text
stringlengths 1
964k
| meta
dict |
|---|---|
Many vehicles, such as aircraft, cars, trucks, etc., have one or more hydraulic systems which are drives or transmission systems that use pressurized hydraulic fluid to power hydraulic machinery. For example, early vehicles had hydraulic brake systems. As vehicles became more sophisticated, newer systems with hydraulic power were developed. Hydraulic systems in, for example, an aircraft provide for the operation of vehicle components, such as landing gear, flaps, flight control surfaces, and brakes.
A hydraulic system has a power generating device (pump) reservoir, accumulator, heat exchanger, and filtering system. System operating pressure may vary from a couple hundred pounds per square inch (psi) in small vehicles and rotorcraft to 5,000 psi in large vehicles.
Hydraulic system fluids (“hydraulic fluids”) flow through components of the hydraulic system during use to transmit and distribute forces to various components of the hydraulic system. If a number of passages exist in a system, pressure can be distributed through the various components of the system. Hydraulic operations have only negligible loss due to fluid friction.
If incompressibility and fluidity were the only qualities required, most liquids that are not too thick could be used in a hydraulic system. However, other properties should be considered when selecting a desired hydraulic fluid for a particular hydraulic system.
One of those properties is viscosity, which is a resistance of the fluid to flow. A liquid such as gasoline that has a low viscosity flows easily, while a liquid such as tar that has a high viscosity flows slowly. Viscosity increases as temperature decreases. A liquid for a given hydraulic system should have enough viscosity to give a good seal at pumps, valves, and pistons, but should not be so thick that it offers resistance to flow, leading to power loss and higher operating temperatures which may promote wear of hydraulic system components. A fluid that is not viscous enough can wear moving parts or parts that have heavy loads.
Another property pertinent to hydraulic fluids is the fire point of the fluid, which is the temperature at which a substance gives off vapor in sufficient quantity to ignite and continue to burn when exposed to a spark or flame. Like a flash point, a high fire point is desirable of hydraulic liquids.
Known hydraulic fluids do not possess ideal properties as discussed above. Polyalphaolefin-based hydraulic fluids are fire-resistant but have a high viscosity and are limited to use down to −40° F. Phosphate ester-based (Skydrol®) hydraulic fluids are not entirely fire-resistant and under certain conditions, they burn. Furthermore, polyalphaolefin-based hydraulic fluids and phosphate ester-based hydraulic fluids do not mix with each other. Furthermore, fluorocarbon-based hydraulic fluids tend to degrade paint and titanium couplings on the hydraulic lines of a hydraulic system. There is also a movement to ban production of chlorocarbon-based and fluorocarbon-based hydraulic fluids because of their toxicity and poor biodegradability. For example, chloroparaffins are stable in soil and persist in soil for years, having a half-life (T1/2) of at least months to years.
Furthermore, synthesis of hydraulic fluids tends to be laborious and cost intensive. Conventional reactions, such as the Arbuzov reaction, do not yield hydraulic fluids having ideal properties as described above. An Arbuzov reaction proceeds by reacting a primary alkyl halide with a phosphite to form a primary phosphono-substituted product. The Arbuzov reaction does not proceed readily using primary, secondary, or tertiary fluoro alkane starting material or using secondary or tertiary chloro-, bromo-, iodo-alkane starting materials.
Therefore, there is a need in the art for new and improved hydraulic fluids and methods of making hydraulic fluids.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Q:
Can't upload data to my Parse Server throught my Android Studio project
I have trouble using my Parse Server that I created using Amazon Web Service.
I try to add a user through ParseUser in my MainActivity with a Button onClick method but it doesn't work for some reason...
The error is :
Error : com.parse.ParseRequest$ParseRequestException: i/o failure
It all worked well yesterday btw, but it was in Android Studio version 2.2.1. But today I want to try it on the updated version 3.4.1. I had to modify some lines in the Gradle files but nothing elsewhere so I don't know if it's relevant.
I don't know either what info you need to help me so I'm gonna put everything that might be implied...
Sorry for the very long message
My MainActivity class:
public class MainActivity extends AppCompatActivity {
public void signUpClick(View view) {
EditText usernameEditText = (EditText) findViewById(R.id.usernameEditText);
EditText passwordEditText = (EditText) findViewById(R.id.passwordEditText);
if (passwordEditText.getText().toString().equals("") || usernameEditText.getText().toString().equals("")) {
Toast.makeText(this, "As username and password are required", Toast.LENGTH_SHORT).show();
} else {
ParseUser user = new ParseUser();
user.setUsername(usernameEditText.getText().toString());
user.setPassword(passwordEditText.getText().toString());
user.signUpInBackground(new SignUpCallback() {
@Override
public void done(ParseException e) {
if (e == null) {
Log.i("test", "Success");
} else {
Toast.makeText(MainActivity.this, e.getMessage(), Toast.LENGTH_SHORT).show();
Log.i("test", "Fail. Error : " + e.toString());
e.printStackTrace();
}
}
});
}
}
@Override
protected void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
setContentView(R.layout.activity_main);
ParseAnalytics.trackAppOpenedInBackground(getIntent());
}
}
A screenshot of my PuTTY session where I read the info of my server in the config.json :
[screenshot][1]
My StarterApplication class where I define my server information:
public class StarterApplication extends Application {
@Override
public void onCreate() {
super.onCreate();
// Enable Local Datastore.
Parse.enableLocalDatastore(this);
// Add your initialization code here
Parse.initialize(new Parse.Configuration.Builder(getApplicationContext())
.applicationId("myappID")
.clientKey("eXK4EAJ8lO7I")
.server("http://18.191.227.26/parse/")
.build()
);
//ParseUser.enableAutomaticUser();
ParseACL defaultACL = new ParseACL();
defaultACL.setPublicReadAccess(true);
defaultACL.setPublicWriteAccess(true);
ParseACL.setDefaultACL(defaultACL, true);
}
}
Thank you for your time, please tell me if you need other info.
A:
com.parse.ParseRequest$ParseRequestException: i/o failure
This means there is a problem with your connection. Your parse server may be down or your phone doesn't have internet access.
If you are sure you have an internet connection and a working parse server, then its probably your server doesnt have SSL sertificate(which means you are using http instead of https. See: .server("http://18.191.227.26/parse/"))
After Android 9(including 9) Android prevents connection to unsafe adresses.(ie http connections)
Add this line between your application tag in your AndroidManifiest file
android:usesCleartextTraffic="true"
You can use this while development phase but I recommend you to switch to https.
|
{
"pile_set_name": "StackExchange"
}
|
#!/usr/bin/env sh
if [ "x$npm_config_node_gyp" = "x" ]; then
node "`dirname "$0"`/../../node_modules/node-gyp/bin/node-gyp.js" "$@"
else
"$npm_config_node_gyp" "$@"
fi
|
{
"pile_set_name": "Github"
}
|
Embodiments of the present invention generally relate to safety rail systems.
Safety rail systems are used to prevent workers or other people from falling off of elevated surfaces or to prevent people from entering dangerous or restricted areas. Conventional safety rail systems may be permanent or temporary. Permanent rail systems are installed on site and are typically integrally mounted or constructed to the surface or area to be protected, which presents a number of drawbacks. For example, these rail systems must be designed and specified by a safety expert and a structural expert, who must coordinate with the building's architect for aesthetic considerations. This tremendously increases the building cost. Permanent railing systems also cannot be removed, which may reduce the building's aesthetic appeal. Temporary railing systems may be used instead of permanent rail systems, but they have drawbacks as well. For example, temporary rail systems must be installed before the protected area can be used or worked on. This is time consuming and costly. In addition, the workers installing the temporary railing system either do not have fall protection or must use alternative fall protection, which further increases time and cost. Also, temporary railing systems may be installed incorrectly by unskilled non-safety oriented workers.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
It took just three charts on Bitcoin’s fundamentals for an analyst to convince institutional investors of Bitcoin’s immense underlying value.
Crypto analyst Plan B said he got an ‘amazing response’ from institutional investors when he showed them three charts related to Bitcoin last week.
“It was not a sales pitch, more a peek into the future / alternative investment presentation,” he explained.
“Quants were interested because of asymmetrical returns and rare cointegration. Managers’ main worry was government ban.”
The charts showed three metrics that investors in traditional finance would be familiar with: the Sharpe ratio, its correlation to other assets and his famed Stock to Flow model.
He presented Willy Woo’s chart showing Bitcoin’s Sharpe Ratio over a four year holding period.
It’s calculated by subtracting the risk-free rate of return from the expected return on the asset and dividing it by the standard deviation of returns of the asset.
A ratio above 1.0 is considered acceptable. Bitcoin’s ratio average of 3 outperformed all other assets.
A second chart showed the Bitcoin price was uncorrelated with other assets including shares, fixed income, gold, and oil.
And of course, he wowed them with his Stock to Flow model, which predicts that because of the decrease in supply due to the halving, the Bitcoin price will hit $100,000 next year or in 2021, on its inevitable way towards a $1 million Bitcoin price in 2024.
Bitcoin price assumptions arguable
That’s the bullish take on the Bitcoin price. However, all three of the charts contain various assumptions and are arguable at best.
Despite Bitcoin’s meteoric rise, many would argue with the calculations about the ‘risk-free rate of return’ included in the Sharpe ratio.
Various pundits also think that stock market and gold price moves are starting to affect or coincide with moves in the Bitcoin price and question its status as an uncorrelated asset.
It’s much more highly correlated with European stock markets than US stocks for example.
Doubters include well known Bitcoin bull Thomas Lee from Fundstrat, who tweeted in September:
“Unpopular opinion, Bitcoin won’t make a new high until S&P 500 makes a new high. BTC has been range bound because macro trendless. Confirmed by our Bitcoin Misery Index falling from 66 (50 now). Since 2009, best years for Bitcoin is when S&P 500 >15%.”
Pitched bitcoin to institutional investors last week. Presentation started with these 3 charts: Sharpe ratio (@woonomic ), zero correlation with other assets (@PanteraCapital), correlation and cointegration with stock-to-flow (@100trillionUSD). Amazing response! pic.twitter.com/gDj39MOe7a — PlanB (@100trillionUSD) December 2, 2019
Plan B conceded Bitcoin’s non-correlation would “get interesting during a recession because we haven’t had a real recession since GFC 2008. How will Bitcoin fare when stocks and/or bonds crash?”
In the event of a major crash, Bitcoin holders may be forced to sell to make up other losses, thereby putting downward pressure on prices.
And there’s plenty of doubters over the Stock to Flow model, which tracks supply but can’t forecast demand.
It’s based on the expected halving of supply due to the Bitcoin block reward halving in May next year which reduces the amount of BTC paid to miners for each block from 12.5 BTC to 6.25 BTC.
Morgan Creek Digital co-founder Jason Williams said this week he doesn’t believe the halving will move markets or do much for the Bitcoin price.
“Bitcoin halving in May 2020 won’t do anything to the price. It will be a non-event,” he summarized.
Unpopular Opinion – Bitcoin halving in May 2020 won’t do anything to the price. It will be a non-event. — Jason A. Williams ???? (@JWilliamsFstmed) December 1, 2019
Researchers from algorithmic trading software company Strix Leviathan analyzed the history of 32 halving events and concluded the widely believed halving price spike narrative is “a myth”.
Bitcoin’s recent bearish price action doesn’t seem in keeping with the forecasts (though Plan B disagrees) and Litecoin has crashed in price and hash rate since its halving this year.
Willy Woo also isn’t a big believer. A couple of weeks ago he tweeted he was short term bearish. “Don’t expect price to repeat past halvings”.
|
{
"pile_set_name": "OpenWebText2"
}
|
Quirky observations about Life in Japan, Canada and the world at large.
2007-03-02
I know it's their year but...
Herds of wild boars have been terrorizing the populace of Tsuruga, a peninsula that juts into the Sea of Japan. The peninsula in Fukui prefecture has been dubbed "the Nuclear Power Plant Peninsula" for it hosts 7 plants. They caught 360 boars last year, some weighing at more than 100 kg.
I think they should count their blessings, there are worse things that could happen in an area with so much radiation. What if one of those little piggies should mutate? Princess Mononoke came across this beastie in her adventures.
About Me
I was born a young white child. After almost 20 years of depressing social work, dealing with all manners of society's dregs, I decided to chuck it all and move to Japan and teach English. Now I'm a happy camper teaching Elementary School kids in Watari, Miyagi.
|
{
"pile_set_name": "Pile-CC"
}
|
#!/usr/bin/env bash
# Copyright 2009 The Go Authors. All rights reserved.
# Use of this source code is governed by a BSD-style
# license that can be found in the LICENSE file.
# Generate Go code listing errors and other #defined constant
# values (ENAMETOOLONG etc.), by asking the preprocessor
# about the definitions.
unset LANG
export LC_ALL=C
export LC_CTYPE=C
if test -z "$GOARCH" -o -z "$GOOS"; then
echo 1>&2 "GOARCH or GOOS not defined in environment"
exit 1
fi
# Check that we are using the new build system if we should
if [[ "$GOOS" = "linux" ]] && [[ "$GOARCH" != "sparc64" ]]; then
if [[ "$GOLANG_SYS_BUILD" != "docker" ]]; then
echo 1>&2 "In the new build system, mkerrors should not be called directly."
echo 1>&2 "See README.md"
exit 1
fi
fi
if [[ "$GOOS" = "aix" ]]; then
CC=${CC:-gcc}
else
CC=${CC:-cc}
fi
if [[ "$GOOS" = "solaris" ]]; then
# Assumes GNU versions of utilities in PATH.
export PATH=/usr/gnu/bin:$PATH
fi
uname=$(uname)
includes_AIX='
#include <net/if.h>
#include <net/netopt.h>
#include <netinet/ip_mroute.h>
#include <sys/protosw.h>
#include <sys/stropts.h>
#include <sys/mman.h>
#include <sys/poll.h>
#include <sys/termio.h>
#include <termios.h>
#include <fcntl.h>
#define AF_LOCAL AF_UNIX
'
includes_Darwin='
#define _DARWIN_C_SOURCE
#define KERNEL
#define _DARWIN_USE_64_BIT_INODE
#include <stdint.h>
#include <sys/attr.h>
#include <sys/types.h>
#include <sys/event.h>
#include <sys/ptrace.h>
#include <sys/socket.h>
#include <sys/sockio.h>
#include <sys/sysctl.h>
#include <sys/mman.h>
#include <sys/mount.h>
#include <sys/utsname.h>
#include <sys/wait.h>
#include <sys/xattr.h>
#include <net/bpf.h>
#include <net/if.h>
#include <net/if_types.h>
#include <net/route.h>
#include <netinet/in.h>
#include <netinet/ip.h>
#include <termios.h>
'
includes_DragonFly='
#include <sys/types.h>
#include <sys/event.h>
#include <sys/socket.h>
#include <sys/sockio.h>
#include <sys/stat.h>
#include <sys/sysctl.h>
#include <sys/mman.h>
#include <sys/mount.h>
#include <sys/wait.h>
#include <sys/ioctl.h>
#include <net/bpf.h>
#include <net/if.h>
#include <net/if_types.h>
#include <net/route.h>
#include <netinet/in.h>
#include <termios.h>
#include <netinet/ip.h>
#include <net/ip_mroute/ip_mroute.h>
'
includes_FreeBSD='
#include <sys/capability.h>
#include <sys/param.h>
#include <sys/types.h>
#include <sys/event.h>
#include <sys/socket.h>
#include <sys/sockio.h>
#include <sys/stat.h>
#include <sys/sysctl.h>
#include <sys/mman.h>
#include <sys/mount.h>
#include <sys/wait.h>
#include <sys/ioctl.h>
#include <net/bpf.h>
#include <net/if.h>
#include <net/if_types.h>
#include <net/route.h>
#include <netinet/in.h>
#include <termios.h>
#include <netinet/ip.h>
#include <netinet/ip_mroute.h>
#include <sys/extattr.h>
#if __FreeBSD__ >= 10
#define IFT_CARP 0xf8 // IFT_CARP is deprecated in FreeBSD 10
#undef SIOCAIFADDR
#define SIOCAIFADDR _IOW(105, 26, struct oifaliasreq) // ifaliasreq contains if_data
#undef SIOCSIFPHYADDR
#define SIOCSIFPHYADDR _IOW(105, 70, struct oifaliasreq) // ifaliasreq contains if_data
#endif
'
includes_Linux='
#define _LARGEFILE_SOURCE
#define _LARGEFILE64_SOURCE
#ifndef __LP64__
#define _FILE_OFFSET_BITS 64
#endif
#define _GNU_SOURCE
// <sys/ioctl.h> is broken on powerpc64, as it fails to include definitions of
// these structures. We just include them copied from <bits/termios.h>.
#if defined(__powerpc__)
struct sgttyb {
char sg_ispeed;
char sg_ospeed;
char sg_erase;
char sg_kill;
short sg_flags;
};
struct tchars {
char t_intrc;
char t_quitc;
char t_startc;
char t_stopc;
char t_eofc;
char t_brkc;
};
struct ltchars {
char t_suspc;
char t_dsuspc;
char t_rprntc;
char t_flushc;
char t_werasc;
char t_lnextc;
};
#endif
#include <bits/sockaddr.h>
#include <sys/epoll.h>
#include <sys/eventfd.h>
#include <sys/inotify.h>
#include <sys/ioctl.h>
#include <sys/mman.h>
#include <sys/mount.h>
#include <sys/prctl.h>
#include <sys/stat.h>
#include <sys/types.h>
#include <sys/time.h>
#include <sys/socket.h>
#include <sys/xattr.h>
#include <linux/if.h>
#include <linux/if_alg.h>
#include <linux/if_arp.h>
#include <linux/if_ether.h>
#include <linux/if_tun.h>
#include <linux/if_packet.h>
#include <linux/if_addr.h>
#include <linux/falloc.h>
#include <linux/filter.h>
#include <linux/fs.h>
#include <linux/kexec.h>
#include <linux/keyctl.h>
#include <linux/magic.h>
#include <linux/memfd.h>
#include <linux/module.h>
#include <linux/netfilter/nfnetlink.h>
#include <linux/netlink.h>
#include <linux/net_namespace.h>
#include <linux/perf_event.h>
#include <linux/random.h>
#include <linux/reboot.h>
#include <linux/rtnetlink.h>
#include <linux/ptrace.h>
#include <linux/sched.h>
#include <linux/seccomp.h>
#include <linux/sockios.h>
#include <linux/wait.h>
#include <linux/icmpv6.h>
#include <linux/serial.h>
#include <linux/can.h>
#include <linux/vm_sockets.h>
#include <linux/taskstats.h>
#include <linux/genetlink.h>
#include <linux/watchdog.h>
#include <linux/hdreg.h>
#include <linux/rtc.h>
#include <linux/if_xdp.h>
#include <mtd/ubi-user.h>
#include <net/route.h>
#include <asm/termbits.h>
#ifndef MSG_FASTOPEN
#define MSG_FASTOPEN 0x20000000
#endif
#ifndef PTRACE_GETREGS
#define PTRACE_GETREGS 0xc
#endif
#ifndef PTRACE_SETREGS
#define PTRACE_SETREGS 0xd
#endif
#ifndef SOL_NETLINK
#define SOL_NETLINK 270
#endif
#ifdef SOL_BLUETOOTH
// SPARC includes this in /usr/include/sparc64-linux-gnu/bits/socket.h
// but it is already in bluetooth_linux.go
#undef SOL_BLUETOOTH
#endif
// Certain constants are missing from the fs/crypto UAPI
#define FS_KEY_DESC_PREFIX "fscrypt:"
#define FS_KEY_DESC_PREFIX_SIZE 8
#define FS_MAX_KEY_SIZE 64
// XDP socket constants do not appear to be picked up otherwise.
// Copied from samples/bpf/xdpsock_user.c.
#ifndef SOL_XDP
#define SOL_XDP 283
#endif
#ifndef AF_XDP
#define AF_XDP 44
#endif
'
includes_NetBSD='
#include <sys/types.h>
#include <sys/param.h>
#include <sys/event.h>
#include <sys/extattr.h>
#include <sys/mman.h>
#include <sys/mount.h>
#include <sys/socket.h>
#include <sys/sockio.h>
#include <sys/sysctl.h>
#include <sys/termios.h>
#include <sys/ttycom.h>
#include <sys/wait.h>
#include <net/bpf.h>
#include <net/if.h>
#include <net/if_types.h>
#include <net/route.h>
#include <netinet/in.h>
#include <netinet/in_systm.h>
#include <netinet/ip.h>
#include <netinet/ip_mroute.h>
#include <netinet/if_ether.h>
// Needed since <sys/param.h> refers to it...
#define schedppq 1
'
includes_OpenBSD='
#include <sys/types.h>
#include <sys/param.h>
#include <sys/event.h>
#include <sys/mman.h>
#include <sys/mount.h>
#include <sys/socket.h>
#include <sys/sockio.h>
#include <sys/stat.h>
#include <sys/sysctl.h>
#include <sys/termios.h>
#include <sys/ttycom.h>
#include <sys/unistd.h>
#include <sys/wait.h>
#include <net/bpf.h>
#include <net/if.h>
#include <net/if_types.h>
#include <net/if_var.h>
#include <net/route.h>
#include <netinet/in.h>
#include <netinet/in_systm.h>
#include <netinet/ip.h>
#include <netinet/ip_mroute.h>
#include <netinet/if_ether.h>
#include <net/if_bridge.h>
// We keep some constants not supported in OpenBSD 5.5 and beyond for
// the promise of compatibility.
#define EMUL_ENABLED 0x1
#define EMUL_NATIVE 0x2
#define IPV6_FAITH 0x1d
#define IPV6_OPTIONS 0x1
#define IPV6_RTHDR_STRICT 0x1
#define IPV6_SOCKOPT_RESERVED1 0x3
#define SIOCGIFGENERIC 0xc020693a
#define SIOCSIFGENERIC 0x80206939
#define WALTSIG 0x4
'
includes_SunOS='
#include <limits.h>
#include <sys/types.h>
#include <sys/socket.h>
#include <sys/sockio.h>
#include <sys/stat.h>
#include <sys/mman.h>
#include <sys/wait.h>
#include <sys/ioctl.h>
#include <sys/mkdev.h>
#include <net/bpf.h>
#include <net/if.h>
#include <net/if_arp.h>
#include <net/if_types.h>
#include <net/route.h>
#include <netinet/in.h>
#include <termios.h>
#include <netinet/ip.h>
#include <netinet/ip_mroute.h>
'
includes='
#include <sys/types.h>
#include <sys/file.h>
#include <fcntl.h>
#include <dirent.h>
#include <sys/socket.h>
#include <netinet/in.h>
#include <netinet/ip.h>
#include <netinet/ip6.h>
#include <netinet/tcp.h>
#include <errno.h>
#include <sys/signal.h>
#include <signal.h>
#include <sys/resource.h>
#include <time.h>
'
ccflags="$@"
# Write go tool cgo -godefs input.
(
echo package unix
echo
echo '/*'
indirect="includes_$(uname)"
echo "${!indirect} $includes"
echo '*/'
echo 'import "C"'
echo 'import "syscall"'
echo
echo 'const ('
# The gcc command line prints all the #defines
# it encounters while processing the input
echo "${!indirect} $includes" | $CC -x c - -E -dM $ccflags |
awk '
$1 != "#define" || $2 ~ /\(/ || $3 == "" {next}
$2 ~ /^E([ABCD]X|[BIS]P|[SD]I|S|FL)$/ {next} # 386 registers
$2 ~ /^(SIGEV_|SIGSTKSZ|SIGRT(MIN|MAX))/ {next}
$2 ~ /^(SCM_SRCRT)$/ {next}
$2 ~ /^(MAP_FAILED)$/ {next}
$2 ~ /^ELF_.*$/ {next}# <asm/elf.h> contains ELF_ARCH, etc.
$2 ~ /^EXTATTR_NAMESPACE_NAMES/ ||
$2 ~ /^EXTATTR_NAMESPACE_[A-Z]+_STRING/ {next}
$2 !~ /^ECCAPBITS/ &&
$2 !~ /^ETH_/ &&
$2 !~ /^EPROC_/ &&
$2 !~ /^EQUIV_/ &&
$2 !~ /^EXPR_/ &&
$2 ~ /^E[A-Z0-9_]+$/ ||
$2 ~ /^B[0-9_]+$/ ||
$2 ~ /^(OLD|NEW)DEV$/ ||
$2 == "BOTHER" ||
$2 ~ /^CI?BAUD(EX)?$/ ||
$2 == "IBSHIFT" ||
$2 ~ /^V[A-Z0-9]+$/ ||
$2 ~ /^CS[A-Z0-9]/ ||
$2 ~ /^I(SIG|CANON|CRNL|UCLC|EXTEN|MAXBEL|STRIP|UTF8)$/ ||
$2 ~ /^IGN/ ||
$2 ~ /^IX(ON|ANY|OFF)$/ ||
$2 ~ /^IN(LCR|PCK)$/ ||
$2 !~ "X86_CR3_PCID_NOFLUSH" &&
$2 ~ /(^FLU?SH)|(FLU?SH$)/ ||
$2 ~ /^C(LOCAL|READ|MSPAR|RTSCTS)$/ ||
$2 == "BRKINT" ||
$2 == "HUPCL" ||
$2 == "PENDIN" ||
$2 == "TOSTOP" ||
$2 == "XCASE" ||
$2 == "ALTWERASE" ||
$2 == "NOKERNINFO" ||
$2 ~ /^PAR/ ||
$2 ~ /^SIG[^_]/ ||
$2 ~ /^O[CNPFPL][A-Z]+[^_][A-Z]+$/ ||
$2 ~ /^(NL|CR|TAB|BS|VT|FF)DLY$/ ||
$2 ~ /^(NL|CR|TAB|BS|VT|FF)[0-9]$/ ||
$2 ~ /^O?XTABS$/ ||
$2 ~ /^TC[IO](ON|OFF)$/ ||
$2 ~ /^IN_/ ||
$2 ~ /^LOCK_(SH|EX|NB|UN)$/ ||
$2 ~ /^(AF|SOCK|SO|SOL|IPPROTO|IP|IPV6|ICMP6|TCP|EVFILT|NOTE|EV|SHUT|PROT|MAP|MFD|T?PACKET|MSG|SCM|MCL|DT|MADV|PR)_/ ||
$2 ~ /^TP_STATUS_/ ||
$2 ~ /^FALLOC_/ ||
$2 == "ICMPV6_FILTER" ||
$2 == "SOMAXCONN" ||
$2 == "NAME_MAX" ||
$2 == "IFNAMSIZ" ||
$2 ~ /^CTL_(HW|KERN|MAXNAME|NET|QUERY)$/ ||
$2 ~ /^KERN_(HOSTNAME|OS(RELEASE|TYPE)|VERSION)$/ ||
$2 ~ /^HW_MACHINE$/ ||
$2 ~ /^SYSCTL_VERS/ ||
$2 !~ "MNT_BITS" &&
$2 ~ /^(MS|MNT|UMOUNT)_/ ||
$2 ~ /^TUN(SET|GET|ATTACH|DETACH)/ ||
$2 ~ /^(O|F|E?FD|NAME|S|PTRACE|PT)_/ ||
$2 ~ /^KEXEC_/ ||
$2 ~ /^LINUX_REBOOT_CMD_/ ||
$2 ~ /^LINUX_REBOOT_MAGIC[12]$/ ||
$2 ~ /^MODULE_INIT_/ ||
$2 !~ "NLA_TYPE_MASK" &&
$2 ~ /^(NETLINK|NLM|NLMSG|NLA|IFA|IFAN|RT|RTC|RTCF|RTN|RTPROT|RTNH|ARPHRD|ETH_P|NETNSA)_/ ||
$2 ~ /^SIOC/ ||
$2 ~ /^TIOC/ ||
$2 ~ /^TCGET/ ||
$2 ~ /^TCSET/ ||
$2 ~ /^TC(FLSH|SBRKP?|XONC)$/ ||
$2 !~ "RTF_BITS" &&
$2 ~ /^(IFF|IFT|NET_RT|RTM|RTF|RTV|RTA|RTAX)_/ ||
$2 ~ /^BIOC/ ||
$2 ~ /^RUSAGE_(SELF|CHILDREN|THREAD)/ ||
$2 ~ /^RLIMIT_(AS|CORE|CPU|DATA|FSIZE|LOCKS|MEMLOCK|MSGQUEUE|NICE|NOFILE|NPROC|RSS|RTPRIO|RTTIME|SIGPENDING|STACK)|RLIM_INFINITY/ ||
$2 ~ /^PRIO_(PROCESS|PGRP|USER)/ ||
$2 ~ /^CLONE_[A-Z_]+/ ||
$2 !~ /^(BPF_TIMEVAL)$/ &&
$2 ~ /^(BPF|DLT)_/ ||
$2 ~ /^CLOCK_/ ||
$2 ~ /^CAN_/ ||
$2 ~ /^CAP_/ ||
$2 ~ /^ALG_/ ||
$2 ~ /^FS_(POLICY_FLAGS|KEY_DESC|ENCRYPTION_MODE|[A-Z0-9_]+_KEY_SIZE|IOC_(GET|SET)_ENCRYPTION)/ ||
$2 ~ /^GRND_/ ||
$2 ~ /^KEY_(SPEC|REQKEY_DEFL)_/ ||
$2 ~ /^KEYCTL_/ ||
$2 ~ /^PERF_EVENT_IOC_/ ||
$2 ~ /^SECCOMP_MODE_/ ||
$2 ~ /^SPLICE_/ ||
$2 ~ /^SYNC_FILE_RANGE_/ ||
$2 !~ /^AUDIT_RECORD_MAGIC/ &&
$2 !~ /IOC_MAGIC/ &&
$2 ~ /^[A-Z][A-Z0-9_]+_MAGIC2?$/ ||
$2 ~ /^(VM|VMADDR)_/ ||
$2 ~ /^IOCTL_VM_SOCKETS_/ ||
$2 ~ /^(TASKSTATS|TS)_/ ||
$2 ~ /^CGROUPSTATS_/ ||
$2 ~ /^GENL_/ ||
$2 ~ /^STATX_/ ||
$2 ~ /^RENAME/ ||
$2 ~ /^UBI_IOC[A-Z]/ ||
$2 ~ /^UTIME_/ ||
$2 ~ /^XATTR_(CREATE|REPLACE|NO(DEFAULT|FOLLOW|SECURITY)|SHOWCOMPRESSION)/ ||
$2 ~ /^ATTR_(BIT_MAP_COUNT|(CMN|VOL|FILE)_)/ ||
$2 ~ /^FSOPT_/ ||
$2 ~ /^WDIOC_/ ||
$2 ~ /^NFN/ ||
$2 ~ /^XDP_/ ||
$2 ~ /^(HDIO|WIN|SMART)_/ ||
$2 !~ "WMESGLEN" &&
$2 ~ /^W[A-Z0-9]+$/ ||
$2 ~ /^BLK[A-Z]*(GET$|SET$|BUF$|PART$|SIZE)/ {printf("\t%s = C.%s\n", $2, $2)}
$2 ~ /^__WCOREFLAG$/ {next}
$2 ~ /^__W[A-Z0-9]+$/ {printf("\t%s = C.%s\n", substr($2,3), $2)}
{next}
' | sort
echo ')'
) >_const.go
# Pull out the error names for later.
errors=$(
echo '#include <errno.h>' | $CC -x c - -E -dM $ccflags |
awk '$1=="#define" && $2 ~ /^E[A-Z0-9_]+$/ { print $2 }' |
sort
)
# Pull out the signal names for later.
signals=$(
echo '#include <signal.h>' | $CC -x c - -E -dM $ccflags |
awk '$1=="#define" && $2 ~ /^SIG[A-Z0-9]+$/ { print $2 }' |
egrep -v '(SIGSTKSIZE|SIGSTKSZ|SIGRT|SIGMAX64)' |
sort
)
# Again, writing regexps to a file.
echo '#include <errno.h>' | $CC -x c - -E -dM $ccflags |
awk '$1=="#define" && $2 ~ /^E[A-Z0-9_]+$/ { print "^\t" $2 "[ \t]*=" }' |
sort >_error.grep
echo '#include <signal.h>' | $CC -x c - -E -dM $ccflags |
awk '$1=="#define" && $2 ~ /^SIG[A-Z0-9]+$/ { print "^\t" $2 "[ \t]*=" }' |
egrep -v '(SIGSTKSIZE|SIGSTKSZ|SIGRT|SIGMAX64)' |
sort >_signal.grep
echo '// mkerrors.sh' "$@"
echo '// Code generated by the command above; see README.md. DO NOT EDIT.'
echo
echo "// +build ${GOARCH},${GOOS}"
echo
go tool cgo -godefs -- "$@" _const.go >_error.out
cat _error.out | grep -vf _error.grep | grep -vf _signal.grep
echo
echo '// Errors'
echo 'const ('
cat _error.out | grep -f _error.grep | sed 's/=\(.*\)/= syscall.Errno(\1)/'
echo ')'
echo
echo '// Signals'
echo 'const ('
cat _error.out | grep -f _signal.grep | sed 's/=\(.*\)/= syscall.Signal(\1)/'
echo ')'
# Run C program to print error and syscall strings.
(
echo -E "
#include <stdio.h>
#include <stdlib.h>
#include <errno.h>
#include <ctype.h>
#include <string.h>
#include <signal.h>
#define nelem(x) (sizeof(x)/sizeof((x)[0]))
enum { A = 'A', Z = 'Z', a = 'a', z = 'z' }; // avoid need for single quotes below
struct tuple {
int num;
const char *name;
};
struct tuple errors[] = {
"
for i in $errors
do
echo -E ' {'$i', "'$i'" },'
done
echo -E "
};
struct tuple signals[] = {
"
for i in $signals
do
echo -E ' {'$i', "'$i'" },'
done
# Use -E because on some systems bash builtin interprets \n itself.
echo -E '
};
static int
tuplecmp(const void *a, const void *b)
{
return ((struct tuple *)a)->num - ((struct tuple *)b)->num;
}
int
main(void)
{
int i, e;
char buf[1024], *p;
printf("\n\n// Error table\n");
printf("var errorList = [...]struct {\n");
printf("\tnum syscall.Errno\n");
printf("\tname string\n");
printf("\tdesc string\n");
printf("} {\n");
qsort(errors, nelem(errors), sizeof errors[0], tuplecmp);
for(i=0; i<nelem(errors); i++) {
e = errors[i].num;
if(i > 0 && errors[i-1].num == e)
continue;
strcpy(buf, strerror(e));
// lowercase first letter: Bad -> bad, but STREAM -> STREAM.
if(A <= buf[0] && buf[0] <= Z && a <= buf[1] && buf[1] <= z)
buf[0] += a - A;
printf("\t{ %d, \"%s\", \"%s\" },\n", e, errors[i].name, buf);
}
printf("}\n\n");
printf("\n\n// Signal table\n");
printf("var signalList = [...]struct {\n");
printf("\tnum syscall.Signal\n");
printf("\tname string\n");
printf("\tdesc string\n");
printf("} {\n");
qsort(signals, nelem(signals), sizeof signals[0], tuplecmp);
for(i=0; i<nelem(signals); i++) {
e = signals[i].num;
if(i > 0 && signals[i-1].num == e)
continue;
strcpy(buf, strsignal(e));
// lowercase first letter: Bad -> bad, but STREAM -> STREAM.
if(A <= buf[0] && buf[0] <= Z && a <= buf[1] && buf[1] <= z)
buf[0] += a - A;
// cut trailing : number.
p = strrchr(buf, ":"[0]);
if(p)
*p = '\0';
printf("\t{ %d, \"%s\", \"%s\" },\n", e, signals[i].name, buf);
}
printf("}\n\n");
return 0;
}
'
) >_errors.c
$CC $ccflags -o _errors _errors.c && $GORUN ./_errors && rm -f _errors.c _errors _const.go _error.grep _signal.grep _error.out
|
{
"pile_set_name": "Github"
}
|
Want to get better at profiling & tracing your programs on Linux? perf is a super useful tool, but
it’s fairly complicated and I found it hard to get started with. Over the last 4 years, I’ve learned
a lot about how perf works, and I’ve compressed what I know into this zine for you!
You’ll learn how you can use perf to profile programs in many different programming languages (C,
node.js, Java, Rust, and more!), how to count any kernel event you’re interested in (syscalls!
network packets sent!), how to analyze the data that perf gives you, and more!
This is a zine about COMPUTER NETWORKING! I spent a very long time
learning how networking works (what happens when you download a picture
from the internet? It turns out, a lot!) So I wrote a zine about it!
This is a zine about some of my favorite Linux debugging tools, especially tools that I don’t think are as well-known as they should be. It covers strace, opensnoop/eBPF, and dstat! netcat, netstat, tcpdump, wireshark, and ngrep! And there’s a whole section on perf because perf is the best.
If you don’t know what any of those tools I just mentioned are – PERFECT. You
are who this zine is for!!! Read it and find out why I love them! Also, a lot
of these tools happen to work on OS X :)
There are a lot of Linux tracing systems. I was extremely confused about the relationship
between perf/ftrace/bcc/LTTng/uprobes/kprobes/BPF, etc. What are all these words? What do they mean?
This zine breaks it down for you.
What's a zine?
A fanzine (blend of fan and magazine or -zine) is a nonprofessional and
nonofficial publication produced by fans of a particular cultural phenomenon
(such as a literary or musical genre) for the pleasure of others who share
their interest.
I love programming and debugging tools (is that a “cultural phenomenon? I
don’t know!“), so I make sometimes make fanzines about how much I love them and give them away.
When I have time (and the printing budget) I like to give them out as handouts
in my talks.
The easiest way to read any of these is on your computer.
But the best way to read them is to print it out, staple it, fold it,
read it, and then give it to a friend. It turns out it’s way easier to
convince your friends to read a physical thing that is in front of them.
Printers are kind of annoying, but people do successfully print them and
send me pictures.
They’re all available under a creative commons license
(CC BY-NC-SA), so you can print as
many as you want to give away.
|
{
"pile_set_name": "Pile-CC"
}
|
Insulin infusion via an intraosseous needle in diabetic ketoacidosis.
We report the successful management of a five-year-old child with severe diabetic ketoacidosis with dehydration, who received his initial resuscitative fluids and a continuous infusion of insulin via an intraosseous needle. The patient had presented to a remote community hospital and intravenous access could not be gained. The correction of hyperglycaemia and metabolic acidaemia was achieved at a rate comparable to intravenous therapy. No complications were observed. Although intraosseous access is well described in paediatric resuscitation guidelines, it is not mentioned in International Diabetes Society guidelines for the management of diabetic ketoacidosis. Alternatives to intravenous administration of insulin delivery recommended in such guidelines, such as the subcutaneous or intramuscular routes, may be less appropriate than the intraosseous route. This route can also allow resuscitation fluids and other drugs to be reliably administered in children with diabetic ketoacidosis and severe dehydration where intravenous access can not be attained. We suggest that the potential role of intraosseous access, when intravenous access can not be obtained, should be considered when management guidelines for paediatric diabetic ketoacidosis with dehydration are reviewed.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
File Uploader using ForceTK using multipart message not working in mozilla
I have been trying to upload file from Visualforce using the blog tutorial on developerforce that explains CORS feature.I am preferring REST API tied with VF since I need to built lot of other client side actions based on response like progress bar and other cool features
https://developer.salesforce.com/blogs/developer-relations/2015/01/spring-15-preview-cors-force-com-rest-api.html
I used exact same code with forceTk imported in my VF
<apex:page docType="html-5.0" title="File Uploader">
<h3>Select a file to upload as a new Chatter File.</h3>
<input type="file" id="file" onchange="upload()"/>
<p id="message"></p>
<script src="//code.jquery.com/jquery-1.11.2.min.js"></script>
<script src="{!$Resource.forcetk}"></script>
<script>
var client = new forcetk.Client();
// Get the token from Visualforce
client.setSessionToken('{!$Api.Session_ID}');
function upload() {
var file = $("#file")[0].files[0];
client.createBlob('ContentVersion', {
Origin: 'H', // 'H' for Chatter File, 'C' for Content Document
PathOnClient: file.name
}, file.name, 'VersionData', file, function(response){
console.log(response);
$("#message").html("Chatter File created: <a target=\"_blank\" href=\"/" +
response.id + "\">Take a look!</a>");
}, function(request, status, response){
$("#message").html("Error: " + status);
});
}
</script>
</apex:page>
trying for few hours now I get below error in the javascript console only for firefox browser .Worked well in chrome
It worked well in chrome but chrome also throws an error but still file upload succeeds while in mozilla it fails .
In chrome the error message is as below
Any help will be appreciated
A:
The comment in the data was a red herring - that's just JavaScript code, rather than JSON, so comments are perfectly ok.
I tracked the issue down to line 326 of forcetk.js:
return this.asyncAjax ? JSON.parse(request.response) : null;
Here, the blob function should return either null, if this is an asynchronous call (the usual case), or JSON.parse(request.response) for the synchronous case.
Now the problem is that, as written above, the logic is reversed! In the usual, async case, we are trying to parse an empty response, where we should be returning null.
Easy fix - I just pushed it to the repo.
|
{
"pile_set_name": "StackExchange"
}
|
Perhaps the only thing that changes more rapidly than technology in today's amped-up digital environment is the terminology used to describe that technology and its impact on consumers--and marketers. One recent example is the advent of the term "omnichannel" marketing, which many struggle to differentiate from another relatively recent term--"multichannel" marketing. Still, those who are most enmeshed in the field say there is a key distinction between the two, and it's one that will have an impact on marketers as they continue to seek ways of having a meaningful impact on the consumers they hope to engage. And, importantly, it's less about technology than it may seem.
Adconion Media Group Acquires Joost Assets
Adconion Media Group acquired assets from privately privately-held online video service Joost. Terms of the deal were not disclosed. In June, Joost announced a change in its business strategy to focus on providing white-label video platforms, and Adconion plans to pursue this strategy. The addition of Joost assets will boost the video library at Adconion, which, prior to the deal, sold 80 million video streams per day to targeted audiences across 2,000 global websites.
|
{
"pile_set_name": "Pile-CC"
}
|
Differential effect of central command on aortic and carotid sinus baroreceptor-heart rate reflexes at the onset of spontaneous, fictive motor activity.
Our laboratory has reported that central command blunts the sensitivity of the aortic baroreceptor-heart rate (HR) reflex at the onset of voluntary static exercise in conscious cats and spontaneous contraction in decerebrate cats. The purpose of this study was to examine whether central command attenuates the sensitivity of the carotid sinus baroreceptor-HR reflex at the onset of spontaneous, fictive motor activity in paralyzed, decerebrate cats. We confirmed that aortic nerve (AN)-stimulation-induced bradycardia was markedly blunted to 26 ± 4.4% of the control (21 ± 1.3 beats/min) at the onset of spontaneous motor activity. Although the baroreflex bradycardia by electrical stimulation of the carotid sinus nerve (CSN) was suppressed (P < 0.05) to 86 ± 5.6% of the control (38 ± 1.2 beats/min), the inhibitory effect of spontaneous motor activity was much weaker (P < 0.05) with CSN stimulation than with AN stimulation. The baroreflex bradycardia elicited by brief occlusion of the abdominal aorta was blunted to 36% of the control (36 ± 1.6 beats/min) during spontaneous motor activity, suggesting that central command is able to inhibit the cardiomotor sensitivity of arterial baroreflexes as the net effect. Mechanical stretch of the triceps surae muscle never affected the baroreflex bradycardia elicited by AN or CSN stimulation and by aortic occlusion, suggesting that muscle mechanoreflex did not modify the cardiomotor sensitivity of aortic and carotid sinus baroreflex. Since the inhibitory effect of central command on the carotid baroreflex pathway, associated with spontaneous motor activity, was much weaker compared with the aortic baroreflex pathway, it is concluded that central command does not force a generalized modulation on the whole pathways of arterial baroreflexes but provides selective inhibition for the cardiomotor component of the aortic baroreflex.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Kentucky Route 56
Kentucky Route 56 (KY 56) is a state highway in Kentucky that runs from Illinois Route 13 (IL 13) near Old Shawneetown, Illinois, on the Shawneetown Bridge at the Kentucky-Illinois state line to KY 81 near Owensboro via Morgantown and Sebree.
Major intersections
References
0056
Category:Transportation in Union County, Kentucky
Category:Transportation in Webster County, Kentucky
Category:Transportation in McLean County, Kentucky
Category:Transportation in Daviess County, Kentucky
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Prevalence and correlates of successful transfer from pediatric to adult health care among a cohort of young adults with complex congenital heart defects.
More than 85% of children born today with chronic medical conditions will live to adulthood, and many should transfer from pediatric to adult health care. The numbers of adults with congenital heart defects (CHDs) are increasing rapidly. Current guidelines recommend that just over half of adult CHD patients should be seen every 12 to 24 months by a cardiologist with specific CHD expertise at a regional CHD center, because they are at risk for serious complications (eg, reoperation and/or arrhythmias) and premature mortality. The present study aimed to determine the percent of young adults with CHDs who successfully transferred from pediatric to adult care and examine correlates of successful transfer. Cross-sectional study with prevalence data from an entire cohort. All patients (n = 360) aged 19 to 21 years with complex CHDs who, according to current practice guidelines, should be seen annually at a specialized adult CHD center were identified from the database of the cardiology program at the Hospital for Sick Children in Toronto, Canada, a pediatric tertiary care center. Of these patients, 234 completed measures about health beliefs, health behaviors, and medical care since age 18 years. All 15 specialized adult CHD centers in Canada formed the Canadian Adult Congenital Heart (CACH) Network. Attendance for at least 1 follow-up appointment at a CACH center before the age of 22 years was ascertained for all eligible patients. Attendance at a CACH center provides a clear criterion for successful transfer. In the total cohort, 47% (95% confidence interval [CI]: 42-52) had transferred successfully to adult care. There was no difference in rates of successful transfer between patients consenting to complete questionnaires (48%) and those who declined (47%). More than one quarter (27%) of the patients reported having had no cardiac appointments since 18 years. In multivariate analyses of the entire cohort, successful transfer was significantly associated with more pediatric cardiovascular surgeries (odds ratio [OR]: 2.47; 95% CI: 1.40-4.37), older age at last visit to the Hospital for Sick Children (OR: 1.29; 95% CI: 1.10-1.51), and documented recommendations in the medical chart for follow-up at a CACH center. In multivariate analyses of the patients completing questionnaires, successful transfer was significantly related to documented recommendations and patient beliefs that adult CHD care should be at a CACH center (OR: 3.64; 95% CI: 1.34-9.90). Comorbid conditions (OR: 3.13; 95% CI: 1.13-8.67), not using substances (eg, binge drinking; OR: 0.18; 95% CI: 0.07-0.50), using dental antibiotic prophylaxis (OR: 4.23; 95% CI: 1.48-12.06), and attending cardiac appointments without parents or siblings (OR: 6.59; 95% CI: 1.61-27.00) also correlated with successful transfer. This is the first study to document the percent of young adults with a chronic illness who successfully transfer to adult care in a timely manner. Patients were from an entire birth cohort from the largest pediatric cardiac center in Canada, and outcome data were obtained on all eligible patients. Similar data should be obtained for other chronic illnesses. There is need for considerable improvement in the numbers of young adults with CHDs who successfully transfer to adult care. At-risk adolescents with CHDs should begin the transition process before their teens, should be educated in the importance of antibiotic prophylaxis, should be contacted if a follow-up appointment is missed, and should be directed to a specific CHD cardiologist or program, with the planned timing being stated explicitly. Adult care needs to be discussed in the pediatric setting, and patients must acquire appropriate beliefs about adult care well before transfer. Developmentally appropriate, staged discussions involving the patient, with and without parents, throughout adolescence may help patients acquire these beliefs and an understanding of the need for ongoing care. Improved continuity of pediatric care and provision of clear details for adult follow-up might be sufficient to cause substantive improvements in successful transfer. An understanding of why patients drop out of pediatric care may be needed to improve the continuity of care throughout adolescence. Almost one quarter of the patients believed adult care should be somewhere other than at a CACH center despite opposite recommendations. For these patients, a single discussion of adult care during the final pediatric visit may be too little, too late. In addition to earlier discussions, multiple mechanisms such as referral letters and transition clinics are needed. Similarly, patients engaging in multiple risky or poor health behaviors such as substance use may need more intensive programs to make substantial changes in these behaviors, which hopefully would lead to successful transfer. Overall, these data support the view that transition to adult care (a planned process of discussing and preparing for transfer to an adult health center) is important and should begin well before patients are transferred. The future health of adults with chronic conditions may depend on our ability to make these changes.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Check out our new site Makeup Addiction
add your own caption
add your own caption
LOL BUT I haven't goat it
|
{
"pile_set_name": "OpenWebText2"
}
|
Identification of a midgut-specific promoter in the silkworm Bombyx mori.
The midgut is an important organ for digestion and absorption of nutrients and immune defense in the silkworm Bombyx mori. In an attempt to create a tool for midgut research, we cloned the 1080 bp P2 promoter sequence (P2P) of a highly expressed midgut-specific gene in the silkworm. The transgenic line (P2) was generated via embryo microinjection, in which the expression of EGFP was driven by P2P. There was strong green fluorescence only in the midgut of P2. RT-PCR and Western blot showed that P2P was a midgut-specific promoter with activity throughout the larval stage. A transgenic truncation experiment suggested that regions -305 to -214 and +107 to +181 were very important for P2P activity. The results of this study revealed that we have identified a midgut-specific promoter with a high level of activity in the silkworm that will aid future research and application of silkworm genes.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
---
author:
- |
Martial MAZARS[^1]\
Laboratoire de Physique Théorique (UMR 8627),\
Université de Paris XI, Bâtiment 210, 91405 Orsay Cedex, FRANCE
title: 'Ewald sums for Yukawa potentials in quasi-two-dimensional systems.'
---
LPT 06-98
[**Abstract**]{}
In this note, we derive Ewald sums for Yukawa potential for three dimensional systems with two dimensional periodicity. This sums are derived from the Ewald sums for Yukawa potentials with three dimensional periodicity \[G. Salin and J.-M. Caillol, J. Chem. Phys. [**113**]{}, 10459 (2000)\] by using the method proposed by Parry for the Coulomb interactions \[D.E. Parry, Surf. Sci. [**49**]{}, 433 (1975); [**54**]{}, 195 (1976)\].
The Yukawa interaction energy between two particles is given by $$E(r)=\frac{y_i y_j}{\epsilon}\frac{\exp(-\kappa r)}{r}$$ where $\epsilon$ is the dielectric constant, $\kappa$ the inverse of the screening length and $y_i$ the “Yukawa charges” defined by the properties and the state of the system ; for instance, at the Debye-Hückel approximation for electrolytes or in the Derjaguin-Landau-Verwey-Overbeek (DLVO) theory of colloids, $\kappa$ and $y_i$ are related to physical parameters of systems as
$\displaystyle \kappa = \sqrt{\frac{q^2\rho}{k_{B}T\epsilon}}\mbox{ }$ and $\mbox{ }\displaystyle y_i=\frac{q\exp(\kappa\sigma_i)}{(1+\kappa\sigma_i)}$
where $\sigma_i$ is the diameter of the hard core of the ions, in the Debye-Hückel approximations, or the radius of macroions, in DLVO theory, and $\rho$ and $q$ are respectively the density of ions or counterions and their charge, $k_B$ the Boltzmann constant and $T$ the temperature.\
Yukawa interactions between particles are used in numerical simulations as effective potentials to simulate systems as plasmas, dusty plasma, colloids, etc. ; on general ground, such potentials may be used as a reasonable approximation, as soon as some microscopic degrees of freedom may be approximated to a continuous background leading to a screening of the direct interaction between particles, while the spherical symmetry of the interaction is preserved.\
As outlined in ref.\[1\], if $\kappa$ is large enough, the screening length can be much smaller than simulation box lengths, then interactions between particles are not long ranged and, in practice, a simple truncation of the potential, with the use of the minimum image convention, could be sufficient. On the contrary, if $\kappa$ is not large or quite small, then interactions between particles may be long ranged and images of particles introduced by the periodic boundary conditions may contribute significantly to the energy of the system. In these cases, a crude truncation of the potential could lead to strong bias in computations (for Coulomb interactions, see for instance refs.\[2-4\] for errors introduced by crude truncations of long ranged potentials). To handle these latter cases, an Ewald method for systems with three dimensional periodicity and Yukawa interaction potentials has been exhibited$^1$.\
Many interesting systems which interaction between particles can be approximated by Yukawa potentials are also confined to quasi-two dimensional geometries$^{5,6,7}$, therefore an Ewald method is of interest to permit to simulate the properties of these quasi-two dimensional systems for any value of the $\kappa$ parameter including at low counterions concentration or high temperatures.\
In this note, we derive Ewald sums for Yukawa potential in quasi-two dimensional systems from results of ref.\[1\] following the same derivation done by Parry$^8$ for Coulomb interactions. For Coulomb interaction in quasi-two dimensional systems several methods exist$^{9,10}$, in particular some methods used the Ewald method for three dimensional systems with a highly asymmetric box$^{11,12}$ and by adding correction terms related to the total dipole of the simulation box ; a general review on Coulomb interaction in quasi two-dimensional systems is done in ref.\[10\]. In a forthcoming work, some numerical implementations on a test system will be given ; the present work is devoted only to provide a simple derivation of Ewald sums for Yukawa potential in quasi-two dimensional systems.\
As computed by Salin and Caillol$^1$, the Ewald-Yukawa interaction energy is given by $$E=E_{\bm{r}}+E_{\bm{k}}-E_{\mbox{\small Self}}$$ with the short ranged contribution $$\displaystyle E_{\bm{r}}=\frac{1}{4}\sum_{ij}\sum_{\bm{n}}' y_i y_j\frac{D(r_{ij},\bm{n},\kappa ; \alpha)}{\mid \bm{r}_{ij}+\bm{nL}\mid}$$ where $$\begin{array}{l}
\displaystyle D(r_{ij},\bm{n},\kappa ; \alpha)=\mbox{erfc}(\alpha\mid\bm{r}_{ij}+\bm{nL}\mid+\frac{\kappa}{2\alpha})\exp(\kappa\mid \bm{r}_{ij}+\bm{nL}\mid)\\[0.05in]
\displaystyle +\mbox{erfc}(\alpha\mid \bm{r}_{ij}+\bm{nL}\mid-\frac{\kappa}{2\alpha})\exp(-\kappa\mid \bm{r}_{ij}+\bm{nL}\mid)
\end{array}$$ and $r_{ij}$ the distance between the pair $(i,j)$ of particles, the long ranged contribution $$E_{\bm{k}} = \frac{2\pi}{V}\sum_{\bm{k}\neq 0}\frac{\exp(-\bm{k}^2+\kappa^2)/4\alpha^2)}{\bm{k}^2+\kappa^2}\mbox{\large{$\mid$}}\sum_{i} y_i\exp(i\bm{k}\mbox{.}\bm{r}_i)\mbox{\large{$\mid$}}^2$$ and the self interaction $$\displaystyle E_{\mbox{\small Self}}=\mbox{\Huge{[}} \frac{\alpha}{\sqrt{\pi}}\exp\mbox{\large{(}}-\frac{\kappa^2}{4\alpha^2}\mbox{\large{)}}-\frac{\kappa}{2}\mbox{ }\mbox{erfc}\mbox{\large{(}}\frac{\kappa}{2\alpha}\mbox{\large{)}}\mbox{\Huge{]}}\sum_i y_i^2$$ where we have set $\epsilon=1$ and used conventional notations for Ewald sums ; namely, $V$ is the volume of the simulation box, $\bm{nL}$ the condensed notation for the vectors of the periodic boundary conditions, $\bm{k}$ are the vectors belonging to the reciprocal lattice associated with the three dimensional periodicity and $\alpha$ the damping parameter of the Ewald method. In Eq.(3), the prime in the sum over $\bm{n}$ indicates that for $\bm{n}=0$, the self terms $i=j$ are not included. The short ranged contributions for the Ewald sums for Yukawa potentials in periodic three dimensional systems are given as in Eq.(3), for quasi-two dimensional$^8$ the short ranged contributions are also given by Eq.(3) ; for pratical applications, a choice of the Ewald damping parameter $\alpha$ is done such that summations over images are restricted to the minimum image convention$^1$.\
In the work by Parry$^8$, the Ewald sums for quasi-two dimensional systems are derived from the Ewald method for three dimensional systems by letting the spatial periodicity along the third direction to tend to infinity ($L_z\rightarrow\infty$).\
In the following, we use the notations $\bm{k}=\bm{G}+k\bm{e}_z$ where $\bm{G}$ are the vectors belonging to the reciprocal lattice associated with the two dimensional periodicity and $k=2\pi m/L_z$, ($m$ integer), where $L_z$ is the spatial periodicity of the simulation box along the $\bm{e}_z$ ; we set also $\bm{r}_{ij}=\bm{s}_{ij}+z_{ij}\bm{e}_z$ and $V=AL_z$, where $s_{ij}$ is the distance in the plane perpendicular to $\bm{e}_z$ and $A$ is the surface of the simulation box for quasi-two dimensional systems.\
Following Parry$^8$, the long ranged contribution is separated into two contributions. The first contribution$^{8(a)}$, noted $E_{G\neq 0}^{(a)}$, is obtained for $\bm{G}\neq 0$ and the second$^{8(b)}$ for $\bm{G} = 0$, as a reminiscent contribution of summation over $k$ as $L_z\rightarrow\infty$, noted below $E_{G= 0}^{(b)}$.\
From Eq.(5), we have $$\begin{array}{c}
\displaystyle E_{G\neq 0}^{(a)}=\frac{2\pi}{A}\sum_{ij} y_iy_j\sum_{\bm{G}\neq 0}\exp(i\bm{G}\mbox{.}\bm{s}_{ij})\exp(-(\bm{G}^2+\kappa^2)/4\alpha^2)\\[0.05in]
\displaystyle \times\lim_{L_z\rightarrow\infty}\frac{1}{L_z}\sum_{r=-\infty}^{+\infty}\frac{\exp(-k^2/4\alpha^2)}{k^2+(\bm{G}^2+\kappa^2)}\exp(ikz_{ij})
\end{array}$$ Taking into account the identity$^{13}$ $$\begin{array}{l}
\displaystyle\lim_{L\rightarrow\infty}\frac{1}{L}\sum_{r=-\infty}^{+\infty}\frac{\exp(-k^2/4\alpha^2)}{k^2+(\bm{G}^2+\kappa^2)}\exp(ikz_{ij})=\frac{1}{2\pi}\int_{-\infty}^{+\infty}dk\frac{\exp(ikz)\exp(-k^2/4\alpha^2)}{k^2+(\bm{G}^2+\kappa^2)}
\end{array}$$ we found $$\displaystyle E_{G\neq 0}^{(a)}=\frac{\pi}{2A}\sum_{\bm{G}\neq 0}\sum_{ij} y_iy_j F(\sqrt{\bm{G}^2+\kappa^2},z_{ij};\alpha) \exp(i\bm{G}\mbox{.}\bm{s}_{ij})$$ with $$\begin{array}{c}
\displaystyle F(K,z;\alpha)=\frac{1}{K}\mbox{\Large{(}}\exp(K z)\mbox{erfc}\mbox{\large{(}}\frac{K}{2\alpha}+\alpha z\mbox{\large{)}}+\exp(-K z)\mbox{erfc}\mbox{\large{(}}\frac{K}{2\alpha}-\alpha z\mbox{\large{)}}\mbox{\Large{)}}
\end{array}$$ The second contribution is given by $$E_{G= 0}^{(b)}=\frac{\pi}{2A}\sum_{ij} y_iy_j F(\kappa,z_{ij};\alpha)$$ As it is shown explicitly on Eqs.(9) and (11), the long ranged contributions of Ewald-Yukawa sums for quasi-two dimensional systems can not be reduced to one particle summation, because of the complicated dependence on $z_{ij}$.\
Self energy is given by $$\left \{\begin{array}{ll}
\displaystyle E^{Q2D}(\mbox{\small Self})&\displaystyle = \mbox{\Huge{[}}\frac{\alpha}{\sqrt{\pi}}\exp(-\kappa^2/4\alpha^2)-\frac{\kappa}{2}\mbox{ erfc}(\kappa/2\alpha)\mbox{\Huge{]}}\sum_i y_i^2 \\
&\\
\displaystyle E_{G= 0}(\mbox{\small Self})&\displaystyle = \frac{\pi}{A}\frac{\mbox{erfc}(\kappa/2\alpha)}{\kappa}\sum_i y_i^2
\end{array}
\right.$$ The Ewald sums for Yukawa potential in quasi-two dimensional systems are given by $$E=E_{\bm{r}}+E_{G\neq 0}^{(a)}+E_{G= 0}^{(b)}-E^{Q2D}(\mbox{\small Self})-E_{G= 0}(\mbox{\small Self})$$ with each contribution given by Eqs.(3,9,11) and (12).\
When $\kappa\rightarrow 0$, the Helmholtz equation, which solutions lead to Yukawa potentials, becomes a Poisson equation, which solutions lead to Coulomb potentials$^1$ ; then the Ewald sums for Coulomb interactions may be recovered from Eqs.(3,9,11) and (12), under the condition that the electroneutrality of the periodic system is recovered too$^{14,15}$ (for instance by letting the counterions concentration acting as an uniform continuous background).\
When $z_{ij}=0$ for all pairs of particles, then all particles are confined in a plan. In this limit, the Ewald sums for a quasi-two dimensional systems reduce to the Ewald sums of two dimensional systems. Then, Eqs.(9,12) and (13) become $$E^{2D}=E_{\bm{s}}+E_{G\neq 0}-E^{2D}_{\mbox{\small Self}}$$ with $$\left \{\begin{array}{ll}
\displaystyle E_{G\neq 0}&\displaystyle =\frac{\pi}{A}\sum_{\bm{G}\neq 0}\frac{\mbox{erfc}(\sqrt{\bm{G}^2+\kappa^2}/2\alpha)}{\sqrt{\bm{G}^2+\kappa^2}}\mbox{\large{$\mid$}}\sum_{i} y_i \exp(i\bm{G}\mbox{.}\bm{s}_{i})\mbox{\large{$\mid$}}^2\\
&\\
\displaystyle E^{2D}_{\mbox{\small Self}}&\displaystyle = \mbox{\Huge{[}}\frac{\alpha}{\sqrt{\pi}}\exp(-\kappa^2/4\alpha^2)-\frac{\kappa}{2}\mbox{ erfc}(\kappa/2\alpha)\mbox{\Huge{]}}\sum_i y_i^2
\end{array}
\right.$$ and $E_{\bm{s}}$ given by Eq.(3), with $\bm{s}_{ij}$ instead of $\bm{r}_{ij}$.\
These results may be applied directly in computer simulations, nevertheless the efficiency suffers from the lack of reduction in one particle summations, as for Coulomb potentials in quasi-two dimensional systems, because of the complicated dependence on $z_{ij}$. For molecular dynamics implementations, the forces acting on particles can easily be obtained with computations of the derivatives of the interaction potential.
\
$^1$ G. Salin and J.-M. Caillol, J. Chem. Phys., [**113**]{}, 10459 (2000)\
$^2$ J.C. Shelley and G.N. Patey, Mol. Phys., [**88**]{}, 385 (1996)\
$^3$ M. Patra, M. Karttunen, M.T. Hyvönen, E. Falck, P. Lindqvist and I. Vattulainen, Biophys. J., [**84**]{}, 3636 (2003)\
$^4$ M. Bergdorf, C. Peter and P.H. Hönenberger, J. Chem. Phys., [**119**]{}, 9129 (2003)\
$^5$ S.H. Behrens and D.G. Grier, Phys. Rev. E, [**64**]{}, 050401 (2001)\
$^6$ J. Santana-Solano and J.L. Arauz-Lara, Phys. Rev. E, [**65**]{}, 021406 (2002)\
$^7$ Y. Han and D.G. Grier, J. Chem. Phys. [**122**]{}, 064907 (2005)\
$^8$ (a) D.E. Parry, Surf. Sci. [**49**]{}, 433 (1975) ; (b) [**54**]{}, 195 (1976)\
$^9$ D. M. Heyes, M. Barber and J. H. R. Clarke, J. Chem. Soc. Faraday Trans. 2, [**73**]{}, 1485 (1977)\
$^{10}$ M. Mazars, Mol. Phys., [**103**]{}, 1241 (2005)\
$^{11}$ E. Spohr, J. Chem. Phys., [**107**]{}, 6342 (1997)\
$^{12}$ I.-C. Yeh and M.L. Berkowitz, J. Chem. Phys., [**111**]{}, 3155 (1999)\
$^{13}$ M. Mazars, J. Chem. Phys., [**117**]{}, 3524 (2002)\
$^{14}$ A. Grzybowski, E. Gwóźdź, and A. Bródka, Phys. Rev. B, [**61**]{}, 6706 (2001)\
$^{15}$ An analysis of the diverging behavior as $\kappa\rightarrow 0$ is done in : M. Mazars, Mol. Phys. [**103**]{}, 675 (2005) ; (cf. Eqs.(2) and (4) of the cited work, with $\beta\equiv\kappa$ ; it is worthwhile to note also that Eq.(3) provides the Lekner sums for Yukawa potentials). Lekner sums for Coulomb interactions have been defined in J. Lekner, Physica A, [**157**]{}, 826 (1989) ; for numerical implementations of this method see for instance : M.Mazars, J. Chem. Phys., [**115**]{}, 2955 (2001) and ref.\[10\].
[^1]: Electronic mail: Martial.Mazars@th.u-psud.fr
|
{
"pile_set_name": "ArXiv"
}
|
presents belly in gesture of good will claws you when you pet belly
45,234 shares
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
Context menu - InvokedOn text not getting cloned
This is my fiddle - http://jsfiddle.net/X9tgY/1526/
This code of line is not working
$(selectedText).clone().insertAfter(selectedText);
you can test by right clicking on the html text, i am getting the html of invokedOn text but i am unable to clone it.
(function ($, window) {
$.fn.contextMenu = function (settings) {
return this.each(function () {
// Open context menu
$(this).on("contextmenu", function (e) {
// return native menu if pressing control
if (e.ctrlKey) return;
//open menu
var $menu = $(settings.menuSelector)
.data("invokedOn", $(e.target))
.show()
.css({
position: "absolute",
left: getMenuPosition(e.clientX, 'width', 'scrollLeft'),
top: getMenuPosition(e.clientY, 'height', 'scrollTop')
})
.off('click')
.on('click', 'a', function (e) {
$menu.hide();
var $invokedOn = $menu.data("invokedOn");
var $selectedMenu = $(e.target);
settings.menuSelected.call(this, $invokedOn, $selectedMenu);
});
return false;
});
//make sure menu closes on any click
$('body').click(function () {
$(settings.menuSelector).hide();
});
});
function getMenuPosition(mouse, direction, scrollDir) {
var win = $(window)[direction](),
scroll = $(window)[scrollDir](),
menu = $(settings.menuSelector)[direction](),
position = mouse + scroll;
// opening menu would pass the side of the page
if (mouse + menu > win && menu < mouse)
position -= menu;
return position;
}
};
})(jQuery, window);
$("#container").contextMenu({
menuSelector: "#contextMenu",
menuSelected: function (invokedOn, selectedMenu) {
var msg = "You selected the menu item '" + selectedMenu.text() +
"' on the value '" + invokedOn.text() + "'";
var itsId = $(invokedOn).attr('id');
var selectedText = $(invokedOn).get(0).outerHTML;
var parentDiv = $(invokedOn).parent();
alert(selectedText);
if (selectedMenu = "Clone"){
alert("inside");
$(selectedText).clone().insertAfter(selectedText);
}
}
});
@import url(http://netdna.bootstrapcdn.com/bootstrap/3.0.0/css/bootstrap.min.css)
<script src="//ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>
<script src="//netdna.bootstrapcdn.com/bootstrap/3.0.0/js/bootstrap.min.js"></script>
<div id="container">
<div id="content">content</div>
<div id="content2">
<p>This is p </p>
<h3> This is h3 </h3>
</div>
<button id="button">show it</button>
</div>
<ul id="contextMenu" class="dropdown-menu" role="menu" style="display:none" >
<li><a tabindex="-1" href="#">Clone</a></li>
<li><a tabindex="-1" href="#">Another action</a></li>
<li><a tabindex="-1" href="#">Something else here</a></li>
<li class="divider"></li>
<li><a tabindex="-1" href="#">Separated link</a></li>
</ul>
<!-- Post Info -->
<div style='position:fixed;bottom:0;left:0;
background:lightgray;width:100%;'>
About this SO Question: <a href='http://stackoverflow.com/q/18666601/1366033'>Use Bootstrap 3 dropdown menu as context menu</a><br/>
<div>
A:
First of all selectedMenu = "Clone" is not comparing anything. It is assigning the word Clone to the selectedMenu variable.
You should use == and since selectedMenu is a jQuery object you should check agains its text. so
if (selectedMenu.text() == "Clone")
Now, selectedText also hold the HTML string extracted with $(invokedOn).get(0).outerHTML
So you most likely want to clone that element and insert it after itself.
$(invokedOn).clone().insertAfter(invokedOn);
(so you actually do not need to extract the html at all)
(function ($, window) {
$.fn.contextMenu = function (settings) {
return this.each(function () {
// Open context menu
$(this).on("contextmenu", function (e) {
// return native menu if pressing control
if (e.ctrlKey) return;
//open menu
var $menu = $(settings.menuSelector)
.data("invokedOn", $(e.target))
.show()
.css({
position: "absolute",
left: getMenuPosition(e.clientX, 'width', 'scrollLeft'),
top: getMenuPosition(e.clientY, 'height', 'scrollTop')
})
.off('click')
.on('click', 'a', function (e) {
$menu.hide();
var $invokedOn = $menu.data("invokedOn");
var $selectedMenu = $(e.target);
settings.menuSelected.call(this, $invokedOn, $selectedMenu);
});
return false;
});
//make sure menu closes on any click
$('body').click(function () {
$(settings.menuSelector).hide();
});
});
function getMenuPosition(mouse, direction, scrollDir) {
var win = $(window)[direction](),
scroll = $(window)[scrollDir](),
menu = $(settings.menuSelector)[direction](),
position = mouse + scroll;
// opening menu would pass the side of the page
if (mouse + menu > win && menu < mouse)
position -= menu;
return position;
}
};
})(jQuery, window);
$("#container").contextMenu({
menuSelector: "#contextMenu",
menuSelected: function (invokedOn, selectedMenu) {
var msg = "You selected the menu item '" + selectedMenu.text() +
"' on the value '" + invokedOn.text() + "'";
var itsId = $(invokedOn).attr('id');
var selectedText = $(invokedOn).get(0).outerHTML;
var parentDiv = $(invokedOn).parent();
alert(selectedText);
if (selectedMenu.text() == "Clone"){
alert("inside");
$(invokedOn).clone().insertAfter(invokedOn);
}
}
});
@import url(http://netdna.bootstrapcdn.com/bootstrap/3.0.0/css/bootstrap.min.css)
<script src="//ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>
<script src="//netdna.bootstrapcdn.com/bootstrap/3.0.0/js/bootstrap.min.js"></script>
<div id="container">
<div id="content">content</div>
<div id="content2">
<p>This is p </p>
<h3> This is h3 </h3>
</div>
<button id="button">show it</button>
</div>
<ul id="contextMenu" class="dropdown-menu" role="menu" style="display:none" >
<li><a tabindex="-1" href="#">Clone</a></li>
<li><a tabindex="-1" href="#">Another action</a></li>
<li><a tabindex="-1" href="#">Something else here</a></li>
<li class="divider"></li>
<li><a tabindex="-1" href="#">Separated link</a></li>
</ul>
<!-- Post Info -->
<div style='position:fixed;bottom:0;left:0;
background:lightgray;width:100%;'>
About this SO Question: <a href='http://stackoverflow.com/q/18666601/1366033'>Use Bootstrap 3 dropdown menu as context menu</a><br/>
<div>
Fixed demo at http://jsfiddle.net/X9tgY/1527/
|
{
"pile_set_name": "StackExchange"
}
|
This is a locked thread. To comment and or discuss please goAt the preset time this is a work in progress, more denims will be added.The images will also be placed in theand on the Iron Heart
|
{
"pile_set_name": "OpenWebText2"
}
|
Search This Blog
Tuesday, April 24, 2012
NS Heritage Fleet
So in honor of the 30th anniversary of the merger of of the Southern Railroad with the *cough* other railroad, Norfolk Southern announced it will honor the occasion by painting 18 locomotives in original paint schemes of railroads that make up the present day company. Five of these will come from the Southern.
How cool is this?
The locomotive is in SR "Green Tuxedo" paint! The others are the Savanna & Atlanta, original Norfolk Southern, Interstate, and Central of Georgia.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Перенос сведений из полей в ячейки таблицы
Как сделать перенос общих сведений, вводимых в заполняемые поля, в нужные ячейки таблицы?
И подсчитать количество вхождений символа «&» в текстовую таблицу?
A:
Не совсем понятна первая часть вопроса: если таблица TStringGrid, то у него в свойстве Options есть настройка goEditing, её нужно поставить True, и в сетку можно вводить данные с клавиатуры.
Вторая часть:
Заводим переменные: кол-во символов, счётчик строк, счётчик столбцов, длина строки, индекс элемента строки (все переменные целые);
кол-во символов = 0;
Мотаем цикл от 0 до кол-во строк-1;
Мотаем цикл от 0 до кол-во столбцов-1;
Берём из ячейки строку;
Присваиваем её длину переменной;
Затем мотаем цикл от 1 до длины строки;
Если символ = "&", то кол-во символов = кол-во символов + 1.
Выводим результат.
Вот как-то так.
Первая часть задания: можно посмотреть здесь, если, конечно, это поможет.
|
{
"pile_set_name": "StackExchange"
}
|
[Social relations and self- rated health: the ageing and health project].
To investigate the association between social relationships and self-perceived health in the elderly. cross-sectional study of a representative sample of elderly individuals covered by the Family Health Program and residents in an area of high health vulnerability in Belo Horizonte, MG. Information was obtained through structured interviews. Factors associated with poor or very poor self-perceived health were identified by multiple logistic regression analysis. 363 out of 371 eligible elderly participated; 17.1% of elderly self-perceived their health as poor. There was a positive dose-response relationship between poor self-perceived health and the number of chronic diseases and the degree of difficulty to perform daily life activities. Elderly individuals who perceived their personal relationships as bad and who could not count on anyone if they became bedridden were more likely to self-rate their health as poor. Working was negatively associated with self-perceived poor health. The results confirm the multidimensional structure of self-perceived health including the issues related to health and social relationships. Our results strengthen the role of social relations on health.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Flutter app print statements will not show up in adb logcat
I am trying to write to adb logcat from my flutter app.
The code I have is as follows. It is just the default init project, with some print writes.
import 'package:flutter/material.dart';
void main() => runApp(MyApp());
class MyApp extends StatelessWidget {
@override
Widget build(BuildContext context) {
return MaterialApp(
title: 'Flutter Demo',
theme: ThemeData(
primarySwatch: Colors.blue,
),
home: MyHomePage(title: 'Flutter Demo Home Page'),
);
}
}
class MyHomePage extends StatefulWidget {
MyHomePage({Key key, this.title}) : super(key: key);
final String title;
@override
_MyHomePageState createState() => _MyHomePageState();
}
class _MyHomePageState extends State<MyHomePage> {
int _counter = 0;
void _incrementCounter() {
setState(() {
print("HELLOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO");
_counter++;
});
}
@override
Widget build(BuildContext context) {
print("HELLOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO");
return Scaffold(
appBar: AppBar(
title: Text(widget.title),
),
body: Center(
child: Column(
mainAxisAlignment: MainAxisAlignment.center,
children: <Widget>[
Text(
'You have pushed the button this many times:',
),
Text(
'$_counter',
style: Theme.of(context).textTheme.display1,
),
],
),
),
floatingActionButton: FloatingActionButton(
onPressed: _incrementCounter,
tooltip: 'Increment',
child: Icon(Icons.add),
),
);
}
}
Once I install to my USB debugging device, I run...
adb logcat
From the terminal. There is lots of logging happening when I do this, but nothing shows up from my flutter application.
When I instead run flutter run , then the print statements will show up in the terminal from which I ran it.
Why is nothing showing up in adb logcat?
A:
Flutter use Run tab to display logs in Android Studio (or DEBUG CONSOLE in VSCode). That's mean adb logcat could not show any thing because it not supported by Flutter. More detail here and here.
However, you could use flutter logs instead of adb logcat to get your log when you run an apk which installed on your device (debug mode). Sadly, sometime it not work (tested: ~30%).
Step 1: Run the commend below.
$ flutter logs
Showing <device name> logs:
Step 2: Start your application.
$ flutter logs
Showing <device name> logs:
I/flutter (<pid>): Observatory listening on http://127.0.0.1:34710/<secret key>/
I/flutter (<pid>): <your log>
...
Step 3: Read log from command line or start a new command prompt and run flutter pub global run devtools after that.
$ flutter pub global run devtools
Serving DevTools at http://127.0.0.1:9100
Step 4: Use the http://127.0.0.1:34710/<secret key>/ link got from command line for start DevTools.
|
{
"pile_set_name": "StackExchange"
}
|
London Bubble Theatre Company
The London Bubble Theatre Company was founded in 1972.
The Company originated Return to the Forbidden Planet for a production in a tent.
Artistic Directors
London Bubble's Artistic Directors have been:
Glen Walford 1972–1974
Peter Coe 1975
Glen Walford 1976–1979
Bob Carlton 1979–1984
Bob Eaton 1984–1986
Peter Rowe 1986–1989
Jonathan Petherbridge 1989–present
References
External links
London Bubble Theatre Company website
Category:Theatre companies in London
Category:Theatre companies in the United Kingdom
|
{
"pile_set_name": "Wikipedia (en)"
}
|
This item cannot be ordered online. If you are interested please click on the Ask a Question button below.
During the development of Statement, Naim Audio's flagship amplification system, their engineers realised that they would need to design a whole new range of high-performance cables for it to reach its true potential.
With this in mind they began a development project to design interconnects and speaker cable that would meet Statement standards of performance. Through a deep understanding of material science and after thousands of hours testing in the listening room, the Super Lumina range was born.
Designed to maximise the performance of Statement but equally at home in 500 Series and Classic Series systems, Super Lumina speaker cables are available with 4mm or spade connectors.
This item cannot be ordered online. If you are interested please click on the Ask a Question button below.
Super Lumina speaker cables are designed to minimise the effect of external and internal interference sources and preserve maximum signal fidelity.
The fundamental cable design consists of several individually-insulated multi-strand silver-plated copper conductors of varying diameters enclosed in a tin-plated copper shield. This is all enclosed in a soft outer jacket which facilitates easy installation whilst minimising microphonic interference. Each signal, return, ground and shield conductor is individually manufactured for its specific function.
Each Super Lumina cable is hand-assembled at Naim Audio in Salisbury to the customer's specification of length and termination. The process is intricate and highly-skilled, following detailed instructions which cover every aspect of the build. Every cable also goes through a proprietary de-stressing process to relieve the materials of the inherent stresses which are a result of the manufacturing process. This means the cables reach optimum performance with minimal run in time.
We endeavour to despatch same day (for orders placed up to 2pm) on available stock items to the vast majority of UK mainland addresses. Please remember to check with us first for a physical stock check if next day delivery is important to you.
UK ORDERS: We despatch the bulk of our UK mainland items on a 24 hour service – Free of Charge. Free delivery also applies to the Isle of Man, Isle of Wight, the Scilly Isles, the Scottish highlands and Islands, the Channel Islands and Northern Ireland but may take a day or so longer. Smaller items are delivered using Royal Mail recorded delivery or special delivery. Larger items are delivered using a courier service such as Interlink Express, DPD, UPS or DHL.
INTERNATIONAL ORDERS: We offer competitive rates which can be confirmed by email. Please just ask – we will need a full delivery address and telephone number. Smaller items are delivered using Royal Mail Small Packets Airmail with International Tracked and/or Signed depending on value of item and availability of the service. Larger International shipments are sent by insured and tracked services using DPD, DHL or UPS. If there are any delays due to specific customs regulations, etc, you will be contacted by Hifisound or by the courier with a request for any further information required. Customs duties do not apply for shipments into any EU country (for a full list please refer to the EU Country List). Customs duties can apply for countries outside of the EU. Customers in these countries are responsible for all taxes and duties incurred when the items enter their country.
COLLECT IN STORE OR HOME INSTALL:At the request of the manufacturer some items cannot be supplied by mail order but you can click and buy them and then elect to collect them from our store or arrange a home install (if applicable). Applicable items clearly state that they are Collect in store or home install. Once ordered you will receive a message prompting you to contact us by phone or email to arrange for us to deliver and install or to reserve and collect from our store at your convenience.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
How to divide paper up into smaller pages in ConTeXt?
I need to create some cards, of various sizes, cut from larger letter (8.5" x 11") pages. These are for putting in different sized pocket charts for displaying information in a classroom.
All are fairly simple, with header (just like on regular pages) plus some large, vertically and horizontally centered text. Here are some sample layouts:
These cards measure 8.5" x 5:
_____________________
| Header |
| | <--page 1
| Centered text |
| |
|---------------------|
| Header |
| | <--page 2, but would be printed on same paper
| Centered text |
| |
|_____________________|
These cards measure 11"x4" in landscape mode and the bottom 0.5" is discarded:
__________________________
| Header |
| Centered text |
|--------------------------|
| Header |
| Centered text |
|--------------------------|
|__________________________|
Is there a way to have ConTeXt setup the pages this way? A simple \pagebreak command would send documents to the next "page" while still being on the same physical page when printed, and headers appear on top like normal. Cuttings lines aren't needed, as I can measure on a paper cutter to get the cuts right.
A:
You could use ConTeXt's imposition mechanism. The examples have to be typeset using context --arrange.
\setuparranging[2TOP]
\definepapersize
[card]
[height=5in,width=8.5in]
\setuppapersize
[card]
[letter]
\definemakeup
[custom]
[align=middle,headerstate=start]
\setupheadertexts[Header][]
\showframe
\starttext
\startmakeup[custom]
Centered text
\stopmakeup
\startmakeup[custom]
Centered text
\stopmakeup
\stoptext
For the second layout just replace in the above
\definepapersize
[card]
[height=4in,width=11in]
\setuppapersize
[card]
[letter,landscape]
|
{
"pile_set_name": "StackExchange"
}
|
To get support, first fill in this FORM
There are some important notes:
To proceed with the swap, we will send you TOMO native manually case by case so it may take some time to get work done.
The program happens every 1st week of the month until December 2020.
We charge a flat fee of 50 TOMO every account to get support.
The address connected to IDEX that stored TOMO ERC20 is the ERC20 address. Please note IDEX is a decentralized exchange , it does not control your wallets. We will send TOMO native back to the ERC20 address you provide in the form.
, it does control your wallets. We will send TOMO native back to the ERC20 address you provide in the form. We will proceed with the TOMO native transactions 5th-7th every month. You will receive the confirmation email from us. Please follow the guide inside to access the Tomo native balance and start transacting new TOMO as you wish.
⚡️ How to connect to TomoChain mainnet on theERC20 address and check a new balance?
What should you do with valid TOMO beside trading on exchanges? 🚩EARN PASSIVE INCOME WITH TOMOCHAIN STAKING🚩
⚡ ️All about TomoChain Staking!
•. Understand TomoChain reward merchanism. Check the reward HERE
•. Which node(s) should I vote for? Join Masternodes and Voters Chat for direct communication with masternode owners.
•. Stake TOMO with Ledger Nano & TomoWallet
Join TomoChain telegram chat to get more support from admins and community members.
Stay tuned and wait for our contact!
Cheers.
|
{
"pile_set_name": "OpenWebText2"
}
|
Ping localhost failed in BackupPC after Ubuntu 12.04 upgrade
After upgrading my backup server from the previous LTS release (Lucid) to the new one, the config which backs up /etc on localhost was failing. It was failing because pings to localhost were failing. This is no good – localhost should be pingable. :) Ultimately, this is because IPv6 is enabled by default now. I don’t use IPv6 on my internal network, mostly because it’s new and scary and I don’t like change. Or because I just don’t need it. So, here’s how to disable IPv6 on your Ubuntu 12.04 / Precise box:
Note how the inet6 address goes away as soon as ipv6 is disabled. This will be in effect until you next reboot. To make it permanent, you can create a file in sysctl.d and apply that (then run sysctl again just to make sure it was set):
The other option is to actually configure the path to ping6 in the BackupPC config file (/etc/backuppc/config.pl) by putting in a value for Ping6Path – such as $Conf{Ping6Path} = ‘/bin/ping6’; The default config on newer systems has that parameter set to an empty string; older installs which have been upgraded don’t even have that parameter included.
Your choice of solution will vary based on whether or not you use IPv6. If you don’t know, then you’re not using IPv6 and can pretty safely just disable it. Otherwise, just configure BackupPC the way it should’ve been configured to begin with.
|
{
"pile_set_name": "Pile-CC"
}
|
Un bărbat din Brașov a strâns gunoiul aruncat de un șofer de TIR, pe marginea drumului, iar în momentul în care a încercat să-i atragă atenția, s-a ales cu înjurături și șicane în trafic, potrivit BizBrașov.ro.
Ionuț Drăguțu, administratorul public al Râșnovului a relatat pe pagina sa de Facebook un episod mai puțin plăcut petrecut, în trafic, pe DN 73, în apropiere de comuna Cristian. Bărbatul a observat cum un șofer de TIR a aruncat gunoiul din cabină pe marginea drumului. În momentul în care a încercat să-i atragă atenția șoferului, brașoveanul s-a ales cu înjurături și șicane în trafic.
Setarile tale privind cookie-urile nu permit afisarea continutul din aceasta sectiune. Poti actualiza setarile modulelor coookie direct din browser sau de aici – e nevoie sa accepti cookie-urile social media
Dorind, totuși, să atragă atenția asupra gestului necivilizat, Ionuț Drăguțu a decis să trimită gunoiul, prin colet, celor de la compania de transport unde este înmatriculat TIR-ul.
„Am decis să le fac un cadou celor de la compania de transport, fiindcă poate așa reușim să schimbăm mentalități și să îi motivăm și pe alții să ia atitudine. Am sunat și la 112 , când s-a întâmplat incidentul, doar ca mare lucru nu am rezolvat, mi-au zis să merg să fac reclamație și să atașez dovezile. Nu mă interesa să-l sancționeze pentru șicanearea din trafic, dar măcar pentru că a aruncat gunoiul pe marginea drumului”, a explicat Ionuț Drăguțu, potrivit sursei citate.
|
{
"pile_set_name": "OpenWebText2"
}
|
[Synapses with myelinated and unmyelinated preterminal portions of axons in cat cerebral cortex].
The electron microscopic study of the cat cerebral cortex revealed two kinds of preterminal axonal regions with synaptic boutons at the end: nonmyelinated and myelinated. In the first case their diameter was about 90 nm; in the second case it was considerably greater; the myelin could reach the bouton. The possible physiological meaning of these structural features is discussed.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
John Klossner
Klossner: Accidents happen?
Every fall, after the leaves have turned but hopefully before the first snow, I go hiking with my friend (and former GAO employee) Andy. Our treks usually follow the same routine: We hike into one of the Appalachian Mountain Club huts, change from our sweaty and smelly hiking gear into our not-yet-sweaty-and-smelly indoor gear, eat one of the incredibly hearty hut meals (of course, after hiking for six to nine hours, a can of Spaghetti-O's qualifies as "hearty," but the hut meals are the real thing, I assure you) and go to the rustic bookshelves for back copies of "Appalachia."
"Appalachia," a publication of the Appalachian Mountain Club in the northeastern United States, calls itself "America's Longest-Running Journal of Mountaineering and Conservation." I first came across it while staying in one of the huts on the Appalachian Trail in the White Mountains of New Hampshire. Since, after a long day of hiking, I was too tired to read any of the lengthy pieces, I looked for shorter, more manageable entries -- pieces that I would be able to finish before falling asleep with the magazine over my face. This led me to the Accidents section.
"Appalachia" is published twice yearly. This allows the editors to compile all the previous season's — winter or summer — accidents in each issue, giving the reader a full slate of accidental possibilities. I find it educational, sobering and at times highly entertaining. (I'd share some favorites with you, but then I'd be exceeding international blogging length standards.)
One of my favorite ingredients of the Accidents section is the editor's comment that follows each entry. The Accidents editor has a wonderful voice — that of a stern, suffer-no-fools parent who offers little sympathy for the cast on your arm while he asks, "Well, what did you THINK would happen when you jumped off the garage roof?" The Accidents editor operates on the basic premise that the mountains and trails are wilderness, with no seatbelt regulations, no Wi-Fi, and no Starbucks, (rumors of Starbucks kiosks being installed in Yellowstone have not been substantiated at this time), and hikers are responsible for their own actions and interactions with nature.
This week's editorial subject brought the Accidents section to mind. The data breach at a National Institutes of Health agency could be read as an accident, something that is none-too-rare in our world these days. A laptop PC getting stolen can happen as easily as slipping on a wet rock at tree line. Besides, the laptop in question had been protected: It had been placed in a locked car trunk. What more could the employee have done? This is where the Accidents editor comes in. Instead of the "Gee, you're right. You did all you could do, short of staying in the trunk with the computer" response, he could give you the "What didn't you do?" response. In this case, I imagine the Accidents editor's comment as something like this:
Data theft is not an uncommon experience these days, and anyone who collects data assumes the responsibility for the safeguarding of the information. This includes taking all current technological precautions. Saying that the stolen laptop was "off and password protected" and that officials "believe it's unlikely that the patients will be victims of identity theft or financial loss" is not enough when there are other steps that could have been taken. In this case, the data was not encrypted, when encryption is an accepted and recommended practice with all sensitive data storage. The response from those who don't encrypt seems to be that it is an inconvenience — for both the party sending and the party receiving the data. One would assume this is not the same inconvenience as the negative publicity (and added man-hours of time spent dealing with the lost data ) an organization receives when they are the victim of a data theft. To its minor credit, NIH has now instituted a policy of encryption for all of its laptops. This is commendable, but it's not as if they didn't know about encryption before the theft. One hopes they are using this experience to become forward-looking with security policy, not shutting the barn door after the horses have left the laptop in the trunk.
In thinking about cartoon possibilities for this subject, I was torn between two directions: ignorance and laziness. If NIH officials were ignorant — they didn't know about encryption — that would be one thing, and I would do this cartoon.
But ignorance, as discussed in the editor's comment above, isn't the case here. The parties involved didn't encrypt because of the inconvenience. That led to this week's cartoon.
|
{
"pile_set_name": "Pile-CC"
}
|
<!DOCTYPE html>
<html lang="en">
<head>
<meta charset="utf-8" />
<meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no" />
<link rel="stylesheet" type="text/css" href="https://www.jqwidgets.com/public/jqwidgets/styles/jqx.base.css">
<link rel="stylesheet" type="text/css" href="https://www.jqwidgets.com/public/jqwidgets/styles/jqx.material-purple.css">
</head>
<body>
<div id="app"></div>
</body>
</html>
|
{
"pile_set_name": "Github"
}
|
I want to know why posts of mine take hours to be put up sometimes, even while moderated posts made long after mine are put thru. This is even when it's not very busy here. I've noticed as long as I have an opinion or observation that agrees with yours' they make it up in no time; but, if I post anything too critical of Nationalism or a Nationalist it takes a very long time or never gets there at all. I'm not here to agree with you, that's why I'm in OV and only a guest. I have mixed views on race and they aren't always going to conform to yours.
I can think of only one post that was too inflammatory, the rest have been within the guidelines. Patience is one thing, waiting a few hours or more is another.
46672
Well, Its not us trying to silence you if thats what you mean...
No seriously, you'd be surprised the number of posts that we have to pass, so cut us some slack...
I want to know why posts of mine take hours to be put up sometimes, even while moderated posts made long after mine are put thru. This is even when it's not very busy here. I've noticed as long as I have an opinion or observation that agrees with yours' they make it up in no time; but, if I post anything too critical of Nationalism or a Nationalist it takes a very long time or never gets there at all. I'm not here to agree with you, that's why I'm in OV and only a guest. I have mixed views on race and they aren't always going to conform to yours.
I can think of only one post that was too inflammatory, the rest have been within the guidelines. Patience is one thing, waiting a few hours or more is another.
46672
I am pretty sure that they let posts through by registered members faster. There is a reason for that. These people took the time to get registered.
My advise is if you want quality debate, I suggest registering, since after a certain amount of posts...we'll take you off moderation list (which means you'll post will appear directly) provided you've followed the guidelines of course...and that'll save you and us alot of time. Ok?
My advise is if you want quality debate, I suggest registering, since after a certain amount of posts...we'll take you off moderation list (which means you'll post will appear directly) provided you've followed the guidelines of course...and that'll save you and us alot of time. Ok?
|
{
"pile_set_name": "Pile-CC"
}
|
Iraqi Scientist Meets U.N. Inspectors
Published 7:00 pm, Friday, January 24, 2003
International arms inspectors met with an unidentified Iraqi on Saturday in their effort to recruit well-placed scientists for private U.N. interviews on Iraqi weapons programs. Neither U.N. nor Iraqi spokesmen reported any progress.
At the request of U.N. inspectors, Baghdad government officials had urged three scientists to submit to such questioning. But knowledgeable sources said at least two of them had refused to speak without Iraqi government officials monitoring the questions and answers.
A U.N. inspections team leader met he unidentified Iraqi man, accompanied by an Iraqi official, at about 10:40 a.m. at the front door of a Baghdad hotel and led him inside. The man departed about noon in a government car, seen off by the same inspector. He refused to speak with waiting reporters.
The subject of private interviews has become a major issue in advance of a U.N. chief inspectors' report Monday on how well Iraq has cooperated during the first two months of renewed arms inspections.
Earlier Saturday, in unrelated and unexplained incidents, two men _ one carrying knives, the other shouting "Save me!" and carrying a notebook _ tried to enter the U.N. inspectors' compound on Baghdad's outskirts, a U.N. spokesman reported.
The first man was apprehended as he tried to get through a front gate and was taken away by Iraqi police. Journalist witnesses said the second was led inside the compound, and U.N. spokesman Hiro Ueki said he was handed over to Iraqi authorities at a government office next door.
Two days before its "report card" on arms inspections, one U.N. agency said Baghdad would get a "quite satisfactory" grade on its responses to inspectors' questions and requests for information. In Washington, the White House, easing off the tougher rhetoric of recent days, said Friday it might give inspectors more time to look for weapons, depending on the content of Monday's report.
Late Friday, the Iraqi Foreign Ministry said new requests had been received from U.N. officials for interviews Saturday with three Iraqi scientists, who were not publicly identified. The Iraqi liaison agency working with the inspectors said it had "encouraged" the three to grant private interviews.
In its harsh criticism of Iraq, the Bush administration has focused most sharply on the issue of private interviews of scientists.
The Security Council resolution governing the inspections declares that "Iraq shall provide … private access" to anyone the inspectors wish to interview.
The inspectors believe that Iraqis knowledgeable about possible weapons programs would be less candid when questioned with government monitors present. In all formal interview requests thus far, however, the Iraqi specialists have asked to have government representatives present.
The Baghdad government says it cannot force its scientists into private interviews, but it reached agreement with the chief inspectors last Monday to "encourage" interview subjects to submit to unmonitored questioning.
The White House on Friday rejected the Iraqi approach. "President Bush believes that Iraq's refusal to allow Iraqi scientists to submit to private interviews with U.N. inspectors is unacceptable," spokesman Ari Fleischer said.
Meanwhile, international opposition to the U.S. threats of war against Iraq appeared to solidify.
France, Germany and Russia all urge that the inspectors be given more time to do their job of assessing whether Iraq has weapons of mass destruction or programs to build them. After conferring Friday with Russian President Vladimir Putin, the German chancellor, Gerhard Schroeder, reported "growing support" in Europe for Germany's opposition to military action.
Secretary of State Colin Powell warned Saturday that the international community it cannot shrink from its responsibility to disarm Iraq by force if necessary just because "the going is getting tough."
"The burden is upon Iraq," Powell said on his arrival in Davos, Switzerland, where 2,300 world political and business leaders have gathered for an annual meeting. "Iraq must comply, or it will be made to comply with military force."
Powell made no mention of a timetable. But the U.S. government were considering giving the U.N. inspectors more time to find Iraq's alleged weapons of mass destruction, a senior U.S. official said.
The Security Council's next moves will be based on a report it receives Monday from chief U.N. weapons inspector Hans Blix and Mohamed ElBaradei, head of the International Atomic Energy Agency (IAEA), on Iraqi cooperation in the two months since inspections resumed.
The IAEA said Friday that analyses of samples taken by nuclear inspectors in Iraq have so far not revealed any evidence of prohibited nuclear activity.
Blix has said his report will be a "mixed bag." He notes the Iraqis have cooperated well on hundreds of daily inspections since Nov. 27 _ of chemical plants, nuclear centers, medical laboratories and other "sites of concern." The inspectors thus far have not reported finding any violations of U.N. bans on Iraqi weapons of mass destruction.
"Their report card will be a `B,'" on requests for information and responses to questions, said Mark Gwozdecky, a spokesman for ElBaradei's nuclear agency.
But Blix complains that Iraq has resisted allowing American U-2 reconnaissance planes to aid the inspection effort.
Saturday's daily inspections took U.N. teams to Al-Qaddissiya University, 150 miles south of Baghdad; the Northern Oil Company in Mosul Province 240 miles north of the capital; and a missile site in the al-Dejehiel area, 36 miles north of Baghdad.
They also revisited the Qa Qa chemical complex, 40 miles south of Baghdad, where inspectors have checked the facilities about a dozen times since November. Western intelligence reports said Qa Qa might be the site of Iraqi chemical weapons work, but no such violations have been reported thus far.
As the crucial U.N. report date approached, the fear of war was taking stronger hold among Iraqis.
The Iraqi Parliament speaker, Saadoun Hammadi, declared Saturday that if war comes, Iraqis "will fight fiercely until the end," and would use "every method to inflict heavy damages on the enemy."
Hammadi, speaking at a news conference in New Delhi, India, did not elaborate on what he meant by "every method." The U.S. government has repeatedly warned the Iraqi military not to use any chemical or biological weapons it may have against U.S. troops.
Here in Baghdad, a few foreign embassies have decided to evacuate dependents, or even to close down. Japan has urged its citizens to leave Baghdad, citing the possibility of military action.
|
{
"pile_set_name": "Pile-CC"
}
|
[Cardiovascular complications of cancers and anti-cancer therapy].
In our aging population the incidence of cancer is increasing in the elderly. We are thus facing a new challenge especially considering incidence of cardiovascular diseases (CVD) in this patients population. Overall survival of cancer patients has significantly improved therefore cancer has become in many cases a chronic disease. We are about to be treating patients who either may develop a new CVD or their current CVD may deteriorate. Cancer can cause various cardiovascular conditions locally (pressure in mediastinum, effusions) or systemically (increased risk of pulmonary embolism, arrhythmias, carcinoid heart disease). Medical cancer therapy can lead to congestive heart failure (CHF) per se, by anthracycline or antiHER2 therapy direct cardiac toxicity or by number of other cardiac conditions medical treatment can cause, such as accelerated arterial hypertension due to anti-angiogenic therapy (tyrosine-kinase inhibitors, bevacizumab) or even standard chemotherapy (alkylating agents, cisplatin) or overusing steroids in cancer patients. Atrial fibrillation (AFib) also contributes to CHF development. AFib in cancer patients may develop secondary to ischaemia in anaemic patients, metabolic disorders caused by cancer or treatment, pulmonary embolism, sepsis or even as a result of direct impact of cytotoxic treatment (cisplatin, ifosfamide, gemcitabine, 5-fluorouracil, etoposide). One of major risk factors for CHF is coronary artery disease (CAD), which is a very serious late sequel of cancer therapy mainly in long time cancer survivors (testicular cancer, childhood cancer, hematologic malignancies, breast cancer). CAD may develop secondary to thoracic irradiation, dyslipidemia caused by hormonal treatment or simply as results of endothelial dysfunction caused by alkylating agents. In summary, long time cancer survivors represent a subgroup of patients at great risk of developing CVD in any form. It is crucial to mention that these patients can develop typical CVD much earlier compared to standard population and therefore require special follow-up with active surveillance.Key words: anthracycline - atrial fibrillation - cardiac toxicity - heart failure - pulmonary embolism.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The wind-and-react method involves winding the precursor to a superconducting material around a mandrel in order to form a coil, and then processing the coil with high temperatures and an oxidizing environment. The processing method results in the conversion of the precursor material to a desired superconducting material, and in the healing of micro-cracks formed in the precursor during the winding process, thus optimizing the electrical properties of the coil.
Superconducting magnetic coils, like most magnetic coils, are formed by wrapping an insulated conducting material around a mandrel defining the shape of the coil. When the temperature of the coil is sufficiently low that the conductor can exist in a superconducting state, the current-carrying performance of the conductor is markedly increased and large magnetic fields can be generated by the coil.
Certain ceramic materials exhibit superconducting behavior at low temperatures, such as the compound Bi.sub.2 Sr.sub.2 Ca.sub.n Cu.sub.n O.sub.2n+4 where n can be either 1, 2, or 3. One material, Bi.sub.2 Sr.sub.2 Ca.sub.2 Cu.sub.3 O.sub.10 (BSCCO (2223)), performs particularly well in device applications because superconductivity and corresponding high current densities are achieved at relatively high temperatures (T.sub.c =115 K.). Other oxide superconductors include general Cu-O-based ceramic superconductors, such as members of the rare-earth-copper-oxide family (ie., YBCO), the thallium-barium-calcium-copper-oxide family (ie., TBCCO), the mercury-barium-calcium-copper-oxide barium-calcium-copper-oxide family (ie., HgBCCO), and BSCCO compounds containing lead (ie.,(Bi,Pb).sub.2 Sr.sub.2 Ca.sub.2 Cu.sub.3 O.sub.10).
Insulating materials surrounding the conductor are used to prevent electrical short circuits within the winding of a coil. From a design point of view, the insulation layer must be able to withstand large electric fields (as high as 4.times.10.sup.5 V/cm in some cases) without suffering dielectric breakdown, a phenomenon that leads to electrical cross-talk between neighboring conductors. At the same time insulation layers must be as thin as possible (typically less than 50-150 .mu.m) so that the amount of superconducting material in the coil can be maximized.
Using existing conducting and insulating materials, the maximum magnetic field generated by a superconducting coil is ultimately determined by the winding density (defined as the percentage of the volume of the coil occupied by the conductor) and the coil geometry. However, the large tensional forces necessary for high winding densities can leave conductors in highly stressed and/or strained states. The bend strain of a conductor, equal to half the thickness of the conductor divided by the radius of the bend, is often used to quantify the amount of strain imposed on the conductor through coil formation. Many superconducting magnet applications involving high-density conductor windings require conductor bend strains on the order of 0.2%, and in some cases much higher. The critical strain of a conductor is defined as the amount of strain the material can support before experiencing a dramatic decrease in electrical performance. The critical strain value is highly dependent on the formation process used to fabricate the conductor, and is typically between 0.05%-1.0%, depending on the process used. If the bend strain exceeds the critical strain of a conductor, the current-carrying capability of the conductor, and hence the maximum magnetic field generated by a coil, will be decreased significantly.
One approach to manufacturing high-performance conductors having desirable mechanical properties involves starting with a precursor to a high temperature superconducting material, typically a ceramic oxide in a powder form. Despite relatively poor mechanical properties and more complex manufacturing processes which requires high temperatures and an oxidizing environment, high temperature superconducting materials are preferred to low temperature superconducting materials for certain applications because they operate at higher ambient temperatures. Oxide powders are packed into a silver tube (chosen because of malleability, inertness, and high electrical conductivity) which is then deformed and reduced in size using standard metallurgical techniques: extrusion, swaging, and drawing are used for axisymmetric reductions resulting in the formation of rods and wires, while rolling and pressing are used for aspected reductions resulting in the formation of tapes and sheets (Sandhage et al., "Critical Issues in the OPIT Processing of High-Ic BSCCO Superconductors", Journal of Metals 3, 21, 1991).
Following the deformation process, heating and cooling results in the growth and evolution of individual crystalline oxide superconductor grains in the conductor which typically take on a rectangular platelet shape. Further deformation results in a collective alignment of the crystallographic axes of the grains. An iterative heating/deforming schedule unique to the ceramic oxide forms of superconductors is typically carried out until the desired grain size, alignment, and density of the superconducting state are achieved.
Conductors having a single oxide core, classified as mono-filament composite conductors, result from the iterative schedule described above and can have critical strain values as high as 0.1%. Mono-filament composite conductors can be transformed into multi-filament composite conductors using a rebundling fabrication operation involving further reduction in size of the mono-filament composite conductors, and finally concatenation of individual conductors to form a single conductor. Typically, the evolution of cracks in response to bend strains is more likely in mono-filament composite conductors than in multi-filament composite conductors, where critical strain values increase with the number of filaments in the conductor, and can be greater than 1.0%. Other limitations of mono-filament composite conductors include decreases in crack healing ability and oxygen access to the conductor during processing. Furthermore, because mono-filament composite conductors have only a single superconducting region, it is difficult to control the conductor size and shape, and mechanically robust conductors can not be easily fabricated (K. Osamure, et al., Adv. Cryo. Eng., ICMC Supplemental, 38, 875, 1992). Thus, multi-filament composite conductors have desirable mechanical properties, and can be used in coils requiring high winding densities.
One method used to fabricate coils with multi- and mono-filament composite conductors is the react-and-wind process. This method first involves the formation of an insulated composite conductor which is then wound into a coil. In this method, a precursor to a composite conductor is fabricated and placed in a linear geometry, or wrapped loosely around a coil, and placed in a furnace for processing. The precursor can therefore be surrounded by an oxidizing environment during processing, which is necessary for conversion to the desired superconducting state. In the react-and-wind processing method, insulation can be applied after the composite conductor is processed, and materials issues such as the oxygen permeability and thermal decomposition of the insulating layer do not need to be addressed.
In the react-and-wind process, the coil-formation step can, however, result in straining composite conductors in excess of the critical strain value of the conducting filaments. Strain introduced to the conducting portion of the wire during the deformation process can result in micro-crack formation in the ceramic grains, severely degrading the electrical properties of the composite conductor.
Another method used to fabricate magnetic coils with mono-filament composite conductors is the wind-and-react method. In this method, the eventual conducting material is typically considered to be a "precursor" until after the final heat treating and oxidation step. Unlike the react-and-wind process, the wind-and-react method as applied to high temperature superconductors requires that the precursor be insulated before coil formation, and entails winding the coil immediately prior to a final heat treating and oxidation step in the fabrication process. This final step results in the repair of micro-cracks incurred during winding, and is used to optimize the superconducting properties of the conductor. However, these results are significantly more difficult to achieve for a coil geometry than for the individual wires which are heat treated and oxidized in the react-and-wind process.
Due to the mechanical properties of the conducting material, superconducting magnetic coils fabricated using the wind-and-react approach with mono-filamentary composite conductors have limitations related to winding density and current-carrying ability. Although the wind-and-react process may repair strain-induced damage to the superconducting material incurred during winding, the coils produced are not mechanically robust, and thermal strain resulting from cool down cycles can degrade the coil performance over time.
A feature of the invention is a wind-and-react process which is used to manufacture superconducting magnetic coils with multi-filament composite conductors. This processing method can be used to manufacture several variations of coils types, all of which are discussed below.
An advantage of the invention is ability to produce mechanically robust coils requiring high winding densities, without significantly degrading the superconducting properties of the multi-filament composite conductors used to form the coils.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Scott D. Fink
At a Glance:
Scott Fink is the Managing Partner of the Bankruptcy practice group of WWR who practices in both the Consumer and Commercial Bankruptcy Groups. He is also involved in the firm's Real Estate Default Group. Based in the Brooklyn Heights office, Scott's responsibilities include managing the attorneys and employees in his unit, creating innovative bankruptcy programs for clients and marketing. He earned his B.A. in Political Science from Miami University in 1993 and his J.D. from Case Western Reserve University School of Law in 1997. A member of the Ohio State and Cleveland Metropolitan Bar Associations, Scott is licensed in Ohio and is admitted to practice before the U.S. District Court (Northern and Southern Districts of Ohio). He is a member of the National Association of Chapter 13 Trustees, a Martindale-Hubbell AV Preeminent Peer Review Rated Attorney and was selected for inclusion in the 2010 Ohio Rising Stars list.
Licenses:
Ohio (1998)
U.S. District Court (Northern District of Ohio) (1998)
U.S. District Court (Southern District of Ohio) (2000)
Education:
B.A. in Political Science, Miami University (1993)
J.D., Case Western Reserve University School of Law (1997)
Practice Area:
Bankruptcy
Practice Groups:
Consumer Bankruptcy Group
Commercial Bankruptcy Group
Real Estate Default Group
|
{
"pile_set_name": "Pile-CC"
}
|
Subscribe to this blog
Subscribe via Email
OnePlus 2 Spotted In TENAA Website With Some New Designs
OnePlus 2 is spotted in China's TENAA Certification, which is going to be launched in few days . OnePlus 2 from the date of announcement of launch started appearing in NEWS. OnePlus 2 camera quality and comparison with other flagship was uploaded in YoutTube by renowned tech reviewer MKBHD . For past few days OnePlus 2 rumors are appearing.
There are some images available of the OnePlus 2 through TENAA. There are some new changes to the OnePlus 2. The changes in phone's exteriro seems to be in camera which is still in center but lowered a little bit compared to OnePlus One.
The Exterior of device is a little changed with a slight curve at top in the back and the most interesting change is HOME BUTTON. As revealed by OnePlus, OnePlus 2 will have fingerprint senor.
With all this we can conclude that fingerprint may be placed in that home button. The power on button is to the left and volume rocker to the right. But these are just imahes we are not sure about the device.
According to the OnePlus 2 specifications announcemet by OnePlus, the OnePlus 2 will be having a 5.7-inch display, Qualcomm Snapdragon 810 SoC, 4GB of RAM, 16MP rear camera and 5MP front facing camera. Lets see the full specification of OnePlus 2 in it's launch. Till that
Comments
Post a Comment
Popular posts from this blog
Get Guest Book All the website
holders want to keep the visitors visit again and again. I have solution for
that Copy the codes below and paste it where you want to paste it in your site
and it acts as a Chat box for them with emoticons . Steps
to Add this widget to Your Blogger 1) Open Dashboard 2) Then Click LAYOUT 3) Click add Gadget >> HTML/Javascript 4) Copy the codes and Click Save DEMO
Google Launched it's duo Pixel 2 and Pixel 2 XL in a event on 4th of October. The event was dynamic and included more announcement that just Pixel 2 smartphones which we will see later in this article.
The first generation Pixel and Pixel XL device got 89 rating for it's camera from DXO Mark and this year the 2017 Pixel 2 and Pixel 2 XL got 98 DXO Mark. The duo feature a 12.2MP rear camera, f/1.8 aperture, Dual-LED flash and can shoot 4K videos, they have both OIS and EIS for stabilization. Yes, the pixel does not have a dual camera, Google is using a technology, in layman language, the an image will be from two angles which will give depth perception.
|
{
"pile_set_name": "Pile-CC"
}
|
Since in a filling device the return gas pipe with its relative height position in the filling valve serves not only to precisely adjust the filling level in the container, but also plays an important role in flushing operations and/or in cleaning processes, and since bottlers often want to set different height positions of the return gas pipe, if possible without any external intervention, when changing between different container types, the well-known solution, i.e. to exchange return gas pipe end sections of different lengths, is too complicated and time-consuming, and a process has therefore been adopted in which the return gas pipe is adjusted by means of a positioning drive in a selective way and as required.
In the filling device known from DE 10 2005 031 319 A, the return gas pipe that is supported against rotation comprises an external thread meshing with an internal thread of a ring rotatably supported in the valve housing. A permanent magnet ring which electromagnetically cooperates through the wall of the valve housing with a stator that is stationarily arranged on the outside is positioned on the ring. Magnetic alternating fields that are rotating the ring and screw the return gas pipe in place are generated via the stator. Although this solution avoids any passages with seals (great constructional efforts, difficult cleaning operations, risk of leakage), noticeable electromagnetic losses and relatively great mechanical losses caused by the thread connection and the anti-rotation of the return gas pipe must certainly be accepted. The components for a precise mechanical conversion of rotational movements into linear movements lead not only to great mechanical losses, but, since they are exposed to the media in the filling device, they are objectionable in terms of hygiene and complicate the cleaning cycles.
In the filling device known from DE 198 55 975 C a permanent magnet ring is fixed to the return gas pipe, the ring electromagnetically cooperating through a chamber wall with a permanent magnet positioned outside the chamber. The outer permanent magnet is linearly adjusted in a mechanical way, dragging along the return gas pipe via the inner permanent magnet ring. However, this necessitates a mechanical passage that poses the known sealing and assembling problems. As an alternative, the return gas pipe can be directly coupled by mechanical actuation, but this requires a passage between zones of different pressures and different media. A further solution suggests an extended chamber leading to the outside for the return gas pipe, and a linearly adjustable permanent magnet that is positioned outside the extension and cooperates with the permanent magnet ring on the return gas pipe through the chamber wall. The precision that is achievable in adjusting operations is not always satisfactory because due to the transmission of the magnetic forces through a wall and because of the large gap the inner permanent magnet ring cannot follow the outer one in a very reliable way.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Lentivirus-mediated knockdown of FcγRI (CD64) attenuated lupus nephritis via inhibition of NF-κB regulating NLRP3 inflammasome activation in MRL/lpr mice.
Lupus nephritis, one of the most serious complications of systemic lupus erythematosus (SLE), has been confirmed in a large number of clinical surveys. Current studies have suggested that inflammatory situation is generally considered to facilitate the occurrence and development of lupus nephritis. Previous research found that Fcγ receptor I (FcγRI) was compulsory for several autoimmune and inflammatory diseases, and it might be involved in the treatment of lupus nephritis. Furthermore, the possible molecular mechanism of the role of FcγRI in lupus nephritis still needs a further study. In the present study, in order to evaluate the effect of FcγRI on kidney function in lupus-prone MLR/lpr mice, FcγRI knockdown was implemented utilizing FcγRI-RNAi lentivirus. We reported that the administration of FcγRI-RNAi lentivirus (1) mainly inhibited FcγRI expression on macrophage of the kidneys, lowered the levels of urinary protein and serum anti-dsDNA antibody and prevented the impairment of renal function; (2) reduced the renal inflammatory cytokines (IL-1β and IL-18); (3) decreased NF-κB p65 nuclear migration, suppressed NOD-like receptor protein 3 (NLRP3) inflammasome activation, and finally inhibited renal inflammation. Together, these results showed the role of FcγRI on macrophages to involve in renal inflammatory response, potentially via regulating the NLRP3 inflammasome-associated signaling.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are included within the paper.
Introduction {#s1}
============
Inflammation of the joint is characterized, among others, by debilitating mechanical hyperalgesia and persistent pain at rest. It is one of the major causes of chronic pain and therefore a relevant clinical problem in need of better therapeutic approaches. In spite of the great advances in the study of articular inflammatory painful conditions and the existence of reliable experimental models, the nociceptive neuronal mechanisms behind these pathologies are still vague and lack investigation [@pone.0108152-Schaible1].
In the peripheral nervous system (PNS), pain mechanisms involve sensitization of primary afferents neurons whose cell bodies are located in the dorsal root ganglia (DRG). In fact, the thermal and mechanical sensations captured at the skin, viscera and joints are conveyed into the CNS through the DRGs, implying that they are the first relay centers for sensory input transmission from periphery [@pone.0108152-Gascon1] and an important site for the processing of neural information [@pone.0108152-Hanani1].
In the DRGs, the cell bodies of these primary afferents are anatomically surrounded by satellite glial cells (SGCs) forming distinct functional units [@pone.0108152-Hanani2]. SGCs may be identified by the expression of several glial markers such as glutamine synthetase (GS) and S100β. The immunoreactivity against glial fibrillary acidic protein (GFAP), an intermediate filament protein, is not readily detectable in SGCs at a resting state or under normal physiological conditions. However, following nerve injury, inflammation or viral infection, GFAP becomes detectable in the SGCs that become activated by the pathological insult. Thus, in the PNS, GFAP expression is commonly used as a marker of SGCs activation [@pone.0108152-Hanani2]--[@pone.0108152-Siemionow1]. Although SGCs\' properties and functions have not yet been fully studied, it is now clear that these cells take an important part in the "intercellular communication" [@pone.0108152-Hanani1] with the neuronal cells they are in contact with.
The role of SGCs has been underestimated for a long time [@pone.0108152-Elson1], but the available data reveal that they are important in the establishment and maintenance of pathological conditions, largely contributing to the development of chronic pain states. In fact, the SGCs\' unique localization around neuronal cell bodies allows a bidirectional crosstalk [@pone.0108152-Hanani2] known to strongly influence nociceptive processing [@pone.0108152-Hanani1], [@pone.0108152-Jasmin1]. Thus, under a pathological condition, neurons are known to release specific mediators, such as ATP, nitric oxide, and neuropeptides as calcitonin gene-related protein (CGRP) and substance P, that are able to activate SGCs. Activated SGCs may also release pro-inflammatory agents that contribute to continued neuronal sensitization [@pone.0108152-Takeda1]. There is also strong evidence pointing to the occurrence of morphological and biochemical changes in SGCs as a response to pathological conditions. Accordingly, both activation [@pone.0108152-Zhang1], [@pone.0108152-Gunjigake1] and proliferation [@pone.0108152-Elson1], [@pone.0108152-Donegan1] of these cells have been described as a response to nerve injury and/or inflammation, and consequent pain development. However, the exact factors and the associated mechanisms leading to these reactive morphological and biochemical changes in SGCs, during a pathological condition, are still partially unknown. Additionally, the onset of those alterations in relation to disease progression has not either been thoroughly investigated in the majority of the studies.
Using a model of chronic articular inflammatory pain, the monoarthritis (MA) induced by Complete Freund\'s Adjuvant (CFA) injection in the tibiotarsal joint, we investigated if SGCs might also be playing a role in this pathological condition. In order to evaluate SGCs activation, we quantified GFAP expression in the DRGs of MA animals by Western Blot (WB). We also confirmed by immunohistochemistry (IHC) that GFAP expression is specifically occurring in SGCs. To evaluate the time course pattern of such changes in relation to the progression of the inflammatory condition we used different time-points of the disease (4, 7 and 14d after CFA injection), that allowed us to correlate the data with our previous studies in the same pain model [@pone.0108152-Nascimento1]. We have previously found a significantly increased expression of the neuronal injury marker activating transcriptional factor 3 (ATF3) in the DRGs at the initial time-points of MA [@pone.0108152-Nascimento1], with a peak of expression at day 4, which suggested that some degree of neuronal damage is occurring in the early stages of this disease. Moreover, it has been suggested that the expression of injury factors might trigger part of the neuron-SGCs communication events [@pone.0108152-Elson2]. Thus, with the aim of evaluating if activation of SGCs occurs preferentially around damaged/stressed neurons, we also performed co-immunolabeling assays for GFAP and ATF3 in the DRGs of controls and MA animals. Lastly, we also analyzed the incorporation of bromodeoxyuridine (BrdU) as a way to investigate if proliferation of SGCs is also occurring during MA.
Materials and Methods {#s2}
=====================
Animal handling and Monoarthritis (MA) induction {#s2a}
------------------------------------------------
All the procedures were carried out according to the European Communities Council Directive of September 22, 2010 (2010/63/EC) and to the ethical guidelines for investigation of experimental pain in animals [@pone.0108152-Zimmermann1], and were authorized by the animal welfare body (ORBEA) of the Faculty of Medicine of the University of Porto, where the experiments were performed. Animals used for Western Blot (WB) purposes (section 2.3) were decapitated after light volatile anesthesia with isoflurane. Those animals that were perfused through the ascending aorta for IHC assays (section 2.4), were deeply anesthetized with sodium pentobarbital. The humane endpoints defined for this project were always respected. Efforts were made in order to minimize pain and distress and reduce the number of animals used. Experiments were carried out in a total of 44 adult male Wistar rats (Charles River Laboratories, France) weighing between 200 and 300 g. Animals were housed 2--3 animals per cage under controlled conditions of lighting (12 h light/12 h dark cycle) and temperature as well as water and food *ad libitum*.
Monoarthritis (MA) was induced by injecting 50 µL of complete Freund\'s adjuvant (CFA), into the left tibiotarsal joint [@pone.0108152-Butler1] under isoflurane anesthesia (5% for induction, 2.5% for maintenance). The CFA solution (5,45 mg/mL) was prepared as previously described [@pone.0108152-LourencoNeto1] and monoarthritic animals were sacrificed at 4, 7 or 14 days of inflammation. Control (non-inflamed) animals were similarly injected with 50 µL of CFA vehicle and were allowed to survive for 2 days, as previously described [@pone.0108152-Nascimento1]. Habituation of the animals to the experimenter was performed for several days before CFA injection and during the progression of MA, to minimize fear-motivated behaviors. The evolution of the inflammatory reaction was monitored daily and was scored taking in consideration the inflammatory signs of the injected ankle and reduction of the locomotor activity [@pone.0108152-CastroLopes1]. The severity of the inflammation was further evaluated by measuring the diameter of the animals\' affected paw just before sacrifice [@pone.0108152-Nascimento1]. One of the animals that had been injected with CFA to be used in the BrdU experiments developed polyarthritis, characterized by inflammatory signs in the contralateral non-injected paw and tail, as described before [@pone.0108152-Butler1], and therefore was immediately excluded from the study.
Bromodeoxyuridine (BrdU) administration {#s2b}
---------------------------------------
Bromodeoxyuridine (BrdU-B5002, Sigma-Aldrich) was intraperitoneally (i.p.) injected (50 mg/Kg of animal weight) immediately after the preparation of a solution of 50 mg/mL, 10% in dimethyl sulfoxide (DMSO) [@pone.0108152-Jasmin1]. Injections were performed twice daily, beginning at the day of CFA or CFA vehicle intra-articular injection (day 0), until 24 h prior to animals sacrifice (to allow BrdU clearance) by intracardiac perfusion, as described below. The following experimental groups were used: controls (CFA-vehicle non-inflamed rats injected with BrdU until day 3 and sacrificed at day 4; N = 6 rats), 4d MA (CFA-inflamed rats injected with BrdU until day 3 and sacrificed with 4d of disease; N = 5 rats) and 7d of MA (CFA-inflamed rats injected with BrdU until day 6 and sacrificed with 7d of disease; N = 6 rats). Prior to these experiments, a group of naive animals was injected twice a day, with 10% DMSO solution i.p., for 6 days and no toxic effects or signs of peritoneal inflammation were found (data not shown).
Analysis of GFAP expression by Western Blotting {#s2c}
-----------------------------------------------
In order to investigate SGCs activation, the expression of glial fibrillary acidic protein (GFAP) was evaluated by WB analysis of freshly harvested DRGs from MA (with 4, 7 and 14 days of disease, N = 5 animals per group) and control animals (N = 6) that had been sacrificed by decapitation under light anesthesia with isoflurane. To correlate data with the previous studies [@pone.0108152-Nascimento1], DRGs from 2d MA animals were also analyzed but significant changes were not found (data not shown). Thus, this time-point was excluded from the following experiments.
For each animal, the L4 and L5 ganglia were pooled, separately for the ipsi and contralateral sides, and then were lysed and homogenized in 70 µL of radio immuno precipitation assay (RIPA) buffer containing sodium chloride 150 mM, triton X-100 1%, sodium deoxycholate 0.5%, sodium dodecyl sulphate (SDS) 0.1% and Tris pH 8.0 50 mM. Cocktails of protease and phosphatase inhibitors (1∶100, Sigma-Aldrich P8340, P5726 and P0044) were also added to the buffer. The samples were sonicated and centrifuged (20 minutes at 20,000 g), the pellets were discarded and the supernatants were used for analysis. The proteins were quantified by the bicinchoninic acid (BCA) protein assay. After heating at 94°C, 30 µg of protein were loaded for each lane and separated on 14% sodium dodecyl sulphate-polyacrylamide (SDS/PAGE) gels. The proteins were then transferred into nitrocellulose membranes which were blocked with non-fat milk (5% milk powder diluted in tris buffer saline tween20; TBST buffer), for one hour, at room temperature, to prevent non-specific bindings. In order to detect GFAP, the membranes were incubated in monoclonal mouse anti-GFAP antibody (Mab360, Chemicon-Millipore) diluted 1∶500 in TBST with 2% of normal goat serum (NGS), for 24 hours at 4°C. As a loading control, the detection of β-actin (polyclonal rabbit anti-β-actin antibody, Ab8227 ABCAM, Cambridge, UK) diluted 1∶4000 in TBST with 2% of normal horse serum (NHS) was also performed.
Detection of GFAP was achieved by incubation in goat anti-mouse secondary antibody conjugated with horseradish peroxidase (HRP; sc-2031, Santa Cruz Biotechnology, Inc), diluted 1∶5000 in TBST with 5% milk powder, for 1 hour, at room temperature. β-actin was also detected using a donkey anti-rabbit secondary antibody conjugated with HRP (711-035-152, Jackson Laboratories), diluted 1∶5000 in TBST with 5% milk powder. Antibody binding was visualized with the SuperSignal West Pico Chemiluminescent Substrat kit (Thermo Scientific; 34080) and the bands were detected by exposing the membranes to X-ray films (KODAK XOMAT Blue (XB) Film, Perkin Elmer, USA; NEF586001EA). Each blot, containing independent samples, was run in triplicates and means were used as raw values.
Double Immunohistochemistry against GFAP-ATF3 or BrdU-GS {#s2d}
--------------------------------------------------------
After deep anesthesia with sodium pentobarbital (Eutasil, Ceva, Sante Animale, France; i.p., 75 mg/kg of animal body weight), the animals were perfused through the ascending aorta with 250 mL of oxygenated Tyrode\'s solution followed by 750 mL of paraformaldehyde (PFA) 4% in phosphate buffer saline 0.1 M (PBS 0.1 M). The ipsi- and contralateral DRGs corresponding to spinal segment L5 were removed and post fixed in the same fixative solution for 4 h and then cryoprotected over night (in sucrose 30% in phosphate buffer 0.1 M). The DRGs were cut into 14 µm sections in a freezing cryostat (−20°C). The tissue was collected sequentially into 5 different poly-L-lysine coated slides, was air dried and stored at −20°C until immunohistochemistry was performed.
To confirm if activation of SGCs is possibly occurring in cells surrounding damaged/stressed neurons (ATF3-positive profiles), double immunoreactions against GFAP and ATF3 were performed. Each slide (containing every fifth section of each L5 DRG) from both controls non-inflamed and 7d MA animals was first thawed and washed in PBS 0.1 M and then PBS containing 0.3% Triton X-100 (PBST). In order to avoid unspecific bindings, sections were incubated for 1 hour in a blocking solution containing 10% of NGS in PBST. Afterwards, slides were incubated for 48 h at 4°C in the primary antibodies rabbit anti-GFAP (ab7260, Abcam, 1∶1000), and mouse anti-ATF3 (ab58668, Abcam, 1∶200), diluted in PBST containing 2% of NGS. After several washes in PBST with 2% of NGS, slides were finally incubated, for 1 hour, at room temperature, in goat anti-rabbit 568 (A11011, Molecular Probes, 1∶1000) and donkey anti-mouse 488 (A21202, Molecular Probes, 1∶1000) secondary antibodies diluted in a solution of PBST with 2% of NGS.
To evaluate SGCs proliferation, sections from perfusion-fixed L5 DRGs of control non-inflamed, 4d and 7d MA animals, previously injected with BrdU, were double immunoreacted against BrdU (which marks proliferating cells) and GS. Slides containing every fifth section of each DRG were treated following a protocol similar to that described above, except that slides were firstly incubated in HCl at 60°C for 30 minutes and then 5 minutes in Borax 0.1 M, for antigen retrieval. Blocking was done in a solution of 10% normal swine serum (NSS) in PBST with 7.5 mg/mL of glycine. Slides were afterwards incubated in sheep anti-BrdU (BP2295, Acris, 1∶100) and mouse anti-GS (MAB302, Millipore, 1∶500), in a PBST solution with 2% of NSS. Detection was achieved by incubation in a biotinilated donkey anti-sheep secondary antibody (B-7390, Sigma Aldrich), 1∶200 diluted in PBST with 2% of NSS, for 1 hour at room temperature. After thorough washes in PBST, the slides were incubated in streptavidin 488 (S32354, Molecular Probes) and Alexa 568 donkey-anti-mouse (A10037, Molecular Probes), both 1∶1000 in PBST with 2% of NSS.
After the immunoreaction, the slides with the stained sections were stored in PBS 0.1 M at 4°C until they were mounted for visualization under a fluorescent microscope. For microscopic analysis, the slides were coverslipped with a mounting media (solution containing 3 parts of glycerol and 1 part of PBS 0.4 M).
Data analysis {#s2e}
-------------
### Quantification of band intensity in Western Blotting {#s2e1}
The protein levels were obtained by densitometric analysis of the signal intensity in the blots, in pixels, using the image computer software ScionImageR (Scion Corporation). Both the areas of the lanes and the background signal were used for values normalization. β-actin was used as loading control and a ratio between GFAP/β-actin protein levels was calculated. Additionally, ratios between the ipsi and contralateral levels were calculated for comparison between the different MA groups and controls. The assays were typically performed three times on samples obtained from independent groups of rats and means of these triplicates were used as raw values.
### Immunoreactivity detection and cell counting {#s2e2}
The immunohistochemistry analysis was performed by using a fluorescence microscope (AXIO Imager.Z1, Zeiss), coupled to a digital camera (Axiocam MRm) and a computer image software (Axiovision 4.6) to grab the images. For the photomicrographs the acquisition conditions, such as amplification of the objective, light intensity, contrast and hue, were maintained constant.
The expression of GFAP in SCGs was confirmed by immunodetection. SCGs were distinguished from nerve cell soma and other perineuronal cells by their shape, position, orientation and nuclear characteristics [@pone.0108152-Pannese1]. Neurons surrounded by GFAP-positive SGCs in half or more than half of their circumference were assumed as positive neuronal profiles. The total number of these immunolabeled GFAP-positive neuronal profiles (**GFAP^+^~total~ NP**) was quantified. The total number of cells bodies of primary afferents analyzed was defined here as **NP~total~** and counted for each slide (corresponding to an animal and containing every fifth section of each L5 DRG). For normalization **GFAP^+^~total~ NP** was divided by **NP~total~** (**GFAP^+^~total~ NP/NP~total~**), and presented as percentage.
The total number of double labeled neuronal profiles (GFAP-positive neuronal profiles also expressing nuclear ATF3; **Double^+^~total~**) was also counted and divided by the total number of analyzed neurons (**Double^+^~total~/NP~total~**), and the final value is presented as percentage. Additionally, we calculated the percentage of double labeled neuronal profiles in the total ATF3-positive population **(Double^+^~total~/ATF3^+^~total~**).
To evaluate the proliferation of SGCs, the total number of double-labeled cells against BrdU and GS (**SGCs^+^** **~total~**) was counted in each slide (containing every fifth section of each L5 DRG). For normalization, a ratio between **SGC^+^~total~/NP~total~** was calculated so that values of different animals could be compared. In order to calculate the mean of proliferating SGCs (**SGC^+^**) around neurons, we divided the **SGCs^+^** **~total~** by the total number of neuronal profiles surrounded by at least one positively labeled SGC (**Mean SGC^+^ around NP**) [@pone.0108152-Elson1]. Neuronal profiles surrounded by SGC^+^ in half or more than half of their circumference were also counted and denominated as **NP^+^** [@pone.0108152-Liu1]. Again, for means of standardization, a ratio between **NP^+^~total~/NP~total~** was calculated to allow comparison between different animals and experimental groups.
### Statistical analysis {#s2e3}
Statistical analysis was performed by using GraphPad Prism 5 (GraphPad Software) and SPSS 13.0. One-way analysis of variance (one-way ANOVA) was performed to investigate significant differences between the different experimental groups. For the WB data, ANOVA was followed by the Tukey\'s Multiple Comparison post-hoc test. In this case, the values were calculated as ratios between the ipsi and contralateral sides after normalization against the loading control, β-actin. Results were displayed as mean±SEM (N = 6 for controls; N = 5 for all the other experimental groups). Data from immunohistochemical GFAP detection was analyzed using ANOVA followed by the Bonferroni post-hoc test. Results (**GFAP^+^~total~;NP/NP~total~**) were shown as mean±SEM (N = 5 for all the experimental groups). The GFAP-ATF3 double-labeling data was analyzed using one-tailed Student\'s t-test analysis between the controls and 7d MA groups. Results (**Double^+^~total~/NP~total~** and **Double^+^~total~/ATF3^+^~total~**) were displayed as mean±SEM (N = 5 for 7d MA and N = 4 for controls). For BrdU quantification, ANOVA was followed by the Newman Keuls Multiple Comparison test, for all the three different displayed results. All values (**SGC^+^~total~/NP~total~**; **NP^+^~total~/NP~total~**; **Mean SGC^+^/NP**) were shown as mean±SEM (N = 6 for controls and 7d MA; N = 5 for 4d MA). In all the statistical analyses, a level of significance of *P*\<0.05 was assumed.
Results {#s3}
=======
SGCs are activated during MA {#s3a}
----------------------------
MA was successfully and homogenously induced in all the animals injected with CFA, as they were all showing severe inflammatory symptoms with swelling, redness and avoidance to put weight over the inflamed paw at each time-point of disease. This was reflected in mean inflammatory scores near 4 (maximum score), immediately after the second day of MA. This condition was maintained up to the 14th day, as well as increased paw volumes (data not shown), in accordance with our previous work [@pone.0108152-Nascimento1]. Controls showed insignificant mean scores.
Western blot analysis showed that the GFAP levels in MA animals were always higher in the ipsilateral (lanes 3, 5, 7 of [Fig. 1A](#pone-0108152-g001){ref-type="fig"}) than in the contralateral DRGs (lanes 4, 6, 8 of [Fig. 1A](#pone-0108152-g001){ref-type="fig"}). Consequently, ratios between ipsi and contralateral GFAP levels were significantly increased at day 7 (2.71±0.35; p\<0.05) and 14 of disease (2.91±0.47; p\<0.01), when compared with controls (1.13±0.08) ([Fig. 1A and B](#pone-0108152-g001){ref-type="fig"}). Controls showed a non-significant basal expression in both ipsi- and contralateral sides, as expected.
{#pone-0108152-g001}
In order to confirm that the GFAP expression detected by Western blot was actually occurring in SGCs, we immunoreacted perfusion-fixed L5 DRG sections of control, 4d, 7d and 14d MA animals against GFAP. The specific labeling, the morphology and the unique localization around the cell bodies of DRGs neurons confirmed that GFAP expression is actually occurring in SGCs ([Fig. 1C](#pone-0108152-g001){ref-type="fig"}) [@pone.0108152-Hanani2]. Quantification of the total number of positive GFAP neuronal profiles (**GFAP^+^~total~ NP/NP~total~**) revealed that there are significant increases for 7d MA animals (34.45±1.95%; p\<0.01) when compared with controls (13.09±2.95%) ([Fig. 1D](#pone-0108152-g001){ref-type="fig"}). Animals with 14d MA presented also an increased number of GFAP-positive neuronal profiles in comparison to non-inflamed controls, although statistical significance was not achieved ([Fig. 1D](#pone-0108152-g001){ref-type="fig"}).
Activation of SGCs increases around stressed neurons, in MA {#s3b}
-----------------------------------------------------------
The total number of neurons counted as positive for both ATF3 and GFAP (**Double^+^~total~/NP~total~**) ([Fig. 2A and B](#pone-0108152-g002){ref-type="fig"}) was significantly increased at 7 days of MA (5.76±2.12%) when compared with controls (0.63±0.18%, p\<0.05) ([Fig. 2C](#pone-0108152-g002){ref-type="fig"}). Also, the percentage of double labeled cells in the total ATF3-positive neuronal population **(Double^+^~total~/ATF3^+^~total~**) increased at 7d MA (43.09±2.37%, p\<0.05) in comparison with controls (17.38±5.68%).
{#pone-0108152-g002}
SGCs proliferate during MA {#s3c}
--------------------------
BrdU was injected in controls (non-inflamed) and in 4 and 7d MA animals ([Fig 3D, E, F](#pone-0108152-g003){ref-type="fig"}). In order to confirm BrdU incorporation in SGCs, a double immunocolocalization with GS was performed ([Fig. 3A, B, C](#pone-0108152-g003){ref-type="fig"} for GS immunoreactivity; [Fig. 3G, H, I](#pone-0108152-g003){ref-type="fig"} for colocalization of BrdU with GS). The **SGC^+^~total~/NP~total~** significantly increased at 7d of MA (1.00±0.11), when compared with both controls (0.53±0.07; p\<0.01) and 4d MA (0.49±0.15, p\<0.05) animals ([Fig 3J](#pone-0108152-g003){ref-type="fig"} and [Table 1](#pone-0108152-t001){ref-type="table"}). Not only the overall number of SGC^+^ increased in the ganglia along disease progression, but, in addition, the number of proliferating SGCs around a specific neuron also augmented. In fact, the **Mean SGC^+^ around NP** was also significantly higher at 7d MA (2.30±0.13) than in controls (1.75±0.08; p\<0.05) and 4d MA (1.75±0.23; p\<0.05) animals ([Fig 3K](#pone-0108152-g003){ref-type="fig"} and [Table 1](#pone-0108152-t001){ref-type="table"}). Moreover, as the number of proliferating SGCs around a neuron increased, more positive neuronal profiles were also found. Thus, **NP^+^~total~/NP~total~** was also significantly higher in 7dMA (1.55±0.29) than in controls (0.29±0.21; p\<0.01) and 4d MA (0.51±0.28; p\<0.05) ([Fig 3L](#pone-0108152-g003){ref-type="fig"} and [Table 1](#pone-0108152-t001){ref-type="table"}). In summary, in all three types of quantification, the controls and 4d MA animals showed very similar values, both being statistically different from 7d MA ([Table 1](#pone-0108152-t001){ref-type="table"}).
{#pone-0108152-g003}
10.1371/journal.pone.0108152.t001
###### SGCs significantly proliferate at 7d of MA.
{#pone-0108152-t001-1}
Total SGCs^+^ ~total~/NP~total~ Mean SGCs around NP \% (NP^+^ ~total~/NP~total~)
-------------- --------------------------------- --------------------- ------------------------------
**Controls** 0.53±0.07 1.75±0.08 0.29±0.21
**(6485/12715)** **(21/12715)**
**4dMA** 0.49±0.15 1.75±0.23 0.51±0.28
**(4401/9117)** **(28/9117)**
**7dMA** 1.00±0.11\*\*^\#^ 2.30±0.13\*^\#^ 1.55±0.29\*\*^\#^
**(13500/14048)** **(212/14048)**
Significant increases in the total number of proliferating SGCs (**SGC^+^~total/~NP~total~**), in the mean number of SGC^+^ surrounding a specific NP (**Mean SGC^+^ around NP**), and in the total number of positive neuronal profiles (NP surrounded by half or more than half of their circumference by SGC^+^ - **NP^+^~total~/NP~total~**), were found at 7dMA.
Values shown as Mean±SEM. In brackets, the total number of cells analyzed for each ratio is displayed. N = 6 for controls and 7d MA; N = 5 for 4d MA. \* Significant differences relatively to controls. \# Significant differences relatively to 4d MA.\* or \# represents p\<0.05; \*\* represents p\<0.01. One-way ANOVA followed by Newman-Keuls Multiple Comparison post-hoc test.
Discussion {#s4}
==========
In this study, we show for the first time in the CFA-induced monoarthritis model of chronic joint inflammation that SGCs are activated and proliferate, with a specific temporal profile. Moreover, significant increases in the GFAP labeling in activated SGCs surrounding ATF3 positive (stressed) neurons were also found. This fact suggests that neuronal ATF3 might be involved in the reactive biochemical and morphological changes occurring in SGCs during a chronic pathological state.
Western blot analysis showed that GFAP levels in the ipsilateral DRGs of MA rats are higher than in the contralateral ganglia, and that this ipsi/contra ratio is significantly increased at 7 and 14 days of disease induction, when compared with control non-inflamed animals. Immunohistochemical quantification of GFAP-positive neuronal profiles in the sections of L5 DRGs also showed significantly increased levels at 7 days of MA. At 14d of MA, although statistical significances were not found, the values were still higher than in controls. The slight differences between WB and IHC data at 14 days of MA are certainly due to the distinct methodological approaches. In the WB assay we measured the total amount of protein in the whole DRGs, which contain both neurons, SGCs and Schwann cells. It is possible that Schwann cells, that also express GFAP [@pone.0108152-Hunt1]--[@pone.0108152-Isacsson1], have a small contribution to the proteic levels measured in the WB. On the other hand, the IHC data represent the number of neurons surrounded by GFAP-positive SGCs, and it is unlikely that this quantification has been biased by considerable Schwann cells\' contribution since these cells are morphologically distinct from SGCs. Thus, altogether the data from these two different experiments indicate that SGCs are significantly activated after 7days of MA and at least until 2 weeks of disease induction, and that the number of positive neuronal profiles increases around day 7, suggesting a higher number of sensitized neurons. In fact, activated SGCs are known to release several pro-inflammatory and other mediators that promote neuronal sensitization [@pone.0108152-Takeda1], [@pone.0108152-Takeda2]. Accordingly, it is expectable that neurons surrounded by a higher number of activated SGCs are also in a higher level of excitability [@pone.0108152-Hanani1], [@pone.0108152-Hanani2], [@pone.0108152-Hanani3].
These data are in accordance with several recent studies proposing that, after peripheral injury and/or inflammation, SGCs undergo relevant reactive biochemical and phenotypic changes (such as activation, proliferation and hypertrophy) that might be related to the establishment/maintenance of certain pathological and painful states [@pone.0108152-Siemionow1], [@pone.0108152-Takeda1], [@pone.0108152-Zhang1], [@pone.0108152-Souza1]--[@pone.0108152-Warwick1]. In fact, GFAP expression was found to be increased in inflamed DRGs, at 7 days of model induction (chromic gut suture application onto the DRG) [@pone.0108152-Siemionow1], as well as in the trigeminal ganglia of rats with orofacial inflammatory pain [@pone.0108152-Stephenson1]. Additionally, two days post-CFA injection into the whisker pad area, the mean percentage of trigeminal ganglia neurons encircled by GFAP and IL-1beta-immunoreactive cells was significantly increased compared with controls [@pone.0108152-Takeda2]. These data corroborate with our results for the GFAP expression in MA animals and indicate that the first week of disease progression seems to be crucial for the events associated to SGCs activation. The slight differences in the temporal expression pattern of GFAP are probably due to the pathophysiological differences of the models under study. As observed, SGCs activation occurs in the initial time-points of disease progression in inflammatory conditions, while little is known about the more prolonged time-points [@pone.0108152-Siemionow1], [@pone.0108152-Takeda2]--[@pone.0108152-Stephenson1]. Conversely, it seems that nerve damage provokes a more demarked and prolonged effect on SGCs activation. Indeed, in neuropathic pain models, such as in chemically-induced neuropathy, GFAP levels were also significantly higher after 1 week, followed by a decrease to control values only 1 month later [@pone.0108152-Warwick1]. In the spinal nerve ligation (SNL) neuropathy model, GFAP expression increased immediately after 4 hours, gradually increasing up to 7 days and staying high until the end of the experiment at day 56 [@pone.0108152-Liu1]. In our studies, we observed that the activation of SGCs is significantly higher than in non-inflamed animals at least until 14 days of MA. We have previously proposed the occurrence of a neuropathic component in MA, possibly triggered by the initial inflammatory milieu at the joint cavity [@pone.0108152-Nascimento1]. Actually, we reported that ATF3, a neuronal injury marker, is induced in primary afferent neurons, with a peak of expression at 4 days of MA [@pone.0108152-Nascimento1], a fact that has not been described frequently in studies using other inflammatory models [@pone.0108152-Schaible1], [@pone.0108152-Braz1], [@pone.0108152-Inglis1]. Therefore, the fact that neuronal damage is possibly occurring during MA, might be one of the reasons for the still significantly increased GFAP levels that we found at day 14. For time-points of disease evolution longer than this it is hard to speculate since the information available in the literature is limited. However, it is possible that GFAP levels do not remain high for too long, as it happens in a neuropathy, since MA is still a model triggered by an inflammatory insult.
Many studies are nowadays devoted to the identification of possible inducers of SGCs activation, in different conditions. Recently, some authors suggested a novel mechanism mediated by fractalkine as the trigger for SGCs\' activation in the carrageenan-induced inflammation model [@pone.0108152-Souza1]. Many other molecules were shown to be released by neurons with their receptors being found in SGCs [@pone.0108152-Ceruti1], [@pone.0108152-Chen1], therefore constituting possible mediators in neuron-glia crosstalk and triggers of SGCs\' activation. Some authors also suggested that the expression of injury factors in stressed neurons might be one possible trigger for the activation and proliferation of SGCs as well as for the augmented intraganglionar communication [@pone.0108152-Elson1]. Considering our previous data [@pone.0108152-Nascimento1], we asked if ATF3 could be one of the injury factors involved in SGCs activation and in communication within neurons, during MA. Interestingly, we also found significant increases in the number of ATF3 positive neurons surrounded by GFAP-positive cells, in both the total neuronal (**Double^+^~total~/NP~total~**) and ATF3-positive populations (**Double^+^~total~/ATF3^+^~total~**), at 7d MA, which supports our hypothesis of a possible role of neuronal ATF3 in the reactive changes occurring in SGCs during articular inflammation. After 7d of MA, more than 40% of the ATF3-positive neurons were surrounded by GFAP-positive SGCs, even though the ATF3-positive population represents a small portion of all DRG neurons in the CFA-induced MA model, as we have previously described [@pone.0108152-Nascimento1]. Our data are in accordance with other studies showing that the number of ATF3-immunoreactive (IR) neurons enclosed by GFAP-IR SGCs increased in a time-dependent manner in the maxillary nerve region of the trigeminal ganglia [@pone.0108152-Gunjigake1], in a model of molar extraction in the rat. Also, after chronic constriction injury of the infraorbital nerve, SGCs proliferation was observed preferentially around ATF3-positive neurons of the trigeminal ganglia, although GFAP expression was associated with both ATF3 IR and immunonegative neurons [@pone.0108152-Donegan1]. In a pathological condition, the number of gap junctions between SGCs increase and this phenomenon is intimately related to SGCs activation. Interestingly, gap junctions promote communication between adjacent SGCs enveloping neighboring neurons [@pone.0108152-Hanani1], [@pone.0108152-Hanani2], [@pone.0108152-Hanani3]. This might result in GFAP labeling around adjacent ATF3-negative neurons, suggesting that it is highly possible to have activated SGCs surrounding non-stressed neurons. Indeed, Gunjigake *et al*. also demonstrated in the model of rat molar extraction that SCGs\' activation spread to uninjured neurons in the maxillary nerve region, as well as to the mandibular nerve region [@pone.0108152-Gunjigake1]. In these studies, as it happened in our case, it has been shown that there is a basal expression of GFAP in control animals, which is probably not labelling activated SGCs [@pone.0108152-Gunjigake1], [@pone.0108152-Ajima1]. Yet, the fact that these increases in GFAP labeling around ATF3 positive neurons are statistically different at 7 days of MA points to a possible relation between ATF3 expression and SGCs-related events.
In the MA animals, the number of SGCs proliferating in the whole DRG was also significantly higher at day 7 of disease when comparing with both controls and 4d MA. Not only the overall number of BrdU-positive SGCs in the DRG increased but also the number of SGCs proliferating around a specific neuron. Moreover, we found significantly more positive neuronal profiles in 7d MA animals, which is in accordance with other studies. There are few reports regarding the proliferation of SGCs, but early in the nineties other authors already showed that these cells proliferated after L5 nerve transection, with maximum activity of the incorporated radioactive marker 1 week after the model induction. In this case, proliferation started decreasing after this time-point [@pone.0108152-Lu1]. Later, other BrdU incorporation studies showed that SGCs proliferate during Herpes Simplex virus infection, with increases up to 5 days of disease, the latest time point evaluated [@pone.0108152-Elson3]. This was proposed to be part of a mechanism of neuronal survival during the disease [@pone.0108152-Elson3]. The same group also found proliferation of SGC in an animal model of scarification of the skin, considered to be a model of minor tissue trauma [@pone.0108152-Elson1]. BrdU incorporation increased by a 10 times fold 5 days after model induction, when compared with controls. Just recently, peaks of SGCs\' proliferation were also observed nearly 4 days after model induction by chronic constriction injury of the infraorbital nerve [@pone.0108152-Donegan1]. Our results are in agreement with these previous studies, indicating that, also in MA, a significant proliferation of SGCs occurs. Also, they suggest that 7d of disease is a triggering time-point for this event.
The reactive changes observed in SGCs appear to be correlated with hypersensitivity to noxious stimuli, although the related mechanisms and their players still remain to be explored. In fact, it has been proved in several models that the administration of fluorocitrate, a metabolic inhibitor of SGCs, not only abolishes GFAP labeling in the DRGs but also alleviates pain [@pone.0108152-Liu1], [@pone.0108152-Souza1]. MA animals display increased allodynia and hyperalgesia in the ipsilateral paw, after 1 week of CFA injection, as we have already reported [@pone.0108152-Borges1]. Therefore, it seems that the temporal profile of the biochemical changes found in the ipsilateral DRGs of these animals matches with the painful behavior. Although further studies are needed, data suggest that SGCs might be involved in the MA nociceptive mechanisms, as, in fact, found for other chronic pain models [@pone.0108152-Liu1].
In summary, this study indicates that SGCs are not bystanders to MA, but that they are crucial in the mechanisms underlying articular inflammation. The reactive changes involving SGCs, namely their activation and proliferation, seem to be particularly active in the early phases of MA development, with peaks around the 7^th^ day, when the expression of the neuronal injury marker ATF3 is already subsiding, and allodynia and hyperalgesia are already obvious in the ipsilateral paws of inflamed animals. The exact functional implications of this early onset for the progression of the disease are still unknown. Additionally, ATF3 might be one potential target for the control of SGCs-mediated mechanisms. Thus, in the future, it will be important to unravel these key mechanisms which will be crucial for the development of new drugs targeting SGCs. This might help to overcome the inefficacy of certain pain-alleviating therapies [@pone.0108152-Jasmin1], that have been traditionally devoted to target primary afferent neurons. This is highly relevant since pain associated with joint inflammatory diseases is still a challenge in the clinical practice.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Conceived and designed the experiments: DSMN FLMN. Performed the experiments: DSMN. Analyzed the data: DSMN FLMN. Contributed reagents/materials/analysis tools: FLMN JMCL. Wrote the paper: DSMN FLMN JMCL.
|
{
"pile_set_name": "PubMed Central"
}
|
Microsoft Offers Peek at Office for Windows Phone 8
Microsoft revealed today in a blog post some details about how Office 13 will integrate with Windows Phone 8. The blog post mostly discusses the cloud-based features of Office 13, but notes that the latest version of Microsoft's suite of productivity software will extend to mobile devices, as well. For example, Microsoft Word will remember where you were reading within a specific document and when re-opened on another device (such as a Windows Phone 8 smartphone) will go straight to that spot. PowerPoint and Excel will exhibit similar behaviors. Microsoft has also revealed a glimpse of the refreshed design of Office for Windows Phone 8, though it stopped well short of revealing all the consumer-facing features. Windows Phone 8 is expected to debut later this year.
|
{
"pile_set_name": "Pile-CC"
}
|
Holiday Snaps
Retirement has many compensations! The opportunity to take holidays at any time I fancy is one I rate highly. This is the story about a recent enjoyable break.
I recently spent Christmas away in a lovely city centre hotel in Bath in the English West Country. What a beautiful town, relaxing, full of history and incredibly photogenic! On Boxing Day I took my camera out to enjoy this photogenic place. When I returned to the warmth of the hotel I witnessed an unusual confrontation at the reception desk.
The duty receptionist, a slightly dumpy but curvaceous Spanish girl, was trying to photograph one of the chambermaids on the other side of the reception counter. For some reason the young blond chambermaid seemed less than willing to have the picture taken and was holding a newspaper in front of her face. The Spanish girl grumpily put the reception's digital camera down and reached for my key. The chambermaid looked triumphant!
Being retired means you can join in almost anything without causing too much offence! "Oh that's not fair" I laughed. "That would have been such a pretty picture. Here let me show you." I picked up the diminutive camera, checked it was switched on and prepared to take a picture. The defensive newspaper was already deployed.
"OK" I tried in my best conspiratorial whisper, "let's try just peeping round the paper". I gently moved the girl's hand so that only half of her face was covered from the camera's viewpoint. Before she realised what was happening I had framed the shot to include her half-face and just a narrow edge of paper. The result on the monitor screen looked OK.
"That's great" I encouraged softly. "Let's try another." I was able to frame and focus even better this time.
"Fantastic", I breathed. "Your eyes are beautiful. Let's try another, just look straight into the lens. Fabulous!" I clicked again. "Tilt your head outwards slightly." Click. "Fantastic, you should be a model." I murmured. Click.
"Now imagine it is not a newspaper and that you are peeping round a shower curtain." My voice was low, no-one else could hear. Click. My face was behind the camera while this lovely girl was concentrating her attention on the lens. Click. She was a photographer's dream!
"You see your lover's back, warm steaming water flowing across the skin." I breathed to her and her expression reflected my suggested scenario. Click.
"You smile back." Click. She was gorgeous when she smiled. Click, click.
Unfortunately other staff had seen what was happening and were standing nearby. They couldn't hear what I had been saying but they saw the effect. When the chambermaid saw them she put her scowling mask back on and flipped the newspaper in my direction. Before she could leave I gave the girl the camera.
"Get these pictures on a computer screen and see what you think." I whispered urgently. "If you want me to take some with a better camera you know my room number." Just to make sure I flashed the key fob so that only she could see it, then she was gone. She looked so cross that I didn't expect to see her again.
Back in my room I took off my outdoor clothes, kicked off my shoes and turned the kettle on to make a cup of tea. In this beautiful Georgian city I had taken numerous pictures so I pulled out my laptop and set it running so that I could look at my results. By the time the computer was ready I had poured boiling water over the teabag in the cup. Leaving it to brew I pulled the compact flash card from the camera and popped it into the slot. As I stirred the tea today's pictures came up on the screen.
I sat back on the bed and watched a slide show of the unedited shots, some were OK, a few were good and the majority were passable record pictures. I was especially pleased with a set I hope to merge into a panorama of the famous Royal Crescent. I drank my tea and thought about how some of the shots could be better. 'Going out earlier in the day' was the best option I could suggest to myself. Well, maybe tomorrow . . "
There was a soft knocking at the door. I opened it to find the chambermaid, no longer wearing her official overalls, she held out the camera and explained that she couldn't access a computer without someone else present. She wanted to see the pictures without the other staff around.
There were two chairs in the room, so rather than have us sit on the bed I moved them so that we could both see the screen with the computer sitting at the end of the bed. She told me her name was Sophie and that she was from Slovakia. There were several staff who came over together every Christmas/New Year to augment the English hotel staff.
"OK Sophie, please call me Jack." I said as I offered the memory card into the slot "Let's see how they came out." Even after several years of using the technology I never cease to be amazed by digital photography! Having grown up with film, which might take days or weeks to fill a roll and a similar time to get developed and printed, I get a thrill every time I plug in a card and see pictures coming up instantly. Fantastic, up they came and didn't look too bad in the thumbnails. I adjusted the display to get them filling the laptop screen and set the slide show running at slow speed.
I sat back a little with half an eye on Sophie and the other on the screen. She was enthralled! The first couple showed an apprehensive girl, nervous of the camera and the photographer. The portraits gradually changed as she got into my 'game'. The final few were not bad at all! The photographic quality might have been better but the content was amazing. Sophie's face as she watched the screen captivated me! By the final shot, which stayed on the screen as the slide show ended, she changed from formal and guarded to animated and delighted.
Sophie turned to me "Mister Jack, can we see them again please?" Her English was quite good with a sexy European accent!
"No problem Sophie, would you like them to go slower or quicker or maybe you would like to control the change?" I asked. Sophie chose to change them for herself.
"I not like this" she pouted at the first picture "It make me look not 'appy!"
"Well Sophie" I explained, "This was the first shot and maybe you were a bit surprised that I would be so bold. But there are some nice things in the shot, see how the light from the window behind you lights up your lovely golden hair."
"OK" she acknowledged "But this next one better, yes?"
"That's much nicer, see how you are looking into the lens - almost looking straight out of the screen at us now." I liked it too, she was still a little apprehensive in this shot but not looking quite so grimly defensive. "Your blond hair looks even better in this - see how it shines in this soft light." I ran my hand across the screen almost in a caress as I demonstrated the part I liked. I watched her eyes follow my hand.
Sophie clicked the mouse. "Next one good too, I think so . . yes, I think it OK." She said, her accent strong, her voice low and sultry. She moved to the next image, nodding and smiling softly. "These nice photos Mister Jack, thank you for making them." She kept clicking until she reached the last one.
"This one best, you think so too, yes?" she asked. The picture was quite sexy, mainly because of the way she was interacting with the lens. The picture filled the screen. "I want send my boyfriend, OK Mister Jack?" She said.
"OK, what's his email address?" I asked. Sophie did not have a bag with her and looked disappointed.
"I not got, you wait please. I bring you Mister Jack, OK?" she was gone before I could reply.
While she was out I copied the set of pictures to my hard drive and started Photoshop Elements. In the few minutes she was away I had made some adjustments to the final picture which improved the light/shade balance and sharpened overall. I saved it with a new name and re-sized a copy ready to send in the email.
Sophie soon returned, she gasped when I showed her the original and my enhanced version. It had come out really well. In no time I set up the email with the small version as an attachment and let her write the text. She struggled a bit with the English keyboard layout and couldn't find her special characters but managed to express her wishes. When she was done I hit the send button and showed her that it was on its way.
"I like these photos but I not want that Spanish girl to 'ave them." Sophie declared.
"OK, I can delete them from the camera card for you. But why don't you want her to have them?" I asked.
Sophie chewed her lip. "You not tell anyone Mister Jack, OK?" She said. "Manuella keep touching me when I near 'er. She say she want make me 'appy. She make me very . . " Sophie searched for an English word. " . . I a bit scared of 'er, I think she like girls not boys. You understan' what I say . .?"
"Sure, Sophie. Watch . . I'm deleting those pictures from the card and I will take the camera back for you." I explained. Just to check I re-loaded the card and the pictures were no longer available. I replaced the memory card in the camera.
"Sophie, I have a better camera. Can I take a few more pictures while the light is good?" I picked up the Canon I had been using in town and showed her.
"OK Mister Jack, if you show me what you take and make me copy please."
The late afternoon sun was still shining through the window so I quickly moved the chairs. I had a tripod set up quickly and asked Sophie to sit so that the sun shone from behind her head.
"OK, the camera is linked to the computer so we can see the results straight away. Let's do a few tests first." The contre-jour lighting was tricky but the first couple of shots were along the right lines. I showed Sophie. Luckily she came up with the next suggestion which was going through my mind too.
"I not like colour of my shirt Mister Jack, it make me look sick. What you think?"
"Just what I thought Sophie, maybe you could wear one of my shirts. I've got a clean white one here." I reached into the wardrobe and pulled out the shirt on its hanger. I turned around to find that Sophie had taken off her blouse and was sitting topless!
"We do it like this please, Mister Jack. Please only my face and down to 'ere." Sophie drew her hand firmly across her chest just above her beautiful breasts.
"OK, let's try Sophie." As she hadn't been wearing a bra there were no strap marks and her shoulders looked great in the viewfinder. I clicked and murmured "Look deep into the lens Sophie, think of your boyfriend." Click. "He's taken his shirt off as well . ." Click.
"OK Sophie that looked super. Can you turn around and look back across your shoulder, that's it just here where the sun will catch your hair." I had my hands on her shoulders to get the position right, her breasts were a delight and it took all my concentration to keep my old hands off them.
From behind the camera again I said "Fantastic Sophie." Click. "You are sensational!" Click, click, click. She was so sultry, sensuous and almost kissing the lens. Click, click, click. "If you show your boyfriend these he will worry about what we were doing!" She laughed. Click.
"Now Mister Jack, we can take some to 'ere." She now drew the line at the top of her jeans!
"OK, Sophie." I was concentrating on the technicalities to avoid becoming too excited. The last of the sun was still illuminating Sophie. "Let's turn you almost sideways. There, as you look at the camera tip your head back - slightly looking down at the lens." Click, click. "Shoulders back a touch Sophie, that's great!" Click, click, click.
"We have lost the light now Sophie, shall we have a look at the results?" I was surprised but very pleased that she did not replace her blouse. Her warm proximity was so arousing! Concentrating hard I opened the file of pictures and ran them as a slideshow in full screen. I sat back but Sophie drew forward to see the screen. The first shots were good, far better quality than our earlier set. They drew ooohs and aaaahs from Sophie. I found it hard to concentrate as her breasts shook and quivered with her tiny movements.
When we came to the head and shoulders she gasped and turned to me excited and smiling. "Mister Jack, I like these." She grasped my face and planted a kiss on my cheek. Oh how I suffered for my art!
The contre-jour lighting was terrific, her face and skin were fantastic. I was thrilled with the shots.
Then the first full topless shot caused her to gasp and wrap herself around my arm. "Oh God!" She whispered, "That's so sexy", she kissed my cheek again. "You make me look so good Mister Jack." The other shots were better and better as she related more closely with the lens. When the show stopped on the final picture we were both breathless!
Sophie swung a leg across my lap and wrapped her arms around my head which was buried between her delightful breasts! I ran my hands gently up her back and softly kissed the tender flesh pressed to my face. My hands were barely touching her skin but Sophie seemed to enjoy the sensation, she eased away slightly from the hug around my head. My lips were now nibbling, kissing and caressing the most exquisite breasts imaginable.
I gently let one of my wandering hands find its way around her rib cage and onto a firm breast. After some tender touches I lifted the nipple to my lips. Sophie gasped and pressed the breast closer to my mouth muttering something unintelligible in Slovakian as she ran her fingers through my hair. I hoped she was encouraging my ministrations and continued to lick then suck on the gorgeous nipple. Sophie groaned and demanded that the other breast get the same loving. I obliged with enthusiasm!
This delightful exercise had been under way for a while when the computer dinged to indicate the arrival of an email. I was all for ignoring it but Sophie turned around on my lap and moved my hands to her breasts - what a thoughtful girl! She clicked the mail button and saw that it was an answer from her boyfriend. Curses, I thought, that's the end of play for today. Not a bit of it!
Sophie read the Slovak's reply and translated roughly that he liked the picture and was laid on his bed looking at it now. That excited Sophie who stood up, unzipped and pulled down her jeans. She sat back on my lap in just a pair of white cotton panties!
"Now, Mister Jack we send 'im the last picture please, OK?"
"If you are really sure Sophie. Maybe he will be a little jealous that I have seen you like this?"
"No, we do now please." She urged, standing up and undoing my shirt buttons. "Take off shirt Mister Jack, I want sit behin' you and hold myself against your body, OK?"
Somehow I edited the picture. It looked fantastic. I was pleased, Sophie was practically drooling over my shoulder! I saved the new version and made a reduced copy to send. Then I clicked the reply tab on the email and attached the latest picture. Sophie was all for leaning around me to reply but I suggested she should get both hands to the keyboard.
"OK, Mister Jack." She whispered as she stood almost naked and moved to the laptop, "Now you take off jeans too, OK?"
I guess I was too surprised to do anything but obey, well that's my excuse! My trousers and socks were quickly dispatched while Sophie concentrated on the keyboard. I was now as unclothed as she was, but not nearly so alluring!
She finished her message and clicked the send button. Turning from the screen she saw me, smiled and pulled the front of my boxer pants waistband to bring me into hugging distance. She was still sitting, I was standing. As she pulled me closer my straining erection flipped out of the fly slot and came to rest alongside her face as she wrapped her arms around me.
She laughed "We not need these now" and pulled down the boxers causing old Willie to twang noisily from down to up as the elastic passed and released him. He bounced, vibrating into the 'on guard' position and she giggled again. She kissed the side of my cock.
"He is beautiful. I think 'e wants to play." She murmured, nibbling her way from bottom to top and back again.
She decided to get more comfortable for 'playing' and signalled for me to get on the bed. Standing back from the bed she stood, almost naked, and posed. I wished I had the camera, but perhaps I was too shaky for that now! Facing me she tucked her thumbs under the top of her panties and in one smooth move pushed them down to her knees. Standing erect and looking deep into my eyes she pushed them down her leg with one foot and flicked them elegantly across the room to where her other clothes were piled.
"You like?" she growled running her hands down her smooth body.
"I like, yes Sophie, I like very much!" I lay back on the bed as she straddled my hips. I had my first view of her delightful vagina. A trimmed downy patch of pubic hair crowned her bare labia which looked moist already. She lowered herself until her groin was brushing the tip of my erect dick. After several increasingly firm passes of her pussy lips across the purple tip she looked deep into my eyes, sighed and slowly descended onto my penis.
Her eyes still locked onto mine were now in soft-focus; maybe that was me or was it her, possibly both. Grinding oh so slowly in a small circular motion against my pubic bone she seemed to be screwing my cock deeper into her body. Now her eyes were definitely in another place even though they looked my way. Her blond hair fell forward around her lovely face as her head tipped forward . . ever the artist I thought 'that could a nice picture!'
Her motion changed subtly into a slow, gentle rocking forward and back. Her neck and upper chest flushed and her cunt squeezed tightly around my cock as an orgasm swept through her beautiful body. I watched in awe as she continued to rock throughout the climax. As it passed she rested hard down on me and slowly lay her body on top of mine, her legs elegantly outstretched along mine. My rampant cock was still snug inside her body.
Panting softly she whispered "That was as beautiful as your photographs Mister Jack." God, what a compliment! Most people just say "That's nice", I think I prefer the Slovak way of photo appreciation!
I wrapped my arms around her and rolled myself on top. I let my legs fall outside hers and raised my knees a little. As I eased my body up there was a new pressure in her cunt from my stiff cock. She gasped. I leaned forward holding my cock hard up against her clitoris and kissed her breasts, first one then the other. Then I stretched up and we kissed deeply, so erotically, so sweetly, so exquisitely . . it was unbelievable!
Here was me, a pensioner, reasonably fit but never-the-less with grandchildren of the same age as Sophie and I was embedded deep into her young gripping, dripping pussy. Being old doesn't get any better than this!
Sophie's movements were becoming more urgent. Her legs parted so I slipped mine between hers and withdrew my cock. I ran the tip up and down her very wet vagina then eased back in, all the way until my balls were on the cheeks of her backside. Sophie was urging me by lifting her hips and dropping them. I took the hint and began long, slow deep strokes. Each arrival brought my pubic bone snugly against Sophie's clitoris. Each arrival brought a gasp of pleasure.
|
{
"pile_set_name": "Pile-CC"
}
|
2020 is getting closer and closer. It’s time for a holiday mood – at Hostry we know how to set it up. On the eve of the New Year, we have prepared valuable presents for you. “Bare Metal” Dedicated Servers are in stock again with huge discounts up to 30% […]
In the past couple of months, Hostry support team has received hundreds of questions regarding the accessibility of payments with cryptocurrencies. It took us time and effort to implement this payment method, but today we came up with an update. We’re happy to announce the cryptocurrency payment method! Since now […]
When everyone else is turning their discounts off, Hostry continues to explode the VPS pricing. It’s Cyber Monday, webmasters! From December 2, 2019, for a limited time you can get yourself 2 months of 30GB SSD & 1GB RAM Virtual Private Servers in our Amsterdam, NL, and Dallas, US data […]
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Reading multiple data from string, separated by characters using sstream
I have .txt file with text like this inside (this is just a fragment):
...
[332, 605]-[332, 592], srednica: 13
[324, 593]-[332, 605], srednica: 14.4222
[323, 594]-[332, 605], srednica: 14.2127
[323, 594]-[331, 606], srednica: 14.4222
[324, 593]-[324, 607], srednica: 14
[323, 594]-[323, 607], srednica: 13
[319, 596]-[319, 607], srednica: 11
[320, 595]-[320, 607], srednica: 12
...
What i need to to is get a first 4 numbers from each line and store them into integers.
I have tried smth like this:
ifstream file("punkty_srednice.txt");
string line;
int ax, ay, bx, by;
while(getline(file, line)) {
stringstream s(line);
string tmp;
s >> tmp >> ax >> tmp >> ay >> tmp >> bx >> tmp >> by >> tmp;
cout << ax << " " << ay << " " << bx << " " << by << endl;
}
Output (just a part of it):
...
506 506 -858993460 -858993460
503 503 -858993460 -858993460
495 503 -858993460 -858993460
497 503 -858993460 -858993460
500 497 -858993460 -858993460
492 503 -858993460 -858993460
...
As u an see there are some strange numbers like -858993460
I did other try by deleting tmp and going straight like this:
s >> ax >> ay >> bx >> by;
but then output contains only trash numbers like -858993460
How i can deal with it?
A:
You can use std::getline with the ',' as separator to get the first parts, with the numbers. Then replace all non-digit characters with space (see e.g. std::transform). Then put the resulting string in an std::istringstream and read four numbers from it.
Some tips on what's wrong with your code, it mostly boils down to that when used with strings, the input operator >> reads space delimited strings.
So for the line
[332, 605]-[332, 592], srednica: 13
your input will be
into tmp it will put "[332,"
into ax it will put the 605
into tmp it will put "]-[332,"
into ay it will put 592
into tmp it will put "],"
into bx it will try to read the string "srednica" which is not a valid number, and the input will fail and set the fail flag on the input stream, making all the following inputs invalid
How to replace any non-digit character in a string to a space using std::transform:
std::string s = "[332, 605]-[332, 592]";
std::cout << "Before: \"" << s << "\"\n";
std::transform(std::begin(s), std::end(s), std::begin(s),
[](const char& ch) -> char
{
return (std::isdigit(ch) ? ch : ' ');
});
std::cout << "After : \"" << s << "\"\n";
The above code prints
Before: "[332, 605]-[332, 592]"
After : " 332 605 332 592 "
|
{
"pile_set_name": "StackExchange"
}
|
Q:
Random Sample vs Simple Random Sample
I am reading, just for fun, the book Essentials of Statististics of Mario Triola.
I am trying to see the differences between Random Sample and Simple Random Sample.
In the book I found these definitions:
"A simple random sample of n subjects is selected in a such way that every possible sample of the same size n has the same chance of being selected.
In a random sample members from the population are selected in a such way that each individual member in the population has an equal chance of being selected."
I believe, but I am not sure, that in the random sample we need to be careful that the sample represent races, ages, economical situation, geographical location but in the simple random sample we do not consider that.
Am I correct?
A:
Okay, let me try to address your question. I am sorry, I did not have time to read other responses. Here is the deal:
In the definition of the random sample Triola is talking about a probability of selecting an object (individual). In the definition of a simple random sample, he talks about the probability of selecting varied samples of size n (groups of objects). That is the difference between the two (individual vs. a group)
Here is an example: You have a class of 50 students, 30 males and 20 females. You are randomly selecting 3 males and 2 females. This is an example of a random sample because each person in the class has the same probability of being selected 3/30=2/20. However, all your samples are going to be the same: 3 males and 2 females. It is not possible to get 2 males and 3 females, or 4 males and 1 female. Therefore, it is not a simple random sample.
I hope this helps )
|
{
"pile_set_name": "StackExchange"
}
|
Voters in Arizona will head to the polls Tuesday for a nationally watched special election for the seat once held by Rep. Trent Franks Harold (Trent) Trent FranksArizona New Members 2019 Cook shifts 8 House races toward Dems Freedom Caucus members see openings in leadership MORE (R), with Republicans hoping to stave off another Democratic upset ahead of the midterm elections this fall.
Republicans think the party can hang on to the solidly conservative district, which President Trump Donald John TrumpOmar fires back at Trump over rally remarks: 'This is my country' Pelosi: Trump hurrying to fill SCOTUS seat so he can repeal ObamaCare Trump mocks Biden appearance, mask use ahead of first debate MORE won by 21 points in 2016. But Republican groups have had to spend more than a million dollars on keeping the seat, which opened up in December when Franks resigned after allegedly asking a staffer to act as a surrogate mother.
ADVERTISEMENT
Even after a string of surprise Democratic wins in recent special elections, a blue victory seems far off in the 8th District. Still, the fact that the GOP sees the race as potentially close enough to merit an infusion of cash has been seen as the latest sign of a potential Democratic wave in the midterms.
“It’s going to be a Republican victory ... but the question is, is it going to be a single-digit Republican win or a double-digit Republican win?” said Mike Noble, a GOP strategist and pollster in Arizona.
“The national narrative is going to be very important depending upon which way it goes,” Noble continued, adding that a close Republican win would indicate “that it’s going to be a tough election year for the GOP.”
The race pits former state Sen. Debbie Lesko (R) against former emergency room doctor and first-time candidate Hiral Tipirneni (D). This is the first time since 2012 that Democrats have even bothered to field a candidate for the seat, but Tipirneni has managed to capitalize on political headwinds facing the GOP to potentially put the safely red seat into play.
Polling reflects that the race could be the closest contest over the seat in decades. Lesko’s initial 14-point lead has shrunk in recent weeks, though polls have shown wildly varying results — reflecting the difficulty of polling in low-turnout special elections.
Two weeks out from the race, a poll from OHPI–ABC15 Arizona found Lesko ahead by 10 points. But other polls — one from Emerson College and another from Tipirneni’s campaign — have shown a statistical dead heat. On the eve of the election, Emerson conducted another poll that showed Lesko up by 6 points.
With days to go before the special election, both candidates made their final pitches alongside political heavy-hitters in Arizona, stressing the national implications of Tuesday’s results seven months out from the midterms.
Over the weekend, Arizona GOP Reps. Martha McSally Martha Elizabeth McSallyTumultuous court battle upends fight for Senate Grassley, Ernst pledge to 'evaluate' Trump's Supreme Court nominee The Hill's Campaign Report: Biden goes on offense MORE and David Schweikert David SchweikertHouse Democratic campaign leader predicts bigger majority Democrat Hiral Tipirneni wins Ariz. primary to challenge Rep. David Schweikert Ethics watchdog finds 'substantial' evidence of improper spending by Rep. Sanford Bishop MORE stumped for Lesko.
Meanwhile, Tipirneni continued canvassing efforts through election day and held an election eve rally with former Rep. Gabrielle Giffords (D-Ariz.) and her husband, retired astronaut Mark Kelly.
The Arizona race will be a tougher race for Democrats than the recent special election in Pennsylvania, where now-Rep. Conor Lamb (D) pulled off an upset win in another district that went big for Trump in 2016.
The demographics of the 8th District strongly favor Republicans — it’s overwhelmingly white, and about 45 percent of the voting-age population is 55 or older. It’s also home to Sun City, an expansive retirement community filled with older voters loyal to the GOP.
But Lamb’s victory has made Republicans cautious of the Arizona race.
The Republican National Committee spent about a million dollars on the Arizona race, according to Federal Election Commission filings. The National Republican Congressional Committee and the Congressional Leadership Fund, meanwhile, have each spent six-figure sums to boost Lesko.
The Republican candidate has also received last-minute boosts from the White House and House GOP leaders. Trump recorded robocalls warning about how “illegal immigrants will pour right over your border” if Democrats take back the House, according to The Washington Post, while Speaker Paul Ryan Paul Davis RyanKenosha will be a good bellwether in 2020 At indoor rally, Pence says election runs through Wisconsin Juan Williams: Breaking down the debates MORE (Wis.) and House Majority Leader Kevin McCarthy Kevin Owen McCarthyMcCarthy's Democratic challenger to launch first TV ad highlighting Air Force service as single mother Trump asked Chamber of Commerce to reconsider Democratic endorsements: report The Hill's Morning Report - Sponsored by The Air Line Pilots Association - White House moves closer to Pelosi on virus relief bill MORE (Calif.) have both fundraised for Lesko.
The Democratic National Committee has boosted Tipirneni with get-out-the-vote texts and digital ads. Other liberal outside groups, like Progressive Turnout Project and End Citizens United, have also been active in the race.
Republicans have outspent Democrats in the race, though Tipirneni has raised more money than Lesko overall since Franks resigned in December.
Early voting numbers suggest that Republicans have the edge. Of the 154,076 voters who have cast ballots so far, 49 percent are registered Republicans, 28 percent are registered Democrats and 23 percent are independents, according to figures from Arizona’s secretary of state as of Monday afternoon.
Republicans are also optimistic about the demographic picture of early voters. A little over 75 percent of early voters are age 55 and older, with the median age of those early voters at 67 — a positive sign for the GOP, since older voters trend Republicans.
Republican groups focused on early voters, since a large number of ballots in Arizona are cast by mail. The Congressional Leadership Fund — a super PAC aligned with Ryan — and GOP firm Cavalry LLC spent $65,000 on a digital ad campaign that targeted those on the permanent early voter list. Republicans who were on that list saw the ads an average of 50 times in the month leading up to the election.
Arizona Democratic strategist Andy Barr Andy BarrPowell, Mnuchin stress limits of current emergency lending programs McConnell holds 12-point lead over Democratic challenger McGrath: poll Democrats fear 2016 repeat despite Biden's lead in polls MORE said that Tipirneni would need to win over a significant number of Republican voters to win. The Democrat would also need to run up the score with independent voters — a demographic where, according to polls, Tipirneni has an advantage.
Political observers like Cook Political Report elections analyst Dave Wasserman believe that anything above 41 percent of the vote will qualify as a strong showing for Tipirneni. Strategists on both sides of the aisle argue that a GOP win that comes down to a single-digit margin would qualify as a positive sign for Democrats.
Observers say even a narrow GOP win will be a sign of trouble for Arizona Republicans. In November, Republicans in the state will be defending the seat now held by retiring Sen. Jeff Flake Jeffrey (Jeff) Lane FlakeJeff Flake: Republicans 'should hold the same position' on SCOTUS vacancy as 2016 Republican former Michigan governor says he's voting for Biden Maybe they just don't like cowboys: The president is successful, some just don't like his style MORE, as well as several swing House districts.
“We’ve activated a base of supporters and activists who didn’t have a lot to be excited about for decades,” Barr, the Democratic strategist, said.
“We built an infrastructure in an area where we desperately need to win more votes if we’re going to win statewide even if we don’t carry the district.”
|
{
"pile_set_name": "OpenWebText2"
}
|
Genetic Disaster Lands in Your Living Room
Team 8 is proud to announce that their first-ever production Genetic Disaster(already in early access) will be available in its final version on Steam December 15, 2017. Be prepared to lose long time buddies due to accidental (they said) friendly fire and betrayals.
In this cooperative rogue-like, casualties and accidental friendly shootings are commonplace. Summon your buddies, bust out the beers, order in the pizza and get ready for a chilled relaxed evening. Join forces to beat the bosses and defeat their minions, but be even more cautious with your happy trigger allies. Caught in the middle between friendly fire and explosive barrels, there will be plenty of opportunities to wipe the entire team out.
Join this band of peculiar characters, named Sneaky, Panic, Devil and Bunker in their fight against the completely nutty scientist! Help them escape from the mansion and face the wacky monsters inhabiting the corridors. For real, get with the program, you will pull your teeth out just like when playing Cuphead but that’s what we like! Die, laugh and retry.Genetic Disaster is a “cooperative” rogue like for up to 4 players, with fun and gratifying gameplay wrapped around cartoony and super colorful cute graphics. You can play alone, with friends (who may not be your friends anymore at the end of the evening), on your couch or online but whatever happens, you will curse everyone ! Collect weapons, potions, share your life (or not) and upgrade your hero at each level to create your own style of play or to match that of your teammates. Therefore, cooperation constitutes the key element to victory, and at the same time very often will drive you to lose the game.
Co-op local and online multiplayer for up to 4 players
Procedurally generated levels
4 charismatic characters, each with their own skills
Seamless and automatic gameplay balance adjustments depending on the number of players
Hand-painted characters and environments
Upgrade your hero throughout levels
PC and Game pad compatible controls
Genetic disaster will be available on Steam on December 15, 2017 for $19.99.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Python mysql database insert query, thread error
This is my code that makes the call (everything works great except for the last line with the insert) all the required imports are there and working. There must be something wrong with the query.
db = Database()
soup = bs(mytrades)
for row in soup.findAll("tr"):
cols = row.findAll("td")
data = []
for col in cols:
data.append(col.text)
query = """INSERT INTO zulutrades VALUES (%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s), (128391,"""+data[0]+""","""+data[1]+""","""+data[2]+""","""+data[3]+""","""+data[4]+""","""+data[5]+""","""+data[6]+""","""+data[7]+""","""+data[8]+""","""+data[9]+""","""+data[10]+""")"""
db.insert(query)
*The "error" (I didn't post it because I didn't think it means much) *
Exception in thread Thread-192 (most likely raised during interpreter shutdown):Exception in thread Thread-2 (most likely raised during interpreter shutdown):
Traceback (most recent call last):
File "/usr/lib/python2.7/threading.py", line 810, in __bootstrap_inner
File "/usr/lib/python2.7/threading.py", line 763, in run
File "/usr/local/lib/python2.7/dist-packages/windmill-1.6-py2.7.egg/windmill/server/https.py", line 401, in start
File "/usr/lib/python2.7/SocketServer.py", line 280, in handle_request
File "/usr/lib/python2.7/SocketServer.py", line 291, in _handle_request_noblock
<type 'exceptions.AttributeError'>: 'NoneType' object has no attribute 'error'
Traceback (most recent call last):
File "/usr/lib/python2.7/threading.py", line 810, in __bootstrap_inner
File "/usr/lib/python2.7/threading.py", line 763, in run
File "/usr/lib/python2.7/SocketServer.py", line 597, in process_request_thread
File "/usr/lib/python2.7/SocketServer.py", line 471, in shutdown_request
<type 'exceptions.AttributeError'>: 'NoneType' object has no attribute 'error'
I'm using the following mysql Database class:
class Database:
host = 'localhost'
user = 'wind'
password = 'mill'
db = 'windmill'
def __init__(self):
self.connection = MySQLdb.connect(self.host, self.user, self.password, self.db)
self.cursor = self.connection.cursor()
def insert(self, query):
try:
self.cursor.execute(query)
self.connection.commit()
except:
self.connection.rollback()
def query(self, query):
cursor = self.connection.cursor( MySQLdb.cursors.DictCursor )
cursor.execute(query)
return cursor.fetchall()
def __del__(self):
self.connection.close()
Here's the mysql table
CREATE TABLE IF NOT EXISTS `zulutrades` (
`id` int(10) NOT NULL,
`currency` varchar(8) NOT NULL,
`type` varchar(8) NOT NULL,
`std_lots` int(8) NOT NULL,
`date_open` varchar(20) NOT NULL,
`date_closed` varchar(20) NOT NULL,
`open_close` varchar(20) NOT NULL,
`high` float NOT NULL,
`low` float NOT NULL,
`roll` float NOT NULL,
`profit` varchar(10) NOT NULL,
`total` varchar(20) NOT NULL
) ENGINE=InnoDB DEFAULT CHARSET=latin1;
A:
query = """INSERT INTO zulutrades VALUES (%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s), (128391,"""+data[0]+""","""+data[1]+""","""+data[2]+""","""+data[3]+""","""+data[4]+""","""+data[5]+""","""+data[6]+""","""+data[7]+""","""+data[8]+""","""+data[9]+""","""+data[10]+""")"""
Here, you're building an INSERT query for two rows (note the two parenthesized groups after the VALUES clause); the first row consists only of 12 placeholders, while the second consists of 12 values directly concatenated within the query string. This query will not succeed, because you never provide values for the placeholders in your cursor.execute(query) call inside your Database.query method.
Your Database.query and Database.insert methods need to be rewritten in order to support passing of query parameters to the cursor.execute method:
class Database:
...
def insert(self, query, params):
try:
self.cursor.execute(query, params)
self.connection.commit()
except:
self.connection.rollback()
def query(self, query, params):
cursor = self.connection.cursor( MySQLdb.cursors.DictCursor )
cursor.execute(query, params)
return cursor.fetchall()
However, your loops are also wrong. You're executing an INSERT query for each cell returned by rows.findAll('td'), not for each row returned by soup.findAll('tr'). The INSERT should happen in the outer loop, not the inner:
query = 'INSERT INTO zulutrades VALUES (%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s)'
for row in soup.findAll("tr"):
cols = row.findAll("td")
data = []
for col in cols:
data.append(col.text)
db.insert(query, [128391] + data)
As you see, the query string itself no longer needs to be defined inside the loop body, as it no longer changes for each row you want to insert — only the parameters for the execution change now, but those are supplied as a separate parameter to db.insert.
|
{
"pile_set_name": "StackExchange"
}
|
L c slp abcs and behaviorTo determine severity and schedule systems of positive reinforcement we are currently using this chart to document behavior frequency and create dro HD Image of L c slp abcs and behavior
|
{
"pile_set_name": "Pile-CC"
}
|
Adobe issues Lightroom 3.6 and ACR 6.6 release candidates
Adobe has released 'Release Candidates' of its Camera Raw 6.6 and Lightroom 3.6 raw processing software. The updates cover 5 additional cameras, namely the Canon Powershot S100, Nikon 1 J1, Nikon 1 V1, Panasonic Lumix DMX-GX1 and Samsung NX5. Also included are lens profiles for a number of recent Sigma and Nikon lenses, along with several medium format optics and the Sigma DP2x. Both updates are available from the Adobe Labs site. The company uses the term 'Release Candidate' to denote software that is well tested but not yet the final version.
I said I was stuck with JPG as the RAW software included with the camera just wasn't worth the trouble as the JPG's are very good and RAW sotfware is bare boned. That's all changed now with the Lightroom 3.6 release.
|
{
"pile_set_name": "Pile-CC"
}
|
Ts65Dn, a mouse model of Down syndrome, exhibits increased GABAB-induced potassium current.
Down syndrome (DS) is the most common nonheritable cause of mental retardation. DS is the result of the presence of an extra chromosome 21 and its phenotype may be a consequence of overexpressed genes from that chromosome. One such gene is Kcnj6/Girk2, which encodes the G-protein-coupled inward rectifying potassium channel subunit 2 (GIRK2). We have recently shown that the DS mouse model, Ts65Dn, overexpresses GIRK2 throughout the brain and in particular the hippocampus. Here we report that this overexpression leads to a significant increase ( approximately 2-fold) in GABA(B)-mediated GIRK current in primary cultured hippocampal neurons. The dose response curves for peak and steady-state GIRK current density is significantly shifted left toward lower concentrations of baclofen in Ts65Dn neurons compared with diploid controls, consistent with increased functional expression of GIRK channels. Stationary fluctuation analysis of baclofen-induced GIRK current from Ts65Dn neurons indicated no significant change in single-channel conductance compared with diploid. However, significant increases in GIRK channel density was found in Ts65Dn neurons. In normalized baclofen-induced GIRK current and GIRK current kinetics no difference was found between diploid and Ts65Dn neurons, which suggests unimpaired mechanisms of interaction between GIRK channel and GABA(B) receptor. These results indicate that increased expression of GIRK2 containing channels have functional consequences that likely affect the balance between excitatory and inhibitory neuronal transmission.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
It’s not often that John Humphrys conducts a genuinely illuminating interview, but he did so this morning (1’10” in) with Neil Kinnock and Michael Gove – albeit perhaps inadvertently.
The revealing thing here is the self-congratulatory matiness. Three old boys are having a laugh together, even including a rape “gag”*. It’s like a bad golf club. This reminds us that the political class – some of the Labour party (thankfully less than in the recent past), the Tories and top journalists are, essentially, all on the same side.
This smugness hid the fact that there are genuine problems with the BBC’s interviewing; in fairness, Gove hinted at one when he said there as too much focus on the Westminster soap opera and too little on policy.
To see a couple of these problems, contrast that interview with Monday’s exchange between Justin Webb and Angela Rayner (1’52 in).
I counted nine interruptions in six minutes. If we compare that to the chumminess of Humphrys with Kinnock and Gove, and to Webb’s own failure to challenge Lord Lawson’s falsehoods on climate change, a picture emerges – that BBC presenters are deferential to insiders such as old white men but more hostile to outsiders: how dare a working class woman like Ms Rayner have the temerity to enter politics?
Yes, the BBC has admitted that Webb’s interview with Lawson breached its own guidelines. But is it really a coincidence that such an insufficiently rigorous interview should have been conducted with a posh old right-winger rather than with (say) someone working class, or black or a woman? (Note in this context the Today programme's consistent deference towards “business leaders”.)
Secondly, note the perspective from which Webb is challenging Ms Rayner. It’s from the “government as housekeeper” view. To his credit, Webb didn’t sink so low as to ask “where’s the money coming from?” but the presumption that Labour might spend too much on education is there.
This left another set of questions unasked. We might ask Ms Rayner: How can it be fair that some young people get two or three times as much spent on their schooling as others? Why is Labour so slow to narrow that gap? (State spending per secondary school pupil is £6300 per year, whereas day fees at Justin Webb’s old school are £15570 pa.) Or: Given that the government can borrow at a real rate of minus 1.5% pa, any education spending with a non-negative real return has a positive NPV, so why isn’t Labour planning to spend even more? Is it failing to take up positive investment opportunities? Or could it be that its spending won’t in fact be so productive?
That such questions went unasked in favour of a perspective that is (to say the least) questionable demonstrates that the BBC does have a bias – a bias against radical questions. This corroborates Tom Mills’ point, that “the BBC will aim to fairly and accurately reflect the balance of opinion amongst elites.” Or as Cardiff University researchers put it (pdf):
The paradigm of impartiality-as-balance means that only a narrow range of views and voices are heard on the most contentious and important issues.
This, though, is not just unbalanced, but also a way of excluding and alienating outsiders – not just women (that rape “gag”) but also the working class, minorities and, we might add, the economically literate.
* Right after that comment, Gove said that “you can make a fool of yourself” in radio interviews. He wasn’t wrong.
|
{
"pile_set_name": "OpenWebText2"
}
|
Scholar’s son says trial pushed back for months after father was due in court as public prosecutor seeks to execute him.
The trial of Saudi Muslim scholar Salman al-Awdah was postponed until December as it was set to begin in an antiterrorism court after nearly two years of pre-trial detention, his son said.
Al-Awdah, who faces the death penalty, was expected to appear in the Criminal Special Court in Saudi Arabia’s capital, Riyadh, on Sunday.
But his son, Abdullah, said on Twitter the session was postponed for five months.
“Update in regard to the trial of my father in which the Saudi attorney general is seeking death penalty against him because of his activism. The session has been postponed for several months from today,” he said.
It was the second such postponement this year in the case of the cleric, who was arrested in September 2017 as part of a widening crackdown on dissent in the ultraconservative kingdom.
My father was not brought to the court and the session was postponed.
The next session is going to be in December.#سننقذ_سلمان_العودة — د. عبدالله العودة (@aalodah) July 28, 2019
Global support
In a statement on Friday, Amnesty International said it feared for al-Awdah’s life.
“We are gravely concerned that Sheikh Salman al-Awdah could be sentenced to death and executed,” said Lynn Maalouf, Amnesty’s Middle East research director.
“Since his arrest almost two years ago, Sheikh al-Awdah has gone through a terrible ordeal – including prolonged pre-trial detention, months of solitary confinement, incommunicado detention, and other ill-treatment – all flagrant violations to his right to a fair trial.
“The Saudi authorities continue to claim that they are fighting ‘terrorism’ when this trial …[is] clearly politically motivated and meant to silence independent voices in the country,” she added.
190521165816192
The news also elicited strong support from his followers around the world. As many took to social media, the Arabic hashtag We_Will_Save_Awdah went viral.
“They want to kill the voice of reason to let ignorance prevail,” one of his supporters said on Twitter.
“Disagreeing with someone over his opinions and ideas, does not justify planning for his execution, unjustly,” said another supporter on Twitter.
Reformist scholar
Al-Awdah is a renowned Saudi Islamic scholar in his early 60s described by UN experts as a reformist.
He gathered supporters from around the world and boasts more than 14 million followers on Twitter. While his social media accounts remain active, his last tweets were posted in September 2017, the month he was arrested.
190603100555782
He faces the death penalty for a number of charges, including stirring public discord and inciting people against the ruler, according to his son Abdullah.
The cleric also faces charges for alleged ties with the Muslim Brotherhood in addition to his public support for imprisoned dissidents, according to a State Department document on the country’s human rights practices for 2018.
According to Amnesty, al-Awdah was arrested a few hours after posting a tweet welcoming reports of a possible reconciliation between Saudi Arabia and Qatar.
Saudi Arabia, the United Arab Emirates, Bahrain, and Egypt cut off all diplomatic and economic ties with Doha in June 2017, accusing it of not following their regional policy direction. Qatar says it practises an independent foreign policy and will continue to do so.
The cleric’s family have said Saudi authorities demanded al-Awdah and other prominent figures publicly back the kingdom in the blockade, but he refused.
Two other arrested Saudi scholars, Awad al-Qarni and Ali al-Omari, also face the death penalty.
The kingdom executed 37 of its citizens in April for what it said were “terrorism-related crimes”, publicly nailing at least one of the bodies to a pole as a warning to others.
At least 100 people have been executed in Saudi Arabia since the beginning of the year, according to official data released by the official Saudi Press Agency.
Last year, the oil-rich Gulf state carried 149 executions, according to Amnesty, which said only Iran executed more people.
|
{
"pile_set_name": "OpenWebText2"
}
|
Why Jon McLaughlin should be called up to the next Scotland squad
08-Feb-2018 10:38:35 | Edinburgh Evening News
The big panic surrounding the Scottish national team over the last couple of years has been the dearth of options at centre-back. We seem to have become so fixated on this issue that we’re missing another potential problem coming up swiftly in the rearview mirror.
|
{
"pile_set_name": "Pile-CC"
}
|
An engineered Pseudomonas putida can simultaneously degrade organophosphates, pyrethroids and carbamates.
Agricultural soils are often polluted with a variety of pesticides. Unfortunately, natural microorganisms lack the capacity to simultaneously degrade different types of pesticides. Currently, synthetic biology provides powerful approaches to create versatile degraders. In this work, a biosafety strain Pseudomonas putida KT2440 was engineered for simultaneous degradation of organophosphates, pyrethroids, and carbamates, enhanced oxygen-sequestering capability, and real-time monitoring by targeted insertion of four pesticide-degrading genes, vgb, and gfp into the chromosome using a scarless genome-editing method. The resulting recombinant strain, designated as P. putida KTUe, could completely degrade 50mg/L methyl parathion, chlorpyrifos, fenpropathrin, cypermethrin, carbofuran and carbaryl within 30h when incubated in M9 minimal medium supplemented with 20g/L glucose. In soil remediation studies, all the tested six pesticides (50mg/kg soil each) were completely removed in soils inoculated with P. putida KTUe within 15days. Moreover, Vitreoscilla hemoglobin (VHb)-expressing P. putida KTUe grew faster than P. putida KTUd without VHb expression under oxygen-limited conditions, suggesting that VHb may enhance the capability of this recombinant strain to sequester oxygen. Furthermore, the green fluorescence was observed on the P. putida KTUe cells, suggesting that this green fluorescent protein (GFP)-marked strain may be tracked by fluorescence during bioremediation. Therefore, this recombinant strain may serve as a promising candidate for in situ bioremediation of soil contaminated with multiple pesticides. This work not only underscores the value of P. putida KT2440 as an ideal host for bioremediation but also highlights the power of synthetic biology for expanding the degradation capability of natural degraders.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Asa Andrew
Asa Andrew (born May 17, 1971) often styled as Dr. Asa, America’s Health Coach, is an American author, radio host, television personality, motivational speaker, and physician. He is best known for his international best-selling book Empowering Your Health, and daily syndicated health talk radio show Dr. Asa On Call. He also makes regular TV appearances in health related segments and interviews. His radio shows, TV shows, live events, and writings usually focus on healthier living by building the mind, body, and spirit through Lifestyle Medicine.
Early life and education
Asa Andrew was born and raised in Tennessee. He moved to Florida to study and received his Bachelor of Science at the Florida State University. Currently, Andrew resides primarily in Daytona Beach, Florida.
Professional career
In addition to his media appearances, daily syndicated television and radio shows, and live events that focus on healthier living, Andrew also assists many celebrities in daily living, weight loss and building better lifestyles including Mike weaver of Big Daddy Weave.. He is a professional member of the American College of Lifestyle Medicine and has been an honorary chair of the American Diabetes Association in 2010.
Radio and Television
Andrew started his radio career with his Radio show 'Dr. Asa On Call' which now airs 3 hours daily syndicated on networks including Cumulus Media, iHeart Radio, Salem Communications and independent stations in North America. Andrew makes recurring appearances as health and medical expert on television news outlets such as FOX, NBC, ABC, and CBS, including shows such as 700 club and Good Morning America.
Bibliography
Empowering Your Health: Do You Want to Get Well?, Foreword by Dave Ramsey (Thomas Nelson Incorporated, 2007, )
References
Category:1971 births
Category:Living people
Category:American health and wellness writers
Category:American television personalities
Category:American motivational speakers
Category:Physicians from Georgia (U.S. state)
Category:People from Hendersonville, Tennessee
Category:Florida State University alumni
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Selkirk’s 2nd XI were humbled by Melrose at Philiphaugh on Sunday, a result which severely damages the Philiphaugh outfit’s hopes of retaining the Border Reserve League title. Realistically Selkirk must win each of their final three fixtures, starting with Sunday’s match against Kelso, if they are to have any chance of topping the end of season table.
Batting first in overcast but warm conditions Selkirk posted a total of 146/9 from their 40 overs. This seemed a more than defensible total bearing in mind that Selkirk had enjoyed a comfortable victory at Melrose earlier in the season.
Certainly few people, least of all the Selkirk players, expected Melrose to canter to a nine wicket victory with 12 overs to spare. Some slapdash fielding and errant bowling certainly helped Melrose on their way and the visitors – notably Kyle Paisley – enjoyed repeated slices of good fortune but Selkirk could have no complaints about the final result. Paisley, indeed, demonstrated an astonishing repertoire of Chinese cuts, sclaffs and mistimed pulls that annoyed Selkirk no end and made it clear that, even before he was twice dropped, it as not to be Selkirk’s day.
Furqan and Paisley had got Melrose off to a flying start before the former was trapped LBW by Bryson for 29. Nevertheless at 65/1 Selkirk needed quick wickets to regain the initiative. Alas these proved elusive a Ross McLennan composed a classy innings of 41 that, in partnership with Paisley’s successful heaving and swiping 66, saw Melrose home with ease.
Earlier it had looked rather better for Selkirk as, led by Ranald Wilkie’s second half century of the season, they posted a perfectly respectable total. After a slow start from Graham and Fairbairn, Wilkie got into his stride, hitting five 4s and a 6 en route to a splendid innings of 66. He was given excellent support by Gordon Branston (23) and young Macaulley [correct] Hislop (9) in particular and these were the three stand-out contributions to a team performance that seemed, for a while, to have put Selkirk in a good position for victory.
All in all this was a bleak, bleak weekend for Selkirk cricket as in two matches the opposition racked up an eye-watering, foot-wearying 460/5. An experience, frankly, that no-one connected to the club wishes to endure again.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Why is Guid.ToString returning capitalised string in Linq?
I have encountered some weird/unexpected behaviour in which Guid.ToString() in a Linq expression returns a different result than Guid.ToString() in a foreach loop.
What the method is doing:
The method in question is simply taking an object and then creates a new view-model from the original object. The company I work for has decided that Guid's will not be allowed on view-models, due to one of our older JSON serializers having an bug in which Guid's were not serialized correctly.
The problem/unexpected result:
While debugging/testing my method I found that the Linq expression I created was returning a strange result. When converting my Guid to its string representation, the result was being automatically capitalised. I didn't believe that it was the Linq expression at first but once I had converted the logic into a foreach loop I got a lower-cased string representation of my Guid.
Example code:
Please note that the property types for lookupList (ID1, ID2, ID3) are all of type Guid and the properties on NewClass are all of type string.
Linq expression:
List<NewClass> returnList = lookupList.Select(i => new NewClass {
Property1 = i.ID1.ToString(),
Property2 = i.ID2.ToString(),
Property3 = i.ID3.ToString(),
.....
}).ToList();
Returns:
{
Property1=7081C549-64D6-458E-A693-0D2C9C47D183
Property2=06DD6A59-D339-4E15-89EA-48803DBA271E
Property3=9A876EDD-3B79-C27E-1680-E0820A0CD6EC
}
Foreach loop:
var returnList = new List<NewClass>();
foreach (var item in lookupList)
{
returnList.Add(new NewClass
{
Property1 = item.ID1.ToString(),
Property2 = item.ID2.ToString(),
Property3 = item.ID3.ToString(),
.....
});
}
Returns:
{
Property1=7081c549-64d6-458e-a693-0d2c9c47d183
Property2=06dd6a59-d339-4e15-89ea-48803dba271e
Property3=9a876edd-3b79-c27e-1680-e0820a0cd6ec
}
The question:
Why is this happening and is this expected behaviour? I would expect both the Linq expression and the foreach loop to return the same result when .ToString() is applied to my Guid but somehow it is not. I have also checked that there are no .ToString() overrides in either class.
Thank you in advance.
Update:
The lookupList has been handled by a .ToList() before it hits my method. LookupList is of type List<t> where t is a custom business entity which has additional properties that the database does not have. Apologies, I did not make this clear in my original question.
A:
If lookupList is a IQueryable object, so that you are using LINQ to SQL, and not LINQ to object, then the two queries are not the same.
lookupList.Select(i => new NewClass { Property1 = i.ID1.ToString(), etc..
Will perform a SQL SELECT, the result will depend on your DBMS. My guess is that the ToString will be translate to something like CAST(Property1, varchar)
Whereas this query:
foreach (var item in lookupList)
{
returnList.Add(new NewClass { Property1 = item.ID1.ToString(), etc..
will first does a select in your database, and then calling ToString on it. So the method triggered is the ToString method of the C# object GUID.
Try this for example :
List<NewClass> returnList = lookupList.ToList().Select(i => new NewClass {
Property1 = i.ID1.ToString(),
Property2 = i.ID2.ToString(),
Property3 = i.ID3.ToString(),
.....
}).ToList();
This should return lowercase Properties.
The .ToString is not normally support in SQL, and the first query should exception. But my guess it that someone in your team read that blog post that explain how you can create a SQL function that will map an Entity Framework call.
Interesting fact : the example function create uppercase Guid strings.
EDIT : In pure LINQ to Object, this code return lowercase strings:
var lookupList = new[] { new Tuple<Guid, Guid>(Guid.NewGuid(), Guid.NewGuid()) };
var returnList = lookupList.Select(i => new
{
Property1 = i.Item1.ToString(),
Property2 = i.Item2.ToString(),
}).ToList();
We need more infos on lookupList object and those properties IDx. Are they pure C# Guid object?
You said that you already .ToListed your object. That will not work if your are doing it the wrong way :
BAD:
lookupList.ToList();
var returnList = lookupList.Select(i => new NewClass {
GOOD:
var purePOCOList = lookupList.ToList();
var returnList = purePOCOList.Select(i => new NewClass {
|
{
"pile_set_name": "StackExchange"
}
|
<?php
if (!defined('SERVER_PATH')) exit("No Access");
class HandlerException
{
public static function appError($err_no = '', $err_msg = '', $err_file = '', $err_line = 0) {
$err_str = "[{$err_no}] 文件:{$err_file} 中第 {$err_line} 行:{$err_msg} ";
static::logRecord($err_str);
}
public static function fatalError() {
$error = error_get_last();
if (isset($error['type'])) {
switch ($error['type'])
{
case E_ERROR :
case E_PARSE :
case E_CORE_ERROR :
case E_COMPILE_ERROR :
$err_str = "[{$error['type']}] 文件:{$error['file']} 中第 {$error['line']} 行:{$error['message']} ";
static::logRecord($err_str);
}
}
}
protected static function logRecord($err_str = '') {
$config = get_config();
$error_log_path = $config['error_log_file'];
$log_file_size = 0;
if (is_file($error_log_path)) {
$log_file_size = filesize($config['error_log_file']);
}
if ($log_file_size > 1024*20) { //超过20M进行清理
file_put_contents($error_log_path,'');
}
$msg = "[".date("Y-m-d H:i:s")."] ".$err_str.PHP_EOL;
file_put_contents($error_log_path, $msg, FILE_APPEND);
}
}
|
{
"pile_set_name": "Github"
}
|
Q:
Storing IPv6 ranges in PostgreSQL
In 9.2, new range functionality was added.
How do I create a table with IPv6 ranges fields?
Do I need to create new type?
An example / link will be appreciated.
A:
PostgreSQL already supports type CIDR, which can store ranges for both IPv4 and IPv6. The only catch that these ranges cannot be like 1.2.3.1-1.2.3.10 for IPv4 or ::5:1-::5-10, but only like 1.2.3/28 or 2001:0:0:5::0/64 - typical for classless subnet declaration.
If you want more flexibility than CIDR, and want to have true arbitrary INET ranges, there is ip4r extension what offers these ready to use. It is included by default in some Ubuntu versions (for example it is included in Ubuntu 12.10).
Don't be fooled by ip4r name: it supports both IPv4 and IPv6 since version 2.0. It also supports typical range operations that you would expect, like BETWEEN, <<= to check if IP belongs to range and some others. Read more here: README.ip4r.
|
{
"pile_set_name": "StackExchange"
}
|
Naruto Shippuden Vol. #08
It’s a period of rest and recovery for the gang as they figure out how to prepare for their next mission.
The Review!
Audio:
The bilingual presentation for Naruto continues to be a solid affair as the two stereo tracks are encoded at 256kbps. The series is fairly standard television fare but it handles itself well and there’s a bit of an extra oomph to it at times with the generally full sounding mix. There are moments of good directionality but by and large it’s nothing all that exceptional. The best moments continue to really be the opening and closing sequences with the music but that’s also somewhat normal. Dialogue is clean and clear throughout and we had no problems with dropouts or distortions during regular playback of the Japanese track or from spot checking the English track.
Video:
Originally airing in 2007, the transfer for these TV episodes is presented in their original full frame aspect ratio. The production values for the series continue to be quite good and the authoring side of the release brings a lot of that to light. Naruto has a lot of movement at times and it maintains a very strong look with no motion artifacts or break-up in general. Throughout the four episodes that are on this disc, there aren’t any real issues to be found at all. There are a few moments of some mild aliasing during a panning sequence and a bit of noise in some of the darker scenes here and there, but by and large this is a very solid looking release that covers a good range of settings without any discernable issues. Colors are nicely solid, bitrates are healthy with a number of good peaks and everything just feels very appealing. Fans of the show are likely to love how this looks.
Packaging:
Similar to previous installments, the cover artwork features a black and white piece of character art featuring the newest Leaf Ninja to arrive in the series looking fairly serious here with his scroll flowing out in front of him. The black and white nature of it really does change the appearance of it all in comparison to the previous kind of singles which were mostly shots from the show with vibrant colors. There’s a lot of color here, with a red original logo on the right side and the US logo along the top brings in reds, oranges, blues and even some pink. It’s an eye-catching and busy cover that stands out because of the disparity. The back cover is kept to white with some gray background circles to give it a bit more accent. A few shots from the show are included that are decent and the summary covers a fair amount of ground with what’s going on here. The episodes are listed clearly by name and number while the rest is given over to production credits. As is usual, Viz wants nothing to do with a technical grid that would make it easy to break down what’s here, so you have to find the basic stats within the various areas of text. No show related inserts are included nor is there a reverse side cover.
Menu:
The menu for this release is pretty decent and stands out more than most other companies at this point in time. There’s a black cloud like border around the screen with a static image of Gaara and Naruto sitting near each other while the background has animation from the film playing through it as various weapons fly by. It’s really nicely creative to fit in with the show overall and it does highlight some care and creativity. The music is spot on for something uplifting and energetic. Menu navigation is straightforward with a strip along the bottom and episode navigation isn’t bad as you can access the parts of each episode from one submenu. Everything loads quickly but the disc doesn’t read our players’ language presets as it defaults to English with no subtitles.
Extras:
None.
Content: (please note that content portions of a review may contain spoilers)
With the first arc now over, thirty episodes in, the inescapable conclusion I come to is that the arc was a huge win for Sakura. No other character has made out as good as her during it by displaying their abilities and composure under difficult circumstances which also highlights the growth of the character since Naruto went on his two year journey to discover his abilities. While Naruto has grown some, he’s certainly not changed visibly as much as Sakura has. Her return to the Leaf Village here later and her time at Gaara’s village paint her as the real successor to the Hokage in the future who will lead well.
The first half of the disc revolves around the epilogue of the battle with the first two Akatsuki that have been encountered. While there’s a small nod to the other Akatsuki out there that come by to search for a particular ring, the focus is on the aftermath of the event. Chiyo has done all she can to save Gaara but at the price that costs dearly, a price that Naruto is surprised about even after he lends her a lot of his chakra in order to save his friend. Chiyo has been an interesting character from the start and she served this arc well. Gaara’s return to the land of the living is fairly understated, as expected, but there are a couple of good moments for him including when he actually offers his hand to Naruto in thanks for all that he’s done. The return to the Village of Sand is particularly poignant, both with bringing Chiyo home and her final resting place where Sakura feels an important connection.
The second half of the disc is a bit more quiet and reflective overall as the two teams make their way back home and get Kakashi taken care of since he’s so out of it. Of course, that’s made worse because Guy is bringing him back and racing with him on his back for the whole thing. Kakashi is out of it for another week so he can recover and that puts the pressure on as a new group must be formed to deal with the next issue. With Sakura having learned of a potential target that may be a trap as well, she wants to head to the Tenchi bridge in six days to acquire the spy that the Akatsuki have planted in Orochimaru’s group so they can get some very valuable data on what’s going on. There’s a lot of politicking going on here as Tsunade wants Naruto to go for various reasons while her advisors are flatly against it.
What is about to add a new dimension to everything is the apparent introduction of a group called the Foundation. This is apparently an older group that was disbanded whose main leader, a man named Danzo, caused a lot of trouble for the Third Hokage with his view on how the village should be run and the operational structure of everything. Danzo has an interest in the new group that’s forming and pushes, quietly, for one of his own to be included and he’s certainly an interesting one with his ability to create paper images into reality as we see during an encounter he has with Naruto where he pushes him to see what he’s like. Tsunade isn’t keen on this but has to accept while making sure she gets her own Black Ops member to be the final member of the team to watch everyone else. The setup is all here for the next arc before Naruto heads out of the village again, something Tsunade wants in order to keep him from being any one place too long.
In Summary:
As an epilogue for the first story arc and a setup for the next, the four episodes here are pretty good. We get to see the position that Sakura now commands with Tsunade while also seeing just what kind of pressures that Tsunade is under. Naruto’s still the same as always in the end, especially when he’s forced to work with other people, so the new group that’s forming will definitely be difficult and complicated. The quiet nature of these episodes is rather welcome after how things have been but it looks like it won’t last long, which is also a good thing as Naruto thrives on excitement and adventure. There’s a lot of groundwork laid down in these first thirty episodes that hopefully has some eventual payoff.
|
{
"pile_set_name": "Pile-CC"
}
|
Yeah not everyone can learn. But I did. Good point L about motorbikes being far heavier than the rider. That is certainly way different. I think leaning the bike more than the body allows the bike to just turn more quickly with less steering whereas a more upright bike needs more steering input to turn at the same radius. Sometimes on slick north shore roots and baby heads at slow speeds one does try and keep the bike more upright otherwise you go down. But that's different. I read somewhere that to turn a bike tighter mid turn, like to avoid something to push down on the inside grip. That leans the bike more and also moves your body to the outside. Some riders recommend for off road to lean the bike, not the body and push down on the outside grip straight down to push the tire into the ground. I'm not sure I agree with pushing down on the outside grip actually pushes the bike straight down but I do think it puts your body in a better position. Been thinking about this quite a bit this summer after reading some tips on off road turning.
Thinking a bit more, you still have the same 156 pounds of bike and rider (in my case.on a good day) stuck the ground on the same contact patches trying to hold the same forces. Same traction requirement no? That's why the rider with the not so leaned over bike over steers and front wheel washes out.
I think Sagan is great. He can corner, what he did on the last turn was take the apex away from the lead rider on the outside. In racing you should protect the inside otherwise Sagan dives in, turns harder and is gone. Once the leader lost control of the inside (& the apex), he had to check up and change his line to way out wide. But that is racing! It is going to be hard to beat him, put it in the books for Sagan.
L7 I think you need to explain yourself to the physics challenged like myself.
In my thinking Sagan's corner required MORE traction. He went around the corner faster in a shorter arc and generated more centrifugal force. (Centrifugal force isn't really an independent force, it is the inertia of bike and rider that wants to continue to go in a straight line). That inertia had to be compensated by his tires traction or the tires would have slid out.
It would seem to me that what Sagan is doing by leaning (angulating) the way he does is more effectively maintain traction. It allows him to maximize the diagonal vector that loads his tires more and generates more traction. That allows him to corner faster. Just like skiers angulate to maximize the effectiveness of their edge. Two skiers trying the same arc at the same speed; if one can cause their edge to grip but the other can't then one generates enough traction to make the turn, the other has insufficient traction and slides out.
The riders who lean further without angulating start to have less of a diagonal vector and more of a horizontal vector. That reduces their ability to load their tires, it decreases their traction, and they have to slow down or take a longer arc. Because they have less traction, they need to decrease their inertia or the amount of traction they are generating will be overcome and their tires will slide out.
I guess what I am asking is that if Sagan is cornering sharper, at higher speed, and generating more forces... how can he require less traction to make the turn?
Nope, not even close. Your logic suggests that anybody can "learn" to do what he did and that is simply not true.
I somewhat disagree. Anyone can be taught a technique, but not everyone will "get it". Can anyone learn the principals to the cornering technique that Sagan is using and become a better rider for it? No question the answer is yes.
Will they be able to do what he did in a race situation? No...well, a few might "get it" and be able to. But that leads back to what I said up thread, who is teaching cornering technique? The advice most people get is "hold your line".
-----
It is his word versus ours. We like our word. We like where we stand and we like our credibility."--Lance Armstrong.
What Sagan did was go around a corner more like a motocross rider, who is standing on his pegs which allows the bike to be controlled and angled separately from the rider. It allows greater bike lean & quicker changes in direction, and quicker adjustments to the turn, and the bike is riding more on the side of the tire. Most riders typically go with the standard butt on the seat turn, where one leans mostly with the bike or leans the body a little more than the bike, like MotoGP racers. They do it to keep the tire patch bigger with the ground as the tires profile has a flatter appearance (on the side of the tire after a certain angle, there is very little patch on the ground) & they are anticipating hitting the throttle ASAP. But changes in the corner or direction are more difficult, they set up for a corner & they are locked in within a narrower arc of control. If you go around a corner, the tires load up the same if the arc of the corner is the same, whether the tire is more vertical or horizontal, the loading is similar. The patch contact with the ground is dependant on the tire profile. Once the maximum load is reached, they all are going to slip or step out.
Its like the kids' track and field coach said, anyone can learn a trick/skill but if they can be taught to "get it" at a young age (< 10 yrs give or take), they can operate several steps above those that get taught the skill at a later age. Sagan is one of those rare occasions where ability, interest and drive lined up at a very young age.
My friend's oldest kid at age 10 is showing some amazing bike handling and snowboarding athetism. I am sure that if he applied himself he could give Sagan a run for his money in terms of bike tricks by the time he reaches that age. But so far the stars do not align in that he's not really interested in competitive sport.
Seems like he did what I do on descent curves - actively push the inside bar towards the outside of the turn. You can see he keeps his left arm straight and right is flexible as he dives to the left. When I do it, it feels like the bike is pulled into the curve without losing speed. Only a couple other riders in the front are doing that, the rest have both arms bent, which means they are just leaning. I just wonder about it because a descent curve has a definite radius and cant, while a flat street does not. The technique might be different.
jmdirt, I suppose we could get into the pure physics but I think we should probably do that off-line. It would involve some pretty extensive unit-vector calculus and whatnot, and I can't see a proper discussion coming off in less than fifteen pages, which wouldn't be tolerated as a forum entry!
Where does the 2% figure come from? When I was yakking with my "guru" this morning, he said that he'd never yet encountered anyone, no matter how ill-adept in a native sense, who couldn't learn to do this pretty well. By "pretty well" he would not mean, "as well as a pro who uses the technique." He would mean, "faster than what they did previously, and, more critically, way, way, way safer."
Maybe the best way to address these questions is the old-fashioned empirical way: go out and try it. Change direction not by steering (in the conventional sense of aiming the handlebar towards the exit) but by pushing down and forward on the inside drop (exactly as CK describes). All the other elements -- the exaggerated bike lean and angulation, the COM shift, and so on -- sort of take care of themselves. Counter-steer/Angulation is so easy, the main danger is that you'll remove a hand from the bar to slap your head.
|
{
"pile_set_name": "Pile-CC"
}
|
“I don’t remember paying attention a lot to what was said about me at Michigan State, and I certainly haven’t gone out of my way to find it here,” Cousins said. “But it still gets back to you one way or the other at times. And I do find the scrutiny in this market and the NFL in general, it does seem to be more intense, more of a fishbowl.
“It’s part of the deal. And I do believe as an NFL quarterback you’ve got to be mentally tough, emotionally tough. You’ve got to block out good and bad. You can’t let praise or criticism get to you. It’s a weakness to get caught up in either one.”
|
{
"pile_set_name": "OpenWebText2"
}
|
Located in the tallest of the six pyramids that house the Nima Sand Museum, Japan, is a 5.2-m-tall (17-ft 0.72-in) 560-kg (1,234.6-lb) hourglass with a diameter of 1 m (3 ft 3.37 in). It is filled with 629,100,000,000 grains of the “singing” Osodani sand, which weigh 1,000,368 g (2,205 lb 6.88 oz). The sand, sifted to ensure that each grain measures an average of 0.11 mm, flows continuously through a nozzle measuring 0.84 mm in diameter. Built in 1991, the huge sand timer is flipped over at midnight every 31 December, with the upper globe taking exactly one year to empty into the lower globe.
All records listed on our website are current and up-to-date. For a full list of record titles, please use our Record Application Search. (You will need to register / login for access)
Comments below may relate to previous holders of this record.
|
{
"pile_set_name": "OpenWebText2"
}
|
The cDNA sequence of murine Nkx-2.2.
We isolated and sequenced a 2026-bp murine Nkx-2.2 cDNA clone that contains an open reading frame encoding 273 amino acids (aa). The 273-aa protein includes a homeobox, an NK-2 box and a N-terminal decapeptide found in other Nk family members.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Swift tableView.reloadData() seems not working
I've just created a new project using CoreData with the "Master-Detail Application" template. I'm using the code provided by Apple, I just added a NSPrediate in the fetchController
var fetchedResultsController: NSFetchedResultsController {
if _fetchedResultsController != nil {
return _fetchedResultsController!
}
let fetchRequest = NSFetchRequest()
// Edit the entity name as appropriate.
let entity = NSEntityDescription.entityForName("Event", inManagedObjectContext: self.managedObjectContext)
fetchRequest.entity = entity
// Here the code i added <<<<<<<<
fetchRequest.predicate = NSPredicate(format: "year = %d", self.selectedYear)
// Set the batch size to a suitable number.
fetchRequest.fetchBatchSize = 20
// Edit the sort key as appropriate.
let sortDescriptor = NSSortDescriptor(key: "timeStamp", ascending: false)
let sortDescriptors = [sortDescriptor]
fetchRequest.sortDescriptors = [sortDescriptor]
// Edit the section name key path and cache name if appropriate.
// nil for section name key path means "no sections".
let aFetchedResultsController = NSFetchedResultsController(fetchRequest: fetchRequest, managedObjectContext: self.managedObjectContext, sectionNameKeyPath: nil, cacheName: "Master")
aFetchedResultsController.delegate = self
_fetchedResultsController = aFetchedResultsController
var error: NSError? = nil
if !_fetchedResultsController!.performFetch(&error) {
// Replace this implementation with code to handle the error appropriately.
// abort() causes the application to generate a crash log and terminate. You should not use this function in a shipping application, although it may be useful during development.
//println("Unresolved error \(error), \(error.userInfo)")
abort()
}
return _fetchedResultsController!
}
where selected.Year is a simple var. I also added a UIButton connected to an IBAction that will change the value of selectedYear.
@IBAction func changeYear(sender: AnyObject) {
self.selectedYear = self.selectedYear + 1
self.tableView.reloadData()
}
(I logged the func changeYear and it's called)
So after that i'm calling self.tableView.reloadData() to update the UITableView that should now fetch different records depending on the new predicate, but the tableView is never updated
(I tried to log the delegate methods but are never fired).
What am i missing?
I also tried to make the tableView an IBOutlet from storyboard and tried to call self.tv.reloadData(), but still nothing.
A:
The fetched results controller does not work this way. You need to tell it to re-fetch based on the new predicate:
_fetchedResultsController = nil
self.tableView.reloadData()
The other way is to change the predicate of the fetch request of the FRC and call
self.fetchedResultsController.performFetch(&error)
Then there is no need to reload the table with reloadData() because the delegate should take care of it. But I presume that you are completely replacing the contents of the table, so the above solution is probably easier and just as performant.
|
{
"pile_set_name": "StackExchange"
}
|
I want to sit and read outside but there's a glare on my ipad screen
59,717 shares
|
{
"pile_set_name": "OpenWebText2"
}
|
Uruguay at the 2014 Summer Youth Olympics
Uruguay will compete at the 2014 Summer Youth Olympics, in Nanjing, China from 16 August to 28 August 2014.
Sailor Dolores Moreira was named the flagbearer of the country at the opening ceremony.
Athletics
Uruguay qualified one athlete.
Qualification Legend: Q=Final A (medal); qB=Final B (non-medal); qC=Final C (non-medal); qD=Final D (non-medal); qE=Final E (non-medal)
Boys
Field Events
Basketball
Uruguay qualified a boys' team based on the 1 June 2014 FIBA 3x3 National Federation Rankings.
Boys' Tournament
Roster
Gaston de Orta
Brian Gonzalez
Joaquin Jones
Camilo Marino
Group Stage
Knockout Stage
Beach Volleyball
Uruguay qualified a boys' and girls' team from their performance at the 2014 CSV Youth Beach Volleyball Tour.
Equestrian
Uruguay qualified a rider.
Field Hockey
Uruguay qualified a girls' team based on its performance at the 2014 Youth American Championship.
Girls' Tournament
Roster
Valeria Agazzi Galeano
Milagros Algorta Ferrari
Constanza Barrandeguy Fernandez
Maria Cecilia Casarotti Gaminara
Lucia Castro Saenz de Zumaran
Paula Costa Puig
Augustina Domingo Esposto
Barbara Petrik Vidal
Augustina Sanchez Greppi
Group Stage
Quarterfinal
Crossover
Fifth and sixth place
Sailing
Uruguay qualified one boat based on its performance at the Byte CII Central & South American Continental Qualifiers.
Swimming
Uruguay qualified one swimmer.
Girls
Table Tennis
Uruguay qualified one athlete based on its performance at the Latin American Qualification Event.
Singles
Team
Qualification Legend: Q=Main Bracket (medal); qB=Consolation Bracket (non-medal)
References
Category:2014 in Uruguayan sport
Category:Nations at the 2014 Summer Youth Olympics
Category:Uruguay at the Youth Olympics
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Hi everyone
The screen cracked on my surface pro 3. I removed the screen an then inspected the board. There are several little bits of foam with very thin pieces of metal wrapped around them. One was torn. They are labeled TDMFoam. Are theses just a static reducer or cushion of some type? I dont want to buy and install a new screen and then still be screwed because of this torn bit of foam.
|
{
"pile_set_name": "Pile-CC"
}
|
Magnesium and blood pressure. II. Clinical studies.
Magnesium deficit may be considered as a cardiovascular risk because of its aetiopathogenic role in the genesis of atherogenous dyslipidaemias and the so-called "idiopathic" mitral valve prolapse. It does not, however, constitute a major antihypertensive factor, though it may sometimes be an accessory co-factor. Plasma magnesium is generally normal in untreated hypertensive patients and normotension is the rule during magnesium deficit. An inverse relationship between magnesium and renin in the plasma of hypertensives has not been confirmed. In practice, plasma magnesium seems to be related to the evolution of the disease. An inverse correlation between blood pressure and erythrocyte total and free magnesium levels has been observed in diverse selected populations but no adjustment has been made in these studies for important covariables. A weak positive association between blood pressure and erythrocyte free magnesium was lost in a multivariate regression analysis. As a rule there is no difference between erythrocyte, leucocyte, and lymphocyte magnesium in hypertensives and controls. More often no relation between urinary magnesium and blood pressure is observed. Daily urine magnesium may be increased with increased excretion of urine adrenaline. Epidemiological data on dietary magnesium, particularly in drinking water, should be carefully scrutinized: these studies do not establish a major role for magnesium as an antihypertensive factor but confirm the importance of magnesium deficit as a nephrocardiovascular risk factor and sometimes gives support for a role of magnesium as an antihypertensive cofactor. The use of magnesium-depleting drugs in hypertensive patients may induce magnesium depletion which must be palliated.(ABSTRACT TRUNCATED AT 250 WORDS)
|
{
"pile_set_name": "PubMed Abstracts"
}
|
class FalseClass
def to_json(options = nil) #:nodoc:
'false'
end
end
|
{
"pile_set_name": "Github"
}
|
Before Dungeons and Dragons was an amusing time waster for nerds, the cooperative board game was a lightning rod for controversy. It let players engage with an imaginative world in which many made-up religions existed, and the core ethical roadmap disturbed conservatives. Characters in the game are not simply good or evil, as many high fantasy worlds maintain — think of Christian-focused Middle-earth or Narnia — and instead, their motives are separated into sub-categories. Though the game’s use of (imagined) wizardry and monsters was certainly the main sticking point for hysterical Christians in the ‘70s and ‘80s, the moral alignment map certainly didn’t help.
Characters in Dungeons and Dragons have a natural stance on both chaos vs. order and good vs. evil. The original gameplay offered an in-world set of questions which players could answer as their characters in order to determine their alignment. In the original game, players could only choose between “lawful,” “neutral,” or “chaotic,” but in 1977 a game update added the concepts of good and evil. The only definition Dungeons and Dragons gives for “evil” is selfishness and disrespect for life, both of which are obviously up for interpretation.
According to the updated version of the Dungeons and Dragons handbook, lawful, neutral, and chaotic characters are defined in this way:
Law implies honor, trustworthiness, obedience to authority, and reliability. On the downside, lawfulness can include closed-mindedness, reactionary adherence to tradition, judgmentalness, and a lack of adaptability. Chaos implies freedom, adaptability, and flexibility. On the downside, chaos can include recklessness, resentment toward legitimate authority, arbitrary actions, and irresponsibility. Someone who is neutral with respect to law and chaos has a normal respect for authority and feels neither a compulsion to follow rules nor a compulsion to rebel. They are honest but can be tempted into lying or deceiving others if it suits him/her.
Similarly, the D&D handbook explains good vs. evil like this:
Good implies altruism, respect for life, and a concern for the dignity of sentient beings. Good characters make personal sacrifices to help others. Evil implies harming, oppressing, and killing others. Some evil creatures simply have no compassion for others and kill without qualms if doing so is convenient or if it can be set up. Others actively pursue evil, killing for sport or out of duty to some malevolent deity or master. People who are neutral with respect to good and evil have compunctions against killing the innocent but lack the commitment to make sacrifices to protect or help others. Neutral people are committed to others by personal relationships.
The math of the moral alignment system puts everyone in the D&D world into nine types. Lawful good characters are sometimes called “crusaders,” neutral good characters are called “benefactors,” and chaotic good characters are “rebels.”
Neutral characters range from “judges” (lawful neutral), to “undecideds” (true neutrals, often animals or creatures), and “free spirits” (chaotic neutrals).
Evil characters are “dominators” (lawful evil), “malefactors” (neutral evil), and “destroyers” (chaotic evil, as in Joker’s “some men just want to watch the world burn”).
Moral Alignment in Pop Culture
The original quiz is available on the Wizards of the Coast website. Though it’s effective for D&D characters, its questions don’t really involve a modern understanding of ethics. Luckily for us, pop culture grabbed onto the moral alignment system, and organizing fictional characters into their alignments became somewhat of a meme.
People have done it to Star Wars characters.
Notice that Jabba the Hut — because he sometimes adheres to contracts and ignores them in other moments — is truly neutral evil. Imgur user Pennsylvaniastan
Characters in The Walking Dead are an interesting fit, too.
This 'Walking Dead' alignment chart makes a case for chaotic characters of all three types being the most interesting to watch.
Weirdly enough, in the show, Eugene references the moral alignment system, saying, “Truth of the matter is, I’m not good. I’m not lawful, neutral, or chaotic. None of the above.” All of those distinctions would make him either neutral evil or true neutral — he’s supposed to be a nerd but somehow thinks he can remove himself from the lawful to chaotic spectrum, which is not accurate.
Game of Thrones, another show that prides itself on lots of dialogue regarding ethics, makes for an interesting moral alignment chart, too.
|
{
"pile_set_name": "OpenWebText2"
}
|
fILED
JUL ~3 2009
UNITED STATES DISTRICT COURT Clerk, U.S. District and
FOR THE DISTRICT OF COLUMBIA Bankruptcy courts
KEVIN RONDEAU, )
)
Plaintiff, )
)
v. ) Civil Action No. 02 1360
)
INTERNAL REVENUE SERVICE, et al., )
)
Defendants. )
MEMORANDUM OPINION
This matter is before the Court on plaintiffs pro se complaint and application to proceed
in forma pauperis.
It appears that plaintiff s causes of action arise from decisions rendered by the state courts
in New Hampshire regarding legal custody of plaintiffs minor child after he and the child's
mother divorced. Generally, plaintiff alleges that defendants have interfered with the parent-
child relationship, have infringed upon his ability to claim his child as a dependent for income
tax purposes, and otherwise have caused him harm and have violated his rights under the First,
Fourth, Fifth, Sixth, Eighth, Ninth and Fourteenth Amendments to the United States
Constitution. His efforts to obtain relief in the state and federal courts have been unsuccessful.
Plaintiff demands compensatory damages totalling $33 million.
"[I]t is well-settled that, since the field of domestic relations involves local problems
peculiarly suited to state regulation and control, a suit whose substance involves domestic
relations cannot ordinarily be maintained in a federal court." Malachowski v. City ofKeene, 787
F.2d 704, 709 (1st Cir.), cert. denied, 479 U.S. 828 (1986) see also Rondeau V. State, No. CIY.
94-289-SD, 1994 WL 262930, at *1 (D.N.H. May 31, 1994) (dismissing for lack of subject
matter jurisdiction plaintiffs motion for ex parte preliminary injunction where "the issues he
raises pertain exclusively to issues of child custody and visitation rights"). Insofar as plaintiff is
challenging any matter pertaining to child custody and support, a federal district court lacks
subject matter jurisdiction.
To the extent that plaintiff raises any other viable claim, in the interest of justice, the
Court will transfer this matter to the United States District Court for the District of New
Hampshire. See 28 U.S.C. § 1404(a); SEC v. Page Airways, 464 F. Supp. 461, 463 (D.D.C.
1978). With the exception of the Internal Revenue Service and its Commissioner, plaintiff brings
this action against individuals and government entities in New Hampshire for acts which
occurred in New Hampshire. The District of Columbia has no apparent connection to this case
aside from being the location of the headquarters of the Internal Revenue Service, and this
connection is not sufficient to warrant proceeding here. See Boers v. United States, 133 F. Supp.
2d 64,66 (D.D.C. 2001) (transferring case to the district where "all the operative facts occurred"
and where "the land that was the subject of the foreclosure is also located" because "the District
of Columbia ha[ d] no apparent connection to this case, aside from the fact that it is the capital of
the United States."). "District Courts have a 'local interest in deciding local controversies at
home.'" Boers, 133 F. Supp. 2d at 66 (quoting Trout Unlimited v. United States Dep't ofAgric.,
944 F. Supp. 13, 16 (D.D.C. 1996)). It appears that this action could have been brought in the
District of New Hampshire and that that is forum is more convenient for the parties and potential
witnesses.
Accordingly, the Court will transfer this action to the United States District Court for the
District of New Hampshire. Resolution of the plaintiffs application to proceed informa
pauperis is left for the transferee court to decide.
An Order consistent with this Memorandum Opinion will be issued separately.
DATE: 1 ,.(~ ~ United States District Judge
|
{
"pile_set_name": "FreeLaw"
}
|
Send this page to someone via email
He stands at almost six-foot-five and is just six years old but Dozer the steer is also a part of the family at the Kismet Creek Farm.
READ MORE: Massive cow named Knickers has been deemed too large to eat
“I had never seen a steer this big in my life,” Kismet Creek Farm owner, Karl Schoenrock said.
Dozer started life on a beef farm, but got so big so fast, his owner decided he needed to be somewhere where he could enjoy the rest of his life.
“I knew where he was, wasn’t where he was meant to stay. I knew a sanctuary would be ideal and he would be able to live out his days happily,” Dozer’s owner, Rebecca Hansuchuk said.
Story continues below advertisement
“We got contacted by this lovely lady named Rebecca, Dozers mom, and she was looking for a home for him … she wanted him to go to a sanctuary where his friends would stay with him his entire life,” Schoenrock said.
Hansuchuk contacted the Schoenrocks and knew Dozer would be welcomed with open arms.
“It is the best feeling in the world to know he’s happy here. It’s nice to have everyone coming and being able to see his personality and see how he’s such a gentle giant,” Hansuchuk said.
Kismet Creek Farms takes care of livestock and allows their guests to pet the animals.
If you’d like to see just how big Dozer is for yourself, head to the Kismet Creek Farm in Steinbach.
Dozer the steer is almost six-foot-five-inches tall.
|
{
"pile_set_name": "OpenWebText2"
}
|
Methyl quadrangularates A-D and related triterpenes from Combretum quadrangulare.
From the MeOH extract of leaves of Combretum quadrangulare, fifteen new cycloartane-type triterpenes, methyl quadrangularates A-D (1-4) and N-P (8, 6, 12), methyl 24-epiquadrangularate C (5), quadrangularic acid E (9), 23-deoxojessic acid (10), 1-O-acetyl-23-deoxojessic acid (11), quadragularols A (7) and B (13) and norquadrangularic acids B (14) and C (15) were isolated together with two known cycloartane-type triterpenes, methyl 23-deoxojessate (16) and 4beta,14alpha-dimethyl-5alpha-ergosta-9beta++ +,19-cyclo-24(31)-en-3beta-hydroxy-4alpha-carboxylic acid (17). Betulinic acid (18), beta-sitosterol (19), kamatakenin (20), isokaempferide (21), 5,7,4'-trihydroxy-3,3'-dimethoxyflavone (22) and 5,4'-dihydroxy-3,7,3'-trimethoxyflavone (23) were also obtained from the same extract. The structures of the new compounds were elucidated on the basis of spectral analysis and chemical conversions. All the isolated compounds were tested for their cytotoxicity towards highly liver metastatic murine colon 26-L5 carcinoma cells, and the cycloartane-type triterpenes showed various degrees of cytotoxicity, whereas all the flavonoids possessed strong cytotoxicity with ED50 values equal to or less than 6 microM.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Canada's Private Sector Union
Food Justice
As the food workers’ union, UFCW is committed to advancing the principles and goals of the food justice movement. We believe that food workers, the people who make the food we eat, must serve a central role in defining the food justice movement and its priorities. Food workers, as citizens, voters and community members, also have a crucial role to play in demanding more from politicians, employers and governments on food justice issues, and using our collective power to help realize the movement’s goals and objectives.
What is food justice?
Food justice is all about taking action on issues that are connected to the production and distribution of food, and, in particular, how those practices impact us as workers, community members, consumers, Canadians and people from around the world.
It includes things like food security, which is all about making sure people have enough high quality, protein rich, safe food to eat and feed their families.
Food justice also means talking about food sovereignty and how every person should have the right to know where their food comes from, and how it’s made. Food sovereignty also means that people should have some say in how food is produced and to what extent high quality, safe, and protein rich food is made available.
In a democratic society, workers, consumers and community members, must have a meaningful role in shaping and governing the polices that affect our food supply, like Canada’s National Food Policy.
Keeping a close eye on the supply chain is very important for the food justice movement. Feeding a country, and creating food exports for other countries, takes thousands of people, and a core principle of the food justice movement is the treatment of food workers.
Food workers, whether they grow and harvest vegetables, make canned goods, cut meat, bake bread, wash produce, stock shelves, serve families at restaurants or in retirement homes, must be treated in accordance with international labour standards, which include sharing the same rights as every other person in Canada.
The food justice movement is also keenly committed to a true definition of sustainability that equally weighs environmental, economic and social concerns, and always includes just transition strategies with any and all proposed actions on climate change.
Why should Canadians care about food justice?
In Canada, we believe that workers have rights, and that the treatment of workers should be in keeping with the international standards signed by our country at the United Nations and the International Labour Organization Conventions 87 and 98 in particular. When we allow right-wing governments and irresponsible employers to break from those beliefs, traditions and commitments, our reputation is tarnished on the world stage, and our ability to be seen and heard as a leading international voice on human rights is undermined.
The ethical treatment of food workers is also in all of our self-interests as food consumers. There is a clear connection between respecting the human rights of food workers and the production of safe food.
Being forced to wear a diaper at work is an indignity, injustice and denial of human rights that none of us would want to endure. And as consumers, we would not, quite rightly, buy food – to feed ourselves and our families – that is made in an environment full of workers wearing dirty diapers.
And in other parts of the world, where freedom of the press, labour rights, food regulations, and the rule of law are not as strong, we can only guess about production standards and practices. Transparent food labelling that clearly outlines country of origin, and other important factors in the food production process, needs to be viewed as a central part of the food sovereignty conversation, and an important tool in helping Canadian families to make food choices, especially for the most vulnerable members of our society like children and aging parents.
The Canadian food industry, from field to fork, employs millions of Canadians, so we are all impacted by the level of justice in our food system as consumers, workers, or the friends, neighbours and family members of food workers.
What are the food justice movement’s goals?
The food justice movement is committed to achieving a number of goals, and from the perspective of food workers, they must include:
A global standard for sustainability that equally includes and reflects environment, economic, and social concerns, and universal, active acceptance of that standard by government, industry and the third sector.
Greater transparency in terms of where our food comes from, and how it is made.
Universal acceptance by government and industry that food workers must serve a central role in all food policy development and governance initiatives.
Union rights for all food workers, because labour rights are human rights, and there is an obvious connection between the advancement of health and safety rights and higher food safety standards.
How can you get involved?
There are many ways for Canadians to make a meaningful contribution to the food justice movement.
Use the power of your shopping cart!
First and foremost, question the foods you eat, and the retail brands you buy:
Do I know where this product is made?
Do I know if this is a company that respects the rights of food workers?
By buying this product I am supporting a company that pays their employees a living wage, and by doing so, creating less food insecurity?
Share your findings with your friends, family members, and coworkers, and encourage them to buy retail food brands that are aligned wit the goals of the food justice movement.
Organize!
Because food insecurity is ultimately a result of poverty, and because collective bargaining is the best anti-poverty tool we have, encourage your friends and family members who are food workers to join the union.
Get political!
Tell your local member of parliament (MP) or member of provincial parliament (MPP or MLA) that food justice is important to you, and if you live in Ontario, voice your outrage at the inability of agriculture workers in the province to join the union. At the national level, be sure to tell your MP that food workers must have an important role to play in developing Canada’s National Food Policy.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Reduce font size
I need your assistance regarding my problem. In fact, I've tried to change the slider's font size on my website : http://compil2rai.com/ on the style.css file, but the changes are not taken in account. Any help ?
http://i.stack.imgur.com/LhKlL.jpg
A:
Not a WordPress question, but add the following in your stylesheet:
.featured-text h2, .featured-text h2 a {
font-size: 24px !important; /* set font size */
}
In the future, simply Inspect Element to find which class or tag to style.
|
{
"pile_set_name": "StackExchange"
}
|
This is an older blade and has seen a lot of usage. The blade has had a lot of steel taken off over the years due to significant polish. I can not tell from your pictures if there is temper all the way up through the boshi or point. Test the temper by taking a penny and running it across the edge of the blade. If there is temper, the coin will catch on the edge. If it slides over, there is no temper.
Bob thank you for the advice and opinion. I like to collect quality items and not care to waste time or money on junk. I thought if I could get it at a low price it may or would be something I could play around with for parts or (gasp affect) try my hand at polishing a blade. Edit added IF the blade is already ruined and there is no historical value to the blade. If there is HV it would go to a professional polisher for the work.
Marty
Bob thank you for the advice and opinion. I like to collect quality items and not care to waste time or money on junk. I thought if I could get it at a low price it may or would be something I could play around with for parts or (gasp affect) try my hand at polishing a blade. Edit added IF the blade is already ruined and there is no historical value to the blade. If there is HV it would go to a professional polisher for the work.
Marty
Good luck in what ever you decide to do. Just do not attempt to polish it yourself. If you decide the blade is worth a chance restoration, be sure to chose an individual with credentials of having been trained in Japan. Avoid the egotistic amateurs who present themselves as something they are not. The blade is very likely pre 1600 and needs study from a trained eye.
On a couple of occasions I've included in my purchase offer a condition that a blade I was interested in be submitted by the seller to a qualified polisher, at my expense. If the blade is deemed worthy of a restoration polish then I complete the purchase. If it does not then I can walk away having lost only a couple hundred dollars. It's not always appropriate for every situation but something to keep in the back of your mind. As you are in the lower 48 I'd use Moses Becerra in Miami as he's Japanese trained and is one of two I trust in the US. Bob Benson in Hawaii is the other.
On a couple of occasions I've included in my purchase offer a condition that a blade I was interested in be submitted by the seller to a qualified polisher, at my expense. If the blade is deemed worthy of a restoration polish then I complete the purchase. If it does not then I can walk away having lost only a couple hundred dollars. It's not always appropriate for every situation but something to keep in the back of your mind. As you are in the lower 48 I'd use Moses Becerra in Miami as he's Japanese trained and is one of two I trust in the US. Bob Benson in Hawaii is the other.
Regards,
Stu
Very good advice from Stu. I also concur with his recommendations for craftsmen.
|
{
"pile_set_name": "Pile-CC"
}
|
In an interview with USA Today, Wolff described the regular-season turnouts at the Coliseum as “depressing,” particularly considering the A’s are on the verge of clinching a second straight American League West division title.
“There is something wrong here,” Wolff was quoted. “You would think that with our lead, people would want to come out, count down the magic numbers, and all that stuff. Even if you’re not a loyal fan, you would think this time of year, where the teams are in the standings, and where every game means something, people would come out.”
According to espn.com, the A's entered Tuesday ranked 24th out of 30 major league teams in home attendance with an average turnout of 22,210. This despite the fact they hold the second-best record in the American League at 88-62.
But Wolff wondered why more fans aren’t showing up now. In reference to the crowd of 14,629 that showed up for Monday’s homestand opener against the Los Angeles Angels, Wolff said:
“It’s depressing. I really expected the crowds to be huge this week. I had a player come up to me and say, ‘I feel sorry for you, Mr. Wolff.’ I told him, ‘Just keep pitching. And whatever you do, don’t look into the stands.’”
Paid attendance was announced at 18,771 on Tuesday night.
Attendance problems are nothing new in Oakland, of course, which is one reason Wolff has been trying for years to move his team to San Jose. The Coliseum is outdated, and a sewage problem earlier this season drew bad press nationally.
But it’s also fair to note that Wolff’s public desire to relocate to the South Bay has done little to win over the fan base in and around Oakland.
|
{
"pile_set_name": "Pile-CC"
}
|
Synthesis of 4,5-dianilinophthalimide and related analogues for potential treatment of Alzheimer's disease via palladium-catalyzed amination.
DAPH (4,5-dianilinophthalimide) has previously been shown to reverse the formation of neurotoxic fibrils associated with Alzheimer's disease. We have developed a synthetic route to DAPH and structurally related analogues that employs palladium-catalyzed amination as the key bond-forming step. The requisite substrates are easily obtained, and their coupling with substituted anilines proceeds in generally high yields. Thus, a variety of DAPH analogues can be quickly accessed in a modular fashion. In addition, the route described herein should also be amenable to the incorporation of other classes of nucleophiles into the molecular framework.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
TERRAFORMING TERRA
We discuss and comment on the role agriculture will play in the containment of the CO2 problem and address protocols for terraforming the planet Earth.
A model farm template is imagined as the central methodology. A broad range of timely science news and other topics of interest are commented on.
Monday, April 18, 2016
Your Food, Thoroughly Poisoned
The case against roundup simply gets worse. This is the first independent reports that picks up on infertility. I have suggested that this is the prime suspect regarding persuasive decline in sperm count over the past six decades. I have also linked it circumstantially to the amphibian dieoff. It is an excellent candidate and i now also assert that Monsanto surely has criminal knowledge and has continued to suppress that knowledge with blantant lies.
Tens of thousands of farmers have died from rare cancers and no one has understood that this is anomalous.
Worse, Monsanto continues to promote their business plan even when blow back must destroy the company..
.
Your Food, Thoroughly Poisoned
Glyphosate Ruining Your Gut and Triggering Autoimmune Diseases
What use is any government that allows its citizens to be poisoned by megarich private corporations?
Glyphosate is the active ingredient in the popular herbicide, Roundup. Glyphosate toxicity is a big deal and what you don’t know just might kill you! Many people routinely spray their lawns with this chemical totally unaware of the toxicity. In the United States, farmers are applying ever increasing amounts to their crops before harvest. According the the World Health Organization, glyphosate is now declared a “probable carcinogen” which means it may cause cancer.
The industry still asserts that it is totally safe for humans, however, one only needs to look at the data to know that is not true. Ignorance may be bliss but I believe we may be on the verge of one of the most toxic man made environmental disasters in history… and unfortunately this chemical is persistent in both the environment and the human body and it is not easy to clean up. France’s highest court found Monsanto guilty of lying as far back as 2008 about the toxicity of its popular weedkiller, Roundup. “The court confirmed an earlier judgment that Monsanto had falsely advertised its herbicide as “biodegradable” and claimed it “left the soil clean” (Read more here)
Glyphosate is the world’s most widely produced herbicide, by volume. It is used extensively in agriculture and is also found in garden products in many countries. The chemical is an ingredient in Monsanto’s weedkiller product Roundup, and glyphosate has become more popular with the increasing market share of crops that are genetically engineered to be tolerant to the herbicide.
California recently became the first state to issue plans to list glyphosate as a chemical known to cause cancer according to EcoWatch. This is big news and we need to pay attention. The use of glyphosate has nearly doubled from 95 million pounds in 2001 to nearly 185million pounds in 2007, according to the latest released report form the EPA and who knows how much it’s increased sine 2007! This is likely in part due to the increase usage of Round-up Ready genetically modified crops during that same time period.
Glyphosate has a large number of tumorigenic [cancer-causing] effects on biological systems, including direct damage to DNA in sensitive cells, disruption of glycine homeostasis, succinate dehydrogenase inhibition, chelation of [minerals such as]manganese, modification to more carcinogenic molecules, such as N-nitrosoglyphosate and glyoxylate, disruption of fructose metabolism, etc…
Sadly epidemiological evidence supports a strong correlation between the dramatic rise in use of glyphosate on crops and the multitude of cancers reaching epidemic proportions, such as breast, pancreatic, kidney, thyroid, bladder, and liver cancers.
In perhaps the most ironic twist of all, glyphosate has proven highly toxic to the basic phase one detoxification of the liver, the cytochrome pathways. I find it incredibly alarming that one of the most toxic chemicals known to mankind also exerts it’s influence by impairing human detoxification. Did you get that!? A toxic chemical that makes is harder to detox… what nonsense!
Here is an excerpt from Entropy 2013, Glyphosate’s Suppression of Cytochrome P450 enzymes and amino acid biosynthesis by the gut microbe:
Glyphosate’s inhibition of cytochrome P450 (CYP) enzymes is an overlooked component of its toxicity to mammals. CYP enzymes play crucial roles in biology, one of which is to detoxify xenobiotics. Thus, glyphosate enhances the damaging effects of other food borne chemical residues and environmental toxins. Negative impact on the body is insidious and manifests slowly over time as inflammation damages cellular systems throughout the body.
Glyphosate may trigger autoimmunity, such as celiac disease by the following mechanisms:
Spraying of wheat before harvest with glyphosate, a common practice in North America allows for a large exposure to glyphosate in wheat.
Glyphosate is toxic to many of our benetifical gut microbes. It may preferentially kill off species, like lactobacillus while leaving potential pathogens, like clostridia to run wild. Glyphosate also chelates essential minerals, such as manganese, iron, cobalt, molybdenum, and copper so that the gut microbes do not have access to them. This leads to chronic inflammatory states in the gut as well as increased intestinal permeability, a mechanism at the core of many chronic illnesses, including inflammatory bowel disease, depression, and autoimmunity.
If you are eating processed food, you are eating glyphosate…
Residues of glyphosate are commonly found in the most common foods in the American Diet, including
5. Cotton (not food but in clothing, sanitary napkins and many products we use daily)
Nearly one billion pounds of glyphosate are doused on both conventional and genetically modified crops world-wide each year but GMO crops receive the largest amounts. Processed foods undoubtable expose you to this toxic contamination, courtesy of wheat, corn, soy and the vegetable oil used. And the meats from conventionally raised animals in confined feed lots are given fed that most likely contains glyphosate-laden corn and soy.
And finally… it gets personal
You may know that I grew up on a farm in Central Illinois. My Dad and brothers still farm corn and soybeans there and I couldn’t be more proud that they have recently switched over to non-GMO versions of these crops. My brothers have started a few fields of organic crops as well. Due to my own history of breast cancer and Crohn’s disease, I have followed a 100% organic diet for at least the past 10-15 years.
Recently I realized just how pervasive this glyphosate exposure is in our environment when I sent out my urine to test my own glyphosate level. I was shocked to get the results back (below) showing that my level was higher than the “Farmer” study, which tested farm workers on application day! This made me realize how pervasive this dangerous chemical is in our environment and how important it is to remain vigilant to decrease exposure and work to get it banned. I am currently working hard on detoxing this chemical from my body and will keep you posted when I do repeat testing.
Dr. Jill glyphosate levels
Ok, so what can I do about it?!
The most important thing to realize is that you cannot wash glyphosate off food since it is incorporated into each cell of plant.
Here are some tips to keep your diet free of glyphosate:
Only way to 100% eliminate from your diet is to avoid conventionally grown and processed foods
Glyphosate accumulates in animal tissues, so make sure your meat was not fed GMO grains and your butter and dairy is organic
Switch over to a 100% organic diet
Take activated charcoal or rice bran powder in aiding elimination of organophosphates and glyphosate after exposure
Maintain adequate mineral status by taking a multi-mineral supplement that includes trace minerals
Support glutathione production with N-acetylcysteine, glycine and glutamine or oral liposomal glutathione
No comments:
About Me
Apr 2017 - 4.1 Mil Pg Views, March 2013 - Posted my paper introducing CLOUD COSMOLOGY & NEUTRAL NEUTRINO rigorously described as the SPACE TIME PENDULUM, September 2010 I am pleased to report that my essay titled A NEW METRIC WITH APPLICATIONS TO PHYSICS AND SOLVING CERTAIN HIGHER ORDERED DIFFERENTIAL EQUATIONS' has been published in Physics Essays(AIP) and appeared in their June 2010 quarterly. 40 years ago I took an honors degree in applied mathematics from the University of Waterloo. My interest was Relativity and my last year there saw me complete a 900 level course under Hanno Rund on his work in relativity,as well as differential geometry(pure math) and of course analysis. I continued researching new ideas and knowledge since that time and I have prepared a book for publication titled Paradigms Shift&. I maintain my blog as a day book and research tool to retain data and record impressions and interpretations on material read. Do join my blog and receive Four items of interest daily Monday through Saturday.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Timers in Windows Service
I want to use timers in my service.
But I heard that timers cause deadlock issues.
Suppose If I set my timer to start every 10 mins.
My service takes 5 mins to finish its current execution.
But in some cases it will take more time.(Its unpredictable).
So what happens if my service couldn't finish current
execution within 10 mins.A new timer event will fire??
And what happens to my current execution of the service?
Appreciate your help.
A:
you can use timers in Windows service as it also stated on MSDN
A service application is designed to be long running. As such, it usually polls or monitors something in the system. The monitoring is set up in the OnStart method. However, OnStart does not actually do the monitoring. The OnStart method must return to the operating system once the service's operation has begun. It must not loop forever or block. To set up a simple polling mechanism, you can use the System.Timers.Timer component. In the OnStart method, you would set parameters on the component, and then you would set the Enabled property to true. The timer would then raise events in your code periodically, at which time your service could do its monitoring.
despite the above you still need to create your logic to avoid both deadlock or the code specified within the Elapsed event takes longer then the interval itself.
The Elapsed event is raised on a ThreadPool thread. If processing of the Elapsed event lasts longer than Interval, the event might be raised again on another ThreadPool thread. Thus, the event handler should be reentrant.
http://msdn.microsoft.com/en-us/library/system.timers.timer%28v=vs.80%29.aspx
|
{
"pile_set_name": "StackExchange"
}
|
[Leber's hereditary optic nerve neuropathy].
The authors present a case report of 26 years old man with bilateral optic nerve neuropathy. Detection of heteroplasmic mutation of mitochondrial DNA at G3460A site confirmed the suspicion on Lebers hereditary optic nerve neuropathy (LHON). Genetic and environmental factors of the disease and various accompanying neurologic and other symptoms, which can together with the optic nerve defect participate in the development of of the LOHN clinical pattern are discussed. (Ref. 12.)
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Get the full exception type/message and stack trace
I've written an API which returns Json in the following format...
{"Success": true, Result: {...}}
{"Success": false, ExceptionId: "(some uuid)"}
The exceptions are logged. This is fine in principle for allowing someone to discuss an error without us ever telling them what it is (as a security measure). During debugging I also want to output the error message to stop me having to refer to a database all the time.
As things stand, the problem is getting useful information from the exception (either to return or log in the db)
I'm doing something like this...
try:
Ret['Result'] = <Blah>
Ret['Success'] = True
except Exception as e:
# ... Logging/ExceptionId
if Settings.DebugMode:
Ret['Exception'] = str(e)
If I put a breakpoint on the last line and inspect e in eclipse's watch window, I get KeyError: 'Something', but str(e) results in 'Something' which is very unhelpful.
I've googled and I can't find any way to get a proper message from an exception. Apparently there used to be a .message in v<2.4 but that's no help to me in 3.3
As an alternative, I tried doing:
Ret['Exception'] = str(type(e)) + ": " + str(e)
Which resulted in <class 'KeyError'>: 'job' which is a little closer but it's starting to feel more and more hackish.
I also want to include a Stack Trace but have had even less luck there - I can get the __traceback__ but of course it's not serializable and calling str() on it just results in a description of the object eg <traceback object at 0x0000000004024E48>
How can I get a decent/comprehensive error message?
A:
You probably want repr:
Ret['Exception'] = repr(e)
For the traceback, use the traceback module:
from traceback import format_exc
Ret['Traceback'] = format_exc()
|
{
"pile_set_name": "StackExchange"
}
|
Capacity (schooner)
Capacity, was an American schooner that arrived in San Francisco on January 9, 1852. The Capacity under Captain Driscoll, subsequently was hired by Captain James Turnbull to carry a cargo of U. S. Army supplies for Fort Yuma. It would also carry the engine, boiler and wood to assemble the side-wheel paddle steamer tug, Uncle Sam to the Colorado River Delta. The Uncle Sam would be the first of many steamboats on the Colorado River.
After arriving in early September, the Capacity then had to wait longer than expected, over two months, in the anchorage in the estuary of the river until the Uncle Sam was built and launched in mid-November and then again waited four more months to empty its hold of the Army supplies. The anchorage was a trial for a ship anchored in that location, subject to extreme tides that left the ship stranded at low tide and struck by a 4 to 6 foot tidal bore when the tide came back in twice a day. The long wait was due to the limited 35 ton cargo capacity and the weakness of the 20hp engine of the tug when pitted against the strong down stream current of the Colorado, that made a round trip to and from its destination at Fort Yuma take 12 days each. The Capacity was successfully unloaded and left the river. The subsequent fate of the Capacity is unknown.
References
Category:Victorian-era merchant ships of the United States
Category:Maritime history of California
Category:Schooners
Category:Steamboat transport on the Colorado River
|
{
"pile_set_name": "Wikipedia (en)"
}
|
[Hyperbaric chamber].
The purpose of this article is to describe a hyperbaric chamber, to expound on the physiology of oxygen dissolved in plasma, state the effects of hyperbaric oxygen therapy and the clinical uses of this therapy. The role of nurses during this entire procedure which this treatment calls for shall also be highlighted in this article.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Abbreviations
=============
BLASTBasic Local Alignment Search ToolC-bandingcentromeric bandinggDNAgenomic DNAGISHgenomic *in situ* hybridizationNCBINational Center for Biotechnology InformationPCRpolymerase chain reactionPMCpollen mother cellSSRsimple sequence repeat
Introduction {#s0001}
============
The ability to transfer alien genes that are agronomically desirable from wild relatives into cultivated wheat is very important for the wheat geneticist and breeder [@cit0016], [@cit0024]. Many wild relatives of common wheat (*Triticum aestivum* L.) possess genetic traits that, when incorporated into the wheat genome, have improved yield and resistance to various adverse environmental factors. Rye (*Secale cereale* L.) is closely related to wheat, and is a most useful source of alien genetic material for wheat-breeding. Several rye genes have already been successfully introgressed into the wheat genome, and these varieties are grown widely throughout the world for their disease resistance and other desirable agronomic traits [@cit0001], [@cit0006], [@cit0010], [@cit0034].
Many studies have reported that through the creation of translocation lines, especially from alien chromosome fragments, alien genes or chromosome segments were transferred from wild relatives into common wheat [@cit0003], [@cit0012], [@cit0014], [@cit0022], [@cit0024]. The best way to create translocation lines is by hybridization of wheat substitution lines [@cit0012]. In our previous studies, we successfully obtained many translocation lines with good traits and heterozygous advantage by hybridizing the wheat-rye substitution lines 5R/5A and 6R/6A. However, the transferred chromosomal segments and genes in most translocation lines have not been identified.
To identify genes inherited from the rye parent, observation of phenotype can be the simplest and most direct method. For example, Sears [@cit0032] identified the 5R chromosome by its associated neck hair character, and Li et al. [@cit0015] identified the 4E chromosome from blue-grained wheat. In addition, many rye genome-specific repetitive DNA sequences are known and have been used to identify rye chromosomes or chromosomal segments in the wheat background. Examples of such sequences include pSc119.1, AF1/AF4, SCM120, SCM138, and SCM268 [@cit0017], [@cit0026]. Chromosome centromeric (C)-banding is another useful method for identifying chromosome translocations [@cit0036], and genomic *in situ* hybridization (GISH) is an efficient and accurate technique that detects all alien chromatin and the translocation breakpoints of interspecies chromosomal rearrangements [@cit0004], [@cit0011], [@cit0021], [@cit0024], [@cit0030] We, therefore, used pollen mother cell (PMC) meiosis analysis, chromosome C-banding and GISH to further identify the six lines.
In this study, we created translocation lines via hybridization of the wheat-rye 5R/5A and 6R/6A substitution lines, and then screened for rye-specific traits favorable for agronomy from hybrid generations F~2~ to F~5~. We identified those lines containing incorporated rye germplasm, using a specific molecular marker. In lines containing the amplified rye-specific fragment, stability of inheritance was assessed via PMC meiosis analysis. Rye chromatin was identified with chromosome C-banding and GISH.
Materials and Methods {#s0002}
=====================
Plant materials {#s0002-0001}
---------------
The wheat-rye 5R/5A and 6R/6A substitution lines, described in detail in previous studies [@cit0012], were obtained from the Biology Department of Harbin Normal University. The lines 06-6-5, 06-6-6, 06-6-9, 6-26-1, 7-23, 7-33 are progeny of wheat-rye 5R/5A and 6R/6A substitution lines. The rye (2n = 14) was obtained from the Institute of Crop Germplasm Resources, Chinese Academy of Agricultural Sciences. Chinese Spring wheat (2n = 42) was provided by Kyoto University of Japan.
Selection method {#s0002-0002}
----------------
The maternal and paternal parents were crossed by conventional methods. All materials, including Chinese Spring wheat and rye, were grown in single-row plots 1.5 m long with 30 cm row spacing and 5 cm plant spacing within rows. Breeding for disease resistance against stem rust (*Puccinia graminis*) and powdery mildew (*Blumeria graminis*) was carried out in the greenhouse. The hybrid F~2~ to F~5~ generations were tagged for recording observations of plant height (cm), spike length (cm), number of spikelets per ear, number of grains per ear and grain yield per ear (g). All lines were selected according to phenotypic characters such as neck hair, abundant spikelets, disease resistance, and drought tolerance until stable [@cit0012].
Cytogenetic and Molecular Identification of Small Chromosome Segment Translocation Lines {#s0002-0003}
----------------------------------------------------------------------------------------
F~5~ generation lines with rye characters were assayed. Genomic DNA was extracted from seedlings, using cetyltrimethylammonium bromide [@cit0027]. To amplify rye chromatin, two sets of the primer pair pSc119.1 (5′-TTGGCCCTCATGCCTTTAGTC-3′; 5′-CTTGGCCCTCTCCGCTTGACCG-3′) amplified a 750 bp fragment, and AF1/AF4 (5′-GGAGACATCATAAACATTT-3′; 5′-CTGTTGTTGGGCAGAAA-3′) amplified a 1500 bp fragment. Polymerase chain reaction (PCR) was performed using 1.0 U of Taq DNA polymerase (TaKaRa, DaLian, China) in 20 μL reaction volumes containing ∼50 ng of genomic DNA, 1× PCR buffer with 1.5 mmol/L MgCl~2~, 7.5 pmol of each PCR primer, and 100 μmol/L of each of the dNTPs. PCR cycling conditions for primers were 94 ºC for 5 min; and then 38 cycles of 94 ºC for 5 min, 94 ºC for 1 min, 55 ºC to 60 ºC for 1 min, 72 ºC for 30 s; and a final extension at 72 ºC for 10 min. Each PCR was repeated three times to preclude any technical errors.
All PCR products were resolved in a 1.4% agarose gel. The fragments were purified from the gels, and then cloned to a pGEM-T Easy vector (TransGen, China). Recombinant clones were sequenced after a PCR test. Sequencings were performed by Shanghai Sangon Biological Engineering Technology & Services (Shanghai, China). Sequence alignment was carried out with Basic Local Alignment Search Tool (BLAST) software. Six lines were assayed through simple sequence repeat (SSR) analysis. Primer sequences and chromosome locations are shown in ([Table 1](#t0001){ref-type="table"}). PCR amplification was performed as described above. The examination and analysis of meiotic behavior and GISH was conducted as previously described by Li et al. [@cit0012], the latter with minor modifications. The procedures for C-banding and chromosome identification were in accordance with Gill et al. [@cit0007]. Chromosome images were obtained with a charge coupled device (CCD) camera and analyzed with Photoshop (Version 8.0) software. Table 1.SSR primer sequences and rye-specific chromosomal fragment verify the translocation lineMarkerSequenceProduct size (bp)Repeat sequenceChromosome armSCM120F:CATTGTTGCGAGTGTTGAAGC127(AC)~10~5RL R:TGTGCTGTCGTCGATGTTGTC SCM138F:ATAGCCGCAGATGGTTGAGGAC188(AC)~23~5RS R:GAGAAGTCTACAAATCAAGGGGGC SCM268F:GCGCACCCCACACAACACG R:GCGGTGGCGGTTGAGGAC,153(CA)~9~5RS
Results and Discussion {#s0003}
======================
The six lines have some beneficial traits and apparent rye characters, e.g., big ears, disease resistance, grey leaf, and heterozygous advantage ([Table 2](#t0002){ref-type="table"}). In particular, line 7-23 has abundant spikelets and powdery mildew resistance; 7-33 has neck hair, a longer spike and abundant spikelets; 06-6-5 and 06-6-6 have abundant spikelets and delayed physiological maturity; 06-6-9 has abundant spikelets; 6-26-1 has abundant spikelets and the grain is shaped like that of rye. The six lines were judged to contain rye genetic material and utilized to screen for wheat-rye small-segment translocation lines. In the present study, the maternal wheat-rye substitution lines 5R/5A possess many obvious and useful traits, such as big ears, neck hair, purple coleoptiles, grey leaf, glumes, as well as drought tolerance and disease resistance. The paternal wheat-rye substitution lines 6R/6A has high spike density, strong glums, no arista, and is highly resistant to powdery mildew. Based on the characteristic traits of 5R/5A and 6R/6A, the plants were screened from the F2 to F5 generations. Observations of phenotype can indirectly identify the presence of chromosomes and genes from an alien genome in the wheat background [@cit0015], [@cit0032]. The effect of alien chromosomal material was not consistent for wheat improvement [@cit0001], [@cit0033]. Therefore, screening for yield components and disease resistance is the primary means of obtaining varieties of synthetically advanced character. In this study, the lines selected from the F5 showed many useful traits ([**Table 2**](#t0002){ref-type="table"}). These results indicate that the desired target character can be obtained by screening the F~2~ to F~5~ generations. Table 2.Morphological observations Disease resistanceLinesMorphological charactersPlant height (cm)Spike length (cm)Spikelets per earGrains per earGrain yield per ear (g)Stem rustPowdery mildew7-23No arista; purple coleoptiles; grey leaf;77.213.626521.6RHR7-33No arista; purple coleoptiles; neck hair92.117.126702.3RR06-6-9Long arista; grey leaf85.314.626652.1RR06-6-6Long arista; grey leaf; purple coleoptiles97.215.4827511.9RHR06-6-5Long arista; grey leaf;85.214.827732.0RR6-26-1Long arista; grey leaf; glumes98.513.7420401.2RR[^1]
The precise identification of translocation lines is an important aspect in the evaluation and utilization of alien genetic material. Specific PCR markers are an easier and reliable means for detecting alien segments in the wheat background [@cit0028], [@cit0037]. McIntyre et al. [@cit0018] was the first to report a molecular marker (Psc119.1) specific to and ubiquitous on a rye chromosome. Many molecular markers, covering almost the entire rye genome, have been developed in the last decades [@cit0017], [@cit0026]. Primer pSc119.1 amplified a 750 bp fragment as a rye-specific band in 7-23 ([Figure 1](#f0001){ref-type="fig"}A), 06-6-9 ([Figure 1](#f0001){ref-type="fig"}A), 6-26-1 ([Figure 1](#f0001){ref-type="fig"}A), and 7-33 ([Figure 1](#f0001){ref-type="fig"}B). Primer AF1/AF4 amplified a 1500 bp fragment as a rye-specific band in 06-6-5 and 06-6-6 ([**Figure 1**](#f0001){ref-type="fig"} **C**). The rye-specific PCR primers amplified specific bands in the rye and wheat-rye lines, whereas in Chinese Spring wheat neither of the rye-specific PCR primers could amplify any band. These results suggest that pSc119.1 and AF1/AF4 were rye-specific PCR primers, and the six lines were verified to contain rye chromatin. The PCR product of 7-33 was cloned and sequenced ([**Figure 1**](#f0001){ref-type="fig"} **B**). A search of GenBank (available through the National Center for Biotechnology Information \[NCBI\] website) and BLAST software showed that the DNA sequence of the analyzed fragment had 99.9% similarity to the big ear gene in wheat (GenBank accession number AF512607.1). This result suggests that 7-33 has the big ear gene. Figure 1.PCR amplification results. Amplification of pSc119.1 (**A** and **B**) and AF1/AF4 (**C**) in the translocation lines, rye, and Chinese Spring wheat. Marker DNA ladder 2000 (100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, 2000 bp).
The SSR markers SCM120, SCM138, and SCM268 were used to identify 5R chromosomes ([Table 1](#t0001){ref-type="table"}). SCM120 is located on rye 5RL and amplified a 127 bp fragment as a rye-specific band in 7-33 ([**Figure 2**](#f0002){ref-type="fig"} **A**). SCM138 and SCM268 are both located on rye 5RS and amplified a 188 bp and 153 bp fragment, respectively, as specific bands in 7-33 ([**Figure 2**](#f0002){ref-type="fig"} **B, C**). These results show that the translocation line 7-33 contained rye 5R chromosomes. Figure 2.Agarose gel electrophoresis of the microsatellite markers SCM120 (**A**), SCM138 (**B**), and SCM268 (**C**) in lines 7-33, rye, and Chinese Spring wheat, indicating the presence of 5RL and 5RS. Marker DNA ladder 2000 (100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, 2000 bp).
In the six translocation lines, meiotic univalents, heteromorphic bivalents, or multivalents were observed in metaphase. Chromosome bridges, chromosome fragments, and lagging chromosomes appeared in anaphase I and anaphase II. Micronuclei were found in the tetrad phase. The meiotic abnormal phenomena ratio was \<2% in all phases of meiosis ([**Table 3**](#t0003){ref-type="table"}), which indicated that heredity is stable in the six translocation lines. Table 3.Observations and statistics of PMC meiosis MetaphaseAnaphase IAnaphase II UV (%) LinesNo. of cellsNB (%)1--2\>2HB (%)MV (%)LC (%)CB (%)CF (%)LC (%)CB (%)CF (%)MC (%)TMN (%)7-2338619.200.500.04 (3-5)0.34 (1-4)0.17 (3-5)0.29 (1-3)0.05 (1-4)0.08 (1-2)0.24 (1-3)0.03 (1)0.03 (1-2)--- ---0.24 (1-3)7-3338219.870.360.01 (3-5)0.43 (1-6)0.16 (3-5)0.63 (1-5)0.03 (1-2)0.09 (1-2)0.22 (1-4)0.06 (1-2)0.02 (1)0.01 (1)0.30 (1-4)06-6-939920.100.110.02 (3-4)0.44 (1-5)0.24 (3-4)0.05 (1-3)0.18 (1-6)0.06 (1)0.01 (1)0.05 (1-3)0.01 (1)---0.01 (1-2)06-6-637520.700.07---0.22 (1-5)---0.08 (1-3)0.07 (1-3)0.11 (1-4)0.06 (1-3)0.03 (1)---0.01 (1)0.09 (1-2)06-6-536820.090.230.07 (3-4)0.57 (1-7)0.01 (3)0.20 (1-8)0.10 (1-4)---0.20 (1-2)0.09 (1-2)0.02 (1)---0.21 (1-3)6-26-135920.110.080.01 (3-4)0.51 (1-8)0.08 (3-4)0.35 (1-5)0.28 (1-7)0.13 (1-5)0.13 (1-2)0.07 (1)0.07 (1-20.02 (1-2)0.34 (1-7)[^2]
Compared with the standard C-banding patterns of rye and Chinese Spring wheat, the translocation line 7-33 was missing the 5A chromosome but increased the 5R chromosome ([**Figure 3**](#f0003){ref-type="fig"} **A**). GISH indicated that there were two hybridization signals specific for rye chromosomes ([**Figure 3**](#f0003){ref-type="fig"} **B**). Together with the results of molecular identification, line 7-33 was designated as a 5R/5A substitution line. The rest of the lines were determined to be small-segment chromosome translocation lines, because no chromosome band patterns changed in the C-banding and because of the presence of a rye-specific hybridization signal in GISH analysis ([**Figure 3**](#f0003){ref-type="fig"} **C--F**). However, it could not be determined which of the wheat chromosomes contain these small rye chromosome segments. Figure 3.C-banding and GISH analysis of translocation chromosomes. C-banding pattern of lines 7-33 (**A**); arrows indicate two chromosomes with intense terminal C-band on arm. The chromosomes of 7-33 (**B**) after GISH using genomic DNA of rye as the probe; arrows indicate two substitution 5R chromosomes (green). The chromosomes of 06-6-9 (**C**) after GISH using genomic DNA of rye as the probe; arrows indicate small chromosome segment translocation. C-banding pattern of 06-6-9 (**D**); no rye chromosome band patterns. The chromosomes of 06-6-6 (**E**) and 06-6-5 (**F**) after GISH using genomic DNA of rye as the probe; arrows indicate small chromosome segment translocation.
Rye has many useful genes for wheat breeding and some of them have been transferred to wheat [@cit0006], [@cit0010], [@cit0023]. Creating wheat-rye substitutions as well as translocations is an effective way of transferring rye chromosome material into wheat. For example, the wheat-rye 1BL/1RS translocation is the most widespread alien resource in wheat breeding worldwide due to its contribution to multiple disease resistance and positive effect on yield [@cit0008], [@cit0020], [@cit0023], [@cit0029], [@cit0033]. Unfortunately, the transfer of the 1RS has resulted in deleterious effects on wheat end-use quality [@cit0008]. To minimize the transfer of deleterious genes, the most desirable method for the plant breeder is to induce small chromosome segment translocations [@cit0025].
Ren and Zhang [@cit0024] created wheat-rye small-segment translocation lines using monosomic addition lines. Davies et al. [@cit0005] reported that some translocation lines were produced via hybridization between two *T. aestivum*--*S. cereale* addition lines. Li et al. [@cit0013] obtained translocation lines from the progeny of wheat--*Haynaldia villosa* and wheat--*Thinopyrum intermedium* disomic substitution lines and determined that the translocation lines were produced through exchange due to pairing of homoeologous chromosomes. Li et al. [@cit0012] created translocation lines through hybridization of wheat-rye substitution lines.
To create wheat-rye translocation lines possessing superior agronomical characteristics, in the present study, 5R/5A was crossed with 6R/6A. Via a tracing screen of target characteristics and cytogenetic and molecular identification, five chromosome segment translocations and one substitution were obtained in the F~5~ generation. This suggests that the crossing of substitution lines can create small-segment chromosome translocation lines with agronomic characteristics of polymeric quality.
The present study began with the crossing of the substitution lines 5R/5A and 6R/6A, and in the field the progeny from generations F~2~ to F~5~ were screened for rye characters. This ensured that traits in the translocation lines that had been selected for superior agronomic performance, such as high yield and resistance to stem rust and powdery mildew, were stable in the F~5~ generation. To avoid painstaking cytological work, we firstly utilized a rye-specific PCR primer to screen the F~5~ population for desirable rye characters. We found that specific PCR markers, pSc119.1 and AF1/AF4, amplified rye-specific bands in six lines and rye. However, no amplification products were found in Chinese Spring wheat. When amplification products of specific PCR markers for translocation were cloned and sequenced, we found the lines 7-33 to possess the big ear gene. These results document that the 5R or 6R chromosome of rye may carry the big ear gene; the definite location of this gene is still to be determined. The lines were then analyzed for genetic stability through observation of PMC meiosis. Identification of alien chromosomes was made using chromosome C-banding and GISH. This identification procedure enhanced accuracy and reliability, decreased the workload and saved time, and thereby gave the study a clear direction and focus.
The development of small-segment chromosome wheat-rye translocation lines that have beneficial agronomic traits has seldom been achieved [@cit0009], [@cit0019], [@cit0031], [@cit0035] although plant breeders have obtained them by several methods. Their creation via selection and then tracing target rye characters through generational progeny can exclude unwanted genes while sufficiently displaying the desired characters. Thus, small-segment chromosome translocation lines have great practical value in terms of improved yield and disease resistance in wheat.
Conclusions {#s0004}
===========
In this study wheat-rye chromosome translocation lines were created by crossing substitution lines. Through tracing selection, the translocation lines we produced have superior agronomic characters and improved wheat germplasm. In addition, these lines are useful for studying the mechanisms of alien chromosome introgressions into the receptor chromosome, and the expression of alien segments in receptor plants. Moreover, small-segment chromosome translocation lines can be used to study the mechanisms of gene exchange and gene expansion in species evolution.
We thank Medjaden Bioscience for assisting in the preparation of this manuscript.
[^1]: R: resistance; HR: high resistance
[^2]: NB: normal bivalent; HB: heteromorphic bivalent; UV: univalent; MV: multivalent; LC: lagging chromosomes; CB: chromosome bridge; CF: chromosome fragment; MN: micronucleus; TMN: tetraspore micronucleus
|
{
"pile_set_name": "PubMed Central"
}
|
Q:
Self defined Function to replicate a Number and return a List?
myreplica :: (Num a,Ord a) => a -> b -> [b]
myreplica num val
| num <= 0 = []
| otherwise = [val] ++ myreplica (num-1) val
The above function takes two values Num and Val and returns a List L = [val,val...num times].The code works fine for 0 and positive values but when i give input like
"ghci> " replicate' -1 123
<interactive>:72:1:
Non type-variable argument in the constraint: Num (i -> a -> [a])
(Use FlexibleContexts to permit this)
When checking that ‘it’ has the inferred type
it :: forall i a a1.
(Num i, Num a1, Num (i -> a -> [a]), Num (a1 -> i -> a -> [a]),
Ord i) =>
i -> a -> [a]
I get the following error message.How can I make it work for negative numbers?
Why do we need (Num a,Ord a) constraint?
A:
Surround the negative number with parentheses i.e. myreplica (-1) 123. However, you might instead want to add a special case using error for negative numbers in first argument, since it doesn't make sense to repeat something a negative number of times.
Demo
|
{
"pile_set_name": "StackExchange"
}
|
Q:
simplexml_load_file only return partial data of xml
I use simplexml_load_file and expect it can be use on a url, strangely some of the data is missing.
my php
$url = "http://www.thestar.com.my/RSS/Lifestyle/Women/";
$xml = simplexml_load_file($url);
echo "<pre>";
print_r($xml);
partial result
[item] => Array
(
[0] => SimpleXMLElement Object
(
[guid] => {936842CF-550D-4CAB-A840-23BB4E766B8E}
[link] => http://www.thestar.com.my/Lifestyle/Women/Fashion/2014/07/02/Jamy-Yang-Mingjie-Shared-travelling-values
[title] => SimpleXMLElement Object
(
)
[description] => SimpleXMLElement Object
(
)
[pubDate] => Wed, 02 Jul 2014 00:00:00 +08:00
[enclosure] => SimpleXMLElement Object
(
[@attributes] => Array
(
[url] => http://www.thestar.com.my/~/media/Images/TSOL/Photos-Gallery/features/2014/07/02/JamyYangMingjie020714.ashx?crop=1&w=460&h=345&
[length] =>
[type] => image/jpeg
)
)
)
item->title became SimpleXMLElement Object?
A:
You forgot to add an additional parameters to get the CDATA Character Data. Try this:
$url = "http://www.thestar.com.my/RSS/Lifestyle/Women/";
$xml = simplexml_load_file($url, 'SimpleXMLElement', LIBXML_NOCDATA);
echo "<pre>";
print_r($xml);
|
{
"pile_set_name": "StackExchange"
}
|
Effect of switch to the highest dose of rosuvastatin versus add-on-statin fenofibrate versus add-on-statin nicotinic acid/laropiprant on oxidative stress markers in patients with mixed dyslipidemia.
Oxidative stress plays an important role in atherosclerosis. Both F2-isoprostane (8-iso-PGF2a) and oxidized low-density lipoprotein (ox-LDL) have emerged as biomarkers of oxidative stress and have been proposed as useful biomarkers that could potentially be used as indicators of cardiovascular disease. This is a prespecified analysis of a prospective, randomized, open-label, blinded endpoint (PROBE) study (ClinicalTrials.gov identifier: NCT01010516). Patients (N = 100) with mixed dyslipidemia on a standard statin dose (10-40 mg simvastatin or 10-20 mg atorvastatin or 5-10 mg rosuvastatin) who had not achieved lipid targets were randomized to switch to the highest dose of rosuvastatin (40 mg/day) or to add-on-statin extended release nicotinic acid (ER-NA)/laropiprant (LRPT) (1000/20 mg/day for the first 4 weeks followed by 2000/40 mg/day for the next 8 weeks) or to add-on-statin micronized fenofibrate (200 mg/day) for a total of 3 months. Levels of plasma and urine F2-isoprostane and plasma ox-LDL were assessed at baseline and 3 months later. Plasma F2-isoprostane levels decreased similarly in all groups. On the other hand, both ox-LDL and urine F2-isoprostane levels decreased similarly in the add-on ER-NA/LRPT and rosuvastatin monotherapy group, while a less pronounced decrease was observed in the add-on fenofibrate group. All treatment interventions reduced the concentration of the assessed oxidative stress markers, but the reduction was more pronounced in the add-on ER-NA/LRPT and rosuvastatin monotherapy groups, compared with add-on fenofibrate. Specifically designed studies should address the abovementioned risk factors modulation in terms of cardiovascular risk.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Encrypt Web.config Windows Azure
I am using a shared website from Windows Azure. I would like to encrypt parts of my web.config, however, I get this error:
Failed to decrypt using provider 'RsaProtectedConfigurationProvider'. Error message from the provider: The RSA key container could not be opened.
I have a page in my site that will encrypt that file and it does, however, after a few hours I get this error. Do I need to send my machine key over to Azure or do they have one I can use?
To encrypt my config file, I use this code:
/// <summary>
/// About view for the website.
/// </summary>
/// <returns>Action Result.</returns>
public ActionResult About()
{
Configuration objConfig =
WebConfigurationManager.OpenWebConfiguration(Request.ApplicationPath);
AppSettingsSection objAppsettings =
(AppSettingsSection)objConfig.GetSection("appSettings");
if (!objAppsettings.SectionInformation.IsProtected)
{
objAppsettings.SectionInformation.ProtectSection(
"RsaProtectedConfigurationProvider");
objAppsettings.SectionInformation.ForceSave = true;
objConfig.Save(ConfigurationSaveMode.Modified);
}
return View();
}
A:
It might not be exactly what you are looking for, but you could use the Configuration tab in the Azure dashboard to overwrite the AppSettings at runtime so the web.config doesn't store any actual sensitive data.
http://www.windowsazure.com/en-us/manage/services/web-sites/how-to-configure-websites/#howtochangeconfig
App Settings – Specify name/value pairs that will be loaded by your web application on start up. For .NET sites, these settings will be injected into your .NET configuration AppSettings at runtime, overriding existing settings. For PHP and Node sites these settings will be available as environment variables at runtime.
|
{
"pile_set_name": "StackExchange"
}
|
Fletcherana insularis
Fletcherana insularis is a moth of the family Geometridae. It was first described by Arthur Gardiner Butler in 1879. It is endemic to the Hawaiian island of Maui. It has been found above the forest belt, high up on Haleakalā.
It is a variable species in size, color and pattern. It might be confused with Eupithecia monticolans which it somewhat resembles in color and markings, but the wing shape and course of the medial band and other markings are distinct.
External links
Category:Larentiinae
Category:Endemic moths of Hawaii
|
{
"pile_set_name": "Wikipedia (en)"
}
|
1/4" Schedule 80 PVC Tee - Socket (801-002)
Description
Details
Schedule 80 PVC Tees
The 801-002 1/4" Schedule 80 PVC Tee has slip x slip x slip sockets and is built to last. With thick schedule 80 walls, this fitting has impressive pressure tolerance in a little package. Don't pay more for fittings - shop PVCFO and save on all your pipe and part needs. Order today for quick shipping.
|
{
"pile_set_name": "Pile-CC"
}
|
Mečji Do
Mečji Do is a village in the municipality of Svrljig, Serbia. According to the 2002 census, the village has a population of 44 people.
References
Category:Populated places in Nišava District
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Losehill Hall
Losehill Hall is a youth hostel located
close to the town of Castleton within the Peak District. Losehill Hall is a refurbished gothic mansion
which is set in beautiful grounds. The
youth hostel is close to the Winnats Pass and Mam Tor, which makes it popular
for groups of hikers.
Losehill Hall was formerly the educational
learning centre for the Peak District National Park, hosting groups of youths
for adventurous activities. Several
courses were also run from the centre which focused on generating awareness for
the Peak District National Park. The
educational centre had to close due to the park having to have found
savings. It was then sold off to the
Youth Hostel Associating who then refurbished and opened the centre.
There are numerous activities on offer for
visitors to Losehill Hall. The first of
these and the most popular is hiking.
Losehill Hall is perfectly located between the Limestone Dales and the
Moors of the Peak District, and has a diverse range of scenery in close
proximity. This ranges from country
houses to deep caverns, all which can be explored. Cycling and mountain biking are also popular
pursuits with a number of trails available in the surrounding area. One of the most popular is the Mam Tor
classic ride. The Grit-Stone rocks of
the Peak District provide some of the best climbing in the whole of the UK,
with visitors flocking to the area from throughout the country. The nearest site to climb can be found just
300 metres from the youth hostel.
There is also a restaurant on site which
serves a range of different meals, and has been rated highly among previous
visitors. A fully stocked licensed bar
sells a wide range of drinks, which can be enjoyed in the onsite lounge areas
which is the perfect place to meet other visitors.
|
{
"pile_set_name": "Pile-CC"
}
|
Art of Fighting (band)
Art of Fighting are an indie rock band from Melbourne, Australia.
History
The band formed in 1995 as a duo, with Ollie Browne playing guitar and Peggy Frew on bass, with both taking turns on vocals. The couple were also in a romantic relationship at this time, though they were to split amicably later.
They were joined six months later by drummer Cameron Grant, and over the following two years released two demo tapes, the first self-titled and the second named The Angry Man. Two of the tracks from the latter, "The Chorus is Suffering" and "You and Me on Mars" were included on the Wonder From A Quarter Acre compilation put out by Au Go Go Records in 1998.
In 1997, the trio began recording The Very Strange Year. During touring for this EP but before its release, Ollie Browne's brother, Miles Browne, joined the group playing guitar and trumpet. The Very Strange Year was released on Half a Cow Records at the end of 1998.
In the middle of 1999 the foursome began recording another EP for Half a Cow, Empty Nights, which was released in November of that year. Cameron Grant left the band in late 2000, being replaced on drums by Marty Brown (also of Sodastream).
Following a move to Trifekta Records, in 2001 the band recorded their debut full-length album, Wires. The album was successful and went on to win an ARIA award for Best Alternative Release, beating the more high-profile You Am I, Something for Kate and Magic Dirt. Not expecting to win, they were famously told of their prize while packing up after a gig in Germany, on their first European tour.
The success of the album not only locally but also internationally - with releases in the USA, Japan, Germany and Taiwan - led to a sustained period of touring. This successful time was followed by a turbulent 2003, when the long-term romantic relationship between Ollie Browne and Peggy Frew ended, amongst other variously momentous events.
Their second album, Second Storey, was released in 2004, once again engendering a burst of touring both local and international. In a coup for the band, Bella Union released the album in the UK and Europe.
At the end of 2006, the release of first single "Eastbound" preceded a forthcoming album titled Runaways released on 10 March in Australia, on Remote Control Records. In April 2007 the band played at All Tomorrow's Parties (curated by Dirty Three) in Minehead UK, which was followed by two live shows in Tokyo.
In 2008 the band scored an original soundtrack for the Australian film Ten Empty and in 2010 saw Ollie create a new group called Parallel Lions.
In 2019 the band released the single "Your Love", announced a new album and played concerts in Sydney and Melbourne.
Discography
Albums
Wires (LP, HORSE008-2, Trifekta, January 2001)
Second Storey (LP, HORSE044-2, Trifekta, January 2004)
Runaways (LP, Remote Control Records, 10 March 2007)
EPs and singles
The Very Strange Year (EP, HAC74, Half a Cow Records, November 1998)
Empty Nights (EP, HAC87, Half a Cow Records, November 1999)
In No Way Good (7" split with 2 Litre Dolby, BBQ'D02, BBQ'D Browne Records, January 2000)
"Reasons Are All I Have Left" (single, Trifekta, 2001)
"Along the Run" (single, HORSE043-2, Trifekta, 5 July 2004)
"Come Round and Show Me" (single, HORSE046-2, Trifekta, 7 February 2005)
"Eastbound" (single, RCON004CDS, Remote Control Records, November 2006)
Compilation appearances
Wonder From A Quarter Acre (Au Go Go Records, 1998)
References
External links
Article on the production of Second Storey
Article on the making of Runaways
Article on the forthcoming release of Runaways
Category:Victoria (Australia) musical groups
Category:Australian indie rock groups
Category:ARIA Award winners
Category:Bella Union artists
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Linear Least Squares Fit of Sphere to Points
I'm looking for an algorithm to find the best fit between a cloud of points and a sphere.
That is, I want to minimise
where C is the centre of the sphere, r its radius, and each P a point in my set of n points. The variables are obviously Cx, Cy, Cz, and r. In my case, I can obtain a known r beforehand, leaving only the components of C as variables.
I really don't want to have to use any kind of iterative minimisation (e.g. Newton's method, Levenberg-Marquardt, etc) - I'd prefer a set of linear equations or a solution explicitly using SVD.
A:
There are no matrix equations forthcoming. Your choice of E is badly behaved; its partial derivatives are not even continuous, let alone linear. Even with a different objective, this optimization problem seems fundamentally non-convex; with one point P and a nonzero radius r, the set of optimal solutions is the sphere about P.
You should probably reask on an exchange with more optimization knowledge.
|
{
"pile_set_name": "StackExchange"
}
|
Q:
One Image not showing in Android, IE7, IE8, everywhere else fine
Hi I'm testing a Wordpress site I've built, a problem I have is for some reason the Art Below logo which appears just about everywhere else, doesn't show in IE7, IE8 and Android.
Anyone with fresh eyes want to take a look?
Its the footer first logo on the left.
http://www.missingtom.com
A:
Looks like it's a CMYK jpeg. Convert it to RGB and give it a try if it works.
I tested with IE8/7 and indeed it doesnt's show up, shows a red circle, loads just fine with other browsers.
Edit: Here is RGB version of your file - http://i.imgur.com/N8K33he.jpg if you don't know how to do it yourself or you're unable to. Rename it to artbelow.jpg and replace the file on your server (http://www.missingtom.com/wp-content/themes/artwars2/images/artbelow.jpg) make a hard refresh (alt+f5 usually) and see if it shows up.
More info about CMYK and IE (possibly also Android browsers as you stated?... - http://www.plaveb.com/blog/cmyk-images-not-displayed-in-internet-explorer
|
{
"pile_set_name": "StackExchange"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.