7.org/CodeSystem/v3-ActCode") self.assertEqual(inst.detail, "Similar test was performed within the past 14 days") self.assertEqual(inst.id, "duplicate") self.assertEqual(inst.identifiedDateTime.date, FHIRDate("2013-05-08").date) self.assertEqual(inst.identifiedDateTime.as_json(), "2013-05-08") self.assertEqual(inst.identifier[0].system, "http://example.org") self.assertEqual(inst.identifier[0].use, "official") self.assertEqual(inst.identifier[0].value, "12345") self.assertEqual(inst.meta.tag[0].code, "HTEST") self.assertEqual(inst.meta.tag[0].display, "test health data") self.assertEqual(inst.meta.tag[0].system, "http://terminology.hl7.org/CodeSystem/v3-ActReason") self.assertEqual(inst.reference, "http://www.tmhp.com/RadiologyClinicalDecisionSupport/2011/CHEST%20IMAGING%20GUIDELINES%202011.pdf") self.assertEqual(inst.status, "final") self.assertEqual(inst.text.status, "generated") def testDetectedIssue3(self): inst = self.instantiate_from("detectedissue-example.json") self.assertIsNotNone(inst, "Must have instantiated a DetectedIssue instance") self.implDetectedIssue3(inst) js = inst.as_json() self.assertEqual("DetectedIssue", js["resourceType"]) inst2 = detectedissue.DetectedIssue(js) self.implDetectedIssue3(inst2) def implDetectedIssue3(self, inst): self.assertEqual(inst.code.coding[0].code, "DRG") self.assertEqual(inst.code.coding[0].display, "Drug Interaction Alert") self.assertEqual(inst.code.coding[0].system, "http://terminology.hl7.org/CodeSystem/v3-ActCode") self.assertEqual(inst.id, "ddi") self.assertEqual(inst.identifiedDateTime.date, FHIRDate("2014-01-05").date) self.assertEqual(inst.identifiedDateTime.as_json(), "2014-01-05") self.assertEqual(inst.meta.tag[0].code, "HTEST") self.assertEqual(inst.meta.tag[0].display, "test health data") self.assertEqual(inst.meta.tag[0].system, "http://terminology.hl7.org/CodeSystem/v3-ActReason") self.assertEqual(inst.mitigation[0].action.coding[0].code, "13") self.assertEqual(inst.mitigation[0].action.coding[0].display, "Stopped Concurrent Therapy") self.assertEqual(inst.mitigation[0].action.coding[0].system, "http://terminology.hl7.org/CodeSystem/v3-ActCode") self.assertEqual(inst.mitigation[0].action.text, "Asked patient to discontinue regular use of Tylenol and to consult with clinician if they need to resume to allow appropriate INR monitoring") self.assertEqual(inst.mitigation[0].date.date, FHIRDate("2014-01-05").date) self.assertEqual(inst.mitigation[0].date.as_json(), "2014-01-05") self.assertEqual(inst.severity, "high") self.assertEqual(inst.status, "final") self.assertEqual(inst.text.status, "generated") def testDetectedIssue4(self): inst = self.instantiate_from("detectedissue-example-lab.json") self.assertIsNotNone(inst, "Must have instantiated a DetectedIssue instance") self.implDetectedIssue4(inst) js = inst.as_json() self.assertEqual("DetectedIssue", js["resourceType"]) inst2 = detectedissue.DetectedIssue(js) self.implDetectedIssue4(inst2) def implDetectedIssue4(self, inst): self.assertEqual(inst.id, "lab") self.assertEqual(inst.meta.tag[0].code, "HTEST") self.assertEqual(inst.meta.tag[0].display, "test health data") self.assertEqual(inst.meta.tag[0].system, "http://terminology.hl7.org/CodeSystem/v3-ActReason") self.assertEqual(inst.status, "final") self.assertEqual(inst.text.div, "<div xmlns=\"http://www.w3.org/1999/xhtml\">[Put rendering here]</div>") self.assertEqual(inst.text.status, "generated")	{ "pile_set_name": "Github" }
Cyclodextrin-derived host molecules as reversal agents for the neuromuscular blocker rocuronium bromide: synthesis and structure-activity relationships. A series of mono- and per-6-substituted cyclodextrin derivatives were synthesized as synthetic receptors (or host molecules) of rocuronium bromide, the most widely used neuromuscular blocker in anaesthesia. By forming host-guest complexes with rocuronium, these cyclodextrin derivatives reverse the muscle relaxation induced by rocuronium in vitro and in vivo and therefore can be used as reversal agents of the neuromuscular blocker to assist rapid recovery of patients after surgery. Because this supramolecular mechanism of action does not involve direct interaction with the cholinergic system, the reversal by these compounds, e.g., compound 14 (Org 25969), is not accompanied by cardiovascular side effects usually attendant with acetylcholinesterase inhibitors such as neostigmine. The structure-activity relationships are consistent with this supramolecular mechanism of action and are discussed herein. These include the effects of binding cavity size and hydrophobic and electrostatic interaction on the reversal activities of these compounds.	{ "pile_set_name": "PubMed Abstracts" }
Q: "Error Code: 2014. Commands out of sync; you can't run this command now" while creating a trigger I am trying to write a trigger that in case of inserting will do following: 1)count number of seats in the plane 2)count number of passengers that are already on this flight 3)compare these values and insert new row into the table OR raise an error saying that there are no more free seats in the plane. Here is my code: DELIMITER // USE AIRPORT; CREATE TRIGGER CHECK_FOR_PLACES BEFORE INSERT ON TICKET FOR EACH ROW BEGIN DECLARE NUM_OF_PLACES INT; DECLARE NUM_OF_PASSENGERS INT; SET NUM_OF_PLACES := (SELECT CAPACITY FROM AIRPLANE INNER JOIN FLIGHT ON FLIGHT.ID_AIRPLANE = AIRPLANE.ID_AIRPLANE WHERE FLIGHT.ID_FLIGHT = NEW.ID_FLIGHT); SET NUM_OF_PASSENGERS := (SELECT COUNT(*) FROM TICKET WHERE TICKET.ID_FLIGHT = NEW.ID_FLIGHT); IF NUM_OF_PASSENGERS >= NUM_OF_PLACES THEN SIGNAL SQLSTATE '-20000' SET MESSAGE_TEXT = 'NO MORE PLACES ON THIS FLIGHT'; END IF; END// DELIMITER ; After trying to compile the script I get the following error: Error Code: 2014. Commands out of sync; you can't run this command now I have no idea what might be the reason of this error. I'd appreciate any help. Thanks in advance A: use airport is a separate statement, should be terminated by // since you changed the delimiter: DELIMITER // USE AIRPORT// ...	{ "pile_set_name": "StackExchange" }
Background ========== The methylenetetrahydrofolate reductase enzyme (MTHFR) catalyzes a reaction that produces 5-methyltetrahydrofolate (5-methylTHF), the methyl donor for homocysteine in the synthesis of methionine. The 677C\>T mutation of the MTHFRgene has been associated with a thermolabile enzyme with decreased activity that may cause an increase in plasma homocysteine concentrations \[[@B1]\] when folate status is poor. This polymorphism is one of the most widely studied clinically relevant polymorphisms in humans, as it is related to cardiovascular disease \[[@B2]\] and neural tube defects (NTD; 601634) \[[@B3]\]. A large number of studies have provided a broad overview of the prevalence of the 677C\>T polymorphism in different human populations, showing that the distribution of frequencies is diverse \[[@B4]\]. These differences have been also observed between groups of different ages in the same Spanish population (older and younger than 24 years) \[[@B5]\] and in a Swiss population (older and younger than 60 years) \[[@B6]\], as well as in a Japanese population \[[@B7]\]. In some populations, such the Toscanians in Italy \[[@B8]\] and Mexicans \[[@B9]\], the homozygous mutated genotype (TT) has reached frequencies greater than 30%. On the other hand, in Africans the frequency of the TT genotype is very low (less than 1%) \[[@B10],[@B11]\], but, in African-Americans, it has already reached 2% \[[@B12]\]. Studies based on the distribution of genotypic and allelic frequencies of the 677C\>T polymorphism and the 1298A\>C polymorphism in the MTHFRgene in Israeli, Japanese and Ghanaian Africans populations \[[@B13]\] concluded that the 677T mutation in the MTHFRgene emerged as a founder haplotype with some selective advantage. Recently, preliminary evidence of genetic selection of this polymorphism related to folate intake has been reported \[[@B14]\]. The aim of the present study is to analyze the changes in frequencies of the 677C\>T polymorphism during the 20^th^century and particularly the evolution of the frequencies during the decade of 1980--1989, by comparing the genotype frequencies between living subjects born in this period versus samples of spontaneous abortions (SA) that occurred during in the same time period. Methods ======= Subjects -------- This study was approved by the Ethics Committee at the University Hospital \"Virgen de la Victoria\" (Málaga). One of the study groups consisted of 344 fetal tissue samples from SA, obtained from the Department of Pathology of the University Hospital Carlos Haya (Málaga). These samples were selected after checking the clinical history and by the inclusion criteria of containing histologically confirmed fetal tissue collected in the 1980s from SA at less than 3 months (11 ± 1.70 week) and of unknown etiology. These fetal samples were compared with a control population of 276 subjects born in the 1980s with an average age of 22 ± 4.58. Another population of subjects born in the south of Spain in the 20th century were genotyped (1305 subjects, 697 women and 608 men) and divided into four groups according to birth date: 1900 to 1925 (n = 206); 1926 to 1950 (n = 320), 1951 to 1975 (n = 408), 1976 to 2000 (n = 371). Individuals were selected randomly from different areas of the province of Malaga, in southern Spain, and from different social statuses to avoid a selection bias. All the selected individuals were Caucasian and residents of the study area. The parents of all subjects included in the study were also Caucasian and born in Spain. The possibility of a founder effect or genetic drift was investigated and rejected. All the selected individuals were also genotyped for an insertion/deletion polymorphism in the angiotensin converting enzyme (ACE) gene and/or the 2756A\>G polymorphism in the methionine synthase gene (MTR), in order to determine whether or not our adult and young populations were genetically homogeneous. No significant differences were observed in allelic or genotypic frequencies for these genes between the different groups. The population studied was randomly selected according to age. Subjects 0--12 years old were selected from dried blood spots from neonatal screening papers; subjects 10--24 years old were recruited from students in primary and secondary schools and in university; subjects 25--50 years old and \>51 years old were recruited using their Andalusia Health Service identity cards. After approval by the University Hospital Ethical Committee, all the subjects were contacted, and, from those whose written consent was obtained, 10 ml of blood was taken. The investigation in this study conforms to the principles outlined in the Declaration of Helsinki. Genetic analysis ---------------- The fetal samples were extracted from the archived formalin-fixed, paraffin-embedded tissue sections. Genomic DNA was extracted from fetal tissue using the method described by Coombs et al. (1999) \[[@B15]\]. Genomic DNA of the second and third groups was extracted from peripheral leukocytes using the AquaPure Genomic DNA Blood Kit (Bio-Rad). Genotyping was performed using Real Time PCR with allele specific Taqman^®^probes and primers described by Ulvik et al. (2001) \[[@B16]\] and the following optimized protocol for 45 cycles: 10 s -- 94°C, 40 s -- 54°C, 15 s -- 72°C. The PCR mix (25 μl total volume) consisted of 5 μl of genomic DNA, 0.5 μl of sense primer, 0.62 μl of anti-sense primer, 0.85 μl Taqman^®^probe FAM, 0.43 μl Taqman^®^probe TET, 20 μl PCR-buffer iQ-SupermixTM (Bio-Rad) (containing 100 mM KCl, 40 mM Tris-HCl, (pH 8.4) 1.6 mM dNTP (dATP, dCTP, dGTP and dTTP), iTaq^®^polymerase (50 units/mL) and 6 mM MgCl2) and 17.75 μl H2O. Statistical and mathematical analysis ------------------------------------- All samples were genotyped, and the allelic and genotypic frequencies were compared. Differences were analyzed statistically using the chi-square test or Fisher\'s exact test. Correlations are expressed using Pearson\'s coefficient (r). Compliance of genotype distributions with Hardy-Weinberg (HW) equilibrium was evaluated by chi-square analysis. For all tests, a p-value \< 0.05 was considered to be statistically significant. Values are expressed as the mean ± SD. The genetic selection model was calculated for the evolution of the 677C\>T genotypes. The genetic selection could be classified as codominant or incompletely dominant and directional with the heterozygous genotype having an intermediate fitness. For this kind of selection, the most appropriate mathematical model is dq = \[spq(2hp+q-h)\]/\[p^2^+ 2pq(1-hs) + q^2^× (1-s)\], where dq is the change of frequency of the allele with lower fitness, s is the fraction of that genotype lost to selection, h is the degree of dominance (between 0, for no dominance and 1, for complete dominance), and p is the frequency of the allele with higher fitness. Results ======= We analyzed the genotype frequencies of the 677C\>T polymorphism in a population born during the 20th century. A total of 1305 subjects were divided into four groups of 25 years according to birth date. The genotype frequencies were compared between the four quarters of the century and showed very significant changes (p \< 0.001) in the group born in the last quarter of the 20th century (1976--2000), when compared to any of the other groups. The changes show a decrease of the CC genotype and an increase of the TT genotype in the last 25 years of the 20th century. (Table [1](#T1){ref-type="table"}) ###### Distribution of C677T genotype frequencies in the 20th century. Frequencies by date of birth -------------- ---------------------------------- ----- ------- ----- ------- ----- ---------- ----- CC 0.393 81 0.394 126 0.37 151 0.299\* 111 CT 0.495 102 0.488 156 0.49 200 0.461 171 TT 0.112 23 0.119 38 0.14 57 0.24\\ 89 C allele 0.641 264 0.638 408 0.615 502 0.53\\ 393 T allele 0.359 148 0.363 232 0.385 314 0.47\\ 349 Note: \p \< 0.05; \\p \< 0.01 (significance values in the last quarter of the century are relative to any other quarter of the century) Considering that each 25 year period corresponds to a generation, allelic frequencies did not change during the first 75 years of the century (HW equilibrium). However, we found that allelic and genotypic frequencies for the 677C\>T polymorphism in the last quarter of the century are significantly different compared to the previous generation (1951--1975). The genotype frequencies in the last quarter of the century are not the expected by a HW calculation using the allelic frequencies of the previous generation. This could be described as a consequence of genetic selection found in this population, in the absence of other causes. Applying the mathematical model described above to our population, the calculated fitness (s) is 0.5, and it can be predicted that both alleles will be approximately at a frequency of 50% in the next generation and allele T will be at 90% after seven generations (Figure [1A](#F1){ref-type="fig"}). Another possibility is that a scenario could be predicted in which both alleles will have frequencies of about 50% in the next generation and that they will maintain this stability while conditions remain unchanged. (Figure [1B](#F1){ref-type="fig"}) ![Hypothetical evolution of the allelic frequencies of mthfr 677c\>t polymorphism. Panel A represents the observed evolution of the allelic frequencies in the 20th century (DATA) and the hypothetical evolution predicted by the mathematical selection model (calculated fitness: s = 0.5) (PRED). Panel B represents the evolution of the allelic frequencies in the 20th century (DATA) and the hypothetical evolution based on an allelic balance dependent on folate abundance conditions.](1471-2350-9-104-1){#F1} The comparison of the genotype frequencies between a group of fetal samples from SA that occurred during the 1980--1989 decade and living subjects born in the same decade showed significant differences in genotype frequencies (p \< 0.001). CC genotypes were almost absent in abortion samples compared to living subjects (0.03 vs 0.33), while CT and TT genotypes were overrepresented in the same group. When 3-year periods are studied in the decade, we detected a significant increase of the mutated subjects during the decade (CT p \< 0.05; TT p \< 0.01). Allele frequencies showed the same pattern (p \< 0.05). Controls showed the same tendency but without statistical significance. (Table [2](#T2){ref-type="table"}) ###### Allelic and genotypic frequency comparison between fetal and control groups. -------------------------------------------------------------------------------------------------------------- C677T-MTHFR*\ Frequencies by date of birth Genotype-Allele --------------------- ---------------------------------- ------------- ------------- ----- ------------- ----- Fetal Group** (n = 110) (n = 129) (n = 105) \% n \% n \% n CC 0.073\\ 8 0.008\\ 1 0.019\\ 2 CT 0.727\\ 80 0.705\\ 91 0.6\\# 63 TT* 0.2 22 0.287 37 0.381\#\# 40 C allele 0.436\\ 96 0.36\\ 93 0.319\\\# 67 T allele 0.564\\ 124 0.64\\ 165 0.681\\\# 143 *Control Group* (n = 88) (n = 93) (n = 95) \% n \% n \% n CC 0.33 29 0.301 28 0.305 29 CT 0.477 42 0.452 42 0.421 40 TT 0.193 17 0.247 23 0.274 26 C allele 0.568 100 0.527 98 0.516 98 T allele 0.432 76 0.473 88 0.484 92 -------------------------------------------------------------------------------------------------------------- Note: \p \< 0.05; \\p \< 0.01 (significant values relative to controls). \#p \< 0.05; \#\#p \< 0.01 (significant values relative to the 1982--1984 period) The evolution of genotype frequencies during the 1980--1989 decade of the TT genotypes correlates well in both living populations as well as fetal samples r = 0.98 (p = 0.11). Discussion ========== Different reports show that the prevalence of the 677C\>T polymorphism of the MTHFRgene differs dramatically among human populations. Evidence of this dynamism can be observed in many reports: frequency variations between populations that are geographically very close, even in the same country \[[@B8]\]; changes found in the same race or ethnic group such as Africans \[[@B10],[@B11]\] and African-Americans \[[@B12]\]; the high prevalence of the 677C\>T poymorphism in populations with special nutritional features such as Mexicans \[[@B9]\] and Japanese \[[@B13]\]; and changes in frequencies between generations of the same population, as has been observed in Spain \[[@B5]\], Switzerland \[[@B6]\] and Japan \[[@B7]\]. There are numerous interpretations of this great diversity, and most tend to be related to adaptation to external conditions such as climate or nutritional status. Dependence of folate degradation on skin pigmentation \[[@B17]\], nutritional habits or human intervention periconceptional periods could explain this genetic variation. Definitely, external factors in combination with different levels of MTHFR enzyme activity, conditioned by polymorphisms, could influence the fetal viability of certain genotypes. In 1998, we suggested the possibility of genetic selection in Spain in favor of the mutants of the 677C\>T polymorphism in the MTHFRgene based on the fact that treatment with vitamins and folates during pregnancy increased the viability of fetuses with the TT homozygous genotype. This hypothesis was based on the increase in the number of mutated individuals found in our population since the mid-1970s \[[@B5]\] and the coincident increased intake of vitamins and folate by pregnant women in Spain \[[@B18],[@B19]\]. In 2002, a new study found changes in genotype frequencies for the 677C\>T and 1298A\>C polymorphisms in different age groups. Total homocysteine (tHcy) levels in plasma were also analyzed according to the different genotype interactions \[[@B20]\]. That study hypothesized about fetal viability and about a genetic selection model on the basis of non-linkage disequilibrium between both polymorphisms. Recently, a study with fetal and control populations showed the strong influence of these polymorphisms, though mainly of the 677C\>T polymorphism, on spontaneous early abortion \[[@B21]\]. In the present study, significant changes in allelic and genotypic frequencies are detected, as is Hardy-Weinberg disequilibrium, at the 677C\>T polymorphism. We hypothesize that there is a dynamic process of genetic selection that favors the T allele. This process of selection started during the last quarter of the 20th century, during which the frequency for mutant homozygous (TT) rose significantly from 14% to 24%. We propose that this increase in mutants is due to the inclusion of an external factor that enhances mutant fetal viability. If we apply the mathematical model for dynamic selection developed for diploid organisms with sexual reproduction, the T allele could reach to 90% in seven generations in our population (Figure [1A](#F1){ref-type="fig"}). However, this model assumes selection in a constant environment that applies to all individuals in the population studied. In our case, we suggest that the external factor is related to an increase in folate and vitamin intake in women in periconceptional period and does not affect to all individuals \[[@B18],[@B19]\]. We assume that prediction of a classic selection model in this case is only theoretical. On the basis of a competition between alleles in which an environmental factor favors one allele versus the other, the final result would be that predicted by the previous mathematical model. However in this case, the environment is not selecting against the wild type allele but rather allowing the survival of more mutated alleles. Therefore, the expected result would be not a systematic increase of the mutated allele but the creation of an allelic balance dependent on vitamin and folate abundance conditions. In this case, the mutation would have a lower influence on fetal viability (Figure [1B](#F1){ref-type="fig"}). The results showed an increase in mutated genotypes (CT and TT) and a strong protection against abortion by the wild type genotype (CC), which is practically non-existent in the SA group. The frequency of the CC genotype shows no change over the decade studied (1980--1989), which indicates that folate does not exert a visible effect on this genotype. However, the frequency of the mutated allele increases during this decade, especially in fetuses from abortions, and this increase correlated with the increase of the T allele in the control population. This finding suggests that the effect of folate is crucial to viability during the early stages of embryonic development, but, even with folate, not all embryos will survive until birth. In this population, the mutant allele with lower enzymatic activity has higher fitness than the wild type. In the folate cycle, it can be observed that 5,10-methyleneTHF availability may be important. 5,10-methyleneTHF is the substrate for several reactions in the cycle, but two of them (5-methylTHF and thymidilate synthesis) might be essential for embryo development in folate deficiency conditions. In both cases, complete or limited MTHFR activity will produce higher or lower 5,10-methyleneTHF availability, which might be an essential factor for embryo development, such that a greater folate levels can compensate the lower enzymatic activity of the mutant. The implications of this polymorphism in nucleotide synthesis have not yet been determined, but certain data, such as high levels of uric acid found in mutated subjects \[[@B22],[@B23]\], suggest that there are different turnover rates associated with different polymorphisms. Conclusion ========== We suggest that there is genetic selection in our population for the T allele of the MTHFR*-- 677C\>T polymorphism, whose origin could be an increase in fetal viability during the early stages of embryonic development because of an increase in folate and vitamin intake by women in the periconceptional period that began to be established in Spain in the last quarter of the 20th century \[[@B18],[@B19]\]. Higher frequencies for the T allele and TT genotype in our population are observed in the living and SA populations. Competing interests =================== The authors declare that they have no competing interests. Authors\' contributions ======================= AMO performed the statistical analysis, helped to draft the manuscript and revised it for publication. GC is the corresponding author, participated in the acquisition of samples and carried out the genotyping. ARP carried out the bibliographic search and helped to draft the manuscript. AJJ participated in the selection and the processing of samples. MJG coordinated the laboratory work and selected the genotyping method. AR selected the control subjects and designed the consent form. MR helped in the interpretation of data and tables performance. ARE conceived the study and is the guarantor of this work and the general coordinator. All authors read and approved the final manuscript. Pre-publication history ======================= The pre-publication history for this paper can be accessed here: <http://www.biomedcentral.com/1471-2350/9/104/prepub> Acknowledgements ================ This study was supported by the Ministerio de Educación y Ciencia (Spain), Grants (SAF2008-03314).	{ "pile_set_name": "PubMed Central" }
Tower Ticker Tower Ticker was a column in the Chicago Tribune, and later a blog. It was originated by Jimmy Savage in 1948 and focused on "night life, show business, and the activities of people in the news". It has been conducted by: Jimmy Savage, 1948–1951 (credited as "Savage") Will Leonard Herb Katz, 1954–1968 Robert Wiedrich Aaron Gold ( –1983) (hiatus) Phil Rosenthal (column and blog) (2005–2011) Notes External references Tower Ticker blog Category:Columns (periodical) Category:Chicago Tribune	{ "pile_set_name": "Wikipedia (en)" }
Toilet Grab-Bar Preference and Center of Pressure Deviation During Toilet Transfers in Healthy Seniors, Seniors With Hip Replacements, and Seniors Having Suffered a Stroke. Multiple toilet grab-bar configurations are required by people with a diverse spectrum of disability. The study purpose was to determine toilet grab-bar preference of healthy seniors, seniors with a hip replacement, and seniors post-stroke, and to determine the effect of each configuration on centre of pressure (COP) displacement during toilet transfers. 14 healthy seniors, 7 ambulatory seniors with a hip replacement, and 8 ambulatory seniors post-stroke participated in the study. Toilet transfers were performed with no bars (NB), commode (C), two vertical bars (2VB), one vertical bar (1VB), a horizontal bar (H), two swing-away bars (S) and a diagonal bar (D). COP was measured using pressure sensitive floor mats. Participants rated the safety, ease of use, helpfulness, comfort and preference for instalment. 2VB was most preferred and had the smallest COP deviation. Least preferred was H and NB. C caused largest COP displacement but had favourable ratings. The preference and safety of the 2VB should be considered in the design of accessible toilets and in accessibility construction guidelines. However these results need to be verified in non-ambulatory populations. C is frequently prescribed, but generates large COP deviation, suggesting it may present an increased risk of falls.	{ "pile_set_name": "PubMed Abstracts" }
Blog Post What Does Your Credit Score Mean? Credit scores are very important, especially in today’s society. They are used to determine how much you can borrow and at what rate you can do so. This is very significant for when you are looking to make larger purchases like a car or home. The same can be said for those who are simply looking to take out a loan for unforeseen circumstances. What is a Credit Check? In many cases your credit score range is very significant in determining what is financially possible for you. You may be wondering; how do I know whether my credit score is good or not? There are credit score ranges that signify how good or bad your credit score is. For example, 350 to 650 is considered to be a poor credit score range while 720 to 850 is considered to be an excellent credit score range. Don’t worry; if you’d like to improve your credit, there are many places to help you get started in the right direction. Free Credit Checks Plenty of great tools exist to help you figure out what your credit score is. Many different sites offer free credit reports to the public so you are able to see where you exactly stand. Here are some great examples of different places to get your free credit report: www.freecreditreport.com, www.creditkarma.com and www.myfico.com. All of these websites are very useful and are great starting points for improving your credit or even just to see where you currently stand. Be sure to take advantage of these free credit report tools! No Credit Check at AmeriCash Loans At AmeriCash Loans, credit scores do not play any role in determining whether or not you can receive a loan from us. We perform no credit score checks. We welcome those with a wide variety of credit scores to apply for a loan from us. Always remember, if you are stuck in a tight spot and need a little extra cash, AmeriCash Loans has got you covered. You may be eligible for a loan up to $2,500, without a credit check! APPLY NOW AMERICASH LOANS * Loan amounts and requirements vary by location. Restrictions may apply. See the location near you for details. Please note that the same-day funding option is only available during normal business hours and at store locations. By submitting a short application you agree to receive email, phone and text correspondence. If using Internet Explorer, this site is best viewed and used with Internet Explorer 10 and later versions. Consumers Beware: Please be on the alert for scam artists using the company name, AmeriCash Loans, or company website, www.AmeriCashLoans.net, in an attempt to defraud you of money. AmeriCash will never ask you to forward a payment before issuing you a loan or on condition of issuing you a loan. If you receive a suspicious call or email, please contact our customer service department at 888.907.4227 to verify its authenticity before sharing any confidential information. Thank you.	{ "pile_set_name": "Pile-CC" }
Manufacturers can often pick and choose between power units, so here's a low-down of what they all equate to Share Tweet Email Whatsapp Power units are always the headline figures associated with any new performance car and can provide interesting comparisons between cars across the entire spectrum of automotive production. Power as an entity is a measure of how quickly and how far an engine can force the car forward, with that force being the torque produced from the internal combustion. This is generalised in engineering as the amount of ‘work’ the car has to do to propel itself along and has taken many forms since the early days of internal combustion. Generally divided into three main units used in different areas across the globe, let’s delve into what each unit of measurement means and how they compare to each other. Kilowatts 1kW = 1.341hp Technically, this form of measurement is the most uniform method of measuring power and is used by every engineer worldwide. Watts are an SI unit (International System) which means they are based around the metre, kilogram, joule and second that make up the metric system. It is a measurement of energy transfer over time, which is the exact job that an internal combustion engine undertakes. Used as a unit for cars mostly in the Southern Hemisphere, Kilowatts can be measured by finding the torque value from the wheels on a rolling road, followed by applying this equation: Kilowatts are a modern take on car power output and I wouldn’t be surprised if it becomes the norm to use this form in Europe, although it may take a lot more to persuade Americans to make the transition. Although considering the rise of the electric car, it would make a whole tonne of sense to start switching, as the capabilities of electric motors are measured using kWh (Kilowatt hours) which dictates how long the electric motors can produce a certain amount of power for. Horsepower Created by the master of the steam engine – Mr James Watt – this unit of power has somehow still survived to this day as the staple unit of power measurement of new cars where I’m from. Horsepower was deemed equivalent to a horse moving 33,000 pounds of mass one foot in one minute. Now no one knows how big this horse was or whether it was a particularly healthy horse or not…but let’s just go with it. This new-found unit allowed Watt to show direct comparisons between his steam locomotives and the common horse that dominated the haulage business up until the invention of the steam engine. Horsepower still survives as the main power unit for us petrolheads in the UK and you lot over in the USA, staving off any outside influences from Continental Europe and Australasia. Again, this power unit can be found by a torque translation using a similar equation to that of the Watt: It may start off as a bit of a mess, but this equation simplifies down to something very similar to that of the Watt equation Horsepower can become a tricky business however, with values measured in different ways. BHP (brake horsepower) refers to the equipment needed to test the engines for their power outputs, with a large drum with a water brake within it measuring the braking force once the engine is spinning at a desired rate. Over in the US, this is measured with only some ancillary components attached to the powertrain, missing things like the power steering pump which would lead to a lack of parasitic losses if in place. Therefore higher ‘HP’ figures are calculated in the US than the BHP figures calculated in Europe where every component is kept in place. WHP or wheel-horsepower is a greater indicator of the usable power that an engine produces, as this is calculated using the exact torque that has made it through the drivetrain and is driving the wheels. PS 1PS = 0.986hp PS stands for pferdestärke which translates simply as horsepower, but it has had some metric tweaking to try and bring good old HP forward into the 21st Century. This metric horsepower has been adopted throughout Europe as the new standard for power measurement and will probably make its way fully into the UK psyche in the not too distant future. The official engineering standard for metric horsepower is the amount of power needed to lift a 75kg of mass one metre vertically in one second, which – once the conversions from imperial to metric are applied – equates to a 1.4 per cent higher figure than the old imperial units. Manufacturers will often pick and choose between PS and HP depending on whatever figure seems more rounded and presentable. Although I’ve always just seen PS as ‘horsepower plus a few’. To summarise these three units of power, let’s break down famous cars and their relevant figures to put the new and old units into perspective: Nissan Skyline GTR R34: 206kW = 276hp = 280PS (advertised) McLaren 570S: 419kW = 562hp = 570PS Honda Civic Type-R FK2: 228kW = 306hp = 310PS Bugatti Chiron: 1,103kW = 1,479hp = 1500PS	{ "pile_set_name": "OpenWebText2" }
Hemodynamic correlates of visuomotor motor adaptation by functional Near Infrared Spectroscopy. The development of rehabilitation engineering technologies such as the design of smart prosthetics necessitates a deep understanding of brain mechanisms engaged in ecological situations when human interact with new tools and/or environments. Thus, we aimed to investigate potential hemodynamic signatures reflecting the level of cognitive-motor performance and/or the internal or mental states of individuals when learning a novel tool with unknown properties. These markers were derived from functional Near Infrared Spectroscopy (fNIR) signals. Our results indicate an increased level of oxy-hemoglobin in prefrontal sensors associated with enhanced kinematics during early compared with late learning. This is consistent with previous neuroimaging studies that revealed a higher contribution of prefrontal areas during early compare to late adaptation learning. These non-invasive functional hemodynamic markers may play a role in bioengineering applications such as smart neuroprosthesis and brain monitoring where adaptive behavior is important.	{ "pile_set_name": "PubMed Abstracts" }
D.G. Kerr (1916 ship) D.G. Kerr was a lake freighter, launched in 1916, for the Pittsburg Steamship Company. Ownership was transferred to US Steel, in 1952. She is considered to be a "600 footer", a vessel whose design was based on the J. Pierpont Morgan, built in 1903. In 1921 the DG Kerr set a record, loading her entire capacity of 12,507 tons of ore, in just 16 and a half minutes. She ran aground in 1970, and was permanently laid up in 1975. She was lost, off the Azores, while under tow to a Spanish ship breaker's yard. Namesake The vessel was named in honor of David Garret Kerr, a Vice President of U.S. Steel. References Category:1916 ships Category:Great Lakes freighters	{ "pile_set_name": "Wikipedia (en)" }
He thought they were his friends. The 16-year-old autistic boy allegedly assaulted by two teenage girls in Southern Maryland is perplexed by the criminal charges they are facing and even considers one of them his girlfriend, according to the boy’s mother. “He doesn’t appear to be traumatized. He thinks these girls are his friends and is surprised the police are involved,” said his mother, who works for a local health department. “But I am glad they are [investigating]. I am glad someone brought this out.” The Post is not naming the mother to protect the identity of the victim, who is a minor. News of the criminal charges in mostly rural St. Mary’s County has rippled across the Internet, creating a furor. Police said the two girls — ages 17 and 15 — assaulted the boy repeatedly between December and February and used their cellphones to record the attacks. The videos allegedly show them holding a knife to the victim’s throat, forcing him to perform various sexual acts, kicking him in the groin and dragging him around by his hair. Lauren Bush, 17, of Mechanicsville (Courtesy of St. Mary's County Sheriff's Office) At least once, the two suspects lured the victim onto a partially frozen pond to chase a ball even though they knew the ice was thin, police said. The boy fell through the ice several times, but the suspects refused to help him out of the frigid water, police said. The boy was able to pull himself out of the pond, according to Sgt. Cara Grumbles, a spokeswoman for the St. Mary’s County Sheriff’s Office. The 17-year-old, Lauren A. Bush of Mechanicsville, is charged as an adult with two counts of first-degree assault, two counts of second-degree assault and other charges. She is being held at the St. Mary’s County Detention Center. The 15-year-old, who is charged as a juvenile, also is facing assault counts, authorities said. She is being held at the Waxter Children’s Center, they said. Police said the investigation is ongoing. Voice mails left by The Post for Bush’s parents produced no response. All three teens attended Chopticon High School in Morganza. In her interview with The Post, the mother said she has pressed her son for details about what happened between him and the girls. But her son, who was diagnosed with autism in elementary school, hasn’t been forthcoming and shrugged off the alleged assaults as playful behavior. The mother said her son is fairly independent and performs well in classes but is socially “naive” and cannot comprehend that he may have been manipulated. “He’s not a good judge of people,” the mother said. “I keep trying to talk to him about it, but it’s hard to get much out of him. I’ll say, ‘This is what so-and-so told me, and I know this happened,’ but he’ll act like, ‘Oh, [the girls] were just playing around.’ He didn’t deny anything. I am trying to make him understand that people are talking about this all over TV, but he wanted to go to school today.” The mother said she learned Friday that police were investigating the incidents involving her son but didn’t learn the details until this week. “Apparently, these girls recorded all this stuff on their phones, and someone saw it and reported it,” she said. The boy and the two girls socialized frequently, the mother said, and she had heard their names but had never met them. The girls would go to movies with her son and hang out at the boy’s home on snow days. The mother said she believes that the attacks against her son took place when she and her husband were at work on days when snow closed schools. She knew about the incident involving the partially frozen pond, she said. When she got home from work that day and asked her son why his clothes were wet, he said he had tried walking on the pond and fell in. He denied that his friends coerced him, she said. Wednesday evening, the mother said she had not seen the videos of her son being assaulted and has not called the parents of the girls. Several weeks ago, she said, she considered calling the younger of the two girls — the 15-year-old who her son believes is his girlfriend — because he had been spending a lot of his savings on her. With so much outrage pouring out online, the boy’s mother said she is trying to reserve judgment about the girls’ parents. “I can’t judge them. They don’t know what their daughters are doing, I assume,” she said. “I fear that people are going to blame me and say, ‘You have this mentally challenged kid; why don’t you know where he is all the time?’ But he has a learner’s permit, and he’s been coming alone from school since he was 12. He can take care of himself, but he trusted these girls.” The mother said she worries that her son is not grasping the full scope of what happened. “We told him that what these girls did was unacceptable,” the mother said. “But yesterday, I asked him, ‘You’re going to stay away from these girls, right? You don’t plan on hanging out with them again, right?’ He said, ‘I don’t know.’ ” Jennifer Jenkins contributed to this report.	{ "pile_set_name": "OpenWebText2" }
Aging The Ohio population is getting old. That's according to a study from Miami University. As WYSO's Emily McCord reports, at least a third of the population will be at least 60 years old by the year 2050.	{ "pile_set_name": "Pile-CC" }
Ukraine is a key transit route of Russian gas to Europe President Viktor Yushchenko has said Ukraine has paid its debt to Gazprom in full, to prevent the Russian firm cutting off its gas supplies. But Gazprom said it had not received the money so far and "it is too early to talk about debt repayment". Talks continued in Moscow as the two sides also need to agree on a price for 2009 gas supplies to Ukraine. The Russian monopoly has threatened to cut off gas to Ukraine unless Ukraine signs a new contract by 1 January. "The money will be transferred today, in two or three hours," said a spokesman for Naftogaz. Earlier, the Ukrainian government allowed Naftogaz to borrow up to $2bn (£1.3bn) to pay the debt. Gazprom has said Ukraine owes $1.67bn (£1.1bn) for gas and $450m in fines for November-December supplies. Earlier, Gazprom chief executive Alexei Miller told Russian news television channel Vesti that "Gazprom will have no grounds for supplying gas to Ukraine" if it does not pay out its debt. Ukraine is a key transit route of Russian gas to Europe, and it is feared that a supply cut could affect countries further west. Gazprom, the world's largest gas producer, supplies a quarter of the European Union's gas needs, or 42% of EU's gas imports. A similar row between Gazprom and Ukraine in 2006 led to gas shortages in several EU countries. Prices impact Gazprom supplies about one quarter of Europe's gas Separately on Tuesday, Gazprom reported a solid rise in profits and sales following record gas and oil prices in the first half of the year. For the six months to 30 June, net profit jumped 85% to 609.4bn roubles ($20.8bn, £14.2bn) compared with the same period in 2007. Sales rose 52% to 1.74 trillion roubles on both higher prices and volumes. However oil prices have slumped from July highs and most observers expect oil firms to see future profits slide. The firm also said the credit crunch has affected its ability to attract loans. "At the moment the management can not certainly assess the impact of further decrease in financial markets' liquidity and the growing instability of foreign exchange and stock markets on the group's financial state," the company said in a statement. Bookmark with: Delicious Digg reddit Facebook StumbleUpon What are these? E-mail this to a friend Printable version	{ "pile_set_name": "OpenWebText2" }
Cell-signaling processes mediated by ubiquitinylation, the post-translational covalent conjugation of ubiquitin molecules, are of prime importance for cellular activity and particularly for protein turnover. Ubiquitin-ligase enzymes, E3s, are responsible for the last step of the ubiquitinylation reaction. The E3 cullin-RING ubiquitin ligases (CRLs) represent the main ubiquitin ligase family. Among several factors that regulate CRL activity, cullin neddylation/deneddylation cycles are central (1). The COP9 signalosome (CSN), a large multiprotein complex that resembles the 19S lid of the 26S proteasome, plays a central role in the regulation of the E3-cullin RING ubiquitin ligases (CRLs). Due to the fact that a large number of proteins are ubiquitinylated by CRLs, the COP9 signalosome (CSN) is implicated in the control of a significant proportion of the proteome, including pro-oncogenes (for example Myc), tumor suppressors (for example p53) and other important cellular protagonists. Different biological and biochemical functions of the CSN complex have been studied over the years, but by far the most studied is its role as a CRL deneddylase. The catalytic activity of the CSN complex, carried by subunit 5 (CSN5/Jab1), resides in the deneddylation of the CRLs, that is the hydrolysis of the cullin-Nedd8 isopeptide bond. Structurally, the CSN is an eight-subunit complex of about 320 kDa (six PCI (proteasome COP9 eIF3)-based subunits and two Mpr1-Pad1-N-terminal [MPN]-containing subunits). Subunit 5 (CSN5), one of the MPN-containing subunits, carries a zinc-dependent isopeptidase catalytic centre that contains a JAMM (Jab1/MPN/Mov34) motif (also known as MPN+ motif; (2)). Recent detailed studies suggested that the organization of the CSN complex resembles that of the 26S proteasome lid (3), with the deubiquitinase enzyme Rpn11 being the equivalent of the deneddylating subunit CSN5 (2, 4). The CSN, implicated in various cellular functions, ranging from cell cycles, to circadian rhythm, to immunity, is a very well conserved multi-protein complex in eukaryotes, from plants to mammalian cells. Its importance in cellular functions has been highlighted by genetic studies (5). The physiology of the CSN in normal cells has been well researched, and many studies have found a strong link between the CSN and cancers (6). Intriguingly, the CSN cancer implication is attributable to mainly CSN5, which is located on human chromosome 8q—itself often amplified in cancers. Smaller forms of the holo-CSN complex, with variable compositions, have been found in vivo (7-11). Although important in cell cycle progression, these sub-CSN complexes have not yet been fully functionally characterized (12). It is interesting that, as alluded to for Rpn11 in the context of the proteasome lid (4), CSN5 is found in two forms, a holo-CSN-associated form that is catalytically active and a holo-CSN-independent state void of isopeptidase activity (2, 3). The modularity and topology of the CSN complex have been explored in vitro by non-denaturing mass spectrometry (MS), which revealed that CSN5 is a peripheral subunit that can homo-dimerize outside of the CSN complex and interacts mostly with the other MPN-containing subunit, CSN6, in the context of the CSN complex (3). The potential interactions of CSN5 with other CSN subunits, namely CSN1, CSN2, CSN4 and CSN7, have been highlighted in earlier reports (1, 8, 13, 14). Whereas CSN-dependent CSN5 displays isopeptidase activity, it is intrinsically inactive in other physiologically relevant forms. To elucidate the molecular regulation of CSN5 activity, the inventors structurally and functionally characterized it in its CSN-independent form by X-ray crystallography, molecular dynamics (MD) simulations, and in vitro studies. Furthermore, the invention provides a preliminary glimpse into the rational screening of small molecules, antibodies, peptides, pseudopeptide, and polypeptides inhibitors of CSN5 isopeptidase activity.	{ "pile_set_name": "USPTO Backgrounds" }
[Immunological studies in a case of congenital nephrotic syndrome with focal extracapillary proliferative glomerulonephritis (author's transl)]. An immunological study in a case of nephrotic syndrome in early infancy with mesangioproliferative glomerulonephritis with focal crescents revealed deficiencies in humoral and cellular immunity. Serum Ig-G antibody levels such as pertussis-agglutinins, tetanus and diophtheria-antitoxing were decreased. A loss of tetanus antibodies in the urine could be observed. The production of tetanus-antibodies after immunogenic stimulation with tetanus-antigen was not diminished. The loss of Ig-A in the urine might have been compensated by a higher synthesis rate, which could also be the cause of the increased serum levels of Ig-M, since a loss of Ig-M in urine was not observed. The diminished serum levels of Ig-G antibodies were considered not only to be the result of loss, but possibly also of higher catabolism, and an insufficient compensation by a higher rate of synthesis. The percentage of T-cells in peripheral blood was found to be low. Stimulation of lymphocytes with PHA was at first normal, but in the last investigations diminished. Special experiments lead to the assumption, that this partial defect of cellular immunity might be the result of lacking or diminution of nutritive plasmafactors.	{ "pile_set_name": "PubMed Abstracts" }
import KsApi import Library import Prelude import UIKit internal final class PaymentMethodsViewController: UIViewController, MessageBannerViewControllerPresenting { private let dataSource = PaymentMethodsDataSource() private let viewModel: PaymentMethodsViewModelType = PaymentMethodsViewModel() @IBOutlet private var tableView: UITableView! fileprivate lazy var editButton: UIBarButtonItem = { UIBarButtonItem( title: Strings.discovery_favorite_categories_buttons_edit(), style: .plain, target: self, action: #selector(edit) ) }() internal var messageBannerViewController: MessageBannerViewController? public static func instantiate() -> PaymentMethodsViewController { return Storyboard.Settings.instantiate(PaymentMethodsViewController.self) } override func viewDidLoad() { super.viewDidLoad() self.messageBannerViewController = self.configureMessageBannerViewController(on: self) self.tableView.register(nib: .CreditCardCell) self.tableView.dataSource = self.dataSource self.tableView.delegate = self self.configureHeaderFooterViews() self.navigationItem.rightBarButtonItem = self.editButton self.editButton.possibleTitles = [ Strings.discovery_favorite_categories_buttons_edit(), Strings.Done() ] self.dataSource.deletionHandler = { [weak self] creditCard in self?.viewModel.inputs.didDelete(creditCard, visibleCellCount: self?.tableView.visibleCells.count ?? 0) } self.viewModel.inputs.viewDidLoad() } override func viewWillAppear(_ animated: Bool) { super.viewWillAppear(animated) self.viewModel.inputs.viewWillAppear() } override func viewDidLayoutSubviews() { super.viewDidLayoutSubviews() self.tableView.ksr_sizeHeaderFooterViewsToFit() } override func bindStyles() { super.bindStyles() _ = self \|> settingsViewControllerStyle \|> UIViewController.lens.title %~ { _ in Strings.Payment_methods() } _ = self.tableView \|> tableViewStyle \|> tableViewSeparatorStyle } override func bindViewModel() { super.bindViewModel() self.editButton.rac.enabled = self.viewModel.outputs.editButtonIsEnabled self.viewModel.outputs.paymentMethods .observeForUI() .observeValues { [weak self] result in self?.dataSource.load(creditCards: result) self?.tableView.reloadData() } self.viewModel.outputs.reloadData .observeForUI() .observeValues { [weak self] in self?.tableView.reloadData() } self.viewModel.outputs.goToAddCardScreenWithIntent .observeForUI() .observeValues { [weak self] intent in self?.goToAddCardScreen(with: intent) } self.viewModel.outputs.errorLoadingPaymentMethods .observeForUI() .observeValues { [weak self] message in self?.messageBannerViewController?.showBanner(with: .error, message: message) } self.viewModel.outputs.presentBanner .observeForUI() .observeValues { [weak self] message in self?.messageBannerViewController?.showBanner(with: .success, message: message) } self.viewModel.outputs.tableViewIsEditing .observeForUI() .observeValues { [weak self] isEditing in self?.tableView.setEditing(isEditing, animated: true) } self.viewModel.outputs.showAlert .observeForControllerAction() .observeValues { [weak self] message in self?.present(UIAlertController.genericError(message), animated: true) } self.viewModel.outputs.editButtonTitle .observeForUI() .observeValues { [weak self] title in _ = self?.editButton ?\|> \.title %~ { _ in title } } } // MARK: - Actions @objc private func edit() { self.viewModel.inputs.editButtonTapped() } private func goToAddCardScreen(with intent: AddNewCardIntent) { let vc = AddNewCardViewController.instantiate() vc.configure(with: intent) vc.delegate = self let nav = UINavigationController(rootViewController: vc) nav.modalPresentationStyle = .formSheet self.present(nav, animated: true) { self.viewModel.inputs.addNewCardPresented() } } // MARK: - Private Helpers private func configureHeaderFooterViews() { if let header = SettingsTableViewHeader.fromNib(nib: Nib.SettingsTableViewHeader) { header.configure(with: Strings.Any_payment_methods_you_saved_to_Kickstarter()) let headerContainer = UIView(frame: .zero) _ = (header, headerContainer) \|> ksr_addSubviewToParent() self.tableView.tableHeaderView = headerContainer _ = (header, headerContainer) \|> ksr_constrainViewToEdgesInParent() _ = header.widthAnchor.constraint(equalTo: self.tableView.widthAnchor) \|> \.priority .~ .defaultHigh \|> \.isActive .~ true } if let footer = PaymentMethodsFooterView.fromNib(nib: Nib.PaymentMethodsFooterView) { footer.delegate = self let footerContainer = UIView(frame: .zero) _ = (footer, footerContainer) \|> ksr_addSubviewToParent() self.tableView.tableFooterView = footerContainer _ = (footer, footerContainer) \|> ksr_constrainViewToEdgesInParent() _ = footer.widthAnchor.constraint(equalTo: self.tableView.widthAnchor) \|> \.priority .~ .defaultHigh \|> \.isActive .~ true } } } extension PaymentMethodsViewController: UITableViewDelegate { func tableView(_: UITableView, heightForFooterInSection _: Int) -> CGFloat { return 0.1 } func tableView(_: UITableView, heightForHeaderInSection _: Int) -> CGFloat { return 0.1 } } extension PaymentMethodsViewController: PaymentMethodsFooterViewDelegate { internal func paymentMethodsFooterViewDidTapAddNewCardButton(_: PaymentMethodsFooterView) { self.viewModel.inputs.paymentMethodsFooterViewDidTapAddNewCardButton() } } extension PaymentMethodsViewController: AddNewCardViewControllerDelegate { func addNewCardViewController( _: AddNewCardViewController, didAdd _: GraphUserCreditCard.CreditCard, withMessage message: String ) { self.dismiss(animated: true) { self.viewModel.inputs.addNewCardSucceeded(with: message) } } func addNewCardViewControllerDismissed(_: AddNewCardViewController) { self.dismiss(animated: true) { self.viewModel.inputs.addNewCardDismissed() } } } // MARK: - Styles private let tableViewStyle: TableViewStyle = { (tableView: UITableView) in tableView \|> \.backgroundColor .~ UIColor.clear \|> \.rowHeight .~ Styles.grid(11) \|> \.allowsSelection .~ false } private let tableViewSeparatorStyle: TableViewStyle = { tableView in tableView \|> \.separatorStyle .~ .singleLine \|> \.separatorColor .~ .ksr_grey_500 \|> \.separatorInset .~ .init(left: Styles.grid(2)) }	{ "pile_set_name": "Github" }
458 U.S. 832 (1982) RAMAH NAVAJO SCHOOL BOARD, INC., ET AL. v. BUREAU OF REVENUE OF NEW MEXICO No. 80-2162. Supreme Court of the United States. Argued April 28, 1982. Decided July 2, 1982. APPEAL FROM THE COURT OF APPEALS OF NEW MEXICO 833 Michael P. Gross argued the cause for appellants. With him on the briefs were Carl Bryant Rogers and Neal A. Jackson. Deputy Solicitor General Claiborne argued the cause for the United States as amicus curiae urging reversal. With him on the brief were Solicitor General Lee, Assistant Attorney General Dinkins, Elinor Hadley Stillman, Edward J. Shawaker, and Maria A. Iizuka. Jan Unna, Special Assistant Attorney General of New Mexico, argued the cause for appellee. With him on the brief were Jeff Bingaman, Attorney General, and Gerald B. Richardson, Assistant Attorney General.[] 834 JUSTICE MARSHALL delivered the opinion of the Court. In this case, we address the question whether federal law pre-empts a state tax imposed on the gross receipts that a non-Indian construction company receives from a tribal school board for the construction of a school for Indian children on the reservation. The New Mexico Court of Appeals held that the gross receipts tax imposed by the State of New Mexico was permissible. Because the decision below is inconsistent with White Mountain Apache Tribe v. Bracker, 448 U. S. 136 (1980) (White Mountain), we reverse. I Approximately 2,000 members of the Ramah Navajo Chapter of the Navajo Indian Tribe live on tribal trust and allotment lands located in west central New Mexico. Ramah Navajo children attended a small public high school near the reservation until the State closed this facility in 1968. Because there were no other public high schools reasonably close to the reservation, the Ramah Navajo children were forced either to abandon their high school education or to attend federal Indian boarding schools far from the reservation. In 1970, the Ramah Navajo Chapter exercised its authority under Navajo Tribal Code, Title 10, § 51 (1969), and established its own school board in order to remedy this situation. Appellant Ramah Navajo School Board, Inc. (the Board), was organized as a nonprofit corporation to be operated exclusively by members of the Ramah Navajo Chapter. The Board is a Navajo "tribal organization" within the meaning of 25 U. S. C. § 450b(c), 88 Stat. 2204. With funds provided by the federal Bureau of Indian Affairs (BIA) and the Navajo Indian Tribe, the Board operated a school in the abandoned public school facility, thus creating the first independent Indian school in modern times.[1] 835 In 1972, the Board successfully solicited from Congress funds for the design of new school facilities. Pub. L. 92-369, 86 Stat. 510. The Board then contracted with the BIA for the design of the new school and hired an architect. In 1974, the Board contracted with the BIA for the actual construction of the new school to be built on reservation land. Funding for the construction of this facility was provided by a series of congressional appropriations specifically earmarked for this purpose.[2] The contract specified that the Board was the design and building contractor for the project, but that the Board could subcontract the actual construction work to third parties. The contract further provided that any subcontracting agreement would have to include certain clauses governing pricing, wages, bonding, and the like, and that it must be approved by the BIA. The Board then solicited bids from area building contractors for the construction of the school, and received bids from two non-Indian firms. Each firm included the state gross receipts tax as a cost of construction in their bids, although the tax was not itemized separately. Appellant Lembke Construction Co. (Lembke) was the low bidder and was awarded the contract. The contract between the Board and Lembke provides that Lembke is to pay all "taxes required by law." Lembke began construction of the school facilities in 1974 and continued this work for over five years. During that time, Lembke paid the gross receipts tax and, pursuant to standard industry practice, was reimbursed by the Board for the full amount paid. Before the second contract between Lembke and the Board was executed in 1977, a clause was inserted into the contract recognizing that the Board could 836 litigate the validity of this tax and was entitled to any refund. Both Lembke and the Board protested the imposition of the gross receipts tax. In 1978, after exhausting administrative remedies, they filed this refund action against appellee New Mexico Bureau of Revenue in the New Mexico District Court. At the time of trial, the parties stipulated that the Board had reimbursed Lembke for tax payments of $232,264.38 and that the Board would receive any refund that might be awarded. The trial court entered judgment for the State Bureau of Revenue. After noting that the "legal incidence" of the tax fell on the non-Indian construction firm, the court rejected appellants' arguments that the tax was pre-empted by comprehensive federal regulation and that it imposed an impermissible burden on tribal sovereignty. The Court of Appeals for the State of New Mexico affirmed. 95 N. M. 708, 625 P. 2d 1225 (1980). Although acknowledging that the economic burden of the tax fell on the Board, the Court of Appeals concluded that the tax was not preempted by federal law and that it did not unlawfully burden tribal sovereignty. The Board filed a petition for rehearing in light of this Court's intervening decisions in White Mountain, supra, and Central Machinery Co. v. Arizona State Tax Comm'n, 448 U. S. 160 (1980). The Court of Appeals denied the petition, stating only that this case did not involve either "a comprehensive or pervasive scheme of federal regulation" or "federal regulation similar to the Indian trader statutes." App. to Juris. Statement 36. After initially granting discretionary review, the New Mexico Supreme Court quashed the writ as improvidently granted. 96 N. M. 17, 627 P. 2d 412 (1981). We noted probable jurisdiction. 454 U. S. 1079 (1981). II In recent years, this Court has often confronted the difficult problem of reconciling "the plenary power of the States over residents within their borders with the semi-autonomous 837 status of Indians living on tribal reservations." McClanahan v. Arizona State Tax Comm'n, 411 U. S. 164, 165 (1973). Although there is no definitive formula for resolving the question whether a State may exercise its authority over tribal members or reservation activities, we have recently identified the relevant federal, tribal, and state interests to be considered in determining whether a particular exercise of state authority violates federal law. See White Mountain, 448 U. S., at 141-145. A In White Mountain, we recognized that the federal and tribal interests arise from the broad power of Congress to regulate tribal affairs under the Indian Commerce Clause, Art. I, § 8, cl. 3, and from the semi-autonomous status of Indian tribes. 448 U. S., at 142. These interests tend to erect two "independent but related" barriers to the exercise of state authority over commercial activity on an Indian reservation: state authority may be pre-empted by federal law, or it may interfere with the tribe's ability to exercise its sovereign functions. Ibid. (citing, inter alia, Warren Trading Post Co. v. Arizona Tax Comm'n, 380 U. S. 685 (1965); McClanahan v. Arizona State Tax Comm'n, supra; and Williams v. Lee, 358 U. S. 217 (1959)). As we explained in White Mountain: "The two barriers are independent because either, standing alone, can be a sufficient basis for holding state law inapplicable to activity undertaken on the reservation or by tribal members. They are related, however, in two important ways. The right of tribal self-government is ultimately dependent on and subject to the broad power of Congress. Even so, traditional notions of Indian self-government are so deeply engrained in our jurisprudence that they have provided an important `backdrop,'... against which vague or ambiguous federal enactments must always be measured." 448 U. S., at 838 143 (quoting McClanahan v. Arizona State Tax Comm'n, supra, at 172). The State's interest in exercising its regulatory authority over the activity in question must be examined and given appropriate weight. Pre-emption analysis in this area is not controlled by "mechanical or absolute conceptions of state or tribal sovereignty"; it requires a particularized examination of the relevant state, federal, and tribal interests. 448 U. S., at 145. The question whether federal law, which reflects the related federal and tribal interests, pre-empts the State's exercise of its regulatory authority is not controlled by standards of pre-emption developed in other areas. Id., at 143-144. Instead, the traditional notions of tribal sovereignty, and the recognition and encouragement of this sovereignty in congressional Acts promoting tribal independence and economic development, inform the pre-emption analysis that governs this inquiry. See id., at 143, and n. 10. Relevant federal statutes and treaties must be examined in light of "the broad policies that underlie them and the notions of sovereignty that have developed from historical traditions of tribal independence." Id., at 144-145. As a result, ambiguities in federal law should be construed generously, and federal pre-emption is not limited to those situations where Congress has explicitly announced an intention to pre-empt state activity. Id., at 143-144, 150-151. In White Mountain, we applied these principles and held that federal law pre-empted application of the state motor carrier license and use fuel taxes to a non-Indian logging company's activity on tribal land. We found the federal regulatory scheme for harvesting Indian timber to be so pervasive that it precluded the imposition of additional burdens by the relevant state taxes. Id., at 148. The Secretary of the Interior (Secretary) had promulgated detailed regulations for developing "`Indian forests by the Indian people for the purpose of promoting self-sustaining communities.'" Id., at 147 (quoting 25 CFR § 141.3(a)(3) (1979)). 839 Under these regulations, the BIA was involved in virtually every aspect of the production and marketing of Indian timber. 448 U. S., at 145-148. In particular, the Secretary and the BIA extensively regulated the contractual relationship between the Indians and the non-Indians working on the reservation: they established the bidding procedure, set mandatory terms to be included in every contract, and required that all contracts be approved by the Secretary. Id., at 147. We found that the state taxes in question would "threaten the overriding federal objective of guaranteeing Indians that they will `receive ... the benefit of whatever profit [the forest] is capable of yielding....'" Id., at 149 (quoting 25 CFR § 141.3(a)(3) (1979)). We concluded that the imposition of state taxes would also undermine the Secretary's ability to carry out his obligations to set fees and rates for the harvesting and sale of the timber, and it would impede the "Tribe's ability to comply with the sustained-yield management policies imposed by federal law." 448 U. S., at 149-150. Balanced against this intrusion into the federal scheme, the State asserted only "a general desire to raise revenue" as its justification for imposing the taxes. Id., at 150. In this context, this interest is insufficient to justify the State's intrusion into a sphere so heavily regulated by the Federal Government. Ibid. B This case is indistinguishable in all relevant respects from White Mountain. Federal regulation of the construction and financing of Indian educational institutions is both comprehensive and pervasive. The Federal Government's concern with the education of Indian children can be traced back to the first treaties between the United States and the Navajo Tribe.[3] Since that time, Congress has enacted numerous 840 statutes empowering the BIA to provide for Indian education both on and off the reservation. See, e. g., Snyder Act, 42 Stat. 208 (1921), 25 U. S. C. § 13; Johnson-O'Malley Act, 48 Stat. 596 (1934), 25 U. S. C. § 452 et seq.; Navajo-Hopi Rehabilitation Act, 64 Stat. 44 (1950), 25 U. S. C. § 631 et seq.; Indian Self-Determination and Education Assistance Act, 88 Stat. 2203 (1975), 25 U. S. C. § 450 et seq. (Self-Determination Act). Although the early focus of the federal efforts in this area concentrated on providing federal or state educational facilities for Indian children, in the early 1970's the federal policy shifted toward encouraging the development of Indian-controlled institutions on the reservation. See 6 Weekly Comp. of Pres. Doc. 894, 899-900 (1970) (Message of President Nixon). This federal policy has been codified in the Indian Financing Act of 1974, 88 Stat. 77, 25 U. S. C. § 1451 et seq., and most notably in the Self-Determination Act. The Self-Determination Act declares that a "major national goal of the United States is to provide the quantity and quality of educational services and opportunities which will permit Indian children to compete and excel in the life areas of their choice, and to achieve the measure of self-determination essential to their social and economic well-being." 88 Stat. 2203, as set forth in 25 U. S. C. § 450a(c). In achieving this goal, Congress expressly recognized that "parental and community control of the educational process is of crucial importance to the Indian people." 88 Stat. 2203, as set forth in 25 U. S. C. § 450(b)(3). Section 450k empowers the Secretary to promulgate regulations to accomplish the purposes of the Act. 88 Stat. 2212, 25 U. S. C. § 450k. Pursuant to this authority, the Secretary has promulgated detailed and comprehensive regulations respecting "school construction for previously private 841 schools now controlled and operated by tribes or tribally approved Indian organizations." 25 CFR §274.1 (1981). Under these regulations, the BIA has wide-ranging authority to monitor and review the subcontracting agreements between the Indian organization, which is viewed as the general contractor, and the non-Indian firm that actually constructs the facilities. See 25 CFR § 274.2 (1981).[4] Specifically, the BIA must conduct preliminary on-site inspections, and prepare cost estimates for the project in cooperation with the tribal organization. 25 CFR § 274.22 (1981). The Board must approve any architectural or engineering agreements executed in connection with the project. 25 CFR § 274.32(c) (1981). In addition, the regulations empower the BIA to require that all subcontracting agreements contain certain terms, ranging from clauses relating to bonding and pay scales, 41 CFR § 14H-70.632 (1981), to preferential treatment for Indian workers. 25 CFR § 274.38 (1981). Finally, to ensure that the Tribe is fulfilling its statutory obligations, the regulations require the tribal organization to maintain records for the Secretary's inspection. 25 CFR § 274.41 (1981). This detailed regulatory scheme governing the construction of autonomous Indian educational facilities is at least as comprehensive as the federal scheme found to be pre-emptive in White Mountain.[5] The direction and supervision provided 842 by the Federal Government for the construction of Indian schools leave no room for the additional burden sought to be imposed by the State through its taxation of the gross receipts paid to Lembke by the Board. This burden, although nominally falling on the non-Indian contractor, necessarily impedes the clearly expressed federal interest in promoting the "quality and quantity" of educational opportunities for Indians by depleting the funds available for the construction of Indian schools.[6] 843 The Bureau of Revenue argues that imposition of the state tax is not pre-empted because the federal statutes and regulations do not specifically express the intention to pre-empt this exercise of state authority. This argument is clearly foreclosed by our precedents. In White Mountain we flatly rejected a similar argument. 448 U. S., at 150-151 (citing Warren Trading Post Co. v. Arizona Tax Comm'n, 380 U. S. 685 (1965); Williams v. Lee, 358 U. S. 217 (1959); and Kennerly v. District Court of Montana, 400 U. S. 423 (1971)). There is nothing unique in the nature of a gross receipts tax or in the federal laws governing the development of tribal self-sufficiency in the area of education that requires a different analysis. In this case, the State does not seek to assess its tax in return for the governmental functions it provides to those who must bear the burden of paying this tax. Having declined to take any responsibility for the education of these Indian children, the State is precluded from imposing an additional burden on the comprehensive federal scheme intended to provide this educationa scheme which has "left the State with no duties or responsibilities." Warren Trading Post Co. v. Arizona Tax Comm'n, supra, at 691.[7] Nor has the State asserted any specific, legitimate regulatory interest to justify the imposition of its gross receipts tax. The only arguably 844 specific interest advanced by the State is that it provides services to Lembke for its activities off the reservation. This interest, however, is not a legitimate justification for a tax whose ultimate burden falls on the tribal organization.[8] Furthermore, although the State may confer substantial benefits on Lembke as a state contractor, we fail to see how these benefits can justify a tax imposed on the construction of school facilities on tribal lands pursuant to a contract between the tribal organization and the non-Indian contracting firm.[9] The New Mexico gross receipts tax is intended to compensate the State for granting "the privilege of engaging in business." N. M. Stat. Ann. §§ 7-9-3(F) and 7-9-4(A) (1980). New Mexico has not explained the source of its power to levy such a tax in this case where the "privilege of doing business" on an Indian reservation is exclusively bestowed by the Federal Government. 845 The State's ultimate justification for imposing this tax amounts to nothing more than a general desire to increase revenues. This purpose, as we held in White Mountain, 448 U. S., at 150, is insufficient to justify the additional burdens imposed by the tax on the comprehensive federal scheme regulating the creation and maintenance of educational opportunities for Indian children and on the express federal policy of encouraging Indian self-sufficiency in the area of education.[10] This regulatory scheme precludes any state tax that "stands as an obstacle to the accomplishment of the full purposes and objectives of Congress." Hines v. Davidowitz, 312 U. S. 52, 67 (1941). C The Solicitor General, in an amicus brief filed on behalf of the United States, suggests that we modify our pre-emption analysis and rely on the dormant Indian Commerce Clause, Art. I, § 8, cl. 3, to hold that on-reservation activities involving a resident tribe are presumptively beyond the reach of state law even in the absence of comprehensive federal regulation, thus placing the burden on the State to demonstrate that its intrusion is either condoned by Congress or justified by a compelling need to protect legitimate, specified state interests other than the generalized desire to collect revenue. He argues that adopting this approach is preferable for several reasons: it would provide guidance to the state courts addressing these issues, thus reducing the need for our case-by-case review of these decisions; it would avoid the tension 846 created by focusing on the pervasiveness of federal regulation as a principal barrier to state assertions of authority when the primary federal goal is to encourage tribal self-determination and self-government; and it would place a higher burden on the State to articulate clearly its particularized interests in taxing the transaction and to demonstrate the services it provides in assisting the taxed transaction. We do not believe it necessary to adopt this new approachthe existing pre-emption analysis governing these cases is sufficiently sensitive to many of the concerns expressed by the Solicitor General. Although clearer rules and presumptions promote the interest in simplifying litigation, our precedents announcing the scope of pre-emption analysis in this area provide sufficient guidance to state courts and also allow for more flexible consideration of the federal, state, and tribal interests at issue. We have consistently admonished that federal statutes and regulations relating to tribes and tribal activities must be "construed generously in order to comport with ... traditional notions of [Indian] sovereignty and with the federal policy of encouraging tribal independence." White Mountain, supra, at 144; see also McClanahan v. Arizona State Tax Comm'n, 411 U. S., at 174-175, and n. 13; Warren Trading Post Co. v. Arizona Tax Comm'n, 380 U. S., at 690-691. This guiding principle helps relieve the tension between emphasizing the pervasiveness of federal regulation and the federal policy of encouraging Indian self-determination. Although we must admit our disappointment that the courts below apparently gave short shrift to this principle and to our precedents in this area, we cannot and do not presume that state courts will not follow both the letter and the spirit of our decisions in the future. III In sum, the comprehensive federal regulatory scheme and the express federal policy of encouraging tribal self-sufficiency in the area of education preclude the imposition of the 847 state gross receipts tax in this case. Accordingly, the judgment of the New Mexico Court of Appeals is reversed, and the case is remanded for further proceedings not inconsistent with this opinion. It is so ordered. JUSTICE REHNQUIST, with whom JUSTICE WHITE and JUSTICE STEVENS join, dissenting. The Court today reproves the New Mexico Court of Appeals for failing to heed our precedents, much as a disappointed parent would rebuke a wayward child.[1] I do not think the Court of Appeals deserves the rebuke; it seems to me that the state court applied our precedents at least as faithfully, and coherently, as the Court itself. In its desire to reach a result that it evidently finds quite salutary as a matter of policy, the Court finds "indistinguishable" a case that is considerably off the mark, and it finds "pervasively regulated" an activity that is largely free of federal regulation. It ultimately accords a dependent Indian tribal organization greater tax immunity than it accorded the sovereignty of the United States a short three months ago in a case involving the precise state taxes at issue here. I The general question presented by this case has occupied the Court many times in the recent past, and seems destined to demand its attention over and over again until the Court sees fit to articulate, and follow, a consistent and predictable rule of law. This insistent question concerns the extent to which the States can tax economic activity on Indian reservations within their borders. I believe the dominant trend of 848 our cases is toward treating the scope of reservation immunity from nondiscriminatory state taxation as a question of pre-emption, ultimately dependent on congressional intent. In such a framework, the tradition of Indian sovereignty stands as an independent barrier to discriminatory taxes, and otherwise serves only as a guide to the ascertainment of the congressional will. The principles announced in White Mountain Apache Tribe v. Bracker, 448 U. S. 136 (1980), are consistent with this trend.[2] Thus, the Court in White Mountain recognized federal pre-emption as a principal barrier to the assertion of state regulatory authority over tribal reservations and members, id., at 142, and specifically invalidated the challenged assertion of taxing authority on that basis, id., at 148, 151, n. 15. The Court also recognized that in some instances a state law may be invalid because it infringes "`the right of reservation Indians to make their own laws and be ruled by them.'" Id., at 142 (quoting Williams v. Lee, 358 U. S. 217, 220 (1959)). But apart from those rare instances in which the State attempts to interfere with the residual sovereignty of a tribe to govern its own members, the "tradition of tribal sovereignty" merely provides a "backdrop" against which the pre-emptive effect of federal statutes or treaties must be assessed. See 448 U. S., at 143. The Court today pays homage to these principles but then promptly bestows its favors on a new analytical framework in which the extent of economic burden on the tribe, and not the pre-emptive effect of federal regulations, appears to be the paramount consideration. Such a shift is necessary, for the 849 Court's purported reliance on White Mountain will not withstand even superficial scrutiny. II The Court declares that "[t]his case is indistinguishable in all relevant respects from White Mountain." Ante, at 839. This statement is quite inaccurate. White Mountain involved an attempt by the State of Arizona to apply its motor carrier license and use fuel taxes to the logging operations of a non-Indian company doing business exclusively on the reservation. The Court concluded that application of the State's taxes was inconsistent with the pervasive federal regulation of the very activity subject to taxation. The Court repeatedly emphasized the comprehensiveness of the regulations on which it relied. "Under these regulations, the Bureau of Indian Affairs exercises literally daily supervision over the harvesting and management of tribal timber. In the present case, contracts between [the tribal organization] and [the non-Indian contractor] must be approved by the Bureau; indeed, the record shows that some of those contracts were drafted by employees of the Federal Government. Bureau employees regulate the cutting, hauling, and marking of timber by [the tribal organization and the contractor]. The Bureau decides such matters as how much timber will be cut, which trees will be felled, which roads are to be used, which hauling equipment [the contractor] should employ, the speeds at which logging equipment may travel, and the width, length, height, and weight of loads. "The Secretary has also promulgated detailed regulations governing the roads developed by the Bureau of Indian Affairs.... On the Fort Apache Reservation the Forestry Department of the Bureau has required [the tribal organization] and its contractors ... to repair and 850 maintain existing Bureau and tribal roads and in some cases to construct new logging roads.... A high percentage of [the contractor's] receipts are expended for those purposes, and it has maintained separate personnel and equipment to carry out a variety of tasks relating to road maintenance." 448 U. S., at 147-148. But the Court in White Mountain did not merely review the comprehensiveness of the regulations and conclude, ipso facto, that state taxes on the logging operations were pre-empted. It found, with considerable attention to specifics, that "the assessment of state taxes would obstruct federal policies." Id., at 148. "At the most general level, the taxes would threaten the overriding federal objective of guaranteeing Indians that they will `receive ... the benefit of whatever profit [the forest] is capable of yielding. . . .' 25 CFR § 141.3(a)(3) (1979). Underlying the federal regulatory program rests a policy of assuring that the profits derived from timber sales will inure to the benefit of the Tribe subject only to administrative expenses incurred by the Federal Government.... "In addition, the taxes would undermine the Secretary's ability to make the wide range of determinations committed to his authority concerning the setting of fees and rates with respect to the harvesting and sale of tribal timber. The Secretary reviews and approves the terms of the Tribe's agreements with its contractors, sets fees for services rendered to the Tribe by the Federal Government, and determines stumpage rates for timber to be paid to the Tribe. Most notably in reviewing or writing the terms of the contracts between [the tribal organization] and its contractors, federal agents must predict the amount and determine the proper allocation of all business expenses, including fuel costs. The assessment of state taxes would throw additional 851 factors into the federal calculus, reducing tribal revenues and diminishing the profitability of the enterprise for potential contractors. "Finally, the imposition of state taxes would adversely affect the Tribe's ability to comply with the sustained-yield management policies imposed by federal law." Id., at 149-150. As noted, the Court thinks that this case is "indistinguishable in all relevant respects from White Mountain." Ante, at 839. It finds that "[f]ederal regulation of the construction and financing of Indian educational institutions is both comprehensive and pervasive." Ibid. But the regulations on which the Court relies do not regulate school construction, which is the activity taxed. They merely detail procedures by which tribes may apply for federal funds in order to carry out school construction. The purpose of the regulations, which the Court quotes only in part, ante, at 840-841, "is to give the application and approval process for obtaining a contract or services from the Bureau for school construction for previously private schools now controlled and operated by tribes or tribally approved Indian organizations ...." 25 CFR § 274.1 (1981) (emphasis added). The regulations that follow explain the procedures by which tribes may obtain, complete, and file application forms for federal funding or services. §§ 274.12-274.18. As the Court observes, ante, at 841, the regulations also authorize the BIA to approve or disapprove plans and specifications for construction as well as construction contracts let by the tribe, which are treated as subcontracts of the funding contract between the tribe and the BIA. The contracts are required to contain a clause establishing a hiring preference for Indians. § 274.38. And the BIA is given access to the tribe's records for auditing purposes. § 274.41. That is the extent of the regulations. In this case the BIA "contracted" with the School Board in order to convey federal funds for the construction project. 852 It also approved the Board's construction "subcontract" with the construction contractor. It played no role in the selection of the contractor and it played no role in regulating or supervising the actual construction of the school. The Court concludes that this scheme, which is little more than a grant application process, "is at least as comprehensive as the federal scheme found to be pre-emptive in White Mountain." Ante, at 841. I simply cannot agree. More important, the Court concludes in the very next sentence that "[t]he direction and supervision provided by the Federal Government for the construction of Indian schools leaves no room for the additional burden sought to be imposed by the State through its taxation of the gross receipts paid to Lembke by the Board." Ante, at 841-842. This statement constitutes the sum total of the Court's pre-emption analysis in this case. In White Mountain the Court engaged in a detailed examination of the extent to which state taxes would interfere both with the Secretary's ability to carry out his congressional mandate and with the tribe's ability to carry out federal policy. In the place of such careful analysis, the Court today relies on ipse dixit. It does so because there is no realistic basis for concluding that the State's taxes would interfere with a "pervasive" regulatory scheme. The BIA simply does not regulate the construction activity which the State seeks to tax. It provides federal money to eligible tribes and tribal organizations and it establishes a contract-approval and auditing mechanism as a means of attempting to ensure that the money is put to the use for which it is earmarked.[3] 853 III A careful reading of the Court's opinion demonstrates that the single, determinative factor in its judgment is the fact that the challenged state taxes have increased the financial burden of constructing a tribal school. Whether the federal regulations are detailed and comprehensive or largely a matter of bookkeeping is an irrelevancy, for the Court concludes that the tax burden "impedes the clearly expressed federal interest in promoting the `quality and quantity' of educational opportunities for Indians by depleting the funds available for the construction of Indian schools." Ante, at 842 (emphasis added). The Court recognizes that the legal incidence of the tax is on the non-Indian contractor, but asserts that "in White Mountain ... we found it significant that the economic burden of the asserted taxes would ultimately fall on the Tribe, 854 even though the legal incidence of the tax was on the non-Indian logging company." Ante, at 844, n. 8. The Court in White Mountain did indeed note that "the economic burden of the asserted taxes will ultimately fall on the Tribe." 448 U. S., at 151. But in a footnote immediately following that sentence, which is today ignored, the Court declared: "Of course, the fact that the economic burden of the tax falls on the Tribe does not by itself mean that the tax is pre-empted, as Moe v. Salish & Kootenai Tribes, 425 U. S. 463 (1976), makes clear. Our decision today is based on the pre-emptive effect of the comprehensive federal regulatory scheme, which ... leaves no room for the additional burdens sought to be imposed by state law." Id., at 151, n. 15. Despite its references to the supposed "comprehensive and pervasive" regulatory scheme in this case, the Court clearly has chosen to bar the State from taxing Lembke's gross receipts principally because the tax imposes an indirect economic burden on the tribal organization. As the Court in White Mountain recognized, our precedents undeniably view that as an insufficient basis for the recognition of an Indian tax immunity. See Washington v. Confederated Tribes of Colville Indian Reservation, 447 U. S. 134, 156 (1980) ("Washington does not infringe the right of reservation Indians to `make their own laws and be ruled by them,' ... merely because the result of imposing its taxes will be to deprive the Tribes of revenues which they currently are receiving"); Moe v. Salish & Kootenai Tribes, 425 U. S. 463, 481-482 (1976) (upholding tax on cigarette sales from Indians to non-Indians because the legal incidence of the tax was on the consumer); Mescalero Apache Tribe v. Jones, 411 U. S. 145, 156-157 (1973) (refusing to imply tax immunity despite economic burden on tribal enterprise).[4] Even under the 855 modified form of pre-emption doctrine applicable to state regulation of reservation activities, there must be some affirmative indication that Congress did not intend the State to exercise the sovereign power challenged in the suit. Until today, the mere fact that the asserted power will impose an economic burden on a tribal endeavor has not provided that affirmative indication. I do not disagree with the Court's judgment that congressional enactments such as the Indian Financing Act and the Indian Self-Determination and Education Assistance Act embody a federal policy encouraging the development of Indian-controlled educational institutions. But it is a considerable leap to infer from that policy the independent principle that all state laws which might increase the cost of such an endeavor are to be considered null and void. It is perfectly conceivable that Congress favored Indian education, but also contemplated that all costs of obtaining that end would be paid in a normal fashion. State taxes are as much a normal cost of school construction as the cost of cement and labor. The cost of taxes was included in the bids submitted to the Board by the construction contractors, and it apparently was also included in the funding requests submitted by the Board to Congress. The Board cannot be faulted for attempting to stretch its federal construction funds as far as possible, but that is a woefully inadequate basis for interfering with the sovereign prerogatives of the State of New Mexico. IV A short three months ago, this Court considered whether the State of New Mexico could impose its gross receipts and 856 compensating use taxes on private contractors that conduct business with the Federal Government. We concluded that tax immunity was appropriate in only one circumstance: "when the levy falls on the United States itself, or on an agency or instrumentality so closely connected to the Government that the two cannot realistically be viewed as separate entities, at least insofar as the activity being taxed is concerned." United States v. New Mexico, 455 U. S. 720, 735 (1982). In reaching this conclusion, we held that "immunity may not be conferred simply because the tax has an effect on the United States, or even because the Federal Government shoulders the entire economic burden of the levy." Id., at 734. If the legal incidence of the tax is on the contractor, it is to be considered valid, absent specific congressional action, as long as "the contractors can realistically be considered entities independent of the United States." Id., at 738.[5] In this case, as in United States v. New Mexico, the legal incidence of the New Mexico tax is on the private contractor, not on the entity whose status might be the source of a tax immunity. And, as in United States v. New Mexico, it is evident that Lembke is a separate taxable entity completely independent of the tribal school board. Were the tax immunity of the Tribe no greater than that of the United States, it seems plain that New Mexico's tax would have to be upheld as applied to the gross receipts of the non-Indian contractor. But the Court reaches a different conclusion because it finds that the tax imposes an economic burden on the Tribe's effort to build a school with federal funds. Thus, the Court accords 857 an Indian Tribe, whose sovereignty "exists only at the sufferance of Congress and is subject to complete defeasance," United States v. Wheeler, 435 U. S. 313, 323 (1978), greater immunity from state taxes than is enjoyed by the sovereignty of the United States on whom it is dependent.[6] For these reasons, I dissent from the Court's judgment. NOTES [*] Briefs of amici curiae urging reversal were filed by George P. Vlassis and Katherine Ott for the Navajo Tribe of Indians; and by Richard W. Hughes for the Pueblo of Santa Ana. Helena S. Maclay and Deirdre Boggs, Special Assistant Attorneys General of Montana, Leland T. Johnson, Assistant Attorney General of Washington, Warren Spannaus, Attorney General of Minnesota, Mark V. Meierhenry, Attorney General of South Dakota, and Richard H. Bryan, Attorney General of Nevada, filed a brief for the State of Montana et al. as amici curiae urging affirmance. Briefs of amici curiae were filed by George Deukmejian, Attorney General, and Neal J. Gobar, Deputy Attorney General, for the State of California; and by Arthur Lazarus, Jr., for the Association of American Indian Affairs, Inc. [1] On July 8, 1970, in his Message to the Congress on Indian Affairs, President Nixon referred specifically to these efforts of the Board to assume responsibility for the education of tribal children abandoned by the State as a "notable exampl[e]" of Indian self-determination. 6 Weekly Comp. of Pres. Doc. 894, 899 (1970). [2] See Pub. L. 93-245, 87 Stat. 1073 (1973) (amending Pub. L. 93-120, 87 Stat. 431 (1973) to specifically earmark funds appropriated there for the construction of the Ramah school facility); Pub. L. 93-404, 88 Stat. 810 (1974); Pub. L. 94-165, 89 Stat. 985 (1975); Pub. L. 95-74, 91 Stat. 293 (1977). [3] Article VI of the 1868 Treaty between the United States and the Navajo Tribe, 15 Stat. 669, provides that "[i]n order to insure the civilization of the Indians entering into this treaty, the necessity of education is admitted." [4] Although these regulations did not become effective until several months after the BIA and the Board had executed the initial contracts, the Secretary and the BIA had applied similar requirements under the authority of the Johnson-O'Malley Act, 48 Stat. 596, 25 U. S. C. § 452 et seq. In any event, the two subsequent agreements between the BIA, the Board and Lembke, accounting for two-thirds of the total construction, were signed after the effective date of these regulations, which clearly authorize the BIA to monitor these construction agreements. [5] JUSTICE REHNQUIST asserts that the comprehensive federal regulatory scheme outlined above "do[es] not regulate school construction, which is the activity taxed." Post, at 851. The dissent fails to explain, however, how this fact distinguishes this case from White Mountain. In that case, we struck down Arizona's use fuel tax and motor carrier license tax, not because of any federal interest in gasoline, licenses, or highways, but because the imposition of these state taxes on a non-Indian contractor doing work on the reservation was pre-empted by the "comprehensive regulation of the harvesting and sale of tribal timber." 448 U. S., at 151. We find that New Mexico is similarly precluded from impeding the federal interest in the construction of autonomous Indian educational institutions by imposing its gross receipts tax on Lembke. JUSTICE REHNQUIST's contention that the New Mexico tax is somehow compatible with this federal interest because such taxes "are as much a normal cost of school construction as the cost of cement and labor," post, at 855, is also foreclosed by White Mountain. Surely, state use fuel and motor carrier license taxes are considered part of the cost of harvesting and marketing timber. Yet in White Mountain, we concluded that these taxes impeded the federal interest in "guaranteeing Indians that they will `receive ... the benefit of whatever profit [the forest] is capable of yielding,'" 448 U. S., at 149, despite the dissent's argument that the taxes amounted to less than 1% of the annual profits produced by the logging operation. Here, as in White Mountain, JUSTICE REHNQUIST continues to press this argument. [6] Appellee would have us impute congressional awareness and approval of the state gross receipts tax from appropriations bills which earmarked funds for the construction of these facilities, see n. 2, supra. Brief for Appellee 21-22. Appellee strains to find this awareness and approval by arguing that the same architects who prepared the cost estimates and requests that the Board submitted to Congress also prepared the bid specifications pursuant to which Lembke submitted its bid. However, as we have indicated, the bid specifications only required prospective bidders to include "all taxes required by law," and the submitted bids did not specify the gross receipts tax as a separate line item. Supra, at 835. Therefore, it is by no means clear, and the Board disputes the contention, that the Board ever intended to have these state taxes included in the construction costs of its school facilities. Furthermore, there is absolutely no indication that Congress was even made aware of the existence of these taxes when it appropriated funds for the construction of the Ramah Navajo school. In any event, as we have noted in a related context, courts should be wary of inferring congressional intent to alter the force of existing law from an appropriations Act. Cf. TVA v. Hill, 437 U. S. 153, 189-191 (1978). [7] Of course, these statutes and regulations do not prevent the States from providing for the education of Indian children within their boundaries. Indeed, the Self-Determination Act specifically authorizes the Secretary to enter into contracts with any State willing to construct educational institutions for Indian children on or near the reservation. 88 Stat. 2214, 25 U. S. C. § 458. This case would be different if the State were actively seeking tax revenues for the purpose of constructing, or assisting in the effort to provide, adequate educational facilities for Ramah Navajo children. [8] The Bureau of Revenue invites us to adopt the "legal incidence" test, under which the legal incidence and not the actual burden of the tax would control the pre-emption inquiry. Of course, in some contexts, the fact that the legal incidence of the tax falls on a non-Indian is significant. See Washington v. Confederated Tribes of Colville Indian Reservation, 447 U. S. 134, 150-151 (1980); Moe v. Salish & Kootenai Tribes, 425 U. S. 463 (1976). However, in White Mountain, 448 U. S., at 151, we found it significant that the economic burden of the asserted taxes would ultimately fall on the Tribe, even though the legal incidence of the tax was on the non-Indian logging company. Given the comprehensive federal regulatory scheme at issue here, we decline to allow the State to impose additional burdens on the significant federal interest in fostering Indian-run educational institutions, even if those burdens are imposed indirectly through a tax on a non-Indian contractor for work done on the reservation. [9] In Central Machinery Co. v. Arizona State Tax Comm'n, 448 U. S. 160 (1980), we held that the Indian trader statutes, 19 Stat. 200, 25 U. S. C. § 261 et seq., pre-empted the State's jurisdiction to tax the sale of farm machinery to the Indian Tribe, notwithstanding the substantial services that the State undoubtedly provided to the off-reservation activities of the non-Indian seller. Presumably, the state tax revenues derived from Lembke's off-reservation business activities are adequate to reimburse the State for the services it provides to Lembke. [10] We are similarly unpersuaded by the State's argument that the significant services it provides to the Ramah Navajo Indians justify the imposition of this tax. The State does not suggest that these benefits are in any way related to the construction of schools on Indian land. Furthermore, the evidence introduced below by the State on this issue is far from clear. Although the State does provide services to the Ramah Navajo Indians, it receives federal funds for providing some of these services, and the State conceded at trial that it saves approximately $380,000 by not having to provide education for the Ramah Navajo children. App. 95, 105-106, 108. [1] "Although we must admit our disappointment that the courts below apparently gave short shrift to this principle and to our precedents in this area, we cannot and do not presume that state courts will not follow both the letter and the spirit of our decisions in the future." Ante, at 846. [2] Nevertheless, the Solicitor General has again suggested that on-reservation activities affecting resident tribes be considered presumptively beyond the reach of state law by operation of the "principle of tribal sovereignty." See Brief for United States as Amicus Curiae 17-24. The same suggestion was urged, and rejected, in White Mountain. It has proved no more appealing in this case. [3] The Court ignores other distinctions between this case and White Mountain. For example, the logging contractor in the latter case, although a non-Indian corporation, operated exclusively to harvest timber on the reservation; it conducted no off-reservation activities whatsoever. See 448 U. S., at 139. The contractor in this case is a general building contractor doing business throughout the State of New Mexico, and enjoying state services to the same extent as any other commercial enterprise in New Mexico. The Court dismisses this factor with the statement that "[p]resumably, the state tax revenues derived from Lembke's off-reservation business activities are adequate to reimburse the State for the services it provides to Lembke." Ante, at 844, n. 9. The Court's "presumptions," however, are no substitute for the considered judgment of the state taxing authority. Indeed, in assessing the validity of a state tax, the Court has previously recognized that the State's interests are strongest when the taxpayer is the recipient of state services. See Washington v. Confederated Tribes of Colville Indian Reservation, 447 U. S. 134, 157 (1980). To the extent presumptions are relevant, the Court has inverted the one that ought to apply. Another distinction is also relevant. The activity taxed in White Mountain was the exploitation of natural resources located on the reservation and devoted to the beneficial use and enjoyment of reservation Indians. Indeed, over 90% of the total profits generated by tribal enterprises were derived from the Tribe's logging operations. 448 U. S., at 138. In this case, the state taxes diminish, not the income generated by the Tribe for its own preservation and welfare, but federal funds appropriated by Congress for the purpose of school construction. No tribal funds are devoted to this endeavor, and congressional appropriations were based on funding requests that included the gross receipts tax as part of the estimated construction cost. [4] In other areas of tax immunity, the Court has steadfastly refused to assess the validity of a tax by reference to the economic burdens it imposes if those burdens are nondiscriminatory and comport with due process. See United States v. New Mexico, 455 U. S. 720 (1982) (state taxation of federal contractors); United States v. County of Fresno, 429 U. S. 452 (1977) (state taxation of Federal Government); New York v. United States, 326 U. S. 572 (1946) (federal taxation of state government); Michelin Tire Corp. v. Wages, 423 U. S. 276 (1976) (state taxation of imports and exports). [5] We recognized one possible exception to this general rule: "In the case of a sales tax ... it is arguable that an entity serving as a federal procurement agent can be so closely associated with the Government, and so lack an independent role in the purchase, as to make the salein both a real and a symbolic sensea sale to the United States, even though the purchasing agent has not otherwise been incorporated into the Government structure." 455 U. S., at 742. In this case, there is no basis for arguing that Lembke has acted merely as a purchasing agent for the Board or the BIA. [6] Of course, the Court purports to rest its decision on the pre-emptive effect of federal law. But the immunity of federal contractors from state taxes is also dependent on "generalized notions of federal supremacy." United States v. New Mexico, supra, at 730. The critical question, both in United States v. New Mexico and in this case, is what factors will the Court examine to determine whether the State has exceeded limits imposed by the Supremacy Clause and by Congress. I think it is evident that in the area of federal tax immunity the Court has required evidence of more than mere economic burdens before it will invalidate a state tax as applied. As this case demonstrates, tribal tax immunity may be invoked on no greater showing than the fact of economic burdens on a federally supported tribal endeavor. Since both immunities derive from precisely the same sourcethe supremacy of federal lawI find the Court's decision today inexplicable. "With the abandonment of the notion that the economicas opposed to the legalincidence of the tax is relevant, it becomes difficult to maintain that federal tax immunity is designed to insulate federal operations from the effects of state taxation." United States v. New Mexico, supra, at 735, n. 11.	{ "pile_set_name": "FreeLaw" }
The demand for xylitol, which is a sugar alcohol existing in nature, is expected to increase from now on. Xylitol has a lower caloric value than that of sucrose but is sweet as comparable to sucrose. Thus, it is promising as a low caloric sweetener. Furthermore, xylitol is anticariogenic and can be a dental caries-preventing sweetener. Since xylitol does not raise the blood glucose level, it has been used for infusion liquids for treating diabetes. At present, xylitol is mainly produced in an industrial scale by hydrogenation of D-xylose as described in U.S. Pat. No. 4,008,825. The raw material, D-xylose, can be obtained by hydrolyzing a starting material such as hardwoods, straws, ear stems of corns, crusts of oats, or the other plant-derived materials rich in xylan. However, D-xylose that is obtained by hydrolyzing the plant materials is disadvantageously expensive because of the high production cost. For example, the yield of the plant material-hydrolyzed product is low, which makes purity of produced D-xylitol low. After the hydrolysis, it is thus necessary to remove the acid used in the hydrolysis and the pigment by the ion exchange treatment. Furthermore, D-xylitol is crystallized to remove other hemicelluloses. Further purification is required to obtain D-xylose that can be used for food. The ion exchange treatment and crystallization results in an increase of the production cost. In order to solve the above problems, a method of producing xylitol that uses a readily available starting material and that produces a reduced amount of waste matters has been desired. For example, a method of producing xylitol using pentitol as a starting material has been developed. One of the readily available pentitols is D-arabitol that can be produced using yeast (Can. J. Microbiol. 31, 1985, 467-471, J. Gen. Microbiol. 139, 1993, 1047-1054). Several methods have been developed for producing xylitol using D-arabitol as a starting material. Applied Microbiology, 18, 1969, 1031-1035 reported a method that comprises producing D-arabitol from glucose by fermentation using Debaryomyces hansenii ATCC20121, converting D-arabitol thus obtained to D-xylulose using Acetobacter suboxydans, and converting D-xylulose to xylitol using Candida guilliermondii var. Soya. EP-A-403392 (applicant: Roquette Freres) and EP-A-421882(applicant: Roquette Freres) each discloses a method which comprises producing D-arabitol by fermentation using an osmotic pressure-resistant yeast, converting D-arabitol thus produced to D-xylulose using a microorganism belonging to the genus Acetobacter, Gluconobacter, or Klebsiella, reacting xylulose thus obtained with glucose (xylose) isomerase to produce a mixture of xylose and xylulose, and converting the thus-formed xylose/xylulose to xylitol by hydrogenation. These publications also disclose a method of preliminarily concentrating xylose in the xylose/xylulose mixture and converting concentrated xylose to xylitol by hydrogenation. The above-described method of producing xylitol using the D-arabitol above as a starting material enables a high yield production of xylitol. However, it is disadvantageous in requiring plural reaction steps, which makes the process complicated. Thus, the method is not economically satisfactory.	{ "pile_set_name": "USPTO Backgrounds" }
The incidence of inflammatory bowel disease in Denmark 1980-2013: a nationwide cohort study. Globally, the incidence rates of inflammatory bowel disease (IBD) are increasing; however, data from high-incidence areas are conflicting. Previous studies in Denmark have assessed incidence rates of Crohn's disease (CD) and ulcerative colitis (UC) using short observation periods. To investigate trends in IBD incidence in Denmark over a thirty-year period using nationwide data. Patients diagnosed with CD or UC in Denmark between 1980 and 2013 were identified in the Danish National Patient Registry (NPR) and included in a nationwide cohort. Incidence rates estimated using different numbers of National Patient Registry records (≥1, 2, 3 or 4) required for case definition were compared. From 1980 to 2013 the incidence of CD increased from 5.2 (95% CI: 5.0-5.4) per 100 000 to 9.1 (95% CI: 8.7-9.5) per 100 000 and the incidence of UC increased from 10.7 (95% CI: 10.4-11.0) per 100 000 to 18.6 (95% CI: 18.0-19.2) per 100 000. The increased incidence in CD and UC was independent of gender. The annual increase in incidence rate was greatest in patients aged <15 years for CD and those older than 15 years for UC. For both CD and UC the incidence rates for females were significantly higher than for males. The number of registry records chosen to define IBD cases greatly influenced incidence estimates. The incidence of IBD in Denmark continues to increase and is among the highest in the world. Using at ≥2 records of IBD diagnosis in the Danish National Patient Registry will result in more valid incidence estimates.	{ "pile_set_name": "PubMed Abstracts" }
The present invention relates to the field of components for optical telecommunications and more particularly concerns a method and a corresponding apparatus for recording optical gratings in a photosensitive medium with an enhanced control of the characteristics of the grating. Phase masks are widely used for the fabrication of UV-induced fiber Bragg gratings since their first reports (see for example K. O. Hill, B. Malo, F. Bilodeau, D. C. Johnson, and J. Albert, xe2x80x9cBragg gratings fabricated in monomode photosensitive optical fiber by UV exposure through a phase maskxe2x80x9d Appl. Phys. Lett., pp.1035-1037 (1993); U.S. Pat. No. 5,367,588 (Hill et al.); D. Z. Anderson, V. Mizrahi, T. Erdogan, and A. E. White, xe2x80x9cProduction of in-fibre gratings using a diffractive optical elementxe2x80x9d Electron. Lett., pp.566-568 (1993); and U.S. Pat. No. 5,327,515 (Anderson et al.). The use of such a diffractive element renders easy the mass production of fiber Bragg gratings as the mask acts somewhat as a master replicated onto a large number of fiber Bragg gratings. However, a typical writing setup with a phase mask is not flexible and allows the fabrication of only one type of fiber Bragg gratings, that is, the one with the specifications prescribed by the phase mask. The fiber is characterized by an effective index neff that is modified by the UV radiation. A fiber Bragg grating is mainly characterized by the period p of the index modulation in the core of the fiber, along its axis. The fiber Bragg grating reflects light having a wavelength xcexB (the Bragg wavelength) given by: xcexB(z)=2p(z)xc3x1eff(z),xe2x80x83xe2x80x83(1) Where xc3x1eff is the slowly varying effective index of the fiber inside the grating, z is the position along the grating and the dependence of the parameters over z indicates that both the period and the slowly varying effective index are not necessarily uniform along the grating. There is an interest in the control of the Bragg wavelength along a grating. This can be done by controlling the period of the grating along the fiber. Translating a UV-beam along the phase mask is a convenient way to achieve long gratings (J. Martin, and F. Ouellette, xe2x80x9cNovel writing technique of long and highly reflective in-fibre gratingsxe2x80x9d Electron. Lett., pp.911-812 (1994)). In particular, it allows a fine control of the apodisation, that is the strength of the grating, along the fiber axis. Several techniques based on a phase mask but with enhanced flexibility have been proposed over the past few years. One of the most straightforward way to modify the grating period is by stretching the fiber, such as taught in K. C. Byron, and H. N. Rourke, xe2x80x9cFabrication of chirped fibre gratings by novel stretch and write techniquexe2x80x9d Electron. Lett., pp.60-61 (1995) and K. Sugden, I. Bennion, A. Molony, and N. J. Copner, xe2x80x9cChirped gratings produced in photosensitive optical fibres by fibre deformation during exposurexe2x80x9d Electron. Lett., pp.440-442 (1994). There is also suggested in Y. Painchaud, A. Chandonnet, and J. Lauzon, xe2x80x9cChirped fibre gratings produced by tilting the fibrexe2x80x9d Electron. Lett., pp.171-172 (1995) and U.S. Pat. No. 5,903,689 (PAINCHAUD et al.) to adjust the period by controlling the angles of both the phase mask and the fiber with respect to the UV-beam axis. Referring to U.S. Pat. No. 6,072,926 (COLE et al.) and M. J. Cole, W. H. Loh, R. I. Laming, M. N. Zervas, and S. Barcelos, xe2x80x9cMoving fibre/phase mask-scanning beam technique for enhanced flexibility in producing fibre gratings with uniform phase maskxe2x80x9d Electron. Lett., pp.1488-1490 (1995), it is known to adjust the period by moving the phase mask. For the fine tuning of the Bragg wavelength, Cole proposed a lateral displacement of the phase mask during a writing process involving a scan of the UV beam. Excellent results have been obtained but the adjustment range is limited to about 1 nm. FIG. 1 (PRIOR ART) shows the limit of the grating period adjustment when the UV beam diameter is 350 xcexcm: the reflectivity decreases as a function of the detuning which corresponds to a decrease in the writing efficiency. The adjustment range increases as the UV beam size decreases. Cole also proposed a displacement of the phase mask at variable velocity for the adjustment of a chirp in the grating period. On another hand, Prohaska, described in U.S. Pat. No. 5,351,321 (SNITZER) and J. D. Prohaska, E. Snitzer, S. Rishton, and V. Boegli, xe2x80x9cMagnification of mask fabricated fibre Bragg gratingsxe2x80x9d Electron. Lett., pp.1614-1615 (1993) a technique for controlling the period of a Bragg grating over a large range (several nanometers) by using a magnifying lens along the UV beam axis. The right side of FIG. 2 (PRIOR ART) shows the interference fringes at the output of a phase mask when a convergent UV beam is incident at the input surface. By placing a fiber at a distance q from the output surface of the phase mask, a grating will be photo-imprinted having a period p given by: p=xcex9/2xc2x7M,xe2x80x83xe2x80x83(2) where M = 1 - q z f , ( 3 ) is the magnification factor, xcex9 is the phase mask period, q is the distance between the output surface of the phase mask and the fiber core and zf is the distance between the output surface of the phase mask and the focal plane, that is the plane where the beam would be focalized. The distance zf also corresponds to the radius of curvature of the wavefront at the phase mask. Oppositely, the left side of FIG. 2 (PRIOR ART) illustrates the interference fringes at the output of a phase mask when a collimated beam is incident. In this case, the period of the grating is independent of the distance between the phase mask and the fiber. The technique described by Prohaska allows an adjustment of the Bragg wavelength over a large range (several nanometers). However, the optical characteristics of the resulting grating are degraded: the photo-induced grating is slanted (blazed) in a spatially-dependent manner. Such a slanted fringes inside the grating causes a spatial dependence of the diffraction efficiency and increases significantly the polarization dependent loss and polarization mode dispersion. Another drawback is the need for uncommonly large lenses when a long grating is to be photo-induced, making the method more costly and unpractical. There is therefore a need for a fabrication techniques for Bragg gratings or the like alleviating the above mentioned drawbacks of the prior art. Accordingly, it is an object of the present invention to provide a method of recording optical gratings in a photosensitive medium that is versatile and commercially practical. It is another object of the present invention to provide an apparatus adapted to carry out such a method. It is a preferable object of the invention to provide such a method that enables the recording of long gratings over a large wavelength range. It is another preferable object of the invention to provide a method and apparatus for recording superimposed grating components in a photosensitive medium. Accordingly, the present invention provides a method for recording an optical grating along a waveguiding axis in a photosensitive medium. The method includes: a) providing a phase mask proximate the photosensitive medium along the waveguiding axis; b) projecting a light beam through a portion of the phase mask to generate a light beam with a modulated intensity profile. The light beam with a modulated intensity profile impinges on the photosensitive medium to locally record therein a portion of the optical grating, having a characteristic period; c) moving the light beam along the waveguiding axis of the photosensitive medium to successively record portions of the optical grating therealong; and d) concurrently to the moving of the light beam: i) moving the phase mask in a direction parallel to the moving of the light beam. The moving of the phase mask is adjusted relative to the moving of the light beam to locally tune the characteristic period of each portion of the optical grating; and ii) providing a curvature in the light beam wavefront along the direction of the waveguiding axis, this curvature having a wavefront radius of curvature at a phase mask plane selected to generally optimize an efficiency of the recording of the optical grating for this characteristic period. In the alternative, the present invention provides another method for recording an optical grating along a waveguiding axis in a photosensitive medium, the method comprising: a) providing a phase mask proximate to the photosensitive medium along the waveguiding axis; b) projecting a light beam through a portion of said phase mask to generate a light beam with a modulated intensity profile, said light beam with a modulated intensity profile impinging on the photosensitive medium to locally record therein a portion of the optical grating having a characteristic period; c) moving the light beam along the waveguiding axis of the photosensitive medium to successively record portions of the optical grating therealong; and d) concurrently to said moving of the light beam: i) moving the photosensitive medium in a direction parallel to the moving of the light beam, said moving of the photosensitive medium being adjusted relative to the moving of the light beam to locally tune the characteristic period of each portion of the optical grating; and ii) providing a wavefront curvature in said light beam along the direction of the waveguiding axis, said curvature having a wavefront radius of curvature in a plane of the phase mask selected to generally optimize an efficiency of the recording of the optical grating for said characteristic period. In accordance with another aspect of the invention, there is also provided an apparatus for recording an optical grating along a waveguiding axis in a photosensitive medium. The apparatus includes a phase mask provided proximate the photosensitive medium along the waveguiding axis. A light source is also provided, generating a light beam for projection through a portion of the phase mask to generate a light beam with a modulated intensity profile. The light beam with a modulated intensity profile impinges on the photosensitive medium to locally record therein a portion of the optical grating having a characteristic period. Light beam moving means are provided for moving the light beam along the waveguiding axis of the photosensitive medium to successively record portions of the optical grating therealong, and phase mask moving means are also included for moving the phase mask in a direction parallel to the moving of the light beam and concurrently thereto. The moving of the phase mask is adjusted relative to the moving of the light beam to locally tune the characteristic period of each portion of the optical grating. The apparatus finally includes curvature means for providing a curvature in the light beam along the direction of the waveguiding axis. The curvature has a wavefront radius of curvature in a plane of the phase mask selected to generally optimize an efficiency of the recording of the optical grating for the characteristic period of each portion of the optical grating. Finally, in accordance with a preferred embodiment of the invention, there is provided a method for recording an optical grating along a waveguiding axis in a photosensitive medium, the optical grating comprising a plurality of superimposed grating components each having a characteristic period profile, the method comprising: a) providing a phase mask proximate the photosensitive medium along the waveguiding axis; b) for each of the superimposed grating component: i) projecting a light beam through a portion of said phase mask to generate a light beam with a modulated intensity profile, said light beam with a modulated intensity profile impinging on the photosensitive medium to locally record therein a portion of the optical grating component having a characteristic period; ii) moving the light beam along the waveguiding axis of the photosensitive medium to successively record portions of the optical grating component therealong; and iii) concurrently to said moving of the light beam: 1) moving the phase mask in a direction parallel to the moving of the light beam, said moving of the phase mask being adjusted relative to the moving of the light beam to locally tune the characteristic period of each portion of the optical grating component; and 2) providing a curvature in said light beam along the direction of the waveguiding axis, said curvature having a wavefront radius of curvature in a plane of the phase mask selected to generally optimize an efficiency of the recording of the optical grating for said characteristic period. Advantageously, the present invention allows to locally control the period of an optical grating over a large range (about xc2x12% of the nominal period) while keeping the optical quality of the grating unaffected. Other techniques have been proposed but result in a degradation of the optical performances. Other aspects and advantages of the present invention will be better understood upon reading a preferred embodiments thereof with reference to the appended drawings.	{ "pile_set_name": "USPTO Backgrounds" }
<?xml version="1.0" encoding="UTF-8"?> <!-- ~ Copyright (c) 2018 The Android Open Source Project ~ ~ Licensed under the Apache License, Version 2.0 (the "License"); ~ you may not use this file except in compliance with the License. ~ You may obtain a copy of the License at ~ ~ http://www.apache.org/licenses/LICENSE-2.0 ~ ~ Unless required by applicable law or agreed to in writing, software ~ distributed under the License is distributed on an "AS IS" BASIS, ~ WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. ~ See the License for the specific language governing permissions and ~ limitations under the License. --> <resources xmlns:android="http://schemas.android.com/apk/res/android" xmlns:xliff="urn:oasis:names:tc:xliff:document:1.2"> <string name="hvac_min_text" msgid="8167124789068494624">"Мин."</string> <string name="hvac_max_text" msgid="3669693372074755551">"Макс."</string> <string name="voice_recognition_toast" msgid="1149934534584052842">"Для распознавания речи используется Bluetooth-устройство."</string> <string name="car_guest" msgid="318393171202663722">"Гость"</string> <string name="start_guest_session" msgid="497784785761754874">"Гость"</string> <string name="car_add_user" msgid="4067337059622483269">"Добавить пользователя"</string> <string name="car_new_user" msgid="6637442369728092473">"Новый пользователь"</string> <string name="user_add_user_message_setup" msgid="1035578846007352323">"Когда вы добавите пользователя, ему потребуется настроить профиль."</string> <string name="user_add_user_message_update" msgid="7061671307004867811">"Любой пользователь устройства может обновлять приложения для всех аккаунтов."</string> <string name="car_loading_profile" msgid="4507385037552574474">"Загрузка…"</string> <string name="car_loading_profile_developer_message" msgid="1660962766911529611">"Загрузка профиля пользователя (с <xliff:g id="FROM_USER">%1$d</xliff:g> по <xliff:g id="TO_USER">%2$d</xliff:g>)…"</string> </resources>	{ "pile_set_name": "Github" }
[Hepatitis A in Oslo]. During the last six years we have registered 237 persons with acute hepatitis A in Oslo, 96 of them with non-Scandinavian names. The number with non-Scandinavian names is increasing. Almost all the hepatitis A patients with non-Scandinavian names are children, and two of three had been infected in Pakistan. Adult immigrants from countries where hepatitis A is endemic do not need any prophylaxis against hepatitis A. 29,800 travellers were given human normal immunoglobulin at our department during the last five years and none of them acquired hepatitis A. To prevent import of hepatitis A it is of particular importance to give human normal immunoglobulin or hepatitis A vaccine to all children of immigrants before they visit their parents' country.	{ "pile_set_name": "PubMed Abstracts" }
The effects of fat loss after bariatric surgery on inflammation, serum hepcidin, and iron absorption: a prospective 6-mo iron stable isotope study. Iron deficiency is common in obese subjects. This may be due to an increase in serum hepcidin and a decrease in iron absorption from adiposity-related inflammation. We evaluated whether weight and fat loss in obese subjects would decrease inflammation and serum hepcidin and thereby improve iron absorption. We performed a 6-mo prospective study in obese [body mass index (in kg/m2) ≥35 and <45] adults who had recently undergone laparoscopic sleeve gastrectomy. At 2 and 8 mo postsurgery, subjects consumed a test drink with 6 mg 57Fe as ferrous sulfate and were intravenously infused with 100 μg 58Fe as iron citrate. We then compared erythrocyte incorporation of iron isotopic labels, changes in body composition, iron status, hepcidin, and inflammation at each time point. Forty-three subjects were studied at baseline, and 38 completed the protocol (32 women and 6 men). After 6 mo, total body fat, interleukin IL-6, and hepcidin were significantly lower (all P < 0.005). In iron-deficient subjects (n = 17), geometric mean (95% CI) iron absorption increased by 28% [from 9.7% (6.5%, 14.6%) to 12.4% (7.7%, 20.1%); P = 0.03], whereas in iron-sufficient subjects (n = 21), absorption did not change [5.9% (4.0%, 8.6%) and 5.6% (3.9%, 8.2%); P = 0.81]. Adiposity-related inflammation is associated with a reduction in the normal upregulation of iron absorption in iron-deficient obese subjects, and this adverse effect may be ameliorated by fat loss. This protocol was approved by the ethics committees of Wageningen University, ETH Zurich, the University of Monterrey, and the Federal Commission for the Protection against Sanitary Risks, and registered at clinicaltrials.gov as NCT01347905.	{ "pile_set_name": "PubMed Abstracts" }
More Resources Peonies Silicone Embossers Product Description The Peonies Silicone Embosser can be used with any medium, edible or non-edible that allows a design to be pressed into them. Perfect for cake decorating, these flexible embossers allow you to build your own design from the beautiful peonies and leaf elements in this set. You can achieve stunning unique textured backgrounds on cakes, cookies, cake boards or use them to create perfect guidelines for brush embroidery, dusting, painting or gilded line piping. Press and cut around the outer edge of the design to create appliqué pieces to give a 3D embossed embellishment. The Butterflies Silicone Embosser can be used with any medium, edible or non-edible that that allows a design to be pressed into them. Perfect for cake decorating, these flexible embossers allow you to build your own design from the beautiful range of 7 different sized butterflies in this set. You can achieve stunning unique textured backgrounds on cakes, cookies, cake boards or use them to create perfect guidelines for brush embroidery, dusting, painting or gilded line piping. Press and cut around the outer edge of the design to create appliqué pieces to give a 3D embossed embellishment. The Butterflies Silicone Embosser can be used with any medium, edible or non-edible that that allows a design to be pressed into them. Perfect for cake decorating, these flexible embossers allow you to build your own design from the beautiful range of 7 different sized butterflies in this set. You can achieve stunning unique textured backgrounds on cakes, cookies, cake boards or use them to create perfect guidelines for brush embroidery, dusting, painting or gilded line piping. Press and cut around the outer edge of the design to create appliqué pieces to give a 3D embossed embellishment. We aim to dispatch orders next working day from when the order was placed. Please allow 3-5 working days for delivery. Please note: during busier periods this may be slightly longer. Our standard delivery charges are shown below: - FREE delivery for all orders over $49.99 - $5.00 for all orders under $49.99 Some customers will need to request a postage cost. To do this, simply select the products you want to order and add them to your basket. Proceed to the basket page and click the Request Shipping Costs button. We will then update your basket and you will be able to proceed with the order. Please note: if you were to update your basket after requesting your initial shipping costs a new request would need to be calculated. Refunds & Returns We want you to enjoy your purchase from Katy Sue Designs. If you're not 100% satisfied with your items, you can return your order by post within 30 days of the purchase date.	{ "pile_set_name": "Pile-CC" }
Q: Rails Devise: two different after_update_path_for I have two pages rendering the update user form of Devise. The classic one (users/edit) and a '/page' page with just a part of the full edit form. I would like to have two different after_update_path whether the form is submited to one or the other page. I tried several things but I none are working... def after_update_path_for(resource) if current_page?('/page') :page else :root_path end end I get the following error: undefined method `current_page?' for #RegistrationsController:0x007fe9db304e28 Did you mean? current_user Any idea if it's possible to do that? A: Looks like you need to include ActionView::Helpers::UrlHelper, as the method is undefined in that controller. class Users::RegistrationsController < Devise::SessionsController include ActionView::Helpers::UrlHelper def after_update_path_for(resource) if current_page?( '/path' ) render :page else render :root_path end end end Here's the docs for the method. Note the comment above: The default url to be used after updating a resource. You need to overwrite this method in your own RegistrationsController. If for some reason this doesn't work in rails 3, you could try to do something like this: def after_update_path_for(resource) if params[:action] == 'my_action' && params[:controller] == 'my_controller' render :page else render :root_path end end	{ "pile_set_name": "StackExchange" }
The U.S. and New Zealand have been pushing plans to create the world’s largest marine reserve, 890,000 square miles in the Ross Sea, an Antarctic bay in the Southern Ocean teeming with spawning fish, whales, seals, penguins, and other wildlife. But that proposal was thwarted by Russia during the last two meetings of the multi-nation Commission for the Conservation of Antarctic Marine Living Resources. (Russia also blocked a separate bid by Australia and Europe to establish a similar but slightly smaller chain of reserves nearby in East Antarctica.) Chile, China, Japan, Korea, and Norway, also members of the commission, share some of Russia’s concerns about the economic impacts of fishing restrictions in the Antarctic. Now comes word that New Zealand will likely propose a smaller reserve to accommodate the Russians. From Fairfax NZ, which operates newspapers in New Zealand: [New Zealand Prime Minister John] Key said today officials are working on a new plan, ahead of talks in Tasmania next month. … “This is the second attempt to get change, and if we are going to get change we are probably going to make some alterations,” he said today. … [I]nsiders are speculating that as much as 40 per cent of the sanctuary, including important spawning grounds in the north, will be cut. Environmentalists are calling for New Zealand and the U.S. to stand strong. “It would be a missed opportunity to retreat from US Secretary of State John Kerry’s commitment earlier this year to the Ross Sea,” Andrea Kavanagh, director of The Pew Charitable Trusts’ Southern Ocean sanctuaries project, said in a statement. “We ask that US and New Zealand officials hold the line. The Ross Sea is one of the most beautiful and pristine areas left on Earth and we are urging governments to protect it.”	{ "pile_set_name": "Pile-CC" }
Tactical Intervention, from Half-Life mod co-developer and Counter-Strike creator Minh Le, will be released in August, Fix Korea studio has announced. The shooter based on the Terrorists vs. Counter-Terrorists setting will be released globally on Steam, where it can be played for free. According to the developers, the game will require “teamwork, strategic thinking and fast reflexes,” and players will be able to choose from dozens of “authentic weapons.” Players can also make use of attack dogs, tactical shields, take hostages, perform a drive-by and repel down buildings if they wish. Locations on the maps include shopping malls, industrial parks, subway stations and on the tops of skyscrapers. Depending on game mode and team selection, players must set up or defuse bombs, rescue or capture hostages or emerge from team death-match duels as winners. The highway mission included in the game is a high-speed car chase where players will be protecting or taking out a VIP. Not not only will weapons skills be put to the test, so will driving skills as players either avoid a helicopter, or find the RPG-7 and take it out. Tactical Intervention will be released worldwide in August.	{ "pile_set_name": "OpenWebText2" }
Protein microarray spots are modulated by patterning method, surface chemistry and processing conditions. The uniformity of the protein patterns, their shape, and the contrast between the fluorescence signal of the pattern and the background, critically modulate the quantitative accuracy of the microarray-derived data. While significant research focused of the identification of the factors that impact the protein microarray patterns, these studies usually have focused on the optimization of one set of these factors, e.g., how the spot uniformity is affected by different additives, or by different surfaces. However, the complex interaction between proteins, carrier fluids, surfaces, and patterning methodologies used would suggest a systematic and more comprehensive study that considers all these parameters, as well as their inter-relationship. The present work compared the patterning of two fluorescently-tagged proteins, i.e., IgG, BSA, on surfaces with different hydrophobicity and chemistry, and printed by inkjet, pin, and microcontact printing (µCP). The quantification of the spot size regularity, its morphology, the signal intensity and its distribution within spots were used to assess the quality of a specific printing method, on a specific surface, with a specific solute of the printed protein. It was found that the optimal uniformity for both droplet-based methods depend on surface chemistry, with glass slides modified with 3-Glycidoxypropyl-dimethoxymethyl silane (GPS) and 3-(Aminopropyl)-triethoxy silane (APTES) exhibiting the greatest uniformity, while uniformity of the µCP patterns was relatively independent of the surface chemistry. For the inkjet and pin printing, the largest fluorescence signal and contrast with the background was found on APTES modified glass slides, whereas for the µCP the fluorescence signal increased with increasing hydrophilicity.	{ "pile_set_name": "PubMed Abstracts" }
Aesthetic lateral canthoplasty. To report our technique and experience in using a minimally invasive approach for aesthetic lateral canthoplasty. Retrospective analysis of patients undergoing lateral canthoplasty through a minimally invasive, upper eyelid crease incision approach at Jules Stein Eye Institute by one surgeon (R.A.G.) between 2005 and 2008. Concomitant surgical procedures were recorded. Preoperative and postoperative photographs at the longest follow-up visit were analyzed and graded for functional and cosmetic outcomes. A total of 600 patients (1,050 eyelids) underwent successful lateral canthoplasty through a small incision in the upper eyelid crease to correct lower eyelid malposition (laxity, ectropion, entropion, retraction) and/or lateral canthal dystopia, encompassing 806 reconstructive and 244 cosmetic lateral canthoplasties. There were 260 males and 340 females, with mean age of 55 years old (range, 4-92 years old). Minimum follow-up time was 3 months (mean, 6 months; maximum, 6 years). Complications were rare and minor, including transient postoperative chemosis. Eighteen patients underwent reoperation in the following 2 years for recurrent lower eyelid malposition and/or lateral canthal deformity. Lateral canthoplasty through a minimally invasive upper eyelid crease incision and resuspension technique can effectively address lower eyelid laxity and/or dystopia, resulting in an aesthetic lateral canthus.	{ "pile_set_name": "PubMed Abstracts" }
Horoscopes Monday 16th January 2017 A situation could evoke stronger feelings than it might normally and this may be down to a tie between the Moon and the potent energies of Pluto. A situation could evoke stronger feelings than it might normally and this may be down to a tie between the Moon and the potent energies of Pluto. We could be moved to look into the matter in more detail and as a result to make certain changes which may be long overdue. For your FREE Daily Horoscope Monday 16th January 2017 please see below... Horoscopes Monday 16th January 2017 Aries 21 March - 20 April You may be keen to get the week off to a positive start by rounding up any overdue tasks and completing them. But in practice, you might find that events occurring out of the blue can deflect attention. There's also a suggestion that an issue may be playing on your mind, and even though it might not be anything major, the coming days can be a call to resolve this for peace of mind. Taurus 21 April - 21 May You may find that when it comes to socializing, spending time with those you cherish can leave you feeling relaxed as well as giving you the chance to discuss an idea or decision. The current picture suggests that there may be many who you could confide in, but allowing your instincts to guide you can be better. Indeed, your oldest friends might know just what to say Taurus. Gemini 22 May - 21 June It may seem as though your efforts are yielding few results over coming days, as a key alignment involving action-orientated Mars and sobering Saturn could be a cause of delays. But this might also be an opportunity to slow down and think about what you're hoping to do. Whether it's a step towards a goal or an opportunity you're keen to grasp, a pause for thought could help. Cancer 22 June - 23 July This can be one of those times when if you have something to say it's best to be honest. Although the celestial backdrop hints that new doors can open by speaking out, there may be some hesitation due to what others think. You could find though, that this matters a lot less than it seems, and that by revealing your thoughts a certain person might follow your example. Leo 24 July - 23 August Two conflicting urges may be at the heart of a dilemma, and could leave you wondering how far you can trust others with something that may be dear to your heart. If you're seeking advice concerning a project or a relationship, the thought of potential criticism might be enough to turn you away. Even so, such fears may be unfounded as a fresh perspective can prove healing. Virgo 24 August - 23 September Although your approach to a certain relationship may be open and accepting, the Moon in your sign and its edgy links suggest that it might be an idea to look to the details too. Whether this is someone you've recently met or someone you know well, they may unknowingly share some inaccurate advice. Taking the time to check it out first could save you much inconvenience. Libra 24 September - 23 October If you can stand back and consider your priorities it may be helpful, especially if you're keen to make a breakthrough over coming days. Time for reflection on your present situation might enable you to sidestep one or two potential delays, especially when it comes to getting any urgent tasks completed. Above all, your horoscope suggests that a can-do approach could enable you to deftly avoid any blips. Scorpio 24 October - 22 November With Mercury now moving further into your sector of thought and communication, you may feel motivated to put ideas down on paper and perhaps to plan for the weeks and months ahead. Indeed, setting goals, whether bigger or smaller, can be a way to stay on track. Looking to purchase a big-ticket item? Resourcefulness could help you net an excellent sale bargain, Scorpio. Sagittarius 23 November - 21 December While it can help to stand your ground in a wavering situation, you may find that the willingness to give way on one or two points might greatly ease matters over the days ahead. This may be the case where a domestic issue is concerned, as the situation could change from one day to the next. A flexible response might be needed so as to obtain the best solution for all. Capricorn 22 December - 20 January The coming days can be a time to delight in small successes, as bigger plans may require patience to get results. While you are often known for your ability to persevere despite obstacles, you may find that any complications you face could be a good thing if they encourage you to go back to the drawing board. Indeed, clarifying certain details can enable a more productive outcome. Aquarius 21 January - 19 February Jupiter's sparkling link to innovative Uranus could be of help in a situation in which tried and trusted methods may not seem to be working. This lively focus can pave the way for discussion that may yield some inspired ideas. Certain others might need some persuading though Water-Carrier, especially if they have a vested interest in things remaining exactly as they are for now. Pisces 20 February - 20 March It can seem as though someone in authority isn't listening to what you have to say, but is this the reality? It may be that by approaching them and talking things through a compromise can be found. The present scenario hints that delegating certain responsibilities might leave you with more time to yourself, especially if you have a full on and busy schedule in coming days.	{ "pile_set_name": "Pile-CC" }
7 Things you can do with potatoes Potatoes are the favorite food of many. Yes, a food. Because they are so versatile, you could have them with anything and the food would instantly become more appealing. If you are a potato lover like we are, you would be happily suprised with the variety of things you could make out of potatoes!	{ "pile_set_name": "Pile-CC" }
Nemeton Mental Mind Food: When the framework of your fear gives way from the force of your rage, the Truth will be revealed. The question is: Are you willing to allow the energy of love (of Fire) shatter the barriers to reveal The Wholeness, that already exists. The absolute perfection in the design, no matter the unconventionality of the construct. #Nemet0n http://ift.tt/2dYBtar	{ "pile_set_name": "Pile-CC" }
Q: What should I do/study in high school if I want to be a software project manager? I'm in high school and I'm curious about what I can do now to increase my knowledge about software management. What should I know about software management to better my chances of becoming a manager? How can I get 'real-world' experience at this stage that's as valuable as possible? A: My honest advice is that there is so much time and "cognitive distance" between high school and a professional career in management, that I would say "take classes you love and will do well in" Go to college/university and discover your passion and career interests there. If you are successful and want to move into management, then you have many options. There are just too many "good paths" into management: I've seen English Majors, Art Majors, History Majors, Biology Majors, CS Majors, EE Majors, and I'm a Physics Major myself. If you want to focus on software, then do something that keeps you coding and developing. having domain experience is a huge help for any management position. Don't be afraid to change directions and try new things. If you really love Project Management, there will always be opportunities... good luck and enjoy the trip! A: Find some projects to manage. The principles of project management apply across all different types of activities. You could help work on a website, blog or coordinate a group event. I would focus on doing something that entails gathering requirements from somebody, working with another person or group of people to produce the deliverable that meets those requirements then deliver the project.	{ "pile_set_name": "StackExchange" }
Cientistas decifram estrutura no novo coronavírus que pode ajudar na fabricação de vacinas Imagem do formato de uma proteína do vírus foi publicada na 'Science' nesta quarta (19).	{ "pile_set_name": "OpenWebText2" }
Q: How to get screen resolution in C++? Possible Duplicate: How to get the Monitor Screen Resolution from an hWnd? Is there a way to get the screen resolution in C++? I have searched MSDN but with no luck. The closest thing I found was ChangeDisplaySettingsEx() but that doesn't seem to have a way to just return the res without changing it. A: #include "wtypes.h" #include <iostream> using namespace std; // Get the horizontal and vertical screen sizes in pixel void GetDesktopResolution(int& horizontal, int& vertical) { RECT desktop; // Get a handle to the desktop window const HWND hDesktop = GetDesktopWindow(); // Get the size of screen to the variable desktop GetWindowRect(hDesktop, &desktop); // The top left corner will have coordinates (0,0) // and the bottom right corner will have coordinates // (horizontal, vertical) horizontal = desktop.right; vertical = desktop.bottom; } int main() { int horizontal = 0; int vertical = 0; GetDesktopResolution(horizontal, vertical); cout << horizontal << '\n' << vertical << '\n'; return 0; } Source: http://cppkid.wordpress.com/2009/01/07/how-to-get-the-screen-resolution-in-pixels/	{ "pile_set_name": "StackExchange" }
Estimating China's Production of Plutonium for Weapons This article discusses the history of China's production of plutonium for nuclear weapons, and uses that history and analogies to the production process in the United States and Russia to estimate the amount of plutonium China produced at its two known facilities. That analysis leads to an estimate that China produced 2 to 5 tonnes of plutonium at these facilities before it ceased production around 1990. The article describes how the analysis was done and what assumptions were used so that a reader can understand how the results are affected by different assumptions or by new information that might become available. Given the lack of information available about most aspects of China's nuclear-weapon program, the estimate of plutonium production developed here is necessarily rough. However, even a rough estimate is interesting since the size of China's fissile material stockpiles will influence China's willingness to join a multilateral "cut-off" convention to ban future production of fissile material for weapons or outside of safeguards.	{ "pile_set_name": "Pile-CC" }
A Fargo man was sentenced Monday in Becker County District Court on a serious felony charge of criminal vehicular operation. Jordan Anthony Braaten, 20, of 1809 4th St. North, Fargo, was initially charged with eight separate counts of criminal vehicular operation -- two of them felonies -- in connection with a July 16, 2011 rollover accident east of Detroit Lakes. He was convicted on the first count, but the other seven charges were dismissed at sentencing. Braaten was ordered to serve 18 months in prison, stayed, on conditions including completion of a 270-day jail sentence and up to five years of supervised probation. He was ordered to report to jail on April 8, until which time he will be subject to electronic home monitoring at his own expense. He has also been ordered to pay $1,160 in court fines and fees, and was authorized for sentence-to-service (STS) work. According to the complaint, witnesses reported that Braaten was behind the wheel of a vehicle that rolled over when he allegedly took the turn off Highway 34 onto 335th Avenue at too high a rate of speed, and lost control. The vehicle narrowly missed landing in the river, according to the complaint. There were four female passengers in the vehicle at the time of the accident; three walked away with bumps and bruises, but a fourth suffered a broken back and is now paralyzed from the waist down. After the crash took place, Braaten reportedly fled the scene, according to witnesses. When law enforcement officers found him later that evening, there was a strong odor of alcohol on his breath and a preliminary breath test administered at the scene showed his blood alcohol concentration to be .18.	{ "pile_set_name": "Pile-CC" }
2 search hits We use a new panel dataset of credit card accounts to analyze how consumer responded to the 2001 Federal income tax rebates. We estimate the monthly response of credit card payments, spending, and debt, exploiting the unique, randomized timing of the rebate disbursement. We find that, on average, consumers initially saved some of the rebate, by increasing their credit card payments and thereby paying down debt. But soon afterwards their spending increased, counter to the canonical Permanent-Income model. Spending rose most for consumers who were initially most likely to be liquidity constrained, whereas debt declined most (so saving rose most) for unconstrained consumers. More generally, the results suggest that there can be important dynamics in consumers’ response to “lumpy” increases in income like tax rebates, working in part through balance sheet (liquidity) mechanisms. We find that on average consumers chose the contract that ex post minimized their net costs. A substantial fraction of consumers (about 40%) still chose the ex post sub-optimal contract, with some incurring hundreds of dollars of avoidable interest costs. Nonetheless, the probability of choosing the sub-optimal contract declines with the dollar magnitude of the potential error, and consumers with larger errors were more likely to subsequently switch to the optimal contract. Thus most of the errors appear not to have been very costly, with the exception that a small minority of consumers persists in holding substantially sub-optimal contracts without switching. Klassifikation: G11, G21, E21, E51	{ "pile_set_name": "Pile-CC" }
/* Copyright 2015-2016 MongoDB Inc. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ using System; using System.Linq.Expressions; using MongoDB.Bson.Serialization; using MongoDB.Driver.Core.Misc; namespace MongoDB.Driver.Linq.Expressions { internal sealed class FieldAsDocumentExpression : SerializationExpression, IFieldExpression { private readonly Expression _expression; private readonly string _fieldName; private readonly IBsonSerializer _serializer; public FieldAsDocumentExpression(Expression expression, string fieldName, IBsonSerializer serializer) { _expression = Ensure.IsNotNull(expression, nameof(expression)); _fieldName = Ensure.IsNotNull(fieldName, nameof(fieldName)); _serializer = Ensure.IsNotNull(serializer, nameof(serializer)); } public Expression Document { get { return null; } } public Expression Expression { get { return _expression; } } public string FieldName { get { return _fieldName; } } public override ExtensionExpressionType ExtensionType { get { return ExtensionExpressionType.FieldAsDocument; } } public override IBsonSerializer Serializer { get { return _serializer; } } public override Type Type { get { return _serializer.ValueType; } } public override string ToString() { return "{" + _fieldName + "}"; } public FieldAsDocumentExpression Update(Expression expression) { if (expression != _expression) { return new FieldAsDocumentExpression(expression, _fieldName, _serializer); } return this; } protected internal override Expression Accept(ExtensionExpressionVisitor visitor) { return visitor.VisitDocumentWrappedField(this); } } }	{ "pile_set_name": "Github" }
"Some chefs call them "lovebirds," a romantic dish for that special occasion." "Properly cooked, they're as tender as butter." "They can be roasted, stuffed with wild rice or barley... ... or you can broil them, poach them... ... barbecue them, and even braise them." "But there's no greater sin than to overcook a quail." "Perfectly cooked, it must have a touch of pink on the breast." "But you need the right quail." "It has to be fleshy or it dries out too easily." "I prefer to serve them roasted." "That makes their taste richer and more robust." "And a side of truffle ravioli and wild mushrooms goes deliciously well with them." "Of course, you can also cook them in a pig's bladder in a mix of Madeira and cognac." "You see, the bladder helps protect the quail, keeps it moist." "You could serve it with a tender sauce of thyme, spring onions caramelized shallots, truffles." "Truffles go perfectly with almost any quail dish because they elevate the delicate taste." "Are you feeling okay?" "I'm fine." "Go on." "They wonderfully elevate the delicate taste of the quail." "But you have to really be able to afford truffles otherwise you just better forget about it." " Now, for a appetizer, I suggest..." " Kate, would you mind if I change the subject for a moment?" " No." "Why do you come to see me every week?" "My boss said she'd fire me if I didn't get therapy." "And why do you think she thinks you need therapy?" "Why?" "You know what?" "I haven't the faintest idea." "Ordering two tasting menus." "Fire two amuse-bouche." "Leah, I need a quail and a Dover sole for table nine." "I'm still waiting on those beef tenderloins." "Where are they?" "Pick up!" "Terrine, carpaccio." "Excuse me, you should know Hal Reeves says the lamb has never been so good before." " Really?" "And what would he know?" "Kate, the Petersons are here." "They wanna tell you how brilliant you are." " Brilliant chefs belong in the kitchen." " At least say hello." "You know they're some of my best customers." "In a minute." "Just don't cook them too long, because they get..." " They get tough, I know." " No, dry." "Dry, Leah." "I get tough." "Quail get dry." "Kate, I wanna go over the menu for next week." "Later, okay?" "You're a magician, Kate." "And you know my husband sings your praises constantly." "In fact, it's hard not to be jealous." "I worship anyone who can surprise my palate." "It's always a pleasure to cook for you both." " We'll see you next week, right?" " Of course." " Good night." " Good night." "Nice to see you." "I'm telling you it's not cooked properly." " May I ask what this is about?" " Kate, I'll handle this." " I take it you're the chef?" " Yes." " There's something I'd like to show you." " Don't do this." "My wife's foie gras hasn't been cooked long enough." " Excuse me?" " Why don't I bring you a new appetizer with my compliments?" " It's cooked just fine." "Nothing to be ashamed of, honey." "Even the best stumble over foie gras." "There's nothing wrong with this." "It's precisely comme il faut." " What is that supposed to mean?" " Comme il faut? "As it should be. "" "140 degrees in the oven, 80 degrees water temperature, for 25 minutes not too long, not too short, with the perfect touch of pink, honey." "That's it." "We'll take our business somewhere else." "Let's go." "May I suggest Vinnie's hot dog stand at the corner?" "He cooks to order." "How many times have I told you?" "You can't make a scene every time someone doesn't like your food." " Please." "The guy's a barbarian." " And a paying customer." "If he says the foie gras is not done, it's not." " Foie gras is cruelty to animals." " Stay out of this." "I swear to God, if you weren't one of the better chefs in this city, I'd fire you." "One of the better chefs?" "What's that supposed to mean?" "I bet she's just saying that to annoy me." "She's just saying that to annoy me." " Isn't she?" " Whatever you say, chef." "Mailbox one." "You have no messages." " Hey, how are you?" " I'm good, Frank." "Got some nice lobsters from Maine." "That one's a little too small." "Try this one." "Yeah, yeah." "Have them delivered by 2:30, okay?" "And send those scrawny ones to La Fontaine." "Kate!" "Who's your best friend?" " You got it?" " Did you ask me to?" "Golden tilefish?" " Bob!" " Just for you." " It's beautiful." " Beautiful golden tilefish, line-caught." " Beautiful." " Give me a kiss." " Bob." " Give me a kiss." " Hey!" "Hey!" "How come I didn't get a kiss?" " How come you didn't get a kiss?" "You ain't got the goods." " What's this?" " I don't see any golden tilefish." " Hello?" " Hey, it's me." "I'm just checking in." "We should be there about 9." "Great, so I'll make sure I'm back by then." "Okay, cool." "So, what are you doing?" "Reading a recipe, right?" "Christine, don't be ridiculous." "I do have other interests." "Of course you do." "Name one." " How's Zoe?" " Adorable." "She's changed so much since you saw her last." " Haven't you, sweetheart?" " I don't know." " So, what do you guys want for dinner?" " Don't worry about us." " We'll just grab a pizza or something." " I don't think so." " So, what does Zoe like these days?" " She eats anything." " She's a vacuum cleaner." " Mom." "I'll call you when we get closer." "Say bye to your Aunt Kate." " Bye, Aunt Kate." " Bye, Aunt Kate." " Hey, Kate." "Did you just get in?" " No, I forgot something." " How are you?" " Good." "Are you working tonight?" "I know this great little Thai place." "Actually, I am." "Just for a couple of hours." "My sister's coming into town with my niece." "I don't give up that easily." "One of these days I'm gonna convince you to have dinner with me." "Look, Sean, I think you should know I don't generally do that." " What, have dinner?" " Dinner dates." " How about breakfast?" " You live in my building." "I don't generally go out with people in my building." "As a rule." "You seem to have a lot of rules." "Didn't you say you forgot something?" " Oh, thanks." "Right." " You're welcome." "So, what's the problem with having rules?" "It's not as if I'm controlling or anything." "I just prefer things to be done exactly right." "That's why I usually end up doing everything myself." "Do you have any idea how complicated it is to coordinate 40 dishes at once?" "I hope you like scallops." "I thought we agreed you weren't gonna cook for me anymore." "I didn't cook it for you, I just tried some new ideas." "Who else am I gonna give it to?" "Now, we're gonna try something new this week." "I'm going to ask you questions, and you're gonna answer them." "How long ago was your last relationship?" "Isn't that a little personal?" "Well, this is therapy." "How long?" "I don't know." "Three years ago." "Maybe four." " Who ended it?" " I did." " He was getting way too demanding." " How so?" "Well, if you must know, after two years he wanted to move in together." "Did you try the saffron sauce?" "And, I'm sorry, what's so bad about moving in together?" "He asked me to give up my apartment." "Why would I wanna do that?" "I'd move out, we'd get a place together he'd eventually leave, then where would I be?" "My God." " The sauce is so good." " Thank you." " Where's my lobster for table 12?" " Plating, chef." "I'm an actress and I don't do naked bondage movies." "The world is so full of pervs." "That guy at table 10 is the worst." "Every week a new bimbo." "I swear, he leers at my tits one more time, he's gonna regret it." "Damn it, Carlos!" "Watch where you're going." " Pay attention, everybody." " Sorry, chef." "Fire two lobsters right away." "Hold the nine." " I'm really sorry about that." " Just don't let it happen again." "Now you're gonna run out of lobster right after I leave." "Kate, we're not gonna run out of anything, we're fine." "Hydrate." "You're a mom already." "Well, I've gotta practice while I can, right?" " Thanks." " Thank you." "Someone get the phone." " Kitchen." " Lf it's my sister, tell her she said 9 can't make it any sooner." " It's for you." " Take a message." "Kate I think you better take this." " Hello." " One's done." "Speaking." "Ms. Armstrong?" "I'm Dr. Burton." "We spoke on the phone." "Zoe's doing great." "She's gonna be fine." "Has anyone told her yet?" "We thought it would be best for her to hear it from someone in the family." "Do you know how we can reach Zoe's father?" "He's never been..." "I don't even know his name." "Dr. Burton to Emergency, please." "Paging Dr. Burton..." "I'm so sorry." "I have to go, but I'll be back to check on her in just a little bit, okay?" "Hello, Zoe." "Where's Mom?" "Is she dead?" "She is, isn't she?" "Yes." "You have one new message." " Hi, it's me." " And me!" "We just wanted you to know we're running late." "Traffic's insane." "We'll get there eventually." "Bye." "End of messages." "Now, this is a beautiful 2002 Dolcetto." "Any idea where it might be from?" " Probably Piedmont." " South Australia." "Adelaide Hills." "If Kate doesn't find a replacement soon, I'll have this baby behind the stove." "I think that would be a health-code violation." "Bernadette." "Look at the color of this wine." "It's absolutely beautiful." "And it's ready to drink..." "Give me three words to describe this wine." "Three words." "Did you know she was coming in?" "Kate, what are you doing?" "What do you mean?" "I thought you were gonna take a few days off." " No." " Are you sure?" "Yeah." "Give me one duck, two beef rare, and a rack of lamb." "I'm still waiting on those tenderloins of beef." "Pick up." "I need a quail and a Dover sole for table nine." "Okay, let's go, guys." "Come on, let's move it." "Terrine, carpaccio." "Carlos, I need more pans, pronto." " Five minutes on the lobster." " Cleanup right away on table 13." "Fire one rare steak on the fly." "Two duck breast, two rack of lamb." "Let's go, people." "Why is there no food on the counter?" "Come on, we got tables!" "Where's my soufflé for 14?" "Dear Kate, the baby is gorgeous." "I've called her Zoe, which means "life. "" "Now she's here, I'm beginning to get what a huge thing... ... it is I'm doing on my own." "So I want you to know if anything should ever happen to me... ... you are the only person I would want to have her." "I know you'll love my baby the same way I would." "Listen to me, it must be the three-day blues." "I love you, sis." "Christine." "Kate I want you to take a week off." "That's not a suggestion, it's an order." "What's up, Doc?" "Allow me to introduce myself." "My name is Wile E. Coyote, genius." "Hello, Zoe." "I'm sorry, Mac, the lady of the house ain't home and besides... ... we mailed your refund check last week." "I cooked us something tasty." "I'm not hungry." "Okay." "You know, you can leave on Friday." "You know that?" "Yes." "Zoe, you and I have to talk about what's gonna happen." "Can I go back home?" "I'm afraid not." "Why not?" "Well, you'd be alone there." "Your mom asked me to take care of you." "So you'll be coming home with me, okay?" "So the kitchen is just to the right there." "The living room." "This is my bedroom and the bathroom." "This will be your bedroom." "We'll have sunshine today." "It's cold, a high of 36." "Her name is Nelly." "I've had her since I was 3." "She has a whole family." "You should see all my other animals." "Zoe, dinner's ready!" "Okay." "Bon appétit." "Everything all right?" "What's the matter?" "Aren't you hungry?" "Can I go back to my room?" "Sure." "Zoe, I have to stop by the restaurant for a couple of minutes." "Will you be okay here on your own for a little while?" " Yes." " Now, if you need me just press one, that's my cell phone, and two, that's the restaurant, okay?" "It's only a few blocks away, so if you need me I can be back here in no time." " All right?" " Okay." "I won't be long." "Hi, Kate." "He says, "Look!" "Look at the stars!" "Gaze at the stars which tremble with love. "" "Hello, chef." "Oh, my God, it's you." "I am begging you, will you please tell me the secret of your saffron sauce?" "Excuse me?" "Listen to this, guys." "Listen to this right here." "Listen." "He's saying, "Fade the stars, fade all the stars. "" "So you guys are my string section." "He says, "In the morning I am going to wake. "" ""This is our love. "" "Now, everybody. "Win our love. "" "All right, all right." "Back to work!" "Who do you think you are?" "Nicholas Palmer." "And may I just say the world would be a dark and depressing place without your quail in truffle sauce." "We need to talk." " You could've at least asked me." " I'm sorry." "I couldn't wait." "Nick became available." "I had to act quickly." "The last thing I need right now is some lunatic in my kitchen." "He's not a lunatic." "He's exuberant." "God knows we could use that around here." "Exuberant?" "Are you kidding me?" "The guy thinks he's Pavarotti." "Good evening." "Do you have a reservation?" " Yes, Matthews." " Matthews." "Yes." "May I take your coats, please?" "Let me show you to your table." "Excuse me." "Your waiter will be right over." "The only demand I had when I took this position was I get to choose who I work with." " Leah would have been just fine." " Leah can barely stand up anymore." "If I push her, she's gonna fall over." "Holding her crotch and chopping at the same time!" "Give him a chance." " Nick is excellent." " I know nothing about him." " I have no idea what..." " Give me some credit." " He was the sous-chef at II Treviso." " Italian?" "You bring a sous-chef from an Italian restaurant, and I'm the one in therapy?" "We were lucky to get him." "Peninsula offered him executive chef." "Why didn't he take it?" "Because he said he wanted to work with you." "Zoe." "Funny thing to me about being in these cabs is when you're in Manhattan... ... for some reason you don't get scared no matter how fast you're going." "Well, you know, he's driving fast and recklessly." "He's a professional." "He's got a cab-driver's license, I can see it right there." "I don't even know what it takes to get a cab-driver's license." "I think all you need is a face." "This seems to be their big qualification." "No blank heads are allowed driving cabs in this town." "Kate, wake up." "Kate." "School starts at 9." "It's 8:20." "Oh, no." "Oh, jeez." "Okay, let's get dressed, come on." "Oh, you're dressed." "Okay, okay, one minute." "Do you need supplies or anything?" "Like pens or paper?" "They usually have those things." "I made your lunch yesterday." "I hope you like duck." "Okay, come on!" "Let's go." " I can't find my scarf." " Don't worry about it." "I can't have you late for your first day of school." "Let's go." " I need my scarf." " Zoe, just use one of mine." "We'll find yours later, all right?" "Let's go find your scarf." "Here it is." "Is this it?" " That's it." " Great." "That was easy." "Let's go." "Okay." "Your lunch." "Could you get that, please?" "Why didn't you get the door?" "I'm not supposed to answer the door for strangers." "Right." "Yeah, that's smart." " Hi, Sean." " Any chance for some coffee?" " I've just run out." " Sure." "We're running a little late but..." "Just one second." "Good morning." "I'm Sean." "I live downstairs." "You must be Kate's niece." "Zoe, right?" "My kids are about your age." "They'll be staying with me this weekend." "Are you gonna be around?" "Here you go." " Thanks." " You're welcome." " The good stuff." " Yeah." "All right, let's go." "Quickly." "Thank you for the Thai noodles last night." " No problem." " That was really nice." " I guess this is where you go in, right?" " I don't know." "Right." "Come on." "It's gonna be fine." "Ms. Armstrong?" "I'm Ellen Parker, the principal." " Kate." " You must be Zoe." " Very nice to meet you." " Hello." "I'll take you to the classroom and we'll meet your teacher." "There has to be someone better suited for this." "I have no idea what to do with a kid, especially one who's lost her mother." "How do their minds work?" "I can't get Zoe to eat anything I make." " What am I supposed to do, force her?" " Maybe she misses her mother's cooking." "My sister never cooked." " She reheated." " Well, that's the point." "Maybe Zoe needs something more familiar, less sophisticated." "What did you eat when you were a kid?" " It's not the same." " What do you mean?" "My mother was an amazing cook." "Of course, I was the only one who appreciated it." "And after your mother passed away, did your father take over the cooking?" "No." "He didn't take over anything." "We were lucky if we even saw him at dinner." " So who took care of the two of you?" " Can we not get into this right now?" "Okay." "What about fish sticks?" "Kids love them." "Fish sticks?" "Yeah, you know, they're frozen and breaded..." "I know what fish sticks are." "I just can't believe I'm paying for these suggestions." "Fish sticks." " Did you learn anything interesting?" " No." " Anything uninteresting?" " No." " How was your teacher?" " Bald." "Well, that's interesting." "Fish sticks." "You know, I was thinking the other day, I know so little about you." "I mean, we're family, but I don't even know what your favorite color is." " Red." " Red?" "See, I didn't know that." "I love red." "Red's a great color." " What's your favorite number?" " You know, you don't have to do this." "Do what?" "Try so hard." "Coming!" "Hi, I'm Charlotte." " From the agency?" " You expecting another Charlotte?" "No." "So can I come in or what?" "Oh, sure." "Come on in." "Excuse me one second." "I told you, I don't need a babysitter." "I'm not a baby anymore." "So, what am I supposed to do?" "I can't leave you here alone." "Why not?" "I'm perfectly fine." "Zoe, you barricaded the door, remember?" "I charge from when I get here, you know." "Yeah." "I see you've brought something to read to Zoe." "It's for my thesis." "Rapidly mutating deadly viruses." "You know, like Ebola, that sort of thing." "Well, have fun at work." "22 Bleecker, can I help you?" "Table for five?" "Yes, I can seat you at 9." " I know." " Yes." "How do you want the sea bass prepared tonight?" "Tell them they're gonna be served to some very important people." " You don't like music?" " It's distracting my staff." "Nick, you were right." "Pavarotti makes sex so much better." "Glad to hear it." "Bocelli's good too, but only for shallow one-night stands." "Pronto." "Food." "Belly." "Now." "Thank you." "Thank you." "Me plus baby equals extra large portions, please." "Bernadette." "Bernadette." "That's it." "David, Richard." "It's gonna be, I think, all men." "I think I can handle it." "Good luck." "John." " Chef." " No, thank you." "Delicious, chef." "Only a full cook can judge food." "When you're hungry, everything tastes better than it really is." " I never eat in the afternoon." "My grandmother whispered this recipe into my ear on her deathbed." "She brought it over from the Old Country and I made it especially for you today." " Happy?" " Very happy." "I thought your grandmother lived in Miami." "Well, you know..." "Well, we all thought she wasn't gonna make it." "It was like a miracle." "It was a miracle." "You take care of those dishes and I'll take care of these." " Then we won't get in each other's way." " Wait, your half is bigger than mine." "Right, right, right." "I have some very big items." "I got beef, I got fish, I got rabbit." "Showtime, folks!" "Let's go." "Fifteen, two terrines, one Dover sole, two lamb." "Seven, carpaccio." " Have you seasoned that right?" " Yes, chef." "It's okay." " Okay, where am I?" "Where's my lamb?" " Slicing it now." "One second." "One second." " Pardon me." " I need that." "And you'll get it right back." " Can I ask you something?" " Do I have a choice?" "Where did you learn to cook so well?" "My mother." "Seriously?" "I thought you were gonna say you studied under Alain Passard at L'Arpege or something." "I did." "But my mom was better, and she didn't throw plates at me." "Oh, God." "I need more space." " Why are you so mad at me?" " I'm not mad at you." "You're very mad." "Look, this is my kitchen." "I've worked really hard to get here and I'm not gonna let you take it away from me." "What makes you think I wanna take it away?" "What else could you possibly want?" "You treat me like a dog, Larry." "I'm not a dog." "I'm a human being!" "A human being, goddamn..." "I'm sorry, I have an audition." "Would you mind?" "Look, I don't need this job." "I can work wherever I want." "I'd like to work here because it's an honor to cook with you but I'd rather work somewhere I'm welcome." "So if you want me to go, you just say the word." "Want to tell me what's going on in here?" "Well?" "Wait a minute, where are you going?" "I'm sorry, you'll have to find someone else." " Kate, what have you done?" " I didn't do anything." "Nick, please." "We need you." "Well, I'll have to hear that from her." "It's my restaurant." "It may be your restaurant, Paula, but it's her kitchen." "Without her all this would just be a pile of hot metal and dirty dishes, so..." "She decides." "Kate." "Seems you've left me no choice." " Do you want me to stay?" " Didn't I just say that?" "I didn't hear those words." "I want you to stay." "Love to." "Thought you'd never ask." "You're on fire." "And I know you guys are scared, but it's okay, because I'm here." "But if you get really scared, you can wake me up and I'll hold your hand." "Especially you, Louie, because you're the littlest." "Zoe?" "Hi." "When did Charlotte leave?" "I don't know." "A while ago." "Looks so cozy in there." "I have an idea." "How about you come with me to the restaurant tomorrow night?" "Night." "Night." "Please." "I've tried everything." "No matter what I make, she doesn't eat it." "Why not try giving her some regular kid food?" "Have you been talking to my therapist?" "All right, two foie gras, one tartare, two bisque and a goat cheese." "Breathe in." "It's basilico." "Kate." "Kate, your biggest fans are dying to see you." "Leah, finish the duck on table five?" "I gotta take a break." "Yeah, sure." "All right, I need one terrine, two bisque and a langoustine, please." "Good." "Table 12's getting a little antsy." "Will it be up soon?" "Hold this." "Fire one duck, one sea bass and a soufflé, please." "It's working now, chef." "Table five's coming up in a few seconds, chef." "Save some for me." "You know, in ancient Rome guys used to chew basil before the prom to get rid of bad breath." "It's true." "Thank you." " They didn't have proms in ancient Rome." " They didn't?" "Are you sure?" "I thought they did." " See you tomorrow." " Thanks, Leah." " Good night." " Good night." "Where are you going?" " Hi, Bob." " Hi, Kate." "How you doing?" " Good." "What you got?" " I got fresh bluefin." "Just came in like five minutes ago." "I got baby mollusks over there." "What's behind you there?" " Colorados." " Yeah, I'm gonna take some of those." "Unbelievably fresh." "Look at this." "Good morning, it's 24 degrees, sunny at 9:00... ... on this Tuesday, February 28th." "Zoe." "Zoe." "Zoe." "Zoe." "Wake up." "You're gonna be late for school." "Here are your boots." "Come on." "Let's go, let's go." "Just tell them it was my fault, okay?" "Ladies, you are very lucky today." "I have new shipment." "They are from all over the place." "Modena, Montferrato, Bologna." "Big sniff." "It's a black truffle from Parma." "It's not bad." " What do you have in white?" " My best product." "Very, very hard to find this time of year." " Who'd you get them from?" " You know I never reveal my sources." " So how much for the white?" " Twenty-two hundred a pound." " Oh, my God." " They are from Alba." "No, no, no." "I think my water just broke." " What?" "You're kidding me." " No, I'm not kidding you." " Oh, my God." "Are you okay?" " I don't know." " Can you call 911?" " No, no, no." "No police." "It's not the police." "We need an ambulance, she's having a baby." "Oh, my God." "Okay, just keep relaxed." "We have pregnant lady, Bleecker and Charles." "22 Bleecker Street." "Her water just broke." " 22 Bleecker on the corner of Charles." " Bernadette!" "Okay, thank you." "Breathe, yes." "Breathe." "Oh, no!" "Just on the left." "You see the steps?" "Here." "Stop!" "Stop!" "Just wait." "Oh, Zoe." " I'm so sorry." " You forgot me." " It's not what you think." " You forgot me." "Leah had her baby, I had to take her to the hospital." "But you still forgot me." "Okay, I forgot you." "And I'm so sorry." "Come on, Zoe." "Let's go home." "Zoe, come on, it's freezing out here." "Zoe." "Move it!" "Zoe, I'm sorry." "I totally blew it." "I know I'm doing everything wrong." "But I'm doing my best, okay?" "Why don't you think of something I can do to make it up to you?" "You mean like a wish?" "Yeah." "Yeah, you wish for something and I try and make it happen." "And in return, you forgive me." " Can I save it for later?" " Sure." "Kate you're not doing everything wrong." "Really expensive." "All over the kitchen, everybody knows about it." "Carrots are a different matter." "Here you go." "How many left?" " Kate?" " Yeah?" " You're not working tomorrow, are you?" " Nope." "And Nick isn't working tomorrow, is he?" "Sunday, we're closed." "Why?" "Why's that?" "It's my wish." "It was Zoe's idea, not mine." " How come I knew that?" " She says she prefers Italian." " Your kitchen or mine?" " Wouldn't it be easier to do it here?" " Fine, we'll use mine." " But my kitchen's fully equipped." "Perfect." "Shall we say noon?" "I'll do the shopping." " Aren't you cold?" " He's late." "Men." "I'll be right there." " Hello?" " Help." "Coming!" " Hey, you." " You need a hand?" "No, I got it." "This way." "I'll get that." "Afternoon, chef." "Got the goodies." "Where's the kitchen?" "Right there." "Yeah, yeah, right." "Okay, Yeah." "Okay, sous-chef, put on your apron." " Now, do you have a cast-iron pan?" " Of course I have a cast-iron pan." "Good." "No, no, no." "Don't touch my Tupperware." "Tonight, Zoe and I make dinner, and only Zoe and I. Zoe." " But I could help." " But it's my wish." "Tonight we're making pizza." " Pizza pans, please, sous-chef." " Okay." "Gotta get the flour, little eggs, we'll roll some dough, okay?" "Work your hands in there." "That's good." "Get your fingers in there." "Just like that." "You create your own person and buy them pets but you have to make enough." "Nice and round." "Then when you're ready, go like that, then you go like that." "That was the first thing he taught me." "Both hands." "Gotta know how to do it." "That's what drapes over." "Right?" "Yeah, good, and then just go like that." "Then you gotta sing Italiano." "You go like that." "Then you slap it down like that." "Remember what I told you." "You can do it." "Kate!" "We're ready." "No shoes." "Okay." "Close your eyes." "Come with me." " What's the secret?" " You'll see." "No peeking." "Almost there." "Okay, open your eyes." "Surprise." "I guess we're not eating at the table." "We don't have one." "We're on safari." "I see." " You forgot the plates." " No, no." "Sit down." "We don't need plates." " No plates?" " No plates." "Dirty plates attract the big cats." "Well, we certainly don't want the big cats." "Let me guess who made the pizza." " Me!" "Me." "Me, me, me." " Really?" "Whose idea, though?" "Your idea." "Yours has the tusks on it." "Oh, you were so close." "Nothing moved." "But I get my eye poked out." "That's okay." "It's a vampire." "It's a king turtle." "The king, The Lion King!" "Yes!" "Yes!" "I should put her to bed." "Allow me." "Thank you." "So where did you go to cooking school?" "As a young child, I sat at my grandmother's knee..." "Oh, yeah, in Miami, right." "It was in Pittsburgh, actually." "My father was a steelworker." "But you did go to cooking school?" "Are you kidding me?" "Cooking was for girls." "After high school, I went backpacking through Italy." "I owe my entire career to a girl named Sophia." " Sophia?" " She's my first love." "An older woman." "Nineteen." "Her father owned a little trattoria in Tuscany." "He was a brilliant chef and he taught me everything he knew." "Sophia told him we were just friends, so he gave me a job in his kitchen." "I fell madly in love with food." "Italian food." "Everything Italian, actually." "So, what happened to Sophia?" "Her father found out what we were up to and he fired me." " That's too bad." " Well, it opened a lot of doors." "I spent the next couple of years working in some of the best restaurants in Milan." "So how come you're not running your own kitchen by now?" "I don't know." "I guess the right offer hasn't come my way." "So, what would you do if you had your wish?" "I got my wish." "I made it this morning." " I'm not a dessert person." " You haven't tried my tiramisu." "Well, maybe I am a dessert person." "You know, in Italian, "tiramisu" means "food of the gods. "" "No, it doesn't." "Well, it should." "You have a little..." "Some cream, right there." "I should go." "You're leaning on my scarf." "Oh, right." "Yeah." "Sorry." "Good night." "He's so unpredictable." " In what way?" " In every way." "He never does the right thing at the right time." "He's..." "Kate." "Life is unpredictable." "Not in my kitchen." "I'm sure you'll be able to prevent the worst." "The worst?" "That he'll tolerate you for any length of time." "What is this?" "Some new kind of therapy?" "Insult the client?" "Only the finest therapists use it." "So I'll see you after school, okay?" "Have a good day." "Hello, Kate." " We're on time." " Do you have a minute?" "Sure." "I've been speaking to Zoe's teacher." "She's been sleeping in class a lot." "And do you know what her explanation for this is?" " No." " She says it's her late work hours." "She tells her classmates she's working as a kitchen assistant in your restaurant to earn her room and board." " I see." " Lf I actually believed that Zoe was working late hours at a restaurant I'd need to contact Child Protective Services." " That won't be necessary." " I know that." "It's better for everyone when children are well cared for by their relatives." "I'd hate to see Zoe end up in foster care after all she's been through." "But I'm confident that you will address this and there will be no need to go that far." "I'll be checking in on Zoe, and we'll talk again soon." "And then Mr. Daniels' cell phone rings and he answers it and talks through the whole class." "It was so funny." "Zoe, we need to talk about something." "You can't come to work with me anymore." "Why not?" "Because I'm afraid they're gonna take you away from me." " But I like going to the restaurant." " I know." "I know you do, but it's just not right for a little girl to be up so late, you know." " You don't want me there." " No, that's not true." "No, you just need to get a good night's rest." "You hear me?" "You don't want to end up being taken away." "Who cares?" "You didn't want me anyway." "Zoe." "Zoe!" "Zoe!" "Zoe!" "Zoe, stop it!" "Stop it!" "Let me go!" "Let me go!" "I want my mom, not you!" "Zoe?" " Can I come in?" " No." "Zoe, please." "I'm sorry." "Go away." " Hi, guys." "Is your dad there?" " Yeah." "Dad!" " Hey." "Hi." " Hi, Sean." " How are you?" " Good." "Can I ask you a favor?" " Of course." " I know it's last minute but I have to go to work soon and Zoe and I had a fight." "You want me to keep an eye on her?" " Lf you could just check on her." " No problem." "Take it inside, guys." " You got a key?" " Sure, I got it right here." " Thanks, Sean." " Hey, how are you doing?" " All this is pretty new to me." " I know what might help." "Call this number." "Anna." "She's a godsend with kids." "Saved me right after my divorce." "I'm sure she'll be able to watch Zoe for you whenever you need." " Thank you." " No problem." "If you're gonna play for Ireland, you're gonna have to get stuck in better." ""Ms. Armstrong introduces bits of truffle in an endive salad that accompanied a lightly steamed and wondrously silken halibut fillet." "It was highlighted by the gorgeous aria of her saffron-infused emulsion. "" "This guy can't decide if you're a cook or a composer." ""The artistry of her signature quail with truffles made it clear that she brought in a great sous-chef to complement her distinctive style. "" "It says that?" "Just making sure you're paying attention." "You look like you need a drink." "I never drink at work." "Are you serious?" "Like that?" "Tell me what else you never do." "What do you mean?" "Well, you never eat dessert." "You never drink at work." "I'm kind of hoping you'll tell me you never go out with guys who sing opera." "I never go out with guys who sing opera." "Yes." " I got it." " I got it." "So I've got one for you." "What are the three secrets of French cuisine?" "Oh, come on." "Everybody knows that." "Oh, yeah?" "So, what are they, smarty-pants?" "Butter, butter and butter." "You're good." "You know, you didn't have to do this." "It's not like I'm drunk or anything." "Sean." "Hi." "Nick, this is Sean, he lives downstairs." "This is Nick." "We cook together." " How are you?" " You obviously don't live in the building." " How was Zoe?" " Sound asleep." "She's a great kid." " Have a good night." " Thanks, Sean." "Yeah, he's so sweet." "He was just keeping an eye on Zoe." "He's just a sweet, nice guy." "I couldn't wish for a better neighbor." "Yeah, he's always just so... in a totally neigh..." "Take an aspirin." "Yeah." "Come on!" "It's time to get up, sweetheart." "I don't wanna go to school today." "Guess what." "I don't wanna go to work today." "Really?" "Today it's just gonna be you and me." ""To all the gang at 22 Bleecker let me introduce you to my little hors d'oeuvre. "" " Let's see the photo." " Emma Jillian." "Here we go." " "Seven pounds, three ounces. "" " She's adorable." ""She can't wait to meet you all." "Love and kisses, Leah. "" "Kate's late." "She asked for some time off." "Something personal came up." "One, two, three, four, five, six!" "Yes, Park Place!" " And with a hotel, 1500 bucks." " I don't have enough." "Mortgage, baby." "Mortgage." "Come on." "I love this game." "Come on." "All right." "Great." "Thank you." "All right, so, what do I need?" "I need a nine." "Give me a nine and it's Free Parking." "Oh, boy." "Here we go." " Yes!" " No!" "This isn't fair." "No!" "I'm rich." "I'm rich." "I'm rich!" "You know what this means, don't you?" " No, what does it mean?" " War!" "Come on and fight!" "You're afraid of a little pillow?" "How's that rib eye doing, you guys?" "I need two sea bass." "All right, pancetta, goat cheese, oysters, steak tartare, grilled rib eye." " How much longer on that rib eye, Mario?" " Rib eye coming." "Come on, let's pick it up." "I needed that soufflé five minutes ago." "Let's go." "We did 110 covers tonight." "Everything was excellent." "You've really mastered the menu, Nick." "You put your signature on the dishes, and all the regulars have noticed." "How would you like to stay on permanently?" "I think I'd like that." "If it's okay with Kate." " Who is it?" " Do you have any idea what time it is?" " What?" " It's very, very late." "The kitchen was a very different place without you tonight." "I'm sure you did just fine without me." " It was hell." " That's better." "Cognac white wine celery leek, shallots and garlic." "I'm getting truffle." " I haven't..." "I think I..." " Don't think." "Pancake time." "Pancake time." "Where's my sous-chef?" " Pancakes?" " You want to help me?" "Okay, flip it." "Nice." "You could start your own restaurant." "Call it Zoe's." "I'll call it Nick and Zoe's." "Excuse me?" "I did squeeze the orange juice." "Okay." "Nick and Kate and Zoe's." "I like the ring of that." "Not in front of Zoe." "Zoe, I'm now going to kiss your aunt." "This is so embarrassing." "So how are we gonna work together now?" "We'll do what we always did." "You tell me what to do and I'll go behind your back and do whatever I want." "I wanna show you something." "Quick!" "Let's go." "Excuse me." "Do you have any kaffir lime leaves?" " Over there." "You touch, you buy." " I know, I know." " What do you need those for?" " You'll see." "Here they are." " One for you." " Smells good." "Like it?" "One for you." "How do I know this smell?" "Is this your saffron sauce?" "Apparently we have no secrets anymore." "You touch." "I know." "I buy." " You buy." " Two dollar." "Today for our entrée special, we are offering a Hudson Valley free-range duck over a butternut-squash purée and that is served with patty pan squash and blood orange and finished with a mushroom sauce made up of a variety of wild mushrooms..." " From the... from the cognac region of France." " What do you think?" " What's that?" "Nick came up with a great idea of sending mini desserts home in a box." "It's so obvious." "So obvious." "And, Nick, I love those wines you recommended for the new menu." "Well, you're gonna have to discuss that with Kate." "John, tell us about the asparagus dish." "We're also serving as a special a side..." "Rather, an appetizer with asparagus and cippolini onions and it has a side of sliced watermelon radishes." "Table five's coming up in two seconds, chef." "Nick, the couple at table eight wants to say hello." " They're drooling over the sea bass." " Kate's responsible for all the food." " She hates leaving the kitchen." " Interesting." " What else can you tell us about her?" " You know what?" "I'm not gonna get into this." "I don't care who goes out there." "But if it is you, do me a favor and try not to stab anyone who complains." "Don't look at me." "You." "Me." "In there." "Now." " So, what's the story?" " What do you mean?" "I turn my back for a couple of days and it's:" ""Nick, the wine." "Nick, the customers." "Nick, the boxes... "" "She offered me your job." "What?" "Why didn't you tell me?" " I can't believe this." " I was going to tell you." "I knew I couldn't trust you." " The moment I met you, I knew." " The truth is that you can't trust anyone." " You've never trusted anyone in your life." " Guess what." "Why should I when this happens?" "Why didn't you have the guts just to run your own kitchen, Nick?" "Instead of coming in here and taking over mine?" " Is that what you think?" " That's exactly what I think." "You know, Kate it's okay to let people in sometimes." "Maybe one of these days you'll figure that out." " You don't understand." "This place is my life." " This is who I am." " No, it's not who you are." "It's only one little part." "Anna, it's me." "Hi." "How did everything go?" "I think we did well." "We played Monopoly." " Who won?" " She did." "Thanks a lot, Anna." " See you tomorrow." " Good night." "Mailbox one." "You have one new message." "Monday, 11:54 p. m." "Oh, and for the record, I did turn her down." "End of messages." "Oh, and for the record, I did turn her down." "Kate." "Still awake?" "Where's Nick?" "He went home after work." "Get some sleep, it's late." " Kate?" " Yeah?" "You can sleep with Louie if you want." "Oh, honey, that's sweet of you." "He needs you, I'm fine." "Night-night." "Night." "You had no right driving him out of here." "This is my restaurant." " You've made that abundantly clear." " You better find me a replacement fast." "You didn't need my help with the last one." " Kate." " Okay." "I'll find someone." "Like a certificate or something?" "I don't have that little piece of paper." "But there's guys driving on the street without a license." "They can't drive, so, you know." "Well, my specialty is in the beef area." "I deal with meats all the time." "Sausage, beef, slaughtering pork." "I'm famous for my Vietnamese pork chops with saffron mashed potatoes and key-lime asparagus." "I get along great with people." "Really, I'm actually a big people person." "Oh, I'm a people person." "I'm a team player so long as everybody follows my lead." "There was a misunderstanding between me and the head chef and the manager and the owners." "Fired is like, you know, it's, "You're fired!" You know." "But, no, I think we parted on amicable terms." "Why doesn't Nick come to see us anymore?" "We had kind of a fight." " What about?" " Just silly grown-up stuff." "How come you don't wanna tell me?" " It's not that I don't wanna tell you." " Is he ever gonna come back?" "No, he isn't, sweetheart." "Zoe." "Zoe, you awake?" "I'm done." "Are you having breakfast?" "Zoe?" "Nick, it's me." "Is Zoe with you?" "I got up this morning, and she was gone." "I'm here right now." "They haven't seen her." "I don't know." "I told her about us last night and she was upset, but..." "Oh, my God." "What did the police say?" "They checked the bus station and the train station." "She could be anywhere." "Well, she's a kid." "She would probably choose someplace she knew, right?" "She went to school and the restaurant, that's it." "Kate, it's gonna be fine." "She's gonna be all right." "You know what, maybe we should check if she's gone back home." "Zoe?" "Maybe she left a note somewhere." "She's not here." "Did she take her backpack?" "If she didn't pack anything..." " She didn't take Louie." " What?" "She wouldn't run away without Louie, right?" "I let her down, Nick." "I feel like I made a mess of everything." " We're gonna find her." "I promise." " She needs her mother." " She just needs her mother." " Kate." "I think I know where she might be." " There she is right there." " Oh, thank God." "Zoe, are you all right?" "Zoe, please, don't ever do that again." "I was so afraid something happened to you." "Sweetheart, what is it?" "I'm afraid I'm gonna forget her." "We'll never forget her." "I promise." "Never." "And we can come here whenever you want, okay?" "You're coming in, aren't you, Nick?" "Not today, sweetie." " Guys still mad at each other?" " No." "Come on." "See you upstairs." " You know..." " You know..." "I just wanna say I'm sorry, Nick." "Don't apologize." "I actually wanna thank you." "I thought a lot about what you said about me not having the guts to go after what I want, and you were right." "That's why I took a job." "In San Francisco." "The executive chef at a new restaurant." " Well, that's great." " Yeah." "Well, I couldn't have done it without you." "Executive chef." "Guy at table seven said if he wanted it cremated he wouldn't have asked for it rare." " That is rare." " Apparently not rare enough." "Any rarer, it'd walk out of here and hail a cab." "Look, these are ad-agency people." "They spend a lot of money here." "No tantrums tonight." "Just fire another one." " Fire one rare steak on the fly." " Rare steak on the fly." "Where is the lamb for six?" " How are the quail?" " Great, chef." "Pick up!" "Terrine, carpaccio." "From the asshole on seven again." "He wants to know whether you've ever seen a rare steak before." " Rare enough for you?" " Are you out of your mind?" " Yeah." "That's why I'm in therapy." " I'm so sorry." "I'll get you a new tablecloth." "No, please, let me take care of that." "Not bad." "That felt so good." "I just want a steak." "I wish there was a cookbook for life, you know?" "With the recipes telling us exactly what to do." "I know." "I know." "You're gonna say, "How else can we learn, Kate?"" "No." "Actually, I wasn't gonna say that." " You wanna guess again?" " Oh, no, go ahead." "What I was gonna say was you know better than anyone." "It's the recipes you create yourself that are the best." "Hold on just a second." "I think you should know there's something else I never do." "What's that?" "I never invite myself into a man's apartment, blindfold him and feed him saffron sauce while begging him not to go to San Francisco." " You never do that?" " Never." "That's too bad." " You're gonna sear that first, right?" " Yeah, chef." "Don't forget to reduce this sauce a little, okay?" " You're crossing the line." " No." "Yes, you are." "Look, your spoon's in my territory." "Look, I can't help if your reduction's a little thin." "I have to say something." "I wouldn't talk." "Your sabayon's got lumps." "You're out of your mind." " It's perfect." " I'll be the judge of that." "You're right, it is perfect." "Pancakes." " Thank you." " Voila." "Zoe, that's enough." " Hi." " Hi."	{ "pile_set_name": "OpenSubtitles" }
Wer als blind eingestuft ist, hat häufig trotzdem noch ein gewisses Sehvermögen. Eine Augmented-Reality-Brille des Start-ups VA-ST soll solchen Personen bald helfen, dieses Sehvermögen besser zu nutzen: Sie filmt die Umgebung und spielt dem Träger ein Schwarzweiß-Bild vor die Augen, auf dem relevante Informationen wie Menschen oder Hindernisse hervorgehoben sind, berichtet Technology Review. Studie mit Prototyp Im Juni hat VA-ST in Großbritannien eine Studie begonnen, bei der 300 Menschen mit Augenproblemen wie Makuladegeneration, Glaukomen oder Retinitis Pigmentosa jeweils vier Wochen lang Prototypen der Brille sowie des dazugehörigen Controller-Kästchens bekommen. Weil die Steuerung aufzeichnet, welche Einstellungen die Probanden wann nutzen, und weil sie außerdem auch Bewegungsdaten eines eingebauten Beschleunigungsmessers erfasst, können die Forscher auswerten, wie Menschen mit unterschiedlichen Augenproblemen die Brille im Alltag verwenden. Zu dem System gehört unter anderem eine Tiefenkamera, mit deren Hilfe ein Android-Computer entscheidet, was hervorgehoben werden soll und was ignoriert. Wenn zum Beispiel eine Person in drei Meter Entfernung steht, zeigt die Software sie in Schwarz-Weiß mit einem weißen Umriss, außerdem sind Gesichtsmerkmale wie Brille, Nase oder Mund zu sehen. Andere Personen und Objekte in größerer Entfernung dagegen erscheinen grau, der Hintergrund ist komplett schwarz. Eine kommerzielle Version soll nach Angaben von VA-ST Anfang kommenden Jahres verfügbar sein und unter 1000 Dollar kosten. (Sascha Mattke) Mehr dazu bei Technology Review online: (sma)	{ "pile_set_name": "OpenWebText2" }
- -39. Factor in + 3n*2 - 6 + 0n + 3. 3(n - 1)(n + 1) Let d(w) be the second derivative of w7/672 - w6/288 - w*5/96 + 5w4/96 + w3/3 - 2w2 + 31w. Let p(i) be the second derivative of d(i). Factor p(t). 5(t - 1)2(t + 1)/4 Let w(l) = -37l - 1776. Let a be w(-48). Find z, given that a - 2/3z + z*2 = 0. 0, 2/3 Determine k, given that -26/7k*2 + 2/7 + 24/7k = 0. -1/13, 1 Let l(j) = 16j - 6 - 6j - j. Let c be l(2). Solve k*2 + 22k - 2k - 5k*2 - 4k*2 + c = 0 for k. -1/2, 3 Let p = 885 + -18589/21. Let v = p - -6/7. Determine z so that 4/3z*2 + 0 + vz*5 + 0z*3 - 2/3z - 4/3z4 = 0. -1, 0, 1 Let x(f) = -f2 + 24f - 41. Let h be x(22). Suppose 36/5q2 - 144/5q - 3/5qh + 192/5 = 0. Calculate q. 4 Let v(d) = d2 + 5d + 4. Let x be v(-5). Suppose k - 185 = -xk. Factor 10l*4 - kl*4 - 21l*5 + 0l*3 - 2l*3 - 4l*3. -3l*3(l + 1)(7l + 2) Suppose -95 - 88 = 38w - 183. What is j in 1/9j*4 + w + 2/9j - 1/3j2 + 0j*3 = 0? -2, 0, 1 Let s be (0 - -1)/((-270)/369) - 0. Let w = s - -17/10. Factor 1/3u*3 + 1/3 - 1/3u - wu2. (u - 1)2(u + 1)/3 Let -135/4x2 - 2835/8x + 75/4x3 - 3969/8 - 3/8x*5 + 15/8x*4 = 0. Calculate x. -3, 7 Let q be (-65)/78(-5)/5027. Let i(w) be the second derivative of -1/2w*3 + 0 + qw*2 + 1/24w*4 - 8w. Suppose i(o) = 0. What is o? 3 Suppose i = 2p, i + i + 2 = 5p. What is w in 81w4 + 60w*p - 12w + 56w4 - 33w*3 - 242w4 = 0? -1, 0, 2/7, 2/5 Let q(l) be the first derivative of -l7/980 - l6/210 + l5/20 - l*4/7 + 34l*3/3 - 3. Let s(m) be the third derivative of q(m). Factor s(o). -6(o - 1)*2(o + 4)/7 Factor 4w4 + 45w + 27 - 112w2 - 104w*3 + 59 + 22 + 59w. 4(w - 27)(w - 1)(w + 1)2 Let s(j) = j3 - j2 - 2j + 24. Let r be s(0). Suppose 2d = c + 10, -r = -4d + 4c - 0c. Factor 1/5fd + 0f*2 + 1/5f*5 + 0f + 0f3 + 0. f4(f + 1)/5 Let q = -62 + 2419/39. Let o(v) be the third derivative of 0v5 + 1/78v*4 - qv*3 + 0 + 1/1365v*7 + 0v - 1/390v6 - 5v*2. Let o(b) = 0. Calculate b. -1, 1 Let -60800x*3 + 960171 - 7000255 - 804x*4 - 4x*5 - 2060000x*2 - 27000000x - 18959916 = 0. Calculate x. -50, -1 Let w = -13 - -85. Find l such that 32l - 354l*3 - 282l*4 + 12 + 7l - 63l2 - 90l*4 - wl*5 = 0. -4, -1/2, 1/3 Let w(c) be the second derivative of -13c*4/36 + 41c3/18 - c2 - 323c. What is b in w(b) = 0? 2/13, 3 Let i(l) = -l4 - 4l + 4l - l. Let c(s) = -s4 - 12s*3 + 18s*2 - 16s + 3. Let m(p) = c(p) - 4i(p). Factor m(d). 3(d - 1)4 Let v(n) be the second derivative of n5/60 + 29n4/36 + 65n*3/6 - 75n*2/2 - 4n - 16. Factor v(o). (o - 1)(o + 15)2/3 Let j(u) be the second derivative of -u7/1890 + u6/1080 + u5/270 - 3u*2 - 13u. Let s(b) be the first derivative of j(b). Let s(m) = 0. What is m? -1, 0, 2 Solve -38/3q - 88/3q*3 - 16/3 + 133/3q*2 + 3q*4 = 0. -2/9, 1, 8 Let g(r) = 20r*2 + 28r + 3. Let t(w) = 20w2 + 28w + 2. Let h(c) = -6g(c) + 5t(c). Factor h(f). -4(f + 1)(5f + 2) Let x(p) be the first derivative of 3/28p*4 + 1/35p*5 + 0p + 1/7p2 - 1/42p*6 - 17 - 5/21p*3. Factor x(i). -i(i - 1)*3(i + 2)/7 Let x(w) be the third derivative of 5w8/336 - w6/8 - w5/6 + 3w*2 + 31w. Factor x(l). 5l2(l - 2)(l + 1)2 Let r(x) = x3 + 6x*2 + 7x + 16. Let d be r(-5). Let v be ((-1)/d - 0)(-15)/5. Determine h, given that vh*2 + 1/2h*3 + 0 + 0h = 0. -1, 0 Suppose 4d - 105 = 111. Find r such that 20r*3 - 85r + 95r - 5 - 19r*2 + dr*2 = 0. -1, 1/4 Suppose 5l - 20 = -o, 0 = 2l - 14 + 6. Suppose -b + 4 = -ob. Factor -27 + 160c + 175c*2 + 2c*5 + 91 - 15c*2 + 8c*4 + 12c*b + 80c*3. 2(c + 2)5 Let m(r) be the first derivative of r9/27216 - r7/3780 + r5/1080 + 7r3/3 - 36. Let v(w) be the third derivative of m(w). Find g, given that v(g) = 0. -1, 0, 1 Suppose -3o + 4r + 40 = -o, -5o - 4r = -72. Let y = -16 + o. Factor 2/11g*3 + y + 0g - 4/11g4 + 2/11g*5 + 0g*2. 2g*3(g - 1)*2/11 Factor -2a*4 + 12a*2 + 27a*2 + 17a*2 + 83a + 8a3 - 19a. -2a(a - 8)(a + 2)2 Let c(u) = -u - 10. Let l be c(-12). Suppose -3x*l + 3 - 2x*3 + x + 5x*3 - 4x = 0. Calculate x. -1, 1 Suppose -1 = 5x - 11. Suppose -2l + 9 = l. Factor -2dl - 48 + 48 - 2d*x. -2d*2(d + 1) Let t(m) be the first derivative of m*6/4 - 4m*5/5 + 3m4/8 + m3/3 + 13. Suppose t(i) = 0. Calculate i. -1/3, 0, 1, 2 Let i be -23 - (-4225)/150 - (6 - 1). Factor -2/3 + 1/2w + iw*2. (w - 1)(w + 4)/6 Let h be 2 - ((-8)/2 - -4). Let n be (h - -1) + (-11 - -10). Factor 4b2 + 3b*3 + 9b - 7b2 + 7b*n + 5b*2 + 3. 3(b + 1)*3 Let r(j) be the first derivative of 0j + 1/3j4 + 0j*3 + 0j*2 - 6 + 2/9j*6 - 2/3j*5. Solve r(c) = 0 for c. 0, 1/2, 2 Let d be (0 - -2 - 5)/((-3)/10). Factor -4c*2 + d + 2 - 10 + 2. -4(c - 1)(c + 1) Let j(q) = q2 + 3q - 1. Let n be j(-4). Suppose 0 = 302i - 300i. Let 4/5l2 + il + 0l4 + 2/5l*5 - 6/5l*n + 0 = 0. Calculate l. -2, 0, 1 Suppose n + 14 = -n + p, -2n - 6 = 3p. Let f be ((3/(-27))/(-1))/(-1)n. Find y such that 2/3y + 2/3 - 2/3y*2 - fy3 = 0. -1, 1 Let u(p) be the second derivative of -p4/42 + 40p3/7 - 17p*2 + p - 52. Suppose u(r) = 0. Calculate r. 1, 119 Suppose 4q + 295 = 5r, q - 7r = -4r - 72. Let h = 75 + q. Suppose h - 1/2p - 3/2p2 = 0. Calculate p. -1/3, 0 Let i be ((-45)/(-36))/((-1)/(-4)). Suppose -4u - 4 = -iu. Determine n, given that -3 - 9n + 3nu + 4n + 6n3 + 5n - 6n = 0. -1, 1 Suppose -49c = -83c + 68. Factor 0 + 9/2x + 3/2xc. 3x(x + 3)/2 Let d(k) = 5k*3 - 2k + 2. Let i be d(1). Factor 2v4 - 22v*5 + 8v*i + 15v5 + v3. v*3(v + 1)*2 Find p, given that 802 + 228p*2 + 1198 + 600p + 2p3 - 168p*2 = 0. -10 Suppose 12/5q - 8 + 4/5q2 = 0. What is q? -5, 2 Let b(r) be the third derivative of r8/1008 + r7/630 - r6/120 - r5/36 - r4/36 + 61r*2. Factor b(c). c(c - 2)(c + 1)3/3 Factor -97m + 78 - 7m3 + 125/3m*2 + 1/3m*4. (m - 13)(m - 3)*2(m - 2)/3 Let k(j) be the first derivative of j*5/50 + 3j4/40 - j3/30 - 3j2/20 + 43. Factor k(n). n(n - 1)(n + 1)(n + 3)/10 Let a(g) be the third derivative of g*6/960 - 3g*5/160 + 9g*4/64 - 9g*3/16 - 134g2. Factor a(u). (u - 3)3/8 Let z(o) = 9o + 1. Let i be z(-1). Let d be (-20)/i - 1/(-2). Factor -3x + dx3 + 2x - 2x. 3x(x - 1)(x + 1) Let b(z) = 17z3 - 4z*2 - 47z - 13. Let u(f) = -8f3 + 2f*2 + 22f + 6. Let h(v) = 6b(v) + 13u(v). Factor h(p). -2p(p - 2)(p + 1) Let v(b) be the second derivative of -b6/45 + 7b5/30 - b4 + 20b3/9 - 8b*2/3 - 37b. Let v(y) = 0. Calculate y. 1, 2 Let -o*5 - 4o*2 - 79 + 156 - 77 + 3o4 = 0. What is o? -1, 0, 2 Let c be 0/(2/((-4)/2)). Let b(f) be the third derivative of -f2 - 1/24f4 + 1/120f*5 + cf + 1/12f3 + 0. Factor b(n). (n - 1)2/2 Let r(q) = 6q*4 - 81q*3 - 316q*2 - 420q - 191. Let w(j) = j*4 - 16j*3 - 63j*2 - 84j - 38. Let n(m) = -4r(m) + 22w(m). Factor n(c). -2(c + 1)2(c + 6)*2 Let c be 4/2 + (-6)/3. Suppose c = 5z + 10, 1 - 15 = -5v + 2z. Factor -2 - 1/2k2 + vk. -(k - 2)*2/2 Suppose 0 = 213m - 468 - 70 + 112. Suppose 0 = k + k - 6. Factor 1/5 - 3/5r4 + 1/5r*5 + 2/5r*k - 3/5r + 2/5rm. (r - 1)4(r + 1)/5 Let y(s) be the second derivative of 11s5/100 + 3s*4/4 + 2s*3/15 - 53s - 2. Factor y(o). o(o + 4)(11o + 1)/5 Let x(w) be the second derivative of -w4/24 - 7w*3/6 - 33w*2/4 + 121w. What is v in x(v) = 0? -11, -3 Determine w so that 6953w3 - 2w*4 + 28w + 4w2 - w4 - 6981w*3 - 4w*4 + 3w*4 = 0. -7, -1, 0, 1 Factor -2/3 - 14/9p - 4/9p2. -2(p + 3)(2p + 1)/9 Let i(o) be the second derivative of o*6/105 + 2o*5/7 + 16o*4/7 - 80o*3/21 - 400o*2/7 + 152o. Determine z, given that i(z) = 0. -10, -2, 2 Let k be 2/5(-7)/84-20. Factor -1/3h3 + 0 + kh*2 + h. -h(h - 3)(h + 1)/3 Let k be 14/216/2. Find m such that m*2 - km*2 - 3 - 6m - 2m2 = 0. -1 Let t(p) be the first derivative of -6 - 5/2p*2 + 0p + 2/33p3 - 1/660p*5 + 0p**4. Let q(d) be the second derivative of t(d).	{ "pile_set_name": "DM Mathematics" }
Automatic regularization parameter selection by generalized cross-validation for total variational Poisson noise removal. In this paper, we propose an alternating minimization algorithm with an automatic selection of the regularization parameter for image reconstruction of photon-counted images. By using the generalized cross-validation technique, the regularization parameter can be updated in the iterations of the alternating minimization algorithm. Experimental results show that our proposed algorithm outperforms the two existing methods, the maximum likelihood expectation maximization estimator with total variation regularization and the primal dual method, where the parameters must be set in advance.	{ "pile_set_name": "PubMed Abstracts" }
AgfC and AgfE facilitate extracellular thin aggregative fimbriae synthesis in Salmonella enteritidis. Salmonella thin aggregative fimbriae (Tafi; curli) are important in pathogenesis and biofilm formation; however, less is known of their structure and morphogenesis. In the Salmonella agfBAC Tafi operon, the transcription and role of agfC have been elusive. In this study, agfBAC transcripts were detected using a sensitive reverse transcriptase technique. Native AgfC was not detected using polyclonal antibodies generated against purified hexahistidine-tagged AgfC; however, in trans expression revealed that AgfC was localized to the periplasm as a mature form. An isogenic DeltaagfC mutant displayed an abundance of 20 nm fibres, in addition to native Tafi (5-7 nm), and had an increase in cell surface hydrophobicity. Purified 20 nm fibres were depolymerized under exceptionally stringent conditions to release what proved to be AgfA subunits. This revealed that the 20 nm fibres represented a different form of Tafi. The role of AgfC in Tafi assembly was investigated further using an antibody-capture assay of isogenic Deltaagf mutants. A soluble antibody-accessible form of AgfA was captured in wild-type (wt), DeltaagfB and DeltaagfF strains, in support of the extracellular nucleation-precipitation pathway of Tafi assembly, but not in DeltaagfC or DeltaagfE mutants. This indicates that AgfC and AgfE are important for AgfA extracellular assembly, facilitating the synthesis of Tafi.	{ "pile_set_name": "PubMed Abstracts" }
This is an archived article and the information in the article may be outdated. Please look at the time stamp on the story to see when it was last updated. Please enable Javascript to watch this video AURORA, Colo. -- A teenager carrying a loaded shotgun on a busy street in Aurora was stopped by police. But he says he should not have been stopped and he videotaped his encounter with officers. Police have a different opinion. The 18-year-old posted his cell phone video online. He spoke exclusively with reporter Dave Young Friday. Young also spoke with police as the two sides debated open carry gun laws and public safety. Steve Lohner claims he was well within Colorado law while he walked in the area of South Buckley Road and East Iliff Avenue while carrying a shotgun. Police who were called to the scene say they weren't able to determine if he was doing it legally. Lohner refused to show them an ID to prove he's 18. "I simply carry this for the protection of myself and those around me," Lohner says. His shotgun is a Stoeger P-350 12 gauge. "I've been stopped close to a dozen times for this and this is actually the first time I've been forced to provide ID," he says. The teen says he's on a campaign to call attention to open carry laws. "I feel like a lot of people now they see a weapon like that and they think, you know, James Holmes or Sandy Hook," Lohner says that's why he started walking along major streets with his gun. "It's alarming to the citizens -- alarming enough to where they call," says Aurora police spokesman Frank Fania. Colorado law backs up Aurora police when asking to see an ID while investigating a possible crime. "He may be within his rights and legal, within the law to carry this gun but if we're investigating it and he refuses to cooperate that may violate other municipal laws," Fania says. In fact, the Colorado Supreme Court ruled that police who are investigating a suspected crime can require an ID from people reasonably believed to have information or were involved with that crime. In this case police couldn't even determine if Lohner, who they determined looks younger than 18, was old enough to legally possess the weapon. Lohner says, "The police treat open carry like you're a criminal until proven innocent." But police say it raises questions of public safety and takes officers off of other calls. "It ties up our resources whether you're right or wrong," Fania says. Lohner, who just turned 18, plans to continue his protest walks. "If enough people were to lawfully open carry in those areas and do it in a safe and lawful manner then these people would end up feeling comfortable around it." The teen admits that the Aurora theater shooting makes police in the city cautious. Police say they have to respond to 911 calls when people call about what Lohner is doing. They reiterate they may be getting pulled away from other real, life-threatening situations. Lohner faces a misdemeanor obstruction charge for refusing to show his identification. We spoke to Lohner's mother and she told us she is concerned about his safety.	{ "pile_set_name": "OpenWebText2" }
--- abstract: 'Stochastic resetting is prevalent in natural and man-made systems giving rise to a long series of non-equilibrium phenomena. Diffusion with stochastic resetting serves as a paradigmatic model to study these phenomena, but the lack of a well-controlled platform by which this process can be studied experimentally has been a major impediment to research in the field. Here, we report the experimental realization of colloidal particle diffusion and resetting via holographic optical tweezers. This setup serves as a proof-of-concept which opens the door to experimental study of resetting phenomena. It also vividly illustrates why existing theoretical models must be improved and revised to better capture the real-world physics of stochastic resetting.' author: - 'Ofir Tal-Friedman$^{1}$' - 'Arnab Pal$^{2,3}$' - 'Amandeep Sekhon$^{2}$' - 'Shlomi Reuveni$^{2,3}$' - 'Yael Roichman$^{1,2}$' title: Experimental realization of diffusion with stochastic resetting --- =1 Stochastic resetting is ubiquitous in nature, and has recently been the subject of vigorous studies in physics [@Evans2011_1; @Evans2011_2; @Evans2011_3], chemistry [@Restart-Biophysics1; @Restart-Biophysics2; @Restart-Biophysics6], biological physics [@Restart-Biophysics3; @Restart-Biophysics8], computer science [@restart-CS1; @restart-CS2], queuing theory [@queue1; @queue2] and other cross-disciplinary fields (see [@review] for extensive account of recent developments). A stylized model to study resetting phenomena was proposed by Evans and Majumdar in 2011 [@Evans2011_1]. The model, which considers a diffusing particle subject to stochastic resetting, exhibits many rich properties e.g., the emergence of a non-equilibrium steady state and interesting relaxation dynamics [@Evans2011_1; @Evans2011_2; @Evans2011_3; @Evans2014_3; @Pal2016_1; @relaxation1; @relaxation2; @local] which were also observed in other systems subject to stochastic resetting [@restart_conc3; @SEP; @return1; @return2; @return3; @return4; @return5; @Bod1; @Bod2]. The model is also pertinent to the study of search and first-passage time (FPT) questions [@RednerBook; @Schehr-review]. In particular, it was used to show that resetting can significantly reduce the mean FTP of a diffusing particle to a target by mitigating the deleterious effect of large FPT fluctuations that are intrinsic to diffusion in the absence of resetting [@Evans2011_1; @Evans2011_2; @Evans2011_3; @review; @Pal2016_1; @Ray; @interval]. Interestingly, this beneficial effect of resetting also extends beyond free diffusion and applies to many other stochastic processes [@review; @return5; @Bod1; @Bod2; @return3; @return4; @ReuveniPRL; @PalReuveniPRL; @branching_II; @Restart-Search1; @Restart-Search2; @Chechkin; @Landau; @HRS]; and further studies moreover revealed a genre of universality relations associated with optimally restarted processes as well as the existence of a globally optimal resetting strategy [@Restart-Biophysics1; @Restart-Biophysics2; @ReuveniPRL; @PalReuveniPRL; @Chechkin; @branching_II; @Landau; @HRS]. ![Experimental realization of diffusion with stochastic resetting. a) A sample trajectory of a silica particle diffusing (blue) near the bottom of a sample cell. The particle sets off from the origin and is stochastically reset at a rate $r=0.05 s^{-1}$. Following a resetting epoch, the particle is driven back to the origin at a constant radial velocity $v=0.8 \mu m/s$ using HOTs (red). After the particle arrives at the origin it remains trapped there for a short period of time to improve localization (green). Inset shows a schematic illustration of the experiment. b) Projection of the particle’s trajectory onto the $x$-axis.[]{data-label="Fig:expt"}](Fig1_slow.pdf) Despite a long catalogue of theoretical studies dedicated to stochastic resetting, no attempt to experimentally study resetting in a controlled environment has been made to date. This is needed as resetting in the real world is never ‘clean’ as in theoretical models which glance over physical complications for the sake of analytical tractability and elegance. In this letter, we report the experimental realization of diffusion with stochastic resetting ([Fig. \[Fig:expt\]]{}). Our setup comprises of a colloidal particle suspended in fluid (in quasi-two dimensions) and resetting is implemented via holographic optical tweezers (HOTs) [@Dufresne2001; @Polin2005; @Grier06; @Crocker1996]. We study two, physically amenable, resetting protocols in which the particle is returned to the origin: (i) at a constant velocity, and (ii) within a constant time. In both cases, resetting is stochastic and time intervals between resetting events come from an exponential distribution with mean $1/r$. In what follows, we utilize the setup in [Fig. \[Fig:expt\]]{} to study two different statistical measures of diffusion with stochastic resetting. First, we study the long time position distribution of a tagged particle and how it depends on the resetting protocol. Then, we study the mean FPT of a tagged particle to a region in space. Finally, we also consider the work and energy required to implement resetting in our system. In all cases, we discover that existing theoretical models must be extended and revised to better capture the physics of stochastic resetting in the real world. We conclude with discussion and outlook on the future of experimental studies of stochastic resetting. Our experimental setup is based on a home built holographic optical tweezers (HOTs) system. It uses a spatial light modulator (Hamamtsu, X10468-04) to imprint a computer generated phase pattern on an expanded laser beam (Coherent, Verdi $\lambda=532$nm). The beam is then projected on the back aperture of a 100x objective (oil immersion, NA = 1.4) mounted on an Olympus microscope (IX71). Samples consist of a dilute colloidal suspension of spherical silica particles with a diameter of $d=1.5\pm 0.02\mu m$ and a refractive index of $n_p=1.46$ (Kisker Biotech, lot\# GK0611140 02) in double distilled water sealed between a glass slide and a coverslip with a sample thickness of approximately $20\mu$m. Motion of the particle (confined to a quasi two dimensional geometry) is recorded by a CMOS camera (Grasshopper 3, Point Gray) at a rate of 20 fps. Particle position is extracted using conventional video microscopy algorithms [@Crocker1996] with an accuracy of approximately 30nm. A laser power of $1$W was used to ensure sufficient trapping of the particle. We utilize in-house developed programs for hardware control and data analysis. We start our experiments by realizing diffusion with stochastic resetting in the following manner. Every experiment starts by drawing a series of random resetting times $\{t_1,t_2,t_3,...\}$ taken from an exponential distribution with mean $1/r$. At time zero, the particle is trapped at the origin and the experiment, which consists of a series of statistically identical steps, begins. At the $i$-th step of the experimental protocol, the particle is allowed to diffuse for a time $t_i$ eventually arriving at a position $(x_i,y_i)$. At this time, an optical trap is projected onto the particle and the particle is dragged by the trap to its initial position. A typical trajectory of a colloidal particle performing diffusion under stochastic resetting with $r=0.05s^{-1}$ is shown in [Fig. \[Fig:expt\]]{}a (see also Supplementary movie 1). Note that the trajectory is composed of three phases of motion: diffusion, return, and a short waiting time to allow for optimal localization at the origin ([Fig. \[Fig:expt\]]{}b). To collect sufficient statistics, we perform approximately 450 resetting events for each constant velocity experiment, and 305 events for the constant return time experiment. Stochastic resetting with instantaneous returns.— We first utilize our setup to study a canonical (yet non-physical) case in which upon resetting the particle is teleported back to the origin in zero time. This case was the first to be analysed theoretically [@Evans2011_1], thus providing a benchmark for experimental results. To obtain trajectories of diffusion with stochastic resetting and instantaneous returns we digitally remove the return (red) and wait (green) phases of motion from the experimentally measured trajectories ([Fig. \[Fig:expt\]]{}b). A sample trajectory obtained via this procedure is shown in Fig. S1. ![Steady-state distribution of diffusion with stochastic resetting and instantaneous returns. a) Distribution of the position along the $x$-axis. Markers come from experiments and the dashed line is the theoretical prediction of Eq. (1). b) The radial position distribution. Markers come from experiments and the dashed line is the theoretical prediction $\rho(R)=\alpha_0^2RK_0(\alpha_0R)$ [@SM] with $K_n(z)$ standing for the modified Bessel function of the second kind [@Stegun]. In both panels no fitting procedure was applied: $D=0.18\pm 0.02 \mu m^2/s$ was measured independently and $r=0.05s^{-1}$ was set by the operator.[]{data-label="Fig:ssDist"}](1DinstantPDFv2.pdf "fig:"){width="4.25cm" height="3.25cm"} ![Steady-state distribution of diffusion with stochastic resetting and instantaneous returns. a) Distribution of the position along the $x$-axis. Markers come from experiments and the dashed line is the theoretical prediction of Eq. (1). b) The radial position distribution. Markers come from experiments and the dashed line is the theoretical prediction $\rho(R)=\alpha_0^2RK_0(\alpha_0R)$ [@SM] with $K_n(z)$ standing for the modified Bessel function of the second kind [@Stegun]. In both panels no fitting procedure was applied: $D=0.18\pm 0.02 \mu m^2/s$ was measured independently and $r=0.05s^{-1}$ was set by the operator.[]{data-label="Fig:ssDist"}](1DinstantPDFradialv2.pdf "fig:"){width="4.25cm" height="3.25cm"} A particle undergoing free Brownian motion is not bound in space. It has a Gaussian position distribution with a variance that grows linearly with time. Repeated resetting of the particle to its initial position will, however, result in effective confinement and in a non-Gaussian steady state distribution [@Evans2011_1; @Evans2011_2]. Estimating the steady state distribution of the particle’s position along the $x$-axis from recorded trajectories (see SI for details), we find (Fig. 2a) that the experimentally measured results conform with the theoretical result derived by Evans and Majumdar [@Evans2011_1; @Evans2011_2] $$\rho(x)=\frac{\alpha_0}{2}e^{-\alpha_0\|x\|}~, \label{Eq:SS}$$ where $\alpha_0=\sqrt{r/D}$ is an inverse length scale corresponding to the typical distance diffused by the particle in the time between two resetting events, and $D$ is the diffusion constant. The steady state radial density of the particle can also be extracted from the experimental trajectories by looking at the steady-state distribution of the distance $R=\sqrt{x^2+y^2}$ from the origin. Here too, we find excellent agreement with the theoretical result (Fig. 2b). Stochastic resetting with non-instantaneous returns.— We now turn our attention to more realistic pictures of diffusion with stochastic resetting. These have just recently been considered theoretically in attempt to account for the non-instantaneous returns and waiting times that are seen in all physical systems that include resetting [@Restart-Biophysics1; @Restart-Biophysics2; @Restart-Biophysics6; @HRS; @return1; @return2; @return3; @return4; @return5]. First, we consider a case where upon resetting HOTs are used to return the particle to the origin at a constant radial velocity $v=\sqrt{v_x^2+v_y^2}$ ([Fig. \[Fig:expt\]]{}). This case naturally arises for resetting by constant force in the over-damped limit. We find that the radial steady state density is then given by [@SM] (R)=p\_D\^[c.v.]{}\_(R)+(1-p\_D\^[c.v.]{})\_(R), \[radial-constant-velocity\] where $p_D^{c.v.}=\left(1+\frac{\pi r}{2 \alpha_0 v} \right)^{-1}$ is the steady-state probability to find the particle in the diffusive phase. $\rho_{\text{diff}}(R)=\alpha_0^2 R K_0(\alpha_0R)$ and $\rho_{\text{ret}}(R)=\frac{2\alpha_0^2}{\pi}RK_1(\alpha_0R)$ stand for the conditional probability densities of the particle’s position when in the diffusive and return phases respectively. Here $K_{n}(z)$ is once again the modified Bessel function of the second kind [@Stegun]. The result in [Eq. (\[radial-constant-velocity\])]{} is in very good agreement with experimental data as shown in [Fig. \[non-inst\]]{}a and Fig. S3. ![Steady-state distributions of diffusion with stochastic resetting and non-instantaneous returns. a) The radial position distribution, $\rho(R)$, as a function of the distance $R$ and the radial return velocity $v$ as given by [Eq. (\[radial-constant-velocity\])]{}. Experimental results of a realization with $v=0.8\mu m/s$ are superimposed on the theoretical prediction (black spheres). b) The radial position distribution as a function of $R$ and the return time $\tau_0$ as given by [Eq. (\[radial-constant-time\])]{}. Experimental results of a realization with $\tau_0=3.79 s$ are superimposed on the theoretical prediction (black spheres).[]{data-label="non-inst"}](3Dradialjoint1.pdf){width="8.5cm"} Next, we consider a case where upon resetting HOTs are used to return the particle to the origin at a constant time $\tau_0$ — irrespective of the particle’s position at the resetting epoch. This case is appealing due to its simplicity and ease of experimental implementation. Here too, we find that the radial steady-state position distribution can be put in a closed form which reads [@SM] (R)=p\_D\^[c.t.]{}\_(R)+(1-p\_D\^[c.t.]{})\_(R), \[radial-constant-time\] where $ p_D^{c.t.}=(1+r \tau_0)^{-1}$ is the steady-state probability to find the particle in the diffusive phase, and with $\rho_{\text{diff}}(R)=\alpha_0^2 R K_0(\alpha_0R)$ and $\rho_{\text{ret}}(R)=\frac{\pi \alpha_0^2}{2}\left[ \frac{1}{\alpha _0}-R \left[K_0\left( \alpha _0 R \right) \pmb{L}_{-1}\left( \alpha _0 R \right) +K_1\left( \alpha _0 R \right) \pmb{L}_0\left( \alpha _0 R \right)\right] \right]$, standing for the conditional probability densities of the particle’s radial position when in the diffusive and return phases respectively. Here, $\pmb{L}_n$ is the modified Struve function of order $n$ [@Stegun]. The result in [Eq. (\[radial-constant-velocity\])]{} is in very good agreement with experimental data as shown in [Fig. \[non-inst\]]{}b and Fig. S5. Comparing the steady-state distributions for the constant time and constant velocity cases, we find that they are almost identical for short return times and high return speeds. Indeed, in these limits the two protocols are virtually indistinguishable as returns are effectively instantaneous. On the other extreme, i.e., for long return times and slow return speeds, marked differences are found between the distributions (Fig. S4 and S6). First Passage under stochastic resetting.— Having realized diffusion with stochastic resetting and analyzed its stationary properties, we now turn to study how resetting affects the first-passage statistics of a Brownian particle. First-passage processes have numerous applications in natural sciences as they are used to describe anything from chemical reactions to single‐cell growth and division, and everything from transport dynamics to search and animal foraging [@Evans2011_3; @Restart-Biophysics1; @Restart-Biophysics2; @Restart-Biophysics6; @Restart-Biophysics3; @Restart-Biophysics8; @RednerBook; @Schehr-review; @ReuveniPRL; @PalReuveniPRL; @branching_II; @Restart-Search1; @Restart-Search2; @Chechkin; @Landau; @HRS; @Frinkes2010; @Branton2010; @Tu2013; @Bezrukov2000; @Grunwald2010; @Ghale2014; @Ma2013; @Iyer2014; @Ingraham1983; @Amir2014; @Osella2014; @cooper1991; @MetzlerBook]. To this end, it is known that while the mean first-passage time (MFPT) of a Brownian particle to a stationary target diverges [@RednerBook; @Schehr-review], resetting will render it finite [@Evans2011_1] even if the returns are non-instantaneous [@Restart-Biophysics1; @Restart-Biophysics2; @Restart-Biophysics6; @HRS; @return3; @return5]. To experimentally study first-passage under stochastic resetting, we consider the setup illustrated in [Fig. \[Fig:MFPT\]]{}a. In this set of experiments, similarly to the previous set, the experiment starts at time zero with the particle positioned at the origin. Resetting is conducted stochastically with rate $r$, and HOTs are used to return the particle to the origin at a constant return time $\tau_0$. However, we now also define a target, set to be a virtual infinite absorbing wall located at $x=L$, i.e., parallel to the $y$-axis. The particle is allowed to diffuse with stochastic resetting until it hits the target, and the hitting times (first-passage times) are recorded. Experiments were performed at 5 different resetting rates: $r=0.05s^{-1}$, $0.0667s^{-1}$, $0.125s^{-1}$, $0.5s^{-1}$, and $1s^{-1}$ with a constant return time of $\tau_0= 3.79s$. A typical trajectory extracted from such an experiment with $L = 1 \mu$m and $r=0.05s^{-1}$ is shown in Fig. \[Fig:MFPT\]b, Fig. S7, and Supplementary movie 2. We extract the FPTs from this and other trajectories from the duration of paths that start at the origin and end at the first crossing of the virtual wall (Fig. \[Fig:MFPT\]b). Several hundreds of resetting events were performed to gather enough FPT statistics (see SI for details). To check agreement between data coming from FPT experiments and theory, we derived a formula for the mean FPT of diffusion with stochastic resetting and constant time returns to the origin. This is given by [@SM] T\_r =( +\_0 ) . \[Eq:MFPT\_return\] Equation \[Eq:MFPT\_return\] is in excellent agreement with the experimental data as shown in [Fig. \[Fig:MFPT\]]{}c, including accurate prediction of the optimal resetting rate which minimizes the mean FPT of the particle to the target. Work and energy.—A central, and previously unexplored, aspect of stochastic resetting in physical systems concerns the energetic cost associated with the resetting process itself. As discussed above, stochastic resetting prevents a diffusing particle from spreading over the entire available space as it normally would. Instead, a localized, non-equilibrium, steady-state is formed; but the latter can only be maintained by working on the system continuously. ![Energetic cost of resetting. a) The radial distance from the origin vs. time for a particle diffusing with stochastic resetting at rate $r=0.05s^{-1}$ and constant radial return velocity $v=0.8\mu m/s$. b) The cumulative energy expenditure for the trajectory in panel a) (neglecting the cost of the wait period). c) The distribution of energy spent per resetting event. Red disks come from experiments and the theoretical prediction of [Eq. (\[Eq:Energy\])]{} is plotted as a solid blue line. d) Normalized energy spent per resetting event at constant power vs. the normalized radial return velocity as given by [Eq. (\[minmax\])]{}. The minimal energy is attained at a maximal velocity for which the trap is just barely strong enough to overcome the fluid drag force and prevent the particle from escaping the trap.[]{data-label="Fig:work"}](work_const_v.pdf) In our experiments, work is done by the laser to capture the particle in an optical trap and drag it back to the origin. The total energy spent per resetting event is then simply given by $E=\mathcal{P}\tau(R)$, where $\mathcal{P}$ is the laser power fixed at 1W and $\tau(R)$ is the time required for the laser to trap the particle at a distance $R$ and bring it back to the origin. As the particle’s distance at the resetting epoch fluctuates randomly from one resetting event to another ([Fig. \[Fig:work\]]{}a), the energy spent per resetting event is also random ([Fig. \[Fig:work\]]{}b). To compute its distribution, we note that $E$ is proportional to the return time whose probability density function is in turn given by [@SM] (t)=\_[-]{}\^ d\_0\^ dR R \_0\^dt’ G\_0(R,t’)f(t’) , where $f(t)=re^{-rt}$ is the resetting time density and $G_0(R,t)=\frac{1}{4\pi Dt}e^{-R^2/4Dt}$ is the diffusion propagator in polar coordinates. For the case of constant radial return velocity, $v$, we have $\tau(R)=R/v$. A simple derivation then yields the probability density of the energy spent per resetting event [@SM] (E)= K\_0(E/E\_0) ,\[Eq:Energy\] with $E_0=\alpha_0^{-1}v^{-1}\mathcal{P}$; and note that this is a special case of the K-distribution [@Redding; @Long]. The mean energy spent per resetting event can be computed directly from [Eq. (\[Eq:Energy\])]{} and is given by $\langle E \rangle=\pi E_0/2$. Equation (\[Eq:Energy\]) demonstrates good agreement with experimental data ([Fig. \[Fig:work\]]{}c). As $\langle E \rangle \propto v^{-1}$, the average energy spent per resetting event in our experiment can be made smaller by working at higher return velocities. Note, however, that the stiffness of the optical trap should be strong enough to oppose the drag force acting on the particle so as to keep it in the trap. Assuming that the maximum allowed displacement of a particle in the trap is $\approx0.5\mu m$ [@Roichman07], we find that working conditions must obey $k\ge2\gamma v$. As the stiffness is proportional to the laser power, $k=\mathcal{C} \mathcal{P}$ (where $\mathcal{C}$ is the conversion factor), the maximal working velocity is given by $v_{\text{max}}\approx \frac{1}{2} \mathcal{C} \mathcal{P}/\gamma$ which—independent of laser power— minimizes energy expenditure to $E_{\text{min}} \approx \pi \gamma \mathcal{C}^{-1} \alpha_0^{-1}$. Going to dimensionless variables we find E /E\_=v\_/v \[minmax\] for $v<v_{\text{max}}$ ([Fig. \[Fig:work\]]{}d). Discussion and future outlook.—In this study, we have demonstrated a unique and versatile method to realize experimentally a resetting process in which many parameters can be easily controlled. We have used this technique to verify an array of theoretical predictions, and further motivate the derivation of new results which come to address novel consideration that arise from experimental realization of diffusion with stochastic resetting. Of prime importance in this regard is the energetic cost of resetting [@thermo1; @thermo2; @thermo3]. The optical trapping method used herein is far from being the most efficient way to apply force to a colloidal particle. In fact, in our experiments we used $1W$ of power at the laser output to create a trap of $k=30pN/\mu m$ for a silica bead of radius $a=0.75\mu m$. For experiments with a constant return velocity $v=0.8\mu m/s$ and resetting rate $r=0.05s^{-1}$, the average return time was $ \langle \tau(R) \rangle=3.68s$. This translates to an average energy expenditure of $\langle E\rangle=\mathcal{P}\langle \tau(R) \rangle=3.68\pm0.05J$ per resetting event. In contrast, the work done against friction to drag the particle at a constant velocity $v$ for a distance $R$ is given by $W_{\text{drag}}=\gamma v R$ where $\gamma=6\pi\eta a$ is the the Stokes drag coefficient. Taking averages, we find that the work required per resetting event is given by $\langle W_{\text{drag}} \rangle= \gamma v \langle R \rangle = \pi \alpha_0^{-1} \gamma v/2$, which translates into $3.4\cdot10^{-20}J$ or $8.3 k_BT$ per resetting event. We thus see that $\langle W_{\text{drag}} \rangle \ll \langle E \rangle$, i.e., that the work required to reset the particle’s position is orders of magnitude smaller than the actual amount of energy spent when resetting is done using HOTs. Concluding, we note that experimental research of stochastic resetting is still in its infancy with many open questions left to be answered by consecutive studies. To this end, the setup described above along with its future extensions provide a promising platform. Acknowledgments The authors acknowledge Gilad Pollack for his help in coding the resetting protocol of the HOTs. Arnab Pal acknowledges support from the Raymond and Beverly Sackler Post-Doctoral Scholarship at Tel-Aviv University; and Somrita Ray for many fruitful discussions. Amandeep Sekhon acknowledges support from the Ratner center for single molecule studies. Shlomi Reuveni acknowledges support from the Azrieli Foundation, from the Raymond and Beverly Sackler Center for Computational Molecular and Materials Science at Tel Aviv University, and from the Israel Science Foundation (grant No. 394/19). Yael Roichman acknowledges support from the Israel Science Foundation (grant No. 988/17). [99]{} Evans, M.R. and Majumdar, S.N., 2011. Diffusion with stochastic resetting. Physical review letters, 106(16), p.160601. Evans, M.R. and Majumdar, S.N., 2011. Diffusion with optimal resetting. Journal of Physics A: Mathematical and Theoretical, 44(43), p.435001. Evans, M.R., Majumdar, S.N. and Mallick, K., 2013. Optimal diffusive search: nonequilibrium resetting versus equilibrium dynamics. Journal of Physics A: Mathematical and Theoretical, 46(18), p.185001. Reuveni, S., Urbakh, M. and Klafter, J., 2014. Role of substrate unbinding in Michaelis-Menten enzymatic reactions. Proceedings of the National Academy of Sciences, 111(12), pp.4391-4396. Rotbart, T., Reuveni, S. and Urbakh, M., 2015. Michaelis-Menten reaction scheme as a unified approach towards the optimal restart problem. Physical Review E, 92(6), p.060101. Robin, T., Reuveni, S. and Urbakh, M., 2018. Single-molecule theory of enzymatic inhibition. Nature communications, 9(1), p.779. Roldan, E., Lisica, A., Sanchez-Taltavull, D. and Grill, S.W., 2016. Stochastic resetting in backtrack recovery by RNA polymerases. Physical Review E, 93(6), p.062411. Budnar, S., Husain, K.B., Gomez, G.A., Naghibosadat, M., Varma, A., Verma, S., Hamilton, N.A., Morris, R.G. and Yap, A.S., 2019. Anillin promotes cell contractility by cyclic resetting of RhoA residence kinetics. Developmental cell, 49(6), pp.894-906. Luby, M., Sinclair, A. and Zuckerman, D., 1993. Optimal speedup of Las Vegas algorithms. Information Processing Letters, 47(4), pp.173-180. Gomes, C.P., Selman, B. and Kautz, H., 1998. Boosting combinatorial search through randomization. AAAI/IAAI, 98, pp.431-437. Di Crescenzo, A., Giorno, V., Nobile, A.G. and Ricciardi, L.M., 2003. On the M/M/1 queue with catastrophes and its continuous approximation. Queueing Systems, 43(4), pp.329-347. Kumar, B.K. and Arivudainambi, D., 2000. Transient solution of an M/M/1 queue with catastrophes. Computers & Mathematics with applications, 40(10-11), pp.1233-1240. Evans, M.R., Majumdar, S.N. and Schehr, G., 2020. Stochastic resetting and applications. Journal of Physics A: Mathematical and Theoretical. Evans, M.R. and Majumdar, S.N., 2014. Diffusion with resetting in arbitrary spatial dimension. Journal of Physics A: Mathematical and Theoretical, 47(28), p.285001. Majumdar, S.N., Sabhapandit, S. and Schehr, G., 2015. Dynamical transition in the temporal relaxation of stochastic processes under resetting. Physical Review E, 91(5), p.052131. Pal, A., 2015. Diffusion in a potential landscape with stochastic resetting. Physical Review E, 91(1), p.012113. Pal, A., Kundu, A. and Evans, M.R., 2016. Diffusion under time-dependent resetting. Journal of Physics A: Mathematical and Theoretical, 49(22), p.225001. Pal, A., Chatterjee, R., Reuveni, S. and Kundu, A., 2019. Local time of diffusion with stochastic resetting. Journal of Physics A: Mathematical and Theoretical, 52(26), p.264002. Eule, S. and Metzger, J.J., 2016. Non-equilibrium steady states of stochastic processes with intermittent resetting. New Journal of Physics, 18(3), p.033006. Evans, M.R. and Majumdar, S.N., 2018. Effects of refractory period on stochastic resetting. Journal of Physics A: Mathematical and Theoretical. 52 01LT01. Bodrova, A.S., Chechkin, A.V. and Sokolov, I.M., 2019. Scaled Brownian motion with renewal resetting. Physical Review E, 100(1), p.012120. Bodrova, A.S., Chechkin, A.V. and Sokolov, I.M., 2019. Nonrenewal resetting of scaled Brownian motion. Physical Review E, 100(1), p.012119. Basu, U., Kundu, A. and Pal, A., 2019. Symmetric exclusion process under stochastic resetting. Physical Review E, 100(3), p.032136. Pal, A., Kusmierz, L. and Reuveni, S., 2019. Time-dependent density of diffusion with stochastic resetting is invariant to return speed. Physical Review E, 100(4), p.040101. Pal, A., Kusmierz, L. and Reuveni, S., 2019. Invariants of motion with stochastic resetting and space-time coupled returns. New Journal of Physics, 21(11), p.113024. Bodrova, A.S. and Sokolov, I.M., 2019. Resetting processes with non-instanteneous return. arXiv preprint arXiv:1907.12326. Maso-Puigdellosas, A., Campos, D. and Mendez, V., 2019. Transport properties of random walks under stochastic noninstantaneous resetting. Physical Review E, 100(4), p.042104. Redner, S., 2007. A Guide to First-Passage Processes. A Guide to First-Passage Processes, by Sidney Redner, Cambridge, UK: Cambridge University Press, 2007. Bray, A.J., Majumdar, S.N. and Schehr, G., 2013. Persistence and first-passage properties in nonequilibrium systems. Advances in Physics, 62(3), pp.225-361. Ray, S., Mondal, D. and Reuveni, S., 2019. Peclet number governs transition to acceleratory restart in drift-diffusion. Journal of Physics A: Mathematical and Theoretical, 52(25), p.255002. Pal, A. and Prasad, V.V., 2019. First passage under stochastic resetting in an interval. Physical Review E, 99(3), p.032123. Kusmierz, L., Majumdar, S.N., Sabhapandit, S. and Schehr, G., 2014. First order transition for the optimal search time of Lévy flights with resetting. Physical review letters, 113(22), p.220602. Kusmierz, L., & Gudowska-Nowak, E. (2015). Optimal first-arrival times in Lévy flights with resetting. Physical Review E, 92(5), 052127. Reuveni, S., 2016. Optimal stochastic restart renders fluctuations in first passage times universal. Physical review letters, 116(17), p.170601. Pal, A. and Reuveni, S., 2017. First Passage under Restart. Physical review letters, 118(3), p.030603. Chechkin, A. and Sokolov, I.M., 2018. Random search with resetting: a unified renewal approach. Physical review letters, 121(5), p.050601. Pal, A., Eliazar, I. and Reuveni, S., 2019. First passage under restart with branching. Physical review letters, 122(2), p.020602. Pal, A. and Prasad, V.V., 2019. Landau-like expansion for phase transitions in stochastic resetting. Physical Review Research, 1(3), p.032001. Pal, A., Kusmierz, L. and Reuveni, S., 2019. Home-range search provides advantage under high uncertainty. arXiv preprint arXiv:1906.06987. Dufresne, E.R., Spalding, G.C., Dearing, M.T., Sheets, S.A. and Grier, D.G., 2001. Computer-generated holographic optical tweezer arrays. Review of Scientific Instruments, 72(3), pp.1810-1816. Polin, M., Ladavac, K., Lee, S.H., Roichman, Y. and Grier, D.G., 2005. Optimized holographic optical traps. Optics Express, 13(15), pp.5831-5845. Grier, D.G. and Roichman, Y., 2006. Holographic optical trapping. Applied optics, 45(5), pp.880-887. Crocker, J.C. and Grier, D.G., 1996. Methods of digital video microscopy for colloidal studies. Journal of colloid and interface science, 179(1), pp.298-310. See supplemental material for the detailed derivation. Abramowitz, M. and Stegun, I.A. eds., 1948. Handbook of mathematical functions with formulas, graphs, and mathematical tables (Vol. 55). US Government printing office. Firnkes, M., Pedone, D., Knezevic, J., Doblinger, M. and Rant, U., 2010. Electrically facilitated translocations of proteins through silicon nitride nanopores: conjoint and competitive action of diffusion, electrophoresis, and electroosmosis. Nano letters, 10(6), pp.2162-2167. Branton, D., Deamer, D.W., Marziali, A., Bayley, H., Benner, S.A., Butler, T., Di Ventra, M., Garaj, S., Hibbs, A., Huang, X. and Jovanovich, S.B., 2010. The potential and challenges of nanopore sequencing. In Nanoscience and technology: A collection of reviews from Nature Journals (pp. 261-268). Tu, L.C., Fu, G., Zilman, A. and Musser, S.M., 2013. Large cargo transport by nuclear pores: implications for the spatial organization of FG‐nucleoporins. The EMBO journal, 32(24), pp.3220-3230. Bezrukov, S.M., Kullman, L. and Winterhalter, M., 2000. Probing sugar translocation through maltoporin at the single channel level. FEBS letters, 476(3), pp.224-228. Ghale, G., Lanctot, A.G., Kreissl, H.T., Jacob, M.H., Weingart, H., Winterhalter, M. and Nau, W.M., 2014. Chemosensing ensembles for monitoring biomembrane transport in real time. Angewandte Chemie International Edition, 53(10), pp.2762-2765. Grünwald, D. and Singer, R.H., 2010. In vivo imaging of labelled endogenous $\beta$-actin mRNA during nucleocytoplasmic transport. Nature, 467(7315), p.604. Ma, J., Liu, Z., Michelotti, N., Pitchiaya, S., Veerapaneni, R., Androsavich, J.R., Walter, N.G. and Yang, W., 2013. High-resolution three-dimensional mapping of mRNA export through the nuclear pore. Nature communications, 4, p.2414. Iyer-Biswas, S., Wright, C.S., Henry, J.T., Lo, K., Burov, S., Lin, Y., Crooks, G.E., Crosson, S., Dinner, A.R. and Scherer, N.F., 2014. Scaling laws governing stochastic growth and division of single bacterial cells. Proceedings of the National Academy of Sciences, 111(45), pp.15912-15917. Ingraham, J.L., Maaloe, O. and Neidhardt, F.C., 1983. Growth of the bacterial cell. Sinauer Associates. Amir, A., 2014. Cell size regulation in bacteria. Physical Review Letters, 112(20), p.208102. Osella, M., Nugent, E. and Lagomarsino, M.C., 2014. Concerted control of Escherichia coli cell division. Proceedings of the National Academy of Sciences, 111(9), pp.3431-3435. Cooper, S., 1991. Bacterial growth and division: biochemistry and regulation of the division cycle of prokaryotes and eukaryotes. Metzler, R., Redner, S. and Oshanin, G., 2014. First-Passage Phenomena and Their Applications (Vol. 35). Singapore: World Scientific. Redding, N.J., 1999. Estimating the parameters of the K distribution in the intensity domain (No. DSTO-TR-0839). ELECTRONICS RESEARCH LAB SALISBURY (AUSTRALIA). Long, M.W., 1975. Radar reflectivity of land and sea. Lexington, Mass., DC Heath and Co., 1975. 390 p. Roichman, Y., Wong, V. and Grier, D., 2007. Colloidal transport through optical tweezer arrays. Phys. Rev. E., 75(1), p011407. Fuchs, J., Goldt, S. and Seifert, U., 2016. Stochastic thermodynamics of resetting. EPL (Europhysics Letters), 113(6), p.60009. Pal, A. and Rahav, S., 2017. Integral fluctuation theorems for stochastic resetting systems. Physical Review E, 96(6), p.062135. Gupta, D., Plata, C.A. and Pal, A., 2020. Work fluctuations and Jarzynski equality in stochastic resetting. Physical Review Letters, 124(11), p.110608.	{ "pile_set_name": "ArXiv" }
Phacofragmentation without perfluorocarbon liquid for dislocated crystalline lenses or lens fragments after phacoemulsification. To evaluate the clinical outcome of vitrectomy with phacofragmentation without perfluorocarbon liquid (PFCL) in the management of dislocation of the crystalline lens, caused by trauma, hereditary disorders, or hypermature cataracts, and lens fragments due to phacoemulsification. A prospective study was conducted to evaluate 30 eyes of 29 patients who had undergone standard pars plana vitrectomy with phacofragmentation without PFCL in the vitreous cavity, for the removal of dislocated crystalline lenses or lens fragments, from January 1998 to July 2000. All cases were followed for more than six months. Final best corrected visual acuity of 0.5 or better increased from 0% preoperatively to 36.7% postoperatively, and 0.2 or better rose to 76.7%. The mean IOP was significant reduced, from 26.35 mmHg to 12.75 mmHg. No intraoperative complications occurred. Although two eyes (6.7%) developed retinal detachment, one (3.3%) had cystoid macular edema (CME) and one (3.3%) had a transient intraocular pressure increase (to 25 mmHg) postoperatively, all others had a favorable outcome. Standard pars plana vitrectomy with phacofragmentation without PFCL in the vitreous cavity is a safe, simple, and effective method for removing a dislocated crystalline lens or lens fragments, with good visual outcome.	{ "pile_set_name": "PubMed Abstracts" }
Background ========== Papaya mosaic virus (PapMV) is a member of the large family of Flexiviridae in the genus Potexvirus. The virus has a flexuous rod shape of 500 nm in length and 13 nm in diameter \[[@B1]\]. The CP, made mostly of alpha helices \[[@B2]\], is composed of 215 amino acids and has an estimated molecular weight of 23 kDa \[[@B3]\]. We showed previously that non-infectious nanoparticles made of recombinant PapMV CP are similar in shape and appearance to wild-type virus purified from plants \[[@B3]\]. PapMV nanoparticles were used previously as a vaccine platform technology to improve the immunogenicity of a peptide antigen fused to the nanoparticle structure \[[@B4]-[@B8]\]. The PapMV vaccine platform can induce a long-lasting memory response to an antigen fused on its surface \[[@B4]\]. Previous studies showed the capacity of PapMV nanoparticles to trigger a CTL response, in both in vitro and in vivo models, when the CTL epitope was fused to the C-terminus of the CP \[[@B6],[@B7],[@B9]\]. Although PapMV tolerates insertion of several peptides to its C-terminus \[[@B4]-[@B7],[@B10]\], a recent study revealed that N-terminal fusion of some peptides is also tolerated \[[@B8]\]. Depending on the nature of the amino acid sequence, some peptides can interfere with the CP assembly or with nanoparticle stability, which can affect their ability to stimulate an humoral response. A modification of the fusion site on the CP can help to resolve this issue. In this study, we compared the efficacy of nanoparticles harbouring fusion of a CTL epitope at either the N- or the C-terminus to trigger a cellular immune response. The crystalline and highly ordered structure of the nanoparticles is critical to triggering an efficient humoral response, as also reported by many other groups \[[@B11]-[@B13]\]. However, it is still unknown if assembly into the highly ordered nanoparticle structure, made of several hundreds of PapMV CP, is more efficient than assembly of a smaller disc-like structure (aggregate of 20 subunits) in triggering the CTL response. Since the mechanisms of induction of humoral and CTL immune responses rely on different immune cells and mechanisms, we also evaluated the importance of highly ordered assembly of recombinant PapMV CP into nanoparticles in triggering a CTL response by comparing the immunogenicity of nanoparticles and discs. Results and discussion ====================== Engineering of PapMV nanoparticles fused to the influenza CTL epitope --------------------------------------------------------------------- In this study, we used the CTL epitope NP~147-155~, a 9-mer H-2Kd epitope specific for Balb/C mice derived from influenza virus to search for the optimal position for fusion of this epitope to the vaccine platform. The CTL epitope was flanked by 5 native residues of influenza NP protein at both the N- and C-termini to favour natural processing of the peptide, and was fused genetically to either the N- (before F13) or C-terminus of PapMV CP \[Figure [1](#F1){ref-type="fig"}A\]. Following expression in E. coli, recombinant PapMV particles harbouring the peptide on their surface (named PapMV NP-12 and PapMV NP-C) were affinity purified on a Ni^2+^ column via the 6xHis tag located at the C-terminus \[Figure [1](#F1){ref-type="fig"}B\]. Purified proteins were subjected to ultracentrifugation to pellet the nanoparticles. The lower molecular weight forms, composed of discs (20 subunits of CP) remained in the supernatant. As shown by dynamic light scattering (DLS), two structures were obtained with this purification protocol: (1) typical long rod-shaped structures of approximately 90 nm in length for PapMV NP-12 and PapMV NP-C \[Figure [1](#F1){ref-type="fig"}C--D\], and (2) smaller discs of approximately 20 nm in length for PapMV NP-12 and PapMV NP-C \[Figure [1](#F1){ref-type="fig"}D\]. The DLS method provides a global view of the size of the particles in solution that fits our qualitative observations by electron microscopy, and revealed the difference in size between discs (black line) and nanoparticles (dotted line) for both constructs (Figure [1](#F1){ref-type="fig"}D). It also shows that structures formed by NP-12 and NP-C constructs are similar in size, confirming observations by transmission electron microscopy showing that PapMV NP-12 and NP-C nanoparticles are similar in length, structure and appearance \[Figure [1](#F1){ref-type="fig"}C\]. ![Recombinant PapMV CP proteins.(A) Amino acid sequences of the N- or C-terminus of the PapMV CP to which fusions were made. The sequence in bold corresponds to the NP~147-155~epitope from Influenza virus nucleoprotein (NP). The sequences in italics represent the flanking amino acids retained to ensure efficient processing of the epitope. (B) Bacterial lysate of the culture before induction with IPTG (first lane), after induction with IPTG (second lane) and after purification with nickel beads (third lane) of PapMV NP-12 (lanes 1--3) and PapMV NP-C (lanes 4--6). (C) Transmission electron microscope images of PapMV NP-12 and NP-C nanoparticles, respectively. (D) Size of nanoparticles and discs recorded by dynamic light scattering (DLS).](1477-3155-11-10-1){#F1} We previously reported that residue F13 of PapMV CP is critical for the interaction between the PapMV CP subunits when assembling into nanoparticles \[[@B14]\]. We showed that this hydrophobic residue fits snugly inside the hydrophobic pocket of the neighbouring CP \[[@B2]\]. Interestingly, insertion of the NP~147-155~ epitope just before F13 in the N-terminal fusions clearly does not interfere with the interaction between PapMV CP monomers that is crucial for self-assembly of nanoparticles. PapMV NP-12 nanoparticles are better inducers of the CTL response ----------------------------------------------------------------- To evaluate the potential of PapMV nanoparticles to induce a CD8+ mediated cellular response, we immunised 6- to 8-week-old Balb/C mice three times at 2-week intervals by the intraperitoneal route with 100 μg of PapMV (without fusion), NP-12 or NP-C nanoparticles. Two weeks after the second boost, spleens were harvested and ELISPOT assays using the NP~147-155~ peptide were performed to quantify the level of IFN-γ secreted by CD8+ cells \[Figure [2](#F2){ref-type="fig"}\]. Secretion of IFN-γ is proportional to the level of precursors of CD8+ cytotoxic lymphocytes specific to the fused CTL epitope in vaccinated mice. The result showed that, compared to all the other treatments, mice immunized with PapMV NP-12 nanoparticles secrete significantly more IFN-γ \[Figure [2](#F2){ref-type="fig"}\]. ![ELISPOT assays of mice immunized with different forms of nanoparticles.Mice, 5 per group, were immunized three times by the intraperitoneal route with 100 μg of recombinant PapMV NP-12, PapMV NP-C and PapMV nanoparticles or discs. Two weeks after the second boost, spleens were extracted and ELISPOT assays performed. The precursor frequency of specific T cells was determined by subtracting the background spots in media alone from the number of spots seen in wells reactivated with NP~147-155~peptide. \\\* p ≤ 0.001 compared to all groups.](1477-3155-11-10-2){#F2} Fusion of a peptide to the PapMV vaccine platform could affect its stability, and potentially the ability to mount an immune response to the fused epitope \[[@B8]\]. As temperature can affect protein stability, we thus measured the influence of temperature on the aggregation of recombinant nanoparticles using DLS. Upon heating, proteins initiate partial denaturation through exposure of their hydrophobic residues to the solvent. This conformational change triggers formation of aggregates that can be measured easily by DLS. We found that PapMV NP-C nanoparticles initiated aggregation at 25°C while PapMV (without fusion) and NP-12 nanoparticles were more stable and initiated aggregation at 37°C or higher \[Figure [3](#F3){ref-type="fig"}A\]. Therefore, the higher stability of NP-12 nanoparticles at 37°C or higher appears to correlate with an optimal CTL response in mice. ![Aggregation of PapMV nanoparticles and discs at different temperatures. A) Aggregation state of recombinant nanoparticles or discs of PapMV NP-12, PapMV NP-C and PapMV (0.1 mg/ml) was measured by DLS at increasing temperature (speed of heating: 1°C/min.). The increase in diameter induced by heat is caused by the aggregation of nanoparticles. B) Using the same conditions as in (A), the aggregation of recombinant nanoparticles of PapMV NP-12, PapMV NP-C and PapMV either treated or not with glutaraldehyde was measured by DLS.](1477-3155-11-10-3){#F3} Based on this observation, it was anticipated that stabilization of NP-C nanoparticles by chemical cross-linking should improve their immunogenicity. Therefore, we compared the capacity of NP-C and NP-12 nanoparticles either cross-linked with glutaraldehyde or not to induce a CTL response. The cross-linked nanoparticles were very stable even at temperatures exceeding 37°C \[Figure [3](#F3){ref-type="fig"}B\]. Mice (5 per group) were immunized three times at 2-week intervals with 100 μg of PapMV NP-C and NP-12 nanoparticles that were either cross-linked with glutaraldehyde or not. Surprisingly, cross-linking NP-C did not lead to an improved CTL response in mice \[Figure [4](#F4){ref-type="fig"}\]. The quantity of IFN-γ secreted by specific splenocytes remained similar to the response obtained with untreated nanoparticles. However, cross-linking of NP-12 nanoparticles did affect the efficacy CTL response induction as compared to native NP-12 \[Figure [4](#F4){ref-type="fig"}\]. We hypothesize that the cross-link made the nanoparticles too rigid, which consequently decreased their susceptibility to the proteases responsible for releasing the CTL epitope. To test this hypothesis, we resolved trypsin digests of cross-linked NP-12 and NP-C nanoparticles by SDS-PAGE (Figure [5](#F5){ref-type="fig"}). NP-12 and NP-C nanoparticles were only partially susceptible to the digest and lost 3 kDa on the gel as compared to non-digested nanoparticles. Cross-linked NP-C and NP-12 appeared resistant to digestion. The PapMV CP subunits of the cross-linked nanoparticles remained tightly attached to each other, leading to a very large molecular weight multimer that can barely enter the acrylamide gel. This experiment highlighted the likely difficulty of digesting cross-linked nanoparticles by host proteases involved in the excision of CTL epitopes for loading onto the MHC class 1 complex---an essential step in triggering a CTL response. In brief, nanoparticles must be sufficiently stable at animal body temperature (37°C) but flexible enough to allow their digestion by cellular proteases for loading onto MHC class 1 molecules. Therefore, an optimal balance between these two properties is crucial to triggering the CTL response efficiently. ![ELISPOT assays of immunized mice.Mice, 5 per group, were immunized three times by the intraperitoneal route with 100 μg of recombinant PapMV NP-12, PapMV NP-C and PapMV nanoparticles that were either untreated or cross-linked with glutaraldehyde. Two weeks after the second boost, spleens were extracted and ELISPOT assays performed. The precursor frequency of specific T cells was determined by subtracting the background spots in medium alone from the number of spots seen in wells reactivated with NP~147-155~peptide. \\ p ≤ 0.01 and \* p ≤ 0.05.](1477-3155-11-10-4){#F4} ![Trypsin digests of recombinant PapMV NP nanoparticles cross-linked with glutaraldehyde.PapMV NP-12 and PapMV NP-C either cross-linked with gluteraldehyde or not were submitted to a trypsin digest. The reaction was stopped by adding 10 μl of loading dye. Samples were heated for 10 minutes at 95°C prior to loading on an 8% SDS-PAGE.](1477-3155-11-10-5){#F5} PapMV NP-12 nanoparticles but not discs are able to trigger a CTL response -------------------------------------------------------------------------- In this experiment, our objective was to compare the efficacy of PapMV nanoparticles and discs in triggering a CTL response. PapMV NP-12 discs and nanoparticles were used to immunize (3 immunizations) mice (5 per group) with 100 μg of protein. We measured the production of IFN-μ after stimulation of splenocytes harvested from immunized mice 2 weeks after the second boost using the NP~147-155~ peptide. The level of IFN-γ secreted by splenocytes specific to PapMV NP-12 nanoparticles was significantly higher than that specific to PapMV NP-12 discs \[Figure [2](#F2){ref-type="fig"}\], suggesting that assembly into a highly ordered structure, i.e. nanoparticles, is critical to triggering the CTL response efficiently. We also noted that NP-12 discs appeared less stable than nanoparticles, and initiated aggregation at 34°C as compared to 37°C for nanoparticles \[Figure [3](#F3){ref-type="fig"}\]. Discs have the same diameter but are shorter than nanoparticles (30 nm vs 90 nm) and also less stable. These differences in size and stability could account for the observed differences in immunogenicity. Another difference between discs and nanoparticles is the RNA that they contain. Discs are associated with only very small amounts of RNA but nanoparticles contains ssRNA of bacterial origin \[[@B3]\]. It is possible that the ssRNA found in nanoparticles plays a role in the efficacy of the measured immune response. It is known that ssRNA of bacterial origin, as found in PapMV nanoparticles, can be recognized as pathogen associated molecular patterns (PAMPs) by several nucleic acid sensors like RIG-I, MDA-5, TLR7 or TLR8 that are at the interface between the innate and the adaptive immune response \[[@B15]-[@B17]\]. We are currently investigating if these sensors play a role in the CTL response. Our results are consistent with findings obtained with peptide fusions made at the N-terminus of the CP of potato virus X (PVX)---another member of the potexvirus family. It was shown that production of recombinant PVX virus particles in planta can elicit either an humoral \[[@B18]\] or a CTL immune response \[[@B19]\]. The use of the N-terminus for fusion of peptides on this type of vaccine platform can, however, be problematic if the recombinant virus particles are produced in planta because the fusion may interfere with long-distance transport of the virus throughout the plants and thus affect yield \[[@B20]\]. This is one of the main reasons why we chose to produce our nanoparticles in a bacterial expression system that does not depend on the replication or cell-to-cell transport of the virus. It is well accepted that the N-terminus of PapMV and potexvirus CP is exposed at the surface of the virus particle \[[@B2],[@B8],[@B21],[@B22]\]. The recently published 3D structure of PapMV CP revealed that the N-terminus is involved in the interaction between two CP subunits in the virus particle \[[@B2]\], and that the 12 N-terminal residues upstream of F13 are directly exposed on the surface \[[@B14]\]. The availability of the CTL epitope located at this position, as compared to the C-terminus, probably facilitates its cleavage by host proteases and favours loading of the MHC class I pocket in the immune cells \[[@B6],[@B9]\]. Conclusions =========== The results of this study improve our understanding of the PapMV vaccine platform and highlight the importance of nanoparticle stability in triggering a CTL response. We can now beneficiate of two different points of fusion for a CTL epitope on the PapMV CP. The fusion at the N-terminus was clearly superior for the NP~147-155~ peptide but it does not mean that this will be the case for another CTL epitope. The amino acid sequence of the CTL epitope and its influence on the structure on the PapMV CP can have a major impact on its stability and their immunogenicity. Those results are increasing the versatility of the vaccine platform and provide more options for production of stable constructs. Because it is well established that the trigger of a CTL response to conserved epitopes is a valuable approach in the design of prophylactic or therapeutic vaccines to chronic diseases \[[@B23]-[@B27]\], we believe that the PapMV vaccine platform will be a very useful tool. Methods ======= Ethics statement ---------------- All the work with animals adhered to the Institution-approved ethics protocol of the "Comité de Protection des Animaux" -- CHUQ (CPA-CHUQ). The approval of this project is listed under the authorization number 2010148--1. Cloning and production of PapMV NP constructs --------------------------------------------- The PapMV CP construct (CPΔN5) used for this study has been described previously (Tremblay et al., 2006). To generate the PapMV NP constructs, PapMV CPΔN5 was used to introduce the following oligonucleotides by PCR at position 12 at the C-terminus of the coat protein \[Table [1](#T1){ref-type="table"}\]. The linear vector harbouring the NP~147-155~ coding region fused to the PapMV was digested with BsiWI and ligated using T4 DNA ligase (New England BioLabs). The resulting PapMV NP clones harbour a fusion of the nucleoprotein epitope from Influenza virus at position 12 or at their C-terminus followed by a 6xHis tag for the purification process. We retained five amino acids on either side of the H-2Kd CTL epitope to ensure efficient processing. The integrity of the PapMV NP clones was confirmed by DNA sequencing. Expression and purification of PapMV particles fused to the NP~147-155~ peptide was performed as described previously \[[@B5]\]. Levels of expression for each recombinant nanoparticle were determined by SDS-PAGE. LPS contamination was always less than 50 endotoxin units (EU)/mg of protein. The size and structure of the nanoparticles were confirmed by observation on a TEM (JEOL-1010, Tokyo, Japan). ###### Forward and reverse oligonucleotides used to produce PapMV CP recombinant proteins *Name* *Oligonucleotide sequence* ------------ ----------------------------------------------------------------------------- NP-12 Forward 5^′^-AGCT*CGTACGCGTGCGCTGGTTCGTACCGGTATGGACTTCCCCGCCATCACCCAGGAAC-3^′^ Reverse 5^′^-TCGACGTACGCTGGTAGGTCGCGTCGTTCAGGTTGGCTATGTTGGGTGTGGATGCC-3^′^ NP-C* Forward 5^′^-ACGT*CGTACGCGTGCGCTGGTTCGTACCGGTATGGACACGCGTCACCATCACCATCAC-3^′^ Reverse 5^′^-TCGACGTACGCTGGTAGGTCGCGTCGTTCAGGTTACTAGTTTCGGGGGG-3^′^ Dynamic light scattering ------------------------ The size of nanoparticles and discs was determined using a ZetaSizer Nano ZS (Malvern, Worcestershire, United Kingdom) at a temperature of 4°C and at a concentration of 0.1 mg/ml in PBS 1x for nanoparticles and at a concentration of 0.25 mg/ml in Tris--HCl 10 mM for discs. The thermal stability of PapMV nanoparticles was measured under the same experimental conditions at temperatures from 24°C to 40°C. Chemical cross-linking with glutaraldehyde ------------------------------------------ Cross-linking was performed using 0.1% glutaraldehyde in 10 mM Tris, 50 mM NaCl pH 7.5 in a final volume of 50 μl. The optimal concentration of protein for cross-linking was 150 ng/ml. After addition of glutaraldehyde, the mixture was incubated at room temperature for 30 minutes in the dark. The reaction was stopped with 15 μl of loading dye and heated for 10 minutes at 95°C before separating the proteins by 8% SDS-PAGE. The cross-linked proteins used to immunize mice were stored at 4°C until immunization without adding loading dye. SDS-PAGE and trypsin digest --------------------------- Prior to SDS-PAGE, samples were mixed with one-third of the final volume of loading buffer containing 5% SDS, 30% glycerol and 0.01% bromophenol blue and heated for 10 minutes at 95°C. For the trypsin digest, we incubated 10 μg of proteins at 37°C in a volume of 50 μl for 120 minutes in 100 mM Tris--HCl pH 8.5 with 0.2 μg trypsin (Roche, 1418475). The reaction was stopped by adding 10 μl of loading dye. Samples were heated for 10 minutes at 95°C prior to loading on SDS-PAGE \[[@B3]\]. Immunization ------------ Five 6- to 8-week-old Balb/C mice (Charles River, Wilmington, MA) were immunized by the intraperitoneal route with: (i) 100 μg of PapMV NP-12 nanoparticles; (ii) 100 μg of PapMV NP-C nanoparticles; (iii) 100 μg of PapMV CP nanoparticles; (iv) 100 μg of PapMV NP-12 discs, and (v) 100 μg of PapMV NP-C discs. Primary immunization was followed by two booster doses given at 2-week intervals. Blood samples were obtained before each injection and 2 weeks after the last one and stored at -20°C until analysis. ELISPOT ------- Two weeks after the last boost, mice were sacrificed and spleens were recovered for ELISPOT assay performed as described previously \[[@B25]\]. The precursor frequency of specific T cells was determined by subtracting the background spots in media alone from the number of spots seen in wells reactivated with NP~147-155~ peptide. Data were analyzed with a parametric or a non-parametric ANOVA test when the variances differed significantly and with a Tukey or a Dunn post-test to compare difference among groups of mice. Values of \p \< 0.05, \\p \< 0.01 and \\\*p \< 0.001 were considered statistically significant. Statistical analyses were done with GraphPad PRISM 5.01. Competing interest ================== DL is founder and shareholder in the company FOLIA BIOTECH INC., a start-up company with the mandate to exploit commercially the PapMV nanoparticle technology. The patent is issued (U.S. Patent No. 7,641,896). This does not alter the authors' adherence to all the BMC policies. Authors' contributions ====================== CB carried out all the experiments presented in this manuscript. NM and DL participated in the design of the study and supervision of CB. CB help to make the first draft of the manuscript. DL coordinated the study and completed the writing of the manuscript. All authors read and approved the final manuscript. Acknowledgements ================ This research project was funded by the Canadian Institute of Health Research Canada (CIHR) (grant number: 185160). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. We also thank Dr Helen Rothnie for English editing of the manuscript.	{ "pile_set_name": "PubMed Central" }
PURPOSE: The face and craniofacial skeleton (CFS) make up a complex 3D structure that is critical to human function and cosmesis. Traumatic injury to the CFS requires fracture treatment to both allow the recovery of mechanical function and forms a foundation for the restoration of soft tissue anatomy. CFS reconstruction aims to restore pre-injury appearance, however in severe injuries shape information for the skull and facial bones may be missing. This presents a particular challenge in bi-frontal injuries and pan-facial fractures where the mirror imaging of the intact side of the head cannot be used to guide reconstruction. The reconstruction of 3D facial surface geometry from pre-injury 2D photographs has recently been established through large scale morphable face modeling.^1^ As well, in forensic sciences, models with variable soft-tissue depths^2^ are used to determine face shape from skull geometry. This study aims to 'reverse-engineer' a forensics' tissue depth model to determine pre-injury CFS shape from reconstructed 3D facial geometry. It is hypothesized that 3D forensics data can be used to fill in missing gaps in CFS geometry with sufficient accuracy to guide pre-operative planning for CFS reconstruction. METHODS: The forensics' tissue depth model was applied to 3D facial geometries acquired through segmentation of head CT data. Age, sex and BMI were used as input parameters to guide the application of the forensics' tissue depth model data to each face. The tissue depths between the face and CFS were determined by finding the Euclidian distance transform (nearest neighbor) employed by the original forensics study and via calculation using normal vectors generated from the face surface. Calculated tissue depth was evaluated against measured thickness on the head CT between the segmented CFS (bone) and the skin. RESULTS: Tissue depth determined by nearest neighbor and normal vector measurements yielded accurate reconstructions of the frontal and zygoma bones (within 1mm, or +/- 2 voxels). However, only the normal vector technique succeeded in estimating tissue depth in bone regions where the face and skull have differing concavity (i.e. eye sockets, maxilla). Agreement was more limited in the lower facial skeleton where greater variation of soft tissue structures occur. CONCLUSION: The reversed forensics tissue depth model was found to appropriately infer bony anatomy for the upper CFS from 3D face geometry. The 3D skull shaping provided by this work yields sufficient accuracy to warrant its inclusion into a translational pipeline of tools for pre-operative planning for CFS reconstruction. References: 1\. Booth J. et al. Int J Comput Vis. 2017, 1--22. 2\. Shrimpton S. et al. Forensic Sci. Int. 2014, 234, 103--110.	{ "pile_set_name": "PubMed Central" }
104 F.3d 361 NOTICE: Sixth Circuit Rule 24(c) states that citation of unpublished dispositions is disfavored except for establishing res judicata, estoppel, or the law of the case and requires service of copies of cited unpublished dispositions of the Sixth Circuit.Jimmy Lee HARVEST, Plaintiff-Appellee,v.John RANDOLPH, Defendant-Appellant, andState of Tennessee, Department of Transportation, Defendant. No. 95-6319. United States Court of Appeals, Sixth Circuit. Dec. 18, 1996. On Appeal from the United States District Court, for the Eastern District of Tennessee, No. 94-00497; Thomas W. Phillips, United States Magistrate Judge. E.D.Tenn. REVERSED. Before: LIVELY and NELSON, Circuit Judges, and HACKETT, District Judge. PER CURIAM. 1 The defendant John Randolph appeals from the district court's denial of his motion for summary judgment on the ground of qualified immunity. We have jurisdiction pursuant to 28 U.S.C. § 1291. See Mitchell v. Forsyth, 472 U.S. 511 (1985). I. 2 Represented by an attorney, Jimmy Lee Harvest, who is an African-American, sued the Tennessee Department of Transportation (TDOT), his former employer, and John Randolph, his immediate supervisor at TDOT, in a Tennessee state court, alleging that the defendants discriminated against him on the basis of his race. The complaint charged both defendants with violating Title VII of the Civil Rights Act of 1964, 42 U.S.C. §§ 2000e-2000e-17, and a Tennessee civil rights statute, and of conspiracy to force his resignation in violation of 42 U.S.C. §§ 1983 and 1985. Though not clearly stated, the claim under § 1983 appears to have charged violation of the Equal Protection Clause of the Fourteenth Amendment. The prayer for relief demanded damages against both defendants in the amount of $250,000 and reinstatement to his former position, with full back pay and benefits. As an action under federal civil rights laws, the case was removed to district court. See 28 U.S.C. § 1443. 3 The defendants filed a motion to dismiss and for summary judgment. With consent of the parties, the case was transferred to a magistrate judge for final disposition. After some discovery, the magistrate judge issued an order granting in part and denying in part the defendants' motion. The court concluded that the plaintiff had failed to make out a prima facie case for recovery under Title VII and had failed to establish a conspiracy in violation of 42 U.S.C. § 1985. The court held that TDOT was immune from suit for damages under the Eleventh Amendment, but that Randolph had been sued in his individual capacity and was not entitled to qualified immunity. 4 In accordance with these rulings, the district court dismissed all claims against TDOT and the claims against Randolph predicated on a Title VII violation and a conspiracy. It also dismissed the state law claim without prejudice. Randolph appeals from the refusal of the court to dismiss the claims against him brought under 42 U.S.C. § 1983. The plaintiff conceded in a memorandum filed in the district court that he had not satisfied the requirements of a Title VII claim or established the existence of a conspiracy. He also conceded that TDOT was immune from suit under the Eleventh Amendment. The only claim remaining is the § 1983 claim against Randolph. 5 The parties waived oral argument, and the appeal was submitted on the district court record and Randolph's brief. The appellee, Harvest, did not file a brief. Although Randolph has challenged several of the district court's rulings, only one need be addressed here: the district court's denial of Eleventh Amendment immunity based on its belief that Randolph was sued in his personal, rather than official, capacity. We have interlocutory appellate jurisdiction over a denial of Eleventh Amendment immunity. Puerto Rico Aqueduct & Sewer Auth. v. Metcalf & Eddy, Inc., 506 U.S. 139 (1993); Williams v. Kentucky, 24 F.3d 1526, 1543 (6th Cir.), cert. denied, 115 S.Ct. 358 (1994). II. A. 6 As he did before the district court, Randolph argues on appeal that he was sued only in his official capacity and therefore shares the absolute Eleventh Amendment immunity of TDOT. We agree. 7 The complaint in this case did not specify the capacity in which Harvest sued Randolph. Under the settled law of this Circuit, where a complaint seeking monetary damages against a state official under 42 U.S.C. § 1983 does not clearly state that the official is sued in his individual or personal capacity, the court must treat the lawsuit as one against the defendant in his official capacity. Wells v. Brown, 891 F.2d 591, 592 (6th Cir.1989). See also Wittington v. Milby, 928 F.2d 188, 193 (6th Cir.), cert. denied, 502 U.S. 883 (1991); Hardin v. Straub, 954 F.2d 1193, 1199 (6th Cir.1992); Thiokol Corp. v. Department of Treasury, 987 F.2d 376, 383 (6th Cir.1993), all to the same effect. The court recognized this rule in Pelfrey v. Chambers, 43 F.3d 1034, 1038 (6th Cir.), cert. denied, 115 S.Ct. 2269 (1995), but found that the plaintiff had taken steps shortly after filing the complaint to make it clear that the defendant was sued in his individual capacity. Thus the individual defendant in that case had sufficient notice that the plaintiff was seeking damages from him individually, not as a state official. B. 8 The magistrate judge recognized the Wells rule, but stated, "Giving plaintiff the benefit of the doubt, the court accepts plaintiff's argument that he is suing defendant Randolph in his individual capacity." We can find no basis for this ruling. Then Chief Judge Merritt's language cannot be misunderstood and is not subject to interpretation. He wrote in Wells that plaintiffs seeking damages under § 1983 must "set forth clearly in their pleading that they are suing the state defendants in their individual capacity for damages, not simply in their capacity as state officials." Wells, 891 F.2d at 592. 9 This case differs from the situation in Pelfrey where a panel of this court found Wells distinguishable. Here the defendants TDOT and Randolph filed their joint motion to dismiss and for summary judgment on May 26, 1995. The magistrate judge filed his dispositive order on September 5, 1995. Although the Tennessee Attorney General filed an answer and the motion to dismiss and for summary judgment on behalf of both defendants, the plaintiff did not amend his complaint to state clearly that he was suing Randolph in his individual capacity though he had more than three months in which to do so. Nor did he take any other steps to notify Randolph that he was being sued individually for damages. In Pelfrey, on the other hand, the court found that the plaintiff gave sufficient notice to defendants who were state officials that they were being sued individually for damages. The notice stemmed from the fact that shortly after filing the complaint Pelfrey filed a motion to prohibit the Ohio Attorney General from representing the individual defendants because they were being sued in their individual capacities. Pelfrey, 43 F.3d at 1038. Thus, the present case is not analogous to the situation in the only published decision where this court has not applied the Wells rule strictly. III. 10 Since the Supreme Court's decision in Will v. Michigan Department of State Police, 491 U.S. 58 (1989), it is settled law that state officials sued for damages under § 1983 in their official capacities are absolutely immune under the Eleventh Amendment. This is so because "a suit against a state official in his or her official capacity is not a suit against the official but rather is a suit against the official's office. As such, it is no different from a suit against the State itself." Id. at 71 (citations omitted). Concluding as we do that Harvest sued Randolph in his official capacity only, Randolph is entitled to absolute immunity. We need not discuss qualified immunity, as that defense applies only to state actors sued in their individual capacities. 11 The judgment of the district court is REVERSED and the case is REMANDED to the district court with directions to remand the 42 U.S.C. § 1983 claim against Randolph to the state court from which it was removed. See Henry v. Metropolitan Sewer District, 922 F.2d 332, 338 (6th Cir.1990). The Honorable Barbara Hackett, United States District Judge for the Eastern District of Michigan, sitting by designation	{ "pile_set_name": "FreeLaw" }
Alkaline phosphatase isoenzyme pattern in human amniotic fluid is dependent on the level of total activity. Implications in cystic fibrosis diagnosis. Alkaline phosphatase activities have been examined in 500 consecutive human amniotic fluids obtained at diagnostic paracentesis between 14 and 38 wk of gestation. They were found to have a non-Gaussian, positively skewed distribution, independent of the protein concentrations. Residual activities after heat treatment or in presence of phenylalanine and levamisole allow evaluation of the placental, hepatic and intestinal isoenzyme components. It is shown that the contribution of the intestinal isoenzyme to the total activity is a linear function of the latter. This fact should be taken into account in the enzymatic diagnosis of cystic fibrosis as it is apparent that the part contributed by the intestinal isoenzyme is predictably smaller when the level of total activity is low.	{ "pile_set_name": "PubMed Abstracts" }
Remembering past journeys, recording current trips and planning for the next one! Menu So Much Yarn! Some visitors come to the North Yorkshire market town of Skipton to immerse themselves in history; Skipton castle, surrounded by 12th century stone walls, was once the home of the aristocratic Clifford family, while the beautiful Parish Church of Holy Trinity houses their resplendent tombs. Others enjoy Skipton’s natural beauty or use it as a base for exploring the hills and woodlands of the Yorkshire Dales. On Thanet Canal, pretty houseboats compete for space with families of swans and ducks. But on one weekend in September, people come from far and wide to see something else altogether – yarn! Celebrating creativity, colour and “all things woolly”, Yarndale brings together producers, designers and textile artists in a festival dedicated to yarn in every imaginable form. More than a kilometre of crocheted bunting decorates the ceiling inside Skipton Auction Mart, where exhibitors display their yarns in all the colours of the rainbow. Beautiful finished works create a collage of colour and texture. It’s an Aladdin’s cave of treasures for any crafter, and the possibilities are only limited by their imagination. Elaine, it was almost overwhelming. I didn’t know where to look first. The yarns were so beautiful and I was excited to see some projects I recognised from websites I follow. I loved the socks and would really like to try making a pair. I have some friends in Yorkshire who attend this event annually and also know of others who travel there especially for this event. It does sound lovely and your photos are the best I have seen of the lovely display of yarniness. Your creations would go well there! 🙂 Thanks, CC. That’s a great compliment considering the standard of work I saw. The festival is mostly exhibitors selling either their yarn, patterns and designs, or finished items. I didn’t buy any but I was certainly tempted and inspired. Now I have a little. more knowledge, I would love to go again with a few ideas for what I would buy. How lucky are your friends. I had read about it online for a couple of years, and when we decided to go to England in September and then put Yorkshire on the itinerary I planned the whole five weeks so we were close by that weekend! My mother would have LOVED this, Carol. She was always knitting and crocheting. In fact I wouldn’t be surprised if she actually visited this at one time or another – she often traveled the world looking for unique places like this xxxx It’s only been going for a few years Dianne, but there are probably other similar events which have been around a lot longer. She would have revelled in all the beautiful yarns. I’ve never seen so many different ones.	{ "pile_set_name": "Pile-CC" }
1. Introduction {#sec1} =============== In wild sika deer, Cervus nippon yesoensis, in Hokkaido, Japan, sarcocysts of protozoan parasites of the genus Sarcocystis are highly prevalent, and four Sarcocystis species have been identified in the region to date: S. ovalis, S. pilosa, S. tarandi-like, and S. truncata-like ([@bib28]; [@bib19]; [@bib12]). Among these species, S. ovalis has been reported to have a corvid as its definitive host in the region ([@bib13]). Although the definitive hosts of the remaining species remain unknown, phylogenetic and epidemiological evidence seems to indicate that members of the Felidae (or unknown animals) are the likely definitive hosts of S. tarandi-like and S. truncata-like ([@bib4]; [@bib10]). The remaining species, S. pilosa, was originally isolated from C. nippon in Lithuania ([@bib21]), where seven Sarcocystis species were characterized in farmed sika deer by means of morphological and molecular methods ([@bib22]). Seven partially different Sarcocystis species, including S. pilosa, were also characterized in wild sika deer (C. nippon centralis) in mainland Japan ([@bib2]). The definitive host of S. pilosa is suspected to be a member of the Canidae, because S. pilosa falls phylogenetically within a clade that includ Sarcocystis spp. using Canidae as their definitive host. Further, sarcocysts that are morphologically similar to S. pilosa have been described in C. nippon centralis and C. nippon yesoensis in Japan, and this type of sarcocyst is experimentally able to infest and reproduce in dogs ([@bib25], [@bib26]; [@bib3]). The red fox, Vulpes vulpes schrencki, is a very common canid in Hokkaido, and has been observed feeding on deer carrion ([@bib29]). It therefore seems likely that red foxes serve to maintain S. pilosa in sika deer in Hokkaido. To clarify the Sarcocystis life cycle and the cause of the high prevalence of these parasites in deer, a survey of fecal sporocysts in red fox fecal samples was conducted. 2. Materials and methods {#sec2} ======================== 2.1. Red fox fecal sample collection {#sec2.1} ------------------------------------ As described by [@bib18], red fox fecal samples were collected along road verges, agricultural fields, and paths that were likely to be utilized by red foxes in eastern Hokkaido. Fecal collection was conducted in May 2018 (n = 44) and in December 2018 (n = 21). To aim to collect feces from different foxes, the sites where feces were picked up were separated by at least 2 km. To confirm that fecal samples belonged to red foxes, fecal DNA was extracted as described by [@bib20], and the 12S ribosomal RNA (rRNA) gene was analyzed as described by [@bib31]. To inactivate Echinococcus multilocularis eggs, which are highly prevalent in red foxes in the study area, fecal samples were incubated at 70 °C for 12 h before being stored at −30 °C until use. 2.2. Fecal sporocyst examination {#sec2.2} -------------------------------- Fecal sporocysts were examined in 1 g of feces using a modified sucrose flotation method (specific gravity, 1.27) ([@bib14]). For species identification, sporocysts were collected from the supernatant of the centrifuge tube by simple sedimentation in saline. 2.3. DNA extraction and PCR sequencing of collected sarcocysts {#sec2.3} -------------------------------------------------------------- Genomic DNA from collected sporocysts was extracted using a PowerSoil DNA Isolation Kit (Mobio Laboratories, Solana Beach, CA) according to the manufacturer\'s instructions. The 18S rRNA and cytochrome c oxidase subunit I (COI) genes were amplified and sequencing was performed using previously described primers ([@bib12]). Direct sequencing was performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA), and the obtained sequences were compared with those deposited in GenBank/EMBL/DDBJ. 3. Results and discussion {#sec3} ========================= Of the 65 fecal samples analyzed, one (collected in December 2018) contained Sarcocystis sporocysts at approximately 500 sporocysts per gram of feces. The fecal sample was confirmed to belong to V. vulpes based on the 12S rRNA gene sequence. To confirm the presence of sporocysts in the feces, fecal examination was repeated again, and revealed reproducibility of the examination. The fecal sample was also positive for eggs of E. multilocularis and Capillariidae, and negative for Cystoisospora oocysts. The Capillariidae species might be Calodium hepaticum (syn. Capillaria hepatica), which reproduces in the liver of vole, and the eggs pass thorough the intestines of foxes that prey on vole. In other feces, eggs of hookworm, Toxocara canis, Dibothriocephalus nihonkaiensis, and oocysts of unidentified Cystoisospora were detected by the flotation. The detected Sarcocystis sporocysts contained four sporozoites and were 15.0 μm (SD = 0.2) long and 9.3 μm (SD = 0.4) wide ([Fig. 1](#fig1){ref-type="fig"}) (mean values for 100 sporocysts). 18S rRNA (1669bp) and COI (1029bp) gene sequences of the sporocysts were deposited in GenBank/EMBL/DDBJ with accession numbers LC496069 and LC496070, respectively. Both sequences were 99.95%--100% identical to those of S. pilosa obtained from sarcocysts from sika deer in Hokkaido and Lithuania, and 99.23%--99.87% identical to such samples from mainland Japan ([Supplemental Table S1](#appsec1){ref-type="sec"}).Fig. 1Morphology of detected sporocysts under light microscopy. Scale bar: 10 μm.Fig. 1 Although Sarcocystis is considered highly endemic in sika deer from Hokkaido ([@bib26]; [@bib12]), very little is known about the life cycles of these Sarcocystis spp. Of the four prevalent species in the region, we focused on S. pilosa, the definitive hosts of which are suspected to belong to the Canidae. We therefore collected and analyzed red fox fecal samples and we detected S. pilosa sporocysts in one sample. Although it was previously experimentally demonstrated that red foxes can act as a definitive host for S. hjorti, which is closely related to S. pilosa ([@bib5]), this is the first record of S. pilosa sporocysts in feces excreted by red foxes in the wild. The finding indicates that the red fox serves as a definitive host of S. pilosa, and also that red foxes could be an infection source for deer in the region. In this study, only one fecal sample from red foxes contained sporocysts, representing 1.5% of the analyzed fecal samples and 4.8% of fecal samples collected in the winter. Prevalence of Sarcocystis sporocysts in feces of red foxes has been evaluated in many studies: 1.9% in Bulgaria ([@bib16]), 3.8% in Ireland ([@bib30]), 10.1% and 17.9% in the USA ([@bib7]; [@bib6]), and 84.4% in Newfoundland ([@bib15]). Species were unfortunately not identified in those studies, and thus intermediate host animals were also not determined. Although simple comparison might not be appropriate because of biological and geographical differences, the rate of sporocyst-positive feces in the present study might relatively be low. However, the number of fecal samples examined in our study was statistically insufficient, and further investigation is necessary to evaluate the true prevalence. In addition, it is indispensable in future work to confirm that S. pilosa can reproduce in fox intestine by histological and/or intestinal scraping examinations, to eliminate the possibility that we have observed pseudoparasitism caused by ingestion by red foxes of carcasses of other animals that do serve as a definitive host of S. pilosa. Red fox feeding habits in Hokkaido were inferred by analyzing residues in collected feces, which revealed that the annual percentage occurrence of material derived from deer was 16.7%, with the highest utilization of deer occurring in May ([@bib29]). Considering the feeding habits of red foxes, the prevalence of Sarcocystis infection in red foxes may be higher than that observed in our study. Moreover, given that S. pilosa endemicity among deer in the region is \>90% ([@bib12]), difference in the prevalence of these parasites between the definitive and intermediate hosts is considered unlikely. Excretion of sporocysts peaks during the early patent period, before dramatically decreasing in just a few weeks in the late patent period ([@bib24]). In addition, in fecal samples of arctic foxes (V. lagopus), lower detectability of fecal sporocysts using a flotation technique was reported than that by qPCR analysis of fecal suspension (3% and 16%, respectively) ([@bib9]). Consequently, fecal sporocyst detectability might be markedly lower than the actual prevalence in the wild. Among the Sarcocystis species that use deer as an intermediate host in Germany (e.g. S. tenella/S. capracanis, and S. gracilis), the prevalence among red foxes was relatively high (6%--10% of surveyed animals) ([@bib17]). Comparison of Sarcocystis detectability based on fecal examination and mucosal scraping examination revealed that the latter exhibited higher sensitivity ([@bib27]). Thus, to more accurately evaluate Sarcocystis prevalence, such mucosal examination of small intestines from the definitive host animal is necessary. Further, sporocysts are known to be resilient in field conditions (especially in cold temperatures), and can remain infective for extended periods of time ([@bib23]). In the same way that the red fox serves as the definitive host for some Sarcocystis spp. ([@bib8]; [@bib5]; [@bib17]), so too does the raccoon dog ([@bib11]; [@bib17]). Indeed, raccoon dogs have been experimentally infested with Sarcocystis by feeding with sarcocysts from sika deer in Japan, and they excreted sporocysts in their feces ([@bib26]). The Sarcocystis species used in that experiment was not clear due to the lack of molecular information at the time. Sarcocysts of S. pilosa were also detected in C. nippon centralis, which exists on the main island of Japan ([@bib2]), and slight molecular diversity was observed compared with S. pilosa isolates from Hokkaido and Lithuania ([Supplemental Table S1](#appsec1){ref-type="sec"}). This might reflect a difference in the definitive host animals; the red fox population is suspected to be smaller on the main island of Japan, and, therefore, red foxes may not play an equally important role in the transmission of S. pilosa in other regions of Japan as they presumably do in Hokkaido. Moreover, the raccoon dog could also be a definitive host of Sarcocystis species, which could be determined by a survey of raccoon dogs in Hokkaido and the main island of Japan. In conclusion, this is the first study to find S. pilosa sporocysts in red fox feces in Hokkaido, which indicates that red foxes could be a definitive host of this Sarcocystis species on this island. Because of the low detectability of sporocysts by fecal examination, examination of intestinal mucosal scrapings from red foxes is considered necessary to more accurately reveal the prevalence of this parasite in the region. In addition, a survey of other canids (e.g. raccoon dogs) should be undertaken to identify the primary definitive host(s) for S. pilosa in this region. Financial supports {#sec4} ================== Part of this work was supported by Health and Labour Sciences Research Grants (H30-Shokuhin-Wakate-003 and H30-Shokuhin-Ippan-011) that organaized by Ministry of Health, Labour and Welfare (Japan). Declaration of competing interest ================================= The authors received no support and have no relationships that could be perceived as constituting a conflict of interest. Appendix A. Supplementary data {#appsec1} ============================== The following is the Supplementary data to this article:Multimedia component 1Multimedia component 1 We thank Mallory Eckstut, PhD, from Edanz Group ([www.edanzediting.com/ac](http://www.edanzediting.com/ac){#intref0010}) for editing a draft of this manuscript. Supplementary data to this article can be found online at <https://doi.org/10.1016/j.ijppaw.2019.12.001>.	{ "pile_set_name": "PubMed Central" }
Again l say to you, the kingdom shall be taken from you and given to another. For many are called, but few are chosen. Now l'm all the more convinced. ''The kingdom will be taken from you,'' He said, ''and given to another.'' Given to the few, who are chosen. Were we few not chosen on the shores of Galilee? The weight of it all. This very temple will be His palace. Friends, do you see these walls? Yes, Master. We know what you're about to say . The day is coming when they shall fall. And there shall not be one stone left upon another . lt doesn't make sense. He rises to power , then the temple is destroyed? That can't be what He meant. There shall not be one stone left upon another. Those were His words. lt must be a parable, or a saying that means something else. Well, maybe a new temple will be built in place of the old one. Maybe there will be a battle, and we'll have to fight those Romans after all. Come, let's ask the Master . Friends, be not deceived concerning the coming day of my power. We are not deceived, Lord. We know you've come to rule over lsrael. Over the whole world. Again, l say unto you, be not deceived, For before that day many shall come in my name saying, ''l am Christ.'' And they shall deceive many. And when ye shall hear of wars, and rumors of wars, be not troubled for such things must need be. But the end shall not be yet for nation shall rise against nation, and kingdom against kingdom. And there shall be earthquakes in many places. And there shall be famines and pestilence. These are the beginning of sorrows. But in those days after that tribulation, the sun shall be darkened. And the moon shall not give her light. And the stars of heaven shall fall. And the powers that are in the heavens shall be shaken. Lord, when shall all this be? No man knows that day. Not even the Son of Man. Watch therefore, for you know not what hour your Lord will come. Hear this parable: For the Kingdom of Heaven is like a man preparing to travel to a distant country, who called his servants and entrusted his property to them. Quick. Quick, quick, quick. The master is setting sail tomorrow. Where to? l don't know. He just turned to me, and right out of the blue, he said, ''We're leaving in the morning on a loooonng journey.'' That's how he said it. ''Looonng journey.'' He didn't say when you would be coming back? All he said was, ''Looonng journey.'' l get seasick. l hate looonng journeys. l'm sick for a looonng time. He's leaving. How do you like that? Oh, no! Now l've got to find a new job. No. No, no, no, no. He wants each of you to stay on. You mean, l have a job working for someone who's never going to be around? Ha ha ha. Now, that is good news. Don't get too comfortable. There's supplies to load. This is a looonng journey. l'm not working through the night. He expects too much. Tell the master everything will be ready in the morning. Ah, thank you, Arad, Tola. Mmm! Good morning, Arad. Good morning, Tola. Where is -- Sorry, master. l'm -- l'm not feeling well. l'm sorry to hear that, Hod. There's something l'd like you three to care for while l'm gone. l'm entrusting you with these precious coins. You may do with them as you wish, but when l return there will be an accounting. See that they multiply. Thank you, Master. l divided these coins according to your different experience and abilities. Hod, l would expect much more from Arad and Tola when l return than l will from you. They have received more. But if you are a good steward over this one silver coin, your reward will be the same as theirs. l promise you. All l expect is for you to do your best. Each one of you is very special to me. l will miss you all. Look, Hod, l'll be happy to help you if you want. Me, too. Oh, no, l know the master too well. l'm not risking this coin. No, sir. ln fact, l'm going to bury it, right now. When master comes back, l'll dig it up and he can have his coin. He's making a big mistake. The best way to persuade him is to show him how to make these coins grow . Dear God in Heaven, l need your help making these coins grow. Give me the wisdom to know -- -- to know the best way for me to use these coins, so l can give a good accounting when the master returns. Amen. Pardon. Can you show me the shortest way to the valley? Beyond the lake? lt's this way. Ten days by foot. Ten days? But -- but l can see it from here. Ha, ha -- that's true, but the lake is very long. Ahh. No one lives in that valley, you know. Oh, l know. But the Emperor got this big idea, and says he wants people to live there now . So he sent all of us. All of who? Two hundred families, all coming this way. Two hundred families? Oh, it's a prime piece of land, that's for sure. Of course, l can't sell it cheap. Well, there's a few hard spots here and there; that's -- that's good for a house, you know . A nice, firm foundation -- ah -- But l'm going to plant wheat. Wheat? Wheat -- as -- as in wheat - wheat? Wheat that -- that grows in the ground wheat? Oh, l've met some crazy men in my life, but you are -- Well, ah -- definitely not one of them. Sold. Guess l'll go feed the horses. Then -- ah, take another nap. Oh, no! How come Arad and Tola didn't fix this? lf they think l'm going to do everything while they're off multiplying their coins, they got another thing coming. l'm take'n the day off. Hod. Zadoc? Haven't seen you ever since you got that a -- What do they call it? Ajob? Yeah, but you're going to be seeing a lot more of me from now on. Ha! You got fired again, huh? The master's gone on a long journey. Well, then, what are we waiting for? Come on! Let's go have some fun. Exactly what l was thinking. E... you're buying right? 'Cause l'm kinda broke right now. Did you haul water to the house? Yeah. You stack the firewood? Uh-huh. And you cleaned out the stables, right? Yep. lt looks like we're done. Good night. Ha, ha, ha. They're going to do it all. Ha, ha, ha, ha. Keep chopping friend. Yah, ha, ha. Whoohoo! Oh, no! Ha, ha, ha -- ho, ho, ho -- hee, hee -- Arad. Hey, Arad. Hod. Look at him. Heh, heh -- Excuse me, sir. May l help you? l - come to you on behalf of many widowed women. Could we follow behind you and gather the wheat you miss, to feed our children? How many children are there? Forty, or so. Wait! The rest of this field belongs to you and the other widows. All of it? lt takes a lot to feed forty children. But you must make a living, too. There's still time to plant again before the end of harvest. l'll be fine. Oh, thank you. Thank you! Ready! Go! [glug, glug] Just the man l was looking for. Two hundred families are moving to the valley beyond the lake. Every one of them will pay to be ferried across the lake rather than walk around it. lf you help me, you could double that one coin of yours in no time. As Hod's friend, l -- l'm not talking to you. And you're the furthest thing from a friend l could possibly imagine. Why do you and Arad keep coming here? l'm not going to risk losing that coin. But the master -- The master expects too much. This is the finest wheat l've ever seen. How much to buy back my field? Sorry. Not for sale. But you can have all of my wheat for ten coins and still make a good profit. Sold! That's all l can pay. Oh, l -- l'm grateful. lf two hundred farmers pay the same, l'll have two hundred chickens to sell. The master, he's come home. What? Oh, oh. Hello, Arad. Welcome home, master. How have you done with my five coins? l have gained five more. Well done. And because you've been faithful over these few things, l will make you ruler over many. Thank you, master. And you, Tola? You gave me two, master , and now l'm returning four. Well done, Tola. You, too, shall be made a ruler over many things. Your reward will be just as great as Arad's. Hod? Master, l -- l was afraid. l knew that no matter what l did with it, you'd never be satisfied, so l buried it. Here! At least l didn't lose it. Oh, Hod. Couldn't you have at least given it to the banker so l could have interest on it? You see. You're never satisfied. You expect too much. l only expected you to do your best. lf you had, your reward would have been no different than the others. l promised you that. Here, give this to Arad. l'm sorry Hod, you can no longer live and work here. l am sorry. He who hath ears to hear, let him hear. Then shall the Kingdom of Heaven be likened unto ten maidens, five of them were wise, and five were foolish. So what, Leah. So we forgot oil for our lamps. lt doesn't matter! l don't know why you made us bring them anyhow. We don't need them in the broad daylight! l told you, sometimes the bridegroom doesn't arrive until very late. ''Sometimes.'' You worry too much, Leah. lt'll be all right. We'll leave for the wedding at sundown. Sundown? That's a bit late, isn't it? l want to make sure that everyone has a chance to get there. Well, you needn't worry about that, Judah. The entire city is waiting to accompany you to the wedding. Do you think we could have missed him? How could we have? We've been here all day. l don't know about you, but l'm getting some rest! Wake us up when he arrives, Leah. Master Judah arrives! Master Judah arrives! Fall in line for the wedding party! Master Judah arrives! Fall in line for the wedding party! Master Judah arrives... Look! He's here! Fall in line for the wedding party! Fall in line! Master Judah arrives! Master Judah arrives... Fall in line for the wedding party... Master Judah arrives! Master Judah arrives! Fall in line for the wedding party! Fall in line for the wedding party! Master Judah arrives! Master Judah arrives! Fall in line for the wedding party! Master Judah arrives! Master... Judah arrives... Master... Judah... arrives Fall in line for the wedding party. Master Judah arrives. Fall in line for the wedding party. Oh, we've been around this part of the city several times, Judah, sir. Are you sure everyone's had a chance to hear? l should think so! l... l don't want to leave anyone behind. Master Judah arrives! Oh, no, no, no, no, no! We've given ample warning. Alright, then. Now on to the wedding. Master Judah arrives! Fall in line for the wedding party! Master Judah arrives! He's arrived! Quick, the wedding party is passing! Wait! Wait for us! Come here! Give us some of your oil! We can't see! But, then we'll all run out. Leah, hurry up! Come here! l'm sorry, Simone. l want to help you, but... but if we don't leave now, we'll all miss the wedding. We'll knock on these doors! Try to buy some! Hurry! Let us begin. Oh God, we come before thee... Judah... Judah! Who calls? Your friends! Your friends?! Do l know you? Hold up your lamps so l can see your faces. Well, we have no oil. Our light has gone out. lf you are my friends, why didn't you come when l called? Come Judah, it's time to begin. l'm... l'm sorry, l know you not. Watch therefore, for ye know neither the day nor the hour wherein the Son of Man cometh.	{ "pile_set_name": "YoutubeSubtitles" }
A fence will not help, they cut the copper out of the air unit they will have no problem cutting the fence around it. The way to stop it is start holding the scrap yards accountable for the scrap they accept. Until there is a penalty this will keep happening over and over. We are so screwed folks. The far Right the far Left are pulling the country so hard that all of the rest of us "in the middle" are being pulled apart. A country divided starts to blame (just look at the comments). This is how I see it ......... A person has a little money, you will stay in jail until you qualify for welfare. A person is on welfare, you will never see a jail cell and you will be back on the street doing whatever got you picked up in the first place. Sounds good but in reality a very very bad idea. A much smarter idea is to put inmates to work cleaning up our streets, boarding up abandon homes, cutting and cleaning up abandon properties. Use them to make our community better no matter what their assets are. Scrap Yard should have to get I.D.'s maybe even finger prints from people turning in copper. I recently sold some gold and had to give my drivers license and thumb print before the money was handed over. @nohelp ....... the problem with Pickel is no matter how much money he is given nothing will change regarding crime in Genesee County. Pickel is only interested in how it looks, not what it does. His type of law enforcement helps no one it only makes his head bigger and gives him more opportunities to tell us how great he is. With these Bill and Joel gone there is no quality news reporting in Genesee County now!!!! I've already started boycotting their advertiser and I will not watch WJRT-12 news anymore. WJRT or your advertisers if you are reading this ....... I'm not alone! Good luck to Joel and Bill. I hope you are hired by a local new organization we need you. There is a differance between non-profit and tax exempt. Watch out what you wish for Mr. JohnofGB, you need to work or spend sometime at a non-profit to open your eyes! I've read many of your comments and they are always so blunt with a one sided group of facts. Non-profit agencys are what is holding this very fragile area together. We don't go around saying "Look at us" but without the non profit agencies many working families in our area "maybe even you Mr. GB" would be out in the cold. Sitting at a computer criticizes the union seems to be a popular topic as of late. Keep in mind the working conditions you have today, union or not are there for you to enjoy because of the unions. Once you get your wish and all the unions are gone, lookout American labor, business will run all over you. Think it will not happen, read your history and see how kind business was to its employees. Unions came to be for a very good reason. I see many problems with the current day unions, but to eliminate the protection and voice unions have brought to us will be the downfall of the middle class. Its interesting that we are not hearing anything from the Tea Party on this. Its so hypocritical to be so down on taxes one day and turn your back the next. It goes to show the real purpose behind the TEA PARTY. Snyder says we need to focus on job creation ..... I find this hard to swallow. Are we to believe cutting education both primary and higher education will increase jobs? With our economy in shambles will decreasing social programs increase jobs? By taxing all seniors pensions ..... those who cannot go out and work to help themselves, will this increase jobs? By cutting state shared revenues which will result in less police and more crime, will this increase jobs? Mr. Snyder, our society must take care of its weak, the old, the disadvantaged. Do you have no heart?	{ "pile_set_name": "Pile-CC" }
Q: How to disable Warnings of Visual Studio 2012? I have this error: error C4996: 'fopen': This function or variable may be unsafe. Consider using fopen_s instead. To disable deprecation, use _CRT_SECURE_NO_WARNINGS. See online help for details. and similar errors pop up when I use other old C functions. My question is: Is there a way that these errors show up like Warnings, without actually preventing the code from compiling ? A: You must define _CRT_SECURE_NO_WARNINGS in the preprocessor settings of your project, or #define _CRT_SECURE_NO_WARNINGS at the beginning of your file where you use fopen(). Or just use fopen_s() instead.	{ "pile_set_name": "StackExchange" }
538 F.2d 332 Soft-Touch Saunasv.Anderson No. 75-1675 United States Court of Appeals, Eighth Circuit 4/1/76 1 D.Minn. AFFIRMED	{ "pile_set_name": "FreeLaw" }
After a careful review of the wholesale and retail gas trading and scheduling process it has been decided that the Gas Logistics teams should report directly into the Enron America's Commercial organization. This realignment will help to strengthen the commercial focus and communication between the trading desks and the schedulers and will play a critical role as Enron tries to maximize opportunities and maintain a competitive trading edge. The details are as follows: Wholesale Bob Superty will maintain his management of the Logistics support functions which include the Transport Rate team (Kim Olinger), Electronic Commerce team (Tammy Lee-Jaquet) and Regulatory Affairs teams (Suzanne Calcagno). In addition, Bob will now manage the Northeast Logistics team as part of the East desk. Bob will report directly to Scott Neal and will also help coordinate the Logistics function across all regions working closely with each of the regional Logistics Managers, Commercial desk heads and Enron Americas senior management team. Victor LaMadrid will manage the Southeast Logistics team and will report directly to Scott Neal. Victor's knowledge and overall east desk experience will be critical to help maximize east desk opportunities and promote new initiatives across all regions. Lisa Kinsey will manage the Central Logistics team and will report directly to Hunter Shively. Patti Sullivan will manage the West Logistics team and will report directly to Mike Grigsby. Darren Farmer will manage the Texas Logistics team and will report directly to Tom Martin George Smith will manage the Well Head Logistics team and will report directly to Fred Lagrasta. Retail Donna Greif will now report directly to Don Black. Each of the regional Logistics Managers (East - Marde Driscoll-Ernest, Central - Charlie Muzzy, West - Sabra Dinari) will continue to report directly to Donna. Donna will continue her ongoing efforts in the development and integration of the new retail trading systems, prior period adjustments and development of a strong and talented Logistics team. Congratulations to all involved and welcome to the commercial gas team - John Lavorato, President and CEO, Enron Americas. _____________________________________________________________________________________________________________________ Assistants - Please forward on to your groups.	{ "pile_set_name": "Enron Emails" }
CUTE LITTLE GIRLS by Mary K Mary says, "I saw the shape and it seemed like a face in the shape and the spikes looked like hair and the other part was the face." I say, the OTHER other part is a large helping of creativity and ability. Well done, Mary. The small red bit that looks like a ribbon in her hair is really part of Vice Principal Hoofenpoofer's desk. Someone has been mailing the desk back to Vice Principal Hoofepoofer, one ounce at a time. Mr. Hoofenpoofer asks that anyone who knows the whereabouts of the rest of his desk, please call him at1-800-BRING-MY-DANG-DESK-BACK.	{ "pile_set_name": "Pile-CC" }
%YAML:1.0 #-------------------------------------------------------------------------------------------- # Info / Statistics / Debug #-------------------------------------------------------------------------------------------- Stats.WriteKFsToFile: 1 #-------------------------------------------------------------------------------------------- # Timing Parameters - After every iteration, the respective model will sleept for x micro-secs #-------------------------------------------------------------------------------------------- Timing.LockSleep: 1000 # Client Timing.Client.RosRate: 1000 Timing.Client.ViewerRate: 1000 Timing.Client.MappingRate: 5000 Timing.Client.CommRate: 10000 # Server Timing.Server.RosRate: 1000 Timing.Server.ViewerRate: 1000 Timing.Server.MappingRate: 5000 Timing.Server.CommRate: 10000 Timing.Server.PlaceRecRate: 5000 #-------------------------------------------------------------------------------------------- # ORB Parameters #-------------------------------------------------------------------------------------------- # ORB Extractor: Number of features per image ORBextractor.nFeatures: 1000 # ORB Extractor: Scale factor between levels in the scale pyramid ORBextractor.scaleFactor: 1.2 # ORB Extractor: Number of levels in the scale pyramid ORBextractor.nLevels: 8 # ORB Extractor: Fast threshold # Image is divided in a grid. At each cell FAST are extracted imposing a minimum response. # Firstly we impose iniThFAST. If no corners are detected we impose a lower value minThFAST # You can lower these values if your images have low contrast ORBextractor.iniThFAST: 20 ORBextractor.minThFAST: 7 #-------------------------------------------------------------------------------------------- # Tracking Parameters #-------------------------------------------------------------------------------------------- Tracking.iInitKFs: 5 #if tracking gets lost before x KFs after initialization, tracking is reset # KF Creation Parameters Tracking.MinFrames: 0 Tracking.MaxFrames: 20 Tracking.nMatchesInliersThres: 15 Tracking.thRefRatio: 0.9 #Tracking.ScaleAfterKF: 20 # Tracking Functions Inlier Thresholds Tracking.TrackWithRefKfInlierThresSearch: 15 Tracking.TrackWithRefKfInlierThresOpt: 10 Tracking.TrackWithMotionModelInlierThresSearch: 20 Tracking.TrackWithMotionModelInlierThresOpt: 10 Tracking.TrackLocalMapInlierThres: 30 #-------------------------------------------------------------------------------------------- # Mapping Parameters #-------------------------------------------------------------------------------------------- Mapping.LocalMapSize: 50 Mapping.LocalMapBuffer: 20 Mapping.RecentKFWindow: 20 Mapping.RedThres: 0.98 #-------------------------------------------------------------------------------------------- # Communication Parameters #-------------------------------------------------------------------------------------------- # Parameters for message passing Comm.Client.PubFreq: 5.0 Comm.Client.KfItBound: 30 Comm.Client.MpItBound: 3000 Comm.Client.PubMaxKFs: 40 Comm.Client.PubMaxMPs: 2500 Comm.Server.PubFreq: 1.0 Comm.Server.KfsToClient: 5 # Maximum Number of KFs that can be processed per iteration of the communication module Comm.Server.KfItBound: 400 Comm.Server.MpItBound: 12000 # ROS Message Buffer Sizes Comm.Client.PubMapBuffer: 100 Comm.Client.SubMapBuffer: 100 Comm.Server.PubMapBuffer: 1000 Comm.Server.SubMapBuffer: 1000 #-------------------------------------------------------------------------------------------- # Place Recognition Parameters #-------------------------------------------------------------------------------------------- Placerec.NewLoopThres: 20 Placerec.StartMapMatchingAfterKf: 30 Placerec.CovisibilityConsistencyTh: 3 #-------------------------------------------------------------------------------------------- # Optimization Parameters #-------------------------------------------------------------------------------------------- Opt.SolverIterations: 5 Opt.MatchesThres: 20 Opt.InliersThres: 20 Opt.TotalMatchesThres: 40 Opt.Probability: 0.99 Opt.MinInliers: 6 Opt.MaxIterations: 300 Opt.GBAIterations: 20 Opt.EssGraphMinFeats: 100 #-------------------------------------------------------------------------------------------- # Viewer Parameters #-------------------------------------------------------------------------------------------- Viewer.Active: 1 Viewer.ShowCovGraph: 1 Viewer.ShowMapPoints: 1 Viewer.ShowTraj: 1 Viewer.ShowKFs: 0 # Display only edges with weight >= CovGraphMinFeats (only used for visualization) Viewer.CovGraphMinFeats: 100 Viewer.ScaleFactor: 20.0 # Line Diameters Viewer.TrajMarkerSize: 0.5 Viewer.CovGraphMarkerSize: 0.02 Viewer.LoopMarkerSize: 0.2 Viewer.MarkerSphereDiameter: 0.05 # Paramters for KF frusta Viewer.CamSize: 0.02 Viewer.CamLineSize: 0.01 Viewer.ColorR0: 1.0 Viewer.ColorG0: 1.0 Viewer.ColorB0: 1.0 Viewer.ColorR1: 0.0 Viewer.ColorG1: 0.8 Viewer.ColorB1: 0.0 Viewer.ColorR2: 0.0 Viewer.ColorG2: 0.0 Viewer.ColorB2: 1.0 Viewer.ColorR3: 0.6 Viewer.ColorG3: 0.0 Viewer.ColorB3: 0.6 # Covisibility Graph Color Viewer.ColorRcov: 0.6 Viewer.ColorGcov: 0.6 Viewer.ColorBcov: 0.6	{ "pile_set_name": "Github" }
2015 Women's EuroHockey Nations Championship squads This article displays the rosters for the teams competing at the 2015 Women's EuroHockey Nations Championship. Each team had to submit 18 players. Pool A Netherlands Head Coach: Sjoerd Marijne Belgium Head Coach: Pascal Kina Spain Head Coach: Adrian Lock Poland Head Coach: Krzysztof Rachwalski Pool B England Head Coach: Danny Kerry Germany Head Coach: Jamilon Mülders Scotland Head Coach: Gordon Shepherd Italy Head Coach: Fernando Ferrara References Category:Women's EuroHockey Nations Championship squads squads	{ "pile_set_name": "Wikipedia (en)" }
Characterization and amino-terminal sequence of apolipoprotein AI from plasma high density lipoproteins in the preruminant calf, Bos spp. The major apolipoprotein of calf plasma high-density lipoproteins, apo-AI, has been isolated and characterized. Apolipoprotein AI (apo-AI) was separated from the protein moiety of high-density lipoproteins (d 1.090-1.180 g/ml) by preparative electrophoresis in SDS-polyacrylamide gels followed by electrophoretic elution. Purified calf apo-AI had an Mr of approx. 27,000-28,000 in SDS-polyacrylamide gels, resembling human apo-AI. The amino acid composition of calf apo-AI displayed an overall similarity to that of its human and other mammalian counterparts (baboon, dog, badger, rabbit, rat and mouse), but differed in having higher proportions of glutamic acid, alanine and isoleucine. Amino-terminal amino acid sequence analysis up to the 47th residue showed close homology between calf apo-AI and those of the mammals with which it was compared. However, residues 2, 7, 20 and 22 in calf AI (i.e. aspartic acid, serine, glutamic acid and isoleucine, respectively) were substituted by glutamic acid, proline or glutamine, aspartic acid, and valine or leucine respectively, in the other mammals.	{ "pile_set_name": "PubMed Abstracts" }
Misasagi Station is a train station in Yamashina-ku ward, city of Kyoto, Kyoto Prefecture, Japan. Lines Kyoto Municipal Subway Tōzai Line (Station Number: T08) Keihan Electric Railway Keishin Line - Misasagi is the terminus of the line. Layout The station is a cross-platform interchange between the Tōzai Line and the Keihan Keishin Line, with two tracks and one island platform on both the second and third basement levels. The westbound platform (which is used for trains to Uzumasa Tenjingawa) is stacked above the eastbound platform (which is used for trains to Rokujizō and Hamaōtsu). 2nd basement 3rd basement History The station originally opened on 15 August 1912 as an at-grade railway station on the Keihan Keishin Line. On 12 October 1997, the at-grade station was replaced with an underground station when the first phase of the Tōzai Line opened. Adjacent stations References Category:Railway stations opened in 1997 Category:Railway stations in Kyoto Prefecture Category:Stations of Keihan Electric Railway	{ "pile_set_name": "Wikipedia (en)" }
Q: Area of overlap of two circular Gaussian functions I am trying to write code that finds the overlap of between 3D shapes. Each shape is defined by two intersecting normal distributions (one in the x direction, one in the y direction). Do you have any suggestions of existing code that addresses this question or functions that I can utilize to build this code? Most of my programming experience has been in R, but I am open to solutions in other languages as well. Thank you in advance for any suggestions and assistance! The longer research context on this question: I am studying the use of acoustic space by insects. I want to know whether randomly assembled groups of insects would have calls that are more or less similar than we observe in natural communities (a randomization test). To do so, I need to randomly select insect species and calculate the similarity between their calls. For each species, I have a mean and variance for two call characteristics that are approximately normally distributed. I would like to use these two call characteristics to build a 3D probability distribution for the species. I would then like to calculate the amount by which the PDF for one species overlaps with another. Please accept my apologies if the question is not clear or appropriate for this forum. A: I work in small molecule drug discovery, and I frequently use a program (ROCS, by OpenEye Scientific Software) based on algorithms that represent molecules as collections of spherical Gaussian functions and compute intersection volumes. You might look at the following references, as well as the ROCS documentation: (1) Grant and Pickup, J. Phys. Chem. 1995, 99, 3503-3510 (2) Grant, Gallardo, and Pickup, J. Comp. Chem. 1996, 17, 1653-1666	{ "pile_set_name": "StackExchange" }
Q: how to change width of without affecting width I have here 2 photos. 1 is my HTML page and the other one is my print page. My question is, how am I going to make my print page the same as my html page? As you can see, the print page is less wide than the HTML page. Also, I want to ask how am I going to make the width of <th> longer without affecting the width of <td>? Is that possible? Sorry, I don't have that much knowledge in CSS. Print Page HTML Page and here is my code: <table width="100%" border="1"> <tr> <th align="left" width="20%">II. Documentation</th> </tr> <tr> <td align="center">Subject Routine</td> <td width="20%" align="center">Person-in-charge</td> <td width="15%" align="center">Complied</td> <td width="10%" align="center">Date</td> <td width="17%" align="center">Remarks</td> <td align="center">Signature</td> </tr> <tr> <td>1. Travel Documents</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>2. National License</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>3. NAC Certificates/MARINA COP</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>4. Medical</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>5. POEA / AMOSUP Contracts</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>6. Flag License</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>7. US Visa</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>8. Joining Port Visa</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>9. Other Certificate</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> </table> A: To get a nice print page width use media queries for example: @media print { @page { margin: 30mm; size:297mm 210mm; } } Or use diffent stylesheets with different widths in stead of the same 100% <link href="style.css" rel="stylesheet" type="text/css" media="screen"> <link href="style_print.css" rel="stylesheet" type="text/css" media="print"> And in the style.css add: table {width:100%} And in style_print.css add: table {width:297mm} Play with the widths untill you are happy in both ;) Here are some great posts on how to set up CSS for printing: https://www.smashingmagazine.com/2011/11/how-to-set-up-a-print-style-sheet/ https://www.smashingmagazine.com/2015/01/designing-for-print-with-css/ Just add colspan="6" to your th to set the correct width of your first cell. <table width="100%" border="1"> <tr> <th colspan="6" align="left" width="20%">II. Documentation</th> </tr> <tr> <td align="center">Subject Routine</td> <td width="20%" align="center">Person-in-charge</td> <td width="15%" align="center">Complied</td> <td width="10%" align="center">Date</td> <td width="17%" align="center">Remarks</td> <td align="center">Signature</td> </tr> <tr> <td>1. Travel Documents</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>2. National License</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>3. NAC Certificates/MARINA COP</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>4. Medical</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>5. POEA / AMOSUP Contracts</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>6. Flag License</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>7. US Visa</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>8. Joining Port Visa</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> <tr> <td>9. Other Certificate</td> <td></td> <td></td> <td></td> <td></td> <td></td> </tr> </table>	{ "pile_set_name": "StackExchange" }
Top abraham hicks Secrets Top abraham hicks Secrets Though a pretense of friendliness is preserved (and predicted) among works associates, it's pretense; the norm is for individuals to speak negatively about each other; and Competitiveness rather than assist is the status quo. that's the infinite intelligence, provides a further and broader point of view on points that could be quite enlightening. Abraham, who describe by themselves as “a group consciousness through the non-physical dimension,” are acknowledged as amongst the initial resources from the teachings with the “The Legislation Of Attraction” concepts And just how we are the creators of our own fact. Perception in the strength of belief continues to be an attractive message for a lot of folks for many hundreds of a long time, Regardless that the evidence to guidance the notion that believing anything will make it so is somewhat deceptive. The majority of the supportive proof is anecdotal, but a minimal acquaintance with genetics need to arouse a nutritious skepticism about the power of controlling thoughts, temper, and disposition by will energy. The proof from science supports a minimal influence through the placebo impact and nocebo influence. Correct scientific assessments of the power of perception to cure significant health problems, nevertheless, are universally negative. They arrived on board and video taped Esther and Jerry all through their seminar and ended up environment a interview by using a eco-friendly screen of Abraham Hicks. Here's Abraham answering a visitor’s questions concerning what transpired and why did it occur that she wasn’t during the movie? Within just 24 several hours of resigning, I felt an immense pressure lift, and we are really pleased creating for every our have technical specs. Most effective regards, Individuals who assert that some exams have proven a optimistic healing impact from prayer, visualization, website or good pondering are inspired a lot more by desire to believe than by the actual evidence. The same is true for scientific tests of the flexibility of people to affect something Bodily employing only considered.* (See, particularly, my entries to the operate completed by Robert Jahn at Princeton as well as get the job done by Roger Nelson.) The research pertaining to staying joyful and here creative imagination, on the other hand, would seem to not assistance the Hickses' claims. Now, because Jerry's Demise (Abraham would say croaking) in 2011, several have questioned what failing on the Regulation of Attraction would allow such a matter to occur, when Jerry, who has been studying this stuff a lot more intently than any individual else for over twenty five a long time could succumb to cancer Even so. In my previous, I've prepared many tales and I wrote them precisely the same way - by 'computerized producing', without a prepare or an idea. It had been my subconscious Talking. Clearly, the scales experienced tipped. Our personalized evolution brought us to the fork from the road, and we found out our priorities had shifted along with our established points. It now not seemed applicable to stand loyally by Jerry and Esther irrespective of their habits; rather it felt like it had been time to face loyally by our values. Other folks said that they had problems While using the upload but I'd no difficulty in the least. I've mediated far more persistently now this application is in my phone. Complete Critique A Google Person June 10, 2011 It’s Thanksgiving time and our (mine and Jerry’s) most beloved time from the calendar year. I pulled out my recipe e-book for pumpkin bread And that i swear I could smell it cooking even though I had been earning my listing of matters for getting within the supermarket to really make it. “Esther is emotionally risky and quick to blame. Because of this, the Business office lifestyle was arrange to point the finger of blame in the direction of someone else, and everyone scurried for cover when Esther bought upset, hoping no ill will fell in the direction of them. Jerry is mistrustful and controlling; he’s not a single to have brazenly upset, but he carries a grudge for months at any given time.” I've labored for Executives and Managers who had been emotionally unstable. I've also worked for numerous corporations over time were being the office culture was setup to stage the finger of blame in direction of Other folks.	{ "pile_set_name": "Pile-CC" }
1. Introduction =============== The occurrence and undesirable complications from healthcare-associated infections have been well recognized in the literature for the last several decades \[[@B1-ijerph-09-03330]\]. The most common sources of infectious agents causing healthcare associated infections, described in a scientific review of 1,022 outbreak investigations \[[@B2-ijerph-09-03330]\] are (listed in decreasing frequency): the individual patient, medical equipment or devices, the hospital environment, the healthcare personnel, contaminated drugs, contaminated food, and contaminated patient care equipment. Although the person-to-person transmission route is the most likely, the role of the environment should not be ignored and hospital linen may contribute to the spread of nosocomial infections \[[@B3-ijerph-09-03330],[@B4-ijerph-09-03330]\]. Healthcare textiles include bed sheets, blankets, towels, personal clothing, patient apparel, uniforms, gowns, drapes for surgical procedures \[[@B5-ijerph-09-03330]\]. Contaminated textiles and fabrics often contain high numbers of microorganisms from body substances, including blood, skin, stool, urine, vomitus, and other body tissues and fluids. Although contaminated textiles in healthcare facilities can be a source of substantial numbers of pathogenic microorganisms, reports of healthcare associated diseases linked to contaminated fabrics are few, therefore the overall risk of disease transmission is very low \[[@B5-ijerph-09-03330]\]. Cleaning in general has two main functions: first: non-microbiological, to improve or restore appearance, and prevent deterioration. Second, microbiological, to reduce the numbers of microbes present, together with any substances that support their growth or interfere with disinfection \[[@B4-ijerph-09-03330]\]. The purpose of laundering hospital textiles is therefore to ensure clean and safe textiles for patients and staff and thus enable uninterrupted implementation of healthcare \[[@B5-ijerph-09-03330],[@B6-ijerph-09-03330]\]. The most common found microorganisms on hospital textiles are: Gram negative bacteria, coagulase negative staphylococci, Bacillus sp. and typical skin flora \[[@B7-ijerph-09-03330]\]. Most people working in hospitals assume that laundry returned to them is in fact clean and therefore safe. Laundry may certainly have had the dirt removed, but it is far from sterile and experience encourages infection control teams to take laundering very seriously in outbreaks that seem to have no obvious cause \[[@B8-ijerph-09-03330]\]. 2. Reports on the Survival of Microorganisms on Hospital Textiles after Laundering ================================================================================== Literature in the field of survival of microorganisms on hospital textiles after laundering is very diverse and perhaps even confusing and contradictory. Each publication states a different laundering temperature as appropriate. It is therefore important to note that a successful laundering procedure is dependent on several factors and each much be optimized. These factors with a possible synergistic effect include: duration of laundering procedure, mechanical action of laundering procedure, dosage and type of added detergents and disinfection agents, bath ratio, type of linen, filling ratio, etc. According to Sinner the four basic interconnected factors of the laundering procedure are: duration, mechanical action, chemicals and temperature \[[@B9-ijerph-09-03330]\]. If one of these factors is decreased such as for example temperature, then other factors such as chemicals, mechanical action or time must be increased to achieve the same laundering and disinfecting effect. This also explains the differences in the published efficient laundering conditions. The exact correct optimized combination of all the mentioned factors is therefore important in order to achieve a hygienic laundering procedure for hospital textiles. Wilcox and Jones \[[@B10-ijerph-09-03330]\] stated that many isolates of Enterococcus faecium survived exposure to laundering temperatures specified in the U.K. Department of Health guidelines for disinfecting foul and used and infected linen (60 °C for 10 min). Another published report by Orr and co-workers \[[@B11-ijerph-09-03330]\] even confirms survival of certain strains of enterococci at laundering temperatures as high as 71 °C. They therefore concluded that hospital linen is a possible source of enterococcal cross-infection. The survival of enterococci on textiles at laundering temperatures as high as 60 °C was also confirmed by a study \[[@B12-ijerph-09-03330]\] where biomonitors (Enterococcus faecium inoculated onto textile swatches with pre-inoculated defibrinated sheep blood) were washed in a simulated common hospital laundry procedure. It was found that Enterococcus faecium, as well as Staphylococcus aureus, Enterobacter aerogenes and Pseudomonas aeruginosa all survived the chosen laundering conditions at 60 °C, but none of the challenge organisms survived laundering at 75 °C. On the other hand other studies \[[@B13-ijerph-09-03330],[@B14-ijerph-09-03330]\] confirm that optimizing the laundering procedure including using high-tech environmental detergents and innovative disinfection agents renders an appropriate disinfection effect, even at laundering temperatures as low as 30 °C as noted in the study \[[@B13-ijerph-09-03330]\] with challenge organisms Enterococcus faecium and Enterobacter aerogenes. In another study \[[@B14-ijerph-09-03330]\] the optimum laundering temperature was found to be at 40 °C. Walter and co-workers \[[@B15-ijerph-09-03330]\] reported that Staphylococcus aureus survived a 10 min laundering at 54 °C followed by drying. Klebsiella pneumoniae also survived the same laundering procedure, but did not survive the drying procedure. The same research also indicated that the challenge bacteria Staphylococcus aureus was not found after a 60 °C laundering procedure; thus recommending a 60 °C laundering procedure for linen in healthcare facilities. In the report by Smith and co-workers \[[@B16-ijerph-09-03330]\] it was found that soiled hospital terry towels initially contaminated with Gram-positive rods (predominantly Klebsiella, Enterobacter and Serratia spp.) and Gram-positive bacteria (predominantly Staphylococci) in the range between 10^7^ to 10^9^/100 cm^2^ were washed in different laundering procedures. It was found that the washing cycle with a temperature of 60 °C followed by the drying cycle at 93.3 °C was sufficient to maintain linen hygiene. Christian and co-workers \[[@B17-ijerph-09-03330]\] also conducted experimental research on low temperature laundering of hospital textiles using economically reasonable chemicals and wash conditions. They examined the disinfection effect of laundering procedures against aerobic chemoorganotrophs, staphylococci and total coliforms. They found that low temperature washing procedures (47.8 °C) using increased concentrations of bleach eliminated all bacterial groups as effectively as the high temperature procedures (77 °C). In the research by Blaser and co-workers \[[@B7-ijerph-09-03330]\] a comparison of laundering procedures at 71.1 °C and 22 °C was conducted. The argument of such low-temperature washing was the vast amount of energy used for laundering at 71.1 °C. The 22 °C laundering procedure included the use of low-temperature chemicals. The initial counts on the use soiled terry towels and sheet were between 10^6^ to 10^8^/100 cm^2^ with predominantly Gram-negative rods (especially Enterobacteriaceae and Pseudomonadaceae) and Staphylococcus species as the most common Gram-positive organisms. It was found that the bacterial counts from low-temperature and high-temperature washed fabrics were comparable. The authors therefore concluded that low-temperature washing for eliminating pathogenic bacteria from hospital laundry is as effective as high-temperature laundering. It has been reported that Clostridium difficile \[[@B18-ijerph-09-03330]\] spores can survive temperatures and chemical treatment of typical hospital laundering cycles and that cross-contamination of Clostridium difficile spores can occur on bed linen during a wash cycle. Therefore the persistent nature of this organism must be considered by infection control personnel when implementing programs for laundering soiled and contaminated hospital linen. Articles reporting on the survival of microorganisms on hospital textiles after laundering, together with their main conclusions are summarized in [Table 1](#ijerph-09-03330-t001){ref-type="table"}. ijerph-09-03330-t001_Table 1 ###### Reports on the survival of microorganisms on hospital textiles after laundering. Described laundering conditions Added disinfection agent or bleach Surviving microorganism Reference ---------------------------------------- -------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------- ----------------------------------------------------- 10 min at 60 °C No Enterococcus faecium Wilcox & Jones, 1995 \[[@B10-ijerph-09-03330]\] 10 min at 60 °C or 3 min at 71 °C No Certain strains of Enterococcus faecalis and Enterococcus faecium Orr et al. 2002 \[[@B11-ijerph-09-03330]\] less than 10 min at 60 °C 3 mL Peroxyacetic acid/ kg textiles Enterococcus faecium, Staphylococcus aureus, Pseudomonas aeruginosa and Enterobacter aerogenes Fijan et al. 2007 \[[@B12-ijerph-09-03330]\] 20 min at 30 °C 10 mL Sodium hypochlorate/kg textiles or 12.5 mL peroxyacetic acid/kg textiles Enterococcus faecium and Enterobacter aerogenes Fijan et al. 2010 \[[@B13-ijerph-09-03330]\] 43 min at 30 °C 10 mL Sodium hypochlorate/kg textiles Enterococcus faecium 13 min at 49 °C Added chlorine bleach (without specifications) Staphylococcus aureus and Klebsiella pneumoniae Walter et al. 1975 \[[@B15-ijerph-09-03330]\] 66 °C Added chlorine bleach cycle (without specifications) Staphylococci, Klebsiella, and Enterobacter species Smith et al. 1987 \[[@B16-ijerph-09-03330]\] 8 min at 47.8 °C 0.58 Chlorine bleach/kg Predominantly aerobic bacteria, staphylococci and total coliforms Christian et al. 1983 \[[@B17-ijerph-09-03330]\] 77.2 °C 0.11 Chlorine bleach/kg 22.2 °C Low temperature bleach (without specifications) Predominantly Enterobacteriaceae, Pseudomonadaceae and Staphylococcus species Blaser et al. 1984 \[[@B7-ijerph-09-03330]\] 71.1 °C High temperature bleach (without specifications) Typical program for hospital bed linen 50 ppm Chlorine, 54 ppm peracid, 100 ppm peroxid Clostridium difficile spores Hellickson & Owens, 2007 \[[@B18-ijerph-09-03330]\] 3. Reports on the Presence of Microorganisms on Hospital Textiles ================================================================= [Table 2](#ijerph-09-03330-t002){ref-type="table"} summarizes reports of articles on the presence of microorganisms on hospital textiles. ijerph-09-03330-t002_Table 2 ###### Reports on the presence of microorganisms on hospital textiles. Surviving microorganism Hospital textile Time Reference --------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------ ---------------------------------------- ------------------------------------------------------- Moulds Sheets, pyjamas After use by patients Bureau-Chalot et al. 2004 \[[@B3-ijerph-09-03330]\] Coagulase-negative staphylococci, Bacillus spp., Corynebacterium spp., saprophytic Gram negative bacilli Sheets, pyjamas, uniforms After laundering in hospital laundry Fijan et al. 2005 \[[@B6-ijerph-09-03330]\] Staphylococcus aureus, Clostridium difficile and vancomycin resistant enterococci Nurses' uniforms After 24 h shift Perry et al. 2001 \[[@B19-ijerph-09-03330]\] Acinetobacter baumannii Bed linen and curtains After use Hota et al. 2004 \[[@B20-ijerph-09-03330]\] MRSA Bed linen and uniforms Coagulase negative Staphylococci, Corynebacterium spp., Micrococcus spp., Bacillus spp., Enterococcus spp., saprophytic Gram negative bacilli, moulds Sheets, pyjamas and uniforms After laundering in hospital laundries Fijan et al. 2005 \[[@B21-ijerph-09-03330]\] Rotaviral RNA Sheets, pyjamas and uniforms After laundering in hospital laundries Fijan et al. 2008 \[[@B22-ijerph-09-03330]\] Parainfluenza virus Hospital gown 4 h after inoculation Brady et al. 1990 \[[@B23-ijerph-09-03330]\] Vancomycin resistant enterococci Bed linen 11 weeks after inoculation Hochmuth et al. 2005 \[[@B24-ijerph-09-03330]\] The report by Brady \[[@B23-ijerph-09-03330]\] indicates that the parainfluenza virus can survive 4 h on clothing; thus suggesting the need to consider fomites as a possible source of transmission of the virus. In the report by Perry and co-workers \[[@B19-ijerph-09-03330]\] microbiological sampling of nurses' uniforms yielded the detection of Staphylococcus aureus, Clostridium difficile and vancomycin-resistant enterococci (VRE) before and after the span of duty. The authors recommended provision and frequent changing of nurses' uniforms. The report by Hochmuth and co-workers \[[@B24-ijerph-09-03330]\] noted that VRE strains can survive for 11 weeks on linen and plastic with a 4 log cfu reduction after 7 weeks. They concluded that VRE can survive for prolonged periods on inanimate surfaces that are frequently encountered in a healthcare setting and that the proper disinfection of these surfaces is important in the prevention of nosocomial transmission of VRE. In the report by Bureau-Chalot and co-workers \[[@B3-ijerph-09-03330]\] over 200 samples of hospital linen (sheets, pyjamas) as well as linen rooms and trolleys for transporting linen were collected. The most common found microorganisms were of human origin (coagulase-negative staphylococci) and of environmental origin (Bacillus spp., moulds). It was found that clean linen can become a vector for transmission of pathogens or that pathogens present on linen may become airborne during bed-making and may then contaminate surfaces. The report by Hota \[[@B20-ijerph-09-03330]\] also reviews the presence of microorganisms on hospital textiles. In her survey of the literature Acinetobacter baumannii was found on bed linen and curtains, as well as other parts of the surrounding inanimate environment \[[@B25-ijerph-09-03330]\], MRSA was found on uniforms worn by health workers and on bed linen \[[@B26-ijerph-09-03330],[@B27-ijerph-09-03330]\]. Other environmental sites that included VRE were gowns worn by patients and health workers \[[@B28-ijerph-09-03330]\]. There are several published articles which show results of investigating the microbial counts of laundered hospital linen using contact plates with RODAC agar and swabbing over period of 5 years between 2004 and 2008 \[[@B6-ijerph-09-03330],[@B21-ijerph-09-03330],[@B22-ijerph-09-03330]\]. The following microorganisms at various occasions were found in hospital laundries on cleaned, folded laundry prepared for reuse: coagulase negative Staphylococci, Corynebacterium spp., Micrococcus spp., Bacillus spp., non-fermentative Gram negative bacilli, Enterococcus spp., saprophytic Gram negative bacilli, moulds and rotaviral RNA. Although the results seem alarming, after the initial microbiological-sanitary surveillance, all laundries underwent systematic sanitary measures and the results of microbial investigations yielded very low counts on the clean and folded hospital textiles. 4. Reports of Microorganisms from Hospital Textiles as a Possible Source of Infection of Patients ================================================================================================= Reports on hospital textiles as possible source of infection of patients are summarized in [Table 3](#ijerph-09-03330-t003){ref-type="table"}. ijerph-09-03330-t003_Table 3 ###### Reports on hospital textiles as possible source of infection of patients. Microorganism Hospital textile Reference --------------------------------------- --------------------------------------------------- ------------------------------------------------------ Streptococcus pyogenes Babies' vests (contamination of dryers) Brunton, 1995 \[[@B8-ijerph-09-03330]\] Bacillus cereus Cleaned hospital linen Barrie et al. 1994 \[[@B29-ijerph-09-03330]\] Cleaned hospital linen Barrie et al. 1992 \[[@B30-ijerph-09-03330]\] Cleaned infants' nappies Birch et al. 1981 \[[@B31-ijerph-09-03330]\] Reused towels Dohmae et al. 2008 \[[@B32-ijerph-09-03330]\] Towels and bedsheets Sasahara et al. 2011 \[[@B33-ijerph-09-03330]\] MRSA Bed linen Creamer & Humphreys, 2008 \[[@B34-ijerph-09-03330]\] Linen Shiomori et al. 2002 \[[@B35-ijerph-09-03330]\] Pseudomonas aeruginosa Patients' clothes, bed linen Panagea et al. 2005 \[[@B36-ijerph-09-03330]\] VRE Drawsheet Bonten et al. 1996 \[[@B37-ijerph-09-03330]\] Staphylococcus aureus Mattress Ndawula & Brown, 1991 \[[@B38-ijerph-09-03330]\] Antibiotic resistant coliform bacilli Blankets, mattresses Kirby et al. 1956 \[[@B39-ijerph-09-03330]\] Trichophyton interdigitale Contaminated socks English et al. 1967 \[[@B40-ijerph-09-03330]\] An extensive investigation \[[@B8-ijerph-09-03330]\] of what seemed to be a recurring outbreak of streptococcal infection associated with a maternity unit was conducted. On each occasion, extensive environmental and epidemiological investigations were carried out, which indicated that babies were being infected very shortly after birth. The infection team decided to look at the laundering of the vests usually given to new-born children. Investigation of the laundry and in particular the hot air dryers, revealed extensive contamination with the MT type of Streptococcus pyogenes involved in the outbreak. After all babies' vests had been autoclaved the outbreaks ceased. An investigation into two cases of post-operative Bacillus cereus meningitis \[[@B29-ijerph-09-03330],[@B30-ijerph-09-03330]\] revealed that hospital linen laundered by a batch continuous washing machine was heavily contaminated by Bacillus cereus spores. It was found that the linen introduced into the washing machine had a high Bacillus cereus spore content and that this was still present after the wash process. In a maternity unit 44% of umbilical swabs from neonates contained an unusual serotype of Bacillus cereus \[[@B31-ijerph-09-03330]\]. On further investigation the same serotype could be isolated from air samples, the hands of members of staff and 'clean' nappies from the hospital laundry. It was found that the nappies appeared to be the primary vehicle of Bacillus cereus dissemination among the infants. Creamer and Humphreys \[[@B34-ijerph-09-03330]\] emphasized that bed linen can rapidly become heavily contaminated with colonised skin scales and may contribute to the spread of infections. They also stated that precautions such as changing of linen after discharge, using national or standard laundering procedures, storage of clean linen in clean linen storage presses, clean trolleys, etc. are sufficient. In their literature survey they found MRSA \[[@B35-ijerph-09-03330]\], Pseudomonas aeruginosa \[[@B36-ijerph-09-03330]\], VRE \[[@B37-ijerph-09-03330]\] to have been associated with the spread of pathogens by bed linen as one of the possible environmental routes. Ndawula and Brown \[[@B38-ijerph-09-03330]\] found mattresses were reservoirs of epidemic methicillin-resistant Staphylococcus aureus. In a study \[[@B39-ijerph-09-03330]\] of the cause of urinary tract infections the authors were unable to determine the source of the resistant bacteria and the exact mode of infection; the catheters themselves, and the solutions used to irrigate them, could not be incriminated. Blankets, mattresses, and possibly the nasopharyngeal flora of hospital personnel appeared more likely possibilities. Several Bacillus cereus nosocomial infections in Japan were investigated \[[@B32-ijerph-09-03330]\] and novel multilocus sequence types were found in patients. After eliminating food-poisoning as a causative agent it was found that the similar strains were found on dried and streamed reused towels and that towels represent an important source of contamination. In the investigation of a Bacillus cereus bacteremia outbreak \[[@B33-ijerph-09-03330]\] it was found that hospital linens and the washing machine were highly contaminated with B. cereus, which was also isolated from the intravenous fluid of symptomatic patients. All of the contaminated linens were autoclaved, the washing machine was cleaned with a detergent, and improved hand hygiene was promoted among the hospital staff. The number of patients per month that developed new B. cereus bacteremia rapidly decreased after implementing these measures. The source of this outbreak was identified as B. cereus contamination of hospital linens, and B. cereus was being transmitted from the linens to patients via catheter infection. The authors concluded that their findings demonstrated that bacterial contamination of hospital linens can cause nosocomial bacteremia. In a study of a significantly higher incidence of Trichophyton rubrum along with a common incidence of Trichophyton interdigitale in a long-stay hospital for mentally retarded men it was found that a significant number of crippled patients who had never walked acquired tinea pedis \[[@B40-ijerph-09-03330]\]. The appropriate fungus was isolated before laundering from the worn socks of three patients with T. interdigitale infection and of one patient with T. rubrum infection. After laundering the fungus was recovered from the socks of one of the patients with T. interdigitale infection. In view of the failure of laundering to eliminate the fungus from worn socks, it was suggested that infected socks were the most important route of cross-infection among the crippled patients. All these research publications emphasise that correct laundering procedures of hospital textiles are an important measure for preventing health-acquired infections especially when other more common sources of infections have been ruled out \[[@B8-ijerph-09-03330]\]. 5. Reports on Microorganisms on Textiles as a Cause for Nosocomial Infections of Hospital Workers ================================================================================================= Reports on hospital textiles as possible source of infection of hospital workers are summarized in [Table 4](#ijerph-09-03330-t004){ref-type="table"}. ijerph-09-03330-t004_Table 4 ###### Reports on hospital textiles as possible source of infection of hospital workers. Microorganism Source Employee Reference ----------------------------------------- ---------------------------------- --------------------------------------------- ---------------------------------------------------- Sarcoptes scabiei Handling unclean hospital linen Hospital laundry personnel Thomas et al. 1987 \[[@B41-ijerph-09-03330]\] Microsporum canis Handling contaminated laundry Hospital staff Shah et al. 1988 \[[@B42-ijerph-09-03330]\] Salmonella typhimurium Handling unclean hospital sheets Hospital laundry personnel Datta & Pridie, 1960 \[[@B43-ijerph-09-03330]\] Salmonella hadar Handling unclean hospital linen Hospital laundry personnel Standaert et al. 1994 \[[@B44-ijerph-09-03330]\] Hepatitis A virus Handling unclean hospital linen Hospital laundry personnel and nurses' aids Borg & Portelli, 1999 \[[@B45-ijerph-09-03330]\] Keeffe, 2004 \[[@B46-ijerph-09-03330]\] Wilson and co-workers \[[@B47-ijerph-09-03330]\] did not find any evidence to support the hypothesis that uniforms could be a vehicle for the transmission of infections as no studies demonstrated the transfer of microorganisms from uniforms to patients in a clinical situation. They state however that there is an epidemiological link between contaminated clothing and healthcare associated infection when clothing is highly contaminated in an industrial laundry. In an outbreak of scabies among the employees of a hospital laundry \[[@B41-ijerph-09-03330]\] it was found that the most probable cause of this outbreak was transmission via unclean hospital bed linen. During the time compatible with the outbreak a patient with Norwegian scabies was hospitalized. It was concluded that improper handling of the dirty laundry by laundry workers (alleged lack of use of protective gloves) led to the outbreak among the laundry workers. Shah and co-workers \[[@B42-ijerph-09-03330]\] reported of an unusual nosocomial outbreak among staff and patient infected with Microsporum canis. It was established that likely modes of subsequent disease transmission from a single infected patient included person-to-person contact and handling of contaminated laundry. In an outbreak of infection with Salmonella typhimurium \[[@B43-ijerph-09-03330]\] in a general hospital extensive research was conducted to find the source of transmission. There was no evidence of food poisoning and it was found that several laundry workers who handled sheets from infected persons were excreting S. typhimurium. These laundry workers did not have any direct contact with infected patients. Therefore handling dirty laundry was the most likely cause of infection among these laundry workers. The same conclusion was reached by Standaert and co-workers \[[@B44-ijerph-09-03330]\], who investigated an extensive outbreak of salmonella gastroenteritis in a nursing home among residents as well as employees (nurses and laundry personnel). Three laundry personnel who had no contact with residents were infected. Due to the delayed onset of symptoms of these laundry personnel; a secondary transmission was suggested. It was concluded that linen soiled with faeces was the source of nosocomial Salmonella hadar infection among the laundry workers. It was found that most of these laundry personnel did not use protective clothing and gloves when handling dirty and infected laundry. The authors stressed the importance of using appropriate precautions when handling dirty linen. Borg and Portelli \[[@B45-ijerph-09-03330]\] investigated laundry personnel and nursing aids in pediatric and infectious disease wards for seropositivity to hepatitis A. It was found that the ratio for seropositivity to hepatitis A between laundry personnel consistently handling dirty linen as compared with colleagues handling only clean items was 16.5. The authors concluded that the increased exposure of hospital laundry workers to potentially infected linen can constitute a risk of occupational hepatitis A for this group of employees. Keeffe \[[@B46-ijerph-09-03330]\] also listed laundry workers as one of the at-risk occupations for a hepatitis A infection. Oliphant and co-workers \[[@B48-ijerph-09-03330]\] also investigated an outbreak of Q fever among laundry workers handling material from a laboratory and found that it was presumably transmitted from contaminated clothing. From all these publications it is obvious that it is necessary to implement infection control practices including proper handling of dirty linen by laundry workers in order to prevent possible health-acquired infections \[[@B49-ijerph-09-03330],[@B50-ijerph-09-03330]\]. Although soiled linen may contain large numbers of pathogenic microorganisms, the risk of actual disease transmission is very low and hygienic and common-sense storage and processing of clean and soiled linen are recommended \[[@B51-ijerph-09-03330]\]. 6. Discussion and Conclusions ============================= Healthcare institutes are obligated to ensure all necessary measures to prevent or limit the spread of healthcare associated infections. One of the possible vehicles of transmission is inanimate fomites such as textiles. When textiles are heavily contaminated with potentially infective body substances, they can contain bacterial loads of 10^6^ to 10^8^ cfu/100 cm^2^ of fabric. However, the incidence of healthcare associated infections transmitted from hospital linen is very low especially when evaluated in the context of the volume of items laundered in healthcare settings (estimated to be five billion pounds annually in the United States) \[[@B5-ijerph-09-03330]\]. It is obvious that the various existing control measures for hospital laundry are effective in reducing the risk of disease transmission to patients and staff. Therefore, use of current control measures should be continued to minimize the contribution of contaminated laundry to the incidence of healthcare associated infections. These control measures are based on principles of hygiene, common sense, and consensus guidance. According to the Slovenian Public Gazette \[[@B52-ijerph-09-03330]\] the correct hygienic management of hospital textiles is achieved by minimal technical requirements regarding sorting, transport and laundering textiles. These requirements according to the Slovenian Expert background and guidelines for management and prevention of health-associated infections include \[[@B53-ijerph-09-03330]\] the following measures: 1. Correct collecting and sorting of contaminated hospital textiles; 2. Correct transporting of contaminated hospital textiles; 3. Correct division of clean and unclean area in laundry; 4. Correct sorting, laundering, drying and ironing of hospital textiles; 5. Correct transport and storage of clean hospital textiles. Very similar conditions are defined in the U.S. Recommendations of C.D.C. and Healthcare Infection control practices Advisory Committee \[[@B5-ijerph-09-03330]\], the USA APIC text of infection control and epidemiology \[[@B54-ijerph-09-03330]\] as well as the standard EN 14065 RABC: Risk Analysis and Biocontamination Control System for textiles in Europe \[[@B55-ijerph-09-03330]\]. These conditions are also implemented in the German Quality and Hygiene assurance for hospital textiles RAL-GZ 992 \[[@B56-ijerph-09-03330]\]. The RABC standard and the RAL-GZ 992/2 quality and hygiene assurance are valid as a system of quality hygiene assurance for hospital textiles in Slovenia. Experience has been shown that proper implementing of any of these chosen Guidelines results in clean and properly disinfected linen in healthcare facilities. The key elements in the laundering process according to the APIC text \[[@B54-ijerph-09-03330]\], supported by the U.S. C.D.C. \[[@B5-ijerph-09-03330]\], include water temperature, type of detergents, disinfectant, rinsing and finishing as well as supplementing the process with common sense and hygienic approaches to collection and transport. According to the C.D.C. guidelines \[[@B5-ijerph-09-03330]\] it is also important to acknowledge that hospital textiles (especially high tough surfaces such as bed linen and pajamas) should not only be appropriately cleaned, but also disinfected and in certain cases (such as surgical drapes and reusable gowns, and in some cases linens in neonatal intensive care units as well as linens in burn therapy units) even sterilization of textiles is necessary \[[@B5-ijerph-09-03330]\]. In the future more research should be conducted in the area of the adherence of microorganisms onto textiles and the likelihood of shedding from the textiles during use thus making them airborne. Another important theme for future research is to study the infectivity of microorganisms after being adhered onto textiles for certain periods of time. This information would give more insight in the transfer of microorganisms from textiles to patients in a clinical situation. Another important future focus is using particles with antimicrobial activity for textile modification in order to enhance antimicrobial properties of medical textiles without adding antimicrobial agents into textiles which can have possible harmful or toxic effects \[[@B57-ijerph-09-03330]\].	{ "pile_set_name": "PubMed Central" }
Extremely low warfarin dose in patients with genotypes of CYP2C93/3 and VKORC1-1639A/A. Patients with the genotypes of both CYP2C93/3 and VKORC1-1639 A/A are expected to require the lowest dose of warfarin, and to have a greatly increased risk of bleeding. The experience for the dosing of warfarin in such extremely rare cases has been seldom reported. Demographic and clinical data from two cases with stable low dose of warfarin in China were studied by resequencing the corresponding gene segments in their whole blood DNA. The potential clinical value of the pharmacogenetic algorithm for them was evaluated by calculating the stable dose of warfarin in pharmacogenetic algorithm developed by International Warfarin Pharmacogenetics Consortium. Both cases (68-year-old female and 50-year-old male) were diagnosed as chronic nonvalvular atrial fibrillation needing warfarin treatment, with target international normalized ratio (INR) 2 to 3. Case 1 had stable warfarin dose of 0.625 mg/d and case 2 1.25 mg/d. They needed more than 1 month to stabilize their anticoagulation. Exceeding INR values were recorded for them when the dose of warfarin was no more than 2 mg/d. Hemorrhagic complication appeared in case 1 when the dose was titrated from 2.5 to 1.25 mg/d. No concomitant medicine to increase or decrease the INR value was recorded for them. Genotyping CYP2C9 and VKORC1 showed both patients were the carriers of the homozygous alleles -CYP2C93/3 and VKORC1-1639 A/A. Their stable doses of warfarin calculated by the pharmacogenetic dose algorithm (0.672 mg/d for case 1 and 1.16 mg/d for case 2) were comparable with their actual stable therapeutic doses. Two Chinese with the rare genotypes of both CYP2C93/3 and VKORC1-1639 A/A were found to require the extremely low dose of warfarin. The pharmacogenetic algorithm incorporating the variances of VKORC1 and CYP2C9 genotypes, as well as the non-genetic factors could predict their stable dose of warfarin with high accuracy.	{ "pile_set_name": "PubMed Abstracts" }
I’m really looking forward to seeing their writeup of the Clan of Death by Matthew Dawkins in Cults of the Blood. Knowing that’s coming out has me excited. I’m also eager to see what they do with the Baali - infernalism is what all the cool kids are doing, and maybe it’s the forbidden fruit appeal of something that literally no chronicle allows but I’ve always been fascinated by the Baali. @enejaner Heard it from the horse’s mouth himself at a convention - he’s doing the write-up, and it will include its different manifestations also, so we ought to be getting Samedi and Harbingers in addition to Giovanni. @enejaner Heard it from the horse’s mouth himself at a convention - he’s doing the write-up, and it will include its different manifestations also, so we ought to be getting Samedi and Harbingers in addition to Giovanni.	{ "pile_set_name": "Pile-CC" }
Tissue engineering approaches for osteoarthritis. With the ageing of the population and the major advances in targeted drug treatments, there is in medicine a shift in attention from survival towards quality of life. Therefore new challenges are emerging in modern health care. Preventive and personalized medicine have been identified as key steps in this context. New targeted biologicals for musculoskeletal diseases such as chronic arthritis have entered daily clinical practice, thereby not only controlling symptoms and signs, inflammation and destruction, but also maintaining function of the joints. The last aspect is essential for the independence of the individual and critical for the quality of life. Since the lifespan of prosthetic devices will always remain limited, new treatment approaches to repair skeletal structures need to be devised for the young and middle aged individuals with skeletal and joint damage caused by either congenital, traumatic, or inflammatory conditions. It is believed that regenerative medicine and more specifically tissue engineering may fill this void to some extent. Indeed, recent cellular therapeutics and combination products, now resorting under a new regulatory class of Advanced Medicinal Therapeutic Products, provide indications that progress is being made with clinically relevant outcomes in well-defined patient populations. For osteoarthritis, a joint disease leading to joint decompensation, novel tissue engineering therapies are being explored and, although most of the developments are still in early phase clinical studies, there are sufficient positive signals to pursue these novel therapeutic approaches in clinics. This article is part of a Special Issue entitled "Osteoarthritis".	{ "pile_set_name": "PubMed Abstracts" }
Enhanced body growth in uremic rats treated with IGF-I and growth hormone in combination. The efficacy of seven days treatment with IGF-I (1.7 mg/kg/day), growth hormone (GH) (2 mg/kg/day), IGF-I+GH (1.7 mg/kg/day + 2 mg/kg/day) or vehicle, in promoting growth was investigated in female Sprague-Dawley rats with 5/6 nephrectomies (N = 8 per group). Treatment commenced after chronic renal failure had been present for seven weeks. Significant increases in body weight gain were found in all groups versus control, with IGF-I+GH causing the greatest response, and increased body weight gains correlating with increased nitrogen retention. GH treatment alone significantly stimulated food intake. IGF-I+GH resulted in close to additive increases in food conversion efficiency (18.8%, 21.5% and 39.6% increases with IGF-I, GH and IGF-I+GH, respectively, over control levels) and longitudinal bone growth (39%, 37% and 67% increases with IGF-I, GH and IGF-I+GH, respectively, vs. control). Serum insulin and cholesterol levels significantly decreased with IGF-I and IGF-I+GH treatment. Creatinine clearance did not change, suggesting there were no effects of treatment on kidney function. Although IGF-I at the doses used did not result in a greater anabolic response than GH, IGF-I+GH caused significantly enhanced growth while reducing serum insulin and cholesterol levels.	{ "pile_set_name": "PubMed Abstracts" }
Com al País Basc i la Bretanya, la marca econòmica 'Produït al País Català' s'ha impulsat per promoure la qualitat territorial, tant al país com a l'exterior. Tal com informa el portal La Clau, el mes de febrer es va posar en marxa la marca "Produït en País Català", un segell territorial inspirat en models d'aqueixes característiques, que funcionen amb èxit a la Bretanya, al País Basc, a Còrsega i a Alsàcia. Aquesta iniciativa ha estat dissenyada per Philippe Simon i Joaquín Fernandez, respectivament empresari en la construcció i dissenyador a Cabestany i a Perpinyà. Aquesta marca qualitativa i identitària del know-how territorial és recolzada per Hermeline Malherbe, presidenta del Consell Departamental dels Pirineus Orientals, Carole Delga, president de la regió d'Occitània i Laurent Gauze, president de l'Agència de Desenvolupament Econòmic de la metròpoli Perpinyà Mediterrània. Per créixer i arribar a l'economia real, la marca «Produït al País Català» funciona sota règim d'associació, amb gestió rigorosa i objectiu de resultats. Concretament, el 2018, uns cinquanta empresaris van ser provats sobre la seva capacitat de compromís. Alguns d'ells van entrar en acció el 2019, pagant la seva contribució. Aqueixos professionals de la indústria alimentària, productors, fabricants, proveïdors de serveis, industrials, bars i restaurants constitueixen un primer nucli.	{ "pile_set_name": "OpenWebText2" }
Salkantay and Machu Picchu: Part 2 Machu Picchu The famous Machu Picchu… we weren’t really sure what to expect. Some say it’s the most amazing thing they have ever seen, while other’s claim places we’ve already visited are superior and don’t require dealing with the hoards of tourists and the hefty expense. The day to decide for ourselves had come! We awoke at 4:30a to get in line for the 5:30a bus. We were pretty near the front and made it on one of the first buses. But while we waited, we watched in amazement as people emerged from every alley and building. It was as if the town was secreting tourists from every crack in the pavement into the line that now stretched far up the street into the darkness. After the standard, single-lane, muddy, switchback-ridden Peruvian bus ride we made our way through the entrance and walked up to the famous lookout for our first view of Machu Picchu. Despite having seen it in so many pics it was still astonishing. Large smiles stretched across everyone’s faces. The sun had just crested the steep ridge line behind us and illuminated the ruins, which for a few more moments would remain uncluttered by the masses. Only shadows and a seemingly lost wisp of cloud competed with the ruins for space in our view. The verdict was in for me: truly amazing. The Incas had carved out a permanent spot in my memory with this awe inspiring place! Click to enlarge! We hung out and snapped photos for a while enjoying the enormous view as the sun continued to rise. With our entrance tickets we had purchased an additional admission to the hike up Machu Picchu Mountain. Right… why not hike 2,000 feet straight up steep stairs for a mile after a 4 day, 40 mile trek through the Andes! We got after it early to beat the heat and crowds. The old Inca stairs seemed endless as they cut up the mountain to the highest point surrounding the ruins. Looking down at MP from the stairs! We knocked it out pretty quickly passing everyone on the trail and had the summit all to ourselves to goof around with the cameras! “In this moment you will see Barba Picchu my friends.”Crew shot! We made the hike down the stairs after a snack on the top. Old knee injuries made their presence felt but this truly marked the last of the hiking for our team! Between Machu Picchu Mountain and the Salkantay we had hiked a combined 41 miles with 18,691 feet of elevation change in 5 days! Not too shabby eh? We switched over to flip flops and enjoyed the rest of the ruins. First we wandered over to the Inca Bridge. In the previous post I had posted a photo of the cliff from the ground on our hike in. Today we could see that the green ledge of vegetation stretching far across the length of the cliff was actually part of the Inca Bridge and was one of two access points for the secret ruins. From here we finally descended into the main ruins to check out the dwellings, plazas, temples and other buildings… and the grass maintenance crew – aka the alpacas. Sector de los TemplosA Chinchilla. These guys just sit silently on the rocks and look wise.Templo de las Tres Ventanas The stone work is amazing. Blocks that fit so precisely together it’s mind boggling and other blocks all over the place that are so large it’s hard to believe they were able to move them. Temple of the Condor One of the reasons Machu Picchu is so spectacular is the landscape it is surrounded by. Not only do you have the beautifully restored ruins, but a peak through a window or a view around a corner reveals staggering knife blade mountains covered in dense green as they reach for the sky. It’s no wonder this place provoked the imagination of the Incas… and after three days of almost constant clouds we were all really stoked for good weather and clear views, though by the end of our visit the clouds were rallying once again and the familiar threat of rain loomed. Click to enlarge Having fully explored Machu Picchu and feeling quite satisfied we jumped a bus back to town. No sooner than we arrived back in Aguas Calientes the clouds that had been building released a huge down pour. We sought refuge in a restaurant and had some victory beers! From Aguas Calientes we jumped a train to Ollantaytambo and then a collectivo from there back to Cusco. I’ll leave you off with a little footage from the train ride. We were in high spirits… I’m a little late catching up in your travels, but what the hey! Thanks for the great M P shots. It brings back special memories. We took the train from Cusco to M P, but don’t recall it being so rock ‘n’ roly.	{ "pile_set_name": "Pile-CC" }
Claude McFayden Claude McFayden was an Australian rugby league footballer who played in the 1900s and 1910s. He played for Western Suburbs in the New South Wales Rugby League (NSWRL) competition. McFayden was a foundation player for Western Suburbs. Playing career McFayden made his first grade debut for Western Suburbs against Glebe in Round 3 1908 at Wentworth Park which was during the opening season of the New South Wales Rugby League (NSWRL) competition in Australia. McFayden played in Western Suburbs first ever victory against Newtown in Round 9 1908 at Wentworth Park which ended with a score of 6-5. The win would be Western Suburbs only victory of the season and the club finished second last on the table above last placed Cumberland who were dissolved at the conclusion of the season. McFayden played with Wests up until the end of 1916 but his time at the club was difficult with the side finishing last in 1909, 1910, 1912, 1913, 1915 and 1916. The club also narrowly avoided coming last in 1914 finishing just above last placed Annandale. At the time of his retirement, McFayden was one of Western Suburbs longest serving players. Post playing McFayden would go on to be a selector and a trainer at Western Suburbs. He then became a committeeman at the club and coached the Western Suburbs Presidents Cup team. McFayden died in 1947 which was disclosed in the club's annual report stating “Western Suburbs Football lost one of its greatest stalwarts in Claude McFayden, who passed away suddenly during the season. Claude was member of the District Club since its inception. Firstly as a player, then a trainer and then a committeeman. Also, during his association with the club, he had on various occasions acted as coach to our lower grades”. References Category:Year of birth missing Category:Australian rugby league administrators Category:Australian rugby league players Category:Western Suburbs Magpies players Category:1947 deaths Category:Rugby league centres Category:Rugby league wingers	{ "pile_set_name": "Wikipedia (en)" }
1. Field of the Invention The present invention pertains generally to microfluidic flow devices and specifically to mixers and splitters of microfluidic flow. 2. Description of the Background The application of microfluidic analytical devices to chemical or biological assays has developed rapidly over the last decade. Although microfluidic devices have been highly successful, several performance limitations exist, notably reagent mixing. Most mixing devices rely on diffusive mixing, wherein the natural laminar flow effects and the reagent's inherent diffusion coefficient cause the reagents to mix. Therefore, the mixing chamber/channel is usually extended to lengths that will ensure a completely mixed outlet stream. This approach may be acceptable for low flowrates, but high flowrates (>1 cm/s) or low analyte diffusion coefficients (<10−7 cm/s2) will require excessively long mixing channels. The difficulty in rapidly mixing reagents results from the fact that the system is restricted to the laminar flow regime (Re<2000) and also because the feature sizes are too small (typically <100 μm) to incorporate conventional mixing mechanisms. The lack of turbulence in microfluidic systems has led to device designs that utilize multi-laminate, or flow splitting techniques to accomplish mixing in channels of shorter length. These designs split the incoming streams into several narrower confluent streams to reduce the mixing equilibrium time. Once mixing is complete, the narrow channels are then brought back together into a larger main channel for further transport, processing, and/or detection. The effectiveness of the flow splitting concept is based on the fact that the equilibrium time scales quadratically with the width of the channel. For example, if the width of the channel decreases by two, then the equilibrium time and the channel length decreased by a factor of four, or 25% of the original length. However, even a mixing length of 25% may still be unsuitable for some applications. Other techniques for mixing may rely on active mechanical mixing, such as stirring paddles and the like. For very small fluidic passages, such devices are extremely fragile and difficult to manufacture. It would therefore be advantageous to provide a device and method of mixing two confluent microfluidic laminar flows that did not require an excessively long channel to effectively mix the flows. Further, it would be advantageous to provide a splitting mechanism that may be able to split a stream of reagents into two streams of differing concentrations.	{ "pile_set_name": "USPTO Backgrounds" }
Lord Charles Hay Lord Charles Hay (c. 1700 – 1 May 1760) was a soldier of the British Army who saw service in the Anglo-Spanish War, the Wars of the Polish and Austrian Successions, and the Seven Years' War. He combined this with a political career, sitting for a time as a member of parliament. Born into the nobility, the younger son of a marquess, Hay entered the army and rose through the ranks, seeing action in some of the European campaigns of the Anglo-Spanish War and the War of the Polish Succession. He won particular renown during the War of the Austrian Succession, when he commanded some of the regiments involved in the fighting. He saw action at the Battles of Dettingen and Fontenoy, distinguishing himself in the latter with an encounter with a French regiment, that was later remarked upon by Voltaire. His political career was also turbulent, at times spent in opposition to the Administration. It ended after a period of apparent mental instability, and he did not seek re-election. Further military promotions nevertheless followed. Hay was appointed to an important command early in the Seven Years' War, to be part of a force sent to capture Louisbourg, but the commanders vacillated and Hay became discontent. He was overheard making opprobrious remarks about the conduct of the campaign, and was arrested. He spent some time waiting for a ship to be able to return to England, and on arriving there, demanded a court-martial to investigate the facts. The court-martial referred its decision to the king, but Hay died suddenly in 1760, before it could be announced. Family and early life Lord Charles Hay was born c. 1700, the third son of Charles Hay, 3rd Marquess of Tweeddale, and his wife Lady Susan Hamilton, the daughter of William Douglas, Duke of Hamilton. Lord Charles was the younger brother of John Hay, 4th Marquess of Tweeddale. Hay entered the army, being gazetted ensign in the 2nd Regiment of Foot Guards on 18 May 1722, and a captain in the 33rd Regiment of Foot on 14 May 1727. He was apparently present at the siege of Gibraltar in 1727, and in 1729 he was serving as a captain of the 9th Regiment of Dragoons. He took part as a volunteer in the armies of Prince Eugene of Savoy during the Rhine campaigns of 1734 in the War of the Polish Succession. He was elected as the member of parliament for Haddingtonshire in 1741 and on 7 April 1743 was given command of a company in the 3rd Foot Guards. He took part in the European campaigns of the War of the Austrian Succession, and was a virtual, if not actual, lieutenant-colonel of the 1st Regiment of Foot Guards at the Battles of Dettingen and Fontenoy. Fontenoy Deploying with the army on 11 May 1745, the day of the battle' he unexpectedly found himself, on reaching the crest of a low hill, face to face with the Gardes Françaises, who, though anticipating an engagement as little as Hay, showed no sign of disorder. According to the French accounts, of which Voltaire's is the best known, Lord Charles stepped from the ranks and, in response to a similar movement promptly made by the French commander, politely called to him to order his people to fire, but in reply was assured, with equal politeness, that the French guards never fired first. According to the story which he himself sent in a letter to his brother three weeks later, his men came within twenty or thirty paces of the enemy, whereupon he advanced in front of the regiment, drank to the health of the French, bantered them with more spirit than pungency on their defeat at Dettingen, and then turned and called on his own men to huzzah, which they did. Hay recalled that "it was our regiment that attacked the French Guards: and when we came to within twenty or thirty paces of them, I advanced before our regiment; drank to them and told them that we were the English Guards, and hoped they would stand till we came quite up to them, and not swim the Scheldt as they did the Main at Dettingen." One of Hay's biographers noted that "whichever be the correct version of the occurrence, Hay unquestionably showed extraordinary coolness." Hay was severely wounded in the ensuing battle, and was initially reported to have been killed. He recovered and continued his career in politics, supporting the Hanoverian faction and the Carteret Ministry. A professional soldier, he was described by Horace Walpole in a letter to Sir Horace Mann as having "more of the parts of an Irishman than of a Scot", and was "so vain of having made a campaign ... [on the Rhine] in 1734, that he talked of it ever after and went by the name of Trentquatre". Walpole had reason to dislike Hay, who supported Lord Carteret against Sir Robert Walpole's Ministry and opposed Walpole's candidate for the chairman of the elections committee. With Walpole's fall in 1742, Hay supported Carteret's new Administration, and its successor, the Pelham Ministry. His political career came to an end after a period in November 1746, when he was apparently "confined raving mad" and to have "been tied in his bed some time". He did not seek re-election at the 1747 general election. Promotions He was made aide-de-camp to King George II in March 1749, and in August was promoted to colonel. In 1751 he succeeded his kinsman Sir Robert Hay, 2nd Baronet to the estate of Linplum in Haddingtonshire. From 1753 until 1760 he was Colonel of the 33rd Regiment of Foot. With the outbreak of the Seven Years' War he was further promoted, to major-general, on 22 February 1757 and was second in command of the force sent to Halifax, Nova Scotia under General Peregrine Hopson. The force was part of the expedition under Lord Loudoun. Halifax and dismissal Loudoun's progress towards the goal of capturing Louisbourg appears to have been too cautious for Hay's liking. The French had sent heavy naval reinforcements, and the attack was called off. Hay had arrived at Halifax on 9 July and was dismayed at the inaction of his superiors. Colonel John Forbes overheard him criticising the conduct of the campaign, commenting while their troops exercised in a sham attack that "by God, difficult as it may be, I shall find a method of letting the mother country know what is doing here, that we are taken up in building sham forts and making approaches to them, when we should be employed in real attacks. The fleet should sail up the bason, and have a sham fight there; and then we might write home that we had a sea fight and taken a fort." He was also said to have commented that "the general was keeping the courage of his majesty's troops at bay, and expending the nation's wealth in making sham sieges and planting cabbages when he ought to have been fighting." The news reached Loudoun, who had Hay arrested in July for "uttering various opprobrious and disrespectful speeches". He did not press a charge though, instead suggesting that "the voyage, climate and season of the year have been prejudicial to his Lordship’s health." The implication was that Hay had gone mad, or suffered a breakdown, and he was closely confined for seven months while awaiting passage back to England. He volunteered for service aboard the 74-gun , which had arrived in Halifax in May 1758 under the command of Captain George Brydges Rodney, carrying Major-General Jeffery Amherst. Hay observed the successful siege and capture of Louisbourg from the Dublin, before his return to England aboard . Hay demanded a court-martial to investigate the charges. This was agreed to, with Hay charged with endeavouring "to bring into contempt the conduct and authority of the commanders of the fleet and land forces in America," and with behaving "in a manner evidently tending to excite mutiny and sedition amongst the troops." The court-martial took place between 12 February and 4 March 1760. Samuel Johnson, who met Hay about this time, was apparently "mightily" pleased with his conversation, and remarked that his defence was "a very good soldierly defence." The result of the court-martial was not made public, but was referred to the king for judgement. Before the king could decide on the matter, Hay died, on 1 May 1760. He was unmarried. Hay's biographer, Julian Gwyn, remarked that it was "doubtful that the first charge would have stuck; the second ... was absurd." Citations References Category:1700s births Category:1760 deaths Category:Younger sons of marquesses Category:Members of the Parliament of Great Britain for Scottish constituencies Category:British MPs 1741–1747 Category:British Army generals Category:9th Queen's Royal Lancers officers Category:Grenadier Guards officers Category:Coldstream Guards officers Category:33rd Regiment of Foot officers Category:British Army personnel of the War of the Austrian Succession Category:British Army personnel of the Seven Years' War Category:British military personnel of the French and Indian War	{ "pile_set_name": "Wikipedia (en)" }
Kayla Moore's 'Jew' comment raises eyebrows The wife of Republican Senate candidate Roy Moore is defending her husband against accusations of bigotry by pointing out his record on supporting African Americans and adding that one of their attorneys “is a Jew.”	{ "pile_set_name": "OpenWebText2" }
1996–97 Shrewsbury Town F.C. season During the 1996–97 English football season, Shrewsbury Town F.C. competed in the Football League Second Division. Season summary In the 1996-97 season, Shrewsbury endured a poor campaign and were relegated to the Third Division which ultimately cost manager Davies his job. Final league table Pld = Matches ; W = Matches won; D = Matches drawn; L = Matches lost; F = Goals for; A = Goals against; GD = Goal difference; Pts = Points NB: In the Football League goals scored (F) takes precedence over goal difference (GD). Results Shrewsbury Town's score comes first Legend Football League Second Division FA Cup League Cup Football League Trophy Squad References Category:Shrewsbury Town F.C. seasons Shrewsbury Town	{ "pile_set_name": "Wikipedia (en)" }
Ewen Collection The Ewen Collection is a collection of railway letter stamps of the United Kingdom from 1891 to 1912 that forms part of the British Library Philatelic Collections. It was formed by Herbert L'Estrange Ewen and donated in 1949 by his sister Mrs Clement Williams. See also Parcel stamp Turner Collection of Railway Letter Stamps References Category:British Library Philatelic Collections Category:Philately of the United Kingdom Category:Cinderella stamps	{ "pile_set_name": "Wikipedia (en)" }
Q: How to apply my own function with r::apply() I have following dataframe GRATE GSHAPE 1 0.04 1.0 2 0.08 0.5 3 0.12 2.0 I want to compute a new column COL by following function myfun = function (Rmax=150, precision=0.1, grate, gshape){ s = seq(0,Rmax,precision) R = pgamma(s, rate=grate, shape=gshape) Rc = 1-R Rc2 = Rc^2 Rc2ds = Rc2*precision intRc2ds = sum(Rc2ds, na.rm=TRUE) return(intRc2ds) } This is not working correctly: mydf$COL = apply(mydf, 2, myfun, grate=mydf$GRATE, gshape=mydf$GSHAPE) How should I do this? A: What do you wish to accomplish exactly? Making it run across columns doesn't make sense, because then you never have both a grate and gshape, but only one at a time. If you want to make it run across rows (so that you get an answer for the combinations of grate and gshape presented in your rows), this code works: mydf$COL = apply(mydf, 1, function(x) {myfun(grate=x[1], gshape=x[2])})	{ "pile_set_name": "StackExchange" }
Atelectasis caused by macrolide-resistant Mycoplasma pneumoniae pneumonia in an adult patient. A 27-year-old, previously healthy woman was admitted to our hospital for mild pneumonia. After 2 days ceftriaxone sodium administration, her chest radiograph revealed a rightward mediastinal shift caused by atelectasis of the upper portion of the right lung. Bronchoscopic examination showed swelling in the right upper lobe bronchus and obstruction in the B1 segmental bronchus caused by complete edematous swelling. Histopathology showed acute cellular bronchitis with edema of the bronchial wall containing lymphocytes, plasma cells, and macrophages. Mycoplasma pneumoniae was detected by culture and a polymerase chain reaction test using sputum collected during bronchoscopy, and treatment was changed to minocycline. After 7 days antibiotic therapy, her condition improved and no relapse was observed. Identification of point mutations in domain V of the 23S rRNA for macrolide-resistant M. pneumoniae was performed, and an A-to-G transition at position 2063 in domain V of the 23S rRNA gene was identified. Atelectasis caused by M. pneumoniae is thought to be a common associated finding in pediatric patients, but it is rare in adults. In addition, our patient showed extremely unusual findings with obstruction caused by complete edematous swelling.	{ "pile_set_name": "PubMed Abstracts" }
Warwick Sisson Senior Manager Warwick has specialist skills in parks and community facility contract management, cricket wicket management, sports field development and project management. His turf career commenced in 1981 and includes managing International cricket wickets for Eden Park and Basin Reserve over a 12 year period. His exacting leadership style, and expectation of excellence from all his staff and the service that is delivered, ensures that whatever needs to happen, will happen. Warwick is currently managing the Auckland Council contract, Recreational Turf (our turf farm business) and our in-house sports field construction and renovations division.	{ "pile_set_name": "Pile-CC" }
Reducing a Shoulder Dislocation Without Sweating. The Davos Technique and its Results. Evaluation of a Nontraumatic, Safe, and Simple Technique for Reducing Anterior Shoulder Dislocations. Anterior shoulder dislocation is a well-known injury for people working in emergency departments (EDs). Throughout the years, the focus has been shifted onto more gentle reduction techniques with less risk of iatrogenic injury, fracture displacement, and less pain for the patient. We present the results of one such technique, the Davos reduction maneuver, also known as the Boss-Holzach-Matter technique, as well as its advantages, disadvantages, and a few practical tips. We evaluated, retrospectively, 100 patients presenting with an anteroinferior shoulder dislocation, who were treated in the ED of the university hospital of Geneva, Switzerland, in a time period of 18 months. In every case, the Davos technique was used for shoulder reduction. The detailed technique is described. Successful reduction was achieved in 86 patients. There were no neurological complications. Greater tuberosity fracture malreduction was noted in one case. Eighteen patients received no analgesia. Our results were comparable or superior to other reduction techniques. We concluded that the Davos technique is an easy, nontraumatic, very well-tolerated, and most of all, safe way to reduce a shoulder. It is complication free and easy to apply, giving reproducible and comparable or superior results to other reduction techniques. At the same time, it is well tolerated by a compliant patient, which makes it an ideal first-time reduction technique for anterior shoulder dislocations.	{ "pile_set_name": "PubMed Abstracts" }
A pair of NFL season ticket holders who wanted to see a full or partial rematch between the New Orleans Saints and the Los Angeles Rams were out of luck Thursday after a federal judge said she wouldn’t force the league to implement a rule that could’ve led to a do-over. U.S. District Judge Susie Morgan ruled against two Saints season ticket holders who brought the legal battle against the NFL and Commissioner Roger Goodell after their team was defeated in the NFC championship game. The loss dashed the organization's hopes of a Super Bowl appearance this year. The issue between the parties came about when game officials didn’t call a penalty after Rams defensive back Nickell Robey-Coleman hit Saints receiver Tommylee Lewis while a Drew Brees pass was in the air with less than two minutes remaining in the Jan. 20 game. NFL OPPOSES RAMS-SAINTS DO-OVER, SAYING IT COULD COST LEAGUE MORE THAN $100M: COURT FILING A flag for pass interference would have given the Saints a first down and a chance to run down the clock before kicking a potential game-winning field goal. Instead, the Saints were forced to kick the field goal sooner and returned possession to the Rams -- giving Los Angeles enough time on the clock to tie the game again and force it into overtime, where the Rams won. The ticket-holder’s filing wanted the NFL to enforce a rule permitting the commissioner to investigate "extraordinarily unfair acts" that affect the game. Remedies under that rule include rescheduling the game in full, or from the point at which the unfair act occurred. However, the judge rejected the petition that the ticketholders were entitled to an order, known as a "writ of mandamus." CLICK HERE TO GET THE FOX NEWS APP “None of the actions Plaintiffs might seek to compel Commissioner Goodell to do are the kinds of actions a writ of mandamus may address,” the order said. “Louisiana Code of Civil Procedure article 3864 authorizes a writ of mandamus be directed to compel performance of a ministerial duty; such as the holding of an election or the performance of other duties required by bylaws, articles of organization, or operating agreement or as prescribed by law; or to compel the recognition of the rights of the shareholders or members.” NFL Chief Financial Officer Joseph Siclare reacted to the lawsuit last week, saying in an affidavit that replaying the final minutes of the game could cost the league “more than $100 million” because it would mean delaying Super Bowl LIII. Fox News’ William Mears, Paulina Dedaj and The Associated Press contributed to this report.	{ "pile_set_name": "OpenWebText2" }
MM 55 STIHL YARD BOSS® - $359.99DSRP Share Using a universal power train, this cultivator can transition into other useful tools for around the home or farm. There are not too many things a STIHL YARD BOSS® can't handle. One of two great multi-task yard care systems, the lightweight and powerful MM 55 C-E STIHL HomeScaper Series™ YARD BOSS® offers the same versatility as the MM 55 but features the Easy2Start™ system. With a pick tine cultivator set included as standard, this system is also available with an optional weight kit — helping the tines more ...Read More Multi-Function Control Handle Having easy access to all of the controls on one comfortable handle makes it easy to complete tasks so the operator’s hand never has to leave the handle. Protected Spark Plug Cover The spark plug cap is integrated in the equipment’s housing, so the spark plug remains protected while still being easy to change. Purge Pump Primer A small fuel pump delivers fuel to the carburetor when pushed, reducing the number of starting strokes required following extended breaks in operation. Important Information Note: STIHL recommends use of fuel with no more than 10% Ethanol content. Using fuel with greater than 10% Ethanol content may cause damage to your equipment and may void your STIHL warranty. Learn More… WARNING! Improper use of any power tool may cause serious or fatal injury. Read, understand and follow carefully the operating and safety instructions in your instruction manual before using such products. STIHL products sold through U.S. STIHL Dealers are for distribution in the United States only. We Also Suggest Now you can turn your STIHL YARD BOSS® into a quality wheeled trimmer, adding ease and convenience to your trimming tasks – all for much less than the cost of a dedicated trimmer mower. The STIHL FS-MM trimmer attachment features a dependable STIHL AutoCut® 25-2 trimmer head for precision cutting tasks. To advance the line, just tap the trimmer head against the ground. Need to change the trimmer head? The FS-MM trimmer head is designed to be removed and replaced with a wide range of STIHL trimmer heads, including STIHL SuperCut™, FixCut™, DuroCut and more! HP Ultra is a fully synthetic 2-cycle engine oil specially suited for high performance chainsaws and power tools. This oil has outstanding engine cleaning characteristics, plus “ultra” superior lubricating qualities in comparison to other 2-cycle engine oils. It is ideal for use in STIHL 4-MIX® engines. This oil is biodegradable, degrading by 80% in 21 days. •2.6 oz. bottle makes 1 gallon mix •5.2 oz. bottle makes 2 gallon mix •6.4 oz. bottle makes 2 1/2 gallon mix •12.8 oz. bottle makes 5 gallon mix STIHL recommends a mix of 50:1 high-quality 89 octane or higher unleaded gasoline to STIHL engine oil. This same mix ratio should be used during break-in. Heavy-duty rubber flaps clean up compacted dirt on roads and sidewalks, moves pebbles and sand from grassy turf, and even removes water and light snow from hard surfaces. Note: This attachment must be used with large deflector and extensions. Are You Ready for a STIHL? Reserve with STIHL Express for In-Store Pick Up With STIHL Express, you can reserve the STIHL product you need right from your home or office and pick it up at your local STIHL Dealer. Compare STIHL products online 24 hours a day, 7 days a week. Pick up products assembled and ready to go Get the ease of reserving online while still having access to advice from your local STIHL Dealer. Distributor Suggested Retail Price All pricing on this site is Distributor Suggested Retail Price. This site strives to maintain accurate and current suggested retail pricing. However, dealers' actual prices may vary or change. Please confirm pricing with your dealer Buy Now for Home Delivery STIHL OUTFITTERS™ goods are sold and shipped by authorized STIHL OUTFITTERS™ Licensees. Ordering online is easy and items can be delivered directly to your address. Show off your STIHL pride today! MM 55 STIHL YARD BOSS® Description There are not too many things a STIHL YARD BOSS® can't handle. One of two great multi-task yard care systems, the lightweight and powerful MM 55 C-E STIHL HomeScaper Series™ YARD BOSS® offers the same versatility as the MM 55 but features the Easy2Start™ system. With a pick tine cultivator set included as standard, this system is also available with an optional weight kit — helping the tines more efficiently cultivate the soil. An optional bolo tine cultivator set for mixing soil is also available. MM 55 STIHL YARD BOSS® MM 55 STIHL YARD BOSS® Please provide your email to receive this special offer. Required fields.<br /> Please Note: STIHL does not rent, sell or share personal information about you with other people or nonaffiliated companies. Thank You! Thank you! You will now receive this special offer within your email, so that it may be printed and redeemed in-store. MM 55 STIHL YARD BOSS® is rated 4.2 out of 5 by 62. Rated 4 out of 5 by Machineman88 from Useful toolGot this to prepare planting beds and use the power sweep attachment as well. Does the job as expected. Sometimes hard to start, as is my Stihl chainsaw. Once running it's fine. Useful machine once I got past the upfront cost to own. Date published: 2017-10-25 Rated 5 out of 5 by Caseman from Great tool!!Unit works as designed, really makes weeding the garden a simple task Date published: 2017-10-16 Rated 5 out of 5 by StihlUserMK from Great machineI enjoy using this machine, it's a great multi tool. I have edged and tilled and both attachments work great. I sedentary recommend this product. Very maneuverable and a handy tool. Date published: 2017-09-23 Rated 4 out of 5 by Relidnit from Small tiller for weeding and defining bedsI've owned a MM55C for a few years and it's good for weeding beds, enlarging small beds, cutting curves and getting into tight spaces.Pro:LighweightRemovable tinesEasy to cleanDecent powerStarts easily IF you do the proper post season maintenanceVersatile - can be run with 2,3 or 4 tinesFolds up neatly and fits into most car trunks with easeCon:NEEDS A MUD FLAP! I added one because this unit throws dirt all over your feet at full power without a mud flap.Be SURE to run the fuel tank dry before storage and avoid gas/ethanol mixtures. Even 10% ethanol in gas will cause the carb on this unit to foul. I replaced the carb and it ran like new. Took the old one apart and it was totally green inside even with the use of Stabil ethanol stabilizer. Date published: 2017-07-28 Rated 5 out of 5 by Mitzie from AwesomeI love my Yard Boss. I have had it for years. I am under 5' tall and it is just perfect for me.Dependable, powerful, easy to handle. Date published: 2017-07-27 Rated 5 out of 5 by Kassie from Excellent Yard ToolWe too have one of these Stihl Yard Bosses. I just love this tool. I LOVE ALL MY STIHL products. Date published: 2017-06-26 Rated 4 out of 5 by KLB311 from Nice MachineWe really love this machine overall. My wife has used it more than myself so she should be writing this. We use this Stihl MS 55 for our garden tilling after we've planted. Excellent chewing up the ground making for easy weed pulling. The only issue at all is it is a little bit tiring after about 30 to 40 minutes of work. We use the wheels to help adjust for depth control and they work great. It's also nice when you stop tilling to just let the unit rest on the adjustable wheel stand! Date published: 2017-05-27 Rated 4 out of 5 by sr12goodman from Nice small machine to get in tight spots.I bought the Yard Boss to compliment my full sized tiller. Both do a good job, sometimes you need a small tool and sometimes you need a bigger tool for a bigger job. I have both now. I'm really pleased so far with the performance of the YB. My only suggestion to Stihl would be a lower price would seal the deal for a solid 5 rating. Good job though. STIHL News Follow STIHL USA on STIHL IS THE NUMBER ONE SELLING BRAND OF GASOLINE-POWERED HANDHELD OUTDOOR POWER EQUIPMENT IN AMERICA.* "Number one selling brand" is based on syndicated Irwin Broh Research as well as independent consumer research of 2009-2016 U.S. sales and market share data for the gasoline-powered handheld outdoor power equipment category combined sales to consumers and commercial landscapers. A majority of STIHL gasoline-powered units sold in the United States are built in the United States from domestic and foreign parts and components.	{ "pile_set_name": "Pile-CC" }
Governo impõe às instituições a prova da empregabilidade dos cursos. O Governo congelou o número de vagas para cursos do Ensino Superior para o próximo ano letivo, que não vão aumentar em relação a 2011-2012, a menos que as instituições consigam provar a empregabilidade dum curso. O despacho que regulamenta a fixação das vagas para o Ensino Superior foi publicado terça-feira à noite na página da Direção-Geral de Ensino Superior (DGES) e determina que o número de vagas para cada universidade ou politécnico "não pode exceder a soma das vagas fixadas para essa instituição para o ano letivo de 2011-2012". A DGES poderá autorizar mais vagas em "situações particulares": quando as instituições consigam provar que os alunos de um determinado curso têm menos probabilidades de ir parar ao desemprego. O Governo recomenda às universidades e politécnicos que "redistribuam" as vagas que têm disponíveis para poderem aumentar o número de alunos nos cursos de "Ciências, Matemática, Informática e Engenharia". "Excesso de oferta" nos cursos de professor do ensino básico e educação de infância Por outro lado, impõe às universidades e politécnicos que reduzam em pelo menos 20% o número de vagas nos cursos de professor do ensino básico e educação de infância, onde identifica "excesso de oferta". Devem também ser reduzidas as vagas nos mestrados de habilitação profissional para a docência. Nos cursos de Medicina, a oferta em 2012-2013 deve ser igual à deste ano letivo. No despacho, o executivo diz ainda às instituições de ensino superior que não devem ter no próximo ano letivo mais cursos do que tiveram este ano, salvo um conjunto de exceções, como sejam cursos lecionados à distância. O Governo decidiu também que não serão financiadas novas admissões em cursos que neste ano letivo tenham tido menos de 20 inscrições ou menos de 40 desde o ano letivo de 2009-2010. Cálculo de empregabilidade O despacho impõe também que não podem ser abertos cursos com menos de 20 vagas, a não ser em cursos preparatórios de Artes, ou resultantes de protocolos internacionais, que não sejam financiados pelo Estado ou quando se prove a sua "especial relevância", entre outras exceções. Para pedirem à DGES a apreciação do aumento de vagas num determinado curso, as instituições terão que provar primeiro que não têm vagas a libertar em cursos que não ficaram completamente preenchidos. Para o cálculo da empregabilidade, devem usar como referência os números da Direção-Geral de Estatística e Ciência, que registam o número de desempregados por curso inscritos nos centros de emprego. Deverão provar que "o nível de desemprego nesse curso é inferior ao nível médio de desemprego dos diplomados com um curso superior".	{ "pile_set_name": "OpenWebText2" }
‘Thor: Ragnarok’ is a Superhero Comedy About the Horrors of Colonialism Posted on Tuesday, April 24th, 2018 by Siddhant Adlakha (Welcome to Road to Infinity War, a new series where we revisit the first 18 movies of the Marvel Cinematic Universe and ask “How did we get here?” In this edition: Thor: Ragnarok reinvents the God of Thunder with humor and subversion.) Compared to Iron Man and Captain America, Thor feels short-changed in both his Avengers appearances. His first solo film narrowly misses a coherent character arc. His second doesn’t give him one at all. He is, at once, one of the most popular Avengers and one of the least narratively interesting. Or rather he was, until New Zealand’s Taika Waititi was handed carte blanche for the character and his grandiose world. To say that Waititi made a weird movie would be a disservice. It’s a really weird piece of an even weirder puzzle, course-correcting Thor’s prior installments while leaning all the way into the Jack Kirby-esque designs of Marvel’s golden age. It has a giant undead wolf. It has a kindly rock monster. It even has a Hulk, but it also has Jeff Goldblum as The Grandmaster, a character so fun and alluring that you forget he’s a human trafficker who sends people to their deaths for sport. Which, in essence, is the thesis of Thor: Ragnarok, a comedy about the effects of downplaying colonialism, made by an unapologetically Maori filmmaker. Read More » ‘Spider-Man: Homecoming’ Fleshes Out the Corners of the MCU Posted on Monday, April 23rd, 2018 by Siddhant Adlakha (Welcome to Road to Infinity War, a new series where we revisit the first 18 movies of the Marvel Cinematic Universe and ask “How did we get here?” In this edition: Spider-Man: Homecoming offers a peek at the margins of the Marvel Cinematic Universe.) The “Homecoming” sub-title has a sly double meaning in North America, but both the phrase and its many localizations – usually some variant of “Returning Home” – sent a singular message to most of the world. This was Spider-Man back where he belonged, at the House of Ideas, right alongside characters he’d shared the page with for over 50 years. In order to re-establish him though, Marvel needed to answer a key question following his appearance in Captain America: Civil War: Where does Spider-Man fit in a world of Avengers? The Marvel Cinematic Universe had been around for nearly 10 years by the time we got Spider-Man: Homecoming. This fictional world began shortly after Tobey Maguire vacated the spider-suit, and it continued through Andrew Garfield fizzling out. Tom Holland was to be the third on-screen Spider-Man in under a decade, and separating him from the other two became imperative. In both prior incarnations, Spider-Man was the only hero around and he had to rise to the occasion no matter how big the threat. Holland’s Peter Parker however – younger, smaller, and of meeker demeanor – exists in a world much like our own: a world where a kid his age had grown up watching Avengers rule the skies, as the little guys looked up in awe. Read More » ‘Guardians of the Galaxy Vol. 2’ is an Intimate Drama About Cycles of Abuse…With a Talking Space Raccoon Posted on Friday, April 20th, 2018 by Siddhant Adlakha (Welcome to Road to Infinity War, a new series where we revisit the first 18 movies of the Marvel Cinematic Universe and ask “How did we get here?” In this edition: Guardians of the Galaxy Vol. 2 beautifully blends sci-fi craziness with an examination of anger, pain, and cycles of abuse.) Guardians of the Galaxy Vol. 2 is oodles of fun, but it spends its first few scenes articulating a thoughtful mission statement. Its prologue, set 34 years in the past, features a budding romance later revealed to have twisted implications, but the love on display is still real. Following this comes the Guardians’ raucous reintroduction in present day, a battle against an inter-dimensional beast in a scene bursting with visual slepndour. Its out-of-this-world action however, is backgrounded and out of focus. The spotlight instead falls on a joyous Baby Groot, dancing his way through the scene as the other Guardians – Star Lord, Drax, Gamora and Rocket – take turns caring for him as if he were their child. When the Guardians collect their reward for this battle, they stand in contrast to the gilded Sovereign, a homogenous people genetically engineered to be perfect, but a people to whom slights and insults are unforgivable. The Guardians, on the other hand, are a group of broken characters from wildly different origins, but in their case, redemption isn’t off the table. In short, Guardians of the Galaxy Vol. 2 is about the complicated relationships we rarely confront. It’s told against a backdrop of action and space-opera, but its focus is on a family of imperfect beings, searching for catharsis while helping one another other find some form of redemption. It may very well be Marvel’s most mature film, zeroing in on the emotional complexities of abuse carried forward into adulthood. But it also solidifies the Studio’s new political direction, acting as the first in a trilogy of films (along with Thor: Ragnarok and Black Panther) whose narrative is adjacent to colonial history. Read More » ‘Doctor Strange’ Opens Marvel’s Mind and Expands Its Worldview Posted on Thursday, April 19th, 2018 by Siddhant Adlakha (Welcome to Road to Infinity War, a new series where we revisit the first 18 movies of the Marvel Cinematic Universe and ask “How did we get here?” In this edition: Marvel Studios enters bold new territory with Doctor Strange.) In August of 2014, as Doctor Strange was being written and as Marvel was figuring out where to film it in 15 months time, the studio underwent a significant restructuring. Kevin Feige would no longer answer to Marvel CEO Ike Perlmutter, a notoriously fickle penny pincher and blockade to diversity, nor would Marvel Studios be subject to the Marvel Creative Committee, whose hellish process of studio-notes was a source of contention behind the scenes. Instead, Feige began answering directly to filmmaker-friendly Disney Charmian Alan Horn. Not long after, Marvel announced films like Black Panther and Captain Marvel and directors like Ryan Coogler (Creed) and Taika Waititi (What We Do in the Shadows) after only having had white men be the major focus on either side of the camera. The message was clear. This was a whole new Marvel, and slowly but surely, the work began to reflect it. Read More » ‘Captain America: Civil War’ is Marvel’s Harrowing Longterm Payoff to Years of Storytelling Posted on Wednesday, April 18th, 2018 by Siddhant Adlakha (Welcome to Road to Infinity War, a new series where we revisit the first 18 movies of the Marvel Cinematic Universe and ask “How did we get here?” In this edition: Captain America; Civil War pays off years of build-up with a painful bang.) The Marvel Cinematic Universe seems to re-invent itself every couple of years. From big, fun crossover action to space-set family soap opera, it’s been laying track one way or another for the upcoming Avengers: Infinity War, but a decade of narrative investment can’t be achieved without a feeling of genuine loss. This year’s culmination re-introduces us to the scattered Avengers, a family at its most discordant after tearing itself apart. And while no Avengers lost their lives in Captain America: Civil War, the team as a whole may have lost its sense of identity. It’s a film where the long-term personal and political narratives boil over, conflicting with one another for reasons both idealistic and petty, and by the end of it, the Avengers implode. It’s a difficult watch at times, even and especially two years later when debates about military intervention rage on. And while it may seem like folly to view a film from 2016 strictly through a lens of America’s 2018 bombing of Syria, this particular real-world intervention isn’t something new. It’s part of a long-standing and long-intervening military apparatus that makes a film like Captain America: Civil War relevant in the first place. The Avengers’ legacy is America’s legacy. And it’s mighty complicated. Read More » With ‘Ant-Man,’ Marvel Goes Small, Simple and Sincere Posted on Tuesday, April 17th, 2018 by Siddhant Adlakha (Welcome to Road to Infinity War, a new series where we revisit the first 18 movies of the Marvel Cinematic Universe and ask “How did we get here?” In this edition: Ant-Man is sometimes muddled, but charm and style go a long way.) While “superhero fatigue” is by no means a cultural phenomenon – Avengers: Infinity War could topple Star Wars: The Force Awakens at the opening weekend box office – it’s most certainly experienced on an individual basis. The bloated Avengers: Age of Ultron, for instance, may not have been everybody’s cup of tea despite being one of this writer’s favourites. Which is perhaps why Marvel Studios, in order to end its run of “Phase 2” films in 2015, decided on a smaller, more intimate project in the vein of a studio comedy. Ant-Man would’ve been very different under director Edgar Wright, who left the project over creative differences in 2013, but that hypothetical scenario assumes there would’ve been an Edgar Wright Ant-Man at all – that is, once The Avengers swept the globe and the Marvel Creative Committee under Ike Perlmutter was still intact. The Marvel Studios of 2015 was a different beast from the Marvel Studios of 2003 (when Wright first got involved), and while it’s nice to imagine what could have been, Peyton Reed of Yes Man and Bring It On did an ample job with a film that, for better or worse, seems more in his wheelhouse than Wright’s. (Side note: the visual flourishes people seem to think are Wright’s are likely Reed’s doing, though the film feels like the product of conflicting rewrites). That said, it does make us ponder whether going smaller and more personal in theory is really more artistically sound when the decisions still feel like they’ve had their edges sanded down. Like the character leading it, it’s tough for Ant-Man to be truly good when forces beyond its control seem to hold it back at every turn. Read More » ‘Avengers: Age of Ultron’ Balances Gods and Monsters, Bringing Marvel’s Legacy Into Focus Posted on Monday, April 16th, 2018 by Siddhant Adlakha (Welcome to Road to Infinity War, a new series where we revisit the first 18 movies of the Marvel Cinematic Universe and ask “How did we get here?” In this edition: Avengers: Age of Ultron takes a long, hard look at gods, monsters, and the humans in-between.) How often do we ask ourselves why we created God and the Devil? We’ve been questioning our own existence for thousands of years – where we came from and what we’ll leave behind – so to have those ideas pumped into a $300 million superhero sequel, albeit to varying degrees of success, is something of note. We’re well into Marvel being the biggest thing in popular culture with Avengers: Infinity War, but the questions asked by Joss Whedon’s medial crossover are of particular interest when it comes to the Avengers’ iconography. By 2015, our entertainment landscape had become dominated by the violent Übermensch in a visage of childlike fantasy, and it warranted artistic introspection. Avengers: Age of Ultron is not some Watchmen-esque deconstruction; then again, neither was the 2009 Watchmen movie, which took straight from the pages of the 1986 comic series rather than drawing from the culture around it. Age of Ultron on the other hand came out a mere two years after the destruction debate post-Man of Steel, which focused largely on civilian causalities. Whether as response to the new tenor of superhero conversation or as a means to set up Captain America: Civil War (or both; the intent isn’t mutually exclusive), Age of Ultron places similar debates in its crosshairs, first by making its characters’ top priority the protection of civilians, and then by exploring the ways in which they ought to go about it. The film forces the Avengers to contend with their in-world legacy as a means to explore their fictional legacy on-screen. It’s a narrative nexus, building on what came before while setting up Marvel’s future, as it attempts to define that very nexus for each of its characters. A mirror to our modern pantheon. Read More » ‘Guardians of the Galaxy’ Goes Cosmic and Gives Marvel Its Raw, Beating Heart Posted on Friday, April 13th, 2018 by Siddhant Adlakha (Welcome to Road to Infinity War, a new series where we revisit the first 18 movies of the Marvel Cinematic Universe and ask “How did we get here?” In this edition: Guardians of the Galaxy gets weird, and it’s spectacular.) Flashback, Comic Con 2012. Marvel Studios head honcho Kevin Feige announces development on Guardians of the Galaxy, to which even seasoned Marvel readers respond: “Wait… Who?” Flashback, Comic Con 2013. Marvel plays the first public footage from the new James Gunn joint to a crowd who had no idea what to expect. I would know. I was there, buzzing with bewildered excitement. And from the moment we got a glimpse of this thing – a sizzle reel not dissimilar from the film’s first trailer – we knew we were in for something special. Flash forward, April 2018. The Guardians’ upcoming team-up with the Avengers is currently outselling the last seven Marvel movies combined. Gunn’s superhero space-opera existed independently of the rest of the Marvel Universe (unless you count post-credit scenes, which I do not) and it seemed to exist independently from most sci-fi films in general. Equal parts grimy and bursting with colour, it felt like bright new world that had been used and lived in by ingrates not unlike ourselves. From an idyllic, multi-species utopia led by Marvel’s Nova Corps, to a floating space-penitentiary with alien inmates of all stripes, even to a mining colony within the severed head of an ancient Celestial, the film departed from its relatively grounded predecessors and marked Marvel Studios going full-Marvel Comics. While Asgard in Thor featured a familiar regality, Guardians of the Galaxy represented a major step out into the larger Marvel cosmos, starting off on Earth before ending up in far-flung corners of an unfamiliar universe – though not without the right characters to guide us through it. Read More »	{ "pile_set_name": "OpenWebText2" }
/* -- mode: c++; -- ----------------------------------------------------------------------------- $RCSfile: String.h,v $ * * See Copyright for the status of this software. * * The OpenSOAP Project * http://opensoap.jp/ ----------------------------------------------------------------------------- / #ifndef OpenSOAP_String_H #define OpenSOAP_String_H #include <OpenSOAP/ByteArray.h> #include <stdarg.h> /** * @file OpenSOAP/String.h * @brief OpenSOAP API String Processing * @author * OpenSOAP Development Team / #ifdef __cplusplus extern "C" { #endif / __cplusplus / /* * @typedef struct tagOpenSOAPString OpenSOAPString * @brief OpenSOAPString Structure Type Definition / typedef struct tagOpenSOAPString OpenSOAPString; /* * @typedef OpenSOAPString OpenSOAPStringPtr @brief OpenSOAPString Pointer Type Definition / typedef OpenSOAPString OpenSOAPStringPtr; /** * @fn int OpenSOAPStringCreate(OpenSOAPStringPtr str) @brief Create 0 length OpenSOAP Character String * @param * str OpenSOAPStringPtr * [out] ((\|str\|)) OpenSOAP String * @return * Error Code / int OPENSOAP_API OpenSOAPStringCreate(/ [out] / OpenSOAPStringPtr str); /** * @fn int OpenSOAPStringCreateWithMB(const char mb_str, OpenSOAPStringPtr str) * @brief Create OpenSOAP Character String Initialized With a MultiByte String * @param * mb_str const char * [in] ((\|mb_str\|)) MultiByte Character String * @param * str OpenSOAPStringPtr * [out] ((\|str\|)) Created OpenSOAP Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringCreateWithMB(/ [in] / const char mb_str, /* [out] / OpenSOAPStringPtr str); /** * @fn int OpenSOAPStringCreateWithWC(const wchar_t wc_str, OpenSOAPStringPtr str) * @brief Create OpenSOAP Character String Initialized With a WideCharacter String * @param * wc_str const wchar_t * [in] ((\|wc_str\|)) Wide Character String * @param * str OpenSOAPStringPtr * [out] ((\|str\|)) Created OpenSOAP Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringCreateWithWC(/ [in] / const wchar_t wc_str, /* [out] / OpenSOAPStringPtr str); /** * @fn int OpenSOAPStringCreateWithCharEncodingString(const char char_enc, OpenSOAPByteArrayPtr char_enc_str, OpenSOAPStringPtr str) * @brief Create OpenSOAP Character String Initialized With a Character-encoding Specified String * @param * char_enc const char * [in] ((\|char_enc\|)) Character Encoding * @param * char_enc_str OpenSOAPByteArrayPtr [in] ((\|char_enc_str\|)) Character String * @param * str OpenSOAPStringPtr * [out] ((\|str\|)) Created OpenSOAP Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringCreateWithCharEncodingString(/ [in] / const char char_enc, /* [in] / OpenSOAPByteArrayPtr char_enc_str, / [out] / OpenSOAPStringPtr str); /** * @fn int OpenSOAPStringCreateWithUTF8(const char utf8Str, OpenSOAPStringPtr str) * @brief Create OpenSOAP Character String Initialized With a UTF-8 Encoded String * @param * utf8Str const char * [in] ((\|utf8Str\|)) UTF-8 encoded string * @param * str OpenSOAPStringPtr * [out] ((\|str\|)) Created OpenSOAP Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringCreateWithUTF8(/ [in] / const char utf8Str, /* [out] / OpenSOAPStringPtr str); /** * @fn int OpenSOAPStringRetain(OpenSOAPStringPtr str) * @brief Add a Reference to a Resource * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringRetain(/ [in] / OpenSOAPStringPtr str); /* * @fn int OpenSOAPStringRelease(OpenSOAPStringPtr str) * @brief Remove a Reference. If the number of references is zero, release the resource. * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringRelease(/ [in] / OpenSOAPStringPtr str); /* * @fn int OpenSOAPStringGetLengthMB(OpenSOAPStringPtr str, size_t len) @brief Get length of MultiByte Stringv for the current locale. * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP Character String * @param * len size_t * [out] ((\|len\|)) length * @return * Error Code / int OPENSOAP_API OpenSOAPStringGetLengthMB(/ [in] / OpenSOAPStringPtr str, / [out] / size_t len); /** * @fn int OpenSOAPStringGetLengthWC(OpenSOAPStringPtr str, size_t len) @brief Get length of WideCharacter String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP Character String * @param * len size_t * [out] ((\|len\|)) length * @return * Error Code / int OPENSOAP_API OpenSOAPStringGetLengthWC(/ [in] / OpenSOAPStringPtr str, / [out] / size_t len); /** * @fn int OpenSOAPStringGetStringMBWithAllocator(OpenSOAPStringPtr str, char * (memAllocator)(size_t), size_t len, char *mbStr) @brief OpenSOAP String GetStringMB with memAllocator * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP Character String * @param * memAllocator() char * [in] ( * ((\|memAllocator\|)) )(size_t) memAllocator function pointer. If NULL, memAllocator acts like (char )malloc(size). @param * len size_t * [out] ((\|len\|)) length return buffer pointer. If NULL, no effect. * @param * mbStr char ** [out] ((\|mbStr\|)) MB string return buffer pointer. If NULL, then error. * @note * After calling this function, the memory allocated to mbStr should be released. @return * Error Code / int OPENSOAP_API OpenSOAPStringGetStringMBWithAllocator(/ [in] / OpenSOAPStringPtr str, / [in] / char (memAllocator)(size_t), / [out] / size_t len, /* [out] / char mbStr); /* * @fn int OpenSOAPStringGetStringWCWithAllocator(OpenSOAPStringPtr str, wchar_t * (memAllocator)(size_t), size_t len, wchar_t *wcStr) @brief OpenSOAP String GetStringWC with memAllocator * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP Character String * @param * memAllocator() wchar_t * [in] ( * ((\|memAllocator\|)) )(size_t) memAllocator function pointer. If NULL, memAllocator acts like (char )malloc(size). @param * len size_t * [out] ((\|len\|)) length return buffer pointer. If NULL, no effect. * @param * wcStr wchar_t ** [out] ((\|wcStr\|)) WC string return buffer pointer. If NULL, then error. * @note * After calling this function, the memory allocated to wcStr should be released. @return * Error Code / int OPENSOAP_API OpenSOAPStringGetStringWCWithAllocator(/ [in] / OpenSOAPStringPtr str, / [in] / wchar_t (memAllocator)(size_t), / [out] / size_t len, /* [out] / wchar_t wcStr); /* * @fn int OpenSOAPStringGetStringUTF8WithAllocator(OpenSOAPStringPtr str, char * (memAllocator)(size_t), size_t len, char *utf8Str) @brief OpenSOAP String GetString as UTF-8 encoding with memAllocator * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP Character String * @param * memAllocator() char * [in] ( * ((\|memAllocator\|)) )(size_t) memAllocator function pointer. If NULL, memAllocator acts like (char )malloc(size). @param * len size_t * [out] ((\|len\|)) length return buffer pointer. If NULL, no effect. * @param * utf8Str char ** [out] ((\|utf8Str\|)) UTF8 string return buffer pointer. If NULL, then error. * @note * After calling this function, the memory allocated to utf8Str should be released. @return * Error Code / int OPENSOAP_API OpenSOAPStringGetStringUTF8WithAllocator(/ [in] / OpenSOAPStringPtr str, / [in] / char (memAllocator)(size_t), / [out] / size_t len, /* [out] / char utf8Str); /* * @fn int OpenSOAPStringGetStringMB(OpenSOAPStringPtr str, size_t len, char mb_Str) * @brief Get MultiByte String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * len size_t * [in, out] ((\|len\|)) size. * @param * mb_Str char * [out] ((\|mb_str\|)) Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringGetStringMB(/ [in] / OpenSOAPStringPtr str, / [in, out] / size_t len, /* [out] / char mb_Str); /** * @fn int OpenSOAPStringGetStringWC(OpenSOAPStringPtr str, size_t len, wchar_t wc_str) * @brief Get WideCharacter String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * len size_t * [in, out] ((\|len\|)) size. * @param * wc_str char * [out] ((\|wc_str\|)) Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringGetStringWC(/ [in] / OpenSOAPStringPtr str, / [in, out] / size_t len, /* [out] / wchar_t wc_str); /** * @fn int OpenSOAPStringGetCharEncodingString(OpenSOAPStringPtr str, const char char_enc, OpenSOAPByteArrayPtr char_enc_str) @brief Get character encoding string * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * char_enc const char * [in] ((\|charEnc\|)) character encoding * @param * char_enc_str OpenSOAPByteArrayPtr [out] ((\|charEncStr\|)) Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringGetCharEncodingString(/ [in] / OpenSOAPStringPtr str, / [in] / const char char_enc, /* [out] / OpenSOAPByteArrayPtr char_enc_str); /* * @fn int OpenSOAPStringSetStringMB(OpenSOAPStringPtr str, const char mb_str) @brief Set MultiByte Character string for the current locale * @param * str OpenSOAPStringPtr [in, out] ((\|str\|)) OpenSOAP String * @param * mb_str char * [in] ((\|mb_str\|)) Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringSetStringMB(/ [in] / OpenSOAPStringPtr str, / [in] / const char mb_str); /** * @fn int OpenSOAPStringSetStringWC(OpenSOAPStringPtr str, const wchar_t wc_str) @brief Set WideCharacter string * @param * str OpenSOAPStringPtr [in, out] ((\|str\|)) OpenSOAP String * @param * wc_str const wchar_t * [in] ((\|wc_str\|)) Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringSetStringWC(/ [in] / OpenSOAPStringPtr str, / [in] / const wchar_t wc_str); /** * @fn int OpenSOAPStringSetCharEncodingString(OpenSOAPStringPtr str, const char char_enc, OpenSOAPByteArrayPtr charEncStr) @brief Set character encoding string for the current locale * @param * str OpenSOAPStringPtr [in, out] ((\|str\|)) OpenSOAP String * @param * char_enc const char * [in] ((\|charEnc\|)) Character encoding * @param * charEncStr OpenSOAPByteArrayPtr [in] ((\|charEncStr\|)) Character String * @return * Error Code / int OPENSOAP_API OpenSOAPStringSetCharEncodingString(/ [out] / OpenSOAPStringPtr str, / [in] / const char char_enc, /* [in] / OpenSOAPByteArrayPtr charEncStr); /* * @fn int OpenSOAPStringSetStringUTF8(OpenSOAPStringPtr str, const char utf8Str) @brief Set UTF-8 encoded string * @param * str OpenSOAPStringPtr [out] ((\|str\|)) * @param * utf8Str const char * [in] ((\|utf8Str\|)) * @return * Error Code / int OPENSOAP_API OpenSOAPStringSetStringUTF8(/ [out] / OpenSOAPStringPtr str, / [in] / const char utf8Str); /** * @fn int OpenSOAPStringFormatMB(OpenSOAPStringPtr str, const char format, ...) @brief Format MultiByte String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * format const char * [in] ((\|format\|)) Format String * @param * ... Variable parameters * @return * Error Code / int OPENSOAP_API OpenSOAPStringFormatMB(/ [out] / OpenSOAPStringPtr str, / [in] / const char format, ...); /** * @fn int OpenSOAPStringFormatWC(OpenSOAPStringPtr str, const wchar_t format, ...) @brief Format WideCharacter String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * format const wchar_t * [in] ((\|format\|)) Format String * @param * ... Variable parameters * @return * Error Code / int OPENSOAP_API OpenSOAPStringFormatWC(/ [out] / OpenSOAPStringPtr str, / [in] / const wchar_t format, ...); /** * @fn int OpenSOAPStringVFormatMB(OpenSOAPStringPtr str, const char format, va_list ap) @brief Format MultiByte String with va_list * @param * str [out] OpenSOAP String * @param * format [in] Format String * @param * ap [in] Variable parameters * @return * Error Code / int OPENSOAP_API OpenSOAPStringVFormatMB(/ [out] / OpenSOAPStringPtr str, / [in] / const char format, /* [in] / va_list ap); /* * @fn int OpenSOAPStringVFormatWC(OpenSOAPStringPtr str, const wchar_t format, va_list ap) @brief Format WideCharacter String with va_list * @param * str [out] OpenSOAP String * @param * format [in] Format String * @param * ap [in] Variable parameters * @return * Error Code / int OPENSOAP_API OpenSOAPStringVFormatWC(/ [out] / OpenSOAPStringPtr str, / [in] / const wchar_t format, /* [in] / va_list ap); /* * @fn int OpenSOAPStringCompareMB(OpenSOAPStringPtr str, const char cmp_str, int cmp_rslt) * @brief Compare MultiByte String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * cmp_str const char * [in] ((\|cmp_str\|)) Character String * @param * cmp_rslt int * [out] ((\|cmp_rslt\|)) Comparison Result. Same as for strcmp(). * @return * Error Code / int OPENSOAP_API OpenSOAPStringCompareMB(/ [in] / OpenSOAPStringPtr str, / [in] / const char cmp_str, /* [out] / int cmp_rslt); /** * @fn int OpenSOAPStringCompareWC(OpenSOAPStringPtr str, const wchar_t cmp_str, int cmp_rslt) * @brief Compare WideCharacter String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * cmp_str const wchar_t * [in] ((\|cmp_str\|)) Character String * @param * cmp_rslt int * [out] ((\|cmp_rslt\|)) Comparison Result. Same as for strcmp(). * @return * Error Code / int OPENSOAP_API OpenSOAPStringCompareWC(/ [in] / OpenSOAPStringPtr str, / [in] / const wchar_t cmp_str, /* [out] / int cmp_rslt); /** * @fn int OpenSOAPStringCompare(OpenSOAPStringPtr str, OpenSOAPStringPtr cmp_str, int cmp_rslt) @brief Compare String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * cmp_str OpenSOAPStringPtr [in] ((\|cmp_str\|)) Character String * @param * cmp_rslt int * [out] ((\|cmp_rslt\|)) Comparison Result. Same as for strcmp(). * @return * Error Code / int OPENSOAP_API OpenSOAPStringCompare(/ [in] / OpenSOAPStringPtr str, / [in] / OpenSOAPStringPtr cmp_str, / [out] / int cmp_rslt); /** * @fn int OpenSOAPStringFindStringMB(OpenSOAPStringPtr str, const char find_str, size_t idx) * @brief Find String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * find_str const char * [in] ((\|find_str\|)) Search string * @param * idx size_t * [in, out] ((\|idx\|)) [in]:Search start index; [out]:Search result index. * @return * Error Code / int OPENSOAP_API OpenSOAPStringFindStringMB(/ [in] / OpenSOAPStringPtr str, / [in] / const char find_str, /* [in, out] / size_t idx); /** * @fn int OpenSOAPStringFindStringWC(OpenSOAPStringPtr str, const wchar_t find_str, size_t idx) * @brief Find String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * find_str const wchar_t * [in] ((\|find_str\|)) Search string * @param * idx size_t * [in, out] ((\|idx\|)) [in]:Search start index; [out]:Search result index. * @return * Error Code / int OPENSOAP_API OpenSOAPStringFindStringWC(/ [in] / OpenSOAPStringPtr str, / [in] / const wchar_t find_str, /* [in, out] / size_t idx); /** * @fn int OpenSOAPStringFindString(OpenSOAPStringPtr str, OpenSOAPStringPtr find_str, size_t idx) @brief Find String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * find_str OpenSOAPStringPtr [in] ((\|find_str\|)) Search string * @param * idx size_t * [in, out] ((\|idx\|)) [in]:Search start index; [out]:Search result index. * @return * Error Code / int OPENSOAP_API OpenSOAPStringFindString(/ [in] / OpenSOAPStringPtr str, / [in] / OpenSOAPStringPtr find_str, / [in, out] / size_t idx); /** * @typedef int (OpenSOAPStringFindIfFunc)(void opt, wchar_t c, int judge) @brief Find String Function Pointer Type Definition * @param * opt void * [in] Find Function Option * @param * c wchar_t [in] * @param * judge int * [out] Result * @return * Error Code / typedef int (OpenSOAPStringFindIfFunc)(/* [in, out] / void opt, /* [in] / wchar_t c, / [out] / int judge); /** * @fn int OpenSOAPStringFindIfStringIndex(OpenSOAPStringPtr str, OpenSOAPStringFindIfFunc find_func, void find_func_opt, size_t idx) * @brief Find String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * find_func OpenSOAPStringFindIfFunc [in] ((\|find_func\|)) Search condition function * @param * find_func_opt void * [in] ((\|find_func_opt\|)) Search condition function first parameter * @param * idx size_t * [in, out] ((\|idx\|)) [in]:Search start index; [out]:Search result index. * @return * Error Code / extern int OPENSOAP_API OpenSOAPStringFindIfStringIndex(/ [in] / OpenSOAPStringPtr str, / [in] / OpenSOAPStringFindIfFunc find_func, / [in] / void find_func_opt, /* [in, out] / size_t idx); /** * @fn int OpenSOAPStringReplaceStringMB(OpenSOAPStringPtr str, const char find_str, const char rplc_str, size_t idx) @brief Replace String * @param * str OpenSOAPStringPtr [in, out] ((\|str\|)) OpenSOAP String * @param * find_str const char * [in] ((\|find_str\|)) Search string * @param * rplc_str const char * [in] ((\|rplc_str\|)) Replacement string * @param * idx size_t * [in, out] ((\|idx\|)) [in]:Search start index; [out]:Replacement start index. If can't replace, set (size_)(-1). * @return * Error Code / int OPENSOAP_API OpenSOAPStringReplaceStringMB(/ [in, out] / OpenSOAPStringPtr str, / [in] / const char find_str, /* [in] / const char rplc_str, /* [in, out] / size_t idx); /** * @fn int OpenSOAPStringReplaceStringWC(OpenSOAPStringPtr str, const wchar_t find_str, const wchar_t rplc_str, size_t idx) @brief Replace String * @param * str OpenSOAPStringPtr [in, out] ((\|str\|)) OpenSOAP String * @param * find_str const wchar_t * [in] ((\|find_str\|)) Search string * @param * rplc_str const wchar_t * [in] ((\|rplc_str\|)) Replacement string * @param * idx size_t * [in, out] ((\|idx\|)) [in]:Search start index; [out]:Replacement start index. If can't replace, set (size_)(-1). * @return * Error Code / int OPENSOAP_API OpenSOAPStringReplaceStringWC(/ [in, out] / OpenSOAPStringPtr str, / [in] / const wchar_t find_str, /* [in] / const wchar_t rplc_str, /* [in, out] / size_t idx); /** * @fn int OpenSOAPStringReplaceString(OpenSOAPStringPtr str, OpenSOAPStringPtr find_str, OpenSOAPStringPtr rplc_str, size_t idx) @brief Replace String * @param * str OpenSOAPStringPtr [in, out] ((\|str\|)) OpenSOAP String * @param * find_str OpenSOAPStringPtr [in] ((\|find_str\|)) Search string * @param * rplc_str OpenSOAPStringPtr [in] ((\|rplc_str\|)) Replacement string * @param * idx size_t * [in, out] ((\|idx\|)) [in]:Search start index; [out]:Replacement start index. If can't replace, set (size_)(-1). * @return * Error Code / int OPENSOAP_API OpenSOAPStringReplaceString(/ [in, out] / OpenSOAPStringPtr str, / [in] / OpenSOAPStringPtr find_str, / [in] / OpenSOAPStringPtr rplc_str, / [in, out] / size_t idx); /** * @fn int OpenSOAPStringClear(OpenSOAPStringPtr str) * @brief Clear OpenSOAPString, set length to 0 * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @return * Error Code / int OPENSOAP_API OpenSOAPStringClear(/ [out] / OpenSOAPStringPtr str); /* * @fn int OpenSOAPStringAppendMB(OpenSOAPStringPtr str, const char mb_str, size_t mb_len) @brief Concatenate MB String To OpenSOAPString for current locale * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * mb_str char * [in] ((\|mb_str\|)) Concatenate string * @param * mb_len size_t [in] ((\|mb_len\|)) Concatenate string number of characters. If 0, concatenate the entire mb_str. * @return * Error Code / int OPENSOAP_API OpenSOAPStringAppendMB(/ [out] / OpenSOAPStringPtr str, / [in] / const char mb_str, /* [in] / size_t mb_len); /* * @fn int OpenSOAPStringAppendWC(OpenSOAPStringPtr str, const wchar_t wc_str, size_t wc_len) @brief Concatenate WC String To OpenSOAPString * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * wc_str wchar_t * [in] ((\|wc_str\|)) Concatenate string * @param * wc_len size_t [in] ((\|wc_len\|)) Concatenate string number of characters. If 0, concatenate the entire wc_str. * @return * Error Code / int OPENSOAP_API OpenSOAPStringAppendWC(/ [out] / OpenSOAPStringPtr str, / [in] / const wchar_t wc_str, /* [in] / size_t wc_len); /* * @fn int OpenSOAPStringDuplicate(OpenSOAPStringPtr str, OpenSOAPStringPtr dup_str) @brief Duplicate String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * dup_str OpenSOAPStringPtr * [out] ((\|dup_str\|)) Duplicate string * @return * Error Code / int OPENSOAP_API OpenSOAPStringDuplicate(/ [in] / OpenSOAPStringPtr str, / [out] / OpenSOAPStringPtr dup_str); /** * @fn int OpenSOAPStringGetSubstring(OpenSOAPStringPtr str, size_t beg, size_t len, OpenSOAPStringPtr sub_str) @brief Duplicate String * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * beg size_t [in] ((\|beg\|)) Substring start index * @param * len size_t [in] ((\|len\|)) Substring length. If len == -1 then copy to end of string. * @param * sub_str OpenSOAPStringPtr * [out] ((\|sub_str\|)) Substring * @return * Error Code / int OPENSOAP_API OpenSOAPStringGetSubstring(/ [in] / OpenSOAPStringPtr str, / [in] / size_t beg, / [in] / size_t len, / [out] / OpenSOAPStringPtr sub_str); /** * @fn int OpenSOAPStringConvertCharEncoding(const char from_enc, OpenSOAPByteArrayPtr from_str, const char to_enc, OpenSOAPByteArrayPtr to_str) * @brief Convert character encoding. This function does not use the OpenSOAP member, but is used for string processing. * @param * from_enc const char * [in] ((\|fromEnc\|)) Convert source character encoding. If NULL or "" then current locale encoding. * @param * from_str OpenSOAPByteArrayPtr [in] ((\|fromStr\|)) Convert source string data. * @param * to_enc const char * [in] ((\|toEnc\|)) Convert destination character encoding. If NULL or "" then current locale encoding. * @param * to_str OpenSOAPByteArrayPtr [out] ((\|toStr\|)) Convert destination string data. If fromEnc equal to toEnc, then copy fromStr to toStr. * @return * Error Code / int OPENSOAP_API OpenSOAPStringConvertCharEncoding(/ [in] / const char from_enc, /* [in] / OpenSOAPByteArrayPtr from_str, / [in] / const char to_enc, /* [out] / OpenSOAPByteArrayPtr to_str); /* * @fn int OpenSOAPStringConvertXMLCharRefToUTF8(const unsigned char utf8Beg, OpenSOAPByteArrayPtr utf8BAry) @brief Convert XML's CharRef to UTF-8 encoding. This function does not use the OpenSOAP member, but is used for string processing. * @param * utf8Beg const unsigned char * [in] ((\|utf8Beg\|)) Convert source UTF-8 encode string data begin pointer. * @param * utf8BAry OpenSOAPByteArrayPtr [out] ((\|toStr\|)) Convert destination string data. * @return * Error Code / int OPENSOAP_API OpenSOAPStringConvertXMLCharRefToUTF8(/ [in] / const unsigned char utf8Beg, /* [out] / OpenSOAPByteArrayPtr utf8BAry); /* * @fn int OpenSOAPStringGetStringUSASCII(OpenSOAPStringPtr str, OpenSOAPByteArrayPtr charEncStr) * @brief Get US-ASCII string * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * charEncStr OpenSOAPByteArrayPtr [out] ((\|charEncStr\|)) output buffer * @return * Error Code / int OPENSOAP_API OpenSOAPStringGetStringUSASCII(/ [in] / OpenSOAPStringPtr str, / [out] / OpenSOAPByteArrayPtr charEncStr); /* * @fn int OpenSOAPStringIterateProc(OpenSOAPStringPtr str, int (iterateProc)(unsigned long c, size_t idx, size_t len, void opt), int (beforeProc)(size_t len, void opt), int (afterProc)(size_t len, void opt), void opt) @brief Iterate procedure * @param * str OpenSOAPStringPtr [in] ((\|str\|)) OpenSOAP String * @param * iterateProc() int [in] ( * ((\|iterateProc\|)) )(unsigned long, size_t, size_t, void ) iterate procedure @param * beforeProc() int [in] ( * ((\|beforeProc\|)) )(size_t, void ) Before iterate procedure. If NULL, then no effect @param * afterProc() int [in] ( * ((\|afterProc\|)) )(size_t, void ) After iterate procedure. If NULL, then no effect @param * opt void * [in, out] ((\|opt\|)) iterateProc, beforeProc, and afterProc's option parameters. * @return * Error Code / int OPENSOAP_API OpenSOAPStringIterateProc(/ [in] / OpenSOAPStringPtr str, / [in] / int (iterateProc)(unsigned long c, size_t idx, size_t len, void opt), / [in] / int (beforeProc)(size_t len, void opt), / [in] / int (afterProc)(size_t len, void opt), / [in, out] / void opt); #ifdef __cplusplus } #endif /* __cplusplus / #endif / OpenSOAP_String_H */	{ "pile_set_name": "Github" }
FILED NOT FOR PUBLICATION AUG 02 2010 MOLLY C. DWYER, CLERK UNITED STATES COURT OF APPEALS U .S. C O U R T OF APPE ALS FOR THE NINTH CIRCUIT LOUIS EUGENE CUNNINGHAM, No. 08-35913 Plaintiff - Appellant, D.C. No. 1:05-cv-00515-FVS v. MEMORANDUM * SGT. FLETCHER, Sgt. Mail Room Operations; et al., Defendants - Appellees. Appeal from the United States District Court for the District of Idaho Fred L. Van Sickle, District Judge, Presiding Submitted July 19, 2010 ** Before: B. FLETCHER, REINHARDT, and WARDLAW, Circuit Judges. Louis Eugene Cunningham, an Idaho state prisoner, appeals pro se from the district court’s judgment dismissing his 42 U.S.C. § 1983 action for failure to effect service of process. We have jurisdiction under 28 U.S.C. § 1291. We * This disposition is not appropriate for publication and is not precedent except as provided by 9th Cir. R. 36-3. ** The panel unanimously concludes this case is suitable for decision without oral argument. See Fed. R. App. P. 34(a)(2). review for an abuse of discretion. Rio Props., Inc. v. Rio Int’l Interlink, 284 F.3d 1007, 1014 (9th Cir. 2002). We reverse and remand. Cunningham substantially complied with Rule 4 of the Federal Rules of Civil Procedure by serving the summons and the original complaint on a Deputy Attorney General, and attempting to serve the operative complaint on Michael J. Elia, who was appointed Special Deputy Attorney General for the purpose of representing defendants in this case. See Travelers Cas. & Sur. Co. of Am. v. Brenneke, 551 F.3d 1132, 1135 (9th Cir. 2009) (so long as there is substantial compliance with Rule 4 and the defendant receives sufficient notice of the complaint, Rule 4 is to be liberally construed to uphold service); Idaho Admin. Code r.06.01.01.106 (2010) (requiring service of summons, complaints, and subpoenas against or upon the Idaho Department of Corrections and its employees to be made upon the deputy attorneys general assigned to the Department in the manner and form required by state and federal rules of procedure). Accordingly, we reverse the judgment and remand for further proceedings. REVERSED and REMANDED. 2 08-35913	{ "pile_set_name": "FreeLaw" }

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.